text
stringlengths
21
4k
label
stringclasses
2 values
> STRUCTURE ET CONTENU DE INTERVENTION DE E-APPRENTISSAGE EN ENTRETIEN MOTIVATIONNEL Une application informatique incluant deux éléments : 1) L’ALGORITHME ÉVALUATIF ALEGRO (Paradis, Cossette et Heppell, 2010) permettant de cibler à quel stade de changement et de motivation (point de jonction entre ces deux évaluations) se situe le patient à l’égard de la réduction des facteurs de risque; 2) 13 CAPSULES VIDÉO de 1 à 2 minutes mettant en vedette une infirmière praticienne spécialisée qui illustre par des jeux de rôles les interventions à appliquer en EM selon chaque point de jonction (motivation x stade de changement →Permet de fournir un soutien motivationnel adapté au stade de changement : DEVIS Pré-expérimental avant-après à groupe unique Les méthodes d’apprentissage électroniques pour la construction des compétences cliniques en entretien motivationnel : un protocole de recherche GUILLAUME FONTAINE, INF., B.SC., ÉTUDIANT M.SC. + SYLVIE COSSETTE, INF., PH.D. + MARIE-FRANCE OUIMETTE, INF., M.SC. + SONIA HEPPELL, INF., M.SC., IPSC PROBLÉMATIQUE Le soutien motivationnel offert par les infirmières lors de l’hospitalisation est essentiel à la réduction des facteurs de risque après un événement cardiaque. Toutefois, l’utilisation des techniques d’entretien motivationnel nécessitent des compétences spécifiques acquises actuellement chez un nombre limité d’infirmières via des formations longues et couteuses. Les méthodes d’apprentissage électroniques (e-apprentissage) sont en plein essor en pédagogie de la santé pour faciliter la construction de ces compétences cliniques. BUT Cette étude pilote vise à évaluer la faisabilité, l’acceptabilité et l’impact sur les compétences cliniques perçues d’une méthode d’apprentissage électronique en entretien motivationnel chez des infirmières en soins critiques cardiovasculaires. MÉTHODE Une étude pilote de faisabilité et d’acceptabilité avec devis avant-après à l’unité coronarienne (UC) de l’Institut de Cardiologie de Montréal. Le cadre théorique de l’intervention de e- learning est le Technology Acceptance Model (TAM) développé par Davis (1989) et le modèle de recherche a été conçu selon les travaux de Cheng (2012). • Cheng, Y. M. (2012). The Effects of Information Systems Quality on Nurses’ Acceptance of the Electronic Learning System. Journal of Nursing Research, 20(1), 19-30. • Cole, J. A., Smith, S. M., Hart, N., & Cupples, M. E. (2013). Do practitioners and friends support patients with coronary heart disease in lifestyle change ? A qualitative study. BMC Family Practice, 14(126). • Kala, S., Isaramalai, S. A., & Pohthong, A. (2010). Electronic learning and constructivism : A model for nursing education. Nurse Education Today, 30(1), 61-66. • Noordman, J., De Vet, E., Van Der Weijden, T., & Van Dulmen, S. (2013). Motivational interviewing within the different stages of change : An analysis of practice nurse-patient consultations aimed at promoting a healthier lifestyle. Social Science & Medicine, 87, 60-67. • Paradis, V., Cossette, S., Frasure-Smith, N., Heppell, S., & Guertin, M. C. (2010). The Efficacy of a Motivational Nursing Intervention Based on the Stages of Change on Self-care in Heart Failure Patients. Journal of Cardiovascular Nursing, 25(2), 130-141. • Söderlund, L. L., Madson, M. B., Rubak, S., & Nilsen, P. (2011). A systematic review of motivational interviewing training for general health care practitioners. Patient Education and Counseling, 84(1), 6-26. • Van der Heijden, H. (2004). User acceptance of hedonic information systems. MIS Quarterly, 28(4), 695-704. > RÉSUMÉ > PROBLÉMATIQUE ↓ des facteurs de risque chez les PATIENTS CARDIAQUES après un évènement cardiovasculaire grâce à l’entretien motivationnel : → Prévient les récidives → Améliore la qualité de vie (Söderlund et al., 2011; Cole et al., 2013; Noordman et al., 2013) Cependant, dans un contexte où les ressources financières et pédagogiques ↓ et que les formations actuelles en ENTRETIEN MOTIVATIONNEL sont caractérisé
poster
Jorge C. S. Cardoso CITAR -­‐ Portuguese Catholic University jorgecardoso@ieee.org The PuReWidgets toolkit for interac6ve public display applica6ons University of Minho School of Engineering Algoritmi Research Centre Portuguese Catholic University School of Arts Research Centre for Science and Technology of the Arts Rui José Algoritmi – University of Minho rui@dsi.uminho.pt 1. PuReWidgets toolkit PuReWidgets is a widget toolkit for web-­‐based interacJve public display applicaJons that provides: • MulJple, extensible, controls; • MulJple interacJon mechanisms; • AutomaJc graphical interface generaJon; • Concurrent interacJon; • Asynchronous events; 2. Mul6ple, extensible, controls • AcJon buOon -­‐ trigger an acJon in the applicaJon, e.g., play a video; • OpJon selecJon -­‐ selects among a set of opJons, e.g., to vote; • Text entry -­‐ sends text to the applicaJon, e.g., a comment, tag, search keyword; • Download -­‐ receives a media file from the applicaJon, e.g., download poster; • Upload -­‐ uploads a media file to the applicaJon, e.g., a photo to be displayed; • Check-­‐in -­‐ says “I’m here”. 3. Mul6ple interac6on mechanisms PuReWidgets abstracts the details of various interacJon mechanisms • SMS, Bluetooth naming, OBEX; • Rich, automaJcally generated, graphical interfaces; • QR codes. 4. Automa6c graphical interface genera6on PuReWidgets provides rich graphical interfaces for desktop and mobile devices, and also QR codes for individual widgets: Desktop & Mobile PuReWidgets generates a webpage which lists the applicaJons available in a locaJon, and provides a web interface to each applicaJon: This work is financed by FEDER funds through the “Programa Operacional Fatores de CompeJJvidade – COMPETE” and by NaJonal Funds through the FCT – Fundação para a Ciência e Tecnologia within the project: FCOMP-­‐01-­‐0124-­‐FEDER-­‐022674 Jorge C. S. Cardoso is also funded by FCT training grant SFRH/BD/47354/2008 5. Concurrent interac6on Allows various users to interact at the same Jme, while providing applicaJons with idenJty informaJon that allows them to differenJate users. • Every input event carries a user id (if available). 6. Asynchronous events Allows applicaJons to receive input events that were generated when the applicaJon was not listening. • PuReWidgets provides a persistent input queue for each applicaJon; • ApplicaJons can request past input at any Jme. 7. Architecture QR codes PuReWidgets provides display owners the possibility of prinJng QR codes for individual widgets in use by applicaJons: I/O Infrastructure • Provides low-­‐level data-­‐based interacJon; • Handles data from interacJon mechanisms such as SMS, email, Bluetooth naming, etc.; • Provides a command-­‐based interface to the PuReWidgets service. PuReWidgets service • Keeps informaJon about every widget; • Generates graphical interfaces for desktop, mobile, touch plaoorms; • Generates QR codes for every widget; • Generates unique reference codes for data-­‐based interacJons (SMS, BT naming, OBEX, etc.). PuReWidgets library • Provides a widget-­‐based interacJon abstracJon; • Provides opJonal graphical representaJons for widgets and for input feedback on the public display; • Provides client and server applicaJon models; • Hides communicaJon details with the PuReWidgets service. 8. Implementa6on PuReWidgets is implemented using Google’s App Engine plaoorm and Google’s Web Toolkit (GWT) . • The library is a GWT module that can be included in their projects; • The service is an App Engine applicaJon that exposes a REST API; • The graphical components take advantage of the standard GWT HTML widgets; • hOp://purewidgets.googlecode.com
poster
STRUDEL - simplifying planning & user interfaces for science softwares User eXperience is important for research Vote for the 3 main challenges in your software projects Technology Resources Team Skillsets UX / UI Knowledge Software Sustainability Community Engagement Funding Others The STRUDEL vision Somewhere in a science laboratory, a new project is about to begin... What timelines should we target ? How much should we invest in UX ? Who all should be on the project team ? Planning Assistant Project composition Software Products People & Teams Ooh !! STRUDEL !?! Let me try and fill in my project details Can it help with software and UX planning? Design Guide Taskflows & examples Oh cool! It also has guidance & reference examples for UI flows. This will help us to get ideas, design & implement the software better Suggestions Wow! It gave me relevant suggestions This is really useful to plan the new project Yay !! STRUDEL gave me ideas & direction for the project planning. I can now discuss these with the larger team and make faster progress I need help with the project plan... Sigh!! BERKELEY LAB We need you! J Typology helps to break down diverse scientific projects for analysis and comparison> J Typology will serve as a strategic thinking partner to guide science teams to think about their product’s needs for UX, software sustainability, and overall strategy Iterative scientific inquiry results in always evolving user needs Our project develops tools to ease the process of planning & designing scientific software from core requirements to UI development. Key outputs‰ ” Typology‘ ” Design Syste„ ” Task-flow˜ ” UI library Key users‰ ” project leader˜ ” funding officer˜ ” domain expert˜ ” software dev‘ ” project contributors User experience is often an afterthought in scientific software that impacts usability, accessibility, design, & functionality of products. Rajshree Deshmukh, Drew Paine, Sarah Poon, Cody O’Donnell, Dan Gunter, Lavanya Ramakrishnan Lawrence Berkeley National Laboratory Software sustainability & efficiency needs regular UX investment Science projects often lack the UX processes & best practices Commercial software practices can’t be directly applied to science softwares Typology J Tool to streamline scientific software UI developmenZ J Ensures implementation of best practices and consistent user experience across the producZ J Provides users with guidelines, task-flow templates, variations & examples, and code as a starting point J The frontend UI library provides a set of React templates for high level components & identified task flows common to scientific softwareo J Uses React javascript framework and is built on top of the popular Material UI (MUI) components library Design system Contact: Rajshree Deshmukh, rajshreed@lbl.gov Disclaimer This presentation was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. Reference herein to any specific commercial product, process, or service by trade name, trademark, manufacturer, or otherwise does not necessarily constitute or imply its endorsement, recommendation, or favoring by the United States Government or any agency thereof. The views and opinions of authors expressed herein do not necessarily state or reflect those of the United States Government or any agency thereof J Lab notebooko J Data analysio J Scientific catalogo J Project management Task flow template for ‘Data contributions’ Task flow with example data for ‘Exploring datasets’ Other task-flows in STRUDEL J Running optimizationo J Viewing & comparing scenarioo J Exploring entitieo J Creating process models Prima
poster
b c a DeepMainmast and CryoREAD: Protein and DNA/RNA Structure Modeling for Cryo-EM using Deep Learning Genki Terashia, Xiao Wangb, Tsukasa Nakamuraa , Han Zhub and Daisuke Kiharaa, b References 1. Terashi, Genki, et al. "DeepMainmast: integrated protocol of protein structure modeling for cryo-EM with deep learning and structure prediction." Nature Methods 21 (2023): 122-131. 2. Jumper, John, et al. "Highly accurate protein structure prediction with AlphaFold." Nature 596.7873 (2021): 583- 589. 3. Wang, Xiao, Genki Terashi, and Daisuke Kihara. "CryoREAD: de novo structure modeling for nucleic acids in cryo-EM maps using deep learning." Nature Methods 20.11 (2023): 1739-1747. Funding: NIH: R01GM133840 and 3R01GM133840-02S1. a Department of Biological Sciences, Purdue University, West Lafayette, Indiana, USA, b Department of Computer Science, Purdue University, West Lafayette, Indiana, USA 21 157 155 22 Results Code Availability: The source code and Colab version of DeepMainmast CryoREAD are available at https://github.com/kiharalab/DeepMainMast. https://github.com/kiharalab/CryoREAD Kiharalab EMSuite Server: https://em.kiharalab.org Cryo-EM Map Structure Detection by Deep Learning CUGACAUACUUGUUCCACUCU AGCAGCACGUAAAUAUUGGCG UAGUGAAAUAUAUAUUAAACA CCAAUAUUACUGUGCUGCUU UAGUGUGACAGGGAUACAGC AA Cryo-EM Map Sugar Detection Phosphate Detection Base Detection Phosphate Nodes Sugar Nodes Base Nodes Structure Node Clustering Backbone Tracing Sugar Graph Sugar Backbone Sequence Assignment Sequence Input Fragment Assembling Base Assignment Full Atom Model S-P-B Backbone Atomic Structure Detection Map by DL Fragment Assignment T-T….C-A-C TT-….G-A-C TG-….-A-A TT-….-C-A G-TT….TT-T G-TT….TC-T Overview of the DeepMainmast protocol applied to the cryo-EM map EMD- 6551 at a resolution of 3.8 Å Overview of CryoREAD CryoREAD [3] is a deep learning-based fully automated de novo DNA/RNA atomic structure modeling method. It can identify phosphate, sugar, and base positions in a cryo-EM map using deep learning, which are traced and modeled into a 3D structure. Single-chain Modeling Results (178 targets) Multi-chain Modeling Results (20 targets) Examples: Multi-chain modeling EMD-6551, PDB 3JCF Chains: A-E DeepMainmast SeqID: 1.00, TM-Score: 0.99 EMD-6374, PDB 3JB0 Chains: A, B and C, D and E DeepMainmast SeqID: 1.00,TM-Score: 0.99 Overview of DeepMainmast DeepMainmast [1] is a new de novo protein main-chain tracing method that uses deep learning to identify the positions of Cα atoms and the types of amino acids. To enhance the modeling performance, AlphaFold2 [2] models can be used as input data. Results Performance Comparison Backbone Recall: the fraction of backbone atoms that were closer than 5 Å to corresponding atoms of matched nucleotides. Sequence Recall: the fraction of nucleotides that have matched nucleotides in predicted structures and share the same base types. Sequence Match: calculated sequence recall only considers nucleotides in the reference structure that have matches. BB Recall Seq Recall Modeling Performance Examples: DNA/RNA Modeling Examples: Protein-RNA Modeling d c a. EMD-7480: BB Recall: 0.852; Seq Recall: 0.557; RMSD: 2.20 Å. b. EMD-4868: BB Recall: 0.907; Seq Recall: 0.54; RMSD: 3.13 Å. c. EMD-20416, BB Recall: 0.842; Seq Recall: 0.474; RMSD: 3.25 Å. d. EMD-12217: BB Recall: 0.903; Seq Recall: 0.657; RMSD: 2.60 Å. Cryo-EM map Deep Learning Detection ■Native ■Predicted Model Cryo-EM map Deep Learning Detection ■Native ■Predicted Model EMD-8622 Resolution: 3.7Å NA BB Recall: 0.910 NA Seq Recall: 0.646 NA RMSD: 3.03 Protein TM-score: 0.810 Cryo-EM map Deep Learning Detection ■Native NA, ■Native Protein ■Predicted NA, ■Predicted Protein EMD-21907 Resolution: 2.9Å NA BB Recall: 0.903 NA Seq Recall: 0.660 NA RMSD: 3.131 Protein TM-score: 0.9730
poster
Collections are Helping Avian Biomechanics Research Take Off Ms I. Szabo1, Dr V. B. Baliga2, Dr C. Harvey3, Ms J. Wong2, Ms F. Ciocca2, Dr D. L. Altshuler2 1University of British Columbia Beaty Biodiversity Museum, Vancouver, Canada, 2Department of Zoology, University of British Columbia, Vancouver, Canada, 3Department of Aerospace, University of Michigan, Ann Arbor, United States Museum collections have a role to play in biomimicry research. At the University of British Columbia Beaty Biodiversity Museum (BBM), the Cowan Tetrapod Collection is assisting members of the UBC Altshuler Lab by providing cadavers and post experiment, archiving a subset of the biological material used. Museums hold the necessary permit plus have frozen inventories not available elsewhere, enabling researchers to tap into a broad catalogue of biodiversity. For one of the studies highlighted, frozen avian cadavers representing 50% of the worlds bird orders were procured and supplied by the museum. The study of how animals fly is an intrinsically multidisciplinary field that involves aspects of anatomy, biomechanics, and evolutionary biology (among many others). Integrating laboratory experiments with evolutionary comparisons increases our understanding of how flight control evolved. Inspired by avian morphology, the search in on to design aircraft that can change the shape of its wings during flight. This ability, termed “morphing”, allows birds to fly in diverse conditions and shift between aerodynamic optima. Natural history collections, as the repositories of biological diversity and libraries of comparative morphology, are natural partners in this quest to understand how living organisms fly. By providing insights on avian global diversity and avian ecology, museum curatorial staff are invaluable informal advisors and mentors to physiology and engineering graduate students. Knowledge gained from working with natural history specimens and especially from unprepared cadavers is contributing to the next generation of aerial vehicles which may transport us out of this world.
poster
BibliotecarIA in-the-loop: oportunidades y desafíos de la Inteligencia Artificial en instituciones GLAM Inteligencia Artificial Datos Visión Artificial Procesamiento del Lenguaje Natural Aprendizaje Profundo Aprendizaje Automático ¿Tipo? Información estructurada (datos tabulares) o información no estructurada (imágenes, vídeo, documentos, audio). ¿Todos? Completos, representativos y bien anotados/etiquetados: ground-truth data. Datasets sesgados Algoritmos sesgados Discriminación / Sesgo algorítmico. Supervisión humana: human-in-the-loop. Algoritmo de recomendación literaria entrenado con una colección de textos literarios escritos en su mayoría por hombres: seleccionará preferentemente obras de autores porque ha aprendido erróneamente que los escritores son hombres. Sesgo de género: TRAINING DATA MODEL TRAINING VALIDATION DATA or Test data ANOTACIÓN Y ETIQUETADO de los datos: DATOS Por ejemplo: documentos e imágenes Docs./imágenes clasificados (género, categorías, etc.) VALIDACIÓN Reentrenar el modelo Nuevos datos sin anotar/etiquetar Datos anotados/etiquetados (por ejemplo, clasificados) Documentos: géneros literarios Imágenes: reconocimiento de objetos/personas Ground-truth data: datos de alta precisión para entrenar algoritmos ¿Reconocimiento facial de las emociones de los visitantes de una exposición? (Share Art, Museos de Bolonia). ¿Combinamos datos?: datos de uso de recursos-e + datos personales + datos de rendimiento académico Es legal, pero ¿es ético? Frey and Osborne: “Estimate the probability of the replacement by computers of ‘library technicians’ as 99%, ‘Library assistants, clerical’ 95%, archivists 76% and librarians 65%’ (Cox, Pinfield & Rutter, 2019). Elements of AI Intro to AI for GLAM (The Carpentries Incubator) Programming Historian ¿Por dónde empezar? Manos a la obra: ¿Actualizamos los códigos éticos? ¿Buenas prácticas que guíen la aplicación de las tecnologías de IA? ¿Abrimos la caja negra? The team discovered late in testing that AWS Transcribe speech-to- text transcription was censoring what it deemed “offensive” words in transcripts without opting into that feature and without providing the list of censored words (Dunn et al., 2021). In a 2017 survey of librarians from across all sectors in the USA, Wood and Evans (2018) found that 56.3% of respondents thought supercomputers, like Watson, could transform librarianship. This still meant that 44% thought it would have nor or not much effect (Cox, Pinfield & Rutter, 2019). No university or university library mentions artificial intelligence in their strategic plan. While most plans were fairly recent, there are no initiatives to address the rise of artificial intelligence technology (Wheatley & Hervieux, 2019). 0 25 50 75 100 125 Knowledge Extraction (Meta-)Data Quality Audience Analysis Human in The Loop Visualising Glam Collections Collections Management Discovery and Search Creative Projects Machine Translation AI4LAM Cultural AI Lab IFLA Special Interest Group on AI CENL AI in Libraries Network Group Europeana Task Force: AI in relation to GLAMs The Museums + AI Network AEOLIAN Network Catalogación automática Libros Depósito Legal (Bibliothèque Royale de Belgique). ...allowed KBR to process 19,000 scans of title pages fairly quickly, which would have taken an average cataloguer nearly five years to do. METADATOS Cataloguing Machine (Deutsche Nationalbibliothek). Indización automatizada materias con .... (National Library of Finland): ¿QUÉ HAY PARA MÍ? OPORTUNIDADES DE LA IA USUARIOS INVESTIGACIÓN (University of British Columbia). IA para la gestión documental. Encuesta realizada en 2020. Fuente: AI in relation to GLAMS Task Force. Report and recommendations (2021) Ninguno Algo Mucho Nivel de interés en IA: Probado. Sin utilidad Probado y útil Ana Fresco-Santalla 0000-0001-8218-6408 IA EN EL SECTOR GLAM: DEL ESCEPTICISMO AL ENTUSIASMO CUESTIONES ÉTICAS Y LEGALES PROFESIONALES GLAM LECTAUREP (Ministère de la Culture, Inria, Archives Nationales). HTR (Ha
poster
Exploring the Relationship between Psoriasis and Pregnancy Pratiksha Patra, BA- MSII University of South Florida Morsani College of Medicine INTRODUCTION: • Psoriasis affects millions of adults and is one of the most common autoimmune disorders in the US.1 Previous studies stress the possible negative teratogenic effects of continuing biologic medications during pregnancy and recommend the use of topical treatments during this time instead.3, 4 It is commonly believed that psoriasis symptoms tend to improve during pregnancy, however, there is limited research documenting the extent to which this occurs3, 4 and how. The aim of this literature review was to thoroughly examine the published literature on the relationship between psoriasis and pregnancy to elucidate possible new routes of treatment. METHODS: 1. Searches were primarily conducted in three databases (PubMed, Scopus, and Embase) available via the University of South Florida library network. Searches were also conducted in Cochrane and clinicaltrials.gov and yielded no relevant results. Articles for consideration to be included in this literature review focused on the presentation of psoriasis during pregnancy. 2. Data coding followed Saldaña’s (2016) methods of first cycle and second cycle coding. First cycle coding began with the researcher hand coding all articles into an Excel file using an a priori code list adopted from Boote and Beile’s (2005) Literature Review Scoring Rubric.10 3. As codes were identified, a master code list was developed. Second cycle coding involved theming of the data allowing for codes to combine and emerge as categories.11 Coding ended with code weaving to create a narrative to see how categories and emergent themes fit together to answer the guiding questions for this review.11 EXAMPLE CODES: DISCUSSION + CONCLUSION: • Collectively, these findings elucidate the individual nature of psoriasis and identify progesterone as a possible non-teratogenic therapy. Primarily, the presence of the HLA-Cw6 allele in a woman’s genome along with the individual variation of estrogen receptors reinforces the researcher’s recommendation for genetic testing following a psoriasis diagnosis. This genetic testing may allow patients and physicians to best understand what to expect of psoriasis during pregnancy as well as help determine the most efficacious treatment course to follow. Findings from this review help close the gap in literature on this topic as well as educate physicians and pregnant psoriasis patients on how their psoriasis might progress during pregnancy and postpartum. REFERENCES: 1. Armstrong, A.W., et al., Psoriasis Prevalence in Adults in the United States. JAMA Dermatol, 2021. 157(8): p. 940-946. 2. Lambert, J.L.W., et al., Practical recommendations for systemic treatment in psoriasis according to age, pregnancy, metabolic syndrome, mental health, psoriasis subtype and treatment history (BETA-PSO: Belgian Evidence-based Treatment Advice in Psoriasis; part 1). J Eur Acad Dermatol Venereol, 2020. 34(8): p. 1654-1665. 3. Simionescu, A.A., B.M. Danciu, and A.M.A. Stanescu, State-of-the-art review of pregnancy-related psoriasis. Medicina (Lithuania), 2021. 57(8). 4. Mervic, L., Management of moderate to severe plaque psoriasis in pregnancy and lactation in the era of biologics. Acta Dermatovenerol Alp Pannonica Adriat, 2014. 23(2): p. 27-31. 5. Parisi, R., et al., National, regional, and worldwide epidemiology of psoriasis: systematic analysis and modelling study. Bmj, 2020. 369: p. m1590. 6. Gratton, R., et al., Unraveling the Role of Sex Hormones on Keratinocyte Functions in Human Inflammatory Skin Diseases. Int J Mol Sci, 2022. 23(6). 7. Hoffman, M.B., M. Farhangian, and S.R. Feldman, Psoriasis during pregnancy: characteristics and important management recommendations. Expert Rev Clin Immunol, 2015. 11(6): p. 709-20. 8. Danesh, M. and J.E. Murase, The immunologic effects of estrogen on psoriasis: A comprehensive review. Int J Womens Dermatol
poster
Radial velocity monitoring of (candidate) hybrid A- and F-type stars from the Kepler mission P. Lampens 1,*, L. Vermeylen 1, P. De Cat 1, Á. Sódor 2, Zs. Bognár 2, Y. Frémat 1, M. Skarka 3,4 and H. Lehmann 5 1Royal Observatory of Belgium (ROB), Ringlaan 3, 1180 Brussels - Belgium 2 Konkoly Observatory, Konkoly Thege M. u. 15-17 H-1121 Budapest - Hungary 3 Astronomical Institute of the Czech Academy of Sciences, Fričova 1, CZ-25165 Ondřejov - Czech Republic 4 Department of Theoretical Physics and Astrophysics, Masaryk Univerzity, Kotlářská 2, CZ-61137 Brno - Czech Republic 5Thüringer Landessternwarte Tautenburg (TLS) , Sternwarte 5, 07778 Tautenburg - Germany *e-mail: Patricia.Lampens@oma.be Instruments and spectroscopic observations Previous and new targets Acknowledgements Abstract We monitored an ensemble of 50 candidate hybrid A/F-type stars from the Kepler mission with the HERMES spectrograph attached to the Mercator telescope over a period of four years. For each target, we obtained radial velocities, improved or new atmospheric properties (Teff, log g, v sin i), and a classification in terms of multiplicity, pulsation and/or fast rotation (LA18). Recently, a sample of 40 additional candidate hybrid A- and F-type stars from the Kepler mission has been identified as an extension of the first survey. High- resolution spectra of the hybrid candidate stars are systematically collected with small and medium-sized telescopes. Furthermore, by combining the radial velocities with the time delays obtained via the study of the pulsation frequencies during the four years of Kepler photometry, we obtained accurate orbits for a number of new stellar systems with good radial velocity coverage. Astrophysical rationale Fig. 1. The mechanisms of stellar formation explain why a vast majority of stars belongs to double and multiple star systems (Tobin, Univ. Oklahoma/Leiden et al.) B. Saxton, ALMA (ESO/NAOJ/NRAO), NRAO/AUI/NSF Physics of Oscillating STars, 03 - 07 Sept. 2018, Banyuls-sur-mer (France) Fig.2. The Mercator telescope is located at the observatory Roque de los Muchachos, La Palma (Canary Islands, Spain). Equipped with HERMES, it offers high-efficiency and high-resolution spectroscopy to all the partners of the HERMES Consortium. References Balona et al. 2015, MNRAS 452, 3073 (BA15) Balona 2018, MNRAS 476, 4840 (BA18) Derekas et al. 2017, MNRAS 464, 1553 (DE17) Grigahcène et al. 2010, ApJ 713, L192 (GR10) Lampens et al. 2018, A&A 610, A17 (LA18) Nemec et al. 2017, MNRAS 466, 1290 (NE17) Raskin et al. 2011, A&A 526, A69 (RA11) Reyniers & Smeyers 2003, A&A 404, 1051 (RS03) Uytterhoeven et al. 2011, A&A 534, A125 (UY11) Fig3. The [0-4] d-1 region of the periodogram of KIC 6381306 (based on Kepler data) Fig. 4. A powerful combination: photometric time delays and radial velocities (KIC 4480321). The time delays (in pink) and the radial velocities (comp. C in red; comp. A & B in blue) are overlaid with the orbital solution (solid lines). The first survey Objectives & Summary - 1. The goal is to characterize the spectroscopic variability of a large sample of Kepler hybrid (Dor - Sct/Sct - Dor) pulsators. We need 4-5 observations at least (Fig. 5) to be able to detect binarity/multiplicity at very different orbital periods, up to a few years, and to establish a meaningful classification/interpretation. We also aim to determine the orbital periods and solutions for the new binary and multiple systems with sufficient and good phase coverage. In the first survey, we performed a multi-epoch spectroscopic study of 49 A/F-type candidate hybrid stars and one target classified as Scuti star from the Kepler mission (cf. Table 3 in UY11). We classified our targets on the basis of their (constant vs variable) behaviour in radial velocity and the shape of the cross correlation functions over a period of four years. Both short- and long-period systems were found, i.e. 4 single-lined (SB1), 4 double-lined (SB2) and 3 triple-lined (SB3) systems.
