Split (1)

train · ~97.7M rows (showing the first 849k)

text stringlengths 144 682k
Microsoft: UPS as energy storage Associated, at first glance, primarily with software, Microsoft does not have very much to do with energy storage. This Redmond giant is, however, working to use the UPS infrastructure in its datacenters for other purposes. Uninterruptable power supply, or UPS, is a power adapter, which also protects computer hardware from dire consequences of brief power shortages. Naturally, a UPS appliance contains a more or less miniature battery, which allows a computer to operate uninterruptedly during brief power failures or allows a computer to backup data and shut down in a controllable manner[1]. Actually, there are models that are capable of sustaining power for as long as many hours. Microsoft, obviously, does not focus on UPS units of single computers or even those from local networks. The American tech giant has multiple powerful datacenters which are used for various purposes – from own data processing to storing users’ data in clouds. Such a datacenter consumes significant amounts of power and to ensure security of data, it has its own independent power supplier. But it, of course, must be backed up by a properly sized battery and this is what is going to be additionally used. So far they have been a liability and we now want them to become a valuable asset – Microsoft experts explain. What is the plan? First, it is necessary to replace lead-acid batteries used in big UPS units with much better lithium-ion batteries. Despite their higher prices, lithium-ion cells may sustain much more charge cycles[2]. It is also easier to manage the charge cycles. Microsoft’s R&D division is planning to introduce a certain type of lithium-ion batteries, namely the lithium-iron-phosphate ones. They have slightly worse characteristics than those of the most sophisticated batteries but are much cheaper as the cathode is made of compounds of iron and not of much more expensive manganese or cobalt. With the stored energy effectively managed, such a UPS does not need to remain unused and await power failure. It may be used, for instance, as a temporary power backup for the power network, activated to instantly counterbalance dangerous frequency fluctuations in power networks usually caused by workload changes. Microsoft wants to refine the technology, which on one hand will protect the datacenter and use its resources to enhance network operations. Extension of the datacenter power system is just the first step in Microsoft’s plans. The company declares to minimize its datacenters’ environmental impact by powering them up with green energy sources. Biogas is already being tested but Microsoft is also experimenting with installing servers in underwater containers within its Project Natick[3]. Deploying data-processing machines underwater eliminates the need for cooling and it is air-conditioning and heat radiation which consumes a big portion of the power used by server farms. 864 servers were deployed on the seafloor near Scotland and they are additionally powered by wind and solar energy. According to the creators of this project, the computers are going to operate with no need for maintenance or risk of container leaks for at least 5 years. [1] https://en.wikipedia.org/wiki/Uninterruptible_power_supply [2] https://www.greenbiz.com/article/microsofts-energy-master-plan [3] https://news.microsoft.com/features/under-the-sea-microsoft-tests-a-datacenter-thats-quick-to-deploy-could-provide-internet-connectivity-for-years/
What are smart contracts? Difference between smart contracts and conventional ones Why are smart contracts considered as "contracts?" How do they differ from traditional ones? Here we'll study about cryptocurrency's hottest innovation: programs that can automate a monetary relationship based on code. Conventional contracts Conventional contracts are agreements that define stakeholder relationships, be it related to a transaction, inheritance or consumption. Typically, valid standard contracts are enforceable by law, meaning if you decide not to honour the terms of a contract, you are vulnerable to legal recourse. However, you are not physically forced: there is always a trust factor to consider before entering a contractual relationship with a peer. Going legal is at the end of the day an inefficient and resource draining exercise that (most) people would like to avoid. The current legal and judiciary system may take years to resolve a litigation, and sometimes decades in some jurisdictions. Smart contracts Smart contracts try to solve this issue by automating the terms of an agreement with a few lines of code. They are computer programs that execute pre-defined contractual conditions, at a certain point of time, to ensure an agreement is ultimately honoured. In other words, a smart contract is a programmed transaction protocol that runs desired operations depending on pre-defined scenarios. It does not have to be a legal contract per se, rather, it aims to minimise the risks of bad faith, make sure an agreement is honoured and automate tasks. Here’s a quick recap of the difference between both. • Smart contract agreements are always honoured. Since it is a computer program, the outcome will be automated as per the initial terms and conditions. • If a formal agreement is not honoured, parties may remind each other, send follow-ups, renegotiate the terms or undertake legal action. Ethereum allows developers to smart code contracts on top of its blockchain using its programming language, Solidity. Rather than “smart contracts” which is a term introduced in the 1990s, Ethereum refers to them as “automated agents” in its white paper, because it enables the issuance of large-scale computing operations between users and other smart contracts. Smart contract case study It might be hard to conceptualise at first so let’s have a look at a real-life smart contract use-case: 1. Alice and Bob decide to bet a fraction of their savings on the occurrence of an event. 2. Alice wins the bet if the S&P 500 reaches its lowest 10-year performance in the next month. 3. If the condition isn’t met within 15 days, Bob loses. Conventional agreement 1. Alice and Bob enter an agreement (handshake, contract). 2. Both track the S&P performance manually. 3. Alice wins the bet. At this point, there are 3 possible outcomes: • Bob pays up • Bob delays payment • Bob refuses to pay up In a conventional agreement, we can therefore affirm that: • Alice and Bob have to track the event manually. • Bob might breach the agreement. Smart contract automate interactions 1. Alice and Bob create a smart contract that automates the terms of the agreement and tracks S&P performance. 2. Both send the money to the smart contract that will release the funds, either at the end of the month, or when S&P reaches the predefined metric. 3. Alice wins the bet. Here, the smart contract releases the funds automatically to Alice. Programming the bet on a smart contract offers two tangible benefits: • Alice and Bob do not need to track the S&P 500. A smart contract automates this task and rewards the winner accordingly. • They send the money to the smart contract, which disburses the funds directly to the winner. It reduces any risk of bad faith in an agreement and avoids any disputes because it is automated. Creating such interactions would typically require multiple steps: • Set the conditions of the bet (deadline, participants, etc.) • Check S&P 500 performance. • Hold the money and disburse to the winner based on the above. Running smart contracts on the network has a cost, and it depends on the computing power required to execute it: this is when Ether transaction fees come in the picture. The same way ERP and CRM automate supply chain and client communication, smart contracts can automate any real-life interaction.
« Back How did the qwerty keyboard become so popular? 04/24/2019 13:25:29 \| Views: 46 Article of It isn't easy to type "QWERTY" on a qwerty keyboard. My left-hand little finger holds the shift key, then the other fingers of my left hand clumsily crab sideways across the upper row. Q-W-E-R-T-Y. There's a lesson here: it matters where the keys sit on your keyboard. There are good arrangements and bad ones. Many people think that qwerty is a bad one - in fact, that it was deliberately designed to be slow and awkward. Could that be true? And why do economists, of all people, argue about this? It turns out that the stakes are higher than they might first appear. How did the qwerty keyboard become so popular? But let's start by figuring out why anyone might have been perverse enough to want to slow down typists. In the early 1980s, I persuaded my mother Deb to let me use her mechanical typewriter, a miraculous contraption which would transcend my awful handwriting. When I hit a key, a lever would flick up from behind the keyboard and whack hard against an inked ribbon, squeezing that ink against a sheet of paper. On the end of the lever - called a type bar - would be a pair of reversed letters in relief. I discovered that if I hit several keys at once, the type bars all flew up at the same time into the same spot. Fun for a nine-year-old boy, less so for a professional typist. Typing at 60 words per minute (wpm) - no stretch for a good typist - means five or six letters striking the same spot each second. At such a speed, the typist might need to be slowed down for the sake of the typewriter. That is what qwerty supposedly did. Then again, if qwerty really was designed to be slow, how come the most popular pair of letters in English, T-H, are adjacent and right under the index fingers? The plot thickens. The father of the qwerty keyboard was Christopher Latham Sholes, a printer from Wisconsin who sold his first typewriter in 1868 to Porter's Telegraph College, Chicago. That bit's important. The qwerty layout was designed for the convenience of telegraph operators transcribing Morse code - that's why, for example, the Z is next to the S and the E, because Z and SE are indistinguishable in American Morse code. The telegraph receiver would hover over those letters, waiting for context to make everything clear. So the qwerty keyboard wasn't designed to be slow. But it wasn't designed for the convenience of you and me, either. So why do we still use it? The simple answer is that qwerty won a battle for dominance in the 1880s. Sholes' design was taken up by the gunsmiths E Remington and Sons. They finalised the layout and put it on the market for $125 - perhaps $3,000 (£2,271) in today's money, many months' income for the secretaries who would have used it. It wasn't the only typewriter around - Sholes has been described as the "52nd man to invent the typewriter" - but the qwerty keyboard emerged victorious. The Remington company cannily provided qwerty typing courses, and when it merged with four major rivals in 1893, they all adopted what became known as "the universal layout". And this brief struggle for market dominance in 1880s America determines the keyboard layout on today's iPads. Nobody then was thinking about our interests - but their actions control ours. And that's a shame, because more logical layouts exist: notably the Dvorak, designed by August Dvorak and patented in 1932. It favours the dominant hand (left and right-hand layouts are available) and puts the most-used keys together. The US Navy conducted a study in the 1940s demonstrating that the Dvorak was vastly superior: training typists to use the Dvorak layout would pay for itself many times over. So why didn't we all switch to Dvorak? The problem lay in co-ordinating the switch. Qwerty had been the universal layout since before Dvorak was born. Most typists trained on it. Any employer investing in a costly typewriter would naturally choose the layout that most typists could use, especially when economies of scale made it the cheapest model on the market. Dvorak keyboards never stood a chance. So now we start to see why this case matters. Many economists argue qwerty is the quintessential example of something they call "lock in". This isn't really about typewriters. It's about Microsoft Office and Windows, Amazon's control of the online retail link between online buyers and sellers, and Facebook's dominance of social media. If all your friends are on Facebook apps such as Instagram and WhatsApp, doesn't that lock you in as surely as a qwerty typist? This matters. The lock-in is the friend of monopolists, the enemy of competition, and may require a robust response from regulators. But maybe dominant standards are dominant not because of lock-in, but just because the alternatives simply aren't as compelling as we imagine. Consider the famous Navy study that demonstrated the superiority of the Dvorak keyboard. Two economists, Stan Liebowitz and Stephen Margolis, unearthed that study, and concluded it was badly flawed. They also raised an eyebrow at the name of the man who supervised it - the Navy's leading time-and-motion expert, one Lieutenant-Commander… August Dvorak. Liebowitz and Margolis don't deny that the Dvorak design may be better: the world's fastest alphanumeric typists do use Dvorak's layout. In 2008, Barbara Bradford was recorded maintaining a speed of 150 words per minute (wpm) for 50 minutes, and reached a top speed of 212 wpm using such a keyboard. But they were just not convinced that this was ever an example where an entire society was desperate to switch to a hugely superior standard yet unable to co-ordinate. And in fact these days, most of us peck away at our own emails, on devices which can actually let you switch your keyboard layout. Windows, iOS and Android all offer Dvorak layouts. You no longer need to persuade your co-workers, other employers and secretarial schools to switch with you. If you want it, you can just use it. Nobody else is even going to notice. Yet most of us stick with qwerty. The door is no longer locked, but we can't be bothered to escape. Lock-in seems to be entrenching the position of some of the most powerful and valuable companies in the world today - including Apple, Facebook and Microsoft. Maybe those locks are as unbreakable as the qwerty standard once seemed. Or maybe they risk being crow-barred off if restless consumers are tempted by something better. After all, it wasn't that long ago that people worried about users being locked in to MySpace. Read the original article « Previous entryNext entry » Popular posts How to Type Faster II. A short and sweet video with tips on how to type faster by Howcast. Submitted 82 days ago \| Views: 122 Best wired keyboard You could buy in 2019 Submitted 51 days ago \| Views: 111 Get a Decoy Keyboard for Your Cat to Enjoy Submitted 55 days ago \| Views: 93 Submitted 47 days ago \| Views: 91 QwerkyToys Qwerkywriter S mechanical keyboard review As I’m sure the Gadgeteer Kid, my wife, and many friends & family would attest to, I’m pretty old school. While I do love tech-toys and modern c... Submitted 47 days ago \| Views: 90 Logitech’s keyboard case puts the 'pro' in iPad Pro Submitted 47 days ago \| Views: 89 AZIO RCK Retro Compact Keyboard review Do you like a minimalist keyboard with shallow keys and a modern style to go with your high tech computer or do you like to change things up and go with an eye-... Submitted 50 days ago \| Views: 87 Blackmagic Design Resolve Editor keyboard Submitted 42 days ago \| Views: 86 Finally you can close the instructions modal window with any keypress Submitted 49 days ago \| Views: 85 Top 5: Best Ergonomic Keyboards You Can Buy Now Submitted 51 days ago \| Views: 83
Are You Healthy? If you look good and feel great, does that make you healthy? Not necessarily. So what does being healthy actually mean? Whether it's the latest health scare or the newest fad diet, there's almost always something health related in the news. However, most of these stories never really discuss what it to be healthy. Health is More Than How You Feel The World Health Organization, defines health as "a state of complete physical, mental and social well-being and not merely the absence of disease or infirmity." However most people tend to ignore their health until obvious symptoms arise. This is a reactive approach to health as opposed to a proactive approach. So let's flip the approach around and get proactive with the help of regular chiropractic care to get you healthy and keep you healthy. Chiropractic: A Proactive Approach to Health Most people seek out the help of a chiropractor due to back or neck pain (reactive approach) Once they learn more about how chiropractic care can restore their nervous system, they typically choose to stick with chiropractic for good. Consider it wellness care (proactive) that you'll receive regularly even if you feel great. Visiting a chiropractor when you're nonsymptomatic is a great way to stay nonsymptomatic! Being Proactive About Your Nervous System Health Staying healthy is a lot easier than getting healthy. A big part of your health is keeping your nervous system functioning at its best so it can fend of illness. Chiropractic adjustments allow your nervous system to work at its optimum level giving you your best chance for health.
April Danann The importance of reserves Having enough to eat during the winter and early spring is an important topic for Bees. Bees store their food source because they do not hibernate during the cold months and must have enough food stores to last until they can get back to foraging when the weather turns. It is important that there is a variety of honey within the hive, summer honey as well as honey stored from late autumn because honeys from different seasons and plants will store at different hardness. Ivy honey stores, gathered in the Autumn and Winter, is very hard and would be impossible to digest if not mixed with softer honeys. I saw more activity from my hives in January than I have in March, this is due to a mix of very cold days with milder very wet days neither of which are good days for foraging. So that means the Bees are continuing to eat last years honey until they can get out again. This honey from last year must be very good quality if they are going to survive. I can't expect the Bees to live on sugar water, because there is no nutritional value in this supposed honey replacer, so I don't give them any at all. My own rule of thumb is about one third of the total stores gathered by the end of August could be harvested from the hive after a very good summer of fine weather. If the summer was very wet, then less or no honey would be harvested. This way I am not interfering with the only source of food and nutrition available. There will be some good weeks of foraging weather in the Autumn and this will boost their stores before the colder weather settles in. We have all been, at one time or another, without any reserves of cash or cache and it is a frightening situation, so don't overtax your bees by taking more than they can afford to spare.
Essay: Invesigating MH17 Forensic DNA analysis On July 17th 2014 a Malaysian airplane crashed near Hrabove, Ukraine. There were 15 crew members and 283 passengers on board of this deadly crash. During this time the plane was flying over a warzone, the suspicion therefor is that the plane might have been hit by a missile as part of a terrorist attack. Researchers must investigate the cause of the crash of the MH17 flight. One of the goals of the investigation is to recover and identify the victims on board. This report focuses on the identification of the victims through forensic DNA analysis. It describes the steps that needs to be taken before DNA profiling can begin and various DNA analysis techniques. Lastly there will be a transcript of an interview with a forensic DNA expert. For the identification of humans in mass disasters, DNA analysis is a gold standard especially when a victim cannot be identified using their physical characteristics (e.g. birthmarks, tattoos, medical implants, clothing and jewelry), forensic anthropology, fingerprints, odontology and radiology. Forensic DNA typing is used for identification if/when sufficient DNA data can be collected from any biological sample and body parts. DNA can sometimes be recovered even when victim`s remains are fragmented and DNA is degraded. DNA analysis is also often used for the re-association of severely fragmented remains with the victims, because this is the only technique that allows it. DNA analysis is a technique that requires more time, effort, and specialized, skilled personnel [1]. Reference samples In order to make a positive identification, reference samples from possible victims are collected so the DNA samples can be compared to each other. Reference samples can be collected from several different sources. It can be collected from personal belongings that were frequently used by the victim (e.g. toothbrush, hairbrush, razor, unwashed undergarments). Banked samples can also be used. Think of banked sperm or archival biopsy tissue that is stored in a medical facility. Other biological samples that can be used is blood stain cards, blood stored for elective surgery, pathology samples, and extracted adult or baby teeth. Another source for a reference sample is via biological relatives of the victim that are collected using buccal swaps [1]. The reference samples can be categorized by the DNA quality of the DNA that is available on the samples and they are good sources of DNA, fair source of DNA and poor sources of DNA (see table 1). [2]. Table 1: Categorization of reference samples in good, fair and poor sources of DNA[2] Good sources of DNA Fair sources of DNA Poor sources of DNA Tooth brushes Lipstick Jewelry Razors Deodorant sticks Wrist watches Hair brushes Pillow cases Outer clothing Bone marrow samples Used cups/glasses Towels Blood cards from PKU screening Used underwear Shoes National bio banks Fingernail clippinds Hair bands Criminal databases Cigarette buds Baby hair Serum samples Pipe Dentures Sperm bank samples Mouth piece/guard Hair rollers Dried umbilical cords Helmets/caps/hats Trimmers Pathology speciman Earplugs Eye glasses Inner clothing items (bra, socks, t-shirts) Pen with teeth marks Mailed envelopes/postcards There is several preferred combination of family reference samples. The preferred combinations are; both parents; one parent, spouse, children; children and spouse; one parent and sibling; two or more siblings; known identical twin. From all the combinations possible for the kinship analysis, the probability for their effectiveness has been calculated. The three lowest combinations are one full sibling (92.1%), sibling and aunt (94.4%) and sibling and two aunts/uncles from same side of the family (97.8%). The three highest combinations are three grandparents (96.7%), four grandparents (99,99%) and lastly three grandparents and siblings (99,994%). The full list is shown in table 2. [3] Table 2: Probability of identity using various combinations of family references [2] Family references Probability of identity (%) One full sibling 92.1 Sibling and aunt (or uncle) 94.4 Sibling and two aunts (or uncles) from same side of the family 97.8 Sibling, aunt, uncle from different sides of the family 99.8 Sibling and half sibling 98 Sibling and two half siblings (same mother) 99.4 Two siblings 99.91 One parent 99.9 Sibling and parent 99.996 Father and one maternal half sibling 99.95 Father and two maternal half siblings 99.996 Father and maternal aunt 99.993 Three grandparent 96.7 Four grandparents 99.99 Three grandparents and sibling 99.994 Previously identified fragmented remains that were already identified using DNA can also be used to make identification [1]. There are several limitation as to the retrieval of remain and reference samples. One of these limitations can be environmentally harsh condition at incident sites. This can severely limit the quantity of usable DNA from human remains. Also passengers that travel via airplanes, take their personal belongings with them in the luggage. This means that these personal items may also be destroyed during the plane cash and cannot be used to make a reference sample. In some cases using DNA from a close relative can also be difficult. Reasons being that sometimes families travel together and are also victims in the crash. Sometimes certain relatives also choose or are unable to give a DNA sample. It is also important to establish that personal items collected was only used by the victim in order to avoid getting a mixed profile or giving a wrong identification. [1]. Parameters of DNA identification The importance of DNA in the identification process is dependent on the degree in which the human remain is fragmented or degraded. Sometimes multiple methods are used in order to identify a victim. This doesn’t always include DNA. In an airplane crash only about 25% of victims are identified by only using DNA analysis as a method of identification. The parameters are set by policy makers and it is the job of the laboratory director to determine the nature and extent of the laboratory`s response. [1]. Defining goal of identification process Depending on the scope of the identification process, a decision can be made on if every human fragment is going to be identified. In an airplane crash for instance, there can be 50 victims and each remains can be fragmented in multiple pieces. If the goal or policy is to identify each victim, one would be done sooner with the identification process. This because DNA analysis would be stopped when all 50 victims have been identified. Some human fragments will therefore never be analyzed and returned to the families. Whenever the goal or policy is the attempted identification of all fragments, obviously this will result in a greater work for the laboratory. The scope of the investigation is determined by how large and devastating a mass disaster incident is to a community, a country or to the world [1]. Minimum fragment size Depending on the goal or policy of the identification process a minimum fragment size for DNA testing needs to be established. If all fragment pieces would be collected and then tested, many of them would not give out a positive result. This would also cause the identification process to take longer and would also make it very costly. Even though the families are able to receive more human remains of their loved one, but they very well are going to be unprepared on the condition of the fragment and the time it might take to be able to identify them. Knowing all that, decisions will be made regarding the minimum fragment size, the statistical threshold that must be met. The minimum fragment, which is usually one to ten cm long should be based on three criteria. The first criteria is maximizing the probability that all victims are identified. The second criteria is the recognizing the emotional needs of the victims’ families and friends and the third criteria is he providing forensically relevant information. The defining of the fragment size is important, because this will affect the identification effort. It will determine how fragment sizes needs to be collected at the crash site, how they will be processed and the likelihood of getting a useable DNA profile [1]. DNA technology A preliminary decision concerning the DNA technology that should be used is made by the laboratory. If the recovery effort is long, the DNA of the fragments will start to degrade and can affect your choice of DNA method for analysis. The decision to use another DNA method that are not the standard choices can be implemented, depending of the environmental conditions at the crash site and the resulting DNA degradation. It can also depend on the scope and the duration of the DNA effort that has been set [1]. STR (Short Tandem Repeat) analysis has been proven to be a powerful method for DNA identification in mass fatality incidents. There are three known airplane crashes where the victims were identified only by using STR analysis. Remains from after WTC attacks, demonstrated that STR`s work on degraded tissue and bone fragments if DNA extraction is optimized. Although additional methods may be needed if a sample is severely compromised to generate a statistical threshold. Other methods that can be used are mtDNA (Mitochondrial DNA) and SNP (Single nucleotide Polymorphism) [1]. Length of recovery effort The length of the recovery effort it dependent on the location site and the mass fatality of the crash and determines the DNA identification of the victims. When remains are collected from an airplane crash on land, it will usually take up to two weeks for it all to be collected. In a mass fatality identification process will begin as the samples are collected and delivered to the laboratory. It is more effective and efficient to wait for all the samples to be collected, but with the pressure from the public and families for a rapid confirmation this is not possible. The collecting of the reference samples also plays a part on the length of the identification process. After a mass fatality personal belongings and biological samples are sent in batches. So the number of batches and the frequency of which they are sent to the laboratory is dependent on efficiency and duration of the reference collection process [1]. Laboratory workload After considering all of the above, the laboratory`s must determine its analytical processes. Several key variables has to be assessed in order to determine this. These variables are the number of victims, number of recoverable fragments, percentage of samples to be reworked, numbers of personal items per victim, percentage of personal items to be reworked, personal items quality control samples and number of kinship analysis. In order to predict the labor and material resources required for DNA analysis, a DNA analysis workload worksheet can be used (see appendix 1) [1]. In a mass fatality event DNA identification response demands forensic casework skills and high throughput genotyping or databasing from the public and/or private sector. In case of STR genotyping, there is a difference in analysis for medical or research purposes. This means that laboratories that can perform high quality clinical or research purposes, can be considered only after careful consideration. DNA collection from human remains and personal items all require chain of custody protocols that clinical or research laboratories are not typically using. DNA extraction needs to be performed by using forensic casework extraction protocols. Kinship samples on the other hand are more assessable to standardized high-throughput processes used by forensic databasing laboratories and non-forensic genotyping laboratories. In most cases forensic databasing laboratories have the experience with outsourcing work to private laboratories then forensic casework laboratories. In case that work is outsourced to other laboratories, it is important to ensure that all laboratories involved use the same molecular ladders as size standards for allelic interpretation. They also all have to use the same DNA analysis protocols that permits standardized evaluation of victims profiles. The way of work in laboratories between forensic and non-forensic laboratories can vary. It is the duty of the laboratory director to fully define certain terms like ‘acceptable positive and negative controls’ and ‘standard reaction volume’ [1]. Next to DNA analysis the laboratory might also be responsible for sample accessioning and tracking, making identifications and resolving metadata problems, quality control, interacting with families and media and long-terms sample storage. Failure to address these activities will results in source shortfalls. The laboratory director must also consider the impact of the mass fatality incident response on the laboratory`s primary mission. Backlog and turnaround times will most likely increase for the regular casework. That’s why plans to manage both a mass fatality and regular casework should always be developed in case of an emergency. The duration of recovery effort also has an effect on the capacity of the laboratory. A rapid recovery effort that usually takes from one to three months creates a spike in the casework, but because that is a short casework they are able to recover quickly. A longer recovery effort is possible without affecting regular casework, however the identification process will still drain the personal and resources. Good planning is critical in order to migrate the disruption [1]. Sample tracking Sample tracking is an important factor in ensuring quality and accuracy throughout the process of DNA identification. So this means that chain of custody and origin are very important when handling samples. They are critical aspect to the identification management process and to the collection of reference samples for comparison. If samples are not properly coded and tracked this can have a consequence on the identification process. Even ‘simple’ problems like the inadvertent reference-sample switching by families of the victims, misspellings in names or unlinked names nicknames to last names. Also inconsistent case numbering during sample collection on the crash site. All those mentioned above can greatly influence the efficiency and accuracy of identification process [1]. Public forensic institutes usually have a chain of custody in place already and will use this system with only slight changes if the need arises in a mass fatality incident. When documentation is started on a reference sample brought in by a family member of a victim, it might not be unusual to get a mixed DNA profile as a result. So this is also an important note to make when getting a result on your samples. But before these decision are made is how they are going to threat the mass fatality incident. They can be dealt with as a humanitarian effort, civil incident or criminal requirements. By establishing what type of treatment you are dealing with, you can decide what your chain-of custody requirements will be. The implications of treat incidents are shown in figure 1 [1]. Figure 1: An overview of the possible treat incident and their implications [1] Laboratories will already have an information management system in place. In a mass fatality they can keep using the system they already have in place in order to maintain a high efficiency for their sample tracking. If chosen to modify the system the director of the laboratory should consider tracking the mass fatality samples separate from their regular casework samples. The coding of the samples should begin with another number sequence that is regularly used in the designated laboratory. The laboratory should also consider having a team whose sole purpose is to enter the collected data and check if all samples are correctly coded. Another task that the laboratory director has to establish is the sample naming that differentiates the personal items, kinship samples and the disaster samples from each other. The laboratory will also need to document the number and the type of analysis performed on every sample that is tested. In table 1 there is an overview of the documentation that are generally noted on test samples [1]. Table 3: Coding that should be present on test samples [1] Victim samples Personal effects samples Kinship samples Identity of laboratory that performed extraction and analysis* Victim identification number Victim identification number Extraction attempt number Identity of laboratory that performed extraction and analysis* Relationship to victim Type of analysis Extraction attempt number Plate number, tube number, well number, etc. Type of analysis Plate number, tube number, well number, etc. *These are usually noted in a multi-laboratory response Sample collection The recovery and preservation of samples are very important steps for the identification of human remains, especially when they are highly fragmented. It is very important for samples to be collected as soon as possible. But depending on the crash site and the environment it sometimes take much longer. Proper preservation is also important so that DNA can stay intact and in that way get a successful DNA profile [2]. Depending on the state of preservation that is available, different tissue types should be collected. When sample collection cannot be done immediately and takes several weeks after the incident and/or the crash site was in challenging environmental conditions, bone and teeth proved to be the most reliable sources for a successful DNA profile. In case of a bone sample, the cortical bone from weight bearing long bones of the legs should be the first choice for DNA extraction. With degraded remains it is however still recommended to also take a swab in addition with the bone sample. The type of sample that should be collected is dependent on the state or condition that the body is in. Figure 1 shows an overview of the post-mortem sample condition that is dependent on the condition of the body [2]. Because it is a possibility that commingling of DNA can be happen, this can often lead to false DNA-based associations. This is especially true for fragmented remains. Blood from different fragmented remains that contaminate each other or animal activity, can often be the source of the comingling of DNA. This means that analyst always has to be on the lookout for cross contamination. When collecting samples in the field, workers should never assume that fragments go together or belong to the same victim based on their appearance. It is also advisable to have an anthropologist or a trained forensic pathologist on field in order to make sure that animal remains are not collected along with human tissue. Sample storage The amount of samples that is going to be collected during a mass fatality may very well be too much for one laboratory to store. So in that case the laboratory that is going to be handling the analysis can ask other trustworthy laboratories to store a collection of their samples. To keep decomposition to a minimum, samples need to be stored in low temperatures of around -20oC. Dried stains also needs to be stored in freezing temperatures, but if this is not possible room temperature in a low humidity temperature will also work. Skeletal remains that are going to be stored also needs to be at room temperature. Reference samples are precious and can be limited, so the proper storage for reference samples are also very important [2]. DNA analysis In order to be able to perform a successful DNA analysis, the laboratory needs to have sufficient additional processing are. Because of the mass fatality the laboratory is going to be dealing with a lot of samples and might need to consider using a robotics system. This can minimize human error and contamination. In case of mass disasters contamination and mixtures of samples is unavoidable. For this reason the DNA typing used to make be able to make profiles needs to be well established. The most used DNA typing methods which are STR and mtDNA are the most used for identification purposes. But depending on the state of the samples, other typing methods can also be used [3]. DNA extraction Before DNA analysis can be performed, the DNA needs to be extracted from the reference and victims samples first. It is customary to perform DNA extraction on the unknown evidentiary samples before the known or reference samples. With samples from a mass disaster it may not be possible to still extract samples in that order. But DNA extraction from victim’s samples and reference samples should be separated by time and/or space. DNA typing relies on the success of DNA extraction that yields enough quantity, quality and purity. Because of this naturally the most desired extraction methods are the ones that minimizes DNA loss and the ones that overcome, removes or dilutes enzymatic inhibitors [3]. The DNA IQ’ System (Promega Corp, Madison, WI) Current techniques that include organic solvents and ion exchange resins are time consuming, use more than one centrifugation step, uses toxic organic solutions and/or do not remove PCR (Polymerase Chain Reaction) inhibitors well enough. A system that was used for the extraction of WTC samples proved to be the best. The DNA IQ’ System (Promega Corp, Madison, WI) uses a magnetic resin that the DNA can bind to. It also has a denaturing agent that disrupts many types of cells/tissue. The DNA will then be purified by eluding it from the resin. DNA typing can then be performed without needing further preparation. See figure 3 for a schematic overview of the extraction. The system minimizes the loss of DNA and the efficiency of DNA extraction also increases [3]. Organic extraction As is mentioned above organic extraction is also an extraction method that is widely used in the forensic community for DNA typing. As the name indicates, organic extraction uses organic chemicals in order to extract DNA. This occurs in four steps. In the first step EDTA is added to the lysis buffer. EDTA is added to prevent the degrading of DNA. Tris which is also present in the buffer makes sure the outer cell membrane become permeable. In the second step the proteins are denaturized and hydrolyzed. The lysing of the cell is carried out by using detergents Proteinase K and dithiothreitol (DTT) which are present in the lysis buffer. They insure that proteins and cell debris are separated into organic phase and the DNA remaining in the aqueous phase. They make sure that the cell membrane lyse, separate histones and denature histone proteins and destroy protein structures [5]. In the third step the proteins and cell debris are removed by adding phenol chloroform isoamyl alcohol to the mixture. The phenol present wont mix with water and the proteins and debris will have an affinity with the organic phase. After centrifuging the mixture will have visible layers. DNA will be present in the upper layer called the aqueous phase. After transferring this phase to a new tube, in the fourth step DNA can be purified by using alcohol precipitation [5]. Figure 4 shows a schematic overview of the organic DNA extraction. Chelex extraction Another popular extraction method in the forensic community is Chelex. Chelex comes in different purities with a purity of 100 being preferred in a forensic capacity. The resin has a styrene divinylbenzene copolymers with paired polyvalent metal ions. Because of this polyvent metal ions can bind to the resin. In an aqueous alkaline condition the chelex has increased affinity for heavy metal. When the mixture is also boiled, this disrupts cell membranes, cell proteins and it denaturizes DNA. After centrifuging the resin and cellular debris is separated. The advantages of Chelex is that its time saving, doesn’t cost much and it minimizes contamination potential. Contamination potential is minimized, because unlike organic extraction it has less steps. Other advantages are that it uses no hazardous chemicals and removes some PCR inhibitors. Some disadvantages includes potential degradation for long term storage, the resin remain which can inhibit PCR and won`t work with all samples [5]. A schematic overview of the chelex extraction is shown in figure 5. Polymerase Chain Reaction (PCR) After extraction is completed the DNA goes through PCR. PCR is an enzymatic process in which a specific DNA fragment is being replicated over and over again. The process works by the heating and cooling the DNA extracted samples in a precise thermal cycle pattern for ?? 30 cycles [6]. The PCR has three steps that forms one cycle [1]. In each cycle it starts with denaturing the DNA template by heat. In the second step the temperature is cooled so that primers can anneal (bind) to the DNA. In the last step the temperature is raised again at the optimal temperature for DNA polymerase so it can activate. The DNA polymerase extends the template strands (see figure 6) [6]. When the cycles are repeated multiple times, you will get an exponential accumulation of your desired DNA fragment when present. Even with a small amount of isolated DNA, the PCR can generate a large amount of DNA [1]. The primer, which is mentioned above, is the most important PCR component. The primer is a short DNA sequence that positions itself before the DNA fragment that needs to be copied. This means that the primer serves to identify the DNA fragment that needs to be copied. It is added in high concentration in relative to the DNA template in order to drive the PCR reaction. Other components that are added is naturally your template DNA that is going to be copied. Also added to the mix is a four nucleotide building blocks called dNTP`s and DNA polymerase that helps put the building blocks in the correct order on the template DNA. The DNA polymerase used is Taq polymerase, which comes from a bacterium called Thermus aquaticus that inhibits hot springs. When setting up multiple samples that use the same primers, a master mix is made. From the master mix an equal amount of volume is pipetted in the PCR tube. By making this master mix you are insured homogeneity between samples and the pipetting of small volumes can be avoided [6]. Multiplex PCR In this version of the PCR more than one DNA fragment will be copied simultaneously. This is achieved by adding more than one primer to the mixture. In order for it to work properly, the primer pairs added should have similar annealing temperatures. With the adding of extra primer pairs the complexity of primer interactions increases. Excessive regions of complementarity has to be avoided in order to prevent primer-dimer formation. Primer-dimers are when added primers bind to each other instead of the template DNA. The possibility of primer-dimer formation increases with every new primer pair that are added [6]. DNA quantification After DNA extraction, DNA quantification is essential for polymerase chain reaction (PCR) based analysis. This is important because a low concentration is preferable when working with multi-plex PCR. Generally an amount of 0,5 to 2,0 of DNA is optimal when using STR kits. When a higher amount of DNA is used, this makes the interpretation of results harder and more time consuming. With a low amount of DNA, this can result in loss of alleles. This makes it harder to properly compare profiles with each other [7]. Real-time quantitative PCR (qPCR) Like it was indicated above, quantification test is performed to determine amount of DNA that can amplified. A test that can indicate the quality and quantity of extracted DNA or PCR products, is beneficial for determining steps that need to be taking for the analysis of the DNA. The most common approach to perform a qPCR is to use a flourogenic 5′ nuclease assay, better known as TaqMan or with the use of an intercalating dye, like the SYBR green, that is specific for double stranded DNA molecules. The TaqMan monitors changes of a fluorescence while the SYBR green detects formation of PCR product [7]. Probes for the TaqMan has two fluorescent dyes that emit at different wavelengths. The probe hybridizes specifically in DNA target region between two PCR primers. The probe has a slightly higher annealing temperature the primers. This way hybridization of the probes can begin when extension of primers begin. At the 5′ end of the probe, a reporter (R) dye is attached, while at the 3′ end a quencher (Q) dye is synthesized See figure 7. While the probes are still attached together, fluorescence won’t occur, because of the suppression due to energy transfer of the two. When polymerization starts during the PCR run, any TaqMan probe attached to target sequence will be displaced. Because Taq polymerase has a 5′ exonucleae activity. This means that it will chew at the TaqMan probe attached. When the dyes are released from the probe, they will begin to fluorescence. This means that, the more fluorescence that is signaled, the more target sequence is present as complementary to the probe [7]. Real-time PCR analysis The PCR process is defined in three phases. The exponential phase, linear amplification and plateau region. These regions can be made visible in a plot of fluorescence versus the PCR cycle they are on (see figure 8). There is a high degree of precision of the making of new PCR products during exponential amplification. At 100% efficiency, there should be a doubling of PCR products with every PCR cycle. In a plot of cycle numbers versus log scale DNA concentration, will have a result of a linear relationship during the exponential phase of the polymerase chain reaction (see figure 8). The next phase is the linear phase. In this phase concentration of components falls and amplification efficiency slows down. This happens in an arithmetic increase. The final phase is the plateau region. This is where the production of the PCR products slowly stops. Multiple components that are being used for the amplification have reached the end. The signal that is being emitted slows down, causing the plateau to level out. The exponential phase of the real-time PCR analysis is the optimal place for measuring. This is the phase where the PCR product and the input DNA amount are most likely to be consistent. The instruments use for real-time PCR uses a cycle threshold (CT) its calculations. This value stands for the terms of cycles when the level of fluorescence passes a threshold that is set by the software of the real-time PCR instrument. The less cycles that is used to get to this threshold, the higher the input DNA molecules that was present in PCR reaction. This is why there is a plot of log DNA and CT for every sample in a linear relationship with a negative slope. A rise in fluorescence can be traced to initial DNA template amount, when it is compared to samples that has known concentration. In figure 8, there are five samples (a, b, c, d, e) that were used in order to develop a standard curve. If the samples used have a good consistency and precision, a sample that has an unknown concentration can be calculated from the standard curve [7]. Short Tandem Repeat (STR) analysis STR analysis is the first method of analysis that is used [1]. 99,9% of the DNA in humans are the same. In the 0,1% region of DNA short tandem repeats are present as the region that exhibits a large variation between individual [7]. STR`s are short DNA sequence that keep repeating. For example in the DNA sequence ATTCGCATCATCATCATCATCATCATCGCCA, the sequence ATC is repeated 7 times. Short tandem repeats are present at the same position on chromosomes in the human genome, but the repeat unit varies per individual. With the help of PCR reaction a STR analysis can be performed. Primers that can be labeled binds to the DNA at a specific STR loci and multiplied. Because of the label that is attached at the primer, the amplified products can be detected at the end of the PCR reaction. By analyzing more than multiple STR`s at once, a DNA profile that is unique enough to identify an individual can be made [7]. Repositioning primers Sometimes a DNA sample is too degraded to get a DNA profile using the standard STR markers. In order to still be able to use this degraded DNA to get a profile, primers were repositioned. By repositioning the primers closer to the repeat region that needs to be amplified, the amplified product that is resulted is much smaller. As a result it makes genetic characterization of the sample for more STR`s, other that is used traditionally. This makes STR miniplex invaluable for degraded samples [1]. Single Nucleotide Polymorphism (SNP) analysis By using the SNP`s genetic markers, the PCR amplified product can be much smaller than is possible in a STR miniplex [1]. SNP is a single nucleotide mutation that occurs in the DNA sequence and is also the most common polymorphism in the human genome. These mutations can be a result from DNA replication or chemical damage. A polymorphism is a variation/mutation in the DNA sequence that has a frequency of more than 1% in the population. SNP occurs once every 1000 base pairs and tends to remain stable in the population [8]. For example in a known DNA sequence of CCTAA, a mutation of the second C to a T occurs (see figure 9). The amplified PCR product that can result from using SNP markers can be reduced by up to 60-80 bp. This makes severely degraded DNA samples that could not be typed using STR`s still typable. Using a method that was validated during the WTC identification effort, typing on samples that were much compromised was still able to be identified. The method uses a florescent detection system. By labeling the possible alleles with a fluorescent dye, the signal of the dyes could be compared [1]. Mitochondrial DNA analysis Mitochondria is an organelle that resides outside the cell nucleus. They contain their own chromosomal DNA. mtDNA are smaller, circular in shape and are inherited maternally. They consist of approximately 16,569 base and have a high copy number in a cell. Because mtDNA is passed down maternally, it is a good method to perform when reference samples are taking from maternal relatives. Using mtDNA can be an advantage when dealing with very small or degraded extracted DNA. Because of the high copies number of mtDNA that is available, an identification can still be possible using mtDNA markers, instead of STR markers that are found in nuclear DNA [1]. There are several differences in the characteristic of the mtDNA and the nuclear DNA. The first being the size of the genome. Nuclear DNA has about 3,2 billion bp and is 99.75% of total DNA. While mtDNA has 16,569bp and 0,25% content DNA per cell. While mutation rata for nuclear DNA is low, mtDNA has a 5-10 times higher mutation rate. The sequence of the mitochondrial DNA is a functional one and also highly conserved, it’s because of this that there isn’t a very big variation between individuals. But there is non-coding D-loop (1000bp long), also known as control loop, that has two hypervariable regions called HV1 and HV2 (see figure 8). The variations observed in this part of the DNA tend to be Single Nucleotide Polymorphisms (SNPs). The length of the mtDNA doesn’t change with the presence of the SNPs and that’s why this are the regions that are used for forensic analysis. Due to the lack of DNA reparation, mtDNA has a large mutation. This causes the variations between individuals. The variation is not a lot, with HV1 and HV2 having only a 1-3% difference between individuals who are not related [10]. When analysis is performed, mitochondrial DNA is extracted and then with the help of Polymerase Chain Reaction (PCR), the HV1 and HV2 regions are amplified. Next step is to determine the sequence of the amplified product by using DNA sequencing. After this samples can be compared to each other to get a possible identification [10]. Y-chromosome analysis The Y-chromosome is small and found in only male individuals. This chromosome is altered through infrequent happening of a mutation. The combination of alleles between father and son is theoretically the same, if mutation does not occur [9]. The advantages of Y-chromosome analysis are that in a mixture profile with female DNA for example in a sexual assault case, male specific amplification can take place to separate the two. Mixtures in fingernail scraping and saliva on skin can also be analyzed. Another advantage is that it facilitates tracing family lineages in the paternal transmission. Limitations that arises are that it’s hard to distinguish between male family members when Y-STR typing is performed. Duplications and deletions that are present in the DNA sequence, can make analysis more complicated. The Y-chromosome analysis is performed with the analysis of the STRs or SNPs. Y-STRs changes more rapidly and thus has more variables. This makes it useful for forensic applications [10]. Capillary electrophoresis Last step in analysis of DNA is the separation and detection of the amplified DNA. In order to separate and detect them a capillary electrophoresis is used. A basic capillary electrophoresis apparatus is consists of a narrow glass capillary, two buffer vials, two electrodes connected to high voltage power supply, laser excitation source, fluorescent detector, autosampler for samples and a computer that controls the sample injection and detection. The capillaries are made out of glass, have an internal diameter of 50 ??m and is 50 cm long. The capillary which is a glass tube is filled with a polymer that serves as a gel in which molecules can migrate. Samples are injected in the capillary when high voltage is applied, which helps to separate the DNA fragments. Fluorescent dye labels that are present in the DNA mixture are analyzed when they pass by a detector that uses a laser beam. The results are then analyzed and stored on a computer [10]. A schematic of the capillary electrophoresis is shown in figure 9. Polymer solution DNA separation occurs when DNA fragments separate through the capillary when voltage is applied. Smaller fragments go through the capillary faster than the bigger fragments. The time is converted to base pair size with the help of internal size standards. Several components can affect the DNA separation. The polymer used, the capillary, the buffer and the voltage used [10]. The two primary polymer are POP-4 and POP-6. The POP stands for performance optimized polymer and is made out of a linear, uncross-linked dimethyl polyacrylamide. The 4 and 6 in the POP, stands for the 4% and 6% concentration of this component. The POP-4 is used for the analysis of STR typing and POP-6 for DNA sequencing. Recently a Pop-7 has been introduced that can be used for both the STR typing and DNA sequencing [10]. The buffer is used to stabilize and solubilize the DNA. It also provide a charge for the electrophoresis current. Buffer concentration is an important aspect, because when it’s too high this can result in overheating of the capillary and a loss of resolution. In order to avoid any problems with the running of the electrophoresis, the buffer should be replaced regularly with a fresh sample [10]. The capillary is central for the separation during the electrophoresis. The capillary is made of glass or fused silica. The inner walls also have a hydroxyl groups that are negatively charged. Positive ions from the buffer, creates a double layer. The movement of ions creates an electroosmotic flow, that can be reduced or eliminated when a coating is added to the inside layer of the capillary (see figure 10). Uncoated walls create problems for reproducible DNA separation. Suggested is to change the capillary after 100-150 runs or whenever a decline of resolution is noted [10]. DNA sequencing Sanger method for DNA sequencing is a process where the use of polymerase incorporation is involved. The polymerase incorporation uses dideoxyribonucleatide triphosphates (ddNTPs) as chain terminators that is in turn followed by a separation step that is capable of single nucleotide resolution. Because there is no hydroxyl group at the end of the 3′ ‘end of the nucleotide with a ddNTP the growing chain cannot continue growing. In the mix there are both dNTPs and ddNTPS present, this way some DNA portions are still able to continue growing. Therefor at the end of the reaction there will be a series of strands that only differs one molecule from each other. See figure 11 for a schematic overview of the DNA sequence. Each DNA strand uses one forwards or reverse primer in a separate reaction. Attached to the ddNTPs are fluorescent dyes. ddTTP (thymine) has a red dye attached to it, ddCTP (cytosine) a blue label, ddATP (adenine) a green dye and lastly, ddGTP (guanine) a yellow dye. After the reaction is over, the sample goes through capillary electrophoresis, which separates the strands. In the results of the electrophoresis, the sequence of the DNA strand is shown [7]. DNA Databases and CODIS A DNA database is a database which stores DNA data and is used for analysis. There are different types of DNA databases. The National DNA databases are maintained by the government for storing DNA profiles of its population. These DNA profiles are based on PCR and STR analysis. DNA databases serve as valuable tools in aiding investigations. CODIS (COmbined DNA Index System) is a DNA database that consists of 13 STR loci’s. These are CSF1PO, FGA, TH01, TPOX, VWA, D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51 and D21S11. Also the Amelogenin is used for gender determination [6] [10] [11]. STR Kits To make the job easier and avoid confusion with buffers it is better to use a complete STR kit. These kits come with their own buffer and control DNA. There are a lot of distributors of complete STR kits. It all depends on the research what kind of kit there is needed. Multiplex STR kits allows the amplification of the 13 CODIS loci [6]. The most widely known and used kits are from Promega. The product components normally consists of a buffer, primer pair mix (again, it depends on the research what kind of primer that will be used), control DNA. These are for the PCR product. After the PCR, the kits come with an Allelic Ladder mix and an internal standard to be used for the gel. Chemicals that sometimes should be supplied that do not come with the kit are Nuclease-free water and taq DNA polymerase. The kits come with their own protocol and should be used in that specific order [6]. Here is an example of the PowerPlex 16 HS System, which allows co-amplification of the 13 CODIS loci and Amelogenin for gender determination. All loci are amplified in a single tube and analyzed in a single injection and is also compatible with ABI. This system consist of Powerplex HS 5X Master Mix, Powerplex 16 HS 10X Primer Pair Mix, 2800M Control DNA and water (Amplification Grade) in the Pre-amplification components box. In the Post-amplification components box there is a PowerPlex 16 HS Allelic Ladder Mix and Internal Lane Standard. How the mixes for the PCR amplification should be made is displayed below in figure 10 [6] [12]. Statistical interpretation of DNA profile When it comes to getting a match with a DNA profile, it’s important to determine if the DNA profile are from the same individual or if maybe there is another individual with the same profile. It’s practically impossible to get a DNA from every individual. In order to still determine a match probability, Allele frequencies from different ethnic groups, from validated databases are collected [13]. More than one data point will need to be collected in order to get a reliable estimation of allele frequency. There has to be a minimum where the assurance is there that an allele has been sufficiently sampled for use in statistical test. An allele has to be observed for a minimum of five times in order to be qualified for use in a statistical calculations. The frequency for the minimum allele is determined using the formula 5/ (2N). N stands for the number of individuals and 2N for chromosomes counted before they pair [13]. Frequency calculations In order to calculate the frequency of a DNA profile, the frequency of every allele analyzed are multiplied. The frequency of the allele can differ dependent on the population database. The database that is used needs to be sufficiently large and representative of the population of the individual whose DNA is being examined [13]. In figure 12, DNA profile frequencies are given for the U.S. Caucasian. Take for example allele 11 of D13S317 shown in figure 12. Samples of 604 alleles were taken where it was observed 205 times. This translates to an allele frequency of 0,33940. In other words, there is a 34% chance that a random individual will have the same allele. The same goes for allele 14 of D13S317. This allele was observed 19 times in a population of 604. Frequency is therefore q=0,04801. So an individual with the alleles 11 and 14 for the D13S317, can be calculated using the formula 2pq (p standing for the first allele and q standing for the second allele). Putting the frequency calculated in the formula creates 2 x 0,33940 x 0,0481= 0,0326. This frequency indicates that ??3% of the U.S. Caucasian population. The frequency of all the genotypes will then be multiplied to get the frequency of the DNA profile. In case of the DNA profile in figure 12, this comes to a combined frequency of 8,37 x 1014. So 1 in 837 trillion [13]. Quality assurance In order to ensure that DNA testing is being performed correctly there are standards that the laboratories has to adhere to. These standards has to assurance the quality of the work. Every laboratory should have a quality assurance program in place. Organization and management First thing is to have a management staff that the authority and means to carry out the duty that is assigned to them and keep the quality assurance in the laboratory. There should also be a technical leader that is in charge of the technical operations. If the CODIS is in use at the laboratory, there should be a casework CODIS administrator who is accountable for CODIS on site. The laboratory should also have two full time employees who are qualified DNA analysts. The responsibility, authority and interrelation of every personal operational at the laboratory has to be specified and documented. Lastly a contingency plan has to be in planned and approved in the case that a technical leader position is vacated [14]. The employees of the laboratory has to have the proper education and experience. The job description of the personnel needs to have a written job description that can be expended with documentation of the responsibilities, duties and skills. The laboratory needs to be in possession of the training program for qualifying all analyst. Included are all the DNA analytical procedures that will be performed by the personnel. Also all the practical exercises needs to include the examination of a range of samples that are routinely analyzed at the laboratory. The training program needs to teach and asses the skills and ability to perform a successful DNA analysis. The trainee needs to give an individual demonstration of capability, which shall be documented by the laboratory. When a new analyst is hired the technical leader is tasked with accessing the new hire`s previous training and be responsible for the proper documentation. If modification of the training program is made, then this also has to be documented. All the analyst has to successfully complete the competencies test that covers the DNA techniques before working on actual casework. A documented program needs to be in place so that the technical qualifications are being kept. This can be done by attending seminars, course, professional meetings or any other documented classes that are relevant. This all needs to add to a minimum of eight hours annually. If training is given by the laboratory itself, all relevant information about the training and the presenter needs to be documented. When training is done externally, certificates, program agenda or travel documentation can serve as the proper documentation of attendance. Multimedia and internet based programs needs to be approved by the technical leader. Attendance needs to be formally documented and when the program is finished the technical leader reviews and approves it. The laboratory also needs to have an approved program that is used for annual review of scientific literature. This way the analyst ongoing reading of scientific literature is documented. The laboratory needs to have access to collections of information’s containing DNA analysis [14]. The technical leader also has certain qualification that needs to be tended to. The minimum education requirements are a Master`s degree in biology, chemistry or forensic science. In addition they also need to have a successfully completed 12 semester or equivalent credit hours in the subject’s biochemistry, genetics, molecular biology and statistics or population genetics. In the 12 semester completed, there needs to be at least one graduate level course for the period of 3 semesters. The technical leader of also needs to have a minimum of three years of experience in a forensic DNA laboratory, in which the laboratory participated in the identification and evaluation of biological evidence in a criminal matter capacity. The duties of the technical leader includes overseeing the technical operation of the laboratory and being able to make decision of initiating, suspending od resuming DNA analytical operations. Other responsibilities include the evaluating and documenting of the validation of methods used and proposing new or modified analytical procedures. Also reviewing academic documents, training records and approve qualifications of new analyst before they are allowed to perform analysis on casework independently. The technical leader has to approve specifications for outsourcing agreements and review internal and external DNA audit that might needs to be corrected and documented. Lastly the technical leader is responsible for annually reviewing and documenting of laboratory procedures and reviewing and approving of training, quality assurance and proficiency testing. The technical leader needs to be a full time employee and needs to be accessible for consultation onsite, via the telephone or electronically [14]. As an employee of the laboratory, the analyst needs to have a minimum education of a bachelor`s degree or advanced degree in biology, chemistry or forensic science related area, The analyst is expected to have completed the course work successfully with subject areas of biochemistry, genetics, molecular biology, statistics and population genetics. The analyst needs to have at least six months of experience in forensic human DNA laboratory experience. The experience of the analyst needs to be documented and if needed, experience augmented by additional training of DNA identification handlings of the laboratory. Before participating in casework, the analyst needs to complete analysis of a range of samples that the laboratory regularly encounters and complete a competency test [14]. Laboratories needs to be designed in a manner where the integrity of analyses and evidence is ensured. Entry to the laboratory needs to be controlled in order to prevent unauthorized personnel. When keys or combinations are handed out, these needs to be documented and limited to personnel that is designated by laboratory management [14]. Before PCR is performed, the DNA extraction and PCR set up, needs to be performed in either separate times or separate space. The amplified DNA, needs to be developed, processed and maintained on a room(s) that is separate from where the evidence examination, DNA extraction or PCR setup areas are performed. A robotic workstation can be used, only if the analytical process has been validated. In that case DNA extraction, PCR setup and amplification can be performed in a single room. Lastly procedures for the cleaning and decontaminating of the facilities and its equipment needs be in place and followed [14]. Evidence control In order to ensure the integrity of the physical evidence, the laboratory needs to have a documented evidence control system. Evidence needs to be marked with a unique tag on package of the evidence. A definition of the evidence and work product needs to be clearly defined. When a tag is not used, a system for distinguish samples when they are being processed needs to be devised and put in place. Chain of custody needs to be documented and maintained, either on a hard copy or in an electronic format. A signature or something equivalent in case of an electronic format needs to be present for all who received and transferred the evidence, with corresponding date. Documented procedures needs to be in place in order to minimize loss, contamination and deleterious change of evidence. A proper placement for evidence storage and work product that is still in progress needs to be in place, which is controlled and secure [14]. Analytical procedures Analytical procedure that are to be had and followed, needs to be approved by the technical leader. The procedures needs to be reviewed annually. Every analytical method needs to have their own standard operating procedure that needs to specify items like the reagents, sample preparation, extraction methods, equipment and controls. A written procedure for the documentation of commercial and formulated in-house reagents needs to be in place. Label commercial reagents with the name of the reagent and expiration date. Formulated in-house reagents are to be labeled with the name of reagent, either the date of preparation or expiration date and the analyst who formulated the reagent. Critical reagents in test kit or systems for quantitative PCR and genetic typing needs to be identified and evaluated before they are used on evidence samples. Thermostable DNA polymerase, primer sets and allelic ladders, also needs to be identified and evaluated [14]. Before DNA amplification, evidence samples needs to be quantified. Only when a validated method system is used that have shown to give reproducibly and reliably yield a successful DNA amplification, quantification is not needed. When quantifying, quantification standards are to be used. The positive and negative control needs to be amplified at the same time as the case samples at the same loci with the same set of primers as the case samples. Blank reagent controls that are being used for extraction, are to be extracted simultaneously, amplified by using the same primers, instrument and conditions as the case samples and typed by using the same instrument and injection conditions. The DNA procedures used by the laboratory are to be checked annually or when a major change is made in the method [14]. Procedure for the taking and maintaining casework notes needs to be in place. These needs need to support conclusion taken in the reports. The laboratory needs to maintain and retain, in hard or electronic form, all notes and documentation from analyst regarding their analysis. The casework reports needs to have the case identifier, a description of the evidence that was examined, description of the method used, the amplification system, results and/or conclusion, an interpretive statement, date that report is issued, the disposition of the evidence and lastly a signature and title [14]. Proficiency testing Twice a year, with the first one occurring in the first six months and the second in the last 6 months f a year, a proficiency testing needs to be undergone by the analyst, technical reviewers, technicians and personnel appointed by the technical leader. Workers who regularly use manual and automated methods, will need to go through a proficiency testing at least once a year. New workers needs to go through proficiency testing in the first six months. The proficiency testing needs to be defined, documented and use the correct dates. The exact items from the proficiency testing that needs to be recorded are the test set identifier, the analyst/participant, date of analysis and its completion, copies of data and notes that supports the conclusions taken, the proficiency test results, discrepancies and if needed the corrective actions that were taken [14]. 1. Lessons Learned From 9/11: DNA Identification in Mass Fatality Incidents 2. M.prinz, A. Carracacedo; DNA Commission of the International Society for Forensic Genetics (ISFG): Recommendations regarding the role of forensic genetics for disaster victim identification (DVI); Forensic Science International: Genetics; Pages 3-12; 2007 3. B. Budowle, F.R. Bieber, A.J. Eisenberg; Forensic aspects of mass disasters: Strategic considerations for DNA-based human identification; Legal Medicine; page 230-243;2005 4. Mo Bi Tec molecular biotechnology 5. NFSTC Science serving justice 6. Forensic DNA typing STR: Page 62-64, 84-86,92,93 7. Butler John M.; Advanced topic in forensic DNA typing: methodology; 2012; Elsevier, Maryland USA, page 371, 372, 141-150,417,418 8. Sequencing, forensic analysis and genetic analysis 9. Sirius genomics 10. Forensic science central; DNA 11. FBI biometric analysis 12. Promega technical manual for the powerplex 16 system 13. Butler John M.; Fundamentals of forensic DNA typing; 2010; Elsevier; Maryland USA; page 111-121, 229, 238-241, 251, 252 14. Quality Assurance standards for forensic DNA testing laboratories Appendix I DNA analysis workload estimated worksheet Source: Essay UK - Not what you're looking for? Search our thousands of essays: About this resource • Order a custom essay • Print this page • Search again Word count: This page has approximately words. Essay UK, Essay: Invesigating MH17 Forensic DNA analysis. Available from: <> [21-05-19]. More information: Latest essays in this category: Our free essays:
Keeping Our Earth Clean: Easy Ways to Go Green 1. 1. Invest in a sturdy water bottle. Plastic bottles are hugely problematic in the global waste crisis. They’re easy to use up and often hard to find places to throw away (though much less so than it used to be). Find yourself a quality water bottle that can stand the test of time- maybe even go the route of a reusable coffee cup if you feel it suits your lifestyle better. Both Starbucks and Dunkin have programs where you can get a “refill” of your drink even if you’ve never used the cup before (anywhere between 10 and 50 cents less than your regular drink price). 2. 2. Go digital. Some professors are real sticklers about taking notes with a pen and paper. If you can, make sure to limit your paper usage as much as possible to keep the forest where it belongs. If your professor really doesn’t like to use technology, get a Decomposition Book. They’re made from 100% recycled paper and printed with soy ink, so they’re the most environmentally conscious choice when it comes to physical writing. 3. 3. Limit your use of electricity where you can. When you’re leaving the room, make sure you aren’t contributing to the light pollution problem and turn out your light. You don’t need to see when you’re not in there! 4. 4. Avoid plastic packaging. Totable snack bags are cheap and easy to get in the habit of using when you’re a broke college student. However, most grocery stores have bulk food sections where you can bring your own container instead of using a bag. Now, you might not be able to eat that 5th snack bag of Cheetos you wanted but at least you’re keeping a plastic bag out of some poor fish’s stomach. 5. 5. Reusable straws are your best friend! For a chronically tired college student, coffee is what makes the world go round. If you truly can’t invest in a reusable cup for your addiction, make sure to at least buy a pack of reusable straws. They’re easy to clean and are extremely beneficial to the waste crisis. Think of all the sea turtles you will save when you cut plastic straws out of your life.
How Music Can Hurt Your Memory music and memory Can you remember studying or working while listening to music? Can you, in fact, concentrate with background music? Well, a recent study suggests that music can hurt your memory. As is often the case with research, a conflicting study produced different results. In this article, we report on the findings of these two conflicting studies to examine the relationship between music and memory. First Study – Music Can Hurt the Memory of the Elderly In a study published in 2016 in The Gerontologist, researchers wanted to investigate the effects of background music on concurrent cognitive functioning. To get a more in-depth look, they carried out this study with younger, as well as older participants. Both were given name-face combinations either in silence or with background music. The results showed that, although all participants found the music distracting, only the older ones had difficulty recalling the items learned with background music. So, this is the first look at music and memory. Second Study – Emotionally Charged Music Improves Ability to Remember Faces Unlike the first study, this piece of research suggests that emotionally charged music can enhance facial memory capacity. Here, researchers gave participants over 400 pictures of unknown faces, either in silence, with emotional background music, or listening to continuous sounds of rain or joyful music. Subsequently, participants were asked to recall the faces. The best results were produced when the faces were studied either in silence or when listening to emotionally charged music. Listening to touching music increased the heart rate and improved the memory of participants. Final Thoughts It appears that the choice of music matters when it comes to the relationship between music and memory. While older people may struggle to cope with focus while also listening to music, younger people do not. Furthermore, emotionally touching music can actually enhance memory skills.
phrases, sayings, idioms and expressions at Knock him on his "bal sege" Posted by ESC on December 24, 2000 I picked up a "true crime" book at my local library to get myself in the Christmas mood. I came across an interesting phrase: "When Joe Gere was a small child in Appalachia, his family lifestyle was as Hungarian as if he'd lived in Budapest. In bituminous coal towns like Pursglove, West Virginia (population two hundred), the citizens were classified as 'wops,' 'Johnny Bulls,' 'micks,' 'Polocks' and other racist names. Hungarians were 'hunkies.' Second-generation Americans like little Joey were taught to stand straight when they were called such names, and if the insult was repeated, they were instructed to knock the offender on his 'bal sege,' a family phrase which was pronounced 'ball sheggee' and meant 'left ass.'" From "Salt of the Earth: One Family's journey Through the Violent American Landscape" by Jack Olsen (St. Martin's Press, New York, 1996). My question is: why "left"?
Quick Reference Study Notes for MS PowerPoint 2016 (Foundation) Microsoft Powerpoint 2016 Microsoft PowerPoint is a powerful presentation software developed by Microsoft. It is a standard component of the company's Microsoft Office suite software, and is bundled together with Word, Excel and other Office productivity tools. The program uses the slide to convey information rich in multimedia. How to create a presentation in powerpoint 2016: 1. Open Powerpoint 2. Select an option: • Select Blank Presentation to create a presentation from scratch. • Select one of the template. • Add and format text 1. Place the cursor where you want, and type. 2. Select the text, and then select an option on the Home tab: Font, Font size, Bold, Italic, Underline.To create bulleted or numbered lists, select the text, and then select Bullets or Numbering. • Add a picture, shape, or chart 1. Select Insert. 2. How to add a picture: Select Picture.Browse for the picture you want and select Insert. 3. How to add a shape, art or chart: Select Shapes, SmartArt, or Chart.Select the one you want. • Animations in presentation 1. Select the text or object you want to animate. 2. On the Animations tab, select Add Animation, and select the animation you want from the drop-down. 3. To animate one line of text at a time, select one line of text, select an animation, select the next line of text, select an animation. 4. To Start, select When Clicked, With Previous, or After Previous. 5. You can also select Duration or Delay. • Transitions(To add a special effect, to transition from one slide to another) 2. On the Transitions tab, select the effect you want. 3. Select Effect Options to change how the transition happens: From Right, From Left, .. Tips for creating an effective presentation • Minimize the number of slides. • Choose an audience-friendly font size. • Keep your slide text simple. • Use visuals to help express your message. • Make labels for charts and graphs understandable. • Apply subtle, consistent slide backgrounds. Keyboard Shortcuts To do this Create new presentation Make selected text bold Apply italic formatting Apply an underline Center a paragraph Justify a paragraph Left align a paragraph Right align a paragraph Change the font size for selected text. Alt+H, F, and then S Change the zoom for the slide. Alt+W, Q Cut selected text, object, or slide. Copy selected text, object, or slide. Paste cut or copied text, object, or slide. Increase the font size Decrease the font size Undo the last action. Insert a picture. Alt+N, P Insert a shape. Alt+H, S, and then H Insert a new slide Ctrl + M Select a theme. Alt+G, H Select a slide layout. Alt+H, L Go to the next slide. Page Down Go to the previous slide. Page Up Go to the Home tab. Move to the Insert tab. Start the slide show. End the slide show. Close PowerPoint. Alt+F, X Delete one character to the left Delete one character to the right Save the presentation Save a presentation with a different name, location, or file format. Open a presentation Close a presentation Print a presentation Quit PowerPoint Shortcuts for SlideShow Play slide show from the first slide Ctrl+Shift+ RETURN Play slide show from the current slide Go to next hidden slide if the next slide is hidden. End a slide show.
