text stringlengths 12 4.76M | timestamp stringlengths 26 26 | url stringlengths 32 32 |
|---|---|---|
In The
Court of Appeals
Ninth District of Texas at Beaumont
___________________
NO. 09-14-00447-CR
NO. 09-14-00448-CR
NO. 09-14-00449-CR
NO. 09-14-00450-CR
NO. 09-14-00451-CR
___________________
JAMES ARTHUR SHANE III, Appellant
V.
THE STATE OF TEXAS, Appellee
__________________________________________________________________
On Appeal from the 410th District Court
Montgomery County, Texas
Trial Cause Nos. 14-05-05425 CR (Count I), 14-05-05425 CR (Count II),
14-05-05425 CR (Count III), 14-05-05425 CR (Count IV),
14-05-05425 CR (Count V)
__________________________________________________________________
MEMORANDUM OPINION
Appellant James Arthur Shane, III was charged by indictment with two
counts of intoxication assault, possession of prohibited weapons, possession of a
controlled substance, and unlawful possession of a firearm by a felon. Shane
entered into a plea agreement with the State wherein the State recommended a
1
punishment cap of twenty years imprisonment. Shane entered a plea of guilty to
each charge. Shane also pleaded true to one enhancement paragraph alleging a
prior felony conviction, and the trial court found the enhancement true.
The trial court found Shane guilty of both counts of intoxication assault and
sentenced Shane to sixteen years’ confinement for each conviction. The trial court
found Shane guilty of the offense of possession of a prohibited weapon and
sentenced Shane to ten years’ confinement. The trial court also found Shane guilty
of the offense of unlawful possession of a firearm by a felon and sentenced him to
ten years’ confinement. The trial court ordered Shane’s sentences to run
concurrently.
The trial court found the evidence sufficient to support a finding of guilt to
the charge of possession of a controlled substance but withheld that finding and
placed Shane on deferred adjudication community supervision for ten years. Shane
filed notices of appeal for each case. 1
Shane’s appellate counsel filed an Anders brief. See Anders v. California,
386 U.S. 738 (1967); High v. State, 573 S.W.2d 807 (Tex. Crim. App. [Panel Op.]
1978). Counsel’s brief presents his professional evaluation of the record and
concludes there are no arguable grounds to be advanced in this appeal. Counsel
1
Shane submitted separate briefs for each cause. Because the issues brought
forward in each case are the same, we dispose of all appeals in a single opinion.
2
provided Shane with a copy of this brief. We advised Shane of his right to file a
pro se response, but we received no response from Shane.
We have reviewed the appellate record and conclude that we lack
jurisdiction over Shane’s appeals. The trial court’s certification states that this is
not a plea-bargain case, but the record reflects otherwise. The reporter’s record
shows that the State recommended punishment be capped at twenty years
imprisonment for each charge made against Shane in exchange for Shane’s
agreement to enter a plea of guilty to each charge. The trial court assessed
punishment in accordance with the cap recommended by the State.
Rule 25.2 of the Texas Rules of Appellate Procedure provides that a
defendant in a plea-bargain case may appeal only “those matters that were raised
by written motion filed and ruled on before trial,” or “after getting the trial court’s
permission to appeal.” Tex. R. App. P. 25.2(a)(2). Rule 25.2 defines a plea bargain
case as “a case in which a defendant’s plea was guilty or nolo contendere and the
punishment did not exceed the punishment recommended by the prosecutor and
agreed to by the defendant[.]” Id. Thus, an agreement to a punishment cap is a plea
agreement within the meaning of Rule 25.2. See Tex. R. App. P. 25.2(a)(2);
Shankle v. State, 119 S.W.3d 808, 813 (Tex. Crim. App. 2003) (en banc); Lemoins
v. State, 37 S.W.3d 556, 557-59 (Tex. App.—Beaumont 2001, no pet.). After
3
reviewing the appellate record, we conclude that the trial court’s certifications do
not accurately reflect the trial court proceedings.
Because the certification is contrary to the record, it is defective. See Dears
v. State, 154 S.W.3d 610, 614 (Tex. Crim. App. 2005) (holding that a certification
is defective if it is correct in form but “when compared with the record before the
court, proves to be inaccurate”); see also Saldana v. State, 161 S.W.3d 763, 764
(Tex. App.—Beaumont 2005, no pet.) (“Despite the trial court’s certification, the
Rule 25.2 requirements recited in a certification must be true and supported by the
record.”). There is nothing in the record to support a finding that Shane filed any
written pretrial motions that could be appealed, or that he otherwise received the
trial court’s permission to appeal from a plea bargain. Therefore, Shane did not
have the right to appeal his convictions. Accordingly, we dismiss these appeals for
lack of jurisdiction. See Tex. R. App. P. 25.2(a)(2); see also Chavez v. State, 183
S.W.3d 675, 680 (Tex. Crim. App. 2006) (en banc).
DISMISSED FOR WANT OF JURISDICTION.
_____________________________
CHARLES KREGER
Justice
4
Submitted on June 12, 2015
Opinion Delivered August 26, 2015
Do Not Publish
Before McKeithen, C.J., Kreger, and Johnson, JJ.
5
| 2024-05-29T01:27:15.642919 | https://example.com/article/9882 |
WASHINGTON (Reuters) - The United States “strongly supports” Israel’s right to defend itself, the State Department spokeswoman said on Saturday, after Israel said it struck 12 Iranian and Syrian targets in Syria, including Syrian air defence systems.
“The United States is deeply concerned about today’s escalation of violence over Israel’s border and strongly supports Israel’s sovereign right to defend itself,” said State Department spokeswoman Heather Nauert. “Iran’s calculated escalation of threat and its ambition to project its power and dominance, places all the people of the region - from Yemen to Lebanon - at risk.” | 2023-10-23T01:27:15.642919 | https://example.com/article/9230 |
Galaxy4D is a Single/Multiplayer space simulator featuring real space physics, spaceship crafting and a full-size galaxy with more than 100 billion star systems, each with hundreds of planets and moons that you can land and walk on.
We believe in a virtual world where you are not limited by anything, and that taking shortcuts and fake stuff is NOT an option !
A gameplay needs to be seamless and totally immersive.
We believe in WYSIWYP (What you see is what you play).
Everything needs to be real. Ohh God do we hate skyboxes !!
The media you are trying to view has been deleted and is no longer available. This may have occurred at the uploaders request, or it may have occurred because it violated the sites Terms of Use. If this is a mistake and you would like it re-activated, please contact us with the details. | 2024-06-18T01:27:15.642919 | https://example.com/article/7597 |
Vegas Sports Masters
Submitted by Richie Baccellieri
on Thursday, September 6, 2018 at 2:00 PM
Before we take a look at the biggest TV games on Saturday, let’s start with the important line movement in Thursday night’s NFL season opener matching the Atlanta Falcons and Philadelphia Eagles. I delayed release of this report on Thursday because some stores had made the Falcons a favorite!
THURSDAY NFL
ATLANTA AT PHILADELPHIA: This game sat on Philadelphia -4 or -3.5. all summer. When it was confirmed Carson Wentz wouldn’t be able to return…on the heels of a dismal preseason performance for the Eagles…the line dropped through the key number of three all the way to Philly -2. That’s a HUGE move in the NFL because the three is so important. Late Wednesday we started seeing Philly -1 painted. Thursday morning pick-em was more common, with even the occasional Atlanta -1 popping up. Obviously sharps (professional bettors) like Atlanta getting two or better. The public has also jumped on this bandwagon. Hard to find real enthusiasm for Philadelphia at pick-em. Some shows at +1. The Over/Under is down from 46.5 to 44.5. Quants apparently like Under 45 or higher. No buyback yet on the Over.
Now to Saturday’s most high-profile college games. These go in rotation order.
SATURDAY
MISSISSIPPI STATE AT KANSAS STATE: An early opener of Mississippi State -7 was bet up to as high as -9 or 9.5. Kansas State interest has started to show late in the week, causing some stores to drop to -8. The Wildcats looked awful last week in a close home win over South Dakota. Mississippi State was one of many SEC teams to win a blowout over a doormat. Old school sharps couldn’t resist a home dog with a respected coach after it became clear +10 wasn’t going to come into play.
ARIZONA AT HOUSTON: Respect for Arizona has fallen a lot. Sharps bet against them hard last week with BYU, and won outright easily. Here, Houston opened at -3.5…and was bet away from the key number of three up to -4. That’s what I’m seeing now. A big indictment of Arizona. But, not any support for the Cougars at the four.
