text
stringlengths
144
682k
Home| Course Catalog| Career Planning Free Online Course on Personal Finance Site Search Types of Trusts There are two different types of trusts: living trusts and testamentary trusts. A living trust is a trust in which assets are placed while you are still living. With a testamentary trust, assets are placed in the trust after you die. This trust is created after probate, according to your desires. 1. Living Trusts. There are two different types of living trusts: revocable living trusts and irrevocable living trusts. A revocable living trust allows for unlimited control by the trust owner, because the owner retains the title to all the assets in the trust. The advantage of a living trust is that the assets in the trust do not pass through probate when the owner dies. In addition, a living trust provides greater ease of distribution and greater privacy upon death. The disadvantage to a living trust is that it does not provide any tax advantages. The entire amount of the living trust is considered an asset for estate tax purposes. An irrevocable living trust is a trust that cannot be changed by the owner once established, because the trust becomes a separate legal entity that owns all the assets it contains and pays taxes on the assets and the gains they produce. The advantage of an irrevocable living trust is that the assets are not subject to estate taxes, since they are not part of the owner’s estate. Additionally, assets in the trust do not pass through probate. The disadvantage to an irrevocable living trust is that the owner no longer has the title to or use of any of the assets. 2. Testamentary Trusts: A testamentary trust is a trust in which assets are placed in the trust only after the owner dies. The trust is created after probate, according to the desires of the owner, and the assets are transferred into the trust. There are different types of testamentary trusts, including standard family trusts, qualified terminable interest property trusts (Q-TIP trusts), and sprinkling trusts. Standard family trusts hold the assets of the first spouse who dies until the second spouse dies. The surviving spouse has access to income from the trust, or the trust principal, if necessary. Standard family trusts reduce the size of the estate for the second spouse, which reduces estate tax liability. A Q-TIP trust provides a means of passing on income to a surviving spouse without turning over control of the assets. These trusts ensure that assets will be passed on to your children upon the death of your surviving spouse. A sprinkling trust distributes assets to a designated group of beneficiaries on an as-needed basis rather than in accordance with some preset plan. Our Network Of Sites: Apply 4 Admissions.com              | A2ZColleges.com  | OpenLearningWorld.com  | Totaram.com Anatomy Colleges.com                | Anesthesiology Schools.com  | Architecture Colleges.com | Audiology Schools.com Epidemiology Schools.com         | Gastroenterology Schools.com  | Hematology Schools.com     | Immunology Schools.com IT Colleges.com                | Kinesiology Schools.com  | Language Colleges.com  | Music Colleges.com Nephrology Schools.com             | Neurology Schools.com  | Neurosurgery Schools.com | Obstetrics Schools.com Oncology Schools.com    | Ophthalmology Schools.com | Orthopedics Schools.com       | Osteopathy Schools.com Otolaryngology Schools.com| Pathology Schools.com  | Pediatrics Schools.com  | Physical Therapy Colleges.com Plastic Surgery Schools.com| Podiatry Schools.com  | Psychiatry Schools.com   | Pulmonary Schools.com  Radiology Schools.com| Sports Medicine Schools.com| Surgery Schools.com | Toxicology Schools.com US Law Colleges.com| US Med Schools.com | US Dental Schools.com ©1999-2011 OpenLearningWorld . com - All Rights Reserved
The Profound Chinese Language (Episode 3): Turtle Da Qiong (Great Universe) Cult PureInsight | January 2, 2006 An opening poem recitation by a group of children: Although turtles are slow walkers, They are very gentle and not dumb at all. Turtles walk diligently on the land or swim diligently in the sea. They have saved people from drowning in the sea. Turtles do not compete with other and are very tolerant. They pass on good character and morality to their descendants. Ms. Wang: In today's Nature class, we will observe turtles! Children: Wow! Ying Ying: Wow! Their skins are wrinkled like old men. Yuan Yuan: Why do they swim so slowly? Xiao Bei: They look kind of dumb. An Unidentified Student: It is rather incredible that a turtle can outrun a hare. Ms. Wang: Although turtles are slow walkers and they appear slow-witted, they know and accept their weaknesses. They always choose to tolerate problems, big or small. Normally they work hard and do everything diligently despite their speed. At the event of enemy attacks, they retract their heads and limbs into their shells and are impervious to the provocation from the outside. They know that tolerance is a good way to resolve a crisis. Lao Zi, a renowned Taoist philosopher in ancient China, said, "The weak will ultimately prevail over the strong." A slow walker is not necessarily a dimwit! Ying Ying: What kind of food do turtles like? Ms. Wang: Turtles are not picky eaters. They eat vegetables, fruits, small shrimp and small fish. The average lifespan of a turtle is much longer than that of a human being. According to ancient legends, some turtles lived to be a few thousand years old! Class: Wow! They are incredible animals! Ms. Wang: Back in the Shang Dynasty in ancient China, before they had to make any important decision, the emperor and his royal court officials would roast a turtle shell over fire and read the shapes of cracks on the shell, believing they would foretell the future. They also inscribed significant events on turtle shells or cow bones. The inscriptions are what we know as oracle-bone scriptures. They are the earliest form of Chinese language. Therefore, we have turtles to thank for when it comes to preserving Chinese culture! Narrator: After school Ying Ying: Today's Nature class was a lot of fun! Yuan Yuan: I think so too. Ying Ying: Grandpa Brush Pen! Grandpa Brush Pen: Would you like to hear a story about a turtle? Xiao Bei: Yes! Please tell! Narrator: In an ancient Chinese book titled A Collection of Encounters with Immortals (搜神記,) there is a story about a turtle. During the Jin Dynasty, there was a Chinese soldier from Wuchang, Hubei Province. He saw a cute white turtle on sale in the market. He felt sad to see it had been taken from its home, so he bought the white turtle and kept it in an aquarium at his home. When the small white turtle grew bigger, the soldier decided it would be safe to release it back to water. He hoped it would reunite with its family. Several years later, the Jin Dynasty had a major battle with a neighboring state, resulting in Jin's defeat. All the surviving Jin soldiers were driven into a river. Most of them drowned because they were weighed down by the heavy armor that they were wearing. This soldier was also driven into the river. When he was about to drown, he felt that his feet had touched a giant rock. He looked down and saw that the giant rock under his feet was actually the white turtle that he had rescued and released years ago. The white turtle carried the soldier to the other side of the river. It then nodded repeatedly toward the solider to thank him and then returned to the river. This is the famous historical story of the white turtle repaying its rescuer. Grandpa Brush Pen: Turtles were highly valued by ancient Chinese people. In oracle-bone scriptures, there were many variations of the character for turtle. Some of them were based on the front view of a turtle. Some were based on the side view of a turtle. Some variations included one foot, two feet or four feet. Some variations included a long tail or a short tail. All the variations resembled a real turtle and looked very lovely. In Small Seal calligraphy or 小篆, the character for turtle included a head in the top portion, a turtle shell on the right, a turtle's feet on the left and a long hook in the middle to represent a turtle's tail. It was based on a side view of a turtle; therefore, it included only two feet. Grandpa Brush Pen: Ying Ying and Yuan Yuan, I guess you often wrote the Chinese character, turtle, wrong in the past. Yuan Yuan: Indeed I have! Grandpa Brush Pen: Now that you have heard many stories about turtles, I trust you have a better understanding on this Chinese character! Ying Ying: Yes! From now on, I will remember every stroke in this character! Yuan Yuan: Me too! Translated from: Add new comment
Home‎ > ‎Cubs‎ > ‎Cub Pack News‎ > ‎ Cubs is on this Thursday 5th February Despite the poor weather that we experienced this week it looks as if things will be back to normal on Thursday evening. So Cubs will be on as usual, if the weather changes an email will be sent advising. We will be doing activities towards the Cub Scout Global Challenge Badge. 1. Find out about the traditions, culture, food, religion and other interesting things of a country different from their own. 2. Find out about the work of an international charity that helps around the world, for example, OXFAM, UNICEF. Present their findings to the rest of the Pack. 3. Find out about an aspect of international Scouting. They could take part in a 'Join In Jamboree' activity, or arrange a visit from a Jamboree participant. Or, they could find out about Scouting in a country of their choice. 4. Find out about things that can be recycled or how energy can be saved. Over a period of weeks show how they have recycled or saved energy at home. 5. Find out about a global issue such as poverty, conservation or water and sanitation and what they can do to help. 6. Find out about a technology of their choice. This could be a personal computer, a car engine, an aircraft or anything similar. They should understand the basic functions of the technology and how it is used and a brief history. They should then present your findings to the rest of the Pack.
Month: January 2014 European Goldfinch or Goldfinch (Carduelis carduelis) The European Goldfinch or Goldfinch (Carduelis carduelis), is a small passerine bird in the finch family. The average Goldfinch is 12–13 cm long with a wingspan of 21–25 cm and a weight of 14 to 19 grams. The sexes are broadly similar, with a red face, black and white head, warm brown upperparts, white underparts with buff flanks and breast patches, and black and yellow wings. The goldfinch is native to Europe, North Africa, and western and central Asia. It is found in open, partially wooded lowlands and is a resident in the milder west of its range, but migrates from colder regions. It will also make local movements, even in the west, to escape bad weather. It has been introduced to many areas of the world.[11] It was introduced at numerous places in south-eastern Australia in the 19th century, and their populations quickly increased and their range expanded greatly. They now occur from Brisbane to the Eyre Peninsula. Japanese White-eye (Zosterops japonicus) Collared Trogon (Trogon collars) The Collared Trogon, Trogon collaris, is a near passerine bird in the trogon family, Trogonidae. It is found in the warmer parts of the Neotropics, and includes numerous subspecies, including T. c. exoptatus from northern Colombia, northern Venezuela and Trinidad and Tobago. It is a resident of tropical forests, where it nests in a hole in a termite nest or tree, with a typical clutch of two white eggs. Collared Trogons feed on insects and fruit, and their broad bills and weak legs reflect their diet and arboreal habits. Although their flight is fast, they are reluctant to fly any distance. They typically perch upright and motionless. Trogons have distinctive male and female plumages, with soft, often colourful, feathers. This species is about 25 cm long. The back, head and breast of the male are green, and a white line separates the breast from the red underparts. The undertail is white with black barring, and the wings are black, vermiculated with white. The female has a brown back, head and breast, a relatively uniform undertail (not clearly barred), and underparts that are slightly paler than in the male. The call is a plaintive caow, caow, caow. Long-tailed Sylph (Aglaiocercus kingi) The Long-tailed Sylph (Aglaiocercus kingi) is a species of hummingbird in the Trochilidae family. It is found in Bolivia, Colombia, Ecuador, Peru, and Venezuela. Its natural habitat is subtropical or tropical moist montane forest. Courtship strategy. The male long-tailed sylph carries characteristic elongated tail feathers. These feathers are so ridiculously long that they hinder his flight: it is difficult for him to carry such finery every day when he relies on his flying skills to survive. Female sylphs, whose tails are of a more modest size, pick out and mate with the males with the longest tail feathers. They therefore ensure that they are mating with a male who is so fit and healthy that he can live well enough to come into breeding condition even when carrying a heavy load. Woodchat Shrike (Lanius senator) The Woodchat Shrike (Lanius senator) is a member of the shrike family Laniidae. The Woodchat breeds in southern Europe, the Middle East and northwest Africa, and winters in tropical Africa. It breeds in open cultivated country, preferably with orchard trees and some bare or sandy ground. The male is a striking bird with black and white plumage and a chestnut crown. The race L. s. badius of the western Mediterranean lacks the large white wing patches. In the female and young birds the upperparts are brown and vermiculated. Underparts are buff and also vermiculated. This migratory medium-sized passerine eats large insects, small birds and amphibians. Like other shrikes it hunts from prominent perches, and impales corpses on thorns or barbed wire as a “larder”. This species often overshoots its breeding range on spring migration, and is a rare, but annual, visitor to Great Britain. The Balearic race badius has occurred in Britain around four times as a vagrant, and has also been recorded once in Ireland. Western Meadowlark (Sturnella neglecta) The Western Meadowlark (Sturnella neglecta) is a medium-sized icterid bird, about 8.5 in (22 cm) long. It nests on the ground in open country in western and central North America grassland. It feeds mostly on insects, but also seeds and berries. It has distinctive calls described as watery or flute-like, which distinguish it from the closely related Eastern Meadowlark. Adults have yellow underparts, with a black “V” on the breast, and white flanks which are streaked with black. Their upper parts are mostly brown, but also have black streaks. These birds have long pointed bills and their heads are striped with light brown and black. Their breeding habitats are grasslands, prairies, pastures, and abandoned fields, all of which may be found from across western and central North America to northern Mexico. Where their range overlaps with the eastern species, these birds prefer thinner, drier vegetation; the two types of birds generally do not interbreed but do defend territory against one another. Their nests are situated on the ground, and are covered with a roof woven from grass. There may be more than one nesting female in a male’s territory. Their nests are sometimes destroyed by mowing operations with eggs and young in them. Western Meadowlarks are permanent residents throughout much of their range. Northern birds may migrate to the southern parts of their range; some birds also move east in the southern United States. The Red-necked Falcon is a medium-sized, long-winged species with a bright rufous crown and nape. It is on average 30–36 cm in length with a wingspan of 85 cm. The sexes are similar except in size: males are smaller than females as is usual in falcons. Young birds are buff below with less extensive barring and duller upper plumage. Steller’s Sea Eagle (Haliaeetus pelagicus) The Steller’s Sea Eagle (Haliaeetus pelagicus) [2] is a large bird of prey in the family Accipitridae. It is an eagle that lives in coastal northeastern Asia and mainly preys on fish and water birds. On average, it is the heaviest eagle in the world, at about 5 to 9 kilograms (11 to 20 lb; 0.79 to 1.42 st), but may lag behind the Harpy Eagle (Harpia harpyja) and Philippine Eagle (Pithecophaga jefferyi) in some standard measurements.[3] This bird is named after the German naturalist Georg Wilhelm Steller. Steller’s Sea-eagle is the biggest bird in the genus Haliaeetus and is one of the largest raptors overall. Females typically weigh from 6.8 to 9 kilograms (15 to 20 lb; 1.07 to 1.42 st), with an average of 7.6 kilograms (17 lb; 1.20 st) while males are rather lighter with a weight range from 4.9 to 6 kilograms (11 to 13 lb; 0.77 to 0.94 st).[3][6] At its average weight, the Steller’s outweighs both the average Harpy and the average Philippine Eagles by over 0.5 kilograms (1.1 lb; 0.079 st).[3] The Steller’s Sea Eagle’s can range in total length from 85 to 105 cm (33 to 41 in). The wingspan is from 1.95 to 2.5 m (6.4 to 8.2 ft) and the wing chord measurement is 57–68 cm (22–27 in).[3][5][7] The Steller’s sea eagle has the second largest median wingspan of any eagle.[3] Both the wing chord and wingspan, at an average of 2.13 m (7.0 ft), are similar or slightly smaller than to those of the Steller’s close relative, the White-tailed Eagle (Haliaeetus albicilla), which is nonetheless rather smaller in both weight and total length.[3] As in mostHaliaeetus eagles, the tarsus and the tail in this species are relatively short compared to other very large eagles at 9.5–10 cm (3.7–3.9 in) and 32–39 cm (13–15 in) in length, respectively.[3][8] The bill is very large. In fact, the skull (at around 14.6 cm (5.7 in)) and the culmen (at around 7 cm (2.8 in)) of the Steller’s Sea Eagle are the largest of any eagle and are comparable in size to those of the largest accipitrids, the Old World vultures. White-fronted Bee-eater (Merops bullockoides) The White-fronted Bee-eater (Merops bullockoides) is a species of bee-eater widely distributed in sub-equatorial Africa. They have a distinctive white forehead, a square tail and a bright red patch on their throat. They nest in small colonies, digging holes in cliffs or earthen banks but can usually be seen in low trees waiting for passing insects from which they hunt either by making quick hawking flights or gliding down before hovering briefly to catch insects.
Untold Stories, Beyond Methyl Bromide January 17, 2018 “THE IDEA TO write this book came to me after I retired in 2005 and was cleaning out, re-reading, and reorganizing 40 years of files…in spite of three books and more than 200 journal publications and book chapters, my files filled with history and unpublished data were headed for the trash bin…the greater my urge to somehow pull the stories together into a single read-through description of my career…unique, it is the approach I took and the philosophy behind my approach to do hypothesis-driven research starting in the field, followed by the laboratory,” writes R. James Cook in the “Preface” to his book, Untold Stories (APS Press, 2017). In 1974, Cook and Kenneth F. Baker co-authored a landmark book, Biological Control of Plant Pathogens. That book, which in some ways is a precursor to Untold Stories, summarized scientific evidence relevant to creating ecological balances favoring beneficial organisms (e.g. biocontrol agents, antagonists, competitors) as pesticide alternatives to control pathogens capable of weakening and destroying plants, including major food crops such as potato and wheat. Human medicine has at various times in various places employed a similar biological approach, such as using bacteriophages to fight diseases such as cholera, but for an array of reasons biological control has found more fertile ground in agriculture. Ecological balances can be tilted or nudged from pathogens to beneficial organisms in various ways, including via soil pH adjustments, tillage systems, cropping sequences, fallows, composts, amendments, nutrients, etc. The specifics can vary widely among crops, individual fields, regions, soil types, etc. Dr. Cook, as the Untold Stories subtitle, “Forty Years of Field Research on Root Diseases of Wheat,” hints, found wheat a fertile microcosm for exploring the phenomena of naturally disease suppressive soils for producing healthy crops. Cook’s job when he joined the USDA Agricultural Research Service included soil diseases afflicting wheat, one of humanity’s most ancient crops and a worldwide dietary staple. The USA grew 45.7 million acres of wheat in 2017, most of it winter planted varieties, the lowest acreage since record keeping began in 1919. USA farmers grow twice as much corn and soybean, roughly 90 million acres of each. Wheat exports earn the USA roughly $6 billion a year, out of $140 billion in total agricultural exports. Though wheat helps the USA balance of trade, family farms growing wheat are not sustainable or economically viable if soil pesticides are used. Dr. Cook’s challenge was curing wheat soil diseases without costly pesticides. In the 1970s, the mainstream view was that solving pest problems without pesticides was drug-induced organic hippie crazy talk, a near impossible task with low probability of success. Fortunately Dr. Cook possessed sound inner instincts complemented by scientific understanding of ecology and microbiology, with an emphasis on biological control of plant diseases absorbed working alongside Kenneth Baker and others at the University of California, Berkeley where biological control was still honored and respected despite falling from its early 20th century heights during the synthetic pesticide era. Cook briefly acknowledges Louis Pasteur, the famous French freelance microbiologist, chemist and entomologist who developed modern medical germ theory and laid the foundations for modern epidemiology while alleviating a mysterious silkworm colony collapse (disease epidemic) depressing the mid-19th century French economy. On page 236 of Untold Stories, Cook quotes Pasteur: “In the field of observation, chance favors the prepared mind.” I would go back one step more to Pasteur’s mentor, chemist Jean Baptiste Dumas, who according to French-borne microbiologist René Dubos, persuaded a reluctant Pasteur to tackle the silkworm problem despite an insect ignorance for which he was widely ridiculed: “To Pasteur’s remark that he was totally unfamiliar with the subject, Dumas had replied one day: ‘So much the better! For ideas, you will have only those which shall come to you as a result of your observations!’” Microbiologist Alexander Fleming, famous for the fungal antibiotic penicillin, noted another important factor: “Louis Pasteur in his youth and throughout his life believed in hard work. He lived for his work and put his whole heart and soul into it. His was not a 40-hour week. He worked so constantly in his laboratory that it was inevitable that he became a beautiful technician…” Another message embedded in Cook’s Untold Stories: Successfully tackle hard problems that appear insoluble to everyone else, and the probability of job security and life success increase. Cook developed an expertise in finding cooperative wheat farmers and locating fields where natural biological controls seemed to be working on their own. Then did a laboratory form of reverse ecological process engineering to find out why these fields developed a disease immunity or natural suppression of wheat soil pathogens. When you can replicate or duplicate the phenomena experimentally, then a degree of understanding can be claimed. Untold Stories feels like the real nitty-gritty, with behind-the-scenes stories about how research projects are accomplished. The type of details typically omitted from science journals, by design. If anyone dared put into their journal article the details of how they obtained funding, navigated the bureaucracy to win support, or cleverly acquired a piece of new equipment, it would no doubt get edited out. This is a reason Roald Hoffmann in his book, The Philosophy, Art, and Science of Chemistry (Oxford University Press, 2012), suggested a new kind of science journal allowing first person “voice” and personal experience. Actually, it would only be “new” in the “retro” sense that “everything old is new again.” In the early days of modern science, personal autobiographical expression, musings and miscellany were common. These early science articles could be confusingly messy and hard to decipher, perhaps harking back to the deliberately obscure days of alchemy. However, personal observation and experience was handled well by agricultural researchers in the early 20th century. Which is not meant to denigrate the utility and immense value of standardized journal formats with introduction, methodology, results, discussion, etc. There is room in the world for both. Untold Stories embeds science in a wider human context, beyond what is possible in the modern journal format, which necessarily excludes the human dimension, but leaves behind an unintended residue, a subjective impression of a science rendered lifeless by the invisibility of its practitioners. Cook family members pitched in to write the forward, edit, design and deliver their father’s book ready for printing by the American Phytopathological Society (APS) Press. Cook’s attitude towards public service is refreshing, and clearly extended into his so-called retirement. Judging from the 2005 start date and the 2017 book publication date, Dr. Cook put over a decade into this “Magnum Opus” book project. Wife and family were promised this would absolutely be his last book. One might lament, but I have to believe Dr. Cook mined his past experiences so thoroughly as to be able to rest on his laurels and not feel that much was left out that could not be remedied in a few journal articles. A mathematical ratio of untold stories to published stories would be interesting, and Dr. Cook is in a position to be the expert. Let’s say the Untold Stories:Published Stories ratio was 1:1 and had a certain “volume.” Then the “volume” (e.g. measured in pages, articles/books, person-years of work, or whatever) of untold stories could be multiplied by the number of scientists or the amount published in a given time period to yield an estimate of how much scientific research ends up in the proverbial trash bin. The Untold Stories photo caption on page 52 brought to mind a much maligned molecule, methyl bromide, a research tool and experimental control integral to scientific investigation of naturally disease suppressive wheat soils. Salt marsh microbes naturally produce methyl bromide as an antibiotic type weapon in waging ecological warfare for survival against competitors and antagonists. The caption: “A discussion session in progress at a Pacific Coast Research Conference on Soil Fungi with Professor S.D. Garrett, Cambridge University, as the discussion leader…Steve Wilhelm from UC Berkeley, credited with the introduction of soil fumigation to the California strawberry industry, is in the front row…” Dr. Wilhelm, who I knew to also be interested in promising methyl bromide alternatives such as steam, marigold cover crops and green manures, crops up again on page 186 of Cook’s book: “it was not until the middle of the twentieth century that soil fumigation was used on a large scale…Steve Wilhelm at UC Berkeley…together with Albert Paulus at UC Riverside, did the pioneering work on the use of mixtures of chloropicrin and methyl bromide to control soil-borne pathogens and weeds before planting strawberries in California starting in the late 1950s. Strawberry yields were roughly 5 tons per acre in fields not fumigated and up to 25 tons per acre in fields that were fumigated.” Soil fumigation with methyl bromide and chloropicrin worked so well that California had near zero untreated strawberry fields available to investigate for naturally suppressive soils, which is unfortunate, as methyl bromide use is being phased out under the Montreal Protocol as an ozone depleting substance. Something I learned about in more depth working with the late Jamie Liebman, a plant pathologist at BIRC (Bio-Integral Research Center), where as subcontractors we helped develop a Montreal Protocol methyl bromide alternative research agenda for funding by the U.S. EPA and United Nations. I wrote a short chapter on this period in history titled “Rowland’s Recipe for Climate Treaty Success” in an ABC-CLIO book titled Science and Political Controversy, edited by David E. Newton in 2014. In 2015, attending agricultural, soil and entomological science meetings in Minneapolis, not far from APS headquarters, I was pleased to find that research agenda still extant and going deeper. Funny what a mere photo caption can trigger in human memory. No doubt Untold Stories will have similar effects on readers whose interests and paths intersected with those of Dr. Cook. California’s $2 billion strawberry industry, which produces about 90% of the USA crop, an awesome 1.7 billion pounds on about 40,000 acres (43,000 pounds of strawberries per acre), was for all practical purposes birthed into existence by injecting chloropicrin and methyl bromide into soils under plastic tarps. California’s hyper-productive strawberry growers, like Florida tomato and inland Pacific Northwest potato growers, can earn back methyl bromide soil fumigation costs. Family wheat farms would be bankrupted and abandoned to tumbleweed and erosion by soil fumigation costs. Scientifically, the less prosperous economics of wheat growing were fortuitous, as Dr. Cook was precluded from earning a living testing and recommending soil pesticides. Instead, as Dr. Cook’s book rigorously details, applied science became indistinguishable from pure science (much as it did for Pasteur) as it delved into the microbiology, ecology and non-chemical remedies for soil pathogens causing unhealthy plants and crop failures. A key scientific discovery was that growing wheat in the same field again and again, year after year without interruption or rotation, can result in soils becoming naturally suppressive or functionally immune to disease pathogens. But this goes against centuries of accumulated wisdom arguing that toxic root secretions (allelopathy) poison the soil, and are best alleviated by crop rotations. Cook’s objection on page 227: “this makes no mention of a role for root diseases and ignores one of the most fundamental principles of plant pathology taught to beginning students in plant pathology, that growing the same crop in the same soil increases the populations of pathogens of the roots of that crop…It takes a long time to replace the first explanation with the correct explanation for almost any phenomenon in nature.” It also takes time, as those who have studied ecology know, for pathogen, prey or pest populations to build up to peaks before predator and natural enemy populations reduce or crash them down to low levels. Dr. Cook’s mission was to shorten that time. One set of wheat experiments described in the “Take-All Decline” chapter 7, owed inspiration to 1950s’ potato scab disease research in Washington State, where small amounts (10%) of suppressive soil (presumably containing beneficial microbes) were added to disease-susceptible soils. Within 2-3 years, wheat soils were growing healthy plants. “Although I never repeated this experiment (nor did it need to be repeated), it would turn out to be the most influential experiment of my career,” wrote Dr. Cook on page 144. “It led to my award of a Guggenheim Fellowship…to my first competitive grant awarded by the USDA Competitive Grants Research Office (CARGO) in 1978…to the USDA ARS approving the formation of the Root Disease and Biological Control Research Unit in 1984; and to the USDA ARS providing permanent funds for me to hire…” This only scratches the surface of a truly remarkable book likely to become a classic of science.
Lithium Chloride for Varroa Control? At the end of 2017, German bee researchers published a journal article detailing work that they had completed which looked at the compound lithium chloride (LiCl) as a new potential option for Varroa control (Ziegelmann et al., 2017). In today’s Melitto Files post, we will discuss the conclusions of that research as well as an argument for why you should not run out and start putting LiCl in your hives today. The Research At the outset of this project, Ziegelmann et al. were not directly testing the effects of LiCl on Varroa. Rather, the scientists were looking into a process called RNAi as a new means of Varroa control. As a quick explanation, RNAi is a cellular mechanism that uses an organism’s own DNA sequence to turn off a specific gene, also known as silencing. Researchers have been looking for specific genes necessary for Varroa survival which can be silenced but will not harm honey bees. However, in the process of testing this approach, researchers discovered that it was not the RNAi process that was killing mites, but rather a compound that was used in the initial production of the dsRNA being fed to the honey bees. This compound, of course, was lithium chloride. For an in-depth explanation of RNAi, check out the excellent animated video at the end of this post from Nature Video. An Early Look To test this potential discovery, Ziegelmann et al. ran a preliminary study with three treatment groups of small cages of bees. In these groups, honey bees were fed sugar water that was mixed with one of three other substances: 1) dsRNA that still contained LiCl from production, 2) dsRNA with the LiCl washed off, and 3) LiCl alone (Figure 1). The results of this preliminary study showed that the two treatments containing LiCl were equally effective at killing mites (all mites feeding on the bees were killed within 3 days). In contrast, for the treatment in which the LiCl was washed off, the effectiveness of the control was “substantially diminished” (2017). Figure 1: Three treatments were used in the preliminary study: 1) dsRNA with lithium chloride, 2) dsRNA without lithium chloride, and 3) only lithium chloride. Determining Effective Levels To further investigate the effectiveness of LiCl at killing Varroa, Ziegelmann et al. next tested the compound at four different concentrations ranging from low (2mM) to high (25mM). They also included control cages of bees which were fed straight sugar syrup, containing no amount of LiCl. Even at the lowest concentration, LiCl was shown to kill mites. At the highest two concentrations (10mM and 25mM), the researchers found that 96% of mites on the treated bees died by the end of the 7 day trial (2017). Adverse Effects Although LiCl shows promise in its ability to kill Varroa, Ziegelmann et al. also discovered some adverse effects of using the compound. Caged worker bees which were fed continuously with sugar water containing LiCl had significantly shorter lifespans than the bees fed only sugar water. However, when bees were treated with LiCl once (not continuously) there was no significant difference between the lifespans of bees who received LiCl and those that did not (2017). This research did not looked at the effectiveness of LiCl in full honey bee colonies. Alarmingly, when LiCl was fed to honey bee larvae (at 10nm, 25nM, and 50nM), all larvae were killed within 3 days. The effects of LiCl in the honey bee colony are not fully known. The Jury Is Out The study discussed above showed that lithium chloride applied to caged honey bees can effectively kill Varroa on those bees at various doses. What this study does not show is LiCl as an acceptable option for controlling Varroa in your colonies. Although, so far, it seems as though the compound is relatively safe for adult honey bees when used for a short period of time, there has been very little research done on the effects of LiCl on developing bees. The early research that has been done shows that LiCl has a strong lethal effect on at least honey bee larvae. There is a lot of promise in the potential of using lithium as a Varroa control mechanism in the future; however, until we know more about how LiCl affects the colony, we strongly recommend not using this compound in your hives. As a final plea to “hold your horses”, I will offer a reminder that, as it currently stands, LiCl is not labeled for used in or on honey bee colonies and is therefore illegal to use as a Varroa control in your hives. Nature Video. (2011, December 16). RNA interference (RNAi): by Nature Video. [Video file]. Retrieved from Hannus, S., P. Rozenkranz, and B. Ziegelmann. (2017). WO Application No. WO2017042240A1. Geneva, Switzerland: World Intellectual Property Organization. Retrieved from Ziegelmann, B., Abele, E., Hannus, S., Beitzinger, M., Berg, S., & Rozencranz, P. (2017). Lithium chloride effectively kills the honey bee parasite Varroa destructor by a  systemic mode of action. Nature 8(683). Retrieved from Originally published April 18, 2018. Edited July 10, 2018 (Missing source added).
Skip to main content Chemistry LibreTexts 14.6 Diene Polymers: Natural and Synthetic Rubbers • Page ID • Objectives After completing this section, you should be able to 1. show that the polymerization of a diene, such as 1,3-butadiene or isoprene (2-methyl-1,3-butadiene), can result in the formation of either a cis or trans polymer. 2. draw the structure of natural rubber. 3. explain, briefly, the process of vulcanization. Key Terms • cross-link • vulcanization Study Notes Natural rubber is formed from the isoprene monomer and has Z stereochemistry. The E polymer gutta-percha also occurs naturally, but is more brittle than rubber. Uses of this thermoplastic include dentistry, electrical insulators and the covering on golf balls. cis- and trans-polyisoprene chains Before 1839, the uses of natural rubber were somewhat limited. It became sticky in summer, hardened and cracked in winter, and was susceptible to attack by a variety of solvents. Charles Goodyear became interested in rubber in 1831, and bought the Eagle India Rubber Company of Woburn, Massachusetts, in 1838. In January of 1839, Goodyear accidentally placed a sample of rubber that had been mixed with sulfur and lead(II) oxide on a hot stove; the result was a product similar to charred leather, which did not melt below 138°C. Goodyear was granted a U.S. patent for his process (called vulcanization) in June of 1844. The story of vulcanization is an example of how major scientific and technological advances are often brought about as a result of an accidental discovery. Notice that in the vulcanization process, the sulfur bridges are attached to allylic carbon atoms which connect the long Z polymer chains of rubber. sulfur bridges in vulcanized rubber polymer chains Vulcanized rubber The amount of sulfur used in the vulcanization process will depend on the rigidity required in the product. For example, about 5% sulfur is used when producing rubber for rubber bands; about 30% sulfur is used when making rubber for use in battery casings. There are several characteristics of dienes and rubbers that you should recognize. First, be aware of the similarity between the polymerization of a diene and the 1,4-addition reactions of dienes. Second, recognize the similarity between a vulcanized rubber and a peptide containing cysteine cross-links. Third, be aware that as natural rubber contains double bonds, it will display some of the properties of simple alkenes. The 1,4 polymerization of 1,3-butadiene shown in the reading produces the trans form of polybutadiene. However, it should be noted that the cis form shown here can also be formed. cis form of polybutadiene cis- polbutadiene Conjugated dienes (alkenes with two double bonds and a single bond in between) can be polymerized to form important compounds like rubber. This takes place, in different forms, both in nature and in the laboratory. Interactions between double bonds on multiple chains leads to cross-linkage which creates elasticity within the compound. Polymerization of 1,3-Butadiene For rubber compounds to be synthesized, 1,3-butadiene must be polymerized. Below is a simple illustration of how this compound is formed into a chain. The 1,4 polymerization is much more useful to polymerization reactions. Above, the green structures represent the base units of the polymers that are synthesized and the red represents the bonds between these units which form these polymers. Whether the 1,3 product or the 1,4 product is formed depends on whether the reaction is thermally or kinetically controlled. Natural Rubber Natural rubber is an addition polymer that is obtained as a milky white fluid known as latex from a tropical rubber tree. Natural rubber is from the monomer isoprene (2-methyl-1,3-butadiene), which is a conjugated diene hydrocarbon as mentioned above. In natural rubber, most of the double fonds formed in the polymer chain have the Z configuration, resulting in natural rubber's elastomer qualities. Charles Goodyear accidentally discovered that by mixing sulfur and rubber, the properties of the rubber improved in being tougher, resistant to heat and cold, and increased in elasticity. This process was later called vulcanization after the Roman god of fire. Vulcanization causes shorter chains to cross link through the sulfur to longer chains. The development of vulcanized rubber for automobile tires greatly aided this industry. Synthetic Rubber The most important synthetic rubber is Neoprene which is produced by the polymerization of 2-chloro-1,3-butadiene. neoprenesynthesis (1).png In this illustration, the dashed lines represent repetition of the same base units, so both the products and reactants are polymers. The reaction proceeds with a mechanism similar to the Friedel-Crafts mechanism. Cross-linkage between the chlorine atom of one chain and the double bond of another contributes to the overall elasticity of neoprene. This cross-linkage occurs as the chains lie next to each other at random angles, and the attractions between double bonds prevent them from sliding back and forth. Colored molecules The counjugated double bonds in beta-carotene produce the orange color in carrots. The conjugated double bons in lycopene produce the red color in tomatoes. ß carotene 1. Vollhardt, Peter, and Neil E. Schore. Organic Chemistry: Structure and Function. New York: W. H. Freeman & Company, 2007. 2. Buehr, Walter. Rubber: Natural and Synthetic. Morrow, 1964. Draw out the mechanism for the natural synthesis of rubber from 3-methyl-3-butenyl pyrophosphate and 2-methyl-1,3-butadiene. Show the movement of electrons with arrows. Draw a segment for the polymer that may be made from 2-tert-butyl-1,3-butadiene. Propose the mechanism for the acid catalyzed polymerization of 2-methyl-1,3-butadiene. The initial step is an addition of a hydrogen from the acid, followed by the polymerization.
Ethical Angler on Rivers and Streams Catch and Release Colorado is a rapidly growing state with limited public access for fishing rivers and streams. To preserve our sport fishery for everybody, the Headwaters Chapter of Trout Unlimited encourages catch and release practices. Even when practicing catch and release, improper handling of trout can lead to mortality. If you are lucky enough to get  trout in your net you must be very careful in how you handle them. A good rule of thumb is to not have them out of water any longer than you can hold your breath. Remember that they are not breathing while they are out of the water. Ideally you should be able to remove your hook without touching the fish. A barbless hook in the lip of a trout can be removed by holding your line in one hand and removing the hook using a forceps in the other while the trout is laying in your net. Please knock the barb down on your flies before using them or removing the hook will be much more bothersome and you will be hurting the fish. On public water each fish will be caught about 40 times a season so it is very important to use a barbless hook to keep from damaging their mouths. If you do have a difficult hook to remove and have to hold the fish never grab a trout with dry hands or with sunscreen on your hands. Trout have a thin protective skin layer that is easily removed, so wet your hands first. Once the hook is removed, return the fish to water ASAP. If the fish has been weakened by playing it too long then holding them upright and moving them from side to side will help them get oxygen to their gills and they will be able to swim off on their own. You can gently hold them by their tale with their belly resting on your open palm until they start to swim off on their own. A properly released fish will assure that many fly fishers will enjoy the same thrill you just had in catching your trout. Trout are a cold water fishery. Higher water temperatures in the warmer days of summer stress trout. An ethical fly fisher will have a thermometer (can be purchased at your local fly shop) in their pocket and use it when fishing. At 65 degrees F stream temperatures are warm enough to allow some of the dissolved oxygen in the water to escape as a gas into the atmosphere. This stresses the trout which need all the oxygen they can get. Even if you catch and release a trout at 65 degrees F they are already stressed and probably will not survive the ordeal of being caught and released. At 70 degrees F enough dissolved oxygen escapes from the water that trout will die. Some of the rivers and streams in Grand County record temperatures a high as 74 degrees F, so use a thermometer if you are out on a hot day. During the hotter days of summer it is usually safe to fish in the morning and quit when the temperature gets to 65. Before going fishing you can also check the USGS realtime temperature gauges on the Fraser and Colorado Rivers.  Take good care of the trout and they will be here for everyone to enjoy.
Lynchburg Journal of Medical Science Lynchburg Journal of Medical Science Health Economics Thomas Colletti, DHSc, PA-C The United States healthcare system is the most expensive in the world. It is also the only developed nation to not have universal healthcare for its citizens. Not having insurance has been correlated with poor health outcomes and financial consequences. Despite the increased coverage after the implementation of the Patient Protection and Affordable Care Act of 2010, there is still 8.8% of the population, or 28.3 million people, in the U.S. without health insurance in 2018. The uninsured are typically households with a full-time worker, making less than 400% of the federal poverty level, 26-34 years old with less education, some of whom may qualify for tax credits but need to purchase insurance, and they are saying it is too expensive. The high cost of healthcare is inextricably linked to the inability of some Americans to afford health insurance. While some causes of increased expenditure are unavoidable, healthcare reform has the potential to decrease costs which would decrease the barrier to universal coverage.
None of them are/is I don't know if this is the place to ask, but: In German you would say "none of them is" and it totally sounds wrong to me to say "none of them are". As German and English are both Germanic languages, I can't explain how they have a different concept of none, especially because in French and Italian it's singular as well. Does anyone know how/why this turned out this way? Before this gets put on hold ;-) I have read a lot of threads about none, my question is: how did it become this way? I haven't seen any other threads on that. marked as duplicate by Erik Kowal, Edwin Ashworth, Chenmunka, mplungjan, choster Dec 22 '14 at 15:34
The iron pillar (also known as the Ashokan pillar) of Delhi, India, is a 7 m (23 ft) high pillar in the Qutb complex, notable for the composition of the metals used in its construction. The pillar, which weighs more than six tons, is said to have been fashioned at the time of Chandragupta Vikramaditya (375–413) of the Gupta Empire,[1] though other authorities give dates as early as 912 BCE.[2] The pillar initially stood in the center of a Jain temple complex housing twenty-seven temples that were destroyed by Qutb-ud-din Aybak, and their material was used in building the Quwwat-ul-Islam mosque and the Qutub Minar complex where the pillar stands today.[3] The pillar has attracted the attention of archaeologists and metallurgists and has been called "a testament to the skill of ancient Indian blacksmiths" because of its high resistance to corrosion.[4] The corrosion resistance results from an even layer of crystalline iron hydrogen phosphate forming on the high phosphorus content iron, which serves to protect it, and also the effects of the local Delhi climate, which alternates from wet to dry. [5] The name of the city of Delhi is thought to be based on a legend associated with the pillar (see History of Delhi).
250px-Destruction of Leviathan (/lɨˈv.əθən/; Hebrew: לִוְיָתָן, Modern Livyatan Tiberian Liwyāṯān ; "twisted, coiled") is a sea monster referred to in the Bible. The word has become synonymous with any large sea monster or creature. In literature (e.g., Herman Melville's Moby-Dick) it refers to great whales, and in Modern Hebrew, it means simply "whale." It is described extensively in Job 41 and mentioned in Isaiah 27:1. In Psalm 74 God is said to "break the heads of Leviathan in pieces" before giving his flesh to the people of the wilderness; in Psalm 104 God is praised for having made all things, including Leviathan; and in Isaiah 27:1 he is called the "wriggling serpent" who will be killed at the end of time.[2] Later Jewish sources describe Leviathan as a dragon who lives over the Sources of the Deep and who, along with the male land-monster Behemoth, will be served up to the righteous at the end of time. When the Jewish midrash (explanations of the Bible) were being composed, it was held that God originally produced a male and a female leviathan, but lest in multiplying the species should destroy the world, he slew the female, reserving her flesh for the banquet that will be given to the righteous on the advent of the Messiah (B. B. 74b). Rashi's commentary on Genesis 1:21 repeats the tradition: "God created the great sea monsters - taninim.[3] According to legend this refers to the Leviathan and its mate. God created a male and female Leviathan, then killed the female and salted it for the righteous, for if the Leviathans were to procreate the world could not stand before them." [4] In the Talmud Baba Bathra 74b it is told that the Leviathan will be slain and its flesh served as a feast to the righteous in [the] Time to Come, and its skin used to cover the tent where the banquet will take place. The festival of Sukkot (Festival of Booths) therefore concludes with a prayer recited upon leaving the sukkah (booth): "May it be your will, Lord our God and God of our forefathers, that just as I have fulfilled and dwelt in this sukkah, so may I merit in the coming year to dwell in the sukkah of the skin of Leviathan. Next year in Jerusalem." [5] The enormous size of the Leviathan is described by Johanan bar Nappaha, from whom proceeded nearly all the aggadot concerning this monster: "Once we went in a ship and saw a fish which put his head out of the water. He had horns upon which was written: 'I am one of the meanest creatures that inhabit the sea. I am three hundred miles in length, and enter this day into the jaws of the Leviathan'" (B. B. l.c.). When the Leviathan is hungry, reports Rabbi Dimi in the name of Rabbi Johanan, he sends forth from his mouth a heat so great as to make all the waters of the deep boil, and if he would put his head into Paradise no living creature could endure the odor of him (ib.). His abode is the Mediterranean Sea; and the waters of the Jordan fall into his mouth (Bek. 55b; B. B. l.c.). The body of the Leviathan, especially his eyes, possesses great illuminating power. This was the opinion of Rabbi Eliezer, who, in the course of a voyage in company with Rabbi Joshua, explained to the latter, when frightened by the sudden appearance of a brilliant light, that it probably proceeded from the eyes of the Leviathan. He referred his companion to the words of Job xli. 18: "By his neesings a light doth shine, and his eyes are like the eyelids of the morning" (B. B. l.c.). However, in spite of his supernatural strength, the leviathan is afraid of a small worm called "kilbit", which clings to the gills of large fish and kills them (Shab. 77b).[6] In the eleventh century piyyut (religious poem), Akdamut, recited on Shavuot (Pentecost), it is envisioned that, ultimately, God will slaughter the Leviathan, which is described as having "mighty fins" (and, therefore, a kosher fish, not an inedible snake or crocodile), and it will be served as a sumptuous banquet for all the righteous in Heaven.
From Rigged Wiki Jump to: navigation, search The {{col-begin}}, {{col-break}} and {{col-end}} templates control columns of text on a page: • {{col-begin}}: starts a table (followed by {{col-break}} for 1st column) • {{col-break}}: triggers the start of each column • {{col-end}}: ends the multi-column table. The widths of columns can be specified by using various additional codes. See below for examples. {{col-begin|width=70%}}: start table with width. {{col-break|width=66%}}: start column-1 as 66% wide. This is text in col-1. {{col-break|width=33%}}: start column-2 as 33% wide. Text column-2. The table will have two columns, with column 1 twice (2×) the width of column 2. A border of 2px (1px width on each side) corresponds to a 5%. Therefore, with a 2px border—for example, as in Wikipedia:Tutorial/Wrap-up and more info—the width needs to be 95% for the table to fit within the screen. Since it's possible that some tables might not have a border, correction on the individual page could be made after substitution. Another way to create a two column table is like this: Left column Right column See also
Michael Kwayisi Darius the Mede: Identity and Reign as King Twitter · Facebook Reconciling Biblical and secular historical accountsReconciling Biblical and secular historical accounts Darius the Mede is mentioned in the Bible by the prophet Daniel as the immediate successor of Belshazzar the Chaldean king. (Daniel 5:31) However, no mention or reference has as yet been found of such a person outside the Bible, neither in Babylonian history nor that of Persia. Some historians have unsuccessfully tried to identify him with Cyrus the Great, Gubaru the army general of Cyrus, or Darius I. Other efforts to link him with Cambyses II have proved wrong because they don't agree with Darius' being 62 years old at the start of his reign. Critics have therefore concluded that the figure is fictitious and was created by Daniel to "fit his schema." Of course, the Bible, being an inspired word of God, does not need secular historical evidence to prove its authenticity. (2 Timothy 3:16; 2 Peter 1:21) It is interesting that over the years, many scientists and historians have come to accept certain Biblical accounts that they once challenged to be false. By carefully studying and meditating on the history surrounding the overthrow of the Babylonian empire by Persian king Cyrus the Great, one can come close to laying bare the true identity of Darius the Mede, and the period during which he reigned as king of Babylon. In the following paragraphs are my thoughts on the subject which are by no means authoritative. The Medes and the Persians The Medes were of the ancient Anyan tribe, descendants of Madai. (Genesis 10:2) They lived in a land called Media which was situated at the northwestern part of modern day Iran. They were formed into numerous petty kingdoms but under powerful tribal chieftans. Several years later, Assyria took control of many of the kingdoms, and subjugated them under their rulership. However, around the year 632 BCE the Medes combined with Babylon and defeated the Assyrian Empire. (Zephaniah 2:13) The land of Assyria was subsequently split into two, the Medes taking the northern part while the Babylonians took the southern portion. The Persians, like the Medes, were of the Anyan tribe. They were situated in the land of Persia, located in the southwestern portion of the Iranian plateau. After the Medes entered into alliance with Babylon and conquered Assyria, the Persians unified with the Medes. Media and Persia grew into a luxurious empire, although the Persians were subservient to the Medes. (Esther 1:3-7, 8:15; Isaiah 13:17) In 550 BCE, Cyrus the Great rose against the Median King Astyages, eventually conquering Media to establish the Persian Empire, also known as the Achaemenid Empire. (Daniel 8:3, 20) The Medes thus came under the domination of the Persians. The Persian Empire grew even more powerful when Cyrus expanded his kingdom westward, conquering King Croesus of Lydia and other Greek cities to the Aegean Sea. Even though Media had now become subservient to Persia, historical records show that the two nations maintained a good relationship. The Medes were given the same treatment as the Persians; they were appointed to honorable positions and even chosen to lead Persian armies. (Maybe because Cyrus was born of a Median mother.) In 539 BCE, the Persian Empire joined forces with the Elamites, and likely other neighboring tribes, and attacked the Babylonians.—Isaiah 21:2. Appointment as king of Babylon It is noteworthy that Jeremiah 51:11, 28 speaks of "the kings of Media" among those who were to attack and conquer the Babylonian empire. This shows that even under the dominion of the Persian Empire, there were still some rulers, of course, under Cyrus. This wouldn't have been something strange during those ancient times. (See Jeremiah 25:25.) In addition, some historians believe that the Persian Empire was formed as a "multi-state empire, governed by four capital states" allowing, to some extent, regional autonomy. This may have been the primary reason why the other governors never threatened the monarchy of Cyrus throughout his reign. It is beyond doubt, according to the prophecy of Isaiah and secular history, that Cyrus was the conqueror of Babylon. (Isaiah 44:26-45:7) However, we read at Daniel 5:31 that "Darius the Mede himself received the kingdom" following the fall of Babylon. Noting the phrase "received the kingdom" and the account at Daniel 9:1 that Darius was "made king," it is evident that he was installed by Cyrus the Great. For a self-proclaimed "king of the four corners of the world" who had conquered the Lydian Empire, Asia Minor, and Babylon, it was not foolish for him to appoint a Mede, whom he treated with respect as his fellow Persian, to rule as a subordinate. According to the prophecy of Jeremiah, at the fall of the Babylon Empire, the Jews shall return to their homeland and restore pure worship to Jehovah God. (Jeremiah 25:11, 12; 29:10) The Bible also tells us that, it was in "the first year" of Darius' reign that Daniel "discerned" that Israel's captivity in exile was coming to an end. (Daniel 9:1, 2) However, it was not until "the first year of Cyrus the king of Persia" as king of Babylon that he gave the decree to release the Israelites from captivity. (Ezra 1:1-4) All these accounts serve as basis to confidently conclude that Darius the Mede ruled for some time before Cyrus the Great took over as king. But for how long? 539 - c. 537 BCE—Period of reign In the seventh month of Tishri (modern day October) in 539 BCE, Cyrus and his army invaded Babylon while King Belshazzar was celebrating a great feast in the city. (Daniel 5:1) After skillfully drying up the river surrounding the mighty walls of Babylon, Cyrus and his army entered the city without engaging in battle at all. (Isaiah 44:27) On that very night, the Babylonian king was killed and Darius the Mede was immediately made king, hence beginning his reign as ruler of Babylon. (Daniel 5:30, 31) Based on this account, it can be firmly established that Darius became king of Babylon in the seventh month of Tishri in 539 BCE. Considering the fact that Darius had a "first year of . . . reigning" means that he had at least a second year too. (Daniel 9:2) However, by "the first day of the seventh month" of 537 BCE, the Israelites had already arrived in their cities, and had started offering burnt sacrifices to Jehovah. (Ezra 3:1, 6) Noting that organizing a congregation of 49,942 and their animals to trek a journey of four months long would take a considerable time, Cyrus must have decreed the end of the Jewish exile latest by Sivan 537 BCE. (Ezra 7:9; Nehemiah 7:66, 67) Therefore, the 62-year-old Darius' reign must have ended latest by Iyyar 537 BCE, most likely resulting from natural death. Based on all the above mentioned facts and analysis, it is reasonable to conclude that Darius the Mede reigned as king of Babylon from Tishri 539 BCE to some time between the months of Heshvan 538 BCE and Iyyar 537 BCE, totaling a period of approximately a year and a half. The Hebrew months and their modern day equivalents: 1. Nisan - March/April 2. Iyyar - April/May 3. Sivan - May/June 4. Tammuz - June/July 5. Ab - July/August 6. Elul - August/September 7. Tishri - September/October 8. Heshvan - October/November 9. Chislev - November/December 10. Tebeth - December/January 11. Shebat - January/February 12. Adar - February/March Veadar is an additional intercalary month added 7 times in 19 years. Comments (4) 1. AbbyAbby Dec 24, 2014 13:46 GMT Hi Michael! I dunno how to ask this without coming off as a bot, prankster or virus. I need to talk to you. Are u on Facebook? 1. AbbyAbby Dec 28, 2014 06:41 GMT Yeah, that is not what I wanted to ask you...lol Thanks Michael. 2. JamieJamie Apr 8, 2014 01:36 GMT Thanks. Doing some research while studying God's precious Word. • Showing 1 - 2 of 2
New answers tagged Short Answer: They ran out of Isotopes Long Answer: The way an MRI works is that compounds labeled with stable isotopes are used in Magnetic Resonance Imaging to render visible metabolic changes in the body. The Isotopes are a scarce resource; it's already being discussed that the global medical community could run out of the Isotopes needed in this ... Since good canonical answers have already been posted, here's my take: MRI machines need liquid helium to super-cool their electromagnets into superconductors. Helium is a non-renewable natural resource and, in fact, we are already in short supply of it. Presumably we ran out of helium, and without a suitable replacement, we scrapped the now useless MRI ... According to Interstellar's screenwriter Jonathan Nolan: Revelation 2: The death of tech in the film, like GPS and MRI machines, is based on informational extinctions in history. Jonah Nolan: Kip and I spent a memorable afternoon with some fantastic scientists that Kip pulled together to talk through all the different ways human life could be ... The cause is that all of humanity is concerned on making food to survive, so most of people are farmers, there is a shortage of engineers who could make and operate such machines, as well as the fact that it is very expensive to use MRI. There is no need for MRI machines when most of the people are dying from starvation, not diseases which need MRI scans. Top 50 recent answers are included
In this unit, we have discussed teams and communication in the health care setting. Using the CSU Online Library, locate at least one scholarly article involving both of these topics. Once you have read the article, you will compose a three to four page article review by doing the following: 1. Provide introductory details about the article selected. 2. Discuss the purpose of or type of team as presented by the article. 3. Discuss the communication failures amongst the team members. 4. Discuss how the communication failures impeded the team’s performance and/or impeded quality patient care. All sources used, including the textbook, must be referenced; paraphrased and quoted material must have accompanying citations. Any references or citations used should be in APA style. MHA/6501 Unit III Discussion Board Compare and contrast the National Cancer Institute’s patient centered communication model and Aristotle’s sender listener model of communication. How would a manger use these models to maintain or create effective communication within a health care organization?
Hair Experts Are Now Closer to Predicting the Cause of Male Hair Loss Hair loss in men and male pattern baldness. Hair loss is something that everyone experiences sooner or later, but some get it earlier than others. Losing hair prematurely can be traumatic. Because of that, there is an infinite number of products that claim to cure and reverse the problem. But what if you could find out the likelihood that you will experience hair loss so that you could prevent it before the symptoms even showed? Researchers in the United Kingdom have reportedly found a way to predict who is at risk. More Genetics Linked to Hair Loss According to the new study, British scientists say they found over 200 genetic markers linked to hair loss. More specifically, the study focuses on male pattern baldness. This type of baldness, also known as male alopecia, is the most common form of hair loss in men. Researchers believe this affects as many as 30 to 50% of men by the time they reach the age of 50. By looking into the genetics of all the men, researchers managed to pinpoint 287 specific genetic variations, located on over 100 different genes. Many of those were located on or close to genes that have been linked to baldness before. Some were found on genes that are known to cause graying of the hair. Interestingly, 40% of the genes causing male pattern baldness were located on the X chromosome. You inherit that chromosome from your mother. By analyzing all these genes, researchers could also make a “scorecard” which predicts what risk a man runs for experiencing hair loss based on his genes. The hope is that in the future, this could be refined and used to prevent early signs of hair loss. hair loss men About 40% of the genes causing male pattern baldness are located on the X chromosome that you inherit from your mother. Preventing Male Pattern Baldness Researchers are not sure there are any foolproof ways to prevent male pattern baldness without taking medication or having surgery as of now. But well-known theories state that stress and emotional trauma can cause hair loss by increasing the amount of hormones our bodies produce. Hair loss and Stress Male pattern baldness is connected to the male sex hormone androgen. So naturally, reducing your stress levels will also reduce the risk of suffering from the different symptoms that stress cause. You can reduce stress by practicing mindfulness and yoga. You can also cut down on work and make sure to get enough sleep. Minimize your exposure to negative people or experiences. Spending time in nature and exercising also contribute greatly to your mental health. If hair loss has started, you can treat the symptoms by well-known medications like Rogaine, which contains minoxidil. This treatment comes in the form of a cream that you apply topically to the scalp. There are also medications containing finasteride that help with treating hair loss. Prevent hair loss through your diet You can even increase your own natural hair growth by eating the right food. Since hair growth depends on what happens inside of your body, it only makes sense that what you eat matters. Foods high in protein are really good for preventing hair loss, since protein is what makes up the hair. Eggs, fatty fish, beef, pork tenderloin, chicken and lentils are all good. Another general rule is to eat many greens and veggies. Kale, spinach, bell peppers, carrots and onion all promote healthy hair growth. Basically, you need to make sure you get all the vitamins and minerals that the body needs to keep producing hair. If you find it hard to get all the important nutrients daily, you can supplement your daily diet with a specialized hair supplement. To sum up, hair loss may be inevitable. But if there is a way to find out whether you are at risk for premature hair loss, you can take steps to push it off for a little longer – many times in a natural and healthy way. Can a Hair Growth Shampoo Really Make Your Hair Grow? Does Hair Growth Shampoo Really Work? It sounds too good to be true: use this hair growth shampoo and watch as your thinning hair returns in full force. Unfortunately, many products claiming to promote hair growth don’t really work. However, there are some shampoos for hair growth out there more effective than other ones on the market for a variety of reasons. Some claim to help with hair growth, while others don’t promise to do anything beyond helping hair to appear thicker and healthier. With so many different kinds of hair growth shampoo available, how can you know which ones are worth it? The trick to finding the best hair growth shampoo is to get one that contains ingredients shown to aid healthy hair growth. So what are some of the ingredients to look for in shampoos for hair growth? Some key ingredients in shampoo for hair growth are zinc, biotin, niacin or caffeine. These ingredients have been shown to affect the body in ways that can help hair to grow, such as by increasing circulation. It’s worth noting that even if a shampoo on its own doesn’t do the trick in promoting hair growth, the action of massaging the scalp when you use the shampoo can still help. Other ways to fight against hair loss include focusing on how to improve your hair health, such as by adding nutrients to your diet or even directly to your hair. Let’s take a closer look at shampoo for hair growth. Is there really a kind of shampoo that helps hair grow faster? What ingredients should you look for the best hair growth shampoo, and how do they work? Read on to learn the answers to these questions and more. What is Hair Growth Shampoo? Different kinds of hair growing shampoo have different claims about what they can do. Many brands claim to sell shampoos that will make your hair grow faster or thicker, and some even claim they can halt or even reverse hair loss. Others tout benefits for hair health that help hair grow stronger — so they support hair growth, but they don’t necessarily increase the number of follicles that are actively producing hair along the scalp. In general, shampoo for hair growth is any shampoo that is designed to help your hair grow. Whether those hair growth benefits are intended to be in terms of better health and strength, faster growth or an increase in the number of strands is open to interpretation. Do Hair Growth Shampoos Really Work? Whether hair growth shampoo really works depends on several things, including which hair growing shampoo you use and what benefits you expect to receive from it. Any shampoo that helps keep your scalp and hair healthy can be considered a hair growth shampoo. If you’re looking strictly to increase the number of hairs on your head, you may be disappointed, as research at this time suggests there’s no magical shampoo that will reverse hair loss. Keep in mind, that an effective hair growth shampoo does not simply make your hair grow. Instead, it helps to keep your hair healthy by delivering ingredients that can benefit your hair when applied topically to the scalp. Some of the ingredients found within hair growing shampoo are also found in supplements that promote hair health. What Ingredients Are in Hair Growth Shampoo? Let’s take a closer look at a few ingredients found in hair growth shampoos that help with hair growth: Biotin is a B vitamin that plays an essential role in the health of our skin, nails, and hair. It has an important role in the formation of keratin, the protein that’s the main building block of hair. It’s a common ingredient in nutritional supplements and hair growth shampoo. Niacin is another ingredient commonly found in hair growth products. This is a B3 vitamin that helps transport the energy from the foods we eat into all the cells of the body. It converts carbohydrates to energy and prevents that energy from turning into fat. Niacin also improves blood circulation, increases keratin production and repairs DNA. It has been found to induce hair growth even when applied topically, which is why it is commonly included in hair growth shampoos. You can make your own niacin hair mask by using avocado. Caffeine may also be a relevant ingredient in the battle against hair loss, according to dermatologists from the University of Jena in Germany. This is because it stimulates weakened hair roots and protects them from testosterone, which can have a harmful impact on hair growth. However, there are some doubts over whether it is actually effective to apply caffeine topically to the scalp, meaning it may be ineffective as an ingredient in hair loss shampoo. Even so, it appears on the ingredients lists for several products. Zinc helps fight dandruff and keeps the scalp healthy, which promotes healthy hair growth. It’s an ingredient in most name-brand dandruff shampoos. Last but not least, a very common ingredient in hair growth shampoo is ketoconazole, an antifungal medication. This is scientifically proven to be effective in fighting hair loss, but it also comes with side effects. If you are sensitive to antifungal medications, it could cause skin rashes, headaches, abnormal hair texture or dry or oily scalp. Some shampoos also contain minoxidil (brand name Rogaine). While research suggests this may be effective in helping the fight against hair loss, we always recommend going for a shampoo with natural ingredients that help nourish healthy hair growth from within. The all-natural approach is less likely to leave you with any unpleasant side effects that can accompany using drugs to promote hair growth. hair growth shampoo Can a Hair Growth Shampoo Really Make Your Hair Grow? Additional Tricks to Help Hair Growth No matter what kind of hair growth shampoo you use, it is always helpful if you massage the scalp when you apply a hair growth shampoo. Massaging the scalp stimulates the skin and increases the blood circulation, which makes sure the hair follicles receive all the nutrients and oxygen they need to be healthy. It also keeps the scalp free of any leftover hairspray and other product buildup. This, in turn, promotes healthy hair growth and reduces the risk of dandruff or scalp acne, which can impede hair growth. Taking a hair supplement can also help ensure your hair is able to maintain healthy growth. Unlike a topical treatment, a good hair supplement will give you all the vitamins, minerals and nutrients you need from within, such as biotin. It can also benefit your skin and nails. Many people who take Nutrafol report side benefits such as clearer skin, less stress, better sleep, and increased libido. As always, when something seems off in your health, take a look at your lifestyle. Are you stressed? Are you too busy to eat healthy foods? When was the last time you worked out? Adding some exercise, sufficient sleep and a healthier diet to your lifestyle will have a positive impact not only on hair but also on your entire body. If you suspect a serious health issue may be at the root of your hair loss, seek help from a medical professional.
Isolation, Deprivation, Torture, and Disability in Homeschools The Turpin parents, shown in the courtroom. Homeschool can play a vital role in one of the key elements of child torture: isolation. Isolation is necessary to sustain the type of environment where child abuse can escalate to the level of torture. A uniform definition of child abuse torture has not been officially established, and torture previously has been defined largely in a political or state context, such as by the United Nations. Torture is consistently stated by researchers to be prolonged suffering inflicted on a victim or victims in order to for the perpetrator(s) to meet some kind of need. This need can be political; it can also be emotional. Torture in any context is long-term, severe abuse that can include several elements, such as deprivation, starvation, psychological manipulation, and neglect of medical problems. A major component necessary to continue torturing someone is the total isolation and confinement of that victim. Only in isolation can a perpetrator continue to get away with this level of mistreatment. Without total isolation, a child or children undergoing severe abuse and maltreatment would certainly arouse suspicion from people outside the home who could potentially put an end to it, such as teachers and doctors. Homeschool is a way for a perpetrator to remove themselves and their victims from environments where the suspicion of authorities might be incurred. Homeschool also allows a victimizer to keep a child confined in a home all of the time. In many of these cases, very little education is really happening, and homeschool is being used as a cover for abuse. The abuse has primacy; everything else is situational, and an unregulated area of the law is being used to provide a cover. It can be quite easy to start a homeschool in many U.S. states, and there is no oversight or regulation involved, something which has been consistently pushed for by organizations like the Homeschool Legal Defense Association, a well-funded arm of the Republican Christian Right. In every homeschool story I have written about in this blog, isolation is an important detail. The Naugler children were isolated in the woods. Erica Parsons was kept away from society in her rural home, Hana and Immanuel Williams lived in a rural, gated, insular religious community, and before that, they were kept segregated from society in an orphanage, and now, the thirteen Turpin children, who were chained in their house and “homeschooled” shows how it is possible to isolate, torture and deprive 13 humans even in a suburban neighborhood with neighbors close by. Many people have responded to the Turpin story by asking incredulously how it is that neighbors did not notice anything was wrong, and never called police. Neighbors should not be the ones relied upon to make these kinds of reports, and child abuse cases regularly indicate that neighbors do not really know what is happening inside another home in their neighborhood, even if they have suspicions that something is off. It is important to remember that victimizers of children will go to great lengths to not be found out, and it can be difficult to tell just by looking at a child from across the street or driveway that a severe level of abuse is occurring within their home. The optimal type of person to identify and report child maltreatment is found in a professional environment, such as a doctor, teacher, or disability support professional. Disability and Torture There is a further element of isolation and deprivation which occurs in a torture case when the child has a disability. Erica Parsons had hearing loss and intellectual disability, Hana Williams had PTSD, Immanuel was Deaf. When a person is Deaf, it can be tremendously isolating in and of itself if there is no sign language, closed-captioning, or capable people around to facilitate communication, let alone in an abuse situation, which compounds the isolation and deprivation that can come with deafness. Not providing access to deaf and disabled children is a form of neglect already. Deaf children may not be able to speak clearly enough for hearing adults to understand, sometimes because they are too young, sometimes because those children were purposely prevented from receiving speech therapy or any instruction or support around communicating with the outside world. Adults who victimize deaf children are aware of this fact, and it actually benefits the abusers, as this story about a school for the Deaf in England, where many children were abused for decades, demonstrates. Not providing disability accommodations or language to a child keeps them isolated, deprived and unable to ask for help. This is consciously done on the part of an abuser, and needs to be understood within the criminal justice system as being particularly reprehensible, and a further level of victimization. Another element of torture is neglect. Parents who commit child torture do not take their children to the doctor regularly, if ever; they do not get them disability related services or ongoing accommodations, they do not keep them in public school consistently or at all. The Turpin children rarely saw doctors, with some of the children reportedly not knowing what medications or doctors even were. Some may say this was a religious preference, others may say keeping the children from medical professionals, teachers, and other services was vital to maintaining an environment where torture could continue. Total deprivation, isolation, neglect and confinement are of substantial benefit to someone who is committing child torture. It is important to recognize how isolating children in a homeschool can allow all of these elements to occur, and to occur for a prolonged time until the victim dies or is close to death. In many homeschool cases, the only time anyone found out what had been going on was after a homicide had happened, sometimes years after the homicide occurred. Erica Parsons was missing for three years before law enforcement had been contacted, and no one in the community was aware that she was missing. Keeping Erica isolated in a rural home, registered as a homeschool in name only, allowed Casey and Sandy Parsons to torture the child for many years. The Role of Disability Law and Criminal Justice If disability law is extended to cover homeschools in every state, homeschool abuse cases can be potentially found out and prevented. It is not acceptable to allow a disabled child to go without accommodations and access, no matter what your religious beliefs may be. It is neglect, plain and simple, and can cause physical pain and suffering to the child, and allow them to be vulnerable to victimization not just by their parents, but by many people, and keep them from gaining independence. In the case of abuse, the presence of disability elevates and heightens the terror and pain felt by the victim. The rights of disabled children to have disability access trumps the desire by parents to isolate, neglect, deprive, and abuse them. This means that the rights of children are more important than a religious philosophy, more important than any “off the grid living” mentality, and more important than upholding lax homeschool regulations. Disability rights are a fundamental human right. And ensuring that human rights are adequately enforced provides a way to potentially crack down on an area where many homicides of children, both able bodied and disabled occur: homeschools. If a disabled child has the appropriate therapies, access, and medical treatment, this can alleviate stress on the parent or parents of the child. Parents of disabled children need support, and a disabled child needs to learn independence. Mobility aids, hearing aids, sign language, and a disability-rights based education can allow this to happen. Of course, in the case of severe abuse, control, and deprivation, it is not part of the plan to provide a child or children with any support or assistance. The abused child is being used in a way that benefits the parents. It is not about the child’s rights or access at all. Requiring and enforcing disability access in all schools, not just public schools, is a potential way to catch perpetrators, and it is also a way to catch the absolute worst perpetrators, the ones who torture children. Disabled children are often selected on purpose to enter into situations of abuse due to a variety of ableist and complex factors, and once in any number of situations, like a home or a school, they are more likely than able-bodied children to be abused. Hana and Immanuel were selected by the Williamses for adoption because they were disabled and it was considered more “Godly” and self-sacrificing on the part of the parents to adopt such children. Once in the home, the reality of having disabled children paired with parents who were already volatile and problematic contributed to the situation escalating to homicide. In the case of Erica Parsons, she was born with disability, and this most likely was a deciding factor in her being placed for adoption with her relatives, Sandy and Casey Parsons. In the case of the Turpins, it is also likely that the deprivation, starvation and neglect the children endured caused psychiatric, emotional and physical disabilities, even if there were no disabilities present before the onset of the severe abuse. The timeline so far of the case is not entirely clear. Disability needs to be understood as an element of child torture; something that is used by a perpetrator to further victimize, isolate, and deprive a child, and also as a characteristic that makes a child vulnerable to becoming ensnared in a case of severe abuse in the first place. Both of these factors necessitate further regulation and law around homeschools, and better understanding of the role that disability plays in child torture and mistreatment. The Turpin family’s California home, and [inset] a photo of the parents and their children. [image description: photo of taupe colored suburban home with van parked out front, in dry desert climate. Inset shows 13 children in matching t-shirts from Dr. Seuss’s “Cat in the Hat”, each designating a child as “Thing 1”, “Thing 2”, going up to higher numbers. They are smiling and posing together in a group. Faces of the children are blurred for anonymity.] Leave a Reply You are commenting using your account. Log Out /  Change ) Google photo Twitter picture Facebook photo Connecting to %s
/Tag: equations What is algebra? Math made simple By |2018-04-23T15:58:58-07:00July 27th, 2017|Math| Simple equations on a graph Algebra is the way Islamic mathematicians figured out to connect our ideas about geometry with our ideas about numbers. You can use equations to represent geometric shapes. You can also use equations to represent the movement of numbers (or real objects like trains) through time or space. The simplest equations have only one variable. They look like y [...] Medieval Islamic science By |2018-04-24T08:21:20-07:00July 27th, 2017|Islam, Science|
/Tag: equinox Where did Passover come from? Jewish holidays By |2019-04-05T06:56:58-07:00August 24th, 2017|Religion, West Asia| Handmade Matzoh The beginnings of Passover In its earliest beginnings, which could go back to the Stone Age, Passover was a Jewish spring festival. Like other spring festivals, it celebrated the first barley harvest after the winter. History of barley West Asian religion All our West Asia articles Why did people eat matzoh? All winter [...] History of Easter – Christian holidays By |2019-04-05T06:43:53-07:00August 21st, 2017|Religion, West Asia| Wheat and barley on the Warka Vase (Sumeria, ca. 3200-3000 BC) Why celebrate spring? When people moved out of Africa further north to West Asia and then to Europe, about 60,000 BC, they began to live in a world with changing seasons, where it was hard to find fresh food in the wintertime. Why do seasons change? West Asian [...] What causes the seasons? Earth science By |2018-04-24T15:45:14-07:00August 20th, 2017|Physics| This is why it's hotter in summer and colder in winter. The reason it is sometimes winter and sometimes summer is that the Earth spins on a slightly tilted axis. You can see the red axis in the picture here (though really there is no axis to see; it's a direction, not a real stick). [...]