poster
SOBREXPLOTACIÓN DE TUNAS, BONITOS, BILLFISHES EN ARRECIFES DE CORAL EN EL CONTINENTE ASIÁTICO Natalia García Cabezas, Daniela Navas González ngarciac4@ucentral.edu.co, dnavasg@ucentral.edu.co Introducción Una de las mayores preocupaciones en la actualidad son los ecosistemas de arrecifes de coral debido al efecto de la pesca no sostenible y a los cambios en las propiedades del agua que sitúan a estos ecosistemas en peligro de desaparición. Por esta razón, es importante analizar el impacto de la sobre explotación pesquera en las especies más comerciales como lo son las tunas, bonitos, billfishes en los últimos 10 años en el continente asiático, el cual es el mayor exportador en el mundo, para permitir ecosistemas resilientes y con ello, lograr desarrollar una explotación de los recursos de manera sostenible y disminuir la afectación a los ecosistemas de arrecife de coral. Objetivos Determinar las alteraciones que ha generado la explotación pesquera en la población de tunas, bonitos y billfishes en los últimos 10 años. Identificar las perturbaciones que sufren los arrecifes de coral en el continente asiático con la sobreexplotación de tunas, bonitos y billfishes. Metodología • Con la investigación anterior se puede determinar que una de las mayores alteraciones en la población de tunas, bonitos, billfishes en los últimos 10 años a causa de la sobre pesca, es el tamaño de las especies que se ha reducido en un 33% y que actualmente sigue disminuyendo aceleradamente. • Por otra parte, en las áreas estudiadas la temperatura ha aumentado 4.8% y la salinidad 6.2% entre los años de estudio, sumándose, la sobreexplotación pesquera incontrolable que no permite alcanzar un equilibrio tanto para las especies como los ecosistemas para adaptarse y recuperarse y generar un aumento en la tasa de mortalidad de 1.6 % de tunas, bonitos y billfishes. Conclusiones Es necesario analizar las alteraciones y afectaciones que tienen el tipo de captación pesquera a nivel nacional para formular políticas de protección y conservación de lo ecosistemas y construir un sistema de explotación sostenible. Recomendación Se puede observar que en los últimos años se presenta un incremento significativo en la captación de estas especies, principalmente en Filipinas, China e Indonesia, que poseen una mayor pendiente; lo que indica una tendencia al aumento acelerado en la explotación de tunas, bonitos, billfishes en estas áreas en años posteriores. Al analizar los datos del tamaño de captura en los 5 países con mayor exportación en el continente asiático de tunas, bonitos y billifesh en los últimos 10 años se puede determinar que los países con mayor explotación de este grupo, presentan una disminución del tamaño de las especies más acelerado en comparación con las áreas de menor captura. Logrando determinar que los países con mayor exportación y con captación industrial no lograran tener una explotación sostenible debido al incremento potencial de explotación en un tiempo reducido para restablecer el equilibrio de las especies. A partir de la base de datos analizada obtenemos que el 57.3% del área marina registrada en el continente asiático corresponde a zonas de explotación pesquera, en donde el 27.4% de estas zonas son áreas protegidas y de esta cifra, el 15.4% son arrecifes de coral. Se puede observar un incremento significativo de temperatura en los puntos de estudio de China, en donde hay mayor exportación de especies con menor tamaño y un aumento mayor de salinidad en Tailandia y Taiwán, en donde la exportación ha disminuido significativamente debido a la alta tasa de mortalidad a causa de la gran variación de las concentraciones de sal. Análisis y resultados • FAO. (2020). El estado mundial de la pesca y la acuicultura 2020. La sostenibilidad en acción. Roma.. ISSN 2663-8649 . • Molina L, Otero F & Izquiero M. (2006). Coral reefs: threats and future focusing in over-fishing, aquaculture, and educational programs. -Management of Natural Resources, Sustainable
poster
Agrosystem models are increasingly important for decision-making support under global change. However, the application of valuable data from agricultural Long-Term Experiments (LTEs) in crop yield modeling faces several challenges: ⭙Data from the numerous global LTEs are rarely published ⭙Individual LTEs typically study only one or a few crop yield constraints ⭙Published LTE data often lack metadata and have heterogeneous quality Susanne Lachmuth (susanne.lachmuth@zalf.de); Carsten Hoffmann; Wahib Sahwan; Gunnar Lischeid (all Leibniz Centre for Agricultural Landscape Research, ZALF) partnering with ZB MED, UBN, TUM in UC 4 On behalf of the FAIRagro consortium Bridging Gaps in Long-Term Experiments (LTE): Data Integration and Plausibility Assessment for Advanced Yield Modeling Use Case 4 Objectives Action 1: Support and standardize new LTE data publication • FAIR-compliant metadata schema and guidelines (M 3.1) • Data publication schema for harmonized data management (M 3.1) • Publish LTE data in FAIRagro infrastructure (M.2.5, data steward support) Action 2: Data Curation for Published Incomplete LTE Data • Transform existing metadata to the new model (M 3.1) • Check completeness and update metadata (M.2.5) • Using web forms of the search service (M.4.3) Action 3: Implement Data Quality Assessment Service • Develop expert-based plausibility database (M.3.3) • Create approach based on statistical models • Implement feedback loop to enrich original datasets with new information (M.3.3) • Integrate with FAIRagro Portal ( M.4.1) Advanced Statistics for Data Integration and Quality Assessment Automated procedures for: • Providing qualitative contextual information beyond the published metadata (e.g., via text mining of LTE associated papers, UC2) • Quantitative imputation of (meta) data gaps • Stepwise integration of the updated but still incomplete data sets into crop yield modeling pipeline (UC6) • Plausibility and fitness-for-use assessment (M.3.3) Use Case 4 – 'Learning from incomplete data’ supports LTE data publication and quality. It automates context (meta)data integration and quality checks, bridging gaps between LTE data collection and reuse. Just started Oct 1st 2024 Icons from thenounproject.com 1st FAIRagro Plenary, 13.-15. November 2024 , Berlin
poster
This project has received funding from the Fuel Cells and Hydrogen 2 Joint Undertaking under grant agreement No 700101. This Joint Undertaking receives support from the European Union's Horizon 2020 research and innovation programme and Hydrogen Europe and N.ERGHY. Nordic Process Control Workshop NPCW-2019, DTU, Copenhagen 22-23 >August 2019 Relay feedback excitation for identification of Fuel Cell performance parameters Ivar J. Halvorsen, Federico Zenith SINTEF Digital, Trondheim, Norway Relay feedback excitation for identification of fuel cell low frequency resistance3 = impedance at: • Add filter d(s) such that • Filter => when • The filter can be partitioned in to pre- and post-filers e.g: • Bias estimator for handling of slow voltage drift must be included • Require access to DC/DC in FC system for setting fuel cell current References: 1. Ivan Pivac, Dario Bezmalinović, Frano Barbir, Catalyst degradation diagnostics of proton exchange membrane fuel cells using electrochemical impedance spectroscopy, International Journal of Hydrogen Energy, Volume 43, Issue 29, 2018, Pages 13512-13520, https://doi.org/10.1016/j.ijhydene.2018.05.095 2. Aström, Karl Johan, Hägglund ,Tore. PID controllers: Theory, design, and tuning, vol. 2. , NC: Instrument society of America Research Triangle Park; 1995 3. Ivar J. Halvorsen, Ivan Pivac, Dario Bezmalinović, Frano Barbir, Federico Zenith, Electrochemical low-frequency impedance spectroscopy algorithm for diagnostics of PEM fuel cell degradation, International Journal of Hydrogen Energy, 2019, In Press, https://doi.org/10.1016/j.ijhydene.2019.04.004. H(s) 0 2 4 6 8 10 12 14 16 -1.5 -1 -0.5 0 0.5 1 1.5 Z LTI System of FC Relay 0 Constant Scope 0.5s+1 s Transfer Fcn 1 0.5s+1 Transfer Fcn1 1 s Transfer Fcn2 1 s Estimated R Product 100 Gain1 Step Step1 Signal Generator 0.003033 Display Rest -0.0008 Bias relayout To Workspace Im To Workspace1 Um To Workspace2 Rest To Workspace3 1 s Estimated_bias Product1 -0.0008045 Display Bias 1 Gain2 -K- Gain 0 1 2 3 4 5 6 7 8 9 Re(Z(j )) [ ] 10 -3 -2 -1 0 1 2 3 4 5 -Im(Z(j )) [ ] 10 -3 Nyquist Diagram for impedance Z(j ) [ ] R real : 0.0083213 [ ] R est : 0.0083129 [ ] @Im(z)==0: 2.2001 [rad/s] est @Im(z)==0: 2.3102 [rad/s] Nyquist curve Real max R Estimated max R Steady state High freq 0 0.05 0.1 0.15 0.2 0.25 Real(Z) -0.01 0 0.01 0.02 0.03 0.04 0.05 -Imag(Z) Nyquist diagram w=0.126 w=0.314 w=0.628 w=3.14 w=6.3 w=12.6 w=1.71 rad/s 0 100 200 300 400 500 600 57 58 59 60 voltage ConstFreq_0020_mHz 0 100 200 300 400 500 600 220 222 224 226 current Relay feedback creates quickly a stable limit cycle at critical frequency of H(s) Gain can be obtained from data Result can be used e.g. for PID tuning Recorded EIS curves from long term test (ref FESB) From simulation data: Full stack test The EU-project: • Building Hydrogen Fuel Cell range extender for heavy duty transport • Diagnostic, Control, Performance and health monitoring for fuel cells Case introduction: Fuel Cell Impedance – electrical equivalent model Z(s): LFR - A dynamic parameter for ageing indication1: • The low frequency resistance (LFR) at the intercept where increases with ageing. • Challenge: How to identify LFR in a running FC application! ( ) 0 Z jω ∠ = ° Alternatives for on-line identification: • Electrochemical impedance spectroscopy (EIS) – use in lab only • Fixed frequency excitation in relevant range - feasible, tested • Phase locked loop - feasible • Relay feedback excitation – studied here Relay feedback excitation2 180 ( ) 180 H H jω ∠ = − ° ( ) 0 Z jω ∠ = ° ( ) ( ) ( ) H s Z s d s = 2 ( ) 1/ d s s = 180 ( ) 0 H Z jω ∠ = ° 180 ( ) 180 H H jω ∠ = − ° 1 1 2 2 2 1 1 1 1 ( )* ( ) ( ) * 1 T d s d s s d s s s T s + = + = = 180 ( ) H H jω Bias Estimator Relay feedback loop • Bias estimation is based on simple adaption by a gradient method • Data can be post processed for more detailed analysis Testing on a full stack: (ElringKlinger) • Tests have been carried out at a set of fixed frequencies and
poster
AIUB BDSD 2021 Bern Data Science Day 23 April 2021 The Satellite Geodesy Team of AIUB Astronomical Institute, University of Bern, Switzerland Poster compiled by D. Arnold and M. Lasser, April 2021 Astronomical Institute, University of Bern daniel.arnold@aiub.unibe.ch Satellite orbit and gravity field determination at AIUB LEO Satellites Plenty of satellites orbit Earth in Low Earth Orbit (LEO), i.e., at an al- titude of about 200 - 2’000 km. For many of them a very accurate and precise knowledge of their positions at any time is crucial. E.g., to reli- ably measure global and regional sea level by means of satellite altimetry (see Fig. 1), the LEO satellit orbits need to be know at a level of cm or even sub-cm accuracy. Figure 1: Principle of satellite altimetry. ©CLS/AVISO Often such LEO satellites carry GNSS (Global Navigation Satellite Sys- tems) receivers on board – most of them for GPS, but newer satellites also for other GNSS like the European Galileo. These GNSS measurements can be exploited to support a Precise Orbit Determination (POD) if • high-quality information about the GNSS satellites (in particular their orbits, atomic clock corrections and signal biases) are known • accurate information about LEO satellite geometry is available • substantial effort for the modeling of satellite dynamics and of the GNSS measurements (including signal propagation and effects in transmitter and receiver) is conducted. LEO POD at AIUB At the Astronomical Institute of the University of Bern (AIUB) the GNSS- based LEO POD is advanced since many years. The orbits of numerous different LEO satellites have been and are being computed using our in- house developed Bernese GNSS Software, which is used by more than 700 other institutions worldwide. For the GNSS orbits and clock correc- tions we use our high-quality Center For Orbit Determination in Europe (CODE) products. As an example, the AIUB is part of the Copernicus POD Quality Working Group, in the frame of which we perform POD for the ESA Sentinel-1, -2, -3, and -6 Earth observation satellite fleet (see Fig. 2) for intercomparison and cross-validation (see Fig. 3). Figure 2: ESA’s Sentinel satellites. ©ESA For a typical 1-day reduced-dynamic (solution of a satellite equation of motion) and kinematic (purely geometric positioning) LEO POD with 10 s sampled GPS data from an 8-channel GPS receiver (e.g., Sentinel-1), we process about 250’000 GPS and 90’000 attitude measurements to estimate orbit and observation technique-specific parameters. The number of esti- mated parameter is in the range of 10’000 for the reduced-dynamic orbit and about 40’000 for the kinematic one. The processing time (including data pre-processing) amounts to 20-40 minutes and the maximum mem- ory consumption to about 150 MB. Processing GPS data at 1 Hz sampling and/or from GPS receivers with more channels increases these numbers. The POD is usually performed on UBELIX, for extended tests or repro- cessing purposes typically many (50-100) days are processed in parallel. Figure 3: Radial differences of numerous orbit solutions for Sentinel-3B w.r.t. a combined solution in the Copernicus Regular Service Review #19. AIUB is delivering dynamic (light green) and a reduced-dynamic (dark green) solutions. The former one belong to the highest- performing solutions within the Quality Working Group. Figure 4: The GRACE Follow-On mission to measure Earth’s time variable gravity field. ©NASA From orbits to gravity field The Earth’s gravity field causes the main force acting on the satellite’s orbit and defines its shape. This process may be reversed, thus, precisely measuring the motion of an artificial satellite in LEO allows to deduce information about Earth’s gravity field. The latter is constant neither in space nor in time, but changes due to all-present mass re-distributions above, on or below the Earth surface. In short time scales, e.g., monthly, mostly water re-distributes, which means one is able to measure through satell
poster
Investigating the reliability of depth monitoring using optical coherence tomography during laser osteotomy Arsham Hamidi 1, Yakub A. Bayhaqi 1, Ferda Canbaz 1, Alexander A. Navarini 2, Philippe C. Cattin 3, and Azhar Zam 1 1 Biomedical Laser and Optics Group (BLOG), Department of Biomedical Engineering, University of Basel 2 Digital Dermatology, Department of Biomedical Engineering, University of Basel 3 Center for medical Image Analysis and Navigation (CIAN), Department of Biomedical Engineering, University of Basel Introduction Laser osteotomy is a contactless and potentially minimally invasive technology for bone surgery, providing freedom of cutting geometry and high precision. One technical drawback of using lasers for osteotomy is the lack of depth feedback. Optical coherence tomography (OCT) is a non-invasive, high- resolution, and high-speed interferometric imaging system. Following the first report of the integrated OCT and laser ablation system, an extensive effort has been made to improve this integrated setup [1]. An irrigation system is commonly used together with laser ablation systems to keep the tissue hydrated and the surface temperature at a fixed level which is, below the damage/carbonization threshold. However, accumulation of water inside the laser-induced cut can lead to a wrong depth measurement, and consequently, damage the critical structure in the vicinity and/or excessive depth of cuts. Thus, a proper depth monitoring system is required to obtain correct depth measurements. Materials and Methods Figure 1 shows a schematic of the integrated system. The swept-source OCT (SS-OCT) system operates at 110 kHz with a central wavelength of 1314 nm, and spectral bandwidth of 64.5 nm. The imaging range was measured as 26.2 mm in the air. The Er:YAG laser (LITETOUCH by Syneron) was integrated with the OCT system with a dichroic filter [2]. A shutter was responsible for controlling the ablative laser, it stopped the laser pulses after reaching the desired depth. Accumulated water inside the laser-induced cut leads to the wrong measurement of the depth of incision. By detection of a less depth of cut in comparison to the measured depth in the previous laser pulse, the shutter was adjusted to be closed, and in the meantime, accumulated water extracted using high air-pressure. Results Figures 2(a)-(c) demonstrate the errors associated with OCT depth monitoring during laser osteotomy. Figure 2(a) shows the actual depth of laser-induced incision (2.6 mm). Although Fig. 2(b) represents the same depth of the cut as Fig. 2(a), the OCT system detects the air-water interface (0.96 mm) instead of the actual depth of the cut. Shooting the next Er:YAG laser pulse will lead to water explosion (Fig. 2(c)), which may cause imaging artifacts. Conclusions This study demonstrates one of the errors accompanied by the OCT system as a visual feedback system during laser osteotomy. An excessive amount of water that accumulated inside the laser-induced cuts can both lead to a wrong depth measurement and inducing imaging artifacts for the real-time OCT system. The results show the possibility of using the OCT system as visual feedback for laser osteotomy. This system can also potentially be used as a feedback system for the irrigation system. An Introduced method shows that this method can be used to control the irrigation system in order to prevent wrong depth measurements. References: [1] Boppart, Stephen A., et al. "High-resolution optical coherence tomography-guided laser ablation of surgical tissue." Journal of Surgical Research 82.2 (1999): 275-284. [2] Hamidi, Arsham, et al. “Long-range optical coherence tomography with extended depth-of-focus: A visual feedback system for smart laser osteotomy." Journal of Biomedical Optics Express, 10.1364/BOE.414300. Fig.1 : Integration of OCT system with laser ablation (Er:YAG laser). Fig.2 : OCT images of different conditions, (a) actual depth of cut, (b) crater filled with water, (c) water
poster
Towards a fully-automated site tie system at SARAO Hartebeesthoek RC Botha α, 1 & M Nickola β, 1 α 0000-0002-5767-1476; β 0000-0001-9526-4380 ¹ South African Radio Astronomy Observatory (SARAO) 10.5281/zenodo.10726248 P r o c e d u r e s • Link optical measurements to WGS84 utilizing a Reference Network of prisms which are co-axial with GNSS antennas • Total station positions determined via resection Total station positions in WGS84 • Measurements done by Total Stations are in WGS84 M e a s u r e m e n t s • Perform regular (semi- to fully- automated) measurements of optical targets in Reference and Network • For antenna axis and IVP, use a combined measurement schedule with: • pre-determined antenna pointing coordinates (antenna steer) • pre-determined prism positions (Leica GeoMoS) • Use IVP in local tie determinations Figure 1: A design for a co-axial optical and GNSS reference points (1) with a) the reference pillar and plate, b) the optional levelling plate, c) the GPH1P Prism Pillar and d) GNSS antenna. GNSS reference stations HRAX (2), ESA’s HRTB (3) and NASA HRAO (4), DLR’s HRAG (5) and the Roscosmos UARJ station (6). Figure 2: Dual prism setup (1) for co-axial mounting, and magnetic prisms (2). Co-axial prism on the M6 telescope (3), co-axial prism on the South-side of the 26m polar shaft (4). R e f e r e n c e N e t w o r k M e a s u r e m e n t N e t w o r k Presented on 4 March 2024 at: 1 2 4 5 6 3 1 2 2 4 3
poster
RECENT RESULTS FROM MICE ON MULTIPLE COULOMB SCATTERING AND ENERGY LOSS Alan Young* on behalf of the MICE Collaboration *a.r.young@strath.ac.uk Acknowledgemnts Work supported by NSF and DOE (USA), the INFN (Italy), the STFC (UK), the EC under the EC FP7, the Japan Society for the Promotion of Science (Japan) and the Swiss National Science Foundation (Switzerland), in the framework of the SCOPES programme. We gratefully acknowledge their support. We acknowledge the use of Grid computing resources deployed and operated by GridPP in the UK, http://www.gridpp.ac.uk/. MICE Data Links to the MICE raw data along with links to other MICE related data can be accessed at https://doi.org/10.17633/rd.brunel.3179644 References [1] S. Geer, “Neutrino beams from muon storage rings: Characteristics and physics potentials”, Phys. Rev. D57 (1998) 6989 [2] D. Neuffer, “Principles and applications of muon cooling”, Part. Accel. 14 (1983) 75 [3] R. C. Fernow and J. C. Gallardo. “Muon transverse ionization cooling: Stochastic approach”. Phys. Rev. E, 52:1039-1042, 1995 [4] MuScat Collaboration, W. J. Murray, “Comparison of MuScat data with GEANT4”, Nucl. Phys. Proc. Suppl. 149 (2005) p. 99-103 [5] GEANT4 Collaboration, S. Agostinelli et al., “GEANT4: A Simulation toolkit”, Nucl. Instrum. Meth. 265 A506 (2003) p. 250- 303 [6] S. Peter, “Particle penetration and radiation effects”. Springer Series in Solid State Sciences, 151. Berlin Heidelberg: Springer- Verlag Measurement of energy loss The mean rate of energy loss for relativistic charged heavy particles traversing matter is given by the “Bethe equation” [6] where the mean excitation energy I in hydrogen is known at the 5% level but has never been measured in lithium hydride. The momentum of the muons is measured upstream and downstream of the absorber using the scintillating-fibre trackers combined with the time of flight detectors. Preliminary results using a convolution fit for 200 MeV/c muons in magnetic field traversing the LiH absorber show that mean momentum loss is ∆p = 12.8 ± 5.3 MeV/c. Figure 3: Reconstructed momentum loss across the LiH absorber for several muon beams Figure 1: Layout of MICE in the Step IV configuration Ionization cooling equation Cooling term Heating term Introduction Muon beams of low emittance provide the basis for the intense, well-characterised neutrino beams necessary to elucidate the physics of flavour at a neutrino factory and to provide lepton- antilepton collisions at energies of up to several TeV at a muon collider [1]. The International Muon Ionization Cooling Experiment (MICE) will demonstrate ionization cooling, the technique by which the phase space volume occupied by muon beams is reduced (“cooled”) [2]. In an ionization-cooling channel, a muon beam passes through absorber material in which it loses energy. The longitudinal energy lost is then replaced using radio frequency (RF) cavities. The combined effect of energy loss and re-acceleration is to reduce the transverse emittance of the beam (transverse cooling). The configuration that has operated until December 2017 at the Rutherford Appleton Laboratory, has made detailed measurements of multiple Coulomb scattering and energy loss of muons in lithium hydride (LiH) and liquid hydrogen (LH2) absorbers, over a range of momenta from 140 to 240 MeV/c with and without magnetic fields in the cooling channel, in order to characterise the ionization cooling equation [3]. The experiment also seeks to measure transverse normalized emittance reduction in a number of lattice configurations. Measurement of scattering distributions Though multiple Coulomb scattering is a well understood phenomenon, results from MuScat [4] indicate that the effect in low Z materials is not well modelled in simulations such as GEANT4 [5] and therefore it is essential for MICE to validate the scattering model. Bayesian deconvolution has been applied to data collected at three different momenta (172 MeV/c, 200 MeV/c and 240 MeV/c) with
poster
LATEX TikZposter Integrating XIOS into the nextSIM-DG next-generation sea ice model Joe Wallwork1, Tom Meltzer1, Tim Spain2, Marion Weinzierl1, Einar ´Olason2 1Institute of Computing for Climate Science, University of Cambridge, U.K. 2Nansen Environmental and Remote Sensing Center, Bergen, Norway Integrating XIOS into the nextSIM-DG next-generation sea ice model Joe Wallwork1, Tom Meltzer1, Tim Spain2, Marion Weinzierl1, Einar ´Olason2 1Institute of Computing for Climate Science, University of Cambridge, U.K. 2Nansen Environmental and Remote Sensing Center, Bergen, Norway Overview nextSIM-DG is developed as part of the Scale-Aware Sea Ice Project (SASIP). One of the main differences between nextSIM-DG and its predecessor – neXtSIM – is that it uses discontinuous Galerkin (DG) methods to better capture fractures in sea ice than with continuous elements. Ice concentration for different discontinuous finite element spaces. Image credit: Richter et al. (2023). XIOS provides a server-based approach for efficient in- put/output (I/O), which may be configured either using XML files or with API calls. It supports asynchronous I/O, as well as the NetCDF and HDF5 data formats commonly used by the geoscientific modelling community. Coupling to XIOS Both nextSIM-DG and XIOS are written in C++. Should be straightforward, right? Not quite. • XIOS’ primary user base is the weather and climate mod- elling community, whose codes are mostly written in For- tran. XIOS provides C bindings and a Fortran interface built from these using iso_c_binding. • Whilst we could make calls to XIOS’ C++ API directly in nextSIM-DG, there is a risk that code which isn’t in the public C interface might change, especially given the planned major version upgrade to XIOS3. • Our approach is to wrap the C bindings in nextSIM-DG. Coupling more generally Coupling geoscience models Earth system modelling requires coupling different model components together (e.g., ocean and atmosphere models). This often involves different grids, making it important to choose appropriate interpolation methods. Interpolation be- tween model components can be achieved with OASIS. Tripolar and bipolar grids over the Northern Hemisphere. Image credit: Winkelbauer, et al. “StraitFlux–Precise computa- tions of Water Strait fluxes on various Modelling Grids.” EGU- sphere 2024 (2024): 1-26. Data considerations • Even if grids match, data is an important consideration. A sub-optimal implementation might copy data unnecessarily between grids =⇒pass pointers where possible. • Integrating tools directly into model data structures can be difficult. We found it simpler to map strings and ar- rays from XIOS’ C interface to C++ std::strings and std::vectors before wrapping in nextSIM-DG syntax. Summary Challenges • (Unexpected) multi-language problem. • Unintended usage. • How much of the API should we wrap? Key lessons • Use public interfaces where possible. • Avoid unnecessary copies / modify data in-place. • Start with standard data types before integrating model data types. References • Richter, et al. “The neXtSIM-DG dynamical core: A Framework for Higher-order Finite Element Sea Ice Modeling.” EGUsphere 2023 (2023): 1-31. • nextSIM-DG: github.com/nextsimhub/nextsimdg • XIOS: forge.ipsl.jussieu.fr/ioserver/wiki • OASIS: oasis.cerfacs.fr/en/home Acknowledgements This project is supported by Schmidt Sciences, LLC.
poster
A Spectroscopic and Photometric Survey of Classical Novae in M31 Conor Ransome (Astrophysics Research Insitute, LJMU) Co-authors: Matt Darnley, Phil James, Stacey Habergham-Mawson and Mike Healy Email: C.Ransome@2018.ljmu.ac.uk Classical novae (CNe) are a subclass of cataclysmic variable comprised of a white dwarf (WD) and a late-type (main sequence to giant, Bode & Evans, 2008) donor which results in a non- terminal explosion once the enough matter has accreted onto the WD such that the pressure at the surface of the WD is adequate to initiate a thermonuclear runaway reaction. Recurrent novae (RNe) are CNe systems where multiple eruptions have been observed, these are systems with a higher mass WD approaching the Chandrasekhar mass and require less accreted mass in order to trigger a TNR due to the higher surface gravity of the WD. RNe are a potential single-degenerate channel to Type Ia supernovae. CNe can be split into two spectral classes, Fe II and He/N based on the strength of emission lines (Williams, 1992) and also the ejecta velocities estimated by the width of the H-alpha profiles with Fe II novae having slower ejecta (up to 2500km/s) than He/N novae (up to 10,000km/s). There are two main hybrid spectral classes: ●Fe IIb exhibit the characterisitic Fe II class lines but the width of the H-alpha profile exceeds that of regular Fe II class novae and more similar to the ejecta velocities of the He/N class. ●He/Nn exhibit the characteristic He/N class lines but with ejecta velocities more similar to the Fe II class. 1. Classical Novae 2. Motivation Previous studies of CNe in M31 have had small samples; for example: 85 – Hubble (1929); 44 Shafter et al. (2011). We have a sample of 180. The environments in which CNe occur can tell us about the stellar populations the systems belong to. In this case we look at UV emission: ●High UV emission points to hot, young O/B stars which reside in young populations with active star formation. Younger populations in the disc are thought to have higher mean WD masses than the bulge which may indicate more He/N novae (Shafter 2013). Galaxies with a central bulge (e.g. M31) have around 80% FeII novae whilst bulgeless galaxies (e.g. LMC) have an equal split of FeII to He/N. Previous work found no difference in the radial distribution of novae of the two spectral classes (Shafter et al. 2011). 3. Methods The sample (compiled using Pietsch et al., 2007) are split into spectral classes and analysed in terms of their spatial distribution and association with UV emission regions. Archival Liverpool Telescope data will be analsyed to make spectral classifications of our CNe. We employ a pixel statistics technique, normalised cumulative rank (NCR) which is usually used in the study of supernova environments (see James & Anderson, 2006) to calculate the relative UV flux of the pixels that a nova falls on in images from the GALEX space telescope. We then use Anderson-Darling (AD) tests to determine if there is a significant difference between the two distributions. We compare the NCR data of the spectral types against each other. Three approaches to looking at the radial distribution of the novae from the centre of M31: ●The offset as seen on the sky. ●The deprojected offsets. ●The isophotal radius. 4. Results The LT had 76 spectra in the archive, 60 were usable to make classifications, we find 48 Fe II novae, 6 He/N novae, 5 Fe IIb hybrids and a single He/Nn hybrid. Despite our much larger sample none of the results of our AD tests were statistically significant. Therefore there is no evidence to suggest there is a difference in either the environments as seen in the NCR analysis or the radial distribution of He/N or Fe II novae in M31. We will produce light-curves to include speed classes (as described by Payne-Gaposchkin, 1964) into our analysis. This investigation will be extended to M33 and the LMC. Above: Novae split into all classes plotted over a Palomar 48-inch Schmidt telescope image of M
poster
Amaryllis Vidalis1, Aristotelis Papageorgiou2, Seraphim Hatziskakis2, Ioannis Tsiripidis3, Oliver Gailing1, Reiner Finkeldey1 1 Department of Forest Genetics and Forest Tree Breeding, Büsgen Institute, Georg-August-University Göttingen, Büsgenweg 2, 37077 Göttingen, Germany 2 Department of Forestry, Environment and Natural Resources, Democritus University of Thrace, P.O. Box 129, Pantazidou 193, 68200 Orestiada, Greece 3 School of Biology, Department of Botany, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece Patterns of genetic diversity in Fagus sylvatica L. in Rodopi Mountains of N.E. Greece PL LL LW LMW LA LP NS AN LI MWI PI RC Elatia 0,95 7,86 4,85 4,02 25,97 19,07 8,00 36,41 163,00 51,16 12,11 1,06 Echinos 0,88 8,56 5,21 4,59 30,74 20,78 9,60 38,48 166,00 53,59 10,31 1,07 Papikio 0,97 8,74 5,33 4,68 31,56 21,15 9,20 38,48 165,00 53,32 11,03 1,07 Dadia 0,83 8,73 5,22 4,62 31,10 20,92 9,30 37,37 168,00 52,81 9,56 1,08 Table 1. Average values of morphological traits measured per population 0% 20% 40% 60% 80% 100% Dadia Papikio Echinos Elatia ФT1 ФT2 ФT3 Figure 2. Phylotypes frequencies within populations Hs Ht Gst AFLPs 0,234 0,255 0,089 cpDNA haplotypes 0,551 0,925 0,405 Elatia Echinos Papikio Dadia Number of polymorphic zones AFLPs 26 26 28 33 Percentage of polymorphic zones AFLPs 76,47 76,47 82,35 97,06 Expected heterozygosity - AFLPs 0,212 0,213 0,243 0,269 Haplotypes numbers - cpDNA 3 4 8 9 Expected "heterozygosity" - cpDNA 0,153 0,438 0,707 0,813 0% 20% 40% 60% 80% 100% Dadia Papikio Echinos Elatia 145-115 146-110 146-115 147-110 147-115 148-110 148-115 149-110 150-110 151-110 152-110 153-110 154-110 156-110 Table 2. Diversity and differentiation of populations (Nei 1987) Table 3. Genetic diversity within populations Figure 3. Frequences of cpDNA haplotypes According to the most accepted taxonomic classification of beech in Europe, Fagus sylvatica can be subdivided into two subspecies (ssp. sylvatica and ssp. orientalis) [1]. The current beech populations of Europe may have a common origin from refugial populations which survived the last glaciation's era [2]. The wider area of Greek Rodopi is being considered as potential refugium for European beech [3]. In previous research, high variation in morphological traits was found in Greek beech populations. At molecular level, variation has been generally found higher in the Mediterranean part of Fagus sylvatica distribution, as compared to that found in central and western European populations [4]. Specifically, in cpDNA of beech, former research has revealed no or minor polymorphism in large areas of its natural distribution [4]. Material and methods PL Petiole length LL Lamina length LW Lamina width LMW Distance between the lower part of the lamina and the maximum width point on the axis LA Lamina area LP Lamina perimeter NS Number of secondary nerves AN Angle between the primary and the central secondary nerve Morphological traits Molecular markers AFLPs [5] Primer pairs Restriction enzymes EcoRI- MseI Preselective amplification E01/M03 (Keygene) Selective reaction E37/M68 LI LL/LW · 100 MWI LMW/LL · 100 PI PL/LL · 100 RC Radius of a cycle with an area equal to LA divided by the radius of a cycle having a perimeter equal to LP DNA was extracted from buds using the DNeasy® Plant Kit (Qiagen) Results Morphological traits Molecular markers Elatia Echinos Papikio Dadia Elatia 0 6,068 4,966 1,522 Echinos 0,04 0 0,276 3,619 Papikio 0,07 0,03 0 3,028 Dadia 0,056 0,018 0,013 0 Conclusions • The beech populations of Rodopi mountains show high levels of genetic diversity within populations in leaf morphological traits, AFLPs and cpSSRs • The levels of genetic variation within populations were found high compared to previous surveys in European populations • Clinal variation patterns were observed at both morphological traits and molecular markers; variation increases from the west to the east • Differentiation among populations was, as expected, stronger at mater
poster
Figure of Merit Data Unfolding for the Helium and Lead Observatory John Franklin Crenshaw, Dr. Kate Scholberg for the HALO collaboration The Helium and Lead Observatory (HALO) is a supernova neutrino detector at SNOLAB that has been operational since 2010, and is a member of the SuperNova Early Warning System (SNEWS). The detector consists of 128 3He counters embedded in a 79-ton lead matrix (Figure 1). Depending on the incident neutrino energy, interactions with lead may generate single (1n) or double (2n) neutron events. The relative rates of 1n and 2n events are sensitive to supernova neutrino spectra. It is therefore important to develop a method for reconstructing true 1n and 2n numbers from detected events. Figure 1. Front view of HALO Numbers of 1n, 2n events in HALO can be calculated from different supernova neutrino flux models using the SNOwGLoBES software [1]. Figure 2. Expected 1n, 2n event numbers in HALO given various neutrino flux models for a supernova at 5kpc. Fluxes for blue and red curves from [2], gray “Shen” and black “LS220” fluxes from [3], green “Basel-Darmstadt” fluxes from [4], pink “GVKM” fluxes from [5], teal “Garching” fluxes from [6]. Detection of 1n, 2n events is simulated using a Monte Carlo that incorporates Poisson statistics and the detector efficiencies. The detector efficiencies, determined via Geant4 simulations and by placing a calibrated neutron source within the detector, are summarized by the efficiency matrix: 𝐴𝐴= 1n measured as 1n 2n measured as 1n 1n measured as 2n 2n measured as 2n = 28.3% 37.6% 0 9.7% Data unfolding must be performed to determine the true number of 1n, 2n events in HALO given the number of detections. A simple unfolding can be performed by inverting the efficiency matrix, but this method results in large uncertainties and unphysical results (Figure 3). A Bayesian unfolding algorithm can improve on these problems. Figure 4. Top: Prior 2 (“distance unknown”). As 1n, 2n pairs scale linearly with distance it is possible to impose a maximum ratio 2n/1n. Bottom: Prior 3 (“distance known”). The data from Figure 2 is plotted twice, for supernovae at 4.5 kpc (red) and 5.5 kpc (blue). An envelope is constructed around the range of points. Sample 1n, 2n values are simulated then unfolded using the three priors. The process is repeated 10,000 times for each. The results are represented as gray contours, which contain 90% of the unfolded data points. The plots below represent neutrino detections in HALO for a supernova at 5 kpc. Similar plots were also created for a supernova at 10 kpc, and for detections in HALO-1kT, the proposed 1-kiloton upgrade to HALO at LNGS. Figure 5. 3 sample 1n, 2n points (represented by stars) for a supernova at 5 kpc are simulated and unfolded using the three priors. Gray contours are drawn around 90% of the unfolded points. The models from Figure 2 are overlaid for reference. The sensitivity of HALO and HALO-1kT decreases with the supernova distance. To quantify this sensitivity, the percentage of reasonable models that is excluded by a contour is plotted as a function of distance. Figure 6. Percent of models excluded by unfolded contour as a function of distance. The “distance known” prior is used. Top: Comparison of HALO and HALO-1kT Bottom: Only HALO-1kT [1] http://www.phy.duke.edu/~schol/snowglobes [2] Väänänen, D., & Volpe, C. (2011). The neutrino signal at HALO: Learning about the primary supernova neutrino fluxes and neutrino properties. [3] Huedepohl, L. (2014). Neutrinos from the Formation, Cooling and Black Hole Collapse of Neutron Stars. PhD. Thesis, Technische Universitat Muenchen . The RooUnfold iterative Bayesian algorithm [7] unfolds by using a prior, which is iteratively updated using the results of the unfolding. This process is iterated until the result converges. I perform the unfolding with three priors: (1) a prior that restricts the unfolding to the positive 1n, 2n plane (2) a prior based on expected 1n, 2n values for an unkno
poster
COVID-19 Biomarkers in Research and Associations with Comorbidities 1The Department of Biochemistry & Molecular Medicine, The George Washington University Medical Center, Washington, DC 20037 2The McCormick Genomic and Proteomic Center, The George Washington University, Washington, DC 20037 Signature molecules, including genes, proteins, target panels, and glycans termed as biomarkers, are becoming increasingly significant in the Coronavirus disease 2019 (COVID-19) pandemic. High-throughput molecular characterization technologies have greatly accelerated the development of tests for risk assessment, diagnosis, prognosis, disease monitoring, and therapeutic evaluation. The disease complexity emphasizes the need for biomarker characterization that can help stratify patients based on their variable clinical manifestations and the presence of comorbidities. Powered by an NCI ITCR funded, comprehensive data model built to capture cancer biomarker data (OncoMX), and incorporating crowdsourced data collection and integration techniques, we have efficiently harmonized COVID-19 biomarker data. As of now, we have 146 potential biomarkers for COVID-19. Most biomarkers are associated with the immune system (including complement factors, inflammatory modulators, and pro-inflammatory factors) as well as coagulation factors. These trends suggest a vascular pathobiology of the COVID-19 disease. Utilizing this collated biomarker data, we propose to identify common features and attributes of COVID-19, with cancer and other metabolic syndromes. Preliminary analysis shows biomarkers such as ACE2, IL-6, IL-4, and IL-2 have similar expression profiles in COVID-19 and cancer. Furthermore, COVID-19 biomarkers such as D-dimer, neutrophil to lymphocyte ratio (NLR), C-reactive protein (CRP), and low-density lipoprotein (LDL) shed light on the underlying physiological or pathological association with metabolic syndrome, diabetes, and hyperlipidemia. The importance of this study lies in identifying specific biomarkers that can successfully stratify patients based on distinct clinical presentations and the presence of comorbidities. Exploration of these patterns will benefit researchers and diagnosticians alike. ABSTRACT Gogate N1, Bell A1, Lyman D1, Cauley E1 , Joseph A1, Kahsay R1, and Mazumder R1,2. Project Overview: Steps for collection, organization, standardization and integration of the data elements in the COVID-19 biomarker resource data model. Rubric for Biomarker data type and column content: Harmonization of biomarker-centric knowledge (including terms, definitions, synonyms), enriched with objects imported from related reference ontologies under a unified framework. Research reported is supported in part by National Cancer Institute Grant No. U01CA215010 to RM. We would like to acknowledge all our HIVE lab volunteers for their hard work and contributions towards this resource. All data reported is freely available at https://data.oncomx.org/covid19 under the Creative Commons CC-BY-4.0 license. COVID-19 Biomarker Highlights: Top biomarkers are depicted as increased or decreased levels. The size of the circle is indicative of the number of articles supporting the biomarker. The color of the circle corresponds to the BEST biomarker type (Monitoring – blue, Prognostic – green, Diagnostic – purple, Predictive – pink). Data suggests that hyper-activation of the immune system, coagulopathies and the targeting of specific types of cells are the primary modus operandi of SARS-CoV-2. It also sheds light on the underlying physiological or pathological association with cancer as well as metabolic syndrome, diabetes, and hyperlipidemia. Model of BEST biomarker subtypes. BEST biomarker types modeled on disease progression. Each category of BEST biomarker fulfils a distinct role ”as an indicator of normal biological processes, pathogenic processes, or responses to an exposure or intervention. 1. Gogate N et al. bioRxiv [Preprint]. 2020 Sep 2. FDA-NIH_Biomark
poster
Engineers Code: Re-usable, Open Educational Modules for Engineering Undergraduates Lorena A. Barba, George Washington University, USA, labarba@gwu.edu Natalia C. Clementi, George Washington University, USA, ncclementi@gwu.edu JupyterCon, 22–24 August 2018, New York Open—Inspired by open-source culture Think of the impact of open-source development: people collaborate on large, complex projects, creating value together. What is the influence of this model in Open Education? Teaching and learning resources are made public, under a license permitting reuse, remix, rework, redistributing. We aim to collaborate with like-minded instructors, to peer-review materials, join in shared online platforms, and bring our students together. Motivation—Using computing to learn Modular—Stackable self-contained modules We can transform science and engineering education by making computational thinking infrastructural: embedded, ubiquitous, and contextual. To accomplish this, we need open instructional materials designed to be reusable, and community efforts to share good practices for using them. Our foundation modules are ready to adopt: 1. Get data off the ground: Learn to interact with Python and handle data. 2. Take off with stats: Hands-on data analysis using a computational approach and real-life applications. 3. Fly at changing systems: Tackle the dynamics of change with computational thinking. Coming soon! 4. Land in vector spaces: A graphical introduction to linear algebra. All materials are under BSD-3 clause and CC-BY licenses. Digital —Using the latest technology in digital pedagogy Find it: https://openedx.seas.gwu.edu Course lessons are Jupyter-first—created as Jupyter notebooks, displayed in Open edX via the new jupyter-viewer-xblock. Assessments are auto-graded via the jupyter-edx-grader-xblock, nbgrader and Docker, providing instant feedback to the learner. Open edX is the only last-generation, full-featured, open-source platform for online learning. We deployed our site on Amazon AWS, with support from technical partners at IBL Education, NY. We take inspiration in the ideas of Seymour Papert about computational thinking. In particular, we want to design course materials adhering to Papert's Power Principle: What comes first, using or understanding? The natural mode of learning is to first use, leading slowly to understanding. New ideas are a source of power to do something! Our approach follows research-based design directions for developing computational thinking skills, embedded in science contexts. These skills are: 1. Data practices 2. Modeling and simulation practices 3. Computational problem-solving 4. Systems-thinking practices Ref. – Weintrop, David, et al., “Defining computational thinking for mathematics and science classrooms,” J. Science Ed. and Tech., Vol. 25(1): 127–147 (2016). Design—Key principles 1. Idea of “computable content”—educational content made powerfully interactive, using Jupyter. 2. Idea of open pedagogy—reflecting in the teaching practice the ethos of open source. 3. Modularization—break-up the typical course format. 4. Harness the “worked-example effect”—empirically shown as better than problem-solving for novices. 5. Live-coding to structure active-learning in class. Credits—Images and thanks Lolly sticks from Wiki Education CC-BY Fuding by NSF award OCI–1730170 @LorenaABarba @ncclementi Please visit: http://lorenabarba.com This poster is licensed under CC-BY 4.0 https://github.com/engineersCode/EngComp Find it: https://github.com/ibleducation/jupyter-viewer-xblock https://github.com/ibleducation/jupyter-edx-grader-xblock From Module 3, lesson 4: “Bird’s eye view of mechanical vibrations”—top: system diagram; bottom: phase plot. From Module 2, lesson 4: “Life expectancy and wealth”—bubble plot of life expectancy vs. gross domestic product for 142 countries, with bubble size scaled by population.
poster
CEDAR CENTER FOR EXPANDED DATA ANNOTATION AND RETRIEVAL Faster and Better Metadata Authoring using CEDAR's Value Recommendations Marcos Martinez-Romero, Martin J. O’ Connor, Ravi D. Shankar, Maryam Panahiazar, Debra Willrett, Attila L. Egyedi, John Graybeal, and Mark A. Musen Stanford University, Stanford, CA 94305, U.S.A. Scientists metadatacenter.org marcosmr@stanford.edu, martin.oconnor@stanford.edu, rshankar@stanford.edu, marypan@stanford.edu, willrett@stanford.edu, attila.egyedi@stanford.edu, jgraybeal@stanford.edu, musen@stanford.edu CEDAR is supported by grant U54 AI117925 awarded by the National Institute of Allergy and Infectious Diseases through funds provided by the trans-NIH Big Data to Knowledge (BD2K) initiative (www.bd2k.nih.gov) Metadata Editor stored Metadata Repository 11/2016 fill in templates templates filled in indexed Search Engine real-time analysis suggest values Decrease authoring time Reusable metadata Increase metadata quality Value Recommender more examples Recommendation score 0 20 40 60 80 100 hepatocellular carcinoma hepatitis C liver cirrhosis carcinoma liver cancer cancer hepatocellular adenoma hepatitis B adenoma alcohol abuse tissue = liver disease = ? Recommendation score 0 20 40 60 80 100 hepatocellular carcinoma lipid metabolism disorder carcinoma lung cancer lymphoma cancer acute myeloid leukemia asthma breast cancer rheumatoid arthritis disease = ? (no context) Recommendation score 0 20 40 60 80 100 lung cancer chronic obstructive pulmonary disease lung squamous cell carcinoma idiopathic pulmonary fibrosis lung adenocarcinoma adenocarcinoma carcinoma cancer non−small cell lung carcinoma pulmonary fibrosis tissue = lung disease = ? Figures above show the top 10 suggestions provided by the Value Recommender for the ‘disease’ field of the ‘Biosample Human’ template. These recommendations were generated based on over 35K instances of the ‘BioSample Human’ template CEDAR is developing novel methods and tools to simplify the process by which investigators annotate their experimental data with metadata The ‘BioSample Human’ template contains the fields used in BioSample for human samples The suggestions provided are context-sensitive, meaning that the values predicted for a particular field are generated and ranked based on previously entered values CEDAR’s value recommendation technology leverages existing metadata to make the authoring of high-quality metadata a manageable task The Value Recommender supports both free-text values and controlled terms. In this particular example, the system suggests terms from the Human Disease Ontology (DOID) BioSample is a database from the National Center for Biotechnology Information (NCBI) that captures descriptive information about the biological samples investigated in projects CEDAR’s Value Recommender identifies common patterns in the metadata repository, and generates real-time suggestions for filling out metadata templates The CEDAR Workbench (cedar.metadatacenter.net) is a set of Web-based tools for the acquisition, storage, search, and reuse of metadata acquisition forms (metadata templates). One of those tools is the Metadata Editor, which allows users to fill in metadata templates with metadata In biomedicine, good metadata is crucial to finding experimental datasets, to understand how experiments were performed, and to reuse data to conduct new analyses We have enhanced the Metadata Editor with value recommendation capabilities Based on: Panahiazar et al. Context Aware Recommendation Engine for Metadata Submission. First Int Work Capturing Sci Knowl. 2015;3–7.