GEORGIA AT SOUTH CAROLINA: An opener of Georgia -9 was bet up to the key number of -10. We didn’t see dog interest at that line, which is telling. Looks like most sharps made the game ten and were happy to get a great team like Georgia just below that. We probably won’t see old school dog lovers come in until +10.5 or +11 becomes available (if it does). Squares (the public) usually love highly ranked favorites. That could push this line higher on game day. Early sharp money wanted to get in before the public.
COLORADO AT NEBRASKA: I decided to take UCLA/Oklahoma off my list because that point spread is higher than four touchdowns. I put this one on the list because so many sharps are interested to see what impact new head coach Scott Frost has at Nebraska this season. They’re not supporting him yet. This opener of Nebraska -4 is down to -3.5 in some spots. Looks like some sharps like the dog at +4, and the public is leaving the game alone for the time being. I would expect the public and many sharps to take Nebraska -3 if that becomes available.
CLEMSON AT TEXAS A&M: An opener of Clemson -11 is up to -12 or -12.5, which is something because Texas A&M is from the SEC, and that conference is coming off a fantastic week. Sharps liked Clemson at -11 on the road at a loud site vs. a talented home dog! That’s a lot of important respect for Clemson. Home dog lovers have a lot of options this week. They’re hoping for +13, but may settle for +12.5 if that’s going to be the apex.
KENTUCKY AT FLORIDA: Not much happening off the opener of Florida -14. Some stores are testing -13.5…which tells you only Kentucky money was hitting the board at two touchdowns. Public doesn’t trust the Gators at high prices yet given woes of the past few seasons. Sharp dog lovers decided +14.5 wasn’t going to be, and started coming in at +14.
PENN STATE AT PITTSBURGH: An opener of Penn State -9 has come down to -8.5. Notice the difference between this and Clemson. Sharps loved Clemson at -11 even against a dangerous home dog. They didn’t like Penn State at a lower price. Nittany Lions didn’t impress vs. Appalachian State last week.
USC AT STANFORD: A lot of love from sharps for Stanford. An opener of -4 has been bet all the way up to -6. That’s a secondary key number (two field goals), and serious USC interest hasn’t been showing up yet when the six is on the board. Maybe that will change. As of right now, sharps like Stanford at -5.5 or lower. Los Angeles-based money may not hit the board until Friday and Saturday when visitors arrive.
CALIFORNIA AT BYU: Looks like a tug-of-war developing between BYU -2.5 and California +3. Bettors who won with BYU at Arizona last week like laying less than a field goal at home. But, when the line is sitting on a field goal, important money hits Cal. Not a big game in the rankings…but could be a great battle to watch. BYU always gets up for Pac 12 teams.
MICHIGAN STATE AT ARIZONA STATE: Michigan State has been bet up from -4 to -6. There is an extra day of rest here. Though, MSU didn’t impress in a late, close win over Utah State as a big favorite last week. Arizona State blasted UTSA, which might not mean much. The quants in particular are betting Sparty. There should be some upsets this week. It’s the job of bettors to figure out who those live dogs are going to be.
I’ll post my best shots for customers. You can always purchase daily BEST BETS right here at the website with your credit card. If you have any questions call the VSM office at 1-888-777-4155. Be sure to ask about long term or combination packages that offer the best value.
Thanks for reading. I’ll be back with you Friday afternoon to look at how sharps have been betting Sunday and Monday NFL. | 2024-01-05T01:27:15.642919 | https://example.com/article/5978 |
761 S.W.2d 63 (1988)
ADAMS RESOURCES EXPLORATION CORPORATION, Appellant,
v.
RESOURCE DRILLING, INC., Appellee.
No. B14-87-770-CV.
Court of Appeals of Texas, Houston (14th Dist.).
October 20, 1988.
Rehearing Denied November 10, 1988.
Michael E. Warrick, Houston, for appellant.
Reagan Wm. Simpson, Scott Rothenberg, Houston, for appellee.
Before PAUL PRESSLER, DRAUGHN and ELLIS, JJ.
OPINION
PRESSLER, Justice.
The trial court granted a Summary Judgment by holding that the indemnity provisions in a contract between the parties were unenforceable. We reverse and remand for further proceedings consistent with this opinion.
In 1984 appellant contracted with appellee to do work on a well. The contract included a provision under which the contractor (appellee herein) would indemnify appellant, for the following: *64... all claims, demands, and causes of action of every kind and character, without limit and without regard to the cause or causes thereof or the negligence of any party or parties, arising in connection herewith in favor of Contractor's employees or Contractor's subcontractors or their employees, or Contractor's invitees, on account of bodily injury, death or damage to property.
An employee of appellee was injured on the job and brought suit. One of the named defendants brought a third party action against appellant for contribution and indemnity. Appellant then filed a third party action against appellee for indemnification under the contract. The trial court granted appellee's Motion for Summary Judgment holding the indemnification clause unenforceable because it failed to satisfy the express negligence doctrine. The third party action against appellee was severed from the original cause. The only point of error contests the granting of the Summary Judgment.
In Ethyl Corp. v. Daniel Construction Co., 725 S.W.2d 705 (Tex.1987) the Texas Supreme Court substituted an express negligence test in cases, such as this one, involving contractual indemnity in the place of the previous test which was that the wording of the contract be clear and unequivocal. The court held as follows:
The express negligence doctrine provides that parties seeking to indemnify the consequences of its own negligence must express that intent in specific terms. Under the doctrine of express negligence, the intent of the parties must be specifically stated within the four corners of the contract. Ethyl Corp. at 708.
The exact wording of each indemnity provision must be evaluated on a case to case basis to determine its validity. Indemnity clauses should be upheld where the parties' intention is specifically set forth by the language of the contract.
In Ethyl, the court held the language of that contract was unenforceable. It read as follows:
Contractor shall indemnify and hold Owner harmless against any loss or damage to persons or property as a result of operations growing out of the performance of this contract and caused by the negligence or carelessness of Contractor, Contractor's employees, Subcontractors and agents or licensees.
In the lawsuit Ethyl attempted to have Daniel indemnify Ethyl for it's own negligence. The contract, however, stated that the indemnity provision would cover the negligence of the contractor, not the owner. The language Ethyl was attempting to use was simply not in the contract. In the case before us, the parties cite language which is indeed in the contract. Therefore, it must be assumed that the parties intended that it be there and be enforced.
The clauses at issue are as follows:
14.8 Contractor's Indemnification of Operator: Contractor agrees to protect, defend, indemnify, and save operator, its officers, directors, employees and joint owners harmless from and against all claims, demands, and causes of action of every kind and character, without limit and without regard to the cause or causes thereof or the negligence of any party or parties, arising in connection herewith in favor of Contractor's employees or Contractor's subcontractors or their employees, or Contractor's invitees, on account of bodily injury, death or damage to property....
14.13 Indemnity obligation: Except as otherwise expressly limited herein, it is the intent of parties hereto that all indemnity obligations and/or liabilities assumed by such parties under terms of this Contract, including, without limitation, paragraphs 14.1 through 14.12 hereof, be without limit and without regard to the cause or causes hereof (including pre-existing conditions), the unseaworthiness of any vessel or vessels, strict liability, or the negligence of any party or parties, whether such negligence be sole, joint or concurrent, active or passive. The terms and provisions of paragraphs 14.1 through 14.12 shall have no application to claims or causes of action asserted against Operator or Contractor by *65 reason of any agreement of indemnity with a person or entity not a party hereto.
To be enforceable three elements must exist: (1) The intent of the parties must be clear; (2) it must be set forth within the four corners of the agreement; and (3) the specific intent of the parties must be expressed.
Here the intent of the parties is clear. It is expressed in the agreement. The clause specifically asserts that it covers the negligence of both parties.
In Gulf Coast Masonry, Inc. v. Owens-Illinois, Inc., 739 S.W.2d 239 (Tex.1987), the Texas Supreme Court held the indemnity provision failed to meet the requirements of the express negligence doctrine. That contract provided:
Contractor agrees to indemnify and save owner harmless from any and all loss sustained by owner by reason of damage to owner's property or operations, and from any liability or expense on account of property damage or personal injury sustained by any person or persons, including but not limited to employees of owner, contractor and subcontractors, arising out of or in any way connected with or attributable to the performance or nonperformance of work here under (sic) by contractor, its subcontractors and their respective employees and agents, or by any act or omission of contractor, its subcontractors, and agents while on owner's premises, or by defects in material or equipment furnished hereunder ...