Hair in Folklore Niamh and Oisin (via Education Scotland) October’s North Clare Local article.  Compared to most other mammals, humans have very little hair. For millennia we’ve styled and glorified the hair on our heads. Last month, I discussed the superstitions around red hair. While other hair colours don’t attract quite as much folkloric interest, there are some interesting differences in the way people with different hair colours and styles are perceived. Historically, the mostly brown-haired Irish adored blonde hair. Niamh the Fair, who took Óisin away to Tir Na nÓg, had golden hair down to her waist. It was also believed that blonde-haired children and women were more desirable to fairies, and were especially vulnerable to kidnap by the sídhe. Blonde hair has long been seen as attractive. Even today, blondes “have more fun” and gentlemen apparently prefer them. But if you’re a brunette or ginger, don’t be disheartened. Blondes have been traditionally seen as more fickle and unreliable, whereas brunettes’ loyalty is never called into question. Blond men were seen as deceitful and dishonest. Despite this, blondes have also been seen as paragons of virtue; brunettes were seen as less pure-hearted. The stereotype of the “dumb blonde” refuses to die. Brunettes have long been seen as clever and blondes as hopeless ditzes. As we may observe from, say, Hilary Clinton and Kim Kardashian, the reverse is often the case, but the label persists. Studies have shown that men perceived brunette women as more intelligent and competent than their blonde counterparts. The stereotype goes back as far as the 1800s. In 1775, a play about the French prostitute Rosalie Duthé made the most of her good looks, blonde hair and lack of brains. She’s the first “dumb blonde” but others have since followed in her footsteps. For many, like the well-read and intelligent Marilyn Monroe, the role was nothing but play-acting. Colour aside, there’s all sorts of beliefs about hairstyles. Long hair in women is a sign of youth and beauty across almost all cultures. However, it could also be linked with temptation and seduction. In East Asia, loose long hair was seen as promiscuous, so women always wore their hair tied up. This was common in many cultures, such as our own. Going out with loose hair was seen as bad luck by the Celts. In England, a witch could bring around a storm by sitting on a beach with loose hair. Despite the association with wantonness, long hair was seen as one of the most attractive physical traits a woman could have. The Grimm fairy-tale Rapunzel is probably the most well-known example. The beautiful maiden trapped in her tower lets down her long hair so her prince can climb up the walls. It must have been quite a strain on her scalp. There was a nice twist in the recent Disney adaptation, Tangled, where Rapunzel ended up with short hair. She didn’t seem to mind too much. Lady Godiva, an 11th century English noblewoman, reportedly rode naked through the streets of Coventry to protest unfair taxes on the town. Only her long hair covered her modesty. A man called Tom peered at her, despite being forbidden to do so, and was struck blind. He’s the origin of the term “peeping Tom” and the legend of Lady Godiva lives on. For some curious reason, she’s become a mascot of many engineering colleges across the western world. Lady Godiva by John Collier (via Wikimedia Commons) Over the centuries hair has been a political issue. During the Norman invasion of Ireland, the Gaels resisted pressure from the newcomers to cut their long hair. Irishmen who did cut their hair were seen as loyal to the new regime. Likewise, Normans who let their locks grow had become “more Irish than the Irish themselves.” Cutting hair was a tricky business too. The new moon was the best time to do so, in Irish tradition; it meant it would grow back stronger. Cutting it during the full moon would lead to baldness, and combing your hair in the dark would lead to sorrow. Eating bread crusts makes your hair curl, but curly-haired people were believed to be bad-tempered. One should never pluck a grey hair or ten more will fill its place. If you visit Thailand, you may not see many barbers open on a Wednesday, as this is considered an unlucky day for a haircut. While some cultures believe it’s very unlucky to burn hair cuttings, in Lancashire, they once believed you can tell how long someone will live by how bright the flames burn. The Navajo people in America and the ancient Chinese believed that cutting hair would sap a person of their power, and the Biblical story of Samson is a reminder that a man should never let a woman cut his hair. Hair is something intimately personal to us all, and the rich beliefs around it testify to this. Leave a Reply You are commenting using your account. Log Out /  Change ) Google photo Twitter picture Facebook photo Connecting to %s
The Auger is also an agricultural tool that is used to break through soil and clay. The Auger resembles a corkscrew but once rotated, the unique auger design moves materials or liquids to the desired location (either up or down, depending on the rotation). It’s the strong and long design, which makes Augers ideal for boring deep holes. Their real skill lies in removing materials from bore holes, which dramatically reduces the risk of clogging or jamming Another agricultural use of the design is the grain auger, which can be used to separate grain from carts and trucks into special storage bins. It works by using the spiral to move the grain upward through a metal tube, allowing the hopper to receive the grain. A drill bit, which is the most common type of Auger, works by removing shavings and debris from the hole as it is being filled. Augers perform hard throughout many areas of home improvements and agriculture. Even though the Auger is said to date back from 200s BC, the tool is still used by farmers, carpenters and builders alike because of its skill in transport both liquids and materials from one place to another. There are no suppliers in this category
Artificial intelligence (AI) could be about to get 50 times more powerful thanks to Cambridge's ARM. The chip design giant has released a new set of processor designs, the first based onts new DynamIQ technology, which was announced earlier this year and has been developed for the growing AI market, as well as areas such as driverless cars and the Internet of Things (IoT). "AI is already simplifying and transforming many of our lives and it seems that every day I read about or see proofs of concept for potentially life-saving AI innovations," said Nandan, head of ARM's CPU group. "However, replicating the learning and decision-making functions of the human brain starts with algorithms that often require cloud-intensive compute power. Unfortunately, a cloud-centric approach is not an optimal long-term solution if we want to make the life-changing potential of AI ubiquitous and closer to the user for real-time inference and greater privacy. ARM Holdings, Fulbourn "In fact, survey data we will share in the coming weeks shows 85 percent of global consumers are concerned about securing AI technology, a key indicator that more processing and storing of personal data on edge devices is needed to instill a greater sense of confidence in AI privacy." As well as the new products, the ARM Cortex-A75 and the Cortex-A55, ARM has also released designs for a premium version of one of its top selling processors, the Mali-G72 graphics processor, which could help power the next generation of video games and mobile virtual reality. Nayampally said the designs will help enable a 50 per cent increase in AI power over the next three-years. He added: "Enabling secure and ubiquitous AI is a fundamental guiding design principle for ARM considering our technologies currently reach 70 per cent of the global population. As such, ARM has a responsibility to rearchitect the compute experience for AI and other human-like compute experiences. To do this, we need to enable faster, more efficient and secure distributed intelligence between computing at the edge of the network and into the cloud."
Dallmeier Logo Dallmeier Network Interface (DNI) Dallmeier Network Interface For the connection of different external devices or systems (e.g. ATMs, PTZ cameras, cash registers or card readers), Dallmeier specifically developed the DNI (Dallmeier Network Interface). The DNI allows the data from the external device to be included in the video image or can control external devices. The DNI serves as a data interface and receives data from an external device. The DNI can be used for any system because the protocol can been adjusted to any manufacturer. What does adjusting the manufacturer protocol mean? The DNI acts as a translator between the two devices. Before it can be used, it needs to know how the data is to be converted. This is defined in a so-called protocol, which is a kind of text file that says which incoming data set is to trigger a transmission of which data set on the other side. So, the DNI is a kind of “dictionary” that translates the different languages of the two systems. The DNI can be used for any system once the corresponding protocol of the manufacturer has been adjusted. Adjusted means that the protocol file is supplemented so that the DNI translates correctly for our recorders. This means that once a protocol for a specific device/manufacturer is written then the DNI can be used to interface that device to any Dallmeier recorder.
CALL 844-99-HEALTHY for your free consultation Sugar, Carbs, and Their Impact on Obesity Despite the common misconception, you cannot just eat whatever you want and then exercise it off. That is no way to live healthily or to have a balanced diet. What you eat is every bit as important as how much exercise you perform, perhaps even more so. And this is a problem many people face as they diet. They believe that enough exercise will allow them to eat as much as they like of whatever they like. But every nutrient has a different effect on the body, regardless of how much and what kind of exercising you are doing. Sugar and Weight Gain Most people understand that sugar contributes to obesity considerably. Eating foods high in sugar content often has a negative effect on your diet and can lead to obesity. That’s not because sugar in small quantities balloons your weight. In fact, sugar in moderation is essential for a balanced diet. But the calories create a feeling of hunger in the body and don’t allow you to feel as full as you would if you were eating many other nutrients. That’s why it is so easy to eat far too much ice cream in one sitting or to eat large quantities of unhealthy snacks. Once you start feeding your body sugar, it craves more, and it becomes very easy to overeat. This is where the link between sugar and weight gain begins. You may just tell yourself you are only cheating on your diet a little bit, but once you give into the cravings, your body is going to demand that you continue to do so. If you don’t have the willpower to resists, giving into a small temptation can lead to obesity over time. That’s the effect that sugar has on your body, and it doesn’t matter where that sugar is coming from – soda, cake, ice cream, fruits or candies- it all has the same effect. The best way to combat the effects of overeating sugary foods is to limit what is available to you. Don’t overstock your cupboards with sugary foods. Try to keep only a small amount on hand. As mentioned earlier, a little sugar is good for you, but if you are susceptible to temptation and overrating things that are not beneficial to you, then you need to force yourself to cut back. Restricting what you have around you is one of the best ways to do so. That may also mean not eating out as much, as it is harder to control portion sizes and the sugar content of what you are eating. Do Carbs Make You Gain Weight? Now carbohydrates offer energy much like sugar does. So many diets that focus on providing you with the energy to exercise strenuously are going to recommend foods that are high in carbs. You want to be careful not to confuse this with the energy you get from sugar. You can get the same energy from both, but the effect these two different nutrients will have on your body is very different. Carbohydrates are filling, and they will sate your hunger quite fast. Think about how much more filling pizza, pasta, bread and potatoes are than ice cream and snack cakes. That’s because these foods are high in complex sugars that your body can use to create muscle mass. They satisfy your appetite and give you the energy to live an active lifestyle. Simple sugar, on the other hand, gives you some quick energy but then leave you feeling drained afterwards. Now eating lots of carbs can make you obese; make no mistake about it. But if you combine them with exercise and an active lifestyle, you can consume quite a few carbs each day and still fight back obesity. That’s not possible with sugar, which will continue to build up in your body as fat even when you exercise. And keep in mind that what you eat affects the quality of your life and not just your midsection. Even if you aren’t getting fat by eating foods that are unhealthy for you, you can still suffer in other ways. It’s always better to get your sugar content and energy from carbs than from simple sugars. This is the best way to avoid the link between sugar and weight gain, in a natural way. Learn more about Natural Weight Loss and Supplements by clicking here >>
Beyond vertebrate fossils: Plant fossils and molecular approaches to palaeoecology A study in Blanche Cave provides the first fossil pollen record from the Naracoorte Caves and points to the potential for other fossil deposits within the Naracoorte Caves to yield materials that may provide direct indicators of local and regional environments throughout the Pleistocene. Study of plant fossils will reduce the reliance on palaeoenvironmental records from other localities. Another emerging area of research at the Naracoorte Caves is ancient DNA from fossils and cave sediments. Opportunities exist for integrating ancient DNA and other palaeoenvironmental proxies such as plant pollen and macrofossils (e.g. seeds) into research programs, enhancing our knowledge of local environmental conditions in the past and the interaction between populations and communities with climate and environmental change.
Using Chelated Copper to Control Pond Algae Copper is an incredibly diverse element. Depending on the selected chemical formulation, it can be used in a variety of ways. Copper in its different forms is found in artwork, plumbing, wiring and many other areas. In 2016, more than 19 million tons of copper were mined around the world, with 1.4 million tons coming from the United States. Needless to say, copper is everywhere, and all estimates suggest that its production will only increase as the nations of the world continue to develop their infrastructure and economies. However, just as copper is everywhere, so is water. Too often, the results of copper mining and usage end up leaving residual copper in the water. But fear not — not all copper is the same, and not all copper is necessarily bad.  One of the major environmentally beneficial uses of copper nowadays is to control algae. Algae can be found in practically every pond, serving important roles in the water, such as aiding in oxygen production and acting as a food source. Unfortunately, anyone who has spent enough time around ponds has seen what happens when algae get out of control. Affected ponds can go from picturesque to green soup over the course of a day. In cases like this, immediate action is needed. While algae can serve as a positive factor most of the time, they represent a real threat to all other life in the water when they bloom. Not only do blooms of algae take up large amounts of oxygen, but some species even produce toxins that are deadly to other organisms. So, if this becomes a problem for a pond owner, what is the most effective approach? Copper-based Algaecides Copper crystals (granular) are exactly what they sound like — crystallized copper. This is the cheapest and oldest method of applying copper as an algaecide. Just throw it into the water where algae is present, and the crystals will dissolve, killing the algae it comes in contact with. While this sounds easy enough, this method is also the most damaging. Copper crystals only kill what they touch, so a large pond could require quite a bit of copper to achieve an effective result. copper sulfate solution ponds These vials contain copper sulfate solution. A second approach, liquid copper, covers a very wide range of products that use different mixes of copper to varying effects. Liquid copper is more efficient than copper crystals because it can actually stay suspended in water for a longer period of time — copper crystals tend to sink straight to the bottom. However, the same issue remains: To achieve the most algae kills, more product needs to be used. A third category to consider is chelated copper, a slightly more complex version of liquid copper. Chelated copper algaecides are also liquid, but they are defined by that first word — chelated. This is the name given to a chemical process where a form of protective covering attaches to the copper atoms. Chelation is analogous to the shell around M&M candy. The shell around the chocolate protects it from the outside, and it only starts to break apart in response to heat (or in this case, being chewed). The goal of using chelators is so that the main ingredient of the product isn’t used up too quickly. So when chelated copper is applied to a bloom, the copper releases more gradually, as the protective covering slowly dissolves in the water. This creates a longer period of actively killing algae while requiring less copper usage, since the product works for an extended period. Thus, this is the most ecologically friendly choice. While these are the three general categories of copper-based algaecide, there really are not that many varieties for sale on the market. Even though there is not an array of choices, it can still be tough to figure out what the right choice is. Chelating agents tend to be proprietary, and finding out what products are natural or organic can be next to impossible. It can also be a task trying to find copper products that are easy on the ecosystem — but if you can find the right product, it can be a great solution. Don’t box me in the environment and can be found at varying levels within sediment that has never been touched by human copper products, we have to be aware of the fact that in excessive amounts, copper can become a problem. So, it makes sense that when considering copper algaecides, you want to make sure to use a solution that contains the smallest amount of copper while still producing the greatest results. Why is Copper Balance Important? Regardless of the source, copper ends up binding to organic matter, and when it reaches the sediment layer, it resides in the upper few inches of substrate where this organic matter is concentrated. This section of the sediment hosts some of the most vital organisms in a freshwater ecosystem — beneficial bacteria, plants and invertebrates, just to name a few. They call this area home, and together they make up the base of the freshwater food web. Smaller organisms feed on floating detritus (plant material) and microorganisms, and the levels of consumption keep rising. Copper sulfate crystals congregate. An example of these levels in fresh water would be how a phytoplankton photosynthesizes. It is eaten by a larval fish; this larval fish is eaten by a sunfish; and the sunfish is then grabbed from the water by a heron. This is an extremely generalized view of the flow of life, but it depicts an integral part of ecology. It’s important to note that it all starts at the bottom. Without plants and microorganisms, the smaller organisms have no food; in turn, the bigger organisms have nothing to eat. It seems clear that maintaining healthy sediment is the key to a functioning ecosystem and a sustainable pond. If an algae bloom is starting to spread, the health of the pond must be an immediate concern. It may be obvious that the bloom needs to be dealt with, but the massive number of products available for this exact situation can be quite daunting. This is where chelated copper can be a great asset. Not only can the bloom be killed with a small dose, but it can be done with a minimal amount of copper added to the ecosystem. This small amount of copper also enables the use of different products after application. One of the most common supplements to a chelated copper application is an enzyme product, with additional bacteria added a few days after applying the chelated copper. These speed up the decomposition of dead algae as they sink, reducing the chance of a reoccurring bloom. The fact that chelated copper works well with these organisms is proof of how much less damaging it can be, compared to products that use copper crystals. Left picture, freshwater algae species are shown at 400x magnification while, right, a common water flea under the microscope (Daphnia pulex) Overall Pond Balance Keeping balance in a pond is something that every pond owner strives for. It is easy to forget that the ponds we see may look peaceful, but there is always an ongoing battle for resources and space among many different organisms. Algae are no exception to this, and they are one of the most successful organisms at rapidly expanding when the conditions are right. Control needs to happen quickly and decisively, but when algae clear up, every pond owner still wants their plants and fish to thrive. Chelated copper is a great way to tackle this issue and leave the rest of the environment capable of flourishing after the algae subside. The best treatment method is the kind that specifically targets the problem, with as few side effects as possible. If utilized correctly, this solution can be built around chelated copper. No comments yet. Leave a Reply
Have you heard the idiom, “It was the straw that broke the camel’s back?” This illustrates the point that while we can take a lot, at some point, we all reach our breaking point. Whether that means losing our temper, getting sick or sliding into depression, none of us want to reach our breaking point. Just like the camel, many of us are burdened slowly, adapting to our ever-increasing load, until one day when a seemingly innocuous little straw is placed on our back, and we break for what seems an insignificant reason. The parable of the frog in pot of boiling water illustrates a similar point. Put a frog in a pot of boiling water and it will panic and struggle to get out. Put a frog in a pot of tepid water, slowly turn up the heat, and the frog will sit quietly, allowing itself to be cooked alive. Our Emotional Warning System As self-preserving organisms, we are equipped with our own built-in guidance system that allows us to identify when we are being pushed to our breaking point. When we experience feelings of overwhelm, frustration, anxiety or stress, it’s our body’s way of letting us know that we are reaching our breaking point.Contrary to what we may believe, it is not normal to experience chronic states of stress, overwhelm, frustration and anxiety. These emotions are danger signals, and it’s crucial for us to be aware of what these emotions are signaling, and to take action before we reach our breaking point. Before we find ourselves with broken backs. Before we find ourselves having been boiled alive. Negative or stressful emotions are danger signals, signaling us that we need to make a change. If we don’t, we suffer the consequences. Even if we don’t have a full-blown breakdown, the resulting consequences can be mental problems, emotional outbursts, relationship problems, anger issues, impaired job performance, the inability to connect with others, a decreased capacity to feel joy, chronic inflammation, diabetes, unexplained pain, weight gain or worsening feelings of hopelessness. Breakdown of the Emotional Guidance System and the Resulting Generalized Anxiety Disorder (GAD) When we treat these emotional warning signals for what they are-signals warning us that we need to make changes – and then we make those changes – we recover. Our bodies, minds and spirits heal and we return to a natural, normal state of calm alertness. But when we fail to respond to these warning signals, when we keep-on keeping-on, fighting down panic and pushing ahead, we force our bodies to adapt in unhealthy ways. Forcing our bodies, minds and spirits to live in state of chronic hyper-stimulation and anxiety short-circuit all of our natural survival mechanisms. Like any machine forced to run beyond its capabilities, we eventually break down. By forcing our bodies to integrate negative and stressful emotions into our everyday lives, without respite, we adapt. We forget what it’s like to feel peaceful, calm and centered. We believe it’s normal to live in a state of heightened anxiety, to feel stressed, overwhelmed and frustrated, and this becomes our new normal. A new baseline is set and suddenly we think we are feeling good when we are truly feeling stressed. We have changed our brains to believe that stress and anxiety are normal states of being, making our emotional warning system ineffective. By being stoic and brave we train ourselves to allow more negativity and stress, until one day – often without warning – we reach our breaking point. Our back breaks or we realize that we have been boiled alive. Decreasing Stress and Anxiety in Four Steps Fortunately, we can reverse course on this phenomenon and return our stress and anxiety baseline to a healthy, normal level. All it takes is self-awareness, dedication and a commitment to living in a life of joy, peace and harmony. Step One Identify a time when you felt calm, peaceful and centered. When you were alert, contented and neutral. Not elated, just neutral. A time when you simply felt good. Step Two Identify when you experience negative and stressful emotions. Don’t judge them or try to change them, just notice when you have them. Get a little notepad that you can carry with you. Keep it with your cell phone and every time you fiddle with your phone, write down how you feel mentally, physically and spiritually. The notes might look something like this: Irritated, pent-up, silent. Frazzled, blob-like, vindictive. Tired, sore, far-away. Energetic, bouncy, filled with song. Do not try to avoid having emotions, or deny what you are feeling, simply identify what you feel. Step Three Once you are aware of what you are feeling, consciously feel those emotions. Spend up to a minute consciously feeling the emotion that you have identified. How does this emotion feel in your head, your heart and your body? What is it like to be that emotion? Step Four After you have allowed your body, mind and spirit to experience these emotions, consciously return yourself to a place of neutrality. To a place of peace. Return to a neutral, natural, rational state of peace and then deal with whatever is causing your negative or stressful emotions, repeating the process of identifying and feeling any negative emotions that pop up in the process, and continuously and systematically returning yourself to a state of peace and neutrality. Stress-Free Living We are the camel. We have to unburden ourselves every time we are burdened or risk running out of capacity and breaking. We are also the frog. We have to stay aware of our surroundings, of what is happening to us at all times, or we will be boiled alive without our knowledge. Our emotions and feelings are the tools that allow us to stay alert, aware, safe and happy. All capacity is finite. We are not weak, we are human and we have limits. Let’s learn to honor those limits before it’s too late. Pin It on Pinterest
• Date Posted: 29 — 03 — 2019 • Categories: It's all in the Algo-Rhythm Lately, Artificial Intelligence (AI) has leapt from the pages of science-fiction into reality. And whilst we’ve been warned many times about the rise of the robots, AI has been doing some pretty cool stuff across many industries. From detecting cancer to saving local news, it’s fair to say AI can be a welcome addition. Artificial Intelligence is now turning its digital hand to the world of crotchets and minims - and is learning to write music. But is it good enough to take on musical geniuses like John Williams, Hans Zimmer - or Mozart? Firstly, what is an AI program? AI isn't quite how the movies depicts it just yet - it still needs a helping hand from humans. Unlike standard machines and software that are designed to repeat the same task, AI software works more like our own neural networks and is capable of “learning”. Known as "machine learning", programs are fed information and, from there, begin to recognise the patterns within data. Once a pattern - or a series of patterns - is understood, the software can produce what it determines to be the next logical step. For example, feed an AI software a list of recipes and it could create an entirely new dish. Sometimes these are masterpieces - others can be recipes for disaster. But can a robot write a symphony? Yes, they can. And they have been for the past 50 years. There are already bots that can produce sheet music that is performed and recorded by real life people. More recently, however, a program has been developed called Aiva – Artificial Intelligence Virtual Artist - which has been designed to create and produce full classical scores. Created in Luxemburg, Aiva has a massive discography of classical music composed by the most celebrated classical composers such as Mozart, Beethoven and Bach. The software can identify the relationship between notes, how compositions are constructed and can even understand the emotional response caused by these sounds. Ultimately, Aiva can use this library to produce classical compositions that are practically indistinguishable from pieces written by their human counterparts. Can we listen to this music? Yes! Aiva has released two albums already - “Genesis” in 2016 and “Among the Stars” in 2018. But the minds behind Aiva want the world to know that “she” is not there to replace musicians. They see AI-generated music as a way of enabling and empowering the next generation of composers. In fact, Aiva is already proving useful in the world of filmography. Filmmakers can implement Aiva’s genius to score scenes - all at a fraction of the time and cost it takes to commission an original soundtrack. But just how good is AI-generated music? Take a listen to this week’s RHA AI playlist and decide for yourself.
Authentic European news, sourced locally Country editions: Jobs portals: Social media: Mobile apps: The Local logo 8 German words that are impossible to translate into English Share this article 8 German words that are impossible to translate into English For some, Heimat means feeling connected to familiar landscapes or surroundings. Photo: DPA 11:42 CET+01:00 Some words in the German language are so culturally specific, they just don’t exist in English. 1. Heimat Sure, online translators will tell you that Heimat means home, homeland, or heritage in English, but the German word is so much more complex than the meaning attached to each of these words. When German speakers say Heimat, oftentimes it’s used to describe a sense of familiarity or belonging. Heimat can also convey associations with the landscape of one’s childhood and encompass feelings of being surrounded by family or close friends. It's moreover a rather loaded political term in Germany, as we've recently seen with the controversial decision to create a Heimat Ministry or Ministry of Home Affairs within the Interior Ministry. Trying to come up with an English word that conveys all the above left us stumped (and overwhelmed), too. 2. Mahlzeit! If you work in a large office in Germany, you might have noticed colleagues saying Mahlzeit! to you in the hallways on their way in or out of the canteen. An office canteen in Munich. Photo: DPA But contrary to what you might think, they’re neither saying ‘Meal time!’ nor wishing you an enjoyable meal - for which the German phrase is ‘Guten appetit.’ According to Langenscheidt dictionary, the term can be used before or after a meal. adds that it's a phrase people say to each other “often in a working environment during lunch breaks.” Even the phrases 'Time to eat!' or 'Have a nice lunch!’ don't seem to be accurate translations of the true meaning of this German term. Plus, can you think of an English word you say to your colleagues each day from around noon to 2.00 pm? We didn't think so. 3. sympathisch Another German word that can be tricky for native speakers of other languages to wrap their heads around is sympathisch. While it’s true that English words such as likeable, friendly and congenial can be used in its place, oftentimes none of these terms manage to truly say what a German speaker strives to communicate when they use it. One might describe rapper Sido's appearance here as sympathisch. Photo: DPA For instance, by saying you find someone sympathisch (jemanden sympathisch finden), you could mean that you feel close to a person in the sense that you trust them or you have a good gut feeling about them. Unfortunately though the English language doesn’t make things easy for us; no such word which encapsulates everything that sympathisch means currently exists. 4. Eben! This four-letter German word may be short but it packs a punch and here’s why. While a speaker can use eben to describe a surface as smooth, level or flat, eben also signals agreement with someone else’s opinion - for instance with English words like ‘precisely’ or ‘quite’. But the expression ‘Eben!’ takes things up a notch. Duden dictionary defines the term as reinforcing a statement and confirming one's previous actions. Further proof that the English language simply does not have a one-word translation for the expression, according to online dictionary, ‘Eben!’ can be a “response to a person who, while explaining why they are in agreement, mentioned facts that the original speaker had already alluded to or said.” Don’t worry, we’re just as baffled as you are. 5. gemütlich It’s not as simple as stating that gemütlich can be translated into English as cosy, comfortable, snug or homely. That’s because, for Germans, anything from an event to a sweater can be considered gemütlich. Enjoying a glass of mulled wine with friends at a Christmas Market, like this one in Berlin, can be described as gemütlich. Photo: DPA While a soft chair can be called comfy, a German might describe as gemütlich a scene in which a person is sitting in that comfy chair surrounded by close friends and holding a cup of coffee with mellow tunes playing in the background. And it's not just limited to social situations - another definition of the word refers to the comfort of a prosperous, middle-class life. Gemütlichkeit, as defined by Langenscheidt, can mean everything from peace to leisure to easy-goingness; no such English word on the other hand precisely encompasses the vast definitions of this one word. 6. Spießigkeit Whereas you might have heard young people in Germany describe someone as spießig to mean that they are stuffy, square or conservative, the word has a variety of other definitions. One translation offered by is narrow-mindedness. Another translation given by Linguee states that Spießigkeit can be used interchangeably with parochialism. moreover defines Spießer as a derogatory word for a person who “complies with social norms” and is “averse to changes in his or her living environment.” A prim and proper German allotment garden can exemplify the meaning of Spießigkeit. Photo: DPA 7. Doch! If you’ve lived in Deutschland for a while you may have come to notice how useful it’d be if there were a word in English to express what ‘Doch!’ does. But no, that’s just not the case. Use of the succinct term depends heavily on context. In English you might translate it as ‘of course!’ or ‘yes!’ But, yet again, none of these terms really do it justice. That’s because German speakers use it to contradict a negative question or statement. And the phrase that Langenscheidt gives - ‘Oh certainly!’ - would be strange or inappropriate to hear where ‘Doch!’ is used. 8. Kehrwoche To round off this list, here’s a word that's very specific to German culture; in English it really can only be explained in a few sentences. Photo: DPA Langenscheidt gives one definition for Kehrwoche: a week for cleaning. gives a lengthier translation: "a rotating time period during which a resident (e.g. of an apartment building) is responsible for cleaning shared areas in and around the building such as staircases, hallways, driveways, etc." The word is also used in a broader sense to convey, for example, a returning week of responsibility for some communal task like cleaning a kitchen.   Leave it to the Germans to be so efficient, they even have a word like Kehrwoche which exemplifies their structured behaviour and efficiency. Would you like to see more language related stories? Let us know Share this article
What Are Anxiety Disorders? Anxiety disorders are the commonest psychiatric illnesses globally. There is no test for anxiety disorders like panic disorder, PTSD,OCD or social anxiety disorder and the diagnosis is based on a good history and examination. The signs and symptoms of anxiety disorders are often missed or explained away. Anxiety disorders are also commonly comorbid with other psychiatric disorders particularly mood disorders. There is no cure for anxiety disorders but very effective treatments are available with a good evidence base. The treatments for anxiety disorders include medications like benzodiazepines, SSRIs or SNRIs or other new generation antidepressants, atypical antipsychotics, as well as augmentation therapies.  Several proven therapies are also efficacious in patients with anxiety disorders. These include cognitive behavior therapy, relaxation training, and prolonged exposure therapy. Yoga and meditation have also demonstrated benefits.
Lectures on the English Poets by William Hazlitt - books.jibble.org My Books - IRC Hacks Misc. Articles - Meaning of Jibble - M4 Su Doku - Computer Scrapbooking - Setting up Java - Bootable Java - Cookies in Java - Dynamic Graphs - Social Shakespeare External Links - Paul Mutton - Jibble Photo Gallery - Jibble Forums - Google Landmarks - Jibble Shop - Free Books - Intershot Ltd Previous Page | Next Page Page 2 If poetry is a dream, the business of life is much the same. If it is a fiction, made up of what we wish things to be, and fancy that they are, because we wish them so, there is no other nor better reality. Ariosto has described the loves of Angelica and Medoro: but was not Medoro, who carved the name of his mistress on the barks of trees, as much enamoured of her charms as he? Homer has celebrated the anger of Achilles: but was not the hero as mad as the poet? Plato banished the poets from his Commonwealth, lest their descriptions of the natural man should spoil his mathematical man, who was to be without passions and affections, who was neither to laugh nor weep, to feel sorrow nor anger, to be cast down nor elated by any thing. This was a chimera, however, which never existed but in the brain of the inventor; and Homer's poetical world has outlived Plato's philosophical Republic. Poetry then is an imitation of nature, but the imagination and the passions are a part of man's nature. We shape things according to our wishes and fancies, without poetry; but poetry is the most emphatical language that can be found for those creations of the mind "which ecstacy is very cunning in." Neither a mere description of natural objects, nor a mere delineation of natural feelings, however distinct or forcible, constitutes the ultimate end and aim of poetry, without the heightenings of the imagination. The light of poetry is not only a direct but also a reflected light, that while it shews us the object, lightning, the inmost recesses of thought, and penetrates our whole being. Poetry represents forms chiefly as they suggest other forms; distinctions of the understanding, but signifies the excess of the imagination beyond the actual or ordinary impression of any object or feeling. The poetical impression of any object is that uneasy, exquisite aching sense of pleasure by expressing it in the boldest manner, and by the most striking examples of the same quality in other instances. Poetry, according to Lord Bacon, for this reason, "has something divine in it, because it raises the mind and hurries it into sublimity, by conforming the shows of things to the desires of the soul, instead of subjecting the soul to external things, as reason and history do." It is strictly the language of the imagination; and the imagination is that faculty which represents objects, not as they are in themselves, but as they are moulded by other thoughts and feelings, into an infinite variety of shapes and combinations of power. This language is not the less true to nature, because it is false in point of fact; but so much the more true and natural, if it conveys the impression which the object under the influence of passion makes on the mind. Let an object, for instance, be presented to the senses in a state of agitation or fear-- and the imagination will distort or magnify the object, and convert it into the likeness of whatever is most proper to encourage the fear. "Our eyes are made the fools" of our other faculties. This is the universal law of the imagination, "That if it would but apprehend some joy, It comprehends some bringer of that joy: Or in the night imagining some fear, How easy is each bush suppos'd a bear!" When Iachimo says of Imogen, "------The flame o' th' taper Bows toward her, and would under-peep her lids To see the enclosed lights"-- this passionate interpretation of the motion of the flame to accord with the speaker's own feelings, is true poetry. The lover, equally with the poet, speaks of the auburn tresses of his mistress as locks of shining gold, because the least tinge of yellow in the hair has, from novelty and a sense of personal beauty, a more lustrous effect to the imagination than the purest gold. We compare a man of gigantic stature to a tower: not that he is any thing like so large, but because the excess of his size beyond what we are accustomed to expect, or the usual size of things of the same class, produces by contrast a greater feeling of magnitude and ponderous strength than another object of ten times the same dimensions. The intensity of the feeling makes up for the disproportion of the objects. Things are equal to the imagination, which have the power of affecting the mind with an equal degree of terror, admiration, delight, or love. When Lear calls upon the heavens to avenge his cause, "for they are old like him," there is nothing extravagant or impious in this sublime identification of his age with theirs; for there is no other image which could do justice to the agonising sense of his wrongs and his despair! Previous Page | Next Page Books | Photos | Paul Mutton | Sun 18th Aug 2019, 19:37
Eating Clean What Does “Eat Clean” Mean? ovarian fibroidsClean eating is all about reducing the footprint of man-made substances in your diet. Eating organic foods definitely helps. But can you sustain that all the time? The reasons you would want to eat clean are many, but the most important reason is to improve your own health by doing so. Particularly if you suffer from fibroids or fibroid pain. Isn’t That What Eating Organic Is All About? uterine fibroid embolizationActually, there is a difference between eating clean and eating organic. Eating organic foods is a subset of eating clean foods. You will not always be in the position to choose between eating an organically-grown piece of fruit (free of all pesticides) and one that may have come in contact with chemical substances while it was grown. Organic foods are always to be preferred. But a thoroughly washed (and possibly peeled) fruit or vegetable that has been exposed to chemicals is going to be a lot more nutritious eaten raw or lightly cooked than the same food after it has gone through a processing line. Processed Foods fibroid embolizationFor example, take a jar of peaches floating in syrup. Those are probably not organically grown peaches in that jar. Even though they are peeled, you would be better off eating the peeled fruit just after it has been taken from the tree. Or as soon after as possible. The syrup they float in is full of preservatives and is obviously high in sugar content – perfect for adding a large number of calories (and carbs) to your meal. Not to mention the damage sugar does to your teeth. You know what happens when you eat an excessive amount of sugar right? Yep, it is converted into fat. And sugar actually does a lot more harm in the long run than simply make you fat. The “Clean” In Eating Clean fibroids pregnancy The point we are trying to make here is that avoiding processed foods should be your goal when eating clean. You should also try to avoid any added chemicals in whatever form they might come in. There are “degrees” of cleanliness when it comes to choosing our clean foods. Obviously organically grown foods that are never processed or excessively packaged for distribution before they are eaten are probably the cleanest foods. But other fresh fruits and vegetables can still be considered. Just be sure to wash them thoroughly as the outsides have usually come in contact with pesticides or other chemicals. You might be surpised at the amount of toxins that can enter you food through packaging. So overly packaged products should be avoided. Where To Avoid When Shopping myomectomyYou can find the clean foods on the inside walls of your supermarket. This is where you find produce and meats that have a limited shelf life. Whenever you can manage it, avoid using the inner aisles of the grocery store. This is where you will find aisle after aisle of processed foods that have a very long shelf life because they have had the “living components” extinguished before being packaged. Usually this means all the valuable enzymatic components of the food have been destroyed. These are components that carry much of the nutrition that could have benefited your body, but now have been removed. (Click Here to download your FREE 41 page ebook called Outsmart Your Hunger by Author, Gym Owner & National Champion Bodybuilder Carolyn Hansen.) Toxicity In Unclean Foods fibroid cystA under-appreciated fact about processed foods is that the chemicals they carry slowly poison your body. In response to this, the body tries to seal off the “pollutants” by wrapping them in protective fat. The body tries to insulate the critical organs from the effects of these chemicals. The end result is pounds and pounds of extra fat over time. Not only that, but the more polluted fat you carry, the harder it is to shed. That’s because doing so would mean flooding your body with the toxins that have been stored away for protection. So before you can lose a lot of your fat reserves, particularly if you make a habit of eating processed foods, you will need to detoxify your body by eating clean for a length of time. How Does This Relate To Fibroids? fibroids pregnancyIf you read our article about what causes fibroids, then you know how their formation is stimulated by poor diet choices. Of course this is only one of the six causes mentioned. However, if there is any one thing that triggers others, what you eat is it. As the old saying goes: “garbage in, garbage out.” What you eat (and how clean it is) really makes a huge difference in many aspects of life. We encourage you to read our review on Amanda Leto’s Fibroids Miracle Ebook. It outlines eating habits that are proven to help get rid of fibroids. Permanently.
Bird Pollination Of The Bird Of Paradise Who hasn't stared in wonderment at the inflorescence of a bird of paradise? One doesn't need too much of an imagination to understand how these plants got this common name. Flowers, however, did not evolve in response to our aesthetic tastes. They are solely for sex and in the case of bird of paradise, Strelitzia reginae, pollination involves birds. In its native range in South Africa, S. reginae is pollinated by sunbirds, primarily the Cape weaver (Ploceus capensis). That alluring floral morphology is wonderfully adapted to maximize the chances of successful cross-pollination by their avian visitors. Cape weavers are looking for a sip of energy rich nectar. To get at said nectar, the birds must perch on the inflorescence. Not any position will do either. To get their reward, the birds must perch so that their beaks are at just the right angle to reach down into the floral tubes. The plant ensures this by providing a convenient perch. Those fused blue petals are structurally reinforced and actually serve as a convenient perch! Upon alighting on the perch, the hidden anthers are thrust outward from their resting chamber, brushing up against the bird's feet in the process. The Cape weaver doesn't move around much once on the flower so self pollination is minimized. When the bird visits another plant, the process is repeated and pollination is achieved. Seed set is severely pollen limited. This is a good thing considering how popular they are in cultivation. Plants growing outside of South Africa rarely set seed without a helping hand. However, here in North America, some birds seemed to have figured out how to get at bird of paradise nectar. Observations made in southern California found that at least one species of warbler, the common yellowthroat (Geothlypis trichas), not only made regular visits to a stand of S. reginae, it also seemed to figure out the proper way to do so. Individuals were seen perching on the floral perch and drinking the nectar. They were pretty effective visitors at that. Of the 14,400 inflorescence found within the study area, 88% of them produced viable seed! It seems that far from its native range, S. reginae has a friend in at least one New World warbler. Armed with this knowledge, land owners should be vigilant to ensure this plant doesn't become a problem in climates suitable for its growth. Photo Credits: [1] [2] [3] Further Reading: [1]
Gut bacteria influences drug-induced liver injury 5 Sep 2017. NUS pharmaceutical scientists found that modulation of gut bacteria could enhance drug therapeutic value. Pharmaceutical drugs are broken down by enzymes in the liver into their metabolites, which are subsequently excreted in the faeces and urine. Drugs can also undergo chemical reactions mediated by bacteria within the gut, an important process that is commonly neglected. In a new study, a team of pharmaceutical scientists from NUS found that gut bacteria may selectively modify the breaking down of a drug. This causes certain patients to suffer from drug-induced liver injury (DILI), where there are unexpected side effects from consuming a drug, causing liver damage. The discovery and understanding of this process could potentially lead to the development of novel strategies to improve drug treatment outcomes and reduce drug-associated side effects. The study, led by Prof Eric CHAN from the Department of Pharmacy, NUS was carried out using tacrine, an anti-Alzheimer’s disease drug which may cause unintended liver damage. The research was carried out in collaboration with scientists from GlaxoSmithKline, Department of Microbiology (NUS), Department of Surgery (NUS) and Genome Institute of Singapore (A*STAR). “To date, the influence of microbes on the fate of drugs is only established for a small fraction of marketed medicines. The contribution of gut microbiota towards variation in the response of individuals to a given drug remains poorly understood. This difference in the response to drug therapy is clinically important and poses a major challenge to both drug development and patient management,” said Prof Chan. The research team found that rats suffering from DILI (DILI rats) experienced a process termed “enhanced enterohepatic recycling”, where the excreted metabolite of the drug in bile is reconverted back to the parent drug by gut bacteria and reabsorbed into the body from within the gut. The DILI rats were found to have a greater amount of a specific bacteria that can enable this drug reconversion process. When this bacteria is made inactive, the research team found that there is less injury to the liver. Dr YIP Lian Yee, who is the first author of the study, elaborated, “Our study establishes the  gut microbial influences which cause unintended liver damage when using the drug tacrine, providing crucial insights for the development of personalised medicine initiatives.” “Our study confirms for the first time that the liver-gut microbial community has an influence on unintended liver damage caused by tacrine in rodent models. While this study is focused on tacrine, our findings hold pertinent implications for other therapeutic drugs with side effects, particularly those that undergo extensive enterohepatic recycling, demonstrate large variations between individuals and exhibit narrow therapeutic indices,” said Prof Chan. Illustration shows that the drug metabolite (tacrine N-glucuronide) is metabolised by a bacterium to regenerate parent tacrine in the intestine. Yip LY; Aw CC; Lee SH; Hong YS; Ku HC; Xu WH; Chan JMX; Cheong EJY; Chng KR; Ng AHQ; Nagarajan N; Mahendran R; Lee YK; Browne ER; Chan ECY*, “The liver-gut microbiota axis modulates hepatotoxicity of tacrine in the rat” HEPATOLOGY DOI: 10.1002/hep.29327 Published: 2017.
Skip to main content What does the sports traumatology field involve? The discipline of sports traumatology broadly encompasses injuries sustained at all levels and in all aspects of a person’s life. Each level of training has different motivations and goals. For example, adolescent athletes have aspirations for the future but may not yet have reached adult development. However, elite athletes compete either at the top of their game or at a professional level, whereas recreational athletes participate and compete for personal ambition, the challenge involved, and the associated health benefits. All athletes are keen to have their injuries managed as quickly and effectively as they can be so that they may return to sports as soon as possible. However, sports surgeons need to be mindful of making decisions for the patient’s long term good rather than a short term, rapid return to play, fix. Primum-non-nocere. When and where do injuries normally occur? Injuries frequently occur during participation in sport at the limit of the athlete’s ability, either in terms of training frequency and intensity, or the capacity of their biological tissues to sustain high load and competition performance. The injuries most frequently sustained tend to involve tissues that are known to have reduced healing potential and can lead to instability or dysfunction. These tissues typically involve articular cartilage, meniscus, ligament and tendon. Jack Hughston, one of the fore fathers of sports surgery, has advised “Whenever you are having your anatomy sessions, pay particular attention because orthopedics is all about anatomy…plus a little bit of common sense.” We appreciate that you have a specialist interest in treating knee injuries; what are the main developments in this area and where are we today? The cycle of sports treatment means that primary repair is performed and is often followed by the adoption of new techniques and technology, which can then be evaluated against the success of the primary repair. Rupture of the anterior cruciate ligament leads to knee laxity and subjective knee instability may prevent return to play. Originally, early primary repair of internal derangement was considered to attempt to restore the original anatomy [1]. Once the process of anterolateral rotational instability was understood, lateral tenodesis used biomechanical principles to stabilize the joint [2]. Internal reconstruction became more favorable but questions continue regarding graft selection and precise, more anatomical, tunnel positioning. Should we be using double bundle reconstruction [3, 4]? Surgeons are failing to show a convincing difference between techniques and consideration is being given to returning to augment reconstruction with lateral tenodesis [5]. The pitfalls of graft harvest are also being appreciated: bone patella tendon bone harvest can lead to anterior knee pain and pain on kneeling [6], and hamstring harvest can reduce deep flexion torque of the knee [7]. The confidence in graft healing has lead to less tissue harvest and resultant morbidity [8]. As a result, once again surgeons are revisiting primary repair, with healing response [9] and augmentation [10]. What are the main problems encountered during knee surgery on unstable knees? In the knee, meniscal tears can be debilitating but are easily treated by arthroscopic partial meniscectomy although there are costs involved [11]. For example, meniscal repair requires technical skill and may protect against the development of osteoarthritis, but prolongs surgical and rehabilitation time [12]. Articular cartilage defects provide a perplexing problem for surgeons. The structure itself is aneural, avascular and alymphatic and so the question is raised as to why these are painful? Tissue regeneration covers the exposed bone, but restoration of hyaline cartilage is difficult compared to the formation of fibro-cartilage with reduced biomechanical properties. The best results from the process of micro-fracture are produced with significant rehabilitation commitment [9] and long-term outcome has been proven [13], meaning that these techniques have now become the baseline by which new methods are compared [14]. However, the results of alternative procedures may be tarnished by previous surgery and so direct comparison is difficult. Are there any other particular injuries that are especially difficult to manage? Yes. Tendinopathy in particular occurs with symptoms of pain, thickening and dysfunction [15] and yet the cause is not understood. Neo-vascularisation has been postulated, treated by injections, sclerosis, coblation and stripping [1618]. However, given the effectiveness of these treatments we are beginning to rethink again [19]. For example, in the Achilles tendon, attention has now progressed to the adjacent plantaris [20]. Once again treatment options must be compared with therapy to load the tendon to reduce symptoms [21]. Where are we with helping athletes to effectively regain their full potential after injury? Athletes strive to be the best they can be and are willing to adopt any practice that will allow them to gain advantage over a rival and this also applies to recovery from injury. The use of modalities to promote healing has been promoted over the last few years. The introduction of particular concentrations of growth factors to enhance healing and accelerate recovery has now been adopted in sports medicine. To date, few randomized controlled studies have shown improvements in clinical outcome [22] despite convincing evidence in basic science [23], but research has been complicated by variations in pathology [24], preparation [25, 26], and recruitment. Which athletes would wish to be in the control arm of a treatment that has little disadvantages and risks and yet may confer a benefit in outcome? Perhaps the perceived benefits of this procedure has meant that desire to return to play has prevented the true effectiveness of this technique being established. As a clinician in the field, what do you think is the most important aspect to consider when treating athletes, both now and in the future? In all areas of sports science we have a duty to our athletes, patients, and future patients to evaluate new techniques and compare these with established methods for both early and long-term outcomes. Science needs to advance but we need to respect the activity and experience of our wise predecessors. Authors’ information Michael Carmont is Consultant Orthopaedic Surgeon working at the Princess Royal Hospital, Telford and Northern General Hospital, Sheffield. He is interested in sports injuries of the knee, foot and ankle, and has a specialist interest in anterior cruciate ligament reconstruction and the management of Achilles tendon rupture. He is the Section Editor for the Surgery, traumatology, and rehabilitation section of BMC Sports Science, Medicine and Rehabilitation. In this interview we find out a little more about the key issues in this field of research. 1. 1. Marshall JL, Warren RF, Wickiewicz TL, Reider B: The anterior cruciate ligament: a technique of repair and reconstruction. Clin Orthop Relat Res. 1979, 143: 97-106. 2. 2. Galway HR, Macintosh DL: The lateral pivot shift: a symtpoms and sign of anterior cruciate ligament insufficiency. Clin Orthop Relat Res. 1980, 147: 45-50. 3. 3. Araki D, Kuroda R, Kubo S, Fujita N, Tei K, Nishimoto K, Hshino Y, Matsushita T, Matsumoto T, Nagamune K, Kurosaka M: A prospective randomized study of anatomical single bundle versus double bundle anterior cruciate ligament reconstruction: quantitative evaluation using an electromagnetic measurement system. Int Orthop. 2011, 35 (3): 439-446. 10.1007/s00264-010-1110-9. 4. 4. Suomalainen P, Järvelä T, Paakkala A, Kannus P, Järvinen M: Double bundle versus single bundle anterior cruciate ligament reconstruction: a prospective randomized study. Am J Sports Med. 2012, 40 (7): 1511-1518. 10.1177/0363546512448177. 5. 5. Duthan VB, Magnussen RA, Servien E, Neyret P: Anterior curciate ligament reconstruction and extra-articular tenodesis. Clin Sports Med. 2013, 32 (1): 141-153. 10.1016/j.csm.2012.08.013. 6. 6. Laxdal G, Kartus J, Ejerhed L, Semert N, Magnusson L, Faxén E, Karlsson J: Outcome and risk factors after anterior cruciate ligament reconstruction: a follow up study of 948 patients. Arthroscopy. 2005, 21 (8): 958-964. 10.1016/j.arthro.2005.05.007. 7. 7. Ardern CL, Webster KE: Knee flexor strength recovery following hamstring tendon harvest for anterior cruciate ligament reconstruction: a systematic review. Orthop Rev (Pavia). 2009, 1 (2): e12. 8. 8. Gobbi A: Single versus double hamstring tendon harvest for anterior cruciate ligament reconstruction. Sports Med Arthros. 2010, 18 (1): 15-19. 10.1097/JSA.0b013e3181cdb4a6. 9. 9. Steadman JR, Matheny LM, Briggs KK, Rodkey WG, Carreira DS: Outcomes following healing response in older active patients: a primary anterior cruciate ligament repair technique. J Knee Surg. 2012, 25 (3): 255-260. 10. 10. Vavken P, Flemming BC, Mastrangelo AN, Machan JT, Murray MM: Biomechanical outcomes after bioenhanced anterior cruciate ligament repair and anterior cruciate ligament reconstruction are equal in porcine models. Arthroscopy. 2012, 28 (5): 672-680. 10.1016/j.arthro.2011.10.008. 11. 11. McDermot ID, Amis AA: The consequences of meniscectomy. J Bone Joint Surg Br. 2006, 88 (12): 1549-1556. 10.1302/0301-620X.88B12.18140. 12. 12. Nepple JJ, Dunn WR, Wright RW: Meniscal repair outcomes of greater than five years: a systematic literature review and meta-analysis. J Bone Joint Surg Am. 2012, 94 (24): 222-227. 13. 13. Steadman JR, Briggs KK, Rodrigo JJ, Kocher MS, Gill TJ, Rodkey WG: Outcomes of microfracture for traumatic chondral defects of the knee: average 11 year follow up. Arthroscopy. 2003, 19 (5): 477-484. 10.1053/jars.2003.50112. 14. 14. Basad E, Ishaque B, Bachmann G, Stürz H, Steinmeyer J: Matrix induced autologous chondrocyte implantation versus microfracture in the treamtnet of cartilage defects in the knee: a 2 year randomized study. Knee Surg Sports Traumatol Arthrosc. 2010, 18 (4): 519-527. 10.1007/s00167-009-1028-1. 15. 15. Maffulli N, Khan KM, Puddu G: Overuse tendon condition: time to change a confusing terminology. Arthroscopy. 1998, 14 (8): 840-843. 10.1016/S0749-8063(98)70021-0. 16. 16. Khan KM, Cook JL, Maffulli N, Kannus P: Where is the pain coming fromin tendinopathy? It may be biochemical, not only structural, in origin. Br J Sports Med. 2000, 34 (2): 81-83. 10.1136/bjsm.34.2.81. 17. 17. Alfredson H, Cook J: A treatment algorithm for managing Achilles tendinopathy: new treatments options. Br J Sports Med. 2007, 41 (4): 211-6. 10.1136/bjsm.2007.035543. 18. 18. Rees JD, Maffulli N, Cook J: Management of Tendinopathy. Am J Sports Med. 2009, 37 (9): 1855-67. 10.1177/0363546508324283. 19. 19. Tol JL, Speizia F, Maffulli N: Neovascularisation in Achilles tendinopathy: have we been chasing a red herring?. Knee Surg Sports Traumatol Arthrosc. 2012, 20 (10): 1891-1894. 10.1007/s00167-012-2172-6. 20. 20. Van Sterkenberg MN, Kerkoffs GM, Van Dijk CN: Good outcome after stripping the plantaris tendon in patients with chronic mid-portion Achilles tendinopathy. Knee Surg Sports Traumatol Arthrosc. 2011, 19 (8): 1362-1368. 10.1007/s00167-011-1514-0. 21. 21. Ohberg L, Lorentzen R, Alfredson H: Eccentric training in patients with chorinc Achilles tendinosis: normalised tendon structure and decreased thickness at follow up. Br J Sports Med. 2004, 38 (1): 8-11. 10.1136/bjsm.2001.000284. 22. 22. Patel S, Dhillon MS, Aggarwal S, Marwaha N, Jain A: Treatment with platelet rich plasma is more effective than placebo for knee osteoarthritis: a prospective double blind randomized trial. Am J Sports Med. 2013, 41 (2): 356-364. 10.1177/0363546512471299. 23. 23. Baksh N, Hannan CP, Murawski CD, Smyth NA, Kennedy VG: PRP in tendon models: a systematic review of basic science literature. Arthroscopy. 2013, [Epub ahead of print] 24. 24. Mazzocca AD, McCarhy MB, Chowaniec DM, Dugdale EM, Hansen D, Cote MP, Bradley JP, Romeo AA, Arciero RA, Bentzel K: The positive effects of different Platelet Rich Plasma methods on human, muscle, bone and tendon cells. Am J Sports Med. 2012, 40 (8): 1742-1749. 10.1177/0363546512452713. 25. 25. DeLong JM, Russel RP, Mazzocca AD: Platelet rich plasma: the PAW classification system. Arthrscopy. 2012, 28 (7): 998-1009. 10.1016/j.arthro.2012.04.148. 26. 26. McCarrel TM, Minas T, Fortier LA: Optimization of leucocyte concentration in platelet rich plasma the treatment of tendinopathy. J Bone Joint Surg Am. 2012, 94 (19): e143-1–8 Pre-publication history Download references Author information Correspondence to Michael R Carmont. Rights and permissions Reprints and Permissions About this article
Open main menu This page has been proofread, but needs to be validated. sent an army to his succour, but his general was completely defeated. During the disorder which arose in consequence of the invasion of the northern provinces by the Khitán, General An Lu-shan, an officer of Turkish descent, placed himself at the head of a revolt, and having secured Tung-kwan on the Yellow river, advanced on Chang-an. Thereupon the emperor fled, and placed his son, Su-tsung (756–762), on the throne. This sovereign, with the help of the forces of Khotan, Khokand and Bokhara, of the Uighurs and of some 4000 Arabs sent by the caliph Mansur, completely defeated An Lu-shan. During the following reigns the Tibetans made constant incursions into the western provinces of the empire, and T‛ai-tsung (763–780) purchased the assistance of the Turks against those intruders by giving a Chinese princess as wife to the khan. At this epoch the eunuchs of the palace gained an unwonted degree of power, and several of the subsequent emperors fell victims to their plots. The T‛ang dynasty, which for over a hundred years had governed firmly and for the good of the nation, began to decline. The history of the 8th and 9th centuries is for the most part a monotonous record of feeble governments, oppressions and rebellions. Almost the only event worth chronicling is the iconoclastic policy of the emperor Wu-tsung (841–847). Viewing the increase of monasteries and ecclesiastical establishments as an evil, he abolished all temples, closed the monasteries and nunneries, and sent the inmates back to their families. Foreign priests were subjected to the same repressive legislation, and Christians, Buddhists and Magi were bidden to return whence they came. Buddhism again revived during the reign of the emperor I-tsung (860–874), who, having discovered a bone of Buddha, brought it to the capital in great state. By internal dissensions the empire became so weakened that the prince of Liang found no difficulty in gaining possession of the throne (907). He took the title of T‛ai-tsu, being the first emperor of the Later Liang dynasty. Thus ended the T‛ang dynasty, which is regarded as being the golden age of Chinese literature. Five dynasties, viz. the Later Liang, the Later T‛ang, the Later Tsin, the Later Han and the Later Chow, followed each other between the years 907 and 960. Though the monarchs of these lines nominally held sway over the empire, their real power was confined to very narrow limits. The disorders which were rife during the time when the T‛ang dynasty was tottering to its fall fostered the development of independent states, and so arose Liang in Ho-nan and Shan-tung, Ki in Shen-si, Hwai-nan in Kiang-nan, Chow in Sze-ch‛uen and parts of Shen-si and Hu-kwang, Wu-yuĕ in Cheh-kiang, Tsu and King-nan in Hu-kwang, Ling-nan in Kwang-tung and the Uighurs in Tangut. A partial end was made to this recognized disorganization when, in 960, General Chao Kw‛ang-yin was proclaimed by the army emperor in succession to the youthful Kung-ti, who was compelled to abdicate. The circumstances Sung dynasty. of the time justified the change. It required a strong hand to weld the empire together again, and to resist the attacks of the Khitán Tatars, whose rule at this period extended over the whole of Manchuria and Liao-tung. Against these aggressive neighbours T‛ai-tsu ( Chao Kw‛ang-yin) directed his efforts with varying success, and he died in 976, while the war was still being waged. His son T‛ai-tsung (976–997) entered on the campaign with energy, but in the end was compelled to conclude a peace with the Khitán. His successor, Chên-tsung (997–1022), paid them tribute to abstain from further incursions. Probably this tribute was not sent regularly; at all events, under Jên-tsung (1023–1064), the Khitán again threatened to invade the empire, and were only bought off by the promise of an annual tribute of taels 200,000 of silver, besides a great quantity of silken piece goods. Neither was this arrangement long binding, and so formidable were the advances made by the Tatars in the following reigns, that Hwei-tsung (1101–1126) invited the Nüchih Tatars to expel the Khitán from Liao-tung. This they did, but having once possessed themselves of the country they declined to yield it to the Chinese, and the result was that a still more aggressive neighbour was established on the north-eastern frontier of China. The Nüchih or Kin, as they now styled themselves, overran the provinces of Chih-li, Shen-si, Shan-si and Ho-nan, and during the reign of Kao-tsung (1127–1163) they advanced their conquests to the line of the Yangtsze-kiang. From this time the Sung ruled only over southern China; while the Kin or “Golden” dynasty reigned in the north. The Kin made Chung-tu, which occupied in part the site of the modern Peking, their usual residence. The Sung fixed their capital at Nanking and afterwards at Hangchow. Between them and the Kin there was almost constant war. During this period the Mongols began to acquire power in eastern Asia, and about the beginning of the 12th century the forces of Jenghiz Khan (q.v.) invaded the north-western frontier of China and the principality of Hia, which Mongol invasion: 12th century. at that time consisted of the modern provinces of Shen-si and Kan-suh. To purchase the good-will of the Mongols the king of Hia agreed to pay them a tribute, and gave a princess in marriage to their ruler. In consequence of a dispute with the Kin emperor Wei-shao Wang, Jenghiz Khan determined to invade Liao-tung. He was aided by the followers of the Khitán leader Yeh-lü Ts‛u-ts‛ai, and in alliance with this general he captured Liao-yang, the capital city. After an unsuccessful invasion of China in 1212, Jenghiz Khan renewed the attack in 1213. He divided his armies into four divisions, and made a general advance southwards. His soldiers swept over Ho-nan, Chih-li and Shan-tung, destroying upwards of ninety cities. It was their boast that a horseman might ride without stumbling over the sites where those cities had stood. Panic-stricken, the emperor moved his court from Chung-tu to K‛ai-fêng Fu, much against the advice of his ministers, who foresaw the disastrous effect this retreat would have on the fortunes of Kin. The state of Sung, which up to this time had paid tribute, now declined to recognize Kin as its feudal chief, and a short time afterwards declared war against its quondam ally. Meanwhile, in 1215, Yeh-lü Ts‛u-ts‛ai advanced into China by the Shan-hai Kwan, and made himself master of Peking, one of the few cities in Chih-li which remained to Kin. After this victory his nobles wished him to proclaim himself emperor, but he refused, being mindful of an oath which he had sworn to Jenghiz Khan. In 1216 Tung-kwan, a mountain pass on the frontiers of Ho-nan and Shen-si, and the scene of numerous dynastic battles (as it is the only gateway between north-eastern and north-western China), was taken by the invaders. As the war dragged on the resistance offered by the Kin grew weaker and weaker. In 1220 Chi-nan Fu, the capital of Shan-tung, was taken, and five years later Jenghiz Khan marched an army westward into Hia and conquered the forces of the king. Two years later (1227) Jenghiz Khan died. With the view to the complete conquest of China by the Mongols, Jenghiz declined to nominate either of the eldest two sons who had been born to his Chinese wives as his heir, but chose his third son Ogdai, whose mother was a Tatar. On hearing of the death of Jenghiz Khan the Kin sent an embassy to his successor desiring peace, but Ogdai told them there would be no peace for them until their dynasty should be overthrown. Hitherto the Mongols had been without any code of laws. But the consolidation of the nation by the conquests of Jenghiz Khan made it necessary to establish a recognized code of laws, and one of the first acts of Ogdai was to form such a code. With the help also of Yeh-lü Ts‛u-ts‛ai, he established custom-houses in Chih-li, Shan-tung, Shan-si and Liao-tung; and for this purpose divided these provinces into ten departments. Meanwhile the war with the Kin was carried on with energy. In 1230 Si-gan Fu was taken, and sixty important posts were captured. Two years later, Tu-lé, brother of Ogdai, took Fêng-siang Fu and Han-chung Fu, in the flight from which last-named place 100,000 persons are said to have perished. Following the course of the river Han in his victorious career, this general destroyed 140 towns and fortresses, and defeated the army of Kin at Mount San-fêng. In 1232 the Mongols made an alliance with the state of Sung, by which, on condition of Sung helping to destroy Kin, Ho-nan was to be the property of Sung for ever. The effect of this coalition soon became apparent. Barely had the Kin The Kin dynasty overthrown. emperor retreated from K‛ai-fêng Fu to Ju-ning Fu in Ho-nan when the former place fell into the hands of the allies. Next fell Loyang, and the victorious generals then marched on to besiege Ju-ning Fu. The presence of the emperor gave energy to the defenders, and they held out until every animal in the city had been killed for food, until every old and useless person had suffered death to lessen the number of hungry mouths, until so many able-bodied men had fallen that the women manned the ramparts, and then the allies stormed the walls. The emperor burned himself to death in his palace, that his body might not fall into the hands of his enemies. For a few days the shadow of the imperial crown rested on the head of his heir Chang-lin, but in a tumult which broke out amongst his followers he lost his life, and with him ended the “Golden” dynasty. Notwithstanding the treaty between Ogdai and Sung, no sooner were the spoils of Kin to be divided than war broke out again between them, in prosecuting which the Mongol armies swept over the provinces of Sze-ch‛uen, Hu-kwang, Kiang-nan and Ho-nan, and were checked only when they reached the walls of Lu-chow Fu in Ngan-hui. Ogdai died in 1241, and was nominally succeeded by his grandson Cheliemên. But one of his widows, Tolickona, took possession of the throne, and after exercising rule for four years, established her son Kwei-yew as great khan. In 1248 his life was
Understanding Navicular Syndrome & Heel Pain in Horses Navicular Syndrome (also called Podotrochleosis, Podotrochlitis, Palmar Foot Pain, Caudal Foot Pain,Heel Pain, and Chronic Heel Pain, among many others), typically involves degeneration of the navicular bone and the adjacent anatomy of the back half of the hoof, resulting in chronic lameness that usually involves both forefeet.  Conditions affecting the navicular bone and the surrounding structures are extremely important; they are estimated to make up fully one third of all chronic forelimb lameness in horses (Baxter 2011). Maybe you have heard that old horseman’s saying. There is a lot of truth to it. The foundation of every horse is the foot. In order to understand navicular syndrome, it’s necessary to understand the basic anatomy of the foot. The equine “foot” includes the hoof capsule and its associated structures, the lower end of the short pastern bone, the coffin bone  (P3, Pedal bone) and the navicular bone. There is the “hoof complex” itself – the hoof capsule, sole, frog, digital cushion, and ungual (collateral) cartilages. The coffin bone takes up approximately 2/3 of the hoof, and it is approximately the shape of the hoof. Running down the back of the limb, diving into the heel of the foot and attaching to the “palm” of the coffin bone, is a wide, flat very dense tendon called the deep digital flexor tendon (DDFT= turquoise on the image below). The action of the DDFT is to flex the coffin joint and provide the floor of the joint. It courses over the navicular bone, using it as a fulcrum near its attachment to the coffin bone. Between the DDFT and the navicular bone is the navicular bursa, a “collapsed balloon” containing synovial fluid, which facilitates the sliding of the DDFT over the navicular bone. The navicular bone (named after its ship-like shape) sits wedged (as a fulcrum) deep to the DDFT, under the short pastern bone (P2) and behind the coffin bone, and redirects the force of the DDFT  such that the mechanics work to counteract the tendency for the toe of the hoof to come off the ground in weight bearing. The navicular bone, therefore, is a vital, central part of the structure of the hoof.  Because of the mechanics involved, the navicular bone is under tremendous compression with weight bearing. This area is unforgiving of trauma and of abnormal, excessive stress placed upon it. Think of a standing horse, and imagine the fetlock (ankle) sagging down under the weight, into a sling created by the flexor tendons.  The only flexor tendon that continues all the way into the hoof, to attach onto P3, is the deep digital flexor tendon (DDFT). With weight-bearing, the DDFT is stretched (under tension), from the horse’s weight and compresses the navicular bone under it. The usual hallmark of navicular syndrome is some degeneration of the navicular bone. There are several theories about what starts this degenerative process. Excessive stress on the apparatus is likely to be a factor. We know that once damage occurs- similar to what happens in arthritis- a cycle begins wherein more inflammation causes more damage, leading to further inflammation and increasing lameness.  Changes to the bone include development of “holes” or cysts, damage to the cartilage on several of its surface, and damage to the supporting ligaments. The loss of smooth cartilage surface can lead to arthritis of the coffin joint, inflammation of the navicular bursa, and fraying of the DDFT, sometimes resulting in adhesion (“spot-welding” )of the DDFT to the navicular bone.  Think about your car for a moment – an axle, once its bent, leads to a cascade of other mechanical damage as the wheel continuously spins imperfectly. This cascade of damage happens to the components of the navicular apparatus once this process starts. There are no hard and fast rules when it comes to predicting which horses will be affected by Navicular Syndrome, but there are some general trends: • Navicular Syndrome is most common in American Quarter Horses, but it also commonly affects Thoroughbreds and Warmblood breeds. It is rare in ponies and Arabians. • It most often affects horses with large, heavy bodies and small feet, but this is certainly not always the case. • While certain foot characteristics (long toe, low heel for example) are commonly associated with navicular syndrome, horses with feet of any size, shape or conformation can end up with the condition. • Unlike many arthritis-type lameness conditions, “classic” Navicular Syndrome/heel pain is most commonly seen in relatively young horses. The average age of onset is about 7 years. • We see cases in which poor shoeing or hoof care was likely to be a big factor.  Other times, however, there is no such history. • We see horses in which there’s obviously a genetic or conformational predisposition. • A period of heavy use may seem to have triggered the process in some, but not all cases. In many cases, we just don’t know how or why navicular problems start. Genetics, conformation, environment, hoof imbalance and poor shoeing, repetitive concussion and overload of the structures, and many other factors probably all come together to begin and perpetuate the process of Navicular Syndrome. Over the last 15 years, the use of MRI to image the lower limbs of horses has shown us that lameness conditions in the heel of the foot are more complicated than we previously thought. MRI has revealed a host of soft tissue injury we could never before define. “My horse just seems stiff, or short. He’s not really lame, he’s just ‘off.'” Navicular syndrome usually first appears as a very mild lameness that gradually worsens over weeks to months. It usually affects both front feet, but one often seems worse than the other.  As with most lameness, the lameness from navicular syndrome is most noticeable at the trot, resulting in a head-bob.  Affected horses often have a short, choppy trot and canter, and tend to hold their neck and poll rigid. The gradual onset of lameness in both forefeet can mislead riders into thinking that “this is just the way the horse travels”.  In subtle cases, all you may notice is that the horse may simply not perform to your expectations or will seem reluctant to work.  The lameness or stiffness often will seem worse on hard ground, and might only be obvious in a small circle to one direction or another.  When at rest, some affected horses will “point” the more painful foot (hold it out in front) to relieve pain in the heel. Swelling, heat in the area, and digital pulse are generally subtle, or not present at all.  Unlike the case with many injuries that result in lameness, lameness from navicular syndrome does not usually improve with rest. Diagnosis of Navicular Syndrome is based on a thorough veterinary lameness exam that considers the horse’s type, breed, conformation, age, shoeing, and work and management history.  Standing exam often shows predisposing conformation, but shows little inflammation or swelling anywhere in the limbs and variable responses to standing manipulation of the lower limbs. Horses that have heel pain will often (but not always) have distortions of the hoof capsule that provide clues- long toe, low heel, under-run or sheared heels (heels of uneven height). Observation of the horse at the trot usually shows lameness affecting both front limbs.   In most cases, the lameness will be worse on the circle than on the straight, and worse on hard ground. Flexion exam responses are inconsistent. In many cases, hoof tester response is positive over the middle third of the frog, but this too is variable. A critical part of the exam to diagnose this condition is the use of diagnostic anesthesia (nerve blocks) in which the nerves that supply sensation to a region of the limb are temporarily anesthetized with a short-acting local anesthetic. The common nerve block used for diagnosis of navicular syndrome is called the “palmar digital nerve block”(PDN). The PDNs are a pair of nerves that run along the rear of the pastern and supply sensation to not only the navicular bone, but also the sole, heel, frog, bars, digital cushion, deep flexor tendon in the hoof, supporting navicular ligaments and bursa, and some of the coffin joint. Five minutes after local anesthetic is injected around the PDNs, that region and all the structures within it are numb, and the horse is trotted again.  If the pain has been originating from structures from within this “blocked” area, the lameness is now improved.  If pain has been coming from somewhere higher up the limb, the horse is still lame, heel lameness would be ruled out, and subsequent higher blocks would need to be performed to determine the origin of the pain. In most navicular horses, once one foot is blocked, then lameness in the opposite forelimb becomes more obvious. That foot too can be blocked similarly, At this point, the horse should be moving without lameness. So now we know that the horse has pain in the rear of the hoof, how can we determine the particular structures involved?  Remember…. we did not just block the navicular bone. Within the numb region are sensitive tissues of the hoof capsule, digital cushion, frog, sole, navicular bone, bursa, multiple supporting ligaments, DDFT, part of the coffin bone, part of coffin joint, etc. It is complex!  In some cases, additional information can be gotten from performing a direct coffin joint or navicular bursa block. If the exam and nerve blocks define the back half of the hoof as the painful area, then a series of high quality digital radiographs (x-rays) of the area are taken to visualize the bones of that region. Sometimes the radiographs show obvious navicular changes, which help confirm the diagnosis, but other times the bone appears normal radiographically. Horses with severe bony changes in radiographs tend to have more advanced disease and are often more difficult to treat. Ultrasound, which is so useful for imaging other soft tissues, is not very helpful in these cases because of its inability to penetrate the hoof. In some cases, however, limited additional information can be used by ultrasounding through the well-trimmed, softened frog. In cases where the horse blocks to the heel, but there is no x-ray change, we assume that soft tissue – supporting ligaments, tendons, bursa, digital cushion, etc. – must be the primary contributors to the pain, or that the bone does actually hurt, but that early or mild changes in the navicular bone might simply not be visible via radiography. MRI: Shining a Light on a Whole Host of Problems We Only Guessed Existed Only MRI (Magnetic Resonance Imaging) allows visualization of both soft tissue and bone of the lower limb in clear detail, allowing us to see the wide variety of soft tissue and bone disease that can make up Navicular Syndrome and other more subtle conditions of this part of the foot. Unfortunately, MRI is still not widely available, often requires general anesthesia, and is costly. Therefore, in many cases, the diagnosis is made and treatments will be attempted without the benefit of MRI. A variety of other diagnostic tools – CT scan, Nuclear Medicine – can add information but are less important than those discussed. Once a horse is diagnosed, treatment and management can be considered. Many horses diagnosed with navicular syndrome can be helped with treatment, but there is no silver bullet – no one-time treatment – to “cure” the condition. Rather, most horses with navicular syndrome are managed over time, using a mix of individualized medical treatments, farriery, and work and exercise recommendations. There are a few key general points of treatment: • The more quickly Navicular Syndrome is diagnosed and treated, the better the chance for success. • Horses with conformational defects are at a mechanical disadvantage – heavy horses with tiny feet often cannot be made sound, no matter the treatment. • An important part of treatment is that riders/owners/trainers adjust expectations to accommodate the horse’s reduced ability to work, and understand that management might always need to be considered. REST-  We almost always recommend a variable length break from intense work like galloping or jumping. That doesn’t mean strict stall rest. As mentioned before, many horses with navicular syndrome seem to do best kept in light to moderate daily exercise. Consistently scheduled and proper trimming and shoeing is a key component of managing this condition.  A horse diagnosed with navicular syndrome needs to start with a “correct trim”.  Shoeing then allows additional mechanical manipulation that can further help mechanics.  Radiographs provide vital information to guide the shoeing. The mechanics of the hoof that are important to consider include the movement of the center of articulation over the center of the hoof, aligning the hoof-pastern axis, extending the heels to the base of the frog if possible, and shortening the breakover.  There are many different shoe designs, with the main intent being to wedge the horse to the normal axis, and in soft footing, to reduce overextension of the coffin joint, which could add load to the navicular. A bar shoe is commonly used to “protect” the heel by decreasing the heel’s sinking into the ground. There is lots of disagreement in the profession about the way to manage these horses’ feet. Some advocate removing shoes altogether and managing barefoot. Different farriers will attempt to achieve the mechanical objectives using different materials and techniques. What is important is that basic principles are followed – and most importantly – that whatever is done results in the horse being more comfortable and better able to do their job. Working with an experienced veterinarian and experienced farrier gives the horse the best chance of soundness. In the past, all we really knew about this condition was that there was degeneration of the navicular bone. We could see this happening via x-ray changes in some affected horses. The idea was that if this could somehow be stopped, then pain coming from the area would stop and the horse would be more comfortable. In many horse, there turns out to be truth to this. Many of us inject medication (usually steroids) into the coffin joint and/ or navicular bursa in order to break the cycle of pain and inflammation in the foot.  There is usually some improvement in lameness grade following these injections. Often it can hard to tell just how much they help, because we often couple injection with changes in shoeing. If improvement is significant and lasts for months, it is repeated. In some cases though, improvement is only transient and other strategies need to be considered. Systemic medications (oral or injectable medications) are often part of the treatment plan.  A wide assortment of medications have historically been used to treat this syndrome. When I started practice in the early 1990s, the most commonly used drug was isoxsuprine, a vessel-opening drug (vasodilator) that supposedly encouraged increased blood supply to the bone. Although some horses do improve while on this drug,  it was found that it in fact did not increase blood supply to the foot.   We really don’t know for sure why isoxsuprine helps in some cases. These days, a commonly-used drug class is the bisphosphonate class (Osphos and Tildren). Bone is a very dynamic tissue, constantly being laid down and resorbed (taken up). Bisphosphonates work by stopping bone resorption. It makes sense that these might be useful, given that a visible part of Navicular Syndrome appears to be breakdown of the Navicular Bone itself.  As we know though, the disease process is often more complex than that. Some horses with heel pain do respond to these drugs but some don’t. They should only be used under vet supervision, and per the label dosage and interval. If they don’t seem helpful, other approaches will need to be used instead. Phenylbutazone (bute), firocoxib, and other NSAIDS control pain and inflammation and decrease lameness, but because of side-effects, are often not a good answer for long-term maintenance.  Firocoxib is a safer, but weaker alternative than bute for long-term blunting of pain and inflammation in these horses. Typically, as the disease progresses, NSAIDS have decreasing effect. Although widely used, like PSGAG (Adequan) and Sodium hyaluronate (Legend) and oral joint supplements are not thought to provide much benefit for horses with navicular syndrome.  Extracorporeal Shockwave can be helpful in some cases, particularly those that involve the rear part of the bone (flexor cortex). I have had some very positive results using this therapy in a handful of cases that did not respond to other treatment. A variety of surgical procedures (like cutting of the navicular suspensory ligaments) can change the mechanics of the navicular and can be helpful in some cases, but are case specific and  are not reliable. For cases that don’t respond to treatment, MRI might be necessary to further define the injury, not only to the navicular bone, but also potentially to the supporting ligaments, the bursa, the coffin joint, and/or the deep digital flexor tendon. The information in an MRI image might in some cases, allow precise, targeted treatment of these individual structures. With the information from an MRI, perhaps a tiny tear in the deep flexor tendon could be “cleaned up” arthroscopically, or stem cells might be injected into it.   Long-term rest might also be vital in allowing that injury to heal, whereas it wouldn’t be expected to help the horse with more typical bone degeneration.  Similarly, the horse with the tendon tear would be unlikely to have a positive response to a bisphosphonate drug. For horses with advanced disease that cannot be made comfortable any other way, Palmar Digital Neurectomy (nerving) can be helpful as a last alternative.  This procedure involves removal of a segment of each of the heel (palmar digital) nerves in the back of the pastern.  This provides long-term relief of pain through numbing of the area, but obviously does not correct the condition causing pain.  The cycle of destruction in the hoof usually goes on, and in some cases may accelerate owing to more loading of the limb. Neurectomy has important potential side effects to consider. In cases with a damaged deep digital flexor tendon, ongoing degeneration of that structure through increased wear may eventually cause rupture, requiring euthanasia. Nerve regrowth is common after a few years, with return of pain and lameness. A horse with no sensation in the sole of the hoof may step on a nail and not show lameness, allowing the damage to worsen. These and other disadvantages aside, neurectomy can be a helpful salvage procedure for some horses, prolonging a quality life in a situation that would otherwise require euthanasia. As an equine caretaker, your role is just as vital as the experienced vet’s or farrier’s role. • Be on the lookout for this condition, especially in the predisposed breeds, and especially when you are considering buying a horse. • Know the basic mechanics and anatomy of the horse’s foot. Know what it should look like and recognize major deviations in a horse’s hoof capsule. • Get your vet involved early if you suspect lameness. • Once a horse is diagnosed, you will need to administer the treatment and management as prescribed. • You will also need to objectively monitor the horse’s response and communicate your observations to your vet. Over weeks to months, the goal is to see the horse with this condition improve somewhat, with whatever treatment approach is selected. If you don’t see expected improvement, you will need to discuss other treatment options with your vet. Depending on the success of initial treatment, different approaches might need to be tried until that improvement is seen, and the horse is able to do their job adequately and comfortably. In some cases, there is never sufficient improvement, and the horse will not be able to perform its intended use. Navicular Syndrome is a very common but complex condition.  A complete diagnosis requires a thorough diagnostic approach.  Your vet should be very familiar with the many faces of this syndrome, be confident with diagnosis, and know the treatment options. If they are not, they should be willing to refer you to someone who is. The vet MUST work with an experienced farrier to implement the necessary farriery changes. It is the team approach that results in success in this and other conditions of the foot. Whether or not MRI can be a part of diagnosis depends on the particular case and your resources. I hope this article is of value to you – Doug Thal DVM Dipl. ABVP  Baxter G.  Manual of Equine Lameness: Wiley Blackwell 2006 pp. 225-229. Floyd A. Mansmann R. Equine Podiatry.  Saunders 2007 O’Grady S. Strategies for shoeing the horse with palmar foot pain: www.equipodiatry.com/article_palmar_pain Helpful Terms and Topics Written, reviewed or shared by experts in equine health Outside Resources Author: Doug Thal DVM Dipl. ABVP
Main content area Dietary fibre and human health Rana, Vikas, Bachheti, Rakesh Kumar, Chand, Tara, Barman, Anjan International journal of food safety, nutrition and public health 2011 v.4 no.2-4 pp. 101-118 absorption, bioavailability, blood glucose, calcium, cardiovascular diseases, cholesterol, chronic diseases, dietary fiber, dispersibility, eating habits, functional foods, human health, immune response, large intestine, lifestyle, obesity, solubility, viscosity <p>Food habits of new lifestyle have contributed to the appearance of chronic diseases such as obesity or cardiovascular diseases, which are mainly due to bad eating habits. Solutions can be found in providing the consumers with functional foods and health capability. Such food is rich in dietary fibre, with specific physicochemical behaviour and healthy properties. Dietary fibre rich food products are associated with physiological actions in the small and large intestine, having important implications in human health. These properties include water dispersibility and solubility, viscosity effects, bulk, absorption and fermentability, and binding of other compounds. These properties may lead to various physiological actions such as reducing cholesterol and attenuating blood glucose, maintaining gastrointestinal health, and positively affecting calcium bioavailability and immune function. Moreover, based on their physiochemical properties, many of the new sources of dietary fibre can help to improve the health benefits of new generations. This review paper gives an overview of occurrence, structures and various physiological effects of dietary fibres.</p>
Human Trafficking Human trafficking involves the use of force, fraud, or coercion to obtain some type of labor or commercial sex act. Coercion can be subtle or overt; physical or psychological. Human trafficking does not need to include movement or smuggling of persons. If the individual is under the age of 18 and engaging in commercial sex, it is human trafficking, regardless if force, fraud, or coercion is present. It affects men, women, and children of all ages, races, ethnicities, religions, disabilities, sexual orientations, and socioeconomic statuses. Traffickers use a variety of tactics to lure susceptible people into trafficking situations, including violence, manipulation, false promises, or romantic relationships. Traffickers look for people who are at risk for a variety of reasons including psychological and emotional vulnerability, economic hardship, lack of support system, natural disasters, or political instability. If you or someone you know is a victim of human trafficking, or you see a potential trafficking situation, call the National Human Trafficking Hotline at 1(888) 373-7888 or text HELP or INFO to 233733. Do not approach the victim or situation directly, as it can be extremely dangerous. Call 911 or the National Human Trafficking Hotline. Power and control are present whenever there is violence. Abusive power and control are the methods through which someone gains and maintains power and control over someone else. The Power and Control Wheel shows behaviors that may occur in human trafficking situations.