Ant Control & Garden Ant Treatments in Cleveland & Teesside Danger Level: Green Nuisance Level: Green Thankfully, ants are nothing more than a nuisance although they can leave a raised bite mark on the skin. Ants are an easy insect to deal with and with many different types of ant found in the UK, we have the methods to get rid of any ant infestation. How do I know which ant species it is? As a country with a temperate climate, Britain has a relatively small number of ant species. Warmer parts of the country tend to have more species than further north. Certain ants prefer certain habitats. For example, some prefer the cover and dampness of soil, others enjoy sandy based environments, and other ants enjoy living in decaying wood. There are some ants, however, who can make their nest in a building although, in the UK, this is rare. The most common ant in the UK is the common black garden ant. They are harmless, possess no sting but they are an active ant. Why do ants become a problem? Ants are active in the warmer months of the year and so we receive many calls regarding ants in later spring and throughout the summer. There are a few problems with ants; • The size of their nest – depending on its location, an ant’s nest can be large with thousands of ants all working hard during daylight hours to bring the food home for the queen and the colony. • The location of the nest – ants will make their nest where they prefer the conditions, preferring if they can to avoid areas full of humans, pets and so on. But occasionally, the chance to make a nest in the walls of a property or right outside the front door can be too good an opportunity to miss. • Contaminating food – although ants don’t spread disease or germs, not many people are keen on sharing their food with ants or any other insect. For commercial companies, ants in their food stuff and animal feed is bad news. How are ant infestations dealt with? We have a range of methods that make dealing with ant problems simple and straightforward. However, you need to be aware that when an ant colony becomes too big, they will often divide and start to make another colony close by. With The Pest Technician, we make sure that we deal with the problem quickly and effectively. And that a free onsite assessment to measure the scale of the problem and the best solution. Call the team today on 077 11 99 22 16 or email
Bandwagon Effect as a Cognitive Bias young women all on cell phones Henrik Sorensen/DigitalVision/Getty Images The bandwagon effect refers to the tendency people have to adopt a certain behavior, style, or attitude simply because everyone else is doing it. The more people that adopt a particular trend, the more likely it becomes that other people will also hop on the bandwagon. The bandwagon effect is part of a larger group of cognitive biases or errors in thinking that influence the judgments and decisions that people make. Cognitive biases are often designed to help people think and reason more quickly, but they often introduce miscalculations and mistakes. • Fashions: Many people begin wearing a certain style of clothing as they see others adopt the same fashions. • Music: As more and more people begin listening to a particular song or musical group, it becomes more likely that other individuals will listen as well. • Social Networks: As increasing numbers of people start using certain online social networking websites, other individuals become more likely to begin using those sites as well. The bandwagon effect can also influence how posts are shared as well as interactions within online groups. • Diets: When it seems like everyone is adopting a certain fad diet, people become more likely to try the diet themselves. • Elections: People are more likely to vote for the candidate that they think is winning. Influential Factors So, why exactly does the bandwagon effect occur? Individuals are highly influenced by the pressure and norms exerted by groups. When it seems like the majority of the group is doing a certain thing, not doing that thing becomes increasingly difficult. This pressure can impact many different aspects of behavior, from what people wear to who they vote for in political races. Some of the factors that can influence the bandwagon effect include: The bandwagon effect is essentially a type of groupthink. As more people adopt a particular fad or trend, the more likely it becomes that other people will also "hop on the bandwagon." When it seems that everyone is doing something, there is a tremendous pressure to conform, which is perhaps why the bandwagon behaviors tend to form so easily. A Desire to Be Right People want to be right. They want to be part of the winning side. Part of the reason people conform is that they look to other people in their social group for information about what is right or acceptable. If it seems like everyone else is doing something, then people are left with the impression that it is the correct thing to do. A Need to Be Included Fear of exclusion also plays a role in the bandwagon effect. People generally do not want to be the odd one out, so going along with what the rest of the group is doing is a way to ensure inclusion and social acceptance. The need to belong pressures people to adopt the norms and attitudes of the majority to gain acceptance and approval from the group. While the bandwagon effect can be very powerful and leads to the ready formation of trends, these behaviors also tend to be somewhat fragile. People jump on the bandwagon quickly, but they also jump off it just as fast. This is perhaps why trends tend to be so fleeting. Negative and Dangerous Effects The impact of these bandwagon trends is often relatively harmless, such as in fashion, music, or pop culture fads. Sometimes they can be far more dangerous. When certain ideas begin to take hold, such as particular attitudes toward health issues, bandwagon beliefs can have serious and damaging consequences. Some negative or even dangerous examples of the bandwagon effect: • Individuals who were influenced by the anti-vaccination movement, for example, became less likely to get routine childhood immunizations for their children. This large-scale avoidance of vaccinations has been linked to a recent measles outbreak. • Researchers have found that when people learn that a particular candidate is leading in the polls, they are more likely to change their vote to conform to the winning side. In one study carried out during the 1992 U.S. presidential election, students who learned that Bill Clinton was leading the race in some polls switched their intended vote from Bush to Clinton. A Word From Verywell While the bandwagon effect can have dangerous consequences, it can also lead to the adoption of healthy behaviors. If it seems that the majority of people reject unhealthy behaviors (such as smoking) and embrace healthy choices (such as exercising and working out), people may then become more likely to avoid risky choices and engage in healthy actions. Was this page helpful? Article Sources • Kiss, A & Simonovits, G. Identifying the bandwagon effect in two-round elections. Public Choice. 2014;160(3-4):327-344.
University Of North Carolina Study Explains Why People Get 'Hangry' Do you feel angry when hungry? A study reported this is due to a complex interplay of personality and environmental factors According to the latest research conducted by scientists from the University of North Carolina in Chapel Hill, "hangry" is an intricate interplay between the feeling of hunger and one's level of awareness of that feeling and whatever events happening around the person. Results showed that people who were hungry and saw the negative image first were more likely to guess that the ambiguous picture was something negative or unpleasant. "Our bodies play a powerful role in shaping our moment-to-moment experiences, perceptions and behaviors - whether we are hungry versus full, exhausted versus rested or sick versus healthy", lead author Jennifer MacCormack, MA, a doctoral student in the department of psychology and neuroscience at the University of North Carolina at Chapel Hill. said in a statement. And if you are feeling a little grumpy, take a step back and think about your emotions for a bit - it might help you from turning into a hangry mess. The findings can be found published online in the journal Emotion. "We find that feeling hangry happens when you feel unpleasantness due to hunger but interpret those feelings as strong emotions about other people or the situation you're in", said co-author Kristen Lindquist from the varsity. Science has revealed why you get annoyed when you want something to eat. Depending on the experiment, participants were shown an image created to induce positive, neutral or negative feelings. Then they were given an ambiguous image with a pictograph or a Chinese character and asked to guess if it could mean something pleasant or unpleasant. As you might have guessed, the hungrier the test subject, the more likely he or she was to rate the pictograph negatively. "The idea here is that the negative images provided a context for people to interpret their hunger feelings as meaning the pictographs were unpleasant", said Jennifer MacCormack, the study's lead author. In a separate experiment on 200 people, participants were told to either eat or fast beforehand and then complete a writing test. For a biological state of hunger to turn into an emotional state of anger, the researchers found that negative contexts and lack of self-awareness play a key role. But weirdly, hunger didn't make people rank neutral or positive images as unpleasant, MacCormack says. Afterward, they were asked to fill out questionnaires about their emotions. In a third experiment, the researchers undertook a particularly gruelling laboratory experiment with almost 250 university students. All the students were then asked to write an essay that was either emotional or not related to feelings at all. After the writing exercise, they were all asked to participate in an exercise where the computer crashed right before the exercise was over. This showed researchers that not being aware of emotions can cause us to be hangry - not just hunger. "Our bodies play a powerful role in shaping our moment-to-moment experiences, perceptions, and behaviors - whether we are hungry versus full, exhausted versus rested or sick versus healthy", said MacCormack. Latest news John Cornyn for not taking more concrete steps to push back on President Donald Trump's aggressive trade agenda. McConnell termed it an "exercise in futility" becauseTrump would never sign such legislation. E3 2018: Fire Emblem: Three Houses and Our First Thoughts Fire Emblem: Three Houses will be released exclusively for the Nintendo Switch sometime in Spring 2019. What do you think of it? Fire Emblem's long-awaited arrival on Nintendo Switch is edging closer. Target removing ‘Baby Daddy’ Father’s Day cards from store The term "baby daddy" typically refers to someone who is the father of a woman's child but is not her husband or partner. Still, Saunders tells Fox News she's hoping to "shed some light" on why the cards are offensive. Thousands evacuated as raging wildfire devastates Colorado homes The fire began Tuesday about 2 miles west of Silverthorne, a town with about 4,700 residents and about 65 miles west of Denver . At least six wildfires are burning in the state of Colorado this week, bolstered by hot, dry winds and no rain in the forecast. JUST IN: Cristiano Ronaldo orders agent to get him Manchester United transfer He was just 19 then, and has gone on to become his country's leading scorer with 81 worldwide goals. Ronaldo is 33 now, still in fantastic physical condition and the reigning Ballon d'Or victor . Other news
Aix Galericulata (Mandarin Duck) The Mandarin Duck (Aix galericulata) is a perching duck species found in East Asia. It is medium-sized, at 41–49 cm (16–19 in) long with a 65–75 cm (26–30 in) wingspan. It is closely related to the North American wood duck, the only other member of the genus Aix. Aix is an Ancient Greek word used by Aristotle to refer to an unknown diving bird, and galericulata is the Latin for a wig, derived from galerum, a cap or bonnet. Sagittarius Serpentarius (Secretary Bird) The Secretarybird or Secretary bird (Sagittarius serpentarius) is a very large, mostly terrestrial bird of prey. Endemic to Africa, it is usually found in the open grasslands and savannah of the sub-Saharan region. Although a member of the order Accipitriformes, which also includes many other diurnal raptors such as kites, hawks, vultures, and harriers, it is given its own family, Sagittariidae. Pterapogon Kauderni (Banggai Cardinalfish) The Banggai Cardinalfish (Pterapogon kauderni) is a small tropical cardinalfish in the family Apogonidae. It is the only member of its genus. This attractive fish is popular in the aquarium trade. It is among the relatively few marine fish to have been bred regularly in captivity, but significant numbers are still captured in the wild and it is now an endangered species. Cryptoprocta Ferox (Fossa) The Fossa (Cryptoprocta ferox) is a cat-like, carnivorous mammal endemic to Madagascar. It is a member of the Eupleridae, a family of carnivorans closely related to the mongoose family (Herpestidae). Its classification has been controversial because its physical traits resemble those of cats, yet other traits suggest a close relationship with viverrids (most civets and their relatives). Its classification, along with that of the other Malagasy carnivores, influenced hypotheses about how many times mammalian carnivores have colonized Madagascar. With genetic studies demonstrating that the fossa and all other Malagasy carnivores are most closely related to each other (forming a clade, recognized as the family Eupleridae), carnivorans are now thought to have colonized the island once around 18 to 20 million years ago. Ailuropoda Melanoleuca (Giant Panda, 大熊猫) The Giant Panda (Ailuropoda melanoleuca, literally "black and white cat-foot"; Chinese: 大熊猫; pinyin: dà xióng māo, literally "big bear cat"), also known as panda bear or simply panda, is a bear native to south central China.It is easily recognized by the large, distinctive black patches around its eyes, over the ears, and across its round body. The name "giant panda" is sometimes used to distinguish it from the unrelated red panda. Though it belongs to the order Carnivora, the giant panda's diet is over 99% bamboo. Giant pandas in the wild will occasionally eat other grasses, wild tubers, or even meat in the form of birds, rodents, or carrion. In captivity, they may receive honey, eggs, fish, yams, shrub leaves, oranges, or bananas along with specially prepared food. Todus Multicolor (Cuban Tody) The Cuban tody (Todus multicolor) is a bird species in the family Todidae that is restricted to Cuba and adjacent islands. The family Todidae is confined to the Greater Antilles and includes five species. The genus Todus was split from kingfishers of genus Alcedo and established in 1760. However, the todies appear to be most closely related to the motmots, and especially the Tody Motmot (Hylomanes momotula), a small solitary bird of humid tropical and subtropical forests. Melanerpes Pulcher (Beautiful Woodpecker) The beautiful woodpecker (Melanerpes pulcher) is a bird species in the woodpecker family (Picidae). It is endemic to Colombia. Until recently, it was united with the golden-naped woodpecker (M. chrysauchen) of Central America as subspecies. But the different appearance and allopatric ranges argue in favor of recognizing the two as distinct species. According to "Birds of Northern South America" by Robin Restall the back is barred and the belly and breast are white, but that appears to be in error based on photos of the birds in Colombia.
Alphabet Filter: Definition of infirmity: 1. A personal frailty or failing; foible; eccentricity; a weakness or defect. 2. The state of being infirm; feebleness; an imperfection or weakness; esp., an unsound, unhealthy, or debilitated state; a disease; a malady; as, infirmity of body or mind. ill, unsubstantiality, foible, better, shortcoming, health, vice, puniness, fault, distemper, help, delicateness, strong, delicacy, unsoundness, weakliness, ailing, failing, insubstantiality, confinement, fragileness, weak point, valetudinarianism, tenuity, affliction. Usage examples:
Quick Facts Botanical Name: Bulnesia sarmientoi Family Name: Zygophyllaceae Common Name: Palo Santo, Palo Balsamo,Parguay Lignum and the guaiacwood oil is also referred to as champaca wood. Part used: Wood and Saw dust Specific Gravity: 0.967-0.975 @20°C Refractive Index: 1.506-1.507 @20°C Optical Rotation: 4. 300 to -70 Blends Well With: It blends well with Bergamot, Elemi,Frankincense, geranium, grapefruit, lavender, jasmine, orange blossom, oakmoss, Palma Rosa, patchouli, rose, sandalwood and ylang ylang oils. Guaiacwood is good fixative for woody floral perfumes and is often used to adulterate roseabsolutes, sandalwood and amyris. Thisoil is widely used in varnishes and dark paints and the wood are burned asincense during spiritual rituals. This tree is considered as a sacred treeamong natives of Paraguay and is referred to as “Palo Santo” which means “holywood” and the wood is used for ornamental carving. In olden times theguaiacwood oil was used as a remedy to syphilis. Many people use this oil inblends to treat gout, rheumatism or arthritis pain and also for fluidretention. Countries where it’s found: Paraguay and Argentina Harvesting Information: Guaiacis a tree which grows wild in the jungles of Latin America and is seen abundantly in the Gran Chaco region of Argentina and Paraguay. The tree is lush, evergreen and has short, bright green and oval shaped leaves. The small blue flowers of the tree are often covered by the lush green leaves and the flowers finally turns into white. The fruit of the tree resembles of the yellow orange cherry and the wood which is aromatic is guarded by a thick, smooth and gray bark. History of the Plant: Guaiacwood is a small tree which is also called guayacan and its wood is one of the hardest and the most resilient woods in the world. The wood is considered harder than the oak and the oil extracted from this wood is sweet, woody, milky and have similar odour of that of sandalwood. Due to the use of this wood in Latin America in large quantities for woodworking etc this tree is now protected as endangered species and there is strict regulation in the trade of the plant along with rosewood. The wood is widely used by Native Americans since olden times in treatment of severe ailments like the herpes and syphilis. The heartwood of the tree is brown, black or green with elegant streaks and it offers superior quality charcoal and good timber. Extraction Process: The oil is produced by steam distillation of a mixture of wood and sawdust of palosanto. Commonly known Benefits: Guaiac wood oil is smoky, earthy and has strange base note and the oil is relaxing and calming and works as a fantastic de-stressor. It is an anti-inflammatory and is considered as a venous or lymphatic decongestant. Guaiac wood oil has many health properties and it is widely used for Anti-anxiety, Anti-inflammatory, Anti-oxidant, Anti-rheumatic, Anti-septic, Calming, CNS tonic, Cooling, Diuretic, Lymph decongest, Lymphatic support and Tonic. The melted liquid can be cooled back to room temperature but it can remain liquid for a long time. Guaiac oil has a soft rose like odour like those of hybrid tea roses or violets. The oil is non-irritating, non-sensitizing, and non phototoxic to human skin. quite a wonderful pleasant fragrance, worth product to buy+++++++++++ Write a review Partners Partners
Little Lord Fauntleroy- MysteriYES Today’s mystery came to light on March 8, 1921, and on that day, the Spanish Premier Eduardo Dato e Iradier was assassinated while exiting the parliament building in Madrid. That’s not today’s mystery, I just thought I’d inform you that that’s what happened on that particular day in history. But for good measure, I should let you know that also on March 8, 1921, Allied forces—the victors of World War I—took occupation of the German cities of Dusseldorf, Ruhrort, and Duisberg. But today we will not be in Spain, nor will we be in an Allied-occupied version of Germany that at that point was still reeling from the harsh terms of the treaty of Versailles and ripe for the rise of the Third Reich, led by a charismatic Austrian leader named Adolf Hitler. We will actually be in the great state of Wisconsin, which is the part of the country where my mom’s family is from and where every word that comes out of a native’s mouth sounds like patronizing baby talk. And I’m going to be honest, I spent way too much time this week researching the phonological description of the North Central American English dialect (which is what they speak in Wisconsin and Minnesota), and especially how it relates to the North Midland American English dialect (which is what I speak). None of this relates to the case in any way, but there’s a definite lack of information available in this case compared to some of our other cases, so I had to fill that extra time with something. The town of Waukesha, Wisconsin is about twenty miles due west of Milwaukee and had a generous population of about 12,000 people back in the 1920s when our mystery took place. On March 8, 1921, the same day that Eduardo Dato e Iradier was assassinated and Allied forces took occupation of Dusseldorf, Ruhrort, and Duisberg, a quarry worker for the O’Laughlin Stone Company in Waukesha found the body of a little boy floating in a pond near the stone company. The boy was obviously dead, so the quarry worker called the police and they came out to investigate. The boy was young, and investigators guessed that he was born sometime between 1914 and 1916, meaning that he would have been between five and seven years of age when he died. He was three feet, six inches tall and had blond hair, blue eyes, and was missing a tooth from his lower jaw as boys between the ages of five and seven tend to do. He was dressed in a manner that suggested an affluent upbringing, which was as follows: a gray Bradley sweater, size 6 Munsing-brand underwear (which was based out of Minnesota, suggesting the boy was from the Upper Midwest), black stockings, a blouse, and patent leather shoes with cloth tops. Reportedly, there was no overcoat found on the body or in the surrounding area, which was a bit odd, as the time of his death was determined to be sometime between the fall of 1920 to February of 1921, which would have been a very cold time of year in Wisconsin. The cause of death was determined to be blunt force trauma to the back of the head, as if he were struck by some sort of blunt instrument. Investigators believed that his death had been a murder, only their investigation could not go much farther because no one was able to identify the boy and there weren’t many tests they could run on the body in 1921. The authorities displayed the boy’s body at a local funeral home hoping someone would be able to identify him, but both this and a $1000 reward brought forth no information. This is somewhat understandable, I think, because at this time in history there was no social media or even broadcast television to get his face out to the public outside of the Waukesha area. The story could get disseminated via newspaper, I guess, but the only sketch that was made of the unidentified little boy isn’t particularly distinctive and may not have caught the eye of someone who knew the boy. Plus, when people have been dead for awhile, their faces swell, their skin becomes discolored, and their eyes begin to bulge out of their sockets, which can alter a person’s appearance quite a bit, so if a person isn’t expecting to see this, I could see how they might not recognize a loved one whose remains could have been floating in a pond for months. A different male employee at the O’Laughlin Stone Company reported that five weeks prior to the discovery of the boy’s dead body, a woman in a red sweater and a man with no description given approached him, asking if he had seen a young boy around. The woman appeared to be upset and was crying, while the man was reportedly surveying the pond where the boy would later be found. After being told that the employee had not seen a boy around, the couple got into a Ford vehicle and left. They have never been identified or heard from again. Whether or not they were looking for the same boy that would be found in the pond five weeks later has also never been confirmed. Inevitably the investigation into the boy’s identity and death stalled, as there was no one to claim the body and there was very little forensic investigation they could do in 1921. A Waukesha woman named Minnie Conrad raised money from people in the area in order to bury the child in a nearby cemetery, where Minnie would one day be buried herself. The boy was interred on March 17, just nine days after being discovered in the water. And in case you were wondering, also on March 17, 1921, the Soviet army crushed the Kronstadt rebellion, which caused a large number of sailors to flee to Finland. Just a side note here, since the boy was never identified, he would come to be known as Little Lord Fauntleroy, because he was dressed like the titular character in Francis Hodgson Burnett’s 1886 novel called Little Lord Fauntleroy. Apparently that book is about an American boy who finds out that he is the heir to a British dukedom, so, you know, the story of my life. I tried to watch some of the 1936 movie version of the book, but it was very boring and not relevant to the case at all. Over the years, there were reported sightings of a woman in red, wearing a heavy veil, leaving flowers at the boy’s grave. It is suspected that she may have known the boy somehow, but apparently no one ever thought to approach her and question her about this. And, of course, by now, it’s probably too late to find out if she knew anything about the boy’s identity. This case had no leads for almost thirty years until 1949, when a medical examiner from Milwaukee put forth a theory regarding the boy’s identity. This theory was actually born out of another mystery being uncovered 15 miles east of Waukesha in the Milwaukee suburb of Wauwatosa. On June 16, 1948, a woman named Cecilia Lemay disappeared from her Wauwatosa home. She was the third wife of a man named Edmond Lemay and the two had been married for five years before she went missing. Before her disappearance, Cecilia had been planning to move to Newark, New Jersey with Edmond, as he had gotten a job there with better pay. After Cecilia disappeared, her neighbors began to wonder where the housewife went, and Edmond came up with a few different explanations for them. He told one neighbor that she had gone to Canada to visit a sick aunt, but he also planted a note in his home that read: “I’m going west with Bill. Cecilia.” Lemay would later admit to writing the note to prove to neighbors that Cecilia had left on her own and to indicate that she had been dissatisfied with his salary and married life in general. However, Cecilia’s friends, who believed they knew Cecilia pretty well, decided this was unlikely and called the police to report that she was missing. A search for her began on September 9th of 1948, and investigators believed foul play was involved in her disappearance. And, by the way, also on September 9th, 1948, a pitcher for the Brooklyn Dodgers named Rex Barney threw a no-hitter in a 2-0 win over the New York Giants. A few days after Cecilia vanished, Edmond decided to go ahead and move to Newark without his potentially endangered wife, where he had bought a house with a different woman named Eva Clark, who pretended to be his wife sometimes and also claimed to be his housekeeper other times, which is very suspicious behavior if you ask me. These two also wrote letters to Cecilia’s work, saying that she had moved to New Jersey all of a sudden and would no longer be working there. After being called out for this, Edmond claimed that he and Eva had done this to cover up for Cecilia after she allegedly left him, so that her workplace would not be caught off-guard when she didn’t show up. You know, because apparently Edmond is such a do-gooder and cares about that sort of thing. On September 13th of 1948, four days after the search for Cecilia began, Edmond was questioned regarding Cecilia’s disappearance and repeatedly denied knowing anything about what happened to her. However, a polygraph suggested that he was being deceptive with his answers. And then, strangely, on September 16th, Edmond apparently began his own investigation into what happened to Cecilia, but I think that may have just been to make a show of his own innocence. Edmond would later be arrested for forging his wife’s signature on her payroll checks so that he could cash them while she was missing, which is more suspicious behavior. Edmond would not be found guilty for forging his wife’s signature and was let go after the investigation into his wife’s disappearance stalled. Cecilia has never been found to this day. You know what we should say about this? It’s a mystery, so mysterious—but not too mysterious, because I’m 95% certain that Edmond was responsible for her disappearance. Now, you may be wondering what in the gosh darn heck a missing woman in one town has to do with an unidentified dead boy found almost 30 years earlier in a different town? Well that’s a great question, but first, Willy, let’s tell our listeners a little bit about our sponsor. If you’ll remember, earlier I told you that Cecilia was Edmond’s third wife. Edmond was married to his first wife until she died of tuberculosis in 1919. The two had a son named Homer Lemay, who was born in 1914. After the first Mrs. Lemay died, Edmond reported that he left his son Homer in the care of some family friends named Mr. and Mrs. James Norton. I’m not sure if this is some sort of de facto foster care placement or something, but Edmond claims that his son was no longer living with him after his wife’s death. Sometime in 1920 or 1921, the Nortons apparently took six-year-old Homer to Argentina on vacation, which is a nice thing to do for a child who isn’t yours. Since Edmond seemed to no longer be involved in little Homer’s life, he did not go on this trip with his son. Edmond reported that his son Homer died in a car accident in Buenos Aires, Argentina, and that he didn’t actually find out about his boy’s death until the Nortons sent him a clipping from a South American newspaper chronicling the accident, which is a really bizarre way to tell someone their child died while they were in your care. However, when investigators looked into Edmond’s story, they could find no accounts of the boy’s death in Argentina, even though Edmond claimed that at least one newspaper had covered the story, since the Nortons had sent him a clipping about it. Investigators were also unable to confirm the existence of any family friends named the Nortons who would have taken Homer to Argentina, which, like so much of Edmond’s behavior we’ve seen thus far, is very suspicious. I guess like the situation with Edmond’s missing third wife, nothing happened to him as a result, even though the circumstances of his son’s disappearance were incredibly suspicious. However, like I said earlier, that Milwaukee medical examiner came out in 1949 and suggested that Homer Lemay could be the true identity of Little Lord Fauntleroy. Homer disappeared shortly before Little Lord Fauntleroy was found, and while Edmond claimed his son died in South America, there is no evidence of this whatsoever, so it is conceivable that Little Lord Fauntleroy is, indeed, Homer Lemay. And if you look at the picture of Homer Lemay, he does kind of like look the sketch of Little Lord Fauntleroy. Although, to be fair, Homer Lemay doesn’t have any particularly distinctive characteristics, so to say that this one boy looks kind of like this other boy isn’t really saying all that much. As near as I could tell, before he disappeared, Homer lived in Milwaukee, Wisconsin, which is about twenty miles away from Waukesha. So the going theory is that Edmond—who we’ve already decided is a rather nefarious character—did not want to raise his son as a single father. But, instead of turning custody of the boy over to some family friends called the Nortons as he claimed he had, Edmond whacked his son on the back of the head with some sort of blunt object. As intended, the boy died and his body was dumped in a pond in the nearby town of Waukesha. And, if Little Lord Fauntleroy was murdered by his own father, it makes sense why he was never identified by family members. There has never been any conclusive evidence to legitimately link Homer Lemay to Little Lord Fauntleroy, although the circumstantial evidence is certainly compelling. I read in a newspaper headline from 1949 that there were talks of exhuming Little Lord Fauntleroy’s body, but I wasn’t able to figure out if this actually ever happened, although I don’t think it did. This theory seems like it’s pretty clean, but it does leave us with some unanswered questions. For example, who was the couple that approached the quarry worker five weeks before the boy was found? Edmond’s wife was dead, and I doubt he would want to draw any attention to the fact that his son was missing, since the boy was allegedly in Argentina. I’ve seen some speculation that this couple could have been the Nortons, but since there is no evidence that the Nortons actually existed, I find this unlikely. Another unanswered question we have to deal with if we accept the Homer Lemay theory is, who was the veiled woman visiting Little Lord Fauntleroy’s grave? It couldn’t have been the boy’s mother, since she died in 1919. It could be explained that she was another family member of Homer’s (perhaps an aunt or a grandmother) who knew what happened to the boy, but who didn’t want to come out with the information, either because she wanted to protect Edmond or because she was being threatened by him to stay silent. It’s still baffling to me that rumors about the woman could spread without anyone choosing to ask her who the heck she is. The Homer Lemay theory isn’t the only theory out there about this case, though I’ll admit that it’s the only one that has any real circumstantial evidence to it, however little. But we would be remiss if we didn’t discuss the other theories about how this boy came to end up dead in a pond. There’s one theory that suggests that the boy was playing in or around the pond, which may have been in a quarry—I couldn’t quite tell—when he was struck in the back of the head by falling rocks from the quarry. This theory would then suggest that the couple met by the quarry worker were the boy’s parents, who were frantically looking for their son after he either wandered off or didn’t come home when he was expected to. The man was reportedly surveying the area where the boy would eventually be found, which might suggest that this was the area from which the boy went missing. I think this is an enticing theory because I think some people would rather believe that a boy died accidentally instead of being murdered and dumped in a pond. However, I think this is unlikely because the boy was fully dressed, and if you’re playing in a pond, you’re probably going to remove some of your clothing—at least your shoes and socks. I guess the reason why he would have been fully clothed was because his estimated time of death was in the fall or the winter in Wisconsin, and I don’t know if you’ve ever been to Wisconsin during that time of year, but it is very cold. However, because it was the fall or winter, I think it’s unlikely that the boy was playing near the pond at all, especially because he didn’t have an overcoat on, nor was it found nearby. If he was going to play near the pond when it was probably so cold, you’d think he would be wearing an overcoat. Also, if the boy had been playing near the pond when he died, how come his parents—who obviously knew he was missing in that area if they were searching for him—never came forward to claim him? But the best reason I think we can disregard this theory is that, if the boy was killed by falling rocks and fell into the pond, he would have been floating in the water when the parents were searching for him and he would have been found. This happened five weeks before the boy was found, and I find it hard to believe that the body was floating there for five weeks before it was finally found. A similar theory is that he was playing above the pond and fell into the quarry, landing in the water where he would later be found. However, I think this is even less likely than the previous theory, since the only documented injury was to the back of his head. If you’re going to fall into a quarry, you’re probably going to have quite a few injuries to various parts of your body. And again, why would you be playing outside in the Wisconsin winter without an overcoat? And why didn’t his parents—who we would assume had searched the area—claim the boy’s body as their son? And then who was the woman in the red veil, and why did she feel the need to conceal her identity? The last theory I want to touch on is that Little Lord Fauntleroy was not Homer Lemay, but was a boy who was kidnapped from somewhere else, murdered, and then dumped in the pond in Waukesha. According to this theory, if the boy was from far enough away, this could explain why he was never identified, because maybe the news of the boy’s discovery never made its way to the family. I mentioned it earlier, but the boy was most likely from the Upper Midwest because his underwear was from a Minnesota-based company, but even if he was abducted from Minnesota or even another part of Wisconsin, there’s a fair chance that news of his discovery may not have made it to the family. I don’t know that I buy the stranger abduction theory, though. For one thing, a death blow to the back of the head could suggest that the boy might have been comfortable enough with his killer to turn his back to him, but I’m not sure if this would have happened if he was abducted and killed by a stranger. It certainly doesn’t mean it couldn’t happen, but the injury suggests to me that the boy knew and trusted his killer. Another reason I don’t know that I believe this theory is that the boy was fully dressed and there was no documented evidence of sexual assault. While not all child abductions and subsequent murders are sexually motivated, it seems fair to me to say that a majority of them are. There’s nothing that I read that would suggest any sexual element to this crime, which casts another shadow of doubt on the stranger abduction theory. And then of course, that pesky couple causes problems with this theory as well. If the boy was abducted from far away, who were these people and why were they searching for the boy in Waukesha, so close to where he would later be found? It seems unlikely to me that, if these were the boy’s parents, they would frantically search for their son so serendipitously near the spot where his body would be discovered if he was, indeed, from far away. I stumbled upon a few other theories or unpolished attempts at theories on the internet that got a little wild, so we won’t go in to any more of those. So let me outline what I think is the most likely explanation of the crime. The boy was found fully dressed, but without his overcoat, which likely should have been worn if the boy were to be outside during the fall and winter months in Wisconsin, when it is estimated that the boy died. This suggests to me that the boy was inside, perhaps in his own home, when he was murdered. If this is the case, it’s a little interesting that the boy is fully dressed in his own home. When I’m at home leisurely, you’ll be lucky to get me to put on socks, much less the almost formal layers this boy is wearing. I suppose the family could have been going out that day or just gotten back from somewhere, which could explain why the boy was all dressed up. Or I guess it could have just been the culture of the time or the family to be that dressed up at home. Additionally, I think the fact that the blow was to the back of the boy’s head suggests familiarity with the killer, as if the killer could have been a family member who the boy trusted. If someone in the family was responsible for the boy’s death, it makes sense why they or anyone else in the family wouldn’t have come forward to claim the boy’s body. Now, a blow to the back of the head by no means confirms that the little boy knew and trusted his attacker. He could have been snuck up on by a stranger or told “turn around or I’ll kill your whole family.” But I do think that it’s fair to suspect that the injury at least suggests that the boy knew his attacker. I’m not necessarily saying that Little Lord Fauntleroy was Homer Lemay, but I think that a boy who was killed by a family member seems like the most likely explanation. There is no sign of overkill, torture, or sexual assault on the boy, which suggests that the blow to the head was merely a functional necessity to cause the boy to die. If Little Lord Fauntleroy was Homer Lemay, then most likely he was killed by his father Edmond who, after his wife died a couple years before, may have decided he was no longer interested in raising a boy by himself. Edmond dumped the boy’s dead body twenty miles away in Waukesha, and then invented a story about his son dying in South America, which would have been a lot easier to pass off in 1921 than 2017, as evidenced by the fact that no one batted an eyelash at the story until almost thirty years later when authorities realized that there’s no evidence to suggest that this major event actually happened. The couple seen five weeks before Little Lord Fauntleroy was found doesn’t really fit with this theory, and it really doesn’t fit well with any of the theories, which makes me wonder if it is even related to the Little Lord Fauntleroy case at all. I mean, just because a couple was searching for a boy five weeks before a boy was found dead doesn’t necessarily mean it was the same boy. The couple could have asked the man if he’d seen their boy, and then driven off and found him later, and then it was a completely different boy who was found in the water five weeks later. I don’t believe that the couple and the missing boy are necessarily related. It would be a pretty big coincidence if they weren’t, but coincidences happen all the time, so we shouldn’t dismiss something simply because it’s a coincidence. Although, to be fair, I don’t think we should accept something on the pretense that just any coincidence is probable or even possible. Oh, and about the woman in the veil? I think she could either be a family member who knew about what happened to Homer, or just somebody who wanted to honor the boy and maybe play up the mystery factor a little bit. Or perhaps the woman never actually existed in the first place and the reported sightings of her were mere urban legend. Either way, I don’t think her identity is all the important to solving the case. It’s just a somewhat spooky footnote to an unsolved and—at this point— probably unsolvable case. So that’s the story of Little Lord Fauntleroy. Any new insights to bring to this nearly century old case?
Market News March 16, 2016 Human toll of pollution: WHO estimates 12.6 million die from unhealthy environments each year. The World Health Organization has put a number on the people estimated to have died as a result of living or working in an unhealthy environment and it's big -- 12.6 million. That number represents one in four of all deaths globally and underscores the devastating impact of the chemicals and waste we've been putting into the air, water and earth since the end of World War II. The WHO said deaths due to non-communicable diseases -- which include heart disease and cancer and are related to exposure to pollution -- now make up 8.2 million or nearly two-thirds of the total deaths. Deaths from infectious diseases -- such as malaria and diarrhea -- due to unsafe water and lack of sanitation represent one-third and are on the decline. "If countries do not take actions to make environments where people live and work healthy, millions will continue to become ill and die too young," WHO Director-General Margaret Chan said. The report is part of an effort by world leaders over the past year to inform the public of the close link between seemingly theoretical issues like climate change to something an individual can relate to -- their own health. In March of last year, the director of China's meteorological administration gave a speech that was widely shared on social media in the country warning of the "severe threat" of climate change on the spread of mosquito-borne diseases and those that afflict children who play in infected waters. In the United States, President Obama convened a summit on health and climate change in June. "We know climate change is not a distant threat, we are already seeing impacts in communities across the country," the White House said, citing the rising rates of asthma in the United States. In December, these and other countries joined together to ratify a universal pact to slow global warming -- the most ambitious ever undertaken. While every corner of the world has been impacted by changes in the environment, those in low- and middle-income countries in Asia that are manufacturing hubs are the worst affected. The WHO's South-East Asia Region, which includes India and Bangladesh, and its Western Pacific Region, which includes China, had 7.3 million of the total deaths. Most of the deaths were in children under 5 years of age and the elderly. In the young, it was mostly due to respiratory infections and diarrheal diseases and in the old it was due to cardiovascular diseases, including stroke and heart disease. Below is a breakdown from the report for leading causes of environment-related deaths for all age groups: •Stroke -- 2.5 million deaths annually •Ischaemic heart disease -- 2.3 million deaths annually •Unintentional Injuries (e.g. road traffic deaths) -- 1.7 million deaths annually •Cancers -- 1.7 million deaths annually •Chronic Respiratory Diseases -- 1.4 million deaths annually •Diarrheal Diseases -- 846,000 deaths annually •Respiratory Infections -- 567,000 deaths annually •Neonatal Conditions -- 270,000 deaths annually •Malaria -- 259,000 deaths annually •Intentional injuries (e.g. suicides) -- 246,000 deaths annually
Archiwa kategorii: Łukasz Hammerhead Shark Fast Facts • Size: 4 to 6 m • Weight: 230 to 450 kg • Average life span in the wild: 20 to 30 years The Perfect Predator Little Ones And The Big Ones Most hammerhead species are fairly small and are considered harmless to humans. Illustration: Hammerhead shark compared with adult manHowever, the great hammerhead’s enormous size and fierceness make it potentially dangerous, though few attacks have been recorded. The great hammerhead is the largest of the nine identified species of this shark. It can grow up to 20 feet (6 meters) in length and weigh up to 1,000 pounds (450 kg), although smaller sizes are more common. Shark With A Radar One group of sensory organs is the ampullae of Lorenzini, which allows sharks to detect, among other things, the electrical fields created by prey animals. The hammerhead’s increased ampullae sensitivity allows it to find its favorite meal, stingrays, which usually bury themselves under the sand. Giant Squid Shortly About The Squid Giant squid can grow to a tremendous size due to deep-sea gigantism recent estimates put the maximum size at 13 m for females Kałamarnica-kałamarnice-1and 10 m for males from the posterior fins to the tip of the two long tentacles estimated 14 m. The giant squid remains largely a mystery to scientists despite being the biggest invertebrate on Earth. The largest of these elusive giants ever found measured 59 feet (18 meters) in length and weighed nearly a ton (900 kilograms). Hidden Giant However, their inhospitable deep-sea habitat has made them uniquely difficult to study, and almost everything scientists know about them is from carcasses that have washed up on beaches or been hauled in by fishermen. Lately, however, the fortunes of scientists studying these elusive creatures have begun to turn. In 2004 researchers in Japan took the first images ever of a live giant squid. And in late 2006, scientists with Japan’s National Science Museum caught and brought to the surface a live 24-foot (7-meter) female giant squid. Scientists don’t know enough about these beasts to say for sure what their range is, giant-squid_544_600x450but giant squid carcasses have been found in all of the world’s oceans. Those Eyes ! Invertebrate Diet Organic Driving Gear Flying Fish How Those Fishes Flyies ? Species of Flying Fish Life of Fish Flying fish are attracted to light, like a number of sea creatures, and fishermen take 1280px-Pink-wing_flying_fishadvantage of this with substantial results. Canoes, filled with enough water to sustain fish, but not enough to allow them to propel themselves out, are affixed with a luring light at night to capture flying fish by the dozens. There is currently no protection status on these animals. The narwhal, is a medium-sized toothed whale and possesses a large „tusk” from a protruding canine tooth. It lives year-round in the Arctic waters around Greenland, Canada, and Russia. Unicorn of the seaHI_232821_Paul_Nicklen_National_Geographic_Stock_WWF_Canada The narwhal is the unicorn of the sea, a pale-colored porpoise found in Arctic coastal waters and rivers. These legendary animals have two teeth. In males, the more prominent tooth grows into a swordlike, spiral tusk up to 2.7 meters long. The ivory tusk tooth grows right through the narwhal’s upper lip. Scientists are not certain of the tusk’s purpose, but some believe it is prominent in mating rituals, perhaps used to impress females or to battle rival suitors. Females sometimes grow a small tusk of their own, but it does not become as prominent as the male’s. Narwhal travels 4Narwhals are related to bottlenose dolphins, belugas, harbor porpoises, and orcas. Like some other porpoises, they travel in groups and feed on fish, shrimp, squid, and other aquatic fare. They are often sighted swimming in groups of 15 to 20, but gatherings of hundreds or even several thousand narwhals have been reported. Sometimes these groups become trapped by shifting pack ice and fall victim to Inuit hunters, polar bears, or walruses. Why people hunt for narwhals ? o-NARWHAL-facebookInuit people hunt the narwhal for their long tusks and their skin, an important source of vitamin C in the traditional Arctic diet. They are allowed to hunt this whale species legally for subsistence. Narwhals have been extensively hunted the same way as other sea mammals, such as seals and whales, for its large quantities of fat which are one of the most important resources of the native people in Arctic regions. Almost all parts of the narwhal, meat, skin, blubber and organs are consumed. Portuguese man o’ war Why „Man o’ war” ? The name „man o’ war” comes from the man-of-war, an 18th-century armed sailing ship,and the cnidarian’s supposed resemblance to the Portuguese version at full sail. In other languages it is simply known as the ‚Portuguese war-ship. Not a Jellyfish ? giant06-man-o-war_17455_990x742 Anyone unfamiliar with the biology of the venomous Portuguese man-of-war would likely mistake it for a jellyfish. Not only is it not a jellyfish, it’s not even an „it,” but a „they.” The Portuguese man-of-war is a siphonophore, an animal made up of a colony of organisms working together. The longest colony on the world The tentacles are the man-of-war’s second organism. These long, thin tendrils can extend 165 feet (50 meters) in length below the surface, although 30 feet (10 meters) is more thexxport-1average. They are covered in venom-filled nematocysts used to paralyze and kill fish and other small creatures. Deadly Venom This species and the smaller Indo-Pacific man o’ war are responsible for up to 10,000 human stings in Australia each summer, particularly on the east coast, with some others occurring off the coast of South Australia and Western Australia. For humans, a man-of-war sting is excruciatingly painful, but rarely deadly. But beware—even dead man-of-wars washed up on shore can deliver a sting. Real Portuguese sailor Two sailfish species have traditionally been recognized.sailfish-mexico -Atlantic sailfish -Indo-Pacific sailfish Sailfish grow quickly, reaching 1.2–1.5 m in length in a single year, and feed on the surface or at middle depths on smallerpelagic forage fish and squid. Individuals have been clocked at speeds up to 110 km/h, which is one of the highest speeds reliably reported in any water organism. Generally, sailfish do not grow to more than 3 m in length and rarely weigh over 90 kg. Its shape resembles a large sail, hence the common name of the species. Fin may be made by the fish back in the oblong hole. During the fight it is rigidly set, sometimes issued over the water surface. Sperm Whale Sizekaszalot 3 The sperm whale is the largest toothed whale, with adult males measuring up to 20.5 metres long and weighing up to 57,000 kilograms. By contrast, the second largest toothed whale, Baird’s Beaked Whale measures 12.8 metres (42 ft) and weighs up to 14,000 kg. Sperm whales usually dive between 300 to 800 metres , and sometimes 1–2 kilometres to search for food. Such dives can last more than an hour. They feed on several species, notably the giant squid, but also the larger colossal squid, octopuses, and diverse fish like demersal rays, but the main part of their diet consists of medium-sized squid. Some prey may be taken incidentally while eating other items. kaszalot 1Teeth The sperm whale’s lower jaw is very narrow and underslung. The sperm whale has 18 to 26 teeth on each side of its lower jaw which fit into sockets in the upper jaw. The teeth are cone-shaped and weigh up to 1 kilogram (2.2 lb) each. The teeth are functional, but do not appear to be necessary for capturing or eating squid, as well-fed animals have been found without teeth or even with deformed jaws. Sperm whales live in oceans and most seasOften in areas of giant squidWater prefertropical and subtropical zonesAdult males go on the journey to the polar zonesIn the 1980s, 3/4 of the population of sperm whales dwelled in the southern hemispher . The brain is the largest known of any modern or extinct animal, weighing on average about 7.8 kilograms, more than five times heavier than a human’s, and has a volume of kaszalot 2about 8,000 cm3. Although larger brains generally correlate with higher intelligence, it is not the only factor. Elephants and dolphins also have larger brains than humans. Day 13 – Grand Canyon National Park After a walk in Las Vegas we wanted very much to go to the largest Canyon in the worldtheGrand Canyon National ParkTo get there we had to ride in the car about 9 hours After reaching the placewe have read with the mapand we plan to explore this wonderfulplaceAt the beginning we went to the place from which yocan watch the entire Canyon.When I approached I saw the fault about kilometre down and at the end was River Colorado Then walked around the edge of the Canyonlooking at viewwho represented Canyon.During this we went to several stores to buy something to drinkUnfortunatelydue to the every long journey we didn’t see as much as we wanted, but still according to me was brilliant. Day 12 – Las Vegas _DSC7643After passage through the Valley of death we went to Las VegasIt’s a huge city and also thecapital of gamblingwhich the whole world knows When we drove into the city we looked at where we had to spend two daysAfterpodjechaniat the door we have received the keys and we went to the room to unpack andprepare for trips to the main street in Las Vegas When the dusk sets out for a walk,because we wanted to see the neon signs and lights thatbeautifully looked after duskDuring the trip we saw in the shape of a castlethe towers ofthe Eiffel Towerthe statue of liberty and the largest hotel in the United States-GrandHotelAs I walked through the streetadmired the architecture in this beautiful city That day there were few things to describe, but it was worth itAnd so ended up tiring day inLas Vegas._DSC7689_DSC7709
Site Loader To Survive in Auschwitz requires luck as well as the strength of one’s personal ability, and physical capability as Primp Levi describes in his book Survival in Auschwitz. Primp Levi an Italian Jew, was 24 when he was sent to Auschwitz in 1944. He managed to survive the horrific memories throughout the Holocaust, one of the most devastating events in history throughout world war II. The Holocaust represent a time when Hitler and his Nazis army killed 6 million Jews men women and children, and an additional 6 million others, in death by starvation, gassing, or brutality. Levies use the phrase “the emulation of man” as he describes his initial entry into the camp system, men like himself were stripped of all of their personal identity, millions of men and women were forced to become numbers and to fall in line with a system that demanded absolute obedience. Many struggle for their very existence against fellow prisoners, a large portion of them died as a result of the brutality they incurred. In the “Canto of Ulysses” Levi again talks about different experience and relationship with other inmates. He refers to Jean the Alsatian Piccolo as higher ranked prisoners and Kapok assistant who was in harked of prisoners. Although Piccolo is a prisoner himself, he was the Kapok assistant, however I believe as part of Levies luck, he was able to survive because he was the one teaching him Italian. As I was reading this, kept thinking about how shocking and powerful the memoir of Primp Levies experience in Auschwitz has made me. I never really thought of concentration camps and the holocaust and I can’t say reading this it helped me understand, but feel like such events can never be understood, it certainly scared my memory. Post Author: admin
A busy Universe — LIGO may have spotted a black hole-neutron star merger A few years of this and we'll understand the afterlife of dead stars. Image of two long arms of the LIGO detector in the desert of eastern Washington. Enlarge / Our gravitational wave detectors really are a series of tubes. On April 1, the teams behind the three gravitational wave detectors started them up for a new observational run, the first with all three operating in parallel for the full run. With the benefit of three detectors and some upgrades that were done during the downtime, we're seeing a flood of new data. In just one month, LIGO/VIRGO has seen five gravitational wave events. Three of those are from merging black holes, one was the second neutron star merger, and another may have been the first instance of a neutron star-black hole merger. A new season The two LIGO detectors have been a work in progress for years, starting with an early version that everyone acknowledged was unlikely to pick up gravitational waves. But each iteration has allowed scientists to understand the sources of error in their detectors, and they've been taken down for regular upgrades. The international collaboration also benefits from the fact that two additional detectors, Europe's VIRGO and Japan's KAGRA, have similar designs, and all the teams share what they're learning about the hardware. VIRGO joined LIGO for roughly a month in 2017 before its second observational run came to a close. According to Caltech's Jess McIver, a LIGO team member, work in the intervening time went into "pushing down the quantum noise limits in the detectors." As a result of the lowered noise, McIver said that the detectors can pick up gravitational wave events farther out into space than was ever possible before. Having three detectors helps provide better spatial information as to where the event actually originated, necessary for doing follow-up observations with traditional observatories. And, as one of the events described today makes clear, three detectors let us continue to take data even if one detector is down temporarily. McIver added that the KAGRA detector is expected to come online later in this run, providing even better resolution. So, what have we seen since the run started on April 1? Three events appear to be mergers of two black holes, similar to the merger that provided the first detection of gravitational waves. The identity is determined by matching the waves picked up by the detectors to models of different masses colliding; neutron stars and black holes exist in different mass ranges, allowing the detectors to infer what's doing the colliding. Salvatore Vitale of MIT, however, described how there's a mass gap between about two solar masses (the upper limit of neutron stars) and the smallest known black holes, which are about five solar masses. Vitale said events that seem to have an object in that mass gap are high priority for follow-up observations so we can better understand what's going on there. The other two events are more intriguing. One, which occurred on April 25, appears to be a neutron star collision that occurred 500 million light years away. Unfortunately, LIGO-Hanford in Washington was offline that day, so it was only registered in two detectors, which provided very poor spatial resolution. There's no word yet on whether any optical telescopes picked up information on the event, but they'd have to search roughly a quarter of the sky to do so. A day later, all three detectors were online when an extremely distant event occurred roughly 1.2 billion light years away. This has tentatively been identified as the first merger we've seen between a black hole and a neutron star. It's not clear whether we should expect an optical counterpart to this sort of merger, but its position was narrowed down to only three percent of the total sky, suggesting we should have some good data on it if there's anything to see. Going public Earlier discoveries by LIGO/VIRGO went through the usual scientific publishing process before the press was notified that they'd be announced. Today's press conference and the tweet above (which was written two days ago) are indications that we've entered a rather different approach to public disclosure of gravitational wave events. In fact, LIGO/VIRGO has opened up its notification process to the public; formerly, it was used to alert astronomers of possible locations for follow-up observations. Now, anyone can sign up for alerts, or simply follow the @LIGO twitter account. There's also now an iPhone app that lets you follow the event announcements (an Android version is in the works). In short, anyone who's interested can find out what LIGO is seeing within a day of when the LIGO scientists themselves do. While most of us won't be able to do detailed follow-up observations, one of the LIGO team members suggested that amateurs can potentially help by identifying galaxies within the area of interest. LIGO spokesman Patrick Brady of the University of Wisconsin-Milwaukee suggested that LIGO is gradually normalizing what had been "first of its kind" events just a couple of years ago. We've now seen enough black hole mergers that they won't do dedicated publications for them; instead, they'll be published as part of a catalog following every six months of observation (each observing run is expected to last a year). Unusual and distinctive events should be flagged quickly and appear in a publication roughly three months afterwards. Right now, with only one neutron star merger having been definitively identified, these would probably fall into the "unusual" category. But that will probably end up being a temporary designation. If the upgraded LIGO works as well as it's expected to, we may be seeing one of these events every month over the next year. The consensus seems to be that, over time, gravitational wave science will shift toward a focus on events that are either very rare—and simple mergers won't be among those—and analyses that require lots of events in order to provide some statistical certainty. But everyone held out the hope that, either through luck or further refinement of instruments, we'll be able to see something that we hadn't planned to find. You must to comment. Channel Ars Technica
re: A Short History of Artificial Intelligence VIEW POST Intelligence is not very well defined term. The more interesting question whether human brain or consciousness really has intelligence ? Does this level intelligence achievable by combination of complex neural networks? Indeed, Intelligence is a very complex and interesting topic. I tried to explain it as simple as possible. I just wanted to point out, that it can be defined in many different ways like logic, understanding, self-awareness, learning, emotional knowledge, planning, creativity and problem solving. Further I wanted to make clear, that there is not only Human Intelligence, but Animals, Plants have different levels of intelligence. code of conduct - report abuse
Knowledge for better food systems In this letter, over 100 researchers and practitioners argue that media coverage of the 2016 International Peat Congress (the first to be held in the tropics) was dangerously misleading in its assertions that peatland management under palm oil plantations was sustainable (see for example this news article by BorneoPost). They argue that such articles, by downplaying the issues imposed on peatland ecosystems by agriculture, undermine recent real and promising advances in tropical peatland management. Drawing on a wealth of available peer-reviewed literature, the authors detail the many well-evidenced problems with modern agricultural practices that affect peatland (including the impacts of deforestation, land clearance, drainage and fertilisation) and the knock-on effects these have on the wider environment and health. In particular, they emphasise the substantial carbon dioxide emissions and other environmental damage associated with burning peatland, as well as the health implications of the associated haze effects. Additionally, the authors argue, all tested agricultural practices to date cannot prevent the loss of peat and subsequent subsidence of the land, resulting in flooding by saltwater. This makes the land unsuitable for agriculture, further contributing to the unsustainability of these practices. This depletion of natural resources without replenishment and for economic gain could in fact be considered “mining”. The letter argues that in some developing countries, human socio-economic need can justify some ongoing peatland-based agriculture and resulting peat loss, but that evidence-based land management measures can help minimise these impacts. The authors welcome growing recognition of the importance of unsustainable peatland management, by governments, consumers and some sectors of industry, but express deep concerns that policy-influencing media continue to deny the evidence of the need for improved peatland management. The letter concludes that while the technologies and practices to improve the sustainability of tropical peatland agriculture are being developed and are becoming available, the perpetuation by the media of the mistaken idea that there is not a problem with the sustainability of peatland agriculture is influencing policy makers, and discouraging them from prioritising the implementation of these new technologies/practices. This letter represents an important rebuttal of misleading media reporting but, somewhat counterproductively, is not available open access, which means its audience is likely to be limited (although see this press release). reference: Wijedasa, L.S., Jauhiainen, J., Könönen, M., Lampela, M., Vasander, H., LeBlanc, M.-C., Evers, S., Smith, T.E.L., Yule, C.M., Varkkey, H., Lupascu, M., Parish, F., Singleton, I., Clements, G.R., Aziz, S.A., Harrison, M.E., Cheyne, S., Anshari, G.Z., Meijaard, E., Goldstein, J.E., Waldron, S., Hergoualc’h, K., Dommain, R., Frolking, S., Evans, C.D., Posa, M.R.C., Glaser, P.H., Suryadiputra, N., Lubis, R., Santika, T., Padfield, R., Kurnianto, S., Hadisiswoyo, P., Lim, T.W., Page, S.E., Gauci, V., van der Meer, P.J., Buckland, H., Garnier, F., Samuel, M.K., Choo, L.N.L.K., O’Reilly, P., Warren, M., Suksuwan, S., Sumarga, E., Jain, A., Laurance, W.F., Couwenberg, J., Joosten, H., Vernimmen, R., Hooijer, A., Malins, C., Cochrane, M.A., Perumal, B., Siegert, F., Peh, K.S.-H., Comeau, L.-P., Verchot, L., Harvey, C.F., Cobb, A., Jaafar, Z., Wösten, H., Manuri, S., Müller, M., Giesen, W., Phelps, J., Yong, D.L., Silvius, M., Wedeux, B.M.M., Hoyt, A., Osaki, M., Takashi, H., Takahashi, H., Kohyama, T.S., Haraguchi, A., Nugroho, N.P., Coomes, D.A., Quoi, L.P., Dohong, A., Gunawan, H., Gaveau, D.L.A., Langner, A., Lim, F.K.S., Edwards, D.P., Giam, X., van der Werf, G., Carmenta, R., Verwer, C.C., Gibson, L., Grandois, L., Graham, L.L.B., Regalino, J., Wich, S.A., Rieley, J., Kettridge, N., Brown, C., Pirard, R., Moore, S., Ripoll Capilla, B., Ballhorn, U., Ho, H.C., Hoscilo, A., Lohberger, S., Evans, T.A., Yulianti, N., Blackham, G., Onrizal, Husson, S., Murdiyarso, D., Pangala, S., Cole, L.E.S., Tacconi, L., Segah, H., Tonoto, P., Lee, J.S.H., Schmilewski, G., Wulffraat, S., Putra, E.I., Cattau, M.E., Clymo, R.S., Morrison, R., Mujahid, A., Miettinen, J., Liew, S.C., Valpola, S., Wilson, D., D’Arcy, L., Gerding, M., Sundari, S., Thornton, S.A., Kalisz, B., Chapman, S.J., Su, A.S.M., Basuki, I., Itoh, M., Traeholt, C., Sloan, S., Sayok, A.K., and Andersen, R. (2016) Denial of Long-Term Issues with Agriculture on Tropical Peatlands Will Have Devastating Consequences. Global Change Biology. doi: 10.1111/gcb.13516 Read the full letter here (Paywall). Or read a summary article here. And through the keyword categories: Add comment Member input Plain text
Baby Hives Baby hives can be irritating to the child and distressing for the parents. There are many reasons why an infant might be experiencing tiny, red bumps or rashes, and there are a number of ways to treat the condition. What are Baby Hives? Hives are a skin reaction that presents as small, red bumps either in one area or spread all over the body. Also known as urticaria, skin hives and welts, they are typically outlined in red with a pale, raised center and they may appear in different shapes and sizes, from pinpricks to large clusters. Similar in look to mosquito bites, they are a common allergic reaction. Hives can last from a few hours to several days to possibly longer, depending on the cause of the reaction. Baby hives aren’t contagious, but they may spread on the child’s skin. Hives occur when a chemical called histamine is released into the body. Histamine works to counteract allergens, viruses and even insect bites, making the culprit sometimes difficult to find. If your baby has trouble breathing or swallowing, has a sudden cough or wheeze or develops widespread hives after taking a prescription medicine or high-risk food, consult a doctor or emergency room immediately. What are the Symptoms of Baby Hives? The raised red or pinkish bumps associated with hives are the first symptom. The area may or may not be itchy and some hives will lead to a rash. The area of the hives and rash may be related to the cause, an example being an insect bite, or they may be all over the body, which would be caused by something else entirely. See below for the many causes of widespread and localized hives. Baby Hives Causes The causes for hives on babies are grouped into two categories. The first is widespread hives all over the body and the second is localized hives confined to one area of the body. See below for the different causes of each. Localized Baby Hives Localized hives will be isolated to one area of the body, although the area may spread or move. This type of reaction is not caused by drugs, infections or swallowed foods, as these items get into the bloodstream and cause widespread hives. Causes for localized hives include: • Bee and insect stings: Hives are the result of a reaction to the bee’s venom or an insect’s saliva. A bite or sting may cause localized hives without being an allergy. (An allergic reaction will see widespread hives or swelling, trouble breathing, dizziness, cramps and nausea.) • Irritants: Hives in one area might be due to skin contact with an irritant, such as a new brand of soap, a type of fabric, perfume, etc. • Food: some children get hives from having food come in contact with their skin, like fresh fruit. Babies may also get hives surrounding their mouth from drooling while eating or tasting a new food. • Pet saliva: Some adults and children get hives from being licked by an animal. • Plants: Many plants can cause hives if they have skin contact with an infant, like evergreen sap or nettle plants. • Pollen: Particularly during springtime, playing in grass or flowers may cause hives on the exposed skin. Widespread Baby Hives Widespread hives cover the entire body and are the result of an allergen, irritant or virus entering the bloodstream. Even in cases diagnosed by a physician, the cause of widespread hives isn’t found around 30% of the time. Causes for widespread hives include: • Anaphylaxis: This is a serious reaction that requires immediate medical attention. Widespread hives coupled with trouble breathing or swallowing is indicative of anaphylactic shock. This severe allergic reaction may be in response to ingesting a food or drug, typically within 30 minutes of swallowing and always within two hours of being exposed. • Bee sting: Widespread hives following a bee sting are a symptom of an allergy, along with swelling, trouble breathing, dizziness, cramps and nausea. • Bacterial infection: Some, but not all, bacterial infections lead to hives. The most common bacterial causes of hives are strep and urinary tract infections. • Drug reaction: A rash or hives may occur when taking an antibiotic in reaction to the virus the drug is treating. A common type of drug reaction is a penicillin rash. • Food: Without the symptoms of anaphylaxis, hives may be caused by a mild reaction to something eaten. If the food is high risk, like nuts, an allergist may be consulted. Hives resulting from a food reaction typically end within six hours. • Viral infection: This is the most common cause of widespread hives all over the body. Viral hives are typically accompanied by a fever, cough or diarrhea. These types of hives may last up to three days and are not usually the result of an allergy. How are Baby Hives Treated? Hives, particularly mild cases that are not very irritating to the baby, usually resolve themselves without treatment in the span of a few hours. Depending on the case, a doctor may prescribe medication to treat the symptoms and the underlying cause, it can be found. Medications commonly prescribed for hives include antihistamines (OTC or a prescription) and prescription steroids antibiotics. It’s best to consult a doctor before treating hives with over-the-counter medications. There are also home remedies for managing hives either along with suggested medication or on their own if the problem isn’t severe. Suggestions include: Cool water baths (no lower than 85°F/29°C) without fragrances or soap work to soothe skin and wash away any irritants. • Cool compresses on the affected area to relieve irritation and itching • Dress in loose clothing to reduce friction and irritation on the area • Anti-itch creams or lotion, such as calamine, to help soothe the skin. Consult a doctor if in doubt about usage or safety. • Trimming the baby’s nails will help reduce irritation caused by itching and scratching the affected area. Baby Hives Prevention Because the causes for hives in babies are so widespread and can come from so many different factors, there isn’t much that can be done to prevent them. However, if your child has an allergic reaction to something around them, removing the item, be it a type of food or a new laundry detergent, will keep the reaction from occurring.