Since this clause of the agreement does not make reference to negligence, it was not specific and failed the express negligence test. Likewise, the Court in Singleton v. Crown Central Petroleum Corp., 729 S.W.2d 690 (Tex.1987) struck down a broadly worded indemnity provision because it did not specifically state that there was indemnity for concurrent negligence. The provisions that have been held unenforceable have either not specifically mentioned negligence or have not properly set forth the extent of coverage which would be applied.
In B-F-W Construction Co., Inc. v. Garza, 748 S.W.2d 611 (Tex.App.Fort Worth 1988), the Court of Appeals found the contract met the requirements of the express negligence doctrine. The contract there stated merely, that indemnity would apply "... regardless of cause or any fault or negligence of Contractor ..." The clause before us is even more specific. It states that it applies to negligence whether it is sole, joint or concurrent, active or passive [section 14.13]. The intent of the parties is specific.
This identical indemnity provision was upheld in DuPont v. TXO Production Corp., 663 F.Supp. 56 (E.D.Tex. 1987). As in DuPont, this provision meets the requirements of the express negligence test. It states that the intent of the parties was for the contractor to indemnify the operator for any accident for which appellant was found liable. DuPont 663 F.Supp. at 58. Here there is a possibility that Adams Resources could be found negligent. If Adams Resources was found to be negligent, Resource Drilling would be required to indemnify it.
Appellee claims that the contract is not specific because it is not clear who is to indemnify whom. The heading of the provision is "Contractor's Indemnification of Operator." This is clear. It provides that the contractor indemnifies the operator for claims or losses from injuries to appellee's employees. The provision is cited above. Appellee asserts that the words "party" and "parties" used therein are too broad to meet the specificity requirement of the express negligence test. The provision states, "... it is the intent of parties hereto that all indemnity obligations and/or liabilities assumed by such parties ..." [Section 14.13 emphasis added]. The meaning is apparent and is not too broad. Appellant and appellee were the only parties to the contract. These terms are commonly used in present day contracts and their meaning is well established.
Both parties are professionals in their fields and employ highly experienced personnel who understand the importance of the wording of a contract. The contracting *66 parties were in similar bargaining positions. They were legally competent to enter into this agreement, and it should be binding upon them.
The opinion of the trial court is reversed and remanded for proceedings consistent with this opinion.
| 2024-05-30T01:27:15.642919 | https://example.com/article/2946 |
Explore
Find the perfect place from the worlds best selection of vacation rentals on VRBO.
Book
Safer and more secure when you pay and book online through VRBO.
Enjoy
Enjoy more space and more privacy of an entire vacation home.
Where to stay around Great Barrington, MA?
Our 2018 property listings offer a large selection of 501 vacation rentals near Great Barrington. From 324 Houses to 66 Cabins, find a unique house rental for you to enjoy a memorable stay with your family and friends. The best places to stay near Great Barrington for a holiday or a weekend are on VRBO.
What is the best area to stay when traveling to Great Barrington?
Whether you're traveling with family or friends, here are the areas with the largest selection of vacation rentals for a holiday trip or just for a weekend in Great Barrington:
Housatonic: 22 vacation rentals
Copake Lake: 28 vacation rentals
Lenox: 43 vacation rentals
Lee: 24 vacation rentals
Lakeville: 18 vacation rentals
For other neighborhoods, please use our search bar to access the selection of vacation rentals available.
What are the popular point of interests near where I can stay when traveling to Great Barrington?
VRBO offers a large selection of vacation rentals near lovely places in Great Barrington. From VRBO travelers, the top most popular points of interest to stay for a holiday trip or just for a weekend are:
Ski Butternut: 553 vacation rentals
Lake Mansfield Park: 678 vacation rentals
Mahaiwe Performing Arts Center: 673 vacation rentals
W.E.B. Du Bois Boyhood Homesite: 671 vacation rentals
Catamount Ski Area: 508 vacation rentals
But there are many other points of interest around Great Barrington listed on VRBO where you can find your place to stay. Please use our search bar to access the selection of vacation rentals available near the point of interest of your choice.
Can I rent Houses in Great Barrington?
Yes, of course. VRBO has 324 Houses in Great Barrington. Our other popular types of vacation rentals in Great Barrington include:
Cabins: 66 rentals available
Cottages: 66 rentals available
Bungalows: 66 rentals available
But you can also enjoy a great stay in one of our other vacation rentals including Condos/Apartments and more.
Can I find a vacation rental with pool in Great Barrington?
Yes, you can select your prefered vacation rental with pool among our 84 vacation rentals with pool available in Great Barrington. Please use our search bar to access the selection of vacation rentals available.
The lively city of Great Barrington awaits you
The area's live music and theater scene are just a few of the reasons to vacation in Great Barrington. Well known for its rock climbing, hiking and cafés, this scenic city won't disappoint. Whether you're planning a family holiday, romantic stay or friends trip, vacation rentals offer features like full kitchens and laundry facilities for a more convenient stay.
Activities and attractions in and around Great Barrington
Are you searching for attractions to see while you're in town? You'll be sure to enjoy Great Barrington for its hiking and skiing. Although it can be tempting to stay in your comfortable vacation rental, you'll want to experience everything that makes Great Barrington a one-of-a-kind vacation spot. Here are some of the most popular attractions to see, all within 30 miles (48.2 km) of the city center:
Ski Butternut (1.2 mi / 2 km)
Les Trois Emme Winery (4 mi / 6.5 km)
Dry Hill (5.1 mi / 8.3 km)
Questing (5.9 mi / 9.5 km)
Catamount Ski Area (7 mi / 11.2 km)
Umpachene Falls Park (7.1 mi / 11.5 km)
Seasonal weather averages in Great Barrington
Travelers enjoy Great Barrington for its skiing. If you're interested in winter sports, you might consider visiting in February, March, December or January, when snowfall averages 16.01 inches and temperatures average 14°F.
Exploring the natural features in Great Barrington
Whether you're an outdoor enthusiast or just want to take in the scenery, you'll be sure to find the perfect setting for your vacation in Great Barrington. Here are a few of the area's noteworthy sights, all within 30 miles (48.2 km) of the city center: | 2023-10-12T01:27:15.642919 | https://example.com/article/2057 |
A Compendium Of Cool Comics Cosplay: Final Edition!
Once again it’s time for our Friday comics cosplay feature, but with a difference. Sadly this week marks the final edition of the regular feature after a long run. Over the past couple of years we’ve been casting the spotlight on the best comics related costumery from the cosplay community, focusing on those cosplayers who we think deserve special recognition for their hard work creating the best costumes, whatever their budget, and also the work of those photographers who capture them for posterity.
However, all good things must come to an end and this week sadly marks the end of the regular Friday features. But never fear – you can still expect to see special editions of the Compendium of Cool Comics Cosplay and new features from the team. Of course, you can also still enjoy Robopanda’s Funny, Sexy, And Awesome Cosplay Of The Week every Wednesday.
We’d like to take this opportunity to especially thank all those cosplayers and photographers who have contributed to our Flickr group over the months and encourage you to still post your work there for future opportunities to be featured on Uproxx. | 2024-04-30T01:27:15.642919 | https://example.com/article/8490 |
Safety of arteriography by direct puncture of a vascular prosthesis.
A total of 122 catheterizations were performed in 105 patients with femoral grafts. Ninety-five femoral grafts were punctured. The mean follow-up time was 21 months. Sixty-one patients had follow-up duplex ultrasounds of the graft puncture site at 6 months. The complication rates for patients with direct graft puncture were comparable to those of patients without grafts undergoing femoral catheter arteriography. Twenty-seven cases with femoral grafts had arteriography using the transaxillary technique. The overall complication rate for the 95 cases with graft puncture was 12% (8% were minor complications) in contrast to 30% (22% were major complications) for the 27 cases with the transaxillary approach. The local, nervous system, and major complication rates were all significantly less in patients with graft puncture than in patients with the transaxillary approach. There was no evidence of early or late pseudoaneurysm formation, disruption of the suture line, or late graft infection in patients with graft puncture. Direct graft puncture arteriography is safe and preferable to the transaxillary approach. | 2024-07-25T01:27:15.642919 | https://example.com/article/6813 |
The present invention relates to protective devices for hydrants and, more particularly, to protective covers for the operating nut which activates a fire hydrant for use.