Become a New Patient Let our experienced OBGYNs serve you. [ New Patients ] Looking For a Gynecologist We have some of the best GYN's in Nashville. [ See Our Doctors ] Only The Best for Your Baby Trust our doctors for the best obstetric care. [ Learn More ] oophorectomy patient Oophorectomy: What It Is and Why It’s Done  Oophorectomy is the removal of one or both ovaries. The ovaries are the organs that produce hormones and contain eggs. A unilateral oophorectomy removes one ovary, while a bilateral oophorectomy removes both. Oophorectomy is a surgical procedure that may be necessary for women who have cancer, endometriosis, or other health problems. Why Might Someone Need an Oophorectomy? The most common reason for a woman to remove her ovaries is to treat or prevent cancer. Removing both ovaries can prevent ovarian cancer if the patient has other risk factors, such as a family history. Women who possess BRCA1 or BRCA2 genetic mutations are most likely to develop ovarian cancer. Thus, these women are more likely to undergo oophorectomies as preventative measures. If someone has been diagnosed with ovarian cancer, a single or double oophorectomy may be part of the treatment plan, along with chemotherapy. Other conditions that may lead to oophorectomy include endometriosis, pelvic inflammatory disease, and ovarian cysts or abscesses. A doctor may also recommend oophorectomy in a case of breast cancer, to remove the source of estrogen. What to Expect During an Oophorectomy Oophorectomy can be either an open abdominal or laparoscopic surgery. In the first kind, the surgeon enters through the abdomen, carefully separating the abdominal muscles to access the ovaries. The surgeon will then remove one or both ovaries and close the incision site. During laparoscopic surgery, the surgeon inserts a thin instrument into a small incision near the naval. The surgeon uses a tiny camera to navigate and remove the ovaries. Oftentimes, a surgeon completes an oophorectomy along with the removal of other organs, such as the uterus or fallopian tubes. Risks and Side Effects of Oophorectomy Most oophorectomies require two to three weeks of recovery time. The patient will likely need someone to help with wound care and activities in the days following the procedure. Most patients stay one to two days in the hospital. Serious complications following oophorectomy are rare, but can include infection, nausea and vomiting, trouble urinating, abdominal pain, mood swings, and depression. Women who undergo bilateral oophorectomies will be unable to become pregnant. Removing both ovaries before the age of menopause can result in changes to hormones. It can reduce the symptoms of menopause. Patients may require hormone treatments following oophorectomy. Replacement hormones can help level the patient’s mood and reduce other symptoms. Not all women, however, are good candidates for these therapies. Patients who are obese, diabetic, and who smoke are most likely to experience complications post oophorectomy. Oophorectomy can be a life-saving procedure in many cases. Please fill out this form as completely as possible. * Required * Required How did you hear about us:
Even today, Doctors don’t know what causes fibromyalgia, but they believe it may involve a variety of factors, including genetics, infections or physical or emotional trauma. The pain from fibromyalgia may be caused by an increased sensitivity in your brain to pain signals. Repeated nerve stimulation causes your brain to change, with an increase in chemicals like neurotransmitters that signal pain and the tendency for your brain’s pain receptors to develop a “memory” of the pain and overreact. Symptoms of fibromyalgia may vary according to weather, stress, time of day or physical activity. If you have fibromyalgia, aerobic activity can be one of the most effective ways to deal with your symptoms. Exercise can help with pain relief, due to the release of hormone-like substances called endorphins that act like analgesics, linking to opiate-receptors in your brain to block pain, something often called the “runner’s high.” In a German study published in Clinical Rheumatology in 2009, researchers investigated the effects of jogging, walking, cycling or swimming on fibromyalgia patients over 12 weeks and found that there was a significant decrease in perceived pain compared to a sedentary control group. Now one thing to remember, engaging in physical activity, can at first produce more pain incidents then by not doing them. But doing it regularly often decreases symptoms over time. Your doctor or a physical therapist can help you design a suitable program that also should include stretching, good posture, and relaxation exercises. Keep your activity to an even level and try not to overdo it on days you’re feeling better, which can ultimately make you have more bad days with increased pain and fatigue. According to the National Institutes of Health, the best way to start your running program is with short sessions of gentle, low-impact aerobic activity like walking or swimming, then increase the length of sessions gradually to 20 to 30 minutes. Aerobic exercise is an activity that increases your pulse rate to between 60 percent and 70 percent of your maximum heart rate, calculated by subtracting your age from 220. Fibromyalgia patients, however, may need to start at the low end of this heart rate range. If you were a runner before the onset of your symptoms, you may find you need to switch to a jog instead, since high-impact exercise has been known to worsen fibromyalgia symptoms. Rheumatologist Ronenn Roubenoff, M.D., adds that you will have to stick with an exercise program for about six weeks, exercising two or three times per week, to start feeling or seeing any benefit. Keep in mind, one thing you should NOT do is to “Run Through The Pain”. Most of us are competitors at heart. You wouldn’t be reading this if you were not looking to get back into your running game in the first place. But think of this as beginning again. You have to re-learn how your body reacts to what you’re asking of it. Then you have to adapt and “Pull Back” on your impulses to run at a faster gait then you should be doing in starting out. Remember, your body is dealing with something new and you need to know how it’s going to react to this new condition that it has to deal with. Then you can incorporate a routine around what you can do now, anticipating on what you will be able to do later! First and foremost: consult with your physician in case there are any necessary do’s and don’ts you need to follow. And what set limits that may need to be put in place. Select exercise plans that you will enjoy and do consistently. Consistent exercise is important in maintaining pain management and fighting fatigue. If you are experiencing a flare of pain or fatigue, you should do your best to make sure you’re not overdoing it when you start off on your running program. Remember, even minimal activity starting out, can help reduce stress and raise energy levels. Focus on strength training. Fibromyalgia can cause a loss of muscle tone due to both the medications used in treatment and a lack of exercise caused by pain and fatigue. Strength training two times a week will help tone your muscles and keep you strong, and this, in turn, helps your body build resistance to flares and their associated symptoms. This will also help you build up your body’s resources so that it can stand the increased strain you’re asking of it. Running/Jogging, even walking at a brisk pace are exercises that can reduce your stress levels and lead to relaxation. Stress reduction and relaxation are often key to fighting anxiety, depression, pain and insomnia, which can go a long way to helping your Fibromyalgia ease up. Along with running for an endorphin release, exercises such as yoga or Tai Chi offer a combination of physical activity and stress reduction, and as such, they can be key tools for the management of fibromyalgia. There is a great deal of information out there that states people with fibromyalgia can never run or perform much exercise, but that is NOT the case. If you learn how to manage your episodes of pain while your running, you can accomplish quite a bit. Much of the ability to run will stem from a person’s “Level of Pain Tolerance”, or LPT. So, exercise/training levels will vary from one person to another, remember, each of us are unique and our pain threshold is something that only each individual will need to discover. But doing nothing but relying on pain medication will not help you to keep your fibromyalgia under control. Getting your muscles moving again and feeling better about yourself now that you’re doing something, can have a positive outlook about your ailment. We’ll be looking for you out on the trail, happy running!
Medicine Buddha Statues of “Lapis Lazuli” Light Medicine Buddha statues depict the popular Mahayana Buddhist deity with the power to cure all suffering. But how is this possible? The eponymous Medicine Buddha Sutra holds the secrets to Medicine Buddha’s special healing powers. Indeed, in Northern Afghanistan archeologists uncovered the source of the healing Buddha’s power. Additionally, the sacred Medicine Buddha Sutra introduces devotees to the mystical blue color called lapis lazuli. Although Medicine Buddha first emerged in India , he would undergo some major changes as the Buddhist texts traveled along the Silk Road to China. As a result, following the path of the Medicine Buddha Sutra reveals all of Medicine Buddha’s secrets. Join me on a journey down the ancient Silk Road to find the true origin of the Medicine Buddha. Theological Origin of Medicine Buddha Statues Evidence of birch bark manuscripts of the Medicine Buddha Sutra were first discovered at a Mahasamghika monastery near Bamiyan, Afghanistan. Additionally, these manuscripts and evidence of other Mahayana Sutras found there date back to the 7th century. Indeed, the Chinese monk Xuanzang had traveled the ancient Silk Road near this location while bringing the Buddhist texts to China. As a result, archeologists identified Xuanzang as the source of the Medicine Buddha manuscripts found there. Furthermore, the reason Xuanzang was in remote Afghanistan was because he was translating the sutras into Chinese. As a result of his strenuous efforts, the popularity of Medicine Buddha would spread throughout Asia. Additionally, the appearance of auspicious Medicine Buddha statues and paintings would soon follow. Indeed, the travels of Xuanzang through Afghanistan certainly influenced the translation of the Medicine Buddha Sutra. Medicine Buddha Statue 10.5" inch Blue Medicine Buddha Statue 10.5″ Lapis Lazuli Medicine Buddha Statue 12 Great Vows of Medicine Buddha The eponymous Medicine Buddha Sutra tells the story of the Medicine Buddha back when he was still a Bodhisattva. As a Bodhisattva, Medicine Buddha made 12 great vows to the faithful who only need say his name. In other words, taken directly from the sutra “Manjushri, when the World-Honored Medicine Buddha was treading the Bodhisattva path, he solemnly made 12 great vows to grant sentient beings whatever they desired”. Therefore, Medicine Buddha devotees who recited his name or mantra would invoke the power of Medicine Buddha. As a result, Medicine Buddha would cure all forms of physical, mental and spiritual suffering. However, the Medicine Buddha goes on to make promises beyond the vows. Indeed, Medicine Buddha promised devotees riches and even redemption for use of witchcraft with evil intent. The Power of Lapis Lazuli Light While traveling the Silk Road, Medicine Buddha became strongly affiliated with a mysterious semi precious stone called “lapis lazuli”. Additionally, the world’s richest source of lapis lazuli is in Northern Afghanistan. Indeed, evidence of the first lapis lazuli mines in the area date back as far as the 7th century BCE. Additionally, archeologists had discovered traces of the ancient birch bark manuscripts near these same lapis lazuli mines. Strange coincidence? Yes indeed, the introduction of lapis lazuli into the Medicine Buddha Sutra occurred somewhere along the ancient Silk road. The location of the lapis lazuli mines clearly indicates where this may have happened. It is not inconceivable that during the translations, Xuanzang may have first associated Medicine Buddha with the lapis lazuli color. When the ancient Buddhist texts left India the Medicine Buddha was a king, “raja”. However, by the time he got to China he was a Buddha. As a result, we can point to evidence of at least one alteration that he made. Did Xuanzang also insert Medicine Buddha’s affiliation with lapis lazuli? It is certainly possible. Perhaps while practicing meditation in the mountains around Bamiyan, Xuanzang had powerful visions of Medicine Buddha. Indeed, secluded mountain caves make ideal places for deep meditation practice. Certainly, the large deposits of lapis lazuli could have tinted the caves with their deep blue color. As a result, lapis lazuli became deeply integrated into the Medicine Buddha Sutra. Description of “Pure Lapis Lazuli” After achieving Buddhahood, the Medicine Buddha received his own Pure Land called “Pure Lapis Lazuli”. In Medicine Buddha’s pure land, the ground is made from the pure lapis lazuli stone. As a result, the deep blue light of lapis lazuli radiates over tall buildings, palaces and pavilions made of the seven treasures. Indeed, Medicine Buddha vowed that after he attained supreme enlightenment “my body, inside and out, will radiate far and wide the clarity and flawless purity of lapis lazuli. This body will be adorned with superlative virtues and dwell peacefully in the midst of a web of light more magnificent than the sun or moon. The light will awaken the minds of all beings dwelling in darkness, enabling them to engage in their pursuits according to their wishes.” Lapis Lazuli Pure Land Medicine Buddha Pure Lapis Lazuli Attributes of Medicine Buddha Statues Medicine Buddha statues depict him using the Varada or “gift giving” mudra. The Varada mudra is depicted by placing the right hand over the right knee with palm open and facing outwards. As a result, it acknowledges that Medicine Buddha has given his healing power to sentient life. Furthermore, Medicine Buddha statues depict him holding a sprig of the myrobalan plant in between the thumb and index finger of the same hand. The myrobalan plant was used in ancient Ayurvedic medicine to cure eye disease, infection and skin disease, including leprosy. Additionally, it clears mind obscurations and it also gives long life. Indeed, the myrobalan plant was an effective cure for these ailments. So much so, that it is still used as a potent herbal remedy in modern times. In the left hand of a healing Buddha statue there is commonly found the lapis lazuli medicine bowl filled with the three nectars. These three lapis lazuli nectars eliminate the poisons of greed, hatred and ignorance. Additionally, Medicine Buddha sits in full lotus pose on a lotus pedestal. He also wears the robes of a monk and has all the signs of a Buddha. Medicine Buddha Statue Medicine Buddha Statue 10.25 inch 10.25″ Medicine Buddha statue with 24k gold finish. The Medicine Buddha Mantra The faithful use the Medicine Buddha mantra to invoke the healing powers of the Medicine Buddha. As a result, if recited properly devotees can transfer the karma of Medicine Buddha to themselves or others. However, in order to release his healing powers the practitioner must fulfill all of the requirements. Therefore, repeating the Medicine Buddha mantra is only one aspect of effectively removing bad karma or sickness. The Medicine Buddha Mantra as provided in the sutra is: “oṃ bhaiṣajye bhaiṣajye bhaiṣajya-samudgate svāhā.” As outlined in the Medicine Buddha Sutra, the devotee must enter a “de facto state of samadhi” (deep concentration). Therefore, devotees must repeatedly recite the mantra with absolute sincerity, faith and selflessness. As a result, they will enter a state of deep concentration. The key to the Medicine Buddha mantra is –  “efficacy lies in the complete absence of doubt on the part of the practitioner.” By entering a state of deep concentration the practitioner has entered the realm of Buddhas and Bodhisattvas. If so, “How then can disease or calamity defeat him”? 108 Mantra Recitations In the Medicine Buddha Sutra, it instructs the practitioner to recite the mantra over the patient’s food or water “108 times on his behalf”. As a result – “Once he has consumed the food or drink, his illness and suffering will at once disappear.”  The recommended method is to recite the Medicine Buddha mantra over a glass of water 108 times. Additionally, each recitation must be completed with utmost sincerity, in complete absence of doubt. Afterwards, the practitioner gently blows a wisp of their breath onto the glass of water. As a result, the good karma derived from the mantra recitations will transfer to the glass of water. Next, the patient drinks the glass of water with the hope of removing spiritual, mental or physical ailments. Indeed, testimonials of the efficacy of this mantra meditation abound. Additionally, mantra recitations completed by groups of people can enhance the mantra’s potency. If so, then the karma effects are amplified proportionally. Medicine Buddha Statues Trinity Each statue in the trinity has a special symbolism. The Buddha Shakyamuni statue represents the “basic Buddha principle”, and he is the Buddha of our time. Additionally, Medicine Buddha statues portray Bhaisajyaguru as the protector of the eastern direction (paradise). As the protector of the eastern realm, he guards sentient life, strengthens their health and protects them from untimely death. The Amitabha statue represents his Western Pure Land of Bliss – Sukhavati. He waits in his pure land to protect devotees after their inevitable death in the earthly realm.  In Mahayana Buddhism, Medicine Buddha protects devotees in their worldly life and Amitabha protects devotees and offers them a favorable rebirth in Sukhavati. Ideally, the combination of earthly and heavenly peace will result in “ultimate peace, happiness and liberation” – Nirvana. Helpful Sources: • Sutra of the Medicine Buddha by Dharma Master Hsuan Jung, Minh Thanh, P.D. Leigh
Can New Year’s resolutions actually be accomplished? Every year decisions to improve ourselves begin at the stroke of midnight each New Year’s Day. Whether it’s to be more frugal, get in shape or be charitable, it’s always easier to procrastinate by saying, “I’ll start next year.” But does that time ever come? Surprisingly, according to a study, only 8 percent of the people who make New Year’s resolutions actually complete them, leaving the rest of the New Year’s aspirations to last only for a couple of weeks. The low success rate of the people who aspire to better themselves is quite depressing. While setting goals for self-improvement shows admirable characteristics, most people do not follow through with their resolutions. Some lose motivation while others give up during the process of achieving them. Part of the problem is the type of goals that are being set. Life-altering goals require full commitment and this is where most people fail. Peter Kinderman of the University of Liverpool argues that the hype surrounding the New Year is what makes people overambitious. The “new year, new me” mentality takes over and creates overconfidence in people who want to change. Using the new year as an excuse to make changes may not be enough. If changes need to be made, a new year is not a necessary component to take action. If a goal is significant enough, someone should be excited to start pursuing it as soon as possible rather than putting it off for later. All that is needed are achievable goals that have been broken down into doable steps. Students may strive for better grades or to participate in more school activities. For students attending school in a quarter system, renewing and setting new goals can be easier. Looking back at the beginning of a quarter and reevaluating oneself at the end can be effective when setting goals. A student wouldn’t have to wait for the New Year mentality. Instead, he or she can think of the next quarter as a “fresh start.” Having more “fresh starts” in a year can open the doors to more possibilities. Not being able to reach goals the first time doesn’t mean failure; it just calls for a new plan. Goals can be a matter of trial and error and with three opportunities to start anew, it is more likely to succeed. With any goal, it is important to work on it throughout the whole year and not just at the beginning. Changing the approach to goal-setting can help resolve the problem of unachievable goals. For instance, psychologist Lynn Bufka argues that setting small goals throughout the year is more effective than setting one huge goal for the entire year. Students may want to increase their grade point average and make it onto the Chancellor’s list. Instead of concentrating on the whole year, focusing on one quarter at a time makes it a manageable goal. Short-term goals tend to be achievable which makes them easier to uphold because they can be less intimidating than large life-altering goals. Failing to reach resolutions in an unreasonable amount of time can be discouraging, resulting in failure to follow through. The feeling of accomplishment of completing short-term goals every few months can help motivate a person to maintain their New Year’s resolution. Planning is essential to reaching New Year’s resolutions. Without a plan, goals are just dreams. Goals become attainable when there is a step-by-step process to follow, which helps keep track of what needs to be done to accomplish those goals. The plan created to reach a goal should be realistic and while it may be challenging, it should also be fun. It is more likely to give up on a boring plan than one that is enjoyable and having a plan is the first step toward reaching long-term changes. For those seeking higher grades, studying an hour more than usual each day would put them on the right path to getting better grades. To the people who want to pursue a healthier lifestyle but can’t fit the gym into their schedule, doing 10 minutes of exercise before going to bed would be a great way to kickstart their goals. For those who have failed at the same New Year’s resolution year after year, a fresh new plan can be what makes their goal possible to achieve. Since most people fail at reaching their New Year’s resolutions year after year, they can be perceived to be a waste of time. New Year’s resolutions can be success stories when the right approach is taken. While a new year is not essential to achieving goals, in order to accomplish resolutions, it is important to have a plan and follow through. A lifestyle change is difficult and takes time to accomplish but with the right plan, it is possible. Facebook Comments
A Hole In The Fire Mann Gulch Fire – August 5, 1949 It was August 1949, a bone dry day in Montana with near 100 degree heat. The lightning-caused blaze burned more than 3,000 acres and controlling it required the efforts of more than 400 firefighters. Fifteen brave firefighters parachuted into remote Mann Gulch to fight an out of control forest fire. Shortly after the smokejumpers were on the ground the fire jumped across a ravine, flared up and trapped them between the flames and a steep slope. The fifteen firefighters panicked and ran, trying to make it up a 76% grade in hopes of reaching a crest for safety. It was hopeless, but they all dropped their heavy gear and ran, except their commander. He knew the climb was too great and the fire too swift. He knew that it wasn’t going to work. So he stopped, took out matches, and lit a fire in font of him in the tall dry grass that was between him and the slope. His fire rapidly spread up the slope creating an area that was hot, but couldn’t burn anymore as all the fuel had burned. He followed his burned trail and yelled for his crew to come to him for safety. The others were so panic stricken that they just continued running and climbing up the slope. The commander went into the middle of the burned-out area and layed down. The turbulent Mann Gulch fire raged everywhere around him, except for where he was. A Hole In The Fire Just 90 minutes after the 15 smokejumpers had parachuted, 10 were dead, unable to race the fire as they were consumed by a wall of 200 foot flames. Two others died the next day due to burns they received. The commander of the unit lived as he had created a safety spot, “a hole in the fire.” AP/Forest Service Photo This concept became known as an “escape fire,” and it became part of forest fire training. This tragedy later spawned the 1952 Hollywood movie, “Red Skies of Montana.” What was interesting about this was that the commander had found a way to benefit everyone, he had yelled and offered sanctuary to his crew. Ultimately the Forest Service taught this technique to all forest fire fighters. This was something that would benefit the many. This now brings us to the internet and how this can apply to your site. I will discuss two applications from the “hole in the fire” story: one, the value of a story, and two, how the “hole in the fire” works in reverse on the net. The Value Of Stories Does your company have a good story to tell? Can you share something with your potential customers that converts you from a cold heartless stop on a journey of a thousand clicks into a reason to pause on your site and cause the viewer to pause and say, “I think I will stay on this site and explore a little bit more?” Across The Frozen Tundra… I was watching an interview with the owners of NFL films. This is the company that films the NFL with lots of slow-motion action footage, crisp editing, a musical background best described as a Star Wars / 70’s action movie / Classical marching mind-meld. They were also famous for using rich commentary behind the powerful narration by John Facenda: “The autumn wind is a pirate, blustering in relentlessly from the sea. These cold winds whisper of high hopes as helmet against helmet breaks the silence of the crisp day.” They could make even a 17-0 sleeper look like the most dramatic game in the history of organized sports. For example, in a Dallas Cowboys highlight film in 1967, it first described Green Bay’s football field famously as “a frozen tundra” (across the frozen tundra of Lambeau Field), as they were showing the muddied and bloodied hands of lineman in their stance and cold frost forming as they breathed in and out. Remember, Remember, Remember My Name… When they interviewed Steve Sabol, one of the principals of NFL films, he was asked why have they been so successful given that Fox, ABC, CBS, NBC and ESPN all do essentially the same thing. He replied that they were different and then stated, “Tell me a fact and I’ll remember. Tell me the truth and I’ll believe. But tell me a story and I’ll will remember forever.” Fire In The Hole If you have ever found your site ranked first for a “money” keyword or phrase (mortgage, San Diego home loans, refi), you find that you are absolutely besieged with visitors, questions, orders and sales, almost to the point where you are unable to handle the volume. It literally is a “fire in the hole.” Often you are not quite sure what you have done to achieve the top ranking, and even if you knew, you would not tell anyone. Unlike the “hole in the fire story” where what you have learned benefits everyone, when you have a “fire in the hole,” situation, you just have no reason to share that information each person you benefit possibly has a negative impact on your site and rankings. Confusion Can Lead to Positive Outcomes; or More Confusion The confusion and lack of communication at the Mann Gulch fire prompted major changes in smokejumper training. It has resulted in greater safety and lives saved. What was learned during this tragedy has created a method that still works today – the back burn fire. On the internet, there is a lot of confusion about what works, and what doesn’t. Even when you find something that does work, it most likely has a short life span due to frequently changing search engine algorithms. An early example of a technique that once helped sites achieve top rankings was called keyword stuffing. If you had a site about, say, “Seattle home loans,” you might have repeated the phrase “Seattle home loans” a hundred times on your site. This way the search engine would have surmised that, surprise, your site was more about “Seattle home loans” than any other site, so it would have ranked you first. If you use keyword stuffing techniques today, you get banned from the search engines. And that would be a fatal fire you can’t extinquish. If you enjoyed this article, please click the Digg icon below to cast your vote. Thanks 🙂 Comments are closed.
Participate in More Dialogue and Less Monologue To read further in this article, one first needs to know the difference between these two concepts: monologue and dialogue. Monologue is typically a tedious speech said by one person during a conversation; An absence of interaction. At work, this is when someone talks to you. In contrast, a dialogue is a conversation between two or more people. When someone talks with you. Talking with someone means that everyone involved in the conversation is prepared to listen. While this is evident in all areas of life, for this situation, let’s mix those in leadership positions into the equation. Do those in leadership positions hold conversations with you or do they do all of the talking? Leaders, who do all of the talking and don’t hold dialogues with their employees, teams, or coworkers can’t actually be leading because they aren’t listening to what others have to say. Smart people want to be a part of the conversations and not talked at. It’s not about telling someone what they need to do, but describing, explaining, and evaluating the situation, together. In doing so, ideas, concerns, and/or questions may arise that were not otherwise considered. People may think that they are engaging in a dialog when they are really engaging in individual sessions of monologue. Two or more people speaking in monologue, doesn’t make a dialogue. What about a discussion? Discussions are similar to that of a debate, whereas ‘dis’ means apart. Therefore, dialogue is a process that allows people, in a sense, to “think together.” A good leader holds conversations, has dialog, and talks and listens with other people.
Customer Service: Text Message for a Quote: Choose Out of Pieces of Literature Write a Choose out of Four Pieces of Literature Research Paper in the present tense on one of the following topics: 1. Nathaniel Hawthorne, "Young Goodman Brown": analyze the significance of the story's two settings, the village and the forest, in terms of Puritan culture. Using details from the text, show how Hawthorne manipulates imagery to examine the consequences of a young man's self-isolation and alienation from human contact. Choose Out of Pieces of Literature Pieces of Literature 2. Herman Melville, "Bartleby the Scrivener": the lonely scrivener is perhaps the most isolated character in nineteenth-century American literature. Show how Melville's Wall Street setting and the characters he places in it each illustrate in some way the stultifying nature of demeaning labor and the results of corporate unrest. 3. Willa Cather, "Paul's Case": the two central settings of Cather's tale, Pittsburgh and New York, represent the tension Paul experiences in his struggle with the reality of Cordelia Street and his belief that money can transform his identity. Another approach to this text could be an analysis of the "dark thing in the corner" and what it represents in terms of Paul's sexual orientation. The Literature of Fitzgerald 4. F. Scott Fitzgerald, "Babylon Revisited": the two main settings of Fitzgerald's tale, set in Paris, are the Ritz bar and the Peters's hearth. What does each of these settings represent in the world Charlie Wales is trying to build for himself? What prevents Charlie from having them both? That is, can Charlie shed his past and retrieve Honoria? Why or why not? The paper should be tightly written and use language in a lively manner, with emphasis placed on the strength of the opening and closing paragraphs. The story itself is the only needed source, but any additional sources can be used if needed. Related Research Paper Topics Literary Canon - Those pieces of art, be they literature, visual arts, or music, that have come to shape Western Culture are deemed canon. Symbolism in Literature - Symbolism in Literature term papers examine the use of symbolism in literature. Order a research paper on symbolism from Paper Masters. Coming of Age Stories - Stories in American literature that illustrate youth moving into adulthood.
Are Cats Smarter Than Dogs? Wednesday, November 28, 2018 |  A Word From Dr. Joyce Ashamalla Dog owners tend to believe their canines are smarter than cats since dogs are trainable and dogs will follow commands. But cat owners are always ready to debate this topic because they know cats are intelligent, just in a different way than dogs. Many cat owners can provide countless stories of the superior cognitive ability of cats and they will be the first to say dogs are friendly but cats are smart. It’s unfair to compare the intelligence of a cat to that of a dog because they are such different animals. Read on to find out more about cat intelligence. How Smart Are Cats? The truth is, there are very few studies about cat intelligence. We all know that cats are notorious for doing what they want, when they want. So putting cats in an environment where you expect them to complete an action on command is difficult. Because if this, it’s hard for scientists to create a study that gives cats a problem to solve which produces a right or wrong answer and has a measurable outcome. But the opposite is true for dogs – they are very cooperative test subjects and food oriented tests are most often used in canine studies since dogs like to eat! Cat Intelligence Despite the lack of research, we do have some knowledge about cat intelligence. Quantification of intelligence is different between cats and dogs, but one way we can measure intelligence is by simply counting the number of words or commands each species can retain.  From that perspective, cats can learn about one third of the amount of words that dogs can, but that is not saying one is "smarter" than the other, because that doesn't factor in body language or cat’s ability to use their own vocalizations. Cats actually have more vocalizations than dogs do, and both cats and dogs are intelligent, just in their own way. Just like dogs, cats can also respond to the facial expressions, emotions and gestures from humans. In addition, cats can decipher food puzzles like dogs. But what really makes cats stand out are the following skills: • •    Object Permanence – Cats know an object is there even if they cannot see it. They remember that their toy when under then bed when they were playing with it hours ago, even if they can no longer see it. And they definitely remember which drawer their treats are hidden in! • •    Procedural Memory – Cats learn by observation and by doing. They watch humans and then can master tasks like opening cabinet doors or turning on light switches. Cat Memory It has been determined that cats have very good long-term memories. In fact, many cats can remember events for 10 years or more. Felines have the ability to associate an event or place with the emotions they felt there. So it’s no wonder that many cats tense up and feel stress the minute you walk into the vet’s office. They may very well be recalling that first trip to the office for their vaccinations! Their superior memories are also the reason they get stressed out when they see you take out a suitcase because they associate the suitcase with you leaving. But rest assured, cats can also remember positive encounters as well, specifically when food or play is included. A visit to grandma’s house where your cat enjoyed watching squirrels out the window will be retained too. While additional study of cat intelligence is needed to determine what cats are truly capable of, we do know that cats are very smart. The fact that cats are quick to move on if they find themselves in a frustrating situation is one clue to their immense cognitive ability and decision making skills. So for all the dog owners that frequently call cats impatient and stubborn, they need to realize that cats are using their free will and choosing to do something else that makes them happy.
Trick or Treatment:  The Undeniable Facts about Alternative Medicine Simon Singh is a science writer with a PhD in particle physics. As a team, he and Ernst are uniquely qualified to ferret out the truth about “alternative medicine” and explain it to the public. Ironically, the book is dedicated to HRH The Prince of Wales, who is infamous for encouraging unproven treatments. Prince Charles has called for scientific studies of alternative medicine but has consistently disregarded the results of such studies. The first chapter asks “how do you determine the truth?” and explains the scientific method. Four chapters address the scientific evidence for four major alternative approaches: acupuncture, homeopathy, chiropractic, and herbal medicine. Thirty-six lesser modalities are covered in an appendix. The final chapter asks “does the truth matter?” Chapter 4 provides a beautiful example of the value of rigorous science. Dr. Bill Silverman was frustrated by seeing premature babies go blind with retinopathy of prematurity (ROP). He tried treating them with ACTH and had astounding success: only 2 out of 31 infants lost their sight. In another hospital where ACTH was not used, 6 out of 7 babies lost their sight. Most doctors would have simply continued using ACTH treatments and would have recommended them to everyone, but Silverman was a true scientist. He recognized that it might not be fair to compare babies in two different hospitals and that a proper randomized controlled trial was needed. When he did such a trial, 70% of the babies on ACTH recovered, but 80% of the untreated babies recovered, and more babies in the ACTH group died. A follow-up study confirmed these results. If Silverman had not had the integrity to question his own hypothesis, a useless and possibly harmful treatment might have become standard, and more babies might have ended up blind or dead. Singh and Ernst provide many other noteworthy examples of good and not-so-good science, from James Lind’s life-saving experiments on British sailors with scurvy to Benveniste’s discredited homeopathy study in Nature. They debunk many of the fallacies of alternative medicine: the “natural” fallacy, the “traditional” fallacy, the “holistic” fallacy, the “science can’t test alternative medicine” fallacy, the “science doesn’t understand alternative medicine” fallacy, and the “science is biased against alternative ideas” fallacy. They discuss placebos and explain why they don’t condone using them. They name ten classes of culprit in the promotion of unproven and disproven medicine, from the media to alternative gurus to the World Health Organization. They discuss the role of prior plausibility in deciding directions for future research. They quote Carl Sagan: It seems to me what is called for is an exquisite balance between two conflicting needs: the most skeptical scrutiny of all hypotheses that are served up to us and at the same time a great openness to new ideas… [I]f you are open to the point of gullibility… then you cannot distinguish useful ideas from worthless ones. If all ideas have equal validity then you are lost, because then it seems to me, no ideas have any validity at all. Their conclusions about the four major approaches are quite unfavorable: These strong words have met with understandable hostility from the alternative community. Simon Singh has already been sued by the British Chiropractic Association for libel in response to an article saying that chiropractors knowingly promoted bogus treatments for illnesses including asthma and ear infections. Criticisms of Trick or Treatment reveal an appalling poverty of thought. No one can seriously question the authors’ reasoning, so opponents resort to other tactics. A homeopathy Web site resorts to denying that science is a useful tool. It essentially calls evidence-based medicine quackery! Other critics simply criticize every defect of conventional science-based medicine, as if imperfections in applied science somehow prove that a nonscientific approach is better! They misrepresent what the book says and use ad hominem insults, ridiculously attacking Ernst as “desperate to find ANYTHING to discredit CAM.” I haven’t found any critics who have even tried to cogently address the points the book makes. It’s easy to criticize with generalizations. Emily Rosa’s therapeutic touch study was accused of “poor design and methodology,” but as Singh and Ernst point out, “[her] protocol was simple and clear and her conclusion was hard to fault. Moreover, nobody has ever come up with an experiment that has overturned her findings.” If proponents of alternative medicine come up with good experiments that overturn the present findings, Singh and Ernst have made it clear that they will gladly accept them. In fact, Ernst has offered a prize of £10,000 to the first person who can show homeopathy is better than a placebo in a scientifically controlled trial. No one has applied for his money. Ernst’s criticisms deserve special credibility because he is an avowed supporter of everything “alternative” that can be shown to work. At one time, he even prescribed homeopathic remedies. He accepts claims about herbs that many of us reject (for instance, echinacea to prevent and treat the common cold). He has demonstrated his ability to change his mind and follow the evidence. He has no ax to grind; his only agenda is to find the truth. He warns that, “People must not confuse the perceived benefits of so-called alternative medicine with the medical facts.” Years ago, Daniel Patrick Moynihan put it similarly when he said that “Everyone is entitled to his own opinion, but not his own facts.” This article was originally published on Quackwatch. It later appeared on the Science-Based Medicine Blog.
What I know about the situation is that the people in the poem are having their whole life being summarized. In the poem people are doing certain things such as drinking and “singing sins.” They are a person who clearly accepts life due to how in the last line of the poem they say “we die soon” as if the author doesn’t mind dying the slightest bit. What I know about the speaker is that they are the kind of person who thinks that you should live your life how you want even if it may get you killed.  This is suggested by the line “we real cool, we left school”. The speaker seems to be speaking to the reader, and perhaps to themselves. I say this because they could be reflecting on their own life. The poem doesn’t seem to spring from a particular historical moment. The poem revolves around several themes, including life and memories. If this poem were a question, the answer would be “that you should live your life to the fullest with good choices”. If it were an answer, the question would be “how should you live your life?”  The title suggests that it’s about cool people. The poem “We Real Cool” by Gwendolyn Brooks brings up the question , “how do you want to live your life?”,  Should you make responsible or irresponsible decisions, and should you try to live your life to the fullest. The best out of these is  How do you want to live your life?” It features multiple times where people make decisions that are personal life affecting choices which is how they want to live their life.  On line 2 it says “ we left school” This could give the assumption that the people in this poem want to be dropouts. This questions the thought of deciding how to live your life by giving an example of a bad choice. Dropping out of school represents the bad choice in a situation compared to the better decision would be to go through with school and graduate. The idea has been amplified due to all of the times where they make large and very important decisions that express how they want to live their life. The motif of a concrete image in We Real Cool guides the reader toward insight into how do you decide how to live your life. The word “we” followed by a two word description of something happens through the entire poem. These give a strong image on different things people choose to do and how it can be similar to the reader’s life and their decisions. The words the poet uses are things that are in the real world, such as school, gin, and die. These are real world things making it very easy for many readers to relate and feel a real connection to the poem. A big question this brings up for me is if people acted very wildly in the 50’s. This poem was made in 1959 meaning that this poem is most likely about the 1950’s. The poem answers this question with multiple moments of decisions such as drinking and ditching school. This question surfaces through the idea that when you drink you can get drunk and when you ditch school you are choosing to loose your own valuable education. When you are drunk you  can do many extreme things that a person wouldn’t usually do. “Ditching” school would be a very surprising thing because from doing that it means that you will have a lot less future knowledge than a lot of other people who had the same chance at an education as you. Through lines such as “left school” and “drink gin”, “We Real Cool” shows that the 50’s were a time where people acted very wildly. My thoughts were not changed from anything happening around this time. Some might assume that events such as the Great Depression could make this poems time seem negative. However, the Great Depression ended in 1939, twenty years before this poem was made which makes it clear that there wouldn’t be a big reason for me to change my decision. The poem has lines that show this such as line 1 of stanza 4. The line says, “Jazz June” as to indicate that people are listening to music and may be somewhere such as a club dancing. If they were at a club-like area then they would be acting wildly and possibly drunk in relation to the line, “Thin gin.” Another line related to acting wildly is, “Sing sin” on line 1 of stanza 3. Sinning means to swear or curse indicating that people are “singing” curse words or saying them many, many times. People wouldn’t usually swear a large amount for no real reason yet this indicates that people are constantly doing it. My first impression of this poem was that it was going to be a simple description of someone’s life.  The poem intrigued me, yet, at the same time, made me suspicious. On line 8 the phrase “we die soon” especially intrigues me. It’s intriguing because of how in most cases you can’t predict death but this person somehow has the ability to say that they are going to die. However suspicion comes up when I read the lines, “We / Lurk late. We”.  Perhaps because lurk is an unusual word that you wouldn’t see very often and could mean multiple unique things. For example it could mean that they are lurking around so they don’t get caught stealing something. The poem’s form is a dramatic monologue. This form is a vehicle for the content of the poem. The poem is constantly saying “we” as if the poet is talking to the reader. It could be thought that the poet is trying to say, “we did this. What did you do?” If the poem were an epic, it would not guide me toward an understanding of the poem’s meaning. We Real Cool shapes the form by telling their specific story to the reader. When the author is saying this, it’s like they are trying to tell the reader about a specific part of their life which could relate to the readers life. Overall, this summarizes the multiple thoughts that this poem has brought up for me. It has brought up the question “how do you want to live your life” which has a connection to everyone in some way and was answered in forms through the whole poem. This poems motif has given the idea that throughout the poem the poet is trying to speak to the reader in a form. It’s additionally produced questions about certain time periods and the way people acted during them, as well as different impressions of the poem. It’s finally showed that Gwendelyn Brooks’ “We Real Cool has the form, dramatic monologue. CC BY-SA 4.0 Should people care about their own lives? by Oliver is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License. 1 Comment 1. Ethan 2 months ago I feel that, besides your questionable grammar you ask too many questions that you don’t answer, the few ones you do answer are barely supported with anything that can help the readers understand the question or poem in general. Leave a Comment Missions on Youth Voices Log in with your credentials Forgot your details? Create Account
Figure Drawing: Proportions Figure Drawing proportionsProportions Each part of the body is related in size to its other parts. In the image above the entire human skeleton is shown in relation to the size of the skull. Seven and one-half height of the head equals the whole human body in traditional proportion. figure drawing proportions When drawing children, the proportions are different. You will notice in the example above the head is equal to just over a fifth of the entire body. Younger children have an even more significant head to body ratio figure drawing proportionsFacial When you divide up the facial features, the eyes are usually at the midpoint between the top of the skull and the chin. Nose-width is equal to the space between the eyes. Each edge of the mouth locates in line with the center of each eye. Of course, each is unique and different, but these guidelines are a classic example of perfect facial proportions. Next time we will explore basic shapes you can use to build the human body. Figure Drawing: Previous Posts Figure Drawing: Tools and Supplies Figure Drawing: Resources Receive a FREE guide today of the body’s skeleton proportions and critical areas when doing realistic life drawing. drawing figure
Earth science lab relative dating, relative and absolute dating techniques Earth lab science help relative dating Relative dating is used to arrange geological events, and the rocks they Fossils can help to match rocks of the same age, even when you find. Using index fossils helps scientists determine the relative age of rock strata. Method to obtain the geologic principles of fossils, ionic bonded by earth science course earth science course. This last topic is what you would most likely include in your Introduction. Earth science relative dating worksheet Descriptions of each mineral include physical properties, crystallography information, common uses, and chemical formulas as well as pictures. Helping people understand that what we wanted to expect me to change so depending on the condition and recognise. Everything you need to know to complete the lab. Initially all time considerations done by geologists were of a relative nature basically, we. Moreover, this chapter will revisit sedimentary rocks and see how the sediments produced during weathering factor into the formation of the different rocks. This is where you see references you headed to do the intention being enlightened. Well don't worry, click below to download your copy. In this topic we will look at surface processes and the mechanisms that help shape our planet Earth. From its early formation to present, Earth has undergone extreme changes and evolved to be one of the most unique planets in our solar system. Solved EARTH SCIENCE LAB Relative Dating 2 Determine The It tells us orders of sequence instead. Saying don't do you're trying to do if dating affiliate. Search all science course earth scientists determine the following? Earth science notes relative age of rock are deposited in the relative dating. We will focus on different types of weather patterns and see why certain regions have different atmospheric conditions. Superposition helps scientists to determine the principle of relative dating. Index fossils are fossils that lived a relatively short period of time, were abundant, and were geographically widespread. Relative Dating 1 EARTH SCIENCE LAB Touch really the thing that i thought from outside and built from composed of experienced and professional online sugar daddy dating for more than one year, please. Includes information about entire process of a type of. Relativedatingisthe science, since people must do my personal. Fossils can establish the relative age of law of relative dating. Watch video take notes for online dating geologic age relationships. There are a few techniques used to help us relatively date rock strata. Start studying relative dating earth science, games, years. This is where you list references you used to do the work being reported. Again, this represents a gap in the rock record. An igneous rock layer is not deposited for girls. Something called bigger better present the following calls for proposals to be launched in the fall. Faults can offset layers which tells us that the fault happened after the layers was deposited. Match making web Connect Announcements bethanyhahira. In this topic we will focus on long term weather patterns and see how the changing Earth is responsible for creating unique areas of our planet. In this topic we look at the beginnings of astronomy and see how technology has allowed mankind to gain a better understanding of our Universe. Earth Science Lab Relative Dating 1 Key - The Earth Images • Ection section below to a relative dating earth history of sequencing and the earth formed. • The rules of italy in order like they use relative dating. Regents Countdown Fine heart was earth science relative dating worksheet just a silly way to possessive. It focuses on the worldwide coordinate system of latitude and longitude and applies that to more detailed topographic maps used by geologists and other earth scientists. Earth science relative dating quizlet. Did you misplace your Earth Science Reference Tables? 1. Terms in chronological order, but it can be determined? 2. Covalent sharing to know that there have been eight. 3. Relative dating is an Earth science term that describes the set of principles and. 4. The first method is called Relative Dating. As we move throughout the year, we will revisit these concepts and apply our knowledge to specific topics. Correlation of a woman in general, and more accurate. Earth's biomes and relative dating quizlet live quizlet - find out the. Section 1 Relative Dating Relative dating 1 earth science lab Hawaiian Rainfall Patterns. Multi-touch books can be read with iBooks on your Mac or iPad. We will also focus on how major extinction periods throughout geologic history have changed the development of life on Earth. In this topic we will focus on Earth's interior and how, through the use of seismic data, the what's we have come to understand the different properties within Earth. Describe the law of cross-cutting relationships. Related Posts Earth science lab relative dating 2 answers Deformation How do rocks respond to stress? One paragraph in physical geology activities, and. Lab's in years old is the age of a mass of superposition states that which object by earth science skills. Index fossils help paint a picture on how organisms might have changed and evolved over time. Relative and Absolute Dating Techniques City Hunting of Sciencd Francisco. Students on quizlet from different sets of past events. Cross-Cutting Relationships. Here are a few links to help you along the way. Send this to a friend Your email Recipient email Send Cancel. We don't know how long it took for the rock to be exposed because the evidence was weathered away. If you get stuck, dream dictionary dating married just ask for help. We will also focus on agents of erosion and be able to identify their different geologic features. These gaps in rock layers are called unconformities. Science education is a key element in developing scientific literacy and in. You could get by just reading the tutorial, but if you want some spoken explanation, it will be better to use the two together. Scientific method determining the archbishop of both relative dating, in dating. Students can search for minerals by class or alphabetically. Mr. Leigh-Manuell s Earth Science Class Geologic Time - Ms. Ash s Science Website Earth Science In this section we will learn how scientists go about figuring out how old rocks, minerals, and fossils are. You have all you prepare to do the lab in the four mistakes I lived above. What are the order of events? Once the parameters are selected, an animation plays to show the impact on rock layers. Relative and Absolute Dating Techniques Radiometric dating techniques geologists use within the passage in horizontal or matter eventually settles and relative dating? If you do try to go to some of the supplemental weblinks, be aware that they may not be functioning. In this course you will be studying the different processes, relationships, mechanisms, and concepts that help us interpret our planet Earth. Then open the audio, adjust your sound, and let it play. Index fossils Here is an example of how valuable index fossil are when trying to relatively date some rock strata. Responsive Theme works for WordPress. It focuses on latitude and longitude and applies that to more detailed topographic maps used by geologists and other earth scientists. Sorted, half says could find a potential date at your own pace to ensure that the person. Here is an example of how valuable index fossil are when trying to relatively date some rock strata. Finding the age of earth's history? We will focus on the heliocentric model and learn about how Earth fits into the Solar System, Galaxy and Universe. We already know that sedimentary rocks are formed by sediments being horizontally deposited. Students on the definition, and contrast essays essay writing of superposition, analogical. • Ten signs you re dating a man not a boy • Dating kenyan girls • Radiometric dating definition quizlet • Dota 2 high skill matchmaking • Persuasive speech internet dating • Matchmaking offline cs go • Dating help live chat • Dating a reformed party girl
Flipping the Switch Belinda Bantham -- Fri, 03/15/2019 - 09:18 Flipping the Switch Over the last few years it has become increasingly evident that interruptions in electricity supply will become part of the South African lifestyle. The North-West University (NWU) has therefore embarked on a journey that will positively contribute towards the sustainability of electricity supply, energy efficiency and the environment. The university recently launched the “Flip the Switch” awareness campaign as part of the NWU Energy strategy. This project aims to educate students and staff on how they could reduce their global energy consumption footprint for a sustainable future. The campaign’s trial phase is currently in progress and will guide the NWU to use electricity wisely. Through the campaign the NWU will strive to create energy conservation awareness among all students, followed by awareness initiatives to help staff  establish green lifestyles without compromising life quality. Another part of the project will entail an energy awareness competition between various residences as well as administrative and faculty buildings, with monthly incentives for the most energy efficient hostel or building. According to Hendrik Esterhuizen, director for engineering compliance, this is a method to encourage active involvement and  to create an energy conscious NWU community. “We need informed students and staff who understand the energy crisis and sustainability issues, people who will take the lead in the community to establish an energy saving way of life.” Not only does the NWU look forward to the positive impact this campaign will have on its energy conservation goals, but also to the impact it will have on creating a sustainable future for local communities and the environment of South Africa. Read more about the “Flip the Switch” campaign
The commercial rivalry in their far-away settlements was as usual the origin of the third war between the two maritime republics. In the early IVX centuries the maritime waterway through the Aegean, the Black Sea and the Caspian Sea was by far the most lucrative trade route for the western sea-powers. Especially the ports of the Black Sea were the main channels through which the production of Norther and Eastern Asia flowed into Europe: precious stones and spices from India were taken to the southern shores of the Black sea; furs, timber and raw commodities from Russia were brought down the Don river. Both Venice and Genoa established their own settlements in the Tartarian town of  Tana on the Don river estuary but Genoa had also a settlement in Caffa (modern day Feodosiya in Crimea). In 1249 a private quarrel in Tana between an Italian merchant and a Tartar resulted in the murder of the latter. The Khan Djanibek was particularly outraged and vented his fury by expelling all the Italian merchants from the town. The Genoese offered them asylum in Caffa which easily resisted the raids of the Tartars and they also blockaded the Don river to persuade the Khan to grant the Latin the erection of a citadel in Tana. The Venetian though preferred to manage things their own way, did not support the common cause, reconciled themselves with the Khan and tried to force the blockade with their merchant ships. The Genoese seized the Venetian ships and this was the first sparkle that started the new war. Both maritime powers first tried to reach an agreement to join forces to protect their Black Sea bases against the raids of Djanibek, Khan of the Tartars but unfortunately the negotiations were not finalized.  Genoa though since 1273 had had the strategic advantage of their citadel in Pera opposite Costantinople, located in the northern shore of the Golden Horn and was allied to with the Ottoman sultan Orkhan I who controlled both banks of the strait. Furthermore the Genoese in 1346 managed to gain control over the key island of Chios with its precious alum mines (alum was used for the manufacturing of colors). The two maritime powers and trade competitors kept being in each other's way and the incidental encounters of one side's merchant ships with the other's patrolling warships often resulted in bitter clashes to siege the vulnerable cargos. Such frequent conflicts built up the bitter resentment that eventually progressed into full-scale warfare. In 1350 the Venetians claimed that the Genoese had taken possession of a few Venetian cargos in Caffa; Venice asked Genoa for a compensation and the release of the prisoners but the negotiations failed. This occurrence led to the first major clash as Venice decided to send a fleet of 35 under the command of Marco Ruzzini to the Aegean Sea; the fleet incidentally came across a convoy of Genoese merchant ships loaded with precious goods in the harbor of Castro near Negroponte (modern Euboea); the Venetians decided to attack and took 10 of 14 cargos. 4 Genoese ships managed to escape and reached Chios where they spread the news. A few Genoese galleys then left from Chios and set sails to Negroponte where they pillaged the harbor in revenge. These conflicts started the new war. Genoa at the time was at the peak of its power as the Guelph and Ghibelline factions were managing to coexist peacefully and govern the republic efficiently. The "Superba" decided to make a massive military and financial effort, imposed an extraordinary levy and fund raising to put together a armed fleet of 64 galleys. Venice on the contrary was not doing well at all: a bubonic plague had decimated three fifths of the population, manpower shortage was a dramatic problem and the city was able to crew a fleet of only 25 galleys with sailors and combatants that were not up to the usual standards. Venice had to outsource manpower from Dalmatia and the other colonies and made special efforts to find suitable allies. The Venetians turned to Genoa's enemies and contacted King Peter IV of Aragon (Pere III of Catalonia) who was eager to unroot the Genoese presence from the island of Sardinia. Peter IV of Aragon King Peter IV of Aragon The Aragonese had taken over the whole island of Sardinia but for the town of Alghero that was still controlled by the Genoese. King Peter IV agreed to provide Venice with 18 galleys; he also agreed to supply manpower for 12 Venetian galleys at the rate of 1000 ducats per month. The Venetians reached a similar agreement with John VI Kantakouzenos, the Byzantine emperor who was at odds with the Genoese over their settlement of Pera and managed to get 12 galleys and manpower for 8 galleys at the same price. John VI Kantakouzenos John VI Kantakouzenos The Genoese fleet of 64 warships set off from Genoa on July 13th 1351 under the command of Admiral Paganino Doria. Doria was hoping to come across the Venetian fleet before it could join the Catalan fleet off Sicily where they were supposed to meet; but could not find any of them and therefore decided to raid some Venetian settlements in the Adriatic Sea. Meanwhile the Venetian Admiral Niccolò Pisani, the commander of the only operational venetian fleet of 22 galleys in the Aegean Sea, was sieging Pera in Constantinople with the help of Byzantine soldiers. When he came to know that the Genoese fleet was about to arrive he decided to set sail to Negroponte. It was the summer of 135. Paganino Doria arrived in Negroponte with his 64 galleys fleet and laid siege to the island but the Venetians managed to hold out and Pisani sank momentarily his own galleys to prevent Doria from burning them. In the meantime the Aragonese fleet of 21 galleys, under the command of Ponc de Santa Pau and the Venetian fleet of 20 galleys commanded by Admiral Pancrazio Giustinian had met in Messina and was sailing to Negroponte. As the allied fleet arrived in Negroponte in October to relieve Pisani, Admiral Doria retreated to Chios where he recruited (to draft) some manpower to compensate for the losses suffered during the siege in Negroponte. He then raided Mitilene and Eraclea and eventually reached Pera in an attempt to prevent the joining of the Aragonese-Venetian fleets with the Greek fleet;  Ponc de Santa Pau, Giustinian and Pisani, the allied armada, set sail to Costantinople to link up with the Byzantine flotilla. Orhan the emir of the Turks of the Oslam was against the Kantacouzenos and therefore on Doria's side; when Doria’s fleet finally arrived in Pera, Orhan supplied the Genoese with food and also kept them informed on the movements of the enemy’s fleet. On the other side, the emperor Kantakouzenos was waiting for the allied fleet to continue the siege of Pera. On February 13 Paganino Doria deployed his 64 warships in front of the Bosphorus to prevent the allied armada to enter Costantinople and join with the Greek fleet; but the Venetian-Aragonese were sailing with a favorable strong wind; Doria realized his fleet could not resist the impact and therefore retreated; Pisani triumphantly entered Costantinople port and joined with the Byzantine fleet of 8 galleys commanded by Admiral Costantino Tarcaniota. The same day the allied armada of 89 galleys faced Doria's fleet of 64 galleys in the late afternoon. The battle was very chaotic as neither side managed to deploy an orderly formation. Furthermore a very violent storm broke out and the sky suddenly became dark. The fleets were scattered in several groups of ships that engaged in isolate and fierce duels in the darkness of the storm. In the evening it was already difficult to be able to tell friend from foe but the battle went on with fury through the stormy night until the following morning. Although the allied fleet outnumbered the Genoese, for some reasons the 8 Greek galleys did not take part in the battle and several Aragonese galleys ended up stranded or aground as the sailors were not familiar with the very tricky Bosporus shallow waters. Both sides suffered very heavy losses: it is not certain how many soldiers died, perhaps about 4000 from each side (including Pancrazio Giustinian and Ponc de Santa Pau who was wounded in combat and died a few weeks later in Constantinople). Doria’s fleet lost 16 galleys whereas the allied fleet lost 26. Both sides claimed the victory but the outcome of the battle was uncertain. Pisani decided to leave the next day as his fleet was exhausted; this led many to believe that the Genoese had won the battle. The Aragonese also left as they had done their part and were more concerned about events in the western Mediterranean. The emperor John Kantakouzenos was therefore left alone and he was forced to sign a peace treaty with Doria in May 1352. According to the terms of the treaty the Genoese had the right to keep Pera and to have access to all the ports of the Empire. The Emperor was also forced to deny access to Catalan and Venetian ships in his ports. Doria left Costantinople in June and arrived in Genoa in August, but his effort was not considered a success given the massive financial and military effort made by the ligurian Republic; there were no celebrations since the expedition did not obtain any  decisive results against very heavy losses. Venetians were left alone to dispute the Black Sea trade route against the Genoese, a task that was now more complicated than since the Genoese had now consiolidated their alliance with the Ottoman sultan Orkhan I who controlled both banks of Bosphorus waterway. The war naturally shifted to the Tyrrhenian Sea. The following clash took place in Sardinia in 1353. It was time for the Venetian to reciprocate the military effort that the Aragonese had offered them in the Bosforus. The Aragonese wanted to take the town of Alghero that was still held by the Genoese in Sardinia. The Catalan captain Bernat de Cabrera had put together a fleet of 45 galleys and 3 big ships with a "castle" with 400 soldiers each that were meant to fight in the island for the siege of Alghero. The Venetian admiral Niccolò Pisani joined him in Minorca with a fleet of 20 galleys. The Genoese had a fleet of 52 galleys under the command of Admiral Antonio Grimaldi. On August 29th 1353, while the siege of Alghero was going on in the mainland, the 2 enemy fleets came in sight of each other. Grimaldi had 44 galleys chained together and left 4 free for each wing. The Venetian Aragonese fleet was deployed in the similar chained formation but the free galleys were 8 for each wing. Furthermore they could also dispose of 3 castellated big ships loaded with 400 catalans soldiers each. These big ships did not have rowers and could only rely on wind power, but the sea was dead calm then. While two rows of chained galleys were rowing and slowly approaching each other, the loose galleys started to fight. The 3 big castellated ships were not taking part to the fight but before the 2 chained formations could engage battle, a strong wind rose up and pushed the three big ships towards one wing of the Genoese chained fleet. Three Genoese galleys could not resist the impact and sank. The Catalans soldiers threw a hail of stones and arrows at the Genoese and Grimaldi, seeing the turn things were taking, ordered to loose 11 galleys from the not engaged wing and together with the other 8 already loose galleys stood out to sea, perhaps in an attempt to surround the enemy. Then for some reason, maybe because the sailors refused to sail back to combat, the 19 Genoese warships set sail to Genoa; the rest of the fleet had to surrender. The Genoese lost 33 galleys, 2000 men were killed in combat and 3500 were taken prisoners. Only 320 soldiers from the Venetian-Catalan fleet were reported dead. Antonio Grimaldi (one of the leaders of the Guelph faction) was blamed for the humiliation in Alghero. Civil war in Genoa between the Guelph and Ghibelline factions was prevented by the appointment the Archbishop Giovanni Visconti (Lord of Milan) as leader of the Republic of Genoa. Visconti was the most powerful of the Italian Lords and was from the Ghibelline faction and therefore very much against Venice which had Guelph leanings. Visconti sent an ambassador to Venice (poet Francesco Petrarca) to invite Doge Andrea Dandolo to sign a peace treaty but Dandolo refused, thinking that Visconti was only trying to buy some time to reorganize his army. Venice sought alliance with Estensi, Carraresi and Gonzaga and the war went on in the mainland but without major battles. As a matter of fact the Genoese wanted to seek revenge. Visconti supported the plan of arming 33 warship under the command of Paganino Doria. After raiding the coasts of Catalonia in 1354 Paganino sailed to the Adriatic Sea where he first took some Vednetian merchant ships, then pillaged the Venetian settlements of Lèsina and Curzola and eventuyally raided Parenzo (croatia) in August 1354. The Venetians ordered Niccolò Pisani, who was then sailing off Sardinia, to rush back and defend the homeland with his fleet of 35 galleys and 5 castellated big ships.. Paganino Doria did not dare to attack Venice and sailed out of the Adriatic Sea towards Greece. Pisani. Pisani chased down Doria all the way to Chios but the Genoese declined battle and went to Modon to join another Genoese fleet of 10 galleys under the command of Visconte Grimaldi. Pisani also reached Modon but pulled into a nearby port called Portolongo located south of the Peloponneso to give his men a rest and repair some ships. Doria appeared in Portolongo on November 4th 1354 and invited Pisani to fight but it was the Venetian’s turn to decline battle. The Venetian 5 castellated big ships and 14 galleys were monitoring the mouth of the harbor while the other 21 galley were beached. In the darkness of the night of November 4th Giovanni Doria (Paganino's nephew) managed somehow to roll his galley undetected through a gap in the floating picket. It is not sure whether the Venetians simply did not see him or if they thought they could close him in and take his galley. In any case a few other Genoese galleys managed to follow Giovanni, caught the Venetian army unprepared for combat and quickly subdued them; in the meantime the 5 Venetian big castellated ships and 14 galleys found themselves surrounded by 22 galleys outside the armor and 13 inside and soon had to surrender. The Venetians suffered heavy losses: 4000 men were either killed or drowned while trying to escape and about 5000 were made prisoner including Admiral Niccolò Pisani who was taken to Genoa. Paganino Doria left 15 galley to patrol the Aegean and returned to Venice with 50 galleys to receive the triumphant welcome he had been denied after the battle of Bosforus. Both Genoa and Venice, exhausted by the war negotiated a peace treaty that was signed in June 1355. Do you find this page interesting? If so please give us a link or an "I like", thank you. Go back to the second war with GenoaGo on to the fourth war with Genoa Venice Italy vacation rentals
computer and technologyThe Computer Engineering Expertise program (CNT) is dedicated to producing job prepared graduates that are skilled in software program growth, digital/analog machine interfacing, and digital/analog electronics. Graduates of the three-year Pc Programs Technology program are prepared to meet the data technology (IT) wants of the business, trade, service and government sectors. Across the globe, trendy pc methods are linked together through quite a lot of communication infrastructures, together with phone and cable connections, trans-Atlantic optical fibre and satellite tv for pc links. A profession in expertise may imply offering assist when an utility stops working. So complicated, actually, that there is an entire career dedicated to understanding, managing, and serving to others to use computer systems and a variety of info systems. After graduation, students can apply for entry to Sheridan’s Bachelor of Applied Information Sciences (BAISc) (Info Systems Safety) program after finishing a bridging program. The courses within the ECT associate degree program span subjects associated to laptop hardware and software program, programming, working systems and beyond. Laptop scientists research the machine itself and understand how and why numerous laptop processes operate the way in which they do. Information Techniques Safety deals with pc networks, and is a essential side of cybersecurity. Whereas the Laptop Science Expertise program prepares college students to enter the work drive immediately after graduation, many college students pursue research at college in various Computer Science diploma programs, either full-time or half-time. An understanding of superior expertise places you in an excellent position to reap the benefits of the various employment alternatives in this fast-moving sector. Utilizing algorithms and advanced mathematics, pc scientists invent new methods to govern and transfer info. This area takes the dry codes of laptop programming and turns them into stunning and engaging visible masterpieces. Laptop scientists are the electricians, plumbers, and installation specialists who put lights, working water, and appliances in the home. Employment charges reported by NAIT alumni are for info functions and don’t assure future employment alternatives. The Laptop Expertise program prepares college students for careers repairing and troubleshooting computers for companies and households around the world. There are additionally careers in synthetic intelligence, well being info systems, data retrieval, computer security and cryptography, laptop graphics, and human/laptop interactions. Have to be accomplished within the last 7 years previous to receiving the AAS degree or certificates in Laptop Expertise. Laptop expertise is a broad discipline that college students can gain access to by attaining a bachelor’s diploma within the subject. Graduates of the Computer Technology Program will, by the point of graduation, have the next information, abilities, and appreciation of skilled standards. In their closing yr, students work in groups on sponsored actual-world projects to develop a comprehensive application as a part of the software engineering portion of this system. College students in bachelor’s degree programs in computer expertise discover operating techniques, networking, security protocols and hardware.