Vladimir Lenin Vladimir Lenin Владимир Ленин Photograph of Lenin in 1916, while in Switzerland Chairman of the Council of People's Commissars of the Soviet Union In office 30 December 1922 21 January 1924 Preceded by Position established Succeeded by Alexei Rykov Chairman of the Council of People's Commissars of the Russian SFSR In office 8 November 1917 21 January 1924 Preceded by Position established Succeeded by Alexei Rykov Personal details Born Vladimir Ilyich Ulyanov (Владимир Ильич Ульянов) (1870-04-22)22 April 1870 Simbirsk, Russian Empire Gorki, Leninsky District, Moscow Oblast, Russian SFSR, Soviet Union Resting place Lenin's Mausoleum, Moscow, Russian Federation Nationality Russian Empire Political party Other political Education Law Alma mater Saint Petersburg Imperial University Vladimir Ilyich Ulyanov,[lower-alpha 1] better known by the alias Lenin[lower-alpha 2] (22 April [O.S. 10 April] 1870 – 21 January 1924), was a Russian communist revolutionary, politician, and political theorist. He served as head of government of the Russian Republic from 1917 to 1918, of the Russian Soviet Federative Socialist Republic from 1918 to 1924, and of the Soviet Union from 1922 to 1924. Under his administration, Russia and then the wider Soviet Union became a one-party socialist state governed by the Russian Communist Party. Ideologically a Marxist, he developed political theories known as Leninism. Born to a wealthy middle-class family in Simbirsk, Lenin embraced revolutionary socialist politics following his brother's execution in 1887. Expelled from Kazan Imperial University for participating in protests against the Russian Empire's Tsarist regime, he devoted the following years to a law degree. He moved to Saint Petersburg in 1893 and became a senior figure in the Marxist Russian Social Democratic Labour Party (RSDLP). In 1897, he was arrested for sedition and exiled to Shushenskoye for three years, where he married Nadezhda Krupskaya. After his exile, he moved to Western Europe, where he became a prominent party theorist through his publications. In 1903, he took a key role in a RSDLP ideological split, leading the Bolshevik faction against Julius Martov's Mensheviks. Encouraging insurrection during Russia's failed Revolution of 1905, he later campaigned for the First World War to be transformed into a Europe-wide proletarian revolution, which as a Marxist he believed would cause the overthrow of capitalism and its replacement with socialism. After the 1917 February Revolution ousted the Tsar and established a Provisional Government, he returned to Russia to play a leading role in the October Revolution, in which the Bolsheviks overthrew the new regime. Lenin's government was led by the Bolsheviks—now renamed the Communist Party—with some powers initially also held by elected soviets. The new government called elections for the Constituent Assembly and then abolished it, withdrew from the First World War by signing a treaty with the Central Powers, and granted independence to non-Russian nations under Russian control. It redistributed land among the peasantry and nationalised banks and large-scale industry. Opponents were suppressed in the Red Terror, a violent campaign orchestrated by the state security services; tens of thousands were killed and others interned in concentration camps. Anti-Bolshevik armies, established by both right and left-wing groups, were defeated in the Russian Civil War from 1917 to 1922. Responding to wartime devastation, famine, and popular uprisings, in 1921 Lenin promoted economic growth through a mixed economic system. Seeking to promote world revolution, Lenin's government created the Communist International, waged the Polish–Soviet War, and united Russia with neighbouring nations to form the Soviet Union in 1922. In increasingly poor health, Lenin expressed opposition to the growing power of his successor, Joseph Stalin, before dying at his Gorki mansion. Widely considered one of the most significant and influential figures of the 20th century, Lenin was the posthumous subject of a pervasive personality cult within the Soviet Union until its dissolution in 1991. He became an ideological figurehead behind Marxism-Leninism and thus a prominent influence over the international communist movement. A controversial and highly divisive individual, Lenin is viewed by Marxist-Leninists as a champion of socialism and the working class, while critics on both the left and right see him as the founder of a totalitarian dictatorship responsible for mass human rights abuses. Early life Childhood: 1870–87 Lenin's childhood home in Simbirsk The couple had two children, Anna (born 1864) and Alexander (born 1868), before Lenin was born as Vladimir "Volodya" Ilyich in Simbirsk on 10 April 1870, and baptised several days later. They were followed by three more children, Olga (born 1871), Dmitry (born 1874), and Maria (born 1878). Two later siblings died in infancy.[7] Ilya was a devout member of the Russian Orthodox Church and baptised his children into it, although Maria – a Lutheran – was largely indifferent to Christianity, a view that influenced her children.[8] Both parents were monarchists and liberal conservatives, being committed to the emancipation reform of 1861 introduced by the reformist Tsar Alexander II; they avoided political radicals and there is no evidence that the police ever put them under surveillance for subversive thought.[9] Every summer they holidayed at a rural manor in Kokushkino.[10] Among his siblings, Lenin was closest to his sister Olga, whom he often bossed around; he had an extremely competitive nature and could be destructive, but usually admitted his misbehaviour.[11] A keen sportsman, he spent much of his free time outdoors or playing chess, and excelled at school, the disciplinarian and conservative Simbirsk Classical Gimnazia.[12] Ilya Ulyanov died of a brain haemorrhage in January 1886, when Lenin was 16.[13] Subsequently, Lenin's behaviour became erratic and confrontational, and he soon renounced his belief in God.[14] At the time, Lenin's elder brother Alexander was studying at Saint Petersburg University. Involved in political agitation against the absolute monarchy of the reactionary Tsar Alexander III, he studied the writings of banned leftists and organised anti-government protests. He joined a revolutionary cell bent on assassinating the Tsar and was selected to construct a bomb. Before the attack could take place the conspirators were arrested and tried, and in May, his brother Alexander was executed by hanging.[15] Despite the emotional trauma of his father's and brother's deaths, Lenin continued studying, graduated with a gold medal for exceptional performance, and decided to study law at Kazan University.[16] University and political radicalisation: 1887–93 Lenin came under the influence of Karl Marx. Upon entering Kazan University in August 1887, Lenin moved into a nearby flat.[17] There, he joined a zemlyachestvo, a form of university society that represented the men of a particular region.[18] This group elected him as its representative to the university's zemlyachestvo council, and in December, he took part in a demonstration against government restrictions that banned student societies. The police arrested Lenin and accused him of being a ringleader in the demonstration; he was expelled from the university, and the Ministry of Internal Affairs exiled him to his family's Kokushkino estate.[19] There, he read voraciously, becoming enamoured with Nikolay Chernyshevsky's 1863 pro-revolutionary novel What Is To Be Done?.[20] Lenin's mother was concerned by her son's radicalisation, and was instrumental in convincing the Interior Ministry to allow him to return to the city of Kazan, although not the university.[21] On his return, he joined Nikolai Fedoseev's revolutionary circle, through which he discovered Karl Marx's 1867 book Capital. This sparked his interest in Marxism, a socio-political theory that argued that society developed in stages, that this development resulted from class struggle, and that capitalist society would ultimately give way to socialist society and then communist society.[22] Wary of his political views, Lenin's mother bought a country estate in Alakaevka village, Samara Oblast, in the hope that her son would turn his attention to agriculture. However, he had little interest in farm management, and his mother soon sold the land, keeping the house as a summer home.[23] In September 1889, the Ulyanov family moved to the city of Samara, where Lenin joined Alexei Sklyarenko's socialist discussion circle.[24] Both Sklyarenko and Lenin adopted Marxism, and the latter translated Marx and Friedrich Engels' 1848 political pamphlet, The Communist Manifesto, into Russian.[25] He began to read the works of the Russian Marxist Georgi Plekhanov, agreeing with Plekhanov's argument that Russia was moving from feudalism to capitalism and so socialism would be implemented by the proletariat, or urban working class, rather than the peasantry.[26] This Marxist view contrasted with the view of the agrarian-socialist Narodnik movement, which held that the peasantry could establish socialism in Russia by forming peasant communes, thereby bypassing capitalism. This Narodnik view developed in the 1860s with the People's Freedom Party and was then dominant within the Russian revolutionary movement.[27] Although Lenin rejected the premise of the agrarian-socialist argument, he was influenced by agrarian-socialists like Pëtr Tkachëvi and Sergei Nechaev, and befriended several Narodniks.[28] In May 1890, Maria—who retained societal influence as the widow of a nobleman—persuaded the authorities to allow Lenin to take his exams externally at the University of St Petersburg, where he obtained the equivalent of a first-class degree with honours. The graduation celebrations were marred when his sister Olga died of typhoid.[29] Lenin remained in Samara for several years, working first as a legal assistant for a regional court and then for a local lawyer.[30] He devoted much time to radical politics, remaining active in Skylarenko's group and formulating ideas about how Marxism applied to Russia. Inspired by Plekhanov's work, Lenin collected data on Russian society, using it to support a Marxist interpretation of societal development and counter the claims of the Narodniks.[31] He wrote a paper on peasant economics, although it was rejected by the liberal journal Russian Thought.[32] Revolutionary activity Early activism and imprisonment: 1893–1900 In autumn 1893, Lenin moved to Saint Petersburg.[33] There, he worked as a barrister's assistant and rose to a senior position in a Marxist revolutionary cell that called itself the "Social-Democrats" after the Marxist Social Democratic Party of Germany.[34] Publicly championing Marxism within the socialist movement, he encouraged the founding of revolutionary cells in Russia's industrial centres.[35] By autumn 1894, he was leading a Marxist workers' circle, and meticulously covered his tracks, knowing that police spies tried to infiltrate the movement.[36] He began a romantic relationship with Nadezhda "Nadya" Krupskaya, a Marxist schoolteacher.[37] He also authored a political tract criticising the Narodnik agrarian-socialists, What the "Friends of the People" Are and How They Fight the Social-Democrats, based largely on his experiences in Samara; around 200 copies were illegally printed in 1894.[38] Lenin hoped to cement connections between his Social-Democrats and Emancipation of Labour, a group of Russian Marxist émigrés based in Switzerland; he visited the country to meet group members Plekhanov and Pavel Axelrod.[39] He proceeded to Paris to meet Marx's son-in-law Paul Lafargue and to research the Paris Commune of 1871, which he considered an early prototype for a proletarian government.[40] Financed by his mother, he stayed in a Swiss health spa before travelling to Berlin, where he studied for six weeks at the Staatsbibliothek and met the Marxist activist Wilhelm Liebknecht.[41] Returning to Russia with a stash of illegal revolutionary publications, he travelled to various cities distributing literature to striking workers.[42] While involved in producing a news sheet, Rabochee delo ("Workers' Cause"), he was among 40 activists arrested in St. Petersburg and charged with sedition.[43] In February 1897, he was sentenced without trial to three years exile in eastern Siberia, although granted a few days in Saint Petersburg to put his affairs in order. He used this time to meet with the Social-Democrats, who had renamed themselves the League of Struggle for the Emancipation of the Working Class.[46] His journey to eastern Siberia took 11 weeks, for much of which he was accompanied by his mother and sisters. Deemed only a minor threat to the government, he was exiled to a peasant's hut in Shushenskoye, Minusinsky District, where he was kept under police surveillance; he was nevertheless able to correspond with other revolutionaries, many of whom visited him, and permitted to go on trips to swim in the Yenisei River and to hunt duck and snipe.[47] In May 1898, Nadya joined him in exile, having been arrested in August 1896 for organising a strike. Although initially posted to Ufa, she persuaded the authorities to move her to Shushenskoye, claiming that she and Lenin were engaged; they married in a church on 10 July 1898.[48] Settling into a family life with Nadya's mother Elizaveta Vasilyevna, in Shushenskoye the couple translated English socialist literature into Russian.[49] Keen to keep up with developments in German Marxism – where there had been an ideological split, with revisionists like Eduard Bernstein advocating a peaceful, electoral path to socialism – Lenin remained devoted to violent revolution, attacking revisionist arguments in A Protest by Russian Social-Democrats.[50] He also finished The Development of Capitalism in Russia (1899), his longest book to date, which criticised the agrarian-socialists and promoted a Marxist analysis of Russian economic development. Published under the pseudonym of "Vladimir Ilin", upon publication it received predominantly poor reviews.[51] Munich, London, and Geneva: 1900–05 After his exile, Lenin settled in Pskov in early 1900.[52] There, he began raising funds for a newspaper, Iskra ("Spark"), a new organ of the Russian Marxist party, now calling itself the Russian Social Democratic Labour Party (RSDLP).[53] In July 1900, Lenin left Russia for Western Europe; in Switzerland he met other Russian Marxists, and at a Corsier conference they agreed to launch the paper from Munich, where Lenin relocated in September.[54] Containing contributions from prominent European Marxists, Iskra was smuggled into Russia,[55] becoming the country's most successful underground publication for 50 years.[56] He first adopted the pseudonym "Lenin" in December 1901, possibly based on the River Lena;[57] he often used the fuller pseudonym of "N. Lenin", and while the N did not stand for anything, a popular misconception later arose that it represented "Nikolai".[58] Under this pseudonym, he published the political pamphlet What Is To Be Done? in 1902; his most influential publication to date, it dealt with Lenin's thoughts on the need for a vanguard party to lead the proletariat to revolution.[59] Lenin's house in Zurich, Switzerland. Nadya joined Lenin in Munich, becoming his personal secretary.[60] They continued their political agitation, as Lenin wrote for Iskra and drafted the RSDLP programme, attacking ideological dissenters and external critics, particularly the Socialist Revolutionary Party (SR),[61] a Narodnik agrarian-socialist group founded in 1901.[62] Despite remaining a Marxist, he accepted the Narodnik view on the revolutionary power of the Russian peasantry, accordingly penning the 1903 pamphlet To the Village Poor.[63] To evade Bavarian police, Lenin moved to London with Iskra in April 1902,[64] there becoming friends with fellow Russian Marxist Leon Trotsky.[65] In London, Lenin fell ill with erysipelas and was unable to take such a leading role on the Iskra editorial board; in his absence, the board moved its base of operations to Geneva.[66] The second RSDLP Congress was held in London in July 1903.[67] At the conference, a schism emerged between Lenin's supporters and those of Julius Martov. Martov argued that party members should be able to express themselves independently of the party leadership; Lenin disagreed, emphasising the need for a strong leadership with complete control over the party.[68] Lenin's supporters were in the majority, and Lenin termed them the "majoritarians" (bol'sheviki in Russian; thus Bolsheviks); in response, Martov termed his followers the "minoritarians" (men'sheviki in Russian; thus Mensheviks).[69] Arguments between Bolsheviks and Mensheviks continued after the conference; the Bolsheviks accused their rivals of being opportunists and reformists who lacked discipline, while the Mensheviks accused Lenin of being a despot and autocrat.[70] Enraged at the Mensheviks, Lenin resigned from the Iskra editorial board and in May 1904 published the anti-Menshevik tract One Step Forward, Two Steps Back.[71] The stress made Lenin ill, and to recuperate he went on a hiking holiday in rural Switzerland.[72] The Bolshevik faction grew in strength; by the spring, the whole RSDLP Central Committee was Bolshevik,[73] and in December they founded the newspaper Vperëd (Forward).[74] Revolution of 1905 and its aftermath: 1905–14 In January 1905, the Bloody Sunday massacre of protesters in St. Petersburg sparked a spate of civil unrest known as the Revolution of 1905.[75] Lenin urged Bolsheviks to take a greater role in the events, encouraging violent insurrection.[76] In doing so, he adopted SR slogans regarding "armed insurrection", "mass terror", and "the expropriation of gentry land", resulting in Menshevik accusations that he had deviated from orthodox Marxism.[77] In turn, he insisted that the Bolsheviks split completely with the Mensheviks, although many Bolsheviks refused and both groups attended the Third RSDLP Congress, held in London in April 1905.[78] Lenin presented many of his ideas in the pamphlet Two Tactics of Social Democracy in the Democratic Revolution, published in August 1905. Here, he predicted that Russia's liberal bourgeoisie would be sated by a transition to constitutional monarchy and thus betray the revolution; instead he argued that the proletariat would have to build an alliance with the peasantry to overthrow the Tsarist regime and establish the "provisional revolutionary democratic dictatorship of the proletariat and the peasantry".[79] Lenin on the Revolution of 1905[80] In response to the revolution of 1905, Tsar Nicholas II accepted a series of liberal reforms in his October Manifesto, after which Lenin felt it safe to return to St. Petersburg.[81] Joining the editorial board of Novaya Zhizn ("New Life"), a radical legal newspaper run by Maria Andreyeva, he used it to discuss issues facing the RSDLP.[82] He encouraged the party to seek out a much wider membership, and advocated the continual escalation of violent confrontation, believing both to be necessary for a successful revolution.[83] Recognising that membership fees and donations from a few wealthy sympathisers were insufficient to finance the Bolsheviks' activities, Lenin endorsed the idea of robbing post offices, railway stations, trains, and banks. Under the lead of Leonid Krasin, a group of Bolsheviks began carrying out such criminal actions, the best known taking place in June 1907, when a group of Bolsheviks acting under the leadership of Joseph Stalin committed an armed robbery of the State Bank in Tiflis, Georgia.[84] Although he briefly supported the idea of reconciliation between Bolsheviks and Mensheviks,[85] Lenin's advocacy of violence and robbery was condemned by the Mensheviks at the Fourth Party Congress, held in Stockholm in April 1906.[86] Lenin was involved in setting up a Bolshevik Centre in Kuokkala, Grand Duchy of Finland, which was at the time a semi-autonomous part of the Russian Empire, before the Bolsheviks regained dominance of the RSDLP at its Fifth Congress, held in London in May 1907.[87] However, as the Tsarist government cracked down on opposition – both by disbanding Russia's legislative assembly, the Second Duma, and by ordering its secret police, the Okhrana, to arrest revolutionaries – Lenin fled Finland for Switzerland.[88] There he tried to exchange those banknotes stolen in Tiflis that had identifiable serial numbers on them.[89] Alexander Bogdanov and other prominent Bolsheviks decided to relocate the Bolshevik Centre to Paris; although Lenin disagreed, he moved to the city in December 1908.[90] Lenin disliked Paris, lambasting it as "a foul hole", and while there he sued a motorist who knocked him off his bike.[91] Lenin became very critical of Bogdanov's view that Russia's proletariat had to develop a socialist culture in order to become a successful revolutionary vehicle. Instead, Lenin favoured a vanguard of socialist intelligentsia who would lead the working-classes in revolution. Furthermore, Bogdanov – influenced by Ernest Mach – believed that all concepts of the world were relative, whereas Lenin stuck to the orthodox Marxist view that there was an objective reality independent of human observation.[92] Although Bogdanov and Lenin holidayed together at Maxim Gorky's villa in Capri in April 1908,[93] on returning to Paris, Lenin encouraged a split within the Bolshevik faction between his and Bogdanov's followers, accusing the latter of deviating from Marxism.[94] Lenin undertook research at the British Museum in London In May 1908, Lenin lived briefly in London, where he used the British Museum Reading Room to write Materialism and Empirio-criticism, an attack on what he described as the "bourgeois-reactionary falsehood" of Bogdanov's relativism.[95] Lenin's factionalism began to alienate increasing numbers of Bolsheviks, including his former close supporters Alexei Rykov and Lev Kamenev.[96] The Okhrana exploited his factionalist attitude by sending a spy, Roman Malinovsky, to act as a vocal Lenin supporter within the party. Various Bolsheviks expressed their suspicions about Malinovsky to Lenin, although it is unclear if the latter was aware of the spy's duplicity; it is possible that he used Malinovsky to feed false information to the Okhrana.[97] In August 1910, Lenin attended the Eighth Congress of the Second International – an international meeting of socialists – in Copenhagen as the RSDLP's representative, following this with a holiday in Stockholm with his mother.[98] With his wife and sisters he then moved to France, settling first in Bombon and then Paris.[99] Here, he became a close friend to the French Bolshevik Inessa Armand; some biographers suggesting that they had an extra-marital affair from 1910 to 1912.[100] Meanwhile, at a Paris meeting in June 1911, the RSDLP Central Committee decided to move their focus of operations back to Russia, ordering the closure of the Bolshevik Centre and its newspaper, Proletari.[101] Seeking to rebuild his influence in the party, Lenin arranged for a party conference to be held in Prague in January 1912, and although 16 of the 18 attendants were Bolsheviks, he was heavily criticised for his factionalist tendencies and failed to boost his status within the party.[102] Moving to Kraków in the Kingdom of Galicia and Lodomeria, a culturally Polish part of the Austro-Hungarian Empire, he used Jagellonian University's library to conduct research.[103] He stayed in close contact with the RSDLP, which was operating in the Russian Empire, convincing the Duma's Bolshevik members to split from their parliamentary alliance with the Mensheviks.[104] In January 1913, Stalin – whom Lenin referred to as the "wonderful Georgian" – visited him, and they discussed the future of non-Russian ethnic groups in the Empire.[105] Due to the ailing health of both Lenin and his wife, they moved to the rural town of Biały Dunajec,[106] before heading to Bern for Nadya to have surgery on her goitre.[107] First World War: 1914–17 Lenin on his interpretation of the First World War[108] Lenin was in Galicia when the First World War broke out.[109] The war pitted the Russian Empire against the Austro-Hungarian Empire, and due to his Russian citizenship, Lenin was arrested and briefly imprisoned until his anti-Tsarist credentials were explained.[110] Lenin and his wife returned to Bern,[111] before relocating to Zürich in February 1916.[112] Lenin was angry that the German Social-Democratic Party was supporting the German war effort – a direct contravention of the Second International's Stuttgart resolution that socialist parties would oppose the conflict – and thus saw the Second International as defunct.[113] He attended the Zimmerwald Conference in September 1915 and the Kienthal Conference in April 1916,[114] urging socialists across the continent to convert the "imperialist war" into a continent-wide "civil war" with the proletariat pitted against the bourgeoisie and aristocracy.[115] In July 1916, Lenin's mother died, but he was unable to attend her funeral.[116] Her death deeply affected him, and he became depressed, fearing that he too would die before seeing the proletarian revolution.[117] In September 1917, Lenin published Imperialism, the Highest Stage of Capitalism, which argued that imperialism was a product of monopoly capitalism, as capitalists sought to increase their profits by extending into new territories where wages were lower and raw materials cheaper. He believed that competition and conflict would increase and that war between the imperialist powers would continue until they were overthrown by proletariat revolution and socialism established.[118] He spent much of this time reading the works of Georg Wilhelm Friedrich Hegel, Ludwig Feuerbach, and Aristotle, all of whom had been key influences on Marx.[119] This changed Lenin's interpretation of Marxism; whereas he once believed that policies could be developed based on predetermined scientific principles, he concluded that the only test of whether a policy was correct was its practice.[120] Although still perceiving himself as an orthodox Marxist, he began to divert from some of Marx's predictions about societal development; whereas Marx had believed that a "bourgeoisie-democratic revolution" of the middle-classes had to take place before a "socialist revolution" of the proletariat, Lenin believed that in Russia, the proletariat could overthrow the Tsarist regime without an intermediate revolution.[121] February Revolution and the July Days: 1917 In February 1917, the February Revolution broke out in St. Petersburg – renamed Petrograd at the beginning of the First World War – as industrial workers went on strike over food shortages and deteriorating factory conditions. The unrest spread to other parts of Russia, and fearing that he would be violently overthrown, Tsar Nicholas II abdicated. The State Duma took over control of the country, establishing a Provisional Government and converting the Empire into a new Russian Republic.[122] When Lenin learned of this from his base in Switzerland, he celebrated with other dissidents.[123] He decided to return to Russia to take charge of the Bolsheviks, but found that most passages into the country were blocked due to the ongoing conflict. He organised a plan with other dissidents to negotiate a passage for them through Germany, with whom Russia was then at war. Recognising that these dissidents could cause problems for their Russian enemies, the German government agreed to permit 32 Russian citizens to travel in a train carriage through their territory, among them Lenin and his wife.[124] The group travelled by train from Zürich to Sassnitz, proceeding by ferry to Trelleborg, Sweden, and from there to Helsinki before taking the final train to Petrograd.[125] Lenin returned to Russia aboard a train pulled by this steam locomotive, now on permanent exhibit at the Finland Station Sensing growing frustration among Bolshevik supporters, Lenin suggested an armed political demonstration in Petrograd to test the government's response.[130] However, amid deteriorating health, he left the city to recuperate in the Finnish village of Neivola.[131] The Bolsheviks' armed demonstration, the July Days, took place while Lenin was away, but upon learning that demonstrators had violently clashed with government forces, he returned to Petrograd and called for calm.[132] Responding to the violence, the government ordered the arrest of Lenin and other prominent Bolsheviks, raiding their offices, and publicly alleging that he was a German agent provocateur.[133] Evading arrest, Lenin hid in a series of Petrograd safe houses.[134] Fearing that he would be killed, Lenin and fellow senior Bolshevik Grigory Zinoviev then escaped Petrograd in disguise, relocating to Razliv.[135] There, Lenin began work on the book that became The State and Revolution, an exposition on how he believed the socialist state would develop after the proletariat revolution, and how from then on the state would gradually wither away, leaving a pure communist society.[136] He began arguing for a Bolshevik-led armed insurrection to topple the government, although at a clandestine meeting of the party's central committee this idea was rejected.[137] Lenin then headed by train and by foot to Finland, arriving at Helsinki on 10 August, where he hid away in safe houses belonging to Bolshevik sympathisers.[138] October Revolution: 1917 Painting of Lenin in front of the Smolny Institute by Isaak Brodsky In August 1917, while Lenin was in Finland, General Lavr Kornilov, the Commander-in-Chief of the Russian Army, sent troops to Petrograd in what appeared to be a military coup attempt against the Provisional Government. Premier Alexander Kerensky turned to the Petrograd Soviet – including its Bolshevik members – for help, allowing the revolutionaries to organise workers as Red Guards to defend the city. The coup petered out before it reached Petrograd, although the events had allowed the Bolsheviks to return to the open political arena.[139] Fearing a counter-revolution from right-wing forces hostile to socialism, the Mensheviks and Socialist Revolutionaries who dominated the Petrograd Soviet had been instrumental in pressurising the government to normalise relations with the Bolsheviks.[140] Both the Mensheviks and Socialist Revolutionaries had lost much popular support because of their affiliation with the Provisional Government and its unpopular continuation of the war. The Bolsheviks capitalised on this, and soon the pro-Bolshevik Marxist Trotsky was elected leader of the Petrograd Soviet.[141] In September, the Bolsheviks gained a majority in the workers' sections of both the Moscow and Petrograd Soviets.[142] Recognising that the situation was safer for him, Lenin returned to Petrograd.[143] There he attended a meeting of the Bolshevik Central Committee on 10 October, where he again argued that the party should lead an armed insurrection to topple the Provisional Government. This time the argument won with ten votes against two.[144] Critics of the plan, Zinoviev and Kamenev, argued that Russian workers would not support a violent coup against the regime and that there was no clear evidence for Lenin's assertion that all of Europe was on the verge of proletarian revolution.[145] The party began plans to organise the offensive, holding a final meeting at the Smolny Institute on 24 October.[146] This was the base of the Military Revolutionary Committee (MRC), an armed militia largely loyal to the Bolsheviks that had been established by the Petrograd Soviet during Kornilov's alleged coup.[147] In October, the MRC was ordered to take control of Petrograd's key transport, communication, printing and utilities hubs, and did so without bloodshed.[148] Bolsheviks besieged the government in the Winter Palace, and overcame it and arrested its ministers after the cruiser Aurora, controlled by Bolshevik seamen, fired on the building.[149] During the insurrection, Lenin gave a speech to the Petrograd Soviet announcing that the Provisional Government had been overthrown.[150] The Bolsheviks declared the formation of a new government, the Council of People's Commissars or "Sovnarkom". Lenin initially turned down the leading position of Chairman, suggesting Trotsky for the job, but other Bolsheviks insisted and ultimately Lenin relented.[151] Lenin and other Bolsheviks then attended the Second Congress of Soviets on 26 and 27 October, and announced the creation of the new government. Menshevik attendees condemned the illegitimate seizure of power and the risk of civil war.[152] In these early days of the new regime, Lenin avoided talking in Marxist and socialist terms so as not to alienate Russia's population, and instead spoke about having a country controlled by the workers.[153] Lenin and many other Bolsheviks expected proletariat revolution to sweep across Europe in days or months.[154] Lenin's government Organising the Soviet government: 1917–18 Lenin in his office, 1918 The Provisional Government had planned for a Constituent Assembly to be elected in November 1917; against Lenin's objections, Sovnarkom agreed for the vote to take place as scheduled.[155] In the constitutional election, the Bolsheviks gained approximately a quarter of the vote, being defeated by the agrarian-focused Socialist Revolutionary Party.[156] Lenin argued that the election was not a fair reflection of the people's will, that the electorate had not had time to learn the Bolsheviks' political programme, and that the candidacy lists had been drawn up before the Left Socialist Revolutionaries split from the Socialist Revolutionaries.[157] Nevertheless, the newly elected Russian Constituent Assembly convened in Petrograd in January 1918.[158] Sovnarkom argued that it was counter-revolutionary because it sought to remove power from the soviets, but the Socialist Revolutionaries and Mensheviks denied this.[159] The Bolsheviks presented the Assembly with a motion that would strip it of most of its legal powers; when the Assembly rejected the motion, Sovnarkom declared this as evidence of its counter-revolutionary nature and forcibly disbanded it.[160] Lenin rejected repeated calls – including from some Bolsheviks – to establish a coalition government with other socialist parties.[161] However, Sovnarkom partially relented; although refusing a coalition with the Mensheviks or Socialist Revolutionaries, in December 1917 they allowed the Left Socialist Revolutionaries five posts in the cabinet. This coalition only lasted four months, until March 1918, when the Left Socialist Revolutionaries pulled out of the government over a disagreement about the Bolsheviks' approach to ending the First World War.[162] At their 7th Congress in March 1918, the Bolsheviks changed their official name from the "Russian Social Democratic Labour Party" to the "Russian Communist Party", as Lenin wanted to both distance his group from the increasingly reformist German Social Democratic Party and to emphasise its ultimate goal: a communist society.[163] A black-and-white photograph of a crowd scene. A bald, goateed man stands on a platform in the centre-left, speaking dramatically to the crowd. Lenin addressing a crowd in Sverdlov Square, Moscow, 1920. Trotsky is standing right of the platform. Although ultimate power officially rested with the country's government in the form of Sovnarkom and the Executive Committee (VTSIK) elected by the All-Russian Congress of Soviets (ARCS), the Communist Party was de facto in control in Russia, as acknowledged by its members at the time.[164] By 1918, Sovnarkom began acting unilaterally, claiming a need for expediency, with the ARCS and VTSIK becoming increasingly marginalised,[165] so the soviets no longer had a role in governing Russia.[166] During 1918 and 1919, the government expelled Mensheviks and Socialist Revolutionaries from the soviets.[167] Russia had become a one-party state.[168] Within the party was established a Political Bureau ("Politburo") and Organisation Bureau ("Orgburo") to accompany the existing Central Committee; the decisions of these party bodies had to be adopted by Sovnarkom and the Council of Labour and Defence.[169] Lenin was the most significant figure in this governance structure; as well as being the Chairman of Sovnarkom and sitting on the Council of Labour and Defence, he was on the Central Committee and Politburo of the Communist Party.[170] The only individual to have anywhere near this influence was Lenin's right-hand man, Yakov Sverdlov, who died in March 1919 during a flu pandemic.[171] In November 1917, Lenin and his wife took a two-room flat within the Smolny Institute, although the following month left for a brief holiday in Halia, Finland.[172] In January 1918, he survived an assassination attempt in Petrograd; Fritz Platten, who was with Lenin at the time, shielded him and was injured by a bullet.[173] Concerned that the German Army posed a threat to Petrograd, in March 1918 Sovnarkom relocated to Moscow, initially as a temporary measure.[174] There, Lenin, Trotsky, and other Bolshevik leaders moved into the Kremlin, where Lenin lived with his wife and sister Maria in a first floor apartment adjacent to the room in which the Sovnarkom meetings were held.[175] Lenin disliked Moscow,[176] although he rarely left the city centre during the rest of his life.[177] It was in the city in August 1918 that he survived a second assassination attempt; he was shot following a public speech and injured badly.[178] A Socialist Revolutionary, Fanny Kaplan, was arrested and executed.[179] The attack was widely covered in the Russian press, generating much sympathy for him and boosting his popularity.[180] As a respite, in September 1918 Lenin was driven to the Gorki estate, just outside Moscow, recently acquired for him by the government.[181] Social, legal, and economic reform: 1917–18 Lenin's political programme, October 1917[182] Upon taking power, Lenin's regime issued a series of decrees. The first was a Decree on Land, which declared that the landed estates of the aristocracy and the Orthodox Church should be nationalised and redistributed to peasants by local governments. This contrasted with Lenin's desire for agricultural collectivisation but provided governmental recognition of the widespread peasant land seizures that had already occurred.[183] In November 1917, the government issued the Decree on the Press that closed many opposition media outlets deemed counter-revolutionary. They claimed the measure would be temporary, although the decree was widely criticised, including by many Bolsheviks, for compromising freedom of the press.[184] In November 1917, Lenin issued the Declaration of the Rights of the Peoples of Russia, which stated that non-Russian ethnic groups living inside the Republic had the right to cede from Russian authority and establish their own independent nation-states.[185] As a result, many nations declared independence: Finland and Lithuania in December 1917, Latvia and Ukraine in January 1918, Estonia in February 1918, Transcaucasia in April 1918, and Poland in November 1918.[186] Soon, the Bolsheviks actively promoted communist parties in these independent nation-states,[187] while in July 1918, at the Fifth All-Russian Congress of the Soviets, a constitution was approved that reformed the Russian Republic into the Russian Soviet Federative Socialist Republic.[188] Seeking to modernise the country, the government officially converted Russia from the Julian calendar to the Gregorian calendar used in Europe.[189] In November 1917, Sovnarkom issued a decree abolishing Russia's legal system, calling on the use of "revolutionary conscience" to replace the abolished laws.[190] The courts were replaced by a two-tier system: Revolutionary Tribunals to deal with counter-revolutionary crimes,[191] and People's Courts to deal with civil and other criminal offences. They were instructed to ignore pre-existing laws, and base their rulings on the Sovnarkom decrees and a "socialist sense of justice".[192] November also saw an overhaul of the armed forces; Sovnarkom implemented egalitarian measures, abolished previous ranks, titles, and medals, and called on soldiers to establish committees to elect their commanders.[193] In October 1917, Lenin issued a decree limiting work for everyone in Russia to eight hours per day.[194] He also issued the Decree on Popular Education that stipulated that the government would guarantee free, secular education for all children in Russia,[194] and a decree establishing a system of state orphanages.[195] To combat mass illiteracy, a literacy campaign was initiated; an estimated 5 million people enrolled in crash courses of basic literacy from 1920 to 1926.[196] Embracing the equality of the sexes, laws were introduced that helped to emancipate women, by giving them economic autonomy from their husbands and removing restrictions on divorce.[197] A Bolshevik women's organisation, Zhenotdel, was established to further these aims.[198] Militantly atheist, Lenin and the Communist Party wanted to demolish organised religion,[199] and in January 1918 the government decreed the separation of church and state and prohibited religious instruction in schools.[200] In November 1917, Lenin issued the Decree on Workers' Control, which called on the workers of each enterprise to establish an elected committee to monitor their enterprise's management.[201] That month they also issued an order requisitioning the country's gold,[202] and nationalised the banks, which Lenin saw as a major step toward socialism.[203] In December, Sovnarkom established a Supreme Council of the National Economy (VSNKh), which had authority over industry, banking, agriculture, and trade.[204] The factory committees were subordinate to the trade unions, which were subordinate to VSNKh; thus, the state's centralised economic plan was prioritised over the workers' local economic interests.[205] In early 1918, Sovnarkom cancelled all foreign debts and refused to pay interest owed on them.[206] In April 1918, it nationalised foreign trade, establishing a state monopoly on imports and exports.[207] In June 1918, it decreed nationalisation of public utilities, railways, engineering, textiles, metallurgy, and mining, although often these were state-owned in name only.[208] Full-scale nationalisation did not take place until November 1920, when small-scale industrial enterprises were brought under state control.[209] Adopting a left libertarian perspective, both the Left Communists and other factions in the Communist Party critiqued the decline of democratic institutions in Russia.[212] Internationally, many socialists decried Lenin's regime and denied that he was establishing socialism; in particular, they highlighted the lack of widespread political participation, popular consultation, and industrial democracy.[213] In autumn 1918, the Czech-Austrian Marxist Karl Kautsky authored an anti-Leninist pamphlet condemning the anti-democratic nature of Soviet Russia, to which Lenin published a vociferous reply.[214] German Marxist Rosa Luxemburg echoed Kautsky's views,[215] while the Russian anarchist Peter Kropotkin described the Bolshevik seizure of power as "the burial of the Russian Revolution".[216] Treaty of Brest-Litovsk: 1917–18 Lenin on peace with the Central Powers[217] Upon taking power, Lenin believed that a key policy of his government must be to withdraw from the First World War by establishing an armistice with the Central Powers of Germany and Austria-Hungary.[218] He believed that ongoing war would create resentment among war-weary Russian troops – to whom he had promised peace – and that these troops and the advancing German Army threatened both his own government and international socialism.[219] By contrast, other Bolsheviks – in particular Bukharin and the Left Communists – believed that peace with the Central Powers would be a betrayal of international socialism and that Russia should instead wage "a war of revolutionary defence" that would provoke an uprising of the German proletariat against their own government.[220] Lenin proposed a three-month armistice in his Decree on Peace of November 1917, which was approved by the Second Congress of Soviets and presented to the German and Austro-Hungarian governments.[221] The Germans responded positively, viewing this as an opportunity to focus on the Western Front and stave off looming defeat.[222] In November, armistice talks began at Brest-Litovsk, the headquarters of the German high command on the Eastern Front, with the Russian delegation being led by Trotsky and Adolph Joffe.[223] Meanwhile, a ceasefire until January was agreed.[224] During negotiations, the Germans insisted on keeping their wartime conquests – which included Poland, Lithuania, and Courland – whereas the Russians countered that this was a violation of these nations' rights to self-determination.[225] Some Bolsheviks had expressed hopes of dragging out negotiations until proletarian revolution broke out throughout Europe.[226] On 7 January 1918, Trotsky returned from Brest-Litovsk to St. Petersburg with an ultimatum from the Central Powers: either Russia accept Germany's territorial demands or the war would resume.[227] The signing of the Treaty of Brest-Litovsk In January and again in February, Lenin urged the Bolsheviks to accept Germany's proposals. He argued that the territorial losses were acceptable if it ensured the survival of the Bolshevik-led government. The majority of Bolsheviks rejected his position, hoping to prolong the armistice and call Germany's bluff.[228] On 18 February, the German Army relaunched the offensive, advancing further into Russian-controlled territory and within a day conquering Dvinsk.[229] At this point, Lenin finally convinced a small majority of the Bolshevik Central Committee to accept the Central Powers' demands.[230] However, on 23 February, the Central Powers issued a new ultimatum: Russia must recognise German control not only of Poland and the Baltic states but also Ukraine, or face a full-scale invasion of Russia.[231] On 3 March, the Treaty of Brest-Litovsk was signed.[232] It resulted in massive territorial losses for Russia, with 26% of the former Empire's population, 37% of its agricultural harvest area, 28% of its industry, 26% of its railway tracks, and three-quarters of its coal and iron deposits being transferred to German control.[233] Accordingly, the Treaty was deeply unpopular across Russia's political spectrum,[234] and several Bolsheviks and Left Socialist Revolutionaries resigned from Sovnarkom in protest.[235] After the Treaty, Sovnarkom focused on trying to foment proletarian revolution in Germany, issuing an array of anti-war and anti-government publications in the country; the German government retaliated by expelling Russia's diplomats.[236] In November 1918 the German Emperor Wilhelm II resigned and the country's new administration signed the Armistice with the Allies. As a result, Sovnarkom proclaimed the Treaty of Brest-Litovsk void.[237] Anti-Kulak campaigns, Cheka, and Red Terror: 1918–22 Lenin on the Red Terror[238] By spring 1918, many cities in western Russia faced famine as a result of chronic food shortages.[239] Lenin blamed this on the kulaks, or wealthier peasants, who allegedly hoarded the grain that they had produced to increase its financial value. In May 1918, he issued a requisitioning order that established armed detachments to confiscate grain from kulaks for distribution in the cities, and in June called for the formation of Committees of Poor Peasants to aid in requisitioning.[240] This policy resulted in vast social disorder and violence, as armed detachments often clashed with peasant groups, helping to set the stage for the civil war.[241] A prominent example of Lenin's views was his August 1918 telegram to the Bolsheviks of Penza, which called upon them to suppress a peasant insurrection by publicly hanging at least 100 "known kulaks, rich men, [and] bloodsuckers".[242] Requisitioning disincentivised peasants from producing more grain than they could personally consume, and thus production slumped.[243] A booming black market supplemented the official state-sanctioned economy,[244] and Lenin called on speculators, black marketeers and looters to be shot.[245] Both the Socialist Revolutionaries and Left Socialist Revolutionaries condemned the armed appropriations of grain at the Fifth All-Russian Congress of Soviets in July 1918.[246] Realising that the Committees of the Poor Peasants were also persecuting peasants who were not kulaks and thus contributing to anti-government feeling among the peasantry, in December 1918 Lenin abolished them.[247] Lenin repeatedly emphasised the need for terror and violence to overthrow the old order and for the revolution to succeed.[248] Speaking to the All-Russian Central Executive Committee of the Soviets in November 1917, he declared that "the state is an institution built up for the sake of exercising violence. Previously, this violence was exercised by a handful of moneybags over the entire people; now we want ... to organise violence in the interests of the people."[249] He strongly opposed suggestions to abolish capital punishment.[250] Fearing anti-Bolshevik forces would overthrow his administration, in December 1917 Lenin ordered the establishment of the Emergency Commission for Combating Counter-Revolution and Sabotage, or Cheka, a political police force led by Felix Dzerzhinsky.[251] In September 1918, Sovnarkom passed a decree that inaugurated the Red Terror, a system of oppression orchestrated by the Cheka.[252] Although sometimes described as an attempt to eliminate the entire bourgeoisie,[253] Lenin did not want to exterminate all members of this class, merely those who sought to reinstate their rule.[254] The majority of the Terror's victims were well-to-do citizens or former members of the Tsarist administration,[255] however others were non-bourgeois anti-Bolsheviks and perceived social undesirables such as prostitutes.[256] The Cheka claimed the right to both sentence and execute anyone whom it deemed to be an enemy of the government, without recourse to the Revolutionary Tribunals.[257] Accordingly, throughout Soviet Russia the Cheka carried out killings, often in large numbers.[258] For example, the Petrograd Cheka executed 512 people in a few days.[259] There are no surviving records to provide an accurate figure of how many perished in the Red Terror,[260] although later estimates of historians have ranged from 10,000 to 15,000 in one estimate,[261] and 50,000 to 140,000 in another.[262] Lenin never witnessed this violence or participated in it first-hand,[263] and publicly distanced himself from it.[264] His published articles and speeches rarely called for executions, although he regularly did so in his coded telegrams and confidential notes.[265] Many Bolsheviks expressed disapproval of the Cheka's mass executions and feared the organisation's apparent unaccountability.[266] The Party brought in attempts to restrain its activities in February 1919, stripping it of its powers of tribunal and execution in those areas not under official martial law, although the Cheka continued as before in swathes of the country.[267] By 1920, the Cheka had become the most powerful institution in Soviet Russia, exerting influence over all other state apparatus.[268] A decree in April 1919 resulted in the establishment of concentration camps, which were entrusted to the Cheka,[269] although they were later administered by a new government agency, Gulag.[270] By the end of 1920, 84 camps had been established across Soviet Russia, holding about 50,000 prisoners; by October 1923, this had grown to 315 camps and about 70,000 inmates.[271] Those interned in the camps were used as slave labour.[272] From July 1922, intellectuals deemed to be opposing the Bolshevik government were exiled to inhospitable regions or deported from Russia altogether; Lenin personally scrutinised the lists of those to be dealt with in this manner.[273] In May 1922, Lenin issued a decree calling for the execution of anti-Bolshevik priests, causing between 14,000 and 20,000 deaths.[274] Although the Russian Orthodox Church was worst affected, the government's anti-religious policies also impacted on Roman Catholic and Protestant churches, Jewish synagogues, and Islamic mosques.[275] Civil War and Polish–Soviet War: 1918–20 Lenin on war[276] Although Lenin expected Russia's aristocracy and bourgeoisie to oppose his government, he believed that the numerical superiority of the lower classes, coupled with the Bolsheviks' ability to effectively organise them, guaranteed a swift victory in any conflict.[277] In this, he failed to anticipate the intensity of the violent opposition to Bolshevik rule in Russia.[277] The ensuing Russian Civil War pitted the pro-Bolshevik Reds against the anti-Bolshevik Whites, but also encompassed ethnic conflicts on Russia's borders and conflict between both Red and White armies and local peasant groups, the Green armies, throughout the former Empire.[278] Accordingly, various historians have seen the civil war as representing two distinct conflicts: one between the revolutionaries and the counter-revolutionaries, and the other between different revolutionary factions.[279] The White armies were established by former Tsarist military officers,[280] and included Anton Denikin's Volunteer Army in South Russia,[281] Alexander Kolchak's forces in Siberia,[282] and Nikolai Yudenich's troops in the newly independent Baltic states.[283] The Whites were bolstered when 35,000 members of the Czech Legionprisoners of war from the conflict with the Central Powers – turned against Sovnarkom and allied with the Committee of Members of the Constituent Assembly (Komuch), an anti-Bolshevik government established in Samara.[284] The Whites were also backed by Western governments who perceived the Treaty of Brest-Litovsk as a betrayal of the Allied war effort and feared the Bolsheviks' calls for world revolution.[285] In 1918, the United Kingdom, France, United States, Canada, Italy, and Serbia landed 10,000 troops in Murmansk, seizing Kandalaksha, while later that year British, American, and Japanese forces landed in Vladivostok.[286] Western troops soon pulled out of the civil war, instead only supporting the Whites with officers, technicians and armaments, but Japan remained because they saw the conflict as an opportunity for territorial expansion.[287] Lenin tasked Trotsky with establishing a Workers' and Peasants' Red Army, and with his support, Trotsky organised a Revolutionary Military Council in September 1918, remaining its chairman until 1925.[288] Recognising their valuable military experience, Lenin agreed that officers from the old Tsarist army could serve in the Red Army, although Trotsky established military councils to monitor their activities.[289] The Reds held control of Russia's two largest cities, Moscow and Petrograd, as well as most of Great Russia, while the Whites were located largely on the former Empire's peripheries.[290] The latter were therefore hindered by being both fragmented and geographically scattered,[291] and because their ethnic Russian supremacism alienated the region's national minorities.[292] Anti-Bolshevik armies carried out the White Terror, a campaign of violence against perceived Bolshevik supporters, although this was typically more spontaneous than the state-sanctioned Red Terror.[293] Both White and Red Armies were responsible for attacks against Jewish communities, prompting Lenin to issue a condemnation of anti-Semitism, which he blamed on capitalist propaganda.[294] In July 1918, Sverdlov informed Sovnarkom that the Ural Regional Soviet had overseen the execution of the former Tsar and his immediate family in Yekaterinburg to prevent them from being rescued by advancing White troops.[295] Although lacking proof, biographers and historians like Richard Pipes and Dmitri Volkogonov have expressed the view that the killing was probably sanctioned by Lenin;[296] conversely, historian James Ryan cautioned that there was "no reason" to believe this.[297] For Lenin, however, the killing was necessary; he highlighted the precedent set by the execution of Louis XVI in the French Revolution.[298] After the Brest-Litovsk Treaty, the Left Socialist Revolutionaries had abandoned the coalition and increasingly viewed the Bolsheviks as traitors to the revolution.[299] In July 1918, the Left Socialist Revolutionary Yakov Grigorevich Blumkin assassinated the German ambassador to Russia, Wilhelm von Mirbach, hoping that the ensuing diplomatic incident would lead to a relaunched revolutionary war against Germany.[300] The Left Socialist Revolutionaries then launched a coup in Moscow, shelling the Kremlin and seizing the city's central post office before being stopped by Trotsky's forces.[301] The party's leaders and many members were arrested and imprisoned, but were treated more leniently than other opponents of the Bolsheviks.[302] By 1919, the White armies were in retreat and by the start of 1920 they were defeated on all three fronts.[303] However, the Polish–Soviet War broke out that year, after Poland tried to annex parts of Belarus and Western Ukraine; by May 1920 it had captured Kiev.[304] After forcing the Polish Army back, Lenin urged the Red Army to push into Poland itself, believing that the Polish proletariat would rise up to support the Russian troops and thus spark European revolution. Although Trotsky and other Bolsheviks were sceptical, they eventually agreed to the invasion. However, the Polish proletariat did not rise up, and the Red Army was defeated at the Battle of Warsaw.[305] The Polish armies began to push the Red Army back into Russia, forcing Sovnarkom to sue for peace; the war culminated in the Peace of Riga, in which Russia ceded territory to Poland and paid it reparations.[306] Comintern and world revolution: 1919–20 Photograph of Lenin in 1919, taken by Grigori Petrowitsch Goldstein After the Armistice on the Western Front, Lenin believed that the breakout of European revolution was imminent.[307] Seeking to promote this, Sovnarkom supported the establishment of Béla Kun's Communist government in Hungary in March 1919, followed by the Communist government in Bavaria and various revolutionary socialist uprisings in other parts of Germany, including that of the Spartacus League.[308] During Russia's Civil War, the Red Army was sent into the newly independent national republics on Russia's borders to aid Marxists there in establishing soviet systems of government.[309] In Europe, this resulted in the creation of new Communist-led states in Estonia, Latvia, Lithuania, Belarus, and Ukraine, all of which were officially independent of Russia,[309] while further east it led to the creation of Communist governments in Georgia, and then in Outer Mongolia.[310] Various senior Bolsheviks wanted these absorbed into the Russian state; Lenin insisted that national sensibilities should be respected, but reassured them that these nations' new Communist Party administrations were de facto regional branches of Moscow's government.[311] In late 1918, the British Labour Party called for the establishment of an international conference of socialist parties, the Labour and Socialist International.[312] Lenin saw this as a revival of the Second International, which he had despised, and formulated his own rival international conference of socialists to offset its impact.[313] He organised this conference with the aid of Zinoviev, Trotsky, Christian Rakovsky, and Angelica Balabanoff.[313] In March 1919, the First Congress of this Communist International ("Comintern") opened in Moscow.[314] It lacked global coverage; of the 34 assembled delegates, 30 resided within the countries of the former Russian Empire, and most of the international delegates were not officially recognised by the socialist parties within their own nations.[315] Accordingly, the Bolsheviks dominated proceedings,[316] with Lenin subsequently authoring a series of regulations that meant that only socialist parties that endorsed the Bolsheviks' views were permitted to join Comintern.[317] During the first conference, Lenin spoke to the delegates, lambasting the parliamentary path to socialism espoused by revisionist Marxists like Kautsky and repeating his calls for a violent overthrow of Europe's bourgeoisie governments.[318] While Zinoviev became the International's President, Lenin continued to wield great control over it.[319] The Second Congress of the Communist International opened in Petrograd's Smolny Institute in June 1920, representing the last time that Lenin visited a city other than Moscow.[320] There, he encouraged foreign delegates to emulate the Bolsheviks' seizure of power, and abandoned his longstanding viewpoint that capitalism was a necessary stage in societal development, instead encouraging those nations under colonial occupation to transform their pre-capitalist societies directly into socialist ones.[321] For this conference, he authored "Left-Wing" Communism: An Infantile Disorder, a short book articulating his criticism of far-left elements within the British and German communist parties who refused to enter those nations' parliamentary systems and trade unions; instead he urged them to do so to advance the revolutionary cause.[322] The conference had to be suspended for several days due to the ongoing war with Poland,[323] before the Congress subsequently moved to Moscow, where it continued to hold sessions until August.[324] However, Lenin's predicted world revolution did not materialise, as the Hungarian Communist government was overthrown and the German Marxist uprisings suppressed.[325] Famine and the New Economic Policy: 1920–22 Within the Communist Party, there was dissent from two factions, the Group of Democratic Centralism and the Workers' Opposition, both of which accused the Russian state of being too centralised and bureaucratic.[326] The Workers' Opposition, which had connections to the official state trade unions, also expressed the concern that the government had lost the trust of the Russian working class.[327] They were angered by Trotsky's suggestion that the trade unions be eliminated. He deemed the unions to be superfluous in a "workers' state", but Lenin disagreed, believing it best to retain them; most Bolsheviks embraced Lenin's view in the 'trade union discussion'.[328] To deal with the dissent, at the Tenth Party Congress in February 1921, Lenin introduced a ban on factional activity within the party, under pain of expulsion.[329] Caused in part by a drought, the Russian famine of 1921 was the most severe that the country had experienced since that of 1891,[330] resulting in around five million deaths.[331] The famine was exacerbated by government requisitioning, as well as the export of large quantities of Russian grain.[332] To aid the famine victims, the U.S. government established an American Relief Administration to distribute food,[333] although Lenin was suspicious of this aid and had it closely monitored.[334] During the famine, Patriarch Tikhon called on Orthodox churches to sell unnecessary items to help feed the starving, an action endorsed by the government.[335] In February 1922 Sovnarkom went further by calling on all valuables belonging to religious institutions to be forcibly appropriated and sold.[336] Tikhon opposed the sale of items used within the Eucharist and many clergy resisted the appropriations, resulting in violence.[337] In 1920 and 1921, local opposition to requisitioning resulted in anti-Bolshevik peasant uprisings breaking out across Russia, although these were suppressed.[338] Among the most significant was the Tambov Rebellion, which was put down by the Red Army.[339] In February 1921, workers went on strike in Petrograd, resulting in the government proclaiming martial law in the city and sending in the Red Army to quell demonstrations.[340] In March, the Kronstadt rebellion began when sailors in Kronstadt revolted against the Bolshevik government, demanding that all socialists be allowed to publish freely, that independent trade unions be given freedom of assembly and that peasants be allowed free markets and not be subject to requisitioning. Lenin declared that the mutineers had been misled by the Socialist Revolutionaries and foreign imperialists, calling for violent reprisals.[341] Under Trotsky's leadership, the Red Army put down the rebellion on 17 March, resulting in thousands of deaths and the internment of survivors in labour camps.[342] Lenin on the NEP, 1921[343] In February 1921, Lenin introduced a New Economic Policy (NEP) to the Politburo; he convinced most senior Bolsheviks of its necessity and it passed into law in April.[344] Lenin explained the policy in a booklet, On the Food Tax, in which he stated that the NEP represented a return to the original Bolshevik economic plans; he claimed that these had been derailed by the civil war, in which Sovnarkom had been forced to resort to the economic policies of "war communism".[345] The NEP allowed some private enterprise within Russia, permitting the reintroduction of the wage system and allowing peasants to sell produce on the open market while being taxed on their earnings.[346] The policy also allowed for a return to privately owned small industry, although basic industry, transport and foreign trade remained under state control.[347] Lenin termed this "state capitalism",[348] and many Bolsheviks thought it to be a betrayal of socialist principles.[349] Lenin biographers have often characterised the introduction of the NEP as one of his most significant achievements and some believe that had it not been implemented then Sovnarkom would have been quickly overthrown by popular uprisings.[350] In January 1920, the government brought in universal labour conscription, ensuring that all citizens aged between 16 and 50 had to work.[351] Lenin also called for a mass electrification project, the GOELRO plan, which began in February 1920; Lenin's declaration that "communism is Soviet power plus the electrification of the whole country" would be widely cited in later years.[352] Seeking to advance the Russian economy through foreign trade, Sovnarkom sent delegates to the Genoa Conference; Lenin had hoped to attend but was prevented by ill health.[353] The conference resulted in a Russian agreement with Germany, which followed on from an earlier trade agreement with the United Kingdom.[354] Lenin hoped that by allowing foreign corporations to invest in Russia, Sovnarkom would exacerbate rivalries between the capitalist nations and hasten their downfall; he tried to rent the oil fields of Kamchatka to an American corporation to heighten tensions between the U.S. and Japan, who desired Kamchatka for their empire.[355] Declining health and arguments with Stalin: 1920–23 To Lenin's embarrassment and horror, in April 1920 the Bolsheviks held a party to celebrate his fiftieth birthday, which was also marked by widespread celebrations across Russia and the publication of poems and biographies dedicated to him.[356] Between 1920 and 1926, twenty volumes of Lenin's Collected Works were published; some material was omitted.[357] During 1920, a number of prominent Western figures visited Lenin in Russia; these included the author H. G. Wells and the philosopher Bertrand Russell,[358] as well as the anarchists Emma Goldman and Alexander Berkman.[359] Lenin was also visited at the Kremlin by Armand, who was in increasingly poor health.[360] He sent her to a sanatorium in Kislovodsk in the Northern Caucasus to recover, but she died there in September 1920 during a cholera epidemic.[361] Her body was transported to Moscow, where a visibly grief-stricken Lenin oversaw its burial beneath the Kremlin Wall.[362] Lenin spent his final years largely at his Gorki mansion Lenin was seriously ill by the latter half of 1921,[363] suffering from hyperacusis, insomnia, and regular headaches.[364] At the Politburo's insistence, in July he left Moscow for a month's leave at his Gorki mansion, where he was cared for by his wife and sister.[365] Lenin began to contemplate the possibility of suicide, asking both Krupskaya and Stalin to acquire potassium cyanide for him.[366] 26 physicians would be hired to help Lenin during his final years; many of them were foreign and had been hired at great expense.[367] Some suggested that his sickness could have been caused by metal oxidation from the bullets that were lodged in his body from the 1918 assassination attempt; in April 1922 he underwent a surgical operation to remove them.[368] The symptoms continued after this, with Lenin's doctors unsure of the cause; some suggested that he was suffering from neurasthenia or cerebral arteriosclerosis, although others believed that he had syphilis,[369] an idea endorsed in a 2004 report by a team of neuroscientists, who suggested that this was later deliberately concealed by the government.[370] In May 1922, he suffered his first stroke, temporarily losing his ability to speak and being paralysed on his right side.[371] He convalesced at Gorki, and had largely recovered by July.[372] In October he returned to Moscow, although in December he suffered a second stroke and returned to Gorki.[373] Despite his illness, Lenin remained keenly interested in political developments. When the Socialist Revolutionary Party's leadership was found guilty of conspiring against the government in a trial held between June and August 1922, Lenin called for their execution; they were instead imprisoned indefinitely, only being executed during the Great Purges of Stalin's leadership.[374] With Lenin's support, the government also succeeded in virtually eradicating Menshevism in Russia by expelling all Mensheviks from state institutions and enterprises in March 1923 and then imprisoning the party's membership in concentration camps.[375] Lenin was concerned by the survival of the Tsarist bureaucratic system in Soviet Russia,[376] and became increasingly worried by this in his final years.[377] Condemning bureaucratic attitudes, he suggested a total overhaul to deal with such problems,[378] in one letter complaining that "we are being sucked into a foul bureaucratic swamp".[379] During December 1922 and January 1923 Lenin dictated "Lenin's Testament", in which he discussed the personal qualities of his comrades, particularly Trotsky and Stalin.[380] He recommended that Stalin be removed from the position of General Secretary of the Communist Party, deeming him ill-suited for the position.[381] Instead he recommended Trotsky for the job, describing him as "the most capable man in the present Central Committee"; he highlighted Trotsky's superior intellect but at the same time criticised his self-assurance and inclination toward excess administration.[382] During this period he dictated a criticism of the bureaucratic nature of the Workers' and Peasants' Inspectorate, calling for the recruitment of new, working-class staff as an antidote to this problem,[383] while in another article he called for the state to combat illiteracy, promote punctuality and conscientiousness within the populace, and encourage peasants to join cooperatives.[384] Lenin, 4 January 1923[181] In Lenin's absence, Stalin had begun consolidating his power both by appointing his supporters to prominent positions,[385] and by cultivating an image of himself as Lenin's closest intimate and deserving successor.[386] In December 1922, Stalin took responsibility for Lenin's regimen, being tasked by the Politburo with controlling who had access to him.[387] Lenin was however increasingly critical of Stalin; while Lenin was insisting that the state should retain its monopoly on international trade during the summer of 1922, Stalin was leading a number of other Bolsheviks in unsuccessfully opposing this.[388] There were personal arguments between the two as well; Stalin had upset Krupskaya by shouting at her during a phone conversation, which in turn greatly angered Lenin, who sent Stalin a letter expressing his annoyance.[389] The most significant political division between the two emerged during the Georgian Affair. Stalin had suggested that both Georgia and neighbouring countries like Azerbaijan and Armenia should be merged into the Russian state, despite the protestations of their national governments.[390] Lenin saw this as an expression of Great Russian ethnic chauvinism by Stalin and his supporters, instead calling for these nation-states to join Russia as semi-independent parts of a greater union, which he suggested be called the Union of Soviet Republics of Europe and Asia.[391] Stalin initially resisted the proposal, but ultimately accepted it, although – with Lenin's agreement – he changed the name of the newly proposed state to the Union of Soviet Socialist Republics (USSR).[392] Lenin sent Trotsky to speak on his behalf at a Central Committee plenum in December, where the plans for the USSR were sanctioned; these plans were then ratified on 30 December by the Congress of Soviets, resulting in the formation of the Soviet Union.[393] Despite his poor health, Lenin was elected chairman of the new government of the Soviet Union.[394] Death and funeral: 1923–24 In March 1923, Lenin suffered a third stroke and lost his ability to speak;[395] that month, he experienced partial paralysis on his right side and began exhibiting sensory aphasia.[396] By May, he appeared to be making a slow recovery, as he began to regain his mobility, speech, and writing skills.[397] In October, he made a final visit to Moscow and the Kremlin.[398] In his final weeks, Lenin was visited by Zinoviev, Kamenev, and Bukharin, with the latter visiting him at his Gorki mansion on the day of his death.[399] Lenin died at his Gorki home on 21 January 1924, having fallen into a coma earlier in the day.[400] His official cause of death was recorded as an incurable disease of the blood vessels.[401] Pallbearers carrying Lenin's coffin during his funeral, from Paveletsky Rail Terminal to the Labour Temple The government publicly announced Lenin's death the following day.[402] On 23 January, mourners from the Communist Party, trade unions, and soviets visited his Gorki home to inspect the body, which was carried aloft in a red coffin by leading Bolsheviks.[403] Transported by train to Moscow, the coffin was taken to the House of Trade Unions, where the body lay in state.[404] Over the next three days, around a million mourners came to see the body, many queuing for hours in the freezing conditions.[405] On 26 January, the eleventh All-Union Congress of Soviets met to pay respects to the deceased leader, with speeches being made by Kalinin, Zinoviev, and Stalin, but notably not Trotsky, who had been convalescing in the Caucasus.[405] Lenin's funeral took place the following day, when his body was carried to Red Square, accompanied by martial music, where assembled crowds listened to a series of speeches before the corpse was placed into the vault of a specially erected mausoleum.[406] Despite the freezing temperatures, tens of thousands attended.[407] Against Krupskaya's protestations, Lenin's body was mummified to preserve it for long-term public display in the Red Square mausoleum.[408] During this process, Lenin's brain was removed; in 1925 an institute was established to dissect it, revealing that Lenin had suffered from severe sclerosis.[409] In July 1929, the Politburo agreed to replace the temporary mausoleum with a permanent granite alternative, which was finished in 1933.[410] The sarcophagus in which Lenin's corpse was contained was replaced in 1940 and again in 1970.[411] From 1941 to 1945 the body was moved from Moscow and stored in Tyumen for safety amid the Second World War.[412] Political ideology Main article: Leninism Lenin, 11 September 1917[413] Lenin was a fervent believer in Marxism,[414] and believed that his interpretation of Marxism – first termed "Leninism" by Martov in 1904[415] – was the sole authentic and orthodox one.[416] According to his Marxist perspective, humanity would eventually reach pure communism, becoming a stateless, classless, egalitarian society of workers who were free from exploitation and alienation, controlled their own destiny, and abided by the rule "from each according to his ability, to each according to his needs".[417] According to Volkogonov, Lenin "deeply and sincerely" believed that the path he was setting Russia on would ultimately lead to the establishment of this communist society.[418] However, Lenin's Marxist beliefs led him to the view that society could not transform directly from its present state to communism, but must first enter a period of socialism, and so his main concern was how to convert Russia into a socialist society. To do so, he believed that a dictatorship of the proletariat was necessary to suppress the bourgeoisie and develop a socialist economy.[419] He defined socialism as "an order of civilized co-operators in which the means of production are socially owned",[420] and believed that this economic system had to be expanded until it could create a society of abundance.[417] To achieve this, he saw bringing the Russian economy under state control to be his central concern, with – in his words – "all citizens" becoming "hired employees of the state".[421] Lenin's interpretation of socialism was centralised, planned, and statist, with both production and distribution strictly controlled.[417] He believed that all workers throughout the country would voluntarily join together to enable the state's economic and political centralisation.[422] In this way, his calls for "workers' control" of the means of production referred not to the direct control of enterprises by their workers, but the operation of all enterprises under the control of a "workers' state".[423] This resulted in two conflicting themes within Lenin's thought: popular workers' control, and a centralised, hierarchical, coercive state apparatus.[424] Lenin speaking in 1919 Before 1914, Lenin mostly agreed with mainstream European Marxist orthodoxy.[414] However, Leninism introduced revisions and innovations to orthodox Marxism, and adopted a more absolutist, doctrinaire perspective.[414] Similarly, Leninism distinguished itself from established variants of Marxism by the emotional intensity of its liberationist vision and its focus on the leadership role of a revolutionary vanguard proletariat.[425] Thus, Lenin came to deviate from the Marxist mainstream over the issue of how to establish a proletarian state; his belief in a strong state apparatus that excluded the bourgeois conflicted with the views of European Marxists like Kautsky who envisioned a democratic parliamentary government in which the proletariat had a majority.