poster
SALT spectroscopy of hydrogen-deficient stars Simon JEFFERY1,2 and Brent MISZALSKI3,4 1Armagh Observatory and Planetarium, 2Trinity College Dublin, 3Southern Africa Large Telescope, 4South African Astronomical Observatory Summary. The majority of hot subdwarfs lie on or close to the helium main-sequence. Many have hydrogen-rich surfaces, but a substantial fraction have hydrogen-depleted or hydrogen-deficient surfaces. Amongst the former, three were known to show extraordinary overabundances of heavy elements including zirconium and lead. A limited survey with Subaru/HDS revealed three new lead-rich subdwarfs. A much wider survey is in progress using SALT. Discoveries include two new extreme helium stars, new intermediate helium subdwarfs, and a new lead star. Analysis of the growing sample shows evidence of connections between hydrogen-deficient classes. Introduction The majority of hot subdwarfs are hydrogen-rich, with helium strongly suppressed. However, some 10% show helium enrich- ments from near equity with hydrogen up to nearly pure helium surfaces (Geier 2013). This diversity is apparent in the helium sub- classes identified by Drilling et al. (2013), who also noted that cer- tain classes of helium-rich hot subdwarf and extreme helium stars are difficult to distinguish at low resolution. At high resolution, more exotic chemistries were discovered by Naslim et al. (2011, 2013), including zirconium- and lead-rich subdwarfs. The extreme rarity of these stars demands a search for additional specimens. We describe a survey using the Southern African Large Telescope (SALT) to identify extreme helium stars and exotic chemistry sub- dwarfs, and to map their connections. Figure 1: SALT/HRS atlas of early-type helium-rich hot subdwarfs binned to show major hydrogen and helium lines. Rest locations of principal hydrogen, helium and carbon lines are indicated in colour . Figure 2: As Fig. 1: late type spectra. Observations SALT/HRS From 2016 to 2018, observations have been ob- tained with the SALT High Resolution Spectrograph (HRS) for southern helium-rich subdwarfs and other stars identified from low-resolution surveys. Echelle spectra were reduced, blaze cor- rected, resampled and stitched (Figs. 1 and 2). SALT/RSS Commencing 2018, observations have been ob- tained with the SALT Robert Stobie Spectrograph (RSS) (Figs. 4 and 5). Methods Classification using the Drilling et al. (2013) system gives prox- ies for effective temperature Teff, surface gravity g, and helium abundance (He/H). The object is to identify stars of interest, es- pecially in the cool low-gravity domain. More refined measure- ments are obtained by fitting the observed spectra in a three- dimensional model grid covering the same parameters. The grid must be adapted (and iterated) to match the heavy-element dis- tribution since this strongly influences the atmosphere structure at low hydrogen abundances. Once established (and then fixed), a final model atmosphere is computed and elemental abundances of minor species are measured. Fig. 3 shows selected results. Figure 3: Surface properties of selected SALT subdwarfs (red), compared with extreme helium stars (black squares), extreme helium subdwarfs (black diamonds) and intermediate helium subdwarfs (violet diamonds). The Eddington limit (Thomson scattering: dashed), luminosity-to-mass contours (solar units: dotted), the post-merger track for a 0.30+0.25 M⊙ He+He white dwarf merger (Zhang & Jeffery 2012) (maroon), and the post-flash track of a 0.46921 M⊙’late hot flasher’ (metallicity Z = 0.01) (Miller Bertolami et al. 2008) (orange) are also shown. Highlights J18455−4138. Originally classified as a helium-rich subdwarf, raw HRS data indicated a prominent spectrum of strong sharp lines found to be mostly singly-ionized nitrogen. The Balmer lines are negligible, and He ii 4686 is much weaker than in other He-rich subdwarfs. Bearing a strong similarity to V652 Her, fine analysis demonstrated that J18455−4138 is a relatively high-gravity
poster
10 rounds of DE for activity recovery were performed by error-prone PCR and activity screening of 350 enzyme variants by fluorescence assay in lysate. In vitro kinetics of purified variants indicated that DE recovered proteolytic activity by an improvement in both kobs1 (2x103-fold) and kobs2 (3x103-fold). Kinetic activity was recorded on purified enzyme in the presence of 1 µM substrate (pH 8, 25°C). Shown are kcat/KM for TEVCys variants (white circles) and kobs1 and kobs2 for TEVSER variants (black and grey circles respectively). The red dashed arrow indicates the effect of the initially introduced handicap nucleophile mutation (C151S). The nucleophile mutation did not affect TEVSer folding: the melting temperature (TM) of purified TEVSer was only marginally reduced (from 47.8 to 47.4 °C) and quantification of soluble expression in E. coli only decreased 10%. However, activity recovery in the TEVSer→TEVSerX DE trajectory correlated with reduced solubility (Fig. 2b) and stability analysis (using FoldX, Fig. 2c) indicated increasing destabilization. (b) Soluble expression of evolved variants (black) and S151C revertants (white) (measured by densitometric analysis of gel bands with ImageJ). (c) Energy difference between the folded and unfolded states (ΔG) for all evolved variants (black) and S151C revertants (white). Values are calculated by FoldX and normalized to TEVCys, higher values indicate lower stability. TOP: Shown are three residues which mutated during the DE lineage. Indicated is the mutation enrichment of any other amino acid. New residue evolved in DE lineage shown in grey boxes. The H28L mutation, introduced in TEVSerIV, showed enrichment of alternative residues in the two subsequent rounds, but is increasingly selected for retention in later rounds. The back mutation of W130C in TEVSerV is also predicted by its purge from the library. Finally the N174K of TEVSerVIII shows enrichment (of both N174K and N174Y) before it is selected in the lineage, after which further mutations are no longer enriched. LEFT: (a) Structure of TEVCys (PDB 1LVM) showing enrichment of non-wt amino acids for each residue averaged over whole TEVSer→TEVSerX lineage. Thick, blue regions indicate positive enrichment of non-wt amino acids, thin red region indicate purging of non-wt amino acids. Also shown are catalytic triad (red sticks) and N- terminal product (black sticks). (b) Proportion of residues that show enrichment >2-fold for each shell (normalized to the average for each round). Reversion of mutant TEVSerX shows unprecedented nucleophile permissiveness of the evolved variant. Although we deliberately evolved TEVCys via a fitness valley, the nucleophile-permissive TEVSerX can also be accessed from TEVCys by nearly-neutral mutations (Fig 7, left). Indeed TEVSerX shows 92.4% identity to TEVCys, as opposed to ~15% of closest serine proteases. The >103-fold improvement to generate a nucleophile generalist with so few mutations explains how divergent evolution of core catalytic machinery can occur within evolutionarily superfamilies such as the PA clan. The neutrality and abundance of these compensatory mutations may allow them to accumulate by drift before any nucleophile switch occurs and so act as ‘enabling’ mutations. A nucleophile mutation would be predicted to be more difficult to reconcile with two different types of bonds (C-O vs S-O) being formed and cleaved, compared to mutations to accommodate promiscuous binding of multiple substrates. However, our data suggest that the differences of nucleophile reactivity and structure can be readily accommodated by TEV protease and apparently little trade-off is necessary between nucleophiles. Previous attempts to quantify evolvability have found that the proportion of beneficial mutations lies in the range of one in 10-2 – 10-7 (depending on the organism and specific evolutionary challenge; Fig. 8, right). Our characterization of the local protein fitness landscapes puts the proportion of
poster
1cmPhysical properties of circumnuclear ionising clusters S. Zamora *1,2, Ángeles I. Díaz,1,2 1Departamento de Física Teórica, Universidad Autónoma de Madrid (UAM), Spain 2Centro de Investigación Avanzada en Física Fundamental (CIAFF), Spain *sandra.zamora@uam.es Abstract Nuclear rings are generally formed because gas is accumulated in orbital resonances, due to a non-axisymmetric gravitational potential related to a barred structure. However, NGC7742 does not exhibit this latter feature, thus being an ideal candidate for a minor merger event. In this work, we analyze 88 HII circumnuclear starforming regions (CNSFRs) of the nuclear ring, from MUSE integral-field spectroscopy data. We expect to test if this is compatible with the idea of all regions having formed at the same time and if a minor merger event is consistent with observations. Observations and analysis NGC7742 was observed with MUSE (Multi-UnitSpectroscopic Explorer, Bacon et al. (2010)). This face-on galaxy is classified as an SA(r)b galaxy. It has a weakly active nucleus and its morphology is dominated by a nuclear ring. Figure 1. Maps for the observed line and continuum fluxes, Av extinction and EW(Hα). Our HII regions segregation is based in HIIEXPLORER (Sánchez et al., 2012) with some additional requirements. We have a total of 88 regions inside and 158 outside of the ring. We have extracted spectra of each region and we have measured: Hβ, Hα, [OIII]λλ4959,5007, [NII]λλ6548,84, [SII]λλ6716,31 and [SII]λ9069 strong lines (S/N>3); and [SIII]λ6312, [OII]λλ7320,30 weak lines (S/N>1). Also, we have calcu- lated integrate fluxes of Sloan Digital Sky Survey(SDSS) filters of each spectrum. Figure 2. Contours of HII regions over the Hα observed map. Characteristics and chemical abundances In general, although the electron density shows similar distributions in the inner and outer HII region, regions within the ring seem to be more diffuse, showing lower filling factors, and therefore lower ionised hydrogen masses, than the regions outside the ring. Figure 3. Funcional parameters of inner and outer ring regions. Direct abundances have been ob- tained for 38 ring HII regions. For the rest of the regions, we have used the recent calibration of the S23 pa- rameter presented in Díaz & Zamora (2022). Total sulphur abundances are between 0.25 and 2.40 times the solar value. The two Ionic species present, S+ and S++, contribute ap- proximately 50% each to the total abundance. Figure 4. Distribution of the total sulphur abundances for the ring HII regions. Ionising cluster properties Figure 5. Ionising and photometric masses. Assuming single stellar population (SSP) PopStar models (Mollá et al., 2009) and the Salpeter IMF we can derive ionis- ing and photometric masses. We have obtained values between 1.22·104 - 5.93·105 M⊙and 2.95·104 - 1.10·106 M⊙respectively. There is an intrinsic difference between photometric and ionizing masses of the clusters in this study, with the first being more than twice the former. Figure 6. Equivalent width and the (R-I) color. Using the equivalent width and the (R-I) color we have estimate a narrow range of ages ∼6.2 Ma. However, a blue and a red excess can be identified in the ring, which suggests the presence of ionizing and non- ionizing composite stellar populations. The underlying disk stellar populations has been subtracted, and the age of the ionising clus- ters is ∼4.7 Ma. Conclusions We can conclude that young stars in the ring of NGC7742 have been formed, almost simultaneously, and they have an age younger than 7.5 Ma. In most cases an underlying stellar population can be identified, besides that of the galaxy disk, pointing to a composite population in the ring. Additionally, regions within the ring show very similar characteristics and abundances among them. This scenario is compatible with the idea of all regions having formed at the same time and if a minor merger event. Bacon R., et al., 2010. p. 773508, doi:10.1117/12.856027 Díaz
poster
Metapopulation theory Metapopulations, i.e., interconnected populations with extinction- (re)colonization dynamics, are ubiquitous. A key evolutionary feature of metapopulations, as compared to large, long-lived populations, is the genetic bottlenecks during the founding of subpopulations. A common form of subpopulation founding is (re)colonization by the establishment of one or few colonizers which originated from a single source population in an empty habitat patch, the so-called propagule model. Apart from the resulting genetic bottlenecks this entails small effective population sizes, and, as a consequence, inbreeding. 100 100 100 200 200 200 300 300 300 400 400 400 500 500 500 0.0000 0.0005 0.0010 0.0015 0.0020 0.0025 0.0000 0.0005 0.0010 0.0015 0.0020 0.0025 H S H N a a a fixed: s=0 gamma: mean=−0.03, shape=0.2 gamma: mean=−0.05, shape nonsyn DFE: Genomic analyses We propose geographic distance as the best predictor for genomic diversity and differentiation in this metapopulation, while population age is also important, but mainly in regards to effects of population founding. Geographic isolation was measured as mean distance to the two nearest neighboring populations (NN2 [m]) and genomic diversity as π. NN2 was also the best predictor for FST (not shown). Metapopulation processes shape genomic diversity and genomic differentiation Study system We sampled a natural Daphnia magna metapopulation from the Finnish Tvaerminne archipelago. Populations of the cyclically parthenogenetic, freshwater planktonic crustacean D. magna inhabit small rock pools, i.e., depressions in the bare rock of these islands. We aimed to collect 50 adult D. magna from all occupied rock pools and do whole-genome Illumina paired-end sequencing of the pooled individuals of each subpopulation (pool-seq). We obtained data from 60 populations and 1,540,716 SNPs. Pascal Angst, Dieter Ebert, and Peter D. Fields Department of Environmental Sciences, Zoology, University of Basel pascal.angst@unibas.ch @pascalangst R 2 = 0.39, p = 0.001 0 1 2 3 1 2 3 Distance [m] (log10) pairwise FST/(1 − pairwise FST) References van Nouhuys, Saskya (November 2016) Metapopulation Ecology. In: eLS. John Wiley & Sons, Ltd: Chichester. DOI: 10.1002/9780470015902.a0021905.pub2 Haller, B. C., & Messer, P. W. (2019). SLiM 3: Forward Genetic Simulations Beyond the Wright–Fisher Model. Molecular Biology and Evolution, 36(3), 632–637. https://doi.org/10.1093/molbev/msy228 See this poster online at https://doi.org/10.6084/m9.figshare.19095344 or scan here: FS−2 FS−27 FS−29 FS−3 FS−31 FSS−18 G−13 G−18 G−2 G−33 G−42 G−43 G−45 LA−10 LA−18 LA−19 LA−29 LG−7 LG−1 M−62 M−64 SK−1 SK−16 SK−45 SK−49 SK−50 SK−58 SKN−1 SKN−2 SKO−1 SKO−3 SKW−1 0 250 500m K N LON 59.815 59.820 59.825 59.830 23.24 23.25 23.26 Longitude East Latitude North 4e−04 6e−04 8e−04 1e−03 0.0 0.5 1.0 1.5 log10(age + 1) π NN2 [m] 50 100 150 0e+00 5e−04 1e−03 0e+00 5e−04 1e−03 πS πN Research questions Is genetic diversity reduced in newly founded subpopulations of a metapopulation? Are newly founded subpopulations more differentiated from each other than older subpopulations? Do metapopulations evolve differently from large, long-lived, stable populations? R 2 = 0.39, p = 0.001 0 1 2 3 1 2 3 Distance [m] (log10) pairwise FST/(1 − pairwise FST) 0e+00 5e−04 1e−03 0e+00 5e−04 1e−03 πS πN 4e−04 6e−04 8e−04 1e−03 0.0 0.5 1.0 1.5 log10(age + 1) π NN2 [m] 50 100 150 100 100 100 200 200 200 300 300 300 400 400 400 500 500 500 0.0000 0.0005 0.0010 0.0015 0.0020 0.0025 0.0000 0.0005 0.0010 0.0015 0.0020 0.0025 H S H N a a a fixed: s=0 gamma: mean=−0.03, shape=0.2 gamma: mean=−0.05, shape=0.5 nonsyn DFE: 5 Accumulation of deleterious mutations Small population size and recurrent founder events were postulated to lead to an increased rate in the accumulation of deleterious mutations. This would be visible as a genome wide increase in nonsynonymous relative to synonymous nucleotide differences (πN versus πS). Our data confirm this predictio
poster
CUORE BOX Trigger thresholds 1. The 2TY dataset of CUORE underwent additional processing for low energy studies Low Energy Analyses with CUORE and a Search for Solar Axions Sensitivity optimizing detector selections Solar axion search • Use an Optimum Trigger (OT) on data processed through an Optimum Filter, a matched filter to optimize the signal to noise ratio • OT triggers are much lower than triggering on the derivative of raw waveforms (DT), enabling low energy searches Samantha Pagan1 on behalf of the CUORE Collaboration (samantha.pagan@yale.edu) CUORE: The Cryogenic Underground Observatory for Rare Events • 988 TeO2 crystal cryogenic calorimeters operated at ~15 mK, which convert deposited energy from particles into heat • Located at Laboratori Nazionali del Gran Sasso • Collected and analyzed over 2 tonne·yrs of TeO2 exposure Low energy analysis methods • 2 tonne·yr dataset of CUORE underwent additional processing for low-energy studies building off of CUORE-0 and CUORE techniques • Te x-rays from calibration data are a tool for optimizing many methods • Study pulse shape and events rate to select the best performing detectors of the array • Greatly increased exposure compared to previous methods x • Specific low-energy variables and event-level cuts developed for: • Multi-site events tagging • Dedicated pulse shape analysis to reject spurious events • Identifying pileup pulses WIMP search References 1Wright Laboratory, Department of Physics, Yale University [1] Lowering the energy threshold of large-mass bolometric detectors: S. Domizio et al. JINST 6 (2011) P02007 [2] Low energy analysis techniques for CUORE: EPJ C (2017) 77: 857 [3] Performance of the low threshold Optimum Trigger on CUORE data: A . Branca et al. Journal of Physics: Conference Series (2020) 1468(1):012118 [4] Search for 14.4 keV solar axions from M1 transition of 57Fe with CUORE crystals: JCAP05 (2013) 007 [2] [1] • Axions and Axion-like Particles (ALPs) are dark matter candidates • Multiple solar axion searches are possible with CUORE • Ongoing search for solar axions produced from an M1 transition of 57Fe in the sun and detected by the axio-electric effect noise power spectrum signal template Optimum Filter Acknowledgments The CUORE Collaboration thanks the directors and staff of the Laboratori Nazionali del Gran Sasso and the technical staff of our laboratories. This work was supported by the Istituto Nazionale di Fisica Nucleare (INFN); the National Science Foundation under Grant Nos. NSF-PHY-0605119, NSF-PHY-0500337, NSF-PHY-0855314, NSF-PHY-0902171, NSF-PHY-0969852, NSF-PHY-1307204, NSF-PHY-1314881, NSF-PHY-1401832, and NSF-PHY-1913374; Yale University, Johns Hopkins University, and University of Pittsburgh. This material is also based upon work supported by the US Department of Energy (DOE) Office of Science under Contract Nos. DE-AC02-05CH11231 and DE-AC52-07NA27344; by the DOE Office of Science, Office of Nuclear Physics under Contract Nos. DE-FG02-08ER41551, DE-FG03-00ER41138, DE- SC0012654, DE-SC0020423, DE-SC0019316; and the NSF Graduate Research Fellowship Program under Grant No. DGE-1752134. This research used resources of the National Energy Research Scientific Computing Center (NERSC). This work makes use of both the DIANA data analysis and APOLLO data acquisition software packages, which were developed by the CUORICINO, CUORE, LUCIFER, and CUPID-0 Collaborations. The authors acknowledge Advanced Research Computing at Virginia Tech for providing computational resources and technical support that have contributed to the results reported within this paper. • Exposures affected by temperature, vibrational controls and time of year • Candidate backgrounds and noise: 210Pb in TeO2 and Cu components, 125mTe, vibrational noise from microseism events • Energy resolution: ~ 2-3 keV FWHM at 30 keV Low energy spectrum for selected channels at 10 keV Preliminary 0 5 10 15 20 25 30 35 40 Analysis Threshold* [keV] 0 20 40 60 80 100 Detectors Selec
poster
Introduction Abstract Cilia are critical for proper embryonic development and maintaining homeostasis. Although extensively studied, there are still significant gaps regarding the proteins involved in regulating ciliogenesis. Using the Xenopus laevis embryo, we show that Dishevelled (Dvl), a key Wnt signaling scaffold that is critical to proper ciliogenesis, interacts with Drg1 (developmentally regulated GTP-binding protein 1). The loss of Drg1 or disruption of the interaction with Dvl reduces the length and number of cilia and displays defects in basal body migration and docking to the apical surface of multiciliated cells (MCCs). Moreover, Drg1 morphants display abnormal rotational polarity of basal bodies and a decrease in apical actin and RhoA activity that can be attributed to disruption of the protein complex between Dvl and Daam1. These results support the concept that the Drg1-Dvl interaction regulates apical actin polymerization and stability in MCCs. Thus, Drg1 is a newly identified partner of Dvl in regulating ciliogenesis. . Developmentally Regulated GTP binding protein 1 modulates ciliogenesis through an interaction with Dishevelled. Moonsup Lee, Yoo-seok Hwang, Jaeho Yoon, Jian Sun, Adam Harned, Kunio Nagashima and Ira O. Daar Cancer & Developmental Biology Laboratory (CDBL), CCR, NCI, NIH MD 1 367 291 TGS G motif - GTP binding regions Drg1 Spatial expression Temporal expression TGS domain – Threonyl-tRNA Synthetase, GTPase, and SpoT proteins Xenbase Ishikawa, 2003 Reported roles of Drg1 1. control cell growth 2. promote tumor progression 3. spindle formation Unknown role in embryonic development Result MASS-SPEC Dvl2 (bait) Drg1 10 (6 kinds) 1. Mass-spec validation exogenous Dvl2:Drg1 binding LS174T HT29 endogenous Dvl2:Drg1 binding HT29 and LS174T : colon cancer cells 2. Drg1 interaction domain mapping of Dvl2. 3. Dvl2 interaction domain mapping of Drg1 4. Drg1 knockdown disrupts ciliogenesis in MCCs. stg17 6. Drg1 knockdown causes ciliogenesis defect in gastrocoel roof plate. Vax1 probe ConMO Drg1 MO Drg1 MO + wild-type Drg1 MO + D329-344 0/44 (0%) 45/50 (90%) 10/40 (25%) 41/49 (83%) Phenotype # / total # Wholemount In situ hybridization 5. Drg1 knockdown does not affect migration of MCC progenitors Drg1 knockdown decreases Vax1 (shh downstream target) transcripts. 7. Drg1 localizes to basal body area in MCCs, and colocalized with Dvl2. 8. Drg1 knockdown causes basal body planar polarity defects. 12. Drg1 knockdown decreases cofilin phosphorylation in MCCs. 17. Drg1 knockdown decreases Dvl2:Daam1 interaction in Xenopus laevis embryos. Summary 1. Drg1 associates with Dvl2 in Xenopus embryos and human cell lines. 2. The DEP domain and the contiguous C-terminal region (DEP+C) domain of Dvl and the TGS domain of Drg1 are required for Dvl2–Drg1 interactions. 3. Drg1 localizes to the basal body area in MCCs. 4. Drg1 is required for ciliogenesis in MCCs. 5. Drg1 is required for planar polarization and apical docking of basal bodies in MCCs. 6. An interaction between Drg1 and Dvl is required for apical actin meshwork formation. 7. Drg1 is required for proper basal body and Dvl2 and Daam1 localization in MCCs. 8. Active Daam1 expression is sufficient to suppress Drg1knockdown phenotypes in MCCs. . Cilia length Cilia number Cilia length Cilia number Centrin4 – basal body marker centrin4 (basal body) CLAMP (rootlet) 9. Drg1 knockdown causes basal body migration and docking defects in MCCs. Phalloidin (actin) Clamp (rootlet marker) 10. Drg1 knockdown causes apical actin reduction in MCCs. RBD : Rho-binding domain of rhotekin Rho ROCK Cofilin Actin stability modulation 11. Rho activity is decreased in Drg1 morphant MCCs. Rho ROCK Cofilin Actin stability modulation 13. Drg1 knockdown has a mild effect on Dvl localization to the basal body region in MCCs. 14. The amino acids 329-344 of Drg1 is required for Daam1 association. Drg1 Daam1 15. Dvl knockdown decreases Drg1 interaction with Daam1 in Xenopus laevis embryos. Drg1 Da
poster
Summary To register visit platform.rd-connect.eu RD-Connect: an integrated infrastructure for data sharing and analysis in rare disease research S. Beltran1,2, D. Piscia1,2, S. Laurie1,2, J. Protasio1,2, A. Papakonstantinou1,2, A. Cañada3,14, J.M. Fernández3,14, M. Thompson6, R. Kaliyaperumal6, S. Lair7, P. Sernadela8, M. Girdea9, M. Brudno9, A. Blavier7, R. Thompson10, H. Lochmüller10, D. Badowska10, V. Straub10, M. Bellgard11, J. Paschall12, M. Roos6, P.A.C. 't Hoen6, A. Valencia3,14, L. Monaco15, CM. Wang15, D. Salgado4,5, C. Béroud4,5,13, I. Gut1,2 and the RD-Connect Consortium 1Centro Nacional de Análisis Genómico (CNAG-CRG), Center for Genomic Regulation, Barcelona Institute of Science and Technology (BIST), Barcelona, Spain, 2Universitat Pompeu Fabra (UPF), Barcelona, Spain, 3Centro Nacional de Investigaciones Oncológicas (CNIO) , Madrid, Spain, 4Aix-Marseille Université, Marseille, France, 5Inserm, UMR_S 910, Marseille, France, 6Department of Human Genetics, Leiden University Medical Center, Leiden, The Netherlands, 7Interactive Biosoftware, Rouen, France, 8DETI/IEETA, University of Aveiro, Portugal, 9Centre for Computational Medicine, Hospital for Sick Children and University of Toronto, Toronto, ON, Canada, 10John Walton Muscular Dystrophy Research Centre, Institute of Genetic Medicine, MRC Centre for Neuromuscular Diseases, Newcastle University, UK, 11Centre for Comparative Genomics, Murdoch University, Perth, Western Australia, 12European Molecular Biology Laboratory, European Bioinformatics Institute (EMBL-EBI), Wellcome Trust Genome Campus, Cambridge, United Kingdom, 13APHM, Hôpital TIMONE Enfants , Laboratoire de Génétique Moléculaire, Marseille, France, 14Instituto Nacional de Bioinformática (INB), Spain, 15Fondazione Telethon, Milan, Italy Around 300 million people worldwide are affected by one of the 6000+ known rare diseases (RD). RD research faces specific challenges because patients, clinical expertise and research communities are scarce and fragmented. Data sharing between researchers is therefore crucial. Next-generation sequencing (NGS) and genomics have opened up new possibilities for gene discovery and diagnosis, but many RD expert centres lack the bioinformatics expertise and computational support to take full advantage of the new genomic paradigm. RD-Connect is an EU-funded infrastructure bringing together multiple data types used in rare disease research into a common resource for researchers and clinicians. RD-Connect consists of three systems: Genome-Phenome Analysis Platform (platform.rd-connect.eu), Sample Catalogue (samples.rd-connect.eu) and Registry & Biobank Finder (catalogue.rd-connect.eu), which are open to any RD and available free of charge. Genome-Phenome Analysis Platform provides both a repository for RD research data and a user-friendly interface for NGS analysis that has much of the same functionality as commercial analysis suites. RD researchers or clinical centres worldwide can submit data, analyse own patients and compare with data submitted by others, and find patients in external databases with matching phenotype and candidate variant in the same gene. Registry & Biobank Finder is a global directory of rare disease patient registries and biobanks, including the numbers of register cases for each disease. Sample Catalogue allows browsing biosample collections of RD biobanks and find detailed information about individual biosamples. RD-Connect ethical and legal experts provide guidance to researchers and work on optimal models for data sharing, while engagement of patient representatives at every level of the project work ensures patient-centred approach. rd-connect.eu Sample selection Inheritance filters Quality filters Population filters Annotation filters Effect prediction filters Candidate gene filters Explore Results EGA Sequencing Lab Raw data (.bam/.fastq) Clinician / researcher PhenoTips (HPO terms) Sample Clinical phenotype Genome-Phenome Analysis Platform Sta
poster
Visualization of Precision Medicine: A Case Study of PD-1 Therapy Efficacy Evaluation through Analytical Algorithm in Triple Negative Breast Cancer Alice Jiang Havergal College, Toronto, Ontario, Canada Introduction & Background Results I would like to acknowledge the help that I received from the Rapidamic Lab and offer special thanks to my parents and advisors for their direct and indirect support and guidance throughout the project. • Future work will focus on the optimization of our algorithm and incorporating more factors to assess the correlations with the outcome to meet the large database analytics requirements of precision medicine. • The system of the analytical platform is quite versatile It can be applied and extended to other different precision medicines for diseases, especially cancer therapy. Figure 5. Correlation matrix. Values range from -1 to 1. Figure 3. Boxplots in comparison of CPS and Placebo/Pembrolizumab to survival length. An increase in combined positive score (CPS) values corresponds to a larger range and median, indicative of a longer survival length. The Pembrolizumab + chemotherapy (2) group exhibits a significantly wider range, higher median, and a more extensive IQR in contrast with the placebo + chemotherapy group (1), highlighting the salient distinctions between the two cohorts. An increased presence of the CPS positively correlates to a higher survival length of individuals for PD-1 therapy + chemotherapy. Other input factors did not display a significant influence or correlation to survival length. The analytical algorithm tool proved to be promising in processing vast datasets and was capable of generating comprehensive visualizations. Utilizing the created linear regression model, approximate survival length (y value) could be predicted from input variables. We can efficiently and precisely identify underlying factors, understanding the strength and general trend of influence. Recognizing key interactions can enable professionals to prioritize these factors when making a medical prognosis, ensuring that treatments are tailored to maximize the therapeutic efficacy and outcome for patients. This guides personalized medicine, moving away from generalized treatment protocols, by identifying influential factors but also quantifying the impact of drug efficacy on a specific individual. The importance of precise data-enhanced decision-making is emphasized. Conclusions [1] Sporikova Z, Koudelakova V, Trojanec R, Hajduch M. Genetic markers in triple-negative breast cancer. Clinical breast cancer. 2018 Oct 1;18(5):e841-50. [2] Jaber N. SACITUZUMAB earns regular FDA approval for TNBC. National Cancer Institute. Available from: https://www.cancer.gov/news-events/cancer-currents- blog/2021/sacituzumab-govitecan-tnbc-regular-approval Figure 1. Visual representation of TNBC’s missing receptors [2] Triple-Negative Breast Cancer (TNBC) is an aggressive breast cancer subtype that lacks the estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2, accompanied by a heightened metastasis and recurrence risk [1]. Treatments lack specificity and are limited by TNBC’s various molecular subtypes and chemoresistance. In this study, we explored programmed cell death protein 1 (PD-1) therapies as a novel TNBC treatment and implemented the concept of precision medicine, developed an analytical algorithm using Python to investigate the drug efficacy of PD-1 therapy based on individual TNBC profiles. There is a positive, moderately strong correlation determined between CPS (r=0.51) and Placebo/Pembrolizumab (r=0.65) with the survival length. Correlations among other variables are relatively weak. Most Breast Cancer TNBC Methodology Future Work Acknowledgements References 93% 5-year survival rate 77% 5-year survival rate Figure 2. Analytical algorithm process. In this study, a mock database was randomized and generated using Pembrolizumab + chemotherapy clinical trial summary statistics on
poster
New perspectives, breaking up traditions! Consultancy of Publication strategies in research proposals Career development of ECR Implementing research related policies Dr. Anneke Meyer Leibniz University Hannover Research and Innovation Services www.uni-hannover/forschungsservice.de @annekemeyer2 The Role of Research Managers in the Advocacy of Open Science Dr. Reingis Hauck Leibniz University Hannover Research and Innovation Services www.uni-hannover/forschungsservice.de @rsilvia77 Radical collaboration, breaking down silos! Building teams & networks with experts What is the right mix of knowledge on individual and team level? Activities of Research Managers with links to Open Science Advocacy of Open Science by building competencies & networks 2D Framework of knowledge Open Access level 3 No more distinguishing between professions but levels of competence! Librarian EC/ Horizon 2020 level 2 FAIR Data level 1 Federal Funding level 3 Academic Prizes level 3 Responsible Metrics level 1 Open Access level 3 German Research Foundation level 3 Research Manager Level 3 - Specialist knowledge Level 2 - Core knowledge Level 1 - Basic knowledge © Foto: Michael Matthey | LUH © Foto: Michael Matthey | LUH
poster
Slum Sisterhood, philanthropy and Sapphic dialogues in Margaret Harkness’s In Darkest London (1890) Garth Wenman-James (g.wenman-james@surrey.ac.uk) Introduction: Sisterhood, Charity, and the Slums My research focusses on three main elements of the slum novel in the late nineteenth century: New Horizons: By the mid-1890s, over half a million women in Britain were ‘occupied continuously’ in philanthropic work (Poole, 2014, p. 3). Up until this point, philanthropic efforts in the slums were often led by clergymen and doctors—typically male occupations. Known as ‘slum sisterhoods’, these groups of women crafted new horizons that made way for major re- forms of the Poor Laws as well as laying foundations for later suffrage movements. Poverty Porn: Novels like Margaret Harkness’s In Darkest London (1890) represent the social reform enacted by these women. Yet, they also act as a form of entertainment, or ‘poverty porn’, to evoke pleasure in readers. Sex and Desire in the Slums: The eroticisation of poverty in the slum novel appears in dialogue with Harkness’s use of the slum space to express ‘Sapphic desire’, an expression of sexual or emotional passion between women (Vanita, 1996). Margaret Harkness: Slum Sister, Socialist, Philanthropist  Margaret Harkness was a socialist, philanthropist, nurse, novelist and journalist working towards social reform at the end of the nineteenth centu- ry  Harkness saw the perceived divides between religious (the Salvation Ar- my) and secular (socialist) philanthropic groups as detrimental to improving the conditions of the poor, stating that the ‘two organisations ought to work more together than they do at present, they have many points of common interest’ (1888, p. 2).  In Darkest London follows the lives of women in the Salvation Army as well as socialist sisterhoods, emphasising the social progress that can be achieved with both groups working together. The title is taken from the Salvation Army manifesto In Darkest England and the Way Out (1890), further indicating the influence that this context had on Harkness’s novel writing  As a socialist herself, Harkness worked as a slum sister alongside Beatrice Webb and Eleanor Marx, both highly influential figures on social reform an economic theory (Ross, 2007, p. 90). Harkness’s experience with slum work sets her writing apart from the slum novels of Arthur Morrison and Eliz- abeth Gaskell. Sapphic desire and Masochism  In much the same way that In Darkest London operates a form of poverty porn which evokes pleasure from the reader through its im- ages of grotesque poverty, the Slum Sisters gain pleasure from their work in the slums.  Speaking of the slum sisters, an unnamed pauper states that ‘you can’t scare those girls […] it’s not good trying to scare em’, they just enjoys it’ (p. 180). A shared masochism (the experience of pleasure when faced with pain or danger) occurs among the slum sisters, who ‘enjoy’ the danger posed by the poor they attempt to as- sist.  Masochism of this form features within Sapphic, same-sex desire as a shared pleasurable experience (Prins, 1999, p. 155). The slum sisters themselves therefore experience the novel’s environment as poverty porn. Slumming together: Passionate dialogues and Sapphic relations among slum sisterhoods Slum sisters enacted social change by ‘dressing, walking, and writ- ing together’ (Rappoport, 2012, p. 136). In these same-sex commu- nities, a Sapphic dialogue was produced; according to Ruth Vanita (1996), the Sapphic mode refers to a same-sex desire created be- tween women through social action and shared sympathetic experi- ence. Harkness herself alludes to something much like Sapphic desire in a letter to Beatrice Webb, where she defined love as the mixture between ‘sympathy + kindred feeling’ (1887); this is represented throughout In Darkest London, with the protagonist Ruth managing to cross from secular to religious sisterhoods. In sharing the sympathies of both sisterhoods, Ruth
poster
Indalo isekelwe Iindlela zokujonga zineenzuzo ezilungileyo. Kodwa indlela ezihlukeneyo zikhokelela kwimpembelel o ezimbi. Isithintelo kulawu Isithintelo kulawu Isithintelo kulawulo “Xa besebenza bebengafumani mrholo. Khange bayigqibe ikontrakthi. Basebenza iinyanga ezintandathu kodwa behlawula imali elinganayo. Omnye osebenza inyanga enye.” Imiqobbo yentlalo yenkcubeko Imida yenkqubo yoosolusapho exhaphakileyo kubafazi. “... ndaqala ndaba yinkokeli yokucoca itywabasini kodwa ngenxa yokungahloniphi kwafuneka ndiyeke umsebenzi ukuze ndifumane izibonelelo ezithile kuphela.” Imithetho eluntwini okanye eyingosi Abazange bangene naluphi na ulwazi Imiqobo yolwazi “Kukho ukunqongophala konxibelelwano. Abantu balapha batyikitya isivumelwamo Kanye ngomnyaka. Bafuna ngakumbi kumbutho wamadlelo, hayi kanye ngonyaka. Ulwazi lunyanzelela intsebenziswano engaphezulu.” Ezoqoqosho kwezentlalo isithintelo Ubusela bemfuyo bubeka esichengeni iindlela zemfuyo kunye namadlelo. kukho Akukho ntengiso yempahla eveliswayo yokupjila, kwaye abaphumezi beprojekthi abakwazi ukuzithenga ezikuluntu. Ukungavisisani phakathi kwendlela yokuphila kunye neendlela zokuphila Indlela zijongelwa phantsi kukunqongophala ukuqonda nentlonipha kunye nolwazi olungangqineniyo luhamba kumanqanaba karhulumente. Abathengi okanye masiko nezithethe ngamnye amaxesha zingqubana neendlela zisekelwe kwindalo. Ulawulo olungacacanga nolungquzulanayo “Ngamanye amaxesha abanalo ulwazi, kwaye abafuni kubandakanya abantu basekuhlaleni. Ngoko ke abantu abathile abanokuthi baxhamle bakhutshelwa ngaphandle. Oko akulunganga. Bafuna uluntu olungundoqo luxhamle umqobo wolwazi.” Imiqobo yolwazi Unxibelelwano olunqabileyo nolulodwa “Sithendabuza uxanduva lokuphendula kwii NGOs njengoko kungekho mali yokuhlwawula ingcaphpephe zalapha ekhaya.” Ufikelelo lwenkxaso-mali oluthintelweyo kunye namaxesha angekho nqgiqweni Uluntu lohlukene njengoko abanye belandela umbutho wamadlelo kwaye Ezinye iinkokeli zemveli, kwaye kukhokelela kwiyantlukwano yolumntu. Ndingathanda ukubandakanyeka ngenxa yokukhethwa kweendawo zokuphumla kwaye usibonda akayonxal; enye zentlalo nekcubeko yombutho wamadlelo. Ukuntsonkotha kwezakhiwo zemveli Imiqobbo yentlalo yenkcubeko Ke silwenza njani ubulungisa kwiindlela ezisekelwe kwindalo kuluntu kunye nabachaphazelekayo kwi projekthi? Yeyiphi imiqobo ekuphumezeni ukulingana ngokwentlalo kwiindlela ezisekelwe kwindalo eMzimvubu? Funded by Sibulela amalungu oluntu aseMatatiele naseMaclear nabo bonke abachaphazekekayo kwiprojekthi kunye no Nosi Mtati and Phumula Nyembezi. By Glynis Humphrey, Tali Hoffman and Petra Holden · August 2024 glynis.humphrey@uct.ac.za Email: https://bit.ly/3BGj0vR Website: Izithintelo zamandla oluntu Ngokutsho kwamalungu olumntu angama 71 Ngokwabaphumezi beprojekthi bangama shumi amabini anesixhenxe
poster
Core global metrics of chronic kidney disease (CKD) prevalence Global CKD prevalence Data: Global Burden of Disease (GBD) Study, 2019 Institute of Health Metrics and Evaluation Numbers on the top indicate global CKD prevalence. Comparisson of global prevalence for selected noncommunicable diseases Country-level CKD prevalence metrics Color filling accounts for three parameters: (1) all-ages and (2) age-standardised rates in 2019, and (3) age-standardised rate change since 1990. Before mapping each parameter was normalised to the scale from 0 to 100 (representing lowest and highest value of the original parameter). This allows to visualize all parameters and to identify the predominant one for each country. Scientific-Tools.Org Data analysis and visualization The creation of these visualizations and infographics has not been financed by any funds. You can donate at https://scientific-tools.org/support-us/ to support this and other visualizations Suggested citation: Bikbov B. (Scientific-Tools.Org). Core global metrics of chronic kidney disease (CKD) mortality in the GBD 2019 Study. Zenodo. DOI https://doi.org/10.5281/zenodo.8312897 1990 2000 2010 2019 341.7 mln 437.7 mln 559.3 mln 697.3 mln Chronic respiratory diseases Diabetes mellitus Neoplasms Cardiovascular diseases Chronic kidney disease Mental disorders 0 500 1000 Prevalence of selected diseases, in 2019, million persons Neoplasms Cardiovascular diseases Chronic respiratory diseases Mental disorders Diabetes mellitus Chronic kidney disease −20% 0% 20% 40% 60% nge in age−standardised prevalence rate between 1990 and 2019, % Data: GBD 2019 revision; Visualization: Scientific−Tools.Org Cha Data: GBD 2019 revision; Visualization: Scientific−Tools.Org
poster
Uncovering the repertoire of legume NLR immune receptors Rita Maravilha Marques1,2, Carmen Santos1, Carlota Vaz Patto1, Sophien Kamoun2, and Jiorgos Kourelis2 1Instituto de Tecnologia Química e Biológica António Xavier, NOVA University of Lisbon, Oeiras 2780-157, Portugal 2The Sainsbury Laboratory, University of East Anglia, Norwich Research Park, NR4 7UH, Norwich, UK 1. Cardoso, D. B. O. S. et al. (2013). Reconstructing the deep-branching relationships of the papilionoid legumes. SA Journal of Botany, 89, 58-75. 2. Mundt, C. C. (2014). Durable resistance: a key to sustainable management of pathogens and pests. Infection, Genetics and Evolution, 27, 446-455. 3. de Queiroz, L. P. et al. (2015). A multilocus phylogenetic analysis reveals the monophyly of a recircumscribed papilionoid legume tribe Diocleae with well-supported generic relationships. Molecular Phylogenetics and Evolution, 90, 1-19. 4. Kourelis J et al. (2021) RefPlantNLR is a comprehensive collection of experimentally validated plant disease resistance proteins from the NLR family. PLOS Biology 19(10): e3001124. https:// doi.org/10.1371/journal.pbio.3001124. BUSCO Assesment Results 7. Conclusions and Outlook The number and distribution of NLR classes across legume species is variable and mostly reflects legume phylogeny Most legume species tend to have more CC-NLRs than TIR-NLRs The number of CCG10-NLRs and CCR-NLRs appears less variable Whole genome duplications and genetic erosion could be altering NLR numbers The Fabaceae NLR repertoire will be an important tool for comparative resistance mapping studies and for R gene enriched Genome-Wide Association Studies What is the nature and diversity of Legume NLRs? 2. Question and Aim Perform a comparative NLRome study 3. The completeness of legume proteomes could be improved 4. We built NLR phylogenies for each species using RefPlantNLR4 5. The abundance and distribution of NLR classes in the Fabaceae is variable 6. Legumes display expansions and contractions in NLR numbers <5% Missing = Good Assembly Max. likelihood trees - Clustal Omega Alignment - FastTree algorithm Phaseolus vulgaris NLR Phylogeny Example: Tree Scale: 1 Proteome + NLR tracker Genome Quality Control NLR Phylogenomics Fabaceae, the legume family, is a large and diverse angiosperm crop family, with much ecological and economic importance.1,3 However, biotic stress continues to seriously constrain legume yield2 Resistance breeding is considered the most sustainable plant disease management method2 Nucleotide-binding Leucine Rich genes (NLRs) are intracellular receptors that detect pathogen effectors, triggering a powerful defensive mechanism known as Hypersensitive Response4 The NLR resistance genes and their respective classes remain largely unexplored in legumes CC NBARC LRR CC NBARC LRR LRR TIR NBARC LRR LRR RPW8 NBARC NLR number according to total number of proteins Number of Protein-coding Loci Total Number of NLRs MLA36-1 MLA30-1 MLA7 MLA13 MLA12 2 MLA9 MLA10//MLA13//MLA30-1//MLA34//MLA36-1//MLA37-1//MLA7//MLA9 MLA10 MLA37-1 MLA3 MLA23 MLA35-1 MLA23//MLA3//MLA35-1 2 MLA34 MLA39-1 1 MLA39-1 2 MLA6 1 MLA6 2 MLA27-2 MLA2//MLA27-1//MLA27-2 MLA27-1 MLA2 MLA19-1 1 MLA19-1 2 MLA12 1 MLA18-2 2 MLA18-2 1 MLA31-1 1 MLA31-1 2 MLA32 1 MLA32 2 MLA22 1 MLA22 2 MLA8 MLA1//MLA8 MLA1 MLA28-1 1 MLA28-1 2 MLA25-1 1 2 MLA25-1 2 2 MLA16-1 1 2 MLA16-1 2 2 MLA18-1 1 2 MLA18-1 2 2 HcMLA1 1 HcMLA1 2 TmMLA1 1 TmMLA1 2 Sr33 1 2 Sr33 2 2 SrTA1662 2 SrTA1662 1 Sr50 2 Sr50 1 Pi36 1 Pi36 2 DES1 2 3 DES1 1 1 Sr35 2 2 Sr35 1 2 Yr-10 1 2 Yr-10 2 2 Pm1a 1 Pm1a 2 Sr22 2 2 Sr22 1 2 SrTm5 Sr22-PI190945//SrTm5 Sr22-PI190945 sr22-PI573523 2 sr22-PI573523 1 Lr10 1 Lr10 2 Sr13a Sr13a//Sr13b//Sr13c//Sr13d Sr13c Sr13d Sr13b Sr26 1 2 Sr26 2 2 NLS1 1 2 NLS1 2 2 Pbr1.b 1 Pbr1.b 2 Pbr1.c 1 2 Pbr1.c 2 2 Pm41 2 Pm41 1 Pm5b 2 4 Pm5b 1 1 Pm5e Pm5-BMDM Pm5-CS Pm5a Pm5-ND Pm5-BMDM//Pm5-CS//Pm5-ND//Pm5a//Pm5e RPG5 2 RPG5 1 YrU1 2 4 YrU1 1 1 Adnr1 2 Adnr1 1 Pi-ta 1 Pi-ta 2 RGA2a 1 RGA2a 2 Pia-2 1 1 Pi
poster