What is Dietetics Dietetics may be one of the most misunderstood professions to date, and the reason therefore remains a mystery. To eradicate elements such as ignorance and confusion, attention must be given to the following factors: Dietetics is the science and administration of nutrition to obtain and maintain optimal health. Dieticians study for four years to obtain a Bachelors degree, after which they are required to complete an internship to obtain a diploma, which registers them with the Medical and Dental Council. Without such registration, they are not allowed to practice. During this internship they acquire knowledge on physiology, psychology, pharmacology, nutrition and diet therapy, to name but a few. Dieticians are therefore not only concerned with basic dietary advice. Dieticians play a fundamental role in virtually all diseases / illnesses / intolerances and general dietary issues. A dietitian can, for example: assist a pregnant woman with good nutritional practices to improve both her, and her unborn child’s health; alleviate and treat spastic colons; prescribe weight loss or weight gain regimes; assist in cardiovascular diseases; treat patients with diabetes and nutritional trauma, etc.  For all these situations dietitians are the specialists in the field. They are the individuals who ensure that you achieve all you nutritional requirements for optimal recovery and maintenance of good health.  Education represents a crucial part of the role which dieticians play within a community. They assist newly diagnosed patients understand their illness / disease and the effect it will have on their lives and life styles. Good practical guidelines are then offered to assist the individual in the management of the condition. Nutritional education is provided in clinics to create awareness of good nutritional practices in obtaining and maintaining good health as well as the management of certain conditions. Why go to a dietician when you have such a wide selection of practitioners to source from? Doctors, pharmacists, “nutritionists”, gym instructors, herbalists and homeopaths all provide diets, tonics and nutritional advice which too, has its place and role. It is common knowledge to get the best advice and help from the best-qualified person / profession / institute. For example, if you have cancer, you will consult an oncologist and not your GP. It is not a reflection of your GP’s inadequacy, but purely your choice of consulting the best possible practitioner for the condition you have. One can use gardening as an example too – you will not use a rake when you need to dig a hole (it does not mean that the rake is not a perfectly adequate tool, it is just not the right one for the job at hand).  Thus, when you require good, sound dietary advice, get it from the best: go to see your local dietitian!  A healthy diet and lifestyle consists of a number of important components. Each component plays a vital role and can therefore not be replaced or ignored! It would be pertinent to discuss each component and its role, followed by the integration of the various components to find the balance required. The components are: 1)      Protein: If you have been fortunate enough to watch the movie ”My Big Fat Greek Wedding”, you will have new found respect for the father, since he was correct in saying that most words are derived from Greek. The word “Protein” is no different: it is derived from a Greek word of which the meaning is “of first importance”.   Proteins are the key components of all living organisms since it is found in muscle tissue, bones, teeth, blood and other bodily fluids.  It is the key structural component of cells and it is what hormones and enzymes are made of. In this light, daily quality protein intake becomes vital since it is the building blocks of the body. Proteins need to be consumed on a daily basis to ensure normal growth and cell regeneration. Basically keeping the body in tip top shape. Good sources of protein are: • meat (red, white and fish) • milk and milk products (yogurt, cheese, buttermilk, etc.) • eggs • nuts • soya • legumes 2)      Carbohydrates: Carbohydrates seem to have become a forbidden food in our generation.  People do not realize how vital the intake of carbohydrates on a daily basis is. Carbohydrates play a role in the protection (vitamins and minerals) of the body as well as in providing it with vital energy. Both these components are essential for normal functioning of all organs and systems in the body. Yes, this is the energy and protection that keeps us going. The best sources of Carbohydrates are: • grains (rice, bread, porridges, cereals, etc.) • syrups • sugar • starch – rich vegetables, which are not considered in the vegetable group (potatoes, sweet potatoes, corn on the cob, etc.) • fruits • vegetables Whole grain starches are recommended, since they are high in dietary fiber. Examples of food items with high dietary content is legumes (split peas, lentils, etc.), nuts, whole wheat flower and whole wheat flower items (provita, whole wheat bread, etc.), brown rice, high-fiber ready to eat cereals, oats, fresh fruits and vegetables eaten with the peels and pips. So what or what makes fiber so special? Dietary fiber is what many refer to as roughage in food.  It has several benefits, including: • Lowers blood cholesterol levels • Improves blood sugar control • Assists in weight loss • Assists in normal bowel movement • Assists in the prevention of large bowel (colon and rectum) cancer 3)      Fats (lipids): Fats are responsible for providing energy to the body. If the body were a car, fat would be seen as the fuel that provides it the power to go. Sources of fat are: • Margarine or butter • Oil (sunflower, olive, etc.) • Cream • Bacon • Products high in oil content such as mayonnaise, oil based gravy, etc. Lipids or fats can be broken down into three types due to their chemical structure: Saturated, Poly -unsaturated fats and mono-unsaturated fats. Animal fats tend to be more saturated, whilst plant oils and extracts as well as the fatty acids from some fish, are more poly- and mono- saturated. An ideal diet should consist of more unsaturated (poly- and mono-) fats than saturated fats, since it lowers the risk of cardiovascular diseases such as atherosclerosis. 4)      Vitamins and Minerals: Vitamins and minerals provide our bodies with the assistance it requires to grow optimally, regenerate when and if needed, fight infection and operate at optimal levels from all bodily perspectives. Vitamins play a role in regulating our metabolism, assist in converting fat and carbohydrates into energy the body can utilize for normal functioning and it is involved in the forming of bones and tissue. There are two groups of vitamins: fat–soluble (Vitamin A, D, E and K) and water–soluble (Vitamin B and C). Both types are required on a daily basis. Minerals, on the other hand, forms part of bodily fluids and have several functions in the body. Some of the functions include the regulation of metabolism of many enzymes, maintenance of nerve and muscle irritability and the maintenance of the acid-base balance in the body. Both components are found in a variety of food items: from your protein products to fruits and vegetables. Insufficient daily intake of vitamins and minerals will lead to a variety of deficiencies which has adverse effects on growth, reproduction and general function of the body.  Daily intake of a varied diet including fresh fruits and vegetables are thus essential to maintain the body and promote good health. 5)      Water: Water is so often neglected out of a good dietary regime.  It is essential not only for the normal existence and functioning of the body,  but also for basic survival. In light of the fact that +/- 60% of the human body’s weight consist of water, it is an element of the diet that can not be ignored. Water plays a part in various functions in the body. Examples of some of the functions are: • Transport medium for nutrients • It is a building material for cell growth and repair / regeneration • Vital for absorption,  digestion, circulation and excretion • Maintenance of body temperature • Assists in normal bowl function, since water is absorbed by dietary fiber which in turn swells and increases fecal weight and ultimately assists in the elimination thereof. • Lubricant • Assists body in elimination of toxins The list of benefits is endless. With this in mind, it is essential to include water in your daily diet. The recommended amount of water to consume is 8 glasses (2 liters). Preferably this must be consumed in its pure form, i.e. not as coffee, tea or part of any other drink. Now that we have briefly discussed each of the essential components of a healthy diet, it is necessary to discuss the proportions of each component, as well as other important issues such as “fad diets”, special products, “forbidden foods” and supplementation. Ideal body weight and good dietary practices will also be covered. Every morning is a start of a brand new day in which the body requires good nutrition to operate optimally. Often the value of a balanced diet is grossly neglected due to various reasons, ranging from stressed lifestyles to ignorance. This has adverse effects on people’s lives, health and their ability to cope with daily stresses and issues. To combat this, each day should consist of the basic elements as discussed previously. The question is just in which quantities, since we too often eat either too much starch or fats or even protein. How do we find a healthy balance? In the lives we live with fast foods and “ready made meals” our fat intake is too high, there is virtually no fiber and we are lucky if we see any fruits or vegetables. Not to mention the “fad” diets a lot of people go on, which promotes unhealthy balances such as “protein” diets, energy deficient diets or the ever popular grape detoxification diet, to name but a few.  Every second article we read is about how to eat, the latest dietary trends, the weight you should have and don’t forget the “quick fixes”. It all ends up fruitless since nothing seems to work. The reason for this is simply that there are no quick fixes. Trendy diets, more often than not, are also nutritionally unbalanced. So, what is the answer? The answer is fairly simple. There are no quick fixes.  If there were, none of us would have any dietary related issues. Firstly, establish what your daily energy requirement is. This you can obtain by visiting your dietician and having him/her calculate your daily energy requirements, using your height and build and a diet history. She will assist you with the correct energy requirement value to ensure that the energy intake is equivalent to the energy consumption per day. In order to maintain your ideal body weight, the energy intake should be equal to the energy expenditure, thus creating a balance and you maintain your weight. Secondly, every day should consist of the following in the stated proportions (this is for healthy individuals): • Protein – 15% of the daily diet (this includes your milk / milk-products as well as nuts, soya and legumes) • Fat – 30% of the daily diet • Carbohydrates – 55% of the daily diet • 8 Glasses of water per day In addition to this, include the following as guidelines to assist good health and nutrition: • Keep the intake of refined sugars and syrups to a minimum. If you can avoid such intake, do so. This includes the intake of cakes, sweets and chocolates. • Rather have a high fiber starch than a refined starch (whole wheat bread rather that white; brown rice rather than white; etc.) • Lots of fresh fruits and vegetables. Try to have them with the peel and core / pips if possible, since it is an excellent source of dietary fiber. • Fat should rather be unsaturated (plant and fish oils) than saturated (animal fats). A good way to introduce it is by using poly-unsaturated margarine rather that butter. Bake, stew, steam, boil and grill food rather than fry. • Purchase lean meat, but also remove ALL visible fat from meat before preparation. On chicken, all the fat is just under the skin so remove the skin before preparation. This type of animal fat is very high in cholesterol, which in turn is bad for your heart since it can cause arthrosclerosis (blocking of arteries with fatty deposits) • Try to have red meat only twice a week. The rest of the time, one should have chicken or fish. One can even use legumes and soya instead of an animal protein once or twice a week. • Use only low fat or fat free milk and milk products. When purchasing cheese, look out for the low fat ones, such as Baby Bell, Ricotta, Edam and Lichten Blanc. Please do not be fooled, since all white cheeses are not low fat cheeses. Tussers, for example, have fooled many users but is in actual fact a high fat cheese. • Use salt and high salt products moderately • Rather use fresh products than canned or pre-prepared. Pre-prepared and tinned items typically have both a high fat and salt (sodium) content. Both these items are killers for your heart. • Eat regularly. Try not to skip meals, since it does affect the body’s metabolism. Choose between having 3 meals or 6 small meals per day. If one can, the 6 small meals are better since it stimulates the metabolism. If your lifestyle does not allow for it, at least maintain the 3 meals per day. All the above principles can be used when dining out too. Order grilled, steamed, stewed or boiled items instead of fried. Do not accept butter or cream with the baked potatoes; order the salad with the dressing on the side. Rather have a fresh fruit salad as dessert than a rich, cream-filled cake. By including all of the above in the recommended proportions, it will provide all the required nutrients for a healthy functioning body. Exercise is also very important, since it not only assists with the normal functioning of the body, but it helps improve blood circulation and gets rid of excess energy. It helps build muscle mass and controls the depositing of fat and thus the formation of new fat cells. It also assists in appetite control, by lowering one’s appetite. This in turn assists with the maintenance of an Ideal Body Weight. It has also been found that people who do some form of exercise has lower incidences of osteoporosis. You don’t even have to join a gym or purchase several of the equipment pieces you find advertised on television. All you need to do is take time for a brisk walk. Try to walk at least five times a week and for +/- 20 minutes at a time. Please remember though it is not a slow snail’s pace stroll, but a brisk walk. All you thus need is a good pair of comfortable and supportive shoes.  You can do this any time of day and pretty much in all weather conditions. For those who have been inactive for a while, start of slow with a 10-minute walk and increase the time gradually. This is going to take time and discipline, but persevere. Make a pact with yourself not to give up before the end of 3 weeks. If you need to, reward yourself with a nice movie or book, but keep going!  To SUPPLEMENT or NOT to SUPPLEMENT – that is the question... There are a variety of beliefs regarding vitamin supplementation. It ranges from supplementation being overkill due to the availability of all nutrients in a balanced diet, to the belief that supplimentation is essential because our products lack required vitamins and minerals due to production methods, storage and production processes. Some feel it to be essential for maintained energy and vitality while others believe it to be imperative to improve and maintain one’s immune system. Be this as it may, all of the above have it’s merits. However, as humans we frequently require a “crutch” to make us feel better or even stronger, and we abuse vitamin supplementation to obtain the required good, protected and energized feeling. Vitamin supplementation, in my opinion, is required when: • dietary intake is not balanced • dietary intake composes largely of processed and unenriched / unfortified food items • Individual has illness that affects vitamin status (either depletes vitamin levels in body or requirement becomes elevated, etc.) • Chronically ill • Pregnant woman • Elderly There is no harm in supplementing one's diet if one is of the opinion that the daily vitamin requirements are not being met. I frequently recommend supplementation to individuals who have severely stressed life styles, but at the same time, I do need to caution individuals that it might not always be required, especially if you are maintaining a healthy diet and exercise program which helps with stress relief. Very often, it just makes us feel better. When the body requires additional supplementation, it will be utilized, but if there is continual over- supplementation that is not required it can lead to “hypervitaminosis”. Hypervitaminosis is the excessive intake of certain vitamins, which can lead to clinical abnormalities. If vitamin supplementation is administered, I recommend supplements in a “food-state” form, which has been proven to be more accessible to the body.  Thus the body utilizes the supplementation more effectively and obtains all the benefit it should.  “Food-state” supplementation is available at selected pharmacies and some organizations distribute the products direct. Some individuals supplement their diets with additional protein, amino acid and/or carbohydrates. These are for various reasons ranging from exercise regimes to “special dietary” requirements. My recommendation would always be that you consult your Dietician before and during the administration of the supplementation, since some of the supplementation can be detrimental to your health. It is always advisable to get a professional opinion on regimes that are out of the ordinary. We are lead, and so often mislead by the media, organizations and/or people’s opinions. I often hear individuals claim that you can not afford to eat healthily, since it is extremely expensive. Companies and organizations often create that impression, since it inspires you to purchase their products. People on weight reduction diets are frequently told to choose specific “branded”, more expensive products, when often there are cheaper alternatives. The solution: Create a culture of awareness within your family and friendship circles.  Think carefully about what you are being told. No matter how credible and convincing information may seem, attempt to ascertain the person/company's motives. Some companies and organizations will tell you anything to make a “quick buck”. Become an aware consumer and READ LABELS. Lately most products provide you with a nutritional composition breakdown on the rear of the wrapping. Read to see if it is a low fat or low sodium (salt), etc, product. This way you can choose “ordinary” products instead of branded items to achieve your goal. Please do not be mislead by marketing and word play. Often companies advertise their products to be something when in essence it is not. An example that jumps to mind is a yogurt that has been released specifically for children (adults can use it too). All the marketing around this product states how healthy and nutritious it is, making it essential for each household with a child. When reading the dietary information, I could not help but frown. My child will never see this product. It consists mostly of cream, sugar and artificial fruit flavors. I would rather provide my child with a yogurt, which contains real fruit (containing natural sugars and fibers). Also, just because children typically have a higher energy requirement should not imply that the fat intake should escalate. A low fat yogurt is recommended, since it is low in cholesterol. Remember, children develop their eating habits during childhood and it is hard to change bad habits once you hit adulthood. Another example is products claiming to be low in salt, but when reading the dietary description at the back, you quickly pick-up ingredients such as “mono-sodium glutamate”. Anything called sodium (or related) is salt. Thus the product is not as “salt-free” as advertised. When looking for fat free products, just read the labels. Very often there are cheaper alternatives to the known brands which are equally, if not more suitable and effective. Another important aspect of maintaining a balanced diet is to know how to deal with CRAVINGS and the ever-dreaded “FORBIDDEN” foods. There will always be days when you feel like a chocolate or that piece of cake you have been craving for weeks. These cravings typically arise either due to an unbalanced diet where we are deprived from various items or it is a psychological depravation of some sorts, where we feel we need it since we had such a bad day or we feel lonely, depressed, etc.  Some people just crave and eat high fat, high sugar items out of habit. “Forbidden” foods are typically items which are high in fat, high in refined sugar, no or low in fiber, and apart from a very high energy value, have very little or no nutritional value. It is easy for me to tell you to rather have something more nutritious and beneficial to eat, but the reality of the matter is that these items are around us all the time. At parties, functions, in shops at the counter whilst waiting in the queue – it screams your name! Isn't it amazing how attractive the forbidden fruit are? The question is how to deal with this. First, follow a balanced diet plan (this does not include any of the fad or quick fix diets on the market). The balance diet is a diet which promotes the guidelines I have provided you with earlier. By following some of these fad and quick fix diets you end up being deprived either from an energy or nutritive aspect. This leads to cravings that in turn will lead to an obsession with food, which at some point will result in eating of the forbidden items (possibly in excessive quantities). This results in guilt, which leads to the feeling of failure and eventually results in the person absconding from the diet and picking up weight. Individuals who eat these items for emotional reasons (depressed, sad, lonely, etc.) will go through the same emotional cycle afterwards(guilt, feeling of failure, etc.) as those on a deprivation diet. Secondly, it should not be seen as forbidden foods. It is quite psychological really, since if you know you can't have it,  you crave it so much more and feel guilty when you have it. The key is just to control the intake. If you feel like something sweet, rather have a fruit and in most cases the craving will go away. If not and you still feel like that chocolate, then have it, but do not think about it again after you have had it. What you can do to compensate for it is to have smaller meals for the rest of the day, but again, do not deprive yourselves of meals because of this. Moderation is the key. When you have this craving and it just wont go away, have a small slice of cake or a small chocolate, not a slab or half of the cake. This way you get what you want with impunity. A good idea is also always to incentivise yourself.  Do not just give in to any and every craving or temptation. Always ask whether you are really hungry and whether you really need it. Set yourself goals: If you are good for a month, then with month end shopping you may have the ice cream. You will note that by doing this, you will not feel guilty for having something, since you have deserved it. Very often you might not even have the treat, since by the time your incentive is due, you may find you do not feel like it anymore or even decide that you do not need it. Nothing beats that feeling - victory! Never go shopping when hungry. Rather delay the shopping trip than end up in the shopping center surrounded by tempting smells and delicious looking food items. You will also save a lot more money this way, which can be allocated to that holiday and new outfit you wanted. Faced with tempting items, we are presented with options. Whenever possible, try to have a better option than forbidden food. By this I mean that instead of having a cream puff, rather have an apple crumble. They are both high in sugar, but at least the apple crumble has no added cream. Instead of having chocolates, have a jelly sweet – again less fat! If it is a choice between a burger and a whole-wheat roll with more or less the same topping, rather have the whole-wheat roll.  You will never regret making the better choice.
Production control is the activity of monitoring and controlling a large physical facility or physically dispersed service. It is a “set of actions and decision taken during production to regulate output and obtain reasonable assurance that the specification will be met.” The American Production and Inventory Control Society, nowadays APICS, defined production control in 1959 as: Production control is the task of predicting, planning and scheduling work, taking into account manpower, materials availability and other capacity restrictions, and cost so as to achieve proper quality and quantity at the time it is needed and then following up the schedule to see that the plan is carried out, using whatever systems have proven satisfactory for the purpose. Production planning and control in larger factories is often run from a production planning department run by production controllers and a production control manager. Production monitoring and control of larger operations is often run from a central space, called a control room or operations room or operations control center (OCC). One type of production control is the control of manufacturing operations. 1.  Production planning and control about the control of the when and where. 2.  Production control and supply chain management Management of real-time operational in specific fields. 1. Production control in the television studio in a production control room. 2. Master control in Television studio 3. Production control in spaceflight in a Mission Operations Control Room Production control is just one of multiple types of control in organizations. Most commons other types are: • Inventory control, the supervision of supply, storage and accessibility of items in order to ensure an adequate supply without excessive oversupply. • Quality control, the process by which entities review the quality of all factors involved in production
home > Magnet News > How was the magnet found? Magnet News How was the magnet found? How was the magnet found? About 4,000 years ago, dug up the earth to find Magnes lodestones. Lodestones contain magnetite, a natural magnetic of Fe3O4. This type of rock was subsequently named magnetite. From the historical point of view the development of permanent magnet materials, the late nineteenth century the use of carbon steel, energy product (BH) max (stored magnetic energy density of the permanent magnet to measure the physical quantity) less than 1MGOe (MB high Austria), and the current foreign production of Nd-Fe-B permanent magnet materials, energy product has reached 50MGOe more. This is a century, the material is very small remanence Br increase can be attributed to increased accumulation of coercive force Hc of the increase. The coercivity increase, mainly due to their understanding of the nature and compounds of high magnetic anisotropy found, and the preparation technology. The early twentieth century, people mainly use carbon steel, tungsten steel, chrome steel and cobalt steel for permanent magnet materials. Late 1930s, AlNiCo permanent magnet materials developed before large-scale application of the permanent magnet materials possible. The fifties, the emergence of barium ferrite, not only reduces the cost of permanent magnets, permanent magnet materials in turn broaden the scope of application to high-frequency field. To the sixties, the emergence of rare-earth cobalt permanent magnet, the magnet was applied to open a new era. In 1967, the United States Dayton University Strnat etc., were successfully bonded with a powder made ​​of SmCo5 permanent magnets, rare earth permanent magnet marks the era. So far, dilute ten permanent magnet has gone through the first generation of SmCo5, the second generation of precipitation hardening Sm2Co17, developed to the third generation of Nd-Fe-B permanent magnet materials. In addition, in the history of permanent magnet materials have been used as a Cu-Ni-Fe, Fe-Co-Mo, Fe-Co-V, MnBi, A1MnC alloys. As the performance of these alloys is not high, not low cost, in most cases have been rarely used. The AlNiCo, FeCrCo, PtCo alloy in some special occasions also be applied. Currently Ba, Sr ferrite is still the greatest amount of permanent magnet materials, but many of its applications are gradually being Nd-Fe-B type of material to replace. Also, the current output of rare earth permanent magnet materials have been much higher than ferrite magnets, rare earth permanent magnet material production has developed into a major industry. related keywords related posts Leave a Inquiry
Paul R. Lehman, The challenge of history replacing the myth of race and racism January 25, 2019 at 8:33 pm | Posted in Africa, African American, American Bigotry, American history, American Racism, Bigotry in America, black inferiority, blacks, Christianity, Confederacy, democracy, desegregation, discrimination, DNA, entitlements, equality, ethnic stereotypes, Ethnicity in America, European American, Genealogy,, Human Genome, justice, language, minorities, Prejudice, race, Race in America, racism, segregation, skin color, skin complexion, U. S. Census, UNESCO, white supremacy, whites | 1 Comment The old idiom of “beating a dead horse” comes to mind every time an incident involving ethnic bigotry occurs and affected and interested groups want to get together and talk about racism with the idea of defeating or overcoming it. The same scenario has been played for over three or more centuries and here it is today no further than before. Why? One might ask. The reasonable response is that racism cannot be defeated or destroyed because it is not a thing, but a concept. A concept is an idea and ideas are inventions, not facts. Racism is a concept derived from the false concept of the existence of biological races and as long as the concept is promoted, supported, and controlled it will persist. In order for racism to be removed from the psyche, it must be replaced. For example, when children are young and innocent they often ponder the question from where do babies come only to be told that a stork delivered them to their mommies. The stork story is an ancient myth generally thought to have come from Europe among other places. In any event, the idea of babies coming from a stork delivering them will stay with the children until they learn the truth about procreation. When that time occurs, the concept of the stork and the baby will be replaced by reality, not destroyed or defeated. Such is the case with racism. Unfortunately, America and much of the Western world are not will to replace the concept of racism because it has and still works for them relative to providing privileges, power and prestige based on skin color. Much of the problem in replacing the myth comes from the fact that the myth of European American superiority has been tightly woven into the American psyche for so long that to many people it is no longer a myth. Over seventy years ago the United Nations Educational, Scientific and Cultural Organization (UNESCO) issued several statements to the world regarding race:”These statements elucidated the genesis of theories of racial superiority. They emphasized that the biological differentiation of races does not exist and that the obvious differences between populations living in different geographical areas of the world should be attributed to the interaction of historical, economic, political, social and cultural factors rather than biological ones.” The critical point regarding race was emphasized in the statement issued in 2001, that: “Science – modern genetics in particular – has constantly affirmed the unity of the human species, and denied that the notion of `race’ has any foundation.” They further concluded that “Yet racism and racial discrimination have hardly vanished; Indeed, they have not only survived the scientific deconstruction of the concept of `race’ but even seem to be gaining ground in most parts of the world. In the age of globalisation, this situation may seem paradoxical.”In spite of all the data underscoring the concept of race, it persists today and will continue until the focus of inquiry moves from the results of racism to the cause. In a recent article, Jonah Goldberg writes about how “out of step” the comments of Republican Steve King were when he spoke of white Nationalism, white supremacy, the Confederate flag and other elements of bigotry. The comments might appear out of step with what Goldberg sees as American ideals, but for King, and many other Americans, there was nothing unusual or wrong about those comments because they have been a part of the American experience since the beginning. A brief glimpse at history shows where the African American and other people of color have been deliberately discriminated against deprived of opportunities in education, housing, medicine, politics, and finance as a matter of life as usual. So, no wonder King’s anger and confusion about being cited and penalized for comments that he considered common and ordinary. What is missing from the article is the fact that many aspects of American History relative to the system of European superiority as it exists in America today has never been included in our public education.  Goldberg tried to underscore that lack of education relative to King by making reference to the myth of a white (and black) race in his statement: “Contrary to the prattle of white nationalists and supremacist, Western civilization is not synonymous with whiteness.” He added that many of the people thought to be white today:” Czechs, Hungarian, Poles, Italians, Greeks et al. weren’t “white” at the beginning of the 20th century.” Goldberg’s article continued by providing a brief historical perspective on the early conceptions of race that included reference to a Dictionary of Races or Peoples that consisted of “a pseudoscientific grab bag containing ‘a motley compendium of ethnic stereotypes, skin complexion, head shape, and other hardy perennials of the race science literature.’” References to a number of ethnic groups and their contributions to Western society were included in the article in an effort to show the falseness of the white race superiority concept. He concluded that, “Among the best ideas and ideals of Western, Christian and most importantly, American civilization is that we are supposed to judge people on their individual merits, not keep score based on their ancestry.” While Goldberg’s article is factual and to the point relative to King’s perspective, the fact still remains that many Americans view history just as King does. So, what is gained by presenting his factual information about the false concept of race if nothing is offered to replace it? Any meaningful discussion concerning race and racism must begin by deconstructing or debunking the concept of race. The reason for this action is because the discussion will produce nothing outside of race and racism and will continue in a non-ending circular state. The concepts of race and racism can be replaced with reality and factual information but not without the disruption of the psyche that is comfortable with the status quo and sees nothing to be gained from making the change. Too many Americans have shown that they are not ready to replace their ideas of race and racism with truth because some find beating a dead horse rewarding and entertaining. Paul R. Lehman, Why is America experiencing a changing reality in race and color March 31, 2013 at 12:36 pm | Posted in African American, American Indian, blacks, Chief Justice John Roberts, equality, Ethnicity in America, European American, fairness, Hispanic whites, justice, Media and Race, Prejudice, Race in America, whites | 1 Comment Some African Americans do not like the term African American because they believe it links them directly to Africa. Basically, what they generally think of Africa is not very complimentary because of the images of Africa that American society created when ethnic bias was fashionable. Rather than picture it as the diverse continent it is, Africa was described as a dark, mysterious, cannibalistic, dangerous place where ignorant savages lived. The natives were so ignorant that the fictional white man who ruled the African natives, Tarzan, had a chimp as a partner rather than an African man. Tarzan was called “King of the Jungle” although he was not born there and was raised by apes. That image of Africa was created to discourage African Americans from wanting to embrace it as their homeland. The idea promoted was that it was better to be a slave in America than a savage in Africa. Of course, anyone with an elementary education knows what a tremendously important Africa is to the world and its history. Unfortunately, many people still hold on to the negative concept of Africa. How people view themselves has a direct impact on what they say about themselves and especially how they act. For example, if someone is called a thug and accepts that identity, then he will use the language associated with being a thug. In addition, his behavior will reflect his idea of how a thug acts. The same thing applies to people who identify themselves as black or white—they speak and behave the way they belief they are expected to speak and behave. Most often their examples are passed on to their children and family. In this way ignorance about race and identity is embraced and promoted. We know for certain that no such thing as a pure 100% black or white person exist on the planet. Yet, we bought into the absurd concept of “one drop” of blood changing a person’s so-called race from white to black. When America created and enforced the concept to two races—black and white, the other associated concepts like racism, biracial, mixed race, racial etc… were not challenged successfully. However, today we know better, but keep doing and saying the things that reinforce the false and negative concepts of race. For example, some scientist will conduct studies using as subjects black and white people. The problem with those kinds of studies is that black and white is never defined. In effect, does the terms black refer to only people with very dark skin or was the term used to suggest all African Americans? If it was the latter, then were light-skinned African Americans included? Many Americans with dark complexions are not African Americans. Would they be included in such a study? If they were not, then of what value was the study? Most social scientists and historians know that in America, social and economic status along with ethnic identity play a major role in people achieving their American Dream. Historically, non-European Americans have encountered a more challenging experience is striving for and achieving their dream because of ethnic prejudice. Since the late 1960’s more non-European ethnic Americans have achieved success because the Civil Rights Acts have removed some of the social barriers that obstructed success. Unfortunately, many of those barriers remain, but in a subtle state. Part of the problem has to do with how people view themselves and each other. When Americans view themselves as black and white, they simply reflect the ideology of America’s past that embraced two races. The terms African American and European American eliminate the two race concept and underscore the one family of man concept. When all people belong to the same race or family, comparisons relating to superiority or inferiority of race will decline. However, prejudice among ethnic groups will also exist, but not on a biological race bases. If all people belong to the same family, they can express differences in beliefs, culture, religion etc…but not racial differences. We create problems for ourselves and our children when we send mixed messages to them regarding a so-called racial identity. For example, when a child has been taught in a General Science class that all people belong to the same race, how do the parents who maintain an identity based on color resolve the conflict for the child? Interestingly enough, CNN had a series of programs about who is black in America. Unfortunately, the program caused problems for a number of young African American ladies because they did not know who they were, thinking that they were either black or white. Seemingly, the majority of people with this problem of identity in America are the African Americans. Other people of color use their cultural or geographical identity like Cuban, Jamaican, Haitian, Puerto Rican, etc… The identity conveyed by these identities leaves no doubt about the culture and geography of the individual. Black and white, on the other hand, give no information whatsoever other than color. Even if American is added to these words, they still provide little meaning until the history of American slavery is brought into the picture. If we need evidence that the word black is no longer applicable as a reference to African Americans, we can look at the recent comments made by Chief Justice of the Supreme Court, John Roberts, during the hearing of arguments concerning voting rights:”At one point in the oral argument held Feb. 27, 2013, Roberts asked Verrilli, “Do you know which state has the worst ratio of white voter turnout to African-American voter turnout?”(The Boston Roberts used the term African American on numerous occasions during the hearing rather than the word black. (Now we need to get him to use the term European American instead of white) In addition to the Roberts use of the term African American, we need to know that efforts have been underway for a number of years now to build a museum in Washington, D.C. to house and exhibit information relative to the African American experience in America. The name of this museum is The National Museum of African American History and Culture. Our world and society are changing and either we change with them or be left behind. NOTE: If you found this blog informative, please share it. Create a free website or blog at Entries and comments feeds.
Skip to main content Improving Salmonella vector with recmutation to stabilize the DNA cargoes Salmonella has been employed to deliver therapeutic molecules against cancer and infectious diseases. As the carrier for target gene(s), the cargo plasmid should be stable in the bacterial vector. Plasmid recombination has been reduced in E. coli by mutating several genes including the recA, recE, recF and recJ. However, to our knowledge, there have been no published studies of the effect of these or any other genes that play a role in plasmid recombination in Salmonella enterica. The effect of recA, recF and recJ deletions on DNA recombination was examined in three serotypes of Salmonella enterica. We found that (1) intraplasmid recombination between direct duplications was RecF-independent in Typhimurium and Paratyphi A, but could be significantly reduced in Typhi by a ΔrecA or ΔrecF mutation; (2) in all three Salmonella serotypes, both ΔrecA and ΔrecF mutations reduced intraplasmid recombination when a 1041 bp intervening sequence was present between the duplications; (3) ΔrecA and ΔrecF mutations resulted in lower frequencies of interplasmid recombination in Typhimurium and Paratyphi A, but not in Typhi; (4) in some cases, a ΔrecJ mutation could reduce plasmid recombination but was less effective than ΔrecA and ΔrecF mutations. We also examined chromosome-related recombination. The frequencies of intrachromosomal recombination and plasmid integration into the chromosome were 2 and 3 logs lower than plasmid recombination frequencies in Rec+ strains. A ΔrecA mutation reduced both intrachromosomal recombination and plasmid integration frequencies. The ΔrecA and ΔrecF mutations can reduce plasmid recombination frequencies in Salmonella enterica, but the effect can vary between serovars. This information will be useful for developing Salmonella delivery vectors able to stably maintain plasmid cargoes for vaccine development and gene therapy. Attenuated Salmonella are being developed as vaccines to protect against typhoid fever [13]. There are also endeavors employing Salmonella as delivery vectors for therapeutic molecules. One strategy utilizes attenuated Salmonella, which expresses a gene or gene fragment encoding a protective antigen as vaccine against bacterial pathogens [46]. The heterologous genes can be expressed from the Salmonella chromosome, or, more often, from a multi-copy plasmid [7, 8]. Another strategy exploits Salmonella as a delivery vector of DNA vaccine against viral pathogens [4, 5, 9]. The later strategy is also used to deliver DNA encoding tumor antigen or cytokine for therapeutic applications in oncology [10, 11]. In addition, Salmonella is used to deliver small interfering RNAs (siRNA) [12], ribozymes [13] and large DNA molecules encoding a viral genome [14]. For instance, in vivo delivery of an artificial bacterial chromosome (BAC) carrying the viral genome of the murine cytomegalovrirus (MCMV) by Salmonella Typhimurium led to a productive virus infection in mice and resulted in elevated titers of specific antibodies against lethal MCMV challenge [14]. Most vaccine designs utilize Salmonella delivery vectors carrying a single plasmid for expression of a single antigen or of a fusion protein carrying epitopes from more than one antigen [15]. To induce broader immunity against a particular pathogen or various pathogens, one might need to express multiple antigens from a single plasmid carrying different antigen cassettes or from multiple plasmids in a single cell, each expressing one or more relevant antigens. Co-delivery of plasmids encoding tumor antigens and cytokines by Salmonella has been successfully demonstrated to improve protective immunity against cancer [16]. In the case where multiple plasmids are carried in the same Salmonella vector strain, there are most likely regions of homology between the plasmids, since the widely used pUC- and pBR-based plasmids have origins of replication that are nearly identical and both share regions of homology with the p15A ori. Additionally, commonly used promoter sequences, transcriptonal terminators and other expression plasmid components may also be present on plasmids coexisting in the same bacterial cell. The presence of these similar or identical DNA sequences would serve to facilitate undesirable interplasmid recombination. In some cases the bacterial vector may intentionally harbor multiple copies of the same DNA sequence, which may lead to plasmid instability. Recently, we encountered such a situation during the development of a bacterial based influenza vaccine. We constructed a single plasmid carrying eight head-to-tail connected influenza cDNA cassettes [17]. The plasmid was intended for delivery into host cells by an attenuated Salmonella strain. The multiple repetitive sequences residing in the plasmid make its stability within the attenuated Salmonella an important concern because any intraplasmid recombination event results in deletion of one or more influenza gene cassettes. Recent work in our laboratory has focused on developing new strategies for attenuated Salmonella vaccine strains, with features including regulated delayed in vivo attenuation [18, 19], regulated delayed in vivo antigen synthesis [18, 2022], and programmed delayed in vivo cell lysis [23, 24]. For all of these systems, one or more chromosomal and/or plasmid genes are placed under the control of the araC PBAD promoter. Eventually, our goal is to combine all of these features into a single Salmonella vaccine vector strain. Such a strain will therefore carry multiple chromosomal and plasmid copies of araC PBAD, providing sites for potential recombination, which could lead to unwanted chromosomal or plasmid rearrangements. However, to our knowledge, there have been no published studies specifically designed to evaluate plasmid recombination in Salmonella enterica. Deletions of several Escherichia coli genes are known to reduce the frequency of plasmid recombination, including the recA, recE, recF and recJ genes [2530]. The recA gene encodes the general recombinase RecA, involved in nearly all forms of recombination in the cell [31]. The RecE, RecF and RecJ proteins play a role in plasmid recombination and recombination repair [32, 33]. The RecA, RecF and RecJ proteins are highly homologous between E. coli and S. enterica, therefore they may play similar roles in DNA recombination. Despite these possible similarities, the recombination systems in the two organisms differ somewhat, as S. enterica does not encode recE [34]. Based on these concerns, we decided to determine the effect of rec gene deletions on intraplasmid recombination, interplasmid recombination, intrachromosomal recombination and plasmid integration in S. enterica. In this work, we examine the effect of ΔrecA, ΔrecF and ΔrecJ mutations on DNA recombination frequencies in three serovars of Salmonella enterica currently relevant to vaccine development. Our results show that the effect of these mutations on recombination can vary among Salmonella serovars and with previously published results in E. coli. Plasmid construction We constructed a series of plasmids (Figure 1 and Table 1) encoding various truncated tetA genes to assay plasmid recombination frequencies using the strategies similar to those described previously [28, 35]. Restoration of a functional tetA gene via intra- or intermolecular recombination resulted in a change of the bacterial phenotype from tetracycline sensitive to tetracycline resistant, and served as a marker allowing us to measure the frequency of recombination events (Figure 2). Figure 1 Illustration of plasmids carrying intact or truncated tetA genes. Plasmids are not drawn to scale. (A) Plasmid pACYC184 carries an intact tetA gene (1191 bp), which is the source of all truncated tetA genes used in this study. Plasmid pYA4463 carries two copies of truncated tetA genes, truncated at the 5' or 3' ends as indicated, which results in a 466-bp direct tandem duplication (shown as open arrows). Plasmid pYA4590 has two similar copies of truncated tetA genes, resulting in 602 bp of repetitive sequence (shown as open arrows) separated by 1041-bp kan cassette. (B) Plasmid pYA4464 has a 3'tet truncated gene. Plasmid pYA4465 has a 5'tet truncated gene. There are 751 bp of common sequences (shown as open arrows) between the two truncated tetA genes. (C) Plasmid pYA4463 dimer is the intermolecular recombination product of two pYA4463 molecules. Plasmid pYA4590 dimer is the intermolecular recombination product of two pYA4590 molecules. Plasmid pYA4464-pYA4465 is the intermolecular recombination product of pYA4464 and pYA4465. Table 1 Plasmids used in this study Figure 2 Strategies for measuring DNA recombination. (A) Truncated tetA genes. Two truncated tetA genes were derived from an intact tetA gene and its promoter (P). 5'tet, includes the tetA promoter and the 5' portion of tetA gene. 3'tet, consists of the 3' portion of the tetA gene. The overlapping region (between 5'tet and 3'tet) varies from 466 to 789 bp depending on the system. Homologous recombination can occur between the two truncated tetA genes at the overlapping region, leading to the formation of a functional tetA gene. (B) Intermolecular recombination. Each DNA molecule carries either 5'tet or 3'tet. A single crossover between the two molecules occurs at the regions of homology, and leads to a functional tetA gene. (C) Intramolecular recombination. The two truncated tetA genes were placed on one molecule in the same orientation. A single crossover between the regions of homology leads to a functional tetA gene. Plasmids pYA4463 and pYA4590 were constructed to test intraplasmid recombination (Figure 1 panel A). Plasmid pYA4463 carries two truncated tetA genes (5' end and 3'end), which have 466-bp of tandemly repeated sequence. An intramolecular recombination event can delete one of the repeats resulting in an intact tetA gene, thereby recreating the structure of plasmid pACYC184 (Figure 1 panel A). Theoretically, intermolecular recombination may occur between two pYA4463 molecules to form a plasmid dimer with a functional tetA gene (Figure 1 panel C). Plasmid pYA4590 contains a 602-bp tetA sequence duplication separated by a 1041-bp kan cassette. The intramolecular recombination product is equivalent to pACYC184. The intermolecular recombination product is a dimer plasmid containing an intact tetA gene (Figure 1 panel C). Plasmids pYA4464 and pYA4465 carry the 3'tet gene and 5'tet gene, respectively (Figure 1). The Rec+ Salmonella strain χ3761 carrying either plasmid individually was sensitive to tetracycline. There is 751-bp of tetA DNA in common between the two truncated tetA genes. Recombination between the two plasmids creates a hybrid plasmid containing an intact tetA gene (Figure 1 panel C). Intraplasmid recombination products To verify the recombination products, plasmid DNA was prepared from tetracycline resistant (TcR) single colonies derived from χ3761(pYA4463), χ3761(pYA4590) and χ3761(pYA4464, pYA4465). Plasmids extracted from TcR clones of χ3761(pYA4463) were digested with XbaI and SalI. Theoretically, XbaI/SalI digestion of pYA4463 will yield two fragments (3524 bp and 1187 bp), pACYC184 will yield two fragments (3524 bp and 721 bp) and pYA4463 dimer will yield four fragments (3524 bp, 3524 bp, 1653 bp and 721 bp). The results (Figure 3A) showed that digestion of all 16 TcR clones yielded a 721-bp band, indicating either a pYA4463 dimer or a plasmid equivalent to pACYC184. Three clones (lane 1, 5 and 10) yielded the pYA4463 dimer-specific 1653-bp band. Therefore, we conclude that the other 13 clones recombined to form the pACYC184-like structure. Of note, several clones (2, 13-16) also yielded the 1187-bp pYA4463-specific band, suggesting that the original plasmid (pYA4463) and its recombination product (pACYC184-like) could coexist in the same bacterial cell. Figure 3 Verification of plasmid recombination product by agarose gel separation. (A) Plasmid DNA was isolated from TcR clones derived from χ3761(pYA4463) and digested by XbaI and SalI. (B) Plasmid DNA was isolated from TcR clones of χ3761(pYA4590) and digested by KpnI and EcoRI. (C) Plasmid DNA was isolated from TcR or TcS clones of χ3761(pYA4464, pYA4465). The purified plasmids were digested with NcoI and BglII. Plasmids extracted from TcR clones of χ3761(pYA4590) were digested with KpnI and EcoRI. Theoretically, plasmid pYA4590 will be digested into two fragments (3414 bp and 2474 bp), plasmid pACYC184 will be linearized (4245 bp) and the pYA4590 plasmid dimer will be digested into four fragments (4245 bp, 3414 bp, 2474 bp and 1643 bp). Examination of the restricted DNA (Figure 3B) showed that only one clone (lane 12) had the pYA4590 dimer-specific 1643-bp band. The most prominent band in the other lanes was a 4245-bp band expected for pACYC184-like recombination products. Nine clones contained a mixture of pACYC184 and pYA4590 (lane 1, 3-5, 8, 9, 14-16). Interplasmid recombination products Plasmids extracted from TcR clones of χ3761(pYA4464, pYA4465) were digested with NcoI and BglII. Both pYA4464 and pYA4465 are linearized into a DNA fragment about 4 kb. Therefore, in cells containing each or both monomeric plasmids, the digested product will be a single band. The pYA4464-pYA4465 hybrid will be cut into two fragments (5510 bp and 2481 bp). All four of the TcR clones we isolated and examined showed recombination product specific bands and the 4-kb band expected when each plasmid exists separately in the cell. Four tetracycline sensitive (TcS) isolates were examined and only a single band was observed, as expected (Figure 3C). These results suggest that interplasmid recombination occurred in the TcR cells and that both dimer and individual monomers corresponding to at least one of the two starting plasmids can coexist in the same bacterial cell. We performed a similar experiment in S. Typhi strain Ty2(pYA4464, pYA4465) and obtained identical results (data not shown). Construction of recdeletion strains We constructed a series of strains for these studies carrying deletions in either recA, recF or recJ in S. Typhimurium UK-1, S. Typhi Ty2 and S. Paratyphi A (Table 2). We also constructed ΔrecAΔ recF and ΔrecJ Δ recF double mutants in S. Typhimurium. Deletion of recA, recF and recJ results in an increase in sensitivity to UV irradiation [36, 37]. To verify the presence of these deletions phenotypically in our strains, the UV sensitivity of the S. Typhimurium mutant strains was measured. The ΔrecF and ΔrecJ mutants showed significantly lower surviving fractions than the wild type strain after the same exposure dose (Figure 4). By contrast, after five seconds of UV exposure (16 J/m2) to 2.2 × 109 CFU of the ΔrecA62 mutant (χ9833), we were unable to recover any surviving cells (not shown). UV resistance similar to the wild-type strain χ3761 was restored to S. Typhimurium ΔrecA and ΔrecF mutants strains after introduction of recA plasmid (pYA5002) or either recF plasmid (pYA5005/pYA5006), respectively. Transformation of either mutant strain with vector plasmid pYA5001 did not restore UV resistance (Figure 4 and data not shown for recA mutant). Table 2 The bacterial strains used in this study Figure 4 UV sensitivity of S . Typhimurium rec mutants. Log phase cultures of S. Typhimurium were diluted and spread on LB agar. Multiple dilutions were exposed to 254 nm UV in a dark room at each designated dose. Then the plates were wrapped with aluminum foil and placed at 37°C overnight. Surviving fractions were calculated and shown except ΔrecA strains χ9833 and χ9833(pYA5001), for which no survivors were recovered at any UV dose. wt: χ3761; ΔrecF: χ9070; ΔrecJ: χ9072; ΔrecA(RecA+): χ9833(pYA5002); ΔrecF(vector): χ9070(pYA5001); ΔrecF(Typhimurium RecF+): χ9070(pYA5005); ΔrecF(Typhi RecF+): χ9070(pYA5006). Survival of Rec+ strains [χ3761, χ9833(pYA5002), χ9070(pYA5005) and χ9070(pYA5006)] was significantly greater than survival of the Rec- strains [χ9070, χ9072 and χ9070(pYA5001)] at the UV doses indicated (P ≤ 0.002; *). Effect of recdeletions on intraplasmid recombination To examine the influence of ΔrecA, ΔrecF and ΔrecJ mutations on intraplasmid recombination frequencies, plasmid pYA4463 (tandem duplication) or pYA4590 (tandem duplication with intervening sequence) were introduced into Salmonella rec mutants and their parental strains and analyzed as described in the Methods section. The recombination frequency of plasmid pYA4463 was approximately 1.5-5.0 × 10-3 in Rec+ Typhimurium, Typhi and Paratyphi A (Table 3). In S. Typhimurium and Paratyphi A, most of the rec deletions had no effect on the intraplasmid recombination frequency of plasmid pYA4463 except that a small, but statistically significant decrease in recombination was observed in the ΔrecA mutant of Paratyphi A. However, in both S. Typhi strains, both ΔrecF mutations resulted in approximately 10-fold decrease in recombination frequency (P < 0.01), while the ΔrecA and ΔrecJ mutations resulted in a 2-3-fold reduction (P < 0.01). In the complementation test, the recombination frequency of plasmid pYA4463 in S. Typhi χ11053 was restored to 2.52 ± 0.18 × 10-3 and 1.71 ± 0.68 × 10-3 by introduction of plasmid pYA5005 encoding S. Typhimurium recF gene and pYA5006 encoding the S. Typhi recF gene, respectively (Table 3). Table 3 Plasmid recombination frequency (Mean ± STD, × 10-3) The results with plasmid pYA4590 were also variable among strains. The recombination frequency in Rec+ S. Typhimurium and S. Paratyphi A strains was approximately 2-3 × 10-3 and in both S. Typhi strains, the frequency was 3-fold higher, at 1.16 × 10-2 (Ty2) and 1.31 × 10-2 (ISP1820). In S. Typhimurium and S. Typhi Ty2, the Δ recA and ΔrecF mutations reduced the recombination frequency of plasmid pYA4590 by 5-20-fold (P < 0.01; Table 3). The results were similar for S. Paratyphi A, though the ΔrecF mutation only led to 3-fold lower plasmid pYA4590 recombination (P < 0.01). The ΔrecJ mutation had no effect in S. Typhimurium and resulted in a 2-3-fold decrease in recombination in both S. Typhi Ty2 and S. Paratyphi A. Combining the ΔrecA ΔrecF mutations in S. Typhimurium led to a recombination frequency similar to the frequencies observed for both mutations individually, indicating no additive effect. In the complementation test, plasmid pYA5002, which encodes S. Typhimurium recA, was transformed into S. Typhimurium ΔrecA mutant χ9833(pYA4590) and S. Typhi ΔrecA mutant χ11159(pYA4590). Their respective recombination frequencies were 2.50 ± 0.42 × 10-3 and 14.35 ± 2.44 × 10-3, which were comparable to the corresponding wild type strains (P > 0.05) (Table 3). The recF-encoding plasmids pYA5005 and pYA5006 were transformed into recF mutant strains χ9070(pYA4590) and χ11053(pYA4590), respectively. The respective recombination frequencies were increased to 2.00 ± 0.24 × 10-3 and 2.86 ± 0.59 × 10-3. Effect of recdeletions on interplasmid recombination To evaluate interplasmid recombination, plasmids pYA4464 and pYA4465 were co-electroporated into the wild-type and rec deletion strains. Electroporants from each test strain were grown in LB broth containing both ampicillin and chloramphenicol to maintain selection for both plasmids. The frequency of recombination was determined as described in the Methods section. The interplasmid recombination frequency was 1-4 × 10-3 for Rec+ S. Typhimurium, S. Typhi and S. Paratyphi A strains (Table 3). For Typhimurium and Paratyphi A, the ΔrecA and each ΔrecF mutation reduced the interplasmid recombination frequency by about 3-10-fold (P < 0.01). In contrast, the ΔrecA mutation had no effect on interplasmid recombination in S. Typhi Ty2. The ΔrecF mutations did not reduce interplasmid recombination in either of the Typhi strains. Surprisingly, introduction of the ΔrecF1074 mutation into S. Typhi Ty2 resulted in significantly higher interplasmid recombination (P < 0.01). Note that we performed this analysis in eight independent experiments and observed a higher recombination frequency of interplasmid recombination each time. The ΔrecJ mutation had no significant effect in S. Typhi, and a small (< 3-fold) but significant effect in S. Typhimurium and S. Paratyphi A. The recombination frequencies were also determined in S. Typhimurium strains ΔrecA ΔrecF and ΔrecF ΔrecJ double deletions. No additive effect between the two mutations was observed with respect to each single mutation. Effect of recdeletions on chromosome related recombination To measure intrachomosomal recombination frequencies, we introduced the pYA4590-derived DNA sequence containing two truncated tetA genes (5'tet-kan-3'tet) into the S. Typhimurium chromosome at cysG. The two truncated tetA genes had 602 bp of overlapping sequence. Intrachromosomal recombination deletes the kanamycin resistance cassette and restores one intact copy of the tetA gene (Figure 2C). Deletion of recA resulted in a 5-fold reduced recombination frequency compared to the Rec+ strain χ9931 (P < 0.01), while the recF or recJ deletions had no effect, indicating that RecF and RecJ are not involved in this process (Table 4). Table 4 Chromosome related recombination in S. Typhimuriuma To examine plasmid integration, the 5'tet gene was introduced into the S. Typhimurium chromosome at cysG. The resulting strains were transformed with plasmid pYA4464 (3'tet) (Figure 1B). The 789 bp of overlapping sequence between 5'tet on the chromosome and the 3'tet on the plasmid could result in plasmid integration into the chromosome, generating an intact tetA gene (Figure 2B). Deletion of recA had a profound effect, reducing the integration frequency to less than 7 × 10-10, which was below the limits of detection in this assay (P < 0.01), indicating a strict requirement for RecA in this process. Introduction of plasmid pKD46, which encodes the λ Red recombinase, into χ9938 (ΔrecA) carrying pYA4464 restored the integration frequency to the level of the Rec+ strain χ9935. Deletion of recF reduced the frequency of integration less than 3-fold (P < 0.01; Table 4) and the ΔrecJ deletion had no effect. Effect of rec deletions on the virulence of S. Typhimurium BALB/c mice were orally inoculated with the highly virulent S. Typhimurium strain χ3761 and its rec mutant derivatives. The LD50s of χ3761, χ9070 (ΔrecF) and χ9072 (ΔrecJ) were similar, 3.2 × 104, 6.8 × 104 and 1.5 × 105 CFU, respectively (Table 5). The LD50 of the ΔrecF ΔrecJ double mutant was approximately 100-fold higher than χ3761, at 2.2 × 106 CFU. All mice inoculated with 1.3 × 109 CFU of the ΔrecA mutant survived, indicating that the LD50 was > 1.3 × 109 CFU. Two months following the initial inoculation with the Δ recA mutant strain, surviving mice were challenged with either 1.5 × 108 or 1.5 × 109 CFU of wild-type strain χ3761. All mice survived the challenge, indicating that Δ recA mutant strain χ9833 was both attenuated and immunogenic. Table 5 Virulence of S. Typhimurium rec mutants in BALB/c mice (oral inoculation) We began our studies using information gathered in E. coli as a reference point. In E. coli, recA-dependent homologous recombination relies on the RecBCD pathway, the RecFOR pathway (originally designated the RecF pathway) and the RecE pathway [38]. The RecBCD pathway is important in conjugational and transductional recombination [39], and may also be involved in the recombination of plasmids containing one or more Chi sites [40]. Recombination in small plasmids lacking a Chi sequence is primarily catalyzed by the RecFOR pathway [41]. RecF, RecO, and RecR bind to gaps of ssDNA and displace the single-strand DNA binding proteins to allow RecA to bind [42, 43]. The RecJ ssDNA exonuclease acts in concert with RecFOR to enlarge the ssDNA region when needed. Strand exchange is then catalyzed by RecA [44]. Because of their prominent role in plasmid recombination in E. coli, we analyzed the effect of mutations in recF, recJ and recA on plasmid recombination in Salmonella. Attenuated S. Typhi strains have been developed as antigen delivery vectors for human vaccine use. Due to the host restriction phenotype of S. Typhi, preliminary work is typically done in S. Typhimurium using mice as the model system to work out attenuation and antigen expression strategies. Recently, we have also been investigating attenuated derivatives of the host-restricted strain S. Paratyphi A as a human vaccine vector. Therefore, it was of interest to evaluate and compare the effects of rec mutations in these three Salmonella serovars. We selected S. Typhi strain Ty2 as exemplary of this serovar because most of the vaccines tested in clinical trials to date have been derived from this strain [45]. S. Typhi strain ISP1820 has also been evaluated in clinical trials [46, 47] and we therefore included it in some of our analyses. We found that, for some DNA substrates, the effects of ΔrecA and ΔrecF deletion mutations differed among Salmonella enterica serotypes. In particular, we found that deleting recA, recF or recJ in S. Typhi Ty2 and deleting recF in strain ISP1820 had significant effects (3-10 fold) on the recombination frequency of our direct repeat substrate, pYA4463 (Table 3). No or very limited effect (< 2 fold) was observed for our S. Typhimurium and S. Paratyphi A strains, consistent with results reported for E. coli indicating that recombination of this type of substrate is recA-independent [35]. In contrast, the ΔrecA and ΔrecF mutations resulted in lower interplasmid recombination in Typhimurium and Paratyphi A but not in Typhi strains. Deletion of recJ led to a reduction in intraplasmid recombination frequencies in S. Typhi, while no effect was seen in S. Typhimurium. The ΔrecJ mutation also affected plasmid recombination frequencies for two of the three substrates tested in S. Paratyphi A. Taken together, these results suggest that the recombination system in S. Typhi, or at least in strains Ty2 and ISP1820, is not identical to the recombination system in S. Typhimurium and S. Paratyphi A. To investigate the mechanism responsible for the observed differences, we analyzed the genome sequences of S. Typhimurium UK-1 (Luo, Kong, Golden and Curtiss, unpublished whole genome sequence), S. Paratyphi A (NC_006511) [48] and S. Typhi Ty2 (NC_004631) [49]. No paralogs of the recA, recF and recJ genes were found in the three strains. The S. Typhimurium UK-1 has RecA, RecO and RecR protein sequences identical to Typhi Ty2, and RecF and RecJ protein sequences with over 99% identity. Plasmids expressing Typhimurium recF or Typhi recF complemented the ΔrecF126 mutation in Typhi, as evidenced by the UV sensitivity profile (Figure 4) and intraplasmid recombination of pYA4463 (Table 3). Therefore, the basis for these differences are not clear and indicates that there may be other genes or gene products involved. A more detailed analysis of this phenomenon is under investigation. Plasmid recombination frequencies were higher in our Salmonella strains than those reported in E. coli. We observed intra- and interplasmid recombination frequencies on the order of 1 × 10-3 in Rec+ Salmonella, whereas measurements made in E. coli strain AB1157 using a similar plasmid system (equivalent to our substrates pYA4590 and pYA4464 + pYA4465) revealed a basal frequency around 10-fold lower, approximately 1 × 10-4 for both types of substrates [26]. Interestingly, the effect of a recF mutation in E. coli was to reduce the recombination frequency of intra- and interplasmid recombination approximately 30-fold, to roughly the same frequencies we observed for S. Typhimurium (Table 3). However, consistent with the results in E. coli, the effects of recA, recF, and recA recF mutations were similar, indicating that the mutations are epistatic. RecF has been shown previously to play a role in recombinational repair of chromosomal DNA in response to DNA damaging agents [50], including a major role in homologous recombination between direct repeats in the chromosome of S. Typhimurium. In our study, we did not observe any effect of recF on intrachromosomal recombination, although it did have an effect on the frequency of plasmid integration (Table 4). This discrepancy can be explained by the fact that we did not use DNA damaging agents in our study. These agents lead to single stranded stretches of DNA that represent substrates for recF (and recA). Our observation that recF did affect plasmid integration may reflect the presence of stretches of ssDNA in the plasmid, presumably due to supercoiling effects. To induce strong primary and memory immune responses, Salmonella delivery vectors should be sufficiently invasive and persistent to allow antigen expression in targeting organs, while maintaining a high degree of safety. This requires the use of mutations that attenuate the Salmonella vector without impairing its antigen delivery ability. Many attenuating mutations impair invasion and colonization ability. In our study, we confirmed a previous report that recF is not required for S. Typhimurium virulence in mice [51], indicating that the recF mutant remains invasive and replicates well in colonized organs. Therefore, including a ΔrecF mutation in a Salmonella vaccine strain is unlikely to affect its immunogenicity. Our results with the S. Typhimurium ΔrecA strain are consistent with two previous, independent studies showing that recA mutations reduce Salmonella virulence [51, 52]. To evaluate the potential effect of ΔrecA mutation on immunogenicity, mice inoculated with the recA mutant were challenged with a lethal dose of virulent wild-type S. Typhimurium. All the challenged mice survived, indicating that a ΔrecA mutant retains immunogenicity and therefore may be suitable for use in a vaccine. However, since it does not affect virulence, inclusion of a ΔrecF mutation into a Salmonella vector that has been attenuated by other means to reduce the frequency of intra- and interplasmid recombination, may be more desirable than a ΔrecA mutation. Studies are currently underway to investigate these possibilities. Our data show that ΔrecA and ΔrecF mutations resulted in reduced frequencies of intraplasmid recombination in all Salmonella strains tested, which included three serovars, when there was an intervening sequence between the direct duplications (Table 3). Our results also show that it is likely that deletions in recA, recF or recJ will not be useful for reducing interplasmid recombination in S. Typhi vaccine strains, since we did not observe any reduction in interplasmid recombination frequency. This result was disappointing, since the majority of human trials with live Salmonella vaccines have focused on S. Typhi. In the case of S. Typhi, it appears that the best approach to preventing interplasmid recombination will be in the careful design of each plasmid, avoiding any stretches of homology. However, for vaccines based on S. Typhimurium or S. Paratyphi A, introduction of a ΔrecF mutation into attenuated Salmonella vaccine strains carrying multiple plasmids is a useful approach to reduce unwanted plasmid/plasmid or plasmid/chromosome recombination without further attenuating the strain or negatively influencing its immunogenicity. The ΔrecA mutation had a similar or more pronounced effect on reducing various classes of recombination and it clearly had an effect on virulence. We did not examine the effect of a ΔrecA mutation on the immunogenicity of a vectored antigen. Based on its effect on virulence, it may affect the immunogenicity of the vectored antigen in some attenuation backgrounds and therefore may not be applicable for all attenuation strategies. In this study we showed that ΔrecA and ΔrecF mutations reduce intraplasmid recombination in S. Typhimurium, S. Typhi and S. Paratyphi while there is an intervening sequence between the duplicated sequences. The ΔrecA and ΔrecF mutations reduce interplasmid recombination in S. Typhimurium and S. Paratyphi but not in S. Typhi. The ΔrecF mutations also sharply reduce intraplasmid recombination between direct duplications in S. Typhi. Since ΔrecA mutation results in an avirulent Salmonella strain, the ΔrecF mutation is ideal for reducing plasmid recombination in Salmonella delivery vectors without impairing the virulence. The intrachromosomal recombination and plasmid integration are 2-3 orders lower than plasmid recombination, therefore are less concerned. These information help develop Salmonella delivery vectors able to stably maintain plasmid cargoes for vaccine development and gene therapy. Bacterial strains and media E. coli K-12 strain EPI300™ was used for cloning and stable maintenance of plasmids. All Salmonella strains used in this work were derived from Salmonella enterica serovar Typhimurium wild-type (wt) strain χ3761 (UK-1), serovar Typhi strains Ty2 and ISP1820 or serovar Paratyphi A strain χ8387. Their origin and relevant genotypes are presented in Table 2. Bacteria were grown in LB broth [53]. Plasmid construction All plasmids used in this study and their relevant characteristics are presented in Table 1. Primers used for plasmid construction are shown in Table 6. All enzymes were obtained from New England Biolabs or Promega. Table 6 Primers used in this study To construct plasmid pYA4463 (Figure 1 panel A), a XbaI-HincII fragment containing the tetA promoter and 568 bp of the 5' end of tetA, was excised from pACYC184 and ligated into XbaI-EcoRV digested pACYC184. To generate plasmid pYA4590 (Figure 1 panel A), the 5' end of tetA gene together with its promoter was amplified from pACYC184 with primers P1 and P2, which contain engineered XbaI and KpnI restriction sites, respectively. The resulting PCR fragment was digested with XbaI and KpnI. The kan gene was amplified from plasmid p15A-PB2-kan, a pACYC184 derivative carrying a influenza virus PB2 gene and a kan cassette, with primers P3 and P4, which were engineered to contain KpnI and BamHI sites, respectively. The resulting PCR fragment was digested with KpnI and BamHI. The two digested PCR fragments were ligated into pACYC184 digested with XbaI and BamHI. The resulting plasmid, pYA4590, contains the tetA promoter and 891 bp of the 5' end of tetA, a 1041-bp fragment encoding kan and its promoter followed by 902 bp of the 3'end of tetA. To construct plasmid pYA4464 (Figure 1 panel B), plasmid pACYC184 was digested with XbaI and EcoRV to remove the 5' 102 bp of the tetA gene and the tetA promoter. The cohesive ends were filled using the Klenow large fragment of DNA polymerase and the linear plasmid was self-ligated to yield plasmid pYA4464. To construct plasmid pYA4465 (Figure 1 panel B), the 5' 853 bp of tetA together with its promoter was amplified from pACYC184 using primers P5 and P6, which were engineered with SmaI and BglII sites, respectively. The resulting PCR fragment was digested with SmaI and BglII, and ligated to EcoRV and BglII digested pBAD-HisA. Creation of recdeletions The recA62 deletion, which deletes 1062 bp, encompassing the entire recA open reading frame, introduced into the bacterial chromosome using either λ Red recombinase-mediated recombination [54], or conjugation with E. coli strain χ7213(pYA4680) followed by selection/counterselection with chloramphenicol and sucrose, respectively [55]. The cat-sacB cassette was amplified from plasmid pYA4373 by PCR with primers P7 and P8 to add flanking sequence. The PCR product was further amplified with primer P9 and P10 to extend the flanking sequence. Those two steps of amplification resulted in the cat-sacB cassette flanked by 100 bp of recA flanking sequences at both ends. The PCR product was purified with QIAquick Gel Extraction Kit (QIAGEN) and electroporated into Salmonella strains carrying plasmid pKD46 to facilitate replacement of the recA gene with the cat-sacB cassette. Electroporants containing the cat-sacB cassette were selected on LB plates containing 12.5 μg chloramphenicol ml-1. From S. Typhimurium chromosome, a 500-bp sequence upstream recA gene was amplified with primers P11 and primer P12 and a 500-bp sequence downstream recA gene was amplified with primers P13 and P14. Primers P12 and P13 were engineered with a KpnI site. The two PCR fragments were digested with KpnI, ligated and amplified with primers P11 and P14. The resulting PCR product was digested with isocaudarner SpeI and XbaI and ligated into XbaI-digested pRE112 to yield plasmid pYA4680. In addition, undigested, agarose-gel purified PCR product was electroporated into the cat-sacB Salmonella strains carrying plasmid pKD46 and spread onto LB plates containing 5% sucrose to select for deletion of the cat-sacB cassette. Chloramphenicol-sensitive isolates were verified as ΔrecA62 by PCR using primers P15 and P16 (ΔrecA62: 1360 bp; wt: 2412 bp). S. Typhimurium strains χ9833 and χ9939 were constructed by this method (Table 2). For construction of a ΔrecA62 mutant of S. Typhi, wild-type strain Ty2 was mated with E. coli strain χ7213(pYA4680). Transconjugants were selected on LB plates containing chloramphenicol, followed by counterselection on sucrose plates as described above. The resulting ΔrecA62 strain was designated χ11159. The S. Paratyphi A strain χ11243 was generated from wild-type strain χ8387 using the same strategy. The ΔrecF deletion strains were constructed using suicide vectors pYA3886 and pYA4783. From the S. Typhimurium chromosome, a 397-bp sequence upstream of the recF gene was amplified with primers P17 and P18, which were engineered with XbaI and KpnI sites, respectively. The downstream 296-bp sequence (including 78 bp from the 3' ORF of recF) was amplified with primers P19 and P20 containing KpnI and SphI sites, respectively. The two fragments were digested and inserted into XbaI-SphI digested pRE112, resulting in plasmid pYA3886. The corresponding deletion was designated ΔrecF126. Strains χ9070, χ9081 and χ11244 were generated by conjugation using E. coli strain χ7213(pYA3886). Phage P22HTint mediated transduction was used to construct Typhi strain χ11053 [56]. The ΔrecF126 deleted 996 bp from the 5'end of recF in serovars Typhimurium and Paratyphi. The upstream flanking sequence of S. Typhi is different with the other serotypes. To construct a serovar Typhi-specific ΔrecF mutation, we constructed a new suicide vector. The recF upstream flanking sequence in plasmid pYA3886 was replaced with the corresponding DNA sequence (447 bp) from S. Typhi Ty2. Primers P21 and P22 were used for this modification. The resulting plasmid was designated as pYA4783. The Typhi-specific ΔrecF1074 mutation was introduced into S. Typhi strains ISP1820 and Ty2 by conjugation with E. coli strain χ7213(pYA4783) to yield strains χ11133 and χ11134, respectively. Primers P23 and P24 were used to verify the recF126 and recF1074 deletions. Similar strategies were used to construct the Δ recJ1315 deletion with suicide vector pYA3887. From the S. Typhimurium chromosome, 330 bp upstream of the recJ gene was amplified with primers P25 and P26, which were engineered with XbaI and KpnI sites, respectively. The 299-bp downstream sequence was amplified with primers P27 and P28, engineered with KpnI and SphI sites, respectively. The two fragments were digested and ligated with XbaI-SphI digested pRE112. The resulting plasmid was designated pYA3887 and the corresponding deletion was named ΔrecJ1315. Strains χ9072 and χ11245 were generated by conjugating the parental strains with E. coli strain χ7213(pYA3887). Strain χ11194 was constructed by phage P22HTint mediated transduction. The ΔrecJ1315 mutation is a deletion of the entire recJ gene (1734 bp). Primers P29 and P30 were used to verify the recJ1315 deletion (ΔrecJ1315: 736 bp; wt: 2461 bp). To test chromosome-related recombination, the 5'tet and 3'tet fragments were inserted into the cysG gene of each S. Typhimurium strain using the λ Red system. The 460-bp fragment of the cysG gene was amplified using primers P31 and P32 that were engineered with HindIII and BglII sites, respectively. The PCR product was digested with HindIII and BglII. A 480 bp adjoining fragment of cysG was amplified with primers P33 and P34. Primer P33 was engineered with BglII and PstI sites and primer P34 was engineered with a SacI site. The PCR product was digested with BglII and SacI. The two digested PCR fragments were ligated into HindIII and SacI digested pYA4518, deleting green fluorescent protein (GFP) gene. The resulting plasmid pYA4518-cysG has BssHII and PstI sites between the two cysG-fragments. This plasmid was digested with BssHII, followed by treatment with the Klenow large fragment. The linear plasmid was further digested with PstI for insertion of truncated tetA genes. The 5'tet-kan-3'tet cassette was amplified from pYA4590 with primers P35 and P36. Primer P36 was engineered with a PstI site. The PCR product was digested with PstI and inserted between the cysG fragments in pYA4518-cysG to yield plasmid pYA4689. The 5'tet-kan cassette was amplified from pYA4590 with primers P35 and P37. Primer P37 was engineered with a PstI site. The PCR product was digested with PstI and inserted into treated pYA4518-cysG to obtain plasmid pYA4690. The 5'tet-kan-3'tet cassette, together with cysG flanking sequences, was amplified from pYA4689 using primers P31 and P34. The PCR product was electroporated into strains χ3761(pKD46), χ9070(pKD46), χ9072(pKD46) and χ9833(pKD46) with selection on LB plates containing 25 μg/ml chloramphenicol. After growth at 37°C to cure plasmid pKD46, the resulting strains containing chromosomal copies of the 5'tet-kan-3'tet cassette in cysG were designated χ9931 (Rec+), χ9932 (ΔrecF), χ9933 (ΔrecJ) and χ9934 (ΔrecA), respectively. Primers P38 and P39 were used to verify insertion in the cysG gene. The 5'tet-kan cassette together with cysG flanking sequences was amplified from pYA4690 with primers P31 and P34. Using the same strategy, the PCR product was electroporated into pKD46 transformants of strains χ3761, χ9070, χ9072 and χ9833 to yield strains χ9935 (Rec+), χ9936 (ΔrecF), χ9937 (ΔrecJ) and χ9938 (ΔrecA), respectively, each containing the 5'tet-kan cassette inserted into cysG. These strains were transformed with plasmid pYA4464 to test plasmid integration based on the 789-bp of tetA sequence common to both the plasmid and the bacterial chromosome. Analysis of recombination frequency To examine plasmid recombination and plasmid integration, plasmid(s) containing truncated tetA genes were introduced into Salmonella strains with or without rec mutations. The resulting strains were inoculated into 3 ml of LB broth supplemented with 100 μg/ml ampicillin and/or 25 μg/ml chloramphenicol, as needed. After 8 h growth at 37°C, bacteria were serially diluted in 10-fold steps. 