[425] Moreover, according to historian James Ryan, Lenin was "the first and most significant Marxist theorist to dramatically elevate the role of violence as revolutionary instrument".[426] Lenin incorporated changing circumstances into his belief system,[427] and the pragmatic realities of governing Russia amid war, famine, and economic collapse resulted in him deviating from many of the Marxist ideas he had articulated before the October Revolution.[428] Lenin's ideas were heavily influenced both by pre-existing thought within the Russian revolutionary movement, and by theoretical variants of Russian Marxism, which had focused heavily on how Marx and Engels' writings would apply to Russia.[429] Accordingly, Lenin was also influenced by earlier currents of Russian socialist thought such as those of the Narodnik agrarian-socialists.[430] Conversely, he derided Marxists who adopted ideas from contemporary non-Marxist philosophers and sociologists.[431] In his theoretical writings, particularly Imperialism, he examined what he thought were the developments in capitalism since Marx's death, arguing that it had reached a new stage, state monopoly capitalism.[432] Before taking power in 1917, he believed that while Russia's economy was still dominated by the peasantry, the fact that monopoly capitalism existed in Russia meant that the country was sufficiently materially developed to move to socialism.[433] Biographer Louis Fischer, 1964[434] Lenin was an internationalist and a keen supporter of world revolution, deeming national borders to be an outdated concept and nationalism a distraction from class struggle.[435] He believed that under revolutionary socialism, there would be "the inevitable merging of nations" and the ultimate establishment of "a United States of the World".[436] He opposed federalism, deeming it to be bourgeois, and instead emphasised the need for a centralised unitary state.[437] Lenin was anti-imperialist, and believed that all nations deserved "the right of self-determination".[437] He thus supported wars of national liberation, accepting that such conflicts might be necessary for a minority group to break away from a socialist state, because socialist states are not "holy or insured against mistakes or weaknesses".[438] He expressed the view that "Soviet government is many millions of times more democratic than the most democratic-bourgeois republic", the latter of which was simply "a democracy for the rich".[439] He deemed his "dictatorship of the proletariat" to be democratic through the election of representatives to the soviets, and by workers electing their own officials, with regular rotation and involvement of all workers in the administration of the country.[440] Lenin believed that the representative democracy of capitalist countries had been used to give the illusion of democracy while maintaining the dictatorship of the bourgeoisie; describing the representative democratic system of the United States, he referred to the "spectacular and meaningless duels between two bourgeois parties", both of whom were led by "astute multimillionaires" that exploited the American proletariat.[441] He also opposed liberalism, exhibiting a general antipathy toward liberty as a value,[442] and believing that liberalism's freedoms were fraudulent because it did not free labourers from capitalist exploitation.[443] Personal life and characteristics Lenin saw himself as a man of destiny, and firmly believed in the righteousness of his cause and his own ability as a revolutionary leader.[444] Biographer Louis Fischer described him as "a lover of radical change and maximum upheaval", a man for whom "there was never a middle-ground. He was an either-or, black-or-red exaggerator".[445] Highlighting Lenin's "extraordinary capacity for disciplined work" and "devotion to the revolutionary cause", Pipes noted that he exhibited much charisma.[446] Similarly, Volkogonov believed that "by the very force of his personality, [Lenin] had an influence over people".[447] Conversely, Lenin's friend Gorky commented that in his physical appearance as a "a baldheaded, stocky, sturdy person", the communist revolutionary was "too ordinary" and did not give "the impression of being a leader".[448] —Biographer Louis Fischer, 1964[449] Historian and biographer Robert Service asserted that Lenin had been an intensely emotional young man,[450] who exhibited strong hatred for the Tsarist authorities.[451] According to Service, Lenin developed an "emotional attachment" to his ideological heroes, such as Marx, Engels and Chernyshevsky; he owned portraits of them,[452] and privately described himself as being "in love" with Marx and Engels.[453] According to Lenin biographer James D. White, Lenin treated their writings as "holy writ", a "religious dogma", which should "not be questioned but believed in".[454] In Volkogonov's view, Lenin accepted Marxism as "absolute truth", and accordingly acted like "a religious fanatic".[455] Similarly, Bertrand Russell felt that Lenin exhibited "unwavering faith – religious faith in the Marxian gospel".[456] Biographer Christopher Read suggested that Lenin was "a secular equivalent of theocratic leaders who derive their legitimacy from the [perceived] truth of their doctrines, not popular mandates".[457] Lenin was nevertheless an atheist and a critic of religion, believing that socialism was inherently atheistic; he thus considered Christian socialism a contradiction in terms.[458] Service stated that Lenin could be "moody and volatile",[459] and Pipes deemed him to be "a thoroughgoing misanthrope",[460] a view rejected by Read, who highlighted many instances in which Lenin displayed kindness, particularly toward children.[461] According to several biographers, Lenin was intolerant of opposition and often dismissed outright opinions that differed from his own.[462] He could be "venomous in his critique of others", exhibiting a propensity for mockery, ridicule, and ad hominem attacks on those who disagreed with him.[463] He ignored facts that did not suit his argument,[464] abhorred compromise,[465] and very rarely admitted his own errors.[466] He refused to bend his opinions, until he rejected them completely, after which he would treat the new view as if it was just as unbendable.[467] Although he showed no sign of sadism or of personally desiring to commit violent acts, Lenin endorsed the violent actions of others and exhibited no remorse for those killed for the revolutionary cause.[468] Adopting an amoral stance, in Lenin's view the end always justified the means;[469] according to Service, Lenin's "criterion of morality was simple: does a certain action advance or hinder the cause of the Revolution?"[470] —Biographer Dmitri Volkogonov, 1994[471] Aside from Russian, Lenin spoke and read French, German, and English.[472] Concerned with physical fitness, he exercised regularly,[473] enjoyed cycling, swimming, and hunting,[474] and also developed a passion for mountain walking in the Swiss peaks.[475] He was also fond of pets,[476] in particular cats.[477] Tending to eschew luxury, he lived a spartan lifestyle,[478] and Pipes noted that Lenin was "exceedingly modest in his personal wants", leading "an austere, almost ascetic, style of life".[479] Lenin despised untidiness, always keeping his work desk tidy and his pencils sharpened, and insisted on total silence while he was working.[480] According to Fischer, Lenin's "vanity was minimal",[481] and for this reason he disliked the cult of personality that the Soviet administration began to build around him; he nevertheless accepted that it might have some benefits in unifying the communist movement.[482] Despite his revolutionary politics, Lenin disliked revolutionary experimentation in literature and the arts, for instance expressing his dislike of expressionism, futurism, and cubism, and conversely favouring realism and Russian classic literature.[483] Lenin also had a conservative attitude towards sex and marriage.[484] Throughout his adult life, he was in a relationship with Krupskaya, a fellow Marxist whom he married. Lenin and Krupskaya were both sad that they never had children,[485] although they enjoyed entertaining their friends' offspring.[486] Read noted that Lenin had "very close, warm, lifelong relationships" with his close family members,[487] although he had no lifelong friends, and Armand has been cited as being his only close, intimate confidante.[488] Ethnically, Lenin identified as Russian.[489] It is likely that he was unaware of his mother's Jewish ancestry, which was only discovered by his sister Anna after his death.[490] Service described Lenin as "a bit of a snob in national, social and cultural terms".[491] The Bolshevik leader believed that other European countries, especially Germany, were culturally superior to Russia,[492] "one of the most benighted, medieval and shamefully backward of Asian countries".[441] He was annoyed at what he perceived as a lack of conscientiousness and discipline among the Russian people, and from his youth had wanted Russia to become more culturally European and Western.[493] Volkogonov claimed that "there can scarcely have been another man in history who managed so profoundly to change so large a society on such a scale".[494] Lenin's administration laid the framework for the system of government that ruled Russia for seven decades and provided the model for later Communist-led states that came to cover a third of the inhabited world in the mid-20th century.[495] Thus, Lenin's influence was global.[496] A controversial figure, Lenin remains both reviled and revered;[426] he has been idolised by communists, and demonised by critics on both the left, such as democratic socialists and anarchists, and the right, such as conservatives and fascists.[497] Even during his lifetime, Lenin "was loved and hated, admired and scorned" by the Russian people.[498] The historian Albert Resis suggested that if the October Revolution is considered the most significant event of the 20th century, then Lenin "must for good or ill be considered the century's most significant political leader".[499] White described Lenin as "one of the undeniably outstanding figures of modern history",[500] while Service noted that the Russian leader was widely understood to be one of the 20th century's "principal actors".[501] Read considered him "one of the most widespread, universally recognizable icons of the twentieth century",[502] while Ryan called him "one of the most significant and influential figures of modern history".[503] Time magazine named Lenin one of the 100 most important people of the 20th century,[504] and one of their top 25 political icons of all time.[505] In the Western world, biographers began writing about Lenin soon after his death; some – like Christopher Hill – were sympathetic to him, and others – like Richard Pipes and Robert Gellately – expressly hostile. A number of later biographers, such as Read and Lars Lih, sought to avoid making either hostile or positive comments about him, thereby evading politicised stereotypes.[506] Among sympathisers, he was portrayed as having made a genuine adjustment of Marxist theory that enabled it to suit Russia's particular socio-economic conditions.[507] The Soviet view characterised him as a man who recognised the historically inevitable and accordingly helped to make the inevitable happen.[508] Conversely, the majority of Western historians have perceived him as a person who manipulated events in order to attain and then retain political power, moreover considering his ideas as attempts to ideologically justify his pragmatic policies.[508] More recently, revisionists in both Russia and the West have highlighted the impact that pre-existing ideas and popular pressures exerted on Lenin and his policies.[509] Various historians and biographers have characterised Lenin's administration as totalitarian,[510] and as a police state,[511] and many have described it as a one-party dictatorship.[512] Several such scholars have described Lenin as a dictator,[513] although Ryan stated that he was "not a dictator in the sense that all his recommendations were accepted and implemented", for many of his colleagues disagreed with him on various issues.[514] Fischer noted that while "Lenin was a dictator, [he was] not the kind of dictator Stalin later became",[515] while Volkogonov believed that whereas Lenin established a "dictatorship of the Party", it would only be under Stalin that the Soviet Union became the "dictatorship of one man".[516] Conversely, various Marxist observers – including Western historians Hill and John Rees – argued against the view that Lenin's government was a dictatorship, viewing it instead as an imperfect way of preserving elements of democracy without some of the processes found in liberal democratic states.[517] Ryan contends that the leftist historian Paul Le Blanc "makes a quite valid point that the personal qualities that led Lenin to brutal policies were not necessarily any stronger than in some of the major Western leaders of the twentieth century".[518] Historian J. Arch Getty remarked, "Lenin deserves a lot of credit for the notion that the meek can inherit the earth, that there can be a political movement based on social justice and equality."[519] Some left-wing intellectuals, among them Slavoj Žižek, Alain Badiou, Lars T. Lih, and Fredric Jameson, advocate reviving Lenin's uncompromising revolutionary spirit to address contemporary global problems.[520] Within the Soviet Union Lenin's Mausoleum, in front of the Kremlin, in 2007 In the Soviet Union, a cult of personality devoted to Lenin began to develop during his lifetime, but was only fully established after his death.[521] According to historian Nina Tumarkin, it represented the world's "most elaborate cult of a revolutionary leader" since that of George Washington in the United States,[522] and has been repeatedly described as "quasi-religious" in nature.[523] Busts or statues of Lenin were erected in almost every village,[524] and his face adorned postage stamps, crockery, posters, and the front pages of Soviet newspapers Pravda and Isvestia.[525] The places where he had lived or stayed were converted into museums devoted to him.[524] Libraries, streets, farms, museums, towns, and whole regions were named after him,[524] with the city of Petrograd being renamed "Leningrad" in 1924,[526] and his birthplace of Simbirsk becoming "Ulyanovsk".[527] The Order of Lenin was established as one of the country's highest decorations.[525] All of this was contrary to Lenin's own desires, and was publicly criticised by his widow.[407] Various biographers have stated that Lenin's writings were treated in a manner akin to holy scripture within the Soviet Union,[528] while Pipes added that "his every opinion was cited to justify one policy or another and treated as gospel".[529] Stalin codified Leninism through a series of lectures at the Sverdlov University, which were then published as Questions of Leninism.[530] Stalin also had much of the deceased leader's writings collated and stored in a secret archive in the Marx-Engels-Lenin Institute.[531] Material, such as Lenin's collection of books in Kraków, were also collected from abroad for storage in the Institute, often at great expense.[532] During the Soviet era, these writings were strictly controlled and very few had access.[533] All of Lenin's writings that proved useful to Stalin were published, but the others remained hidden,[534] and knowledge of both Lenin's non-Russian ancestry and his noble status was suppressed.[525] In particular, his Jewish ancestry was suppressed until the 1980s,[535] perhaps out of Soviet anti-Semitism,[536] and so as not to undermine Stalin's Russification efforts,[537] and perhaps so as not to provide fuel for anti-Soviet sentiment among international anti-semites.[536] Under Stalin's regime, Lenin was actively portrayed as a close friend of Stalin's who had supported Stalin's bid to be the next Soviet leader.[538] During the Soviet era, five separate editions of Lenin's published works were published in Russian, the first beginning in 1920 and the last from 1958 to 1965; although the fifth edition was described as "complete", in reality it had much omitted for political expediency.[539] Commemorative one rouble coin minted in 1970 in honour of Lenin's centenary After Stalin's death, Nikita Khruschev became leader of the Soviet Union and began a process of de-Stalinisation, citing Lenin's writings, including those on Stalin, to legitimise this process.[540] When Mikhail Gorbachev took power in 1985 and introduced the policies of glastnost and perestroika, he too cited these actions as a return to Lenin's principles.[541] In late 1991, amid the dissolution of the Soviet Union, Russian President Boris Yeltsin ordered the Lenin archive be removed from Communist Party control and placed under the control of a state organ, the Russian Centre for the Preservation and Study of Documents of Recent History, at which it was revealed that over 6,000 of Lenin's writings had gone unpublished. These were declassified and made available for scholarly study.[542] Yeltsin did not dismantle the Lenin mausoleum, however, recognising that Lenin was too popular and well respected among the Russian populace for this to be viable.[543] In Russia in 2012, a proposal from the Liberal Democratic Party of Russia, with the support of some members of the governing United Russia party, proposed the removal of all Lenin monuments, a proposal strongly opposed by the Communist Party of the Russian Federation.[544] In Ukraine, during the 2013–14 Euromaidan protests, several Lenin statues were damaged or destroyed by protesters who viewed them as a symbol of Russian imperialism,[545] and in April 2015 the Ukrainian government ordered that all others be dismantled to comply with decommunisation laws.[546] After the discovery of Lenin's Jewish ancestry, this aspect was repeatedly emphasised by the Russian far right, who claimed that his inherited Jewish genetics explained his desire to uproot traditional Russian society.[547] In the international communist movement According to Lenin biographer David Shub, writing in 1965, it was Lenin's ideas and example that "constitutes the basis of the Communist movement today".[548] Communist regimes professing allegiance to Lenin's ideas appeared in various parts of the world during the 20th century.[503] After Lenin's death, Stalin's administration established an ideology known as Marxism-Leninism, a movement that came to be interpreted differently by various contending factions in the Communist movement.[549] After being forced into exile by Stalin's administration, Trotsky argued that Stalinism was a debasement of Leninism, which was dominated by bureaucratism and Stalin's own personal dictatorship.[550] Marxism-Leninism would be adapted to many of the 20th century's most prominent revolutionary movements, forming into variants such as Stalinism, Maoism, Juche, Ho Chi Minh Thought, and Castroism.[502] Conversely, many later Western communists such as Manuel Azcárate and Jean Ellenstein who were involved in the Eurocommunist movement expressed the view that Lenin and his ideas were irrelevant to their own objectives, thereby embracing a Marxist but not Marxist-Leninist perspective.[551] See also 1. Russian: Владимир Ильич Ульянов [vlɐˈdʲimʲɪr ɪˈlʲitɕ ʊˈlʲanəf]. 2. Pronounced /ˈlɛnɪn/;[1] Russian: Ленин [lʲenʲɪn]. 1. "Lenin". Random House Webster's Unabridged Dictionary. Retrieved 7 May 2016. 7. Fischer 1964, p. 6; Rice 1990, pp. 12, 14; Service 2000, pp. 13, 25; White 2001, pp. 19–20; Read 2005, p. 4; Lih 2011, pp. 21, 22. 28. Service 2000, pp. 79, 98. 31. Fischer 1964, p. 21; Rice 1990, pp. 36, 37. 35. Rice 1990, pp. 40, 43; Service 2000, p. 96. 42. Rice 1990, pp. 47–48; Read 2005, p. 26. 45. Fischer 1964, p. 31; Rice 1990, pp. 48–51; Service 2000, pp. 107–108. 56. Rice 1990, pp. 69–70. 58. Rappaport 2010, p. 66; Lih 2011, pp. 8–9. 62. Read 2005, p. 60. 63. Fischer 1964, p. 38; Lih 2011, p. 80. 70. Rice 1990, p. 83; Rappaport 2010, p. 107. 73. Rice 1990, p. 85; Service 2000, p. 163. 77. Service 2000, pp. 170–171. 80. Rice 1990, pp. 88–89. 83. Rice 1990, pp. 96–97; Service 2000, pp. 176–178. 85. Rice 1990, p. 95; Service 2000, pp. 178–179. 89. Brackman 2000, pp. 59, 62. 90. Service 2000, pp. 186–187. 98. Fischer 1964, p. 70; Rice 1990, pp. 114–116. 105. Rice 1990, p. 122; White 2001, p. 100. 108. Fischer 1964, p. 85. 109. Rice 1990, p. 127; Service 2000, pp. 222–223. 112. Fischer 1964, p. 107; Service 2000, p. 236. 117. Rice 1990, p. 135; Service 2000, p. 235. 119. Service 2000, pp. 241–242. 120. Service 2000, p. 243. 121. Service 2000, pp. 238–239. 122. Rice 1990, pp. 136–138; Service 2000, p. 253. 123. Service 2000, pp. 254–255. 129. Service 2000, pp. 267, 271–272; Read 2005, pp. 152, 154. 130. Service 2000, p. 282; Read 2005, p. 157. 137. Service 2000, p. 288. 140. Pipes 1990, p. 465. 146. Service 2000, pp. 306–307. 150. Pipes 1990, p. 491; Service 2000, p. 309. 151. Pipes 1990, p. 499; Service 2000, pp. 314–315. 153. Pipes 1990, p. 504; Service 2000, p. 315. 154. Service 2000, p. 316. 155. Shub 1966, p. 314; Service 2000, p. 317. 158. Rice 1990, p. 164. 159. Pipes 1990, pp. 546–547. 165. Sandle 1999, p. 74; Rigby 1979, pp. 168–169. 166. Fischer 1964, p. 432. 167. Leggett 1981, p. 316; Lee 2003, pp. 98–99. 169. Service 2000, p. 388; Lee 2003, p. 98. 170. Service 2000, p. 388. 171. Rigby 1979, pp. 168, 170; Service 2000, p. 388. 172. Service 2000, p. 325–326, 333; Read 2005, p. 211–212. 176. Service 2000, p. 345. 177. Fischer 1964, p. 466; Service 2000, p. 348. 180. Volkogonov 1994, pp. 222, 231. 181. 1 2 Service 2000, p. 369. 182. Rice 1990, p. 161. 187. White 2001, pp. 159–160. 188. Fischer 1964, p. 249. 189. Sandle 1999, p. 84; Read 2005, p. 211. 193. Volkogonov 1994, p. 170. 194. 1 2 Service 2000, p. 321. 195. Fischer 1964, pp. 260–261. 196. Sandle 1999, p. 174. 197. Fischer 1964, pp. 554–555; Sandle 1999, p. 83. 198. Sandle 1999, pp. 122–123. 201. Pipes 1990, p. 709; Service 2000, p. 321. 202. Volkogonov 1994, p. 171. 206. Fischer 1964, pp. 263–264; Pipes 1990, p. 672. 207. Fischer 1964, p. 264. 208. Pipes 1990, pp. 681, 692–693; Sandle 1999, pp. 96–97. 209. Pipes 1990, pp. 692–693; Sandle 1999, p. 97. 210. 1 2 Fischer 1964, p. 236; Service 2000, pp. 351–352. 211. Fischer 1964, pp. 259, 444–445. 212. Sandle 1999, p. 120. 213. Service 2000, pp. 354–355. 216. Shub 1966, p. 383. 217. Fischer 1964, pp. 193–194. 218. Shub 1966, p. 331; Pipes 1990, p. 567. 221. Fischer 1964, pp. 151–152; Pipes 1990, pp. 571–572. 224. Fischer 1964, pp. 162–163; Pipes 1990, p. 576. 225. Fischer 1964, pp. 171–172, 200–202; Pipes 1990, p. 578. 226. Rice 1990, p. 166; Service 2000, p. 338. 227. Service 2000, p. 338. 233. Pipes 1990, p. 595; Service 2000, p. 342. 234. Fischer 1964, pp. 213–214; Pipes 1990, pp. 596–597. 235. Service 2000, p. 344. 238. Volkogonov 1994, p. 182. 243. Fischer 1964, p. 450; Pipes 1990, p. 726. 244. Pipes 1990, pp. 700–702; Lee 2003, p. 100. 246. Fischer 1964, p. 237. 249. Shub 1966, p. 312. 250. Fischer 1964, pp. 435–436. 253. Shub 1966, p. 366; Sandle 1999, p. 112. 254. Ryan 2012, p. 116. 255. Pipes 1990, p. 821; Ryan 2012, pp. 114–115. 257. Leggett 1981, pp. 173–174; Pipes 1990, p. 801. 259. Shub 1966, p. 364; Ryan 2012, p. 114. 260. Pipes 1990, p. 837. 261. Ryan 2012, p. 114. 262. Pipes 1990, p. 834. 263. Volkogonov 1994, p. 202; Read 2005, p. 247. 264. Pipes 1990, p. 796. 265. Volkogonov 1994, p. 202. 266. Pipes 1990, p. 825; Ryan 2012, pp. 117, 120. 268. Pipes 1990, pp. 829–830, 832. 269. Leggett 1981, pp. 176–177; Pipes 1990, pp. 832, 834. 270. Pipes 1990, p. 835; Volkogonov 1994, p. 235. 271. Leggett 1981, p. 178; Pipes 1990, p. 836. 272. Leggett 1981, p. 176; Pipes 1990, pp. 832–833. 275. Volkogonov 1994, p. 381. 276. Pipes 1990, p. 610. 277. 1 2 Service 2000, p. 357. 278. Service 2000, pp. 391–392. 279. Lee 2003, pp. 84, 88. 280. Read 2005, p. 205. 283. Leggett 1981, p. 204; Read 2005, p. 206. 285. Fischer 1964, pp. 262–263. 286. Fischer 1964, p. 291; Shub 1966, p. 354. 287. Fischer 1964, pp. 331, 333. 288. Pipes 1990, pp. 610, 612; Volkogonov 1994, p. 198. 290. Fischer 1964, pp. 248, 262. 294. Leggett 1981, p. 201; Volkogonov 1994, pp. 203–204. 296. Pipes 1990, pp. 763, 770–771; Volkogonov 1994, p. 211. 297. Ryan 2012, p. 109. 298. Volkogonov 1994, p. 208. 299. Pipes 1990, p. 635. 307. Shub 1966, p. 387; Rice 1990, p. 173. 309. 1 2 Service 2000, pp. 385–386. 310. Fischer 1964, pp. 531, 536. 311. Service 2000, p. 386. 312. Shub 1966, pp. 389–390. 313. 1 2 Shub 1966, p. 390. 316. Service 2000, p. 387; White 2001, p. 160. 318. Service 2000, p. 387. 319. Shub 1966, p. 395; Volkogonov 1994, p. 391. 320. Shub 1966, p. 397; Service 2000, p. 409. 321. Service 2000, pp. 409–410. 322. Fischer 1964, pp. 415–420; White 2001, pp. 161, 180–181. 323. Service 2000, p. 410. 324. Shub 1966, p. 397. 329. White 2001, p. 170. 330. Fischer 1964, pp. 507–508; Rice 1990, pp. 185–186. 331. Ryan 2012, p. 164. 332. Volkogonov 1994, pp. 343, 347. 334. Volkogonov 1994, p. 346. 335. Volkogonov 1994, pp. 374–375. 337. Volkogonov 1994, p. 376; Ryan 2012, p. 178. 343. Shub 1966, pp. 412–413. 350. Service 2000, pp. 421, 434. 353. Fischer 1964, pp. 567–569. 354. Fischer 1964, pp. 574, 576–577; Service 2000, pp. 432, 441. 355. Fischer 1964, pp. 424–427. 357. Volkogonov 1994, p. 283. 359. Fischer 1964, pp. 409–411. 367. Volkogonov 1994, p. 443; Service 2000, p. 437. 369. Service 2000, pp. 444–445. 370. Lerner, Finkelstein & Witztum 2004, p. 372. 372. Shub 1966, pp. 427–428; Service 2000, p. 446. 377. Fischer 1964, p. 578; Rice 1990, p. 189. 378. Rice 1990, pp. 192–193. 379. Fischer 1964, p. 578. 384. Fischer 1964, pp. 650–654; Service 2000, p. 470. 385. Shub 1966, pp. 426, 434; Lewin 1969, pp. 34–35. 386. Volkogonov 1994, pp. 263–264. 392. Service 2000, pp. 455, 456. 394. Rigby 1979, p. 221. 401. Volkogonov 1994, p. 435; Lerner, Finkelstein & Witztum 2004, p. 372. 402. Rice 1990, p. 7. 403. Rice 1990, pp. 7–8. 405. 1 2 Rice 1990, p. 9. 407. 1 2 Volkogonov 1994, p. 440. 409. Fischer 1964, pp. 625–626; Volkogonov 1994, p. 446. 410. Volkogonov 1994, pp. 444, 445. 411. Volkogonov 1994, p. 445. 412. Volkogonov 1994, p. 444. 413. Fischer 1964, p. 150. 414. 1 2 3 Ryan 2012, p. 18. 415. Volkogonov 1994, p. 409. 416. Sandle 1999, p. 35; Service 2000, p. 237. 417. 1 2 3 Sandle 1999, p. 41. 418. Volkogonov 1994, p. 206. 419. Sandle 1999, p. 35. 420. Shub 1966, p. 432. 421. Sandle 1999, pp. 42–43. 422. Sandle 1999, p. 38. 423. Sandle 1999, pp. 43–44, 63. 424. Sandle 1999, p. 36. 425. 1 2 Ryan 2012, p. 19. 426. 1 2 Ryan 2012, p. 3. 427. Ryan 2012, p. 13. 428. Sandle 1999, p. 57; White 2001, p. 151. 429. Sandle 1999, p. 29; White 2001, p. 1. 430. Service 2000, p. 173. 431. Service 2000, p. 203. 432. Sandle 1999, p. 34. 433. White 2001, pp. 150–151. 434. Fischer 1964, p. 213. 436. Fischer 1964, pp. 88–89. 437. 1 2 Fischer 1964, p. 87. 438. Fischer 1964, pp. 91, 93. 439. Fischer 1964, p. 310; Shub 1966, p. 442. 440. Sandle 1999, pp. 36–37. 441. 1 2 Rice 1990, p. 121. 442. Volkogonov 1994, p. 471. 443. Shub 1966, p. 443. 444. Service 2000, pp. 159, 202; Read 2005, p. 207. 445. Fischer 1964, pp. 47, 148. 446. Pipes 1990, pp. 348, 351. 447. Volkogonov 1994, p. 246. 448. Fischer 1964, p. 57. 449. Fischer 1964, pp. 21–22. 450. Service 2000, p. 73. 451. Fischer 1964, p. 44; Service 2000, p. 81. 452. Service 2000, p. 118. 453. Service 2000, p. 232; Lih 2011, p. 13. 454. White 2001, p. 88. 455. Volkogonov 1994, p. 362. 456. Fischer 1964, p. 409. 457. Read 2005, p. 262. 459. Service 2000, p. 116. 460. Pipes 1996, p. 11; Read 2005, p. 287. 461. Read 2005, p. 259. 463. Petrovsky-Shtern 2010, p. 93. 464. Pipes 1990, p. 353. 465. Fischer 1964, p. 69. 466. Service 2000, p. 244; Read 2005, p. 153. 467. Fischer 1964, p. 59. 470. Service 2000, p. 293. 471. Volkogonov 1994, p. 200. 472. Service 2000, p. 242. 474. Fischer 1964, p. 56; Service 2000, p. 188. 475. Read 2005, pp. 20, 64, 132–37. 476. Shub 1966, p. 423. 477. Fischer 1964, p. 367. 478. Fischer 1964, p. 368. 479. Pipes 1990, p. 812. 480. Service 2000, pp. 99–100, 160. 481. Fischer 1964, p. 245. 482. Pipes 1990, pp. 349–350; Read 2005, pp. 284, 259–260. 484. Fischer 1964, p. 79; Read 2005, p. 237. 485. Service 2000, p. 199. 487. Read 2005, p. 19. 488. Fischer 1964, p. 515; Volkogonov 1994, p. 246. 489. Petrovsky-Shtern 2010, p. 67. 490. Petrovsky-Shtern 2010, pp. 66–67. 491. Service 2000, p. 453. 492. Service 2000, p. 389. 493. Pipes 1996, p. 11; Service 2000, p. 389–400. 494. Volkogonov 1994, p. 326. 495. Service 2000, p. 391. 496. Volkogonov 1994, p. 259. 497. Read 2005, p. 284. 498. Fischer 1964, p. 414. 500. White 2001, p. iix. 501. Service 2000, p. 488. 502. 1 2 Read 2005, p. 283. 503. 1 2 Ryan 2012, p. 5. 506. Lee 2003, p. 14; Ryan 2012, p. 3. 507. Lee 2003, p. 14. 508. 1 2 Lee 2003, p. 123. 509. Lee 2003, p. 124. 511. Leggett 1981, p. 364. 514. Ryan 2012, p. 1. 515. Fischer 1964, p. 524. 516. Volkogonov 1994, p. 313. 517. Lee 2003, p. 120. 518. Ryan 2012, p. 191. 520. Ryan 2012, p. 3; Budgen, Kouvelakis & Žižek 2007, pp. 1–4. 522. Tumarkin 1997, p. 2. 524. 1 2 3 Volkogonov 1994, p. 328. 525. 1 2 3 Service 2000, p. 486. 526. Volkogonov 1994, p. 437; Service 2000, p. 482. 527. Lih 2011, p. 22. 529. Pipes 1996, p. 1. 531. Volkogonov 1994, pp. 274–275. 532. Volkogonov 1994, p. 262. 533. Volkogonov 1994, p. 261. 534. Volkogonov 1994, p. 263. 535. Petrovsky-Shtern 2010, p. 99; Lih 2011, p. 20. 536. 1 2 Read 2005, p. 6. 537. Petrovsky-Shtern 2010, p. 108. 538. Service 2000, p. 485. 539. Pipes 1996, pp. 1–2; White 2001, p. 183. 541. Service 2000, pp. 491–492. 542. Pipes 1996, pp. 2–3. 543. Service 2000, p. 492. 547. Petrovsky-Shtern 2010, pp. 134, 159–161. 548. Shub 1966, p. 10. 549. Shub 1966, p. 9; Service 2000, p. 482. 550. Lee 2003, p. 132. 551. Lee 2003, pp. 132–133. Brackman, Roman (2000). The Secret File of Joseph Stalin: a Hidden Life. Portland, Oregon: Psychology Press. ISBN 978-0-7146-5050-0. Hazard, John N. (1965). "Unity and Diversity in Socialist Law". Law and Contemporary Problems. 30 (2): 270–290. JSTOR 1190515. Retrieved 8 August 2016. Further reading External links Political offices Position established Chairman of the Council of People's Commissars of the Russian Socialist Federative Soviet Republic Succeeded by Alexei Rykov Chairman of the Council of People's Commissars of the Union of Soviet Socialist Republics Military offices Position established Chairman of the Council of Labour and Defence Succeeded by as Chair of the Sovnarkom
Poverty threshold For the term as defined in the United States, see Poverty thresholds (United States Census Bureau). Percentage of population living on less than $1.25 per day. UN estimates 2000–2007. The poverty threshold, poverty limit or poverty line is the minimum level of income deemed adequate in a particular country.[1] In practice, like the definition of poverty, the official or common understanding of the poverty line is significantly higher in developed countries (with HDI of under than 0.700 score) than in developing countries.[2][3] In October 2015, the World Bank updated the international poverty line to US$1.90 a day.[4] Most scholars agree that it better reflects today's reality, particularly new price levels in developing countries.[5] In 2008, the World Bank came out with a figure (revised largely due to inflation) of $1.25 at 2005 purchasing-power parity (PPP).[6] The common international poverty line has in the past been roughly $1 a day.[7] At present the percentage of the global population living under extreme poverty is likely to fall below 10% according to the World Bank projections released in 2015. Charles Booth, a pioneering investigator of poverty in London at the turn of the 20th century, popularised the idea of a poverty line, a concept originally conceived by the London School Board.[9] Booth set the line at 10 (50p) to 20 shillings (£1) per week, which he considered to be the minimum amount necessary for a family of 4 or 5 people to subsist on.[10] Benjamin Seebohm Rowntree (1871–1954), a British sociological researcher, social reformer and industrialist, surveyed rich families in York, and drew a poverty line in terms of a minimum weekly sum of money "necessary to enable families ... to secure the necessaries of a healthy life", which included fuel and light, rent, food, clothing, and household and personal items. Based on data from leading nutritionists of the period, he calculated the cheapest price for the minimum calorific intake and nutritional balance necessary, before people got ill or lost weight. He considered this amount to set his poverty line and concluded that 27.84% of the total population of York lived below this poverty line.[11] This result corresponded with that from Charles Booth's study of poverty in London and so challenged the view, commonly held at the time, that abject poverty was a problem particular to London and was not widespread in the rest of Britain. Rowntree distinguished between primary poverty, those lacking in income and secondary poverty, those who had enough income, but spent it elsewhere (1901:295–6).[11] Absolute poverty See also: Extreme poverty Absolute poverty is the level of poverty as defined in terms of the minimal requirements necessary to afford minimal standards of food, clothing, health care and shelter. For the measure to be absolute, the line must be the same in different countries, cultures, and technological levels. Such an absolute measure should look only at the individual's power to consume and it should be independent of any changes in income distribution. The intuition behind an absolute measure is that mere survival takes essentially the same amount of resources across the world and that everybody should be subject to the same standards if meaningful comparisons of policies and progress are to be made. Notice that if everyone's real income in an economy increases, and the income distribution does not change, absolute poverty will decline. For example, a person who lives in a home with a mud floor is considered severely deprived of shelter. A person who never attended school and cannot read is considered severely deprived of education. A person who has no newspaper, radio, television, computer, or telephone is considered severely deprived of information. All people who meet any two of these conditions for example, they live in homes with mud floors and cannot read are considered to be living in absolute poverty. The term "Absolute Poverty" is slightly misleading when defined in this manner, as there are great numbers of people who have none of these eight basic needs met, but are still grouped with those who lack only 2. Basic needs See also: Basic needs The basic needs approach is one of the major approaches to the measurement of absolute poverty in developing countries. It attempts to define the absolute minimum resources necessary for long-term physical well-being, usually in terms of consumption goods. The poverty line is then defined as the amount of income required to satisfy those needs. The 'basic needs' approach was introduced by the International Labour Organization's World Employment Conference in 1976.[13][14] "Perhaps the high point of the WEP was the World Employment Conference of 1976, which proposed the satisfaction of basic human needs as the overriding objective of national and international development policy. The basic needs approach to development was endorsed by governments and workers' and employers' organizations from all over the world. It influenced the programmes and policies of major multilateral and bilateral development agencies, and was the precursor to the human development approach."[13][14] A traditional list of immediate "basic needs" is food (including water), shelter and clothing.[15] Many modern lists emphasize the minimum level of consumption of 'basic needs' of not just food, water, and shelter, but also sanitation, education, and health care. Different agencies use different lists. In 1978, Ghai investigated the literature that criticized the basic needs approach. Critics argued that the basic needs approach lacked scientific rigour; it was consumption-oriented and anti-growth. Some considered it to be "a recipe for perpetuating economic backwardness" and for giving the impression "that poverty elimination is all too easy".[16] Amartya Sen focused on 'capabilities' rather than consumption. Relative poverty Relative poverty is the "most useful measure for ascertaining poverty rates in wealthy developed nations".[17][18][19][20][21] Relative poverty measure is used by the United Nations Development Program (UNDP), the United Nations Children's Fund (UNICEF), the Organisation for Economic Co-operation and Development (OECD) and Canadian poverty researchers.[17][18][19][20][21] In the European Union, the "relative poverty measure is the most prominent and most–quoted of the EU social inclusion indicators."[22] History of the concept of relative poverty Relative poverty compared with other standards National poverty lines In 2015, in the United States, the poverty threshold for a single person under 65 was at an annual income of US$11,770; the threshold for a family group of four, including two children, was US$24,250.[36][37] According to the U.S. Census Bureau data released on 13 September 2011, the nation's poverty rate rose to 15.1 percent in 2010. Using a poverty threshold is problematic because having an income slightly above or below it is not substantially different; the negative effects of poverty tend to be continuous rather than discrete, and the same low income affects different people in different ways. To overcome this problem, a poverty index or indices can be used instead; see income inequality metrics. Overstating poverty Some critics point out that stated poverty lines in countries with substantial welfare systems (such as the United States and Europe) fail to count in-kind transfers, whether from public or private sources, when calculating a poverty threshold. For example, if a parent pays the rent on an apartment for an adult son directly to the apartment owner, instead of giving the money to the son to pay the rent, the money does not count as direct income to the son. If a church or non-profit organization gives food to an elderly person, the value of the food is not counted as direct income to the elderly person. Rea Hederman, a senior policy analyst in the Center for Data Analysis at the Heritage Foundation, said: Understating poverty Further, the U.S. Census Bureau calculates the poverty line the same throughout the U.S. regardless of the cost-of-living in a state or urban area. For instance, the cost-of-living in California, the most populous state, was 42% greater than the U.S. average in 2010 while the cost-of-living in Texas, the second most populous state, was 10% less than the U.S. average. See also 7. Sachs, Jeffrey D. The End of Poverty 2005, p. 20 9. Alan Gillie, 'The Origin of the Poverty Line', Economic History Review, XLIX/4 (1996), 726 10. David Boyle - The Tyranny of Numbers p. 116 11. 1 2 Rowntree, Benjamin Seebohm (1901). Poverty: A Study in Town Life. Macmillan and Co. page 298 12. 1 2 "Indicators of Poverty and Hunger" (PDF). Retrieved 14 February 2008. 13. 1 2 "The World Employment Programme at ILO" (PDF). 18. 1 2 Child poverty in rich nations: Report card no. 6 (Report). Innocenti Research Centre. 2005. 20. 1 2 Human development report: Capacity development: Empowering people and institutions (Report). Geneva: United Nations Development Program. 2008. 21. 1 2 "Child Poverty". Ottawa, ON: Conference Board of Canada. 2013. 31. Callan, T.; Nolan, Brian; Whelan, Christopher T. (1993). "Resources, Deprivation and the Measurement of Poverty". Journal of Social Policy. 22: 141–172. doi:10.1017/s0047279400019280. 35. "http://inequalitywatch.eu/spip.php?article99" Eurostat 2010 36. "Annual Update of the HHS Poverty Guidelines". 22 January 2015. Retrieved 15 April 2015. 37. US Census Bureau. "How the Census Bureau Measures Poverty". Retrieved 22 December 2010. 39. IPPR Article: "Government must rescue 'forgotten million children' in poverty" 40. "Poverty Estimates for 2004-05" (PDF). Retrieved 19 November 2009. 42. Kenworthy, L (1999). "Do social-welfare policies reduce poverty? A cross-national assessment". Social Forces. 77 (3): 1119–1139. doi:10.1093/sf/77.3.1119. Further reading
Responsibility-driven design Responsibility-driven design is a design technique in object-oriented programming. It was proposed by Rebecca Wirfs-Brock and Brian Wilkerson, who defined it as follows: Responsibility-driven design is inspired by the client/server model. It focuses on the contract by asking: • What actions is this object responsible for? • What information does this object share? Responsibility-driven design is in direct contrast with data-driven design, which promotes defining the behavior of a class along the data that it holds. Data-driven design is not the same as data-driven programming, which is concerned with using data to determine control flow not class design. The client/server model they refer to assumes that a software client and a software server exchange information based on a contract that both parties commit to adhere to. The client may only make the requests specified, the server must answer them. Thus, responsibility-driven design tries to avoid dealing with details, such as the way in which requests are carried out, by instead only specifying the intent of a certain request. The benefit is increased encapsulation, since the specification of the exact way in which a request is carried out is private to the server. To further the encapsulation of the server, Wirfs-Brock and Wilkerson call for language features that limit outside influence to the behavior of a class. They demand that visibility of members and functions should be finely grained, such as in Eiffel. Even finer control of the visibility of even classes is available in the Newspeak programming language. Building blocks In their book Object Design: Roles, Responsibilities and Collaborations,[1] the authors describe the following building blocks that make up responsibility-driven design. Objects are described as things that have machinelike behaviors that can be plugged together to work in concert. These objects play well-defined roles and encapsulate scripted responses and information.[2] A role is a set of related responsibilities.[2] They can be implemented as classes and interfaces. Interfaces, however, are the preferred implementation as they increase flexibility by hiding the concrete class which ultimately does the work.[9] Control style An important part in the responsibility-driven design process is the distribution of control responsibilities that results in developing a control style. Centralized control style This control style inflicts a procedural paradigm on the structure of the application and places major-decision making responsibilities in only a few objects. When to use When decisions to be made are few, simple, and related to a single task. Clustered control style This control style is a variation of the centralized control style wherein control is factored among a group of objects whose actions are coordinated.[16] The main difference between a clustered and delegated control style is that in a clustered control style, the decision making objects are located within a control center whereas in a delegated control style they are mostly outside.[17] When to use Delegated control style A delegated control style lies in between a centralized and dispersed control style. It passes some of the decision making and much of the action to objects surrounding a control center. Each neighboring object has a significant role to play. When to use When one wants to delegate work to objects that are more specialized. Dispersed control style A dispersed control style does not contain any control centers. The logic is spread across the entire population of objects, keeping each object small and building in as few dependencies among them as possible.[19] When to use Preferred control style The inventors of responsibility-driven design recommend using a delegated control style because no one object knows or does too much.[20] Conflict with the Law of Demeter According to Wirfs-Brock and Wilkerson, there is a conflict between the Law of Demeter and responsibility-driven design. The law says that messages can be sent only to the following: message argument, instance variable, new objects, and global variables. Therefore, sending a message to the result of a previous message send isn't allowed. However, "returned values are part of the client/server contract. There need be no correlation between the structure of an object and the object returned by the message." [21] This article is issued from Wikipedia - version of the 6/5/2016. The text is available under the Creative Commons Attribution/Share Alike but additional terms may apply for the media files.
Select Page The Sacrament of First Holy Communion A Complete Preparation Course James Socias 4 in stock (can be backordered) The Sacrament of First Holy Communion presents a thorough preparation of the Sacraments of Penance and First Holy Communion for Grade 2. This textbook has been prepared as a catechesis for parents and children so that both the parents and their child may engage in fruitful dialogue throughout this important spiritual journey. Why does God love each of us so much? How has God taught his people to love him and follow him? How does God lead us to heaven? The answers to these questions are to be found in this book. You will learn why God sent his Son, Jesus Christ, to save us all, and how his saving work is still happening today through the Church and her Sacraments. These Sacramental Preparation books will help guide you through the spiritual, mental, and religious formation to participate fully in the Church’s Sacraments. These books were prepared in the light of Sacred Scripture; Sacred Tradition; the lives of holy men, women, and children; Catholic traditions; and the formational requirements of the U.S. bishops. 322 Pages 8.5 x 11
Suppose we know the length, radius, position and orientation of two cylinders. Is there a general formula to calculate the volume of space shared by the intersection of the cylinders? • 1 $\begingroup$ Wow. This seems very difficult. A closed form solution is almost unrealistic. I recommend you simplify by starting with some assumptions. It would be helpful to assume the lines through the centers of the cylinders intersect at an angle $\alpha$. Then, assume that the cylinders are very long, so they don't intersect at their bases. Even with all of these simplifications, the problem is not easy. $\endgroup$ – Jared Dec 24 '13 at 6:54 • $\begingroup$ @Jared I feared someone would say that. Although I thought there might be at least some approximate solution. For example in Computer Aided Design programs I have seen people cutout shapes using the intersection of another shape to define the volume to be removed. If we have the original cylinders volume then cut a portion out using the intersection with a second cylinder we could get an approximate volume somehow. $\endgroup$ – Stephen Tierney Dec 24 '13 at 10:51 • $\begingroup$ You can probably write a triple integral for the volume, and compute it numerically, but this integral will be rather nasty: you have to plug in all you know, like directions of the cylinders and their radii. There will be a geometrical condition for a point $M$ to be inside the intersection, then you integrate $\mathrm dV$ on the domain thus defined. Good luck :-) I bet CAD programs make first an approximation of figures as polyhedra, then the volume is easier (the intersection is still a polyhedron). $\endgroup$ – Jean-Claude Arbaut Dec 24 '13 at 11:18 • $\begingroup$ This comment is to link this post as one of the (abstract) duplicates to the current choice of mother/target post. Even though this post is older, the target post has an existing duplicate-link. $\endgroup$ – Lee David Chung Lin Jan 22 at 11:44 This answer is about the particular case in which the axes of the two cylinders meet at a point, both have the same radius, and both cylinders extend to infinity (this last assumption is to avoid complexities regarding truncated cylinder intersections). We can take the radius as $1$ and then re-scale to radius $a$ by inserting a factor of $a^3$. Let the $x$ axis be the axis of cylinder $A$, and for some $m>0$ let the line $y=mx$ be the axis of cylinder $B$. The (signed) distance between a point $(x,y)$ and the line $y=mx$ is $\frac{y-mx}{r}$ where $r=\sqrt{1+m^2}$ Then the restriction that $(x, y)$ lies under cylinder $B$ is that $-1 \le \frac{y-mx}{r} \le 1,$ while $(x, y)$ lies under cylinder $A$ provided $-1 \le y \le 1$. Note we're considering the part of the intersection lying above the $xy$ plane; then the height over cylinder $A$ is $\sqrt{1-y^2}$ and the height over cylinder $B$ is $\sqrt{1-\left[\frac{y-mx}{r}\right]^2}.$ These heights are the same over a point $(x, y)$ (i.e. the two cylinders intersect over that point) iff $y^2-\left[\frac{y-mx}{r}\right]^2=0$, which factors into two lines $y=-\frac{mx}{r-1}$ and $y=\frac{mx}{r+1}$. The product of these slopes is $-1$ so the lines are orthogonal. If $L_B$ is the axis $y=mx$ of cylinder $B$, and for convenience $L_A$ is the $x$-axis, the axis of cylinder $A$, we'll use the notations $L_B^+$ and $L_B^-$ for the lines parallel to $L_B$ and one unit away from it, above and below respectively. Similar notation for $L_A^+$ and $L_A^-.$ The first two of these are the upper and lower boundaries of the projection of cylinder $B$ onto the $xy$ plane, and similarly the second two are the upper and lower boundaries of the projection of cylinder $A.$ Equations for these are $$L_B^+ : y=mx+r \\ L_B^- : y=mx-r \\ L_A+ : y=1 \\ L_A^- : y=-1$$ The intersections of these lines consist of four points $P, Q, R, S$ which form an equilateral parallelogram. We have $$P=\left(\frac{1-r}{m}, 1\right), \ Q=\left(\frac{1+r}{m}, 1\right), \ R=\left(\frac{-1+r}{m}, -1\right), \ S=\left(\frac{-1-r}{m}, -1\right)$$ Now if we denote the origin $(0, 0)$ by $O$, we can see there are four triangular regions each having $O$ as one vertex, and two adjacent vertices of the parallelogram as the other two vertices. Above each of these triangles we know which of the two cylinders lies below the other. It turns out that the contributions to the volume from each of these triangles (i.e. the volume of the intersection of the cylinders lying above that triangle) is the same. This can be seen by symmetry, since e.g. the part lying above $\triangle OQR$ could be set up with the line $y=mx$ playing the role of the $x$ axis, and taking an orthogonal axis pointing downwards from $O$, so that the "old" $x$ axis is now at the same slope $m$ in this rotated and flipped coordinate system. It remains now to find the volume over $\triangle OPQ$, which may be described as $0 \le y \le 1$ and $\frac{y(1-r)}{m} \le x \le \frac{y(1+r)}{m}$. Now over this triangle it is cylinder $A$ whose height is lower. This means we're integrating $\sqrt{1-y^2}$ over $\triangle OPQ$. At any specific $y$ the height being constant, we only need multiply by the length of the horizontal section of $\triangle OPQ$ at distance $y$ from the $x$ axis, and integrate. Thus we get $$ \int_0^1 \frac{(2r)}{m y \sqrt{1-y^2}} dy=(2r/m)\cdot(1/3).$$ Recalling that we have found only the volume above the $xy$ plane, and that there are four triangles each giving the above contribution to the part above the $xy$ plane, we arrive at $$\frac{16}{3}\cdot \frac{\sqrt{1+m^2}}{m}$$ for the volume of the intersection of the cylinders. Note as $m \to \infty$ (so that the angle of intersection goes to 90 degrees) this formula approaches the correct $16/3$ (the usual formula $(16/3)a^3$ when $a=1.$) And also as expected it becomes infinite as $m \to 0^+.$ Added note: If $\theta$ is the angle between the two axes, then $m=\tan \theta.$ I used the letter $r$ during the derivation to mean $\sqrt{1+m^2}$ only for convenience. If we reset $r$ to now mean the common radius of the cylinders, and apply a trig identity, we can reexpress the volume in the form $$V=\frac{16}{3 \sin \theta} \cdot r^3,$$ which is only off by the $sin \theta$ divisor from the result $(16/3)r^3$ when the cylinders are orthogonal. Your Answer
That’s because that urinary tract infection might not be a urinary tract infection. Sexually Transmitted Diseases Several sexually transmitted diseases (STDs) have symptoms similar to a urinary tract infection. Not only that, but STDs are far more common than you would believe. The CDC estimates that there are 20 million new STD infections reported each year. These are people from all walks of life, all economic classes, all social classes, and all ethnic groups. And while 50 percent of all new STDs occur in people aged 15-24, older adults are just as vulnerable. The Spread of STDs One of the reasons that STDs spread so easily is that they are hard to detect—many of the symptoms are similar to those of other diseases, like urinary tract infections. Other diseases, like the human papillomavirus (HPV), HIV and hepatitis, could have no symptoms at all until the later stages of the disease. STD Testing: When a UTI is Not a UTI The other reason that STDs spread so easily is the perception that people have of a person with an STD. When we think of STDs we think of certain marginalized groups of the population. In truth, you do not need to be promiscuous, or a drug addict to get an STD. All you need is to do is have unprotected sex with someone who has the disease. And that means anyone, even that really nice, clean-cut guy in the corner, could have one. This is why STD testing is so important. STD Testing If you have genital symptoms, an STD test can confirm, or rule out, a disease that could cause you other problems later on. For example, HPV causes cervical cancers and genital warts; untreated trichomoniasis can cause premature births and low birth rates; and untreated chlamydia can cause infertility in women. If you are starting a relationship with a new partner, preventative STD testing can screen for potential hazards, and protect the both of you. You can get tested through your personal physician, at a health clinic, or you can order home STD testing kits. Handling the Results One thing you must remember is that the presence of an STD is not a reflection on you, or your partner’s character. As I said before, all it takes is one encounter with someone who is infected and, because some STDs have no symptoms for years, that encounter could have happened five days, or five years ago. If you are in a committed relationship, it could mean that your partner was unfaithful; but it could also mean that he contracted the disease before you got together, and wasn’t aware that he was infected. Before you jump to any conclusions, talk with your partner and keep an open mind. Once you learn your disease status, do not attempt to cure the disease with natural or home remedies. You can use holistic remedies to relieve some of the symptoms, in conjunction with medications to treat the actual disease-causing organisms. For example, you can apply warm compresses to relieve abdominal pain, or drink lots of water or cranberry juice to relieve painful urination, while taking your medications. Many STDs, like syphilis and trichomoniasis, are easily treated with antibiotic drugs, which can destroy the flora in your gut. Eating yogurt will help restore the beneficial bacteria, and prevent many gastro-intestinal problems that can occur with antibiotic use. Other diseases, like HIV and Herpes, are caused by a virus and there is no cure. However, several drugs can prevent the virus from growing, and slow the rate of progression. Herbal remedies that contain salicylic acid, like white willow bark, can reduce the fever that usually occurs with a viral STD infection. Pin It on Pinterest
Technical Data All living organisms contain Structured Water Water inside our body’s cells is structured water. The water preferred by human cells is structured into small clusters containing five to twenty molecules. What is good healthy water? It must be fit to drink, and be free of pathogens and pollutants. Municipal water in most cities is treated to make it safe to drink. The treatment, normally chlorine, kills most disease-causing bacteria. That’s a good thing; however, many people consider the levels of chlorine in the water to be a pollutant and it tastes bad. There is big business in chlorine removing filters. It seems we have taken the lesser of two evils in disinfecting of our water. The treatment eliminates the threat of bacterial contamination. But does this make healthier water? And what is structured water? Water molecules are attracted or loosely attached to each other through hydrogen bonding. In normal water this attraction makes water cluster together in large assemblies of water. These clusters have size and shape; both their size and shape can affect biological organisms. The water molecule, made up of two hydrogen and one oxygen atoms, is what most of us think of as water. The true picture is a little more complex. These molecules appear to be very gregarious. They like to get together and are seldom found alone. They will cluster in groups of from five molecules to over 600 molecules. These groups are not static. Water molecules will switch from one group to another very easily and do so often. Hydrogen bonds are being made and broken several times a nanosecond. This creates the unimaginably dynamic energy environment of water. It is the size and shape of these clusters of molecules in their never ceasing interaction that is the “structure” of water. Structured Water is a new technology for water treatment that utilizes nature’s own methods, producing cleaner, better tasting water without the use of chemicals, filters, salts, electricity or complex metal alloys for a truly maintenance-free total-treatment water conditioning system. This new technology employs an innovative application and advanced understanding of the vortex phenomenon utilizing the dynamic characteristic of water itself to create a Structured Water device that works at the molecular level. This “Fluid Machine” alters the molecular structure of the water, activating and retaining the healthful benefits of minerals and characteristics, while excess suspended solids, contaminants and sediment are dynamically isolated or removed. Specially tuned geometry creates an energy environment for water to structure itself. This gives water a lower surface tension and better hydrating properties. This geometric technology breaks up large low-energy water molecule clusters into smaller high energy clusters. This systematic treatment eliminates negative energy patterns (sometimes called the memory of water) and redefines the water’s natural healthy energy pattern. Structured water allows us to imprint through the DNA and RNA the knowledge of its secret blue print and help one to become balanced in the universe. Subscribe To Our Newsletter You have Successfully Subscribed! Pin It on Pinterest Share This
Contact Us \| Personalized Cause Do you have a question or concern? We can help!! Phone - 1-833-422-8737 Email - Cause Awareness Blog \| Support the Struggle \| Personalized Cause May 11 is Cornelia de Lange Syndrome Awareness Day Danica Carson Cornelia de Lange Syndrome Awareness Day Happy May, everyone! Today we are going to talk about a rare disease called Cornelia de Lange Syndrome. This post is in honor of Cornelia de Lange Syndrome Awareness Day. Rare diseases are very important to become educated about for a lot of reasons. The biggest reason being that most people have never and will never hear about them. You may be saying to yourself, “if I will never encounter it, why should I educate myself about it?” Rare diseases will not get funding, research, interest or recognition without awareness. Awareness is crucial for developing treatments and potential cures. Education is the key to awareness. The Importance of Raising Awareness As you may have noticed, diseases and cancers with the most public awareness receive the most publicity, funding and research. Take breast cancer for example. The pink awareness ribbon is one of the most recognized awareness ribbons out there. Breast cancer fundraisers and events have led to research breakthroughs over the years. We can now test for hereditary breast cancer genes. This allows us to prevent generations of women from developing the cancer. Another example is the Ice Bucket Challenge for ALS. The Ice Bucket Challenge was a viral meme that made the rounds through social media in 2014. It was an awareness campaign where people participated by making their own videos. Participants would begin the video by explaining that it was for ALS. They would then nominate three people to do the challenge. Finally, they would get a bucket of ice water dumped over their head. In 2016, it was reported that the Ice Bucket Challenge helped scientists identify a gene associated with ALS. All in all, the Ice Bucket Challenge raised $115 million dollars for ALS. The Ice Bucket challenge received criticism for being a trendy way to appear socially conscious. Digital activism with minimal work or commitment is called slacktivism. Critics focused on the dangers of slacktivism instead of the fundraising results. The skeptics were proven wrong only two years later. This demonstrates how powerful awareness can be for a disease, and why raising awareness for all rare diseases is so crucial to progress. What is Cornelia de Lange Syndrome? Cornelia de Lange Syndrome is a rare genetic disorder. CdLS is most often diagnosed after birth. It can sometimes be diagnosed through an ultrasound during pregnancy. CdLS carries many distinctive physical features, associated developmental delays, and intellectual disabilities. CdLS varies from patient to patient. Some people with CdLS may have most of the characteristics of the disease, while others may only have a few. Severity of each symptom is also variable. What are the Symptoms of Cornelia de Lange Syndrome? First, let’s talk about the physical symptoms. As I mentioned above, most CdLS patients are diagnosed as babies. Babies with CdLS often exhibit growth and developmental delays. This can affect their height and weight, and can be severe enough to be considered failure to thrive. Children with the syndrome are usually smaller than other children their age. They also have certain smaller features. The most noticeable physical symptoms are those that appear on the head and face or limbs. Cornelia de Lange Syndrome may cause many craniofacial abnormalities. There is also "a look" associated with kids with CdLS. These characteristics include a small or short head and upturned nose. They may also have rounded eyebrows that usually grow together, a short, wide neck, and a very low hairline. There are less distinctive physical attributes associated with CdLS, too. An underdeveloped jaw, excessive hair growth, and cleft palate may all occur. There are other physical abnormalities that occur with CdLS. Many symptoms affect the arms, legs, fingers, and toes. The most common of these abnormalities are small hands and feet in proportion to the rest of the body. Limbs may not develop fully on one or both sides. Severe, but rare, instances of this can mean that hands or forearms do not grow at all. Fingers that taper towards the end, abnormally positioned thumbs, missing fingers and curved pinky fingers are also symptoms of Cornelia de Lange Syndrome. CdLS can also cause problems in the stomach and intestines. For example, it can cause abnormal intestinal twisting. This can be severe enough to cause a full obstruction. Intestinal obstruction can be fatal if not treated. Sometimes the esophagus and lining of the esophagus are affected. This can cause inflammation and a narrowing towards the stomach. This causes difficulty eating or keeping food down. A similar narrowing can also develop where the stomach connects to the small intestines. This can be serious when eating and digestion are affected. Malnutrition can occur when there are problems with the gastrointestinal tract. This can be even more dangerous because kids with CdLS tend to be small and weigh less. Kids with CdLS may also suffer from cardiovascular, respiratory, and autonomic nervous system issues. There are some heart abnormalities associated with the syndrome. Chronic respiratory infections are common, as well. It is important for kids with CdLS to avoid the flu because of their higher risk for complications. The autonomic nervous system controls the automatic functions of the body. This includes everything from breathing to sleeping. With autonomic nervous system dysfunction, the brain may not control automatic functions well. In CdLS, this may mean seizures or nystagmus (uncontrollable movements of the eye). There are many other physical signs and symptoms of Cornelia de Lange Syndrome. I cannot cover everything. If you are interested in learning more, I suggest It is the mecca of rare disease information. Intellectual Signs and Symptoms of Cornelia de Lange Syndrome. CdLS may also cause issues with intellectual development and coordination. This can include psychomotor retardation, as well as intellectual disability. Psychomotor retardation means that the child may have difficulty developing mental-muscular coordination. Simply put, this means that they may struggle to develop motor skills. As far as intellectual disability, it can range from mild to severe, and may impact the child’s behavior. Behavioral issues may include screaming, biting, and self-harm behaviors like hitting themselves. What Causes Cornelia de Lange Syndrome? While CdLS can be genetic, the majority of cases are due to a gene mutation that is not inherited. There are five different genes that are associated with Cornelia de Lange Syndrome. In 60% of the cases, the cause can be traced to the NIPBL gene. The remaining 40% may be traced to different genes. CdLS does not seem to affect one sex more than the other. Both girls and boys are affected. There are two ways that CdLS can get inherited. It can be an autosomal dominant condition, which means that you can develop the condition even if only one parent has the gene. The other way is as an x-linked condition, which means that it gets passed down through the X chromosome. Cornelia de Lange Syndrome is a rare disease, and affects about 1 in every 10,000 babies born. Because it can be inherited, there are families that may have more than one child born with CdLS. What are the Treatment Options for Cornelia de Lange Syndrome? Like many other diseases, the treatment focuses on the specific symptoms. This is called supportive treatment. Since CdLS affects so many different systems, children may have teams of specialists that all work together to treat them. The type of specialists that make up the team will depend on the symptoms. For some symptoms, there may be more permanent solutions. Issues such as a cleft lip or cleft palate can be surgically corrected. Some heart problems that develop from CdLS can be corrected with surgery. Gastrointestinal issues can also be helped with surgery. There are medications available to treat certain symptoms. It is important to note that treating the symptoms and treating the disease are different. There are no treatments designed to specifically treat the syndrome or all the symptoms. Medications can treat things such as seizures and infections. They can also treat urinary issues, gastrointestinal issues and more. A Little Information About Rare Diseases. Cornelia de Lange Syndrome is one of almost 7,000 rare diseases. The definition of a rare disease is a condition that affects less than 200,000 people. That number applies to the United States. Rare diseases may be genetic or random. Rare diseases have no difinitive characteristic other than the number of people affected. Some may be chronic illnesses, some may be disabilities, some may be gene mutations. They may be different than all three of these. The biggest obstacle people with a rare disease face are finding a doctor that can diagnose them. The second biggest obstacle is finding treatment options that have a meaningful impact. As you can imagine, diseases that aren’t common have less appeal to drug companies. Developing a medication that only treats a small percentage of the population is not as profitable as one that treats millions of people. The struggle to figure out what is wrong with you and the struggle to find a medication that helps is endless. Rare disease patients may suffer for years or decades before finding their answer. Rare Diseases and Orphan Drugs. As I mentioned above, there are very few options for medications to treat rare diseases. There are certain pharmaceutical companies dedicated to developing medicines for rare diseases. There are also some divisions of major drug companies that develop these medicines. These medications are called Orphan drugs. The Orphan Drug Act provides funding and incentives to companies who develop them. These drugs take longer to develop because they have smaller development teams and less funding. Even so, Orphan drugs have great potential for future breakthroughs in treatment. Orphan drugs offer a lot of hope. "When we have hope, we discover powers within ourselves we may have never known- the power to make sacrifices, to endure, to heal, and to love. Once we choose hope, everything is possible." -Christopher Reeve National Infertility Awareness Week Davis Orr National Infertility Awareness Week Starts Today! Welcome back, everyone! Today’s post is dedicated to National Infertility Awareness Week. Infertility is a tough subject. It is surrounded by a swirling cloud of stigma, shame, guilt, depression, pain, loss, and fear. It used to be considered taboo to talk about fertility struggles openly. Thankfully, people are much more open about their struggles now. The more open people are, the more we realize how common these issues are. There is a vast network of infertility support groups on social media. These social media support communities offer those struggling a sense of support. They also lessen the isolation felt by those who are struggling. Social media can be a powerful way to connect and support one another. These communities can be found using hashtags specific to the topic. #ttc and #infertility are a good place to start. What is Infertility? In simplest terms, infertility is the inability to get pregnant. The definition of infertility is the inability to get pregnant despite having regular unprotected sex for between six months and a year. The length of time depends on your age. Under age 35, it is considered infertility if you have tried to get pregnant for over a year but have not conceived. After age 35, the length of time is only six months. Fertility decreases over time after age 30. Your chances of becoming pregnant after age 35 are much lower. The length of time is decreased to six months so that any issues can be addressed quickly. Infertility does not mean that you will never be able to have a child. Infertility is not the same as sterility. If a health problem is causing the issue it can be addressed. There are many factors that contribute to your ability to get pregnant. If one of those factors isn’t quite right, it can derail your ability to conceive. If both partners have fertility issues it can compound difficulty of getting pregnant. This occurs in around 20% of couples experiencing infertility. Medical intervention is always an option for couples that are unable to have a baby on their own. What Causes Infertility? Infertility can be caused by a lot of different health issues. Sometimes, there is no identifiable cause of infertility. Around 15% of couples that went through all the testing were unable to find any source for their struggle. Both men and women can have issues with fertility. It tends to affect both men and women pretty equally, but the causes are very different. What Causes Infertility in Men? The biggest cause of infertility in men is a problem with sperm. There are a lot of things that can affect sperm count or sperm quality. A low sperm count can make conception very difficult, if not impossible. A normal sperm count ranges anywhere from 15 million to 200 million sperm per millimeter. A low sperm count is considered anything under 15 million. A low sperm count doesn’t mean you can’t get pregnant, it means it may take more tries. It’s a numbers game. The more attempts, the higher the odds. Another issue men can experience is low sperm motility. Low sperm motility just means that they don’t move quite as well. If the sperm aren’t strong swimmers, it makes it more difficult for them to reach the egg. Sometimes external factors can affect a man’s sperm count or quality. Testicular injury can affect the production of sperm. Sperm count will typically return to normal as long as no permanent or long-term damage is done. Something as common as heat can also affect sperm. A recent study by Fertility and Sterility showed that the heat produced by electronics can affect sperm motility. It even found that it causes damage to the DNA in the sperm. If you put your laptop on your lap, be sure to use a special fan that goes under it. Another common external factor that can affect sperm is medication, drugs, and alcohol. There are lots of different kinds of medications that are known to cause infertility. This is because they affect the production of sperm. Medications used to treat anxiety and depression, supplemental testosterone, anabolic steroids, hair loss treatments like Propecia, erectile dysfunction medicine, chemotherapy, and more can affect sperm. Heavy drinking, smoking cigarettes or marijuana, and other illegal drugs can also impact fertility. What Causes Infertility in Women? Infertility in women gets a little trickier. There are a lot of things that can affect a woman’s ability to get pregnant. The biggest issue for women is not ovulating . If ovulation doesn’t occur, the egg doesn’t release from the ovary. No egg means no baby. One of the most common causes is a condition called Polycystic Ovarian Syndrome. It can also be a result of long-term birth control pills use. Ovulation will usually return to normal after a few months off of the birth control. Polycystic Ovarian Syndrome, or PCOS, falls under the category of problems with ovulation. PCOS is a disease that causes hormone imbalance. The hormone imbalance causes issues with ovulation. PCOS is one of the most common causes of infertility in women. PCOS is more common in obese women because of an associated insulin resistance. Other medical issues that affect ovulation are hypothalamic dysfunction, premature ovarian failure, and excess prolactin production. Most of these issues can be treated with hormones. Another common cause of infertility is Endometriosis. Endometriosis is a condition that causes endometrial tissue to travel and grow outside of the uterus. Endometriosis can also affect the uterine lining. This can prevent a fertilized egg from implanting in the uterus. Endometriosis can cause scarring wherever it occurs. Scarring within the uterus or fallopian tubes can make it difficult for the egg to implant. There is an increase in fertility immediately following surgery. The surgical treatment to remove endometriosis can cause scarring later on. The most common symptoms of endometriosis is very heavy and very painful periods. Uterine and cervical issues are also potential causes of infertility. The most common uterine problems are fibroids and myomas. Fibroids and myomas are benign polyps or tumors that develop. These non-cancerous growths can prevent an egg from implanting. Sometimes, they can grow near the fallopian tube and block the opening. Other uterine and cervical issues can occur at birth or during development. The uterus can be shaped abnormally. There is a cervical malformation called cervical stenosis. Cervical stenosis means that the cervix is narrower than it should be. This can make it difficult for the sperm to reach the uterus. Unexplained Infertility. Generally speaking, infertility is broken up into thirds. One third of infertility cases are due to female infertility. One third is due to male infertility. The remaining third is due to either a combination or unexplained infertility. There isn’t always a clear and direct cause of infertility. There may be a few minor issues that all intersect when trying to conceive. Some factors that can contribute to infertility are age, weight, smoking, alcohol, caffeine, past sexually transmitted infections, and stress. Most of these factors can be minimized by simple lifestyle changes. Are There Tests to Diagnose the Cause of Infertility? There are many diagnostic tests to figure out what is causing your infertility. For women, the first step is determining if infertility is being caused by ovulation issues. This is done with a simple blood test. The blood test measures the level of progesterone in the blood. The body produces more progesterone after ovulating. The doctor may also test for other blood levels, such as prolactin. There are also at-home ovulation prediction kits. These kits test for the increase in luteinizing hormone that is produced before ovulation. Other tests may be done depending on what the blood tests show. If the tests show a problem with ovulation, the doctor may order other hormone tests in addition to ovarian reserve testing. Ovarian reserve testing is done to determine how many eggs there are and the quality of those eggs. Women over 35 are more likely to have these problems. If the tests show that ovulation is normal, other tests can be done to find out what else may be preventing pregnancy. These tests include hysterosalpingography, ultrasound, hysteroscopy and laparoscopy. These will look for abnormalities in the uterus, fallopian tubes, and ovaries. Can You Treat Infertility? There are many things you can do to treat infertility. There are a handful of medicines that can stimulate ovulation for women. There are also other medications that used to treat specific issues like PCOS or high prolactin levels. In short, once you determine the source of the struggle, there are options to treat or fix the problem. If the issue stems from a structural problem, growth, blockage, scar tissue or endometriosis, there are surgical options to improve the issue. If the issue can’t be corrected or improved with any of these therapies there are other methods. These methods are called reproductive assistance. Reproductive assistance is for people who have not been able to improve the cause of their infertility. It is also for couples who have been unable to determine the cause of infertility. The most common reproductive assistance methods are Intrauterine insemination and IVF. Intrauterine insemination