Has the Public’s Knowledge of Anatomy Been Hamstrung? A Questionnaire-Based Exploration of Basic Anatomical Awareness Within the General Population. Todd FS1, Whiting JR1, Taylor A2, Smith CF1 1Department of Medical Education, Brighton and Sussex Medical School (BSMS), Brighton, United Kingdom 2Clinical Anatomy Learning Centre, Lancaster Medical School, Lancaster, United Kingdom Introduction Despite a recent resurgence in public interest for anatomical sciences,1 little research exists to determine the extent of their knowledge. We aimed to assess this through a questionnaire-based localisation of anatomical structures. Our findings suggest a significant gender discrepancy, as well as the presence of prevalent anatomical misconceptions which, to our best knowledge, have not been documented in the literature. These results have implications for the content and targeting of future public and clinical teaching. Methodology Recruitment: Questionnaires were distributed to attendees of a public talk delivered by BSMS Anatomy faculty as part of the September 2017 British Science Festival. Questionnaire: Developed at Lancaster Medical School, and asked participants to identify the location of 22 anatomical structures on a blank human outline (Figure 1). Demographics: 45 questionnaires were returned, of which 37 had complete demographic information. The age range was 18 to 86. Of the 45 questionnaires returned, 37 had complete demographic information (24 females and 13 males). Questionnaires with incomplete information were omitted from gender analysis, but included in the misconception analysis. Results Gender Differences Females consistently outperformed males in 18/22 anatomical structures tested. Only the prostate, rectum, cornea and kidneys were answered better by males. Large gender differences in scores were seen for several of the structures, as highlighted in figure 2. Notably, only the prostate exhibited a large gender discrepancy in favour of males. Interestingly, no males were able to correctly identify the location of the gallbladder. Figure 3 compares the remaining structures. The mean female score was 14.0, whereas the mean male score was 11.7. Anatomical Misconceptions Two consistent mistakes were highlighted amongst participants during analysis. These were: 1) The “calves” were mistakenly labelled as the “hamstrings”. 2) The adrenal glands were incorrectly identified as being located in the head or neck. The first misconception was seen on 31.1% of respondent’s questionnaires (14/45), whilst the second was seen in 20% (9/45). This includes two participants who had both misconceptions on their answer sheet. In total, 46.7% of participants (21/45) had at least one of the above anatomical misconceptions. Discussion and Conclusions Literature The mean scores for both males and females closely reflect that of prior studies by Kljakovic et al.2 (Females: 52.0%, Males: 50.0%, n=1156) and Weinman et al.3 (Females: 50.9%, Males: 45.4%, n= 722), however neither differences reached significance. Whilst the larger gender difference seen in our results may be attributed to a small sample size or baseline knowledge biases introduced by sampling attendees of a public anatomy talk, Weinman et al.3 corroborates our findings in that females outperformed males in 10/11 structures tested. The detailing of public anatomical misconceptions has, to the best of our knowledge, not been documented in the literature. Implications Miscommunication is a major source of poor outcomes in general practice5 and a significant discrepancy exists between doctor and patient interpretations of medical terms, including anatomical language.6 This study highlights the need for doctors to be aware that misconceptions are prevalent and answers such as “glands in the neck” or “hamstrings” should be clarified in the history. An awareness of the public’s lack of ability to localise organs, particularly in males, may further improve patient satisfaction and outcome
poster
Environmental Data Initiative (EDI): enabling reproducible ecology and environmental science Information Management Training EcocomDP: • Community ecology researchers met and defined the structure of a dataset pattern that facilitates synthesis of community datasets. • EDI personnel write code to translate community observations into this pattern EDI offers several options for education about the five stages of data publishing (Organize, Clean, Describe, Upload, and Cite) • Webinars (available on YouTube) • On-site (EDI personnel go to a professor’s lab to teach multiple grad students how to archive data) • EDI Training Lab (above, a 2018 training workshop on the EML Assembly Line R tool for generating Ecological Metadata Language (EML)) Datasets and metadata are evaluated for quality and congruence before upload into the repository • Some quality checks result in a failure to upload: • Field delimiter is a single character • URL returns data • Some quality checks return a warning or information, but do not result in a failure to upload: • Geographic Coverage present • DateTime format in metadata matches data • Record delimiter is present K. Vanderbilt1, C. Gries2, M. Servilla1 , D. Costa1 , Susanne Grossman-Clarke2, P. Hanson2 , M. O'Brien3, C. Smith2, R. Waide1 1Biology, University of New Mexico, Albuquerque, NM, 2Center for Limnology, University of Wisconsin, Madison, WI, 3Marine Science Institute, University of California Santa Barbara, Santa Barbara, CA Overview The NSF-funded Environmental Data Initiative (EDI): • Offers data curation assistance to scientists affiliated with NSF-funded programs including: • Organization of Biological Field Stations (OBFS), • Long Term Research in Environmental Biology (LTREB), • Macrosystems Biology (MSB), and • Long Term Ecological Research (LTER), as well as • Individual environmental scientists without a viable data archive. Data Repository • Built on PASTA+ software • Contains high quality, well-documented datasets • Data are documented in Ecological Metadata Language (EML), a standard that can describe many types of data in great detail Data Synthesis Support Information Management Software Development • The EML Assembly Line, an R package, makes generating EML metadata a straightforward process • The user fills out several templates and runs the program to produce EML Outreach • The six EDI Summer 2018 Fellows learned information management practices from EDI personnel before heading to their host sites to conduct information management projects • EDI hosted a “hackathon” to begin populating the Information Management Code Repository (http://imcr.ontosoft.org/) • EDI supported the 2017 AGU Data Fair and co-organized the 2018 ESA Data Help Desk. Visit us at booth 722 in the Exhibition Hall! Summer 2018 EDI Fellows & Workshop Instructors portal.edirepository.org @EDIgotdata github.com/EDIorg https://environmentaldatainitiative.org/ AGU Data Fair
poster
Additional modes and cycle-to-cycle variations of non-Blazhko RR Lyrae stars József M. Benkő1, Johanna Jurcsik1, Aliz Derekas2,1 & Margit Paparó1 1Konkoly Observatory, MTA CSFK, Konkoly Thege u. 15-17. H-1121 Budapest, Hungary 2ELTE Eötvös Loránd University, Gothard Astrophysical Observatory, Szombathely, Hungary Questions? Comments? Let me know! benko@konkoly.hu Cycle-to-cycle variations Acknowledgements This work was supported by the Hungarian National Research, Development and Innovation Office by the Grants NKFIH K-115709 and K-119517. AD was supported by the ÚNKP 17 4 New National Excellence Program of the Ministry of Human Capacities. AD would like to thank the City of Szombathely for support under Agreement No. 67.177 21/2016. Reality of cycle-to-cycle variation Appearing additional modes Data handling origin? The local instrumental trends was handled three different ways. We applied both (i) our moving average subtraction method described in Benkő et al. (2014) and (ii) a method in which we adjust each pulsation cycle to a common zero point. Moreover, (iii) if there were no evident instrumental trend in the flux curves, the data without further processing were also investigated. These two (or three) data sets show qualitatively similar C2C variations. Photometric problems? We choose high and low maxima pairs from the light curves and plotted the flux in the pixel maps either at the high maxima phase or the flux differences between the high and low maxima phases. In Fig. 2 can be seen such a plot pairs for NR Lyr. The figure shows that (1) the amplitude difference is connected to the star itself and there is no other source of flux, and (2) the position of the star is unchanged in the pixel mask. These detection make doubts any serious photometric defects as an origin of the C2C variation. Unknown instrumental effects? For testing unknown instrumental effects as an explanation of C2C variations similar observations from a different instrument is the best chance. Currently the only independent instrument which observed high precision time series for non-Blazhko RR Lyrae stars is the CoRoT satellite (Baglin et al. 2016). Three non-Blazhko stars were observed with the so-called oversampled mode (32 sec sampling) during the CoRoT runs. Two of them proved to be bright enough for our purpose: CM Ori (CoRoT 617282043, rCoRoT= 12.64 mag, Benkő et al. 2016) and the BT Ser (CoRoT 105173544, rCoRoT=12.99 mag). Investigating the CoRoT light curves as we did for Kepler stars' data we found C2C variation for the two brighter stars CM Ori and BT Ser. Fig. 3 shows their amplitude variation as panel c) of Fig. 1. Even though for these stars the scatter is evidently higher than NR Lyr the amplitude variations are obvious. The maximal difference between high and low amplitude maxima is about 0.005-0.006 mag. This value is the same as we estimated for Kepler stars. Figure 3. The amplitude difference of consecutive cycles in CoRoT non- Blazhko stars CM Ori and BT Ser. The purple plus signs mean the original light curve points while the green `x' symbols show the light curve points shifted one pulsation cycle. Figure 2. The pixel mask of NR Lyr during the SC (Q11.1) observation. The left panel shows the flux in `high' maxima signed by `C' in Fig. 1, while the right-hand-side panel contains the flux difference between the `high' (`C') and `low' (`B') maxima points. Figure 4. Sample spectra showing additional modes around the main pulsation frequency f0 and its first harmonic 2f0. In the left-hand-side and in the middle: The black curves show the LC spectra. Spectra computed from the SC data are signed red and blue curves (see also labels in panels). Providing comparable spectra either we divided the frequency scales with the actual f0 and also the flux scales are normalized to the signal to noise ratio of the LC spectra. In the right hand side: Typical time-frequency plots. The colour scales show the power values. The C2C behaviour of NR Lyr
poster
Constraining stellar cores in the main sequence mass-transition zone Benard Nsamba, Marion Asasira, and Ronald Ssembatya Core evolution of stars in the main-sequence transition zone How long does core overshoot sustain a convective core on the main sequence? Radiation Vs. Convection We implemented core overshoot using the exponential decay recipe with a diffusion coefficient described by Herwig (2000), Model with no overshoot Model with overshoot *** Depending on the core extension implemented via the overshoot parameter, the mass transition region varies from [1.02 – 1.14] Solar masses. We note that metallicity also impacts on the probability of models being convective along the main-sequence phase*** Dov = D0exp( z f . H p) , where f is the overshoot parameter, Hp is the pressure scale height, z is the distance from the boundary of the convective region, and Do is the diffusion coefficient of the unstable convective region. Convective core evolution of models in the mass transition zone *** Hydrogen profile and sound speed profile are the best indicators of a uniformly mixed core region***
poster
The European Testing and Experimentation Facilities for Agrifood Innovation Swedish node There are two fantastic facilities for your tests: Testbed Digitalized Agriculture and AstaZero. In addition, RISE has more than 130 test & demo facilities that can also be used depending on what you want to test. By combining our capabilities and competencies in agriculture with other areas such as AI, digitization and autonomous vehicles, we help companies between prototype and market introduction and to build trust for new AI and robotics solutions in the agricultural sector. A network of test and experimentation infrastructures in Europe that supports Agri-Food technology companies to do near product validation of their AI and Robotics solutions, using real-world facilities. AgrifoodTEF Swedish Node AgrifoodTEF Swedish Node AgrifoodTEF Sweden aims to promote technology development in agriculture and offers opportunities to test new technology in realistic environments before market introduction. The goal is to introduce AI and robotics solutions in agriculture that strengthen the sustainability of food production in an era of climate change and global competition. What is AgrifoodTEF? What is AgrifoodTEF? Main Objectives Main Objectives
poster
Rosa M. González Delgado1, Julio E. Rodríguez Martín1, Ginés Martínez-Solaeche1, André de Amorim2, Luis Díaz García1, Rubén García Benito1, Matteo Maturi3,4 and J-PAS collaboration In this presentation, we report the results derived from analyzing the J-NEP field observed using the Pathfinder camera. We characterize the properties of stellar populations by fitting the J-PAS data with the parametric code BaySeAGal, focusing on galaxy members of groups detected by AMICO, as well as a sample of galaxies situated in filaments from the entire J-NEP sample down to an apparent magnitude limit of r < 22.75 (AB). We identify blue, red, quiescent, and transition (blue quiescent or green valley) galaxy populations based on their intrinsic colors and specific star formation rates. Furthermore, we estimate the fraction of red galaxies within groups, the excess fraction of quenched galaxies, and the evolution of the quenching rate within groups. These findings are compared with those from other fields, allowing us to assess the efficiency of group galaxy quenching as a function of the group or cluster mass. Introduction Galaxies in dense environments, such as galaxy clusters and groups, are more likely to interact among themselves and with the gas in the medium among themselves. These interactions lead to the suppression of the star formation of galaxies, by either heating or removing the cold gas reservoirs from galaxies, through mechanisms such as the ram-pressure stripping (Gunn et al., 1972), the tidal stripping (Malumuth & Richstone, 1984), or the harassment (Moore et al., 1996). This process is commonly referred to as environment quenching (Peng et al., 2010, Ilbert et al., 2013). Additionally, the populations and the distribution of the properties of the galaxies found in clusters and groups is different from those found in the field (see e.g. Dressler 1980; Bower et al. 1990; Lewis et al., 2002; Balogh et al., 2004; Kauffmann et al., 2004) The J-PAS survey has already started its science verification. Thanks to its photometric filter system, composed of 56 narrow-band filters, which provide an spectral resolution R~60, allowing for SED-fitting, as well as its large FoV (4.2 deg2), which allows for the unbiased detection of galaxies in galaxy clusters and groups, it will be an excellent survey to study the role of environment on galaxy evolution. In fact, works using data from the miniJPAS survey have already proven these capabilities (see González Delgado et al., 2022 and Rodríguez-Martín et al., 2022). In this work, we use the data from the J-NEP field, observed with J-PAS’ photometric filter system to further delve into this matter. Data The selected sample consists of 3257 galaxies with photo_z ≤ 1. We selected those objects with total_prob_star < 0.5. Galaxies in the sample reach a depth of 24 AB magnitudes in the rSDSS band. Most galaxies are dimmer than 18 AB magnitudes (peaking at ~23 mag) with an error lower than 0.1 mag. The distribution of the redshift of galaxies peaks at ~0.5. The brightness of galaxies decreases with redshift, and the median S/N decreases with the AB magnitude. Methodology SED fitting In order to retrieve the stellar population properties of galaxies we use BaySeAGal (de Amorim et al., in prep.; González Delgado et al., 2021), a bayesian SED-fitting code that uses a Markov Chain Monte Carlo approach. This way, we can estimate the errors of the properties and parameters as the standard deviation of the values of the chains, as well as retrieving the PDF of the properties. The code assumes parametric SFH. For our analysis, we choose a delayed-tau model, this is: Galaxy clusters and groups detections The classification of the galaxies into galaxies in groups and clusters and galaxies in the field was done using the AMICO code (Maturi et al., 2005; Bellagamba et al., 2018). This code is based on the Optimal Filtering technique and it was adapted by Maturi et al. (2023) in order to work with data using the J
poster
THE NEED TO CLASSIFY MOON SOILS: PROPOSAL FOR A FIRST STEP FOR PLANETARY PEDOLOGY CONTEXT The Industrial Revolution during the 19th spurred the development of standards and methodologies in the search of mineral resources. Likewise, the first step in space resources utilization is the identification and assessment of the distribution, composition, and quantity of extra-terrestrial material, i.e. the mapping of the so-called regolith or real soil [1]. The creation of a lunar resource cartography requires to agree on a standardized language to communicate about the different soil layers or “horizons” of the upper regolith. This consensus is a prerequisite to ensure effective communication, accurate interpretation, proper classification and reliable mapping of the lunar soils. This proposal provides a starting point for discussions among lunar scientists and soil scientists to establish a foundation for Moon Soil Sciences Mapping methods in the context of space resources. REFERENCES: [1] Certini, G. and Scalenghe, R. (2010) Do soils exist outside Earth? Planet. Space Sci. 58, 1767– 1770. [2] IUSS Working Group WRB. (2022). World Reference Base for Soil Resources. International soil classification system for naming soils and creating legends for soil maps. 4th edition. International Union of Soil Sciences (IUSS), Vienna, Austria. [3] Morris, R.V. (1978) Proc. LPSC 9th, 2287-2297. [4] Laul J.C. and Papike J.J. (1980) The Apollo 17 drill core: Chemistry of size fractions and the nature of the fused soil. Proc. 11th Lunar Planet. Sci. Conf. 1395-1413 [5] Taylor G.J., Warner R.D. and Keil K. (1979) Stratigraphy and depositional history of the Apollo 17 drill core. Proc. 10th Lunar Planet. Sci. Conf. 1159-1184. Jérôme Juilleret1, Abigail Calzada-Diaz 1,2, Riccardo Scalenghe 3, Giacomo Certini 4 1Luxembourg Institute of Science and Technology, 2European Space Resources Innovation Centre 3Universita degli Studi di Palermo, 4Universita degli Studi Firenze EARTH EXPERIENCE Terrestrial pedologists have developed an international nomenclature of soil horizons based on interpretive symbols, which link soil description to properties and/or genesis of the layers [2]. This system facilitated the parallel development of pedological classification and soil mapping in the 20th century, allowing for systematic interpretation of soil properties and genesis. For example, the World Reference Base for Soil Resources International soil classification system uses capital letters (master symbol), often followed by one or more lowercase letters (suffixes) to label soil horizons [2]. PROPOSAL FOR THE MOON We propose to use a combination of the Is/FeO maturity index of Morris [3] (i.e., the amount of single-domain and nanophase Fe0 (Is) normalized for total FeO content), and the agglutinate content to differentiate soil reference horizons, as these variables reflect the surface exposure time of lunar soils to weathering. In addition, we suggest using a labelling system inspired by Earth’s pedology concept but adapted to the Moon context. To avoid confusion with terrestrial soils horizons, we have chosen to use the degree symbol ° (Unicode U+00B0) as a prefix to the master horizon designation. We have defined 4 master horizons (°A,°B, °C, °D) based on the agglutinates content, and these, combined with the Is/ FeO maturity index, allow us to define 12 reference soil horizons (see Table below). We suggest naming the °A horizon the Agglutinic Master Horizon, as it has the highest content of agglutinates. Finally, we recommend integrating rock fragment cover, texture and other important features for in-situ resource utilization (ISRU) as diagnostic properties. Agglutinates (%) Master Horizon Is/Fe (%) Reference Horizons Comments > 30 °A > 60 °Am Mature °A 30 - 60 °As Submature °A < 30 °Ai Immature °A 15 - 30 °B > 60 °Bm Mature °B 30 - 60 °Bs Submature °B < 30 °Bi Immature °B 5 - 15 °C > 60 °Cm Mature °C 30 - 60 °Cs Submature °C < 30 °Ci Immature °C < 15 °D > 60 °D
poster
CHARACTERIZATON OF A HOLLOW-CATHODE LAMP TO MEASURE ACCURATE TRANSITION PROBABILITIES OF RARE EARTH ELEMENTS P. R. Sen Sarma, M. T. Belmonte, S. Mar , N. Lorenzana Universidad de Valladolid, Department of Theoretical and Atomic Physics and Optics, Paseo de Belén 7,47011 Valladolid, Spain. WHAT DO WE DO AND HOW IS IT DONE? The quality and quantity of atomic data, like transition probabilities of rare-earths, is a major hindrance for astrophysicists to accurately calculate chemical abundances of stars[1]. Thus it is of utmost importance to produce new improved atomic data. Spectral Range: 200 nm to 800 nm Resolving Power: 150 000 at 450 nm ACKNOWLEDGEMENTS: P. R. Sen Sarma thanks the University of Valladolid for his PhD grant. M. T. Belmonte acknowledges the funding provided by the Spanish government through projects PID2021-127786NA-100 and a Beatriz Galindo Fellowship. PRATYUSH RANJAN SEN SARMA pratyushranjan.sen-sarma@uva.es MARIA TERESA BELMONTE SAINZ EZQUERRA mariateresa.belmonte@uva.es In order to report transition probabilities (Aki) of Nd III in the UV-visible range, we use a diffraction grating spectrometer (2400 lines/mm) to measure the branching fractions (BFi). Using this BFi and lifetimes (τk), Aki is calculated. VOLTAGE-CURRENT CHARACTERISTIC OF THE HOLLOW-CATHODE LAMP (HCL) STABILITY OF THE HCL OVER TIME We measure intensities of Ar II lines at different wavelengths for transitions from different upper energy levels over a period of almost two hours. Current and pressure are 300 mA and 150 Pa, respectively. To make sure that our Hollow-cathode Lamp is operating in the abnormal glow region of its discharge curve, the voltage-current characteristic is obtained for low pressures in order to get “nice spectroscopic property” [2]. The resistance of the lamp decreases with an increase in pressure due to the increase in Ar atoms. Wavelength (nm) Transition Probability (*108s-1) Upper Energy Level (eV) Intensity Variation 349.1 2.31 [3][4] 22.8 10% 423.72 0.112 [3][4] 21.4 7% 611.5 0.2 [3][5] 21.1 3% Hollow-Cathode lamp is operated in the abnormal glow region of the gas-discharge curve of Ar II. We have used standard Tungsten and Deuterium lamps to obtain the response function. We measure the same response using the branching ratio (BR) method [6]. This method takes the transmittance of the lamp’s front window into consideration. RESPONSE FUNCTION OF OUR SETUP REFERENCES [1] Banerjee, Smaranika, et al. ApJ 934.2 (2022): 117. [2] B. Barbieri, N. Beverini and A. Sasso, Rev. Mod. Phys. 62, 603 (1990). [3] Kramida, A., Ralchenko, Yu., Reader, J., and NIST ASD Team (2022). NIST Atomic Spectra Da- tabase (ver. 5.10), [Online]. Available: https://physics.nist.gov/asd [2023, June 21]. National Insti- tute of Standards and Technology, Gaithersburg, MD. DOI: https://doi.org/10.18434/T4W30F [4] W. R. Bennett, Jr., P. J. Kindlmann, and G. N. Mercer, in Chemical Lasers: Applied Optics Supplement 2, 34 (Edited by J. N. Howard, Opt. Soc. America, 1965) [5] R. Schnapauff, Z. Astrophys. 68, 431 (1968) (Ger.) [6] Whaling, W., M. T. Carle, and M. L. Pitt. JQSRT 50.1 (1993): 7-18. [6] Ical : Calibrated Intensity; Imeasured : measured Intensity Ɛ(λ) : Response function of the setup at wavelength λ
poster
OPEN, FREE & FAIR DATA GUIDE CHEAT SHEET FOR NASA-FUNDED EARTH SCIENCE DATA PRODUCTS § Keep a holistic view with FAIR core concepts. § Follow NASA established processes and practices. § Utilize NASA enterprise systems and tools. § Leverage community standards and practices. F1 IDENTIFIER F2 RICH METADATA F4 RESOURCE A1, A1.1 PROTOCOL A1.2 PROCEDURE R1 ATTRIBUTE R1.1 LICENSE R1.2 PROVENANCE R1.3 STANDARD Obtain and use unique, persistent, and resolvable identifiers: § Data product: DOI from DataCite (via a DAAC) or Zenodo. § Metadata records: UUID or ARKs. Additionally, use these IDs if appropriate: § Person (Data producer and (meta)data curator): ORCID. § Organization: ROR ID. § Data center or Repository: re3data ID. § Instrument/Platform: PIDInst § Other artifacts: RRID § Use CMR UMM-C schema. § Ensure inclusion of required UMM-C metadata elements such as: DOI, Title, Abstract, Creator and/or Publisher [Data Centers], Version, Platform, Spatial Extent, Temporal Extents, Processing Level, Science Keywords, and Metadata Specification. When publicly releasing data products and associated metadata records: § Include an open license, following practices in R1.1. § Include data provenance, following practices in R1.2. Additionally, § include those in I3 if appropriate. § Review and include relevant attributes from Appendices D and E in DPDG (Ramapriyan et al. 2024). § Use CC0 1.0 + Attribution for mission data products. § Use CC0 1.0 + Attribution or CC-BY 4.0 for NASA-funded scientific data products. § Make it both human and machine-readable* and include recommended citation in metadata and on DOI/data product landing pages. * See the side panel on the right for examples. § Use UMM-C metadata fields (Version, Data Dates, Metadata Dates, DOI/PreviousVersion, RelatedURL, Data Center, Collection Citation/Creator). § Use global attributes in netCDF data files for source data, algorithm used, and data producer and/or publisher. WHAT YOU SHOULD KNOW Making data FAIR is a multi-dimensional, multi-layered, and multi- faceted problem (Figure 1) that requires multi-domain information and knowledge. § FAIR Principles consist of 15 FAIR sub-principles in 4 quality dimensions (Findability, Accessibility, Interoperability, and Reusability), covering three categories (Data, Metadata, and Infrastructure) (Figure 2). § The FAIR principles can be mapped to 28 category-specific requirements (Figure 3) and 21 unique category-specific unique core concepts (Figure 2). FAIR ID / CORE CONCEPT Integrate with NASA’s Earth data publication process: § Register data product DOIs and UMM-C/G metadata records in CMR § Integrate to Earthdata Search Portal Ensure integration to additional searchable resources, including: § DataCite, if it minted DOI § Google Search Engine § Register for an Earthdata account. § Use Earthdata Search Portal for retrieving metadata records. § Download data with Earthdata Login. § Use Earthdata (Cloud/GIS) login for data access. § Use Earthdata Search Portal or CMR API for metadata access. Figure 2. FAIR dimensions and sub-principles IDs (filled circles); categories (filled ovals) for data (D), metadata (M), and infrastructure (IS); and core concepts (round triangles). The pink-filled core concepts are FAIRness quality measures. Source: Peng et al. (2024a). License: CC-BY 4.0 DEVELOPED BY NASA ESDS O’FAIR Working Group Recommended Citation: Peng. G., R.R. Downs, H. K. Ramapriyan, and NASA ESDS O’FAIR WG, 2024: Open, Free & FAIR Data Guide Cheat Sheet for NASA-funded Earth Science Data Products. Version: v01r00-20240926. DOI: https://doi.org/10.5281/zenodo.11520035. License: CC0 1.0 + Attribution. Acknowledgement: The work for this cheat sheet and the O’FAIR data guide document (i.e., Peng et al. 2024b) was carried out across multiple United States government-funded institutions under contracts with NASA (see details in Peng et al. 2024b). Government sponsorship is acknowledged. § Follow a standard for enabling data identifiers globall
poster
4 4 4 4 When it comes to measuring the quality of an open access repository, it is not the size that matters but the sum of its characteristics. The Open Access Repository Ranking (OARR) is a ranking that lists all German open access repositories according to a metric that evaluates a certain set of criteria that are summarized in categories. The OARR metric is open, transparent and developed in accordance with the open access community. The data for the current ranking was collected in the course of the 2014 Census project seminar at the BLIS. The ranking is planned to be published annually at the Open-Access-Tage conference in September. The preceding January each open access repository that meets the OARR definition will be contacted to submit their data via an online form. The OARR team reviews all submissions assuring its quality and validity. What? For now OARR is a ranking limited to Germany. We are planning to extend it to other countries. OARR is a research project based at the Information Management Department of Professor Peter Schirmbacher at the Berlin School of Library and Information Science (BSLIS), Humboldt-Universität zu Berlin (HU Berlin). If you have any ideas (e.g. cooperations) of how to work on the future of OARR we encourage you to contact us. For whom? OARR aimes primarily at repository managers and institutions that host, run or plan to build a repository. With OARR funders and repository managers get an overview of the (technical) developments within the open access repository community. Finally OARR enables researchers to identify the open access repository that suits best their needs when looking for a proper place to deposit their publications. Where to? Ranking Profile Page Metric REPOSITORY RANKING OPEN ACCESS 2014 RANKING METRIC STATISTICS SUBMIT Team: Paul Vierkant, Maxi Kindling, Dennis Zielke, Thomas Hartmann
poster
• At the end of each trial, the correct category was revealed and the subjects recorded the accuracy of their category guess. Investigating the effects of a non-native salamander on the native salamander community at Mountain Lake Biological Station, Pembroke, Virginia. Alexander J. Novarro1 and August Blackman2 Background Results Literature Cited Methods 1. Rissler et al. 2000. Spatial and behavioral interactions between a native and introduced salamander species. Behavioral Ecology and Sociobiology, 48, 61-68. 2. Hairston, N.G. 1983. Alpha selection in competing salamanders: experimental verification of an a priori hypothesis. The American Naturalist., 122, 105-113. 3. Fiske, I. and R. Chandler. 2011. An R package for fitting hierarchical models of wildlife occurrence and abundance. Journal of Statistical Software, 43, 1-23. 1Department of Biology, University of Maryland, College Park, MD; 2Department of Biology, Oberlin College, Oberlin, OH Discussion @TheSalexmander Plethodon cinereus and Plethodon glutinosus naturally co-occur at Mountain Lake Biological Station. In the 1930s-40s, a third Plethodon species, P. montanus, was introduced1. Although these species coexist elsewhere, the introduction of novel salamander species is known to negatively impact the abundance of naïve species2. We hypothesized that the abundance of P. cinereus and P. glutinosus would be lower in the presence of P. montanus than in the absence of P. montanus. Has the introduction of Plethodon montanus affected the abundance of native Plethodon species at Mountain Lake Biological Station? Our study shows that a non-native Plethodon salamander may persist in a community of ecologically similar species without negatively impacting the abundance of the native species. However, an increase in the number of P. montanus is likely to have a negative impact on the dominant native species, P. cinereus. To our knowledge, this is the only human-introduced population of lungless salamanders. Our study provides insight to the community-level effects of human- and climate-induced range shifts in Plethodon salamanders. Anova1@umd.edu Our results suggest that the non-native P. montanus has not reached high enough densities to negatively impact the native salamander community at Mountain Lake Biological Station. We performed three nocturnal visual encounter surveys in 48 15x3m transects at sites where P. montanus was either absent, introduced, or native. We used N- mixture models in the R package unmarked to estimate abundance while accounting for imperfect detection3. Table 1. Beta estimates, standard error, confidence intervals, and P-values for the best-supported abundance models. Fig. 3. Mean abundance of Plethodon salamanders in a 45m2 transect at sites where P. montanus is absent, introduced, and native. a b c Fig. 1. Photos of Plethodon species at Mountain Lake Biological Sta9on: (a) P. cinereus, (b) P. glu1nosus, and (c) P. montanus. Fig. 2. Predicted relationship between the abundance of P. montanus and the abundance of P. cinereus in a 45m2 transect. Fig. 2. Map showing the loca9on of study sites in Giles County, Virginia where surveys were conducted. Circles are color coded to represent the state of P. montanus. 0 20 40 60 80 100 Absent Introduced Native State of P.montanus Estimated Abundance Species P. cinereus P. glutinosus P. montanus 0 10 20 30 40 50 60 70 0 50 100 150 200 P. montanus P. cinereus Fitted Regression Line 95% Confidence Interval (SE) β SE 95% CI P-value P. cinereus Detection covariates: Precipitation 0.019 0.003 0.012 0.026 < 0.001 Time of survey -0.003 0.001 -0.004 -0.002 < 0.001 Understory cover 0.005 0.004 -0.004 0.013 0.275 Abundance covariates: Distance to stream -0.001 0.000 -0.002 < 0.001 0.118 Understory cover -0.007 0.005 -0.017 0.002 0.149 Estimated abundance of P. montanus -0.027 0.005 -0.036 -0.017 < 0.001 P. glutinosus Detection covariates: Precipitation -0.019 0.011 -0.041 0.002 0.088 Time of survey -0.003 0.001 -0.006 -0.001 0
poster
RESEARCH POSTER PRESENTATION DESIGN © 2015 www.PosterPresentations.com Long-baseline neutrino oscillation sensitivity with Theia Guang Yang1 , Michael Wilking1, Elizabeth Worcester1,2 on behalf of the Theia collaboration 1.Stony Brook University, 2. Brookhaven National Lab Neutrino detection and reconstruction Long-baseline sensitivity Theia detector Neutrino mixing and oscillation Background reduction PMNS matrix: - A non-zero Ɵ₁₃ has been measured. - Different appearance probability between ν and anti-ν indicates the CP phase. Theia has proposed two possible masses of 25 kt and 100 kt with features: - large-scale water-based liquid scintillator - Advanced photo-sensor technology with improvements in time resolution, light collection, spatial granularity etc. - Multiple complementary and advanced reconstruction techniques - Main neutrino interaction channels at GeV: - CCQE: νe 0 decay electrons ; νμ typically 1 decay electron - CCπ+ : 1, 2 or 3 rings; νe 1 decay electron ; νμ 2 decay electrons - NC π : NCπ0 can be mis-ided as an electron ; NC π+ can be mis-ided as either μ or e. - As a reconstruction package, FiTQun is now exclusively used for all T2K oscillation analysis -For any hypothesis of final state particles, predict the charge and hit recorded by every PMT Theia 25 Theia 100 -FiTQun can handle any number of reconstructed tracks in the water detector -Event hypotheses are distinguished by comparing best-fit likelihoods. - BDT has been used for the background reduction for each i-ring j-decay sample (i from 1-3, j from 0-1). - T2K-like fully contained fiducial volume cuts have been applied as pre-cuts. - Variables with FiTQun after the pre-cuts: - vertex, distance to wall, direction - pi0 fit momenta, likelihood, angle, mass - 1-ring fit: momenta, likelihood - 2-ring fit: kinematics, differences between the best fit likelihoods of each combination (e-like or pi-like) - 3-ring fit: similar to the 2 ring case, with all possible differences between the best fit likelihood of each combination (e-like and pi-like) - Energy-dependent BDT cuts are applied to the samples after the pre-cuts. FHC 1 ring 0 decay FHC 1 ring 0 decay - There are totally 9 samples included in the sensitivity study. - FHC: - 1-ring, 0 or 1-decays - 2-rings, 0 or 1-decays - 3-rings, 0 or 1-decays - RHC: - 1-ring, 0-decay - 2-rings, 0-decay - 3-rings, 0-decay - Full set of spectra: Eur. Phys. J. C 80, 416 (2020). https://doi.org/10.11 40/epjc/s10052-020-7977-8 - The CP and mass hierarchy sensitivities with a 25 kt (fiducial) Theia module are comparable to a 10 kt (fiducial) DUNE module. guang.yang.1@stonybrook.edu
poster
Stephanie Werner (Darmstadt University of Applied Sciences): stephanie.werner@h-da.de ORCID: 0000-0002-0468-8856 Arnela Balic (Frankfurt University of Applied Sciences): arnela.balic@fit.fra-uas.de ORCID: 0000-0002-7049-5737 1.5 hours per module 6 modules published reusable materials individual adjustments 20-80 attendees per module about 400 registrations The HeFDI universities and universities of applied sciences What is HeFDI? Various different infrastructures and services are needed to support researchers in managing their digital research data. Led by the Philipps-University of Marburg, eleven Hessian universities and universities of applied sciences collaborate to establish common research data services fit for the needs at hand. HeFDI offers, amongst many other products, training courses targeted towards PhD students at Hessian universities and universities of applied sciences. Decentralized and collaborative: Data School RDM training HeFDI Data School HeFDI Publications HeFDI Website HeFDI Data School in the future Future plans for the HeFDI Data School include the possibility of granting credit points for participation as well as improving workflows and planning processes. Up-to-date-content regarding RDM is continuously fed into the materials and the quality of those materials is improving based on growing expertise as well as feedback of the attendees. English modules and materials are currently being discussed as well. Advantages The idea of the Data School comes with many advantages such as opportunities for individual adjustment of focus for each institution. On top of that, the whole HeFDI network works together to evolve its contents, enabling especially smaller institutions to develop and take advantage of this training concept while significantly conserving staff efforts. The attendance of the HeFDI Data School is possible from anywhere with a stable internet connection offering maximum flexibility to speakers and attendees alike, allowing for increased attendance rates. Attendees can also request a certificate of participation after completing the courses. All in all, the HeFDI Data School is a popular training offer with consistently high registration numbers, also attracting registrations from outside the HeFDI community. Formation of the HeFDI Data School The HeFDI Data School started as a decentralized online offer in the beginning of the COVID-19 pandemic. The mostly digital environments during the time of the pandemic led to an accelerated productivity in the planning process. A working group on this topic was established that still continues its activities. Initially it was carried out by volunteers of universities of applied sciences in the HeFDI network to reduce individual workloads when educating about Research Data Management on a local scale alone. Since it has grown and shifted with every year. At this point, the fourth edition of the HeFDI Data School is being held and participants of the symposium are encouraged to register. All about the HeFDI Data School Contents The Data School consists of several modules imparting basic knowledge regarding Research Data Management such as data management plans or FAIR principles. The contents of the Data School are continuously being evaluated, developed and extended to fit the needs of the attendees as well as reflecting current developments in the RDM community. The basic Data School curriculum typically consists of six modules: • Introduction to Research Data Management • Data Management Plans (DMPs) • Data Organization and Documentation • Archiving and Publication of Research Data • Legal Aspects (Copyright and Rights of Use) • Legal Aspects (Data Protection) 16th October 30th October 13th November 27th November 11th December 15th January Data School III attendance per status group PhD students professors others students administrative staff academic staff Modules that have been taught previously as additional courses were for example: • Open Science
poster
Design and Formalization of Blockchain Oracles By: Mohammad Shaheer Advisor: Giselle Reis • Blockchain: Decentralized, distributed ledger that stores information securely and transparently. • Ethereum: Blockchain based decentralized computing platform that allows developers to build dApps (Decentralized Applications). • Smart Contracts: Computer programs running on Ethereum that can be called by users by creating requests. • Example: Alice agrees to pay Bob X ETH if team Y wins the match. The smart contract for this match needs to obtain the results of the match. • Solution 1: Smart Contracts call the off-chain APIs themselves. Issue: Blockchain loses determinism. • Solution 2: Oracles Entities that connect blockchains to external systems 1. Background • Oracle Problem: Connecting Blockchain to off-chain systems without losing the transparency, consensus and decentralization. • Agood oracle should satisfy the following properties: 1.Confidentiality, Integrity and Availability 2.End-to-End Decentralization 3.Discourage Dishonest Behavior • Problems with current oracles: 1. No formal guarantees 2. Ad hoc 3. Prone to attacks by malicious entities 4. Uncertainty 2. Problem • Chainlink is the most trusted Oracle used in industry. • Adopts decentralization at every layer. • Issues: 1. Not Formally Verified 2.Complex Implementation 3. State of the Art • Provide guarantees through Formal Verification. • Ensure protocol is sustainable and charges consumers fairly. 4. Our Approach • Smart Contract implemented using Solidity. • Every external data source connected to an oracle smart contract on- chain. • Data Model: Subscription based model. Consumers deposit credit to obtain data. • Price setting Model: 1. Every consumer charged (weight * base fee). 2. The model tries to keep the total cost and total revenue the same by adjusting the Base Fee at periodic intervals. 3. 𝑹𝒌+ 𝝓′ ∗𝛀𝒌= 𝑪𝒌+ 𝜶𝒌∗𝑵𝒌(Solving for 𝜙′). • Under certain assumptions, total cost equals total revenue right before the next base fee adjustment. 5. Implementation • Coq (Interactive Theorem Prover) used for formalizing the Solidity smart contract. • The oracle is modeled as a state machine. • The state of oracle is formalized as an n-tuple. • Trace: Record of events ordered from least-recent to most-recent. • Using the initial oracle state and the trace we can track the evolution of the oracle state. 6. Formalization 𝑆𝑡𝑎𝑡𝑒𝑖+ 𝑃𝑎𝑟𝑎𝑚𝑒𝑡𝑒𝑟𝑠 𝐶𝑜𝑞𝐹𝑢𝑛𝑐𝑡𝑖𝑜𝑛 𝑆𝑡𝑎𝑡𝑒𝑖+1 • Theorem 1: After every action, the credit of all consumers remains non- negative. 2 helper lemmas • Theorem 2: Between any 2 data write calls, a consumer pays exactly once for obtaining data. 9 helper lemmas • Theorem 3: If the base fee is adjusted under certain assumptions, total revenue equals total cost right before the next base fee adjustment. 16 helper lemmas • Theorems proved inductively using the trace. • Desired property and assumptions expressed as Coq propositions. 7. Specifications • PID Control: Technique used in Control Theory to control the system’s behavior (controlled variable) in order to achieve the desired output (commanded variable). • Intuitively, it’s a function that receives an input and produces an output. • Objective: Over time, we want the total revenue (controlled variable) to be equal to the total cost (commanded variable) which indicates sustainability and fairness of the protocol. 8. Price Setting using PID control Total Cost Total Revenue Base Fee • We can modify the Adjust Base Fee function to implement a PID control. • Determining 𝑲𝒑,𝑲𝒊,𝑲𝒅(also known as gains) is the main challenge. • Heuristic Approach: Run input sequences and use Cohen Coon/Ziegler Nichols method for determining the gains. • Model Based Approach: Determine a model that describes how the total revenue is affected by the base fee and use it to determine gain values. • 𝑻𝒐𝒕𝒂𝒍𝑹𝒆𝒗𝒆𝒏𝒖𝒆𝒕= ׬𝟎 𝒕𝝓𝒕∗𝒓𝒕𝒅𝒕 • 𝑻𝒐𝒕𝒂𝒍𝑪𝒐𝒔𝒕𝒕= ׬𝟎 𝒕𝜶𝒕∗𝒘𝒕𝒅𝒕 Total Revenue = 𝑅𝑘 Total Cost = 𝐶𝑘 Reads = Ω𝑘 Writes = 𝑁𝑘 Latest Cost = 𝛼𝑘 Base Fee Adjustedk Total Re
poster
Segmentation Neural Networks for Particle Identification in ProtoDUNE Carlos Sarasty Segura for the DUNE Collaboration† †University of Cincinnati Segmentation Neural Networks for Particle Identification in ProtoDUNE Carlos Sarasty Segura for the DUNE Collaboration† †University of Cincinnati ProtoDUNE-SP Detector The ProtoDUNE single-phase (SP) detector is the prototype of the DUNE far detector SP technology built with full scale compo- nents at the CERN neutrino platform. With a total liquid argon mass of 0.77 kt it is the world largest Liquid Argon Time Projec- tion Chamber (LArTPC) built to date. The TPC consist of a cen- tral Cathode Plane Assembly (CPA) held at 180kV that is flanked by 6 Anode Plane Assemblies (APAs) at a distance of 3.6m. Each APA is 6 m long x 2.5m wide and contains a set of three planes of sense wires (tow collection planes and one induction plane) oriented at different angles. Fig. 1: Ilustration od the ProtoDUNE-SP detector Semantic Segmentation We apply sparse CNNs for semantic segmentation at a pixel level using simulated event displays in two and three dimensions in the ProtoDUNE (LArTPC) detector. We use a hybrid network of two popular architectures that are U-Net and ResNet. U-Net is an auto-encoder made of two parts where the first part applies a series of convolution blocks that reduces the size of the feature maps and learns important properties of the image at different scales. The second part applies a series of up-sampling oper- ations and convolutions to recover the original resolution of the image. Based on ResNet architecture, we allow residual skip connections that speed learning. Fig. 2: Illustration of the UResNet architecture, figure from [1] Ground Truth The performance of any machine learning model is limited by the quality of the definition of the ground truth. In this case the ground truth is a tensor that holds the true informa- tion of the different types of particles present in each pixel (or voxel for the 3D case) of an event display. In order to define the ground truth, we use the information from the underlying simulation such as the PDG code of the particles, the track ID, the process name and the amount of energy deposited by each particle per pixel (or voxel). The different particle classes used in our training are: Mouns, pions, heavily ionizing particles (such as protons, kaons and nuclei), Michel electrons, electromagnetic showers, and diffuse electromagnetic activity. Then we record the fraction of energy deposited by each type of particle per pixel. Results We trained a sparse CNN for particle identification using a set of 70.000 3D recon- structed samples that we split into 95% and 5% for train and test respectively. We calculated the accuracy of each particle class and we summarized those results in a confusion matrix. Moreover, we tested the capability of the neural network to correctly separate pions and protons. Fig. 3: Confusion Matrix. Fig. 5: True and classified scores for pion and proton separation. Fig. 6: The figure in the top represents the true labels. The figure in the bottom shows the classified labels Status and Future Plans • These results show a very good performance of the network for the task of semantic segmentation at a pixel level, they also show that pions can be well separated from protons. • We plan to train the network using single particles dataset. • Test the capability of the network to separate electrons and pho- tons as well as muons and pions. References [1] Laura Domine and Kazuhiro Terao. “Scalable Deep Convolutional Neural Networks for Sparse, Locally Dense Liquid Argon Time Projection Camber Data”. In: arXiv:1903.05663 (2019).