The unauthorized operation of fire hydrants is a common urban problem having possibly severe consequences, such as the waste of large quantities of water and the resulting substantial drop in an area's water pressure. Moreover, such tampering oftentimes results in damage to or loss of the operating nut of a fire hydrant which can make the hydrant inoperative and thus result in substantial property damage in the area due to fire.
There have been many attempts in the prior art to protect the operating nut of a hydrant from damage and prevent unauthorized access thereto. For example, U.S. Pat. No. 4,485,595 discloses a cap which surrounds the nut and contains an operating member which fastens to the operating nut and which together prevent access to the nut without a special tool. U.S. Pat. No. 4,398,556 discloses a similar device in which the entire bonnet of the hydrant is replaced with a special bonnet that prevents access to the operating nut without a special tool. U.S. Pat. Nos. 3,453,665; 3,709,249 and 2,118,233 disclose similar devices.
Damage to the operating nut or jamming of the protective devices of the prior art is a common problem as a result of vandals battering on the devices with sledgehammers or other objects which deliver considerable blows to the devices and either break the devices or prevent their removal. | 2024-07-13T01:27:15.642919 | https://example.com/article/5026 |
The structural impact of water sorption on device-quality melanin thin films.
The melanins are a class of pigmentary bio-macromolecules ubiquitous in the biosphere. They possess an intriguing set of physico-chemical properties and have been shown to exhibit hybrid protonic-electronic electrical conductivity, a feature derived from a process termed chemical self-doping driven by the sorption of water. Although the mechanism underlying the electrical conduction has been established, how the sorbed water interacts with the melanin structure at the physical level has not. Herein we use neutron reflectometry to study changes in the structure of synthetic melanin thin films as a function of H2O and D2O vapour pressure. Water is found to be taken up evenly throughout the films, and by employing the contrast effect, the existence of labile protons through reversible deuterium exchange is demonstrated. Finally, we determine a sorption isotherm to enable quantification of the melanin-water interactions. | 2024-02-01T01:27:15.642919 | https://example.com/article/3141 |
---
author:
- |
Nicolae Angelescu $^{1}$, Robert A. Minlos $^{2}$,\
and\
Valentin A. Zagrebnov $^{3}$
title: Lower Spectral Branches of a Particle Coupled to a Bose Field
---
[${}^{1}$ National Institute of Physics and Nuclear Engineering “H. Hulubei”, P.O.Box MG-6, Bucharest, Romania, e-mail: nangel@theory.nipne.ro\
${}^{2}$ Institute for Information Transmissions Problems, Bolshoj Karetny per.19, GSP-4, Moscow 101447, Russia, e-mail: minl@ittp.ru\
${}^{3}$ Université de la Méditerranée and Centre de Physique Théorique - Luminy, Case 907, Marseille 13288, Cedex 9, France, e-mail: zagrebnov@cpt.univ-mrs.fr]{}
[**Abstract** The structure of the lower part (i.e. $\varepsilon
$-away below the two-boson threshold) spectrum of Fröhlich’s polaron Hamiltonian in the weak coupling regime is obtained in spatial dimension $d\geq 3$. It contains a single polaron branch defined for total momentum $p\in G^{\left( 0\right) } $, where $G^{\left( 0\right) }\subset {\mathbb R}^d$ is a bounded domain, and, for any $p\in
{\mathbb R}^d$, a manifold of polaron + one-boson states with boson momentum $q$ in a bounded domain depending on $p$. The polaron becomes unstable and dissolves into the one boson manifold at the boundary of $G^{\left( 0\right) }$. The dispersion laws and generalized eigenfunctions are calculated.]{}
Introduction {#sec:1}
============
We consider the quantum system consisting of a particle coupled with a Bose field by an interaction linear in the creation-annihilation operators, known in the physics literature as Fröhlich’s polaron model [@Frohlich]. There are many papers, both physical and mathematical, devoted to this subject, see [@Minlos]-[@J.Frohlich]. These are mainly concerned with the ground state $F_p^{(0)}$ of the Hamiltonian $H_p$ of the system at fixed total momentum $p$ acting in the Hilbert space ${\cal H}(p)$ (see below). It is shown that for sufficiently small particle-field coupling constant $\alpha $ the ground state $F_p^{(0)}$ exists only for momentum $p$ in a certain domain $G^{\left( 0\right) }\subset {\mathbb R}^d$, where $G^{\left( 0\right) }$ is bounded for space dimension $d\geq 3$ and $G^{\left(
0\right) }={\mathbb R}^d$ for $d=1,2$. The ground state describes the ”polaron”, i.e. the particle in a ”cloud of virtual bosons”.
Here we study the next, ”one-boson”, branch of the spectrum of $H_p$ for $d\geq 3$. The expected mathematical picture is the following: there exists an invariant subspace ${\cal H}_1(p)\subset {\cal H}(p)$ of the operator $H_p$, which is isomorphic in a natural way with $L_2\left( G_p^{(1)},dq\right) $, where $G_p^{(1)}\subset {\mathbb R}^d$ is a certain bounded domain, such that $H_p$ acts in this subspace as multiplication with a function $\xi _p\left( q\right) $, which can be viewed as the energy of a boson of momentum $q$ (while the total momentum of the system is $p$). The range of this function is the segment $\left[ \lambda _1\left(
p\right) ,\lambda _2\left( p\right) \right) $, where $\lambda _1\left( p\right) $ and $\lambda _2\left( p\right) $ are the thresholds of the one- and two-boson states, respectively. Moreover, in the subspace orthogonal to ${\cal H}_0(p)\oplus {\cal
H}_1(p)$, where ${\cal H}_0(p)=\left\{ cF_p^{(0)}\right\} $ is the one-dimensional subspace generated by the ground state whenever it exists, the spectrum of $H_p$ lies above $\lambda _2\left( p\right) $ (this latter property will be called ”the completeness of the one-boson spectrum”). The states in ${\cal H}_1(p)$ can be viewed as scattering states of a boson and a polaron.
Unfortunately, we shall obtain here only part of the above picture. Namely, we are able to construct only a subspace ${\cal H}_1^\kappa (p)\subset {\cal H}_1(p)$ isomorphic to $L^2\left( G_p^{(1),\kappa },dq\right) $, where $G_p^{(1),\kappa }=\left\{ q\in G_p^{(1)}:\xi _p(q)<\kappa \right\} $. Here, $\kappa <\lambda _2\left( p\right) $ can be chosen arbitrarily close to $\lambda _2\left( p\right) $, at the expense of taking the coupling constant $\alpha $ sufficiently small. Apparently, our techniques allow the construction of the whole space $G_p^{(1)}$ and the proof of the completeness of the one-boson spectrum for sufficiently large space dimension $d$.
Our analysis of the one-boson branch covers only the cases $d\geq 3$, though we expect that the same picture holds in lower dimension, with $G_p^{\left( 1\right) }={\mathbb
R}^d$ for $d=1,2$. The calculations are based on a technique used by one of the authors in [@Minlos], and also on certain facts connected with the spectral analysis of the so-called generalized Friedrichs model [@friedrichs].
We proceed now to a detailed presentation of the model and a precise statement of the main result.