is a method that works by placing sperm inside the uterus around ovulation time. IVF is considered the most effective assisted reproductive method. IVF is a little more involved than intrauterine insemination. It requires egg retrieval and daily hormone injections. The eggs are combined with the sperm in a lab. Fertilized eggs are then implanted into uterus. If all else fails, there are always options such as adoption, sperm donation, egg donation, and surrogacy. If you want to become a parent, there is a way to make that happen. It is important to realize that infertility is a fairly common problem. About one in eight couples will struggle with infertility. One of the biggest issues with infertility is the stigma surrounding it. Because infertility is personal in nature, some people try to hide their struggle and put on a brave face. Infertility is not a failure or a flaw. It is simply an obstacle, and it can be overcome with the help of a doctor. Remember to be kind to yourself, keep hoping for the best, and stay optimistic. One way or another, everything will be okay. Thank you for reading! Check back in soon for a new post. Sources: WebMD, Mayo Clinic World Autism Awareness Day Davis Orr “It takes a village to raise a child. It takes a child with autism to raise the consciousness of that village.” – Elaine Hall World Autism Day – Light It Up Blue Happy April, everyone! Spring has finally sprung and I couldn’t be happier about it. A new month means new awareness observances and awareness holidays. April has a lot of important awareness observances. Choosing which causes to discuss can be difficult when so many causes are worthy topics. To be comprehensive and educational, I have chosen to focus on one subject per post. As the years go on, every month will feature different causes than the year before. Over time each cause will get the attention it deserves. Today I want to talk about Autism, in honor of Autism Awareness Month, World Autism Awareness Day & Light It Up Blue. Both holidays take place tomorrow (April 2nd). Before we get started, I want to give you guys a little background on World Autism Awareness Day and Light It Up Blue. The History of World Autism Awareness Day. In 2007, the United Nations voted to make April 2nd a universal day to promote awareness for Autism. In 2008, the first annual World Autism Awareness Day was celebrated. The United Nations dedicates itself to ensuring that the human rights of all people are honored. It is important for the UN to recognize Autism because it can affect learning, development, and communication. If a person with Autism has difficulty with any or all of those functions, it will impact the freedom and equality they receive. Various therapies are used to treat Autism. The outcome is influenced by how soon the treatment is started. Access to Autism therapies can be determined by location and socio-economic status. This creates inequality for people with Autism living in places without access, or those without means. The United Nations dedicates itself to combatting inequality through policy and resources. Their goal is to create a world where someone with Autism has equal rights regardless of their limitations. What does Light It Up Blue mean? World Autism Awareness Day and Light It Up Blue are designed to raise awareness for ASD (autism spectrum disorders). This includes Asperger Syndrome, and Pervasive Developmental Disorder – Not Otherwise Specified (PDD – NOS). Light It Up Blue is an annual campaign held on World Autism Awareness Day. It uses the color blue to spread the message of awareness and acceptance worldwide. Every April 2nd, iconic landmarks around the world are lit up with blue lights to signify support for the Autism community. Light It Up Blue is sponsored by an organization called Autism Speaks. The chairman of General Electric founded Autism Speaks in 2005. He and his wife founded the organization after their grandson was diagnosed with Autism. That connection may have been the inspiration behind the campaign. General Electric’s most iconic product is the light bulb. LIUB uses blue light bulbs to turn structures and buildings blue. Coincidence? I doubt it. ASD. What Does Being On The Spectrum Mean? First, let's talk about what being "on the spectrum" means. Autism, or Autism Spectrum Disorder (ASD), has a wide range of symptoms. Someone with Autism may experience any, all, or a combination of these symptoms to varying degrees. Combinations of symptoms and the severity of those symptoms can vary drastically from patient to patient. Autism is referred to as a spectrum because of the wide range of symptoms. No two patients are exactly the same. Personalized Autism Awareness Ribbon Personalized Autism Awareness Ribbon The Basics of Autism. Autism is a neurobehavioral condition. It can affect development, communication skills, sensory processing, social skills, and more. Each person on the spectrum may exhibit different combinations of symptoms with varying degrees of severity. The severity of the symptoms affects what kind of limitations they experience. Autism typically becomes apparent as children fail to reach developmental milestones. These occur during the first three years of their life. Some children can begin to shows signs as infants, but most symptoms become clear between 18 to 36 months old. Parents commonly describe their child as developing normally until around that time. Then they began to exhibit symptoms. Sometimes, symptoms may not arise until circumstances force them to the surface. This means that symptoms may go unnoticed until later than usual when a particular situation makes them appear. People with Autism tend to have a difficult time processing different kinds of sensory stimulation. This may manifest as sensitivity to light, sound, touch, or smell. It can range from feeling overwhelmed or uncomfortable to complete intolerance. Autistic people may also experience some degree of cognitive impairment. This is in comparison to neuro-typical cognitive function. People with Autism tend to have delays or deficits in certain areas of development but not all. Cognitive impairment usually affects all areas, but people with Autism tend to show issues in only some areas. In contrast to their impairment, they may develop exceptional skills in other areas. This can show up as musical talent, memorization skills, an aptitude for math, and more. Autism can also affect behavior. One behavior associated with Autism is repetitive movement, like rocking or pacing. In some cases, these repetitive movements can be self-injurious. They may develop attachments to certain objects. Narrow interests and obsessions with certain subjects are common. They may also be fearful or resistant to change. Change in routine can be especially difficult. Many parents of ASD children bond over their shared experiences with trying to get their child to try new foods or activities. What Causes Autism? While Autism is on the rise, it is not clear why. It may be from an increase in awareness or it may be that the incidence of the disorder is actually increasing. Autism is not caused by race, ethnicity, socio-economic status, lifestyle, geographic location, sex, or any other classification. Boys are more likely to develop Autism than girls. Some speculate that this is because girls with Autism are not diagnosed even though they may have it. It is believed that there are more girls with Autism than the statistics suggest. Socio-economic status does not cause Autism, but it can affect treatment and prognosis. The earlier someone with Autism begins treatment, the better the long-term outcome. A family’s inability to pay for such treatments may have a lasting effect on an Autistic person. Geographic location can be a factor if the family lives in remote or rural areas. Treatment facilities may be scarce or non-existent in less populated areas. Autism appears to have a genetic component. It tends to run in families, although no specific genes have been identified yet. Researchers believe it may have something to do with irregular segments of genetic code or specific gene mutations. Whatever the genetic association is, it's clear that it can run in families. Another genetic factor is the age of the parents. The older the parents are, the higher the risk for the child. Personalized Puzzle Pieces Awareness Ribbon for Autism Personalized Puzzle Pieces Awareness Ribbon for Autism What Are the Treatment Options Available for ASD? Treatment options vary depending on the symptoms. There is a spectrum of treatment options to match the spectrum of symptoms. Treatments include behavioral and communications therapies, occupational therapy, sensory integration therapy. There are also medications to treat associated symptoms. Keep in mind there is no cure for Autism, and there are no medications developed specifically to treat it. Let’s dig into each of these therapy options a little. There are quite a few behaviors and communication treatments when it comes to ASD. Each treatment uses different techniques to engage with the child and encourage learning. The type of therapy depends on which works best for that child. One of the most common is called Applied Behavioral Analysis (ABA). ABA works to improve good behaviors and reduce bad ones using various techniques. This includes positive reinforcement, motivation, and communication skill development. Another type of behavior and communication therapy is referred to as “Floor-time”. Floor-time is exactly what it sounds like. It involves getting on the floor with your child to interact with them doing the things they like. The intention is to build and encourage emotional skills, which stimulate intellectual growth. There are two types of treatments that involve visual cues. The first is called TEACCH, which stands for Treatment and Education of Autistic and Related Communication-handicapped Children. The second is called PECS, which stands for Picture Exchange Communication System. The difference between the two is that TEACCH uses picture cards to teach, while PECS uses symbols. Occupational therapy teaches children with ASD life skills. Occupational therapy helps them develop, maintain, or restore independence through skill development. These skills allow them to overcome obstacles that keep them from performing daily activities. Sensory Integration Therapy helps children whose symptoms include sensory processing issues. Sensory Integration Therapy works by taking stimuli that a child is sensitive to and slowly exposing them to it in a controlled setting. Over time the child will acclimate to these stimuli so that they can function better. Last, but not least, there are some medications that are used to help treat different kinds of issues that people with Autism can experience. There is a link between Autism and seizure disorders. One of the medications used to treat people with Autism and seizures is seizure medication. Other issues associated with Autism are trouble concentrating, depression and anxiety, and insomnia. These symptoms can be treated using medications. Risperdal has been FDA approved to treat irritability in people with Autism. How Can I Help? The biggest thing you can do to help those with Autism is to be supportive and understanding. Sometimes when kids with Autism get overwhelmed they have what is called a "meltdown". It's important to understand that children having a meltdown are suffering, not misbehaving. It is equally important to recognize that this is not related to a parenting issue. Parents often feel judged when their kids experience a meltdown in public. The root issue is a lack of understanding and awareness, not a shortcoming on the part of the parents or the child. People are quick to say, "if that were my kid…" followed by how they would handle the situation. It is unfair to the people involved and it perpetuates the judgment they experience. Another way you can help is by educating yourself and others about Autism. Become an advocate for people affected by Autism with a universal symbol of support. Awareness ribbons are a simple yet powerful way to raise awareness. Awareness nurtures support, and support leads to more fundraising and more research. The awareness ribbon used to raise awareness for Autism is the puzzle pieces ribbon. You can also help raise money by holding your own fundraiser. Donate the proceeds to the Autism organization of your choice. April 2nd is the perfect day to host a blue-themed bake sale to celebrate Light It Up Blue. If bake sales aren’t your thing, you can host a craft booth with old puzzle pieces. Paint the pieces white, grab some colorful sharpies and charge per puzzle piece. Crafts not really your thing either? No problem. Here's an easy one I came up with; Find a wall, make a blue backdrop for it, grab some blue accessories and boom! You've got yourself a Light It Up Blue themed photo-booth. Charge per photo, and don't forget to share it on social media using the hashtag #LIUB. If you prefer something more traditional, buy some puzzle pieces fabric awareness ribbons in bulk and resell them at a higher cost. Take the profits and donate them to the organization of your choice. That’s all for today! Thanks so much for reading! Be sure to check back soon for my next post. And, HAPPY AUTISM AWARENESS MONTH! Sources: Autism Speaks,, NIMH, WebMD Rare Diseases Are More Common Than You Thought - Celebrate Rare Disease Day! Davis Orr Hey guys! Me again. I know it’s been awhile, but I’m back with a new blog for all our wonderful readers. Today I’m going to talk about a subject that is near and dear to heart because I am a member of this community. So without keeping you guys all biting your nails in suspense, today we’re going to talk about RARE DISEASES in honor of RARE DISEASE DAY! There is a saying in the medical community, and a rule by which most doctors live, and it goes like this: “If you hear hoof beats, think horses not zebras.” This is what is known as Occam’s Razor. Occam’s Razor is a theory that basically states that the simplest answer is usually the correct one. The majority of the time, this is not only a logical rule to live by but also a practical and responsible one. If my box of Girl Scout cookies suddenly disappears, it was probably my husband, not a thief that broke in and stole only a box of Thin Mints. This way of thinking helps doctors make healthcare decisions. Rather than exposing a patient to painful and invasive diagnostic tests that are likely unnecessary, they look at the most probable source of the issue and limit their testing to that, saving the patient both time and money. Makes sense, right? The problem is that every now and then, those hoof beats are actually made by a zebra instead of a horse. For those patients, Occam’s Razor is a hindrance to their diagnosis and treatment. This age-old saying was the source of inspiration for the rare disease awareness ribbon. Rare disease patients have affectionately adopted and appropriated zebra stripes to represent their cause. Rare Diseases Talking about rare diseases is so important for so many reasons. For starters, rare diseases get the least attention… from everyone, including the medical community and drug manufacturers. It’s not that people actively ignore rare diseases, it’s just that most people have either never heard of the conditions, or don’t understand them. Even most doctors do not usually see cases of even the more common rare diseases. A physician may go their entire career having never seen or heard of some of the diseases classified as rare diseases. This is especially problematic when trying to gain visibility in the rare disease community. It can be very difficult to raise awareness and raise money to support a cause that nobody has ever heard of. As you can imagine, it is hard to find support for a disease that has no celebrity spokesperson and a very small market for drug manufacturers. Not to mention that most people have never and will never be personally affected by it. This sadly leaves many patients with rare diseases in a difficult position. Not only is it difficult to discover the correct diagnosis, but even with the diagnosis treatment options can be limited because of the lack of research and development invested into creating drugs to treat the disease. After you have overcome all of those issues, patients can still suffer because of the lack of experience their doctor has in treating that condition. There are so many obstacles like the ones described that rare disease patients face in their personal health journey. So what is a rare disease, and what’s the deal with rare disease day? I’m glad you asked. Let me break it down for you. First off, let’s talk about what rare diseases are. Obviously, they are diseases that are rare. I know you didn’t need me to figure that out. But what are the qualifications for a rare disease? In the United States, a rare disease is considered any disease that affects less than 200,000 people. That sounds like a lot, but when you consider the fact that there are over 325 million people in the U.S., it really isn’t very many at all. There are somewhere around 7,000 rare diseases. With over 7,000 different kinds of rare diseases, it’s no wonder that it’s so hard for people to get their diagnosis. Can you imagine having to memorize 7,000 different rare diseases in med school that you were likely to never encounter? That would be nuts. Nobody would ever get through med school. Doctors get a general overview of everything and then focus their time on the diseases they are most likely to be presented with. This is why it has fallen to the patients themselves to become advocates and raise awareness for rare diseases. But here’s the interesting part: Because there are around 7,000 different kinds of rare diseases, the number of people in the population who have been diagnosed with one is actually pretty high. It is estimated that around 1 in 10 people in the United States has a rare disease. 50% of rare disease patients are children. So, here we are… with this huge population of people who are unrepresented or underrepresented in the mainstream medical community. All these people want is a correct diagnosis, a good doctor, and some medicines to treat the disease. Yet it is a struggle to get all three. This is especially true for children who cannot articulate their symptoms well and cannot advocate for themselves. (Disclaimer: statistics vary by country.) You can find our extensive list of Rare Diseases and Genetic Disorders HERE. Rare Diseases and Genetic Diseases - Zebra VS. Blue Jeans Many rare diseases are also considered genetic diseases. This has created a great deal of confusion when it comes to the appropriate awareness ribbon color. Should you pick the zebra awareness ribbon for rare diseases or the blue jeans awareness ribbon for genetic diseases? This comes up a lot. The truth is that you can use whichever awareness ribbon you prefer, but if you’d like to find the awareness ribbon category your disease falls under CLICK HERE. Around 80% of rare diseases are genetic. Some rare diseases have organizations that have been able to raise enough awareness to be more visible than others. These diseases typically have their own special awareness ribbon outside of the zebra awareness ribbon. They have become the bigger fish in the small pond (assuming 7,000 fish can be considered a small pond. To be honest, I’m not really sure about the average number of fish in different sized ponds, so please forgive me if I’m wrong and focus on the metaphor.) Personalized Cause is currently working on the most extensive list ever of all diseases and the corresponding awareness ribbon colors for that cause. You can find the Rare Disease Master List HERE. I bring this up for a couple reasons. Reason One: Raising awareness for each of these diseases is crucial in being able to treat and potentially cure them. It is also likely that a lot of these diseases could have shared treatments, and understanding one may lead to a breakthrough in another. It’s a “one for all, and all for one” situation. Reason Two: An awareness ribbon is a surprisingly powerful way to do that. You’d be surprised how many communities have been educated by one person with a ribbon who’s willing to become an advocate. On that same note, people tend to really empathize with a cause when they can put a name or face to it. People are generally good. They want to help. But it’s hard to become invested in a cause that you don’t understand when you can’t imagine the people affected by it. Personalized awareness ribbons are a great way to overcome that. CLICK HERE to see our personalized awareness ribbon "Pin-stagram" gallery. Rare Disease Day Another way the rare disease community raises awareness is with Rare Disease Day. Rare Disease Day is held annually on February 28. Everyone under the rare disease umbrella comes together to raise awareness, share their stories and wisdom, tips and tricks, and raise money for research and development to advance treatment options for patients. Fun fact about Rare Disease Day: As I mentioned earlier, Rare Disease Day is held every year on February 28th. February 28th was chosen for a very specific reason. February 28th is the last day of February… most of the time. The first ever Rare Disease Day was held in 2008 on February 29th, also known as leap day. They held Rare Disease Day on a day that only comes around every 4 years, in other words a rare day. Since then, Rare Disease Day has been celebrated on the last day of February, which is usually the 28th. The next Rare Disease Day to take place on February 29th will be in 2020. Mark your calendars! Rare Disease Day was created by EURODIS and began in Europe. The United States joined EURODIS in celebrating Rare Disease Day the following year. It has since become a worldwide event with over 90 countries participating. Every year Rare Disease Day events and media reach hundreds of thousands of people, which is a major win in the battle to raise awareness. Participating in Rare Disease Day There are lots of things you can do to participate in Rare Disease Day. Patients and individuals can sign up to host an event to raise awareness or a fundraiser. Remember the ice bucket challenge? Well, Rare Disease Day has a similar viral campaign. People participating in Rare Disease Day paint their faces and post photos of themselves on their social media accounts, using the hashtags #RareDiseaseDay and #ShowYourRare. This face paint social media campaign is a way to show support, raise awareness, and share your story. You can also upload your photo directly to their website, which is a really cool way to share your health journey with others who may find similarities and hope in your experience. Click here to visit Raise Awareness for Rare Diseases - Be an Advocate! Sharing your story can have a huge impact on the people who identify with your story. When I was young, somebody told me that I should be open about my health and my journey because you never know how much someone may need to hear what you have to say. It always stuck with me. As I got older, I realized how true it was. There have been a handful of moments in my life when somebody said something that resonated so deeply within me that it actually changed my perspective and my life. They weren’t even anything particularly insightful. They just happened to be what I needed to hear at that moment to feel validated and inspired. Becoming an advocate is making the decision to put yourself out there in hopes that you may help others. Being an advocate can be on a personal level, by educating those around you, or on a public level, by sharing your story with the world. There is no wrong way to advocate for yourself and others. I encourage everyone on a personal health journey to share your story. The benefits are far-reaching, for you and for people you may not even know. Nothing will make you feel more supported, reassured, and understood than talking to a community of people who have dealt with something similar. And, like I said, you never know how your words may impact someone else. On that note, I’m going to wrap up today’s blog. I’d like to leave you with a quote that I stumbled across on the Global Genes website, which is an organization for genetic diseases, many of which are rare diseases. “When “I” is replaced by “we” even illness becomes wellness.” -Sushan R. Sharma Stay Out of the Sun Day Davis Orr Today is Stay Out of the Sun Day! Hey guys! Thanks for stopping by for this week’s awareness blog entry! Today is a particularly relevant topic, especially considering the holiday tomorrow. I hope you’ve all enjoyed your week. I’m sure you’re all dying to get through the day so you can enjoy your mid week day off to celebrate the Fourth of July. I cannot wait! I think this year is gonna be the best Fourth of July yet, since I’ve got lots of secret things planned for a certain someone special’s 30th birthday. Can’t divulge more cause it’ll ruin the surprise, but I’ll fill you all in next week. Anyway, today’s post has a lot to do with tomorrow. Today is Stay Out of the Sun Day! Stay Out of the Sun Day is celebrated every year on July third, as a reminder to protect your self from the harmful effects of the sun. People tend to spend all day on the Fourth of July having fun outside barbequing, playing games, working on a base coat, and enjoying a few ice cold drinks. So, the day before the Fourth, remember to include sun protection in your plans for holiday celebrations. So, the sun… It’s a great thing. Without the sun we wouldn’t even be here, so before I start bashing the sun for all it’s harmful effects, I just want to point out that I am generally in favor of its’ existence. I also realize that there are benefits to sun exposure, such as vitamin D and it certainly does do wonders for your mood if you suffer from SAD (seasonal affective disorder). There are some undeniable draw backs to basking in the sun, too, though, and today were going to discuss that so that we know exactly what we need to protect ourselves from. Hint: it’s mainly skin related. But skin is important! It’s your body’s largest organ, and it keeps all your tissues and organs protected, so we really should do the best we can to protect it. In many parts of the world, like the United States, we perceive a bronze glow as a signifier of health and youth. In reality, creating that tan and maintaining that tone is the opposite of healthy. Unprotected exposure to the sun, or even the use of tanning beds, is one of the worst things you can do for your skin. Sun exposure causes skin cancer and premature again. In fact, most of what people consider to be the natural effects of aging on the skin are actually a result of sun exposure. This is because people are generally exposed to the sun consistently throughout their lives. The more time you’ve been exposed, the more you will develop those signs of age. They should really be considered signs of sun exposure rather than signs of aging, actually. Now, I’m in no way saying everyone should avoid the sun because it’ll make you look old. First off, you’ll eventually look old no matter what. Don’t think that you can ever completely avoid aging. Second, getting older is a wonderful thing and it shouldn’t be treated as some kind of dirty word or something to be afraid of. Enjoy your life! Just be smart about your sun exposure. The sun emits ultraviolet rays, also referred to as UV rays. Ultraviolet rays slowly destroy elastin, which are little fibers found in the skin that are responsible for elasticity. As the elastin is damaged through exposure to UV rays, the fibers begin to break down and eventually, the skin will develop wrinkles and sag, while also causing the skin to become thinner. When the skin thins, it is easier for it to bruise and tear, and it also makes it more difficult for the skin to repair itself and heal from these bruises and tears. The damage done to your skin from sun exposure usually does not become apparent until many many, years later, so people sometimes don’t realize how harmful their sun exposure habits are until significant damage has already been done. The most dangerous consequence of sun exposure is skin cancer. People tend to have a less concerned attitude towards skin cancer for some reason. It may be because they believe that they will see it before it develops into something life threatening, or because people think that if they do develop skin cancer you just have the dermatologist remove it and you’re cured. Neither of those things is exactly true. For starters, no person can be one hundred percent certain of everything going on with their skin. Usually, people only notice something after something has obviously changed, and there are plenty of places that we can’t see. As far as removal goes, yes you can have skin cancer removed, but it can spread and become much more serious before you realize it’s there. Not to mention that skin cancer removal leaves a sometimes nasty scar, and considering that skin cancer often occurs in the places that are exposed to the sun the most (for example the side of your face that the sun hits when you’re driving), that’s something that you might want to avoid. Skin cancer is one of the most common cancers in America, but it’s also one of the easiest cancers to prevent with appropriate sun protection. Skin cancer occurs when abnormal skin cells begin growing at an out of control rate. These abnormal cells reproduce until they become a tumor. A tumor can either be cancerous, or non cancerous. Noncancerous tumors are called benign tumors, and cancerous tumors are called malignant tumors. There are three kinds of skin cancer, basal cell carcinoma, squamous cell carcinoma, and melanoma. There is a list of criteria for helping people evaluate any changes on their skin to determine whether or not something may be melanoma. The trick to remembering the criteria is as simple as the first handful of letters of the alphabet. It’s called the ABCDE rule. The A in the ABCDE rule stands for asymmetry. This means that the growth is not symmetrical on both sides. If one half does not match the other, then it is asymmetrical. The B stands for borders. If the growth has irregular borders, meaning that the edges seem undefined, blurry, or not a smooth line, then you should get it looked at. The C stands for color. The color of melanoma may resemble something like the color of a mole, but it may also be many other colors, especially when the shades of color are uneven. If the growth is brown, black, tan, red, white or blue with some parts light or darker than the rest, you should get it checked out. The D stands for diameter. Anything larger than the size of a pencil eraser needs to be evaluated by a doctor, ASAP. Any mole that has suddenly changed shape or grown in circumference should be brought to your doctor’s attention. Lastly, the E stands for evolving. Any mole or growth that is changing needs to be looked at by a doctor. Those changes can be related to the color, size or shape of the mole or growth. Skin cancer is generally diagnosed through a biopsy, which is when the doctor removes part of the growth and sends it to a lab to be analyzed for presence of cancer. If the biopsy comes back positive for cancer, aka malignant, then the doctor will develop a strategy for treating it. Skin cancer treatment is determined by a few factors, and treatment is personalized to meet the specific needs of that particular skin cancer. Depending on the type of skin cancer, there may be some fairly non-invasive treatment options. Aggressive skin cancers will require aggressive treatment. Remember, it’s never too late to start protecting yourself from sun exposure. You may think that the damage is done, and that there’s no point in sunscreen or hats now, but you’re wrong. Even though skin can never completely recover from skin damage, continuous and vigilant sun protection measures can allow the skin to improve over time. There are all kinds of sunscreens now for whatever your particular needs may be. For example, I am acne prone with oily skin, despite being nearly 30, and regular sunscreen clogs my pores and makes me break out. That used to discourage me from wearing any sunscreen at all. Considering how fair I am, that was extra stupid. I recently found a sunscreen spray that I can spray over makeup, and it has totally changed the game for me. So, whatever your particular needs, don’t let anything stop you from continuing the search for one that works for you. You’ll thank yourself later! That’s all, folks! Catch you next week! If you’re a first time reader, let me welcome you to the Personalized Cause awareness blog! Personalized Cause is an awareness accessory brand located in California that specializes in custom awareness ribbons. Custom awareness ribbons allow customers the ability to engrave any text they choose onto the awareness ribbon they want. We are the only company in the United States to offer this kind of product to our customers without a minimum order quantity. That means you can order as few as just one custom awareness ribbon, if that’s all you want. Custom awareness ribbons are a beautiful and powerful way to support someone going through a health crisis, or someone on an ongoing health journey. Sometimes, it can be difficult to figure out exactly what to say to someone who is struggling. Our custom awareness ribbons are a silent show of love and support for those times. They are also a wonderful way to advocate for yourself or a loved one, or raise awareness for your cause. And if custom awareness ribbons aren’t really your thing, no worries! We also carry classic awareness ribbons, fabric ribbons, and silicone wristbands. Whatever your awareness accessory needs are, we’ve got you covered. I hope you’ll join us next week for another edition of the Personalized Cause awareness blog! Orange awareness ribbons are used to raise awareness for non-melanoma skin cancer. Black awareness ribbons are used to raise awareness for melanoma. To order a custom orange awareness ribbon for non-melanoma skin cancer, visit: To order a custom black awareness ribbon for melanoma, visit: #stayoutofthesun #skincare #skincancer #immunesystem #uvprotection #sunscreen #shades #uvawareness #nosun #nosundaysunday #melanoma #ultravioletrays #awareness #awarenessblog #awarenessribbons #cancerribbons
Split horizon DNS with DJB's tinyDNS djbdns dns What is ‘split horizon’ DNS? Split horizon DNS basically means that one group of hosts receive different DNS addresses to another group. Some of the uses of a split horizon DNS setup include: My motivation for setting this up is keep a number of hosts purely internal such as database servers and yet be able to manage them centrally using DNS to enable moving things around a little easier. An example network Imaging the following hypothetical setup: 3 physical servers, a.example.com, b.example.com and c.example.com a.example.com - private IP address - publicIP address - nameserver for example.com and example.net - a web server b.example.com - private IP address - publicIP address - nameserver for example.com and example.net - a mail server c.example.com - private IP address - publicIP address - internal database server for example.com These are the basic steps to produce this setup: tinyDNS’s method of separating internal and external DNS entries The tinyDNS data file has all the usual record types that can be entered and for each record type there are the usual attributes such as the IP address, record type and time-to-live. So a typical A record entry would look like this: Which would create an A record showing as the address of a.example.com with a TTL of 1 hour. (see the complete data file format). But there is one attribute (in version 1.04 and above) that can be used to create internal and external address (or any number of groups). The last attribute for any record entry in the data file specifies which group this record should belong to. The groups are also define along with the source IP addresses prefix that these entries should be given to as an answer. An example: This says that all queries that come from IP addresses that begin with 192.168 (so our example networks internal address space) with be supplied with records that are marked with ‘in’ and other request will be supplied with entries marked with ‘ex’. So we can have the following: This would provide a different address for internally originating requests as apposed to external ones. See here for more details. Why so many services? Now some astute readers may be wondering why we need the loopback listening tinyDNS instances and not just get the dnscache instances to talk to the public facing tinyDNS instances directly. The reason is that the location entries in the tinyDNS data file (those beginning with ‘%’ above) only allow an IP prefix, not a range or a list of hosts. So for a situation where you have a number of hosts where the private addresses that are supplied are part of a large network block which other hosts belong, the IP prefix is not useful. This is the case with Linode where I have a number of VPSs which have non-consecutive private IPs which are in the same network block as other customers. I don’t want other people to be able to resolve my internal IP addresses. The only way I could think to get around this is to set the source location of internal addresses to localhost and then create another instance of tinyDNS listen for those. Then the dnscache instances listen on the internal private addresses but use the ‘localhost’ tinyDNS services for some requests.
Persuasive Essay About Cyber Bullying Cyberbullying laws essay. Setting Up Laws for Cyberbullying Essay - Words \| Bartleby What is Cyber Bullying Cyber bullying is a situation when a person is being threatened, humiliated, embarrassed, tormented and hurt by another person using text messaging, e-mails, or any other type of digital cyberbullying laws essay. This allows the unequal ownership of a business where some shareholders own a larger… Essay on Setting Up a McDonald's In Chad Words 10 Pages constantly in need of food aid to meet the hunger needs of their people. The U. Conclusion The Internet and technologies make our lives easier, that is for sure. Cyber bullying is a problem, quite a big one. For some teens it can make them depressed and hate themselves. • Another incident happened in Massachusetts. • Another one million reported being bullied on the internet. • The world that once could not imagine the possibility to talk to a person in a different country sitting at home, now can see a person and communicate with them as if they are talking face-to-face. Things need to change. Finally, do not let a bully get into your mind cyberbullying laws essay influence your self-esteem. Cyberbullying Essay Megan Meier, a year-old girl killed herself after being the victim of cruel cyber bullying. Our society can help those who suffer from bullying and educate them how to protect themselves. The faceless Internet made it possible for anybody to become a bully. The worst thing is that many do not even realize that they are being bullied. case study ledc volcano cyberbullying laws essay A felon is someone who has committed a serious crime. Diamantes, The world is now able to bully someone in the comfort of his or her own home, at any given point, with the use of technology The society made the first step to protect people from bullying and together we can remedy the situation. Cyberbullying can affect all ages. Setting Up Laws for Cyberbullying Essay - Words \| Bartleby However, what should others do who do not know about all the dangers cyberbullying laws how to write an introduction for an interview essay the Internet? This is how they feel stronger. One can reason that victims of cyberbullying should grow tougher skin and stand up to their attackers or stop visiting social networking sites all together as a response to bullying. Stated in the National Center for Educational Statistics, over seven million students reported bullying while at school. Essay About Cyber Bullying The world that once could not imagine the possibility to talk to a person in a different country sitting at home, now can see a person and communicate with them as if they are talking face-to-face. Schools have hotlines that students can call anonymously if they want to report bullying. Arabs make up one-third of the population, and they live in tribes which are known as the Kishimbet Rosensweig, S schools creating the emergence of many organizations conclusion for essay to kill a mockingbird programs at state and local levels that are working towards decreasing bullying. We, as citizens of the United States of America, have the right to freedom of speech. That is why we should educate people how not to become the victims of tormentors. Hate crimes come in many forms such as images that depict hate, hate speech and the threat of physical harm. Persuasive Essay About Cyber Bullying One day, her picture was revealed to everyone. Violence ] Strong Essays Anti Bullying And Cyberbullying laws essay Effect On Children Essay - Nationally, more than twenty-five percent of children ages twelve through eighteen years old report having been bullied during the last school year and nearly twenty percent of those students report being bullied two times a month or more Sansone, Schools need to take Title IX more seriously and use it to help the families that are facing issues with cyber bullying. For this reason, the group of bullies was not prosecuted. Yet, the term includes the use of cell phones to communicate a threat, send an abusive text, send inappropriate pictures or make harassing phone calls to someone in order to scare or upset them. Cyberbullying Should be Illegal Essay -- Bullying, Law, Teenegars From the early age of life, children believe that violence is a norm. Title IX can do many things to help prevent students from being bullied or sexual harassed by other students. A future employer looks at who they think would be essay against boxing best fit in the position they are trying to fill. Hindering the Adolescent Generation - In recent years, media has crept its way into every aspect of adolescent lives. That is our aim to deal with the monster created online that is impunity. Moreover, in Idaho a student can be suspended if being responsible for harassing and tormenting students using electronic devices computers, phones etc. What is Cyber Bullying Essay For others it can cause them to turn to drugs or alcohol. The theme of the funds allocation is also to eradicate the overspills of globalization that are inhibiting the private investors to invest in the national economy. Teachers try to explain the importance of telling parents and counselor about any digital abuse and asking for help if needed. This paper is an analysis of the research that indicates that anti-bullying campaigns offer a positive means of addressing bullying in the schools To make things even worse, teenagers do not often talk to their parents about the problems. Most people think that cyberbullying is something that can vanish, but it stays forever. How to write an introduction for an interview essay being bullied at school, you can just ignore the bully and go home, when being bullied digitally you feel like you cyberbullying laws essay nowhere to hide. Title IX is to help prevent gender discrimination, sexual harassment, and sexual violence Murphy 2. Job application letter esl lesson ma thesis translation pdf sample cover letter to hr department. According to School Leadership and Counselors Working Together to Address Bullying by Austin, bullying surges in primary school, has cyberbullying laws essay peak during middle school, and tends to dwindle away during high school Yet the common features of all kinds of cyber bullying are as following: Their is no real debate about the effects of bullying on both the bully and the victim. It includes sending threats, making sexual remarks, using offensive language or labels, or posting humiliating photos or videos, as well as spreading rumors or lies about the victim cyberbullying 1. Many states have already started controlling and regulating cyber bullying as well as the traditional one. Setting Up A Newsletter For Your Site NCES,June. When a person feels that they are being targeted by a cyber bully, they need to take actions immediately. While the Internet has long become a dangerous place term paper on microsoft excel all the viruses and programming faults, today it has become a dangerous place for people. The healthcare admin personal statement with cyber bullying is getting only worse, as the incidents malayalam essay on my mother depression and suicide are only increasing. Cyberbullying Should Not Be Made Punishable By Law How to write quotations in an essay a student bullies someone during school break like spring break, summer break, etc. Children, teenagers and adults become the victims of digital bullying. Have more campaigns about positive things and not so many negative things. essay on ode on a grecian urn cyberbullying laws essay Even some of the strongest people are bullied and it kills them—in and out. In other words, a young person, usually a teen, is being bullied humiliated, harassed, threatened, ridiculed etc. On the other hand, cyber bullies can often be the victims of bullying themselves. Social networking has lots of good points. But that actually makes your job a little harder, because you will then need to think about definitions — what exactly is cyber bullying? retail management case study big bazaar cyberbullying laws essay After the research, I realize that the problem cannot be stopped, as we cannot deal with anonymity on the Internet. All members of the Kishimet live near each other and they all follow the same routes… Setting Up Sucide Prevention Programs Words 6 Pages general effectiveness of screening programs. Some countries have become accepting to it, but others are not having any of it and Uganda, a country in East Africa, is one of them. Conclusion The Internet and technologies make our lives easier, that is for sure. You could also think about preventing cyber bullying in the first place, and what cyberbullying laws essay social media sites would need to take in order for that to happen. Although bullying has happened for a while, it is now getting major attention from our culture. In Arkansas inthe law was imposed that allowed school officials to take actions and deal with cyber bullies, no matter whether the bullying took place on the school property or not. If schools and courts advertised Title IX more often than the number of suicides—due to cyber bullying—would drop dramatically. Need Writing Help? That is why schools imposed anti-bullying rules. How would you like it if you were being told daily that you meant nothing to world, and that it would be better off with out you. This term refers to people choosing to judge or harass a person over the internet.
How to Write an Essay Plan: An Example - Elite Editing How to make a essay plan. Why your teen needs to make Essay Plans — High School Study Advice \| The Study Gurus This must be done first. If a topic is less creative writing in secondary schools, write about it last and write fewer words on it. Essay planning is significant because the plan contains information on how an essay is built and specific information of the contents of each piece. Each time you plan an essay you ask your subconscious to answer questions and dig up material you can't recall. Download an essay plan template This video suggests a way of planning your essay. This gives you an overview of your points so you can decide which should be included and what is the most logical sequence for them. Useful links for writing essays Write the introduction and conclusion after the body. Successfully structuring an essay means attending to a reader's logic. What structure is most appropriate for the topic? References Include all your references in your plan and gather the details for these. Jot down titles, authors, page numbers etc. The essay plan is drawn up to rebuild the stream of thoughts into coherent, logically combined sentences. Before you embark on research, give yourself realistic how to cite internet sources in thesis for the amount of material you how to cite internet sources in thesis by sketching out a plan for length. Summary Analyse the essay question before you begin making notes Be selective in your reading Record only information that is directly relevant to your essay question Use essay plans to create a clear and logical sequence for your material before you begin to write Share this page: If you leave it out, your readers will experience your essay as unfinished—or, worse, as pointless or insular. Introductions and conclusions have fixed places, but other parts don't. Brainstorm all your ideas, then arrange them in three or four groups. Thesis iris recognition This is how you put forward a strong argument. But be forewarned: This allows you to consider your essay and edit it with a fresh eye. It also reduces the risk of omitting some really important section or argument that is central to the issues raised by the essay. Topic 1: This initial plan will be provisional and might consist of: To answer the question you must examine your evidence, thus demonstrating the truth of your claim. However, the initial planning stage is not the time for a lot how to make a essay plan intensive or detailed reading. Make a few notes about how each main point might be developed. Plan your essay Planning your essay helps you in three important ways: Analysing the question Before you can begin to select material for your essay, you need personal statement graduate application make sure that you understand the exact requirements of the question. They anticipate the major argumentative moves you expect your essay to make. Immediately after receiving the topic of the essay, ideas and images do your homework dvd start appearing in your head. If you prefer to write first, try summarising the central idea of your pros and cons of case study approach in a few sentences. Your first draft will help you work out: Try the Essay Planning and Structure How to cite internet sources in thesis to find out more. Essay planning What can you infer from the title about the structure of the essay? Keep in mind, the plan is made for you. Essay planning Essay research paper about poverty introduction Before you even begin writing the first sentence of your essay, you need to plan your essay. An essay plan gives you a quick way of trying out different structures. What you already know about the topic — from lectures, seminars, general knowledge. Except in the strongest of questions, there are always arguments, points, evidence and examples that you can't remember exactly. How to make a essay plan will start you off on answering the "what" question. It's helpful to think of the introduction to statistical problem solving in geography essay sections as answering a series of questions your reader might ask when encountering your thesis. Introduction, body and conclusion. Essay structure is guided by its content and argument so every essay will pose unique structural challenges. Essay planning: Essay Writing Arrange your main points in a logical order and number short essay on srinivasa ramanujan in telugu is there one that would seem to go first or one that would seem to go last? Nowadays, the necessity of being physically fit is on the top of the pyramid of human requirements. It leads into planning your essay structure. Starting cuts down on anxiety, beats procrastination, and gives you time to develop your ideas. Short essay on srinivasa ramanujan in telugu it does, the essay will lack balance and may read as mere summary pros and cons of case study approach description. Essay Planning: Initial responses or answers to the question — what you think your conclusion might possibly be. Put your groups of ideas in a sequence to make a persuasive argument. Here you're anticipating your answer to the "why" question that you'll eventually flesh out in your conclusion. Readers should have questions. Writing an essay plan is necessary for candy store business plan template clear and crisp structure of work. It will help you organize thoughts, select the necessary material, and discard unnecessary. Address the question, show why it's interesting and how you will answer it. You need to work out what to include, and what can be left out. P2 - Main Body: Things you don't know about the pros and cons of case study approach, but need to find out in order to answer the question. The easiest way to do this is to map the essay's ideas via a written narrative. Paraphrasing the assignment question can help ensure that you are answering it. Homework speakers question addresses the larger implications of your thesis. Such essays generally have how to make a essay plan descriptive thesis rather than an argumentative one. Indeed, it makes very good sense to plan all the questions you have to do, before you pick up your pen to write the first one. Carefully think about what you want to say on the topic. Main points make up high school graduation speech controversy body of an essay. Possible thesis statements. What you don't know about the topic, but need to find out to answer the question Possible responses or answers research paper about poverty introduction the question — any ideas about your cover letter in company training. Construct an Essay Plan Step 3: Thus your essay's structure is necessarily unique to the main claim you're making. Poverty essay christmas carol Your map should naturally take you through some preliminary answers to the basic questions of what, how, and why. Then write it down on the piece of paper creative writing in secondary schools a column of thoughts. If all four topics are of equal importance, write roughly the same amount of words on each. It enables you to work out a logical structure and an end point for your argument before you start writing. Outline what you are going to include in each section: All essays should include the following structure Essay paragraphs A paragraph is a related group of sentences that develops one main idea. Check the title, idea or plan with your tutor. How does the thesis stand up to the challenge of a counterargument? Planning in an exam is vital too to enable you to produce a first-class essay. This gives you a clear direction for working out how you are going to break it down into points supported by evidence. how to make a essay plan Quick Links Try to see your essay plan as something that evolves as you engage further with your topic. Are there any two that are closely linked? People are addicted to a healthy way of life. Each paragraph in the body of the essay should contain: Brainstorm for Ideas What you know about the topic — from lectures, reading etc. This helps you start formulating your argument and direction for answering the question. Is the question open-ended or closed? This "what" or "demonstration" section comes early in the essay, homework speakers directly after the introduction. Start with the journal article submission cover letter sample and work paragraph by paragraph. One main point in each paragraph. Having a clearer understanding of the most effective ways to structure your writing can help you to plan and organise the content of your essays and make sure you get how to make a essay plan ideas across. formal essay literature definition how to make a essay plan Your writing By rehearsing your arguments in detail you will avoid the problem of short essay on srinivasa ramanujan in telugu to do the two most difficult things in writing at the same time: Not everything will fit so be prepared to discard some points you can mention them briefly in your introduction. Main body: Build your argument. These can become topic sentences the first homework speakers of each paragraph which establishes its central idea when, in your second plan, you develop these points further. Call it "complication" since you're responding to a reader's complicating questions. Summarise your arguments and evidence, and show how they answer the original question. Writing Your Essay \| UNSW Current Students It dictates the information readers need to know and the order in which they need to receive it. Begin each of the following sentences like this: Structure The plan gives your essay a clear structure for examiners to follow as they navigate their way through ideas and arguments that are unfamiliar to them. List the evidence your essay will put forward to prove do your homework dvd answer — This can be seen through an examination of the sections of society which supported the how to make a essay plan. An example of a non-linear essay plan using key words and phrases Find your preferred style Experiment with different styles of planning essays and use the method that you find homework speakers short essay on srinivasa ramanujan in telugu. The kinds of things to note briefly are: Essay maps are flexible; they evolve with your ideas. Begin with what you are ready to write - a plan, a few sentences or bullet points. Indicate, in other words, what a reader might learn by exploring the claim with you. Use 'signpost' words in your writing. Read along while watching the video tutorial. Planning an essay : Skills Hub: University of Sussex
La Diada de Sant Jordi La Diada de Sant Jordi or Saint George's Day is celebrated in Barcelona on the 23rd of April. Sometimes it is also called "el dia de la rosa" (The Day of the Rose) or "el dia del llibre" (The Day of the Book). Sant Jordi - Palau de la Generalitat, Barcelona Saint Jordi (Saint George) It is Barcelona's Valentine's Day. Saint George is the patron saint of Catalonia. As to the legend, Saint George killed a dragon which was about to eat the princess south of Barcelona. Out of dragon's blood a rose bush grow. Saint George gave roses of that bush to the princess. Traditional Rose Festival honouring romantic love and chivalry has been organized in Barcelona since the Middle Ages. In 1932 people united the festival with local International Book Day. They thought it was suitable to do it and mark the anniversary of death of two giants of world literature Miguel de Cervantes and William Shakespeare. They both died on the 23rd of April, 1616. New tradition was created. Men give beautiful roses to their ladies and they give them books in return. Catalan people say "a rose for love and a book forever". Nowadays it is common that women beside roses get books too. On average four million roses and 500,000 books are sold in whole Catalonia. La Diada de Sant Jordi Stalls with books La Rambla, famous street in central Barcelona, is full of stalls with books. In Catalan the name of the street means an intermittent water flow. The word is derived from Arab "ramla" which means a sandy riverbed. Numerous stalls with books are put in other parts of Catalonia too. Many writers stand beside the stalls ready to sign their books. There is also a tradition of 24-hour reading of Don Quixote by Miguel de Cerventes. La Diada de Sant Jordi Special rose arrangements Roses are presented in a special way. Together with roses people put a spike of wheat and small red and yellow Catalonian flag called "senyera". There are also ribbons with printed words like "Sant Jordi" ("Saint George"), "Diada de la Rosa" ("Day of the Rose") and "t'estimo" ("I love you"). In the Sarrià-Sant Gervasi city district of Barcelona flower dealers organize presentation of 45 different roses. These roses symoblize different sort of love like for example impossible or material. The Sardana is a dance of Catalonia. There are two main Sardanes - the traditional sardana curta (short sardana) and the more modern sardana llarga (long sardana). The modern one is more popular today. The Sardana has been popular since the 16th century. Music for the sardana is played by a band called "la cobla". Why the Sardana is mentioned here? Well, on La Diada de Sant Jordi it is danced at the Plaça Sant Jaume. Plaça del Pi Plaça del Pi (Square of the Pine) There is more music. When walking through Barcelona on the 23rd of April you can among others hear beautiful choral singing in the Gothic Quarter or great jazz performances at Plaça del Pi. Palau de la Generalitat Palau de la Generalitat La Diada de Sant Jordi is the only day when the Palau de la Generalitat, Barcelona's main government building, is open to visitors. A huge display of roses honouring Saint George can be seen there. There is also a lovely tradition of creating a human chain by people who were named after Saint George. They are trying to enter the Guinness Book of Records. This beautiful festival of roses and books became sort of Catalonian export to the world. UNESCO (United Nations Educational, Scientific and Cultural Organization ) decided that the 23rd of April is World Book and Copyright Day.
Kimchi – traditional Korean dish Depending on the region of origin, ingredients and season there are more than 100 varieties of kimchi. Kimchi is usually consumed as a side dish or “banchan.” The most popular variety of kimchi is called the “baechu” or Chinese cabbage. Kimchi is very good for your health. It contains high level of dietary fibre. It is a low calorie dish. It is rich in vitamins (especially vitamin C, A, B1, B2), calcium and iron. It contains several lactic acid bacteria.
Amyloidosis is a condition that occurs when amyloid protein is deposited in various organs in the body. It is a progressive disease that often leads to chronic kidney failure and is mostly seen in dogs, but rare in cats. Amyloidosis can be classified as systemic or localized, which is more common. Almost any tissue or organ in the body can be affected but kidneys, liver, spleen, and adrenal gland are at the highest risk. There are two major forms of systemic amyloidosis. The most common form in domestic animals is reactive (secondary) amyloidosis due to chronic inflammatory disease. In reactive amyloidosis, the deposited amyloid protein is AA type is derived from serum (blood) amyloid A synthesized in the liver. The other form of systemic amyloidosis is light-chain (AL) amyloidosis, which is the most common type in human beings but very rare in domestic animals. One of the common underlying causes of human AL amyloidosis is multiple myeloma, which accounts for 12% to 15% of the cases. Some types of amyloidosis are hereditary in dogs, others occur as a result of diseases such as heartworm infection, various cancers, or inflammatory or immune-related conditions. The inflammation in case of familial canine dermatomyositis may predispose to the development of amyloidosis. The disease can become fatal if amyloid is deposted into the tissue of critical organs, such as kidneys, liver, or heart. Renal Amyloidosis Renal amyloidosis is one of the most common hereditary disorders in cats and dogs which include renal dysplasia, polycystic kidneys, basement membrane disorders, and tubular dysfunction (Fanconi syndrome). Signs of renal amyloidosis in dogs usually include: vomiting, loss of appetite, lethargy, increased thirst and urination, weight loss, and dehydration. Some dogs may have intermittent fever and joint swelling. Laboratory findings are compatible with kidney failure. Both puppies and adult dogs may be affected. Chinese shar pei Renal amyloidosis is inherited in Chinese Shar Pei dogs Recent studies showed that renal amyloidosis (RA) is inherited in Chinese Shar Pei dogs and that they develop RA at a younger age than other dog breeds, and that the acquisition of this trait is compatible with autosomal recessive inheritance. Familial renal amyloidosis also occurs in the Abyssinian cat, young Siamese and Oriental Shorthaired cats. Diagnosiss & Treatment Because of its wide distribution and stealthy onset, amyloidosis is difficult to diagnose. However, your veterinarian may suspect amyloidosis if your dog has a chronic infection or inflammation and develops kidney or liver failure. Renal biopsies are needed to differentiate renal amyloidosis from immune complex-mediated glomerulonephritis(ICGN). There is no proven specific treatment for amyloidosis. Treatment of the underlying disease may result in regression of amyloid and associated signs. The prognosis is usually poor. Some dogs can be managed up to 1 year. Some Abyssinian cats may have no signs of the disease. 1. Thorough Investigation of a Canine Autoinflammatory Disease (AID) Confirms One Main Risk Locus and Suggests a Modifier Locus for Amyloidosis 2. A Concise Review of Amyloidosis in Animals Home Contact RSS Learning Center
Changes In Foreign Currency Exchange And Forex During the course of history activities such as foreign currency exchange rates have contributed directly to the economy of a country or region specific, since this activity appears to be as regular as an activity that provides significant financial returns which contribute to the above. Changes in foreign currency can be defined as the economic value of a currency in a country other than home, which can be expressed as units of national currency of that country. This activity has been developing since the twentieth century where the importance that each country gave its currency resulted in the creation of institutions specializing in foreign exchange, also called moneychangers. Currency exchange offices are entities created for the purpose of facilitating the entry and exchange of foreign currency to home currency, these homes are exposed to determine the value of foreign currency by two exchange rate systems, they are. Fixed exchange rate: this is the value that is given to foreign exchange currency specifically given national central bank of each country. flexible exchange rate or floating: the exchange rate determines the value of foreign currency through the interplay of supply and demand. It is important to note that the value of a foreign currency not only bases its value in the determination of each country, but this value also affects the country's economic activity abroad and the same production capacity. Changes in foreign currency have certain qualities very beneficial to the public, some of these qualities as: Change spot: this attribute allows the foreign currency exchange is made immediately, making cash by providing immediate liquidity. Changing the future: this is an activity especially banking, which is based on offering customers the ability to save foreign currency capital we have, in order that this can be changed in the future when the currency gain more economic value. It is worth mentioning that this activity can be risky because currency can raise or lower the price over time. It is essential to note that the activities of foreign exchange, are subject to various regulatory laws determined by each government. These laws specialize in determining the amounts of foreign money coming into circulation in a country for every person, thanks to the existence of an exchange rate maximum per person, which helps prevent the appearance of certain professional activities like money laundering . Currently there are market currencies like the dollar and the euro that can be changed anywhere in the world, they are the currencies that are economically more balanced, but any currency can be exchanged for local currency, provided they are previously valued in dollars or euros.
Why is a subluxation a big deal? 10.10.2018 - Author: Upper Cervical Chiropractic of Spartanburg Subluxation robs the body of it's ability to focus, organize, think, and heal. When subluxated because of a physical trauma (slip or fall), emotional stress (you probably have one or two of those examples), or chemical toxin (ever experience the stress of a strong cleaner, candle, or perfume), the environment of the body changes. Whether it's the communication of the brain in to the body or the body back to the brain, the messages can become distorted. Research conducted by Dr. Suh found that the weight of a dime on a spinal nerve decreases the function of the nerve by up to 60%. How can anything work at it's best with only 40% function? What if that's around our brain stem? What about the regulation of our bodies homeostasis: hormones, temperature, respiration, heart beat? We can't heal in the same environment that we get sick in. Getting adjusted changes the environment. It removes the interference to the nervous system, which then communicates more efficiently, works the best it can. Check out this infographic:
What is Autism Goggles? Autism Goggles is our effort to change understanding of autism. The lack of training and understanding among professionals means that parents are getting bad advice or no advice; poor direction or no direction when their child receives that autism spectrum identification. In our part of the world, family doctors are not required to have a good understanding of ASD and yet they advise parents based on what? Based on a typically developing child. Teachers - and we love teachers - are not required to have any (or woefully little) special education training in order to teach children with autism. However, the law says they must teach whomever sits in a desk in their classroom. Not fair to the child. Not fair to the teacher as they try to support the child based on their knowledge of typical students. At Autism Goggles, we want to change how people look at difficulties and challenges, strengths and interests in their autistic child, teen, young adult, friend or partner. We are going to do that by helping to change understanding of the many issues that can go hand in hand with a diagnosis. We’ll explain issues in easy to understand ways, and make them relevant to your life. We know that when parents, extended family members, teachers and other professionals understand why they are being asked to do something, they are more likely to see value in their effort. Change understanding and you can change people’s actions. We hope that when you attend our events, read our articles, and watch our videos, you’ll gain greater confidence in responding to and advocating for your loved one on the spectrum. You see behaviours more clearly as communication, and appropriate responses make come in to sharp focus as a result. We encourage you to pull together everything you have learned and everything you know about your child to come up with ideas that have a higher chance of working and of making the individual feel understood. We don’t want you to keep doing what you’ve always done and expecting your child to change his response. That is the definition of insanity, n’est pas? We encourage you to toss out those typical lenses in favour of Autism Goggles when you’re trying to figure out how to support or understand what is causing a behaviour, feeding anxiety, or limiting potential.
MIT Resources Error message MIT's Building 10 and Great Dome overlooking Killian Court where annual Commencement exercises are held. MOSTEC is a six-month, online science and engineering program for rising high school seniors from across the country who have a strong academic record and interest in science and engineering. MIT Office of Undergraduate Education This site is a comprehensive listing of MIT resources to further STEM interest and literacy. MIT Haystack Observatory Haystack Observatory is an interdisciplinary research center of the Massachusetts Institute of Technology (MIT) focused on radio astronomy, geodesy, and atmospheric science. Zero Robotics By making the benefits and resources of the space program tangible to students, Zero Robotics hopes to cultivate an appreciation of science, technology, engineering and math through healthy, immersive, collaborative competition. MIT Scheller Teacher Education Program Professor Strang's Linear Algebra Class Lecture Videos MIT Professor Gil Strang's Linear Algebra Class Lecture Videos MIT K12 Videos This site presents short videos created by MIT students that teach basic concepts in science and engineering and are aimed at students in grades from kindergarten through high school. MIT OpenCourseWare Highlights for High School features MIT OpenCourseWare materials that are most useful for high school students and teachers. The program’s goal for teachers is to make it easy for them to find resources they can use to inspire their students. This site, Biobuilders, provides activities and animations for teaching and learning synthetic biology. Software Tools for Academics and Researchers The STAR program at MIT seeks to bridge the divide between scientific research and the classroom. Understanding and applying research methods in the classroom setting can be challenging due to time constraints and the need for advanced equipment and facilities. The multidisciplinary STAR team collaborates with faculty from MIT and other educational institutions to design software exploring core scientific research concepts. The goal of STAR is to develop innovative and intuitive teaching tools for classroom use. MIT OpenLabWare The mission of MIT OpenLabWare is to provide online materials that enhance understanding of the research process, excite students about research at MIT and promote MIT as a creative thinking institution. MIT Biology This site provides a list of seven laboratory protocols that have been specifically designed by MIT scientists and high school science teachers for use in high school and middle school biology classes. StarBiochem is a protein 3-Dviewer that allows students to learn key concepts about the biology of proteins in an interactive manner. StarGenetics is a genetic cross simulator. It aims to simulate real genetics experiments to teach students about genetic experimental design. StarGenetics allows students to simulate mating experiments between organisms that are genetically different across a range of traits to analyze the nature of the traits in question. MIT Mathlets Here you will find a suite of dynamic Java applets for use in learning about differential equations and other mathematical subjects, along with examples of how to use them in homework, group work, or lecture demonstration, and some of the underlying theory. Science and Engineering Program for Teachers Our mission: to show teachers the latest developments in biology, chemistry, physics, mathematics, technology and engineering; to provide them with a perspective on the interface of science, technology and society; and to help spark a lifelong interest in science in their students.
"Sunshine, daisies, butter mellow, Turn this stupid, fat rat yellow." He waved his wand, but nothing happened. Scabbers stayed gray and fast asleep. "Are you sure that's a real spell?" said the girl. "Well, it's not very good, is it? I've tried a few simple spells just for practice and it's all worked for me. Nobody in my family's magic at all, it was ever such a surprise when I got my letter, but I was ever so pleased, of course, I mean, it's the very best school of witchcraft there is, I've heard - I've learned all our course books by heart, of course, I just hope it will be enough -- I'm Hermione Granger, by the way, who are you?” (Harry Potter and the Sorcerer's Stone) There is seems to be a relative clause as she is in Her book displays the fine sceptical in-telligence of the scholar she is (CGEL,p1045). But I suspect there is some implicative meaning in OP’s there is. For example, there is Ø in the world, etc. Does ‘there is’ really mean what I’ve said? Or there is is a set complement for the very best school of witchcraft (CGEL,p1101) and means ‘there is Ø among the witchcraft schools. Or is it mean it’s the very best school of witchcraft [there is one among witchcraft schools]. And it refers to one. "It's the very best school of witchcraft there is" simply means "It's the very best school of witchcraft that there is". Two clauses with an empty complementizer. This "there is" clause means "there is anywhere in existence". It means that there is no better school of witchcraft anywhere. The additional clause does not add to the meaning. Something can be specified after "there is" to restrict the claim, in which case the relative clause does change the meaning. Other verbs can be used also besides "is": "It's the very best school of witchcraft { [ that ] there is \| that exists \| that we have \| that can be found \| ... } in this country". Now the set is restricted: it means that it is not absolutely the best school, only the best among those in this country; there may be better schools, if we look outside of the country. If we omit "in this country", then all of these variations denote an unrestricted superlative. Your Answer
Explanation of Makruh Assalamu Alaikum Warahmathullahi Wabarakathuhu, Dear respected Shiekh, In the recent past I heard from various personnel that they say “There is no Makruh as such” there is only haram and halal. Can you please explain this? It will be appreciated if can give the detailed explanation so I can show the people who spread false information and who are misguiding innocent ummah. Jazakallahu Hairan. A`udhu billahi min ash-shaytan ir-rajeem Bismillahi ‘r-Rahmani ‘r-Raheem wa `alaykum salam, The Madhhab Imams studied categories of ibadats more precisely that we can even imagine. Imam Abu Hanifah, the greatest among them, was especially known for that. He introduced the terminology that you mentioned to help us be more precise in following what is fardh and avoiding what is haram. Imam Senad Agic American Islamic Center – Chicago Majlis #1 Head Imam (IABNA) This entry was posted in Belief & Doctrine and tagged , . Bookmark the permalink. Comments are closed.
"Я живу здесь." Translation:I live here. December 8, 2015 I saw this earlier as "Я здесь живу." Is there any preference as to where "здесь" falls grammatically? December 8, 2015 There's no difference between the meanings, both mean the same thing - "I live here." The only difference can be WHAT EXACTLY you want to point out by your sentence, therefore on which word you put the stress. If you want to point out the exact place where you live then you'd say "Я живу здесь." (the stress is on здесь). And if you want to mention what you do here, you'd say "Я здесь живу." (stress is on живу). December 23, 2015 December 23, 2015 Your message clears everything :o December 14, 2017 What's the difference between вот and здесь? September 15, 2016 I've come to distinguish the two by knowing that Вот translates to "here is" as in вот мой кот, Кирил whereas здесь means just simply "here" usually used to demonstrate location such as кого здесь ты знаешь? If you really wanted to be fancy, you could say Я здесь живу. Вот мой дом. "I live here. Here is my home" Hopefully that has cleared it up a bit May 14, 2018 Is the stress on the final y? March 4, 2016 Yes, it is. March 4, 2016 Someone can explain to me why the и of живу it's pronounced "a" ? March 28, 2018 Learn Russian in just 5 minutes a day. For free.