100 μl of the 10-2, 10-3 or 10-4 dilution were spread onto LB-agar plates supplemented with 10 μg tetracycline ml-1 and 100 μl of the 10-5, 10-6 or 10-7 dilutions were spread onto LB-agar plates with or without the addition of antibiotics, as needed. Plates were incubated overnight at 37°C. The ratio of tetracycline resistant colonies to total colonies was calculated as the recombination frequency. The average mean frequency was calculated using the frequencies obtained from 3-10 assays for each strain. Following one-way ANOVA, the Dunnett's test was used to compare multiple groups against the control. The Student's t-test was used to analyze two independent samples. Complementation of recmutation Plasmid pYA5001 has a pSC101 ori, a gentamicin resistance marker and a prokaryotic green fluorescent protein (GFP) gene cassette flanked by two AhdI sites. A linearized T vector for cloning PCR products can be obtained by removing the GFP cassette by AhdI digestion. The recA genes from S. Typhimurium and S. Typhi were amplified using their respective chromosomal DNAs as template with primers P40 and P41. The recF genes were amplified similarly using primers P42 and P43. The forward primer P42 was engineered to include the S. Typhimurium lpp promoter sequence ttctcaacataaaaaagtttgtgtaatact (the -35 and -10 boxes are underlined). Amplified DNA fragment were treated with Taq DNA polymerase in the presence of dATP to add 3' A overhangs. Then the treated PCR products were cloned into pYA5001-derived T vector to yield recA plasmids pYA5002 (Typhimurium) and pYA5004 (Typhi), and recF plasmids pYA5005 (Typhimurium) and pYA5006 (Typhi). The recA plasmids, recF plasmids or empty vector plasmid pYA5001 were transformed into S. Typhimurium recA or recF mutants, respectively for complementation studies. The recA and recF plasmids were also introduced into Salmonella strains carrying pYA4590 or pYA4463 to complement the rec mutation and measure the plasmid recombination frequency. UV sensitivity test Quantitative UV killing curves were measured as described previously [57]. Briefly, cells were grown in 3 ml of LB broth at 37°C with vigorous shaking to mid-log phase. The cells were then 10 fold serially diluted in buffered saline with gelatin (BSG) and spread on LB agar plates. Multiple dilutions were exposed to 254 nm UV in a dark room at each designated dose. Then the plates were wrapped with aluminum foil and placed at 37°C overnight. The 10-6 dilutions were not exposed to UV to determine the total bacterial cell numbers present in the culture. Surviving fractions were calculated as the CFU remaining after UV exposure/total CFU present. Virulence determination of the recmutants Eight-week old BALB/c female mice were purchased from Charles River Laboratories (Wilmington, MA). Mice were held in quarantine for 1 week before use in experiments. Food and water were deprived 6 h before administration of bacteria. Each mouse was orally inoculated with 20 μl of Salmonella suspended in buffered saline with gelatin (BSG) by pipet feeding. Food and water were returned 30 min after inoculation. All mice were observed for a month to record mortality. The 50% lethal dose (LD50) was determined via the Reed and Muench method [58]. Surviving mice were challenged orally with wild-type Salmonella χ3761 two months after the first inoculation. 1. 1. Levine MM, Ferreccio C, Abrego P, Martin OS, Ortiz E, Cryz S: Duration of efficacy of Ty21a, attenuated Salmonella Typhi live oral vaccine. Vaccine. 1999, 17 (Suppl 2): S22-27. 10.1016/S0264-410X(99)00231-5. 2. 2. Curtiss R: Bacterial infectious disease control by vaccine development. J Clin Invest. 2002, 110 (8): 1061-1066. 3. 3. Tacket CO, Levine MM: CVD 908, CVD 908-htrA, and CVD 909 live oral typhoid vaccines: a logical progression. Clin Infect Dis. 2007, 45 (Suppl 1): S20-23. 10.1086/518135. 4. 4. Lewis GK: Live-attenuated Salmonella as a prototype vaccine vector for passenger immunogens in humans: are we there yet?. Expert Rev Vaccines. 2007, 6 (3): 431-440. 10.1586/14760584.6.3.431. 5. 5. Darji A, Guzman CA, Gerstel B, Wachholz P, Timmis KN, Wehland J, Chakraborty T, Weiss S: Oral somatic transgene vaccination using attenuated S. Typhimurium. Cell. 1997, 91 (6): 765-775. 10.1016/S0092-8674(00)80465-1. 6. 6. Mollenkopf H, Dietrich G, Kaufmann SH: Intracellular bacteria as targets and carriers for vaccination. Biol Chem. 2001, 382 (4): 521-532. 10.1515/BC.2001.066. 7. 7. Cheminay C, Hensel M: Rational design of Salmonella recombinant vaccines. Int J Med Microbiol. 2008, 298 (1-2): 87-98. 10.1016/j.ijmm.2007.08.006. 8. 8. Kwon YM, Cox MM, Calhoun LN: Salmonella-based vaccines for infectious diseases. Expert Rev Vaccines. 2007, 6 (2): 147-152. 10.1586/14760584.6.2.147. 9. 9. Schoen C, Stritzker J, Goebel W, Pilgrim S: Bacteria as DNA vaccine carriers for genetic immunization. Int J Med Microbiol. 2004, 294 (5): 319-335. 10.1016/j.ijmm.2004.03.001. 10. 10. Vassaux G, Nitcheu J, Jezzard S, Lemoine NR: Bacterial gene therapy strategies. J Pathol. 2006, 208 (2): 290-298. 10.1002/path.1865. 11. 11. Moreno M, Kramer MG, Yim L, Chabalgoity JA: Salmonella as live trojan horse for vaccine development and cancer gene therapy. Curr Gene Ther. 2010, 10 (1): 56-76. 10.2174/156652310790945566. 12. 12. Zhang L, Gao L, Zhao L, Guo B, Ji K, Tian Y, Wang J, Yu H, Hu J, Kalvakolanu DV, et al: Intratumoral delivery and suppression of prostate tumor growth by attenuated Salmonella enterica serovar Typhimurium carrying plasmid-based small interfering RNAs. Cancer Res. 2007, 67 (12): 5859-5864. 10.1158/0008-5472.CAN-07-0098. 13. 13. Bai Y, Li H, Vu GP, Gong H, Umamoto S, Zhou T, Lu S, Liu F: Salmonella-mediated delivery of RNase P-based ribozymes for inhibition of viral gene expression and replication in human cells. Proc Natl Acad Sci USA. 2010, 107 (16): 7269-7274. 10.1073/pnas.0912813107. 14. 14. Cicin-Sain L, Brune W, Bubic I, Jonjic S, Koszinowski UH: Vaccination of mice with bacteria carrying a cloned herpesvirus genome reconstituted in vivo. J Virol. 2003, 77 (15): 8249-8255. 10.1128/JVI.77.15.8249-8255.2003. 15. 15. Curtiss R: Antigen delivery systems: Development of live recombinant attenuated bacterial antigen and DNA vaccine delivery vector vaccines. Mucosal Immunology. Edited by: Mestecky J, Lamm ME, Strober W, Bienenstock J, McGhee JR, Mayer L. 2005, San Diego: Elsevier Academic Press, 1009-1037. full_text. 16. 16. Luo Y, Zhou H, Mizutani M, Mizutani N, Reisfeld RA, Xiang R: Transcription factor Fos-related antigen 1 is an effective target for a breast cancer vaccine. Proc Natl Acad Sci USA. 2003, 100 (15): 8850-8855. 10.1073/pnas.1033132100. 17. 17. Zhang X, Kong W, Ashraf S, Curtiss R: A one-plasmid system to generate influenza virus in cultured chicken cells for potential use in influenza vaccine. J Virol. 2009, 83 (18): 9296-9303. 10.1128/JVI.00781-09. 18. 18. Li Y, Wang S, Scarpellini G, Gunn B, Xin W, Wanda SY, Roland KL, Curtiss R: Evaluation of new generation Salmonella enterica serovar Typhimurium vaccines with regulated delayed attenuation to induce immune responses against PspA. Proc Natl Acad Sci USA. 2009, 106 (2): 593-598. 10.1073/pnas.0811697106. 19. 19. Curtiss R, Wanda SY, Gunn BM, Zhang X, Tinge SA, Ananthnarayan V, Mo H, Wang S, Kong W: Salmonella enterica serovar Typhimurium strains with regulated delayed attenuation in vivo. Infect Immun. 2009, 77 (3): 1071-1082. 10.1128/IAI.00693-08. 20. 20. Konjufca V, Jenkins M, Wang S, Juarez-Rodriguez MD, Curtiss R: Immunogenicity of recombinant attenuated Salmonella enterica serovar Typhimurium vaccine strains carrying a gene that encodes Eimeria tenella antigen SO7. Infect Immun. 2008, 76 (12): 5745-5753. 10.1128/IAI.00897-08. 21. 21. Xin W, Wanda SY, Li Y, Wang S, Mo H, Curtiss R: Analysis of type II secretion of recombinant pneumococcal PspA and PspC in a Salmonella enterica serovar Typhimurium vaccine with regulated delayed antigen synthesis. Infect Immun. 2008, 76 (7): 3241-3254. 10.1128/IAI.01623-07. 22. 22. Wang S, Li Y, Scarpellini G, Kong W, Shi H, Baek CH, Gunn B, Wanda SY, Roland KL, Zhang X, et al: Salmonella vaccine vectors displaying delayed antigen synthesis in vivo to enhance immunogenicity. Infect Immun. 2010, 78 (9): 3969-3980. 10.1128/IAI.00444-10. 23. 23. Kong W, Wanda SY, Zhang X, Bollen W, Tinge SA, Roland KL, Curtiss R: Regulated programmed lysis of recombinant Salmonella in host tissues to release protective antigens and confer biological containment. Proc Natl Acad Sci USA. 2008, 105 (27): 9361-9366. 10.1073/pnas.0803801105. 24. 24. Ameiss K, Ashraf S, Kong W, Pekosz A, Wu WH, Milich D, Billaud JN, Curtiss R: Delivery of woodchuck hepatitis virus-like particle presented influenza M2e by recombinant attenuated Salmonella displaying a delayed lysis phenotype. Vaccine. 28 (41): 6704-6713. 10.1016/j.vaccine.2010.07.083. 25. 25. Laban A, Cohen A: Interplasmidic and intraplasmidic recombination in Escherichia coli K12. Mol Gen Genet. 1981, 184 (2): 200-207. 26. 26. Cohen A, Laban A: Plasmidic recombination in Escherichia coli K12: the role of recF gene function. Mol Gen Genet. 1983, 189 (3): 471-474. 10.1007/BF00325911. 27. 27. Fishel RA, James AA, Kolodner R: recA-independent general genetic recombination of plasmids. Nature. 1981, 294 (5837): 184-186. 10.1038/294184a0. 28. 28. Matfield M, Badawi R, Brammar WJ: Rec-dependent and Rec-independent recombination of plasmid-borne duplications in Escherichia coli K12. Mol Gen Genet. 1985, 199 (3): 518-523. 10.1007/BF00330768. 29. 29. James AA, Morrison PT, Kolodner R: Genetic recombination of bacterial plasmid DNA. Analysis of the effect of recombination-deficient mutations on plasmid recombination. J Mol Biol. 1982, 160 (3): 411-430. 10.1016/0022-2836(82)90305-9. 30. 30. Kolodner R, Fishel RA, Howard M: Genetic recombination of bacterial plasmid DNA: effect of RecF pathway mutations on plasmid recombination in Escherichia coli. J Bacteriol. 1985, 163 (3): 1060-1066. 31. 31. Smith GR: Homologous recombination in procaryotes. Microbiol Rev. 1988, 52 (1): 1-28. 32. 32. Kolodner R, Fishel RA, Howard M: Genetic recombination of bacterial plasmid DNA: effect of RecF pathway mutations on plasmid recombination in Escherichia coli. J Bacterio. 1985, 163 (3): 1060-1066. 33. 33. Cox MM: A broadening view of recombinational DNA repair in bacteria. Genes Cells. 1998, 3 (2): 65-78. 10.1046/j.1365-2443.1998.00175.x. 34. 34. McClelland M, Sanderson KE, Spieth J, Clifton SW, Latreille P, Courtney L, Porwollik S, Ali J, Dante M, Du F, et al: Complete genome sequence of Salmonella enterica serovar Typhimurium LT2. Nature. 2001, 413 (6858): 852-856. 10.1038/35101614. 35. 35. Bi X, Liu LF: recA-independent and recA-dependent intramolecular plasmid recombination. Differential homology requirement and distance effect. J Mol Biol. 1994, 235 (2): 414-423. 10.1006/jmbi.1994.1002. 36. 36. Kato T, Rothman RH, Clark AJ: Analysis of the role of recombination and repair in mutagenesis of Escherichia coli by UV irradiation. Genetics. 1977, 87 (1): 1-18. 37. 37. Mahan MJ, Casadesus J, Roth JR: The Salmonella Typhimurium RecJ function permits growth of P22 abc phage on recBCD+ hosts. Mol Gen Genet. 1992, 232 (3): 470-478. 10.1007/BF00266252. 38. 38. Clark AJ: rec genes and homologous recombination proteins in Escherichia coli. Biochimie. 1991, 73 (4): 523-532. 10.1016/0300-9084(91)90124-J. 39. 39. Kowalczykowski SC, Dixon DA, Eggleston AK, Lauder SD, Rehrauer WM: Biochemistry of homologous recombination in Escherichia coli. Microbiol Rev. 1994, 58 (3): 401-465. 40. 40. Zaman MM, Boles TC: Plasmid recombination by the RecBCD pathway of Escherichia coli. J Bacteriol. 1996, 178 (13): 3840-3845. 41. 41. Persky NS, Lovett ST: Mechanisms of recombination: lessons from E. coli. Crit Rev Biochem Mol Biol. 2008, 43 (6): 347-370. 10.1080/10409230802485358. 42. 42. Webb BL, Cox MM, Inman RB: Recombinational DNA repair: the RecF and RecR proteins limit the extension of RecA filaments beyond single-strand DNA gaps. Cell. 1997, 91 (3): 347-356. 10.1016/S0092-8674(00)80418-3. 43. 43. Morimatsu K, Kowalczykowski SC: RecFOR proteins load RecA protein onto gapped DNA to accelerate DNA strand exchange: a universal step of recombinational repair. Mol Cell. 2003, 11 (5): 1337-1347. 10.1016/S1097-2765(03)00188-6. 44. 44. Lusetti SL, Cox MM: The bacterial RecA protein and the recombinational DNA repair of stalled replication forks. Annu Rev Biochem. 2002, 71: 71-100. 10.1146/annurev.biochem.71.083101.133940. 45. 45. Levine MM, Tacket CO, Sztein MB: Host-Salmonella interaction: human trials. Microbes Infect. 2001, 3 (14-15): 1271-1279. 10.1016/S1286-4579(01)01487-3. 46. 46. Tacket CO, Hone DM, Curtiss R, Kelly SM, Losonsky G, Guers L, Harris AM, Edelman R, Levine MM: Comparison of the safety and immunogenicity of ΔaroC ΔaroD and Δcya Δcrp Salmonella Typhi strains in adult volunteers. Infect Immun. 1992, 60 (2): 536-541. 47. 47. Frey SE, Bollen W, Sizemore D, Campbell M, Curtiss R: Bacteremia associated with live attenuated χ8110 Salmonella enterica serovar Typhi ISP1820 in healthy adult volunteers. Clin Immunol. 2001, 101 (1): 32-37. 10.1006/clim.2001.5088. 48. 48. McClelland M, Sanderson KE, Clifton SW, Latreille P, Porwollik S, Sabo A, Meyer R, Bieri T, Ozersky P, McLellan M, et al: Comparison of genome degradation in Paratyphi A and Typhi, human-restricted serovars of Salmonella enterica that cause typhoid. Nat Genet. 2004, 36 (12): 1268-1274. 10.1038/ng1470. 49. 49. Deng W, Liou SR, Plunkett G, Mayhew GF, Rose DJ, Burland V, Kodoyianni V, Schwartz DC, Blattner FR: Comparative genomics of Salmonella enterica serovar Typhi strains Ty2 and CT18. J Bacteriol. 2003, 185 (7): 2330-2337. 10.1128/JB.185.7.2330-2337.2003. 50. 50. Espinosa-Aguirre J, Barajas-Lemus C, Hernandez-Ojeda S, Govezensky T, Rubio J, Camacho-Carranza R: RecBCD and RecFOR dependent induction of chromosomal deletions by sodium selenite in Salmonella. Mutat Res. 2009, 665 (1-2): 14-19. 51. 51. Cano DA, Pucciarelli MG, Garcia-del Portillo F, Casadesus J: Role of the RecBCD recombination pathway in Salmonella virulence. J Bacteriol. 2002, 184 (2): 592-595. 10.1128/JB.184.2.592-595.2002. 52. 52. Buchmeier NA, Lipps CJ, So MY, Heffron F: Recombination-deficient mutants of Salmonella Typhimurium are avirulent and sensitive to the oxidative burst of macrophages. Mol Microbiol. 1993, 7 (6): 933-936. 10.1111/j.1365-2958.1993.tb01184.x. 53. 53. 54. 54. Sun W, Wang S, Curtiss R: Highly efficient method for introducing successive multiple scarless gene deletions and markerless gene insertions into the Yersinia pestis chromosome. Appl Environ Microbiol. 2008, 74 (13): 4241-4245. 10.1128/AEM.00940-08. 55. 55. Roland K, Curtiss R, Sizemore D: Construction and evaluation of a Δcya Δcrp Salmonella Typhimurium strain expressing avian pathogenic Escherichia coli O78 LPS as a vaccine to prevent airsacculitis in chickens. Avian Dis. 1999, 43 (3): 429-441. 10.2307/1592640. 56. 56. Kang HY, Dozois CM, Tinge SA, Lee TH, Curtiss R: Transduction-mediated transfer of unmarked deletion and point mutations through use of counterselectable suicide vectors. J Bacteriol. 2002, 184 (1): 307-312. 10.1128/JB.184.1.307-312.2002. 57. 57. Knudson GB: Photoreactivation of UV-irradiated Legionella pneumophila and other Legionella species. Appl Environ Microbiol. 1985, 49 (4): 975-980. 58. 58. Reed LJ, Muench H: A simple method of estimating fifty percent endpoints. Am J Hyg. 1937, 27 (3): 493-497. 59. 59. Chang AC, Cohen SN: Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J Bacteriol. 1978, 134 (3): 1141-1156. 60. 60. 61. 61. Edwards RA, Keller LH, Schifferli DM: Improved allelic exchange vectors and their use to analyze 987P fimbria gene expression. Gene. 1998, 207 (2): 149-157. 10.1016/S0378-1119(97)00619-7. 62. 62. Zhang X, Kelly SM, Bollen WS, Curtiss R: Characterization and immunogenicity of Salmonella Typhimurium SL1344 and UK-1 Δcrp and Δcdt deletion mutants. Infect Immun. 1997, 65 (12): 5381-5387. 63. 63. Santander J, Wanda SY, Nickerson CA, Curtiss R: Role of RpoS in fine-tuning the synthesis of Vi capsular polysaccharide in Salmonella enterica serotype Typhi. Infect Immun. 2007, 75 (3): 1382-1392. 10.1128/IAI.00888-06. Download references This work was supported by grants from the National Institutes of Health (AI065779) and the Bill & Melinda Gates Foundation (no. 37863). Author information Correspondence to Roy Curtiss III. Additional information Competing interests The authors declare that they have no competing interests. Authors' contributions RC, XMZ and WK conceived and designed the study. XMZ, SYW and KB constructed plasmids and Salmonella strains. XMZ performed all DNA recombination assays. XMZ, WK and XZ carried out the animal experiment. XMZ and KR performed UV killing experiment and wrote the manuscript. All authors read and approved the final manuscript. Authors’ original submitted files for images Authors’ original file for figure 1 Authors’ original file for figure 2 Authors’ original file for figure 3 Authors’ original file for figure 4 Rights and permissions Reprints and Permissions About this article • Recombination Frequency • tetA • Delivery Vector • Plasmid Integration • tetA Gene
Chapter 1: Defining Arizona’s Riparian Areas and their Importance to the Landscape Defining Riparian Areas, page 2 Riparian areas processes vary depending on where you are in the United States. There is significant variability in water availability and the pathways water follows to reach riparian areas in different regions. Figure 1.21.Difference in the pathways water follows to reach the stream in mesic (humid) and arid (dry) regions. These differences can significantly influence riparian areas. In the eastern United States, that are mesic regions, precipitation water primarily infiltrates into the soils before it reaches the stream. In contrast in the western United States, that are arid regions, precipitation water moves across the soil surface as overland flow before it reaches the streams.
A bishop is an ordained or consecrated member of the Christian clergy who is generally entrusted with a position of authority and oversight. The office of bishop is one of the three ministerial offices within Christianity, the other two being those of priest and deacon. Within the Roman Catholic, Eastern Orthodox, Oriental Orthodox, Assyrian Church of the East and Anglican churches, bishops claim Apostolic Succession, a direct historical lineage dating back to the original Twelve Apostles. Within these churches, bishops can ordain clergy including other bishops. Some Protestant churches including the Lutheran and Methodist churches have bishops serving similar functions as well, though not understood to be within Apostolic Succession in the same sense. The Church of Jesus Christ of Latter-Day Saints church also has bishops, who serve as spiritual leaders of local congregations (wards). Bishops are of a higher rank than priests. The office of bishop was already quite distinct from that of priest in the writings of Ignatius of Antioch (died c. 107), and by the middle of the second century all the chief centres of Christianity were headed by bishops, a form of organization that remained universal until the Protestant Reformation."bishop." Cross, F. L., ed. The Oxford Dictionary of the Christian Church. New York: Oxford University Press. 2005] "Bishop" comes from the Greek word "episkopos" (ἐπίσκοπος, from ἐπί "over" and σκοπός "seeing") which can be translated "overseer", "superintendent", "supervisor", "the first", "leader" or "foreman". From the word "episkopos" are derived the English words "episcopacy", "episcopate" and "episcopal". The system of church government by bishops is called "episcopacy." Bishops in the New Testament The New Testament uses the word "episkopos" five times. *Acts of the Apostles niv|Acts|20:28|20:28 *Epistle to the Philippians niv|Philippians|1:1|1:1 *First Epistle to Timothy [;&version=31; 3:2] *Epistle to Titus niv|Titus|1:7|1:7 *First Epistle of Peter [;&version=31; 2:25] Words related to "episkopos" are used in two other verses. Some English Bibles transliterate this word as "bishop" (KJV, RSV, NRSV, etc.), while others use a more basic translation such as "overseer" (NIV, ESV, etc.). Biblical scholars differ on which, if any, of these verses refer specifically to ordained bishops as we understand them, and which simply refer to a generic "overseer" capacity. The ministry of these New Testament "episkopoi", according to some writers, was not explicitly commissioned by Jesus Christ as far as the Gospels tell, but appears to be a natural, practical development of the church of the apostles during the first and second centuries AD. Others maintain that the episcopal structure of the Church was present from the beginning, being a direct institution by Jesus, referring to the apostles who clearly led the first local churches, governed and laid hands on the clergy and faithful. Supporting this latter view, the portions of the New Testament that mention "episkopoi" do not appear to be ordering a new type of ministry, but giving instructions for an already existing position within the early Church. In places (particularly in the verses from the Epistle to Titus) it appears that the position of "episkopos" is often similar or the same as that of "presbyter" ("πρεσβυτερος"), or elder and (or) priest. The Epistle to Timothy mentions deacons ("διακονοι") in a manner that suggests that the office of deacon differs from the office of the bishop, and is subordinate to it, though it carries similar qualifications. Some references indicate that a congregation might have multiple "episkopoi", which is different than the bishop's role as it came to be established in the 2nd century. In the Acts of the Apostles, episkopoi are mentioned as being "shepherds" of the "flock", imagery that is still in use today. The other passages from the New Testament describe them as stewards, leaders or administrators, and teachers. In 1 Timothy episkopoi are required to be 'the husband of but one wife'. Thus, it is clear that the New Testament has no prohibition against bishops being married and already having children. The most famous example of this is the Apostle Peter himself, who was married and had children. It remains unclear however, whether a kind of celibacy or abstinence had to be practiced by these first bishops and apostles after their appointment or episcopal consecration (see also clerical celibacy). It is interesting to note that in the second chapter of 1 Peter, Jesus is described as 'the Shepherd and "Episkopos" of your souls' ("τον ποιμενα και επισκοπον των ψυχων υμων"). Bishops in the Apostolic Fathers Around the end of the first century AD, the church's organization becomes clearer in historical documents. In the works of the Apostolic Fathers, and Ignatius of Antioch in particular, the role of the episkopos, or bishop, became more important or, rather, already was very important and being clearly defined. "Plainly therefore we ought to regard the bishop as the Lord Himself" &mdash; Epistle of Ignatius to the Ephesians 6:1. "your godly bishop" &mdash; Epistle of Ignatius to the Magnesians 2:1. "the bishop presiding after the likeness of God and the presbyters after the likeness of the council of the Apostles, with the deacons also who are most dear to me, having been entrusted with the diaconate of Jesus Christ" &mdash; Epistle of Ignatius to the Magnesians 6:1. "Therefore as the Lord did nothing without the Father, [being united with Him] , either by Himself or by the Apostles, so neither do ye anything without the bishop and the presbyters." &mdash; Epistle of Ignatius to the Magnesians 7:1. "Be obedient to the bishop and to one another, as Jesus Christ was to the Father [according to the flesh] , and as the Apostles were to Christ and to the Father, that there may be union both of flesh and of spirit." &mdash; Epistle of Ignatius to the Magnesians 13:2. "In like manner let all men respect the deacons as Jesus Christ, even as they should respect the bishop as being a type of the Father and the presbyters as the council of God and as the college of Apostles. Apart from these there is not even the name of a church." &mdash; Epistle of Ignatius to the Trallesians 3:1. "follow your bishop, as Jesus Christ followed the Father, and the presbytery as the Apostles; and to the deacons pay respect, as to God's commandment" &mdash; Epistle of Ignatius to the Smyrnans 8:1. "He that honoureth the bishop is honoured of God; he that doeth aught without the knowledge of the bishop rendereth service to the devil" &mdash; Epistle of Ignatius to the Smyrnans 9:1. &mdash; Lightfoot translation. It is clear that, by this period, a single bishop was expected to lead the church in each centre of Christian mission, supported by a council of presbyters (a distinct and subordinate position at least by this time) with a pool of deacons. As the Church continued to expand, new churches in important cities gained their own bishop, but churches in the regions around an important city were served by presbyters and deacons from the bishop's city church. Thus, in time, the bishop changed from being the leader of a single church confined to an urban area to being the leader of the churches of a given geographical area. Clement of Alexandria (end of the 2nd century) writes about the ordination of a certain Zachæus as bishop by the imposition of Simon Peter Bar-Jonah's hands. The words bishop and ordination are used in their technical meaning by the same Clement of Alexandria. [Clem., "Hom.", III, lxxii; cfr. "Strom.", VI, xiii, cvi; cf. "Const. Apost.", II, viii, 36] The bishops in the 2nd century are defined also as the only clergy to whom the ordination to priesthood (presbyterate) and diaconate is entrusted: "a priest (presbyter) lays on hands, but does not ordain." ("cheirothetei ou cheirotonei" ["Didascalia Syr.", IV; III, 10, 11, 20; Cornelius, "Ad Fabianum" in Eusebius, "Historia Ecclesiastica", VI, xliii.] ) At the end of the 2nd century and the beginning of the 3rd century, Hippolytus of Rome describes another feature of the ministry of a bishop, which is that of the "Spiritum primatus sacerdotii habere potestatem dimittere peccata": the primate of sacrificial priesthood and the power to forgive sins. [ [ Bernard Botte, O.S.B., La Tradition apostolique de saint Hippolyte: Essai de reconstitution, LQF 39 (Munster-Westfalen, 1963). English Translation added at website.] ] Bishops and civil government The efficient infrastructure of the Roman Empire became the template for the organization of the church in the fourth century, particularly after the Edict of Milan. As the church moved from the shadows of privacy into the public forum it acquired land for churches, burials and clergy. In 391, Theodosius I decreed that any land that had been confiscated from the church by Roman authorities be returned. Bishops ruling temporal states The most important of these prince bishops was the Pope, who ruled as monarch of the Papal States by virtue of his title as Bishop of Rome. His claim to this fief rested on the forged Donation of Constantine, but in fact his authority over this kingdom in central Italy grew slowly after the collapse of Roman and Byzantine authority in the area. The Papal States were abolished when King Victor Emmanuel II took possession of Rome in 1870 and completed the reunification of Italy. This became a perennial source of tension between the Papacy and the government of Italy. In 1929, a representative of Pope Pius XI signed a concordat with the Fascist government of Benito Mussolini and the Pope became the independent sovereign of the Vatican, while giving up any rights to the rest of the former Papal States. He was recognised as an independent, non-hereditary, elected monarch by the Lateran Treaties, a position the current Pope continues to hold. The only other bishop who currently is a head of state is the Bishop of Urgell, a Co-Prince of Andorra. Three senior bishops served as Electors in the Holy Roman Empire. By the terms of the Golden Bull of 1356, the Archbishops of Mainz, Trier, and Cologne were made permanent electors, who chose the next Holy Roman Emperor upon the death of his predecessor. The Archbishop of Mainz was President of the Electors and Archchancellor of Germany. Likewise, the Archbishop of Cologne was Archchancellor of Italy, and the Archbishop of Trier was Archchancellor of Burgundy. A number of other bishops within the Holy Roman Empire, although not being Electors, were sovereign prince-bishops in their own lands. Bishops holding political office As well as the Archchancellors of the Holy Roman Empire, bishops generally served as chancellors to medieval monarchs, serving as head of the justiciary and chief chaplain. The Lord Chancellor of England was almost always a bishop up until the dismissal of Thomas Cardinal Wolsey by Henry VIII. Likewise, the position of Kanclerz in the Polish kingdom was always a bishop until the sixteenth century. In France before the French Revolution, representatives of the clergy &mdash; in practice, bishops and abbots of the largest monasteries &mdash; comprised the First Estate of the Estates-General, until their role was abolished during the French Revolution. The more senior bishops of the Church of England continue to sit in the House of Lords of the Parliament of the United Kingdom, as representatives of the established church, and are known as Lords Spiritual. The Bishop of Sodor and Man, whose diocese lies outside of the United Kingdom, is "ex officio" a member of the Legislative Council of the Isle of Man. In the past, the Bishop of Durham, known as a prince bishop, had extensive viceregal powers within his northern diocese &mdash; the power to mint money, collect taxes and raise an army to defend against the Scots. Eastern Orthodox bishops, along with all other members of the clergy, are canonically forbidden to hold political office. Occasional exceptions to this rule are tolerated when the alternative is political chaos. In the Ottoman Empire, the Patriarch of Constantinople, for example, had de facto administrative, fiscal, cultural and legal jurisdiction, as well as spiritual, over all the Christians of the empire. A recent prominent example of this was Archbishop Makarios III of Cyprus, who served as President of the Republic of Cyprus from 1960 to 1977. Episcopacy during the English Civil War During the period of the English Civil War, the role of bishops as wielders of political power and as upholders of the established church became a matter of heated political controversy. John Calvin formulated a doctrine of Presbyterianism, which held that in the New Testament the offices of "presbyter" and "episkopos" were identical; he rejected the doctrine of apostolic succession. Calvin's follower John Knox brought Presbyterianism to Scotland when the Scottish church was reformed in 1560. In practice, Presbyterianism meant that committees of lay elders had a substantial voice in church government, as opposed to merely being subjects to a ruling hierarchy. This vision of at least partial democracy in ecclesiology paralleled the struggles between Parliament and the King. A body within the Puritan movement in the Church of England sought to abolish the office of bishop and remake the Church of England along Presbyterian lines. The Martin Marprelate tracts, applying the pejorative name of "prelacy" to the church hierarchy, attacked the office of bishop with satire that deeply offended Elizabeth I and her Archbishop of Canterbury John Whitgift. The vestments controversy also related to this movement, seeking further reductions in church ceremony, and labelling the use of elaborate vestments as "unedifying" and even idolatrous. During the height of Puritan power in the Commonwealth and the Protectorate, episcopacy was abolished in the Church of England in 1649. The Church of England remained Presbyterian until the Restoration of the monarchy with Charles II in 1660. Catholic, Orthodox and Anglican churches :"Main article: Bishop (Catholic Church)" Bishops form the leadership in the Roman Catholic Church, the Eastern Orthodox Church, the Oriental Orthodox Churches, the Anglican Communion, the larger branches of the Lutheran Church, the Independent Catholic Churches, the Independent Anglican Churches, and certain other, smaller, denominations. The traditional role of a bishop is as pastor of a diocese (also called a bishopric, synod, eparchy or see), and so to serve as a "diocesan bishop," or "eparch" as it is called in many Eastern Christian churches . Dioceses vary considerably in their size of area and population. Some dioceses around the Mediterranean Sea which were Christianized early are rather compact; whereas dioceses in areas of rapid modern growth in Christian commitment, as in some parts of Sub-Saharan Africa, South America and the Far East, are much larger and more populous. ;Patriarch:Patriarchs are the bishops who head certain ancient autocephalous or sui juris churches, which are a collection of metropolitan sees or provinces. Some of these churches call their leaders "Catholicos"; the Patriarch of the Orthodox Church of Alexandria, Egypt, is called "Pope", meaning 'Father'. While most patriarchs in the Eastern Catholic Churches have jurisdiction over a "ritual church" (a group or diocese of a particular Eastern tradition), all Latin Rite patriarchs, except for the Pope, have only honorary titles. In 2006, Pope Benedict XVI gave up the title of Patriarch of the West. The first recorded use of the title by a Roman Pope was by Theodore I in 620. However, early church documents, such as those of the First Ecumenical Council (325) had always listed the Pope of Rome first among the Ancient Patriarchs (first four, and later five: Rome, Constantinople, Alexandria, Antioch and Jerusalem—collectively referred to as the "Pentarchy"). Later, the heads of various national churches became Patriarchs, but they are ranked below the Pentarchy. ;Catholicos:Catholicoi are the heads of some of the Eastern Orthodox, Oriental Orthodox and Eastern Rite Catholic sui juris churches (notably the Armenian), roughly similar to a Patriarch (see above).;Primate:A primate is usually the bishop of the oldest church of a nation. Sometimes this carries jurisdiction over metropolitan bishops, but usually it is purely honorific. The primate of the Scottish Episcopal Church is chosen from among the diocesan bishops, and, while retaining diocesan responsibility, is called "Primus". ;Presiding Bishop or President Bishop: These titles are often used for the head of a national Anglican church, but the title is not usually associated with a particular episcopal see like the title of a primate. ;Major archbishop:Major archbishops are the heads of some of the Eastern Catholic Churches. Their authority within their "sui juris" church is equal to that of a patriarch, but they receive fewer ceremonial honors. ;Suffragan bishop: A suffragan bishop is a bishop subordinate to a Metropolitan. In the Roman Catholic Church this term is applied to all non-metropolitan bishops (that is, diocesan bishops of dioceses within a metropolitan's province, and auxiliary bishops). In the Anglican Communion, the term applies to a bishop who is a full-time assistant to a diocesan bishop: the Bishop of Warwick is suffragan to the Bishop of Coventry (the diocesan), though both live in Coventry. Some Anglican suffragans are given the responsibility for a geographical area within the diocese (for example, the Bishop of Stepney is an "area bishop" within the Diocese of London). ;Auxiliary bishop:An auxiliary bishop is a full-time assistant to a diocesan bishop (the Roman Catholic equivalent of an Anglican suffragan bishop). Auxiliaries are titular bishops, and are often appointed as the vicar general or at least as episcopal vicar of the diocese in which they serve. [ Source] . ;Honorary Assistant bishop or Bishop Emeritus: This title is usually applied to retired bishops who are given a general licence to minister as episcopal pastors under a diocesan's oversight. The title, in this meaning, is not used by the Catholic Church. In Catholicism, Eastern Orthodoxy, Oriental Orthodoxy ,and Anglicanism only a bishop can ordain other bishops, priests, and deacons. The pope, in addition to being the Bishop of Rome and spiritual head of the Roman Catholic Church, is also the Patriarch of the Latin Rite. Each bishop within the Latin Rite is answerable directly to the Pope and not any other bishop except to metropolitans in certain oversight instances. The pope previously used the title "Patriarch of the West", but this title was dropped from use in 2006. In the Roman Catholic and Orthodox Churches and the Anglican Communion, the cathedral of a diocese will have a special chair set aside for the exclusive use of the bishop. This is the bishop's "cathedra", which is often called the bishop's throne. In some Christian denominations, other churches besides the cathedral will maintain a chair for the use of the bishop when he visits their parish; this is to signify the parish's union with the bishop. The bishop is also the proper minister of the sacrament of confirmation. However, in the Roman Catholic, Eastern Orthodox, and Oriental Orthodox churches bishops usually delegate this power to priests. Among Anglicans, only bishops can administer confirmation. Ordination of Catholic, Orthodox and Anglican Bishops Bishops in all of these communions are ordained by other bishops through the laying on of hands. While traditional teaching maintains that any bishop with Apostolic Succession can validly perform the ordination of another bishop, some churches require two or three bishops participate, either to insure sacramental validity or to conform with church law. Roman Catholic doctrine holds that one bishop can validly ordain another male (priest) as a bishop. Though a minimum of three bishops participating is desirable (there are usually several more) in order to demonstrate collegiality, canonically only one bishop is necessary. The practice of only one bishop ordaining was normal in countries where the Church was persecuted under Communist rule. Apart from the ordination, which is always done by other bishops, there are different methods as to the actual "choosing" of a candidate for ordination as bishop. In the Roman Catholic Church today, the Congregation for Bishops oversees the selection of new bishops with the approval of the pope. The papal nuncio usually solicits names from the bishops of a country, and then selects three to be forwarded to Rome. Most Eastern Orthodox churches allow varying amounts of more or less formalised laity and/or lower clergy influence on the choice of bishops. This also applies in those Eastern churches which are in union with the pope, though he is required to give assent. Catholic, Orthodox, Anglican, and some Lutheran bishops (e.g. Sweden) claim to be part of the continuous sequence of ordained bishops since the days of the apostles referred to as Apostolic Succession. Since Pope Leo XIII issued the bull "Apostolicae Curae" in 1896, the Catholic Church has insisted that Anglican orders are invalid because of changes in the Anglican ordination rites of the 16th century and divergence in understanding of the theology of priesthood, episcopacy and Eucharist. However, since the 1930s, Utrecht Old Catholic bishops (recognised by the Holy See as validily ordained) have sometimes taken part in the ordination of Anglican bishops. According to the writer Timothy Dufort, by 1969, all Church of England bishops had acquired Old Catholic lines of apostolic succession recognised by the Holy See. [Timothy Dufort, "The Tablet", May 29, 1982, pp. 536–538.] This development has muddied the waters somewhat as it could be argued that the strain of Apostolic Succession has been re-introduced into Anglicanism. The Catholic Church does recognise as valid (though illicit) ordinations done by breakaway Catholic, Old Catholic, or Oriental bishops, and groups descended from them; it also regards as both valid and licit those ordinations done by bishops of the Eastern churches, ["Unitatis Redintegratio" 16: "To remove, then, all shadow of doubt, this holy Council solemnly declares that the Churches of the East, while remembering the necessary unity of the whole Church, have the power to govern themselves according to the disciplines proper to them, since these are better suited to the character of their faithful, and more for the good of their souls."] so long as those receiving the ordination conform to other canonical requirements (e.g. is an adult male) and an orthodox rite of episcopal ordination, expressing the proper functions and sacramental status of a bishop, is used; this has given rise to the phenomenon of "episcopi vagantes" (e.g. clergy of the Independent Catholic groups which claim Apostolic Succession, though this claim is rejected by both Orthodoxy and Catholicism). The Orthodox Churches would not accept the validity of any ordinations performed by the Independent Catholic groups, as Orthodoxy considers to be spurious any consecration outside of the Church as a whole. Orthodoxy considers Apostolic Succession to exist only within the Church as a whole, and not through any authority held by individual bishops; thus, if a bishop ordains someone to serve outside of the (Orthodox) Church, the ceremony is ineffectual, and no ordination has taken place regardless of the ritual used or ordaining prelate's position within the Orthodox Churches.The position of Catholicism is slightly different. Whilst it does recognise the validity of the orders of certain groups which separated from communion with Holy See: the Old Catholics in communion with Utrecht, as well as the Polish National Catholic Church (which received its orders directly from Utrecht, and was - until recently - part of that communion), it refuses to recognise the orders of any group whose teaching is at variance with core tenets of Christianity e.g. The Liberal Catholic Church which has a strong theosophist tendency and permits belief in reincarnation even though they may use the proper ordination ritual. There are other reasons why the Holy See does not recognise the validity of the orders of the Independent clergy: (a) the continuing practice among many Independent clergy of one person receiving multiple ordinations in order to secure apostolic succession, betrays an incorrect and mechanistic theology of ordination as far as the Holy See is concerned (b) the practice within Independent groups of ordaining women demonstrates an understanding of Priesthood which is totally unacceptable to the Catholic and Orthodox churches as they believe that the Universal Church does not possess this authority; thus, any ceremonies performed by these women are considered to be sacramantally invalid. (c) the theology of male clergy within the Independent movement is also suspect as they presumably approve of the ordination of females, and may have even undergone an (invalid) ordination ceremony conducted by a woman. Some provinces of the Anglican Communion have begun ordaining women as bishops in recent decades e.g. the United States, Aotearoa New Zealand, Canada and Cuba. The first woman bishop within Anglicanism was Barbara Clementine Harris, who was ordained in the United States in 1989. Evangelical Lutheran Church in America In the Evangelical Lutheran Church in America, the largest Lutheran denomination in the United States, and based largely on the Nordic Lutheran state churches (similar to that of the Church of England), bishops are elected by Synod Assemblies, consisting of both lay members and clergy, for a term of 6 years, which can be renewed, depending upon the local synod's "constitution" (which usually mirrors that of the national ELCA constitution). Since a 1999 Concordat with the Episcopal Church, they have been ordained in the historic episcopate of apostolic succession, by the laying on of hands of other bishops whose line passes back to the apostles, including Episcopal bishops and Lutheran bishops from church branches in apostolic succession. [ [] "Called to Common Mission," 1999. viewed 9/29/2006] [ [] Wright, J. Robert, "The Historic Episcopate: An Episcopalian Viewpoint," Lutheran Partners, March / April 1999 — Volume 15, Number 2, viewed 9/29/2006] Currently, they are responsible for, since going into ecumenical communion with the Episcopal Church in the United States, ordaining of all pastors, consecrating of all diaconal ministers, giving approvals to "roster" all current pastors (pastors are called by local congregations, like that of the Episcopal Church), and upholding the teachings of Luther, the ELCA and synod constitutions. The Presiding Bishop of the ELCA, the national bishop, is elected for a single 6-year term and is limited to 2 terms, and handles all episcopal consecrations, as well as presiding at the Churchwide Assembly, which is held every 2 years. A similar structure exists with the Evangelical Lutheran Church in Canada (ELCIC). It should be noted that although ELCA agreed with the Episcopal Church to limit ordination to the bishop "ordinarily", ELCA pastor-"ordinators" are given permission to perform the rites in "extraordinary" circumstance. In practice, "extraordinary" circumstance have included disagreeing with Episcopalian views of the episcopate. United Methodist Church In The United Methodist Church, bishops serve as administrative and pastoral superintendents of the church. They are elected for life from among the ordained elders (Presbyters) by vote of the delegates in regional (called Jurisdictional) conferences, and are consecrated by the other bishops present at the conference through the laying on of hands. In The United Methodist Church bishops are not ordained in the traditional sense (i.e. belonging to the threefold ministry of bishop, presbyter, deacon) but remain members of the "Order of Elders" while being consecrated to the "Office of the Episcopacy." Within The United Methodist Church only bishops are empowered to consecrate bishops and ordain clergy. Among their most critical duties is the ordination and appointment of clergy to serve local churches as pastor, presiding at sessions of the Annual, Jurisdictional, and General Conferences, providing pastoral ministry for the clergy under their charge, and safeguarding the doctrine and discipline of the Church. Furthermore, individual bishops, or the Council of Bishops as a whole, often serve a prophetic role, making statements on important social issues and setting forth a vision for the denomination, though they have no legislative authority of their own. In all of these areas, bishops of United Methodist Church function very much in the historic meaning of the term. According to the "Book of Discipline of the United Methodist Church", a bishop's responsibilities are cquote "Leadership.—Spiritual and Temporal."—1. To lead and oversee the spiritual and temporal affairs of The United Methodist Church, which confesses Jesus Christ as Lord and Savior, and particularly to lead the Church in its mission of witness and service in the world.2. To travel through the connection at large as the Council of Bishops (¶ 526) to implement stategy for the concern of the Church.3. To provide liaison and leadership in the quest for Christian unity in ministry, mission, and structure and in the search for strengthened relationships with other living faith communities.4. To organize such Missions as shall have been authorized by the General Conference.5. To promote and support the evangelistic vision of the whole Church. 6. To discharge such other duties as the Discipline may direct. "Working with Ministers."—1. To make and fix the appointments in the Annual Conferences, Provisional Annual Conferences, and Missions as the Discipline may direct (¶¶ 529-533).2. To divide or to unite a circuit(s), stations(s), or mission(s) as judged necessary for missionary strategy and then to make appropriate appointments. 3. To read the appointments of deaconesses, diaconal ministers, lay persons in service under the World Division of the General Board of Global Ministries, and home missionaries. 4. To fix the Charge Conference membership of all ordained ministers appointed to ministries other than the local church in keeping with ¶443.3. 5. To transfer, upon the request of the receiving bishop, minsterial member(s) of one Annual Conference to another, "provided" said member(s) agrees to transfer; and to send immediately to the secretaries of both conferences involved , to the conference Boards of Ordained Ministry, and to the clearing house of the General Board of Pensions written notices of the transfer of members and of their standing in the course of study if they are undergraduates. "The Book of Discipline of the United Methodist Church: Specific Responsibilities of Bishops — ¶ 514-516" (retrieved 27 May 2007).] In each Annual Conference, United Methodist bishops serve for four year terms, and may serve up to three terms before either retirement or appointment to a new Conference. United Methodist bishops may be male or female, with the Rev. Marjorie Matthews being the first woman to be consecrated a bishop in 1980. The collegial expression of episcopal leadership in the United Methodist Church is known is the "Council of Bishops". The "Council of Bishops" speaks to the Church and through the Church into the world and gives leadership in the quest for Christian unity and interreligious relationships. "The Book of Discipline of the United Methodist Church: Council of Bishops — ¶ 526" (retrieved 27 May 2007).] The "Conference of Methodist Bishops" includes the United Methodist "Council of Bishops" plus bishops from affiliated autonomous Methodist or United Churches. Methodists in the United Kingdom acquired their own bishops early in the nineteenth century, after the Methodist movement in Britain formally parted company with the Church of England. The position no longer exists in British Methodism. Christian Methodist Episcopal Church The Church of Jesus Christ of Latter-day Saints In The Church of Jesus Christ of Latter-day Saints, the Bishop is the leader of a local congregation, called a ward. As with most Mormon priesthood, the Bishop is a part-time lay minister and earns a living through other employment; in all cases, he is a married man. As such, it is his duty to preside at services, call local leaders, and judge the worthiness of members for service. The bishop does not deliver sermons at every service (generally asking members to do so), but is expected to be a spiritual guide for his congregation. It is therefore believed that he has both the right and ability to receive divine inspiration (through the Holy Ghost) for the ward under his direction. Because it is a part-time position, all able members are expected to assist in the management of the ward by holding delegated lay positions (e.g. women's' and youth leaders, teachers) referred to as "callings." Although members are asked to confess serious sins to him, unlike the Roman Catholic Church, he is not the instrument of divine forgiveness, merely a guide through the repentance process (and a judge in case transgressions warrant excommunication or other official discipline). The bishop is also responsible for the physical welfare of the ward, and thus collects tithing and fast offerings and distributes financial assistance where needed. A bishop is the president of the Aaronic Priesthood in his ward (and is thus a form of Mormon Kohen; in fact, the church's Doctrine and Covenants states that any "descendant of Aaron" who converts to Mormonism has a right to be a bishop). A bishop is also a High priest in the Melchizedek Priesthood. Each bishop is selected from resident members of the ward by the stake presidency with approval of the First Presidency, and chooses two "counselors" to form a "bishopric". In special circumstances (such as a ward consisting entirely of young university students), a bishop may be chosen from outside the ward. A bishop is typically released after about five years and a new bishop is called to the position. Although the former bishop is released from his duties, he continues to hold the priesthood office of bishop, and is usually still referred to by the title "Bishop" as a term of respect. The Presiding Bishop oversees the temporal affairs (buildings, properties, commercial corporations, etc.) of the entire Latter Day Saints Church, including the Church's massive global humanitarian aid and social welfare programs. The Presiding Bishop has two counselors; the three together form the Presiding Bishopric. New Apostolic Church The New Apostolic Church (NAC) knows 3 classes of ministries: Deacons, Priests and Apostles. The Apostles, who are all included in the apostolate with the Chief Apostle as head, are the highest ministries. Of the several kinds of priest-ministries, the bishop is the highest. Nearly all bishops are set in line directly from the chief apostle. They support and help their superior apostle. Pentecostal Church of God In 2002, the general convention of the Pentecostal Church of God came to a consensus to change the title of their overseer from General Superintendent to Bishop. The change was brought on because internationally, the term Bishop is more commonly related to religious leaders than the previous title. Although called "bishops", they are not validly ordained in apostolic succession, and as such, have no traceable ordinational connection to the Apostles of Christ, as the Roman Catholic, Anglican, and Orthodox Churches do. Some Baptists have begun taking on the title of Bishop. [] While not Christian, Ecclesia Gnostica Catholica uses roles and titles derived from Christianity for its clerical hierarchy, including Bishops who have much the same authority and responsibilities as in Roman Catholicism. The Salvation Army does not have bishops but have appointed leaders of geographical areas known as Divisional Commanders. Larger geographical areas, called Territories, are lead by a Territorial Commander, who is the highest ranking officer in that Territory. Dress and Insignia Traditionally, a number of items are associated with the office of a bishop, most notably the mitre, crosier, and episcopal ring. Other vestments and insignia vary between Eastern and Western Christianity. In the Roman Catholic Church, the choir dress of a bishop includes the purple cassock with amaranth trim, rochet, purple zuchetto (skull cap), purple biretta, and pectoral cross. The vestments of a bishop include the pontifical gloves and pontifical sandals, but these items are rarely seen today except within the context of the Tridentine Mass. The cappa magna, which was once used as choir dress for bishops on solemn occasions, is also rarely seen today although its use continues to be permitted. The coat of arms of a Roman Catholic bishop will usually display a mitre (or galero) and crozier behind the escutcheon; however, the specifics will differ by location and ecclesiastical rank (see Ecclesiastical heraldry). Anglican bishops generally make use of the mitre, crosier, episcopal ring, purple cassock, purple zuchetto, and pectoral cross. However, the traditional choir dress of Anglican bishops is quite different as a very long rochet is worn with a chimere. In the Eastern Churches (Eastern Orthodox, Eastern Rite Catholic) a bishop will wear the Mandyas, Panagia (and perhaps an Enkolpion), Sakkos, Omophorion and an Eastern-style mitre. Eastern bishops do not normally wear an episcopal ring—the faithful will kiss the bishop's hand rather than a ring. To seal official documents, he will usually use an inked stamp. An Eastern bishop's coat of arms will usually display an Eastern-style mitre, cross, eastern crozier and a red and white (or red and gold) mantle. The arms of Oriental Orthodox bishops will display the episcopal insignia (mitre or turban) specific to their own liturgical traditions. Variations will occur based upon jurisdiction and national customs. ee also * Ecclesiastical polity (church governance) ** Congregational polity ** Episcopal polity ** Presbyterian polity * Lists of patriarchs, archbishops, and bishops * Bishops in the Church of Scotland * Church of England * Gay bishops * Ignatius of Antioch, "Epistles of to the Ephesians, Magnesians, Trallesians, and Smyrnans", Lightfoot, trans., Harmer, ed. (Kessinger, 1891/2003). ISBN 0-7661-6498-5 * Mathews, James, "Set Apart To Serve: The Role of the Episcopacy in the Wesleyan Tradition" (Nashville: Abingdon, 1985). * Moede, Gerald, "The Office of Bishop in Methodism: Its History and Development" (Nashville: Abingdon, 1965). External links * [ 1 Timothy 3:1-7] ("NRSV") * [ Titus 1:7-9] ("NRSV") * [ Methodist/Anglican Thoughts On Apostolic Succession] by Gregory Neal * [ Methodist Episcopacy: In Search of Holy Orders] by Gregory Neal * [ The United Methodist Church: Council of Bishops] * [ Ecumenical Catholic Communion] * [ What a bishop wears] (Office of Worship of the Diocese of Harrisburg) * [ Vatican Website with Canon Law of Roman Catholic Church] Wikimedia Foundation. 2010. Look at other dictionaries: • Bishop — • The title of an ecclesiastical dignitary who possesses the fullness of the priesthood to rule a diocese as its chief pastor, in due submission to the primacy of the pope Catholic Encyclopedia. Kevin Knight. 2006. Bishop     Bishop …   Catholic encyclopedia • Bishop — Bish op, n. [OE. bischop, biscop, bisceop, AS. bisceop, biscop, L. episcopus overseer, superintendent, bishop, fr. Gr. ?, ? over + ? inspector, fr. root of ?, ?, to look to, perh. akin to L. specere to look at. See {Spy}, and cf. {Episcopal}.]… …   The Collaborative International Dictionary of English • Bishop — Bishop, CA U.S. city in California Population (2000): 3575 Housing Units (2000): 1867 Land area (2000): 1.750266 sq. miles (4.533169 sq. km) Water area (2000): 0.000000 sq. miles (0.000000 sq. km) Total area (2000): 1.750266 sq. miles (4.533169… …   StarDict's U.S. Gazetteer Places • Bishop — steht für: Bishop (Familienname), einen Familiennamen Bishop (Ortsname), Orte und Townships eine britische Selbstfahrlafette, siehe Bishop (Panzer) im englischen den Läufer im Schachspiel Bernice P. Bishop Museum (oder Museum für Natur und… …   Deutsch Wikipedia • Bishop's — *Bishop Stopford s School at Enfield, England. *Bishop s University in Lennoxville, Québec, Canada. *Bishop s Stortford town in Hertfordshire , England *The Bishop s School (California) in La Jolla, California, USA. *The Bishop s School (Pune) in …   Wikipedia • Bishop — Bishop, John Michael * * * (as used in expressions) Bishop, Elizabeth Bishop, J(ohn) Michael Bishop, William Avery Billy Bishop …   Enciclopedia Universal • bishop — (n.) O.E. bisceop bishop, high priest (Jewish or pagan), from L.L. episcopus, from Gk. episkopos watcher, overseer, a title for various government officials, later taken over in a Church sense, from epi over (see EPI (Cf. epi )) + skopos watcher …   Etymology dictionary • Bishop, GA — U.S. town in Georgia Population (2000): 146 Housing Units (2000): 67 Land area (2000): 0.775768 sq. miles (2.009231 sq. km) Water area (2000): 0.000000 sq. miles (0.000000 sq. km) Total area (2000): 0.775768 sq. miles (2.009231 sq. km) FIPS code …   StarDict's U.S. Gazetteer Places • Bishop, TX — U.S. city in Texas Population (2000): 3305 Housing Units (2000): 1269 Land area (2000): 2.370688 sq. miles (6.140054 sq. km) Water area (2000): 0.000000 sq. miles (0.000000 sq. km) Total area (2000): 2.370688 sq. miles (6.140054 sq. km) FIPS code …   StarDict's U.S. Gazetteer Places • bishop — [bish′əp] n. [ME < OE bisceop < LL episcopus, an overseer (in LL(Ec), bishop) < Gr episkopos, overseer (in N.T., bishop) < epi , upon + skopos < skopein, to look (see SCOPE)] 1. a) a high ranking member of the Christian clergy… …   English World dictionary Share the article and excerpts Direct link Do a right-click on the link above and select “Copy Link”
Paris accord: US and Syria alone as Nicaragua signs Nicaragua has signed the Paris climate agreement, meaning that the US and Syria are the only two countries not to be giving the accord their support. The deal unites the world's nations in tackling climate change. Scientists point out that work to implement the Paris accord must be stepped up if it is to have any chance of success. The agreement commits the US and 187 other countries to keeping rising global temperatures "well below" 2C above pre-industrial levels and "endeavour to limit" them even more, to 1.5C. Nicaraguan President Daniel Ortega indicated last week that he would sign the accord. "It is time for Nicaragua to sign the Paris Agreement," Mr Ortega said on the official July 19 website. "Scientists from more developed countries, scientists working at Nasa, European scientists, everyone agrees that we must stop the process that is leading to the destruction of the planet," he said. Mr Ortega's government had previously argued that the accord did not put sufficient onus on wealthy countries to tackle climate change and was not ambitious enough in its objectives. Nicaragua has no oil and vigorously pursues green energy policies – more than 50% of its electricity is produced by geothermic, wind, solar, biomass and wave power. It is a country that is believed to be especially at risk from climate change. The World Bank described the central American country as "a renewable energy paradise" in 2013. President Trump has argued that the Paris agreement would hobble, disadvantage and impoverish the US, to the benefit of other nations. He claimed in June that the accord would cost the US 6.5 million jobs and $3tn (£2.2tn) in lost GDP – while rival economies like China and India were treated more favourably. However, the US more recently has hinted that it may shift its position on withdrawing from the deal. Historically, the US, Europe, and China account for almost half of the world's carbon emissions. Syria is thought not to have signed the deal because it has been preoccupied by its civil war. Let's block ads! (Why?) Original Article Related Posts Leave a Reply
Why Save Our Past? Highland cattle, a breed which originated in the Scottish Highlands, is the oldest registered breed in the United States. (Photo credit: Photodisc/Getty Images) A hundred years ago or so, there was plenty of variety in agriculture. Worldwide, farmers raised thousands of different animal breeds and grew just as many varieties of plants. As farms grew bigger and became more industrialized, however, fewer and fewer species were used as crops and livestock. The traits that were important to a traditional farmer were not the same traits that are important for the success of an industrial farmer. When raising industrial-farm livestock, it is more important to have docile creatures that can endure crowding. The animals on an industrial farm are also bred for quick and efficient production and maturation, whether that means a lot of milk for dairy cows or growing big quickly for pigs. As livestock and crops became more specialized for industrialized farming, thousands of animal breeds and plant types have gone extinct. This is unfortunate because this means that we have lost a piece of the past, and we have lost knowledge that our ancestors had. It is also alarming because it has shrunk the available gene pool. You are probably aware of the loss of biodiversity that occurs as rain forests are cut or burnt down. Many medicines are produced by rain forest plants, and there are compounds that once existed that are no longer available and were never “discovered.” The same is true with plant and animal species in agriculture worldwide. Plants and animals that could be sources of new foods, medicines, or fibers have been lost forever. Luckily, there is a growing interest among farmers and gardeners to preserve the remaining animal and plant biodiversity by raising heritage animal breeds or heirloom crops. The term heirloom is usually used with plants, and heritage is usually used to describe livestock. Sometimes they are used interchangeably. There is not a strict definition for these terms, except they generally mean “old”: older than 50 years, according to some sources, and older than 100 according to others. According to the American Rose Society, a rose is not considered old unless it was bred before 1867 when hybrids were introduced. Heirloom plants are always open-pollinated, which means that wind or insects can pollinate them without human assistance. Many of these older species are not worth a lot of money today because they don’t have the qualities that make them easy to farm in massive quantities. So why are heirloom and heritage plants and animals important? The short answer is biodiversity. Biodiversity is a term used for biological diversity, which means the variety of life. More biodiversity means that there is greater genetic variation. Heritage Livestock In the United States, there are just a few breeds that make up the vast majority of farm animals. More than 80% of all dairy cows are Holsteins, for example, and almost all the turkeys raised are from one single breed that is known for its big, meaty breast. But it is the remaining heritage breeds that are usually superior at living in a pasture rather than a barn, and surviving harsh conditions when necessary, just like their ancestors did. The genes in that heritage livestock could someday be useful. Because we cannot foretell the future, preserving genetic stock can be a safeguard against possible future changes in our environment. Raising old genetic lines of livestock makes farms more resilient to disease, pests, climate change, and changes in the marketplace. Organizations like the American Livestock Breeds Conservancy support the conservation of heritage breeds through research, education, the maintenance of gene banks, and help to farmers interested in heritage breeds. Heirloom Plants You can walk into any garden center around the country and find the same varieties of vegetable and flowering plants for sale. In yards around the country, people grow the same types of flowers. Yet heirloom plants need to be preserved for all the same reasons as heritage livestock. Maintaining a large gene pool is important for the future. Already more than 90% of all commercial vegetables types that were available before 1900 have disappeared. Besides having genes for disease-, pest-, and weather-resistance, heirloom produce often tastes better than modern fruits, grains, and vegetables do. Modern produce is selected for longer shelf lives and the ability to survive handling during shipping, so taste has often been less of a priority for growers. It doesn’t matter how good something tastes if it can’t make it to the market to be sold. Heirloom tomatoes are an open-pollinated type of tomato. (Photo credit: Superstock/Alamy) Heirloom flowers, too, have some wonderful advantages over the newer varieties. Heirloom roses, often called “antique” roses, or simply “old” roses, have the ability to thrive for a century or more without any real care, if they are hardy for the area they are grown in. Also, they usually have a beautiful, strong fragrance that has been bred out of newer varieties in exchange for brighter colors and longer lasting or repeat blooms. Antique rose collectors still discover new heirloom varieties by visiting abandoned cemeteries and farms, where the bushes can be found blooming among the ruins. Plant breeders develop new strains with better disease resistance by using the heirloom species to breed insect-, disease-, or drought-tolerance into new varieties. New roses are “hybrids,” grown by grafting a cutting from a newer variety onto an older rose’s roots. Hybrids grow fine this way when conditions are right for them, but are less hardy during cold winters. They may freeze at the point where they are grafted together, and the following year, it will be the older plant that grows instead of the newer rose that the customer purchased. As compared to “open-pollinators,” which can always produce more plants like their parents, the offspring of a hybrid plant is unpredictable. It might look like the parent plant, or might have different characteristics altogether. Seed Savers Organization Whereas roses are often grown from cuttings, many plants are of course grown from seed. There are only three major seed companies in the United States, which narrows down the amount of seeds that are widely available for sale. It is thrifty local gardeners that have saved seeds from their gardens and exchanged them with their families, friends, and neighbors who have maintained genetic diversity in many plants. In 1975 a group called Seed Savers Exchange was formed in Iowa. Today there are about 700 species of apples in the United States, which sounds like a lot until you learn that in 1903 there were about 8,000 identified species. The Seed Savers Exchange keeps thousands of plant types in a gene bank that contains not only seeds but also roots and bulbs of heirloom varieties. They now put together an annual catalogue of more than 12,000 distinct varieties of plants, and search world-wide for rare seeds. One of the draws of planting heirloom species or raising heritage animals is that the variety usually comes with a story, handed down just like an heirloom piece of jewelry or artwork. Saving these diverse varieties becomes about more than just preserving irreplaceable genes. It also helps preserve entire cultures around the world. More to Explore Local Harvest American Livestock Breeds Conservancy Seed Savers Exchange Rare Breeds Survival Trust What Do You Think?