poster
1.1. 3. 3. 4. 4. 2. 2. Could Norway supply its own P fertilizer? High-resolution analysis of the agricultural phosphorus cycle. Miguel Las Herasª, Francis Barrea, Nils Dittrichb, Avijit Panditb, Anne Falk Øgaardc, Daniel B. Müllerb a The Climate and Environmental Research Insitute NILU b Norwegian University of Science and Technology c Norwegian Institute of Bioeconomy Research 1 Cordell, Drangert, and White, (2019). The Story of Phosphorus. Global Environmental Change. 2 Jasinski, Stephen (2019). Mineral Commodity Summaries 2019. USGS. 3 Hamilton et al. (2016). Investigating Cross-Sectoral Synergies... Journal of Industrial Ecology. Project funded by NFR - Bionær Mineral P is currently the main source of P-fertilization, essential for food production1. Mineral P reserves are highly concentrated in a few regions: ~70% of global P is found in Morocco and West. Sahara2. Over half of the P fertilizer applied to cropland is wasted (runs off to water or accumulates in the soil)3. P emissions increase the risk of eutrophication. FOOD SECURITY + EUTROPHICATION RISKS FOOD SECURITY + EUTROPHICATION RISKS METHODS METHODS Farm: P flows quantification P cycles of x40 000 farms Spatial aggregation Modelling of manure management optimization P CYCLE OF NORWEGIAN FARMS P CYCLE OF NORWEGIAN FARMS mineral fertilizer biosolids & biowaste accumulation runoff vegetables roughage grass animals grain products eggs milk manure B. Farm with crop production A. Farm with mixed production (livestock and crops) C. Farm with pig production P accumulation in Norway (t/yr) 0,0 - 6,0 6,1 - 16,0 16,1 - 42,0 42,1 - 112,0 112,1 - 355,0 A. B. C. * A, B and C are three example farms from the Norwegian 40,000 and are not representative of the national P cycle. If you are interested in the aggregation of flows on a national level, please see the additional documentation hanging on the side. POTENTIAL REDUCTION OF MINERAL P IMPORTS POTENTIAL REDUCTION OF MINERAL P IMPORTS IN CONCLUSION, AND ANSWERING THE TITLE: YES IN CONCLUSION, AND ANSWERING THE TITLE: YES mineral P traded manure animal deposition biosolids & biowaste collected manure fertilization demand -52% -74% -78% -89% Farm Optimiz. Regional Market Municipal Market Status Quo National Market 1 2 3 4 Strategies to replace imported mineral P with secondary P from collected manure: ▪Optimizing manure and fertilizer application at the farm level (1). ▪Secondary P fertilizer markets: Implementation of processing and trading infrastructure for manure and recycled fertilizer (2, 3, 4). Fertilizer demand under different strategies The effective application of collected manure as P fertilizer by farms with livestock could reduce mineral P imports by 52%. Trade of surplus manure between neighboring farms could reduce mineral P imports by an additional 22%. A country-wide market for recycled fertilizer from surpluss manure could increase the reduction by up to 89%. An improved treatment of sewage sludge to enhance the plant uptake of P from biosolids could allow the P fertilizer independence. 0 250 500 750 1000 1250 1500 1750 Age of the cow (days) outflows | inflows 0.08 0.00 -0.06 body growth lactation mass embryo growth manure milk (feed) concentrated (feed) roughage (feed) total feed PRETTY COOL: DYNAMIC MFA OF INDIVIDUAL ANIMALS (here, dairy cow) kg P Feel free to ask! :)
poster
0 0.5 1 TINnorm -20 -15 -10 -5 0 5 10 15 20 dbar shallower than peak dT/dz Jul-Sep Midl Shelf Composite TIN norm rel to peak dT/dz -0.2 -0.1 0 0.1 0.2 mmol N m-3 d-1 -20 -15 -10 -5 0 5 10 15 20 0 10 20 30 40 50 60 70 80 90 100 Days Since 1 July 0 5 10 15 20 25 30 35 TINdeep [ mol l-1] Deep (>50 dbar) TIN concentrations, SE Middle Shelf Jul-Sep • Researchers at NOAA PMEL and AFSC are currently working on a compendium of CTD (1974- present) and nutrient (2001- present) data based on NOAA sampling in Alaska waters. • This will include EcoFOCI and predecessor programs at PMEL, along with data from the BASIS program at AFSC. • Here, we show an example application: investigating the nutricline on the SE Bering Sea middle shelf. • A strong thermocline there is a consistent feature in summer. • The compendium data are used to demonstrate the composite structure relative to this thermocline, post-spring bloom. • We use total inorganic nitrogen TIN = NO3+NO2+NH4 to characterize the nutricline (Lomas et al. 2012). Data are referenced to the thermocline in each profile. • Composites at left are based on 991 casts in 18 years (2003-2020) of sampling on middle shelf in July-Sept (red). • E Bering Shelf is among most densely sampled areas for nutrients in the compendium. • Coverage extends into Chukchi (not shown) and Gulf of Alaska (partially shown). • Observed subsurface chl maxima – e.g., shown here at M2 site (green, above) in 2019 sampled by prawler instrument (Nielsen et al., 2023) – are often also coincident with or just above thermocline. • Confirmed in composite (right) of data in vertical coordinates relative to thermocline. Compare with profile of convergence of turb. flux at left. Conditions at M2 site in 2019 Bloom Thermocline Convergence of vertical turbulent flux, assuming constant Kz applied to composite • Composite deep concentrations (right) increase with day of year. • Suggests that replenishment due to biogeochemical processes in lower layer outpaces upward mixing. • Though, likely some geographic variability on the middle shelf that needs to be more fully accounted for in sampling. Data Compilation An Example Summer The Composite Deep Layer The Composite Nutricline Composite Fitted Data Composite Fitted (descriptive) • The composite nutricline in these profiles is almost exactly centered on depth of peak dT/dz. • Here TINnorm = TIN / TINdeep (avg of bottles ≥50 dbar in each profile). • The mean summer profile implies nutrients are being supplied to upper half of nutricline. And, being depleted in lower half. • ~0.5 mmol N per day total supplied to a 5-meter region in upper nitricline, if Kz ~ 10-5 m2 s-1 and is constant, and TINdeep ~ 15 micromol kg-1 • Results support the common assumptions that thermocline and nutricline are coincident, and that nutrients are often depleted in surface layer, and imply a vertical structure of nutrient supply under certain conditions/assumptions. Data are to be described in: Mordy C, Pelland N, Stabeno P, Bell S, Cheng W, Eisner L, Farley E, Gann J, Hermann A, Nielsen J, Proctor P, Wisegarver E. A fifty-year compendium of hydrographic data in Alaska waters by the U.S. National Oceanic and Atmospheric Administration. Data manuscript in preparation. Other references: Nielsen J, Pelland N, Bell S, Lomas M, Eisner L, Stabeno P, Harpold C, Stalin S, Mordy C (2023) Seasonal Dynamics of Primary Production in the Southeastern Bering Sea Assessed Using Continuous Temporal and Vertical Dissolved Oxygen and Chlorophyll-a Measurements. JGR: Oceans, 128, e2022JC01907. Lomas M, Moran S, Casey J, Bell D, Tiahlo M, Whitefield J, et al. (2012). Spatial and seasonal variability of primary production on the eastern Bering Sea shelf. DSR-II, 65–70, 126–140 The composite southeast Bering Sea shelf nutricline, within a multi-decade compendium of NOAA Alaska hydrography Noel Pelland1,3, Jens Nielsen1,3, Calvin Mordy1,2, Phyllis Stabeno2, Shaun Bell2, Wei Cheng1,2, Al Hermann1,2, Lisa Eisner3, Jeanette Gann3 1.
poster
Empowering disease knowledge representation with the Disease Ontology Knowledgebase (DO-KB) J. Allen Baron, Mike Schor, Claudia Sanchez-Beato Johnson, Lynn Schriml Institute for Genome Sciences, University of Maryland School of Medicine. Let’s talk: allenbaron@som.umaryland.edu ... or msg me on the conf app! A Global Core Biodata Resource As a recognized Global Core Biodata Resource (GCBR) the Human Disease Ontology Knowledgebase is: “[O]f fundamental importance to the wider biological and life sciences community and the long term preservation of biological data.” The DO-KB and ~ 400 biomedical resources & databases are powered by the disease data and relationships in the Human Disease Ontology (DO), including many of the genomic databases at TAGC. The Disease Ontology Knowledgebase: Tools powered by data from the Human Disease See how the Alliance of Genome Resources uses the DO to organize links from alleles, genes, and models to diseases. Example: DOID:0050117 disease by infectious agent Other biomedical and genomic resources that use the DO include Reactome, CIViC and the Common Fund Data Ecosystem, along with a number of the Common Fund programs it collects data from. The DO is used for research in a variety of fields. The number publications citing a DO publication by field are shown. Courtesy lens.org. doi:10.6084/m9.figshare.25320946 TAGC disease presentations -- What could have been... Want to find all the presentations at TAGC 2024 related to neurodegenerative disease without searching for each individually? Tagging presentations with diseases from the Disease Ontology could have made that possible, as this figure shows. A larger version of this figure with presentation program numbers colored by type (poster, talk, etc.) is available on figshare to make it easier to find TAGC24 presentations by disease. Dashed lines represent simplified relationships (intermediate diseases removed). 567T - Homology and Disease curation at Saccharomyces Genome Database: Budding yeast as a model for eukaryotic biology - Stacia R Engel, et al 594F - Xenbase: latest support for genomics and disease models - Malcolm Fisher, et al Alliance presentations with the DO NIH/NHGRI U24-HG012557 NIH/NHGRI U41-HG008735 Funded by FAIR & TRUST For a detailed look at how the DO makes data FAIR-er and is managed to ensure TRUST, check out our recent poster from Rare Disease Day at NIH. doi: 10.6084/m9.figshare.25292731 Using the SPARQL query language and the DO Sandbox or endpoint it’s possible to query diffuse data across the web. Data can be pulled to or from the DO. For example, add synonyms from MeSH to the DO, hierarchically organize the disease- linked proteins in UniProt, and more. disease-ontology.org OBO & OWL Tree Browsers with (Advanced) Search DO-KB SPARQL Sandbox & Endpoint DO-KB Faceted Search Interface DO-KB SPARQL sandbox: https://disease-ontology.org/do-kb/sparql DO-KB SPARQL endpoint: https://sparql.disease-ontology.org/ SPARQL info: https://www.w3.org/TR/sparql11-query/ The browser and basic or advanced searches can be used to look up information. The OBO tree is limited to diseases, while the OWL tree includes semantically-linked terms from other ontologies. The tree selected affects basic search results. The Human Disease Ontology (DO) is an expertly curated, etiological disease classification written in OWL/RDF (Web Ontology Language). The DO has 37,000 vocabulary mappings to authoritative biomedical resources (OMIM, Orphanet, etc.) and semantically integrates disease features like inheritance, phenotypes, chemical and environmental drivers, anatomy, and infectious agents. The Human Disease Ontology Knowledgebase (DO-KB) comprises the data in the DO and the tools at disease-ontology.org that make that data easier to search or expand interoperability. Think simple! All eye diseases that involve inflammation... yep! This is just one more possible application of the DO. Enjoy the conference!
poster
Relativistic effects in HgTe and CdTe electronic structure C. D. Hinostroza and P. H. Rivera cristhian.hinostroza2@unmsm.edu.pe priverar@unmsm.edu.pe ABSTRACT Quantum spin Hall phase, or also referred as Topological Insulator state, has been obtai- ned in 2007 in a CdTe/HgTe quantum well. These novel state is possible due to the in- verted band order near the Fermi energy, for the HgTe. These behaviour is originated becau- se there exist a non negligible correlation bet- ween valence electrons of the 5d- and 6s-orbital of Hg, and relativistic effects, specifically spin- orbit coupling. In this work, we present the electronic struc- ture of Cadmiun Telluride (CdTe) and Mercury Teluride (HgTe), obtained using the local spin density approximation, including the Hubbard correction (LSDA+U), in the density functional theory (DFT), considering non relativistic, rela- tivistic, and relativistic with spin-orbit coupling effects for each alloy. The results show that re- lativistic effects reduce the band gap for both alloys, and inverted band ordering for HgTe is only possibe if spin-orbit copupling is conside- red. THEORY Density functional theory is a method used to solve the many body problem based on the Hohemberg and Kohm theorems. Thus, the ob- servables could be calculates as a functional of the ground state energy electronic density, wich is obtained calculating the density that mini- mizes the energy expresion derived from the Kohn-Sham equation: E = N X i ϵi −EH[ρ] + Exc[ρ] − Z δExc[ρ] δρ(r) ρ(r)dr Where ϵi is related to the kinetic Kohn-Sham energy, EH to the Hartree energy, and Exc is the exchane and correlation nergy, wisch is consi- dered using the LDA approximation, as presen- ted by Perdew and Wang: EXC[n↑, n↓] = Z d3rn(r)ϵhom XC (n↑, n↓) Some systems need to consider a correction in the correlation function due to strong inter- action between electrons. This is achieved ad- ding the Hubbard correction in the LDA energy function. ELDA+U[n(r)] = ELDA[n]+EHub[nσ mm′]−Edc[nσ] Where Edc is the double counting term: Edc[nIσ mm′] = X Iσ U I 2 Tr[nIσ(1 −nIσ)] The relativistic solution is calculated using the Zero order regular aproximation: HZORA = V +p c2 2c2 −V p+ c2 (2c2 −V )2 σ·(∇V ×p) PROCEEDINGS Cadmium and Mercury Telluride are both II- VI type semiconductors. These materials have a Zinc Blende structure with lattice parameter a = 6,46Åand a = 6,48Åfor CdTe and HgTe repec- tively. Both semiconductors below to the F¯43m space group, with group number 216. Wich co- rrespond to two FCC displaced by ( 1 4, 1 4, 1 4) each other. We used the DFT method to get the band structure aplying the LAPW basis as implemen- ted in the package Exciting code. The Ex- change and Correlation energy considered was the LDA as presented by Perdew and Zhang icn- luding the Hubbard correction, and the relativis- tic effects where obtained with the Zero Order Regular Approximation of the Dirac Hamilto- nian. To appreciate the effects of relativistic con- siderations we performed calculations without any relativistic terms, with relativistic terms but without spin-orbit coupling, and within relati- vistic terms considering spin-orbit coupling. RESULTS Non relativistic L Γ X -2 -1 0 1 2 Energy (eV) Cd s L Γ X EF Te p L Γ X -2 -1 0 1 2 Energy (eV) Hg s L Γ X EF Te p Relativistic without s · L L Γ X -2 -1 0 1 2 Energy (eV) Cd s L Γ X EF Te p L Γ X -2 -1 0 1 2 Energy (eV) Hg s L Γ X EF Te p Relativistic considering s · L L Γ X -2 -1 0 1 2 Energy (eV) Cd s L Γ X EF Te p L Γ X -2 -1 0 1 2 Energy (eV) Hg s L Γ X EF Te p CONCLUSIONS From our calculations, we observe that the- re is a dependece between spin-orbit coupling and band ordering, obtained only if electron co- rrelation is considered. Relativistic effects chan- ges the band structure in a non neglible way, reducing the band gap from 3.07 and 2.87 eV to 1.05 and -0.104 eV for CdTe and HgTe res- pectively, also invreasin the velocity of charge carriers at Γ point. There must exist a value x for HgxC
poster
The diverse history of counter-rotating galaxies Tjitske K. Starkenburg1, Laura V. Sales2, Shy Genel1,3, Christina Manzano-King2, Gabriela Canalizo2 1Center for Computational Astrophysics, the Flatiron Institute, 2University of California Riverside, 3Columbia University Introduction Galaxies containing significant counter-rotating components are particularly interesting as it can provide additional dynamical constraints (i.e. polar ring galaxies: Schweizer et al 1983; Athanassoula & Bosma 1985; Sackett & Sparke 1990) and hold clues to evolutionary history and past environment (e.g. Cappellari 2016). However, while isolated simulations have shown that mergers and smooth accretion onto gas-poor galaxies can form galaxies with counterrotating components (Thakar & Ryden 1996, Puerari & Pfenniger 2001, Algorry et al. 2014) the statistical occurrence and completeness of these origins are not clear. Moreover, there is no general prediction of the occurrence and properties of these galaxies within the cosmological framework. This poster is a first step towards a study of these issues using the Illustris cosmological simulation (Vogelsberger et al. 2014; Genel et al. 2014). We focus on the evolutionary history of 1 disky sub-L* galaxy that shows extremely clear gas disk - stellar disk counterrotation. This specific galaxies is selected as an analogue to an observational sample of counterroting dwarf galaxies carried on with Keck. Abstract Galaxies with counter-rotating gas or stars are particularly interesting. Their distinct kinematical components can provide additional dynamical constraints and possible clues to evolutionary history and past environment. These intriguing systems have since long been observed, but have rarely been studied collectively. We present a study of their occurrence, properties, and evolutionary history using the Illustris cosmological simulation. In this poster we focus in detail on the surprising evolutionary history of 1 disky sub-L* galaxy that shows clear gas disk - stellar disk counterrotation. The counter-rotation in this system is due to the system being a splashback satellite that re-accretes material. We thus show that the origin of significant counter-rotation in low mass galaxies can be diverse and unexpected. Figure 1.1: Face-on (top four panels) and edge-on (bottom four panels) of the stellar disk (left) and the gaseous disk (right) defined by the total angular momentum of the stars within 2 stellar half mass radii, where the top and third row show the projected surface density and the second and bottom row show the line-of- sight velocity. The bottom row shows clearly the opposite direction of rotation for the stellar disk and the (inclined) gaseous disk. Section 1: a counterrotating galaxy The galaxy used as an example for this poster shows clear counterrotation. The angle between the total angular momentum of the stars and the gas disks is 131 degrees, and the stellar and gaseous projected surface densities and velocities (face-on and edge-on with respect to the stellar disk) in Figure 1.1 show that the complete gas disk actually is inclined with respect to the stellar disk (by 131 degrees). Even though the stellar disk is very thick, the rotation in the stellar disk is significant. Figure 1.2 shows simple mock observational rotation curves (red: stars; blue: gas), measured assuming a slit that includes all gas and stars along the line-of- sight, with the galaxy perfectly edge-on, within a vertical distance of 1 kpc above and below the plane of the stellar disk. The points and error bars indicate the mean and standard deviation of all material along the line-of-sight. The gas and stellar velocities in this plane are similar in magnitude but exactly opposite in sign. Figure 2.1: Evolution of the angle of the total angular momentum vector of the stars and the gas within the galaxy and the gas in the halo with respect to the total angular momentum vector of the stars at the present day. The direc
poster
TERMOGRAFIA INFRAVERMELHA MÉDICA NA DIÁFISE DISTAL DA TÍBIA EM PACIENTE COM DIAGNÓSTICO DE PSEUDOARTROSE - ESTUDO DE CASO Wally auf der Strasse1, Daniel Padro Campos1, Celso Junio Aguiar Mendonça1, Jamil Faissal Soni2, Percy Nohama1,2 1 Universidade Tecnológica Federal do Paraná, Programa de Pós-Graduação em Engenharia Elétrica e Informática Industrial 2 Pontifícia Universidade Católica do Paraná, Programa de Pós-Graduação em Tecnologia em Saúde 1. INTRODUÇÃO 2. OBJETIVO Investigar alterações no padrão térmico na fratura da tíbia com diagnóstico de pseudoartrose com o uso do fixador externo Ilisarov 4. CONCLUSÃO Pseudoartrose não consolidação de uma fratura processo de reparação óssea deixou de atuar Não uniões ósseas complicações de saúde expressiva diminuição da qualidade de vida aumento nos custos dos serviços de saúde Termografia alternativa de diagnóstico imediato na evolução clínica do paciente com pseudoartrose 3. MÉTODO Setup experimental Temperatura média da região de interesse na diáfise distal da tíbia entre os anéis do fixador Ilisarov. Gráfico de dispersão da temperatura média na diáfise distal da tíbia entre os anéis do fixador Ilisarov. Os resultados preliminares indicam Termografia como método promissor de diagnóstico em traumatologia e ortopedia Necessidade de aplicação do método em um grupo amostral maior de pessoas com diagnóstico de pseudoartrose de tíbia e uso de fixador externo Ilisarov
poster
A Cross-Institutional, FAIR VIVO for Metabolomics Michael Conlon, Kevin S. Hanson, Taeber Rapczak, Naomi Braun, Christopher P. Barnes, University of Florida, Gainesville, Florida, USA Metabolomics Data The Metabolomics Workbench (MWB) (https://metabolomicsworkbench.org) is the National Metabolomics Data Repository of the US National Institutes of Health (NIH). Anyone can deposit data to the MWB. As of August 28, 2019, the workbench provides data from 982 publicly available studies. Another 205 studies are currently embargoed and will be available subject to their embargo dates. MWB develops and uses RefMet (http://bit.ly/2PkxY5p), a nomenclature for representing metabolites found using mass spectroscopy (MS) and nuclear magnetic resonance (NMR) techniques. Investigators upload study data to the workbench and provide metadata regarding themselves and their work. The MWB provides an API that can be used to access metadata about studies and investigators. MWB metadata has been mapped to an ontology developed by the authors to represent it as RDF and load it to VIVO. PubMed (http://pubmed.gov) is an open access index to literature in metabolomics. Its API can be used to find and retrieve publication data regarding metabolomics investigators. Many groups use PubMed data in VIVO. PubMed data has been mapped to the VIVO Ontology (http://vivoweb.org/ontology/core) Data regarding software used in metabolomics studies has been difficult to find. An index to such software will be created and curated by a group at the University of Colorado Anschutz Medical Campus funded by the NIH. This data will be in the form of a spreadsheet. The authors will use the Software Ontology (SWO) (http://www.obofoundry.org/ontology/swo.html) to represent the data as RDF and load the data into VIVO. Metabolomics Metabolomics is the scientific study of metabolites present within an organism, cell, or tissue. Human metabolites are small molecules found in human tissue that occur naturally as a result of human metabolism, or are present as a result of drugs, food components, or exposure to environmental conditions. Along with genomics (the study of DNA), transcriptomics (RNA), proteomics (proteins), metabolomics provides information regarding biochemical compounds and processes in cells, leading to a better understanding of cellular biology. “Metabolic profiling can give an instantaneous snapshot of the physiology of a cell, and thus, metabolomics provides a direct "functional readout of the physiological state" of an organism.” (Wikipedia http://bit.ly/2Pg06X3) Such profiles can be used to distinguish tissue types, disease states, and health status of individuals. Understanding the changes in profiles over time can lead to improved understanding of diseases such as cancer and diabetes, leading to potential treatments. Over 450,000 human metabolites have been identified to date. Metabolomics is considered an emerging field. Technical challenges in compound identification and data analysis are significant. The NIH Common Fund Metabolomics consortium originated in 2013 to help address these and other challenges. Fourteen investigators across the US are supported to advance metabolomics. Five are engaged in compound identification, seven in software tools and data analysis. The group at UCSD supports the Metabolomics Workbench, a data repository. The group at the University of Florida provides overall coordination for the consortium. FAIR Data Principles The FAIR Data Principles (Wilkinson, et. al https://www.nature.com/articles/sdata201618) provide a framework for creating data that can be used by groups beyond the group that created the data. The principles are difficult to achieve in practice and much has been written about implementation. VIVO supports the principles naturally, it is designed to share data. • Findable – data should be found using search engines on the Internet • Accessible – the data can be accessed without technical, legal or operational barr
poster
Fossil Record – the palaeontological journal of the Museum für Naturkunde Berlin Constanze Bickelmann1, Stefanie Paß1, Florian Witzmann1, Xenia van Edig2, Jana Hoffmann1, and Johannes Müller1 1Museum für Naturkunde – Leibniz-Institut für Evolutions- und Biodiversitätsforschung Invalidenstrasse 43, 10115 Berlin 2Copernicus Publications (Copernicus GmbH), Bahnhofsallee 1e, 37081 Göttingen The Journal Fossil Record is one of three journals issued by the Museum für Naturkunde Berlin (Fig. 1). It handles palaeontological science, spanning such fields as taxonomy and systematics, biostratigraphy and biogeochemistry, palaeoecology, evolution and earth history. All taxonomic groups are covered, including vertebrates, invertebrates, plants, and microfossils. Fossil Record was founded in 1998 under the name „Mitteilungen aus dem Museum für Naturkunde in Berlin, Geowissenschaftliche Reihe“ by Prof. Hans-Peter Schultze. In 2009, the journal became ISI-listed. Since 2014, simultaneously with publication by Copernicus Publications, it has been open access, and increased its impact factor up to 1,250 in 2016. As an online open-access journal, Fossil Record closes the gap between the requirements of scientists, funders, and libraries for open access to scientific publications. Besides enjoying better visibility, scientific papers are thus much more widely distributed and available for scientific databases. We welcome international contributions dealing with fossil specimens and collections, as well as research on pa- laeobiological processes and patterns using common and innovative analytical methods. Fossil Record enjoys an internationally good reputation, resulting in submission of excellent manuscripts from all over the world (Fig. 2). We offer a peer-review process with at least two independent reviews. Since 2006, Fossil Record has appea- red with two issues each year. In addition, special issues are printed on chief editors’ demand. Advantageously, comprehensive manuscripts such as (doctoral) monographs are also printed (Fig. 3). We provide opportunity for high quality illustrations (Fig. 4). Article processing charges (APCs) covering costs for the review process, ty- pe-setting, web publication and long term archiving upon publication are currently not requested from authors, instead covered by the Museum für Naturkunde. However, different models for author contributions are current- ly evaluated and may be introduced at a later stage. Manuscripts can be uploaded on the Fossil Record website (https://www.fossil-record.net/). The Editor The Museum für Naturkunde is an integrated research museum and since 2009, the museum has been a member of the Leibniz Association, which is a non-profit organization combining and promoting world-renowned research institutions. The Museum für Naturkunde conducts excellent research in biology and earth sciences. Specifically, we study the geo- logical and biological evolution and diversity of life, and transfer this knowledge to the international scientific community as well as the public. To date, our collections, comprising over 30 million zoological, palaeontological, geological and mi- neralogical specimens, are of unique cultural, historical, and scientific value inextricably linked to our research (Fig. 5). In order to provide as much free access to knowledge as possible we aim to develop an open-access strategy, offering open-access advisory services to our researchers. This process is part of the science programme “Digital World and Infor- mation Science”, which combines information and communication technology, biodiversity informatics, and library and information sciences at the museum. The Publisher Copernicus Publications is a German open-access publisher based in Göttingen. It has been a partner of scientists and socie- ties since 1988 and launched its first open-access journal in 2001. Since 2004, all journals have been open access. With a clear focus on in-house services, Copernicus Publications promot
poster
I-RIM Conference 2019 October 18 - 20, Rome, Italy ISBN: 9788894580501 Design of a parallel device for neurorehabilitation Jawad Yamine∗, Alessio Prini†, Tito Dinon†, Hermes Giberti‡ and Matteo Malosio† ∗Dipartimento di Meccanica, Politecnico di Milano, via La Masa 1, 20156 Milano, Italia Email: jawad.yamine@mail.polimi.it †Istituto di Sistemi e Tecnologie Industriali per il Manifatturiero Avanzato, Consiglio Nazionale delle Ricerche via Alfonso Corti, 12, 20133 Milano, Italia Email: alessio.prini@stiima.cnr.it, tito.dinon@stiima.cnr.it, matteo.malosio@cnr.it ‡Dipartimento di Ingegneria Industriale e dell’Informazione, Universit`a di Pavia, Via A. Ferrata 5, 27100 Pavia, Italia Email: hermes.giberti@unipv.it Abstract—This paper presents the mechanical architecture and the design of a 2DOF parallel device for upper-limb neurorehabil- itation. Geometric parameters have been obtained by optimizing kinematic performances. The prototype has been designed so that it can be bound on one side of a table with a clamp. The structure embeds two single-point load cells to measure the force exchanged with the patient, and to allow the execution of assist-as-needed therapies. Index Terms—Parallel kinematic architecture; kinematic op- timization; rehabilitation robotics; assist-as-needed control algo- rithms. I. INTRODUCTION Stroke is one of the main causes of long-term disability in the world and the most common in Western countries [1]. The number of patients having difficulties in performing activities of daily livings due to physical disabilities is constantly increasing while the number of therapists and caregivers is increasingly inadequate, creating an unmet market need. Robotic devices for neurorehabilitation have been widely investigated, developed and introduced to the market to offer an alternative to conventional therapy and meet a portion of the created need [2], [3]. Since the invention of the MIT-Manus [4], robot-assistance, force-feedback and force-based control are stat-of-the-art features of neurorehabilitation devices [5], enabling them to sense and react to patient interactions with the robot and adapt the level of physical assistance provided to the patient. Most of the proposed robots are technically advanced, but relatively expensive and designed for clinical settings, which makes it hard for patients to afford such treatment. On the other side, and focusing on upper-limb rehabilitation, a number of low-cost rehabilitation devices are currently available, but they are typically passive or passively gravity-balanced [6]. The lack of actuation and of an assist- as-needed support precludes them to be effectively used by patients with low-medium motion capabilities. Therefore, there is still a significant need to develop home- based devices that provide similar or better functionality for a reduced cost. From there, rises the idea of our project that consists of designing and implementing a planar and relatively This work was partially funded by Fondazione Cariplo within the EMPA- TIA@Lecco project, Rif. 2016-1428 Decreto Regione Lombardia 6363 del 30/05/2017. affordable home-based upper-limb rehabilitation device that offers assist-as-needed functionalities to give the patient the best rehabilitation experience. Focusing on planar robotic devices for neurorehabilitation, two of them stand out in literature: the MIT-Manus [4] and the Braccio di Ferro [7]. A negative aspect of their structure is that both of them are characterized by a distribution of the inertia ellipses which are not symmetric, with respect to the sagittal plane of the patient. Zollo et al. faced this issues by developing a planar orthogonal device, characterized by an isotropic behavior throughout the whole workspace [8]. Nevertheless, in the opinion of the authors, such architecture is relatively cumbersome and complex to allow an effective commercial exploitation, especially in the domestic environment. For these reasons, a new device, namely PLANarm2, b
poster
DDI 4 Class Library (301 classes) as XMI R6Class source code R functions source code DDI2 to DDI4 mapping table DDI 4 Prototype is implemented as a model. This translates well into objected‐oriented software like Integrating Lifecycle Metadata into the R workflow – Implementing DDI4 in R Capturing, reporting on, and computing on metadata at the source Initial Work – Developing the Infrastructure User Interface not available yet, will be next step IASSIST Conference 2019, Sydney, Australia, May 27‐31, 2019. Joachim Wackerow, GESIS ‐ Leibniz Institute for the Social Sciences; Larry Hoyle IPSR, University of Kansas This work is licensed under the Creative Commons Attribution 4.0 International (CC BY 4.0). ‐ Email: joachim.wackerow@gesis.org; larryhoyle@ku.edu XSD OWL/RDF‐S XML RDF Discovery and interoperability Transformation to DDI Alliance default syntax representations Purpose Exchange and preservation DDI4_Code. A type of Designation that relates a representation expressed as a string with or without meaningful white space to a specific classification Description Implementation of the DDI4 class Code Definition ============ A type of Designation that relates a representation expressed as a string with or without meaningful white space to a specific classification. For use in a Code List. The representation property (Value) is expressed as it would be found in a data file. Multiple representations may relate to the same Category but should be expressed as separate Codes. Help in R ‐ ?DDI4_Code Transparency and replication are crucial for open science • Capture metadata at the earliest point possible • Building this into the scientific workflow • means making tools available in the platforms people use • Attach the metadata to the data to travel together • Especially important for tables and variables • Example: unit of measurement, scale, precision • When a variable is created, this has to be known. Attach it to the variable. • Operating on Metadata • Harmonization procedures Metadata in the Statistical Package Workflow Transformation by program DDI4Contents.equal(CodeListA, CodeListB) DDI4R code fragment for comparing two Codelists on equality of content Documentation In the UML Model Classes in the UML Model of DDI4 • Built‐in validation of imported metadata • Capturing correct metadata on the fly • Fetching remote DDI resources • Functions for comparison and harmonization of metadata Features in DDI4R Classes in R str(DDI4_Code) Class 'R6ClassGenerator' <DDI4_Code> object generator Inherits from: <DDI4_Designation> categoryDescription <- DDI4_InternationalStructuredString$new(languageSpecificStructuredString=  list(DDI4_LanguageSpecificStructuredStringType$new(content="Male"))) myCategory <- DDI4_Category$new(descriptiveText=list(categoryDescription )) myCode <- DDI4_Code$new(denotes=myCategory$DdiUrn,  representation=list(DDI4_ValueString$new(content="M"))) Category="Male" Code="M" DDI4R code fragment for: R package DDI4R A class is a template for an object.