The state space of our model is the Hilbert space $${\cal H}=L^2({\mathbb R}^d)
\otimes {\cal F},$$ where ${\cal F}$ is the symmetric (boson) Fock space $${\cal
F}={\cal F}_{{sym}}\left( L^2({\mathbb R}^d) \right) =\bigoplus\limits_{n=0}^\infty
{\cal H}^{\left( n\right) },$$ with ${\cal H}^{\left( 0\right) }={\mathbb C}$, ${\cal
H}^{\left( n\right) }=\left( L^2({\mathbb R}^d) \right) _{{sym}}^{\otimes n}$ the symmetric tensor power ($n\geq 1$). Thus, the vectors of ${\cal H}$ are sequences $$\label{eq. 1.1}F=\left\{ f_0\left( p_0\right) ,f_1\left( p_0;q\right)
,...,f_n\left( p_0;q_1,...,q_n\right) ,...\right\} ,$$ where $f_n$ are, for every $p_0\in {\mathbb R}^d$, symmetric functions of the variables $q_1,...,q_n$, and the norm is given by $$\label{eq. 1.2}\left\| F\right\| ^2=\int_{{\mathbb R}^d}\left| f_0\left(
p_0\right) \right| ^2dp_0+\sum\limits_{n=1}^\infty \frac 1{n!}\int_{{\mathbb R}^d}\int_{{\mathbb R}^{nd}}\left| f_n\left( p_0;q_1,...,q_n\right) \right|
^2dp_0\prod\limits_{i=1}^ndq_i.$$ The Hamiltonian of our system has the form $$\label{eq. 1.3}H=H_0^{{part}}+H_0^{{field}}+\alpha H_{{int}},$$ where $\alpha >0$ is a coupling constant and $$\label{eq. 1.4}
\begin{array}{l}
\left( H_0^{
{part}}F\right) _n\left( p_0;q_1,...q_n\right) =\frac 12p_0^2f_n\left(
p_0;q_1,...,q_n\right) , \\ \\
\left( H_0^{
{field}}F\right) _n\left( p_0;q_1,...q_n\right) =\left(
\sum\limits_{i=1}^n\varepsilon \left( q_i\right) \right) f_n\left(
p_0;q_1,...,q_n\right) , \\ \\
\left( H_{
{int}}F\right) _n\left( p_0;q_1,...q_n\right)
=\sum\limits_{i=1}^nc(p_0;q_i)f_{n-1}\left( p_0+q_i;q_1,...,\check
q_i,...,q_n\right) \\ \hfill+\int_{{\mathbb R}^d}\overline{c(p_0;q)}f_{n+1}\left( p_0-q;q_1,...q_n,q\right) dq ,
\end{array}$$ with the convention that a sum over a void set is 0, and where the notation $\check q$ means that the variable $q$ is omitted. The properties of the functions $\varepsilon $ and $c$ will be given in detail later. Notice that, with the minimal assumptions: $\varepsilon $ is a positive real function and the function $c$ is bounded and with sufficiently rapid decay for $q\rightarrow \infty $, the operator $H$ is self-adjoint and bounded from below.
A first simplification in the spectral analysis of $H$ comes from the conservation of the total momentum, i.e. from the fact that $H$ commutes with the operator $$\label{eq. 1.5}\left( \hat PF\right) _n\left( p_0;q_1,...q_n\right) =\left(
p_0+\sum\limits_{i=1}^nq_i\right) f_n\left( p_0;q_1,...,q_n\right) ,n\geq 0.$$ As a consequence, ${\cal H}$ can be written as a direct integral of Hilbert spaces ${\cal H}\left( p\right) $$$\label{eq. 1.6}{\cal H}=\int_{{\mathbb R}^d}^{\oplus }{\cal H}\left( p\right) dp,$$ which reduces both $\hat P$ and $H$, i.e. induces the decompositions $$\label{eq. 1.7}\hat P=\int_{{\mathbb R}^d}^{\oplus }pIdp,\;\;H=\int_{{\mathbb R}^d}^{\oplus }H_pdp,$$ where $I$ (the unit operator) and $H_p$ are operators in ${\cal H}\left( p\right) $. For a vector $F$ as given in (\[eq. 1.1\]), we get the representation: $$F=\int_{{\bf
R}^d}^{\oplus }\hat F_pdp,$$ where $\hat F_p=\left\{ \hat f_{p,n}\right\}_{n\geq 0} $ and $\hat f_{p,n}$ is the restriction of $f_n$ to the hyperplane $p_0+\sum\limits_{i=1}^nq_i=p$. The spaces ${\cal H}\left( p\right) $ will be identified with ${\cal F}={\cal F}_{{sym}}\left( L^2({\mathbb R}^d) \right) $ by means of the unitaries $$\label{eq. 1.8}\left( U_p\hat F_p\right) _n\left( q_1,...q_n\right)
=f_n\left( p-\sum\limits_{i=1}^nq_i;q_1,...,q_n\right) .$$ With this identification, the action of $H_p$ in ${\cal F}$ is given by the formula $$\label{eq. 1.9}
\begin{array}[b]{ll}
\left( H_pF\right) _n\left( q_1,...q_n\right) & =e_{n,p}^0\left(
q_1,...,q_n\right) f_n\left( q_1,...,q_n\right) \\
& +\alpha \sum\limits_{i=1}^nc(p-\sum\limits_{j=1}^nq_j;q_i)f_{n-1}\left(
q_1,...,\check q_i,...,q_n\right) \\
& +\alpha \int\limits_{{\mathbb R}^d}\overline{c(p-q-\sum\limits_{j=1}^nq_j;q)}f_{n+1}\left( q_1,...q_n,q\right) dq,
\end{array}$$ where $$\label{eq. 1.10}e_{n,p}^0\left( q_1,...,q_n\right) =\frac 12\left(
p-\sum\limits_{i=1}^nq_i\right) ^2+\sum\limits_{i=1}^n\varepsilon \left(
q_i\right) ,$$
The functions $\varepsilon $ and $c$ are supposed to fulfill the following conditions:
1. $\varepsilon (q)$ [*is a convex, non-decreasing function of* ]{}$\left| q\right| $[* and there exists* ]{}$c_o>0$[*, such that*]{} $$\label{eq. 1.11}\varepsilon (q_1)+\varepsilon (q_2)\geq \varepsilon
(q_1+q_2)+c_o,\;\;\forall q_1,q_2\in {\mathbb R}^d.$$ Also, we need stronger regularity properties: $\varepsilon \in C^\infty \left(
{\mathbb R}^d\right) $[* and it has bounded derivatives, i.e. there exists* ]{}$R>0$[*, such that for all multi-indices*]{} $\alpha =\left( \alpha _1,...,\alpha
_d\right) \neq 0$, $$\label{eq. 1.12}\sup _{q\in {\mathbb R}^d}\left| \partial _q^\alpha \varepsilon \left(
q\right) \right| \leq R,$$ [*where*]{}$$\partial _q^\alpha =\frac{\partial ^{\left| \alpha \right| }}{\partial
q_1^{\alpha _1}...\partial q_d^{\alpha _d}},\;q=(q_1,...,q_d),\;\;\left|
\alpha \right| =\sum\limits_{i=1}^d\alpha _i.$$ The following are physically interesting examples of such functions:$$\begin{array}{ll}
a)\;\varepsilon \left( q\right) =\varepsilon \left( 0\right) >0 & \\
b)\;\varepsilon \left( q\right) =\sqrt{q^2+m^2}+c_o, & m>0 ,\, c_o
>0
\end{array}$$
2. $c(p,q)$ [*is sufficiently smooth and there exists a bounded, rapidly decreasing function* ]{}$h:{\mathbb R}^d\rightarrow {\mathbb R}_{+}$[*dominating* ]{}$c$[* and all its derivatives, i.e., for all multi-indices* ]{}$\alpha ,\beta $[* there exists* ]{}$C_{\alpha ,\beta }>0$[* ($C_{0,0}=1$), such that*]{} $$\label{eq. 1.13}\left| \partial _p^\alpha \partial _q^\beta c\left( p;q\right) \right|
\leq C_{\alpha ,\beta }h(q),\;\forall p,q\in {\mathbb R}^d.$$
We are concerned here with the study by perturbation theory of the (lower part of the) spectrum of the Hamiltonian (\[eq. 1.9\]) for every fixed $p$: $$\label{eq. 1.14}H_p=H_p^{(0)}+\alpha H_{p,{int}},$$ where $H_p^{(0)}$ denotes the first term, and $\alpha H_{p,{int}}$ the other terms, of equation(\[eq. 1.9\]); sometimes, for notational simplicity, the index $p$ will be omitted.