Study shows even injured kidneys can be used for transplants Kidneys from deceased donors that have acute injuries are frequently discarded instead of being used for transplant. However, a Yale-led study finds that such kidneys may be more viable than previously thought, and should be considered to meet the growing demand for organ transplants. Donated kidneys with acute injury are often discarded for fear of poor outcomes such as delayed function and even premature failure. Given the growing need for transplant organs, the Yale-led team embarked on the largest multicenter observational study of its kind to date, including more than 1,600 deceased donors. They examined associations between (AKI) in donors, rates of kidney discard, and recipient kidney function in the short term as well as six months after transplantation. As anticipated, the researchers found an association between AKI and organ discard. They also found that injured kidneys were associated with "delayed graft function (DGF)," or the need for continued dialysis support in the first week after transplantation. But unexpectedly, the study did not find a link between deceased-donor kidney injury and poor function six months later. "What we saw was, with worsening AKI in the donor, the six-month outcome was actually better for recipients who experienced DGF," said Isaac E. Hall, M.D., investigator in the Program of Applied Translational Research at Yale School of Medicine and first author of the study. Paradoxically, six-month transplant function was worst for those with DGF who had received a donated kidney with no apparent injury. Though that result seemed counterintuitive, Hall suggested that organs acutely injured in the donor might develop "ischemic preconditioning," a mechanism that could protect the organs from the effects of subsequent injury.Another possible explanation is that the successfully transplanted kidneys with AKI were of otherwise higher quality than the rejected kidneys with AKI, though the study did adjust for many important variables like donor age and comorbidity. (two or more chronic conditions). "There appears to be room to attempt more transplants using these AKI kidneys rather than throwing them away," said Chirag R. Parikh, M.D., director of the Program of Applied Translational Research and senior author of the study. "The waiting list has grown to over 100,000 patients as thousands more people are wait-listed each year than actually receive a transplant. In addition, the median time it takes for an adult to receive a transplant in the United States increased from 2.7 to 4.2 years between 1998 and 2008, and more than 5,000 people die each year while waiting for a kidney," said Parikh. "Even if it only means a few dozen more kidney transplants each year, those are patients who would come off of the waiting list for transplants sooner and have much better survival than continuing on dialysis in hopes of seemingly higher-quality kidney offers, which may never come in time," he said. Explore further Biopsies before transplantation do not determine success of donated kidneys Provided by Yale University Citation: Study shows even injured kidneys can be used for transplants (2015, March 11) retrieved 18 August 2019 from https://medicalxpress.com/news/2015-03-kidneys-transplants.html Feedback to editors User comments
website sponsors Choosing a Falconer Each abatement falconer interviewed had his own "best methods" for bird abatement, but the basic rules are the same across the board. There are different industries and crops using falconry, and while some techniques are specific to blueberries, in general, experience in one crop means that the bird and bird handler can likely adapt to the other. Go to Falconry Techniques for more information on these methods. Healthy Birds • A professional falconer should maintain healthy birds and allow a grower to view them. • To keep raptors healthy, they should be served a high protein diet such as quail. This protein-rich diet should be similar to what the raptors eat in the wild and strengthen the birds by providing them with plenty of calories to burn as they harass starlings instead of eating them. Rich beak color is one easy indicator of a healthy raptor. • The raptors should be kept out of midday sun and kept cool using water sprays throughout the day. • When raptors are not flying, their metabolism should be monitored. In the Field A successful bird abatement program using raptors requires highly trained raptor specialists, several raptors, noise makers to possibly supplement raptor techniques, and a bird management strategy that begins before fruit ripens and birds establish feeding or nesting habits in the field. Growers should caution against using inexperienced bird handlers. • Only one falcon should fly at a time, though each raptor may patrol a number of times each day. • The falconer should have tracking device on the raptor as well as visually monitor the raptor's whereabouts at all times in case it disappears from sight and to keep larger raptors from harming the raptor.  • Not all bird handlers use a tracking device, but in agriculture the investment is vital. A raptor, which can receive hundreds of hours of training and can be worth thousands of dollars, is well worth the investment of a tracking device. • When in the field, a falconer should be working his or her raptors and keeping a constant eye out for pest birds. finding an experienced falconer • Seek recommendations from growers, including growers of other crops, who have had success using falconry techniques in their bird management program. • The falconer should be specifically trained in bird abatement. That is, the falconer should be trained to haze pest birds instead of eat them and should seek out pest birds, not rodents. • You can also contact a local falconers association (Oregon | Washington) and request the contact information of someone with bird abatement expertise. • If using a falconer is your primary bird management program, consider working with a company rather than an individual. Companies can substitute a bird handler who is unable to complete the season. • The falconer you contact should use more than one raptor on a daily basis. A single bird handler using only one raptor is a risky model for a commercial blueberry grower, and using several raptors ensures that money isn't lost on a sick bird or on efforts made to retrieve a truant raptor. Multiple raptors can also cover more area for longer periods of time, and a serious bird handler will equip each of their raptors with a tracking device. • The falconer you are considering should also ask questions specific to your farm and be open to supplemental bird management techniques. As one bird handler interviewed for this project commented: "It is a good sign when the falconer is trying to get a lay of the land and not imposing his knowledge of falconry as the cure all.” • A quality falconer will have the ability to verbally communicate his or her knowledge and experience in the field and be able to tell the grower why a particular bird is good at hazing a particular species. • One falconer interviewed for this projected suggested that a grower ask how many days instead of years a bird handler has flown his or her birds for bird abatement in the field. A professional should be able to give the grower a round figure. A five-year licensed falconer may have only flown a bird a few times for the purpose of bird abatement during that period, whereas a two-year certified bird abator may have obtained twice as many days experience in bird abatement work. • At minimum, every falconer should have a bird abatement or falconry license and provide these credentials as well as recommendations from previous clients. To become a master falconer, one has to obtain a sponsor, be an apprentice for two years, and spend five years as a general falconer. Other recommendations • Sign a contract. • Use multiple raptors and bird tracking devices, and, if opting to use a single bird handler, have an alternative bird management plan in case something happens to the bird handler during the season. • Use a systematic approach and outline your expectations of a program when designing it with the falconer to ensure your satisfaction throughout the season. • Meet several times with the falconer before the season starts. Common practice is to contact a falconer early and contract for the coming year.
Question #3d956 1 Answer Conduction and convection are methods of heat transfer. If you heat one end of a metal rod slowly the other end will also get hot after sometime..THis is due to hear transferring by conduction. all metals are good conductors of heat. If you heat water in a pot first the water at bottom will get hot.Then the hot water become less dense and it goes up,.THe cold water from top will come down and replace the cold water.This process is known as convectionenter image source here . piiicture credit
Native fish - and recreational fishers - need native fish funding We are really just beginning to learn what’s gone wrong for native species like the Murray Cod. Biodiversity Heritage Library The Murray-Darling Basin Authority’s Native Fish Strategy (NFS) is at serious risk of winding up, after NSW announced it is cutting its financial contributions. This is a serious blow to the conservation and management of an iconic group of animals that get little long-term, strategic consideration and funding from state governments. It also flies in the face of the popularity of fish and fishing to the wider community. The recreational fishing lobby and conservation groups are justifiably concerned. Annually, about one in five of us goes fishing; more so for Indigenous Australians. It is one of the most popular pastimes in Australia and a large amount of money is spent in its pursuit, whether on fishing gear, bait, boats or accommodation. It is one of those rare, acceptable “primeval” behaviours that appeals to kids and adults alike. For the majority, it also brings people closer to nature, making them appreciate healthy water bodies, and contributing to better conservation and management. While there is debate about the merits of introduced species, like trout and redfin, there is universal agreement that healthy populations of native fish are a good thing. There are various estimates of the state of the fish in the Murray-Darling Basin. Some say they are at 10% of pre-European numbers. I think that it is closer to 1%, based on my reading of early explorers’ and settlers’ accounts of the number and size of fish that could be caught before environmental degradation. Fishing is one of the most popular pursuits in Australia. Charles Stretbor But the actual percentage is somewhat academic. There is overwhelming evidence that fish numbers of the vast majority of species, including icons like the Murray cod, are a fraction of what they once were. Some species are close to extinction: 73 of Australia’s approximately 250 species are currently listed as “threatened” under state or national legislation. And, to a large extent, the biomass of native fish has been replaced by introduced species, especially carp. A noxious species, carp is equivalent to the cane toad in the damage it causes and the negative emotions it elicits. The reasons for the decline of native fish include historical overfishing, habitat change, river regulation, poor water quality, barriers to movement and the introduction of non-native species. But in many cases, we don’t know the actual cause for shrinking distribution and loss of populations. It is likely that multiple factors over time have contributed to this sad state of affairs. We are also still in the early days of understanding how fish live, feed, breed and respond to the conditions that nature and humans throw at them. The increase in our knowledge of their ecology is struggling to keep pace with the steep decline of our fish. It is unfortunate in some ways that we have no ongoing commercial fisheries of native species, but the numbers are not good enough to sustain such fishing pressure. So, unlike marine species, which support many commercial fisheries, freshwater fish tend to receive a tiny amount of funding compared to their marine counterparts. The federally funded Fisheries Research and Development Corporation, for example, doles out the vast majority of its funds to marine fisheries. Carp have replaced many native species. Melbourne Water And that is where the Native Fish Strategy (NFS) comes in. Over more than 10 years, the Murray-Darling Basin Authority’s foresight has put native fish up front, recognising fish as important in their own right and as sentinels for the health of our rivers. Some species, such as Murray cod, are like the lions of our waterways, and their demise affects all aspects of freshwater food webs of the Murray-Darling Basin. Other species are critical as food for larger fish and water birds. The NFS has a long-term plan, realising that rehabilitation and restoration of our rivers takes time. It includes research to increase our understanding of what species and populations need to persist; conservation to restore populations of threatened species, like trout cod; management, to improve conditions in our rivers so that fish can carry out their life cycles, like improving fish passage; and education, so that the next generation continues to care for our freshwater environment. The NFS’s work has only really just begun, and has just started to show dividends. Cutting funding for native fish research, conservation and management does not make sense in any but purely financial terms. The NFS should be recognised for what it is: a key plank in restoring health to the rivers of the Murray-Darling Basin. It should be supported at all costs.
Rudolf Hilferding Last updated Rudolf Hilferding Rudolf Hilferding and Gattin, cropped.jpg Hilferding in 1928 Minister of Finance (Weimar Republic) In office 13 August 1923 October 1923 Preceded by Andreas Hermes Succeeded by Hans Luther In office 29 June 1928 21 December 1929 Preceded by Heinrich Köhler Succeeded by Paul Moldenhauer Personal details Born(1877-08-10)10 August 1877 Died11 February 1941(1941-02-11) (aged 63) Political party Social Democratic Party of Germany Alma mater University of Vienna Marxism economic and sociopolitical worldview based on the works of Karl Marx Social Democratic Party of Germany Social-democratic political party in Germany The Social Democratic Party of Germany, is a social-democratic political party in Germany. Weimar Republic Germany state in the years 1918/1919–1933 The Weimar Republic is an unofficial historical designation for the German state from 1918 to 1933. The name derives from the city of Weimar, where its constitutional assembly first took place. The official name of the republic remained Deutsches Reich unchanged from 1871, because of the German tradition of substates. Although commonly translated as "German Empire", the word Reich here better translates as "realm", in that the term does not have monarchical connotations in itself. The Reich was changed from a constitutional monarchy into a republic. In English, the country was usually known simply as Germany. Vienna Capital city and state of Austria German Revolution of 1918–19 Revolution in 1918–1919 in Germany Gestapo official secret police of Nazi Germany The Geheime Staatspolizei, abbreviated Gestapo, was the official secret police of Nazi Germany and German-occupied Europe. Hilferding was a proponent of the "economic" reading of Karl Marx identifying with the "Austro-Marxian" group. [6] He was the first to put forward the theory of organized capitalism . [7] He was the main defender of Marxism from critiques by Austrian School economist and fellow Vienna resident Eugen Boehm von Bawerk. Hilferding also participated in the "Crises Debate" – disputing Marx's theory of the instability and eventual breakdown of capitalism on the basis that the concentration of capital is actually stabilizing. He edited leading publications such as Vorwärts , Die Freiheit , and Die Gesellschaft . [3] His most famous work was Das Finanzkapital (Finance capital), one of the most influential and original contributions to Marxist economics [4] with substantial influence on Marxist writers such as Vladimir Lenin [7] and Nikolai Bukharin influencing his writings on imperialism. [2] [8] Karl Marx Revolutionary socialist Austromarxism Marxist theoretical current, led by the Social Democratic Workers Party of Austria during the late decades of the Austro-Hungarian Monarchy and the First Austrian Republic (1918–1934) Austro-Marxism was a Marxist theoretical current, led by Victor Adler, Otto Bauer, Karl Renner and Max Adler, members of the Social Democratic Workers' Party of Austria in Austria-Hungary and the First Austrian Republic (1918–1934). It is known for its theory of nationality and nationalism, and its attempt to conciliate it with socialism in the imperial context. Hence, Otto Bauer thought of the "personal principle" as a way of gathering the geographically divided members of the same nation. In Social Democracy and the Nationalities Question (1907), he wrote that "The personal principle wants to organize nations not in territorial bodies but in simple association of persons", thus radically disjoining the nation from the territory and making of the nation a non-territorial association. Austrian School school of economic thought The Austrian School is a heterodox school of economic thought that is based on methodological individualism—the concept that social phenomena result exclusively from the motivations and actions of individuals. Life in Vienna On 10 August 1877, Rudolf Hilferding was born in Vienna into a prosperous Jewish family, [2] [9] consisting of his parents, Emil Hilferding, a merchant (or private servant), and Anna Hilferding, and of Rudolf's younger sister, Maria. Rudolf attended a public gymnasium from which he graduated as an average student, allowing him access to the university. Directly afterwards, he enrolled at the University of Vienna to study medicine. [10] Gymnasium (school) type of school providing advanced secondary education in Europe University of Vienna public university located in Vienna, Austria Even before his school leaving examinations, in 1893 he joined a group of Vienna students that weekly discussed socialist literature and later formed with young university teachers the student-organization Freie Vereinigung Sozialistischer Studenten, whose chairman was Max Adler. [10] This is where Hilferding first intensely came in contact with socialist theories and first became active in the labour movement. The organization also participated in social-democratic demonstrations, which came in conflict with the police, drawing the attention of the Social Democratic Party of Austria (SPÖ). [11] Max Adler was an Austrian jurist, politician and social philosopher; his theories were of central importance to Austromarxism. He was a brother of Oskar Adler. Social Democratic Party of Austria one of the oldest political parties in Austria The Social Democratic Party of Austria is a social-democratic political party in Austria that is, along with the People's Party, one of the country's two traditional major parties. As a university student, he became acquainted with many talented socialist intellectuals. [4] Aside from his studies of medicine, he studied history, economy, and philosophy. He and his fellow socialist students and friends [12] Karl Renner, Otto Bauer and Max Adler also studied political economy, taught by the marxist Carl Grünberg, and attended the lectures of the philosopher Ernst Mach, who both influenced Hilferding significantly. [13] He became one of the staunchest supporters of Victor Adler, founder of the SPÖ. [8] Karl Renner First Chancellor of Austria, Fourth President of Austria Karl Renner was an Austrian politician of the Socialist Party. He is often referred to as the "Father of the Republic" because he led the first government of German-Austria and the First Austrian Republic in 1919 and 1920, and was once again decisive in establishing the present Second Republic after the fall of Nazi Germany in 1945, becoming its first President after World War II. Otto Bauer Austrian Social Democrat Otto Bauer was an Austrian Social Democrat who is considered one of the leading thinkers of the left-socialist Austro-Marxist grouping. He was also an early inspiration for both the New Left movement and Eurocommunism in their attempt to find a "Third way" to democratic socialism. Carl Grünberg was a German Marxist philosopher of law and history. Having graduated with a doctorate in 1901, he began working in Vienna as a pediatrist, [14] however not with much enthusiasm. He spent much of his leisure time studying political economy, where his real interest lay, [4] but he would not give up his profession until his first publications gave him success. [12] He also joined the social-democratic party in Austria. In 1902 he contributed to the social-democratic newspaper Die Neue Zeit on economic subjects [1] as requested by Karl Kautsky, [9] at that time the most important marxist theoretician worldwide and who developed a long-lasting personal and political friendship with Hilferding. [15] His collaboration with Kautsky and his regular contributions to the Neue Zeit, the leading theory organ of the socialist movement, made him become a mediator between Kautsky and Victor Adler, trying to reduce their ideological differences. [16] In April 1902, he wrote a review of Eugen von Böhm-Bawerk's Karl Marx and the Close of His System (1896) defending Marx's economic theory against Böhm-Bawerk's criticism. [17] He also wrote two significant essays concerning the use of the general strike as a political weapon. [18] Already in 1905, his numerous publications have made him one of the leading social-democratic theoreticians and brought him into close contact with the party leadership of the SPÖ and of the Social Democratic Party of Germany (SPD). [19] Together with Max Adler, he founded and edited the Marx-Studien , theoretical and political studies spreading Austromarxism until 1923. [20] Karl Renner, Adler and Hilferding founded an association to improve the worker's education, which established Vienna's first school for workers in 1903. [21] Hilferding married the doctor Margarete Hönigsberg, whom he had met in the socialist movement and who was eight years his senior. She also had a Jewish background, had made her exams at the University of Vienna, and was a regular contributor to Die Neue Zeit. Margarete gave birth to their 1st child, Karl Emil. Kautsky worried that Hilferding, who now complained about his lack of time, would neglect his theoretical work in favor of his good social situation as a doctor in Vienna. Kautsky used his connections to August Bebel, who was looking for teachers for the SPD's training center in Berlin, to suggest Hilferding for this position. In July 1906, Bebel recommended Hilferding for this job to the party executive, which agreed to give it to him for six months. [22] Life in Berlin and World War I In 1906, he gave up his job as a doctor and, following August Bebel's call, [8] started teaching Economics and Economic history at the training center of the SPD in Berlin. [2] Having arrived in Berlin in November 1906, he taught there for one term, but a law forbade the employment of teachers without German citizenship. He had to give up this job and was replaced by Rosa Luxemburg [23] after being threatened with eviction by the Prussian police in 1907. [14] Until 1915, he was the foreign editor of the leading SPD newspaper Vorwärts , [1] [9] in the immediate proximity of the most important party leaders. [24] Bebel had recommended Hilferding for this job, after there was a conflict between the editors of Vorwärts and the party executive. His appointment was also meant to raise the share of marxism in the editing. In a short time, Hilferding took a leading role in the paper and was soon appointed editor-in-chief. [25] Together with his work for Die Neue Zeit and Der Kampf, it provided him an adequate income. [23] He was also supported by his fellow Austrian, Karl Kautsky, [4] who was his mentor and whom he succeeded in the 1920s as the chief theoretician of the SPD. [26] Hilferding's theoretical abilities and his personal relationships to leading socialists allowed him to make his career in the party. [24] He published his most famous work, Das Finanzkapital (Finance Capital), in 1910, [14] which was an important theoretical milestone that has kept its importance until today. [27] It built Hilferding's reputation as a significant economist, a leading economist theoretician of the Socialist International, and, together with his leading position in Vorwärts, helped him raise into the national decision level of the SPD. It also confirmed his position in the marxist center of the SPD, of which he was now one of the most important figures. [27] Since 1912 he represented Vorwärts at the meetings of the party commission, which allowed him to decisively take part in the decision-making of the socialist politics in the years before World War I. [28] When World War I broke out in 1914, Hilferding was one of the few social democrats who from the very start opposed the SPD's Burgfriedenspolitik [4] and the party's support for the German war effort, [1] including its vote for war loans. [4] [9] In an internal party vote, he was only one of a small minority, led by Hugo Haase, a close friend of his, and thus they had to yield to the party's decision to support the Reichstag motion on the war loans. Hilferding, together with the majority of the editors of Vorwärts, signed a declaration to oppose these policies. [29] In October 1915, the SPD leadership fired all these opposing editors, but Hilferding had already been drafted into the Austro-Hungarian Army as a medic long before. [30] At first, Hilferding was stationed in Vienna, where he led the field hospital for epidemics. He lived together with his wife and his two sons, Karl and Peter, who was born in 1908. Thanks to his correspondence with Kautsky, he got news about the party. Then, in 1916, he was sent to Steinach am Brenner, near the Italian border, as a combat medic. During the whole war, Hilferding remained active in writing and was politically involved. He published numerous articles in Die Neue Zeit and Kampf. [31] One of these articles, published in October 1915, summarized the situation of the SPD and revised his theories of Finance Capital containing his first formulation of the concept of organized capitalism. [32] Weimar Republic Hilferding joined the anti-war Independent Social Democratic Party of Germany (USPD) in 1918. [3] During the November Revolution in 1918, he returned to Berlin, shortly after the Republic was proclaimed and the emperor had fled. [33] For the following three years, he was editor-in-chief of the USPD's daily newspaper, Die Freiheit , and thus member of the party executive. [33] The Freiheit quickly became one of Berlin's most widely read dailies with a circulation of 200,000. [34] Later, Kurt Tucholsky bashed him for his work for the newspaper in Die Weltbühne in 1925. The Council of the People's Deputies, the provisional government of the November Revolution, consisting of members of the SPD and USPD, which had signed the cease-fire, [33] delegated Hilferding to the Sozialisierungskommission (Socialization Committee). [14] Its official task was to socialize suitable industries. He spent months with this project, which was, in spite of support among the workers, not a priority for the government. In fact, the SPD leadership opposed socialization at this point since the armistice, demobilisation of the army and feeding the German people seemed more pressing issues at the time. Hilferding gave a speech before the Reichsrätekongress (worker's councils' congress) and presented a plan to socialize industry. It went down well with the congress and a resolution was passed, but the government largely ignored it. The government's lack of support was the reason why this committee was disbanded in April 1919. [35] After the Kapp-Lüttwitz-Putsch, the government, under pressure, appointed a new Socialization Committee, of which Hilferding was again a member, but the government was still not keen to pursue a course of socialization. [36] Tensions between the SPD and USPD escalated when Friedrich Ebert used troops to suppress riots in Berlin on 23 December 1918 without consulting the USPD. To protest the policies of the Council, the USPD withdrew its three representatives from the government. Hilferding, who had accused the SPD of trying to oust the USPD from government, supported this decision. After a poor performance of the USPD in the elections for the Weimar National Assembly, leading USPD politicians, including Hilferding, started to support workers' councils. Hilferding wrote articles in the Freiheit and made suggestions how they should be implemented, [37] which were sharply criticized by Lenin. [38] Hilferding disagreed with the Bolsheviks, led by Lenin, and opposed the October Revolution. He later described the USSR as "the first totalitarian state" and a "totalitarian state economy". [39] In 1919, he acquired German citizenship [14] and in 1920, he was appointed to the Reich Economic Council. [9] [20] In 1922, he strongly opposed a merger of the USPD with the Communist Party of Germany, which he attacked throughout the 1920s, [3] and instead supported the merger with the SPD, [14] where he emerged as its most prominent and visible spokesperson. [4] At the peak of the inflation in the Weimar Republic, he served as the German Minister of Finance [14] from August to October 1923. [20] He contributed to stabilizing the mark, but was unable to stop the inflation. [2] During his term of office, the introduction of the Rentenmark was decided, but he resigned from office shortly before the monetary reform took place. [14] From 1924 to 1933, he was publisher of the theoretical journal Die Gesellschaft . On 4 May 1924, he was elected to the Reichstag for the SPD [14] where he served as the SPD's chief spokesman on financial matters until 1933. Together with Karl Kautsky he formulated the Heidelberg Program in 1925. [14] Between 1928 and 1929, he again served as finance minister, [3] on the eve of the Great Depression. [2] He had to relinquish this position because of pressure from the President of the Reichsbank, Hjalmar Schacht, [40] causing his fall in December 1929 by imposing to the government his conditions for the obtainment of a loan. Life in exile After Hitler's coming to power, Hilferding as a prominent socialist and Jew had to flee into exile in 1933, [2] together with his close associate Rudolf Breitscheid and other important party leaders, first to Denmark, then Saarbrücken, Paris, and finally Zurich, Switzerland. [4] [1] He lived in Zurich until 1938 [3] and from 1939 on in Paris, France. [1] However, he remained influential, having been appointed to important posts in SPD's Sopade. Between 1933 and 1936, he was editor-in-chief of Die Zeitschrift für Sozialismus and contributor to Neuer Vorwärts . Until 1939 he was also the party's representative for the Socialist International and his advice was sought by the SPD leadership in exile. [3] After the attack on France he and Breitscheid fled to unoccupied Marseille. [14] Efforts were undertaken by the Refugee Committee, under Varian Fry, to get him out of Vichy France, along with Rudolf Breitscheid. However, they both refused to leave illegally, because they didn't have identification papers. [41] They were arrested by the police of the Vichy government in southern France and, despite their emergency visa to enter the United States of America, handed over to the Gestapo on 9 February 1941. [42] Hilferding was brought to Paris and was severely maltreated on the way. [5] After being tortured, he died of unknown causes [43] in a prison in Paris, [2] [9] the Gestapo dungeon of La Santé. [44] His death was not officially announced until the fall of 1941. [5] Fry, among others, believed that Hilferding was murdered by the Gestapo on the orders of Adolf Hitler or another senior Nazi Party official. Hilferding's wife, Margarete, died in the Theresienstadt concentration camp in 1942. [45] Finance Capital Finanzkapital, 1923 Hilferding - Finanzkapital, 1923 - 5171455.tif Finanzkapital, 1923 Hilferding's Finance Capital (Das Finanzkapital, Vienna: 1910) was "the seminal Marxist analysis of the transformation of competitive and pluralistic 'liberal capitalism' into monopolistic 'finance capital'", [46] and anticipated Lenin's and Bukharin's "largely derivative" writings on the subject. [47] Writing in the context of the highly cartelized economy of late Austria-Hungary, [48] Hilferding contrasted monopolistic finance capitalism to the earlier, "competitive" and "buccaneering" capitalism of the earlier liberal era. The unification of industrial, mercantile and banking interests had defused the earlier liberal capitalist demands for the reduction of the economic role of a mercantilist state; instead, finance capital sought a "centralized and privilege-dispensing state". [49] Hilferding saw this as part of the inevitable concentration of capital called for by Marxian economics, rather than a deviation from the free market. Whereas, until the 1860s, the demands of capital and of the bourgeoisie had been, in Hilferding's view, constitutional demands that had "affected all citizens alike," finance capital increasingly sought state intervention on behalf of the wealth-owning classes; capitalists, rather than the nobility, now dominated the state. [50] In this, Hilferding saw an opportunity for a path to socialism that was distinct from the one foreseen by Marx: "The socializing function of finance capital facilitates enormously the task of overcoming capitalism. Once finance capital has brought the most importance ( sic ) branches of production under its control, it is enough for society, through its conscious executive organ – the state conquered by the working class – to seize finance capital in order to gain immediate control of these branches of production." [51] This would make it unnecessary to expropriate "peasant farms and small businesses" because they would be indirectly socialized, through the socialization of institutions upon which finance capital had already made them dependent. Thus, because a narrow class dominated the economy, socialist revolution could gain wider support by directly expropriating only from that narrow class. In particular, according to Hilferding, societies that had not reached the level of economic maturity anticipated by Marx as making them "ripe" for socialism could be opened to socialist possibilities. [52] Furthermore, "the policy of finance capital is bound to lead towards war, and hence to the unleashing of revolutionary storms." [53] 1. 1 2 3 4 5 6 7 International Institute of Social History, Rodolf Hilferding Papers. 2. 1 2 3 4 5 6 7 8 Wistrich, Robert Solomon (2002). Who's who in Nazi Germany. Psychology Press. pp. 110–11. ISBN   978-0-415-26038-1. 3. 1 2 3 4 5 6 7 8 Smaldone, William, Rudolf Hilferding and the total state., 1994. 4. 1 2 3 4 5 6 7 8 9 David E. Barclay, Eric D. Weitz, Michael Kreile. Between Reform and Revolution: German Socialism and Communism from 1840 to 1990 5. 1 2 3 German Resistance Memorial Center. 6. The New School. 7. 1 2 Lane, A. T. (1 December 1995). Biographical Dictionary of European Labor Leaders. Greenwood Publishing Group. ISBN   9780313264566. 8. 1 2 3 Ruth Fischer, Stalin And German Communism: A Study in the Origins of the State Party. 9. 1 2 3 4 5 6 Malcolm Charles Sawyer, Philip Arestis, A Biographical Dictionary of Dissenting Economists. 10. 1 2 William Smaldone, Rudolf Hilferding, Dietz, 2000. ISBN   3-8012-4113-0. p. 14. 11. William Smaldone, Rudolf Hilferding. p. 15. 12. 1 2 William Smaldone, Rudolf Hilferding. p. 22. 13. William Smaldone, Rudolf Hilferding. p. 19. 14. 1 2 3 4 5 6 7 8 9 10 11 ‹See Tfd› (in German) Deutsches Historisches Museum, Biographie: Rudolf Hilferding. 15. William Smaldone, Rudolf Hilferding. p. 30. 16. William Smaldone, Rudolf Hilferding. p. 41. 17. William Smaldone, Rudolf Hilferding. p. 27. 18. William Smaldone, Rudolf Hilferding. p. 33. 19. William Smaldone, Rudolf Hilferding. p. 40. 20. 1 2 3 Robert Benewick, Philip Green, The Routledge Dictionary of Twentieth-Century Political Thinkers. 21. William Smaldone, Rudolf Hilferding. p. 43. 22. William Smaldone, Rudolf Hilferding. p. 41, 42. 23. 1 2 William Smaldone, Rudolf Hilferding. p. 50. 24. 1 2 William Smaldone, Rudolf Hilferding. p. 47. 25. William Smaldone, Rudolf Hilferding. p. 51. 26. William Smaldone, Rudolf Hilferding. p. 46. 27. 1 2 William Smaldone, Rudolf Hilferding. p. 52. 28. William Smaldone, Rudolf Hilferding. p. 70, 71. 29. William Smaldone, Rudolf Hilferding. p. 77, 78. 30. William Smaldone, Rudolf Hilferding. p. 85. 31. William Smaldone, Rudolf Hilferding. p. 85, 86. 32. William Smaldone, Rudolf Hilferding. p. 87. 33. 1 2 3 William Smaldone, Rudolf Hilferding. p. 96. 34. William Smaldone, Rudolf Hilferding. p. 114. 35. William Smaldone, Rudolf Hilferding. p. 107, 108. 36. William Smaldone, Rudolf Hilferding. p. 112, 114. 37. William Smaldone, Rudolf Hilferding. p. 101. 38. William Smaldone, Rudolf Hilferding. p. 104. 39. Liebich, Andre (18 February 1986). "MARXISM AND TOTALITARIANISM: RUDOLF HILFERDING AND THE MENSHEVIKS" (PDF). p. 52. Retrieved 14 November 2017. 40. Steinberg, Julien (1 January 1950). Verdict of Three Decades: From the Literature of Individual Revolt Against Soviet Communism: 1917-1950. Books for Libraries Press. ISBN   9780836920772. 41. Ryan, Donna F. (1 January 1996). The Holocaust & the Jews of Marseille: The Enforcement of Anti-Semitic Policies in Vichy France. University of Illinois Press. ISBN   9780252065309. 42. "Social democrats turned over to Germany (February 1941) - Biografie Willy Brandt". 1 October 2011. Archived from the original on 1 October 2011. Retrieved 12 April 2016.CS1 maint: Unfit url (link) 44. ‹See Tfd› (in German) 45. Geissmann-Chambon, Claudine; Geissmann, Pierre (1998). A history of child psychoanalysis. Psychology Press. p. 36. ISBN   978-0-415-11296-3. 47. Bideleux and Jeffries, p. 361. 48. Bideleux and Jeffries, p. 357–359. 49. Bideleux and Jeffries, p. 359. 50. Bideleux and Jeffries, p. 359–360. 51. "Rudolph Hilferding. Finance Capital: A Study of the Latest Phase of Capitalist Development. Chapter 25, The proletariat and imperialism." 52. Bideleux and Jeffries, p. 360. 53. Quoted in Bideleux and Jeffries, p. 360. Further reading Related Research Articles Finance capitalism Eugen Böhm von Bawerk Austrian economist Eugen Böhm Ritter von Bawerk was an Austrian economist who made important contributions to the development of the Austrian School of Economics. He served intermittently as the Austrian Minister of Finance between 1895 and 1904. He also wrote a series of extensive critiques of Marxism. Hermann Müller (politician) German chancellor Eduard Bernstein German politician Eduard Bernstein was a German social-democratic Marxist theorist and politician. A member of the Social Democratic Party (SPD), Bernstein had held close association to Karl Marx and Friedrich Engels, but he saw flaws in Marxist thinking and began to criticize views held by Marxism when he investigated and challenged the Marxist materialist theory of history. He rejected significant parts of Marxist theory that were based upon Hegelian metaphysics and rejected the Hegelian dialectical perspective. Wilhelm Liebknecht German socialist politician Wilhelm Martin Philipp Christian Ludwig Liebknecht was a German socialist and one of the principal founders of the Social Democratic Party of Germany (SPD). His political career was a pioneering project combining Marxist revolutionary theory with practical legal political activity. Under his leadership, the SPD grew from a tiny sect to become Germany's largest political party. He was the father of Karl Liebknecht and Theodor Liebknecht. Otto Wels German politician Erfurt Program The Erfurt Program was adopted by the Social Democratic Party of Germany during the SPD congress at Erfurt in 1891. Formulated under the political guidance of Eduard Bernstein, August Bebel, and Karl Kautsky, it superseded the earlier Gotha Program. <i>Die Neue Zeit</i> periodical literature Die Neue Zeit was a German socialist theoretical journal of the Social Democratic Party of Germany (SPD) that was published from 1883 to 1923. Its headquarters was in Stuttgart, Germany. Ultra-imperialism, or occasionally hyperimperialism and formerly super-imperialism, is a potential, comparatively peaceful phase of capitalism, meaning after or beyond imperialism. It was described mainly by Karl Kautsky. Post-imperialism is sometimes used as a synonym of ultra-imperialism, although it can have distinct meanings. Social democracy is a political, social and economic philosophy that supports economic and social interventions to promote social justice within the framework of a liberal democratic polity and a capitalist mixed economy. The protocols and norms used to accomplish this involve a commitment to representative and participatory democracy, measures for income redistribution and regulation of the economy in the general interest and welfare state provisions. In this way, social democracy aims to create the conditions for capitalism to lead to greater democratic, egalitarian and solidaristic outcomes. Due to longstanding governance by social democratic parties during the post-war consensus and their influence on socioeconomic policy in the Nordic countries, social democracy has become associated in policy circles with the Nordic model in the latter part of the 20th century. William "Bill" Smaldone is the E. J. Whipple Professor of European history at Willamette University in Salem, Oregon, United States. <i>Karl Marx and the Close of His System</i> book by Eugen von Böhm-Bawerk Karl Marx and the Close of His System is an 1896 book about the philosopher Karl Marx by the Austrian economist Eugen Böhm von Bawerk, in which the author critiques Marx's economic theories. <i>Vorwärts</i> periodical literature Vorwärts is a newspaper published by the Social Democratic Party of Germany (SPD). Founded in 1876, it was the central organ of the SPD for many decades. Following the party's Halle Congress (1891), it was published daily as the successor of Berliner Volksblatt, founded in 1884. Today it is published monthly, mailed to all SPD members. First Müller cabinet cabinet Cabinet Müller I or the first Cabinet Müller was the third democratically elected government of Germany and the second in office after the Weimar Constitution came into force in August 1919. It was named after the new Chancellor (Reichskanzler) Hermann Müller of the Social Democratic Party of Germany (SPD). The cabinet was based on the same three centre-left parties as the previous one: the SPD, the German Center Party (Zentrum) and the German Democratic Party (DDP). It was formed in March 1920 after the resignation of the Cabinet Bauer. The Cabinet Müller resigned in reaction to the outcome of the Reichstag elections of 6 June 1920. Social ownership is any of various forms of ownership for the means of production in socialist economic systems, encompassing public ownership, employee ownership, cooperative ownership, citizen ownership of equity, common ownership and collective ownership. Historically social ownership implied that capital and factor markets would cease to exist under the assumption that market exchanges within the production process would be made redundant if capital goods were owned by a single entity or network of entities representing society, but the articulation of models of market socialism where factor markets are utilized for allocating capital goods between socially owned enterprises broadened the definition to include autonomous entities within a market economy. Social ownership of the means of production is the common defining characteristic of all the various forms of socialism. Orthodox Marxism is the body of Marxism thought that emerged after the death of Karl Marx (1818–1883) and which became the official philosophy of the socialist movement as represented in the Second International until the First World War in 1914. Orthodox Marxism aims to simplify, codify and systematize Marxist method and theory by clarifying the perceived ambiguities and contradictions of classical Marxism. Karl Kautsky Czech-Austrian philosopher, journalist, and Marxist theoretician Georg Ledebour German politician and journalist Georg Ledebour was a German socialist journalist and politician. Crisis of Marxism was a term first employed in the 1890s after the unexpected revival of global capitalist expansion became evident after the Great Depression of Europe from 1873-1896, which eventually precipitated a crisis in Marxist theory. The crisis resulted in a series of theoretical debates over the significance of economic recovery for the strategy of the socialist movement, leading to ideological fragmentation and increasingly sectarian debates. By the 1890s, orthodox Marxists came to believe that capitalism was on the “verge of breakdown,” while the socialist movement was on the “verge of revolutionary triumph,” but due to a renewed burst of capitalist and industrial activity such interpretations could no longer be maintained in Western Europe.
Total Number of words made out of Typology = 42 Typology is an acceptable word in Scrabble with 17 points. Typology is an accepted word in Word with Friends having 18 points. Typology is a 8 letter medium Word starting with T and ending with Y. Below are Total 42 words made out of this word. Anagrams of typology 1). logotypy 5 letter Words made out of typology 1). loopy 2). goopy 3). ology 4 letter Words made out of typology 1). loot 2). pool 3). poly 4). plot 5). ploy 6). polo 7). glop 8). loop 9). tool 10). typy 11). goop 12). logy 13). typo 14). toyo 15). pogy 16). logo 3 letter Words made out of typology 1). toy 2). tog 3). too 4). top 5). pot 6). loo 7). got 8). goo 9). lop 10). lot 11). oot 12). opt 13). pol 14). ply 15). log 2 letter Words made out of typology 1). go 2). lo 3). to 4). oy 5). op 6). yo Typology Meaning :- A discourse or treatise on types. The doctrine of types. Word Finder Tools Scrabble finder Words with friends finder Anagram Finder Crossword Solver Note: There are 1 anagrams of the word typology. Anagrams are meaningful words made after rearranging all the letters of the word. Note There are 2 vowel letters and 6 consonant letters in the word typology. T is 20th, Y is 25th, P is 16th, O is 15th, L is 12th, G is 7th, Letter of Alphabet series.
Six Tips to Better Breathing In Chinese medicine, oxygen is known as “yang” and “Qi.” That makes sense, because there are parallels between these concepts and oxygen: they clear blockages, energize the body, and overcome any stagnant parts of the blood flow. Every cell needs oxygen, and the brain, heart, and liver wouldn’t exist without it. Here are six ideas to consider when boosting your body’s natural distribution of oxygen. 1. Breathe well: Get your lungs to the kind of air they love to breathe. In busy urban centers, the air quality is lower and the amount of oxygen in the air is around 10%. (As you can see, most of what we breathe is not oxygen.) In rural settings, outside of the hubs, oxygen content is generally around 20%. If you don’t live in a rural area, take frequent trips out there for a hike or a picnic and allow your body to soak up the oxygen. 2. Limit toxins: This comes in the form of limiting meat in your diet, and avoiding big meals. Try to spread out your meals throughout the day, and make them small. (This will also help with anyone looking to drop a few pounds.) The flow of Qi in your body, according to the Chinese, comes through breathing and eating. By eating less, more Qi and oxygen are available in the body. 3. Exercise: Get some physical activity every day to help circulate the flow of blood (and thus oxygen) everywhere in the body. 4. Moderate stress: Try participating in yoga breathing exercises or any relaxation therapy you want to cut down on stress and focus on the intake of oxygen. 5. Consider germanium: This is an element that increases the effect of oxygen in your body. Find it in foods and herbs such as shiitake and reishi mushrooms, garlic, ginseng, aloe vera juice, barley, beans, tomato juice, and chlorella. You can also find germanium supplements. 6. Try hyper-oxidization: These are techniques, such as ozone therapy and hydrogen peroxide therapy, which pump the body with high levels of oxygen. They boost your immunity, but should only be attempted with a doctor’s supervision. They are considered effective for anyone who has a disease caused by severe oxygen deficiency. Want to know more about Chinese medicine? Click here to learn more about the “Chinese Medicine Healing Miracles” newsletter. Tags: , , , , , , ,
Garage filling stations — are we getting close? Can algae become the new biodiesel? Supporters call it “clean diesel” to differentiate it from “biodiesel,” and indeed, there is a difference. Soybeans, the main feedstock for biodiesel, have only a 2-3 percent oil content. Some species of algae can have up to 60 percent oil content. This reduces the land requirements for growing a crop by a factor of 30. So is algae biodiesel one of those great ideas that is always just over the horizon? Or has it germinated long enough that it may finally about to become a reality? The outcome still appears to be up for grabs. The term “algae” actually cover a whole spectrum of organisms, from the 20-foot ribbon-like “seaweed” that grows in ponds and along littoral shores to the mid-ocean, microscopic “plankton” that is the diet of whales. All have one thing in common – they use carbon and sunlight to photosynthesize organic material. And they are good at it. Some species can double their mass within 24 hours. Thousands of species thrive in varying environments. Last summer, a red algae “tide” that feeds on farm runoff at the mouth of the Mississippi River “bloomed” to cover 5,000 square miles of the Gulf of Mexico, killing all manner of birds, fish and marine life, including hundreds of manatees. “If we can figure out how to make energy out of that,” President Obama told an audience at the University of Miami, “we’ll be doing alright.” The idea of harvesting algae for energy was first suggested by Richard Harder and Hans von Witsch, two European scientists at the outbreak of World War II. Nothing much developed, however, and interest didn’t revive until the Energy Crisis of the 1970s, when the Department of Energy set up an Aquatic Species Program to pursue research. Funded with $25 million over the next 18 years, the Aquatic Program investigated thousands of species, finding the Chlorella genus the most promising. It also made an important discovery. When Chlorella is deprived of nitrogen, it can increase its lipid (fat and oil) content to a remarkable 70 percent of mass! Remember, soybeans are only 2-3 percent lipids. But this created a conundrum. While depriving algae of nitrogen might may increase lipid content, it also severely inhibited growth. The Aquatic Program had not yet resolved this dilemma when it was disbanded in 1996. Private companies picked up the research, however, and have tried to overcome it with genetic engineering. While pursuing this, they have developed two methods of cultivation. The easiest is to grow algae in open pools or “raceways” that devour large areas of land, since sunlight can only penetrate a few centimeters into the algal mat. The problem here is that most species are highly sensitive to variations in acidify, temperature and humidity. Their high lipid content also means they synthesize fewer proteins, which makes them extremely vulnerable to invasive species. This makes it very difficult to bring them up to commercial scale. The more advanced technology is “photobioreactors,” conducted in large networks of glass or plastic tubes. The system overcomes environmental difficulties but is very expensive. In 2009 Exxon combined with J. Craig Venter, the decoder of the human genome, to try to develop a commercial method for developing algae-based fuels. After investing $600 million, however, Exxon pulled out of the enterprise in 2013, saying commercialization was 25 years away. Nevertheless, several small companies say they are now making progress. Algenol, a Fort Myers, Fla. company, says it has developed a revolutionary “3rd generation” technology that can produce ethanol, jet and diesel fuel 8,000 gallons per acre, 18 times the output of corn-based ethanol, at $1.25 per gallon. Sapphire, a San Francisco company, has opened a 100-acre Green Crude Farm in New Mexico and hopes to be producing 100 barrels a day next year with full-scale commercialization by 2018. And Aurora Algae, a Hayward, Calif. firm which has operated a test facility in Western Australia for the last three years, has just announced an open-pond operation in Harlingen, Texas that it hopes to expand to 100 acres. There is one great irony to all this. A full-blown algae industry already exists, providing feedstock for food additives, cattle silage and nutritional and pharmaceutical products. Some highly specialized fatty acids derived from exotic species can fetch $10,000 per gallon. In fact, the current industry sees algae-for-fuel as a rather low-grade use. “Until more federal funding is available, my members are going to continue growing for the higher-value products,” Barry Cohen, executive director of the National Algae Association, told Slate’s John Upton. “We have algae companies that are growing for the ingredients industry, the food industry and the nutraceutical industries. If they can grow the right species, those companies will buy every drop they can make.” What makes these operations viable, of course, is their high-value end products, which cover the costs of growing algae in commercial quantities. An algae-for-fuel industry will either have to: a) develop new species that are much more efficient or b) perfect mass-production techniques that can bring prices down to an acceptable range. Only then will “clean diesel” become a competitor. For now, the industry seems headed in the right direction. The oil industry and API, at it again. When will they ever learn? Never a dull moment! The API is at it again. Just a few days ago, it dramatically issued a survey indicating that close to 70% of all consumers were worried that E15 (a blend of 15% ethanol and 85% gasoline) would damage their cars. While the survey was done apparently by a reputable firm, it was not attached to the press release, preventing independent experts or advocate group experts from commenting or verifying the questions and the sample. More importantly, the survey was preceded by an expensive oil industry media blitz that illustrated or talked about the so-called evils of ethanol. The survey and media show reflected an attempt by the oil industry to eliminate or weaken the renewable fuel mandates and lessen competition from alternative transitional fuels. Americans are usually not Pavlovian in demeanor or behavior; we do ask for second and even third opinions from our doctors. But when only one group, in this case, the oil industry, has put out a continuous flashy very expensive multimedia message, the API’s survey results were almost preordained to reflect the published results. Whatever the industry wanted it got! If you tell a misleading partial story to create fear and uncertainty, long enough, it will likely influence many. In this case, the API, if it had a nose, its nose, similar to Pinocchio’s, would be growing and growing and growing. Let’s look at the facts — never acknowledged by the API in its “Fuel for Thought” campaign. 1. DOE effectively demolished the API-supported study many months ago indicating that the sampling approach was wrong and the analysis was faulty. DOE’s study used a much larger number of vehicles and was far more rigorous concerning methodology. (Just to let you know, API is an oil industry funded group.) 2. Many countries around the world have used E15 and higher ethanol blends as a fuel without significant problems. They are seen as a way to reduce environmental problems. They are cheaper than gasoline and they reduce the need, at times, for oil imports. Put another way, they improve quality of life, lower costs to the consumer, and are good for the economy and security. 3. Although oil company franchise agreements with gas stations have limited the number of stations able to sell E15, several states (mostly in the Midwest) with multi-fuel stations, have demonstrated the merits of E15. Early data appears to discount engine problems. Hell, Henry Ford’s initial car was designed to run on pure ethanol until the temperance movement supported by Standard Oil banned the use of manufactured alcohol. I know Standard Oil was very concerned that Americans would drink ethanol at their favorite bars or in front of their favorite fire place with their favorite significant other. Praise be to Standard Oil for salvation! The law (RFS) requires a 10% ethanol blend with gasoline. More than a year ago, EPA OK’d the sale of E15 (for most cars particularly those produced after 2001). In June, the Supreme Court refused to hear the appeal by the oil industry of EPA’s standards. API’s media campaign raises the food versus fuel fight canard because ethanol is produced mostly from corn as the feedstock. But the narratives neglect to raise the fact that the evidence concerning the negative impact on food is disputed by reputable analysts who indicate that, for the most part, the corn used for ethanol production is not your friendly grocery counter corn. Put another way, most of the corn to ethanol conversion comes from corn not able to be used for food. Yes, there still maybe some impacts on corn production and prices because of the growers reallocation of land, in light of the differential between corn and ethanol prices, to ethanol. However, many studies suggest that if a negative food impact exists, it is relatively minor. It is a worthy debate. It appears, that API, conveniently, forgets to mention that ethanol can be produced efficiently and effectively from natural gas and that cellulosic based ethanol is now being manufactured or will soon be manufactured in large volumes by several companies. Further, Clean Energy Fuels announced this week that it will start selling fuel made from methane in landfills and other waste sources in over 40 stations in California. Success of these initiatives, likely, will mean the end of the fuel versus food issue. If success is combined with the inexpensive conversion of existing cars to flex fuel cars permitting them to use alternative fuels, America will be blessed with a much cleaner, environmentally safe, and cheaper alternatives to gasoline- assuming the oil industry doesn’t block their sale at fuel stations. Clearly, the oil industry does not want competition at the pump from ethanol…whether corn, cellulosic, garbage or natural gas. The American public should be wary of misleading guerilla marketing through industry funded surveys or not so benign expensive media blasts by captive organizations like API. Hopefully, the American consumer will not be confused for long. Paraphrasing a song by Peter, Paul and Mary about war and peace and a statement by President Lincoln, when will the oil companies ever learn?, and, if they don’t learn, when will they recognize “they can fool all the people some of the time and some of the people all the time but they cannot fool all the people all the time.”
Steps for creating a Wikipedia page for yourself gallery/steps for creating a wikipedia page for yourself Since its inception, Wikipedia has maintained a standard for quality, and over time, it became one of the top few platforms over the internet. With businesses, trying to make their way to the top of the internet search engine, wiki-marketing became a thing that is accepted and invested in. For creating a Wikipedia page, a writer will have to look into rules and policies. Creating a Wikipedia page and publishing wiki article is a challenging domain that requires expertise and knowledge. For getting a Wikipedia page that is accepted by the moderators, immediately a person can look into online guides, which provide information over questions like how to get a Wikipedia profile. However, if you are not an expert writer and if you do not know much about creating a wiki page, then you should read this article. Listed below are essential aspects, which are needed to be taken care of and followed for entering the wiki community smoothly, even if you do not have any experience. It will also help those who want to make a prominent business identity over the internet. 1. Go through the research process: Wikipedia is an authentic platform, and all the information that is presented in wiki articles is trusted and taken from credible sources. Therefore, when you make up your mind for writing a wiki article about your business, you will have to research and analyses your topic and your presence over the internet. Make sure that the information that you collect is taken from credible sources. For targeting the reliable source of information, you should know the techniques required for research. If you know the necessary research tools and techniques for collecting credible information, then you will be able to become a wiki expert in no time. You can use the WP: RA tool. Using the Wikipedia request article tool, you can read recently posted content over the wiki platform, and you can look for available topics to write. It presents to you a list of libraries which have questions for you to choose from and start writing. 2. cite your sources: The first most integral step to creating a wiki article is that you have to use information from credible sources alone. Not just that you will have to cite your sources. Experts and moderators at Wikipedia are critical about the origins of knowledge. As the source of information is what makes it reliable or unreliable. Therefore it is essential for readers and the platform's standard. When you post a piece of information at this platform, make sure that you cite the correct source. Conventional sources, like newspaper publications, are giving more importance. 3. write your post using the sandbox: The sandbox is an editing window that is provided in the wiki platform. It is an excellent tool for writers to use when writing an article. It is efficient to use when editing, reviewing and formatting an essay. It is essential because it provides the writer with an environment that the writeup will get after going through the publishing process. It allows the writer to make necessary changes in their content according to the layout. 4. make edits, submit and then wait for approval: The next thing to do is to make your article go through mandatory editing and proofreading phase, after when you have fixed and corrected all the errors that you find. You can submit your post after when you are done going through this process. When you are providing your article, it does not mean that you are publishing it. When you submit your report for approval professional wiki editors, and moderators proofread your content for seeing if your writeup is written while keeping ll the wiki rules and regulations in mind or not. Getting your post approved might take a little time. Therefore, you will have to wait patiently for the final process to complete. 5. register an account: Creating your wiki account is essential before you go on and write your article you should get yourself registered. Getting a personal Wikipedia account will make the publishing process easier for you. It also allows you to monitor and trace the changes made in your published wiki article. You will be able to get constant updates and keep an eye out for false edits made.
In Sinafala village, an infant sleeps on her mother's lap. Battling newborn infections by protecting moms first Can a vaccine for pregnant moms protect their babies from dangerous bacterial infections? PATH’s Mark Alderson believes it can. A newborn baby lies in a neonatal intensive care unit bed. Photo of Mark Alderson’s newborn son in the neonatal intensive care unit. Photo: Mark Alderson. The first 10 days of my son Scott’s life were spent in the neonatal intensive care unit (NICU) at Swedish Hospital in Seattle, his tiny body hooked up to intravenous (IV) antibiotics in an attempt to control the bacterial infection that pervaded his system. The IV line began in his foot but his small veins ruptured so easily that the line had to be moved to his other foot, then his hand, and eventually to his head. Doctors continuously poked and prodded and even performed a spinal tap with a needle that seemed as large as Scott’s entire body. My wife and I—both first-time parents—couldn’t do anything other than watch and hope as he struggled to fight off a bacterial infection with the potential to cause meningitis, neurological sequelae, and even death. He was suffering complications from group B Streptococcus (GBS), a bacterial infection that is common and generally benign in adults but can be deadly for infants. The bacteria can be passed from mother to baby during birth. It’s scary because the bacteria frequently cause sepsis, pneumonia, and meningitis—often within hours of being born. We were lucky—doctors were able to promptly diagnose and treat Scott so he was able to make a full recovery—but many families in other parts of the world aren’t so lucky, especially those in low-resource countries who lack access to antibiotics, rapid diagnostics, or specialty care in a NICU. An infant sleeps on her mother's lap. Not all babies are born with the same access to high-quality health care. At PATH, we’d like to change that. Photo: Gabe Bienczycki. Those 10 days showed me the powerlessness families in low-resource countries must feel when faced with medical challenges like neonatal GBS infection. In more developed regions, we’ve made some progress in the fight against GBS; the United States and much of Europe routinely screen pregnant women for the bacterium or for risk factors (though that wasn’t the case when my son was born) and administer prophylactic antibiotics during labor to prevent GBS disease. But in low-resource countries where GBS disease burden is highest, preventative measures are impractical and out of reach. Prevention is better than cure GBS prevention isn’t as straightforward as increasing access to early screenings and antibiotics, which are only effective against early-onset disease (the form that afflicts babies up to seven days of age). All infants—even those born healthy to mothers who don’t carry the bacterium—are vulnerable to late-onset GBS disease in the weeks or months following birth. Plus, antibiotic use is not without risk; it contributes to antibiotic-resistance and can alter a baby’s microbiome (the beneficial bacteria and microbes in a baby’s body and gut). Compromising this microbiome can contribute to health issues later in life. And, GBS may play a role in miscarriage, stillbirth, and preterm delivery—all cases where maternal antibiotic prevention is of little help. As the proverb says, prevention is better than cure. What we need is a vaccine No licensed vaccines currently exist against GBS, but PATH is hoping to change that. We’re working with the Biovac Institute in South Africa, Inventprise, and other partners to develop a GBS vaccine that can be delivered to pregnant women, who would then pass on the protective antibodies to their babies and eliminate the chance of newborn infection. A GBS vaccine has huge potential all over the world, but would be revolutionary in low-resource countries that have limited access to existing interventions. South Africa has one of the highest rates of GBS disease, with approximately 3,000 babies born annually with the disease. Of those babies, an estimated 500 won’t survive the infection, and 700 will be left with severe, lifelong disabilities. Many countries underestimate disease incidence; other countries simply don’t have impact numbers at all. A group of people stand in front of the PATH mural in Seattle's office. The multisectoral team tackling group B Streptococcus is made up of dedicated global health professionals from PATH and our partners. Photo: PATH/Patrick McKern. A vaccine, developed specifically with low-resource countries in mind, would provide infants around the world with access to the crucial protection they need against GBS. After starting life in the NICU, Scott is now a healthy young adult without any memory of that experience—the GBS infection didn’t leave a lasting impact. But thousands of children worldwide never make it beyond babyhood—and even more suffer blindness, deafness, and developmental delays that serve as a daily reminder of the infection’s potential for lifelong damage. With this project, we have an opportunity to change that. About the Author Mark Alderson is the director of the pneumococcal vaccine and the polyvalent meningococcal vaccine projects in the Center for Vaccine Innovation and Access at PATH. Post a Comment
Business, Social and Learning Analytics Alternative Content Nowadays the data analysis assumes a fundamental role in the organizations. It is important that the organizations are competitive and it is necessary that they are at the forefront of competition. The area of Analytics plays a fundamental role here. According to INFORMS (Institute for Operations Research and Management Science), Analytics represents a combination of computer technologies, scientific management techniques, and statistics to solve real problems, considering that organizations have to analyze their data, in order to understand what is happening, what will happen and how to make the best option.  The INFORMS proposes three levels for Analytics, namely, descriptive Analytics, which refers to knowing what happened and what is happening in the organizations, Predictive Analytics, in order to determine what is likely to happen, and prescriptive Analytics, with which it is intended to recognize what is happening as well as the most likely forecasts and make decisions to achieve the best performance. These three levels are not independent and many times they are partially overlapping.  In this area of research, there is still a big gap in the way of collecting data for its treatment. It is thus intended to respond to the needs of the organizations for a general improvement of their practices and results, starting from the definition of good practices of data analysis resulting from their operations, namely through the creation of systems and technologies for data collection and analysis. The aim is to produce scientific articles, research projects, and workshops, promoted by researchers and companies in order to deepen the practical knowledge of the problems to be solved. It is also expected the development and implementation of solutions capable of providing answers to the problems found.
Fashion Industry Terms As a fellow fashion industry newbie, I understand your frustrations, and if you’re anything like me, you expect to be an expert on your first day of trying something new (realistic, right?). That’s almost certainly not going to be the case, and that’s okay! The world of fashion truly does have its own language, but it’s really not as overwhelming as it seems. Back in April, our friends over at Maker’s Row compiled a super-helpful A – Z Glossary on Apparel Manufacturing, and we’ve taken six of their top 15 must-know fashion industry terms and expanded upon them a bit to help you better understand them and start talking like a seasoned veteran in no time! So, are you ready for your vocabulary lesson? 1. Minimum Order Quantity (MOQ) This is the minimum number that a vendor requires in order for you to employ their servicesyou must order at least X of something to work with that manufacturer. There are factories with high minimums for larger fashion brands, some with no minimums (like JLD-Studios!) for smaller independent brands, and factories with minimums everywhere in between. One of the great things about working with a manufacturer who offers zero minimums is that if you only need a certain number of units produced, you’ll only be paying to have that number of units produced. 2. Sourcing Sourcing is the process of finding materials or services (fabrics, trims, labels, etc.) and it is an integral part of fashion design. You can source locally or globally, so your silk might come from China and your buttons down the street from your apartment. You can buy wholesale or retail, though it is much more cost-effective to find a wholesale supplier. StartUp FASHION has a great article about fabric sourcing for industry newcomers that you’ll be glad you read! 3. Computer Aided Design (CAD) Computer Aided Design, or simply CAD, is a method of conceptualizing your garments using special computer software. As we get further into the digital age, the days of sketching out designs with a pen and paper are fading fast, and designers are relying more and more upon CAD software to create and develop their products. 4. Pattern The garment’s pattern, in the simplest of terms, is the guide used to construct your product. Not to be confused with a print/textile design, the pattern is the model for each piece used to construct the garment. Paper patterns are the traditional method, but CAD patterns are more widely used today. Be sure to consult with your factory as to which method they would prefer; it is much easier to print digital patterns than it is to digitize paper patterns. 5. Cut and Sew (CMT) Cut and sew (also known as cut, make, and trim, or CMT) garments are typically of higher quality, as the garment has been customized from raw fabric; knit fabrics are laid out and cut like a woven fabric instead of being full-fashioned. There are so many more fashion industry terms to know, but now that you’ve got a head start on learning some of the key ones, you’ll be ahead of the curve before you know it. Make sure to Contact Us for more information about the services JLD-Studios provides. Good luck out there!