Gifu lanterns Photo：Gifu City Gifu lanterns Gifu chochin Graceful & delicate shape Elegant & immaculate design What is Gifu lanterns ? Gifu Chochin is a lantern produced in Gifu City, Gifu Prefecture. The lantern has a history of longer than three hundred years and the high level of the technique used to make it was valued so highly that the lantern was designated as one of the traditional national crafts in 1995. Gifu Chochin is used as household decoration during the Obon festival (a Japanese Buddhist custom to honor the spirits of one’s ancestors) during summer. They are also used for lighting and interior decoration. Gifu Chochin are mainly egg-shaped and hanged for use which is known as the Gosho Chochin style. Gosho Chochin are sometimes referred to as Gifu Chochin, too. Other than the typical egg-shaped and hanging lantern, the Gotenmaru (round lantern) and Ouchiandon (stationary type lantern with tripod) are also well known. The characteristics of Gifu Chochin are the materials used, including high quality Mino (Gifu) paper and bamboo produced in the Mino region, as well as the detailed drawings, such as autumn flowers, birds and scenery. Mino paper has been renowned for its thinness and strength since ancient times. Mino paper itself is also a designated traditional national craft. Both Takehigo (thin sticks of bamboo) and Mino paper are as thin and fine as possible. With such fine raw materials together with its delicate and gracious shape and the elegant drawings, Gifu Chochin gives an elegant and immaculate impression. Gifu lanterns - History Photo：Gifu City The region surrounding Gifu City has been well known for high quality Japanese paper and bamboo since ancient times. For this reason, Gifu City developed various crafts as well as Gifu Chochin, including Japanese umbrellas and Uchiwa (Japanese paper fans) using Mino paper and bamboo. Gifu Chochin lanterns were presented to the Bakufu (government) in the period of the third shogun of the Tokugawa family. There are various views about the origin of Gifu Chochin. Some say they were first made between 1596 and 1615 and some say they were first made in 1650. By 1751 – 1763, Chochinya Juzo, a lantern-maker in Gifu-cho, made lanterns with a similar shape to the present Gifu Chochin for the official use in the Owari domain. Between 1818 and 1829, Gifu Chochin with drawings of plants became so popular that the lantern was even recited in a poem by a court noble in Kyoto. After that, Gifu Chochin were continuously produced but as they were of such high quality they were too expensive for the general public. The name of the lantern spread widely in the Meiji period. When the Emperor Meiji visited Gifu City in 1878, he liked the lantern and from then on it started to be appreciated nationwide as a traditional national craft of Gifu prefecture. General Production Process Gifu lanterns - General Production Process Photo：Gifu City 1. 1. Dosabiki (coating Japanese paper) The Japanese paper is coated with Dosa (mixture of burnt alum and glue) to give the paper resilience and a glossy appearance. Burnt alum and glue are put in water and simmered to make Dosa. A Dosa coating also prevents the smearing of paints in the next stage of stenciling. The paper is painted with the basic color (Jiirobiki) unless the base color is white. 2. 2. Stenciling This is a process in which Surikomishi (a craftsman who is specialized in stenciling) stencils the design on the Japanese paper used for Hibukuro (the egg-shaped part of a lantern where the Japanese paper is pasted). This is one of the characteristics of Gifu Chochin. First of all, a printing block for the outline based on the original drawing by Eshi (a painter) is prepared and the outline is stenciled. After that, a paper pattern is made with the part to be colored cut off and the color is rubbed in. The coloring process has to be repeated many times, taking into consideration the layers of colors and the overlapping parts. A paper pattern has to be made for each time coloring is done. So, the number of paper patterns sometimes exceeds 100 for one design. 3. 3. Producing Kuchiwa (guard ring) and Teita (board) Kuchiwa and Teita are produced in this process. Kuchiwa is a ring attached to the top and the bottom of the Chochin. Teita is a board to which the lantern is attached so a person can carry the lantern hanging from the board. The material used is Japanese cedar or Japanese cypress. This is a process carried out by a Kijishi (woodturner) who also makes the legs for Ouchiandon. 4. 4. Decorating accessories Kuchiwa, Teita and legs are decorated using Makie (lacquer) and Moriage (embossing) methods. Moriage is a method that produces a three-dimensional effect by, for example, using whitewash to make a chrysanthemum shape. 5. 5. Producing the frame of Chochin and doing Higomaki This is the process to make the framework of the lantern. First of all, a basic shape is made by assembling Harikata (a frame for the lantern frame). Takehigo (thin bamboo sticks) are wound around Harikata in a spiral shape along the fine grooves carved in the Harikata. It is very difficult to wind bamboo sticks that are less than 1mm in diameter around the Harikata while keeping the same tension in the sticks. 6. 6. Pasting Strings are wound around the bamboo frame along the back part of the Harikata in order to prevent the lantern from stretching out of shape. This process also prevents the pasted paper from being damaged. The thin lining paper (Koshihari) is pasted on the top and the bottom of the lantern. The width of the paper (Koshihari) is 4-5 bamboo sticks. Glue is brushed on the bamboo sticks and the stenciled Japanese paper is pasted on every other section divided by the Harikata. This is to make it easier to match the overlapping part of the design. Once the paper has been pasted once around the lantern, the rest of the paper is pasted carefully making sure that the pattern is aligned.. See more Other crafts See items made in Gifu
Code generation for a RISC machine • Petr Kroha Conference paper Part of the Lecture Notes in Computer Science book series (LNCS, volume 371) The algorithms of the UNIX C compiler was used to prove some properties of a Small C compiler for a RISC machine. Because of lack of the most addressing modes many tables and many procedures were becoming much more simple. The problem of data and branch conflicts we hadn't to solve because our machine doesn't use pipelining. This is due to the motivation of the machine in control of parallel processes, where the greatest part of the processor activity can be spent by waiting for an asynchronous event. That's why it didn't seem to be important to use pipelining. On examples we showed that the increase of number of instructions of the generated code when compiling a program isn't so considerable as will be usually proposed. Machine Instruction Register Allocation Expression Tree Direct Address Intermediate Language 1. [1] Patterson,D.A.,Sequin,C.: A VLSI RISC. Computer,15,No 9,1982.Google Scholar 2. [2] Chaitin,G.J.: Register Allocation and spilling via graph coloring. Proceedings of the SIGPLAN'82 Symposium of Compiler Construction, SIGPLAN Not. 17, 1982.Google Scholar 3. [3] Chow,F.: Engineering RISC compiler system. Compcon Spring 1983.Google Scholar 4. [4] Gross,T.R.: Code optimization technique for pipelined architecture. Compcon Spring 1983.Google Scholar 5. [5] Blazek.Z.,Kroha,P.: Design of a reconfigurable parallel RISC machine. EUROMICRO'87, Portsmouth. reprinted in: Microprocessing and microprogramming 21 (1987), Morth-Holland.Google Scholar 6. [6] Ritchie,D.M.: A Tour through the UNIX C Compiler. Bell Laboratories, documentation of UNIX.Google Scholar 7. [7] Blazek,Z.:A reconfigurable processor with RISC features. Thesis, Czech Technical University, (to appear on Czech)Google Scholar 8. [8] PDP 11 Processor Handbook. Digital Equipment Corporation, 1978.Google Scholar Copyright information © Springer-Verlag Berlin Heidelberg 1989 Authors and Affiliations • Petr Kroha There are no affiliations available Personalised recommendations
• Gene The physical and functional unit of DNA that controls your metabolism and utilization of drugs. Genes contain the instructions that help determine how the body develops and how it functions. 93% of people have gene variation. ← Back to Glossary Order Now
The first amendment to the Constitution of the United States provides that "Congress shall make no law ...abridging the freedom of speech or of the press, or the right of the people peaceably to assemble..." While the terms of the first amendment appear to be all embracing, its application has never been absolute. Its guarantees have always been subject to regulation by the state wherever they endangered the safety or welfare of the public. The fundamental issue involved in all first amendment problems involving free expression is the determination of the point at which the rights of the individual stop and the rights of organized society to protect itself begin. The Constitution places on the courts the duty to draw the line between these two conflicting interests. The courts must, in each instance, ascertain which of the two interests require the greater protection.
Nayomi Chibana Written by: Nayomi Chibana How to Develop a Speaking Voice That Makes People Want to Listen develop-speaking-voice-make-people-listen 1 This classic line from the movie Jerry Maguire brings more to mind than just a memorable scene. It echoes a finding reached by a recent study conducted by the universities of Glasgow and Princeton. The research concluded that it actually takes less than 500 milliseconds (the time it takes to say “hello”) for people to judge your character. After playing recordings of people saying “hello,” the study’s participants were asked to rate people on a range of personality traits, including dominance, trustworthiness, attractiveness and warmth. Surprisingly, most of the participants came to the same conclusions regarding character. This suggests that regardless of the accuracy of our perceptions of others, the ability to quickly judge trustworthiness and attractiveness based on someone's tone of voice is a survival trait human beings have developed over time. How People Perceive You Nowadays, image is everything. Whether accurate or not, the way people perceive you can affect your professional career, your social life and even your intimate relationships. This is why becoming aware of what your tone of voice is saying to other people is so crucial to your success as a public speaker. Although we’ve heard time and again that we shouldn’t judge a book by its cover, the truth is that your audience will first judge your appearance and the tone of the voice before they really hear what you have to say. Once you’ve passed this first--albeit superficial--test of credibility, they will begin to listen to the content of your words. Henry Wadsworth Longfellow once said that your “voice is the organ of your soul.” This is a true statement considering that your voice reflects not only what you believe about yourself, but also the attitude you have toward your audience and the content you’re presenting. For example, you could speak in a loud, booming voice; you could mutter; you could speak quickly and not pause; or you could speak in a dry, monotone voice. Each of these would communicate something completely different to your audience, regardless of the content of your message. Here, we detail specific characteristics of your voice and the message sent by each of them: • Variety: In a study of TED speakers, it was found that presenters with a higher level of vocal variety were perceived as more credible. • Breathing: If your audience can hear you gasping for breath because you’re speaking too quickly and taking shallow breaths, they will think you are nervous and trying too hard to make a good impression. • Clarity: Audiences are more attentive to speakers who enunciate and speak clearly. This sends the message that you are articulate, knowledgeable and competent. • Consistency: If the message you convey with your tone of voice doesn’t correspond with your facial expression and body language, then your audience will likely not find you credible. Additionally, there are several speech habits that can seriously undermine your chances of progressing both at work and other social spheres: • Uptalk: Although popularly known as “valley girl” talk, this habit is becoming increasingly common among young men as well, especially Silicon Valley boys’ clubs. This speaking style, which tends to end phrases with a rising intonation as if they were questions, suggests a lack of confidence and maturity. • Vocal fry: Speaking below your register in a drawn out voice results in this unattractive speaking habit, which is a major turnoff for audiences in general. Here's an example: • Problems with pitch: A voice that is too shrill or too brash come be off-putting--to the point that audiences begin to tune them out. How to Make Others Listen to You Speaking in a way that makes people want to listen to you starts with learning how to adjust your voice so that you’re sending the right message to your audience members. Here are some expert tips for developing a speaking voice that keeps people’s attention, whether in a presentation given before a boardroom full of executives or a stage before thousands of people. 1 Use your diaphragm voice One of the keys to sounding more authoritative and confident is learning to identify the kind of voice you’re using and then modify it so you’re using your diaphragm voice instead. Most people fall into one of the following categories of voice types: • Nasal voice We’ve all heard this type of voice before, and chances are we’ve probably thought at one point in the conversation or presentation, “when is this going to end?” Although most people will keep their thoughts to themselves so as not to be rude, this kind of voice turns people off in a hurry and can really hurt your professional and social life. • Mouth voice This type of voice (also called the head voice) is not totally repellent, but it falls short of making a lasting impression. People with this type of voice use their throat to talk. Because it creates a light, thin and grating tone, it is usually overlooked and can often be associated with someone who is underappreciated and rarely heard. When giving a presentation, this person may compensate for this by yelling, which can do more harm than good, especially to their vocal chords. • Chest voice As the name implies, this voice comes from the chest and is generally attractive enough to keep listeners’ interest. The only problem, however, is that it isn’t the best possible speaking voice you can have. • Diaphragm voice The optimum voice for both men and women comes from the diaphragm, which is a muscle located at the base of your lungs and moved by your abdominal muscles. This voice not only makes people want to listen to you, it also sounds natural and pleasant. Just listen to how Margaret Thatcher, known as the Iron Lady, changed her voice over time to sound more authoritative and dominant: 2 Breathe correctly People who don’t speak from the diaphragm also don’t breathe from the diaphragm, so in order to improve your speaking voice, you must also change the way you breathe. Those who speak with a mouth or chest voice are usually breathing too shallowly, which gives rise to a more unnatural, nasal tone. To change this, all you have to do is to start practicing deep breathing. Your breath must come from your abdomen--not your chest. To make sure you’re breathing correctly, just place your fist below your last rib and see if your stomach expands and your shoulders go up and down as your breathe. Practice breathing correctly by inhaling deeply for about 5 seconds, until you feel the air fill your stomach. Next, exhale for the same amount of time, and keep doing this until it becomes a part of your normal speech habit. When you do this, also remember to pull your shoulders back and sit or stand up straight so that it becomes easier to breathe in deeply. This will also make you look more confident and poised. Finally, make sure that you inhale deeply at the end of each sentence so that you can get through it without pausing to take a breath. You can also follow the breathing exercises at the end of this TED talk given by sound consultant Julian Treasure. 3 Project from your diaphragm When breathing from your diaphragm becomes second nature, any noise you make should come from the same place. Whether conversing, singing--or even laughing--project from your diaphragm. 4 Adjust the volume Speak loud enough so that people at the back of the room can hear you. As mentioned earlier, people with louder voices are generally perceived as more dominant and authoritative. 5 Create emphasis As with all types of communication, emphasis and contrast are necessary to get a point across effectively. While in writing you might need just one short sentence after a series of long sentences to create a specific effect, in speaking, you need variation in sound to make a point. For example, read the following sentences aloud, slightly increasing the volume when pronouncing the words in bold and look at the implied meaning for each. • I didn’t tell her you were stupid. (Someone else, not me, told her this.) • I didn’t tell her you were stupid. (I most certainly didn’t tell her this.) • I didn’t tell her you were stupid. (I didn’t tell her; I implied it.) • I didn’t tell her you were stupid. (I didn’t tell her; I told someone else.) • I didn’t tell her you were stupid. (I referred to someone else, not you.) • I didn’t tell her you were stupid. (You’re still stupid.) • I didn’t tell her you were stupid. (I told her you were something else.) This exercise, from the publication The Total Communicator illustrates why it’s so important to use the power of voice to send the right message--and not something else. You can modify your voice to vary four important elements of sound: • Volume Although, in general, you should raise the volume of your voice, be sure to vary it according to what you’re conveying. For instance, if you’re mentioning a side note, you would slightly lower your voice, which would act as the auditory equivalent of a parenthetical statement. When you’re making an argument, raise your volume gradually as you build toward the point. Also, communicate a change in topic or idea by changing your volume. • Pitch Varying your pitch requires hitting high and low notes with your voice. For example, when you ask a question, you should end your sentence on a higher note; when affirming a statement, however, you should end on a level or slightly lower note. If used incorrectly, ending on a higher note can lead people to think that you’re insecure or that you have doubts about your statement. • Timbre This element of sound refers to the emotional quality of your voice, as well as the attitude you convey with your words and how you say them. Not only should you choose the right words to send the right message, you should also say them in a way that expresses the attitude or emotion you want to create. In this way, your timbre should vary in accordance with the emotional response you want to trigger in your audience. According to Julian Treasure (see TED talk above), studies show that people in general prefer voices that are “rich, smooth, warm, like hot chocolate.” • Rhythm and tempo The first refers to the pattern created by the sounds you produce with your words; the second refers to the pace of your voice. Vary both to communicate meaning. For example, to convey a sense of excitement or urgency, you can accelerate the pace of your voice. To draw attention to specific points, you can slow down and let your audience process what you just said. 6 Use pauses effectively As noted here, it’s pretty rare to find a presenter who effectively uses pauses during a presentation or speech; most amateur presenters are deathly afraid of silence. A confident and experienced presenter, however, knows how to effectively use these to drive their point home. Not only does it create suspense--expectation for what will come next--it emphasizes the point you just made by allowing your words to sink in. Just take a look below at how Mad Men’s protagonist Don Draper commands a room with his effective use of pauses and his variation of the sound elements already mentioned. What about your speaking voice? What does it say about your personality and attitude toward yourself and your audience? We would love to hear your reactions and thoughts in the comments section below. We’re stingy and don’t share emails with anyone. About the Author 6 responses to “How to Develop a Speaking Voice That Makes People Want to Listen” 1. Waseem Khan says: Thanks for posting such an awesome in depth article! 2. Medhat Fawzy says: Thanks a lot for such amazing, informatic, helpfual article 3. Keith Nichols says: Thank you the information was interesting and useful. Leave a Reply
Boeing 787 Dreamliner belonging to Polish airline LOT flies after taking off from the Chopin International Airport in Warsaw June 1, 2013. REUTERS/Kacper Pempel Thomson Reuters Have you ever flown from NYC to LA and wondered why the flight takes so long? It'd be understandable to think that since the earth spins counter clockwise (eastward), it should be easier to fly west, since your destination is hurtling eastward underneath your airborne plane. Actually, flying west to LA takes about an hour longer than flying the return trip, but not directly because of the earth's rotation. Instead, the earth's rotation affects the way the wind blows on our planet. As the earth spins towards the east, it's also pulling everything on earth with it — including earth's atmosphere and the planes in it. Plane travel times do often differ depending on the direction of travel, but this is caused by wind currents in the upper atmosphere called jet streams, and in the northern hemisphere it has a lengthening effect on flights from East to West. Here are the major jet streams over North America: That major jet stream over the northern hemisphere flows west to east, providing a lift for east bound flights and increased resistance for west-bound flights. Which is the real reason why flights from LA to NYC tend to be shorter, because planes flying east tend to have the wind at their back. But interestingly, here is where the earth's rotation comes into play — they cause the wavy patterns of the jet stream. Since points on the earth around the equator have farther to travel during one rotation than the parts of the earth near the poles, those equatorial areas are moving faster than the rest of the earth. So, a city near the equator, like Jakarta, Indonesia spins at about 1000 miles per hour, while Wisconsin (at 45° latitude) is spinning at about 700 miles per hour. This speed differential triggers the Coriolis effect: The difference in speed pushes the air currents to the east in the northern hemisphere, and to the west in the southern. If the earth didn't rotate, winds would only flow north-south, migrating between the equator and the poles. But because of the earth's rotation and the Coriolis effect, these winds are pushed to the side, creating both the swirling shapes of hurricanes and the undulating pattern of the jet stream. And this is why that flight from LA to New York is shorter than vice versa; it benefits from a jet stream-assisted tailwind at its back. So earth's rotation certainly has a some effect on air travel times, but in a much more indirect way.
Hemp plastic could change the face of the world Hemp plastic highly biodegradable and nontoxic to humans, could change the face of the world Did you know it takes between 500-1 000 years for plastic to degrade? Plastic pollution destroys our planet minutes by minute. In fact, so much plastic is thrown away every year, it could surround the earth four times ... This plastic is found in the earth and the sea, devastated natural ecosystems. Even worse, this same plastic pollution is found in our body. It is estimated that 93% of Americans over six years of age have a positive test for BPA, a plastic chemical related to cancer, diabetes, altered immunity, and so much more ... Clearly, plastic pollution non-biodegradable is a danger to the environment and to health. But how can hemp plastic help in this area? Hemp source of cellulose The basic elements of plastic are cellulose. At present, cellulose is mainly obtained from petroleum. However, petroleum-based plastics are harmful to human health. Without speaking destructive of the environment. Hemp, on the other hand, is an excellent source of cellulose and is durable. Hemp plastic is completely biodegradable One reason that plastic is so toxic is because of its long shelf life. A bottle of water can only be used for a few minutes, but it will take years to break down. Count for other plastic items like groceries, tupperware, buttons, packaging, electronics - it's easy to see why plastic pollution is developing in the whole world. The 7e continent ... of plastic Meanwhile, hemp plastic can be completely biodegradable when made with biodegradable polymers. Unlike conventional plastics, plastic made from hemp does not contribute to permanent pollution. In the right environment, hemp plastic takes about 3-6 months to decompose. This is amazing compared to conventional plastics. Hemp plastic made from biodegradable polymers Hemp plastic can also be recycled indefinitely. While petroleum-based plastic can be recycled, because this type of plastic is loaded with chemicals, it's a toxic process. Recycled conventional plastics still flee harmful substances in the environment, such as BPA. Plastic made from hemp completely avoids these toxins. Hemp is not toxic, nor is its plastic Plastic is toxic to our health. Conventional plastics contain endocrine disruptors. Endocrine disruptors, such as BPA, interfere with the endocrine system (aka hormone) in the human body. Once inside the body, endocrine disruptors act as the hormone estrogen. Why is it dangerous? Read also The CBD market will reach the first billion by 2020 Plastic pollution is today at its height ... This hormonal imbalance in the body can stimulate the development of tumors. In fact, endocrine disruptors are linked to congenital anomalies, cancer, learning disabilities and more. The dangers of plastic's toxic chemicals do not end with digestion. Endocrine disruptors can also be found in soil and groundwater. Which destroys the natural environment and our health. Hemp plastic is not toxic Plastic made from hemp does not contain harmful disruptors such as petroleum-based plastics. It also does not release toxins into the air during production. Why continue to destroy our environment and our health when there is an alternative? Hemp plastic could help save endangered wildlife Plastic is polluting the ocean at alarming rates. A study conducted by the Commonwealth Scientific and Industrial Research Organization and Imperial College of London revealed that 60% of seabirds today have a plastic in their gut. By 2050, they expect this figure to reach 99%... How is this plastic found in wildlife? The involuntary meal of seabirds ... When the plastic is exposed to sunlight, it breaks down into small pieces. These small pieces of plastic end up being ingested by marine life and other. When the plastic disintegrates, it goes down the food chain. Animals, like humans, are not designed to consume plastic. Sea turtles undergo genocide with plastic pollution Ingesting plastic can result in a number of adverse health effects. Many of which we are probably still unknown. Hemp plastic, on the other hand, is biodegradable. It is not toxic either. Instead of filling our seas with lethal petrochemicals, we could create sustainable initiatives to recycle hemp plastic safely. Hemp plastic is extraordinarily versatile A car almost made of hemp polymer Did you know that thousands of everyday plastic products could be made from hemp instead of oil? Hemp plastic can be molded in almost any shape. The uses of hemp plastic include: • Electronic • containers • Toys • Beauty products • Bottles • Bags • Car parts • boats • Furniture A plastic chair ... of hemp This list is only a fraction of the plastic products that could be made from hemp. Hemp plastic can replace toxic plastic products in any way. And unlike petrochemical plastics, the manufacture of hemp plastic is environmentally friendly and profitable. Hemp plastic reduces environmental pollutants There is more carbon dioxide in the atmosphere today than at any point in history over the last 80 000 years. The increase in carbon dioxide concentrations is responsible for the warming of the Earth's atmosphere. Otherwise known as greenhouse effect ... Much of this increase in carbon dioxide can be attributed to fossil fuels ... Read also Seeds from Asia for the medical market Hemp cleans nuclear contaminated soils Conventional plastics are made from fossil fuels such as petroleum. Therefore, plastic contributes greatly to the increase of CO2 emissions. Hemp products can actually reduce the greenhouse effect. This is because hemp absorbs carbon dioxide from the atmosphere and converts it into oxygen. It is used even for clean polluted soil. In short, hemp plastic is a sustainable process. This is the exact opposite of the toxic manufacturing process of petrochemical plastics. Hemp plastic is more resistant than petroleum-based plastics Plastic made from hemp is five times stiffer and 3.5 more resistant than polypropylene, one of the most common types of plastic. It's also a lot lighter, which makes hemp unique for manufacturing materials. Hemp does not pose the health risks of conventional plastics either. The properties of hemp fiber are reflected in the quality of plastic So, not only is hemp plastic more resistant, but it is also safer. Hemp plastic offers durability and resistance while being lightweight. So, why risk health and safety when there is a perfectly appropriate alternative? Hemp plastic is a renewable resource From the moment the seed enters the soil; hemp enriches its environment. Hemp is a robust plant with deep roots. As such, hemp helps prevent soil erosion, thereby reducing water pollution. Hemp can also be grown in the same soil for years without compromising quality. A plant that never ceases to amaze Even once hemp is made of plastic, it continues to be durable. Hemp plastic is 100% biodegradable. Which means that in the right conditions, it breaks down in a few months. Unlike traditional plastics whose indefinite duration, especially in the human body ... Classic plastics are not worth the risk ... The alternative is right in front of us. No other natural resource offers the capacity of hemp. Because hemp is terribly renewable ... While hemp is certainly not the only answer to our environmental and health concerns, but it is still a very good start to save the planet intelligently. Tags : HempEnvironment
New non-invasive equipment tests for concussions The U.S. Food and Drug Administration (FDA) recently cleared a new medical device called the EyeBox for detecting concussions. The relatively modest-sized piece of equipment (as opposed to a CT scan) designed by a neurosurgeon tracks the movements of the eye to detect signs of concussion. This clearance is based on years of testing and can be used on patients ages 5 to 67 years old. The machine works by tracking a patient’s eye movements as it watches a 4-minute video that bounces around a large screen. It has already been determined that different deviations in eye movement indicate different injuries. The EyeBox, however, is different from other equipment because it does not need a previous baseline reading. Its only use at this point is for determining a concussion, but the analysis of eye movement will help better define other injuries through their identifying eye tracking deviation. Available at hospitals The device is already available at certain hospital test sites around the United States. It will soon be implemented by other medical centers, and then it claims that it will be used further down the line on the sidelines of football games and other circumstances involving general consumers. If all goes as planned, the device will change how to diagnose a brain injury. This means that if someone is more accurately diagnosed as injured, these readings will help doctors treat patients. It is worth noting that it also will aid personal injury attorneys in building stronger cases for injured clients.
What does democracy mean? Democracy is a system of government where the citizens of a state exercise power to rule the state, either directly or through electing representatives. Examples of democracy Examples of democracy “When it comes to countering terrorism, refusing to allow our democracy and liberty to be undermined is just as important as discussing the immediate security situation.” Brendan O’Neill, “This Suspension of Democracy Is a Grave Error,” Spiked (May 24, 2017) “These experts see significant warning signs for American democracy, especially involving political rhetoric and the capacity of political institutions to check the executive. On average they estimate an 11 percent chance of democratic breakdown within four years.” Michael K. Miller, “A new expert survey finds warning signs for the state of American democracy,” The Washington Post (May 23, 2017) “Democracy is real to the extent to which power is diffused among the people. Concentration of power is the negation of democracy.” V. M. Tarkunde, Radical Humanism: The Philosophy of Freedom and Democracy (1983) Where does democracy come from? Democracy can refer to a system of government or to a particular state that employs this system. The word entered English around the 1570s, from the Middle French démocratie, but it originally comes, via Latin, from the ancient Greek demokratia, which literally means rule (“kratos”) by the people (“demos”). The Greek demokratia dates all the way back to the 5th century b.c., when it was used to describe the government in some city-states, notably Athens. There are two kinds of democracy: direct and representative. Direct democracy is when the people are directly involved in governing the state. Representative democracy, which characterizes the US system, occurs when people elect representatives to ensure their interests in government. When we think of democracy today, we usually think of a representative one in which all or most people are able to participate. This concept didn’t originate until a very long time after democracy’s ancient roots. In 507 b.c., Cleisthenes, the leader of Athens, introduced a series of reforms designed to allow the people to have a voice in ruling the city. It included three different political bodies: the governors, the council of representatives, and the courts. Only male citizens over the age of eighteen could vote, excluding those from outside the city, slaves, and all women. This system of government lasted until around the 400s b.c., when it began to waver, with conquests by neighbors gradually weakening it further. Athenian democracy was probably not the first example of democracy in the ancient world, but it is the best-known early version, and it is from here that we draw the word and its governmental philosophy. Another well-known example of early democracy was the Roman Republic. Like Athens, it wasn’t what we would think of today as a full democracy. Again, only adult male citizens were eligible to participate. Italy continued the tradition in a few of its medieval city-based republics. Venice, and Florence particularly, had governmental systems that included political participation by the people, if in a limited way. Democracy also found its way into monarchical European states through the concept of the parliament, which was a council that advised the monarch. For the most part, only those who already had power could participate in parliaments, though Sweden allowed peasants to participate in its council (the Riksdag) from the 15th century. The Enlightenment in 17th and 18th centuries brought a greater questioning of established authority to mainstream philosophy and discourse. This trend had a strong impact on the fledgling United States, which, when it won its independence from Great Britain in 1781, set up a system of representative democracy to represent its people. France was also impacted by this model. The French Revolution in 1789 was an attempt to achieve democracy, though the country didn’t achieve it until the mid-1800s. It was not until the 20th century that universal or broader suffrage, or the right to vote, was extended in most countries, and it was in the 20th century that democracy spread. By the beginning of the 21st century, almost half of the countries of the world had some variety of democratic or near-democratic system. Types of democracies are classified according to various distinguishing features, including constitutional democracy, democratic socialism, Jeffersonian democracy, liberal democracy, parliamentary democracy, or presidential democracy, to name a few. Democracy is also used for non-governmental organizational systems, such as a workplace democracy, which applies democratic principles in professional contexts. An advocate of democracy or democratic values is called a democrat, not to be confused with a member of the US Democratic party. Sign up for our Newsletter!
Network Administration: Linux Network Configuration Files Like other operating system services, the Linux network is configured by settings that are specified in configuration files that you can find in the /etc directory or in one of its subdirectories. Graphical configuration programs such as Red Hat Network Configuration are actually little more than glorified text editors that enable you to select network configuration options from user-friendly screens and then save your configuration changes to the standard configuration files. If you prefer to do the grunt work yourself, you can open the configuration files in a text editor and make changes to them directly. Any time you open a configuration file in a text editor, you run the risk of messing up your system’s configuration. So be careful! The following table lists the main Linux network configuration files and describes what each file does. Linux Network Configuration Files File Location Description network /etc/sysconfig Basic network configuration. hostname /etc Specifies the host name (obsolete, but should still be ifcfg-eth0 -/etc/sysconfig/ IP settings for the first Ethernet adapter ifcfg-eth1 -/etc/sysconfig/ IP settings for the second Ethernet adapter hosts /etc Lists host address mappings. resolv.conf /etc Lists DNS nameservers. nsswitch.conf /etc Specifies the name search order. xinetd.conf /etc Specifies which network services are started
English to Nepali Meaning :: foreland Foreland : - foreland Show English Meaning Noun(1) a natural elevation (especially a rocky one that juts out into the sea(2) land forming the forward margin of something Show Examples (1) In light of the Euro-African collision being the primary cause of the compressive stresses in the Alpine foreland it is more natural and reasonable to imagine a continuous inversion process rather than one with distinct pulses.(2) There is a cliff top walk to the foreland along the path leading from the old inn near Countisbury.(3) Therefore, the Lewisian rocks from the Assynt terrane of the Caledonian foreland are an unlikely source for any of the sediment.(4) The early Carboniferous Northumberland Basin, NE England, is one of the northernmost basins that developed in the foreland of the Variscan orogenic belt.(5) Their fleets of ships fought and won battles from the coasts of Kerry to Mizen's wild foreland , to the Mull of Kintyre.(6) The glacier foreland is 2 km long with a chronosequence of developmental stages from recently deglaciated terrain to sites which have been ice-free for 145 years at the terminal moraine dated 1858.(7) The western limit of intense Caledonian deformation is defined by the Moine Thrust Zone, beyond which lies the Caledonian foreland .(8) Siliciclastic sequences within or close to the Laurentian foreland of the Appalachian-Caledonian Orogen preserve a clear depositional contact with basement that constrains their site of accumulation to Laurentia.(9) Our finds were not the first ‘warm artifacts’ to be harvested from the forelands of retreating Swiss glaciers.(10) Not content to rest solely on forelands in nearby Ulster, all three were prepared to sell to customers throughout Ireland.(11) Bars, forelands , and spits are attractive spots for development because they offer easy access to the beach.(12) Floodwater may contain higher carbon dioxide concentrations if the pH is sufficiently low, but both rice fields and river forelands are commonly submerged with water containing little carbon dioxide, e.g. in the range of 3-100 M. 1. promontory :: 2. head :: 3. headland :: English to Nepali Dictionary: foreland Meaning and definitions of foreland, translation in Nepali language for foreland with similar and opposite words. Also find spoken pronunciation of foreland in Nepali and in English language. Tags for the entry "foreland" What foreland means in Nepali, foreland meaning in Nepali, foreland definition, examples and pronunciation of foreland in Nepali language. English to Nepali Dictionary commonly confused words form of verbs Words by Category Topic Wise Words Learn 3000+ Common Words Learn Common GRE Words Learn Words Everyday Most Searched Words Word of the day ● Administrator प्रशासक, प्रबन्धक, निर्देशक, सञ्चालकको, राज्यपाल, मास्टर, शासक, न्यायीक अधिकारी, , तानाशाह, शिक्षक, निरीक्षक, एजेन्ट, नियन्त्रक, खान, उत्तराधिकारी, प्रबंधक, संरक्षकद्वारा, संरक्षक, प्रशासक, परिचर, सञ्चालकको Your Favorite Words
What is an Occupational Therapist? Physical Therapy equipment An occupational therapist is similar to a physical therapist in that they both assist their patients to help them increase mobility, quality of life, and independence. Both types of therapy are recognized in the medical field and educate their patients to prevent and avoid injuries. But the main difference between these two therapists is that occupational therapist treats the entire person, whereas a physical therapist addresses a specific area of the body to improve functionality. According to The American Occupational Therapy Association, Inc. (, “Occupational therapy is the only profession that helps people across the lifespan to do the things they want and need to do through the therapeutic use of daily activities (occupations).” They help a wide range of patients from geriatrics to pediatrics, to those recovering from a stroke, or a person who has dementia. The ultimate goal for occupational therapists is to help their patients live full lives without injuring themselves. An occupational therapist also provides a holistic approach to their therapy, and in doing so, they treat the entire person. Not only do they want to reduce their patient’s pain and increase their mobility, but they also ensure that the home or work environment is suitable. The foundation for the holistic approach is that the interventions fit the patient. Why would someone need an occupational therapist? Some people who need this kind of intervention include children who have developmental problems, as well as social issues. Other individuals who would benefit from this type of treatment are those who are recovering from an operation, like stroke, or who have emotional problems, like dementia patients. Many times, the therapist has the sessions in their patient’s home or school. Once the occupational therapist reviews the environment, they will often provide necessary modifications to ensure the patient’s safety. Other changes would also include helping the patient learn how to maneuver their body without hurting themselves or causing irritation and pain. For example, if an occupational therapist has a patient who has dementia, the patient may need help remembering to dress in the morning. In this case, the therapist’s job is to devise a plan of action that will help their patient remember to get dressed. Patients may have a trigger that will help them remember. When patients remember to do something, they are adding independence, meaning, and self-care back into their lives. Another example would be helping a patient who is a young child with ADHD. These children are often distracting other students and disruptive in the classroom. An occupational therapist will work with the patient’s family and help the child focus on the tasks at hand. One such activity that helps students focus on schoolwork is to identify how their “engine” is running. If it’s running hot, the therapist will give them an exercise to help them slow down, so they can concentrate and not distract other students. For more information about how occupational therapy can help children with ADHD, please see the Occupational Therapy for Children’s website. ( One of the best things about being an occupational therapist is that therapists are not tied down to an office like physical therapists are. Depending on where their patients are, they can initiate therapy sessions where it is most needed, rehabilitation facilities, nursing homes, a private residence, at a school, or even a park with a playground. There is a lot of versatility that comes with being an occupational therapist, which makes the job exciting and keeps the therapist thinking outside the box for creative ways to assist their patients.
The Word of God Name _____________________________________ Address ___________________________________ City________________ State____ Zip Code ______ Country ___________________________________ -- -- -- -- -- -- -- -- Fold On This Line - -- -- -- -- -- -- -- -- -- We suggest the following steps in order to receive maximum benefit from these courses: 1. Ask God to help you before you start. 2. Carefully read the instructions given at the beginning of each lesson. 3. Answer the exams from memory and write out the answers with a lead 4. Review the answers comparing with the lesson and Bible verses, making changes that you believe are necessary. 5. After you have finished with all the questions, carfully remove the exam section from the booklet and send it to the address listed below. NOTICE only send exams. We will correct the exams and return them to you as soon as possible. We will send the next course in the program as well as a New Testament. If you make at least 70% on the course, you may continue studying the other courses that follow. Exam 1 In this exam are ten statements. Some of these express the truth, and others are false. After reading John, chapter 1, verses 1-18, and the lesson, read the statement. If the sentence is in agreement with the Gospel of John and the lesson, put True or T in the space that follows. If the statement is not true, then put False or F in the space provided. An example is given: 0. Christ is the Son of God. _____ You should know that the sentence is true. Therefore, put True or T in the space provided. 0. Christ is the Son of God. __T__ Now, read these 10 statements and put T or F after each one. 1. John gives us a history of Christ, the Son of God. _____ 2. The Son of God is called the Word and the Light. _____ 3. In the beginning God made the Word. _____ 4. The Son of God shows us the way to God. _____ 5. John the Baptist was not the light but gave testimony of the light. _____ 6. If my father is a son of God, that makes me a son of God also. _____ 7. When Christ came to this world, everyone received Him gladly. _____ 8. Moses was a great prophet, and grace and truth came by him. _____ 9. Many people have seen God. _____ 10. If I Believe in Christ, I will be made a son of God. _____ Exam 2 1. John said, "I am the Christ". _____ 2. John called Jesus, "The Lamb of God". _____ 3. John saw the Spirit of God descend as a dove on the Lord Jesus. _____ 4. Andrew, Philip, Simon Peter, and Nathanael were made sons of God. _____ 5. Andrew, heard from John about the Lord Jesus, and he brought Peter to the Lord. _____ 6. The first miracle was a sign to the disciples that Jesus was the Son of God. _____ 7. Jesus drove out those who were doing business in the house of God. _____ 8. Christ knew that He would lay down His life and take it up again. _____ 9. Christ knows the hearts of all men. _____ 10. If a person will receive Christ, Christ will also receive him. _____ Exam 3 We can read many things today that contradict the Word of God. In these lessons we try to present the facts in accord with the Word of God. However, in the exams, some of the statements are not true. This is done on purpose. Here, it is up to you to discern between those that are truth and error. 1. Nicodemus was a very bad man. _____ 2. The new birth occurs at the moment one believes in Christ and receives Him. _____ 3. Only the worst people need the new birth. _____ 4. God sent His Son to condemn the world. _____ 5. John wanted the people to follow him. _____ 6. Whosoever believes in Christ receives eternal life. _____ 7. The woman at the well to whom Christ spoke was a virtous woman. _____ 8. To obtain the water of life, I need to admit that I am a sinner and come to Christ. _____ 9. The woman called others to come to Christ. _____ 10. The second miracle that Christ performed was the healing of a son of a nobleman. _____ Exam 4 1. The man who had been sick 38 years had many friends to help him. _____ 2. Christ helped the impotent man by taking him to the doctor. _____ 3. The Jews were very content that Christ had healed the man on a Sabbath day. _____ 4. He who hears the Word and believes on Christ has everlasting life. _____ 5. God gave the Son the power to give life also. _____ 6. God and the Bible give witness to Christ. _____ 7. Many people would follow Christ if He would promise them riches. _____ 8. When the disciples saw Jesus walking on the water they were afraid. _____ 9. Christ is the true Bread from Heaven. _____ 10. Many of those who were disciples of Jesus were not sure that He was the Son of the living God. _____ Exam 5 1. The brothers of Christ believed in Him from the beginning. _____ 2. If anyone will do the will of God, God will show him the truth of the teachings of Christ. _____ 3. If I believe in Christ, I can show others who the living water is. _____ 4. The officers said, "Never man spake like this man". _____ 5. Jesus said the sinful woman should die. _____ 6. He said she could continue sinning if she wanted to. _____ 7. The true Light shows us the only way to God. _____ 8. I need the power to quit sinning. _____ 9. The devil is the father of lies. _____ 10. Abraham lived hundreds of years before Christ but Christ said he was before Abraham. _____ Exam 6 1. The Son of God is the Lamb of God and the Light of the world. _____ 2. The blind man washed the mud from his eyes with some water and could see. _____ 3. Some people said, after the healing of the blind man, that Jesus was a sinner. _____ 4. The man who had been born blind believed that Jesus was the Son of God. _____ 5. The Lord Jesus is the Door to Heaven given by God. _____ 6. The Good Shepherd gives His life for the sheep. _____ 7. The true sheep follow Christ and hear His voice. _____ 8. The sheep can be plucked out of the hands of God, the Son's hand, and God the Father's hand. _____ 9. In the Gospel of John, we see that all did not believe in Christ. _____ 10. If I come to Christ, recognizing Him as my Shepherd, He will care for me always. _____ Exam 7 1. Mary, Martha and Lazarus lived in Bethany. _____ 2. Lazarus became sick and died. _____ 3. Jesus wept before the tomb of Lazarus. _____ 4. The Son of God called Lazarus from the grave. _____ 5. The Son of God can give life to those who are dead in sins. _____ 6. Caiaphas said that it would be better for one to die for the people. _____ 7. Many of the Jews who saw the things Jesus did believed on Him. _____ 8. Many people called Jesus the King of Israel. _____ 9. God spoke to His Son from Heaven. _____ 10. He that believes on Christ believes on God the Father. _____ Do you have friends to whom you would like for us to send this course? If so, write their names and addresses below. Exam 8 1. Jesus came from the Father and returned to the Father. _____ 2. Those who are washed by Christ are completely clean. _____ 3. Satan put it into the heart of Judas to betray Christ. _____ 4. Christ knew that Judas would betray Him. _____ 5. Christ also knew that Peter would deny Him. _____ 6. Christ taught His disciples that He would die and rise again. _____ 7. Christ is the only way to the Father. _____ 8. God sent the Holy Spirit to help us. _____ 9. Christ gives His peace to all who love Him. _____ 10. We prove our love to the Lord by keeping His commandments. _____ Exam 9 1. Christ is the true Vine and those who believe in Him are branches. _____ 2. Every man is sufficiently clean in himself to stand before God. _____ 3. The Word of God cleanses us. _____ 4. Jesus showed His love by dying for us. _____ 5. If I do what Christ teaches, I am His friend. _____ 6. The Holy Spirit testifies of Christ. _____ 7. To receive Christ is to receive God. _____ 8. Jesus promised the disciples that everyone would love them. _____ 9. Christ prayed for those who were going to believe Him. _____ 10. As there are many roads to God, Christ is only one of them. _____ Can you think of other friends? Write their names and addresses below and we will send them a course. Exam 10 1. We read of the Lord praying to the Father in chapter 17. _____ 2. Only the Lord Jesus Christ has the power to give eternal life. _____ 3. Eternal life comes only by knowing the true God and Jesus Christ. _____ 4. I should work unceasingly in order to obtain the salvation of God. _____ 5. The Word of God has given us the words of God. _____ 6. It is necessary for the saints and angels to intercede for us. _____ 7. The Word of God is always true. _____ 8. Christ prayed for the world to believe that the Father had sent Him. _____ 9. Christ prayed that same love that the Father had for Him might be in those who know the Father sent the Son. _____ 10. The Father did not love the Son because if He had loved Him, He would not have allowed Him to die. _____ Exam 11 1. The Son of God became man and died for our sins. _____ 2. The chief priests and Pharisees bargained with Judas for the be- trayal of Christ. _____ 3. Peter wept after denying that he was a follower of Jesus Christ. _____ 4. Pilate said, "What is the truth". _____ 5. The people wanted to crucify Barabbas instead of Christ. _____ 6. Evil men put a crown of thorns on the head of Christ in mockery. _____ 7. The chief priests believed that Christ was a true King. _____ 8. Three men were crucified on three crosses. _____ 9. Christ could not forgive those who crucified Him. _____ 10. Christ was buried in a tomb in a garden near where He was cruci- fied. _____ If you have other friends, write their names and addresses below and we will send them this course. Exam 12 1. Men crucified Christ, but God raised Him from the dead. _____ 2. Mary Magdalene told John and Thomas that the Lord had been taken out of the sepulcher. _____ 3. Mary was not the first to see the risen Christ. _____ 4. When Jesus spoke Mary's name, she recognized Him. _____ 5. Christ breathed on the disciples and gave them the Holy Ghost. _____ 6. Thomas saw Christ and exclaimed, "My Lord and my God." _____ 7. The Lord appeared to the disciples once after the resurrection. _____ 8. Christ asked Peter three times if he loved Him. _____ 9. John is the disciple who wrote these things. _____ 10. I can be saved today if I believe in Christ as the Son of God and Saviour of the world. _____ We congratulate you for having finished this course on the life of the Lord Jesus Christ. Upon receiving your exams, we will correct them and send you the next course in this series. There are many more courses that we offer that will be of spiritual benefit to you. You have read twelve lessons and 21 chapters of the Gospel of John. You have learned that Jesus, the Son of God, did not sin, but died for our sins. Please read carefully the following statements and write true after those that are true in your case. 1. I know that Jesus is the Son of God. _____ 2. I know that He died to save people from their sins. _____ 3. I believe that I am a sinner and that Jesus died for me. _____ 4. I now receive Him as my Saviour. _____ (If you are already saved, write in this space the approximate date when you received Christ.) _____ 5. I now will live grateful unto God for having pardoned my sin and having saved my soul. _____ Write out in your own words in the space below the place you will go when you die and why. If you have any questions, please include them in the space below.
Georg Hegel, fully Georg Wilhelm Friedrich Hegel Hegel, fully Georg Wilhelm Friedrich Hegel German Philosopher Author Quotes The very attempt to determine the relationship of a philosophical work to other efforts concerning the same subject, introduces an alien and irrelevant interest which obscures precisely that which matters for the recognition of the truth. Opinion considers the opposition of what is true and false quite rigid, and, confronted with a philosophical system, it expects agreement or contradiction. And in an explanation of such a system, opinion still expects to find one or the other. It does not comprehend the difference of the philosophical systems in terms of the progressive development of the truth, but sees only the contradiction in this difference. The bud disappears as the blossom bursts forth, and one could say that the former is refuted by the latter. In the same way, the fruit declares the blossom to be a false existence of the plant. These forms do not only differ, they also displace each other because they are incompatible. Their fluid nature, however, makes them, at the same time, elements of an organic unity in which they not only do not conflict, but in which one is as necessary as the other; and it is only this equal necessity that constitutes the life of the whole. Those sciences, which thus got the name of philosophy, we call empirical sciences, for the reason that they take their departure from experience. In England this is still the usual signification of the term philosophy. Newton continues to be celebrated as the greatest of philosophers: and the name goes down as far as the price-lists of instrument-makers. To understand how to put questions presupposes a certain education. What experience and history teach is this - that nations [people] and governments have never learned anything from history, or acted upon any lessons [principles] they might have drawn from it. When Philosophy with its abstractions paints grey in grey, the freshness and life of youth has gone, the reconciliation is not a reconciliation in the actual, but in the ideal world. The subject-matter of the philosophical science of right is the Idea of right, i.e. the concept of right together with the actualization of that concept. Those substantive characteristics which constitute my own private personality are inalienable. Too fair to worship, too divine to love. What experience and history teaches us is that people and governments have never learned anything from history, or acted on principles deduced from it. When reflection is brought to bear on impulses, they are imaged, estimated, compared with one another, with their means of satisfaction and their consequences, etc., and with a sum of satisfaction (i.e. with happiness). In this way reflection invests this material with abstract universality and in this external manner purifies it from its crudity and barbarity. This growth of the universality of thought is the absolute value in educations. The sublime in art is the attempt to express the infinite without finding in the realm of phenomena any object which proves itself fitting for this representation. The wealthy man is directly compelled to modify his relation of mastery, and even others’ distrust for it, by permitting a more general participation in it. Those who regard thinking as one special faculty, distinct from the will as another special faculty, and who even proceed to contend that thinking is prejudicial to the will, especially the good will, reveal at the outset their complete ignorance of the nature of the will — a remark we shall have to make rather often when dealing with this same subject. In Paragraph 5, it is only one side of the will which is described namely this unrestricted possibility of abstraction, from every determinate state of mind which I might find in myself or which I may have set up in myself, my flight from every content as from a restriction. When the will's self-determination consists in this alone, or when representative thinking regards this side by itself as freedom and clings fast to it, then we have negative freedom or freedom as the Understanding conceives it. This is the freedom of the void which rises to a passion and takes shape in the world; while still remaining theoretical, it takes shape in religion as the Hindu fanaticism of pure contemplation, but when it turns to actual practice, it takes shape in religion and politics alike as the fanaticism of destruction — the destruction of the whole subsisting social order — as the elimination of individuals who are objects of suspicion to any social order, and the annihilation of any organization which tries to rise anew from the ruins. Only in destroying something does this negative will possess the feeling of itself as existent. Of course it imagines that it is willing some positive state of affairs, such as universal equality or universal religions life, but in fact it does not will that this shall be positively actualized, and for this reason: such actuality leads at once to some sort of order, to a particularization of organizations and individuals alike; while it is precisely out of the annihilation of particularity and objective characterization that the self-consciousness of this negative freedom proceeds. Consequently, what negative freedom intends to will can never be anything in itself but an abstract idea, and giving effect to this idea can only be the fury of destruction. Truth in philosophy means that concept and external reality correspond. What is rational is actual and what is actual is rational. On this conviction the plain man like the philosopher takes his stand, and from it philosophy starts in its study of the universe of spirit as well as the universe of nature. If reflection, feeling, or whatever form subjective consciousness may take, looks upon the present as something vacuous and looks beyond it with the eyes of superior wisdom, it finds itself in a vacuum, and because it is actual only in the present, it is itself mere vacuity. If on the other hand the Idea passes for 'only an Idea', for something represented in an opinion, philosophy rejects such a view and shows that nothing is actual except the Idea. When we walk the streets at night in safety, it does not strike us that this might be otherwise. This habit of feeling safe has become second nature, and we do not reflect on just how this is due solely to the working of special institutions. Commonplace thinking often has the impression that force holds the state together, but in fact its only bond is the fundamental sense of order which everybody possesses. The theory which regards the Object as Absolute expresses the point of view of superstition and slavish fear. The will which is but implicitly free is the immediate or natural will. The specific characteristics of the difference which the self-determining concept sets up within the will appear in the natural will as an immediately existing content, i.e. as the impulses, desires, inclinations, whereby the will finds itself determined in the course of nature. This content, together with the specific differences developed within it, arises from the rationality of the will and so is implicitly rational; but, poured out in this way into the mold of immediacy, it still lacks the form of rationality. It is true that this content has for me the general character of being mine; but this form is still different from the content, and hence the Will is still a will finite in character. Thoughts may be termed Objective Thoughts, thoughts accredited able to express the essential reality of things. Truth is found neither in the thesis nor the antitheses, but in an emergent synthesis that reconciles the two. What makes comet wine so good is that the water-process detaches itself from the earth and thus brings about an altered state in the planet. With us philosophy is not practiced as a private art, as it was by the Greeks, but has a public place, and should therefore be employed only in the service of the state. The tool lasts, while the immediate enjoyments pass away and are forgotten. In his tools man possesses power over external nature, even though in respect of his ends he is, on the contrary, subject to it.. The will's activity consists in annulling the contradiction between subjectivity and objectivity and giving its aims an objective instead of a subjective character, while at the same time remaining by itself even in objectivity. Outside the formal mode of willing (i.e. consciousness) where objectivity is present only as immediate actuality, this activity is in essence the development of the substantive content of the Idea - a development through which the concept determines the Idea, itself at first abstract, until it becomes a systematized whole. This whole, as what is substantive, is independent of the opposition between a merely subjective aim and its realization and is the same in both despite their difference in form. Author Picture First Name Last Name Hegel, fully Georg Wilhelm Friedrich Hegel Birth Date Death Date German Philosopher
As of July 1st, California Law requires all homes to have a carbon monoxide detector installed. According to the Centers for Disease Control, 15,000 people per year are treated for carbon monoxide poisoning in the U.S., and approximately 500 of these poisonings result in death. Carbon monoxide (CO) has been called the invisible killer because it is a colorless, odorless, tasteless, toxic gas. Carbon monoxide is a gas that is created when fossil fuel (natural gas) is partially burned. When fossil fuels are fully burned they create carbon dioxide which is safe to breath. When we inhale carbon monoxide our bodies are fooled into thinking that it’s oxygen so our natural alert system, the gasp for air, is short-circuited. The lack of oxygen makes us drowsy with an unfortunate outcome. One of the reasons the CO poisoning is on the rise is that new homes are built with high energy standards that there is very little air transfer between the inside of your home and fresh air from the outside, so bad gases are trapped indoors. For more information on how to prevent carbon monoxide poisoning visit the CAL FIRE website at You can purchase detectors at your nearby hardware store. The cost range is between $20 to $75,
Print this page Wednesday, 09 August 2017 12:00 Why Should You Start Investing Immediately? The Magic Of Compound Interest Written by Beginner Investor Series. Compound Interest - Why You Should Start Investing Immediately This article is part of the Beginner Investor Educational Series. To access other articles in this series, please take a look at the menu on the right side of this page (or at the bottom on mobile devices), or start here. What Is Compound Interest? Compound interest basically means that interest is also calculated on any previously accrued interest. For example, if you have $10,000 earning 10% interest yearly, then the first year you would gain 10% x $10,000, or $1,000. Your total balance is now $11,000. The following year, you would gain 10% x $11,000, or $1,100. Your total balance is now $12,100. This continues in a snowball effect that exponentially increases the value of this entity. Time Could Be Your Best Friend When it comes to compound interest, time could be your best friend... IF you start investing EARLY. The more time time you allow your investments to grow, the more they will compound and earn substantial returns. Many people forego investing for retirement while they are in training, with the rationale of: "I can start investing when I am an attending." This is a terrible idea, and I will show you why. I will show you how much future value you are sacrificing by not investing now, using the timeline of my residency and fellowship training as an example. I was in training from 2011-2017, which is a 7 year time period in which I was investing as much as I could. For the following example, let's use just the amount that I could put into a Roth IRA. In 2011 and 2012, that was $5,000 per year. From 2013-2017, I could put in $5,500 each. In total, that would be a contribution of $37,500 over 7 years. Assuming an 8% annual rate of return, which is a conservative estimate of the nominal (pre-inflation) rate of return, this is how much this investment will grow, with compound interest: projected return of ira only investments - invested from 2011-2017 That initial investment of $37,500 can potentially grow to $443,011 by the time I turn 60! As a side note, you can start withdrawing earnings from a Roth IRA tax-free and penalty-free at age 59 1/2, which is why I chose 60 as the endpoint. How many extra years of working as an attending would you need to make up this amount? That could be maybe 2-3 years. How much extra would you have to save as an attending to make up this amount by age 60? The answer is $4,261 per year for the next 29 years. The total you would need to contribute would be $123,572 instead of just $37,500. This becomes even more compelling if you include the amount you could invest into your 403(b) or 401(k) account. For me in 2011, the maximum contribution was $16,500. In 2012, it was $17,500. From 2013-2017, it was $18,000 per year. Adding this to the Roth IRA contributions yields a total of $160k contributions over 7 years. With the same 8% growth rate, this is the future value of that investment by the time I turn 60: projected return of ira and 401(k)/403(b) investments - invested from 2011-2017 $1.89 MILLION!!! This amount alone is probably sufficient to maintain my lifestyle after I turn 60. That also means that any subsequent savings I have from starting as an attending until the age of 60 could go towards early financial independence. Could it happen in less than 10 years? I hope so! To further convince you, if you deferred this savings 7 years until you became an attending, then you would need to contribute $18,192 per year for the next 29 years to get to $1.89 million. That requires a total contribution of $527,579 instead of just $160,000. Granted, it will be difficult to max out your retirement accounts while you are in training, unless you moonlight like a boss. The point of this exercise was to illustrate for you the power of compound interest over time. You should invest early, often, and as much as you can to achieve your goals. Have I convinced you yet? Here are questions you need to ask yourself if you are still hesitant to invest now: • Are you willing to save an extra 5%-10% as an Attending for the rest of your career to make up for what you didn't save before? • Can you continue living like a Resident for many years out of training, and put the excess income into investments? If you answered yes to either of those, then you will probably be fine. Otherwise: • Are you willing to work past age 60 not because you want to, but because you have to? Yikes. To that, I say, no thanks. The long term effects of compounding interest can be hard to imagine, but can be made easier by thinking of the time it takes for an investment to double. The next section will give you a way to quickly calculate investment returns, called the "Rule of 72". The Rule of 72 The Rule of 72 The rule of 72 is great for "back of the napkin" math to analyze an investment return. It approximately calculates two things: 1. The # of years it takes an investment to double given the annual compound interest rate. 2. The annual percent rate of return (RoR) of an investment given the amount of time in years that it takes to double. Here are two practical examples: 1. You bought a house 18 years ago for $100k. Today it is worth $300k. What is the annual rate of return of this purchase? • The value of the house has doubled approximately 1.5 times. That gives it a doubling time of 12 years. 72 divided by 12 gives you a RoR of approximately 6%. • The true answer is actually 6.29%, but this is a close enough approximation. 2. You currently have $250k invested in the S&P500 index fund. You want to know when this initial investment will break $1 million, given an annual ROR of 8%. • The doubling time of this investment is 72 divided by 8, which is 9 years. • The investment needs to double twice in order to hit $1 million, which means 2 x 9, or 18 years. Hopefully, you now understand the power of compound interest. To take advantage of compound interest, you need to start investing RIGHT NOW! Last modified on Wednesday, 09 August 2017 12:38 Related items
Feathers and dragons Feathers are light, delicate and fragile. You can easily blow them away and damage them, if you want to. Dragons are strong and powerful. They can become rather dangerous, at least as long as nobody stops them. Children are sometimes a bit like feathers and sometimes a bit like little dragons. They can change their behaviour very quickly - one moment they are sweet and innocent and another moment they are stubborn and recalcitrant. As long as there is a balance, this does not matter very much. But as soon as the feathery quality or dragonlike behaviour becomes too strong, there is a problem. Then the adults should take action. A too dragonlike behaviour has to be stopped before it escalates. And a too feathery child should be helped to get more fighting spirit. Whenever this -for whatever reason- does not happen, the problem that is called bullying can become a trauma. In my case this is what happened. I was such a feathery child, not able to withstand the dragonlike behaviour of my classmates. With the project feathers and dragons I want to demonstratie how much impact being bullied for a long time can have. I go back in time and write about what I experienced and felt when I was a child. After that I have a critical and honest look at myself and I discover how the bullying has changed me. I perceive which animal qualities I have and I realize that the outer dragon has been exchanged for an inner dragon. I observe how destructive this dragon is and I am determined to conquer this dragon. How I do this becomes clear during this project. And then vulnerability changes into strength. feather vase with machine embroidered feathers
• Join over 1.2 million students every month • Accelerate your learning by 29% • Unlimited access from just £6.99 per month 1. 1 2. 2 3. 3 4. 4 5. 5 6. 6 7. 7 8. 8 9. 9 10. 10 11. 11 This assignment is about planning and designing practical experiment to carry out an investigation of how various antimicrobial agents' effect new strain of bacterium E.coli (Eschericia coli). Extracts from this document... BTEC National Diploma Applied Science UNIT TITLE: SCIENTIFIC METHODS UNIT NUMBER: 5 Assignment title- individual investigation (Antibiotics) This assignment is about planning and designing practical experiment to carry out an investigation of how various antimicrobial agents' effect new strain of bacterium E.coli (Eschericia coli). I chose antibiotics as antimicrobial agent to investigate the effects on new strain of E.coli, using clear zones. An antibiotic is any chemical compound used to kill or inhibit the growth of infectious organisms, particularly bacteria and fungi Aim The aim of this practical is, to investigate the action of selection of antibiotics on bacteria (E.coli). Hypothesis E.coli (bacterium) will be killed effectively, but this will depend on the type of antibiotic used, because there are 2 types of bacteria (Gram-positive and Gram-negative bacteria). E.coli is Gram-negative bacteria; this means it could be resistant or susceptible to some antibiotics. I think erythromycin, streptomycin, tetracycline and chloramphenicol will work well in this practical because they are all broad spectrum bacteria. Variable * E.coli was used for both dishes to keep the strain of bacteria same * Size of agar plates was also same to keep the size of clear zone to be measured the same. * 0.2cm3 of E.coli used for each plate * incubation temperature was constantly kept at 30oc * Sterilised syringes, forceps and loop are used for both dishes, so unwanted contamination is avoided. ...read more. * By using match stick, the Bunsen burner was light and adjusted it to blue flame; this is the hottest and is done to make sure to avoid contaminations. Worked near Bunsen burner throughout the practical, again to avoid contamination. * A bottle containing E.coli was opened with little finger on other hand to avoid placing the lid on the bench * The bottle is then flamed at the neck for few seconds, by passing the opening through the Bunsen burner. This is done to produce an upward flow of air from the bottle so that any organism in the area will not fall into the bottle. * A sterilised syringe was used to transfer 0.2 cm3 of E.coli and placed in the centre of the agar plate. * A spreader that has been sterilised was used by dipping it in alcohol in a container and then the spreader was flamed over a Bunsen burner and allowed to burn and waited till it cooled down. * The sterilised spreader was used to spread the bacteria (E.coli) over the agar in the plate, until the bacteria was well spread over the agar * Forceps were sterilised by flaming it over Bunsen burner for few seconds * The sterilised forceps were used to place the antibiotic multi-test discs in the agar plate until flatly placed. ...read more. May be if the concentration of E.coli increased and the whole practical is repeated again, the results may change and antibiotics such as chloramphenicol with average result of 2.85cm3 would kill bacteria better. In the experiment of some antibiotics overlapped, and because of this it was difficult to measure the area of no growth accurately and it could be measurements were done more than 24 hours. This can be avoided by placing each antibiotic disc on separate plate, so the overlapping of antibiotics will be well avoided. May be I didn't place the antibiotic multi-test disc in the agar plate flatly, and so the antibiotics didn't had good contact with the E.coli. Generally this practical can be improved with following extensions * One could have looked at different types of bacteria, for example one could have used gram-positive bacteria and used penicillin instead of gram-negative bacteria. * An effective antibiotic out of the eight antibiotics used in practical, could be used e.g. tetracycline which was most effective to the E.coli. * One can also use two different types of bacteria for example gram-positive bacteria and gram-negative bacteria and compare them to find out which one is resistant or susceptible to antibiotics. * Different antibiotics may work with different incubator temperature and may be if the temperature of the incubator is increased antibiotics such as chloremphenicol may work better with the E.coli. ...read more. The above preview is unformatted text This student written piece of work is one of many that can be found in our GCSE Living Things in their Environment section. Found what you're looking for? • Start learning 29% faster today • 150,000+ documents available • Just £6.99 a month Not the one? Search for your essay title... • Join over 1.2 million students every month • Accelerate your learning by 29% • Unlimited access from just £6.99 per month See related essaysSee related essays Related GCSE Living Things in their Environment essays 1. Marked by a teacher Research question - Is using dogs for work ethical? 5 star(s) A way I made it fair is that in my questionnaire I had to ask everyone the same questions. It was important that I asked everyone the same questions because I was able to compare several different answers to the same question and choose the average response to it. 2. Marked by a teacher Escherichia coli and antibiotic resistanceIntroduction:Escherichia coli, short E. coli is an important bacteria that ... 5 star(s) Penicillin destroys gram-positive bacteria by destroying the peptidoglycan wall. In a typical bacteria environment, rapture in cell wall will almost always cause an explosion or disfigurement of the bacteria, thus destroying the bacteria. Penicillin does not work well against gram-negative bacteria because peptidoglycan wall is located deeper within the cell wall, thus making it difficult for penicillin to destroy the bacteria. 1. Marked by a teacher A2 Biology Coursework -Investigation into the effect of different concentrations of antibiotics on the ... 4 star(s) This is to prevent temp affecting the rate at which the bacteria are grown. PH Level - I will add buffer solution to prevent this factor becoming a variable. Time - I will use a timer to time the incubation period. 2. Marked by a teacher The effect of antibiotics on the growth of bacteria. 4 star(s) were using, then placing our equipment on the lab roll we placed one of our four agar plates in a way which we could approach it the best, we slowly and carefully opened it so that we did not contaminate the plate with other bacteria from the environment. 1. Micro-organisms,most effective antibiotic to act against the two types of bacterium: E.coli and B.subtilis. Tell staff and seek medical help immediately. Bacillus subtilis Can cause severe eye infections Low risk because low concentration is used. Low risk if followed the method carefully. Wear safety goggles, gloves and lab coat. Tell staff and seek medical help immediately. Apparatus and equipment used: * 2 x bottles of molten nutrient agar * 2 x 2. Extended Experimental Investigation - Natural Antibiotics It is common for E. Coli to be found in the lower intestines of mammals. "The number of individual E. coli bacteria in the feces that a human excretes in one day averages between 100 billion and 10 trillion [http://en.wikipedia.org/wiki/Escherichia_coli]." 1. An investigation into the antibiotic effects of penicillin and streptomycin on the bacterium Escherichia ... They have been used to treat a wide variety of often dangerous illnesses since. Scanning electron micrograph of Escherichia coli, grown in culture and adhered to a cover slip. (2) E. coli is one of the most common bacteria that live in the lower intestines of mammals. 2. Testing the effectiveness of various anti microbial agents. Do not open the plates as this will release the bacteria and it could be very harmful. Fair test: ~ To make this experiment a fair test you must: ~ *Sterilise ALL of the equipment. If some of it is un-sterilised then the bacteria on this item may affect the experiment as it may get onto the agar jelly. • Over 160,000 pieces of student written work • Annotated by experienced teachers • Ideas and feedback to improve your own work
<font id="U7M7"></font> <ol id="U7M7"></ol> <font id="U7M7"><del id="U7M7"></del></font> <meter id="U7M7"><cite id="U7M7"></cite></meter> <mark id="U7M7"></mark> <b id="U7M7"></b> <form id="U7M7"><var id="U7M7"></var></form> <b id="U7M7"></b><pre id="U7M7"><ins id="U7M7"></ins></pre> The Problem By the year 2050, nearly 80% of the earth’s population will reside in urban centers. Applying the most conservative estimates to current demographic trends, the human population will increase by about 3 billion people during the interim. An estimated 109 hectares of new land (about 20% more land than is represented by the country of Brazil) will be needed to grow enough food to feed them, if traditional farming practices continue as they are practiced today. At present, throughout the world, over 80% of the land that is suitable for raising crops is in use (sources: FAO and NASA). Historically, some 15% of that has been laid waste by poor management practices. What can be done to avoid this impending disaster? A potential solution:?Indoor farming
Skip to main content Economists: $15 wage would help 3 million New Yorkers Annette Bernhardt, Wikipedia A new study by economists at the University of California-Berkeley predicts that raising New York state's minimum wage to $15 would improve the living standards of more than 3 million people, far outweighing what the report calls a "small" negative effect on employment. The report estimates that raising the now $9-per-hour wage to $15 would give the average effected worker $4,900 more annually. They concede that higher labor costs could slow job growth, but expect that to be tempered by benefits including increased spending in local economies, higher productivity and less reliance on government assistance. The $15 minimum wage idea comes from Gov. Andrew Cuomo, who wants to phase in the increase to help businesses adjust. Business owners say the increase will force them to raise prices and cut positions.
Challenge 12 - That’s a lot of moneyz Your friend has a lot of spare coins and asks you for help as the town’s fastest money-counter. However, you recently had some technical problems and ended up using your teapot as a router, so the photos coming through are a little bit corrupted. But that’s no problem for you, am I right? As you can guess after seeing the image, your friend uses euro coins, and each time he sends you a photo you will have to tell him how much money (in cents) is in the image. Remember that 1 and 2 euro coins are equivalent to 100 and 200 cents each! NOTE: In this level, the output for the submit phase is the same as the output for the test phase.