The spectrum of $H_p^{\left( 0\right) }$ consists of the eigenvalue $\frac 12p^2$, corresponding to the bare particle, and branches of continuous spectrum $e_{n,p}^0\left( q_1,...,q_n\right) $, corresponding to bare particle + $n$-boson states, starting at the thresholds $$\label{eq. 1.15}\lambda _n^0(p)=\min _{q_1,...,q_n}e_{n,p}^0\left(
q_1,...,q_n\right) .$$ Remark that, in view of the convexity of $p^2$ and $\varepsilon $, the minimum of $e_{1,p}^0\left( q_1\right) $ is attained at a single point $q_1^0 $, which is its unique critical point and is nondegenerate. Moreover, as a consequence of the inequality (\[eq. 1.11\]), $$\label{eq. 1.16}\lambda _n^0(p)\geq \lambda _{n-1}^0(p)+c_o.$$
The main result of the paper is summarized in the following:
\[T1.1\] 1) For any $d\geq 3$, there exists $\alpha _0=\alpha _0(d)$ such that, for any $\alpha <\alpha _0$ there exist functions $\lambda _1(p)<\lambda _2(p)$ , with $\lambda _1(p)<\lambda _1^0(p),\, \lambda
_2(p)<\lambda _2^0(p)$ , and a bounded domain $G^{(0)}\subset {\mathbb R}^d$ , such that the spectrum of $H_p$ in $\left( -\infty ,\lambda _1(p)\right) $ consists of one nondegenerate eigenvalue $\xi _p^{\left( 0\right)} $ if $p\in G^{(0)}$ and is void if $p\notin G^{(0)}$ . Moreover, $\xi _p^{\left( 0\right) }<p^2/2$ and $\lim \limits_{p^{\prime
}\rightarrow p\in \partial G^{(0)}}\xi _{p^{\prime }}^{\left(
0\right) }=\lambda _1(p)$ , where $\partial G^{(0)}$ denotes the boundary of the domain $G^{(0)}$ . The associated eigenvector $F_p^{(0)}$ is the ground state of $H_p$ .\
2) For any $\kappa \in \left( \lambda _1(p),\lambda _2(p)\right) $ and any $p\in {\mathbb R}^d$ , there exists $\bar \alpha _0=\bar \alpha _0\left(
\kappa ,p,d\right) $, such that for any $\alpha
<\bar \alpha _0$ there exists a domain $G_p^{(1),\kappa }\subset
{\mathbb R}^d$ , a $C^\infty $-function $\xi _p^\kappa :G_p^{(1),\kappa}
\rightarrow \left[\lambda _1 (p),\kappa \right]$ and a subspace ${\cal H}_1^\kappa (p)\subset {\cal F}$ invariant for $H_p$ , such that the restriction of $H_p$ to ${\cal H}_1^\kappa (p)$ is unitarily equivalent to the operator of multiplication by the function $\xi
_p^\kappa $ in $L^2\left( G_p^{(1),\kappa },dq\right) $ . Thereby, for $\kappa _1<\kappa _2\in \left( \lambda _1(p),\lambda _2(p)\right) $ one gets $G_p^{(1),\kappa _1}\subset G_p^{(1),\kappa _2}$ and $\xi _p^{\kappa _1}=\xi
_p^{\kappa _2}\mid _{G_p^{(1),\kappa _1}}$ .
\[R1.1 \] Refining slightly the technique of this paper, one can reach $\kappa =\lambda _2(p)$ if the dimension $d$ is sufficiently large, i.e. $\bar \alpha _0\left( \cdot ,p,d\right) $ is bounded away from zero, and the whole one-boson subspace ${\cal H}_1^{\kappa =\lambda
_2(p)}(p)$ and the function $\xi _p^{\kappa =\lambda _2(p)}$ can be constructed.
Outline of the proof\[outline\]
===============================
We shall present first the strategy we adopt in proving Theorem \[T1.1\], in order not to obscure it by the cumbersome calculations to be done.
Our constructions involve the resolvent of $H_p:$$$\label{eq. 1.17}R(z)=\left( H_p-zI\right) ^{-1}.$$ We have therefore to solve, for any $L\in {\cal F}$, the equation: $$\label{eq. 1.18}\left( H_p-zI\right) F=L.$$ We split the space ${\cal F}$ as an orthogonal sum ${\cal H}^{(\leq
1)}\oplus {\cal H}^{(\geq 2)}$, corresponding to number $n$ of bare Bosons $\leq 1$, and $\geq 2$, respectively, and denote $\Pi _1,\Pi _2$ the corresponding orthogonal projections. Hence, $F=F_1+F_2$, where $F_1=\Pi _1F$=$\left\{ f_0,f_1,0,0,...\right\} $, $F_2=\Pi _2F=\left\{ 0,0,f_2,...\right\} $ and similarly the vector $L=L_1+L_2$. Then the operator $H_p$ has a matrix representation: $$\label{eq. 1.19}H_p=\left(
\begin{array}{cc}
A_{11} & \alpha A_{12} \\ \alpha A_{21} & A_{22}
\end{array}
\right) ,$$ where $A_{ii}=\Pi _iH_p\Pi _i$, $\alpha A_{ij}=\Pi _iH_p\Pi _j$ ($i\neq j$), in terms of which equation (\[eq. 1.18\]) writes as $$\label{eq. 1.20}\left\{
\begin{array}{c}
\left( A_{11}-zI\right) F_1+\alpha A_{12}F_2=L_1 \\ \alpha A_{21}F_1+\left(
A_{22}-zI\right) F_2=L_2
\end{array}
\right. .$$
We define $$\label{eq. 1.21}\lambda _2(p)=\inf \;spec\left( A_{22}\right) .$$ By the variational principle, $$\label{eq. 1.22}\lambda _2(p)=\inf \limits_{F\in {\cal F};\left\| F\right\| =1}\left(
\Pi _2F,H_p\Pi _2F\right) \leq \lambda _2^0(p)$$ as $\lambda _2^0(p)$ is obtained as the infimum of the same expression taken over the subspace ${\cal H}^{(\leq 2)}$ of vectors $F$ with at most two bare bosons. Likewise, we define $$\label{eq. 1.22'}\lambda _1(p)=\inf \limits_{F\in {\cal H}^{(\geq
1)};\left\| F\right\| =1}\left( F,H_pF\right) \leq \lambda _1^0(p)$$ the infimum of the spectrum of the restriction of $H_p$ to the subspace ${\cal H}^{(\geq 1)}$ with at least one bare boson.
For $z$ in the resolvent set of $A_{22}$, the second equation in (\[eq. 1.20\]) can be solved for $F_2$$$\label{eq. 1.23}F_2=\left( A_{22}-zI\right) ^{-1}\left( L_2-\alpha
A_{21}F_1\right) ,$$ and hence one arrives at the following equation for $F_1$$$\label{eq. 1.24}\left( A_{11}-\alpha ^2A_{12}\left( A_{22}-zI\right)
^{-1}A_{21}-zI\right) F_1=L_1-\alpha A_{12}\left( A_{22}-zI\right) ^{-1}L_2.$$
Let now restrict to real $z =\xi$ and consider the family of self-adjoint operators acting in ${\cal H}^{(\leq 1)}$: $$\label{eq. 1.25}A_p\left( \xi \right) =A_{11}-\alpha ^2A_{12}\left(
A_{22}-\xi I\right) ^{-1}A_{21},\;\xi \in \left( -\infty ,\lambda
_2(p)\right) .$$
We shall show that, under our assumptions and for $\xi \leq \kappa \in \left( \lambda
_1(p),\lambda _2(p)\right) $, $A_p\left( \xi \right) $ are generalized Friedrichs operators, i.e. each operator $A_p\left( \xi \right) =A $ allows in the space ${\cal
H}^{(\leq 1)}={\mathbb C}\oplus L^2({\mathbb R}^d,dq)$ a representation of the form:
$$\label{eq. 1.26}
\begin{array}{l}
\left( AF\right) _0=e^{\left( 0\right) }f_0+\alpha \int \bar v\left(
q\right) f_1\left( q\right) dq \\
\left( AF\right) _1=\alpha v\left( q\right) f_0+a\left( q\right) f_1\left(
q\right) +\alpha ^2\int D\left( q,q^{\prime }\right) f_1\left( q^{\prime
}\right) dq^{\prime },
\end{array}$$
where $F=\left( f_0,f_1\right) \in {\cal H}^{(\leq 1)}$. Here $v\left( q\right) $, $a\left( q\right) $ and the kernel $D\left( q,q^{\prime }\right) $ fulfill a set of smoothness conditions (given in detail in Section \[sec:fried\]), $a\left( q\right) $ is bounded from below and grows at most linearly at $\infty $, and $v\left( q\right) $, $D\left( q,q^{\prime }\right) $ decrease fast at $\infty $. Such operators allow, for small $\alpha $, a complete spectral analysis (see [@friedrichs]-[@Reed] and Section \[sec:fried\] below), namely, letting aside the possible eigenvalue $e_p$ (ground state), they are unitarily equivalent to the operator of multiplication by $a\left( q\right) $ in $L_2\left( {\mathbb R}^d,dq\right) $.