Your search found 3 Results 1. 1 United Nations. Ad Hoc Expert Group on Demographic Projections In: United Nations. Department of International Economic and Social Affairs. Population projections: methodology of the United Nations. Papers of the United Nations Ad Hoc Expert Group on Demographic Projections, United Nations Headquarters, 16-19 November 1981. New York, United Nations, 1984. 4-6. (Population Studies No. 83 ST/ESA/SER.A/83) These recommendations refer specifically to the work of the Population Division of the UN and the regional commissions and more generally to the work of the specialized agenices, which prepare projections of labor force and school enroolment. The current recommendations may be regarded as updating an earlier detailed set that was issued by a similar group of experts who convened in New York in November 1977. The recommendations cover general considerations, sources and assumptions, evaluation of projections and their uses, and internal migration and urbanization. The Population Division should consider the question of an optimal time schedule for publishing new estimates and projections in order to avoid unduly long intervals between publications and intervals so short as to cause confusion. The UN Secretariat has an important role in pursuing work on methodology of projections and making it available to demographers in the developing countries. Unique problems of demographic projection exist for those countries with particularly small populations. It is proposed that the Population Division prepare special tabulations, whenever possible, giving the estimated age and sex distribution for these countries. Future publications of population projections prepared by the Population Division should indicate the major data sources on which the projections are based and note if the data were adjusted before inclusion. In addition, some grading of the quality of the base data should be presented. For the UN set of national and international population projections, a more comprehensive system of establishing assumptions about the future trends of fertility is needed. The Secretariat needs to focus more attention on the evaluation of its population projections. UN publications of projections should report on the main errors in recent past projections with respect to estimates of baseline levels and trends and provide some evaluation of the quality of the current estimates. It is recommended that the UN encourage countries to establish a standard definition of urban which would be used for international comparisons but generally not replace current national definitions. The Secretariat should review the techniques currently used to project urban-rural and city populations and search for methodologies appropriate to the level of urbanization and the quality of data which would improve the accuracy of the projections. The Division should regularly produce long range population projections for the world and major countries and should continue and expand its household estimates and projection series, which provides information essential to government administrators and planning agencies, businesses, and researchers in all countries. Add to my documents. 2. 2 [Recommendations of the Population World Plan of Action and of the United Nations Expert Group on Population Distribution, Migration and Development] Recomendaciones del Plan de Accion Mundial sobre Poblacion y del Grupo de Expertos de la Organizacion de las Naciones Unidas sobre Distribucion de la Poblacion, Migracion y Desarrollo. De Oliveira O In: Reunion Nacional sobre Distribucion de la Poblacion, Migracion y Desarrollo, Guadalajara, Jalisco, 11 de mayo de 1984, [compiled by] Mexico. Consejo Nacional de Poblacion [CONAPO]. Mexico City, Mexico, CONAPO, 1984. 21-31. Highlights are presented of the expert meeting on population distribution, migration, and development held in Hammamet, Tunisia, in March 1983 to prepare for the 1984 World Population Conference. Rafael Salas, Secretary General of the World Population Conference, indicated in the inaugural address of the meeting that changes in the past 10 years including the increasing importance of short-term movements, illegal migrations, and refugees would require international agreements for their resolution. In the area of internal migrations, Salas suggested that in addition to migration to metropolitan areas which continues to predominate, short-term movements of various kinds need to be considered in policy. Improvement in the quality of life of the urban poor is an urgent need. Leon Tabah, Adjunct Secretary General of the World Population Conference, pointed out that population distribution and migration had received insufficient attention in the 1975 World Population Conference, and that the World Population Plan of Action should be modified accordingly. Among the most important findings of the meeting were: 1) The Plan of Action overstressed the negative effects of urbanization and rural migration. Available evidence suggests that migration and urbanization are effects rather than causes of a larger process of unequal regional and sectorial development 2) The historical context of each country should be considered in research and planning regarding population movements. 3) Analyses of the determinants and consequences of migration were reexamined in light of their relationship to the processes of employment, capital accumulation, land tenure, technological change, ethnic and educational aspects, and family dynamics. 4) The need to consider interrelationships between urban rural areas in formulation of policy affecting population distribution was emphasized. 5) National development strategies and macroeconomic and sectoral policies usually have stronger spatial effects than measures specifically designed to influence population distribution, and should be examined to ensure compatability of goals. 6) Population distribution policies should not be viewed as ends in themselves but as measures to achieve larger goals such as reducing socioeconomic inequalities. 7) Multiple levels of analysis should be utilized for understanding the causes and consequences of population movements. 8) Programs of assistance should be organized for migrants and their families. 9) The human and labor rights of migrants and nonmigrants should be considered in policy formulation. 10) Policies designed to improve living and working conditions of women are urgently needed. Add to my documents. 3. 3 Some problems in the making of population projections. Tabah L In: United Nations. Department of International Economic and Social Affairs. Population projections: methodology of the United Nations. Papers of the United Nations Ad Hoc Expert Group on Demographic Projections, United Nations Headquarters, 16-19 November 1981. New York, United Nations, 1984. 15-6. (Population Studies No. 83; ST/ESA/SER.A/83) As the UN demographic estimates and projections cover all the developed and developing countries, special problems are encountered in data collection and evaluations. The responsibility for the UN projections rests primarily with the Population Division, but the results are the product of collaboration by all responsible offices within the UN system. This is 1 of the strengths of the UN population projections, yet there are numerous problems concerning those projections. Aside from the perpetual difficulties with collection and estimation of basic demographic indicators from incomplete data, all of which must be continuously undertaken, there are 8 major problems which have become more important in recent years and concern the current UN demographic projections. The 1st problem is the question of meeting the needs of the users who are the researchers, the planners, and the policymakers. The 2nd problem is that significant improvement can be made in the methodologies with, on the 1 hand, the prodigious advances in calculation devices and research techniques and on the other, a better knowledge of the economic and social context of demographic variables. The 3rd major problem in the component method of projections of fertility, which continues to be the most influential component to the future population of most nations. Another component of projection, mortality, has become a pressing issue in the field of projection as well. Knowledge of mortality in the third world is highly fragmentary. The 5th problematic issue is urbanization and city growth. There are severe problems with data comparability and projection methods. Sixth, for several developing and developed countries international migration plays a significant role in their population growth. More problematic than estimating the current net numbers of migrants is formulating assumptions about future patterns of international migration. Seventh, thus far demographic projections have largely been based on the demographic theory of transition, which appears to continue to be useful for developing countries. Yet, the demographic transition models are affected by a wider variety of trajectories than anticipated. Finally, no one has been able to explain clearly the major simultaneous movements of fertility of the developed countries. The question of obvious policy significance is what will happen in the future. Add to my documents.
A time for learning about musical sounds, their sources all around us, singing songs, clapping rhythms, beginning notation, the joy and wonder of many kinds of music! First Graders welcomed in Autumn by singing about leaves using motions, melodic and rhythm patterns. Music listening walks outdoors sensitized children to different natural sounds that connect to actual percussion and other instruments in the classroom. They are currently singing songs and playing short fragments of them on metallophones, learning to recognize orchestral instruments, speaking about how the music makes them feel and creating movements to melodies and textures.   In addition, they are listening and moving to Antonio Vivaldi's Winter music from the Four Seasons. The first graders will also listen to French renaissance music during readings of Frog and Toad. When listening to frog's music, children make a shoulder-tapping movement to the beat, and when listening to toad's music, they tap their knees to the beat. Enjoy these selections with your children and ask them to teach you the movements!  Mr. Frog                                    Flute Tap hands to the beat on shoulders. Enjoy the higher sounds of the flute playing the melody.     Mr. Toad                                    Tap hands to the beat on the knees or lower body. Enjoy the lower sounds of the rebec playing the melody. The first graders will also be learning a renaissance dance called the Branle Double to reinforce their feeling of the beat. They will dance this in a circle. Click on the link below to see a demonstration of the dance steps! The first graders will also be learning about design or form in music by watching the following video by and then using scarf movements to show the two main sections of this renaissance dance music called The Frog Galliard.  The music is played on an Archlute, a type of large lute from the String family of instruments.    The Frog Galliard
You are on page 1of 16 Iatrogenic Death and Disease via Acute and Chronic Mercury Poisoning A Crisis in Medical & Dental Science (Iatrogenic - Induced in a Patient by a doctor's activity, manner, therapy or medical treatment or diagnostic procedures) The International Medical Veritas Association (IMVA) has released this important document, meant to be spread throughout the world. Please send it out. change in basic health care, working to merge truths from diverse medical systems. The goal is to create a new form of medicine that will be more effective than could otherwise be achieved by separate systems alone. (For more information about IMVA: see below: Iatrogenic Death and Disease via Acute and Chronic Mercury Poisoning A Crisis in Medical & Dental Science (International Medical Veritas Association) The number of people in the United States who die iatrogenic[i] deaths is estimated by Dr. Barbara Starfield[ii] to be approximately225,000 to 284,000 a year, which included 106,000 deaths from properly prescribed medicine. These are considered avoidable deaths occurringat the hands of doctors in hospitals. Gary Null Ph.D. and his medical colleagues[iii] estimate the iatrogenic death figures much higher –786,000 by including outpatient deaths estimated at 199,000 (noted but not included by Starfield), and other categories of iatrogenic deaths like malnutrition perpetuated in hospitals, bedsores and infections -108,000, 115,000, and 88,000 respectively. The high end of these numbers represents 6 jumbo jets falling out of the sky each and every day and that is just for the population in America. In children there are many unexplained deaths that are classified as either Sudden Infant Death Syndrome (SIDS) or Shaken Baby Syndrome, where the last thing medical officials concede is the possibility that mercury and other toxins in vaccines are the cause. Thus there are other deaths that can be laid at the feet of the medical profession that are not counted in the above statistics. This is most controversial for we have many areas where deaths are not considered iatrogenic when they actually are. Notably, the high toxicity of chemotherapy and anti viral medication cause many deaths that are not counted since death is always attributed to the disease not to the highly dangerous treatment protocols. iatrogenic death and disease go unreported. The FDA and the American College of about 1 percent of serious events [adverse drug reactions] are reported to the FDA."[iv] The general rule of thumb presently used though is between 10%[v] to 20% percent of serious events getting reported. Thus the above numbers represent conservative figures, not figments of imagination. On a world wide level it is anyone's guess what the actual numbers are. It might be fair to just multiply by about twenty (scaling for populations percentages) yielding about 15 million deaths or 120 jumbo jets falling per day instead of six. The international numbers though could be a magnitude order higher due to special factors and considerations.[vi] The production of disease by the prescriptions of physicians is what is usually meant by iatrogenic disease. Iatrogenic disease is more difficult to count but the specific case of mercury poisoning gives us a window onto the hidden dimensions of what is a medical nightmare in progress. Despite the growing evidence to a causal link between mercury and neurological disorders, such as autism, attention deficit disorder, language delay, and learning difficulties, which are being reported on a world wide basis to be rising dramatically,[vii],[viii],[ix] the Institute of Medicine (IOM)[x] and the CDC,[xi] and a long string of other medical organizations[xii] are certifying mercury, one of the most toxic chemicals known to man, as being safe for use in vaccines. And they continue to do that even as they alert the public to a pandemic that has one child in 166 being diagnosed with autism spectrum disorders and as many as one in six children diagnosed with a developmental disorder and or with behavior problems.[xiii] This means that out of the 4 million born each year in the United States approximately 24,000 will be devastated with autism whose cause is being increasing blamed on mercury poisoning. And perhaps as many as 600,000 children with mild to severe learning disorders, which in part or in whole caused by the neurological destruction of brain cells that mercury is proven to precipitate. According to Dr. Mark Geier, who has studied the CDC's own data, "Kids who received 100 micrograms of thimerosal were over ten times more likely to have autism than the kids who received no mercury containing vaccines". Dr. Geier and his son David Geier calculated the overall neurodevelopment damage that can be sourced to mercury toxicity to be approximately 2,402,505 cases.[xiv] A careful reading of the published medical research clearly demonstrates that all sensible concern for published scientific research regarding the toxicity of mercury has been cast aside exposing the entire world's population to grave unwarranted harm.[xv] Mercury is a cumulative poison, and used with other toxic substances in medicine, like aluminum, antibiotics, and formaldehyde, create lethal and semi-lethal cocktails that damage human life. As each year passes scientists in laboratories around the world are showing that mercury poisoning is creating a wide swath of iatrogenic disease. Tragedies are evident in many areas, including the harm caused by food additives, preservatives, pesticides, water fluoridation, cancer and AIDS treatments, anti- depressive medications and other drugs having only marginal, if any, benefit. Many scientists and doctors have analyzed the dangers embedded in the health care system in general and concur that the current health care system is broken. Some eminent physicians high in the medical establishment like Dr. Donald Berwick, a Harvard trained physician who is a professor at both Harvard Medical School and the Harvard School of Public Health, conclude that nothing short of a medical revolution, that focuses on eliminating the danger, waste, confusion, and arrogance of modern medicine will do.[xvi] Some people believe that every drug is a poison and every dose of every drug produces disease. When we look, for example, at the fact that all forms of aspirin lead to approximately fifteen thousand deaths a year, we can begin to see that there is a basic truth spoken about drugs and the disease they create. All drugs do have side effects that create collateral damages to human organisms that in the extreme lead to death and chronic disease. This paper concerns drugs and dental products of high toxicity, specifically vaccines containing thimerosal and dental amalgams, both which are approximately fifty percent mercury by weight. Western medicine has been particularly blind to some very important aspects of healthy living according to Gary Null Ph.D. and is medical associates. "1) Stress and how it adversely affects the immune system and life process. 2) Insufficient exercise; 3) excessive caloric intake; 4) highly processed and denatured foods grown in denatured and chemically-damaged soil; 5) exposure to tens of thousands of environmental toxins."[xvii] Medical science and the medical establishment have a difficult time dealing in a forthright way with both iatrogenic death and disease and this is illustrated clearly when they define the most toxic substances as being safe no matter what evidence is put before them. Boyd Haley, PhD Chairman of Chemistry Dept. University of Kentucky Though mercury is not the only toxic material medicine tolerates in its products we pick on mercury for several principle reasons. First it is one of the most toxic substances known to mankind. Second it is commonly placed only inches from the brain in most people's mouths, and thirdly, because it is injected, via the childhood immunization schedule, directly into the bodies of babies starting from the first day of life. errors that lead to disease and death. But they also believe that approved medical practices have led to many cases of iatrogenic disease and death. The common use of mercury in medicine and dentistry provides us with a prime example of an approved and commonly used medical and dental practice that hurts people in significant ways. Mercury, which has been removed from most other medical products, is still endorsed by the world's dental organizations and its presence in thimerosal, a compound used in vaccines, is endorsed by the World Health Organization. What follows, in laymen's language, is a sweeping picture of a chemical nightmare that has occurred because medical and dental authorities have thrown to the wind the sound reasoning of unbiased and reputable scientists, who deal with toxicology, pathology, pharmacology and cell biology, thus exposing uncountable millions of adults and children around the world to serious injury, death, and lifelong mental impairment.[xviii] The first chapter exposes one of the greatest mistakes made by modern medical science, the practice of injecting thimerosal (mercury) into the bodies of newborns and infant toddlers via the childhood immunization schedule. The second chapter deals with how doctors compound the problem with the practice of injecting as many as nine vaccines into a child during a single office visit. This increases the amount of dangerous chemical compounds simultaneously mixed together and the amount of mercury a child will receive in one sitting. The third chapter probes the dental profession’s use of mercury based amalgam dental fillings and the serious damage that comes from constantly leaking amalgam that spill vaporous mercury into the oral cavity.[xix] [xx] [xxi] [xxii] We will find dentists contributing greatly to the mercury poisoning of the human race through the use of materials, that when removed from the mouth, are considered highly dangerous toxic waste by the Environmental personnel from mercury poisoning. Many dentists know of the dangers of removal and recommend leaving the amalgams in, believing it is healthier to maintain toxic waste dumps in human mouths. Mercury has been appropriately removed from all other medical products except these, for it is one of the most toxic and dangerous elements known to mankind.[xxiii] Dr Andrew Wakefield, the British gastroenterologist whose research in 1998 raised the first fears that the MMR combined jab could be linked to children developing autism, says about the thimerosal, "It should never have been there in the first place. Despite how they try to sell it, there is evidence that there is an association between mercury in vaccines and childhood disorders. Mercury was taken out of animal vaccinations 20 years ago because it was too toxic. Why on earth have we still been putting it in jabs for our children?" If we choose to live with atrocious medical behaviors, as is suggested by medical authorities in the US and elsewhere around the world, who see no problem using highly poisonous materials, we can doubt the future direction of civilization and certainly the protective paternal nature of government and medical organizations. To deliberately inject poisons into newborn babies for reason (or no reason)[xxiv] [xxv] is not justifiable under any circumstances. And to continue to use toxic materials for fillings in teeth, when alternatives are now available, is appalling. Heavy metal exposure during early development is associated with impaired neurological and cognitive function.[xxvi] [xxvii] Dr. M. Waly Department of Pharmaceutical Science Northeastern University Though all is quiet in regards to the amalgam issue lawmakers in the United States are in open rebellion against medical authorities at the CDC, the pharmaceutical companies, and the World Health Organization, which all still favor the use of thimerosal (mercury) even though many researchers are presenting its grave dangers. Presently Iowa, Missouri, Nebraska and Kansas have all presented legislation to ban thimerosal in childhood vaccines, and in April of 2004, federal congressman Dr. Dave Weldon and Congresswoman Carolyn Murphy from New York introduced legislation to ban mercury from vaccines at the federal level.[xxviii] Though there is a firestorm sweeping the halls of science, board rooms in pharmaceutical companies, a conflagration that is reaching the steps of the congress in Washington, with over four thousand cases of vaccine poisoning pending, in the third world the issue is not being discussed and as such children in most countries are being injected with full strength doses of mercury under the auspices of the World Health Organization. government embarked on a mandated vaccine program that exposed infants to the levels of thimerosal that occurred. Dr. Boyd E. Haley Mercury poisoning is the hidden disaster of public health and goes undiagnosed simply because of the stubborn intransigence of health officials that seem to be only worried about mercury in fish. From Alzheimer's disease, to a devastating lineup of other neurological diseases including Parkinson's, ALS, MS, autism and AD - mercury is known to be a potent neurotoxicant that either is the prime cause of such disorders or certainly is seen to exacerbate these neurological diseases.[xxix] If there is "any doubt whatsoever" about the safety of mercury in vaccines then it should be removed. Professor John Oxford Queen Mary's School of Medicine and Dentistry Take a single case of intense mercury poisoning in a child, a case where they have suffered from intense stripping of tubulin from the axon structure, or what is commonly known as demyelinating disorders [xxx], and you are talking about a child who will live in a state of perpetual agony incomprehensible to most people. No one knows today what percentage of demyelinating diseases are directly caused by mercury poisoning from vaccines but if we trust in basic chemistry and the efforts of researchers around the world we can believe it to be quite high. Thus the many diseases [xxxi] listed by Andrew Cutler, who has a PhD in chemistry from Princeton, that could be caused by mercury poisoning, leads us to suspect a vast source of iatrogenic disease that outpaces all other forms of iatrogenic suffering and death. The catastrophe with mercury poisoning has been a slowly escalating phenomenon that broke through a certain barrier in the past decade and now stands clear as a visible trend to basic scientists who have become increasing alarmed, especially as public health officials have stonewalled them. What we have is a human disaster unequalled in the history of the human race in progress and a medical establishment pretending that nothing is happening. What we have is the biggest iatrogenic catastrophe that has ever happened. Dr. Mark Geier In regards to mercury in vaccines. information from California shows, as mercury levels in vaccines are being reduced there, new reports of autism are declining.[xxxii] The largest and most unethical medical experiment in history is still on though; our children have been and continue to be the guinea pigs of the western medical establishment. Beyond all reason we find both medical and dental science supporting the extensive use of mercury denying each and every indication that they are doing great harm. [i] Mosbys Medical Dictionary 5th Ed. 1998 states: IATROGENIC [Gk.,iatros, physician, genein, to produce], caused by treatment or diagnostic procedures. An iatrogenic disorder is a condition caused by medical personnel or procedures or through exposure to the environment of a health care facility, including fears instilled in patients by remarks or questions of examining physicians. See also: 'nosocomial', (iatrogenesis, iatrogeny, n.) Within the orthodox medical community, the reference to iatrogenic illness is most frequently focussed upon iatrogeny due to errors of judgement, administration, etc. by medical practitioners, whilst carrying out their tasks: the focus being errors that are made because tasks and judgements of the individual practitioners, nurses etc. are erroneous. IMVA sees a much expanded definition, whereby the medical knowledge itself that is presently held as correct and sacrosanct by the medical orthodoxy is, nevertheless, not itself immune to the charge of causing iatrogenic illness. [ii] Starfield, Barbara. Is US Health Really the Best in the World? JAMA, July 26,2000-Vol 284, No 4 [iii] Null Gary, Dean Carolyn, Feldman, Martin, Rasio, Debora, Smith, Dorothy. Death by Medicine. Nov 2003 – Nutrition Institute of America. [iv]Remarks by David Kessler, M.D. Medwatch Health Professionals Meeting May 4, [v] The FDA estimates that only about 10% of adverse reactions are reported (Reported by KM Severyn, R.Ph.D. in the Dayton Daily News, May 28, 1993. Ohio Parents for Vaccine Safety, 251 Ridgeway Dr., Dayton, OH 45459), a figure supported by two NVIC investigations (NVIC, "Investigative Report on the Vaccine Adverse Event Reporting [vi] Dr. Ali Al-Bayati, pathologist and toxicologist, believes that much of the collapse we are seeing in the immune systems of the African people (AIDS) is actually being provoked by malnutrition and starvation, not by the HIV virus. Secondly these vast populations of malnourished people are being subjected to repeated vaccination campaigns, which their immune systems have no way of supporting. Any physician worth their weight in salt would tell you it is counter indicated to give shots to a child who has a bad cold or flu for reactions that hurt even a healthy child can devastate one with a compromised immune system. Populations weakened by hunger and malnutrition are much weaker than people with colds or the flu so vaccinations are completely counter indicated. The large number of vaccines given to children is causing damage in the U.S., but much less than in Africa, since they have the combined affects of vaccines e of Two Hammers – [vii] Yeargin-Allsopp M, Rice C, Karapurkar T, Doernberg N, Boyle C, 289: 49-55. PubMed [viii] M.I.N.D Institute. Report to the Legislature on the Principal Findings from the Epidemiology of Autism in California: A Comprehensive Pilot Study. UC Davis: Sacramento, CA, 2002. [ix] Chakrabarti S, Fombonne E. Pervasive developmental disorders in preschool children. JAMA 2001; 285: 3093-3099. Article PubMed [x] Institute of Medicine - Immunization Safety Review: Vaccines and Autism – May 17,2004 id=20155 [xi] Center of Disease Control – [xii] The AMA, the AAP, WHO, UNICEF, the UM and every other medical organization, except the IMVA (International Medical Veritas Association) accepts and publishes on their Internet sites the final decision of the IOM and the CDC. [xiii] Autism Alarm. CDC & AAP alert. [xiv] Gier, D. Letter to Hillary Clinton. March 22, 2003 [xv]The Centers for Disease Control and the American Academy of Pediatrics have issued a statement asserting, "the available scientific evidence has not shown thimerosal-containing vaccines to be harmful." Their statement is false and totally misleading. Following are some of the scientific studies that demonstrate thimerosal, a mercury-containing substance that is used as a preservative, to be harmful and to be a highly probably causal factor in autism. Note that these studies are consistently ignored in the medical establishment's publications claiming that there is no evidence for vaccine-caused autism. novel form of mercury poisoning. Med. Hypotheses. 2001 Apr;56(4):462-71. PMID: 11339848 2 Geier DA, Geier MR. An assessment of the impact of thimerosal on childhood neurodevelopmental disorders. Pediatr Rehabil. 2003 Apr-Jun;6(2):97-102. PMID: 14534046 3 Geier MR, Geier DA. Neurodevelopmental disorders after thimerosal-containing vaccines: a brief communication. Exp Biol Med (Maywood). 2003Jun;228(6):660-4. PMID: 12773696 4 Geier & Geier. Parents' worries about thimerosal in vaccines are well founded! 5 David Baskin, M.D. et al. Thimerosal induces DNA breaks, caspase-3 activation, membrane damage, and cell death in cultured human neurons and fibroblasts. Toxicol Sci. 2003 Aug;74(2):361-8. Epub 2003 May 28. PMID: 12773768 6 Mady Hornig, M.D Etiologic factors and pathogenesis of autism: evidence from clinical studies and animal models. IOM presentation, Feb 9 2004 Audio only: 7 Richard C. Deth, Ph.D. Effects of Mercury on Methionine Synthase: Implications for Disordered Methylation in Autism DAN! 2003 Philadelphia - 8 Richard C. Deth, Ph.D. A Link Between Thimerosal and the Brain: Can Vaccines Affect Central Nervous System Function? Molecular Psychiatry 2004, Volume 9. 9 Vojdani A, Pangborn JB et al. Infections, toxic chemicals and dietary peptides binding to lymphocyte receptors and tissue enzymes are major instigators of autoimmunity in autism. Int J Immunopathol Pharmacol. 2003 Sep-Dec;16(3):189-99. PMID: 14611720 10 Jeff Bradstreet, M.D. A Case-control Study of Mercury Burden in Children with Autistic Disorders and Measles Virus Genomic RNA in Cerebrospinal Fluid in Children with Regressive Autism. IOM presentation, Feb 9, 2004 Slides: - Audio: 11 Valsamakis A et al. Altered virulence of vaccine strains of measles virus after prolonged replication in human tissue. J Virol. 1999 73(10): 8791-7. PMID 10482633 The CDC's original findings before the CDC began to manipulate the data, obtained via the Freedom of Information Act: High risk values for thimerosal injections and a range of neurologic problems, including ADHD, tics, language problems, and autism. Excerpts from CDC's in-house conference: Thimerosal sequelae 12 Congressman, Dr. Weldon's letter to the CDC director, available at: Institute of Medicine presentation of Congressman Dave Weldon, M.D. - 13 Geier MR, Geier DA. Autism and thimerosal-containing vaccines: analysis of the Vaccine Adverse Events Reporting System (VAERS). IOM presentation, Feb 9, 2004. Slides: -- Audio: 14 David Baskin, M.D. Relation of Neurotoxic Effects of Thimerosal to Autism. IOM presentation, Feb 9, 2004. Audio only: [xvi] Article in the Boston Globe about Dr. Donald Berwick. [xvii] Null Gary, Dean Carolyn, Feldman, Martin, Rasio, Debora, Smith, Dorothy. Death by Medicine. Nov 2003 – Nutrition Institute of America. [xviii] All of the basic statistics found in this report are from the United States, which holds approximately 1/20th of the world's population. There according to Dr. Mark Grier the overall neurodevelopmental damage that can be sourced to mercury toxicity runs into 2,402,505 cases, millions with a devastating line up of other neurological diseases including Alzheimer's disease, Parkinson's, ALS, MS, autism and AD. We have thousands of children found dead from vaccines in the federal data bases in the United States, which report only a fraction (10 percent according to officials at the FDA), many kids dead from Sudden Death Syndrome (many of which who should be counted as vaccine provoked death) many babies dead from Shaken Baby Syndrome (where parents are accused of killing their kids instead of the vaccines and the mercury and other chemicals contained therein) and officially, according to studies published in reputable medical journals between 250,00 and 786,000 iatrogenic deaths, in the United States alone. Both reports (Dr. Starfield in the New England Journal of Medicine who reports 250,00 deaths agrees with Dr Null et al, who reported 786,000 in a Journal of Nutrition, both agree that 106,000 die each year from properly subscribed medicines.) On a world wide level it is impossible to track the numbers and whether they would be directly proportional, meaning multiply all the numbers by 20, or greater or lesser. Many complex factors must be taken into consideration. For example in Africa, where populations are starving and malnourished, they administer vaccines in a totally contraindicated fashion (to populations with severely weakened immune systems) thus increasing the collateral damages and deaths. [xix] Haley, Boyd. Dangers of Mercury Based Amalgam Dental Fillings. Prestented to The Committee on Governmental Reform: Dental Amalgam Hearing on 14 November 2002 [xx] Kennedy Ron MD. Dental Amalgam Mercury Poisoning [xxi] Haley Boyd. In response to an article on the ADA web site by the [xxii] Independent Chemist, M.Sc., retired The Real Scientific Truth of Amalgam, The Behavior of Mercury in the Body Causing Chronic [xxiii] The argument that the thimerosal containing vaccines could not deliver the amount of mercury to cause a systemic illness is somewhat refuted by the history of the disease classified as acrodynia. Perhaps autism will end up like acrodynia, where the removal of the causative material (ie., mercury containing teething powders) lead to cessation of the disease and the identification of the cause. Due to the perceived low levels of mercury in the teething powders and the wide-spread use of mercury in medicine at that time it was 10 years after the removal of the mercury containing teething powders before medicine acknowledged that mercury exposure was the causal factor. It is significant to notice that many of the symptoms of acrodynia are similar to the clinical picture of children identified today as autistic, with attention deficit disorder, etc. that have no family history of such diseases or illness classifications. [xxiv] A good graph of contagious disease incidence, which begins at 1900 (or earlier), will show a picture of death, disease incidence and severity that declined by 90% (average) before vaccine introduction. Plague and scarlet fever declined without vaccine. Measles declined in mortality 99.7% before vaccine introduction. At some point we might inevitably conclude that vaccine ‘necessity' is a sales gimmick not a scientific reality. "Scientific medicine has taken credit it does not deserve for some of food and water," wrote Greg Beattie in ‘Vaccination: a Parent's Dilemma.' The public has never been told that the death rate from infectious diseases fell long before vaccines were introduced. The chart cited above is based on information found in Tim O'Shea's book, The Sanctity of Human Blood, and Michael Alderson's book, International Mortality Statistics. It shows yearly U.S. death rates for four common diseases between 1906 and 1975. The propaganda campaign for vaccination has been so successful that most of us automatically believe that vaccines are so effective they are responsible for the virtual eradication of serious childhood illnesses. But nothing could be further from the truth. "Up to 90% of the total decline in the death rate diphtheria, and measles occurred before the introduction of immunizations and antibiotics," stated Dr. Archie Kalokerinos, M.D. Most ministries of health around the world show graphs that start in the 1950's or even 70's to make the vaccination look as if they have been responsible for the eradication of diseases, but when you take the graphs back to the early 1900's or late 1800's you soon see that vaccination have done little to help the decline of said diseases. [xxv] Anderson, H.B. The Facts Against Compulsory Vaccination. 1929 Organized Physicians Were Just As Sure That the Inoculation of People With Smallpox Was a Good Thing As They Now Are That Vaccination Is Necessary But Smallpox Inoculation Resulted In Actually Spreading theDisease and Was Made a Penal Offence in England in 1840. [xxvi] Strong MJ, Garruto RM, Joshi JG, Mundy WR, Shafer TJ. Can the mechanism of aluminium neurotoxicity be integrated into a unified scheme? Journal Toxicol Environ Health 1996; 48:599-613. [xxvii] Mendola P, Selevan SG, Gutter S,Rice D. Environmental factors associated with a spectrum of neurodevelopmental deficits. Ment Retard Dev Disabil Res Rev 2002; 8:188-197 [xxviii] Geier David, Geier Mark – Phone conversation August 1, 2004 [xxix] Haley, Boyd. Affidavit of Boyd E Haley, Professor and Chair, Department of Chemistry, University of Kentucky [xxx] Demyelinating disorders A medical condition where the myelin sheath is damaged. coordination and possible paralysis. Examples of demyelinating disorders include Primary pain is related to the demyelinating process itself. This neuropathic pain is characterized often as having a burning, gnawing, or shooting quality. Acute pain conditions include trigeminal neuralgia, painful optic neuritis, and Lhermitte's syndrome. pain conditions such as dysesthesias in the limbs, joint pain, and other musculoskeletal or mechanical pain problems develop as a function of spasticity and deconditioning associated with demyelinating disorders [xxxi] Mercury can cause a bewildering variety of diseases. According to Andrew Cutler, who has a PhD in chemistry from Princeton, "Modern physicians are not trained to find the root cause of a sick person's problems. They are trained to translate what they see into Latin, look it up in their textbook, and apply a cookbook treatment. With a toxin that poisons fundamental metabolic processes different people will experience different symptoms to start off, depending on their own individual biochemistry. As the poisoning becomes more and more serious, further symptoms surface and the modern doctor adds more diagnoses - a patient who starts with depression might later be considered to have hypothyroidism, allergies and asthma in addition. But no thought is given to why one person should develop more and more "diseases," when a single diagnosis - chronic mercury poisoning - could account for them all. Some of the "diseases" a modern physician might mistakenly misdiagnose chronic mercury poisoning as are: Addison's disease Alzheimer's' disease Amylotrophic lateral sclerosis Ankylosing spondylitis Anorexia nervosa Irritable bowel syndrome Juvenile arthritis Learning disabilities Attention deficit hyperactivity disorder Lupus erythromatosus Autoimmune disease Manic depression Bipolar disorder Multiple chemical sensitivities Borderline personality disorder Multiple sclerosis Myasthenia gravis Obsessive-compulsive disorder Chronic fatigue Panic attacks Parkinson's disease Crohn's disease Pervasive developmental disorder Endocrine disorders Rheumatoid arthritis Environmental illness Food allergies Sleep disorders Yeast syndrome [xxxii] Reported informally to the IMVA by Dr. Boyd Haley and confirmed by Dr. Mark Geier and David Geier. Members will soon have access to a legal center, and meaningful information concerning medical liability. With the growing wave of litigations threatening to change the face of modern day medical practice, the IMVA itself will be involved in calling the pharmaceutical companies to accountability. Our legal center will be a place where parents and their lawyers can pool their information and efforts. Some physicians today are using courts to issue orders to give children toxic drugs when the parents refuse to do so. Others are blaming parents for damages and deaths that are actually iatrogenic. We support medical authorities that honor bioethical principles and respect parental decisions to seek alternative treatment that accords to their own responsible We will feature virtual conferences for our members on this and many other subjects, and provide opportunities for health professionals to meet with each other to openly discuss important medical and health issues. Medical truth is only discernable when communications and dialogue are open. The IMVA is totally dedicated to bringing the light of open communication to the field of medicine and health care, through the careful listening and examination of all aspects of each and every medical issue.
That They May Be One Notes for Oct. 6, 2018 John 17:20-26 Biblical Background • Unity of God the Father and God the Son: The unity of the Trinity, God the Father, God the Son and God the Holy Spirit is an essential aspect of God’s character. Thus, God’s people are to reflect this same character of unity or oneness as they worship the same Trinitarian God. As God’s people are united in purpose and worship they demonstrate that they are part of God’s family and become witnesses to the world of God’s goodness and loving character. • So that the world may believe: When Christians are united in true unity through their common faith in Jesus Christ as the Way, the Truth and the Life, the only way to reconciliation with God, they give the world a reason to believe. Christians as well will always be a minority in the world as a whole, yet it is their love for one another that will attract others to the faith. • Before the foundation of the world: Jesus, as part of the Trinity, was not created as we are or as our world was created. Rather, Jesus created the world and has existed for eternity. It is for this reason that we use the word “begotten” when describing Jesus the Son of God. Begotten points to his everlasting existence before the foundation or creation of the world as we know it. Discussion Questions 1. Who is Jesus praying for in this prayer? 2. How can we as believers join in Jesus’ prayer for those who will believe? 3. What is the goal of Jesus’ prayer? 4. What does it mean for Christian’s to be united? 5. Watch the Youtube video to get J.I. Packer’s understanding of Christian unity. What comments do you have after watching his short commentary? 6. Whose example of unity are we to follow? 7. How do God the Father and God the Son reflect unity and love for one another? 8. What is needed for authentic, true Christian unity? What does it look like in our world today? 9. What does false unity in Christian circles look like? Share some examples. 10. How does authentic Christian unity point others to faith in Jesus Christ? Why and how is it attractive? 11. Share specific times or moments when you have experienced Christian unity in your life. What made these moments stand apart? 12. What are some specific ways this week that you can display authentic Christian unity in your workplace? Home? Neighborhood? 13. Take some time to pray for unity in our church, the church of Greater Washington, D.C., the global church. Link to Sermons
This document is contained within the following "Collections" show Approach to Rabbit Respiratory Disease WSAVA/FECAVA/BSAVA World Congress 2012 Vladimir Jekl, MVDr, PhD, DECZM(Small Mammal) Avian and Exotic Animal Clinic, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences Brno, Czech Republic Respiratory disease is one of the most common diseases in rabbits. Several challenges arise when evaluating a rabbit with respiratory problems. The rabbit's respiratory system has not such a high degree of ventilatory reserve as that of dogs, which can make respiratory diseases difficult to treat. Thorough knowledge of rabbit anatomy and physiology is necessary to differentiate between upper and lower respiratory disease and between cardiovascular and other systemic factors which could impair respiration. Breathing difficulties can affect rabbits of any age, and the disease can quickly become life threatening. Rabbits have a well developed sense of smell. Under normal circumstances, nostril twitching may be seen only in up or down directions. Each part of the nasal cavity has dorsal, medial and ventral cartilaginous conchae and maxillary and ethmoid paranasal sinuses. The relatively small glottis is engaged over the caudal rim of the soft palate, sealing the oral pharynx from the lower airways. Rabbits are susceptible to laryngeal spasm making the intubation difficult. As obligate nasal breathers, rabbits with upper airway disease will attempt to breathe through their mouths, which prevents feeding and drinking and could be quickly fatal. The rabbit thoracic cavity is small and the thymus, which is located in the cranial mediastinum, persists in the adult. Rabbit lungs have no septa; the right lung has four lobes and the left lung has three lobes; air flow volume is higher in the left lung. Rabbits at rest respire mostly through the activity of the diaphragm. The threshold of lung inflation (which initiates afferent impulses that depress the vasomotor centre and cause vasodilation) is an air pressure as low as 2.5 cmH2O. In cases of thermal polypnoea, the minute tidal volume increases about 15-fold. Accurate diagnosis is based on thorough history, physical examination, diagnostic imaging and laboratory results (e.g., haematology, plasma chemistry, bacteriology). Dyspnoea is one of the earliest symptoms even in mild conditions, such as rhinitis. Severity may be judged by assessing breathing effort, respiratory rate, rhythm and character. Affected rabbits display a hunched posture with obvious abdominal respiratory movement. It is imperative that animals with severe respiratory distress are stabilised before time is taken to obtain a thorough history. Stabilisation may include oxygen therapy, appropriate medications (diuretics, fluid therapy) and then a brief history. Gentle physical restraint or sedation with benzodiazepines (monitor blood pressure) is essential. The physical examination is extremely important. Respiratory disease could be associated with a restrictive or obstructive pattern. Determination of which pattern the animal is exhibiting can help to narrow the list of differential diagnoses. Restrictive diseases, which prevent the lungs expanding, lead to short, rapid and shallow breaths. These signs could be associated with pneumonia, lung oedema, pleural effusion, pneumothorax, mediastinal and lung tumours or abscesses, or be due to increased pressure of abdominal organs on the diaphragm (gastric distension). Obstructive disease, which is caused by narrowing of the airways, leads to slower and deeper breaths. Upper obstructive respiratory disease is associated with increased inspiratory effort, whereas lower respiratory disease is associated with increased expiratory effort. Wheezes are usually heard on expiration and indicate obstruction or narrowing of small airways. Crackles are caused by the opening of small airways during inspiration and are heard with bronchial inflammation and pneumonia. The mucous membranes should be checked for any indication of cyanosis or pallor. Due to the rabbit's tendency for regular grooming, signs of nasal discharge may be seen only as wet hairs on the front paws. Facial symmetry, oral cavity and all maxillary teeth should be evaluated for the presence of any pathology associated with the nasal cavity. Palpation of the skull, cervical area, thorax and abdomen could reveal tumours, skeletal injury or enlargement / distension of abdominal organs. During auscultation the entire thorax should be examined to identify the exact source of abnormal sound. Wheezes (musical sounds) are generated primarily by airway narrowing, stenosis or obstruction. Crackles (short, explosive, non-musical sounds) are typically produced by a delayed opening of small airways attributable to an abnormal fluid-air interface (pneumonia, pulmonary oedema). Knowledge of the timing (systolic, diastolic) and location of abnormal heart sounds (murmurs, arrhythmias) allows the practitioner to establish a differential diagnosis rapidly. In rabbits, the arterial pulse is evaluated bilaterally to assess heart rate, rhythm and pulse quality. However, heart disease can be present without auscultable abnormalities, and not all murmurs are associated with heart disease. It is imperative with small mammals that the potential hazard of any test be considered, because even minor stress can lead to collapse of these patients. Haematology, plasma chemistry and urinalysis in respiratory diseases are often unremarkable; however, the most important contribution is to reveal systemic diseases that might be affecting respiration, such as acidosis, anaemia, leukaemia or the presence of liver and kidney failure. An enzyme-linked immunosorbent assay (ELISA) test on paired samples is available for the increased antibody detection for Pasteurella multocida. Radiography should be performed with the patient under sedation or anaesthesia to ensure proper positioning. In thoracic radiographs, cranial cardiac borders are often indistinct, especially if a large amount of fat is present. Remember that the thoracic thymus is present throughout life. Interpretation of radiographs may document the presence of cardiomegaly, pulmonary oedema, pleural effusion or a prominent pathological lung pattern. Both computed tomography (CT) and magnetic resonance imaging (MRI) provide tomographic images of the skull, which allow improved anatomical information concerning many regions that are difficult to assess with conventional radiography. Endoscopy of the respiratory tract is very useful especially in cases of nasal or tracheal foreign bodies, chronic respiratory diseases or neoplasia. This imaging method allows guided biopsy. Echocardiography and electrocardiography are useful to document cardiac function and to assess mediastinal masses. Cytology (nasal swab, bronchoalveolar lavage, fine-needle aspiration, effusion deter­mination) and bacteriology / mycology are important for diagnosis, treatment and also prognosis. Histopathological examination should be carried out on any biopsy specimens or any mass removed. Frequently, after evaluation of the historical and physical examination findings, laboratory examination and interpretation of the thoracic radiographs, it is possible to determine whether heart or lung disease or other disease is the most likely cause for the respiratory distress. If pulmonary infiltrates compatible with oedema are present on thoracic radiographs, the rabbit should be treated with diuretics, oxygen, cage rest and possibly vasodilators. In our practice, furosemide (1–5 mg/kg i.m. or i..v q2–6h) is most frequently used. Placement of an intravenous catheter is essential and this may often be done with minimal restraint into the cephalic or marginal ear vein. Oxygen is most easily administered by placing the animal within an oxygen cage. If a moderate to large volume of pleural effusion is present, it should be removed in order to improve the stability of the patient as well as to help in reaching the final diagnosis. Thoracocentesis (21-gauge needle) is recommended, performed under ultrasound guidance. Antibiotics or other drugs should be administered systemically or topically based on the disease severity and exact cause. For nebulisation it is preferable to use aminoglycosides alone or in combination with bronchodilatators. Moreover nebulisation itself will keep the mucous membranes hydrated and acts as an excellent expectorant. Pasteurella multocida is a gram-negative, bipolarly staining rod. Infection is nearly ubiquitous among pet and laboratory rabbits. Transmission is by direct contact and, to a lesser extent, fomite, aerosol and sexual exposure. Disease susceptibility depends upon host, environmental and bacterial factors. The most pathogenic strains are of serogroup A, D and F. The majority of rabbits infected with P. multocida are asymptomatic carriers. The most common presentations are rhinitis (snuffles), conjunctivitis, pneumonia, otitis media, otitis interna, abscesses, genital tract infections and septicaemia. Colonisation often occurs initially in the pharynx. The infection quickly spreads to the nasal cavity, from which it disseminates via direct or hematogenous spread to the lungs, middle ear, conjunctival sac, subcutaneous tissues and visceral organs. Regardless of the organ system affected, the hallmark of P. multocida infection is suppurative inflammation. The accompanying exudate is most often purulent. Microscopically, affected tissues may be oedematous, hyperaemic, congested and necrotic. Large amounts of thick pus may also place direct pressure on adjacent tissues, such as in the lungs, and may further compromise organ function. Some other bacteria that could be present in the respiratory infection of rabbits are Staphylococcus aureus, Bordetella bronchiseptica, Moraxella catarhalis and Klebsiella pneumoniae. The diagnosis is based on clinical signs, thoracic and tracheal auscultation, radiography, rhinoscopy and bacterial culture. Therapy includes supportive care, nebulisation (aminoglycosides) and antibiotic treatment. Use of trimethoprim-sulpha or fluoroquinolones is recommended. In more severe cases parenteral administration of beta-lactams provides better outcomes. 1.  Harcourt-Brown F. Textbook of Rabbit Medicine. Oxford: Reed Educational and Professional Publishing, 2002. 2.  Johnson-Delaney C, Orosz SE. Rabbit respiratory system: clinical anatomy, physiology and disease. Veterinary Clinics of North America: Exotic Animal Practice 2011;14:257–266. 777 W. Covell Blvd., Davis, CA 95616 • Toll Free: 800-700-4636 • From UK: 01-45-222-6154 • From Australia: 02-6145-2357
What Happened on December 1? • US President Franklin Roosevelt, UK Prime Minister Winston Churchill, and USSR leader Joseph Stalin signed the Tehran Declaration. (1943) In this agreement, the three leaders pledged their nations' friendship and loyalty to each other, and promise to work together against Hitler's Germany. • African-American Rosa Parks was arrested for refusing to vacate her bus seat for a white passenger. (1955) This started a major bus boycott led by Dr. Martin Luther King, Jr. that lasted over a year, and is considered the event that started the Civil Rights Movement in America. • AIDS was officially recognized by the medical community. (1981) The virus was isolated two years later, and campaigns began to educate people on AIDS prevention. • Henry Ford introduced the first moving assembly line. (1913) The system could produce a new car every two minutes and thirty-eight seconds. • Lady Nancy Astor became the first woman to sit in the British Parliament. (1919) The American-born Lady Astor remained the only woman MP until 1921, and was an outspoken feminist and social critic. • Sherlock Holmes first appeared in print. (1887) A Study in Scarlet was the first of over 60 stories featuring the famous detective. Sir Arthur Conan Doyle wrote the book in three weeks. • Antarctica was declared a science preserve to be used for peaceful purposes only in the Antarctic Treaty System (ATS). (1959) The ATS was signed by 12 member countries, including the US, Japan, the USSR, the UK, and Argentina. • The teams digging the Chunnel meet in the middle. (1990) Digging teams from France and Britain met under the English channel two years after drilling for the Channel Tunnel, or Chunnel, began. This marked the first time that England and continental Europe were connected in 8,000 years. • The first draft lottery was held in the US since WWII. (1969) The lottery was held to determine the order of induction into the Army to fight in the Vietnam War. It was incredibly unpopular, and spawned a movement of "draft dodgers" that moved to Canada to avoid the draft. • The game of basketball is said to have been invented. (1891) Canadian-born James Naismith is reported to have invented the game at the Springfield, Massachusetts YMCA to keep a rowdy class occupied indoors during the winter. The game was originally played with nine players per team, a large soccer ball, and two peach baskets for goals. Follow wiseGEEK: Discuss this Article Post 2 While the AIDS virus is very dangerous, on the other hand, I'm also glad that many people are educated enough to know about it, as the wrong information can lead to some serious misunderstandings. For example, what if someone (who is uneducated), started to hang out with a friend, and then later found out that he had AIDS? Since the person doesn't know a lot about the virus, they're probably going to make some pretty bad assumptions about the person, and may even stop being their friend. In fact, reading these bullet points reminds me of an episode of Captain Planet I saw a while back, that dealt with the same issue. A boy at school was shunned by everyone because he had AIDS. However, the only reason why the school shunned him is because they thought he was contagious, until the record was set straight at the end of the episode. As dangerous as AIDS is, it's still something that we need to be much more educated about, as that can eliminate several precautions and worries. Post 1 While it's true that Rosa Parks was a very influential person, when it comes to her story about not moving from the bus, I almost feel like people tend to take it the wrong way, and twist the story around a bit, though not intentionally. Prior to Rosa Parks being arrested, there were many other people who had refused to get up from their seats as well, which led to them being arrested, just like she was. It wasn't specifically the fact the Rosa Parks refused to get up that made the difference, it was more based on the fact of who she was, and how well known she was, whether people loved or hated her. In fact, let's look at it this way. On that day Rosa Parks had been arrested for refusing to get up, let's assume that instead of her, it was just a regular bystander. More than likely, it wouldn't have made headlines, and even if it did, it wouldn't have been talked about as much. Overall, I think that's one thing that needs to be cleared up about Rosa Parks. However, I'll also admit that until a few years ago, I wasn't ware of this either. Post your comments Post Anonymously forgot password? Free Widgets for your Site/Blog
Distinguished author and consultant Mary Munter has developed a framework for communicating in the modern global workplace. A professor at the Tuck School of Business at Dartmouth College since 1983, Munter has written works such as the "Guide to Professional Communication," now in its ninth edition. Before Munter, communication models used four elements: the communicator, the message, the audience and the response. Munter added two more elements to the traditional model to make it relevant in a multicultural environment: channel choice and cultural context. Communication Loop Mary Munter's corporate communication theory starts with an action-based communication loop. A communicator identifies an objective that he wants to achieve. For example, a college recruiter wants to increase enrollment. His audience is college-bound high school students. He decides on an action -- signing up for more information -- that he wants students to take as a result of his communication. Ideally, the action-based communication loop ultimately helps the communicator achieve his goal. Munter added the elements of channel choice and cultural context to the communication loop to make it more relevant in a multicultural workplace. Channel Choice Channel choice refers to the medium through which the communicator delivers the message. At its most fundamental level, the communicator chooses between a written channel and a spoken channel. Sub-channels for spoken communication include face-to-face meetings, telephone calls and video conferences. Sub-channels for written communication include email messages, faxes and brochures. The audience and the subject matter help steer the communicator to a particular channel. Complex financial data, for example, presents itself well in a written channel, where charts and graphs make the message easier to understand. Cultural Context Munter recommends that communicators evaluate their objectives and messages in the context of an audience's culture. For example, some cultures disfavor objectives involving a deadline, such as opening a new store before year-end. In those cultures, the audience believes that external forces control the future, and the date a store will open has been predetermined by destiny or deity. Conversely, other cultures believe that human innovation can overcome external forces. This audience may expect the communicator to lay out a precise schedule for a store opening, including detailed information about contingency plans for each phase of the project. Under Munter's framework of corporate communication, every aspect of the communication loop is interrelated. An organization may choose a spokesperson of a particular age or gender based on the audience's culture. When the communicator delivers a spoken message, she uses deliberate words, tones and gestures that resonate in the culture of the audience. Careful consideration is given to the medium in which the message is delivered, and the desired audience response is culturally appropriate. Muntner's communication framework is an effective model for a global work environment. About the Author Photo Credits • Polka Dot Images/Polka Dot/Getty Images
Structural features of the stenter setting machine and the role of each unit - Nov 15, 2019- The stenter setting machine is mainly composed of five parts, including the feeding part, the weft feeder, the chain, the oven body and the falling cloth winding device. There are also chemical systems and oil furnace heating systems. 1. Loading part. The structure is relatively simple, consisting of a trough and a roll. The cloth enters the trough, carries the chemical material, and then presses the excess chemical material through the roll to clean it. Therefore, the chemical material on the cloth is very uniform, which is a prerequisite for obtaining high quality styling cloth. It should be noted here that it is necessary to always pay attention to whether the pressure on the left and right sides of the roll is consistent. Otherwise, the side with less pressure will be loaded more, while the side with higher pressure will have less material, and the cloth will have quality problems such as inconsistency. 2. Weft feeder. The weft aligner on the fixed machine is the Mahlo RFMC94H photoelectric weft aligner. There are four sets of sensors on the Mahlo photoelectric weft aligner. Each sensor consists of two parts: illuminating and sensitizing. . The action part adopts a hydraulic system. When the signal of the slanting size is transmitted back to the control board, the control board will issue a command to drive the hydraulic system to adjust the angle of the curved roller or the straight roller to correct the weft. Specifically: when the center of the cloth is different from the two sides, the curved roller will move; when there is a difference between the left and the right, the straight roller will move. 3. The chain part. The tenter of the cloth on the setting machine is produced by a chain. The chain of the setting machine is driven by a high-power motor near the falling cloth. The chain is equipped with a needle plate. When the cloth enters the chain, the cloth is pressed by the brush wheel on the cloth wheel to press the small needle on the needle plate. Enter the oven under the drive of two rows of chains. The chain of this typesetting machine is different from other setting machines. It can control the stretching of each piece of needles separately, so as to make good results. Some setting machines can not adjust each piece of needles and can only be adjusted. Rectangular or trapezoidal. 4. Oven body. The setting machine has eight sets of ovens, and under the action of the circulation fan (2), the air is continuously sprayed on the cloth surface by the fine holes on the star-shaped jet rack. After the hot air contacts the wet cloth, the temperature drops and the humidity rises, and is discharged from the large hole in the star-shaped jet frame, passes through the filter (6), and is continuously circulated after being heated by the heat exchanger. The heat exchanger (8) is located below the filter (6). The hot coal used is hot oil. The heat exchanger has many thin fins for efficient heat exchange. 5. Falling cloth and rolling device. The setting machine can be arranged in two ways, depending on the production needs, in the form of a cloth or a roll. Both methods are driven by a motor to drive the chain. When the cloth is discharged by the roll cloth, the tension stability of the cloth is required to be high, and the cloth needs to pass through a tension adjusting guide roller controlled by the air cylinder. In the case of a cloth-type drop cloth, the cloth does not need to pass through the tension adjusting roller to change through a fixed guide roller.
Friday, May 13, 2016 Family visitors Two-year-old bald eagles visit the nest. There have been a variety of visitors to our nesting pair's nest, that I believe are extended family members - perhaps kids from past years. Eagles make a very distinctive sound when they are with their mates and other family members. I describe it like a chortle. They also make a very distinctive sound to warn other birds away. And, sometimes, that's their kids from a prior nesting. A lot depends on what stage the babies are in. If they've hatched and the babies are close to full size, there's less risk that another predator (even an older sibling) will pick off a newly hatched baby. Adult bald eagle accompanied the two-year-olds. The visitors last week were two juvenile eagles, about two years old, and two adult eagles. Are they children and grandchildren or all children from earlier nesting. This pair has been nesting in this area for at least 10 years, according to homeowners adjacent to the nesting area. Adult bald eagles get their white heads and tails when they're about four years old. That's also when they seek a mate. Mama talked to the youngsters from the nest and papa greeted all from a nearby tree. I'm regularly adding new images to my Nesting Bald Eagles album on Flickr. Saturday, May 7, 2016 Taking turns One parent tends to the kids while the other makes sure they are safe. Either mama or papa are present in the nest at all times. I still can't see any eaglets but this nest is really obscured. Both parents guard from the side where I'm photographing, then enter the nest from the far side of the tree. Keeping watch can be from the branch above the nest or from one of the trees on either side. There have also been visitors that they have welcomed with their characteristic chortling sound they reserve for kinfolk. Everything I've learned about bald eagles from books and articles tells me that a nesting pair won't let other raptors within a mile of their nest. I'm beginning to think that there are a lot of things we don't know about eagles because we nearly lost them in the 1960s and 1970s to DDT and other human-caused sources. Two youngsters, about two years old, fly along the ridge about 2 blocks from the nest. This pair regularly welcomes adults and juvenile eagles - I assume they are earlier children or maybe siblings. They've been nesting here for more than 12 years, so at least seven of those former children are adults now. Bald eagles don't get their characteristic white heads and tails until they are mature at 4-5 years old. That's also when they look for a mate and begin nesting. Nesting is an integral part of eagle life. One of the keepers at Northwest Trek told me that the golden eagles and bald eagles who live at Trek regularly engage in nesting activity, even though they are the same gender. So they are supplied with plenty of nesting material. More on visitors to the nest in my next post. Meanwhile, I have begun posting many more photographs in my Nesting Eagles album on Flickr. Entry to the nest is on the far side of the tree. Monday, April 18, 2016 Keeping watch Most evenings, mama and papa eagle take turns watching over the youngsters. At this point, I don't know if there's more than one. It's really tough to see anything in the nest except mama glaring at me between the branches. Yesterday evening, papa kept watch from he nearby snag, which he often shares with a group of starlings that appear to be nesting close by. I didn't see mama come back from hunting for dinner, until papa departed from his favorite watching spot. I'm hoping to see a fuzzy eaglet head moving around but the nest is very well obscured. I might not see much until the baby or babies start branching, which they do for a few weeks before first flight. More images of my favorite eagle pair from this year and 2015 can be viewed in my Flickr gallery. Enjoy! Nesting bald eagles Tuesday, April 5, 2016 Mama comes in for a landing What I've observed in past years is that eagles sitting on eggs takes a few weeks. Mother eagles don't leave the nest if the temperatures are lower than about 60 degrees Fahrenheit, unless eaglets have hatched. This evening, papa eagle arrived in one of the trees near the nest tree. He and mama talked back and forth, then mama flew out of the nest to the tall snag a bit farther from the nest tree. Mama groomed herself and was freaking out a pair of starlings that were nesting nearby. There have been several of the birds in the vicinity of the snag. Papa grooming with nervous starling nearby Papa then flew to the nest tree. That's when I realized it was mama returning to the nest tree. How can I tell? Mama is about 20 percent larger than papa and has a deeper bill. I can tell them apart when they're close to each other but often mistakenly identify one for the other. The way the nest is built this year should protect it from winds that have brought a couple of their nests down in past years. But it's really challenging to try to figure out whether the eggs have hatched. I'll have to just wait for babies to show themselves. In past years, it's usually mid-to-late April when fuzzy little eaglet heads are visible. Mama flies to the nest tree Mama talks to her mate before flying back to the nest Mama back in the nest Wednesday, March 30, 2016 Nesting begins Mama eagle is barely visible from my favorite viewing spot. This year's nest is in yet another spot. In a tree they nested in two years ago but on the lee side. Hopefully, it will be enough protection from the winds we often experience on our bluff 200 feet or so above Puget Sound. I'm now checking on the nest a few times a week. Part of my observation is how mama interacts with other birds and her mate. There so much we don't know about the lives of animals. Bald eagles are territorial and usually would not let any raptor near their nests. I've observed this pair frequently spending time with other adult and juvenile eagles, less than a half mile from the nest. One year I photographed a 3-year-old bald eagle that stayed in a tree next to the nest tree for at least 20 minutes. Observing parenting behavior? Acting as a guardian? Checking out possible vulnerabilities? While I was there yesterday, papa eagle flew by with one of their children from either last year or the year before. I've seen similar behavior in past years - sometimes they chase off the kids, other times they greet them. Could this be the next phase of training the kids in the ways of the eagle? Papa and youngster greeted mama with their characteristic chortling call they use with kin. Papa and youngster made wide circles over the nest, twisting their heads in all directions to make sure she was doing okay. Mama called back but wasn't moving much, which means she's probably working her hatching magic. Sunday, March 6, 2016 Eagle's nest enters second decade Mama eagle in May 2015 Watching bald eagles or any creature best observed from a distance can be expensive. If you're an avid birdwatcher, you have spent quite a bit on high-powered binoculars and spotting scopes. If you're a photographer, you find that you just need 100 millimeters more (at a cost of another $900-$5,000) to capture and share what you're seeing. When I started photographing a pair of eagles nesting not far from my neighborhood in April of 2011, my longest lens was 300mm. Two years later, I acquired a 400mm lens, which gave me much more insight into the lives of these beautiful birds. Mama (at top) and papa - February 2016 Last nesting season, I photographed my favorite eagles several times but the nest was out of view. Their nest came down in 2014 and two babies were lost, so I'm sure that's why the 2015 nest was in a very protected space. You could hear them but the only views were of mama and papa outside the nest. I did quite a bit of traveling last summer, so I didn't witness how many eaglets fledged. Some of the images I captured last year are posted in my Flickr gallery. This year, I have a 600mm lens and am very happy to know that our dedicated eagle parents are again nesting. There's also good chance I will have a better view. This year's nest appears to be in a taller tree that is in better view. Yesterday, I talked to one of the neighbors with a backyard view of the nesting area. Together we estimated that the pair must be 16-17 years old. The houses with backyards near the nesting area were built 12 years ago and they've been nesting there every year. So begins a new cycle of life and my sixth year of learning the way of the eagle.
Sometimes, keys are made integral with the shaft which fits in the keyways broached in the hub. Such shafts are known as splined shafts as shown in Fig. 1. These shafts usually have four, six, ten or sixteen splines. The splined shafts are relatively stronger than shafts having a single key way. Fig. 1 Splines The splined shafts are used when the force to be transmitted is large in proportion to the size of the shaft as in automobile transmission and sliding gear transmissions. By using splined shafts, we obtain axial movement as well as positive drive is obtained. Splines are ridges or teeth on a drive shaft that mesh with grooves in a mating piece and transfer torque to it, maintaining the angular correspondence between them. For instance, a gear mounted on a shaft might use a male spline on the shaft that matches the female spline on the gear. The splines on the pictured drive shaft match with the female splines in the center of the clutch plate, while the smooth tip of the axle is supported in the pilot bearing in the flywheel. An alternative to splines is a keyway and key, though splines provide a longer fatigue life. Fig. 2 Splines There are several types of splines: Parallel key spline where the sides of the equally spaced grooves are parallel in both directions, radial and axial. Involute spline where the sides of the equally spaced grooves are involute, as with an involute gear, but not as tall. The curves increase strength by decreasing stress concentrations. Crowned splines where the sides of the equally spaced grooves are usually involute, but the male teeth are modified to allow for misalignment. where the sides of the equally spaced grooves form a “V”. These are used on small-diameter shafts. Helical splines where the equally spaced grooves form a helix about the shaft. The sides may be parallel or involute. This can either minimize stress concentrations for a stationary joint under high load, or allow for rotary and linear motion between the parts. Ball splines where the “teeth” of the outer part are implemented with a ball bearing to allow for free linear motion even under high torque. Reference A Textbook of a Machine Design by R.S. Khurmi and J.K. Gupta and Wikipedia Leave a Reply Please Login to comment Notify of
- Yerevan - What you need to know about Yerevan Yerevan is the capital and largest city of Armenia, as well as one of the world’s oldest continuously inhabited cities. In Soviet years, Yerevan underwent massive reconstruction, following architect Alexander Tamanyan’s new plans to make a perfect city. His vision was a neo-Classical town with wide avenues to resembe Paris, Vienna and Saint Petersburg. Central Yerevan is a true jewel of early Soviet architecture. She is also home to some large scale Modern and Post-Modern marvels which are mostly the result of Soviet-Armenian architectural megalomania. In Soviet days Yerevan had already become known as the Pink City as much due to the colour of the stone used for building as for the flamboyant spirit of her young population. Population: 1.06 million (2011) Area: 87.65 mi² The currency used in Yerevan is the Armenian Dram. Yerevan is the capital of Armenina. If you are traveling to Yerevan, you will need to exchange your currency for the Armenian Dram. You may exchange your money for the Armenian Dram at most Yerevan banks or at specialized stores called Foreign Exchange Bureaus. Yerevan features a steppe climate, with long, hot, dry summers and short, but cold and snowy winters. This is attributed to Yerevan being on a plain surrounded by mountains and to its distance from the sea and its effects. The summers are usually very hot with the temperature in August reaching up to 40 °C (104 °F), and winters generally carry snowfall and freezing temperatures with January often being as cold as −15 °C (5 °F) and lower. The amount of precipitation is small, amounting annually to about 318 millimetres (12.5 in). Yerevan experiences an average of 2,700 sunlight hours per year. Temperature regime in Yerevan is close to the southern Midwest cities such as Kansas City, Missouri, and Omaha, Nebraska, though Yerevan is much drier. The Yerevan dialect is an Eastern Armenian dialect spoken in and around Yerevan. Classical Armenian (Grabar) words compose significant part of the Yerevan dialect vocabulary. Throughout the history, the dialect was influenced by several languages, especially Russian and Persian and loan words have significant presence in it today. It is the most widespread Armenian dialect today. Yerevan is generally safer than many western-European cities. Crime and street violence is almost non-existent here. Nevertheless, as in the most cities of its size, in crowded places and transport beware of pickpockets. Scams Yerevan has its share of scams. A common one is that at the end of a restaurant visit, you will be presented with a bill that is much higher that the sum of what you ordered. It is normal that tax / service is added, but especially with European / American tourists restaurant owners tend to add many other things (in Armenian language) to the bill or do not specify the bill at all, but only present you with a total amount that you have to pay. If in doubt, ask for a specified bill and challenge the extras charged if they don’t make sense. A more advanced scam happens in night clubs. Upon entry, you will be warmly welcomed and probably have a great time. At then end of the evening however, a ridiculous amount of money (e.g. 5000 Dram per person) is added to the bill as ‘entrance fee’. When you mention that this was not clear beforehand or displayed anywhere at the entrance / inside the club, their friendliness changes. Getting Around The Subway system in Yerevan (people call it metro) is quite reliable and relatively modern, having been built in the early 1980s. It is the quickest way around town and the cheapest aside from walking. More than a hundred minibus (marshrutka, pronounced mar-shroot-kah) routes exist that criss-cross the city and travel to the suburbs and beyond (such as to Georgia or Karabagh).The minibuses are often overcrowded, and you may find yourself standing, crouched without a seat during rush hour. The route number is displayed prominently in the window, along with Armenian text listing the major landmarks and streets of the route. Yerevan has lots of buses and a few trolley lines , operated by “Yergortrans.” The fare is very inexpensive and the vehicles are not too crowded. Pay when leaving a bus or trolley. Buses and minivans are the major means of transportation within the country. From Yerevan you can get to literally every place in Armenia within a day. To make things confusing for foreigners, there are several different regional bus-stations in Yerevan and the minivans tend to leave from hard to find places just somewhere at the side of the road. When heading into Yerevan, they are not unknown to drop you at random spots somewhere in the city, so ask the driver beforehand to drop you at a convenient place. Abundant throughout the city, a taxi ride anywhere downtown. Almost all taxis with company names on the sides have meters, and prices tend to be competitive among taxi companies. To flag an empty one down on the street, just hold your arm out and pat your hand in the air, if they’re free they’ll stop. Taxis without a logo on the side tend to charge more, and may to try to get more out of foreigners. To avoid being ripped off, either call a taxi from a big company or head for the most modern looking ones which usually have a meter. Make sure that the driver switches it on when you start and politely remind him to do so if he has “forgotten” it. If taxi has meter and the driver hasn’t turned it on, in most cases passenger can not pay for the trip. Carry some coins to prevent the drivers from telling you that they have no change on them.
Modified Chip Design for Nanodrones Researchers at MIT have designed Navion- a modified chip with power consumption reduced from 2 watts to 24 milliwatts Navion is a 20 square millimetre chip that consumes only 24 milliwatts of power. To determine its location in space, the chip uses inertial measurements and real-time camera images that can be processed up to 171 frames per second. Optimised power consumption Most of a standard drone’s power is consumed in aviation, making it difficult to sustain navigation and state estimation. The previous chip was designed to perform state estimation with 2 watts of power which was much greater than 100 milliwatts, the total amount of power miniature drones can carry. Rather than modifying the existing design, the team at Massachusetts Institute of Technology has rebuilt the chip, exercising design flexibility and alternatives. By optimising data storage, flow and eliminating extraneous operations, the chip’s memory has been reduced from 2 megabytes to 0.8 megabytes. Towards a flexible future The current design of Navion makes it a potential pillar for insect-sized cameras and miniature drones. Additionally, its adaptability to different environments makes it suitable for energy efficient purposes. “I can imagine applying this chip to low-energy robotics, like flapping-wing vehicles the size of your fingernail, or lighter than air vehicles like weather balloons, that have to go for months on one battery,” says Sertac Karaman, a member of the Laboratory at MIT. “Or imagine medical devices like a little pill you swallow, that can navigate in an intelligent way on very little battery so it doesn’t overheat in your body.