poster
Niki Messini1,2, Joel Roca-Martínez3, Nitin Kachariya1,2, Paola Redeghieri4, Anahí Higuera5,6, Francisco Morales4, Mireille Dumoulin4, Wolfgang Kaiser6, Wim Vranken3, Michael Sattler1,2 1 Bayerisches NMR Zentrum, Technical University of Munich, Garching, Germany 2 Institute of Structural Biology, Helmholtz Zentrum Munich, Neuherberg, Germany 4 Center of Protein Engineering, University of Liege, Belgium 3 Vrije University of Brussels, Belgium 5 Physics Department, Technical University of Munich, 85748 Garching, Germany 6 Dynamic Biosensors GmbH, Lochhamer Str. 15, 82152 Martinsried, Germany [1] J. Hennig, Nature 2014. [4] Y. Shamoo, Nucleic Acids Research 1995. Understanding and designing RNA binding specificity of the RRM domain The RNA recognition motif (RRM) is the largest family of RNA binding domains, and fulfills crucial roles in gene regulation. The canonical RRM fold has a β-α-β-β-α-β-β secondary structure, harboring two conserved ribonucleoprotein (RNP) sequence motifs, RNP1 and RNP2, in β3 and β1, respectively. Canonical RNA binding usually involves the RRM β-sheet, but many variations of RRM-RNA interactions are seen. Although numerous three-dimensional structures of RRM domains in complex with RNA are known, the RNA recognition code of RRM domains remains poorly understood. We combine computational approaches with experimental methods to identify key residues and their role for defining RNA binding specificity. The Sex-lethal protein (Sxl) from Drosophila Melanogaster is used as a model system, to redesign the RNA binding specificity of one of its two RRM domains. Binding kinetics and thermodynamic features are analyzed by NMR, ITC and switchSENSE® experiments, which show distinct on- and off-rate binding kinetics for the Sxl RRM domains, and significant binding preference for RNA over DNA. Computationally, a carefully curated multiple structure-based sequence alignment was analyzed to reveal residue-nucleotide preferences on a set of RRM-RNA complexes. This information is translated into a score to predict RNA binding preferences for millions of theoretical mutants. To enhance the scoring and improve its accuracy, phage display selection from a large combinatorial library of RRMs is used as an experimental validation of the approach, with the results validated by Bio-Layer Interferometry, NMR and further biophysical techniques. 1:00 1:0.25 1:0.5 1:0.75 1:1.0 1:2.0 Molar ratio Sxl RRMs show binding preference for RNA over DNA Distinct RNA binding preference and kinetics for RRM1 and RRM2 9 9 9 9 9 9 9 9 1 2 3 4 5 6 7 8 9aa mutations for 8 positions 89 mutants Designing novel RRMs by random mutagenesis and computational predictors Computational predictors • Expression of the synthetic DNA library with large number of RRM1 mutants at the surface of phages and selection of those specific of the target RNA by panning N Q D E R H K S T X01 (N) 7% 2% 27% 59% 2% 0% 0% 0% 2% X02 (N) 24% 17% 0% 5% 17% 2% 29% 5% 0% X03 (T) 2% 2% 2% 0% 7% 20% 51% 12% 2% X04 (R) 17% 2% 0% 2% 10% 27% 34% 0% 7% X05 (D) 54% 2% 12% 7% 17% 0% 5% 2% 0% X06 (K) 0% 15% 0% 0% 12% 20% 51% 0% 2% X07 (S) 7% 10% 22% 0% 15% 7% 17% 22% 0% X08 (R) 5% 37% 0% 10% 15% 7% 24% 2% 0% WT1: GUU GUU (4x) WT2: UUU UUU (4x) CCC CCC (4x) AAA AAA (4x) UUAGGA(4x) strong binder strong binder no/weak binder strong binder strong binder RRM1 +GUUGUU (4x) WT1: GUU GUU (4x) WT2: UUU UUU (4x) CCC CCC (4x) AAA AAA (4x) UUAGGA(4x) strong binder moderate binder no binder weak binder no/weak binder Computational predictors RRM2 RNA Anchor RRM1 Novel RRM • Design and modulate RRM-RNA binding preference • Sxl RRM1-RRM2 as a model system • RNA specificity of individual domains • Identify key positions in the RRM fold that mediate RNA binding specificity using 1) computational analysis and 2) random mutagenesis of key positions in RRM1, using RRM2 as “anchor” • Phage display selection of specific binders for RNA targets Novel RRMs • SXL RRM1,2 binds with higher affinity to RNA compared to
poster
Convertio Measure 3.2: Agrosystem Templates for Easy Data Management Plan Creation Data Management Plans Budget planning Benefits Project management Challenges ●Requires know how on Research Data Management topics ●Costs resources DFG Horizon Europe Other funders Customized agrosystem templates ●Answer options ●Help texts ●Links to other FAIRagro services ●Available via RDMO (DMP tool) ●What are your requirements towards DMPs? ●How can we improve the templates? We need your feedback! Follow the QR code and let us know what you need Antonia Leidel1, Gabriel Schneider2 1 - Leibniz Institute of Plant Genetics and Crop Plant Research (IPK), 2 - Information Centre for Life Sciences (ZB MED) ...
poster
Courses, Events and Workshops Plazi analysts have been giving a number of training courses over the recent years. The training courses are tailored to the audience and their general objectives for data to be liberated and made available. Synospecies A linked open data based service to leverage taxonomic names, its synonyms and its justification through access to the respective taxonomic treatment. eBioDiv Matching Service The crowdsourcing tool allows users to match material citations contained in the academic literature to the respective specimens in natural history collections (in GBIF). Helpdesk Users can interact with the helpdesk service by creating issues on Plazi’s Community Github repo and find answers to FAQs. TreatmentBank Plazi’s service to liberate taxonomic information and provide access to all the liberated data and links. How to contribute to liberate taxonomic data from scientific publications, make them FAIR, and widely available Taxonomic publications contribute to a continually updated corpus of over 500 million pages of research results and the best expert curated datasets, including the entire history of taxonomic names. To harness its power, the data needs to be liberated, that is, converted into digitally accessible knowledge. Donat Agosti President agosti@plazi.org Bern, Switzerland ORCID: 0000-0001-9286-1200 CC0-DA/Bern, July 18, 2024 312848 308454 Training course at the University of Pretoria, South Africa, 2023 Jonas Castro Data Quality Analyst castro@plazi.org Porto Alegre, Brazil ORCID: 0000-0002-7403-409X Plazi Workflow images refs </> metadata tables Taxonomic treatments Biodiversity PMC Provides information retrieval across life science literature (MEDLINE, PMC), biodiversity publications and treatments. LIBERATING DATA IMPRISONED IN TAXONOMIC PUBLICATIONS Minimally, this includes machine actionable, semantically enhanced taxonomic treatments, taxonomic names, treatment citations, figures, tables, material citations and bibliographic references as Findable, Accessible, Interoperable, and Reusable (FAIR) data. Plazi provides a workflow to annotate and extract case by case or fully automated data from target or corpora of publications respectively. VISUALIZATION OF DATA IN PUBLICATIONS Plazi Verein and Plazi GmbH form the Swiss based nonprofit organization Plazi, supporting and promoting the development of persistent and openly accessible digital taxonomic literature. Our production facility at Porto Alegre, Brazil, runs all aspects of processing publications, development of learning tools and dashboards creation. MAKING TAXONOMIC DATA FINDABLE AND ACCESSIBLE AT SCALE: TREATMENTBANK ACCESS TO LIBERATED DATA AND LINKS SERVICES REUSING LIBERATED DATA Global Biodiversity Information Facility (GBIF) GBIF is including in its aggregation process taxonomic articles as datasets, taxonomic treatments, taxonomic names and materials citations. Ocellus A frontend to search liberated figures in BLR World Flora Online WFO is linking taxonomic names to treatments, using TreatmentBank and soon on an automated service to add to new incoming treatments. 15 years of discovering known biodiversity PLAZI Biodiversity Literature Repository (BLR) In collaboration with Zenodo, BLR allows FAIRization of treatments and figures by minting DataCite DOIs, and long term storage and preservation of the data. Annotated and FAIRized data can be used to evaluate a botanist's contribution to science, the scope or reach of a scientific journal, the biodiversity present in a given area, among various other practical applications. HOW TO PARTICIPATE IN DATA LIBERATION Visualization of Jocélia Grazia’s contribution to taxonomy Introduction to data annotation and FAIRization An introduction and learning material is provided leading to a certification enabling contributing to growing FAIR data using the Plazi workflow. Statistics for 2024-07-18 Poster #229 DOI:10.5281/zenodo.12764847 European Nucleotide Archive Notebooks related with bio
poster
Brea Tessaria absinthioides Los humedales son uno de los ambientes con mayor diversidad biológica y productividad en el mundo. A través de esta guía te invitamos a descubrir y apreciar algunas de las fascinantes especies de flora y fauna que habitan en los cercanos y valiosos humedales y cuencas de la bahía de Coquimbo. De norte a sur, se localizan la Laguna Saladita de Punta Teatinos, el humedal desembocadura río Elqui, el humedal Quebrada de Peñuelas y el humedal Estero El Culebrón. Además, encontrarás información sobre las contribuciones de los humedales al bienestar humano, sus principales amenazas, hitos en la protección de estos ecosistemas en Chile, junto con información sobre el turismo sustentable y acciones para proteger los humedales. Aquí se presenta información resumida de 112 especies que puedes encontrar en estos humedales y sus cuencas, con 6 grandes grupos de flora y fauna: 11 especies de flora, 20 de artrópodos, 11 de mamíferos, 9 de reptiles, 2 de anfibios y 59 de aves*. Esta guía fue co-producida entre múltiples organizaciones, instituciones y personas voluntarias que aportaron con información, fotografías e ideas. Esperamos que este material contribuya a mejorar tu experiencia durante la visita a los humedales de la bahía de Coquimbo y a profundizar tu vínculo con estos ecosistemas. FLO RA AVES AR TRÓ PODOS ANFIBIOS/ REPTILES MA MÍ FEROS Orden: Araneae Familia: Araneidae Orden: Diptera Familia: Ulidiidae Orden: Asterales Familia: Asteraceae Orden: Charadriiformes Familia: Charadriidae Orden: Charadriiformes Familia: Laridae Orden: Charadriiformes Familia: Laridae Orden: Charadriiformes Familia: Haematopodidae Orden: Charadriiformes Familia: Scolopacidae Orden: Charadriiformes Familia: Laridae Orden: Charadriiformes Familia: Laridae Orden: Charadriiformes Familia: Charadriidae Orden: Charadriiformes Familia: Charadriidae Orden: Charadriiformes Familia: Scolopacidae Orden: Charadriiformes Familia: Scolopacidae Orden: Charadriiformes Familia: Laridae Orden: Falconiformes Familia: Falconidae Orden: Gruiformes Familia: Rallidae Orden: Gruiformes Familia: Rallidae Orden: Gruiformes Familia: Rallidae Orden: Gruiformes Familia: Rallidae Orden: Charadriiformes Familia: Scolopacidae Orden: Charadriiformes Familia: Scolopacidae Orden: Passeriformes Familia: Furnariidae Orden: Passeriformes Familia: Icteridae Orden: Passeriformes Familia: Thraupidae Orden: Passeriformes Familia: Tyrannidae Orden: Passeriformes Familia: Hirundinidae Orden: Pelecaniformes Familia: Ardeidae Orden: Pelecaniformes Familia: Ardeidae Orden: Pelecaniformes Familia: Pelecanidae Orden: Podicipediformes Familia: Podicipedidae Orden: Strigiformes Familia: Strigidae Orden: Pelecaniformes Familia: Ardeidae Orden: Pelecaniformes Familia: Ardeidae Orden: Pelecaniformes Familia: Ardeidae Orden: Pelecaniformes Familia: Ardeidae Orden: Anseriformes Familia: Anatidae Orden: Anseriformes Familia: Anatidae Orden: Cathartiformes Familia: Cathartidae Orden: Cathartiformes Familia: Cathartidae Orden: Apodiformes Familia: Trochilidae Orden: Anseriformes Familia: Anatidae Orden Orden: Myrtales Familia: Onagraceae Duraznillo de agua Ludwigia peploides Flor del pato Azolla filiculoides Araña bandeada Argiope trifasciata Hormigón dorado Camponotus chilensis Orden: Didelphimorphia Familia: Didelphidae Yaca común Thylamys elegans Avispa cazadora de arañas Entypus unifasciatus Orden: Orthoptera Familia: Acrididae Saltamontes Dichroplus elongatus Orden: Araneae Familia: Araneidae Araña verde Molinaranea magellanica Camarón de río del norte Cryphiops caementarius Orden: Diptera Familia: Culicidae Mosquito charquero o Zancudo Aedes albifasciatus Mosca de alas pintadas Pterotaenia fasciata Orden: Caryophyllales Familia: Amaranthaceae Sosa Salicornia neei Batro o Trome Schoenoplectus californicus Junquillo o Junco espinoso Juncus acutus Totora Typha angustifolia Roseta de los pantanos Goodenia radicans Hierba de la plata Hydrocotyle ranunculoides Chorlo de collar Anarhync
poster
An Imaging Search for Circumstellar Companions of Sirius B Miles Lucas1, Michael Bottom1, Garreth Ruane2, Sam Ragland3 Why study Sirius B? • Little is known about planetary systems around evolved hosts; we are interested in looking for second-generation companions that form or migrate after the violent RGB and AGB phases • Sirius B is close, which lets us probe sub-AU regions without coronagraphy. It is relatively dim from white dwarf cooling, decreasing the contrast required to image a giant planet. Lastly, it is young (225 Myr), which means giant planets will still be bright from their latent formation heat. • Sirius B is well-characterized: especially its mass, age, and astrometry- reducing uncertainties of companion properties Observations • We took direct images over three epochs in 2020 using Keck/NIRC2 in L’-band (3.776 µm) and narrow FOV (10”x10”) • Sirius A is so bright that diffraction was present in the Sirius B FOV, stalling the AO loop and ruining the coronagraphic pointing algorithm (QACITS) • We were able to close the AO loop by targeting Sirius A using a narrow (~10 nm) laser-line filter in front of the WFS to avoid saturation. We then guided off-axis to Sirius B • We set the field rotator to track the pupil, enabling angular differential imaging (ADI) 0 200 400 x 0 100 200 300 400 500 y 1500 1000 500 0 500 1000 1500 1500 1000 500 0 500 1000 1500 spider diffraction spike from Sirius A 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 2 projected separation [AU] 2 4 6 8 10 12 14 companion mass [MJ] mean uncertainty from age dynamical stability limit 0.1 0.2 0.3 0.4 0.5 0.6 0.7 separation [arcsec] 2020-02-04 2020-11-21 2020-11-28 model mass limit 0.1 0.2 0.3 0.4 0.5 0.6 0.7 separation [arcsec] Sensitivity Analysis ADI Analysis -2.0 -1.0 0.0 1.0 2.0 -2.0 -1.0 0.0 1.0 2.0 y [AU] median Epoch 2020-02-04 -2.0 -1.0 0.0 1.0 2.0 x [AU] median Epoch 2020-11-21 -2.0 -1.0 0.0 1.0 2.0 annular PCA(2) Epoch 2020-11-28 Results & Discussion • Consistent with previous results, we do not detect any companions around Sirius B • We improve on the sensitivity limits of Sirius B by reaching an average sensitivity of ~2 MJ in the speckle-limited regime (< 1 AU) down to 0.4 MJ in the background-limited regime (> 1 AU). • These sensitivities are the deepest and closest, yet, and only have ~0.1 MJ uncertainty due to Sirius B’s precise age • Future space-based observations can improve the mass sensitivities (if the challenges presented by Sirius A can be overcome), but would be limited by current planetary grid models Acknowledgements The data presented herein were obtained at the W. M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California and the National Aeronautics and Space Administration. The Observatory was made possible by the generous financial support of the W. M. Keck Foundation. The authors wish to recognize and acknowledge the very significant cultural role and reverence that the summit of Maunakea has always had within the indigenous Hawaiian community. We are most fortunate to have the opportunity to conduct observations from this mountain. 1. Repeatedly inject fake companions at different seperations with a fixed S/N (100) 2. Reduce the injected cube for each ADI algorithm and measure the S/N of the companion in the residual frame 3. Compute the 5σ detection limit in terms of contrast. Dashed curves correct for small-sample statistics 4. Convert the contrast curves to planetary masses using grid models (AMES/COND) 1. Pre-process data with typical ADI workflow: calibration, co-registration, cropping, and parallactic angle calculation 2. Using the following ADI algorithms (median, PCA, NMF, GreeDS), model the stellar PSF and subtract it from the data 3. Derotate and collapse the residual cube using a weighted sum 4. Calculate detection probability using S/N and STIM map; calculate sensitivity using contrast curves 5. Residuals from the best algorithm for each ep
poster
Counting analysis of Borexino Phase-III data for the detection of CNO solar neutrinos Riccardo Biondi on behalf of Borexino Collaboration 1Laboratori Nazionali del Gran Sasso Abstract An accurate measurement of the Solar Neutrino Flux from CNO cycle can shed light on the so called “solar abundance problem“: new determinations of the photospheric abundances of heavy elements indicates that the Sun metallicity is lower than previously assumed, however Solar Models incorporating lower abundances are no more able to reproduce the helioseismic results. We propose a method for detecting the CNO interaction in the Borexino detector from a counting analysis in a Region of Interest determined maximizing a Figure of Merit and using both analytical and Monte Carlo modeling of the detector response. In such a way we can keep under control all systematics and avoid unwanted sources of uncertainties. The procedure itself is inspired by a CNO sensitivity[1] study pointing out that the sensitivity to CNO is basically given by the knowledge of the background from Bi210 and pep neutrinos, being the other backgrounds negligible or constrainable. Mini-abstract: CNO interaction rate in the Borexino detector from counting analysis Poster Id: 93 Contact: riccardo.biondi@lngs.infn.it Motivation and Strategy We want to use counting analysis to determine CNO neutrinos interac- tion rate in Borex- ino detector[2]. Muon PMTs Stainless Steel Sphere Internal PMTs Water Tank Nylon Vessels Scintillator Non-scintillating Buffer Motivation: Complementary to a full spectral study[3] without the uncertainty of background and de- tector response modeling. Systematics can be reliably evaluated. This method could give high sensitivity[1]. Strategy: Choose an energy Region of Interest (ROI) where the expected discovery significance of CNO neutrinos is maximized(Figure of Merit). Count the events in ROI Subtract all identified background events Profile parameters to estimate uncertainties Results obtained with analytical response of the de- tector and Number of Photo-Electrons (Npe) as en- ergy estimator will be shown in this poster. Figure of Merit Figure of Merit is defined as: F = NCNO σCNO (Sys.⊕Stat.) Major contributions of systematics comes from 210Bi and detector response parameters such as 11C quenching and Light Yeld 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 Tot σ / iσ Relative contribution of Systematics Bi 210 C Qch 11 LY C 11 (pep) ν Be) 7( ν Others Relative contribution of Systematics 200 250 300 350 400 450 500 550 600 min Npe 200 250 300 350 400 450 500 550 600 max Npe 0 1 2 3 4 5 Figure of Merit 200 300 400 500 600 700 800 900 1000 Npe 1 − 10 1 10 2 10 3 10 4 10 events / Npe Data (CNO) ν Bi 210 (pep) ν C 11 Be) 7 ( ν Others Selected Energy Range Optimum Range: [375 - 429] Npe Region of Interest Species (Si) Events Fraction N 823 ± 28.7 210Bi 261.5 ± 29.6 0.31 ν(pep) 171.7 ± 2.4 0.21 ν(7Be) 86.8 ± 2.6 0.10 11C 57.9 ± 5.8 0.07 Others 15.6 ± 1.6 0.02 P i Si 593.5 ± 30.4 0.71 In the selected ROI we have a total of 823 ± 28.7 events. The expected values and errors on number of events for each species is calculated according to bounds coming from independent studies[4][5][6] and using a reference response model of the Detector. If we subract the sum of the species Si from the to- tal N we are left with the sought after signal: NCNO = N −P i Si = 229.5 ± 41.8 events Systematics Systematics are obtained as the width of the distri- bution of CNO rate after varying parameters on 104 Toy-MC realizations where we determine the num- ber of CNO events subtracting all the other species from the total events in the ROI. Parameters are varied according to: 210Bi: independent determination[4]. ν(pep) Luminosity constraint [5]. ν(7Be) rate according to Solar Models[6]. Light Yeld: generated according to its correla- tion with ν(7Be) rate, adding a 0.7 % smearing. All the other species and detector response parame- ters are varied in a conservative way with respect to the reference
poster
William Kent:The Many Forms of a Single Fact* Data sharing and integration properties A simple fact Example of a simple fact: Certain salesmen serve certain territories. Some data design options Why the "many forms" of solutions matters Representations of data items Interpretations of Transformations between structural organizations Different data types Field lengths Units of measure Precision Etc. Meaning of some terms Measurement qualities Reconciliation of quantities Relational, hierarchical, & network models Various file formats Implementations of lists, vectors, arrays, object models, etc. A simple connection between two things A relationship or an attribute A semantic web assertion Does NOT always map onto a pair of fields Each salesman has one territory Each territory has one salesman Many salesmen in many territories: many-to-many Many-to-few Usually many-to-one Salesmen without territories Several connections Data interchange: accommodate variations in semantics Data documentation (dictionaries): facts in a database do not always correspond to data elements in simple and direct ways Data design competence Design tools and methods: number of options large; heuristics and expert system support needed Data sharing by new apps Redundancy management Data integration High-level queries: distributed data: heterogeneity can exist between databases containing the same information in the same type of data structure Entity-relationship theory: data design choices need to be based on data processing concerns Conceptual schema: a logical data model is not a data-independent model of the enterprise Kent, W. "The Many Forms of a Single Fact", IEEE Compcon, 1989, DOI: 10.1109/CMPCON.1989.301972 W.L. Anderson, 2013, CC-BY
poster
Lea Sophie Singson (FIZ Karlsruhe); Constantin Breß (FIZ Karlsruhe) Don‘t be scared of the big bad wolf: a call to improve licensing landscapes in agro science repositories The need: Science loves open data. But science also loves to be attributed. How do we fix this? We license our work! A call to action: We have two options: ●Use dedicated data licenses with attribution, e.g. Datenlizenz Deutschland. Caveat: Depends on access and is relative ●Trust the GWP. Binding use of the GWP is spreading in research institutions and includes attribution Repositories should take a leading role and inform users The FAIRagro DSSC can provide support (https://fairagro.net/helpdesk/) The practise: On the hunt for the perfect attribution mark, we found the CreativeCommons licenses. And they seem perfect! They are well known, easily understandable and they do exactly what I need. But do they? The Problem: The CreativeCommons are licenses specifically created to license copyright protected work. This is a discrepancy with the scientific data mostly published in agricultural science! To be protected under copyright, a work has to reach a threshold of originality -> the effect of using CC-licenses incorrectly What is a threshold of originality? -> a certain reflection of the authors personal touch -> the work must not only consist of content and structure defined by the specific domain Using CC-Licenses incorrectly: no security for creator to be cited; creates legal uncertainty regarding the validity of the CC-License
poster
The Metallicity-Inclination Relation: Higher Metallicity, Higher Mutual Inclination Xinyan Hua (huaxinyan1996@gmail.com), Sharon Xuesong Wang, Songhu Wang, Dongsheng An, Wei Zhu, Fei Dai, Dichang Chen, Jiwei Xie vAbstract vSample Selection Ø Kepler & K2 samples from Dai et al. 2018 Ø TESS samples from this work Innermost 2 planets R < 4 [Earth Radii] + Innermost planet a/Rs < 12 vMain Results Ø A postive trend with metallicity: Higher matallicity, higher mutual inclination Ø Not significant with mass vDiscussion Ø Unlikely to be caused by USPs Ø Metal-rich systems tend to be dynamically hotter REFERENCES: Dai, F., Masuda, K., & Winn, J. N. 2018, ApJL, 864, L38, doi: 10.3847/2041-8213/aadd4f Brewer, J. M., Wang, S., Fischer, D. A., & Foreman-Mackey, D. 2018, ApJL, 867, L3, doi: 10.3847/2041-8213/aae71 Ø Need more followups to constrain giants Winn, J. N., Sanchis-Ojeda, R., Rogers, L., et al. 2017, AJ, 154, 60, doi: 10.3847/1538-3881/aa7b7c Ultra-short-period planets [Fe/H] ∆𝑖 Winn+ 2017 Dai+ 2018 This Work Stellar metallicity is very often found to correlate strongly with occurrence of certain types of planets or planetary system properties. For instance, Jupiter analogs are more common around metal-rich stars, while compact multis tend to be metal- poor. In this study, we present a correlation between the stellar metallicities and the mutual inclinations of multi-planet systems, suggesting that metal rich stars host planetary systems that are dynamically hotter. After investigating ~100 targets with measured mutual inclinations from photometry analysis, we observed that planets orbiting metal-rich stars tend to exhibit more dispersed mutual inclinations. Moreover, there is no clear evidence linking the high mutual inclination of these inner small planets with the existence of outer gas giants, though more data are needed to draw any definitive conclusion. We also observed a similar trend in the stellar mass - mutual inclination space, which is not as significant as with stellar matellicity. We hypothesize that such systems accumulate more material within their proto-planetary disks, leading to a more intensive dynamical evolution process that can perturb the planets into misaligned orbits, resulting in higher mutual inclinations. Planet formation and population synthesis models tracking evolution of mutual inclinations would be needed to provide explanation for this correlation.
poster
The ALMA Program Management Group (PMG) is responsible for the day-to-day management of observation execution, tracking of the status of ALMA programs, data quality control, and coordination of these activities with staff at the three ALMA Regional Centers (ARCs). It consists of a Program Manager and eight Data Analyst, with the support of about thirty Astronomer on Duties (AoD) to carry out the ALMA observation executions, in service mode, at the ALMA Control rooms at the Operations Support Facility (OSF) and Santiago Central Offices (SCO). Here, we present the mission, core operational tasks, deliverables, and activities of the ALMA Program Management Group, as well as, a description of the entire ALMA Data Acquisition Process, and its last cycles performance based in the ALMA Key Performance Indicators (KPI). The ALMA Program Management Group and the ALMA Data Acquisition Process Juan R. Cortés1,2, Matías Radiszcz1, Celia Verdugo1, Cristián López1, Gabriel Marinello1, Jorge Morgado1, Priscilla Nowajewski1 & Kurt Plarre1. 1Joint ALMA Observatory, Santiago Central Offices, Alonso de Córdova 3107, Vitacura, Santiago, Chile 2National Radio Astronomy Observatory, Alonso de Córdova 2860, of. 702, Vitacura, Santiago, Chile Contact E-mail: juan.cortes@alma.cl Program Management Group Mission The ALMA Program Management Group (PMG) has the following Mission: To carry out Efficient and Effective, ALMA program management and quality assured data Acquisition. i.e. its responsibilities are –ALMA Program Management: • Tracking of ALMA programs. To know exactly what is the status of every ALMA Project, and SchedBlock (SB). • Ensure that Projects/SBs must be in the right status. SBs shouldn’t get stuck for any reason in data acquisition workflow. –Data acquisition: • Take the best possible data (effectiveness, QA0) • Making the best use of ALMA Observing time (Efficiency) • Ensure data acquisition –Antenna readiness for Science. –Data calibrations: Calibration Surveys, etc. PMG Operational Tasks Core Deliverables What PMG delivers: –Full Deliverables: »Calibratable Fully Observed MOUS/SBs »QA0 Pass EBs »Suitable calibrators candidates (BP, Phase, Flux, Check Sources, TP-off) »Key data for data processing: Calibration sources flux ingestion, Antenna Position. »Complete follow up of Data Acquisition workflow. »Reports on completion of Projects SB »Data Acquisition Metrics and KPI »Tools that allows accurate tracking of projects, SBs. »Management and Coordination of Data Acquisition activities. –Partial Deliverables: Calibratable Observing Timed Out MOUS/SBs. ALMA Data Acquisition Process ALMA Data taking and Reduction Processes can be divided in four stages: • Data Request: PI proposal approval and Phase 2 preparation (SBs) • Data Acquisition: Data taking itself. • Data Processing: Data reduction and analysis. • Data Delivery: Archive Ingestion and Delivery to PI Data Acquisition Metrics and KPIs Data Acquisition Workflow Fig. 4. Data Acquisition Workflow. Data acquisition starts with SB Generation by P2G. Antenna array are prepared and calibrated (Delay, and Focus). SB is observed using the Dynamical Scheduling Algorithm based on raking, observing conditions, etc. Execution is quality assured and once the SBs reach required rms is declared Fully Observed and goes to data processing. In parallel, calibration observations are done (Cal. Survey, TP-off, Cone-searches), and antennas are integrated to the array. Cycle 9 Performance Contact Information Fig. 5. Accumulated QA0 Pass time. Upper panel: 12m-Array. Data acquisition affected by Cyberattack. We reached 3362 hours. Lower panel: 7m-Array. We reached 3466 hours, almost all our allocated observations. TP-array (not shown) reached 2369 hours, a record in ALMA history for TP array. PMG Level 1 KPIs. • Operations Efficiency (target ≥ 90%): 88% • Remaining Time (≤ 290 hours): 281 hours. • QA0 failures + QA0 semi-pass time (≤ 200 hours). 233 hours. Fig 1. PMG Core Operational Tasks. These are th
poster
Development projects: complex endeavors, that not only re- quire the coordination of a multitude of stakeholders, but the continued support by key decision-makers. Research gap: present project management frameworks tend to disregard the role end-users can play in the project implemen- tation phases, relegating their impact on project success primari- ly to the adoption of project outputs. Research question: Cape Verde, an insular African nation located in the Atlantic Ocean, as a climatic pattern off prolonged dry seasons with very brief monsoons. Water scarcity is a major limiting factor of food production, and dramatically conditions food security. In 2010 the government launched a ten year plan, calling for the construction of irrigation reservoirs. One these reservoirs was the Figueira Gorda reservoir, which although completed in 2014 the irrigation network was never built. Project success can be a contentious issue (Ika & Pinto, 2022), however, regardless of the specific success criteria, the absence of an irrigation network renders the Figueira Gorda a failure. Despite the project's top-down abandonment, local small farm- ers, the end-users, creatively utilized the water made availa- ble by the reservoir within their water-constrained environment to cultivate irrigated crops. We applied an abductive research design (Sætre & Van De Ven, 2024), starting with an exploratory case study analysis (Yin, 1994), focusing on the Figueira Gorda due to its extreme nature (Flyvbjerg, 2006), characterized by a distinct top-down abandon- ment of the project, juxtaposed with evident end-user-driven pro- ject success. Utilizing an inductive qualitative approach, we triangulated findings from various data sources (Denzin & Lincoln, 2018), in- cluding farmer surveys, subject-matter expert interviews, pub- licly available news, and satellite imagery. We sincerely thank Luís Brites Pereira of Nova School of Business and Economics, Miguel Lino Ferreira of the Graduate School of Business at the University of Cape Town, and Arlindo Fortes of the Universidade de Cabo Verde for their support and guidance throughout this project. Their insights and inputs have been invaluable in shaping this research. Bricolage, defined as 'making do by applying resources at hand to new problems' (Busch & Barkema, 2021, p. 741), encap- sulates the actions of small-farmers at the Figueira Gorda reser- voir. Following the project's construction, and despite its failure, the small-farmers became bricoleurs, ingeniously utilizing the limiting resource just made available. Our study demonstrates that when failed or abandoned pro- jects offers access to the limiting resource, end-users can de- velop a bricolage repertoire to extract value from it, fostering a virtuous cycle that leads to project success. Busch, C., & Barkema, H. (2021). From necessity to opportunity: Scaling bricolage across resource- constrained environments. Strategic Management Journal, 42(4), 741-773. doi.org/10.1002/ smj.3237 Denzin, N., & Lincoln Y. (2018). The SAGE Handbook of Qualitative Research (6th ed.). SAGE Publica- tions, Inc Flyvbjerg, B. (2006). Five misunderstandings about case-study research. Qualitative Inquiry, 12(2), 219-245. doi.org/10.1177/1077800405284363 Ika, L. A., & Pinto, J. K. (2022). The “re-meaning” of project success: Updating and recalibrating for a modern project management. International Journal of Project Management, 40(7), 835-848. doi.org/10.1016/j.ijproman.2022.08.001 Sætre, A. S., & Van De Ven, A. (2024). Abductive Theorizing Is More Than Idea Generation: Disciplined Imagination and a Prepared Mind. Academy of Management Review, amr.2021.0317. https:// doi.org/10.5465/amr.2021.0317 Yin, R. K. (1994). Discovering the future of the case study. Method in evaluation research. American Journal of Evaluation, 15(3), 283-290. https://doi.org/10.1177/109821409401500309 Cape VerdeSantiago IslandFigueira Gorda reservoirPhD thesis tutor:María Concepción López-Fernández Univ
poster
AÑOS (OBRAS) MÁS FRECUENTES EN LA HISTORIOGRAFÍA LINGÜÍSTICA HISPÁNICA 1492 1771 1847 1726 1555 1870 1495 FUENTE: "BiTe_Corpus" Battaner, Elena & Herranz, Cristina & Segovia, Ana (2022). "BiTe_Corpus" (Version 01) [Data set]. doi.org/10.5281/zenodo.6828326) Elena Battaner Moro, Universidad Rey Juan Carlos (@BattanerElena) I Congreso Iberoamericano de Ciencia abierta 2022 Gramática castellana Antonio de Nebrija Gramática de la lengua castellana compuesta por la Real Academia Española (Primera GRAE) Gramática de la lengua castellana, destinada al uso de los americanos Andrés Bello Diccionario de la lengua castellana, en que se explica el verdadero sentido de las voces [...] (Diccionario de Autoridades) Vtil y breve institution para aprender los principios y fundamentos de la lengua hespañola. = [...] (Anónimo de Lovaina) Gramática de la lengua castellana por la Academia Española (12.ª ed. de la GRAE) Introductiones latinae Antonio de Nebrija, Recognitio
poster
Background The Visual Question Answering (VQA) task consists on having a model that, given an image and a natural language question about the image, can provide an accurate natural language answer [1]. In the medical domain, VQA systems from the general domain have been adapted. However, because the nature of medical images differs from general images, some techniques like object detection cannot be easily adapted. Furthermore, the type of questions that can be asked about medical images is different too. This work in progress addresses the question of how can VQA systems and corresponding datasets be built, that deal with questions about specific regions of an image. This includes possible questions about the contents of a single region, as well as about two different regions of an image. 1 Dataset Models As a baseline, the model shown in Figure 2 was implemented. In this model, the mask is applied to the image in order to isolate the region about which the question is asked. Alternative models with different ways of including the region mask are implemented as well. These include for example applying the mask to the attention maps, or fusing it directly in the multimodal fusion step. Preliminary Results Tests have been carried out in order to establish the best way to include the information about the region into the VQA. These preliminary tests show that applying the mask to the image brings the best performance, which suggests that contextual information is actually not needed in order to answer questions about the inside of a region. Figure 3 shows the corresponding precision-recall and ROC curves of the baseline model. Current and future work includes the creation of a similar dataset for general images, as well as asking questions about multiple non-overlapping regions. References [1] Agrawal, A., Lu, J., Antol, S., Mitchell, M., Zitnick, C.L., Batra, D., & Parikh, D. (2015). VQA: Visual Question Answering. In Proceedings of the IEEE International Conference on Computer Vision (pp. 2425-2433). [2] Prasanna Porwal, Samiksha Pachade, Ravi Kamble, Manesh Kokare, Girish Deshmukh, Vivek Sahasrabuddhe, Fabrice Meriaudeau. (2018). Indian Diabetic Retinopathy Image Dataset (IDRiD). IEEE Dataport. https://dx.doi.org/10.21227/H25W98. 3 AIMI Lab AIMI Lab, ARTORG Center, University of Bern sergio.tasconmorales@artorg.unibe.ch Sergio Tascon-Morales , Pablo Márquez-Neila, Raphael Sznitman Building a VQA dataset that contains questions about regions of an image is a challenging task because of the lack of annotated data and also because of the complex task of defining the questions that could be asked. Another important factor to consider is the data imbalance. As basis for building a region-based VQA dataset we use the Indian Diabetic Retinopathy Image Dataset (IDRiD) which contains a total of 81 fundus images with corresponding segmentations for 4 different biomarkers: microaneurysms, soft and hard exudates, and hemorrhages. Annotations for the optic disc are also available. For each image-biomarker pair, a total of 100 random regions were generated with questions about the presence of the biomarker in the region (Figure 1). Figure 3. Preliminary precision-recall and ROC curves for the region-based dataset. Figure 2. Simplified baseline model with multi-glimpse attention mechanism (left) and attention mechanism structure (right). Figure 1. Examples of questions in the region-based dataset. Q: Is the optic dist in this region? A: Yes Q: Are there hard exudates in this region? A: No Visual features Question features fusion Classifier Question Answer ResNet152 LSTM Conv 2d 1x1 Linear Expand ReLU Conv 2d 1x1 fusion Hadamard Softmax dim -1 Image Mask (1, 448, 448) X Attention mechanism Apply attention Question features Visual features Attention maps
poster
Aim 2: Track changes in phageomes and bacteriomes of captive mice after tranpantation of wild phageomes. Čížková D. 1, Payne P. 1,2, Bryjová A. 1, Ďureje Ľ. 1, Piálek J. 1, Kreisinger J. 2 1 - Institute of Vertebrate Biology of the Czech Academy of Sciences, Brno, Czech Republic 2 - Department of Zoology, Faculty of Science, Charles University, Prague, Czech Republic Gut bacteriomes have profound effects on their vertberate superhosts. Bacteriophages are key regulators of bacterial communties. Aim 1: Comparison of gut phageomes and bacteriomes between wild and captive mice. Study design: House mouse - Mus musculus musculus • 10 wild mice from 3 localities (Jedov, Naloucany, Velke Pole) • 26 captive mice from 2 wild-drived strains (BULS and BUSNA) Phageome transplantation - caecal filtrates Bacteriome monitoring - 16S rRNA metabarcoding from feces Phageome monitoring - Whole metagenome sequencing of fecal filtrates PCoA - phage contigs Wild and Captive Phageomes are different: Cluster heat map - abundant phage contigs Phageomes Mirror Bacteriomes: Procrustes - correlation in bacteriome and phageome Changes in the Contig level phageome distances between recipents and donors Phageome of captive recipents converge to wild donors: Changes in the Sub-Contig level phageome distances (SNPs in shared contigs) BUSNA phageomes converge to wild donors at the Contig level distances. BULS phageomes converge to wild donors at the Sub-contig level distances. BUSNA BUSNA BULS BULS day x treatment: p = 0.225 day x treatment: p = 0.070 day x treatment: p = 0.250 day x treatment: p = 0.480 day of experiment day of experiment day of experiment day of experiment Changes in the ASV level bacteriome distances between recipents and donors No effect of phageome transplantation on bacteriome: Gut phageome differed between wild and captive house mouse. Phageome transplantation resulted in transfer of wild phages to captive phageomes, but without major changes in phageome structure. Transferred phages differed between the two recipient mouse strains. Phage transfer did not induce any measurable effects on the gut bacteriome. This has implications for safety of medical phage transplants. This research has been supported by the Ministry of Education, Youth and Sports of the Czech Republic grant Talking microbes - understanding microbial interactions within One Health framework (CZ.02.01.01/00/22_008/0004597).