Let us denote, for given $p$ and $\xi $, by $a_p\left( \xi ,q\right) $ the function $a\left( q\right) $ entering equation (\[eq. 1.26\]) written for $A_p\left( \xi \right) $. In essence, the key to the spectral analysis of $H_p $ lies the following remark:
\[R2.1\] Let $F=F_1 + F_2$ ($F_1\in {\cal
H}^{(\leq
1)},F_2\in {\cal H}^{(\geq 2)}$) be (generalized) eigenvector of $H_p$ with eigenvalue $\xi .$ Then, by equation (\[eq. 1.24\]), $F_1$ is a (generalized) eigenvector of the operator $A_p\left( \xi
\right) $ with the same eigenvalue $\xi $ . Conversely, suppose that $F_{\xi ,1}$ is the eigenvector of $A_p\left( \xi \right) $of eigenvalue $e_p\left( \xi \right) $ (whenever it exists). If the equation $$\label{eq. 1.27}e_p\left( \xi \right) =\xi$$ has a solution $\xi _p^{\left( 0\right) }$, then $F=F_{\xi
_p^{\left( 0\right) },1} + F_{\xi _p^{\left( 0\right) },2}$ , where $$F_{\xi _p^{\left( 0\right) },2}=-\alpha \left( A_{22}-\xi _p^{\left(
0\right) }I\right) ^{-1}A_{21}F_{\xi _p^{\left( 0\right) },1}$$ is an eigenvector of $H_p$ with eigenvalue $\xi _p^{\left(
0\right) }$ . Likewise, let for a given $p$, $F_{\xi ,1}^q$ be a generalized eigenvector of the operator $A_p\left( \xi \right) $ corresponding to the eigenvalue $a_p\left( \xi ,q\right) $ and $\xi _p\left( q\right) $ be a solution of the equation $$\label{eq. 1.27'}a_p\left( \xi ,q\right) =\xi .$$ Then for $F_1^q=F_{\xi \left( q\right) ,1}^q $ and $$\label{eq. 1.50}F_2^q=-\alpha \left( A_{22}-\xi \left( q\right)
I\right) ^{-1}A_{21}F_1^q \,,$$ *the vector* $F^q=F_1^q+F_2^q$ is a generalized eigenvector of $H_p$ for the eigenvalue $\xi _p\left( q\right) $ .
The domain $G^{(0)}$ is identified with the set of $p$ for which equation (\[eq. 1.27\]) has a solution. For any given $p$, $G_p^{(1),\kappa }$ is the set of $q$ for which equation (\[eq. 1.27’\]) has a solution $\xi \left( q\right) \leq \kappa $. The constructions of the subspace ${\cal H}_1^\kappa (p)$ and of the unitary equivalence of the operator $H_p\mid _{{\cal H}_1^\kappa
(p)}$ to the multiplication by $\xi _p^\kappa (q)=\xi _p(q)$ are done in the standard way in terms of the family $\left\{
F^q\right\}_{ q\in G_p^{(1),\kappa }} $ of generalized eigenvectors of $H_p$.
Elimination of the many-body components
=======================================
In this section we study perturbatively the solution (\[eq. 1.23\]) and derive its main properties of interest to us. By virtue of equation (\[eq. 1.14\]) and the inequality (\[eq. 1.22\]), one can factorize the unperturbed (diagonal) part $H_p^{\left( 0\right) }-z$ for $z\notin \left[ \lambda _2(p),\infty
\right) $, and bring the second equation (\[eq. 1.20\]) to the form of the equivalent fixed-point equation: $$\label{eq. 2.1}F_2+Q(z)F_2=\alpha \left( H_p^{\left( 0\right)
}-z\right) ^{-1}L_2-GF_1,$$ where $$\label{eq. 2.2}Q(z)=\alpha \left( H_p^{\left( 0\right) }-z\right) ^{-1}\Pi
_2H_{p,int}\Pi _2,$$ $$\label{eq. 2.3}G=\alpha \left( H_p^{\left( 0\right) }-z\right)
^{-1}\Pi _2H_{p,int}\Pi _1 \,,$$ Explicitly, the vector $GF_1$ has the form $\left\{ 0,0,g_2,0,...\right\} $ with $$\label{eq. 2.4}g_2(q_1,q_2)=\frac{\alpha \left[ c\left( p-q_1-q_2;q_1\right)
f_1(q_2)+c\left( p-q_1-q_2;q_2\right) f_1(q_1)\right] }{e_{2,p}^0\left(
q_1,q_2\right) -z}.$$
\[L3.1\] For every $\kappa \in \left(
\lambda _1(p),\lambda _2(p)\right)$ there exists $\alpha _0\left(
\kappa \right) $ such that, for any $\alpha <\alpha _0\left( \kappa
\right) $, and any $z\in {\mathbb C}$ with $\mathfrak{Re}\,z=\xi
\leq \kappa $, $\left\| Q(z)\right\| <1/2$, therefore equation (\[eq. 2.1\]) has a unique solution $F_2$ for every $f_1\in L^2({\mathbb R}^d,dq) $ and $ L_2\in
{\cal H}^{(\geq 2)}$ .
*Proof* : We write $Q\left( z\right) $ as a sum of its creation and annihilation parts: $Q\left( z\right) =Q^{\prime
}+Q^{\prime \prime }$, with $$\label{eq. 2.5}
\begin{array}{l}
\left( Q^{\prime }F\right) _n\left( q_1,...,q_n\right) \\
=\left\{
\begin{array}{ll}
0, & n=2 \\
\alpha \left( e_{n,p}^0\left( q_1,...,q_n\right) -z\right)
^{-1}\sum\limits_{i=1}^nc\left( p-\sum_jq_j;q_i\right) f_{n-1}(...\check
q_i...), & n>2
\end{array}
\right.
\end{array}$$ $$\label{eq. 2.6}
\begin{array}{l}
\left( Q^{\prime \prime }F\right) _n\left( q_1,...,q_n\right) \\
=\alpha \left( e_{n,p}^0\left( q_1,...,q_n\right) -z\right) ^{-1}\int
\overline{c\left( p-\sum_jq_j-q;q\right) }f_{n+1}(q_1,...,q_n,q)dq, \\
\hfill n\geq 2
\end{array}$$ By condition (\[eq. 1.11\]) and the inequality (\[eq. 1.22\]), one gets for $\xi
\leq \kappa $$$\label{eq. 2.7}\left| e_{n,p}^0\left( q_1,...,q_n\right) -z\right| \geq
e_{n,p}^0\left( q_1,...,q_n\right) -\xi \geq \left( n-2\right) c_o+\lambda
_2\left( p\right) -\kappa ,$$ therefore, by virtue of (\[eq. 1.13\]), $$\left\| \left( Q^{\prime }F\right) _n\right\| _{L^2\left( {\mathbb R}^{dn}\right) }\leq \frac{n\alpha \cdot \left\| h\right\| _{L^2\left( {\mathbb R}^d\right) }\cdot \left\| f_{n-1}\right\| _{L^2\left( {\bf
R}^{d(n-1)}\right) }}{\left( n-2\right) c_o+\lambda _2\left(
p\right) -\kappa },\;n>2,$$ while, for $n=2$, the norm vanishes. Therefore, $$\begin{array}{l}
\left\| Q^{\prime }F\right\| _{ {\cal H}^{(\geq 2)}}^2=\sum\limits_{n=2}^\infty \frac
1{n!}\cdot \left\| \left( Q^{\prime }F\right) _n\right\| _{L^2\left( {\mathbb
R}^{dn}\right) }^2 \\ \leq \alpha ^2\left\| h\right\| _{L^2({\mathbb R}^d) }^2\max
_{n\geq 3}\left[ n\left( \left( n-2\right) c_o+\lambda _2\left( p\right) -\kappa
\right) ^{-2}\right] \\ \hfill {\times \sum\limits_{n=3}^\infty }\frac 1{\left(
n-1\right) !}\cdot \left\| f_{n-1}\right\| _{L^2\left( {\mathbb R}^{d(n-1)}\right) }^2
\\ \leq \alpha ^2\left\| h\right\| _{L^2({\mathbb R}^d) }^23\left( c_o+\lambda _2\left(
p\right) -\kappa \right) ^{-2}\left\| F\right\| _{{\cal H}^{(\geq 2)}}^2,
\end{array}$$ implying that $\left\| Q^{\prime }\right\| \leq \alpha \cdot \left\| h\right\|
_{L^2({\mathbb R}^d) }\sqrt{3}/\left( c_o+\lambda _2\left( p\right) -\kappa \right) $. A similar calculation shows that $\left\| Q^{\prime \prime }\right\| \leq \alpha \cdot
\left\| h\right\| _{L^2({\mathbb R}^d) }\sqrt{3}/\left( \lambda _2\left( p\right)
-\kappa \right) $. This finishes the proof of the lemma. $\square$
Let us denote by $F_2^0(z,f_1)=\left\{ f_n^0\left( z;\cdot \right)
;n\geq 2\right\} $ the solution of equation (\[eq. 2.1\]) for $L_2=0$. Under the conditions of Lemma 3.1 and taking into account equation (\[eq. 2.4\]), we get that $ \left\| F_2^0(z,f_1)\right\| _{{\cal H}^{(\geq 2)}}\leq C\alpha
\left\| f_1\right\| _{L^2({\mathbb R}^d) }$. From now on, we shall denote by $S(z)$ the linear operator: $$\label{eq. 2.7a}{\cal H}^{(\leq 1)}\ni f_1\stackrel{S(z)}{
\longmapsto }F_2^0(z,f_1)\in {\cal H}^{(\geq 2)}.$$
To proceed further with the analysis we need more information about the structure and regularity of the solution $F_2^0(z,f_1)$. To this aim, we shall solve equation (\[eq. 2.1\]) with $L_2=0$. In particular, we shall show that the components of $F_2^0(z,f_1)$ have the representation $$\label{eq. 2.8}
\begin{array}{r}
f_n^0\left( z;q_1,...,q_n\right) =\sum\limits_{i=1}^nb_n\left(
q_1,...,\check q_i..,q_n;q_i\right) f_1\left( q_i\right) \\
+\int d_n\left( q_1,...,q_n;q\right) f_1\left( q\right) dq,
\end{array}$$ where the functions $b_n\left( q_1,...,q_{n-1};q_n\right) $ are symmetric in $q_1,...,q_{n-1}$ and the functions $d_n\left(
q_1,...,q_n;q\right) $ are symmetric in $q_1,...,q_n$, $n\geq 2$. The functions $b_n$ and $d_n$ will be called *coefficient functions*.