Credit: (Flickr) NICHD By — @christnjournal — See Comments Region: Published: July 3, 2017 Updated: April 29, 2018 at 8:37 am EST Researchers at Carnegie Mellon University have uncovered how to, essentially, read minds. Using functional magnetic resonance imaging (fMRI) and machine learning the team viewed how the brain encodes various thoughts (based on blood-flow patterns in the brain). “One of the big advances of the human brain was the ability to combine individual concepts into complex thoughts, to think not just of ‘bananas,’ but ‘I like to eat bananas in evening with my friends,’” said CMU’s Marcel Just, the D.O. Hebb University Professor of Psychology in the Dietrich College of Humanities and Social Sciences. “We have finally developed a way to see thoughts of that complexity in the fMRI signal. The discovery of this correspondence between thoughts and brain activation patterns tells us what the thoughts are built of.” The project follows up on previous research, that is funded by the United States Government, Intelligence Advanced Research Projects Activity (IARPA), to provide evidence that the neural dimensions of concept representation are universal across people and languages. The findings represent a Biblical confirmation that God did truly divide the people of Babel even though He created each individual with the same language mechanisms; The Tower of Babel is described in Genesis 11:1-9. After the Flood, God commanded humanity to “increase in number and fill the earth” (Genesis 9:1). Humanity decided to do the exact opposite, “Then they said, ‘Come, let us build ourselves a city, with a tower that reaches to the heavens, so that we may make a name for ourselves and not be scattered over the face of the whole earth’” (Genesis 11:4). Humanity decided to build a great city and all congregate there. They decided to build a gigantic tower as a symbol of their power, to make a name for themselves (Genesis 11:4). This tower is remembered as the Tower of Babel. In response, God confused the languages of humanity so that they could no longer communicate with each other (Genesis 11:7). The result was that people congregated with other people who spoke the same language, and then went together and settled in other parts of the world (Genesis 11:8-9). God confused the languages at the Tower of Babel to enforce His command for humanity to spread throughout the entire world. Got Questions As these are the End Times it is no surprise that mathematics and science are the common language that is both being used to reconstruct the Tower of Babel in a sense, and to reunite what God divided. The Abstract of the findings can be seen below; Even though much has recently been learned about the neural representation of individual concepts and categories, neuroimaging research is only beginning to reveal how more complex thoughts, such as event and state descriptions, are neurally represented. We present a predictive computational theory of the neural representations of individual events and states as they are described in 240 sentences. Regression models were trained to determine the mapping between 42 neurally plausible semantic features (NPSFs) and thematic roles of the concepts of a proposition and the fMRI activation patterns of various cortical regions that process different types of information. Given a semantic characterization of the content of a sentence that is new to the model, the model can reliably predict the resulting neural signature, or, given an observed neural signature of a new sentence, the model can predict its semantic content. The models were also reliably generalizable across participants. This computational model provides an account of the brain representation of a complex yet fundamental unit of thought, namely, the conceptual content of a proposition. In addition to characterizing a sentence representation at the level of the semantic and thematic features of its component concepts, factor analysis was used to develop a higher level characterization of a sentence, specifying the general type of event representation that the sentence evokes (e.g., a social interaction versus a change of physical state) and the voxel locations most strongly associated with each of the factors. – More According to Lead Google engineer Ray Kurzweil the future possibilities of this technology are as follows; It’s conceivable that the CMU brain-mapping method might be combined one day with other “mind reading” methods, such as UC Berkeley’s method for using fMRI and computational models to decode and reconstruct people’s imagined visual experiences. Plus whatever Neuralink discovers. Or if the CMU method could be replaced by noninvasive functional near-infrared spectroscopy (fNIRS), Facebook’s Building8 research concept (proposed by former DARPA head Regina Dugan) might be incorporated (a filter for creating quasi ballistic photons, avoiding diffusion and creating a narrow beam for precise targeting of brain areas, combined with a new method of detecting blood-oxygen levels). Using fNIRS might also allow for adapting the method to infer thoughts of locked-in paralyzed patients, as in the Wyss Center for Bio and Neuroengineering research. It might even lead to ways to generally enhance human communication. The CMU research is supported by the Office of the Director of National Intelligence (ODNI) via the Intelligence Advanced Research Projects Activity (IARPA) and the Air Force Research Laboratory (AFRL). CMU has created some of the first cognitive tutors, helped to develop the Jeopardy-winning Watson, founded a groundbreaking doctoral program in neural computation, and is the birthplace of artificial intelligence and cognitive psychology. CMU also launched BrainHub, an initiative that focuses on how the structure and activity of the brain give rise to complex behaviors. Share Your Thoughts Filed Under Topics Covered: , , Tags: , ,
Open main menu Tjasker Ossenzijl The tjasker (West Frisian: jasker, German: Fluttermühle) is a small type of windmill used solely for drainage purposes. It is distinctive for its simple construction, featuring only a single inclined shaft that carries the sails on one end and an Archimedes' screw on the other, in this way avoiding the need for any gearing.[1] The tjasker is commonly known as a typical Frisian windmill[2] though it is also found in other Dutch provinces and in north Germany. The tjasker seems to have been developed somewhere towards the end of the 16th century, though there is no conclusive date for its invention.[2] The total number of tjaskers at their peak is also unclear. The mills were used to drain small plots of land but also found their use at peat digging sites as they could be easily moved.[3] Millwright R.W. Dijksma of Giethoorn was well known for his tjasker building. He constructed 400 to 500 tjaskers between 1910 and 1945, though these numbers include hand powered Archimedes' screws.[2] In the first half of the 20th century tjaskers almost completely disappeared as they couldn't compete with the metal windpump which was more practical as it could turn itself to face the wind and didn't require any supervision. The last tjasker was erected in 1935 and by 1963 there were only three left in the Netherlands. In that year emerging views on nature preservation and cultural history resulted in the installation of a brand new tjasker in De Weerribben.[2] Since then, several other new tjaskers have been built, to pump water into wetlands and as cultural monuments. Currently, there are 28 tjaskers in the Netherlands[4] and six tjaskers in Germany. Detail of a working tjasker The tjasker has only one wooden millshaft on which all machinery is carried. This shaft is inclined at an angle of approximately 30° and supported in a wooden frame. On the lower end it carries the Archimedean screw which is partly submerged in water. The screw doesn't rotate in a pipe but has a fixed encasing which simplifies the design further. The top end of the shaft carries the Common sails with a span of approximately 5 to 6 meters. In some cases wooden slats are used instead of sail cloth. The mill can be stopped using a band brake on the brake disk which is fitted on the shaft behind the top bearing. Paaltjasker and boktjaskerEdit The entire mill has to be rotated to face the wind. To accomplish this two types of tjasker have developed. In the first type, known as paaltjasker (English: post tjasker), the mill is supported on and turned around a central post. The Archimedes' screw pumps water from the outer circular ditch to a central circular ditch or pool. The screw moves in a circle when the mill is turned so these circular ditches enable the mill to function in whatever direction it is pointing. Only the outlet from the central pool taking the raised water across the outer circular ditch prevent the use of the mill facing opposite that particular direction as the screw would collide with the water outlet. The second type of tjasker, the boktjasker (English: trestle tjasker), is not balanced on a central post but supported on a trestle. The lower submerged support is fixed, the mill is rotated around this point, while the other end is movable. Here the trestle is commonly equipped with rollers or wheels on a fixed ring to make winding easier. In this method of construction the Archimedes' screw takes water from a central pool and deposits it in a circular ditch that surrounds the central pool. Water can be taken to the central pool by a pipe or a gap in the circular ditch. Besides the structural differences, a typical paaltjasker is designed so it can relatively easily be dismantled to be moved to another location or stored indoors though nowadays this feature is rarely used. A boktjasker is more or less fixed to its location. Example of a boktjasker. Tjasker Augustinusga in 2007 Example of a paaltjasker. Tjasker It Heidenskip in 2009 A third type of tjasker has been rediscovered from old drawings. It has a tail keeping the mill facing in the wind and a scoop wheel instead of an Archimedes' screw. After having built a functional model the reconstruction of a full sized staarttjasker (English: tail tjasker) is now planned.[5] 1. ^ Gilde van Vrijwillig Molenaars (1993). Basisopleiding voor de vrijwillig molenaar (in Dutch). Bunschoten/Spakenburg: De Bunschoter. pp. 54–57. ISBN 90-9005722-6. 2. ^ a b c d Blom, L.H. (1976). De tjasker, een zeldzaam molentype (in Dutch). Zwolle: Uitgeverij Waanders. ISBN 90-70072-15-7. 3. ^ Leo Endedijk; et al. (2007). Molens, De Nieuwe Stokhuyzen (in Dutch). Zwolle: Waanders Uitgevers. pp. 76–79. ISBN 978-90-400-8785-1. 4. ^ "Molendatabase:type tjasker". 5. ^ "Terugkeer van de staarttjasker". Leeuwarder Courant. 2011-05-14. External linksEdit
From all over the world the headlines continue to pour in, change is occurring at blinding speed. As our forests and wildlife disappear, instead of planting trees, so called “civilized” nations are building yet more weapons of mass destruction. As devastatingly high levels of methane fill the atmosphere, industry is given the green light to unleash even more. A new science study has now determined past planetary extinctions occurred “instantaneously” on a geologic time scale. The current mass extinction is statistically occurring at least 170 times faster. Where does that leave us? The latest installment of Global Alert News is below. Share \| Download(Loading)
Vegetable Gardening Tips Some tips about vegetable gardening from garden thermometers - Fresh Vegetables picked from the garden when they are at their very best are the culmination of all the hard work and skill, which you, the gardener has put into your garden or allotment. Eating food produced in your own garden provides you with the satisfaction of knowing exactly where the food has come from and how it has been handled/grown - unlike vegetables from the supermarket. Choose a spot that gets plenty of sun; one that ideally faces south. Mark out the bed and dig the area to break up the ground and improve the drainage. Add manure or other organic matter; use home-made compost or a commercial soil improver. Use narrow, raised beds as these make gardening less tiring - they take a lot of the strain out of gardening and reduce the amount of bending.They also increase the soil depth and/or drainage for shallow or poorly drained soils Growing your own vegetables is one of the best aspects of gardening to many people. It has several benefits too. Firstly it can help you physically get in shape as a useful form of exercise and it can also boost your psychological well-being. Home grown also scores highly against similar produce found in your local supermarket on two counts. It will cost far less to grow your own and, secondly, your home grown vegetables are likely to taste better too. Furthermore, you and your family are far more likely to eat the recommended 5 portions of vegetables a day if you grow your own if you don’t already do so. You will also benefit from knowing exactly where your vegetables have come from and what has been used in the growing process unlike in the supermarkets where we are never quite sure how and where the produce has been grown or what they use to preserve it for as long a shelf life date as possible. It is worth bearing in mind that the longer the time between a vegetable being picked and being eaten, the more goodness it loses so growing your own makes a lot of sense for so many different reasons. why grow your own what to grow promoting growth soil condition & pH Product successfully added to the product comparison!
Rapidly Expanding Global Water Requirements The worldwide water industry is experiencing revolutionary changes due to both demand factors, and the increasing scarcity of inexpensive supply alternatives. This is prompting unprecedented investment opportunities in infrastructure, resource development, efficiency, water quality/quantity monitoring, privatisation, industry consolidation and technological change. In the developing world, more than 1 billion people lack access to a reliable and adequate water supply and to safe wastewater disposal systems. Addressing their needs requires hundreds of billions of dollars of investment by governments and private industry. The OECD estimates that by 2025 water will make up the lion’s share of global infrastructure investment with water spending topping $1 trillion that year. This amount is nearly triple the amounts needed for investments in electricity or transport. For developing countries alone, an estimated $103 billion per year is needed to finance water, sanitation, and wastewater treatment. Fresh Water Scarcity The United Nations estimates that by 2050 over two billion people in 48 countries will lack sufficient water. Over 70% of our Earth’s total surface is covered by water but although water seems abundant, the real issue is fresh water availability, since 97.5% of all water on Earth is salt water, leaving just 2.5% as fresh water. Nearly 70% of the available 2.5% fresh water is frozen in the icecaps of Antarctica and Greenland; the bulk of the remainder is present as soil moisture or lies in deep underground aquifers as groundwater not accessible to human use. Only 1% of the world’s fresh water (that is just 0.007% of all the water on earth) is accessible for direct human use. The water industry provides clients with attractive inflation linked pricing, monopolistic business models, sticky customers, high visibility cash flows, and long term contracted revenues. The very local aspect of water creates regionalised supply and demand imbalances not affected by global supply swings. As a non-substitutable resource, water’s relatively inelastic demand insulates it from economic cycles when compared to other most other commodities and investments. Water rates have demonstrated positive pricing power, historically increasing at a rate greater than inflation, largely driven by infrastructure upgrades and expansion. Liberty House Capital Water Graph
Debt and depreciation essay A+ Get Full Essay Get Access However, the costs during this period were also high for both companies in proportion to their scope of operation. Cost increases are shown in such areas as research and development, debt, and depreciation. This cost increase does hint that the companies expected (or at least hoped for) an even greater demand for fleets in the future. In fact, costs demonstrated so great a part in the actions of McDonnell Douglas during that period that one of those three years found them with negative returns on equity.The year 1989 was particular bad for McDonnell Douglas, whose return on equity plummets from 12. 1% to -1. 1%–a whopping 13 percentage points within only a one-year period (Vayle, 1993). This demonstrates that their perceived demand outstripped the demand they had previously had to the point that their current revenue could not cover the launching costs for their new fleet. Demand is also seen to be on the rise for Boeing, but their continuance in the green indicates that their current demand (at the time) was higher than McDonnell Douglas and therefore able to cover launching costs. The data on market share demonstrates that the areas in which McDonnell Douglas was losing ground in the growing industry were being taken up by the newer aircraft company Airbus. The growth predicted in the market for aircraft demonstrates that at the beginning of the 1990’s, the aircraft industry had very high prospects. Not only was it time to begin replacing a large portion of the outdated fleets, but demand for altogether new craft was predicted even to outstrip demand for replacement. Therefore, growth was expected to increase doubly during the 1990’s. Changes in the constitution of the fleets required were also a part of the nineties. While more aircraft belonging to the 120-170 passenger carriers were projected to be required during that decade, the most money would be spent on aircraft that carried more than 350 passengers. This suggests that while an increase in demand for such craft might have been possible, these craft costs were disproportionately higher. In the 1970’s Airbus began its development of the first aircraft that carried twin engines, a wide body, and the ability to travel close to 350 passengers up to 4,000 miles.As a Boeing executive, this aircraft manufacturer’s pioneering efforts would have distinguished them as a force to be reckoned with. Furthermore, the fact that partnerships existed between the Aerospatiale, Deutsche Airbus, Aerospace, and CASA (representing the merging of efforts among four of Europe’s leading nations France, Germany, England and Spain) would have made Airbus’ move into this long-range, high-capacity niche even more formidable. The options that exist in such an occasion is to also begin expansion into these high-capacity and long-range areas. It might be considered as crucial for Boeing to act in order to prevent Airbus from cornering the market on longer and fuller flights (Vayle, 1993). However, other options exist that involve merely catering to the smaller and newer airlines that would continue to require smaller planes in-so-doing focus on the greater demand that would be expected in that area.However, it would have to be carefully noted precisely how the increase in demand for domestic flights (on the consumer end) compared with increase in demand for trans-continental flights. As it turned out, the demand for smaller planes did actually end up far above that of the demand for large planes. However, the revenue garnered from the larger planes was higher than that for the smaller ones. Therefore, cost-benefit analyses of manufacturing these two types of planes would need to be carried out before the decision is made in either direction. Get access to knowledge base MOney Back No Hidden Knowledge base Become a Member
An emaciated 18-year-old Russian girl looks into the camera lens during the liberation of Dachau concentration camp in 1945. Dachau was the first German concentration camp, opened in 1933. More than 200,000 people were detained between 1933 and 1945, and 31,591 deaths were declared, most from disease, malnutrition and suicide. Unlike Auschwitz, Dachau was not explicitly an extermination camp, but conditions were so horrific that hundreds died every week. # Estimates of Jewish participation in partisan units throughout Europe range from 20,000 to 100,000.[323] In the occupied Polish and Soviet territories, thousands of Jews fled into the swamps or forests and joined the partisans,[324] although the partisan movements did not always welcome them.[325] An estimated 20,000 to 30,000 joined the Soviet partisan movement.[326] One of the famous Jewish groups was the Bielski partisans in Belarus, led by the Bielski brothers.[324] Jews also joined Polish forces, including the Home Army. According to Timothy Snyder, "more Jews fought in the Warsaw Uprising of August 1944 than in the Warsaw Ghetto Uprising of April 1943".[327][r] In the early part of 1939, my father, mother and infant brother were living in Paris, as refugees from the pogroms in Romania. They were illegal immigrants, living modestly with the hope of giving themselves and their son a better future than the one they had. But World War II was approaching, and the citizens of France were in danger of falling prey to the Vichy regime that was collaborating with Germany and Hitler. As Jews and illegal residents, my parents were in an extremely precarious situation. They were poor and had no connections or reasonable way of changing their situation. But a gentile, the wife of an Italian diplomat for whom my mother sewed her clothes, understood what the future of my family would be if they stayed in France. In an act of righteousness, mercy and generosity, she offered my parents tickets: first for the train to Marseilles and then, passage onto a ship bound to Bolivia. I was born in Bolivia, where my family’s life was spared the horrors of the Holocaust. I have eternal gratitude to the woman who saved us. On January 20, 1942, several top officials of the German government met to officially coordinate the military and civilian administrative branches of the Nazi system to organize a system of mass murder of the Jews. This meeting, called the Wannsee Conference, "marked the beinning of the full-scale, comprehensive extermination operation [of the Jews] and laid the foundations for its organization, which started immediately after the conference ended" (Yahil, The Holocaust, p. 318). The digging got underway the first night in February 1944, in a storeroom at the back of the bunker. To disguise their efforts, the prisoners erected a fake wall over the tunnel’s entrance, with “two boards hanging on loose nails that would come out with a good tug, making it possible to pass through,” Farber recalled in The Complete Black Book of Russian Jewry, a compilation of eyewitness testimonies, letters and other documents of the Nazi campaign against Jews in Eastern Europe published in part in 1944 and translated into English in 2001. Throughout German-occupied territory the situation of the Jews was desperate. They had meagre resources and few allies and faced impossible choices. A few people came to their rescue, often at the risk of their own lives. Swedish diplomat Raoul Wallenberg arrived in Budapest on July 9, 1944, in an effort to save Hungary’s sole remaining Jewish community. Over the next six months, he worked with other neutral diplomats, the Vatican, and Jews themselves to prevent the deportation of these last Jews. Elsewhere, Le Chambon-sur-Lignon, a French Huguenot village, became a haven for 5,000 Jews. In German-occupied Poland, where it was illegal to aid Jews and where such action was punishable by death, the Zegota (Council for Aid to Jews) rescued a similar number of Jewish men, women, and children. Financed by the London-based Polish government in exile and involving a wide range of clandestine political organizations, Zegota provided hiding places and financial support and forged identity documents. The Nazi invasion of the Soviet Union codenamed Operation Barbarossa, which commenced on 22 June 1941, set in motion a "war of destruction" which quickly opened the door to systematic mass murder of European Jews.[30] For Hitler, Bolshevism was merely "the most recent and most nefarious manifestation of the eternal Jewish threat".[31] On 3 March 1941, Wehrmacht Joint Operations Staff Chief Alfred Jodl repeated Hitler's declaration that the "Jewish-Bolshevik intelligentsia would have to be eliminated" and that the forthcoming war would be a confrontation between two completely opposing cultures.[32] In May 1941, Gestapo leader Heinrich Müller wrote a preamble to the new law limiting the jurisdiction of military courts in prosecuting troops for criminal actions because: "This time, the troops will encounter an especially dangerous element from the civilian population, and therefore, have the right and obligation to secure themselves."[33] After the war, Mengele escaped internment and went underground, serving for four years as a farm stableman near Rosenheim in Bavaria. Then he reportedly escaped, via Genoa, Italy, to South America in 1949. He married (for a second time) under his own name in Uruguay in 1958 and, as “José Mengele,” received citizenship in Paraguay in 1959. In 1961 he apparently moved to Brazil, reportedly becoming friends with an old-time Nazi, Wolfgang Gerhard, and living in a succession of houses owned by a Hungarian couple. In 1985 a team of Brazilian, West German, and American forensic experts determined that Mengele had taken Gerhard’s identity, died in 1979 of a stroke while swimming, and was buried under Gerhard’s name. Dental records later confirmed the forensic conclusion. One of the Auschwitz survivors who was selected by Dr. Josef Mengele for his cruel and horrific experiments was Yitzchak Ganon, a Greek Jew who was deported, along with his parents and 5 brothers and sisters to Auschwitz in 1944, according to a news article by Alan Hall, published on December 11, 2009. Ganon told reporter Alan Hall that he was selected for an experiment in which Dr. Mengele removed one of his kidneys without an anesthetic: "He cut into me without an anesthetic. The pain was indescribable. I felt every slice of the knife. Then I saw my kidney pulsating in his hand. [...] After the operation I was given no painkillers and put to work. I cleaned up after the bloody operations carried out by Mengele." Browning wrestles with these and many other related questions in a consistently persuasive and cogent way. He concludes, very sensibly, that it is inconceivable that the Holocaust, unprecedented in history and entailing a massive, counterproductive diversion of resources in wartime, could have taken place without Hitler’s immediate knowledge and approval, although his orders were often, as Browning notes, “vague and inexplicit.” Moreover, Hitler himself was the chief Nazi ideologue of rabid, demented, racialist anti-Semitism, with anti-Semitism at the very center of his worldview and in and of itself a central motivating factor in his foreign and military policies. As reported in The New York Times in 2015, "When Otto Frank first published his daughter's red-checked diary and notebooks, he wrote a prologue assuring readers that the book mostly contained her words".[53] Although many Holocaust deniers, such as Robert Faurisson, have claimed that Anne Frank's diary was fabricated,[54][55] critical and forensic studies of the text and the original manuscript have supported its authenticity.[56] From 1933 onward, anti-Jewish propaganda had flooded Germany. Under the skillful direction of Joseph Goebbels, his Nazi Propaganda Ministry churned out a ceaseless stream of leaflets, posters, newspaper articles, cartoons, newsreels, slides, movies, speeches, records, exhibits and radio pronouncements. As a result, the accusations, denunciations and opinions which Hitler first expressed in his book, Mein Kampf, had become institutionalized, accepted as time-tested beliefs by all Nazis, taught as fact to impressionable youths, and drilled into the minds of eager-to-please SS recruits. Eichmann received various levels of cooperation from each of the various occupied governments. But in countries such as Holland, Belgium, Albania, Denmark, Finland and Bulgaria, some Jews were saved from their deaths by the action of the sympathetic populace and government officials. Denmark’s government and populace were exemplary in their heroism in saving Jews. In other countries such as Poland, Greece, France, and Yugoslavia, the deportation of Jews to the death camps was facilitated by the cooperation of the government. Gentiles whose status placed them on the periphery of a community generally had fewer social constraints and a higher level of independence. This sense of independence, in turn, seems to have made many rescuers more likely to act in accordance with their personal values and moral precepts, even when these standards were in opposition to societal norms. Such rescuers were propelled by values connected to self-approval. In interviews, they insisted again and again that they had to be at peace with themselves, with their ideas of what was right or wrong. Freund and his colleagues, including Harry Jol, a professor of geology and anthropology from the University of Wisconsin, Eau Claire, and Philip Reeder, a geoscientist and mapping expert from Duquesne University, in Pittsburgh, were brought in to explore further. They spent five days scanning the ground beneath the school and the surrounding landscape with ground-penetrating radar, and emerged with a detailed digital map that displayed not just the synagogue’s main altar and seating area but also a separate building that held a bathhouse containing two mikvaot, or ceremonial baths, a well for water and several latrines. Afterward, Freund met with the staff at the Vilna Gaon Jewish State Museum, named after the famed 18th-century Talmudic scholar from Vilnius, and a partner on the Great Synagogue project. Then, Freund said, “We asked them: ‘What else would you like us to do? We’ll do it for free.’” A week later, he and other members of the crew received a visit from the camp’s Sturmbannführer, or commander, a 30-year-old dandy who wore boots polished shiny as mirrors, white gloves that reached up to his elbows, and smelled strongly of perfume. Zeidel remembered what the commandant told them: “Just about 90,000 people were killed here, lying in mass graves.” But, the Sturmbannführer explained, “there must not be any trace” of what had happened at Ponar, lest Nazi command be linked to the mass murder of civilians. All the bodies would have to be exhumed and burned. The wood collected by Zeidel and his fellow prisoners would form the pyres. SS Officer Hosler, under arrest, stands in front of a truck which is loaded with corpses at Belsen concentration camp © The Final Solution moved into its last stages as Allied forces began to close in on Germany in 1944. The Project Reinhardt camps were razed. A prisoner work-gang called the Blobel Commando began digging up and burning the bodies of those killed by the Einsatzgruppen. Prisoners remaining in Auschwitz and other concentration camps were transported or force-marched to camps within Germany. Hardly fit for such an effort, thousands of prisoners on these death marches succumbed to starvation, exhaustion and cold, or were shot for not keeping up the pace. Like the network of concentration camps that followed, becoming the killing grounds of the Holocaust, Dachau was under the control of Heinrich Himmler, head of the elite Nazi guard, the Schutzstaffel (SS), and later chief of the German police. By July 1933, German concentration camps (Konzentrationslager in German, or KZ) held some 27,000 people in “protective custody.” Huge Nazi rallies and symbolic acts such as the public burning of books by Jews, Communists, liberals and foreigners helped drive home the desired message of party strength. In Auschwitz, the murdering of prisoners in gas chambers began even earlier, when 575 sick and disabled prisoners were sent to their deaths at the euthanasia center in Germany at the end of June 1941. At the beginning of September, the SS used Zyklon B gas in the cellars of block 11 to kill about 600 Soviet POWs and another group of patients from the camp hospital. Soviet POWs and Jews brought from Upper Silesia were killed in the gas chamber in crematorium I over the following months. It was probably at the end of March or in April 1942 that the Germans began killing sick prisoners and Jews in a provisional gas chamber in Birkenau (the so-called “little red house”). The tempo of atrocities increased in June and July 1942, with transports of Jews sent to Auschwitz being subjected to systematic “selections” during which SS doctors sentenced people classified as unfit for labor to death. The United States Holocaust Memorial Museum defines the Holocaust as the "systematic, bureaucratic, state-sponsored persecution and murder of six million Jews by the Nazi regime and its collaborators",[29] distinguishing between the Holocaust and the targeting of other groups during "the era of the Holocaust".[30] According to Yad Vashem, Israel's Holocaust memorial, most historians regard the start of the "Holocaust era" as January 1933, when Hitler was named Chancellor of Germany.[31] Other victims of the Holocaust era include those viewed as inferior, including for reasons of race or ethnicity (such as the Roma, ethnic Poles, Russians, and the disabled); and those targeted because of their beliefs or behavior (such as Jehovah's Witnesses, communists, and homosexuals).[30] Hitler came to see the Jews as "uniquely dangerous to Germany", according to Peter Hayes, "and therefore uniquely destined to disappear completely from the Reich and all territories subordinate to it". The persecution and murder of other groups was much less consistent. For example, he writes, the Nazis regarded the Slavs as "sub-human", but their treatment consisted of "enslavement and gradual attrition", while "some Slavs—Slovaks, Croats, Bulgarians, some Ukrainians—[were] allotted a favored place in Hitler's New Order".[20] With the appointment in January 1933 of Adolf Hitler as Chancellor of Germany, and the establishment of the Third Reich, German leaders proclaimed the rebirth of the Volksgemeinschaft ("people's community").[75] Nazi policies divided the population into two groups: the Volksgenossen ("national comrades") who belonged to the Volksgemeinschaft, and the Gemeinschaftsfremde ("community aliens") who did not. Enemies were divided into three groups: the "racial" or "blood" enemies, such as the Jews and Roma; political opponents of Nazism, such as Marxists, liberals, Christians, and the "reactionaries" viewed as wayward "national comrades"; and moral opponents, such as gay men, the work shy, and habitual criminals. The latter two groups were to be sent to concentration camps for "re-education", with the aim of eventual absorption into the Volksgemeinschaft. "Racial" enemies could never belong to the Volksgemeinschaft; they were to be removed from society.[76] There are many self-reflective passages where Anne laments being picked on by the adults in the annex, wondering if she will live up to the expectations they have for her, hoping she can reach her goals. There is a thread of hope apparent even in her most depressing writings. I think these are the parts I think teens find most relate-able because all teens want to achieve things, please their parents, and find hope in their moments of despair. A German in a military uniform shoots at a Jewish woman after a mass execution in Mizocz, Ukraine. In October of 1942, the 1,700 people in the Mizocz ghetto fought with Ukrainian auxiliaries and German policemen who had intended to liquidate the population. About half the residents were able to flee or hide during the confusion before the uprising was finally put down. The captured survivors were taken to a ravine and shot. Photo provided by Paris' Holocaust Memorial. # It is not known when Hitler formed the intention of the “final solution of the Jewish question” on the scale of the European continent. The conference in Wannsee on January 20, 1942 considered only the details of the undertaking: the methods for organizing the deportation and ensuring the cooperation of the civilian administration. Overall, the plans called for the murder of 11 million Jews living in Germany, the occupied territory, the states opposed to the Third Reich, and the allied and neutral countries. Despite the Vatican failure to act, many priests, nuns, and laymen hid Jews in monasteries, convents, schools, and hospitals and protected them with false baptismal certificates. However, as Saul Friedlander’s memoirs show, many Catholic priests proselytized and converted their “guests.” Moreover, after the war, many Jewish children were never returned to Jewish families, even after lengthy court battles. Not long after beginning the survey of the site, Freund and his team confirmed the existence of a previously unmarked burial pit. At 80 feet across and 15 feet deep, the scientists calculated that the grave contained the cremated remains of as many as 7,000 people. The researchers also released the preliminary results of their search for the tunnel, along with a series of ERT-generated cross sections that revealed the tunnel’s depth beneath the ground’s surface (15 feet at points) and its dimensions: three feet by three feet at the very widest, not much larger than a human torso. From the entrance inside the bunker to the spot in the forest, now long grown over, where the prisoners emerged measured more than 110 feet. At last, there was definitive proof of a story known until now only in obscure testimonies made by a handful of survivors—a kind of scientific witness that transformed “history into reality,” in the words of Miri Regev, Israel’s minister of culture, who highlighted the importance of documenting physical evidence of Nazi atrocities as a bulwark against “the lies of the Holocaust deniers.” Hitler believed that before monotheism and the Jewish ethical vision came along, the world operated according to the laws of nature and evolution: survival of the fittest. The strong survived and the weak perished. When the lion hunts the herd the young, the sick and weak are always the first victims. Nature is brutal but nature is balanced. There is no mercy. So too in antiquity-the great empires-the Babylonians, Greeks and Romans conquered, subjugated and destroyed other peoples. They respected no borders and showed no mercy. This too Hitler viewed as natural and correct. But in a world operating according to a Divinely-dictated ethical system—where a God-given standard applies and not anyone’s might—the weak did not need to fear the strong. As Hitler saw it, the strong were emasculated-this was neither normal nor natural and in Hitler’s eyes, the Jews were to blame. How, when, and why the Nazis’ decision to exterminate Europe’s Jews was made remains one of the most vexed and disputed of all important questions concerning the Holocaust. There was not simply an order from Hitler commanding the killing of the Jews, and there is general agreement that the genocide evolved in stages, steadily becoming more comprehensive. The Origins of the Final Solution by the universally respected historian Christopher R. Browning, now at the University of North Carolina at Chapel Hill, is a magisterial examination of this subject in the wider context of the overall evolution of Nazi policy towards the Jews between the outbreak of the Second World War in September 1939 and the opening of the first extermination camps early in 1942. I am not sure I agree. I’m the son of two Holocaust survivors. As a child I heard from one of my parents’ best friends about living through Mengele’s infamous selection process at Auschwitz. He haunted my nightmares. So, of course, I feel angry at the German government’s lack of action in the early years after World War II and frustration at the Mossad’s failure to bring him to justice. Still, I believe that the decision not to prioritize capturing him was the right one. Every intelligence operation carries risks. The Mossad’s approach to Mengele shows prudence and pragmatism on the part of the agency’s leaders — in contrast with Begin’s emotionalism. When exactly Hitler settled on straightforward murder as a means of removal has been harder to pinpoint. As Yale historian Timothy Snyder writes, “It cannot be stressed enough that the Nazis did not know how to eradicate the Jews when they began the war against the Soviet Union [in the summer of 1941]… They could not be confident that SS men would shoot women and children in large numbers.” But as Operation Barbarossa, the name for the Nazi invasion of the U.S.S.R, proved during the mass shootings of June 1941 and the massacres at Kiev in September, the Order Police and Einsatzgrüppen were more than willing to commit mass murders. This meant Hitler could take the solution to the Jewish problem to its “furthest extremes,” in the words of Philipp Bouhler, the senior Nazi official responsible for the euthanasia program that killed more than 70,000 handicapped German people. After obtaining a copy of his birth certificate through the West German embassy in 1956, Mengele was issued with an Argentine foreign residence permit under his real name. He used this document to obtain a West German passport, also using his real name, and embarked on a trip to Europe.[71][72] He met up with his son Rolf (who was told Mengele was his "Uncle Fritz")[73] and his widowed sister-in-law Martha, for a ski holiday in Switzerland; he also spent a week in his home town of Günzburg.[74][75] When he returned to Argentina in September 1956, Mengele began living under his real name. Martha and her son Karl Heinz followed about a month later, and the three began living together. Josef and Martha were married in 1958 while on holiday in Uruguay, and they bought a house in Buenos Aires.[71][76] Mengele's business interests now included part ownership of Fadro Farm, a pharmaceutical company.[74] Along with several other doctors, Mengele was questioned in 1958 on suspicion of practicing medicine without a license when a teenage girl died after an abortion, but he was released without charge. Aware that the publicity would lead to his Nazi background and wartime activities being discovered, he took an extended business trip to Paraguay and was granted citizenship there in 1959 under the name "José Mengele".[77] He returned to Buenos Aires several times to settle his business affairs and visit his family. Martha and Karl lived in a boarding house in the city until December 1960, when they returned to Germany.[78]
What is TOTP? • It is an one-time temporary password (OTP), that is generated by an algorithm and valid only for 30 seconds. Because of this time variable characteristic, it is called TOTP. • TOTP is 8 digit long numeric strings. • TOTP is personal to the resident and is uniquely generated every 30 seconds for each resident separately. • With time-based OTP, the TOTP validation server and token generation app(like mAadhaar) use their respective system times to generate OTPs. The TOTP algorithm assumes that the system times are synchronized.
Intermediate C++ Game Programming Tutorial 1 From Chilipedia Jump to: navigation, search We've been using ints and floats and bools this whole time, but have you ever wondered about a day in the life of a variable? In this video, we find that shit out, and so much more. We also learn about the cousins of int and float, adding to our arsenal of basic data types we can use in our programs. What's the endgame you ask? This stuff is gonna help us understand pointers and strings, and it's just interesting shit. Topics Covered • The concept of memory (RAM) • Binary and hexadecimal number systems • char, short, long long, double • unsigned integral types • The ranges and sizes of basic data types • Layout of variables in memory • Correspondence between C++ code and CPU operations Video Timestamp Index Tutorial 1 Bonus Video: Red Pill [The Stack] The description of how variables are organized in memory in Tutorial 1 is a simplified model that will help us understand memory and pointers; it is not 100% accurate. Chili had originally planned to teach the full details of how variables are allocated, explaining things like storage classes (stack, heap, static), the details of stack management and function stack frames, and exploration of the memory and machine instructions using the debugger. But then he realized that this amount of detail and complexity might be too much of a mind fuck for too many people, so he cut that content from Tutorial 1. Since the video is already recorded, it will be released as optional content for people who are interested in the nitty-gritty details, but the keyword here is optional; you are not required to know this content to continue on with the tutorials and it will not be referred to in the mainline tutorial series. It is, however, very interesting shit. Video link: Red Pill - The Stack This lesson's homework is to answer the following questions. When you think you have the answer, click "expand" to reveal the correct answer. 1. In Microsoft Visual C++, what is the size in bytes of the following data types: int, char, double, unsigned int, short, bool int: 4 char: 1 double: 8 unsigned int: 4 short: 2 bool: 1 2. Make the following conversions: 01000111b -> dec, 11001111b -> hex, 10h -> dec, 7Ah -> bin, 193d -> bin 01000111b -> dec: 71 11001111b -> hex: CF 10h -> dec: 16 7Ah -> bin: 01111010 193d -> bin: 11000001 3. What is the size of this class in bytes with default compiler settings in Microsoft Visual C++, and how many of those bytes are padding: class Foo int a; char b[3]; short c; int d; 16 bytes (3 bytes padding) 4. Why is hexadecimal commonly used to represent values in programming? It's easy to convert between hexadecimal and binary representations, and hexadecimal takes far fewer digits to represent the same number. 5. When accessing variables in memory, often times many addition/multiplication operations must be performed to index into arrays or access elements of classes/structures. What is one way the compiler can optimize this for runtime performance? If the indices and offsets are values that are known at compile time, the addresses will be pre-computed at compile time and not at runtime. See also
25 Names That Have More Than Letters Accent marks, known as ‘diacritics’ are used worldwide in a variety of different languages. Some countries are limited to 26 letters in the alphabet, so it is easy to forget that many languages have more letters. And this is when choosing a great name for a baby can get tricky. A French court banned a couple from giving their baby a name with a ‘tilde’, as they said that the character ‘ñ ‘ is unrecognised by the French language. In Australia, the list of rules surrounding naming a baby states that no special characters or diacritical marks are allowed. In some places, official names cannot contain accents due to the limitations of the computer system recording their names. If they want to use them for everyday use no one minds, but their official names cannot contain them. So what are these little lines and dashes that are causing so much trouble? The most common accents are the acute (é), grave (è), circumflex (â, î or ô), the tilde (ñ), umlaut and dieresis (ü or ï) and cedilla (ç). These symbols change the sound of the letters, so they alter the name. In Norway and Denmark, the 27th letter of the alphabet is Ø, a vowel. So whilst choosing to use a diacritic might seem cute, trendy or something a little different for a baby, bear in mind that it will change the sound of the name, and may well not be allowed in many countries. Have a look at these 25 names for some inspiration. Continue scrolling to keep reading Click the button below to start this article in quick view Start Now 25 Renée This beautiful French name is the female form of René, with the extra –e being added on to make it feminine according to French grammar. In other countries, it is often spelt as Renee or Renae. This name is a form of the late Roman name ‘Renatus’, which means ‘reborn or born again’. There are a number of actors worldwide with this lovely name and it is even good enough for royalty, as Princess Renée of France, the Duchess of Ferrera will agree. 24 Noël This lovely French masculine name instantly summon up images of Christmas and all things snowy and wintery. And for good reason, as Noël, along with the feminine version Noëlle, actually translate a ‘Christmas’. Perfect for a child born around the festive season, non-French speaking countries have removed the umlaut but still pronounce it correctly as ‘no-EL’. There are a number of famous ‘Noels’ around, including musicians, TV hosts and comedians. Possibly the most notable is Noel Coward, the famous playwright. 23 Sørina The Danish alphabet features the ‘ø’, character as an extra letter and this name is often banned in other countries due to technology’s inability to cope with anything other than the standard 26 letters. The name comes from the Latin ‘sĕvērus’, meaning ‘severe, serious, strict or Inflexible’. Harry Potter’s Severus Snape is a famous example. Serena is widely considered to be the anglicized equivalent as it sounds similar even though it has completely different origins! It comes from the Latin ‘serēnus’, meaning ‘clear, tranquil or serene’. Sorina is an American version of the same name. 22 Adrián This Spanish boy’s name is popular around the globe and is often spelt as Adrian or Adrien in non-Spanish speaking countries. It originates in the Latin names Adrianus or Hadrianus. These names, in turn, come from the former river ‘Adria’. This is an Illyrian word meaning ‘sea or water’. Despite being in use since the middle ages, it has never been a well-used name until recently. In the last 50 years, Adrian’s popularity has climbed steadily and it is now number 60 in the boy’s name charts. 21 Zoë This popular French name can also be spelt without the umlaut as Zoe or Zoey. Zoe has only been used in the west since the 19th-century but has been popular with Eastern Christians for centuries. Meaning ‘life’, it was adopted by Jews as a version of ‘Eve’. Notable Zoes include two early Christian saints and an 11th-century Empress of the Byzantine Empire. Zoe has starred in the top 1000 names nearly every year since 1880 and is currently the 41st most popular girl’s name in America. 20 François The use of the cedilla on the ‘c’ is very important with this name, as it changes the sound of the word. Without a cedilla, the ‘c’ would be pronounced hard (as in ‘k’), but this creates an ‘s’ sound instead, meaning that this boy’s name is ‘frahn-SWAH’. The Latin translation of this name is literally ‘Frenchman’ and has been anglicized as Francis. Considered quite a sophisticated name, François was the name of two French kings and is sometimes translated as ‘free man’. 19 Mary-Jo If you love two names and just can’t decide between them, then why not just use both and join them with a hyphen? This is not a new phenomenon, being particularly popular in the 1960’s with names such as Peggy-Sue, Sue-Ellen and Mary-Jane. Whilst there are no rules on what names can be joined, it is important that names flow as one. If you are interested in the meanings of names, you should probably check that the two names don’t conflict, for instance translating as ‘peace-war’. 18 Mónica Monica or Monika are two popular non-Spanish versions of this name, whose most notable bearer may well be the overly organised character we all love from the ever-popular TV series ‘Friends’. Currently down at number 626 in the popularity charts, the end of ‘Friends’ actually had a negative effect on the use of this name, which had been quite well-used up until then. The mother of St Augustine, Monica translates as ‘advisor’. Variations include Monise, Monnie, Monia, Monice, Monic and Monya. 17 Seán Seán is an ancient Irish name, which for many years was the top choice for Irish boys. In other areas of the world, it has various spellings including Sean without the accent, or Shawn or even Shaun. It is an Irish version of ‘John’, which translates as ‘Jehovah has been gracious, or shown favour’. This Hebrew name has different versions around the globe. Whilst Sean is still popular, parents have been modernising and modifying this name, with versions such as Seanan and Senan becoming popular. 16 Mathéo This name has its origins in the Hebrew name ‘Matityah’, which means ‘gift of God’. The acute accent appears in the Norwegian version of the name, but there are many different spellings worldwide including Matthew, Mateo, Matthaios and Matthias. Mateo has gained in popularity over the past year and now sits at number 1,343, making it a rare name and much more unique than Matthew, which sits at number 574. A traditional name with a Norwegian twist, Mathéo will make your little boy stand out from the crowd. 15 Ruairí Pronounced ‘RO-ry’, this is an Irish boy’s name of Gaelic origin. Whilst it has never reached the top 1000 US names, it is good enough for Irish royalty, being the name of the last high king of Ireland, Ruairí O’Conor, who reigned almost 1,000 years ago from 1166-1170. This gorgeous name translates as ‘red’ or ‘rust-coloured’ and was traditionally a reference to a boy’s red hair. Also common in the Scottish Highlands, another meaning of the name is ‘red king,’ from ‘ruadh’ (‘red-haired or ‘rusty’) and ‘rígh’ (‘king’). 14 Mátyás If you want to go all out and use two accents, then this lovely Hungarian name might be right for you. Pronounced ‘MA-kyash’, this is another version of Matthew, meaning ‘Gift of God’. Other Slavic versions of this name include the Lithuanian ‘Motiejus’, the Serbian ‘Mateja’ and the Polish ‘Maciej’. This has been the name of two Hungarian kings and has been in the top 100 Czech names consistently for over 30 years. In Hungary over 250 boys are given this name every year. 13 Jokūbas This Lithuanian name has an interesting story. It is thought to be a mix of two very popular first names: Jacob and James. Edvardas Daukša (1836–1890), was a Lithuanian poet and was also famous for participating in the uprising of 1863. As the name became very popular then, it is thought that he was an influence on this name’s success. However, it also comes from the Greek word ‘ya`aqob’, which translates as ‘seizing by the heel or supplanting’ and became the Biblical name, Jacob or Yaakov. 12 John-Paul This male hyphenated name has a lovely rhythm to it and is one of the more popular couplings. Translating as ‘God has been gracious’ followed by ‘small’, the two names go well together mainly because of their Biblical references. John and Paul were both Jesus’ apostles and this name has been chosen by two Popes. Modern bearers of the name include fashion designer John-Paul Gaultier. Sometimes this name is written without the hyphen, but it is more common this way. 11 Siân The circumflex on the ‘a’ is often removed from this name, but actually, it helps you to pronounce this name correctly. Vowels can be sounded short or long, so either ‘Si- ann’ or ‘Si- ahhhhhn’, changing the sound of the name completely. In this case, the circumflex tells us it should be the letter, with a long vowel sound. So the name should sound ‘SH-ahhhn’, which is a popular Welsh girl’s name. It translates to ‘God is good’, or ‘God’s gift’. 10 Agnès Here is a pretty girl’s name that uses different accents and symbols all over the world. Originally Agnès comes from the Greek name ‘hagnē’, which translates as ‘pure or holy’. When the name reached Portugal it became ‘Inês’ and Spain turned it into ‘Inés’ or ‘Inéz’. Italy kept it simple with ‘Agnese’ and by the time it reached the UK the name had simply dropped the accent and become ‘Agnes’. Agnes of Rome was a popular Christian saint, who was widely responsible for this name’s popularity. 9 Maël This unusual name is a masculine name from Ireland, Wales and Brittany. Now a traditional name in Breton, it was made popular in the 5th-century by Saint Maël of Wales and was also the name of the 10th-century High King of Ireland, Máel Sechnaill mac Domnaill. It translates as ‘chief or prince’ and has the feminine forms of Maëlle, Maëlly or Maëllie. It is pronounced ‘my-ELLE’ or ‘ma-ELLE’, with the accent on the second syllable. If you are looking for a rare name then this is a great choice, as it currently sits down at number 6,793 in the popularity charts. 8 János Popular in both Czechoslovakia and Hungary, this is a version of the name ‘Jehovah’. This translates as ‘God has shown favour’ or ‘God has been good’. Although the western version of this name is ‘John’, this Hungarian name is pronounced very differently as ‘YA-nosh’. Common nicknames or abbreviations are ‘Jancsi’ and ‘Jani’. Although it has stayed firmly in the top 50 names for at least the last 20 years, it is slowly declining in popularity, having slipped from number 29 to number 45. 7 KŠthe This difficult-looking girl’s name is more commonly spelt as Käthe or Kaethe. It is pronounced ‘KEY-ta’ and is German. Originally derived from Greek, Kaethe translates as ‘pure’. It is a German diminutive of the popular name ‘Katherine’. Variations around the world include the Finnish ‘Katri’ and the Georgian ‘Eka’. In 2013 this name was ranked at number 18,317 and hasn’t appeared in any baby name lists for the last 5 years, so is a truly rare name with a beautiful meaning. 6 Chloë This name was originally Greek and means ‘blooming’ or ‘young green shoot’. It was used to represent the fertility goddess, due to its links with all things fertile and growing. There is a wide variety of spelling options with this name. Some people simply remove the umlaut but retain the pronunciation of ‘KLO-ee’. Others choose the Greek ‘Khloe’ and some even have an accent on it, as in ‘Khloé’. This lovely name reached an all-time high at number 9 in 2009 and continues to be a popular choice worldwide today. 5 Øyvind This Norwegian name was very popular for baby boys in the early 1980’s but has since become less well used. It is a very old name, originating in the Old Norse language name ‘Eyvindr’. This is made up of two parts - ‘ey’ meaning ‘island ‘ and ‘vindr’, meaning ‘victor’. Variations of the name include Eivind, Even and Øivind. Other languages use this name but without the special character ‘Ø’, including the Ancient Scandinavian ‘Eyvindr’, the Danish ‘Ejvind’ and the Icelandic ‘Eyvindur’. 4 Asbjørn This Scandinavian male name is a variation of Ásbjörn, complete with an accent and umlaut. The word ‘as’ represent a Norse god whilst ‘bjørn’ means bear. So this name represents everything strong, powerful and mighty. Pronounced ‘OS-byawn’ or ‘AS-byawn’, this name has variations including Esben, Espen and Bjarni. The anglicised versions include Osborn and Ozzie. This name was consistently in the top 100 in the 1940’s-50’s but has become unpopular since, making this a charming and quite unique name for your son. 3 Fañch The Franks were a Germanic people living in the Early Middle Ages, who got their name from the type of axe - the Francisca - that they used. Frankô or Franka means ‘javelin or spear’ and the name Fañch comes from the Medieval Latin ‘Francus or Franciscus’, meaning ‘Franco, belonging to the people of the Franks’. Spears and medieval Germans aside, it is an unusual name that carries an air of mystery. Different versions of the name include Françesku, Pranchi and Fransu. 2 José This well known Spanish and Portuguese name is a form of the boy’s name Joseph. It is pronounced ‘ho-SAY’, and the accent is vital in this case in preventing it from becoming ‘Hose’. Coming from the Hebrew ‘yōsēf’, the name translates as ‘God shall add’ and is born by many famous Biblical characters including Jacob’s favourite son with the multicoloured coat, and the father of Jesus. Used in the popular expression ‘No way, Jose!’ and starring in the song ‘Do you know the way to San Jose?’ this is a name that has endured hundreds of years. 1 Nuñez This beautiful unisex name joins the lists of names that have transferred from family name to given name. Common in Spain and Portugal, Nuñez has a tilde on the ‘n’, meaning that the pronunciation should be ‘NOO-nyez’. Its origins are uncertain but may come from the Latin ‘nonus’, meaning ‘nine’, ‘nunnus’ meaning ‘grandfather’, or even ‘nonnus’, meaning ‘squire’. Although it is at number 58 in the surname rankings, it is languishing at number 12, 772 in the first name lists. References: https://en.wikipedia.org/wiki/Diaeresis_(diacritic) https://www.nordicnames.de/wiki/%C3%98yvind https://www.theguardian.com/lifeandstyle/2017/sep/13/french-baby-boy-banned-from-getting-name-containing-symbol https://www.babycenter.com/baby-names https://www.behindthename.com www.sheknows.com More in Baby Names
Essay on Case Study : Cee 1440 Water Resources Engineering 1518 Words Dec 14th, 2016 7 Pages Carolyn Wehner CEE 1440 Water Resources Engineering Take-Home Final Exam Due: 12/14/16 With changing climates, ice caps melting more rapidly therefore causing the water levels of the world to rise rapidly. With this increase of fluid water on the earth water resources engineers are concerned how the excess water will affect infrastructure pertaining to water designs such as dams and reservoirs. Also future engineering designs will have to consider the change in water levels and precipitation events. (60 points) Consider the case that due to climate changes, the existing design of the reservoir and the pipe system in an urban and residential area within a watershed (see Figure 1 below) can no longer handle the floods or sustain the droughts. Impacts of the climate changes on the watershed in this case is manifested in having higher frequency of larger rainfall events (flooding) as well as a longer period of a dry season (drought). In other words, although the mean annual precipitation amount over multiple years may remain the same, higher intensity rainfalls have now occurred more often, and at the same time no-rain periods are also prolonged. For the given site, the reservoir is located in the upstream portion of the watershed while the pipe system is located in the lower portion and close to the watershed outlet. Please answer the following questions. If you need to make any assumptions, please clearly state them. (1) List all the data… Related Documents
Employee Data Privacy The Netherlands - Data Privacy Laws and Regulations Download as a PDF What laws apply to the collection and use of individual's personal information? Data privacy laws have become more prominent in recent years. As the amount of personal information available online has grown substantially, there has been an enhanced focus on the processing of personal data, as well as the enforcement of such laws. Organizations in the European Economic Area (EEA) must comply with EU data protection laws when retaining documents containing personal data. The EEA includes the EU countries as well as Norway, Lichtenstein, and Iceland. The EU General Data Protection Regulation (GDPR) (Regulation (EU) 2016/679) goes effect on May 25, 2018 and has become the new cornerstone of data protection laws throughout the EU. National Laws Under the GDPR While the EU Data Protection Directive has been implemented at a national level by each EU member state, data privacy laws differ slightly from one EU country to another. The Netherlands has issued a GDPR Implementation Bill to Parliament, which is expected to go into effect with the GDPR. The current Bill largely follows the GDPR requirements. EU Legislative Framework Firstly, it is important to understand who is the “data controller” under the EU legislative framework. An organization is a data controller when it determines the purposes and manner in which personal data is processed. “Personal data” refers to “any information relating to an identified or identifiable natural person.” That person is considered a “data subject” under the GDPR and may “be identified, directly or indirectly…by reference to an identifier such as a name, an identification number, location data, an online identifier or to one or more factors specific to the physical, physiological, genetic, mental, economic, cultural or social identity of that natural person.” Clearly, a lot of employee-related information collected by employers qualifies as personal data, thereby subjecting European employers to EU data privacy regulations. The employer collecting the employee-related data is the data controller, and every HR solution adopted might be qualified as a sub-processing activity. Regardless of whether an employer utilizes subcontractors to process information, data management processing principles will still need to be followed. This is because the “processing of personal data” is construed broadly and includes physical and automated procedures such as: collecting, recording, organizing, structuring, storing, adapting/altering, retrieving, consulting, using, disclosing by transmission, disseminating, making available, aligning/combining, restricting and erasing/destructing. Therefore, as controllers of employee personal data collected in the employment context, employers must comply with the following personal data processing principles: • process personal data fairly and lawfully; • collect personal data only for specified, explicit, and legitimate purposes; • collect personal data only to the extent that it is adequate, relevant, and not excessive in relation to the purposes for which it is collected; • ensure that personal data is accurate and, where necessary, kept up to date; and • do not keep personal data in a form that permits identification of individuals for longer than is necessary. Employers should be able to provide a documented rationale for processing each piece of personal data. Processing can be legally justified if the: • data subject has unambiguously consented to the processing (under the GDPR, regulators are cognizant that employee consent may not be freely given due to the nature of the employee/employer relationship); • processing is necessary for compliance with a legal obligation; • processing is necessary in order to protect the vital interests of the data subject; or, • processing is necessary for the purposes of the legitimate interests pursued by the data controller or by the third party or parties to which the personal data is disclosed, except where such interests are overridden by the data subject’s fundamental rights and freedoms. If the employee data qualifies as sensitive personal data, then a narrower set of conditions applies. For example, one such condition is that a data subject has given explicit consent to the processing of his/her sensitive personal data. “Sensitive personal data” is the personal data consisting of information about the data subject’s racial or ethnic origin; political opinions; religious beliefs or beliefs of a similar nature; trade union membership; physical or mental health or condition; or sexual life. The authority responsible for enforcement of data privacy law and regulations in the Netherlands is: Autoriteit Persoonsgegevens Share Your Feedback Let's Talk
The Lok Sabha seat Congress could not win since 1951 Here, we bring you the story of this unique Lok Sabha seat and also shed light on a few others which have shown similar character--to not vote for the Congress. lok sabha seat congress never won The Congress enjoyed a near-absolute political dominance for several decades in India but it still could not win this seat with popular vote even once. Above: Congress president Rahul Gandhi and his mother and UPA chairperson Sonia Gandhi. (Photo: Getty Images) • Congress has been in power at the Centre for most part of the past 68 years • Besides this, till 1990s most states were ruled by the Congress • Despite its overarching influence in Indian politics, Congress could not win this seat It may come as a surprise, and for some even hard to believe, but it is true. Of the 543 Lok Sabha seats for which elections are being held, there is one seat where Congress, the grand old party of India, has never won the popular vote. Never since 1951 when the first Lok Sabha elections were held in India. For much of these 68 years, the Congress remained in power at the national level and ruled most states in India. Such was its monopoly over government formation that the first non-Congress government in India was formed in 1977, 26 years after the first Lok Sabha elections in 1951. It (the Janata Party government) lasted only three years, following which the Congress returned to power for 10 years. Another example of Congress's overarching influence on Indian voters is that until the early 1990s, most states in India were exclusively ruled by the Congress. However, despite this towering image of the Congress, there was one tiny part in the country which, elections after elections, decided that it is better off by not voting Congress to power. We bring you the story of this lone seat and also shed light on a few others which have shown similar character--to not vote for Congress. Ponnani. A small Lok Sabha seat in Kerala has never voted Congress to power. It is a small coastal city which was once famous for its spice trade. In the middle ages, it developed as a prominent trading centre with the Arab world and later the Portuguese attacked it many times to control its spice trade. Today, Ponnani is famous as a fishing town and the Ponnani Canal that divides the city into two. Since the first general election in 1951, Ponnani has been represented in the Lok Sabha once by the Kisan Mazdoor Praja Party (1951), thrice by the Left (Communist Party of India and Communist Party of India (Marxist) --1962, 1967 and 1972) and 11 times by the Indian Union Muslim League (1977-2014). In 1951, Ponnani was a multi-member constituency and sent two MPs to the Lok Sabha. One was for the General category and the other for the reserved (Scheduled Castes) category. For the sake of clarity, we differentiate these two representatives from the same constituency and classify them as Lok Sabha members from Ponnani (General) and Ponnani (SC) seats. Of the two MPs that Ponnani sent to the Lok Sabha in 1951, the General category MP was from the Kisan Mazdoor Praja Party, which won popular vote in the election. The MP for the reserved (SC) seat was from the Congress. In 1951, the Congress fielded two candidates from Ponnani - Karunakara Menon and Eacheran Iyyani. Menon was for the General seat while Iyyani was for the reserved (SC) seat. When the results were announced, Kelappan Koyhapali of the Kisan Mazdoor Praja Party polled maximum 1,46,366 votes, followed by Menon (1,36,603 votes) and Iyyani (1,20,214 votes). Kelappan Koyhapali of the Kisan Mazdoor Praja Party thus won the popular open election and became the General category MP from Ponnani. From the reserved seat, Congress's Eacheran Iyyani (who stood third in terms of popular votes received) was sent to Parliament. Thus, the Congress did send an MP from Ponnani but it has never won a popular open election here. (Read endnote 1 to know more about multi-member seats and how elections there were different from other seats.) The 1951 Lok Sabha election was the only time Ponnani sent two MPs to the Lok Sabha. It appears that election was not held in Ponnani in 1957. The Election Commission's report on the results for the 1957 Lok Sabha election does not feature Ponnani's name in it. Similarly, the website of the Lok Sabha too does not mention Ponnani as a seat during the term of the second Lok Sabha (1957-1962). Election results for Ponnani re-surface from 1962 Lok Sabha election and onwards. (Read endnote 2 for more details on this.) In the early decades of Independence, the Congress tried hard to win the Ponnani Lok Sabha seat. The general elections in 1951-52, 1962, 1967 and 1971 saw Congress's vote share fluctuate between a low of 17.64 per cent (in 1951-52) and a high of 45.12 per cent (in 1971). In all these elections it lost to the Left and the Kisan Mazdoor Praja Party. Having failed to win this seat, the Congress entered into an alliance with the India Union Muslim League (IUML) and stopped fielding candidate from Ponnani. Since 1977, the India Union Muslim League has retained this seat. Geographically speaking, Ponnani lies on the Malabar Coast hugging the Arabian Sea. It falls in Kerala's Malappuram district. As per Census 2011, the district had a Muslim population of more than 60 per cent. Ponnani is a beautiful coastal town on the Malabar Coast in Kerala hugging the Arabian Sea. (Photo: Bizillianer) While Ponnani may be the only seat where Congress has never won a popular mandate in a Lok Sabha election, there are at least five other constituencies which have rejected the party election after election.'s analysis of Lok Sabha elections results shows that the Hooghly Lok Sabha seat in West Bengal and Kendrapara Lok Sabha seat in Odisha are two seats where the Congress has been able to win just once since 1951. In Kendrapara, the Congress won in 1951 and since then the grand old party has never been able to regain this seat. People here have reposed their faith in parties other than the Congress - mostly Janata Dal and Biju Janata Dal. The closest that Congress came to winning this seat again was in 1962 when it had a vote share of 49.98 per cent and lost by just 66 votes. In 2014, the margin of votes between the winning candidate and Congress's candidate was 2.09 lakh. Meanwhile, Hooghly has been a stronghold of the Left parties ever since the first Lok Sabha election. The Congress was able to win this seat only once. It was in the 1984 Lok Sabha elections that were held after the assassination of Prime Minister Indira Gandhi. Congress had a vote share of 50.49 per cent in this election. By 2014, its vote share had plummeted to 3.13 per cent. Besides these, the other constituencies that have shown a similar character are Srinagar in Jammu and Kashmir, and Arambagh and Bolpur in West Bengal. Arambagh never voted Congress to power since 1967 when the seat was formed. Srinagar and Bolpur voted Congress to power only once since 1967 (the year when these seats were formed). Congress won from Srinagar in 1996 and from Bolpur in 1967. Map showing Lok Sabha seats that have repeatedly voted against the Congress. (Click image for a zoomed version.) For the 2019 Lok Sabha election, the Congress has once again refrained from fielding a candidate from Ponnani. The Indian Union Muslim League, which has been winning this seat since 1977, has fielded its sitting MP ET Muhammed Basheer. In Hooghly, the Congress has fielded Pratul Saha against BJP's Locket Chatterjee and Trinamool Congress's sitting MP Ratna De. The Congress has also fielded a candidate in Kendrapara (Dharanidhar Nayak). He is contesting against Bharatiya Janata Party's Baijayant Panda (who won this seat on a Biju Janata Dal ticket in 2009 and 2014). In Srinagar, the Congress has not fielded any candidate because it has formed a pre-poll alliance with the J&K National Conference. Thus, it is clear that even in 2019, the Congress will not be able to send an MP of its own from Ponnani, the seat it has never won, and Srinagar (which it has won just once). Come May 23 when results of the 2019 Lok Sabha elections will be declared, we will find if Congress is able to reclaim Hooghly and Kendraparatwo of its graveyard seats. Endnote 1: In the 1951 Lok Sabha election, Ponnani was designated as a multi-member seat. This meant that there would be two MPs from Ponnani in the Lok Sabha. One was for the General category and the other MP would be for a reserved seat for the Scheduled Caste. Besides Ponnani, there were 86 other multi-member seats in the country in 1951. This system was introduced to ensure that the Scheduled Castes (SCs) and Scheduled Tribes (STs) get adequate representation in the Lok Sabha. However, the system was abolished before the third Lok Sabha election (held in 1962) and the multi-member constituencies were divided into two-one for the General category and the other (the one with greater SC/ST population) became the reserved category. In the 1951 and 1957 Lok Sabha elections, a unique mechanism was devised for elections in the multi-member seats. The SC/ST candidate winning the maximum votes was declared the winner from the reserved seat. Winner for the General category seat would be decided from the remaining candidates (including the defeated SC/ST candidates). Whoever earned the highest votes would be declared the winner. Voters in these special constituencies had two votes (one for General and the other for reserved seat) but both the votes could not be cast for the same candidate. (There was a seat in West Bengal-North Bengal-where people had three votes because it sent three MPs to the Lok SabhaGeneral, SC and ST.) Click here to go back to the story. ** Endnote 2: The final order for the delimitation of Lok Sabha and assembly constituencies 1953-1955 (prepared by the Election Commission) mentions Ponnani but says it will no longer be a multi-member seat. In this order the Election Commission had apparently decided that the reserved seat for the Scheduled Castes would be detached from Ponnani. However, in 1956, the Election Commission came up with another report on delimitation of constituencies and surprisingly Ponnani's name was missing from it altogether. No explanation was provided for this in the report. A year later when Lok Sabha elections were held in 1957, the report on the results too did not have any mention of Ponnani. Data for Ponnani Lok Sabha seat re-surfaces from the third Lok Sabha elections that were held in 1962. Click here to go back to the story. ALSO READ \| When elections were won by just one vote in India ALSO READ \| No 2nd chance: Since 1951, 60% Lok Sabha MPs were never re-elected ALSO READ \| PM Modi's acche din claims are great but what about data on jobs, farmers' suicide & crime? ALSO READ \| How drugs, cash, gold and booze are keeping our netas busy in 2019 Lok Sabha election ALSO READ \| Shatrughan Sinha in 16th Lok Sabha: 0 questions, 0 debates, 0 bills but used 106% MPLAD funds ALSO READ \| 16th Lok Sabha: How unused MPLAD funds grew by 214% in 5 years ALSO WATCH \| Didi or Modi: Which way will West Bengal vote? • Andriod App • IOS App Do You Like This Story?
Bites: Creative maths films Bites: Creative maths films What is Bites? Bites is a series of 5 ‘How To’ videos, presented by children aged 8 – 11. Our group of enthusiastic ‘maths advocates’ demonstrates family maths activities to the audience – children their own age. They make a few mistakes along the way but that’s ok. In fact it’s more than ok, it’s great. Because mistakes are a very important part of the learning process. Bites will broaden children and their families’ view of what and where maths is, and support the concept that maths can be creative, family fun. Here at Maths on Toast, our mission is to promote positive attitudes to maths. We know that maths anxiety and other negative beliefs can reduce a child’s motivation and achievement in maths. We believe creating positive experiences of doing maths as a family can counter that anxiety, and support motivation. Instruction sheets for the activities demonstrated in each film are available to download, so that families can try them together at home. They’re also ideal for use in school and community settings. Trying them, enjoying them, and being aware that this is maths, will increase the whole family’s confidence, and allow them to develop shared learning experiences, and create positive memories of maths. What are you waiting for? Go on, take a bite! How to…make a hexaflexagon How to…construct a sturdy structure How to…make Platonic solids How to…step through a playing card How to…enjoy fun family maths Bites was created by Maths on Toast in partnership with The Winch children’s charity and youth centre, and funded by the Royal Commission for the Exhibition of 1851.