poster
POSTER PRESENTATION Open Access SpineML and Brian 2.0 interfaces for using GPU enhanced Neuronal Networks (GeNN) Thomas Nowotny1*, Alexander J Cope2, Esin Yavuz1, Marcel Stimberg3, Dan FM Goodman4, James Marshall2, Kevin Gurney5 From The Twenty Third Annual Computational Neuroscience Meeting: CNS*2014 Québec City, Canada. 26-31 July 2014 Background The GPU enhanced Neuronal Networks (GeNN) frame- work [1,2] was introduced in 2011 to facilitate the efficient use of graphical processing units (GPUs) as accelerators for neuronal network simulations, in particular as part of computational neuroscience investigations. GeNN is based substantially on code generation for the NVIDIA CUDA application programming interface. Code generation pro- vides decisive advantages over stand-alone simulators in that (i) code can be optimized both for every individual model and for the specific GPU hardware detected at compile time, and (ii) code generation allows to provide a practically limitless number of pre-defined models while the generated simulation code remains as small and effi- cient as possible. While GeNN is an important step towards facilitating the use of GPU acceleration for computational neu- roscience applications it has been designed with expert users in mind. Particular emphasis has been put on flex- ibility and extendibility and, in case of conflict, these were prioritized over the easy of use. In the work presented here we are aiming to make GeNN and the corresponding GPU acceleration now also available to non-expert users by providing two new inter- faces from SpineCreator [3]/SpineML [4] and the Brian 2 simulator [5,6] to GeNN. Results We have created prototype interfaces from SpineCreator using the SpineML markup language and from Brian 2 by modifying the code generation facilities within Brian 2 to generate valid GeNN input files. In both cases, a middleware was created that takes the model descrip- tions that were either available in SpineML (as gener- ated by SpineCreator) or the internal representation in Brian 2 and translate them into the three main code parts necessary to run a GeNN simulation: (i) Neuron, synapse and network definitions including variables, parameters, code to integrate dynamical equations and properties of the connectivity, (ii) Code that runs the GeNN generated code to execute the simulation and (iii) code that regulates the transfer of information from SpineCreator/Brian 2 to GeNN and vice versa (e.g. for providing connectivity matrices and returning simula- tion results). Conclusions We believe that when the new SpineCreator and Brian 2 interfaces will have been fully developed, tested and released we can make a decisive difference in the uptake of GPU acceleration for neuronal network simulations. The completed prototypes show sufficient flexibility and ease of use to be appealing to a wide range of future users. Acknowledgements This work was supported by the EPSRC (Green Brain Project, grant numbers EP/J019690/1, EP/J019534/1 and Delivery Plan ‘Kickstart’ funding). Authors’ details 1CCNR, School of Engineering and Informatics, University of Sussex, Falmer, Brighton BN1 9QJ, UK. 2Department of Computer Science, University of Sheffield, Sheffield S1 4DP, UK. 3Institut d’Etudes de la Cognition, Ecole Normale Supérieure, Paris, France. 4Harvard Medical School, Harvard University, Boston, MA 02115, USA. 5Department of Psychology, University of Sheffield, Sheffield S10 2TP, UK. Published: 21 July 2014 References 1. Nowotny T: Flexible neuronal network simulation framework using code generation for NVIDIA CUDA. BMC Neurosci 2011, 12(Suppl 1):P239. * Correspondence: t.nowotny@sussex.ac.uk 1CCNR, School of Engineering and Informatics, University of Sussex, Falmer, Brighton BN1 9QJ, UK Full list of author information is available at the end of the article Nowotny et al. BMC Neuroscience 2014, 15(Suppl 1):P148 http://www.biomedcentral.com/1471-2202/15/S1/P148 © 2014 Nowotny et al; licensee BioMed Central
poster
Positionality, reflexivity and ethics in global public health research Chloe Tuck1, Isaac Boadu2, Laura Gray1, Robert Akparibo1,3, Richmond Aryeetey2, and Richard Cooper1 School of Health and Related Research, University of Sheffield, UK. 2. University of Ghana, Accra, Ghana. 3. University of Health and Allied Sciences, Ho. Correspondence to: Chloe Tuck cztuck1@sheffield.ac.uk Herein we aim to critically reflect on levels of discordance to foster more ethical and collaborative research. Reflexivity and positionality were applied to better understand the role of the researcher, their social experiences, position and power hierarchies influence knowledge generation. This involved sharing researchers’ experience following an exchange between the University of Ghana and the University of Sheffield, fostering a collaboration with a teaching hospital in northern Ghana for mixed methods data collection and analysis, discussion and reviewing relevant literature from Health Sciences, Geography and Sociological sciences. “Please use your liberty to promote ours” Aung San Suu Kyi, Feb 19979 “colonisation gave the world… a particular way of looking (or, rather, not looking) at Africa that endures, alas, into our own day” Chinua Achebe, 1998: page 20, In Africa’s Tarnished Name1 Funded by [108903/B/15/Z] We would like to acknowledge the ongoing support of all collaborators in this work at Tamale Teaching Hospital and the University of Ghana. Writings by Achebe in 1998 do not cease to have pertinence today. As global public health researchers, we strive to increase health system efficiency and reduce inequity due to factors associated with healthcare access and societal wellbeing. Many of the areas of greatest health need are in low-income contexts whilst funding and decision making remain tied to high-income settings. Poorly considered research across settings can create disconnect between the researcher and research, further instils colonialist attitudes, and enforces power hierarchies. Background Visual summary of findings Methods References can be found here: We also invite feedback on our approach to: cztuck1@sheffield.ac.uk Conclusions “the Bantu declaration 'Umuntu ngumuntu ngabantu' represents an African communal aspiration: 'A human is a human because of other humans'. Our humanity is contingent on the humanity of our fellows.” Chinua Achebe, 1999 Africa Is People.8 Reflexivity and positionality are vital to consider for ethical global health research. This further Achebe quote reminds us our communality, our becoming through cooperation and relationships to each other. To construct collaborative approaches, we need to actively challenge colonial imperatives that have dominated western thought and to which we are often blind. Where we have liberties, use it to promote others.
poster
High-dose busulfan (BU) is the cornerstone of conditioning regimens prior to HSCT in children. The relation of BU exposure and event-free survival (EFS) is not clear due to conflicting reports especially in pediatric patients The cum AUC (mg × h/L ) exposure targets for BU were : EMA: 59–99 ; US-FDA: 59–89 Bartelink IH et al. 1: 78-101 mg × h/L Better EFS with cumAUC of <57.6 or between 57.6 - 67.2 mg × h/L1,2,3 cumAUC of 86.4 mg × h/L showed better EFS, in pediatric patients4 All these studies were evaluated retrospectively with a sample size varying from 45 to <100 patients. No clear consensus among peers about the utility of BU cumAUC as an indicator of EFS Is there any other dynamic indicator/marker of BU efficacy ? Background References 1. Bartelink et al., Lancet Haematol. 2016; 3: e526-e536 2. Ansari et al., Ther Drug Monit 2014;36:93-99 3. Baker et al., Bone Marrow Transplant 2000; 26,:607–614 3. 4. Maheswari et al., Bone Marrow Transplantation 2014: 49, 366–369. 5. McCune et al., Bone Marrow Transplant. 2002;30(3):167-73. Results Methods Conclusion The BU MR (BU/SU) on day 3 above 4.973 and 25.06 were associated with worse EFS in children undergoing HSCT and received BU in QID and QD dosing schedules, respectively. Predictive nature of MRs measured were replicated in two different BU dosing schedules followed. These observations deserve attention and need to be replicated in a larger study, especially in an external cohort to rule out any unidentified bias in this analysis. 44 received BU four times daily (QID) and 13 received BU once daily (QD; (n=13; 10 allogeneic HSCTs and 3 autologous HSCT). BU/SU = MR was measured on the 3rd day of conditioning. EFS was defined from the time of transplant until death, relapse, or rejection, whichever occurred first. Chakradhara Rao S Uppugunduri1,2, Aziz Rezgui3, Patricia Huezo-Diaz Curtis1,2, Tiago Nava1,2, Simona Mlakar1,2, Yves Theoret4, Henrique Bittencourt5, Maja Krajinovic3, Marc Ansari1,2 Busulfan/Sulfolane metabolic ratio on the third day of conditioning may predict the event-free survival in children receiving busulfan based conditioning prior to hematopoietic stem-cell transplantation Huezo‐diaz P & Uppugunduri CRS et al., CDM, 2014; 15:251‐264 Objective: To evaluate the utility of BU MR (busulfan/sulfoalne,SU) to predict event-free survival (EFS) in children undergoing HSCT, retrospectively. Four times daily BU (n=44) Events occured No Events N (%) N(%) Gender Male 7 (31.8) 15 (68.2) Female 10 (45.5) 12 (55.5) Diagnosis (S) Malignancies (ALL, AML, MDS) 16 (59.3) 11 (40.7) Non‐ malignancies (/HP, ID, Met Dis,) 1 (5.9) 16 (94.1) Disease Status (Leukemia) (T) CR1 6 (60) 4 (40) CR2 / CR3 / Relapse 4 (80) 1 (20) HLA compatibility MUD 3 (57.1) 4 (42.9) MRD 3 (21.4) 11(78.6) MM RD 2 (66.7) 1 (33.3) MM UD 9 (45) 11 (55) Stem Cell Source BM 5 (27.8) 13 (72.2) Cord Blood 12 (46.2) 14 (53.8) Conditioning Bu/Cy 16 (39) 25 (61) Bu/Cy/VP16 1 (50) 1 (50) Bu/Mel 0 1 (100) Serotherapy ATG 13 (37.1) 22 (62.9) None 4 (44.4) 5 (55.6) Mean (SD) Mean (SD) Age (years) 8.9 (4.9) 6.2 (5.94) Weight (Kg) 35.1 (20.9) 22.7 (18.5) Once daily BU (n=13) Events occured No Events N N Gender Male 1 3 Female 6 3 Diagnosis (S) Malignancies (ALL, AML, MDS) 6 2 Non‐malignancies (/HP, ID, Met Dis,) 1 4 Disease Status (Leukemia) (T) CR1 3 0 CR2 / CR3 / Relapse 2 0 Partial Remission 1 1 HLA compatibility MUD 1 0 MRD 1 5 MM RD ‐ ‐ MM UD 3 0 Stem Cell Source BM 1 3 Cord Blood 4 2 PBSC (AUT) 2 1 Conditioning Bu/Cy 2 3 Bu/Flu 3 2 Bu/Mel 2 1 serotherapy ATG 3 4 None 4 2 Mean (SD) Mean (SD) Age (years) 6.1 (5.6) 7.4 (4.7) Weight (Kg) 17.4 (2.6) 17.0 (1.4) 1University Hospitals of Geneva, Onco‐Hematology Unit, Department of Pediatrics, Geneva, Switzerland, 2CANSEARCH Research Laboratory, Faculty of Medicine, University of Geneva, Geneva, Switzerland, 3Charles‐Bruneau Cancer Center, CHU Sainte‐Justine Research Center, Montreal, Canada, 4Charles‐Bruneau Cancer Center, Department of Pharmacology and Physiol
poster
Innovative Research for a Sustainable Future www.epa.gov/research m/z 455.2897, 6.70 min 0.1 1 Verapamil (Parent Drug) Normalized Abundance Tyler S. Larson l larson.tyler@epa.gov l 434-942-5470 Untargeted LC-MS/MS Analysis of Drug Metabolites in Human Hepatocyte Suspensions for Comparison to Liver S9 Fractions Tyler S. Larson1, Krishna Ravindra2, Barbara A. Wetmore3, Denise K. MacMillan3 1Oak Ridge Institute for Science and Education (ORISE), 2Oak Ridge Associated Universities (ORAU) 3U.S. Environmental Protection Agency, Office of Research and Development Introduction Experimental Coumarin Verapamil Conclusions Rosiglitazone The U.S. EPA, in collaboration with Unilever, is developing new approach methods (NAMs) to quickly evaluate chemicals for human health hazards. Incorporating metabolism in NAMs is important to evaluate both parent compound and metabolite exposures during risk evaluations. Here, untargeted LC- MS/MS analysis is used to characterize metabolism of Coumarin, Rosiglitazone, and Verapamil in human hepatocyte suspensions and S9 protein fractions, and rat S9 protein fractions. Human hepatocytes are the gold standard for evaluating metabolism, but S9 fractions are easier to use and are not limited by toxicity. O O Rosiglitazone DTXSID7037131 Verapamil DTXSID9041152 Coumarin DTXSID7020348 O O Top: (left) Abundance of the coumarin parent drug in each system. The Human S9 fractions showed the highest clearance. (right) Abundances of the detected coumarin metabolites Metabolite ID: (left) Each metabolite m/z value matched to two possible isomers. For C-Met-1a-b two features were detected while only one was detected for C-Met-2a-b. (right) Example of an MS/MS spectral match using MetFrag. MetFrag does not match abundances, only m/z values. All identifications were Level 2: Probable Structure on the Schymanski scale. Label m/z (M+H)+ RT (min) Matched Structure C-Met-1a-b 163.0389 5.60 and 6.25 C-Met-2a-b 339.0690 5.60 Label m/z (M+H)+ RT (min) Matched Structure R-Met-1 344.1072 5.69 R-Met- 2a-d 374.11 5.61, 5.80, 6.60 O S NH O O N + N CH3 O – O S NH O O N N CH3 OH Label m/z (M+H)+ RT (min) Matched Structure V-Met-1 196.1325 5.22 V-Met-2 291.2048 6.08 V-Met-3a-c 441.2739 (total) 6.50 and 6.70 V-Met-4a-c 471.285 6.15, 6.41, and 6.59 V-Met-5a-b 427.2568 6.48 V-Met-6a-b 457.2678 6.55 NH O O O O CH3 C H3 C H3 CH3 C H3 N CH3 N O O O O H CH3 CH3 C H3 CH3 C H3 N CH3 N OH O O O CH3 C H3 C H3 CH3 C H3 N CH3 N O O O O CH3 CH3 C H3 C H3 CH3 C H3 CH CH3 OH N O O O O CH3 CH3 CH3 C H3 CH3 C H3 N CH3 OH N O O O O CH3 CH3 C H3 C H3 CH3 C H3 N CH3 OH NH O O O O CH3 C H3 C H3 CH3 C H3 N CH3 OH NH O O O O CH3 C H3 C H3 CH3 CH3 N C H3 OH NH O H O O O C H3 C H3 CH3 C H3 N CH3 C H3 NH O O O O H C H3 CH3 C H3 N CH3 A B A B A B C D A B C A B C A B A B Top: (left) Abundance of the verapamil parent drug in each metabolic system. The human S9s showed the highest clearance. (right) Abundances of the detected verapamil metabolites in each system. Metabolite ID: All metabolites were annotated as Level 2 except for V-Met-1 for which no MS/MS was acquired (Level 5: Accurate mass only). Many metabolite MS/MS spectra matched to two or more isomers. Two metabolites were detected that were not predicted. They were annotated the same way as the others. N O O O O CH3 CH3 C H3 C H3 CH3 C H3 N CH3 Top: (left) Abundance of the rosiglitazone precursor. The rat S9s showed the highest clearance. (right) Abundance of the detected rosiglitazone metabolites. Metabolite ID: All matched structures were considered Level 2: Probable Structure on the Schymanski scale. R- Met 2a-d matched to four possible isomers despite three m/z values being detected. Level 2: Probable Structure 50 100 150 200 m/z Experimental MetFrag Not Predicted Not Predicted • Metabolism was compared between three different systems: human hepatocytes, human S9 fractions, and rat S9 fractions which all differed slightly in the metabolites observed. • Human liver S9s contain the native enzymes present
poster
INTRODUCTION CONCEPTUAL FRAMEWORK OBJECTIVE To explore first contact physiotherapist service rapid adaptation for musculoskeletal conditions during Covid-19 pandemic in the UK and Australia Healthcare services initially experienced disruption due to Covid- 19 pandemic, for example, World Health Organisation reported 53% disruptions in primary care services and 38% in emergency care globally. However, services quickly adapted for the continuity of care There is currently no evidence on the adaptation strategies implemented by first contact physiotherapy (FCP) services since the onset of the pandemic and how they have been experienced by patients and staff There is a need to describe this process and identify barriers and facilitators in the implementation of this change to understand and reflect on the experience of the service providers and users for future practice Adaptation framework, World Health Organisation Responsiveness framework and Dearing Readiness tool will be combined to understand adaptation and its associated factors RESULT/CONCLUSION EXPLORING ADAPTATIONS TO FIRST CONTACT PHYSIOTHERAPY SERVICES FOR MUSCULOSKELETAL PATIENTS DURING COVID-19 PANDEMIC AFFILIATIONS 1) School of Health Science, University of Surrey 2) School of Nursing, University of the Highlands and Islands 3) University of Wollongong, Australia AUTHORS Oluwatoyin A. Adeniji Dr Theopisti Chrysanthaki Dr Karen Stenner Dr Nicola Carey Prof Evangelos Pappas Prof Victoria Traynor METHODS A cross-sectional study design will be used to explore changes that occurred in FCP service delivery for Musculoskeletal patients during the Covid-19 pandemic in the UK and Australia using an online survey (Qualtrics©). The online survey (questionnaire) was developed a priori, drawing on literature and consultation with experts. About 439 FCP practitioners will be recruited through physiotherapy associations both in the UK and Australia. ANALYSIS Data will be imported into SPSS and analysed using descriptive statistics of mean, frequencies, and percentage. Content analysis will be used to analyse responses to open-ended questions to provide numerical counts of categories where appropriate. RELATED LITERATURE AL AWAJI, N. N., ALMUDAIHEEM, A. A. & MORTADA, E. M. 2022. Changes in speech, language and swallowing services during the Covid-19 pandemic: The perspective of speech-language pathologists in Saudi Arabia. PLoS One, 17, e0262498. BARTON, C. J., EZZAT, A. M., MEROLLI, M., WILLIAMS, C. M., HAINES, T., MEHTA, N. & MALLIARAS, P. 2022. “It's second best”: A mixed-methods evaluation of the experiences and attitudes of people with musculoskeletal pain towards physiotherapist delivered telehealth during the COVID-19 pandemic. Musculoskeletal Science and Practice, 58. MARSHALL, J., SCOTT, B., DELVA, J., ADE, C., HERNANDEZ, S., PATEL, J., MORENO-CHEEK, M., ROJAS, D., TANNER, J. P. & KIRBY, R. S. 2020. An Evaluation of Florida’s Zika Response Using the WHO Health Systems Framework: Can We Apply These Lessons to COVID-19? Maternal and Child Health Journal, 24, 1212-1223. STIRMAN, W. S., BAUMANN, A. A. & MILLER, C. J. 2019. The FRAME: an expanded framework for reporting adaptations and modifications to evidence-based interventions. Implementation Science, 14. DEARING, J. W. 2018. Organizational Readiness Tools for Global Health Intervention: A Review. Front Public Health, 6, 56. This study will provide an overview of changes that have occurred in FCP service delivery for musculoskeletal patients and its associated factors in the UK and Australia. This will provide an opportunity for cross-contextual learning and may inform future practice. Contact o.adeniji@surrey.ac.uk Twitter: @Adenijimojisola LinkedIn QR code 1,3 1 1 2 3 3
poster
RESULTS METHODS INTRODUCTION Fig. 1: A, C. eucalypti; B, B. occidentalis; C, G. brimblecombei; D, S. cf. plicatuloides; E- H, infestation of the respective psyllids on eucalypt leaves and shoots; I, P. pilosus (known parasitoid of A); J, P. blastopsyllae (known parasitoid of B); K, P. bliteus (known parasitoid of C). Table 3: Antennation, probing and oviposition attempts by P. blastopsyllae when exposed to B. occidentalis, G. brimblecombei and C. eucalypti; and of P. bliteus when exposed simultaneously to G. brimblecombei and S. cf. plicatuloides, in choice tests. The known host psyllid of each parasitoid is indicated in bold. No-choice host specificity testing Behavioural assay • The three Psyllaephagus species were collected from their known hosts. • Each Psyllaephagus species was separately exposed to B. occidentalis, C. eucalypti, G. brimblecombei and S. cf. plicatuloides. • Antennation, probing and oviposition behaviour of the parasitoids was monitored for 3 h. Choice host specificity testing • Based on the results of the no-choice tests, host preference of P. blastopsyllae was tested between G. brimblecombei, C. eucalypti and B. occidentalis, and host preference of P. bliteus was tested between G. brimblecombei and S. cf. plicatuloides, using the same methods as for the no- choice tests. No-choice host specificity testing Parasitoid development assay • The four psyllids were reared on their hosts. • For each psyllid-parasitoid combination, 10 infested trees were sleeved and a pair (female and male) of the parasitoid was introduced. • After 40 days, the number of Psyllaephagus wasps that emerged from the sleeve was recorded. Table 2: Average numbers of parasitoids that emerged from the test psyllid species and known hosts in the para- sitoid development assays. The known host psyllid of each parasitoid is indicated in bold. REFERENCES 1. Bush SJ, Slippers B, Dittrich-Schröder G, Hurley BP. 2020. Host specificity tests reveals new host of a global biological control agent Psyllaephagus bliteus (Hymenoptera: Encyrtidae. African Entomolo- gy 28: 238–248. 2. Hodkinson ID. 1999. Biocontrol of Eucalyptus psyllid Ctenarytaina eucalypti by the Australian parasi- toid Psyllaephagus pilosus: a review of current programmes and their success. Biocontrol News and Information 20: 129–134. ACKNOWLEDGEMENTS Tree Protection Co-operative Programme (TPCP), DSI – NRF Centre of Ex- cellence in Plant Health Biotechnology, University of Pretoria, South Africa for financial support. DISCUSSION AND CONCLUSION • P. pilosus only parasitised nymphal instars of C. eucalypti, its known host, which agrees with previous observations [2]. • G. brimblecombei was identified as a potential new host for P. blastopsyllae, and S. cf. plicatuloides was confirmed as an alternate host for P. bliteus. • Our findings indicate that some Psyllaephagus spp. have a wider host range, whereas others are highly host specific. Future work • Determine relative parasitism of the Psyllaephagus spp. on their different psyllid hosts in natural (Australia) and planted (e.g. South Africa) eucalypt forests. • Increase our knowledge on the host range of Psyllaephagus spp. in their native range, to inform future biological control programmes. • Two free-living eucalypt-feeding psyllids, Blastopsylla occidentalis and Ctenarytaina eucalypti, and two lerp-forming eucalypt-feeding psyllids, Glycaspis brimblecombei and Spondyliaspis cf. plicatuloides, all native to Australia, have been accidentally introduced into South Africa (Fig 1A-D). • The pest status of these psyllids varies but damage to eucalypts include bud degeneration, necrosis, defoliation, dieback and death (Fig 1E-H). • The co-evolved parasitoids (Psyllaephagus spp.) of three of the psyllid species were unintentionally intro- duced into South Africa with their insect hosts (Fig 1I-K). • A previous study showed that the parasitoid of G. brimblecombei, namely, Psyllaephagus bliteus, also parasitised S. c.f. plicatuloides [1],
poster
Cultivando Consciência Ambiental desde a Infância: A Importância da Educação Ambiental nas Escolas para Crianças e Jovens Izomar Silva Amorim Mestrando em Educação pela UniNorte PY Professor de Ciências na rede Municipal e Estadual de Manaus Universidade Nilton Lins, AM Resumo A crescente preeminência da preocupação ambiental e da busca por respostas aos desafios globais relacionados ao meio ambiente tem se manifestado nas últimas décadas de maneira notória. Este cenário é marcado pela emergência de questões prementes, tais como as mudanças climáticas, a redução da biodiversidade, a degradação dos ecossistemas e a escassez de recursos naturais, cuja importância não pode ser subestimada e deve ser ressaltada dentro da sala de aula, pois ela desempenha um papel fundamental na formação das futuras gerações, promovendo a conscientização , a conexão com o meio ambiente e o desenvolvimento de valores e comportamentos sustentáveis de crianças e jovens. Neste trabalho, foi realizada uma reunião de conteúdos de artigos científicos em bases de dados como Scielo e Google acadêmico. Nesse contexto, este artigo teve o objetivo de apresentar a importância da abordagem do ensino da sustentabilidade para os discentes nas escolas, a forma como se manifesta de maneira a impactar o cotidiano dos estudantes e os desafios do futuro face ao agravamento dos desafios ambientais e à imperiosa urgência de fomentar a sustentabilidade. Esta modalidade educacional assume, portanto, um papel fundamental na configuração da consciência, valores e condutas das atuais e vindouras gerações, exercendo influência de notório alcance em múltiplos domínios. Palavras-chave: Ambiental, recursos, desenvolvimento, conscientização. III CONGRESSO AMAZONENSE DE EDUCAÇÃO Maysa Girlane Araújo Amorim Mestranda em Educação pela UniNorte PY Coordenadora do PNAIC pela SEMED-Manaus de 2013 a 2016 e pela UNDIME/Am de 2017 a 2018 Universidade Estadual do Amazonas - UEA, AM Introdução O território brasileiro é notório por abrigar riquezas naturais de relevância inegável. No entanto, é incontestável que a degradação progressiva e a exploração desenfreada desses recursos têm desencadeado impactos adversos que repercutem de maneira nociva, tanto sobre os próprios recursos naturais quanto sobre a qualidade de vida das comunidades envolvidas. Esses impactos nefastos pressagiam desafios de ordem socioambiental e econômica, cujas ramificações se estendem não somente ao presente, mas também lançam sombras ameaçadoras sobre o horizonte das gerações vindouras. O horizonte de um futuro sustentável representa uma visão abraçada globalmente, mas sua realização plena repousa inteiramente nas decisões que tomamos no presente. Hodiernamente, somos confrontados por desafios de grande magnitude, que abarcam desde os imperativos das mudanças climáticas e a depreciação do ecossistema até as complexidades das questões relacionadas à desigualdade social e a crescente escassez de recursos. Entretanto, é de suma importância internalizar que a concretização de um futuro sustentável é tangível, desde que abracemos ações imediatas. Autores de renome, a exemplo de Paulo Freire, ressaltam que a educação ambiental confere às pessoas a capacidade de engajamento efetivo no processo de tomada de decisões pertinentes ao meio ambiente. Este processo, por sua vez, constitui um estímulo à cidadania ativa, fomentando a participação democrática em pautas ambientais. Conforme as ponderações de SEGURA (2001), a educação ambiental se erige como um meio de capital importância na possibilidade de reformulação do paradigma de degradação ambiental que prevalece. As abordagens educacionais relacionadas a esta temática podem desempenhar um papel de cariz transformativo, conferindo, assim, aos indivíduos, uma vez imbuídos de consciência, uma posição fulcral na promoção do desenvolvimento sustentável. Logo, embora a EA não se restrinja estritamente ao contexto do ensino formal, é imperativo considerar sua inserção prioritária no âm
poster
HI grouping overlaid on DES RGB image A serendipitous MeerKAT discovery of an HI-rich grouping of galaxies with megaparsec-scale filamentary-like structure Overview ●Probing HI in a group environment ●Serendipitous MeerKAT HI grouping discovery ●In the foreground of Abell 3365 at z~0.04 MeerKAT data ●MeerKAT L-band observations (as part of MeerKAT Galaxy Cluster Legacy Survey) ●Combination of 2 ⨉ ~10 hour observations ●4k mode, ~209 kHz channel width (46 km s-1 at z~0.04) ●~52 µJy/beam channel RMS at a Briggs robust weighting of 2 Ancillary data ●DES, an optical imaging survey carried out by the Dark Energy Camera (DECam), we use g, r, i bands for optical counterpart identification ●WISE, mid-infrared data used in calculation of stellar mass and star formation rates, where possible Name: Graham Lawrie Email: grahamdavidlawrie@gmail.com Prof. Roger Deane1,2 Prof. Romeel Davé3,4 1. University of the Witwatersrand 2. University of Pretoria 3. University of Edinburgh 4. University of the Western Cape Source-finding ●Visual source-finding within the HI data cube using CARTA ●Semi-automated source-finding with SoFiA 2, using a S+C threshold of 3.4 ●Crossmatching is done using the visual and SoFiA generated catalogues, together with false positive removal with the help of DES imaging Grouping ●We take a simplistic friends of friends approach to qualitatively associate galaxies ●Linking parameters of 1.3 Mpc spatial separation and 350 km/s in velocity separation Conclusion ●We made a serendipitous discovery of an HI-rich galaxy group with numerous galaxy-galaxy interactions shown by HI bridges and tails ●MeerKAT provides us with a powerful tool for probing the environmental effects on cold gas evolution ●MeerKAT appears to be particularly successful at detecting groups of galaxies at z~0.04, potentially providing astronomers with a useful environment in which to probe galaxy evolution Comparison to hydrodynamical simulation ●We compare the MeerKAT group detection to predictions derived from cutting edge cosmological hydrodynamical simulation, SIMBA Davé et. al. 2019 ●FoF is run on the flagship SIMBA box with full physics to find 31 analogous HI galaxy groups ●By comparison of the volume a MeerKAT pointing will probe out to z~0.1 we find the likeliness of a HI group detection to be 1 detection per ~15 pointings ●Future work includes construction of mock HI galaxies with MARTINI for individual galaxy comparison, see the following example: Acknowledgements: SARAO for data and funding, ILIFU for access to HPC for data reduction, CARTA for data visualisation, SoFiA 2 for source-finding, SoFiA Image Pipeline for cutout generation, MARTINI for mock data generation, Wits-UK foundation for funding a 6 week research visit to Edinburgh ● HI total intensity HI velocity field DES g-band
poster
Not targetable No mutation Level 1 ( n = 55, 35%) PIK3CA (n = 32, 20%) HRD genes (n = 20, 14%) Level 2 (n = 7, 4%) Level 3 (n = 3, 2%) Level 4 (n = 10, 6%) Table 1: Clinical and histopathological characteristics of the cohort. FPN 139P Genomic prognostic and potential theragnostic factors in anal squamous cell carcinoma treated with abdominoperineal resection Conclusion • In patients with HPV-positive ASCC treated by APR, PIK3CA exon 9/20 and KMT2C pathogenic variants are independent prognostic factors of overall survival. • The high prevalence of alterations with potential theragnostic value strongly supports the use of genomic profiling to allow patient enrollment in precision medicine clinical trials. A. Hamza1, J. Masliah-Planchon1, C. Neuzillet2, J. H. Lefèvre3, M. Svrcek4, S. Vacher1, C. Bourneix1, M. Delaye2, D. Goéré5, P. Dartigues6, E. Samalin7, M. Hilmi2, J. Lazartigues2, E. Girard8, J. Emile9, E. Rigault10, V. Dangles-Marie11,19, N. Rioux-Leclercq12, C. de la Fouchardiere13, D. Tougeron14, A. Casadei-Gardini15, P. Mariani16, F. Peschaud17, W. Cacheux18, A. Lièvre10,20, I. Bièche1,21 abderaouf.hamza@curie.fr 1: Genetics Department, Institut Curie, PSL Research University, Paris, France, 2: Medical Oncology Department, Institut Curie, PSL Research University, Saint-Cloud, France, 3: Sorbonne Université, Department of Digestive Surgery, Assistance Publique-Hôpitaux de Paris, Hôpital Saint Antoine, Paris, France, 4: Pathology Department, Hôpital Saint-Antoine, Assistance Publique-Hôpitaux de Paris, France, 5: Digestive Surgery Department, Gustave Roussy Institute, Villejuif, France, 6: Pathology Department, Gustave Roussy Institute, Villejuif, France, 7: Medical Oncology Department, Institut du Cancer de Montpellier, Montpellier, France, 8: INSERM U900 Research unit, Institut Curie, PSL Research University, Paris, France, 9: Université Paris-Saclay, Assistance Publique-Hôpitaux de Paris, UVSQ, BECCOH, Hôpital Ambroise-Paré, Pathology Department, Boulogne-Billancourt, France, 10: Gastroenterology Department, Rennes University Hospital, Rennes, France, 11: Laboratory of preclinical investigation, Translational Research Department, Institut Curie, PSL Research University, Paris, France, 12: Pathology Department, University Hospital of Rennes, Rennes, France, 13: Medical Oncology Department, Centre Léon Bérard, Lyon, France, 14: Department of Gastroenterology and Hepatology, Poitiers University Hospital, Poitiers, France, 15: Department of Oncology, Vita-Salute San Raffaele University, IRCCS San Raffaele Scientific Institute Hospital, Milan, Italy, 16: Department of Surgery, Institut Curie, PSL Research University, Paris, France, 17: Department of Digestive and Oncologic Surgery, Ambroise Paré Hospital, Versailles Saint-Quentin University, Paris Saclay University, Boulogne-Billancourt, France, 18: Medical Oncology Department, Hôpital Privé Pays de Savoie, Annemasse, France, 19: Faculty of Pharmaceutical and Biological Sciences, Paris Cité University, Paris, France, 20: Rennes 1 University; Inserm U1242, COSS (Chemistry Oncogenesis Stress Signaling), Rennes, France, 21: INSERM U1016, Faculty of Pharmaceutical and Biological Sciences, Paris Cité University, Paris, France Background • The management of anal squamous cell carcinoma (ASCC) has yet to benefit from the progress of precision medicine. • The few prognostic factors assessed to date are insufficient to accurately predict clinical outcomes. • Genomic analyses could identify new prognostic biomarkers and potential avenues for targeted therapies. HPV status Characteristic N Overall, N = 158 Positive, N = 1411 Negative, N = 171 p-value2 Age 158 57 (49, 66)1 58 (50, 66) 52 (49, 62) 0.43 Sexe 158 0.001 Female 102 (65%) 97 (69%) 5 (29%) Male 56 (35%) 44 (31%) 12 (71%) Stage 145 0.47 I 14 (10%) 11 (9%) 3 (20%) II 70 (48%) 63 (48%) 7 (47%) III 59 (41%) 54 (42%) 5 (33%) IV 2 (1%) 2 (2%) 0 (0%) ypT 156 0.15 ypT1 19 (12%) 19 (14%) 0 (0%) ypT2 60 (38%) 50 (36%) 10 (59%) ypT3 32 (2
poster
Polyclads from the Gulf of Mexico
poster
Potential participants who meet the inclusion criteria are invited to participate in the study. Following informed consent, participants complete a graded treadmill exercise test conducted in the Cardiology Department to determine the participant’s exercise status, possible underlying cardiac disease and to outrule any contraindication to participation in an exercise programme. RESULTS During the period November 2006 to November 2007, 394 patients (residing within geographical proximity to Beaumont Hospital) with ABIs < 0.9 were identified from the Non-Invasive Vascular Laboratory Segmental Pressures records. Of the 394 patients identified, 271 medical charts were available for review. Seventy-nine of the 271 patients (29%) met the inclusion criteria. One hundred and eighty –seven patients were excluded. Reasons for exclusion are illustrated in Figure 1. Recruitment to Exercise Programmes: Challenges in the Peripheral Arterial Disease Population Guidon M1, Chavira M1, McGee H2, Sheahan R3 and Kelly C4 1 School of Physiotherapy, Royal College of Surgeons in Ireland; 2Psychology Department, Royal College of Surgeons in Ireland, 3Cardiology Department, Beaumont Hospital; 4Vascular Surgery Department, Beaumont Hospital INTRODUCTION Current evidence suggests that 27 million people in Europe and North America have peripheral arterial disease (PAD)1. Although only 3% of patients with intermittent claudication (IC) require amputation, a significant number will require hospital admission and other surgical intervention for IC and associated cardiac and cerebrovascular complications. An important aim of exercise therapy in the peripheral arterial disease population is to decrease cardiovascular risk factors and consequent morbidity and mortality. Several studies have demonstrated that exercise programmes result in significant improvements in walking distances but the long-term benefits are unknown. A randomised controlled trial is currently being conducted in Beaumont Hospital to determine the effects of a supervised exercise programme on quality of life, risk factor modification and morbidity and mortality in patients with PAD. AIM This is a report of ongoing recruitment to the trial whereby participants are randomly allocated to either a control or an exercise group. The aim is to determine the uptake to a 12 week (twice weekly) supervised exercise programme and to identify factors which promote and impede uptake. Figure 2. Exercise Testing Outcomes DISCUSSION Although the risk factors for PAD are the same as those for coronary artery disease, individuals with PAD face considerable challenges to exercise due to their symptomatology. Walking is associated with the onset of leg pain and frequent rest periods during walking are required to relieve the pain. To date the recruitment profile in this study population is similar to the recruitment profile for exercise programmes and cardiac failure (CF) populations with a high level of co-morbidity identified3. This highlights the importance of early detection of IC in primary care. The reasons for non-participation in this study are also similar to those in the CF populations i.e. lack of motivation, work/time conflicts, domestic responsibilities and transport difficulties. CONCLUSION Recruitment to this study is ongoing. However these results highlight the significant recruitment challenges presented by this clinical population. In addition to the traditional barriers to recruitment, barriers in this patient population also include a reluctance to exercise due to leg pain, an acceptance of reduced mobility as part of aging and a fear of exercise equipment. REFERENCES 1. Regensteiner J and Hiatt W (2002). Current medical therapies for patients with peripheral arterial disease: a critical review. American Journal of Medicine, 112, 49-57. 2. ACSM’s Guidelines for Exercise Testing and Prescription. (2000). Lippincott, Williams and Wilkins. 3. Lloyd-Williams et al (2003). Why are patients in cli
poster
1. RATIONALE Keep data safe and unaltered for 20 years in a closed off-site storage system Retain original data for audit in case questions about the integrity of a research article are raised Increase compliance with Crick’s core funders’ data management requirements Improving the integrity of research data: building an institutional data archive Minna Ventsel, Research Integrity & Data Specialist The Francis Crick Institute minna.ventsel@crick.ac.uk 3. DATA ARCHIVING FLOW • Crick’s Figshare repository – option to select and upload data files to Figshare at the same time as archiving to increase openness • Metadata fields filled out automatically by the system, drawing details from an uploaded manuscript – to make archiving as easy as possible 2. THE SOLUTION Ticket creation •Researcher submits their manuscript to a journal •Researcher submits a ticket to inform the Library & Information Services team about their manuscript submission •Once ticket submitted, the Data Integrity team creates an archiving folder in researcher’s lab storage space Data •Researcher adds raw data associated with the manuscript to the archiving folder and informs the RI team when completed •The Data Integrity team conducts checks on data/metadata Archiving •Submission approved by the RI team and sent to the archiving team •Data encrypted and compressed •Data is archived in tape storage off-site and cannot be altered – data can now only be retrieved by request Creation of a team to oversee the project and discuss the needs of the archive System design & architecture team come up with the most feasible technology solution IT team start building the system. Preliminary test with one lab at the Crick Wider testing with 2-3 labs Identification of any issues and feedback from users Final changes before official launch First image by pch.vector on Freepik Second image by storyset on Freepik 4. FUTURE INTEGRATION IDEAS
poster
Manufacturing Capability of Micro-Transfer Printing X-Celeprint Inc., Research Triangle Park, NC, www.x-celeprint.com, dgomez@x-celeprint.com David Gomez, Tanya Moore, Matthew A. Meitl, Salvatore Bonafede, Andrew Pearson, Brook Raymond, Tiffany Weeks, Kevin Oswalt, Erich Radauscher, David Kneeburg, Julia Roe, Alin Fecioru, Steven Kelleher, Raja Fazan Gul, Alexandre Ferrell, Antonio Jose Trindade and Christopher A. Bower
poster
High Precision Robotic Navigation and Sensing Jiazhe Tang Dr. Rodrigo Aviles-Espinosa Dr. Elizabeth Rendon-Morales jt558@sussex.ac.uk e.rendon-morales@sussex.ac.uk r.aviles-espinosa@sussex.ac.uk School of Engineering and Informatics, University of Sussex, Brighton, UK Machine vision system for quantification of aortic and pulmonic valvuloplasty catheter compliance Reference [1] F. C. A. Groen, I. T. Young, and G. Ligthart, ‘A comparison of different focus functions for use in autofocus algorithms’, Cytometry, vol. 6, no. 2, pp. 81–91, Mar. 1985, doi: 10.1002/cyto.990060202. [2] University College London, China et al., ‘Valvuloplasty Balloon Catheter Sizing Approach for Calcified Aortic Valve with Different Annulus Ratios’, in Proceedings of The 15th Hamlyn Symposium on Medical Robotics 2023, The Hamlyn Centre, Imperial College London London, UK, Jun. 2023, pp. 37–38. doi: 10.31256/HSMR2023.19. [3] X. Huang, E. Rendon-Morales, and R. Aviles-Espinosa, ‘ROMI: Design and Experimental Evaluation of a Linear Delta Robotic System for High-Precision Applications’, Machines, vol. 11, no. 12, p. 1072, Dec. 2023, doi: 10.3390/machines11121072. Introduction Research Gaps Experiment Methods & Results Balloon aortic valvuloplasty (BAV) is a simple and low-cost treatment for patients with severe aortic stenosis, for aortic valve replacement and to select the proper transcatheter heart valve (THV) size. During THV implantation choosing the correct balloon size is paramount to reduce the risks of coronary occlusion, annular damage or THV embolization. In this research, we present a non-contact metrology system for BAV measurement based on a high precision robotic system equipped with a five elements brightfield microscope system. The robot is controlled though a custom-made GUI operated though an FPGA. The balloon initial diameter is determined optically. Upon ballon inflation, the defocused image is then refocused though passive focusing algorithms used to identify the best focal position. Current methods for selecting the proper balloon dimensions are based on transoesophageal echocardiography and computed tomography all these requiring exposing the patients to high doses of radiation [1]. Moreover, the images require to be analysed by specialized staff. Alternative methods propose the use of BAV to determine the correct THV size using a sterile calliper [2]. This, being a contact-based measurement may compromise the measurement accuracy. Sterile Calliper [2] ROMI [3] Transoesophageal Echocardiography Computed Tomography [1] Each focus evaluation function has its own array of scores. We normalize each of these arrays individually and then plot the results. Balloon with 1 Atmosphere, All Focus Methods Test Results Conclusion • Current results considering algorithms such as the Absolute Tenengrad based on image differentiation, Vollath‘s F4 based on correlation measurement, and Normalized Variance based on statistics, shows that the selected focus algorithms are able to converge at the same focal position. • It allowing for a fast and precise BAV balloon calibration with sub-millimetre accuracy <10 um showing the potential of the here presented work to be used in medial settings to automate preoperative balloon characterization. • Future work will focus on measuring the initial size of the balloon, and according effective passive automatic focus method to determine the change of the size of the balloon. Balloon with 1 Atmosphere, Effective Focus Methods Test Results Not Focused Focused • Set initial position. (Position C) • Down to position A. • Start autonomy moving. • Go to A, go to B, then go to A. • It should pass the best focus point twice, which will give back two peak on the results of the focus evaluation function diagram.