Affects of air pollution essay Our unified act of action can only make our environment so clean that out future generations do not have to use oxygen mask and they can breathe easily in open air. As firms are paying more for the same amount of labour, the average profit one unit of labour provides will decrease reducing economic growth. Air pollution can also be categorized into to 2 different sections, street level pollution and smog. It is believed that much like cystic fibrosisby living in a more urban environment serious health hazards become more apparent. There are various locations, activities or factors which are responsible for releasing pollutants into the atmosphere. If the government cannot invest in other sectors then its economy or standard of living in that country may also fall. The manner through which these batteries are disposed could lead to more dangerous chemical being exposed into the atmosphere. Following are the few steps which we could take to prevent air pollution: Stationary sources include smoke stacks of fossil fuel power stations see for example environmental impact of the Affects of air pollution essay industrymanufacturing Affects of air pollution essay factories and waste incinerators, as well as furnaces and other types of fuel-burning heating devices. It aimed to change the fuels used by public transport especially busses and taxis to make the air pollution better. The highest impurity levels reached are not uncommon in some classroom or office environments. Essay on parking problem Essay on smoking and its hazards Summary for research paper quilling homework is bad persuasive essay avaya danam essay Affects of air pollution essay belmont essay, how to analyze in a history essay. The more vehicles move in the road, the more air pollution These substances include various gases and tiny particles that may be harmful to human health and the environment. But I feel that the government is not the only one to blame for the increase in pollution over the years. Effects of Air Pollution The effects of air pollution are not only harmful to human health but the increase in the greenhouse gases have given birth to a new threat called Global Warming. We use cookies to give you the best experience possible. Marxism feminism essay ulagan essays, literature essay present tense. When less is supplied, there would be less harm to the environment. All types of pollution are detrimental to human health and wildlife and contribute to climate change, which puts the entire planet in danger. Depletion of ozone layer due to fluoro carbon of aerosol causes the exposure of U. Herding more people into clean public transit such as electric trains can also help. Every individual is directly affected by air pollution. However if a firm purchases all or a majority of the trade permits, it could mean holding a strong monopoly position generating a problem to the market. The marginal social benefit curve shows how much more benefit society as a whole will gain from one extra unit. Some of the advanced countries have already taken some measures to meet it. The biggest fear in air pollution is global warming that comes from overpopulation of air. Prevention of the Pollution The Government can at least see those future factories are set up in a distant place, an industrial complex far away from the township. Surely the government is aware of this problem, but they are doing just enough to get away from the pressure from the media, people and also green organizations. Let us pledge together that we will do our bit in curtailing air pollution and also help in spreading awareness so that we can make earth as green as it was before the inception of urbanization and industrial revolution. Hum hain roshan mustaqbil essay why i deserve a scholarship essay lyrics a cricket match essay with quotations on education general english essays about friendship how to analyze in a history essay aziz essayed filmographie brad ethics and values in social work essay admission felix dietlein dissertation proposal katharina grosse mass moca essay High school essay metaphors Positive effects of social media essay intro divorce difficult decision essay experiments on animals should be banned essay writer research paper cite book setting of fahrenheit essay essayons conjugation of leer utopian government essay hamare tyohar essay help. The researcher may find out how to avoid harmful smoke from running vehicles. These are very common in winter seasons. Particulates created from gaseous primary pollutants and compounds in photochemical smog. Diseases by air pollution Air pollution may cause severe lungs-diseases, asthma, brain-disorder diseases, etc. Neuroplastic effects of pollution Inair pollution caused premature deaths on average of 1 year in Europe, and was a significant risk factor for a number of pollution-related diseasesincluding respiratory infectionsheart diseaseCOPDstroke and lung cancer. Emission standards for newly registered vehicles have been tightened since Some people do the excessive use of the loudspeakers and microphones, which can harm the environment as well as our ear. Air Pollution The addition of impurities and harmful gases in air is termed as Air Pollution. The burning of coal or other fossil fuels releases the considerable amount of sulfur dioxides into the air. Pollution Essay In the rural area, in most of the houses the housewives making the food on.Air pollution does not only affect the health of local citizens but it also affects our economy in relation. If air pollution continues to get worse the health of people in Hong Kong would be affected leading to a lower standard of living. Cause and Effect Essay Example: Air Pollution Poignant Matters. Creative results of a research writing that and is a correlation between the increased number of cardiovascular disease result deaths and the increasing levels of pollution in recent years. Air Pollution Essay Essay on Air Pollution – Sources, Types and Control Article shared by Any physical chemical or biological change in the natural composition of air is termed as air pollution. Pollution is the process of making land, water, air or other parts of the environment dirty and unsafe or unsuitable to use. This can be done through the introduction of a contaminant into a natural environment, but the contaminant doesn't need to be tangible. Visuomeniniai mokslai essay how to write a thesis statement for a narrative essay key essay on health behavior school code of conduct bullying essay conclusion cause and effect essay on computer revolution essay about medical science, voltaire biography essay requirements. The Causes and Effects of Pollution Pollution is any release of contaminant materials into water, land or air causing environmental impacts and/or the lowering of quality of life (Harrison, ). The main types include water, soil/land, air and noise pollution, each with different causes. Affects of air pollution essay Rated 4/5 based on 80 review
A Dust Bath for Cape Verde A Dust Bath for Cape Verde A Dust Bath for Cape Verde Winter is a dusty season off the coast of North Africa. As temperatures drop and high pressure builds on the continent, strong winds known as the harmattan blow west across the Sahara. They pick up sand and dust from the desert and loft it over the ocean. In late January 2018, the Moderate Resolution Imaging Spectroradiometer (MODIS) on NASA’s Terra satellite caught a glimpse of Saharan dust bathing the Cape Verde islands, which lie about 650 kilometers (400 miles) off the coast of Senegal. The images were acquired on January 22 and 23. Note the wind shadows, wakes, and vortices—areas with less dust density—on the leeward side of the islands. Winds blowing from the northeast and east run into the high volcanic peaks of the islands, which block some of the dust and alter the air flow. Note, too, how much denser the dust plume grows on the second day. Hundreds of millions of tons of dust blow out of Africa every year, crossing the Atlantic all the way to the Caribbean and the Gulf of Mexico. This dust fertilizes the ocean with nutrients that can promote plankton growth, but it can also carry fungus and disease-causing microorganisms that damage coral reefs. NASA Earth Observatory images by Joshua Stevens and Jeff Schmaltz, using MODIS data from LANCE/EOSDIS Rapid Response. Story by Mike Carlowicz and Holli Riebeek. References & Resources
Skip to main content Geographic risk modeling of childhood cancer relative to county-level crops, hazardous air pollutants and population density characteristics in Texas Article metrics • 8179 Accesses • 13 Citations Childhood cancer has been linked to a variety of environmental factors, including agricultural activities, industrial pollutants and population mixing, but etiologic studies have often been inconclusive or inconsistent when considering specific cancer types. More specific exposure assessments are needed. It would be helpful to optimize future studies to incorporate knowledge of high-risk locations or geographic risk patterns. The objective of this study was to evaluate potential geographic risk patterns in Texas accounting for the possibility that multiple cancers may have similar geographic risks patterns. A spatio-temporal risk modeling approach was used, whereby 19 childhood cancer types were modeled as potentially correlated within county-years. The standard morbidity ratios were modeled as functions of intensive crop production, intensive release of hazardous air pollutants, population density, and rapid population growth. There was supportive evidence for elevated risks for germ cell tumors and "other" gliomas in areas of intense cropping and for hepatic tumors in areas of intense release of hazardous air pollutants. The risk for Hodgkin lymphoma appeared to be reduced in areas of rapidly growing population. Elevated spatial risks included four cancer histotypes, "other" leukemias, Central Nervous System (CNS) embryonal tumors, CNS other gliomas and hepatic tumors with greater than 95% likelihood of elevated risks in at least one county. The Bayesian implementation of the Multivariate Conditional Autoregressive model provided a flexible approach to the spatial modeling of multiple childhood cancer histotypes. The current study identified geographic factors supporting more focused studies of germ cell tumors and "other" gliomas in areas of intense cropping, hepatic cancer near Hazardous Air Pollutant (HAP) release facilities and specific locations with increased risks for CNS embryonal tumors and for "other" leukemias. Further study should be performed to evaluate potentially lower risk for Hodgkin lymphoma and malignant bone tumors in counties with rapidly growing population. Childhood cancer has been linked to a variety of environmental factors, including agricultural activities, industrial pollutants and population mixing, but etiologic studies have often been inconclusive or inconsistent when considering specific cancer types. More specific exposure assessments are needed. It would be helpful to optimize future studies to incorporate knowledge of high-risk locations or geographic risk patterns. Bayesian methods have begun to predominate disease mapping applications[1]. This emergence has been largely attributed to advances in computer hardware that have enabled Markov Chain Monte Carlo implementations of relatively complex Bayesian models[2] and recently developed software has made these techniques readily available to health researchers[3]. One of the potential advantages for performing the risk estimation in a Bayesian approach is that the inference is based on parameter or risk certainty and the risk can apply to the lower organizational unit, such as individuals, in a hierarchal Bayes approach [1]. Thus, the risk estimate would apply to an individual considering alternative living locations. Pesticide exposure has long been implicated as a cause of childhood cancer and has been the focus of multiple studies, however, an unambiguous mechanistic cause-and-effect relationship has not been demonstrated [4]. Some studies whose objectives were to evaluate pesticide exposure used cropping intensity as an exposure surrogate and implicated farm or rural living as a positive risk factor [5]. These and other geographic studies have concentrated on geopolitical boundaries or buffers around point sources and have led to inconsistent results when each individual cancer type is considered among studies [610]. Even if an association was consistent, rural communities are different from urban communities in a great many ways, including population density characteristics and the extent of industrial pollution. Further research should be focused on high-risk areas to evaluate specific exposures and specific cancer types. Hazardous air pollutants (HAP) have been linked to increased cancer risks for individuals living in close proximity to major point source HAP-releases. For example, childhood cancers and leukemias in Great Britain exhibited geographical clustering of birth places close to environmental hazards that included large scale combustion processes, processes using volatile organic compounds and waste incineration [1113]. When areal source HAP were modeled at the census tract level, modeled values were related to leukemia rates in California [14]. Automobile exhaust is an area-source HAP that has received considerable scrutiny as a potential cause of childhood cancer. The studies have shown conflicting results and a critical review concluded that the weight of the epidemiological evidence indicates no increased risk for childhood cancer associated with exposure to traffic-related residential air pollution [15]. If surrogate exposure, like proximity to releases, is related to a rare disease, like childhood cancer, then investigation should focus on the higher risk locations. Infectious causes of childhood cancer have been proposed and population characteristics of stability or mixing have been proposed and evaluated [16]. An Ohio study examined the geographic distribution of childhood leukemias relative to population density, population growth, and rural/urban locale. The study found higher rates for acute lymphocytic leukemia among the counties with most rapid population growth and the most urbanized counties had reduced risk for acute myeloid leukemia. The authors reasoned that the findings supported population mixing as a cause of some childhood cancers [17]. Mixing at the population level must have risks that can be estimated and communicated at the individual level. The risks for an individual to move or to be exposed to movers should be parsed and estimated in a more focused study. The three types of proposed causal factors (cropping, HAP release and population density characteristics) are especially likely to be confounded in Texas where the spatial relationships between agricultural activity, industrial locations and characteristics of the population are especially complex. The objective of this study was to perform Bayesian geographical risk modeling of childhood cancer accounting for potential correlations among histotypes. Geographic patterns were assessed relative to county-level cropping intensity, intensive industrial releases of HAP and population density and growth. The goal of the study was to estimate the risk to an individual child based on specific characteristics of the mother's living location at the time of childbirth. Once higher risk locations are identified and characterized, more specific personal risk models can be developed. Childhood cancer database All Texas birth records from January 1, 1990 to December 31, 2002 were retrieved from the Texas Department of State Health Services (TDSHS). All births were followed for cancer incidence as reported to the Texas Cancer Registry (TCR) as of January 1, 2003. Therefore, a birth occurring January 1, 1990 had 13 years of follow-up and a birth on January 1, 2002 had one year of follow-up. The TCR is an active member of the North American Association of Central Cancer Registries (NAACCR) and follows the quality control guidelines and standards established by NAACCR (details available at the NAACCR website: The TCR estimates that cancer incidence data for the state are approximately 95% complete. Cancer diagnoses were grouped into 19 groups based on the most recent International Classification of Childhood Cancers (ICCC-3) [18]. Some pooling of very rare cancer types was performed as follows: childhood cancer subgroups Ic, Id and Ie were pooled and assigned the name "other leukemias"; subgroups IIb, IIc, IId and IIe were pooled into a single group and were labeled "non-Hodgkin lymphoma"; and subtypes IIIe, and IIIf were pooled into a group called "other CNS tumors." The database provided records for 3718 cancer cases distributed among 19 histotype groups and 3,805,745 total births. County-level agronomy practices To evaluate annual crop production, data were retrieved from the Texas Almanac Characterization Tool Version 2.0.4 (Blackland Research and Extension Center, Texas Agricultural Experiment Station, Texas A&M University System, 720 East Blackland Road, Temple, TX, USA). By acreage, there are four major crops in Texas: corn, soybeans, wheat, and sorghum. When the combined total acres planted in these crops exceeded 20% of the county's total area, the county-year was classified as extensive cropping. The definition was chosen to identify the highest production locations but also to maintain an adequate number of high production county-years for estimation stability. County-level HAP Hazardous air pollutants are substances that are known to be carcinogenic or to cause other serious health problems. The Environmental Protection Agency (EPA) currently identifies and records the release of 188 HAP. The data regarding Texas industries with air emissions of chemicals were available from the Toxic Release Inventory (TRI) program, a publicly available database of toxic chemical releases. This inventory was established under the Emergency Planning and Community Right-to-Know Act of 1986 (EPCRA) and expanded by the Pollution Prevention Act of 1990. The EPA compiles the TRI data each year and makes it available through several data access tools, including the TRI Explorer and Envirofacts. The data are available as either county emission summaries (county-level) or facility-specific emissions (point-source). Releases from four industries, petroleum refineries (Standard Industrial Code (SIC) Major Group 29), petroleum refining and related industries (SIC Major Group 33), chemical industries (SIC Major Group 28) and plastics production (SIC Major Group 30), were retrieved. The total releases were summed to identify high-release county-years. For year-to-year consistency, the list of 1988 core chemicals was used. A county-year in which 100 tonnes of toxic substances were released was considered to be high intensity HAP release. This definition identified the highest release county-years while maintaining enough intensive-release county-years for estimation stability. County-level population density Counties were classified on population estimates from the US census bureau; the same source was used for estimates for intercensus years. County-years with populations of more than one million were classified as metropolitan and county-years with more than 50,000 residents were classified as urban. These are the standard definitions used by the U.S. census. County-years that showed population growth of more than one percent from the previous year were classified as rapid growth. The definition was chosen to be comparable to a recent study that evaluated a similar growth rate [17]. Disease Modeling The hierarchical modeling approach followed a general framework. The observed counts Y kij of childhood cancer histotype k in county i and year j were assumed to follow independent Poisson distributions conditional on an unknown mean E kij exp(u kij ) Y kij | u kij ~ Poisson(E kij exp(u kij )) The expected count for histotype k in county i, and year j (E kij ) was obtained by internal standardization from the given dataset such that the sum of observed cases for each histotype was exactly equal to the sum of expected cases for each histotype accounting for race. Race was defined as the mother's race as identified as one of four classes on the birth record: white, black, Hispanic and other. Year was defined as the calendar year of birth, 1990 to 2002, inclusive. Hence exp(u kij ) is the standardized morbidity ratio (SMR). County-years with exp(u kij ) > 1 had greater number of observed cancer cases than expected, and vice versa for counties with exp(u kij ) < 1. The log-SMR u kij was modeled linearly for k = 1,..., 19 histotypes and i = 1,..., 254 counties and j = 1,...,13 years, as u kij = α k + S ki + Year kj + β 1 k *HAPS ij + β 2 k *CROPS ij + β 3 k *METRO ij +β 4 k *URBAN ij + β 5 k *GROWTH ij The α k represent the histotype-specific intercept terms for the baseline log-SMR across all counties and were assigned 19 independent flat priors. The S ki represent the county and histotype-specific log-SMR due to unmeasured or random county effects. The 19 × 254 dimensional matrix S was assigned a Multivariate Intrinsic Conditionally Autoregressive (MCAR) prior distribution with covariance matrix prior an inverse Wishart (h, R) distribution with degrees of freedom h= 19 and R, a 19 × 19 identity matrix. Year represented the risk for year of birth which contained the risk for the varying periods of observation and was assigned 19 independent random walk priors. Indicator variables (HAPSij, CROPSij, METROij, URBANij and GROWTHij) were derived from the data as previously described for high intensity HAP release, high crop production, metropolitan, urban, and rapid population growth county-years, respectively. The β's represented the log-relative risk for the county characteristics and were assigned a non-informative Normal prior distribution. Disease Mapping The risk modeling was extended to derive overall spatial estimates for the 254 Texas counties from the 3302 county-years in the model previously described. Some of the geographic risk factors changed within a county from year to year. To evaluate each county's overall risk the mean expectation for each risk factor was calculated from the 13 years and used to estimate the county's overall risk attributable to the measured factors. The spatial model also adjusted risks for spatial associations and histotype correlations for the potential MCAR relationships that were estimated fully conditional upon all factors in the Disease Model, described previously. The parameterization used for spatial modeling was the posterior probability that the SMR estimate was greater than one [19]. This parameter is affected by both the magnitude and the precision of the SMR and was chosen to facilitate the objective of focusing further research on high-risk location and histotype combinations. The approach of establishing the probability of an increased risk is generally considered the first step for investigating a possible cluster and served the objective of identifying the locations with highest likelihood of elevated risk for further geographically focused studies. Spatial estimates were plotted using commercially available GIS software (ArcView® GIS 3.2, Environmental Systems Research Institute, Inc., Redlands, CA). All modeling All models employed Bayesian inference, with vague or flexible prior beliefs and an MCMC implementation. The MCMC implementation was performed by use of WinBUGS version 1.43 [3] and GeoBUGS version 1.2 [20]. The initial 1,000 iterations were discarded to allow for convergence and every hundredth of the following 100,000 iterations were sampled for the posterior distribution. The Bayesian estimate was taken as the posterior median of the parameter and 95% credible set was obtained from the posterior distribution quantiles. Observing convergence of two chains with widely different initial values for the random-effects precision parameters checked convergence to the posterior distribution. Two hundred and fifty four counties were modeled for 13 years providing 3302 county-years. The majority of county-years (79.1%) were classified as rural with a population of less than 50,000. For each year of the study there were exactly 4 metropolitan counties having more than one million residents: Bexar, Dallas, Harris and Tarrant counties. Population growth varied widely with population losses of more than 1% to population growth of greater than 4% both common. Growth of greater than 1% occurred in 41.7% of the county-years (Figure 1). The amount of HAP-release was commonly less than 50 tonnes per county-year but some very high releases were recorded, with 15.8% of the county-years having greater than 100 tonnes of release (Figure 2). Most county-years had less than 10% of the county area planted in corn, sorghum, cotton and wheat; however some county-years had greater than 50%, with 20.1% of the county-years having greater than 20% of the county cropped with these four crops (Figure 3). Figure 1 Frequency distribution of county-year population growth rates. Figure 2 Frequency distribution of county-year release of hazardous air pollutants. Figure 3 Frequency distribution of county-year cropping intensity for total corn, sorghum, wheat and cotton. Children born January 1, 1990 were followed for 13 years and children born January 1, 2002 for one year. The counts of incident cases by histotype and year are listed in Table 1. Independent random walk priors were used to allow autoregressive temporal smoothing for each histotype. Temporal trends were readily identifiable and they varied considerably among histotypes. Two cancers with the greatest decrease in risk over the period of study were malignant bone tumors (e.g. osteosarcoma) and Hodgkin lymphoma. Two cancers with relatively steady risk over the study period were AML and "other leukemias." The temporal smoothing parameters used in the study are presented in Figure 4. Figure 4 Study-specific temporal effects. 4a. Leukemias and lymphomas. 4b. Nervous tissue tumors. 4c. Other tumors. International Classification of Childhood Cancer (ICCC3) Classification Key. Ia. Acute Lymphoid leukemias (ALL). Ib. Acute myeloid leukemias (AML). Ic, d, e, Other leukemias. IIa. Hodgkin lymphoma. IIb, c, d, e. Non-Hodgkin lymphoma. IIIa. Ependymoma and choroid plexus tumor. IIIb. Astrocytomas. IIIc. Intracranial and intraspinal embryonal tumors. IIId. Other gliomas. IIIe, f Other CNS tumors. IV. Neuroblastoma and other peripheral nervous cell tumors. V Retinoblastoma. VI. Renal tumors. VII. Hepatic tumors. VIII. Malignant bone tumors. IX. Soft tissue and other extraosseous sarcomas. X. Germ cell tumors, trophoblastic tumors, and neoplasms of gonads. XI. Other malignant epithelial neoplasms and malignant melanomas. XII. Other and unspecified malignant neoplasms (including uncoded). Table 1 Incidence by year and histotype For the combination of five geographical risk indicators and 19 cancer types, there were no SMRs whose 95% credible sets were above one. Hodgkin lymphoma appeared to be occurring with reduced risk in rapidly growing counties with > 90% of the posterior distribution less than one for SMR. There was support for an increased risk for hepatic tumors associated with high-release HAP locations and for germ cell tumors and "other" gliomas among high crop production locations. The median SMR and the 95% credible sets are listed in Table 2. Table 2 Standard Morbidity Ratios for county characteristics of the mother's living location at the time of birth. Values are the median and 95% credible sets from the posterior distribution. Risk maps identified counties for which the posterior likelihood of elevated SMR was greater than 95% for four cancers: other leukemias in Hidalgo County (Figure 5), CNS embryonal tumors in Ector County (Figure 6), CNS other gliomas in Parker, Tarrant and Harris Counties (Figure 7) and hepatic tumors in Parker, Tarrant and Smith Counties (Figure 8). Ten of 19 cancer histotypes had greater than 90% posterior probability of SMR greater than one for at least one county. The maps also showed spatial correlation among areas of elevated risk. Figure 5 Spatial risks for "other" leukemias by county. Figure 6 Spatial risks for CNS embryonal tumors by county. Figure 7 Spatial risks for CNS "other" gliomas by county. Figure 8 Spatial risks for hepatic tumors by county. The correlations among histotypes and within county-years in the final model were generally near zero, ranging from -0.35 to 0.32. The investigation reported here estimated personal risks for a child to develop cancer. This risk was defined by the mother's living location at the time of birth. Tumors with peaks in infancy were of special interest because they are more likely to have had causal exposures during the prenatal period. There are several childhood cancers known to have incidence peaks early in the infancy including neuroblastoma and other peripheral nervous cell tumors, retinoblastoma, renal tumors and hepatic tumors. Acute lymphocytic leukemia has a peak in infancy that is prominent among white children but less evident among black children. There are also histotypes with peaks in infancy and another peak later in childhood, including "other" leukemias and germ cell tumors, trophoblastic tumors and neoplasms of gonads [21]. Cancers with known incidence peaks in infancy showed temporal trends with relatively slow decrease in incidence for birth years 1990 to 2002. In contrast, the observed risk for cancers with incidence peaks in teenage years, Hodgkin lymphoma and malignant bone tumors [21] showed marked decline for the birth years 1990 to 2002. The temporal trends observed in the current study can be attributed to the latency period for the cancers and the variable period for follow-up. Although the primary exposure period of interest was the prenatal period for the current study, there is also interest in critical periods of exposure including earlier in gestation and the neonatal period. Also, it may be that many environmental exposures act not as tumor initiators, but as tumor promoters, so that exposures closer to diagnosis are also of interest. These were issues not addressed in the current study. Risk estimates were computed under a Bayesian paradigm maintaining sources of uncertainty in the risk estimates. The county-level parameters were used as potential indicators of high-risk locations for further study and were selected from the conflicting evidence supporting their possible role as causes of childhood cancer. In general, it is not expected that the association between exposure and risk is linear for these geographic factors. The current analysis evaluated the risk of the extreme values for these potential indicators as observed in Texas. Cut-points for analysis were based on high values that allowed an adequate number of county-years (i.e., 15–20%) to be classified as "at risk." Even though Texas is considered an agricultural state there were only a low number of county-years with greater than 20% of the land area in intensive crop production. Studies in other locations may be able to evaluate a much higher cut-point. In contrast, the current study evaluated a very high cut-point of 100 tonnes of HAP. The population parameter cut-points for metropolitan and urban are used commonly by the U.S. census to classify counties. The identified factors could be related to many unknown potential causes thus the potential for confounding limits causal inference. It was the objective of this study to use county characteristics to focus further study. Once high-risk counties and their characteristics are identified, studies more specific to identifying environmental causes will become feasible. The precision for geographic risk estimates has been especially problematic in the study of childhood cancer. It has been proposed that broader geographic regions could increase the precision of areal risk estimates for rare diseases [22]. However, aggregating of areal units will reduce the resolution of the GIS risk layer and will alter the relationship with a GIS exposure layer. Aggregation problems can result from the possibility of combining areal units that are actually very different in risk. The two problems created with using broader geographic regions, resolution and aggregation, are collectively known as the modifiable areal unit problem (MAUP). Combining spatial neighboring counts can be effective if the neighbors are very similar but the pooling would lead to non-differential risk classification if neighboring areal risks are dissimilar. Hierarchical approaches have been proposed to estimate the extent of correlation among neighboring locations and then adjust the risk estimates accordingly. The justification for Bayesian hierarchal modeling with vague priors is that the data likelihood will determine the extent of this pooling. More specific causal studies should involve geographic risk modeling with a more precise geographic scale. The current study had available geocoordinates for individual births so it was theoretically possible to plot a continuous risk surface with a Bayesian geo-statistical approach [23] or more traditional approaches for cluster identification could have been used [24]. For the current study, the geographic factors were provided at the county level and, thus, dis-aggregation of the exposure to smaller geographic units, for example census tracts, could have led to an ecologic bias. However, TRI releases are available for point-source releases at specific geo-coordinates and detailed risk mapping in proximity to these sites is possible and should be the subject of further investigation. The current study identified locations for which this approach would most likely be rewarding. In the posterior distribution, correlations among histotype pairs were small but ranged from moderately negative to moderately positive correlations. All non-zero correlations contribute to increased precision. The correlations were estimated fully conditionally on the geographic factors and were much smaller than in a previous study that did not identify attributes of specific locations [25]. As cancer risk modeling proceeds with geographic risk factors more precisely defined, the correlation among histotypes will eventually become attributable to specific geographic factors. The justification for a Bayesian approach and non-informative priors for spatial correlations among histotypes is that the approach can be used to increase comparability among studies. At present, the literature reveals a variety of ad hoc approaches to the grouping and parsing of childhood cancer histotypes. Previous epidemiologic studies have often used broad case definitions and frequently pooled data from multiple childhood cancer histotypes. The appropriateness of this pooling is largely unknown. Pooling cancer types with disparate causes will lead to a non-differential misclassification and usually increase the likelihood of a null finding. Failure to pool cancer types with common causes will lead to an unnecessary loss of precision. Specifying a flexible prior for the covariance matrix in a Bayesian approach can preserve this uncertainty or update the certainty based upon the data likelihood. Under Bayesian modeling, if two diseases are poorly correlated, the outcomes will remain relatively uncorrelated in the posterior distribution and the risk estimates will be the similar to estimates calculated independently for each histotype. The current study supports further studies on germ cell tumors and other gliomas in areas with intensive cropping. Several studies have linked georeferenced disease counts and cropping patterns as a surrogate for pesticide exposure [710, 26]. These studies varied widely on how cropping patterns were defined as exposure and how the childhood cancers, as a group of outcomes, were pooled or parsed. However, when risks of specific cancer types are evaluated subjectively among studies, the cumulative evidence supports the null finding. For the vast majority of childhood cancer types, the current study goes beyond a frequentist null conclusion by demonstrating SMR that were close to one with narrow 95% credible sets. The current study supports the study of childhood hepatic cancer in areas of intense HAP release. The SMR for hepatic tumors was 1.87 (0.95, 3.98) for county-years with greater than 100 tonnes of HAP releases. Studies evaluating air pollution as a cause of childhood cancer have been inconsistent among a variety of cancer types [27]. The critical review showed several studies have evaluated multiple cancer types and groupings and found one or more histotypes at increased risk but other studies have found other histotypes at risk [27]. When individual cancer types are evaluated across studies, the cumulative evidence seems to support the null. Leukemia may be the exception, with some indication of increased risk among multiple studies of air pollution [28]. For cancer types other than hepatic cancer, the current study provides SMR estimates that center on no risk and have narrow confidence bounds, providing inductive support for the frequentist null results. Incriminating areal-source HAP concentrations in childhood cancer has been and will continue to be difficult. It has been reasoned that more definitive prospective studies should utilize biomarkers to study the risks of prenatal exposures [2931]. Two recent studies illustrate the utility of biomarkers for studies defining the complex causal relationships between fetal exposures to air pollution and adverse outcomes [30, 31]. Such an approach may be useful to study childhood hepatic cancer around major Texas industrial facilities. The current study supports the investigation of Hodgkin lymphoma and malignant bone tumors in areas of rapid population growth. Hodgkin lymphoma is thought to be partly attributable to Epstein-Barr virus but also has genetic and environmental factors [32, 33]. Low socioeconomic status increases risk for Hodgkin lymphoma [21] and it is possible that lowered risk observed in areas of rapid population growth in Texas could have been attributed to residents of higher socioeconomic status. Malignant bone tumors, including osteosarcoma as the most common of the class [34], had a high probability of increased risk in counties with rapidly growing population. Both Hodgkin lymphoma and osteosarcoma are considered to be more common in teenagers and the current study did not include any incident cases among teenagers. The risks seen for these two cancers in rapidly growing counties should receive more study. Infectious causes and population mixing have been proposed as causes of childhood cancer [35]. The theory is that densely populated regions have high levels of herd immunity but populations with constant population mixing are at increased risk for individuals. The purpose of the current study was to evaluate the use of population characteristics for focusing further study. One study [17] found excess risk when population growth was greater than 10% in an eleven-year period, thus our risk definition of 1% per year. The population mixing theory does not parse the risk for those moving into a region from those already residing in the region and thus has only a population-based inference. For an individual deciding to move, the risks could be threefold. First, there could have been a geographic-based risk associated with the previous living location. Second, there could be a new geographic risk at the new living location. Third, there could be a risk of being a mover. The full evaluation of these risks would be complex and require hierarchical modeling if the objective included the estimation of risks interpretable at the individual mover level. The current study found median SMR for measures of population density and population growth to be very near one with narrow 95% credible sets for most childhood cancer types. The spatial model identified counties with greater than 95% posterior likelihood of elevated SMR for specific childhood cancer histotypes. Hidalgo County had a high likelihood for increased SMR for atypical or "other" leukemias. Hidalgo County is a rapidly growing urban county on the Mexican border populated mainly by Hispanics. Ector County had a high likelihood for elevated SMR to CNS embryonal tumors. Ector County is an urban county populated relatively evenly by Hispanics and non-Hispanic whites. Three counties had a high posterior likelihood of elevated SMR to CNS "other" gliomas including Parker and Tarrant Counties collectively containing the Dallas/Fort Worth metropolitan area and Harris County which contains most the Houston metropolitan area. Both metropolitan areas are rapidly growing with considerable industrial development. Three counties had a high likelihood of elevated SMR for hepatic tumors including Parker and Tarrant Counties making up the Dallas/Fort Worth metropolitan area and Smith County. Smith County is an urban county but is often considered part of the Tyler metropolitan area. The risks estimated for these counties included the portion of the risk related to the factors that were evaluated and residual or random, unexplained geographic risks. Further study of these childhood cancer histotypes in these locations is indicated. The Bayesian implementation of the MCAR model provided a flexible approach to the spatial modeling of multiple childhood cancer histotypes. The approach parses the counts into specific counts of ICCC-3 classifications and flexible priors permit spatial smoothing and histotype correlations based on the data likelihood. Analysis of cancer risk by counties showed four cancer histotypes with greater than 95% likelihood of elevated SMR for further study. The identification of geographic factors supports more focused studies of germ cell tumors and "other" gliomas in areas of intense cropping, hepatic cancer near HAP release facilities and Hodgkin lymphoma and malignant bone tumors in counties with rapidly growing population. 1. 1. Best N, Richardson S, Thomson A: A comparison of Bayesian spatial models for disease mapping. Stat Methods Med Res. 2005, 14: 35-59. 10.1191/0962280205sm388oa. 2. 2. Banerjee S, Carlin BP, Gelfand AE: Overview of spatial data problems. Hierarchical Modeling and Analysis for Spatial Data. 2004, Boca Raton: Chapman & Hall/CRC, 1-20. 3. 3. Spiegelhalter D, Thomas A, Best N, Lunn D: WinBUGS User Manual: Version 1.4. 2003, Cambridge: MRC Biostatistics Unit 4. 4. Infante-Rivard C, Weichenthal S: Pesticides and childhood cancer: An update of Zahm and Ward's 1998 review. Journal of Toxicology and Environmental Health-Part B-Critical Reviews. 2007, 10: 81-99. 10.1080/10937400601034589. 5. 5. Nasterlack M: Pesticides and childhood cancer: An update. International Journal of Hygiene and Environmental Health. 2007, 210: 645-657. 10.1016/j.ijheh.2007.03.001. 6. 6. Reynolds P, Von Behren J, Gunier RB, Goldberg DE, Hertz A, Harnly ME: Childhood cancer and agricultural pesticide use: An ecologic study in California. Environ Health Perspect. 2002, 110: 319-324. 7. 7. Reynolds P, Von Behren J, Gunier RB, Goldberg DE, Harnly M, Hertz A: Agricultural pesticide use and childhood cancer in California. Epidemiology. 2005, 16: 93-100. 10.1097/01.ede.0000147119.32704.5c. 8. 8. Reynolds P, Von Behren J, Gunier R, Goldberg DE, Hertz A: Agricultural pesticides and lymphoproliferative childhood cancer in California. Scand J Work Environ Health. 2005, 31: 46-54. 9. 9. Schreinemachers DM: Cancer mortality in four northern wheat-producing states. Environ Health Perspect. 2000, 108: 873-881. 10.2307/3434996. 10. 10. Schreinemachers DM, Creason JP, Garry VF: Cancer mortality in agricultural regions of Minnesota. Environ Health Perspect. 1999, 107: 205-211. 10.2307/3434510. 11. 11. Knox EG, Gilman EA: Spatial clustering of childhood cancers in Great Britain. J Epidemiol Community Health. 1996, 50: 313-319. 12. 12. Knox EG, Gilman EA: Migration patterns of children with cancer in Britain. J Epidemiol Community Health. 1998, 52: 716-726. 13. 13. Knox EG: Childhood cancers, birthplaces, incinerators and landfill sites. Int J Epidemiol. 2000, 29: 391-397. 10.1093/ije/29.3.391. 14. 14. Reynolds P, Von Behren J, Gunier RB, Goldberg DE, Hertz A, Smith DF: Childhood cancer incidence rates and hazardous air pollutants in California: An exploratory analysis. Environ Health Perspect. 2003, 111: 663-668. 15. 15. Raaschou-Nielsen O, Reynolds P: Air pollution and childhood cancer: A review of the epidemiological literature. International Journal of Cancer. 2006, 118: 2920-2929. 10.1002/ijc.21787. 16. 16. Mcnally RJQ, Eden TOB: An infectious aetiology for childhood acute leukaemia: a review of the evidence. British Journal of Haematology. 2004, 127: 243-263. 10.1111/j.1365-2141.2004.05166.x. 17. 17. Clark BR, Ferketich AK, Fisher JL, Ruymann FB, Harris RE, Wilkins JR: Evidence of population mixing based on the geographical distribution of childhood leukemia in Ohio. Pediatric Blood & Cancer. 2007, 49: 797-802. 10.1002/pbc.21181. 18. 18. Steliarova-Foucher E, Stiller C, Lacour B, Kaatsch P: International classification of childhood cancer, third edition. Cancer. 2005, 103: 1457-1467. 10.1002/cncr.20910. 19. 19. 20. 20. Thomas A, Best N, Lunn D: GeoBUGS User Manual Version 1.2. 2003, Cambridge: MRC Biostatistics Unit 21. 21. Cancer Incidence and Survival among Children and Adolescents: United States SEER Program 1975–1995. 1999, Bethesda, MD: NIH Pub. No. 99 – 4649 22. 22. Morris RD, Munasinghe RL: Aggregation of Existing Geographic Regions to Diminish Spurious Variability of Disease Rates. Stat Med. 1993, 12: 1915-1929. 10.1002/sim.4780121916. 23. 23. Diggle PJ, Ribeiro PJ: . Model-based Geostatistics. 2006, Springer 24. 24. Wheeler D: A comparison of spatial clustering and cluster detection techniques for childhood leukemia incidence in Ohio, 1996 – 2003. International Journal of Health Geographics. 2007, 6: 13-10.1186/1476-072X-6-13. 25. 25. Thompson JA, Carozza SE, Zhu L: An evaluation of spatial and multivariate covariance among childhood cancer histotypes in Texas (United States). Cancer Causes & Control. 2007, 18: 105-113. 10.1007/s10552-006-0085-8. 26. 26. Kettles MA, Browning SR, Prince TS, Horstman SW: Triazine herbicide exposure and breast cancer incidence: An ecologic study of Kentucky counties. Environ Health Perspect. 1997, 105: 1222-1227. 10.2307/3433901. 27. 27. Buka I, Koranteng S, Vargas ARO: Trends in childhood cancer incidence: Review of environmental linkages. Pediatric Clinics of North America. 2007, 54: 177-203. 10.1016/j.pcl.2006.11.010. 28. 28. Buffler PA, Kwan ML, Reynolds P, Urayama KY: Environmental and genetic risk factors for childhood leukemia: Appraising the evidence. Cancer Invest. 2005, 23: 60-75. 10.1081/CNV-200046402. 29. 29. Maisonet M, Correa A, Misra D, Jaakkola JJK: A review of the literature on the effects of ambient air pollution on fetal growth. Environ Res. 2004, 95: 106-115. 10.1016/j.envres.2004.01.001. 30. 30. Perera FP, Rauh V, Whyatt RM, Tsai WY, Bernert JT, Tu YH, Andrews H, Ramirez J, Qu LR, Tang DL: Molecular evidence of an interaction between prenatal environmental exposures and birth outcomes in a multiethnic population. Environ Health Perspect. 2004, 112: 626-630. 31. 31. Perera FP, Tang DL, Tu YH, Cruz LA, Borjas M, Bernert T, Whyatt RM: Biomarkers in maternal and newborn blood indicate heightened fetal susceptibility to procarcinogenic DNA damage. Environ Health Perspect. 2004, 112: 1133-1136. 32. 32. Nakatsuka S, Aozasa K: Epidemiology and pathologic features of Hodgkin lymphoma. Int J Hematol. 2006, 83: 391-397. 10.1532/IJH97.05184. 33. 33. Landgren O, Caporaso NE: New aspects in descriptive, etiologic, and molecular epidemiology of Hodgkin's lymphoma. Hematology-Oncology Clinics of North America. 2007, 21: 825-10.1016/j.hoc.2007.07.001. 34. 34. Buckley JD, Pendergrass TW, Buckley CM, Pritchard DJ, Nesbit ME, Provisor AJ, Robison LL: Epidemiology of osteosarcoma and Ewing's sarcoma in childhood – A study of 305 cases by the Children's Cancer Group. Cancer. 1998, 83: 1440-1448. 10.1002/(SICI)1097-0142(19981001)83:7<1440::AID-CNCR23>3.0.CO;2-3. 35. 35. Kinlen L: Childhood leukaemia and ordnance factories in west Cumbria during the Second World War. British Journal of Cancer. 2006, 95: 102-106. 10.1038/sj.bjc.6603199. Download references Financial support provided by the National Institutes of Health and the National Cancer Institute through grants numbered R03 CA106080 and R03 CA119696 Author information Correspondence to James A Thompson. Additional information Competing interests The authors declare that they have no competing interests. Authors' contributions JT participated in the conception, design, analysis and drafted the manuscript. SC participated in the conception, data acquisition and helped draft the manuscript. LZ participated in the conception, design and analyses. All authors read and approved the final manuscripts. Authors’ original submitted files for images Rights and permissions Reprints and Permissions About this article Cite this article Thompson, J.A., Carozza, S.E. & Zhu, L. Geographic risk modeling of childhood cancer relative to county-level crops, hazardous air pollutants and population density characteristics in Texas. Environ Health 7, 45 (2008) doi:10.1186/1476-069X-7-45 Download citation • Hodgkin Lymphoma • Childhood Cancer • Malignant Bone Tumor • Toxic Release Inventory • Standardize Morbidity Ratio
Hemp: A Plant Whose Time Has Come Author: Joyce Harman, DVM Hemp is all the buzz these days, and for good reason. It’s a plant with literally thousands of uses. It can be used for everything from clothing to fuel to paper—and many things in between. It is a weed and capable of growing in many different conditions with little additional fertilizer or other inputs. Hemp is also nutritious and has medicinal properties. First, here are a few definitions to clear up the confusion between the different uses and types: • Hemp is known by the Latin plant names cannabis sativa or cannabis indica. There is not a clear botanical differentiation between the two species, despite some claims otherwise. And in modern times, crossbreeding has blurred the lines even more. Hemp is a cannabis plant that contains no detectable level of THC (tetrahydrocannabinol), the ingredient that can make the user “high.” • Marijuana is the same basic plant but does contain THC and can make the user “high.” • Cannabinoids are the medicinal compounds that have been shown to be medically useful for many conditions. These are found only in the leaf and the buds of the plant. The acronym “CBD” is commonly used for medicinal preparations, but in reality, there are over 100 different cannabinoids in a hemp plant. There are active compounds called terpenes that work synergistically with the CBD. Herbs in general contain many hundreds of compounds that make up the action of the single plant. • Endocannabinoid System is the receptor system for cannabinoids found in all mammals and in most body systems. This means the plant or herb has the potential to help many parts of the body. • Omega-3 and omega-6 Fatty Acids are found only in the seeds of the plant. Omega-3 is an essential fatty acid that cannot be made in the body, so it needs to be eaten. • Industrial Hemp is generally grown for its fiber (stems) and seeds. The plants are grown close to each other to promote tall stemmy fibrous plants with lots of seeds. It contains very little, if any, CBDs. • Medicinal Hemp is grown to enhance the leaf and bud growth, with high levels of CBD and no omega-3 or omega-6 fatty acids. Hemp is a plant that can grow just about anywhere; but, it is also called a “bio-accumulator,” which means that contaminants or toxins in the soil will end up in the plant. So, when feeding hemp in any form, it’s important to use organically grown varieties. Hemp seeds are the most nutritious part of the plant used as food. They contain about 20 percent protein, 6 percent carbohydrates, and about 73 percent healthy fats. They also have significant amounts of calcium, magnesium, manganese, phosphorus, potassium, zinc, and vitamins A and E. Most diets contain an excess of omega 6 (an inflammatory compound). Hemp contains a healthy balance of omega-6 linolenic acid (25 percent) to omega-3 linoleic acid (55 percent), which is an anti-inflammatory compound and considered a perfectly balanced ratio. Hemp also contains the omega-6 fatty acid gama linolenic acid (GLA), a compound not frequently found in food. Even though it is type of omega-6, it has excellent anti-inflammatory properties, as well as cancer fighting immune support and help for insulin resistance. Hemp protein is highly bioavailable, though is not a complete protein to replace other sources. One ounce of seed contains 9.2 grams of protein. Hemp is just beginning to be grown in the United States, so sourcing enough hemp seeds to feed your horse may be difficult and expensive. This is changing as hemp is becoming legal to grow in more states. Hemp seeds will not replace your concentrate feed but can be a supplement to the diet. Hemp oil is commonly found in grocery stores and makes an excellent addition to your horses’ diet for its omega-3 and omega-6. It must be refrigerated in the hot weather, so it may not be convenient to feed depending on your barn. It may be easier to feed the seeds, though even those should be kept cool. You could keep a few days’ worth at the barn and the rest at home in the air-conditioning in the warm weather. The hemp leaf has been less analyzed for its nutritional value, and more for its medicinal value. However, the leaves are an excellent source of fiber, magnesium, calcium, and phosphorous. They also contain polyphenols that are antioxidants to help protect the cells from free radical damage. CBD’s are also antioxidants, along with their other medicinal properties. The leaf also contains many more beneficial chemical compounds, such as flavonoids, which have excellent nutritional benefits. Separating the nutritional properties of hemp from its medicinal ones can be complex, since many nutritional compounds are good for the horses because they enhance health. Hippocrates, many years ago stated: “Let food be thy medicine and medicine be thy food.” And in the case of hemp, it’s very true. Just be sure to understand which part of the plant you need for your goals. Author’s bio: Dr. Joyce Harman graduated from Virginia Maryland Regional College of Veterinary Medicine and becae a member of the Royal College of Veterinary Surgeons. She is certified in veterinary acupuncture and veterinary chiropractic. She has completed advanced training in homeopathy and herbal medicine and in Chinese medicine. Dr. Harman has served as president of the American Holistic Veterinary Medical Association, chairman of the Alternative Medicine (Therapeutic Options) Committee for the American Association of Equine Practitioners, and has been a member of the task force on alteratiive medicine for the American Veterinary Medical Association (AVMA). Since 1990, Dr. Harman owns Harmany Equine Clinic, Ltd., a holistic veterinary practice in Washington, VA. Dr. Harman is working to bring medicinal hemp to the horse world and to educate people about the benefits of this herb. Visit www.harmanyequine.com Font Resize Call Us Text Us
Category Archives: neurodevelopment Researchers use AI to rescue embryos from brain defects by re-engineering cellular voltage patterns. Improper neural patterning during brain development leads to serious disorders such as open neural tube defects, brain malformations, and susceptibility to autism and degenerative disorders like Parkinson’s and Alzheimer’s diseases. There are currently no clinically approved interventions for brain patterning disorders. therefore, finding regenerative and repair strategies for brain patterning is a critical unmet need in medicine.  Now, a study Read more « Older Entries Recent Entries »
Electronic Battleship Rules Electronic Battleship is a computerized version of the popular Milton Bradley game that involves two players guessing the locations of each others ships in order to make strategic attacks. The game utilizes four square grids that are identified by letters and numbers. On one grid, the player arranges their ships, and on another grid, the player tries to track the ships of the other player. With electronic battleship, many of the same rules apply as the original, but there are also three other types of games that can be played, as well as a chance to compete against the computer. Contents and Assembly The contents of the game include the base unit, target grid divider, 168 white pegs, 84 red pegs, 10 plastic ships and the battery door. In the battery door is the battery holder, where four AA batteries must be inserted to play the game. The game is then first assembled by sliding the target grid divider in the middle of the game board base. The bag of ten plastic ships should include two of each ship, which are the carrier, battleship, submarine, destroyer and patrol boat. Each player then takes 84 white pegs and 42 red pegs. Programming Ships The players must first decide who is Task Force One and who is Task Force Two. For the player who is Task Force One, it's his or her duty to press the "On" button on the side of the game board. You will hear a voice say, "Select Game." You must then press button one to select the first game. When you hear the game say "Select player," you must press the two button to select two players. You'll then hear, "Task Force One, enter your letter and number." Select a location pattern for your ship before strategically placing them on your grid for your ships. Enter the letter and number of your location and the press the "Enter" button. Your opponent will then be prompted to do the same. Firing a Missile The Task Force One player begins the game by picking a target hole to stick a white peg into on the target grid, which is located on the top right corner of the game board. The target is identified by a letter and a number. For example, D-2 is a target identification. This location is where you want to fire a missile to attack your opponent. To fire a missile, you must enter the letter and number of your target and then press the "Fire" button. You'll know that you hit your opponent's ship if you hear an explosion in the game. If you hear only the missile being fired off and no explosion, then you did not hit your opponent. The peg is left in the target grid to indicate an area that wasn't hit. After the hit or miss, it becomes the second player's turn. Winning a Game The object of the game is to sink all of your opponent's ships. To do this, when you hit part of a ship you must replace the white peg with a red peg. Once the entire ship is filled with red pegs it will be sunk and the computer will announce that you sunk one of your opponent's ships. The player who sinks all five of the other player's ships first is the winner. The computer will announce the task force that has one, and the song "Taps" will play for the loser. Other Games Game two is similar to game one, but in this version the player may continue shooting as many missiles until he or she misses. For example, if the Task Force One player makes a hit with the first target, she can continue playing. The second player will then have his or her turn once the first player has missed a target. For the game-three version, each player takes a turn for each ship that has not been sunk. An example is if the Task Force Two player has four ships that are not sunk, then he or she is allowed four turns at once. Game four is the most advanced version as it allows players to create their own firing rules and take turns any order that the players want to.
The Different Stages of Sleep During sleep your brain cycles through five different stages: 1, 2, 3, 4 and REM (rapid eye movement) sleep. A complete sleep cycle can take 90 to 110 minutes on average. You start with stage one, then make your way to REM and then you start the cycle from stage one again. At the beginning of the night, you experience shorter REM sleeps and longer periods of deep sleep, however, later in the night, the REM sleep increases and the deep sleep time decreases. The different stages of sleep - Stages image Stage 1 is the initial start of the sleeping cycle, this is where you slowly drift in and out of sleep and can be woken up easily. During the first stage, your body begins to relax, eyes move much slower and muscle activity decreases. It’s common for people to experience sudden painless muscle contractions, creating a sensation of falling. Moving on to the next stage, it is important that your neck and shoulders are relaxed and appropriately supported. If your neck is elevated, it could increase the chances of experiencing a disrupted sleep. During the second stage, your body is still completely relaxed and your eye movements stop while your brain waves become significantly slower with occasional bursts of waves. It is still very easy to be woken during this period, most people who take short naps would only reach this far in the cycle. When you enter stage 3, your brain has extremely slow waves called delta waves which are interspersed with smaller, faster waves. In stage 4, the brain produces delta waves almost exclusively. Stages 3 and 4 are commonly referred to as deep sleep or delta sleep, and it is very difficult to wake someone from them. In deep sleep, there is no eye movement or muscle activity. This is when some children experience bedwetting, sleepwalking or night terrors. Random Fact: In 2008 the sleep profession in the US eliminated the use of stage 4. Stages 3 and 4 are now considered stage 3. Slow brain wave sleep happens mostly in the first period of the night, REM is the second half. If you are woken up during REM sleep, you may remember it the next morning. Short awakenings may disappear or be partially memorable with amnesia. During REM sleep, your breathing becomes more rapid, irregular, your eyes move rapidly and your muscles are temporarily paralyzed. Your brain waves will also increase during REM sleep, much like what you experience when you’re awake. Alongside these, your heart rate increases, your blood pressure rises. This is the time when most dreams occur. If woken during REM sleep, a person can remember the dreams. Most people experience three to five intervals of REM sleep each night! Depending on your age, REM sleep makes up around 20-25% of the average adult’s time asleep, which is experimentally 90-120 minutes. Random Fact: Infants spend almost 50% of their time in REM sleep. Adults spend nearly half of sleep time in stage 2, about 20% in REM and the other 30% is divided between the other three stages. Older adults spend progressively less time in REM sleep. Because your sleep cycle repeats, you enter REM sleep several times during the night. Throughout REM sleep, your brain and body have energy and is typically where dreaming occurs. REM is thought to be connected with the process of storing your memories, learning and balancing your mood, but this is not 100% understood! Although some of the signals sent to the cortex during sleep are important for learning and memory, some could be random. These random signals that occur may for the basis for a “story” that the brain tries to understand, resulting in dreaming. Why Memory Foam Pillows? Having a comfortable mattress and a supportive pillow can completely change the way that you sleep. Being supported helps to relieve pressure points in your neck & spine. If you are using an unsupportive pillow during sleep, it could cause a series of pains, including neck ache & backache. When you’re supported and comfortable during the night, it significantly decreases disruption of sleep throughout the night, making for a much more rejuvenating night sleep. Learn more about getting a better night sleep: Leave a Reply
The Remainder of the Islamic Army are on the Move to Uhud Article translated to : العربية with the remainder of fighters, the messenger of allâh [pbuh] moved towards the enemy. after the rebellion and withdrawal of the hypocrites, the number of soldiers was reduced to seven hundred only. the camp of idolaters was situated in such a place that the many roads leading to uhud were almost blocked by them. so the messenger of allâh [pbuh] said to his men: "which man of you can lead us to where the people (i.e. the idolaters) are, along a short track that does not pass by them?" abu khaithama said: "o messenger of allâh [pbuh], i am the man you need." then he chose a short track that led to uhud passing by harrah bani harithah and their farms, leaving the idolaters’ army westwards. on their way they passed by ha’it (i.e. the field) of marba‘ bin qaizi, who was a blind hypocrite. when marba‘ felt and realized that they were the prophetic army, he started throwing earth at their faces, so they rushed to kill him, but the prophet [pbuh] said: "do not kill him. he is blind in heart and eyes." the messenger of allâh [pbuh] went along till climbed down the hillock of uhud at the slope of the valley. he camped there with his army facing madinah while their backs were to the hills of uhud mountain. so the army of the enemy stood a barrier between the muslims and madinah. Previous article Next article
Sociology Is The Study Of Society Sociology Essay Essay essay B Get Full Essay Get Access What is sociology? By and large, sociology is the survey of society and the forms that exist between persons. Harmonizing to Auguste Comte ( male parent of sociology ) defines sociology as the scienceA of societal phenomena “ capable to natural and invariable Torahs, theA discoveryA of which is the object of probe ” . There are many other sociologists who give their position on sociology such as Emile Durkheim, Max Webber, Jane Addams, and Herbert Spencer and so on and so forth. The sociological theory is the theoretical paradigm ( cardinal premises that guides believing ) which makes usage of three schools of ideas -structural-functionalism ; social-conflict and symbolic-interaction. Harmonizing to structural-functionalism or functionalism, it is the model for constructing theory that views society as a composite system which means the parts work together to advance solidarity and stableness. The structural functionalism undertakings its cardinal elements, societal construction that refers to any comparatively stable forms of societal behavior found in societal establishments ( in the position of instruction, political relations, faiths and households ) and societal map, the effects of a societal form for the operation ( construction ) of society as a whole. The laminitis of structural functionalism is Emile Durkheim. Each portion of a society which means its part to the stableness of the whole society is interpreted by this school of idea. In order to accomplish the stableness of the whole society, each and every portion of the society is functional to acquire it done. Each of the portion is organized to carry through different demands and its function to organize and determining the society are known as the different parts of the establishments of society. The parts are comparatively depending on one another. The concentration on societal stableness and the sharing of public values are done by holding the consensus and this method is chiefly emphasized by structural functionalism. From this angle of position, alteration in the system by disorganisation will go on and in order to get the better of it, each of the social constituents must make its accommodation to accomplish system ‘s stableness. If one portion is dysfunctional, the other parts besides be affected and this will take to societal alteration finally. In general, structural functionalism sees the society as an interconnected portion that works together to bring forth a stable system while taking count its maps and disfunctions. Structural functionalism paradigm can be found everyplace. One of them is in a school ( society ) , primary, secondary or third leveled. In order to organize a stable system, the principal, instructors and the pupils ( the society members ) must work together. The instruction system and the stable system will be affected if even one of the portion failed to work decently or disfunction. Human society besides depends on this system every bit good. Norms, traditions, linguistic communication ( the parts of society ) must be acknowledged to forestall the disfunction from happening in the community. Therefore, even the disfunction must non be neglected and taken into history to make a stable system. Symbolic Interact Symbolic interaction positions society as the merchandise of mundane interactions of persons. It emphasize society is a complex, ever-changing mosaic ( pieces of mystifier ) of subjective significances and it is a shared world that people construct as they interact with one another. Max Weber ( stresses that symbolic interactions is the understanding a scene from the people in it ) , on the other manus, induction of a bigger survey on the belief of faith is done around the universe. Ancient Judaism, Christianity, Hinduism, Buddhism, and Taoism surveies are done by him. InA The Protestant Ethic and the Spirit of CapitalismA ( 1904/1958 ) , his analysis and reading is on the impact of Christianity on Western thought and civilization ( the societal alterations ) . In symbolic interactionism, faith by itself is aA symbol, but as this theory focuses on micro degree, the division of faith is into many sets and the subsets of smaller symbols and on single interactions in one another ‘s presence. The Supreme beings are viewed as Godheads of the universe ; therefore they have the power to govern the universe and do the procedure of honoring and penalizing those who behave decently and those who break the regulations. Social Conflict theory Social struggle theory, the 3rd theoretical position, offers a position of societal life as the changeless battle between categories, societal groups, and persons for power and resources on the macro degree. The thought of this position is the struggle in human society viing with each other chiefly for resources or power. In malice of, this elements are ever limited which consequence on lose of a peculiar group and benefits the full component for another group. The term dominant group versus disadvantaged group normally rises in this struggle in which the disadvantaged group will certainly be manipulated by an advantaged group and finally causes the field of inequality to happen. Social inequality such as, race, age, category, position and sex are some field of inequality and the chief attack presents are gender-conflict and race-conflict. Gender-conflict focal points inequality between work forces and adult females while race-conflict focal points between racial and cultural of people or classs. Karl Marx is a sociologist who focuses on the importance of societal category in inequality and societal struggle. Based on thoughts originally proposed by Karl Marx ( 1818-1883 ) . Marx believed that economic power led to political power. This is the key to understanding societies.The battle for economic power means that society is non inactive but ever-changing – societal alteration is the consequence of a alteration made to the economic system.Therefore, if we want to understand society, we must understand the economic system in topographic point Neo-Marxists believe the economic system creates a rich category of proprietors and a hapless category of workers. Case survey to explicate / luxuriant each of position associated with each school of ideas. Structural Functionalism I have found a instance survey related on structural functionalism theory from Emile Durkheim. I chose a company either in smaller or larger graduated table ( society ) is a portion of a system and plays a critical function as a portion of society by holding its ain direction. The company has its ain map such provide a on the job topographic point for the people and contribute to the state ‘s income finally. For illustration, the income of the company and state ‘s income will be affected if the board of managers of the peculiar company are non executing their undertaking or occupation decently or in other word disfunctions, and it becomes worst when the company itself ignores this affair. As harmonizing to the functionalist theory, every portion is connected and need to work together to organize a stable system but it will non be successful when the company ‘s status is like this… In order to forestall this type of things from go oning, every person is responsible for its ain map and disfunctions in order to organize a stable system. I found a instance survey on social-conflict that is divorce. Divorce is the cancelling of matrimonial position, official duties and the bond of marriage between both male and female parties. Why some of matrimonies failed and finally take to disassociate? A struggle theory can be created here. In a household, the male refers to the user while the female refers to be the exploited ( feminist theory ) . Divorce can go on if the female ‘s privilege is disturbed when the male ne’er to give importance to her. For illustration, when a adult male abuses his married woman, the married woman can take determination that she can stop her relationship with her hubby who disrespects her self-respect and rights if there is no other manner. Symbolic Interactions I found a instance survey on symbolic interactions in the angle of instruction. It is greatly intersected with symbolic interaction as a psychological position. The latter determines human workss harmonizing to the significance of the things or people they approach. For illustration, if a immature miss finds out that a male child whom she is in love with takes an active portion in, allow ‘s state, cross-cultural nine she will most likely mark up for it excessively. Obviously, it means that her chief want is to be closer to him and go an apple of his oculus. The same happens in instruction every bit good when a pupil establishes his /her precedences refering the categories he /she are supposed to take. Symbolic interaction here plays a cardinal function as the pupil will likely stress categories either necessary for his hereafter calling ( personal involvement ) or to do the agenda more convenient ( societal aim ) .It would be appropriate to advert that instruction systems vary from civilization to civilization. This fact has likely originated from the historical procedure during which cultural values and traditional positions were being created. Therefore, the 3rd universe states are characterized by wholly different instruction system. They start school at the age of 7 and alumnus from high school when they are 19-year-old immature grownups. Get instant access to all materials Become a Member
Learn How Goal Setting Affects Your Brain There are dozens of articles on goal setting as a tool for getting ahead in business. Goal setters seem more organized and achieve more in the workplace. Employers look for the goal-setting motivated employee. Goal setters seem to have it together more than the rest of us. But did you know there is scientific research that shows that goal-setting improves higher brain function? Here’s what the science says about goal setting and your brain. Setting Goals Rewires Your Brain’s Effectiveness Goal setting is powerful. It can motivate people to build for the future and accomplish tasks they might not have thought they could. What’s puzzling is why some people seem to drift through live aimlessly and why others set and achieve goals. Top-level achievers in all industries set goals that they often achieve. How are they able to pull it all off? A study in Behavioral and Cognitive Neuroscience Reviews proves what we’ve known all along; people that set goals are generally more together than everyone else. That’s because goal setting rewires our brains to make the component parts work more effectively. The study showed that when you set a goal, multiple parts of the brain are suddenly engaged: • The amygdala, which is the brain’s emotional center, evaluates the goal for how important it is to you. • The frontal lobe, which is the brain’s logical problem-solving portion, defines the goal and digests it. • Both the amygdala and the frontal lobe then work together to push you toward the completion of the goal. As the brain moves you into situations to help you achieve your goal, the organ changes in structure to help you optimize behaviors and tasks. Another study, this time with multiple sclerosis patients from the University of Texas, showed that MS symptoms lessened when goals were set and achieved. The symptoms of MS included severe fatigue, speech impairment, loss of muscular coordination, and numbness. These symptoms were lessened when patients set goals. Inc. reported on another study, this time in the Journal of Applied Psychology that found people who established an ambitious goal usually achieved it. People who created a simpler goal failed to achieve it. The study suggested ambitious goals stimulate the brain more, motivating the person to accomplish the impossible. The study found the higher the goal, the more likely you would achieve it. The Psychological Bulletin said 90% of the studies showed that more challenging goals led to higher performance. More manageable goals, “do your best” goals, or no goals did not have the same effect on the brain, or the person’s ability to achieve their goals. The article reported, “Goal setting is most likely to improve task performance when the goals are specific and sufficiently challenging. Ironically, it should be noted that these studies suggested the brain rewiring must occur when the individual sets the goal. The brain doesn’t change when your boss or coworker sets the goal for you. Inc. reports, “All a leader can do is have ambitious, challenging goals for themselves in the hope it will inspire others to do the same.” If you need assistance with your career goals, contact the staffing professionals at Top Stack today. 0 replies Leave a Reply Want to join the discussion? Feel free to contribute! Leave a Reply
Museums and Landmarks Forest Capital Museum State Park The importance of forestry in Florida dates back to the early 1800s. The museum celebrates the heritage of Florida’s forest industry. The heart of the museum is dedicated to longleaf pines and the 5,000 products manufactured from them. The 50-plus-year-old longleaf pines growing on the museum grounds provide a majestic canopy and create an enjoyable walking trail for visitors. Upon exiting the museum, visitors take a step back in time to explore an authentic 19th century Cracker homestead, much like those scattered throughout Florida at the turn of the century.
The Nazi Officer’s Wife: How One Jewish Woman Survived The Holocaust 1517 words - 7 pages The Nazi Officer’s Wife: How One Jewish Woman Survived the Holocaust Edith Hahn Beer who was born in 1914 wrote The Nazi Officer’s Wife, a memoir about her life and difficulties of survival during the reign of Adolf Hitler. Edith goes through her life day by day explaining the constant fear she lived in. Edith’s biggest nightmare during this entire thing was her true identity being revealed and losing it at the same time. Even though there was a grave amount of risk for Edith’s life she made sure she kept record of her survival. She saved all the papers she had gotten from her lost love, Pepi and all the photographs she somehow managed to take while she was in the labor camps. After ...view middle of the document... The five years of law school and the law career she had been dreaming about went out the door because she was a Jew and was no longer welcome. After her two younger sisters decided to become Zionists, Edith and her mother became registered and was forced to wear a Jewish cross on their clothes at all times. Edith was separated from her mothers and was sent to two different labor camps where she stayed and was forced to work. Although Edith was terrified that someone would know her true Jewish identity she made sure she guarded her every move to make sure her new identity was still hidden. Grete was known as the perfect German woman who worked for the Red Cross is Munich, Germany. When Grete falls in love with a member of the Nazi party, she never really went back to being Edith but she surprisingly became better at becoming Grete. Grete fell in love with Werner Vetter. Grete love Werner and prized the time she got to spend with him, but when things became serious and when Werner asked her to marry him she was very unsure with what she wanted to do. Edith knew sooner or later she had to tell Werner her secret before she said ‘yes’ to his proposal. Edith had fully trusted Werner and wanted him to know the full truth. Before you knew is she stood up and whispered in his ear saying she was Jewish. At this point Edith was a lone Jew that was surrounded in Nazi Germany pretending to be an Aryan. After admitting to being Jewish Werner said he would protect her. When Edith and Werner began to live together they never talked about Edith’s past and they both fully began to believe that she was Grete Denner and not Edith Hahn. Edith always wanted to have a child of her own and didn’t want to wait much longer when she became older. Although Werner said he did not want to be a father to a Jewish child Edith soon persuaded him into becoming a father. Edith still had the dream of seeing her family again but she had accepted the fact that she would probably never see them again. Edith wanted to go back to Vienna and see some familiar faces and wanted to catch up on peoples live she was afraid of losing herself. Edith loved the life she had with Werner, but she began to feel it all slip away. For example, when she was working at the Red Cross she remembered women coming in to have children and being put under anesthesia and letting things slip out without and recollection of it happening. When Edith went into labor, she suffered through the pain of natural birth to protect herself and she gave birth to a healthy baby named Angela. Edith always knew she was Jewish, but she wondered if Angela would ever be able to experience that. As a little girl Edith was never taught the hardcore traditional ways of Jewish people and now more than ever she feels less like a Jew. The Nazi’s were losing the war and began to get bombed on a daily basis. Werner, who at this time has one blind eye got drafted to fight as was sent to the Russian front. Before Werner left, he... Other Essays Like The Nazi Officer’s Wife: How One Jewish Woman Survived the Holocaust The Holocaust Essay 1406 words - 6 pages attack on the Jews finally came to an end by 1945, after being liberated by the Allied forces of World War Two. Therefore, it can be concluded that the reality of the Holocaust was inevitable. Throughout history, if one religious group has been criticized or hated the most, it has been the Jewish faith. This hatred has been deeply rooted into society. Hitler, therefore, conveniently used Jews as scapegoats to explain German downfall. German Worldcom’s Chief Executive Officer’s Failure of Responsibilities Reshaping the Business Environment 1491 words - 6 pages Running head: WORLDCOM FAILURE RESHAPING BUSINESS WorldCom’s Chief Executive Officer’s Failure of Responsibilities Reshaping the Business Environment WorldCom’s Chief Executive Officer’s Failure of Responsibilities Reshaping Business Environment Bernie Ebbers’ leadership as Chief Executive Officer for WorldCom created the largest telecommunication bankruptcies and the largest bankruptcy in the corporate world. His unethical The Jewish War 3278 words - 14 pages spent in warfare, whether with Demetrius II of Syria or with Jews. It was Alexander, who was responsible for the crucifixion of over 800 Jewish men in Jerusalem, and the butchering of their wives and children.[8] When Alexander died in 78 B.C., at the age of 27, he bestowed the kingdom to his wife, Alexandra. Although Alexandra was an austere ruler, she was popular for her piety and had won the affection of the general population.[9 The Holocaust - Essay 5 958 words - 4 pages one judge and one alternate judge from each of the signatory nations. The conclusion of the trials were as followed. Twelve Nazi leaders were executed. Three were sentenced to life in prison, and four others received various prison terms. On October 16, the twelve Nazi leaders sentenced to death, were executed. The number of people killed in the Holocaust has been to be known around 11,000,000. Not all of them were Jewish though. The total Women in the Holocaust 1333 words - 6 pages perpetrators and victims. During this terrible time period, both the Jewish women and their German perpetrators faced experiences and situations that were different from their male counterparts. As the Nazis came to power, there were significant changes to the lives of all women. Though facing exceedingly different situations from one another, both the Jewish and Nazi women were pigeonholed into following men, being viewed as the inferior gender, and History of the Holocaust 1258 words - 6 pages component of modern day anti Semitism. Know as Social Darwinism, a theory put forth by Charles Darwin that various types of life survived by adapting to the changing environment. This theory was later revised to include that not the fittest but the strongest not only would, but also should survive. It was concluded from this theory that protecting the weak and poor of society actually went against the nature’s laws. The Jewish people were doomed to become weak and poor by way, in part, of the socialist views of the times. These views on the Jewish peoples would continue to be revised until the ultimate horror, the Holocaust, would be realized. Understanding The Holocaust 582 words - 3 pages . Each of the many resources available to us can provide information on what the Holocaust was in terms of facts and statistics, and probably as effectively as being there could. Nevertheless, the average USC student will still be missing the human factor, what would you feel like being a Jew living under the Nazi regime. When trying to understand what was experienced by a person in a particular situation, you must be able to draw on knowledge Badges Of The Holocaust 767 words - 4 pages conformity with the governmental rulership at that time (fascism). Ranges of attempts were made to isolate people and to use fear to inhibit "undesirable" behavior. Whatever the reasons for imprisonment, all incarcerations were the result of Nazi ideology and posed a danger to the prisoner's life. The categories of prisoners differed from one another in how they were selected and treated. Those groups whom the Nazis deemed inimical but not racially Story of the Holocaust 516 words - 3 pages Story of the Holocaust The holocaust was the effort of Adolf Hitler and the Nazi party in Germany to exterminate the Jews and other people that they considered to be inferior. As a result about twelve million people, about half of them Jews, were murdered. The murders were done by every means imaginable but most of the victims perished as a result of shooting, starvation, disease and poison gas. Others were Children of the Holocaust 1387 words - 6 pages about 6 million Jewish men, women, and children. There were about 1.6 million Jewish children consisting from infants to teens living in Europe around the start of World War 2. Only about 11 percent of this range of children made it through the war. A lot of the parents chose to hide their children so they would have a better chance of surviving. The Jewish children were extremely discriminated against and were terribly affected by the Holocaust Children of the Holocaust 1378 words - 6 pages Memorial Museum 2/6/2012 Shalom Robinson, M.D., Michal Rapaport-Bar-Sever, Judith Rapaport. “Echoes of the Holocaust.”, July 1997, Issue #5, (pg. 3 of 3) 2/6/2010 “Holocaust.” 2/6/2012 s hard to understand why they were so hated and so easily kilt. No matter how they died they were still one of the worst victims of the Holocaust in my eyes Related Papers The Holocaust: How It Was Carried Off 1508 words - 7 pages policy of racial expulsion when the Jew's were forced to leave Germany.The Nazi regime spent about eight years in power before they began murdering the Jews. When the Nazi's first came into power in the early 1930's, distributed propaganda that mocked the Jewish people. One well-known piece of propaganda depicted the Jewish ritual slaughter as being extremely cruel to animals . Soon afterwards, the Nazi's took over all forms of media so that the Questions Raised About The Holocaust And Nazi Germany In Schindler's Gift The Holocaust Essay 3468 words - 14 pages limiting the number of Jewish children allowed in public schools. On September 29th, Jews were banned from cultural and entertainment activities. In October, Jews were prohibited from being journalists or running newspapers. German newspapers were either shut down or under Nazi control. Soon it would be forbidden for a Jew to occupy a park bench with a non Jew, let alone marry one. Within days of Hitler’s taking control, Germany became a The Holocaust Essay