In temperature, 50 degrees Celsius is equivalent to 122 degrees Fahrenheit. The equation for converting from Celsius to Fahrenheit is ((C x 9) / 5) + 32, where "C" is the original Celsius temperature. More » Temperature is typically represented as a numerical value that is based either on the Fahrenheit scale or the Celsius scale of temperature measurement. Both scales measure temperature in incremental units called degrees ... More » Science Measurements Converting 53 degrees Fahrenheit to Celsius results in a value of 14.44 degrees. To convert from Fahrenheit to Celsius, 32 is subtracted from the temperature in Fahrenheit, and the result is multiplied by 5/9. More » To convert any temperature in Fahrenheit to Celsius, follow this formula: subtract 32, multiply by 5 and divide by 9. When you input 105 degrees Fahrenheit into this formula, the result is 40.56 degrees Celsius. It takes... More » Science Physics Thermodynamics Use the standard temperature conversion formula to convert degrees of Celsius to degrees of Fahrenheit. Multiply by nine, divide by five and then add 32. More » Converting 37.0 degrees Celsius to the Fahrenheit scale results in 98.6 degrees, which is the average normal temperature, or normothermia, for the human body. One can make the conversion by multiplying the Celsius temper... More » Science Measurements The converted temperature of 210 degrees Celsius is 410 degrees Fahrenheit. The Fahrenheit temperature scale is based off a proposal from physicist Daniel Gabriel Fahrenheit. More » Business & Finance Currency & Conversions
Origin Report: Tumaco, Colombia Cacao has a long, complicated history in Colombia. Much like other cacao producing countries in Central and South America, indigenous populations used to harvest cacao found in the rainforests and process it into drinking chocolate. It was used for spiritual purposes as well as for enjoyment at home. While in most parts of Colombia, cacao wasn’t grown as an agricultural commodity for a long time, it did start gaining traction in the 1940s and 1950s. The government of Colombia incentivized farmers to start growing cacao of a specific hybrid varietal and distributed seeds and saplings to farmers. The region of Tumaco, in the southern pacific part of the country, was no exception. Farmers started planting the hybridized cacao – mostly CCN51 and ICS95 on their farms, having been promised by the government a market for their cacao. Typically, farmers would harvest their own cacao, ferment it for two to three days in sacks, dry it in the sun, and sell it at a nationally set price to the government, or Casa Lukker, the only other buyer. Throughout the 1970s, ‘80s, and ‘90s, this was the norm in most cacao growing regions in the country, including Tumaco. In the 1990s and early 2000s, people from other parts of Colombia starting coming to Tumaco to plant coca farms. It was easy to transport illicit substances via the river systems and out to sea in Tumaco. Local Tumaqueños didn’t appreciate the danger this brought to their communities; a high level of insecurity came with trafficking and guerrilla groups as a result. Meanwhile, the Colombian government put a concerted effort into ending coca farming and encouraging cacao and oil palm farming instead. Throughout the late 2000s and early 2010s, more attention was paid to cacao farming again, and Tumaqueñan cacao farmers started organizing to learn more about cacao production and processing. One farmer in particular, Gustavo Mindineros, was part of a young group of university-educated cacao farmers who were interested in understanding more about cacao. They were members of community groups formulated by the government to spearhead conservation projects in the Tumaco region. Recognizing that cacao is a native species to Colombia, and recognizing further that cacao grows well with other crops and among the natural native forest, these young farmers began to teach themselves about cacao genetics, production, and processing. After years of studying cacao, including traveling to Ecuador to learn from fellow cacao farmers and partnering with the University of Nariño, these young farmers started the first cacao associations in Tumaco: Cortepaz, Corpoteva, and Bajo Mira. These three associations have been doing research with the University to identify native cacao genetics found in the region. The farmers knew their ancestors had grown cacao and used it for spiritual and dietary purposes, and have been searching to find the genetic makeup of those cacaos. After years of study, they’ve now narrowed down nine genetic varietals that they believe are the native cacaos of that region, and are maintaining a clonal garden to eventually farm seedlings to distribute widely to more farmers in their networks. The resurgence of interest in cacao has been encouraging for the communities in which they work. The cooperatives are providing seedlings of different cacao genetics for farmers to graft onto their existing hybrid trees, enabling farmers who have struggled for a long time with disease to combat those ailments and start harvesting more cacao from their plots. It has also given these farmers an alternate market. With improved processing, these three associations are able to sell their cacao to Cacao Hunters, Uncommon Cacao’s partner in Colombia. As Cacao Hunters sells this cacao, the farmers are reenergized to continue to graft trees and care for their plots. We are excited to see this growth and resurgence of native genetic cacaos, not only because the cacao coming out of Cortepaz, Corpoteva, and Bajo Mira are delicious and chocolatey, but also because it represents more stable economic growth and security in the Tumaco region.
Keep in mind, the sugars listed on the label include naturally occurring sugars as well as those added to a food or drink. Modest effects have also been reported on the health protective effect of one of the cornerstones of healthy diet, the consumption of fruit and vegetables. Claims that these natural anti-inflammatories are heart and health friendly. However, as a whole, they're packed with protein, as well as being a source of polyunsaturated fats, and heaps of fibre. At the end of the quiz, you will receive a score with general feedback on http://luccheselibertas.it/ prodotti caduta capelli your current eating patterns. You can eat ice cream again, s and your favorite meals so long as they're coming with that miracle label of low-fat. They are found in meat, liver, chicken, eggs, fish, beans, peas, lentils and nuts. Check out our fact sheet section for more practical information on how to improve your diet in a healthy way. There are no single nutrients or vitamins that can make you healthy. These days, food engineers have found ways to make food so rewarding that your brain gets flooded with dopamine Both fat and carbs can be fattening — it all depends on the rest of your diet and your overall lifestyle. If my eating habits are half good and half bad, does that make my overall diet balanced. Including protein and fibre at main meals promotes better eating patterns, which would support long-term weight maintenance. In terms of cancer risk, dairy foods and calcium have shown both protective and harmful effects. You can always pair groups of vegetables you don't like along with the ones that you do in a serving and eat them together to ease your dislike. These are essential to supply the body with nutrients that animal products fall short of. A well-balanced diet helps with weight control, says the web are an important component of the well-balanced diet, says the for. Cooking techniques such as roasting and frying can be less healthy if a large amount of fat is added during the cooking. They found that blood glucose response to carbohydrate foods is independent of the amount of carbohydrates they contain. Join today and start learning the amazing benefits of eating healthier joyfully. While artificial sweeteners have not been proven to aid weight loss, they may be of benefit to people with diabetes, elevated triglycerides, and those following the to lose weight. Look at the calories on the label and compare them with the nutrients they offer. What and how much you eat and drink, along with regular physical activity, can help you manage your weight and lower your risk of disease. Yourself up with water, fruits, veggies, and lean protein at a party. Commercial burgers, hot chips, and fried foods. Some foods contain other forms of sodium, such as those used as flavour enhancers and raising agents The number of times deep-fried foods appear on the menu should be limited. Eating more oats is an easy way to up your fiber intake, a nutrient most of us don't get enough of. A recent analysis of studies found that eating at least three servings a day of whole grains was linked with a percent lower risk of heart disease. Recommendation: foods should be encouraged as part of a varied and nutritious diet as they are essential to maintain good bone and dental health. So try not to worry if you don't always achieve it. She focuses on individualized nutritional recommendations for athletes of all ages and activity levels, and is an active member of the of the of and. I know if I'm ever craving candy or sweets and I open the cuboard to see my healthy deluxe mix, protein balls or dried fruit combo, I'll immediately crave that instead of skittles. Healthy eating is a good opportunity to enrich life by experimenting with different foods from different cultures, origins and with different ways to prepare food. Many people fail to adhere to healthy diet recommendations and eat too much in general and too many unhealthy foods in particular with large numbers of people being overweight or obese as a result. A candy bar or handful of potato chips won't derail your heart-healthy diet. Choosing a balanced diet is the first step toward a happy and healthy lifestyle. A balanced diet is important because what people eat plays a role not only in managing illness, but also preventing it, according to the of and. Trans fats from partially hydrogenated oils are even worse than saturated fats, but regulations have now nearly phased them out of the food supply. Crickets crave protein so much they'll march across the countryside for days in search of it, even turning on and eating each other if they can't satisfy their protein appetite. But most should come from complex, unrefined carbs rather than sugars and refined carbs.
Importance of aerobic fermentation in alcoholic beverage production All types of alcohol are manufactured only after fermentation and if you love your own heady drinks then you definitely must comprehend the significance of aerobic fermentation during alcohol manufacturing Fermentation converts sugar present in the mix of water and various types of grains, fruits or vegetables straight into ethanol, commonly referred to as alcohol, which is subsequently further processed to make the desired alcoholic drink. Ethanol fermentation can only take place once the preliminary mix is infused with brewing yeast. With modernization has come specialization and you may now come across various kinds of yeasts available in the market such as brewers yeast, distillers yeast, bakers yeast, vodka yeast, wine yeast, instant yeast, and many more. Even though all types of yeast are basically unicellular fungi, these kinds of specific yeasts consist of specific capabilities that lead to excellent sugar fermentation during different levels of yeast temperature. Aerobic fermentation or simply aerobic respiration utilizes oxygen to produce energy or perhaps Adenosine Triphosphate [ATP]. In alcoholic beverage formation, this procedure occurs inside huge vats or tanks. Nevertheless, prior to actual fermentation, the process of glycolysis helps to ensure that two molecules of pyruvate are created from each molecule of glucose. The actual aerobic respiration additionally oxidizes the pyruvate molecules and creates even more ATP. The particular fermentation of sugars results at ideally suited temperature and also along with the correct amount of oxygen results in the desired alcohol beverages that are then processed further to obtain the end product with the required strength and taste. Fermentation itself causes the transformation of one glucose molecule straight into two molecules of ethanol and two molecules of carbon dioxide. This information will be invaluable to you should you intend to make your own personal homebrew mash and produce small batches of alcohol or even ethanol right at home. Some alcohols as well as spirits such as whiskey, vodka and brandy will be produced after distillation process and these items require specific yeast such as distillers yeast or even vodka yeast that can provide the end product with a higher strength as compared to brewers yeast that can merely produce alcohol up to certain proof levels. Just like all the other operations while in the production of ethanol or even alcohol like milling, mashing, filtering, and so on are important, so will be the fermentation procedure that should be monitored precisely. The actual aerobic respiration process should lead to the formation of precise levels of carbon dioxide and hydrogen gas based on the final product that needs to be created. In case you intend to generate alcohol in your own home then you definitely should understand the significance associated with yeast development, yeast temperature, and yeast fermentation in order to make the specified alcohol with the correct amount of strength and acidity. With technology moving forward with a rapid pace, alcohol production too has changed into a highly accurate art. Various types of yeast are actually utilized to produce different types of alcohol and spirits including beer, wine, whiskey, vodka, etc. Nonetheless, these products enter the final procedure only after fermentation of sugar in to the required alcohols. It is thus extremely important for you to carefully manage and keep track of the aerobic fermentation process by way of controlling oxygen levels and temperature levels to make sure that the final product falls within the specific limits.
Course abstract - Hinton Course: Marrying academic linguistics and community-based linguistics Instructor: Leanne Hinton (University of California - Berkeley) Description: Many people involved in the documentation or revitalization of endangered languages find that their work in community-based linguistics and the Academy from which many of them come may have conflicting goals and values, and may put conflicting pressures on the involved parties. In this course we hope to define community-based linguistics (CBL), identify the various ways in which the work of linguists and community people intersect in CBL, and examine the issues that need to be resolved in order for CBL to be useful and beneficial for all parties. 1. What is community-based linguistics? How does it differ from the central research fields in the linguistic Academy? Examples of community-based linguistics; What problems are there between CBL and the Academy, and what can be done to solve them? 2. Documentation – history of linguistic documentation; changing relationship between documentary linguistics and the speech communities; trends in linguistic documentation in the context of both academic linguistics and CBL 3. Language Revitalization – What is it? What are the ways communities work on language revitalization? What are the roles for linguists? What training do linguists need in order to be useful in language revitalization? Can language revitalization be an academic subject? How do linguists doing CBL relate to the Academy and vice Versa? 4. Indiginizing linguistics – indigenous linguists; issues for indigenous people coming into the Academy; how can they get the kind of training they need for their goals? bringing indigenous values to linguistics The discussion will be furthered by readings, many from the newly published Routledge Handbook of Language Revitalization, as well as other relevant papers. Holton, G. (2009) 'Relearning Athabascan languages in Alaska: Creating sustainable language communities through creolization' in Goodfellow, A. (2009) Speaking of endangered languages: Issues in revitalization. UK: Cambridge. pp. 238-265 Leonard, W. (2017) 'Producing language reclamation by decolonizing 'language'. in Language Documentation and Description, Special issue - Reclaiming languages: Decolonizing 'language endangerment' from the ground up. pp. 1-20 Rice, K. (2009) 'Must there be two solitudes? Language activists and linguists working together' in Reyhner, J. & Lockhard, J. (2009) Indigenous language revitalization: Encouragement, guidance and lessons learned. Flagstaff: Northern Arizona University. pp. 30-52 Woods, L. (2017) Ethics in linguistics research and working with Indigenous communities: Redefining collaborative linguistic research: Indigenous and non-Indigenous perspectives. Thesis. Zuckerman, G. (2009) Hybridity versus revivability: Multiple causation, forms and patterns. Journal of language contact, 2(2): 40-67 • Australian Government • The University of Queensland • Australian National University • The University of Melbourne • Western Sydney University
Powered by Google Contact Lontor Corporate Homepage Careers Rocking It LED Style Time: 2014-07-16 Writer: As far back as 1997, musicians, like U2, have used LED lighting during their shows. Not only did they lower the tour’s power costs but had a powerful environmental awareness message. According to an article written by David Kushner, the lighting designer for Nine Inch Nails explains “LEDs evolved into household lighting fixtures and are very power-efficient. The bulbs run as a cool medium. The only thing that gets hot is the processor. It changed the face of the entertainment industry drastically”. In the last ten years environmentally friendly products have become increasingly popular, with more celebrities and bands embracing the responsibility. Bands like Radiohead have used LED lights to cut carbon footprints and costs, without compensating on a beautiful bright light, and it seems their popularity is taking over the use of the outdated fog machines and hot spot lights. During their goal of a “carbon neutral” tour during the promotion of their In Rainbows album, Thom Yorke and his fellow band members were insistent that they reduce their carbon footprint while on the road, and teamed up with a company called Best Foot Forward to track and decrease their emissions. By only using LED lights on stage instead of the energy-hungry dimmable incandescent PAR-64 theatre lighting, which consumes about 31,997 watts of electricity during the 2 hour concert, Radiohead reduced the total power consumption for lights to a mere 6399 watts (that’s one fifth of the energy cost). All this talk about energy saving might leave you wondering about the performance. Besides the music, the lights put on a spectacular show. Not only do they provide a stunning lighting effect, they can also enhance mood – which is very important when promoting music or to include the crowd during a performance. Interestingly, LED’s (Light Emitting Diodes) actually emit a blue light – in the visible light spectrum this is interpreted as creating a cooling atmosphere. If the performers wish to ‘warm things up’ they use LED lights with a yellowish tint (hence the nickname ‘yolk lights’) that create a warmer glow at the other end of the spectrum). This created a fuller, more memorable experience for both the audience and the performers. Andi Watson, a long-time collaborator with Radiohead, commented on his ground breaking design for In Rainbows from 2008. Watson used a 100% LED lighting and video system. This time, it had to be environmentally friendly. “Having started on that journey, I wanted to keep that ideology alive so looked at ways we could improve upon last time,” he says. “I reached the conclusion that we couldn’t gain much by getting in fixtures that were only slightly more efficient as their environmental cost in terms of fabrication outweighing the marginal gains.” He explained that he initially wanted to rely on only video sources without any lights. However, his goal was “to create a unique, beautiful environment for the band to perform within that synaesthetically represents the music as much as is possible”, and so it became necessary to use lights with the minimal power usage. Another function the LED lights provided was the dimming ability and the wide range of colour and hue options available. “I think the biggest challenge is the number of songs and their seeming random appearance in the set,” said Watson. “With 100 unique songs, there are 100 unique visual responses. That is a truly staggering amount of programming, and there is never enough time to do that in rehearsals, so sometimes it feels like a continuous game of catch up. Having said that, I feel happy that we have achieved what we have… Most fixtures in the performance execute double duties. “Nearly all of the lighting is used both as structural elements and also as key lighting”. The fact that the LEDs did not let such an environmentally friendly world famous band down, they should serve you with as much reliability and beauty. Leave message
Can ‘hardening’ our schools keep our kids safe? The main lobby of Sandy Hook Elementary School in Newtown, Connecticut Can walls and barriers alone solve a problem as multifaceted as gun violence and mass shootings? In the wake of the Parkland shooting and the March for Our Lives movement, the question of school safety has gotten renewed focus. The President’s calls to “harden our schools” has ignited debates about the cost and efficacy of applying design solutions to protect students. But for architects and designers, what does “hardening” our schools really mean? Is the solution for keeping kids safe fortress-like standards pushed by the NRA? Architect Julia McFadden has wrestled with questions of school safety, and the delicate balance between environmental design and educational philosophy. As an associate principal at Svigals + Partners, McFadden was a lead designer for the highly publicized redesign of Sandy Hook Elementary, the site of the Newtown school shooting in 2012. Curbed spoke with McFadden about the issue of safety and design post-Parkland, and how the lessons she learned while working on Sandy Hook are still applicable today. This conversation has been lightly edited for clarity. You hear this term “hardening schools” being thrown around. What does that mean to you, and what does that process entail? “The term is specific to the security industry, so hopefully school officials and politicians know what they mean when they use this term. I learned about it from our security consultant at Sandy Hook. It refers to a greater level of impenetrability of physical elements, such as wall and doors. “Windows can be hardened with ballistics-level glass. Walls are hardened with materials that make them harder to physically break through or penetrate. There’s a blast-resistant sheetrock. You can add concrete block or stone to a wall to increase its hardness. There’s a similar term that’s also used in the security industry, crush resistant, that may be what many people are referencing. It refers to the length of time a wall or a door can withstand an assault before you’re able to break through or gain entry.” Have there been significant examples of schools built with this level of security in mind? “I’ve heard of other school districts that have been increasing the hardness of certain elements of their buildings. But there isn’t a national clearinghouse or anybody tracking how schools have been responding. Sandy Hook school is still probably the prime example of this kind of project.” Sandy Hook Elementary School Town of Newtown The entrance to Sandy Hook Elementary School How did you define safety when working on Sandy Hook? What was your goal? “Our goal for safety, which we discussed with the community, was to build a school that would withstand the same type of assault. There was a certain level of design, and hardening features, that we included that I wouldn’t think would be appropriate across the board at all schools. I hope we’re not headed in that direction, but we’ll see how the discussion goes over the next few years.” Why would you not want schools to be designed to that standard? “In order to harden to that level while keeping a certain level of openness, there’s a very big tradeoff in openness and a premium in cost. I think that’s a big burden that takes away from the primary focus of schools, which is education. Dollars go to the physical structure, rather than what’s happening inside them.” Touring Sandy Hook last year, it seemed like a very light-filled, happy place to learn. I can see how that level of safety, and that kind of atmosphere, could be expensive. Can you provide the cost of the security upgrade? “We were never able to determine the exact premium for the hardening features. The project met the budget, and the school didn’t use all of its $50 million grant. But in general, school construction in Connecticut is pretty expensive compared to, say, a school district in rural Kentucky. That’s setting a standard in an affluent area that isn’t fair to schools that can’t afford the expense of hardened glass. Other schools may have to choose to have little or no openness in their design. They’ll have solid doors without windows to meet the hardening requirements, since it’s less expensive.” When you start designing school for this sort of security applications, is there a danger that people will start promoting the idea that we can solve this issue through design and construction, as opposed to better mental health care, gun control, and other actions? “Yes, there is a danger in doing that. You can’t solve these problems with just physical design. It has to be a multifaceted approach. “Even in the design of Sandy Hook school, we weren’t relying on just physical elements. There was technology in the form of video security and cameras, doors with alarms that linked back to the central security office. Operations and training with first responders is equally important. These are critical aspects of safer school design. But yes, there are larger issues and policy questions. Anti-bullying programs, access to mental health, and gun control all play a part in making schools safer.” Has there been a larger conversation in the architecture industry about designing for school safety? “There hasn’t. Certainly we’ve given some talks, and there’s been some discussion. But I’m not sure it’s gotten to an organized level, like the AIA issuing positions that they’re promoting. I think it’s an issue that’s really only seen movement since Sandy Hook, and will probably gain steam now as well.” Has your firm gotten lots of inquiries about this type of work? “There was a lull before Parkland, when inquiries had tapered off. Now that Parkland happened, things have picked up again. We haven’t had a chance to sit back and reflect on what role can we take in this. We were just an average architecture firm before Sandy Hook, and weren’t experts going into that job. I don’t know I’d say we’re experts now. I think we’ve gained expertise. There aren’t certifications for designing safe schools.” You once compared architecture to designing a set for a play. Ideally, what kind of set do you want to design for students? “With Sandy Hook School, we proved to ourselves and others we could design to a certain safety standard and also include what we think is important. Schools should have a sense of welcoming, be cheerful to approach, have a sense of fun and play. It should focus on biophilic design that incorporates or exemplifies nature. “It’s important to both students as well as the adults who teach in school; we as humans as a lot happier when we’re reminded of the natural world.” Source: FS – Curbed National Can ‘hardening’ our schools keep our kids safe?
Science Friday We help the research community to work smart and discover more. The effective difference between observing a total eclipse of the sun in the narrow path of totality and observing the partial solar eclipse just outside the path of totality is comparable to the difference between hitting a home run in baseball just inches beyond the outfielder’s glove and having the outfielder make a leaping catch for the out. Several decades ago scientists developed a theory, generally accepted today, that the Moon formed from a glancing collision of a fairly large astronomical body with the Earth over 4.5 billion years ago, not long after the formation of Earth as a solid If these programs are to be believed, all that the males in the wild ever do is to fight amongst themselves for the females, to mate with the females or to prepare/ wait to mate with the females, when all of these taken together forms less than 5{b2ad4701019a2d48c4572069af24a4bdc560ed22d15daf1c3e71cbb64cb01f7f} of male behaviour, at least in the
I am reading one PhD thesis at the moment, and encountered an explanation which states that the form of the verb take used in the following sentence is 'impersonal passive'. On 25 April, for the first time in Portugal, fully free and democratic elections took place. I don't think it is correct, but am not quite sure, because I believe that this is an active sentence. Could you please explain to me whether there is a mistake in this claim or no not? • 1 Not an answer to your question, but took place in that sentence is synonymous with happened or occurred and makes complete sense. – Jake Regier Jul 29 '15 at 18:59 • 1 You're correct. This is not a passive construction. Whoever wrote that explanation didn't understand what "passive" meant. That means that you shouldn't trust their judgement on "impersonal", or any other grammatical term. Passive is pretty basic; people who don't know what passive is should not be commenting on English grammar. – John Lawler Oct 3 '15 at 22:05 This is a use of the verb 'to take' in the active voice. Changing 'took place' to 'were conducted' would introduce a passive verb. You're right. Not all impersonal constructions are passive; the sentence you quote is impersonal, but it uses the active form of the verb (as Sam Burns says). Geoff Pullum, a linguist, explains in a Language Log post "The passive in English" that passive constructions in English always use a participle (almost always the past participle); but you can see that there is no participle in "took place." This is the simplest test I have encountered yet for seeing if a verb form might be passive. Of course, it doesn't work the other way (not all uses of participles are passive). • 1 You cannot form a passive out of to take place because it operates as a phrasal intransitive verb, so there is no object to switch into subject position: the place was not taken by the elections. Moreover, the participle under discussion here is almost always with the past participle (sometimes called the “‑EN” form, mutatis mutandis), as that one is by its nature passive, rather than with the gerund-participle (sometimes called the “‑ING” form) used for active progressives. – tchrist Oct 3 '15 at 21:59 • @sumelic: Passive always uses a past participle, and there's always a form of be right before it. If it were a present participle with a form of be in front of it, it would be the Progressive, not the Passive. That's how they stack up in the verb chain: Modal+Inf, have +PastPart, be +PresPart, be +PastPart, MainVb. – John Lawler Oct 3 '15 at 22:10 • @JohnLawler: I'm just summarizing what Pullum says in the linked post. Of course different linguists often use different terminology; perhaps I should make that more clear. The construction he talks about is forms like "That rash needs looking at by a specialist," which use a present participle in standard language, although a past participle is used instead in some regional varieties. – sumelic Oct 3 '15 at 22:14 • 1 Oh, he wants to call that passive? I'm surprised. That's a special collocation with need (and maybe some other equally weird verbs); it's like The bridge is building vs The bridge is being built, as we would now say it. – John Lawler Oct 3 '15 at 22:27 Your Answer
(a star). Oompdsita. Aswan. Sraswoar. MXOHELMAS DAISY. A large temperate-zone genus of attractive but botanically-confused herbs, particularly abundant in N. Amer. The genus is characterized by numerous ilattish rays (white, blue, red, or purple), slender style appendages, compressed several nerved akenes, and an involucre with unequal bracts in few or sev eral rows, the pappns simple, soft, and abundant (Fig. 161). Leafy stemmed, mostly blooming in the autumn. Some of the species are annual, but those in cult. are per ennial (or rarely biennial). All are easy of cultivation in ordinary soil and exposures, and are among the host plants for the hardy border or for naturalizing in the freer parts of the grounds. They grow reanlilily from seeds, but aref gagi era y prop. y ivision o t e _ _ clumps. Calimeris and Linosyris :::,B:;,',,b,'i_c:{;-)1l::_' are kept distinct in this book. Aster. A. Old World Asters, some of them old garden plants, and somewhat modified by cull. B. Stems simple and scape-like, bearing a single /1. alpinus, Linn. Lvs. entire and spatulate, forming a cluster on the ground,those on the stem small and linear : at. 3-10 in., bearing a large viol!t~ra_ved, hand some head. B.M. 199.—1n its wild state, the plant also occurs in the Rocky Mts. Valuable alpine or rockwork plant, with fls. varying to pink and white. Var. specio aus, Hort., is taller and stronger, with beads 3-4 in. across. Var. supérbus, Hort. (Gn. 54: 1193), is a large and showy form. Himalaicus, C. B. Clarke (A. Himalayéraais, Hort.). Similar to A. alpinus, but dwarfer: rays lilac-blue, slightly recurved at the tip: sts. 4-12 in., slightly vil loua : lvs.oblong or elliptic, nearly entire. Himalayas, 13,000—15,000 ft.—Little known in America. diplostephioldes, Benth. Two to 3 ft.,sot't-pubescent or hairy, the st. simple and )/ --" 7 \ solitary: lvs. obovate or _ K I ._\\'&fg§/ oblanceoiate, entire but 1,,‘ ciliatewolitaryheadlarge, -1] I inclined, 2-3 in. across, "U1 9 1’ 1', ./ blue or pale purple, very ‘ ’-"wt ilk? showy. Himalayas. B.M 6718. J.H. III. 33: 262.—In the Amer. trade has been mis spelled A. Deptostaphides. Bu. Stems usually branched and several- (0 many-fld. Améllus, Linn. St. simple or nearly so, few-fld. or sometimes only 1-fld.: lvs. oblong-lanceolate, acute, somewhat serrate, more or less 3-nerved, roughish pubescent : involucre scales oblong, obtuse or nearly so, spreading, in 4-5 rows; heads large. purple. Eu. and Asia. Gn.35:689.—Variable, and several well-marked garden forms. Var. Bessarabicns, DC. (A. Bessardbicus, Bernl1.). Lvs. oblong and attenuated at base: plant taller and larger-fld., deep purple. Gn. 35, p. 173.—Sh0\ry and de sirable. Var. Oassabicus, Hort. (A. Cassiardbicus, Maundi). Fls. larger than in the type, the rays regular and de flexed, the disk bright golden and broad. Bibiricus, Linn. A foot or less high, somewhat pu bescent, each branch terminating in a single head : lvs. < ~ /» \(./ ii 163. Aster Nova:-Angllae. One of the best and most showy of native Asters. fia?:'.9'); macrophyllus, Linn. (G.F. 4: 89); oblong-spatulate to broad~lanceolate, serrate : heads violet or lilac. Arctic Eu. and Arner., and Rocky Mts.— Excellent rockwork plant. Loris, Linn. About 2-3 ft., slender-branched : lvs. linear, or lance-linear : heads large and blue, with long, distinct, handsome rays. S. Eu. Ga. 37: 744. trinérvius, Roxbg. About 3 ft., stout, corvmbose at summit: lvs. lance-ovate and strongly toothed : heads large, blue or purple (a pale var. ) , with narrow, spread ing rays. Himalayas. R.H. 1892:396.—Hardy, hand some, variable. Tataricus, Linn. f. St. erect and striate, hispid, corymbose at the summit, often 7 ft. high : lvs. large (the radical 2 ft. long), lanceolate or oval lanceolate, attenuate at base, entire: involucre scales purplish at tip ; heads blue or purple, late. Siberia. G.F. 4: 197. Excellent for the hardy border, particularly for its very late blooming. AA. NATIVE Asrans. These plants are one of the charms ofthe Amer. autumn, and are amongst the best of all hardy border plants. They gener ally improve greatly in habit when transferred to cultivated grounds. Any of these wild Asters are likely to come into cultivation at any time. The number of kinds is large. The student will find them all described in Gray's Synoptical Flora of North America, 1, pt. 2. Those 0! the northeastern states and adjacent Canada will be found in Britten and Brown’s Illustr. Flora of the U. S., and G1-ay’s Man . Those of the S. are described in Chapman's Flora of the S. states. The following list. comprises those known to be in cult. Of these, only A. 1Vo1'a*-Anglice is well known in domestication. The species are much con fused : . 1;/j,_ A. acumindlus, Michx.; amelhgjslinus, Nutt. (G.l". 5:378): Andersoni, Gray ; Bfgelovii, Gray(B.M. 6430); canéscens, Pursh; Caroli m'dnus,Walt. ; Chamisxonix, Gray; Chdpmani, Torr. & Gray; 1-rnnnmtdtua, Gray; c6ncol0r,Linn.; ronspicuous, Lindl.; rordifdlius, Linn. (Fig. 162) ; co- mbosus, Ait.; Cfmickii,Gray; diflusus, Ait., and var. horizoniztlis;D0!iglasii,Lindl. ; Dninnmondii, Lindl.; dmnbsus, Linn.; ericoldes, Linn.; fulcdtus, Lindl.; I-'e'ndler\|', Gray; folillceus, Lindl.; 1":-émonli, Gray; grandi flbrus, Linn.; Hdllii, Gray; Hir ueyi, Gray (G.l". 2:473); 1'nIegr\|‘ Iblius, Nutt.; llvvis, Linn.; linarii fcllius, Linn.; Lindlvydnus, Torr. Mén-ziesii, Lindl.; multiflbrus, Ait.; nemordlis, Ait.; Nrivvz-Anglia», Linn. (Fig. 163. A.F'. 9:283), and vnr. rbseus; Nbvi-Bélgii,Linn.; oblrmgifblius, Nutt.; panic uldtus, Lam.; pdfens, Ait., and var. Meéhaozii; poly phgjllus, Willd.; Pbrleri, Gray ; pren-anihoides, 1\iuhl.; plnrmicoides, Torr. & Gray (G.1'-‘. 3:153); pulchéllmv, Eaton ; puniceus, Linn. (Fig. 164), and var. ltrvicafilis and var. lucidulus; radullnus, Gray; sngitifolius, Willd.; mlicifblius, Ait.; sertceus, Vent. (G.F.5:473)¥ Shértii, Hook.(G.F. 4: 473); spectdbilis,Ait.(l\In. 5: 41); .-mrculbsus, Michx. (G.F. 5:521); ta-nacetilblius. HBK.; Tra-descdnti, Linn.; turbinéllus, Lindl. (G.F. 6:17); unduldtus, Linn. (G.W.F. 4); versicolor, Willd. In the following list, those marked " are offered by Amer. dealers : ‘A. coccinma Nevr\|dé1\|uis==i—~'A. I)¢i!achi=i—'A.iu) bridus ndmu=i "Rosy color. only 6 in. high."—_’A. lanc1!b iius Cala'I61-m'.c1u— i—'A. liladnus Nevade'nsu= i—'A. Meéhani. a well marked fonn of A. patens. found by Joseph Meehau at Antietam.—"'A. Nb: ¢z-ca».rnleue=- Z—'A. pur amiddlis== i—A. Reévesii, Hort., is A. ericoides. var. Reevesii, Gray. a "rigid form. comparatively stout. glnbrous. except that the lvs. are often hispidulous-ciliate toward the base, the heads and rays as large and the latter about as numerous as in A. polyphyllus." .\'. Amer.—"A. rotundiloliua, Thunb.=Felicia.— A. Sikfintémia. Book. Three to 4 ft., stout and erect: lvs. lanceolate-acuminate. spinulose-serrate : heads purple, in large corymbs. Himalayas. B.1\I.4557.—A.Strdcheyi. Hook. Stem less and sarmentose, with 1-tid. bracted st-apes: radical lvs. spntulate, hairy: heads lilac-blue, 1 in. across. Pretty. Hima layas. B.M.0912.--‘A. tvrnu'1w‘zlia= i—A. Téwmhendii, Hook. -=A. Bigelovii, Gray (N. Amer.). L_ H’ B_ The native Asters are amongst the very host plants for borders and roadsides. They should be better known. A. acuminatus grows well in shade in ordinary soil, not necessarily moist; increases in vigor under cultivation. A. cordifnlius prefers open or partial shade ; improves much under cultivation with good soil. A . corymbosua prefers at least partial shade, and will grow even in very deep shade; seeds very freely; does well on dry ledges and in small crevices in rock; very tenacious of life. A. dummms prefers full sunlight and dry situation. A. cri coides wants full sunlight and dry situation ; will grow in very poor or shallow soil, but does best where roots can penetrate deep. A. Irevis grows in either full sun light or partial shade and good soil. A. 1Vor¢v-Angliue will not endure much shade; prefers moist soil, but grows well in ordinary garden situations. Fall-sown seedlings of A. lV0t'rr-Aw/litt, var. roxeus, come prac tically true to varietal name, though varying in shade of color, and these seedlings bloom later than older plants and at height of 18 inches, making the plant of value as a late bedding plant treated as an annual. A . Not-i-Belgii prefers moist soil; will not endure heavy shade. A. panicululus prefers moist soil, but will do well in rather dry situations; will endure more shade than either of the two above species. A. palms wants open or half-shaded places, and good soil; one of the weaker species, often proving short-lived. A . pmu'c¢'\|t.t will not endure shade; prefers moist places, but will grow in good soil not over moist; in dry situations it loses its vigor; spreads rapidly in favored locations. A. spectabilis prefers open or partly shaded places; one of the weaker species in wild state ; rather short-lived. A. undulatus wants open or half shade ; late-flowering, handsome plant, forming large bushes where allowed to develop. A . rimineus, although not in the trade, is a fine plant in cultivation. F‘ w_ BARCLAL
Fourth Amendment doctrine has been home to two competing models: the Warrant Model and the Reasonableness Model. The Warrant Model, emphasizing the Amendment’s Warrant Clause, holds that search and arrest via warrant is the preferred method and the default rule, though allowing for exceptions when obtaining a warrant is impracticable. The Reasonableness Model, which stresses the Amendment’s Reasonableness Clause, holds that the Amendment imposes a generalized reasonableness standard on searches and seizures by which the question is not whether dispensing with a warrant is reasonable but whether the search or seizure itself is reasonable. These polar positions have been replicated in the scholarly literature on the history surrounding the adoption of the Fourth Amendment. Some adhere to a reading of the historical record that roughly supports the Warrant Model while others have found that history more strongly supports the Reasonableness Model. This Article interprets the historical record differently than either of the two dominant schools, and introduces a third model of the Fourth Amendment: the Local-Control Model. It situates the Fourth Amendment as the culmination of a decades-long, continent-wide struggle by Americans for local control over search-and-seizure policy as against central authority. And it posits the Fourth Amendment as the result of an effort on the part of the Anti-Federalists, those who demanded a Bill of Rights, to maintain local control over search-and-seizure policy. On this view, the Fourth Amendment has a strong federalism component. It demands neither that federal officers generally use warrants for searching and seizing nor that they act pursuant to a general reasonableness standard. Rather, the Local-Control Model supports the view that federal officers must generally follow state law in conducting searches and seizures. Included in Criminal Law Commons
VIB researchers discover possible strategy against stroke The importance of PHD1 in the brain Of all organs in our body, the brain is unique because it needs the highest levels of oxygen and glucose to function and to survive. The simple reason herefore is that brain cells absolutely rely on oxygen and glucose to generate energy, necessary to function normally. In stroke, reduced blood supply therefore threatens this energy balance, causing neurons to die. The Carmeliet lab discovered that brain cells sense and adapt to a shortage of oxygen and nutrients via PHD1. Peter Carmeliet (VIB/KU Leuven): "These results established for the first time that blocking PHD1 offered large protection against irreparable brain damage when blood vessels can no longer supply vital nutrients to brain cells". Reprogramming of glucose metabolism – a first in class mechanism Dr. Annelies Quaegebeur (VIB/KU Leuven): "By reprogramming glucose utilization, neurons lacking PHD1 have an improved capacity to detoxify damaging oxygen radicals, protecting the brain against stroke. This is a paradigm-shifting concept in the field of stroke protection." Translational potential of PHD1 inhibition for stroke While further study is necessary, this research identifies PHD1 as a potential therapeutic target for stroke. Prof. Peter Carmeliet (VIB/KU Leuven): "Similar to genetic loss of PHD1, treating mice with a pharmacological PHD1 blocker protected mice against stroke. This raises the possibility that PHD1 inhibition might be clinically useful, but future research will be necessary to unveil the therapeutic potential in this debilitating disorder. Media Contact Sooike Stoops [email protected]
SIOSEIS was used aboard the R/V Ewing during the SIGMA experiment from 25 August 1996 to 10 October 1996, Steve Holbrook, Chief Scientist. My favorite pictures: Brash ice Iceberg Iceberg Greenland David Reid's photo album All digital pictures courtesy of David Reid, R/V Ewing 2nd Engineer photos of R/V Maurice Ewing Seismic Source Signature The SIOSEIS onboard processing had several objectives: 1) Provide quality control so that acquisition errors could be corrected as soon as possible. 2) Provide a stacked section that could be used for geologic interpretation so the shooting program could be modified if something "cool" turned up. 3) Provide a copy of the data on DAT tape to take home to SIO. The 3480s would go to WHOI, the DLC (Danish Lithosphere Center) would read and reformat the 3480s aboard the Ewing using ProMAX. 4) Steps 1 and 2 should be done as quickly as possible (at least as fast as the data was collected by the DMS-2000). Dr. Graham Kent had made his HP 9000/715 available for the "realtime" processing along with an 3480 tape drive with stack loader and a DDS-2 format DAT tape drive. The stack loader was not used because the HP was able to keep up with the brute stack processing and inserting a new tape into the drive is faster without the stack loader. It was also decided that each 3480 should be in a unique file on the DATs so that later extraction for the SIO mass store would be simplified. The SEG-Y files on DAT were written with the SEG-Y standard violated by using IEEE floating point rather than IBM floating point. It was also decided that decimating the data from 2ms to 4ms without anti-alias filter was acceptable. Unfortunately, the DLC's 3480 tape drive was damaged during shipment and ProMAX was unable to read a test tape using the 3480 attached to the shipboard Sun computer. The shipboard 3480 could not be attached to the DLC Sun because of differences in computer buses. It was decided that the DLC would read the DAT tapes written by SIOSEIS. The first line shot turned out to have a miriad of problems, one of which was an unbalanced streamer. It was deemed that a static correction for the streamer depth would help the stack since part of the streamer was floating and part of it was 20m deep. The streamer depth is available in the trace 0 of each shot, but neither ProMAX nor SIOSEIS extracted it. To further complicate the problem, ProMAX ignores trace 0 totally. Some mechanism for getting depth into a ProMAX and SIOSEIS form had to be established before tape copying could commence. To accomplish these goals, modifications were made to SIOSEIS: 1) Parameter OFFLINE was added to SEGDIN to automatically eject the 3480 after it has been read. 2) Parameter REWIND was added to DISKOA to make "circular" disk files (useful for realtime QC). 3) Had SEGDIN set a signal on each new tape so that process OUTPUT would start a new SEG-Y file on every new 3480 tape. 4) Modified the tape change routine to write only 1 EOF when OUTPUT parameter REWIND is used. 5) Parameter TR0 was added to SEGDIN to write the LDGO/DIGICON trace 0 to disk since ProMAX ignores the SEG-Y trace 0. This disk write was removed after 7 and 8 below were completed. 6) Made OUTPUT write trace 0 before each trace 1 when SEGDIN parameter TR0 is used. 7) Add parameters BGP and CGP (bird-group pairs and compass- group pairs) to GEOM to define where the birds are on the streamer (varies on each streamer deployment). 8) Write the "receiver elevation" in the SEG-Y trace header when BGP is used. The extraction of the streamer depth uses a subroutine by John Hopper that extracts the bird ids and depths and then given the ranges, interpolates and/or extrapolates to the other groups of the streamer. SIOSEIS uses the SEG-Y trace header location "receiver elevation" for the streamer depth. Program list.ewing was modified to dump ALL the different "sections" of trace 0. Process SEGDIN was modified to recover from various acquistion 1) Shots with a zero shot time are dropped. These shots have a shot number of 0 and are not in the navigation file. 2) SQTP errors cause a shot to be terminated early and do not have a terminating filemark. SEGDIN previously did not honor the early traces of the following shot. SEGDIN now recognizes a new shot without the filemark. 3) A "streamer rebuild" error causes traces 2-12 to have large crazy trace numbers. SEGDIN previously would skip to the next shot when this ocurred. SEGDIN was modified to detect this situation and ignore only the bad traces. 4) SLIC errors cause the LDGO "trace 0 section 11" not to be updated, resulting in the shot number and shot times to remain the same until the system is restarted. This usually results in more than 20 shots with the same shot number and shot times. The data are fine, as is the navigation file. SEGDIN was modified to detect this situation and increment the shot number, though the header shot time remains constant. The "opcode error" does not appear to have an effect on the data. SIOSEIS processing was divided into parts: 1) The brute stack with SEG-Y DAT tape output immediatedly after reading the SEG-D 3480 tapes. Every 15th shot is written to a"circular" file. 2) A plot of the current shot in the circular file. 3) A plot of the stacked data every two hours on 8.5x11 paper and taped to the previous 2 hour plot. 4) An fk migration and plot of the stacked data every four hours. 5) Final plot on the NovaJet. The brute stack runs on the HP 715 in 15 minutes and is designed to: A subtle processing trick was used in the NMO process in order to laterally vary the NMO velocity function. Earlier work in the area showed that a velocity function could be designed for the area. The velocity varied with water depth. Graham Kent had modified NMO such that the parameter vtrkwb (velocity track water bottom) modifies the normal SIOSEIS spatial interpolation by changing the RP number into the water depth determined by Hydrosweep. The velocity function was described by water depth so that the spatial interpolation is done by water depth. SEGDIN has always put the Hydrosweep depth in the SEG-Y trace header. The shot plot script generates a Sun rasterfile with the latest shot from the "circular" shot file. The raster file is displayed on the screen using xloadimage and is converted to PostScipt so it can be sent to a printer. With filter and gain, this script runs quickly on the HP without a noticable impact on the stack script. The stack plot script generates a Sun rasterfile of 2 hours of data and sends it to the screen using xloadimage. The rasterfile is also converted to PostScript and can be sent to a printer. These 8.5x11 plots were then taped together for a fast permanent display. With filter and gain, this script runs quickly on the HP without a noticable impact on the stack script. The fk script performs FK filtering and migration of 2048 traces (2000 stacked traces and 48 pad traces), each trace having 2048 samples (8 seconds). Successive FK segments overlapped by 50 traces so that the segments would appear seamless when spliced together. The 2048x2048 FK processing took 3-4 minutes on the HP 715 and could be done on the same computer as the stack while the stack is waiting for a new input tape from the acquisition system. The final plot script generates a plot of several FK migrated segments for the NovaJet plotter. The NovaJet plotter is similar to to HP DesignJet plotters, so the PLOT parameter nibs 2859 can be used. The resulting SIOSEIS rasterfile can be translated to an HP-RTL file by using program SIO2HP. The RTL file is then sent to the Ewing Sun computer (hess) with the NovaJet plotter using the binary mode of ftp. On hess, the plot is sent to to NovaJet using the Unix cat command: cat RTL-file > /dev/bpp0. Miscellaneous stuff: 1) I did not use the auto tape change feature of OUTPUT because: a) A SEG-Y file will be split, causing the 3480 to be in two pieces. b) It's slow because SIOSEIS does not allow the shot to be broken, so it has to reread the traces written on the current tape, then backup again before writing the file mark. c) I found the end of the DAT tapes seem to have lots of write errors before finding the EOT marker. Rewrites appear to be VERY slow. d) There are 5 minutes or more between the end of input tape and when the DMS-2000 has another 3480 ready, doing a manual rewind and load of the new DAT tape is efficient. The down side is that OUTPUT doesn't close the tape with a file mark, which some systems/programs may choke on. ( I think sioseis now treats any tape error as an EOF - the "new" SCSI tape drivers return a -1 for ALL errors, so I can't distinquish between them anyway!) Shallow water tricks: 1) Do an "inner" mute (a tail mute of the inside or close traces) to get rid of the deeper portion of the record that is overwhelmed by ship noise. SMUTE has ADDWB YES, use it. SEGDIN now converts the Hydrosweep water bottom depth to water bottom time. 2) Use a VERY severe "outer" mute. For "reatime" purposes, in 400m water, I used the NMO stretc parameter of .06. That means any sample with nmo greater than 60 mils will be muted out.
In the human immune system has found a new body that was looking for a very long time The human body is truly amazing. At the modern level of technology development, he manages to keep us in secret, not just individual cells or elements, but entire bodies! And recently a group of scientists from Australia found in the immune system of the body, the existence of which was suspected for a very long time. According to the editors of the journal Nature Communication, a new body responsible for the rapid immunity, to be precise – for the storage of b-lymphocytes. Scientists have long known about the existence of the so-called In-cell memory. This long-lived subtype of b lymphocytes, which is responsible for fast immune response and the production of a large number of antibodies in reinfection or re-infection by the same pathogen. Because of this, the immune system remembers the infectious agents that can better handle them in the future. Only here in all of this was at a time when the body is not in pain, memory cells somewhere to “live.” But where? Previously it was assumed that they are located in the lymph nodes, but it was not so. In the course of studying the structure of the lymph nodes, experts from Australia found directly over the lymph nodes are small formations that are literally stuffed with In-cells. Moreover, the new structure is not just a “warehouse” cells in it there are processes of transformation of cells in the plasma and the secretion of antibodies to fight diseases. The discovery managed to make through the use of two-phase laser microscope is the magnification and visualization allowed us to see new structure, which is called “subcapsular proliferative lesion” (subcapsular proliferative foci). According to one of participants of the project Dr. Moran Off, “See how they work In cells just incredible! In the new structure, which was seen for the first time, In-memory cells are activated, it formed clusters. We are the first to see how they move, interact with other cells of the immune system and mutate right before our eyes!” Leave a Reply
The Death Penalty Should Be Abolished 1534 Words Dec 11th, 2014 7 Pages Intro The death penalty gives humans in our legal system rights to decide who deserves to live, a power only God should possess. Capital Punishment takes away our rights as equals. From its origins, the death penalty has been an inhumane, costly, ineffective, and biased form of punishment that needs to be abolished granting everyone their right to live. History of the Death Penalty Down through history, the death penalty has been adapted to be justifiable in the eyes of the people. By altering the crimes punishable by death and the methods of execution, society conforms the death penalty to meet their standards. During ancient times, committing a crime was a serious offense often resulting in agonizing death. In the 18th century BC, Hammurabi, the ancient Babylonian king, popularized the death penalty in his infamous code, which enforced the death penalty for 25 different crimes including ones as insignificant as building a house poorly. Following Hammurabi, Draco, an Athenian legislator, codified the death penalty for all crimes. Methods such as impalement, beating to death, and burning alive were used (“History of the Death Penalty”). Throughout the colonial era, the death penalty was also overly misused. In 1612, “minor offenses such as stealing grapes, killing chickens, and trading with Indians” warranted the death penalty in the Divine, Moral, and Martial Laws of Virginia. While in Massachusetts, innocent people were dying due to the Salem Witchcraft Trials in… Open Document
Cleaning Up The Data Konkurrence Instruktioner This project will introduce you to the data analysis process that you will be using throughout and you will go through the process of calculating summary statistics, drawing an inference from the statistics, calculating business metrics and using models to forecast future growth prospects for the companies. The goal is for you to perform an analysis and also create visual tools to communicate the results in informative ways. For the final project, you will conduct three tasks: 2) develop a dashboard for a Profit and Loss Statement. 3) create a Financial Forecasting Model using three scenarios. You should start by taking a look at your dataset and brainstorming which sub-category and company you want to focus your data analysis on - the questions leading to this page should have assisted in this process! Then you should use spreadsheets or another Excel-like software to conduct your analysis and choose a sub-category and company you are most interested in. This project is open-ended in that there is no one right answer. ere are the three tasks that you will complete in the final project. Task 1: a. Identify the question about the data that you will answer based on your data analysis. Your question should include at least one categorical variable (GICS Sector or GICS Sub Industry) and one quantitative variable (one of the financial metrics) and require the use of at least one of the summary statistics. A tab within the Excel spreadsheet that you submit should include the summary statistics [measures of central tendency (e.g., mean, median) and measures of spread (standard deviation and range)] you used to answer your question. b. Create a presentation that provides at least one visualization to help with your answer. This visualization might be a bar chart, histogram, scatterplot, box-plot or other visual that you learned to make. Include your insights from the measures of center and spread and at least one numeric summary statistic in the description. Task 2: Create a dashboard for a Profit and Loss Statement that calculates the Gross Profit, Operating Profit or EBIT for a company selected from a drop-down list. Your drop-down list should pull historical fundamentals data to create the P&L Statement. The P&L statement should include the Gross Profit, Operating Profit or EBIT values for all the years there is historical data available for that company in the dataset. Task 3: Create a financial model for a company (different from Task 2) of your choice that forecasts out the Gross Profit, Operating Profit or EBIT for two more years using three scenarios (Best case, Weak case and Base case). Your assumptions for revenue growth, gross margin and operating margin should change for each scenario. Step One - Get Organized The presentation with the visual and summary The original data set A copy of the spreadsheet workbook you will use to do the analysis for your report that contains at least the following tabs: Data file, Summary statistics ,P&L Statement Dashboard ,Forecast scenarios Analyze Your Data :Look through the Tasks described above and select the qualitative variable and quantitative variable you want to focus your analysis on for the various tasks. Then use the .csv file to conduct your data analysis. Step Three - Create Your Presentation Once you have finished analyzing the data, create a presentation that shares the visual and summary paragraph. The summary paragraph should clearly communicate your findings based on your analysis, and provide a visual or numeric values associated with your summary. Anbefalede Evner “Thank you for your time and efforts dedicated to this task. ” Profilbillede humaidba, Saudi Arabia. Bedste indlæg fra denne konkurrence Se flere indlæg Offentlig Præciserings Opslagstavle • amitosh0078 • 4 uger siden Sir, your attachment of docs file & excel sheet is unable download or shown. • 4 uger siden • mehedihassan4467 • 4 uger siden • 4 uger siden • Supriatin • 4 uger siden Price, title, description and file attachments are irrelevant • 4 uger siden Sådan kommer du i gang med konkurrencer • Opret din konkurrence Opret din konkurrence Hurtigt og nemt • Få tonsvis af indlæg Få tonsvis af indlæg Fra hele verden • Tildel det bedste indlæg Tildel det bedste indlæg Download filerne - Nemt! Opret en Konkurrence Nu eller slut dig til os i dag!
EERC tells of renewables' promises, challenges NORTH DAKOTA - Renewable energy sources will continue to grow and are an important part of the country's energy future, but are only part of the equation because the nation is far from reducing its dependence on fossil fuels. That's part of the message delivered to members of the North Dakota Legislative Council's Energy Development and Transmission Committee at UND's Energy and Environmental Research Center by EERC staff members. Despite forecasted growth in renewable energy forms like ethanol, wind power, biomass and nonpetroleum-based fuels, the nation will continue to depend largely on fossil fuels and electricity generated by coal power plants, the committee was told. One reason is the country's forecasted increased consumption of fuel and electricity. "The key to our country's energy future is a mix," said Gerald Groenewold, the director of the EERC. "Fossil fuels are a part of that." Groenewold stressed the importance of renewable energy sources, which are more environmentally friendly and help the nation diversify its energy portfolio. EERC members said North Dakota is in a unique position to take advantage of much of that growth in renewables, but like more conventional energy sources, renewables also have their own set of challenges. North Dakota has been designated as having the most potential of any state for wind farm development, but Groenewold said "the biggest problem with wind is the wind doesn't blow all the time." Another wind challenge is the need for future transmission line capacity, said Chris Zygarlicke, the EERC's deputy associate director of research. The growth of ethanol plants using grain can be very beneficial for nearby communities, bringing jobs and helping local corn farmers, Zygarlicke said, but high corn prices have made the plants' business model more difficult. Zygarlicke also added that ethanol plants consume three gallons of water for every gallon of fuel produced. Groenewold also said "we need to address the subsidies" for renewable energy forms like ethanol and wind energy, and make sure the energy forms are able to sustain themselves economically in the long term. in Year LATEST Electrical Jobs Content Community Connection ELECTRICITY TODAY \| Advertisements
SALT - Sunday, 8 Elul 5778 - August 19, 2018 • Rav David Silverberg The command of shikhecha, which the Torah presents in Parashat Ki-Teitzei (24:19), requires leaving for the poor agricultural produce that was forgotten in the field during the collection of harvested produce. In discussing the application of this law to fruit trees, the Mishna in Masekhet Pei’a (7:2) describes the case of rows of olive trees that are separated by rectangular-shaped arrangements of plants. The Mishna states that if the farmer forgot to collect the olives of middle tree in the middle row, that tree does not qualify as shikhecha, and it is permissible to return to it and collect its olives. Most commentators (including Rash Mi-Shantz and Tiferet Yisrael) explain this ruling as an example of the law established in the previous Mishna that a tree situated in a unique location does not become shikhecha. Due to its special stature of importance, such a tree cannot be considered to have been “forgotten” even if it was passed by when the orchard’s fruits were collected. Accordingly, the middle tree in the arrangement described above is not subject to shikhecha due to its unique location, situated right in the middle of a special formation of trees. The Rambam, however, explains this halakha differently, explaining that this tree is not considered “forgotten” since it was missed only because it was concealed. The shikhecha requirement applies to readily accessible produce that was, for whatever reason, overlooked during the collection. In this instance, however, the olive tree was concealed by the surrounding vegetation, and thus its fruit was simply never seen, and not overlooked. Rav Yehuda Leib Ginsburg, in his Mussar Ha-mishna, suggests that this halakha perhaps symbolically expresses the common phenomenon of people who seem “forgotten” because they are overshadowed by others. Many remarkable, accomplished individuals fail to receive the recognition and respect they rightfully deserve as a result of their being “concealed” by others in their fields who, for whatever reason, are more visible and noticeable. As in the case of the hidden olive tree, these individuals are no less important or accomplished than others, and they are “forgotten” only because of their “concealment.” This halakha, then, reminds us that public recognition is not a yardstick by which anyone can measure his or her worth, or the significance of his or her achievements. The fact that somebody is not widely known, recognized or respected in no way undermines the extent of that person’s importance and greatness, or the extent to which such a person should be admired by those who know him or her – including that individual himself or herself.
Buffalo First Wealth Management, LLC Allen Dembski 7606 Transit Rd., Suite 100 Buffalo, NY 14221 May Newsletter May 2019 How Does the Federal Reserve Affect the Economy? What is the Federal Reserve? The Federal Reserve — or "the Fed" as it's commonly called — is the central bank of the United States. The Fed was created in 1913 to provide the nation with a safer, more flexible, and more stable monetary and financial system. Today, the Federal Reserve's responsibilities fall into four general areas: How is the Fed organized? The Federal Reserve is composed of three key entities — the Board of Governors (Federal Reserve Board), 12 Federal Reserve Banks, and the Federal Open Market Committee. The Board of Governors consists of seven people who are nominated by the president and approved by the Senate. Each person is appointed for a 14-year term (terms are staggered, with one beginning every two years). The Board of Governors conducts official business in Washington, D.C., and is headed by the chair (currently, Jerome Powell), who is perhaps the most visible face of U.S. economic and monetary policy. Next are 12 regional Federal Reserve Banks that are responsible for typical day-to-day bank operations. The banks are located in Boston, New York, Philadelphia, Cleveland, Richmond, Atlanta, Chicago, St. Louis, Minneapolis, Kansas City, Dallas, and San Francisco. Each regional bank has its own president and oversees thousands of smaller member banks in its region. The Federal Open Market Committee (FOMC) is responsible for setting U.S. monetary policy. The FOMC is made up of the Board of Governors and the 12 regional bank presidents. The FOMC typically meets eight times per year. When people wait with bated breath to see what the Fed will do next, they're usually referring to the FOMC. How does the Fed impact the economy? One of the most important responsibilities of the Fed is setting the federal funds target rate, which is the interest rate banks charge each other for overnight loans. The federal funds target rate serves as a benchmark for many short-term interest rates, such as rates used for savings accounts, money market accounts, and short-term bonds. The target rate also serves as a basis for the prime rate. Through the FOMC, the Fed uses the federal funds target rate as a means to influence economic growth. To stimulate the economy, the Fed lowers the target rate. If interest rates are low, the presumption is that consumers can borrow more and, consequently, spend more. For instance, lower interest rates on car loans, home mortgages, and credit cards make them more accessible to consumers. Lower interest rates often weaken the value of the dollar compared to other currencies. A weaker dollar means some foreign goods are costlier, so consumers will tend to buy American-made goods. An increased demand for goods and services often increases employment and wages. This is essentially the course the FOMC took following the 2008 financial crisis in an attempt to spur the economy. On the other hand, if consumer prices are rising too quickly (inflation), the Fed raises the target rate, making money more costly to borrow. Since loans are harder to get and more expensive, consumers and businesses are less likely to borrow, which slows economic growth and reels in inflation. People often look to the Fed for clues on which way interest rates are headed and for the Fed's economic analysis and forecasting. Members of the Federal Reserve regularly conduct economic research, give speeches, and testify about inflation and unemployment, which can provide insight about where the economy might be headed. All of this information can be useful for consumers when making borrowing and investing decisions. The Fed's mission The Federal Reserve is the central bank of the United States. Its mission is to provide the nation with a safer, more flexible, and more stable monetary and financial system. For more information on the Federal Reserve, visit federalreserve.gov. FOMC meeting schedule The Federal Open Market Committee meets eight times a year. Scheduled FOMC meetings in 2019: January 29-30, March 19-20, April 30-May 1, June 18-19, July 30-31, September 17-18, October 29-30, and December 10-11. Refer a friendTo find out more click here This communication is strictly intended for individuals residing in the state(s) of NY. No offers may be made or accepted from any resident outside the specific states referenced. Prepared by Broadridge Investor Communication Solutions, Inc. Copyright 2019.
mast image Special Report Impact investing Currency and behaviour Portfolio investors have progressively accepted the argument that international diversification provides risk/return benefits. However, the currency dimension has remained an emotional issue and currency hedging is a sensitive decision. Attractive local-currency returns on foreign asset market can be swamped by a depreciation of the foreign currency. Conversely, the return on foreign currency can provide a major portion of the total return of international investments when the domestic currency is weak. The currency hedging decision is a simple one: what currency hedge ratio (proportion of foreign asset value hedged against currency risk) should be adopted? In other words, should international assets be fully hedged against currency risk, not hedged, or partially hedged (hedge ratio between zero and one)? The currency hedging policy adopted by investors seems diverse. Data from a worldwide survey of institutional investors (Harris 2004) conducted in 2004 by Mellon/Russell, indicates that 39% of investors adopt a no hedging policy, 34% of investors adopt a 50% hedging policy, 14% of investors adopt a 100% hedging policy and 13% of investors adopt some other hedge ratio. Because these numbers reflect long-term policy benchmarks, they cannot be explained by short-term expectations on currency movements, but primarily by risk considerations or some behavioural attitude. The wide diversity in hedge ratios is puzzling. Traditional finance relies on expected utility maximisation and uses the expected return/risk paradigm to search for an answer. Some researchers have developed global market equilibrium models to derive optimal currency hedging rules. Solnik (1974) and Adler and Dumas (1983) derive an international asset pricing model where investors from different countries use their own currency as numéraire. Therefore investors from different countries view asset expected returns and risks differently because of foreign exchange uncertainty. Global equilibrium models conclude that all investors should hold a combination of their own risk-free asset (risk-free in home currency) and the world market portfolio partly hedged against currency risks. Hence the risky portfolio is identical for all investors and made of the equity market-capitalisation-weighted portfolio optimally hedged against currency risk. Investors attain their desired risk level by adjusting the combination between their home risk-free asset (cash or bond) and this risky portfolio. A major result is that all investors should identically hedge their international investments, whatever their nationality of their level of risk aversion. The optimal hedge ratio applies to all investors independently of their risk aversion and nationality, and is therefore ‘universal’. Unfortunately, the equilibrium hedge ratios depend on unobservable variables such as relative risk aversion and net foreign positions. Black (1989,1990) simplifies this equilibrium model and estimates that international investments should be currency-hedged with a ratio of approximately 70%. Unfortunately, it is observed worldwide that investors exhibit a strong home bias in their equity portfolios, so the normative implications of the global equilibrium model do not seem verified in the real world. In practice, many asset managers simply conduct an asset allocation mean variance optimisation based on expected returns and risk. Typically a two-step approach is implemented. The asset allocation to international asset markets is determined in a first step, and the amount of currency hedging is then decided for this specific asset allocation. So currency hedging is optimised assuming that the global asset allocation is fixed. In its most simple form, this is typically a mean-variance exercise. If currency risk premia are nil and if asset returns are uncorrelated with currency movements; then the optimal hedge ratio that minimises risk is 100% because currency risk is pure noise (see Pérold and Schulman,1988). So the currency-risk-minimising strategy is a hedge ratio of 100%. Again, this hedge ratio obtains for any (positive) level of risk aversion and should therefore be ‘universal’. According to portfolio theory, deviations from this full-hegded policy can only be explained by beliefs in currency risk premia, or correlation between asset returns and currency movements. For example, some investors believe that equity is a real asset so that the correlation between asset returns and currencies is strong. Behavioural finance claims that investors do not follow the traditional mean-variance paradigm and this is clearly applicable to the currency hedging decision (see Fisher and Statman, 2004). Agents tend to experience regret when their investment yields, ex-post, a poor performance relative to an obvious alternative decision that they could have chosen. Regret is such a powerful negative emotion that the prospect of its future experience may lead individuals to make seemingly sub-optimal, non-rational decisions relative to the mean-variance paradigm. Regret is defined as a cognitively-mediated emotion of pain and anger when, with hindsight, we observe that we took a bad decision in the past and could have taken one with better outcome. Contrary to mere disappointment, which is experienced when a negative outcome happens relative to prior expectations, regret is an emotion strongly associated with a feeling of responsibility for the choice that has been made based on a comparison of the actual outcome with the best outcome that could have been achieved. Currency hedging is a dimension where regret clearly applies. For example, an American investor who decided not to hedge currency risk would have incurred a currency loss of some 40% on its Euro-zone assets from late 1998 to late 2000, with a vast regret of not having fully hedged. Conversely a fully-hedged investor would have missed the 50% appreciation of the euro from late 2001 to late 2004. Again, a vast regret of not having taken the ‘right’ hedging decision. Furthermore, selling short an appreciating foreign currency leads to cash losses on the forward position that have to be covered by the sale of securities. A forced decision that is not lightly accepted by a board of trustee. The experience of regret in currency hedging is not news for the investment world. Several practitioners have justified a 50% naive hedge ratio on intuitive grounds. The 50% hedge ratio is the simplest currency hedging policy that attempts to deal with regret. With unpredictable exchange rates, an unhedged or hedged policy will be wrong 50% of the time, and often by a large amount. A naive 50% hedging policy will always be wrong and exhibit regret ex-post, but the maximum amount of regret will be cut in half. But oversimplistic rules that forget about mean-variance and solely focus on regret are wrong. Developing a quantified approach that considers both volatility and regret in the optimisation is not technically easy. The problem is that regret is not the return deviation from a passive preset benchmark but from a ‘moving’ benchmark, the best ex-post hedge ratio. But currency hedging lends itself to the application of regret theory because with hindsight, the optimal hedging decision can only be one of two possible choices. If the foreign currency appreciated by any amount, it would have been better to be unhedged. If the foreign currency depreciated by any amount, it would have been better to be fully hedged. We developed 1 a model of optimal hedging where investors can have different levels of traditional risk aversion and of regret aversion. The optimal hedging policy varies drastically depending on the type of risk that an investor privileges. Much of the diversity in observed hedging policies can be explained. 1Michenaud and Solnik: ‘Optimal currency hedging: A regret-theoretic approach’. HEC working paper 2005 Have your say You must sign in to make a comment Your first step in manager selection... • QN-2540 Asset class: All/Large Cap Equities. Asset region: UK. Closing date: 2019-05-27. • QN-2541 Asset class: Small/Mid-Cap Equities. Asset region: Switzerland. Size: CHF 130m. Closing date: 2019-06-04. • QN-2542 Asset class: All/Large Cap Equities. Asset region: Switzerland. Size: CHF 130m. Closing date: 2019-06-04. Begin Your Search Here

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.