poster
Vendula Smolikova PhD student vendula.smolikova@vub.be Acknowledgements: This work was supported by the project PROFISH CZ.02.1.01/0.0/0.0/16_019/0000869. The DGT passive samplers can not only overlap the lack of knowledge in the biogeochemical cycling of trace elements and their bioavailability for living organisms but they also represent a useful tool for long-term monitoring of trace metal concentrations in-situ. The field application of new DGT designs utilizing different sorbents is a crucial part of the technique validation. The salinity gradient found in estuaries represents an ideal location for evaluation of the DGT technique performance which may be hampered by the complex composition of seawater in contrary to freshwater. The potential of Diffusive Gradients in Thin films (DGT) technique as a monitoring tool for uranium in the aquatic environment V. Smolikova1,2, P. Pelcova2, A. Ridoskova2, M. Leermakers1 1Department of Analytical, Environmental and Geochemistry, Vrije Universiteit Brussel, Pleinlaan 2, 1050 Brussel, Belgium 2Department of Chemistry and Biochemistry, Mendel University in Brno, Zemedelska 1, 613 00, Brno, Czech Republic INTRODUCTION • 2 campaigns in 2019 and 2020, • 6 replicates of DGTs with each sorbent per station, • S01–HEM deploymen for 24 h, • HZ1 deployment for 28 days, • water samples collected at each station for comparison of the dissolved uranium concentration with the DGT-determined U concentration. MATERIALS & METHODS An improper selection of the binding phase can lead to providing skewed results that do not correspond to reality. The results of this study demonstrate that thorough testing of the DGT technique in a natural environment is a crucial prerequisite for obtaining reliable data and application of the DGT as a speciation tool. Using selective sorbents (such as Diphonix) may provide a DGT design that has the potential not only to quantify the labile fraction of uranium that may pose a risk to biota but may be used as a long-term monitoring passive sampler in seawater. CONCLUSIONS RESULTS OBJECTIVES How can be the performance of various DGT designs influenced by utilizing sorbents with different functional groups? Is any of the DGT design able to provide time- weighted average concentrations of U over the long deployment time in seawater? • Four tested sorbents: • Chelex -100, • Diphonix, • PIWBA, • Lewatit FO 36.UO22+OH-UO22+CO32-UO22+PO43-UO22+ Cl- UO2 2+ Downstream Upstream • Uranium shows typical conservative behaviour with increasing salinity along the Scheldt estuary. • Chelex-100 and Lewatit FO 36 are not suitable for application in seawater (salinity > 5 and 18, respectively). Both sorbents are not selective for U and their binding sites are therefore saturated by other competing ions occurring in the complex matrix of seawater. • PIWBA and Diphonix sorbents gels provide overall comparable results with very good agreement between the DGT-determined U concentration and dissolved U concentration at all stations. • Only DGTs utilizing Diphonix sorbent are able to provide reliable and accurate results for U determination even even after 28 days of deployment in seawater.station HZ128 PSU Salinity U (µg L−1) Station 0.0 1.0 2.0 3.0 4.0 5.0 0 10 20 30 2020 0.0 1.0 2.0 3.0 4.0 0 10 20 30 2019 HEM S04 S07 S01 S09 S12 S15 S22 U (µg L−1) Salinity HEM S04 S07 S01 S09 S12 S15 S22 Station Diffusion of labile U species from the solution 0 2 4 6 8 10 12 14 16 0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 S22 S15 S12 S09 S07 2020 0 5 10 15 20 25 30 0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 HEM S22 S15 S12 S09 S07 S04 S01 2019 0.0 1.0 2.0 3.0 2 28 U (µg L−1) Deployment time (days) Diphonix Chelex-100 Dow-PIWBA Lewatit FO 36 Dissolved Chelex-100 Chelex filter Diphonix PIWBA Lewatit FO 36 Dissolved Salinity
poster
A Tale of Two Telescopes: Identifying Kepler False Positives Using TESS Data Drake Lehmann𝟏and Andrew Vanderburg2,1 University of Wisconsin Madison1 and Massachusetts Institute of Technology2 We have also recreated a plot by Coughlin et al. (2014) in which we match Kepler Objects of Interest to themselves. In these plots, sigma P is the closeness in period, and sigma T is the closeness in the time of transit. The red box in the Coughlin plot “…corresponds to significant, real, physically caused matches” (Coughlin et al. , 2014). These matches are likely false positives. Current Results Next Steps and Conclusion Introduction There are many planet candidates identified by Kepler and TESS space telescopes that have yet to be confirmed as planets or false positives. False positives are signals that look like there is an exoplanet orbiting a star, but the exoplanet does not actually exist. There are many causes behind false positives. One common cause is background eclipsing binary stars. These eclipsing binaries emit enough light to contaminate the data of nearby stars, making it seem like there is an orbiting exoplanet. Another cause behind false positives are detector artifacts like column anomaly and image crosstalk. These technical problems causes smearing and pixel bleeding which can contaminate many stars with false positive signals. Having false positives in the catalogs of real planets damages the integrity of these lists. It is important that we identify these false positives and remove them from the sample of possible planets. This way, we boost our confidence in the surviving signals. In order to investigate possible false positives, we use a method called ephemeris matching. To do this, we combine data collected by TESS and Kepler space telescopes to create light curves from many unrelated stars that are close to each other. From these light curves, we can find the orbital period of exoplanet candidates and eclipsing binaries. However, if multiple light curves show the same period, then the exoplanet in question is likely a false positive. This is because it is very unlikely that two different and unrelated stars would give the same exact orbital period. We need data collected by TESS in addition to Kepler, because Kepler only collects data from specific pixels (see figure A for an example). However, TESS takes full frame images every 30 minutes. By combining both data sets, we can confirm or rule out more planets than either would by itself. We are currently working on incorporating TESS data into our code so we can use a sample of TESS data to search for Kepler matches. Michelle Kunimoto and Chelsea Huang have kindly provided a list of eclipsing binaries detected by TESS in the Kepler field which we are using to match against Kepler planet candidates. Once we’ve completed this work, we can be more confident in the surviving planets. Figure C is Coughlin et al. (2014)’s plot and figure D is our recreation. This shows us that our code is successful in matching Kepler data. Now that we know our code works, we can move onto incorporating TESS data into the code. So far, we’ve written code to plot the light curve of a star and line up the orbital period of the potential exoplanet with the dips of light. We’ve confirmed that this works by testing known false positives. On the right, we show an example of finding the light curve and matching the orbital period from another star close by. Because the lines line up with the dips, this is most likely a false positive. Approach Our first step is to write code that plots the light curves of stars from both Kepler and TESS that are close to each other and line up the orbital periods of the potential exoplanets. This is so we can see what a single false positive looks like in a plot. We show an example of this in figure B. Our second step is to write code that searches for ephemeris matches using the procedure provided by Coughlin et al. (2014). We will test this code on Kepler da
poster
Tomographie aux rayons X pour évaluer la composition corporelle des carcasses de porcs ibériques Maria FONT-I-FURNOLS, Albert BRUN, Marina GISPERT IRTA -Qualité du Produit, Finca Camps i Armet, 17121 Monells, Catalogne, Espagne maria.font@irta.cat Avec la collaboration de Albert ROSSELL, Adrià PACREU et Agustí QUINTANA (IRTA) Computed tomography to assess body composition of Iberian pig carcasses Iberian pigs are an autochthonous breed with a higher fat content than commercial white pigs. Computed tomography scanning allows non-destructive evaluation of carcass composition. The aim of this study was to assess, using computed tomography, the carcass composition of pure Iberian pigs and crossbreeds of Iberian pigs and white pigs to visualize differences in the distribution of fat and muscle in the anatomical regions of the ham and the loin. For this purpose, two 100% Iberian pig carcasses and four carcasses of crossbreeds of Iberian pigs (50%) were scanned with computed tomography equipment. The scanning procedure was helical, at 140 kV, 145 mA, a 512 × 512 matrix, and 10 mm thickness. Additionally, information on more than 120 carcasses of white pigs was used to obtain mean values. Images were analysed with a program purpose-built in Matlab and with VisualPork software. Results show both visually and quantitatively differences in the distribution of the volume of fat and of muscle in the three pig genotypes. The 100% Iberian carcasses had much more fat than lean. Fat and lean percentages were similar for the 50% Iberian carcasses. Finally, white pig carcasses had much less fat than lean. It can be concluded that carcass composition depends greatly on genotype and that computed tomography can visualize these differences without needing to cut carcasses. INTRODUCTION La race autochtone des porcs ibériques se caractérise par une teneur élevée en gras par rapport aux races « industrielles » de porcs blancs (Mayoral et al., 1999 ; Ayuso et al., 2014 ; Martínez-Mancipe et al., 2016). La tomographie aux rayons X permet d’évaluer la composition des carcasses d’une manière non destructive à la fois chez les animaux vivants et sur les carcasses (Font i Furnols et al., 2009 ; Carabús et al., 2014). L'atténuation des rayons X (mesurée en unités Hounsfield, HU) dépend de la densité du tissu traversé ; on obtient ainsi une image de l'intérieur du corps où chaque pixel a une valeur Hounsfield. Le maigre correspond à des valeurs HU positives et le gras à des valeurs HU négatives (Font i Furnols et al., 2009). Cette étude a pour objectif d’évaluer, avec la tomographie aux rayons X, la composition corporelle des carcasses de porcs ibériques de race pure, de porcs croisés ibériques et de porcs « blancs » pour visualiser les différences de distribution du gras et du maigre dans la région anatomique de la longe et du jambon. 1. MATERIEL ET METHODES 1.1. Carcasses Deux carcasses de porc 100% ibériques et quatre carcasses de porcs 50% ibériques – 50% Duroc ont été obtenues dans deux abattoirs. À 24-48 h post mortem les carcasses ont été radiographiées aux rayons X avec l’équipement General Electric HiSpeed Zx/I en mode hélice, 140 kV, 145 mA, matrice 512x512, 10 mm d'épaisseur, champ de vision 460 mm et algorithme de reconstruction STD+. Les données de plus de 120 carcasses de porcs blancs, radiographiées dans les mêmes conditions que les précédentes, ont été utilisées pour obtenir une valeur moyenne. 1.2. Analyse d’images Les images ont été analysées avec les logiciels Matlab (R2007b© MathWorks Inc., Natick, MA, USA) et VisualPork (Bardera et al., 2012). Le volume associé à chaque valeur Hounsfield a été obtenu pour chaque carcasse, et un volume moyen des carcasses de porc pour chaque génotype a été calculé. Pour la comparaison entre génotypes, le volume entre +1 et +130 HU a été considéré comme du maigre et le volume entre -120 et 0 HU a été considéré comme du gras. Le pourcentage de volume maigre par rapport au total (maigre + gras) a été calculé.
poster
PILOT 4 Durable fastening solutions production NON-DESTRUCTIVE INSPECTION SERVICES FOR DIGITALLY ENHANCED ZERO WASTE MANUFACTURING OBJECTIVE Improve the manufacturing process of high-quality large metric fasteners for the wind or aerospace industry to obtain a proper microstructure and hardness by means of non-destructive testing, increasing productivity and reducing the quantity of scraps. PARTNERS INVOLVED CONTEXT Manufacturing process of the fasteners Problems & needs Digital Twin models EXPECTED SCENARIO THE ZDZW PROJECT HAS RECEIVED FUNDING FROM THE EUROPEAN UNION’S HORIZON EUROPE PROGRAMME UNDER GRANT AGREEMENT NO 101057404. VIEWS AND OPINIONS EXPRESSED ARE HOWEVER THOSE OF THE AUTHOR(S) ONLY AND DO NOT NECESSARLY REFLECT THOSE OF THE EUROPEAN UNION. NEITHER THE EUROPEAN UNION NOR THE GRANTING AUTHORITY CAN BE HELD RESPONSIBLE FOR THEM EXPECTED IMPACT ON KPIs END-USER High-performance demanding sectors such as aerospace, energy and biomaterials require good fatigue and mechanical resistance. Induction heat treatment is the main manufacturing process of the fasteners that affect their microstructure and hardness. The objective is to predict the resulting microstructure and the mechanical hardness properties after the different heat treatments carried out, adjusting the necessary parameters to reduce the rejection rate.0 Heading Machine Induction heating machine for heading Thread rolling machine Induction Hardening Tempering furnace AE Insp. Equip. EMAT Ultrasonic Insp. Equip. Digital Twin ERP BIG DATA AI AE Integrity tool AI Hardeness and Microestructure Digital Twin AI EMAT Integrity tool Digital twin ↓ >2h set-up time Reduction of material waste 7.000kg/ year Part energy consumption ↓25% energy consumption Productivity ↑20 units/h Correlate induction processing parameters with the fasteners’ heat treatment, phase diagrams and final products NON- DESTRUCTIVE INSPECTION TECHNIQUES Monitoring the induction hardening process in real-time, acting as a diagnostic method for in- situ monitoring allowing traceability and ↓ scrap rates. Acoustic Emission (AE) inspection to ↓ uncertainty and variability of the production Digital Twin and AI to define the phase formation after hardening and tempering thermal processing to ↑ quality and ↑ consistent final products. 1. 2. 3. ZDZW INTEGRITY INSPECTION SUITE ZDZW solutions No real-time process control  fastener quality control is carried out at the end of the production process Considerable number of reprocessing operations Elevated volume of scraped material No in-situ inspection of microstructure and defects No feedback from the manufacturing processes
poster
Non-thermal plasma treatment of landfill leachate for detoxification of hazardous pollutants Visit the PROMISCES website for more information: https://promisces.eu/ This work is supported by the PROMISCES (Preventing Recalcitrant Organic Mobile Industrial chemicalS for Circular Economy in the soil- sediment-water System) project which has received funding from the European Union’s Horizon 2020 research and innovation program under Grant Agreement No 101036449. The equipment used in the investigation is from the Clean&Circle Center of Competence, Grant № BG05M2OP001-1.002-0019: "Clean Technologies for Sustainable Environment - Waters, Waste, Energy for a Circular Economy", financed by the Science and Education for Smart Growth Operational Program (2014-2020) and co-financed by the EU through the ESIF. P. Marinova1,3*, T. Bogdanov2,3, E. Benova3, M. Kirilova3,4, Y. Todorova3,4, I. Yotinov3,4, I. Schneider3,4, Y. Topalova3,4 1 Faculty of Forest Industry, University of Forestry, 1756 Sofia, Bulgaria 2 Medical University of Sofia, Faculty of Medicine, 1431 Sofia, Bulgaria 3 Clean & Circle Center of Competence, Sofia University, 1164 Sofia, Bulgaria 4 Sofia University “St. Kliment Ohridski”, Faculty of Biology, 1164 Sofia, Bulgaria (∗) plamena_dragozova@ltu.bg Cold atmospheric plasma as an alternative method for cleaner Environment Can the additional contaminants affect the degradation of PFAS? More information on poster P2-T10-62 In the treatment of wastewater and sludge with a high content of various pollutants, it is important how the additional contaminants affect the degradation of PFAS. The competitive reactions to the PFAS defluorination occurring during the treatment need to be investigated. Determining the dependence between the concentrations of contaminants as NOx and the suppression in degradation of persuasive compounds will help to increase the degradation ratio and to understand the mechanisms of PFAS degradation. Treatment with microwave plasma torch at continuous flow mode Interaction mechanism: PFAS concentrations in model water and leachate contaminated with Perfluorooctanoic acid (PFOA) Model water with PFAS PFAS C (ug/L) Perfluorooctanoic acid PFOA 2 Perfluoropentanoic Acid PFPeA 2 Perfluorodecanoic acid PFDA 2 Perfluorohexanoic acid PFHxA 2 Perfluorobutanoic acid PFBA 2 RONS in plasma treated model water contaminated with PFAS Treatment with microwave plasma torch at continuous batch mode Treatment with Beta at two configurations: underwater mode surface mode Wave power of 100 W, Argon flow 3 l/m, flow rate of 1.127 ml/min, batch treatment time 2 min Plasma treatment of samples distilled water with PFOA PFOA and RONS concentrations landfill leachate distilled water NO2 NO3 H2O2 Wave power of 30 W (underwater) and 25 W (surface), Argon flow 5 l/m, treatment time 10 min Beta device
poster
Joseph Naar1, François Forget1, Ehouarn Millour1 and Antoine Bierjon1 References: [1] Naar et al., (2021) 10.5194/epsc2021-559 [2] Madeleine, JB., et al. (2009), 10.1016/j.icarus.2009.04.037 [3] Madeleine, JB., et al. (2014), 10.1002/2014GL059861 1Laboratoire de Météorologie Dynamique, UMR CNRS 8539, Institut Pierre-Simon Laplace, Sorbonne Universités, UPMC Univ Paris 06, 4 place Jussieu, 75005, Paris, France. MARTIAN WATER ICE LATITUDE DEPENDENT MANTLE PREDICTED BY IMPROVED CLIMATE MODEL Converging geomorphological evidences point to the deposition of a “Latitude-Dependent Mantle” (LDM) of water ice on Mars up to ~30° latitude in both hemispheres, of age consistent with the latest obliquity rise to 35°. GCM studies can’t explain how ice would accumulate outside the polar regions assuming a permanent reservoir at the north pole like today. We present our simulations at 35° obliquity with the latest improvements of the Mars PCM, with a focus on albedo and thermal inertia. Guys pls give postdoc Introduction Mars PCM settings • 0.08 ecc., Lp=270° mild northern summer • TI feedback with ice accumulation [2] • Radiatively active H2O clouds (RACs) with improved nucleation scheme [1] • Latent heat of ground water ice sublimation /condensation [1] • Sentivity of water frost albedo : α= 0.33 ; α = 0.5 ; α = 0.7 Atmospheric humidity limited by latent heat of ground ice • Water vapor content is 10 times higher than present [2], or even 100 times higher with RACs [3] • Latent heat of ground ice reduces the NPC sublimation and limits atmospheric water vapor Frost deposition outside the polar regions • CO2 albedo parametrization • Improved H2O albedo parametrization : snowfall • Different orbital forcing • Sensitivity to the dust cycle • Planetary Evolution Model (PEM) : evolution of subsurface ice table and thermal inertia • PEM : Microclimate of slopes within PCM cells Future developments Contact me (please) : joseph.naar@lmd.ipsl.fr • NPC is ~20K warmer than present-day Mars • Increased albedo of frost affects the CO2 cycle and acts as a cold trap • Sublimation is maximal when α = 0.7 because of complex retroactions with RACs α= 0.33 : • No ice accumulation outside the NPC Latent heat cooling isn’t sufficient to prevent summertime sublimation α= 0.5 : • Ice accumulates outside the NPC at high latitudes in both hemispheres (not shown) α= 0.7 : • Multi-annual frost deposition down to ~60° latitude North • Thermal inertia feedback enhances ice accumulation Thermal inertia (TI) : • Set to 800 J.m−2.K−1. s− 1/2 in the PCM (lower limit for ice) • TI feedback alone doesn’t allow ice accumulation outside the Northern Polar Cap Main results : • First GCM simulations to compute RACs and latent heat of ground ice at 35° obliquity : « only » ten times more humid than present • Using the NPC as an initial ice reservoir, ice can accumulate outside the polar region if summer sublimation is dampened, by higher frost albedo (e.g. due to snowfall) or increased thermal inertia (pore filling or consolidated subsurface ice) Excursion to 35° obliquity increases insolation and sublimation of the NPC: The Northern Polar Cap (NPC) I would be glad to work with you !
poster
Actividad Cueva Emiral (ss. VII-X) Plenomedieval (ss. X-XIII) "La cerámica medieval y moderna de la prospección del proyecto Verasur en la depresión de Vera” Alba Mª Molina Fernández (Universidad de Granada) e.albammf95@go.ugr.es "I Congreso Internacional de Arqueología Bayra. La producción cerámica en el siglo XVI. Bayra y el sureste de la península ibérica, desde el Mediterráneo al Atlántico" Nuestro estudio se ha basado en la identificación mediante la observación macroscópica, el dibujo arqueológico y la comparación bibliográfica de cerámicas medievales y modernas recogidas en la prospección que realizó el proyecto Verasur en la cuenca de Vera en 2021. Dicho proyecto, dirigido por por M. Murillo Barroso y B. Legarra Herrero, estuvo financiado por la Este póster muestra algunos de los resultados que forman parte de un trabajo más extenso que será presentado como Trabajo de Fin de Máster tutorizado por A. García Porras y mentorizado por M. Alonso Valladares. Si bien el TFM desarrollará objetivos más diversos, en este póster nos centraremos en la localización de los yacimientos en los que hemos reconocido cerámicas medievales y modernas y sus posibles afecciones a través de la observación de elementos del paisaje. La depresión de Vera se sitúa en una amplia llanura del área centro-septentrional de Almería que se ve atravesada por el paso de los ríos Almanzora, Antas y Aguas. Se trata de un espacio de amplias llanuras que se dispone entre el mar Mediterráneo al este y un paisaje montañoso hacia el interior conformado por las sierras Almagrera, Almagro, Lisbona, Bédar y Cabrera. Estas aptitudes geográficas han favorecido que se trate de una zona nuclear de ocupación humana. Se trata de un yacimiento que L. Siret nombró originalmente “Cabezo del Pajarraco” y en el que señaló restos neolíticos y protohistóricos. En la actualidad queda dividido en dos áreas por el paso de la carretera Vera-Garrucha, lo que, junto a la excavación de trincheras durante la guerra civil, ha alterado el yacimiento. También encontramos cuevas y estructuras que pueden haber contribuido a su afección. Se han identificado restos cerámicos de todas las etapas a excepción de la nazarí (ss. XIII-XV). 1.A: tinaja de borde entrante engrosado. Este tipo de cerámicas de almacenamiento se caracterizan por presentar un borde que se une al cuerpo, sin cuello, resultando similares al dolium romano. Aunque perduran aún en época emiral, son mayormente comunes durante la tardoantigüedad. 1.B: base de almacenamiento. Presenta una pasta bastante tosca con signos de haber sido confeccionada a torno y a mano. Este tipo de fabricaciones mixtas se mantienen en el sureste peninsular hasta el s. VIII. 1.C-D: jarrita/o que presentan decoración pintada en manganeso. Este tipo de producciones son muy populares en el sureste peninsular entre los ss. X- XIII perdurando hasta finales de época nazarí. 1.E: mortero de base plana y vidriado verde al interior. Podemos datarlo entre los ss. XV-XVI. 1.F: base de plato con fondo estannífero. Llama la atención el salto cronológico de ocupación en la zona, ya que sólo hemos identificado cerámicas tardoantiguas y modernas. Quizá estas últimas estén relacionadas con el comienzo de la explotación agrícola en la zona en épocas más recientes. Cabezo María se encuentra sobre un cerro volcánico de la Sierra de Bédar (Antas). Domina la depresión de Vera con una altura máxima de 256 m.s.n.m. Lo corona la ermita de Santa María que le da nombre (s. XVI). La bibliografía académica afirma que en Cabezo María aparecen indicios del que podría haber sido el poblado altomedieval más extenso encontrado en la depresión de Vera. Sin embargo, a día de hoy se encuentra diseminada por canteras y estructuras que podrían haber favorecido su pérdida. A sus pies queda Qurénima, una necrópolis descubierta por los hermanos Siret a finales del s. XIX. Habría funcionado durante el Bronce y el Primer Hierro. En la actualidad está llena de campos de cultivo y de embalses de
poster
EFSA Partnering Grants- ListeriaPredict: A case study in capacity building at EU level in predictive microbiology F. Butler, U. Gonzales Barron, V. Cadez, L.Iannetti, A. Valero Diaz, G. Redmond, K. Hunt The objective of EFSA Partnering Grants is to enhance capacity across Europe in risk assessment. The focus of ListeriaPredict is applying predictive microbiology techniques to shelf-life studies on Listeria monocytogenes in ready-to-eat foods. Listeria monocytogenes continues to be a major hazard of concern in many ready to eat foods. Predictive microbiology techniques have a critical role in interpretating experimental challenge test data (Fig 1) Introduction • Four partners across Europe form the ListeriaPredict Project - UCD Ireland, IPB Portugal, IZSAM Italy, UCO Spain Methodology The Partnership will train key personnel in recent predictive microbiology advances including Dynamic modelling and Global modelling through focussed workshops and webinar events. Results To date a number of workshops and webinars have taken place across Europe, including: • Workshop - Basic Bioinformatics Skills Relating to Using Genotypic /Phenotypic techniques for Risk Assessment, Dublin November 2021 • Webinar – Case studies on food safety, Dublin May 2022 • Workshop - Modern Predictive Microbiology Analysis in R (PredMicro 2022), Braganza, June 2022 Conclusions Acknowledgments This project directly aligns with the specific objectives of EFSA to promote the building of risk assessment capacity within university and research agencies across Europe. This project ‘showcases’ how small focussed actions can deliver significant impact contributing to the overall goals and objectives of EFSA. The project demonstrates how building and sharing of capacity at organisational level can be achieved through the strategic choice of partners across Europethat each have individual expertise within key elements of predictive microbiology. Further information ListeriaPredict would like to acknowledge the financial assistance of EFSA, AGREEMENT NUMBER – GP/EFSA/ENCO/2020/03 Partnering grants – GA 3, Application of novel predictive microbiology techniques to shelf-life studies on Listeria monocytogenes in ready-to-eat foods Growth curves for L. monocytogenes stored at the three temperatures ( 4.5 oC, * 7.8 oC, 12 oC) predicted by omnibus modelling Participants at a recent ListeriaPredict meeting in Spain, March 2022 For further information, contact the Project coordinator, Francis Butler, UCD, f.Butler@ucd.ie Project website: www.ipb.pt/listeriapredict/
poster
Nationale Forschungsdateninfrastruktur (NFDI) e.V., Albert-Nestler-Str. 13, 76131 Karlsruhe, Vorstand: Prof. Dr. York Sure-Vetter; Eva Lübke (V.i.S.d.P.), Stand: März 2023Unser Ziel: Datenkompetenz im Wissenschaftskontext fördern Die Angebote und Anforderungen an Datenkompetenz Weiterbildungsangebote für Wissenschaftler:innen sind vielfältig und werden in verteilten Systemen bereitgestellt. Das vom BMBF geförderte Projekt Datenkompetenz in NFDI unterstützt durch die gezielte Vernetzung der verschiedenen Akteure den ganzheitlichen und nachhaltigen Aufbau von Datenkompetenz für Wissenschaftler:innen. Angestrebte Ergebnisse: • Bereits bestehendes Angebot zum Thema Datenkompetenz in NFDI erfassen • Weiterführende Bedarfe zum Thema Datenkompetenz in NFDI identifizieren • Zielgruppenorientierte Lösungen und Konzepte entwickeln • Monitoringkonzept entwickeln, um Wirksamkeit der Ansätze langfristig zu überprüfen Expert:inneninterviewsPhase: Basis Ziel: • Identifikation des Bestands und der Bedarfe von Trainingsangeboten im Bereich Datenkompetenz und möglicher Messwerte von Datenkompetenz im Kontext NFDI. • Aufdeckung möglicher Lücken im Aufbau von Datenkompetenz in NFDI und Entwicklung potentieller Strategien zur Behebung, insbesondere durch Nutzung des NFDI-Netzwerkes.Umsetzung: • Durchführung von 9 Expert:inneninterviews.Ergebnis: • Interviews befinden sich derzeit in der Auswertung. Community Workshop I Phase: BasisZiel: • Datenkompetenz Angebote vernetzen und sichtbar machen. • Diskussion über Herausforderungen der Community. Umsetzung: • 4-stündiger virtueller Workshop • Interaktive Break-out Sessions • 186 Teilnehmer:innenErgebnis: • Kartierung der Datenkompetenzangebote auf einer Landkarte. • Basis einer fortführenden Workshopserie.Status Erfassung Phase: Basis Ziel: • Gewinnung eines Überblicks über Aktivitäten und vorhandener Ressourcen im Bereich Datenkompetenz Traniningsangebote.Umsetzung: • Vernetzungsgespräche mit NFDI Konsortien. • Vernetzung über NFDI hinaus. • Recherche.Ergebnis: • Aufbau einer Sammlung bestehender Datenkompetenzangebote. • Sichtbarmachen von Schulungsmaterialien und Weiterbildungsangeboten. • Vernetzung dezidierter Angebote.Anbindung an NFDI-SektionEduTrain Datenkompetenz von Anfang an! Die Sektion befasst sich mit dem Aufbau von Datenkompetenz mit Fokus auf Forschungsdatenmanagement und hochschulbasierter Lehre. Das Projekt arbeitet mit der Sektion zusammen und nutzt Synergieeffekte. Online-UmfragenPhase: Realisationwww.nfdi.de/datenkompetenz/ Ansprechpartnerinnen: Anne Lehmann Sarah Day anne.lehmann@nfdi.de sarah.day@nfdi.de +49 721 988 994 28 +49 721 988 994 27KEY Messages für Phase: Basis • Datenkompetenz wird zur Kernkompetenz von Wissenschaftler:innen. • Die vielfältige Angebotslandschaft muss auffindbar gemacht werden. • Synergien der Akteur:innen sollten genutzt werden.
poster
Asteroseismology of Ruprecht 147 Mikkel N. Lund1∗, Jason L. Curtis2, Allyson Bieryla3, Luca Casagrande4, David W. Latham3, Karsten F. Brogaard1, Andrea Miglio5,6, Sarbani Basu7, J. M. Joel Ong7,8, Aldo M. Serenelli9,10, et al. Introduction Ruprecht 147 (NGC 6774) is the nearest old open cluster, located at a distance of approximately 300 pc and with an age of around 2.5 Gyr. Initially discovered by Ruprecht in 1966, the cluster remained largely unnoticed for decades until it was “re-discovered” by Curtis et al. in 2013. Since then, it has been the focus of several studies, particularly on the calibration of gyrochronology (e.g., Curtis et al., 2020). During Campaign 7 of the K2 mission (Howell et al., 2014), many known members of Ruprecht 147 were targeted for ∼1-min cadence observations. Additionally, the central part of the cluster was observed with a superstamp at a 30-minute cadence (Figure 1). In this study (Lund et al., in prep.), we are performing a detailed asteroseismic analysis of Ruprecht 147, aiming to establish it as one of the best asteroseismically constrained open clusters available. Fig. 1: Left: Sky plot containing part of Ruprecht 147. Circular and triangular markers indicate targets from Curtis et al. (2013); Red and gold markers indicate targets observed during K2 C7 for which pixel stamps were defined by the mission. Seismic signals were detected for the gold ones. Right: K2 superstamp superstamp with targets given as in the left panel. Methods All data from K2 were processed using the K2P2 pipeline (Lund et al., 2015). The power density spectra for all targets were searched for asteroseismic excess power, and global asteroseismic parameters were measured for stars with identified excess power. Individual mode frequencies were extracted for a subset of these stars using peak-bagging techniques (following Lund et al., 2017; Davies et al., 2015). Spectroscopic observations for the asteroseismic targets were obtained using the Magellan Inamori Kyocera Echelle (MIKE) and the Tilling- hast Reflector Echelle Spectrograph (TRES). A smaller subset of tar- gets was observed using the UVES and GIRAFFE spectrographs on the FLAMES instrument at VLT. Additionally, effective temperatures were measured using the infrared flux method (IRFM; Casagrande et al., 2020). 1Stellar Astrophysics Centre, Aarhus University, DK (∗mikkelnl@phys.au.dk) | 2Department of Astronomy, Columbia University, USA | 3Center for Astrophysics, Harvard- Smithsonian, USA | 4Research School of Astronomy and Astrophysics, Mount Stromlo Observatory, The Australian National University, AUS | 5INAF - Osservatorio di As- trofisica e Scienza dello Spazio, Bologna, ITA | 6Department of Physics and Astronomy, Università di Bologna, Bologna, ITA | 7Department of Astronomy, Yale University, USA | 8Institute for Astronomy, University of Hawai‘i, Honolulu, USA | 9Institute of Space Sciences (ICE, CSIC) Campus UAB, ESP | 10Institut d’Estudis Espacials de Catalunya (IEEC), Barcelona, ESP Results We have extracted asteroseismic parameters for a total of 33 members of Ruprecht 147. What sets Ruprecht 147 apart from other clusters studied using asteroseismology is that oscillations can be analyzed for stars ranging from the main-sequence (MS) to the red giant branch (RGB), as shown in Fig. 2. Importantly, several of the asteroseismic stars reside near the cluster turn-off, where isochrones are most distin- guishable. 10 20 30 40 50 60 EPIC 219437560 400 600 800 10 20 30 40 EPIC 219630458 600 800 1000 1200 10 20 Power density (ppm2 /µHz) EPIC 219495504 600 800 1000 Frequency (µHz) 10 20 EPIC 219684426 600 800 1000 1200 0 400 800 1200 1600 Frequency (µHz) 10 20 EPIC 219609927 0.0 0.2 0.4 0.6 0.8 1.0 Frequency mod ∆ν (∆ν) 800 1000 1200 1400 1600 0 10 20 30 40 Frequency spacing (µHz) PS ⊗PS 0 10 20 30 40 50 Frequency spacing (µHz) PS ⊗PS 0 10 20 30 40 50 Frequency spacing (µHz) PS ⊗PS 0 10 20 30 40 50 60 Frequency spacing (µHz) PS ⊗PS 0 10 20 30 40 50 60 70 Frequency s
poster
This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No 862357 Legume-based intercropping: A pathway to reduced N2O emissions from agriculture? Methods Treatments Barley (Hordeum vulgare ‘Laureate’) and pea (Pisum sativum ‘Prophet’) were planted in isolation (Sole crop) and together (Intercrop) using three fertilizer rates (Table 1) Plots organized in a randomized block design, replicated four times (Fig 1). Luke Harrold, Kairsty Topp, Christine Watson & Robin Walker Introduction Intercropping of legumes with cereal crops can play a crucial role in the path towards sustainable agriculture and achieving net-zero. Literature and IPCC report suggests a reduction in N2O emissions in legume intercropped systems. However, reductions have been shown to be dependent on the variety of pea used. We tested if legume-based intercropping systems (pea/barley) can support sustainable farming by balancing environmental (N₂O emission, soil health) and economic (yield) goals. Figure 2 – Gas sampling from static chamber. Two static chambers per subplot. Photo by Robin Walker. Results Nitrous oxide emissions Intercrop with half-rate or without added N emitted the same amount of N2O over a 114 day period as sole barley with full-rate N addition (Fig 4). With no synthetic nitrogen addition the pea treatment maintained a cumulative N2O emission that does not significantly differ from the barley which received 120 kg N ha-1 (Fig 4). N₂O flux closely linked to soil water content, peaks corresponding to higher soil moisture (Fig 3). N addition to barley doubled mean N₂O emissions over 114 days compared to no-N barley (Figure 4). Periodically soil samples were taken to determine mineral N (NH4 + and NO3 -). Soil moisture and temperature probes measured continuously on an hourly basis. Conclusions Intercropping of these varieties of barley and pea failed to reduce N2O emission over 114 days even with no synthetic nitrogen addition. Pea added sufficient nitrogen to maintain the same yield-to-seed ratio for barley as the full rate fertilizer treatment and a half rate of N led to a greater barley yield-to-seed ratio when intercropped. Other pea varieties have been shown to reduce N2O in intercropping systems suggesting that the right mix of cereal/legume would need to be found for particular soil types/region. Figure 4 – Cumulative emission of N2O over 114 days Treatment Fertiliser Sole crop Barley (Laureate) Full N 120 kg/ha Sole crop Pea (Prophet) No N Intercrop Barley/Pea No N Intercrop Barley/Pea Half N 60 kg/ha Sole crop Barley No N Table 1 – Crop treatment including fertilizer addition Figure 3 – N2O flux and soil moisture over 74 days. Solid lines show the flux of N2O over time with the left-hand y-axis. Dashed lines show the soil moisture content (%) overtime with the right-hand y- axis. Standard error is shown. Gas sampled from chambers on days 1,2,4,8 and 10 then twice a week for four weeks followed by once per month until experiment end. N2O concentration measured via gas chromatograph. Also measured Bulk density Infiltration Soil carbon (POXC) Soil structure (VESS) Earthworm count Figure 1 – Plot layout, external plots used for GHG sampling (Fig 2) and destructive harvesting (described below) and internal plots used for yield. @SoilandGas Figure 5 – a) Yield of barley, the mass of pea has been removed b) barley yield normalised by sowing rate Much of the N2O derived from the pea-only treatment seems to be associated with a wetting event. A similar peak is evident in the barley with full nitrogen addition but to a lesser degree. Yield Despite having half the sowing rate, the two intercrop treatments have the same yield as the unfertilised barley (Bar_NoN) treatment at full sowing rate (Fig 5a). Similarly, despite receiving no fertilizer the unfertilised intercrop achieved half the yield of the fertilised full sowing rate barley (Bar_FullN) resulting in the same yield per
poster
Results: Broad range of retained atmospheric masses Observational implications Residual H/He Atmospheres of Super-Earths William Misener & Hilke Schlichting (University of California, Los Angeles) Full paper: MNRAS 503:5658 TESS Science Conference 2 – August 2021 Figure 4: Evolution in atmospheric mass fraction f with time for two sets of planets: (a) with set Teq and varying Mc and (b) with set Mc and varying Teq. Dots mark time at which tcool=tloss Figure 6: Contours of log10fret, in orange, for finit=0.03. Super-imposed are planets with well-measured radii and masses. TESS planets are marked by crosses, those discovered by others are marked by dots. Planets are colored by their K band magnitude (planet data from Exoplanet Archive) • Fig. 6 demonstrates many known planets, including TESS discoveries, could have retained substantial residual atmospheres after core-powered mass loss • A number of these planets are amenable to further characterization with transmission spectroscopy • Such studies will be able to distinguish residual H/He atmospheres from those composed of heavier outgassed species • Mass fraction retained varies orders of magnitude across super- Earth regime, from <10-8 (negligible) to 10-2 (sub-Neptune) • Generally matches analytic trends • Exact values vary due to variation in Rrcb at which tcool=tloss • After spontaneous mass loss, if planet maintains atmosphere with larger heat capacity than its core, atmosphere will cool and contract, cutting off atmospheric mass loss →sub-Neptune (Fig. 1a) • If core has larger heat capacity than atmosphere, Ccore > Catm, its cooling will inhibit contraction, leading to continued mass loss →super-Earth • If planet can never cool more quickly than it loses mass →atmosphere entirely stripped (Fig. 1b) • If it can cool more quickly, atmosphere resumes contraction and mass loss ceases →thin H/He atmosphere saved (Fig. 1c, Fig. 2) Figure 1: schematic of the evolution of sub-Neptune and super-Earth planets from disk dispersal. Super-Earth atmosphere evolution References • Retained atmospheric mass is f at which tcool becomes shorter than tloss • Analytic form (plotted in Fig. 3): • Higher mass and lower equilibrium temperature planets retain more massive primordial atmospheres • Assumes Rrcb=2Rc when timescales become equal fret / M 3/2 c T −1/2 eq exp [M 3/4 c T −1 eq ] Main Takeaways Motivation • Previous work has shown core-powered mass loss can reproduce the observed dichotomy of super-Earths and sub-Neptunes (e.g., Ginzburg et al. (2016), Gupta & Schlichting (2019), Berger et al. (2020)) • But what is the long-term imprint of this mass loss process on super-Earth atmospheres? Mechanism • As core-powered mass loss unbinds overlying atmospheres, super-Earth cores can cool more quickly • These planets’ cooling timescales eventually become shorter than their mass loss timescales, allowing super-Earths to keep small residual H/He envelopes Results • The mass of these retained envelopes increases with planet mass and semi-major axis • The retained atmospheric mass fraction, fret, ranges from <10-8 to 1% of the planet’s total mass and is of order 10-3 for a 5 Earth mass planet at Teq = 1000 K Importance • Retaining such quantities of H/He reduces the atmosphere's mean molecular weight compared to an outgassed secondary atmosphere • This signature could be observable today or in the near future via transmission spectroscopy (e.g., Benneke & Seager (2012), Fortney et al. (2013), Greene et al. (2016)) • Large amounts of retained H/He after core-powered mass loss would affect the early geochemistry and rock-atmosphere interactions of this common class of planet (e.g., Wordsworth et al. (2018), Doyle et al. (2019), Seager et al. (2020)) • It therefore affects their potential habitability • Such tenuous atmospheres may be susceptible to further processing, e.g. by long-term photo- evaporation • TESS and related missions have found and continue to find excellent candidates to test these
poster