A simple calculation shows that, if $F\in {\cal H}^{(\geq 2)}$ has the representation (\[eq. 2.8\]), then also $\hat F=Q\left( z\right) F$ has the same kind of representation, with coefficient functions $$\label{eq. 2.9b}
\begin{array}{l}
\hat b_n\left( q_1,...,q_{n-1};q_n\right) =\alpha \left( e_{n,p}^0\left(
q_1,...,q_n\right) -z\right) ^{-1} \\
\times \left[ \sum\limits_{i=1}^{n-1}c\left(
p-\sum\limits_{j=1}^nq_j;q_i\right) b_{n-1}\left( q_1,...,\check
q_i..,q_{n-1};q_n\right) \right. \\
\left. +\int \bar c\left( p-\sum\limits_{j=1}^nq_j-q;q\right)
b_{n+1}\left( q_1,...,q_{n-1},q;q_n\right) dq\right]
\end{array}$$
$$\label{eq. 2.9d}
\begin{array}{l}
\hat d_n\left( q_1,...,q_n;q\right) =\alpha \left( e_{n,p}^0\left(
q_1,...,q_n\right) -z\right) ^{-1} \\ \times \left[
\sum\limits_{i=1}^nc\left( p-\sum\limits_{j=1}^nq_j;q_i\right)
d_{n-1}\left( q_1,...,\check q_i..,q_n;q\right) \right. \\ +\int
\bar c\left( p-\sum\limits_{j=1}^nq_j-q^{\prime };q^{\prime }\right)
d_{n+1}\left( q_1,...,q_n,q^{\prime };q\right) dq^{\prime } \\ +
\left. \overline{c}\left( p -\sum\limits_{j=1}^nq_j-q;q\right)
b_{n+1}\left( q_1,...,q_n;q\right) \right]
\end{array}$$
Let now define the space ${\cal M}$ of all pairs $\mu =\left\{ \left( b_n\right)
_{n\geq 2},\left( d_n\right) _{n\geq 2}\right\}$ of sequences of bounded continuous functions, $b_n:\left( {\mathbb R}^d\right) ^{\left(
n-1\right) }\times {\mathbb R}^d\rightarrow {\mathbb C}$, $d_n:\left( {\mathbb R}^d\right) ^n\times {\mathbb R}^d\rightarrow {\mathbb C}$, symmetric with respect to the first group of variables. Let them fulfill the following condition: there exists a constant $M$, such that, $$\label{eq. 2.10}
\begin{array}[b]{l}
\sup _q\left| b_n\left( q_1,...,q_{n-1};q\right) \right| \leq M
\prod\limits_{i=1}^{n-1}h\left( q_i\right) , \\ \left| d_n\left( q_1,...,q_n;q\right)
\right| \leq M h\left( q\right) \prod\limits_{i=1}^nh\left( q_i\right) ,\hskip 6mm
\forall n\geq 2
\end{array}$$ where $h$ is the function appearing in equation (\[eq. 1.13\]). ${\cal M}$ is a Banach space with the norm $$\label{eq. 2.11}\left\| \mu \right\| =\inf M,$$ where the infimum is taken over all $M$ for which the condition (\[eq. 2.10\]) holds. Clearly, equation (\[eq. 2.8\]) defines a continuous application of ${\cal H}^{(1)}$ into ${\cal H}^{(\geq
2)}$.
The linear operator $\Gamma \left( z\right) $ acting in ${\cal M}$ according to $\Gamma
\left( z\right) \mu =\hat \mu $, where $\mu =\left\{ \left( b_n\right) _{n\geq 2},\left(
d_n\right) _{n\geq 2}\right\} $ and $\hat \mu =\{(\hat b_n) _{n\geq 2},(\hat d_n)
_{n\geq 2}\} $ are related by (\[eq. 2.9b\]), (\[eq. 2.9d\]), translates in ${\cal
M}$ the action of $Q(z)$. Then equation (\[eq. 2.1\]) with $L_2=0$ is transformed into $$\label{eq. 2.12}\mu +\Gamma \left( z\right) \mu =\mu _0,$$ where $\mu _0=\left\{ \left( b_n^0\right) ,\left( d_n^0\right) \right\} $ with $b_n^0=0$, $\forall n\geq 3$, $d_n^0=0$, $\forall n\geq 2$, and $$\label{eq. 2.13}b_2^0\left( q_1;q\right) = -\frac{\alpha c\left( p-q_1-q;q_1\right)
}{e_{2,p}^0\left( q_1,q\right) -z}.$$
\[L3.2\] For every $\kappa \in \left( \lambda
_1(p),\lambda _2(p)\right) $ there exists $\tilde \alpha _0\left(
\kappa \right) $ such that, for any $\alpha <\tilde \alpha _0\left(
\kappa \right) $, and any $z\in {\mathbb C}$ with $\mathfrak{Re}
\,z=\xi \leq \kappa $, $ \left\| \Gamma (z)\right\| <1/2$, and $\mu
_0\in {\cal M}$, $ \left\| \mu _0\right\| \leq \alpha /\left(
\lambda _2(p)-\kappa \right) $. Therefore, equation (\[eq. 2.12\]) has a unique solution $\mu \left( z\right) \in {\cal M}$, which is an analytic function of $z$ in the half-plane $\mathfrak{Re}\,z\leq
\kappa $. Moreover, for any $r\geq 1$, there exists $\tilde \alpha _r\left( \kappa \right) $, such that, for $\alpha <\tilde \alpha _r\left( \kappa \right) $, the components of $\mu \left( z\right) $ are $C^r$-functions of their arguments and the derivatives up to order $r$ satisfy estimates like (\[eq. 1.13\]), more precisely, for any multi-indices ${\cal A}_n=\left\{
\alpha _1,...,\alpha _n,\beta \right\} $ with $\left| {\cal
A}_n\right| =\sum\limits_{i=1}^n\left| \alpha _i\right| +\beta \leq
r$, where $ \alpha _i=\left( \alpha _i^1,...,\alpha _i^d\right) $ , $\beta =\left(
\beta ^1,...,\beta ^d\right) $, there exist constants $C\left( {\cal A}_n\right) $, $\tilde C\left( {\cal A}_n\right) $, such that, for any $n\geq 2$ and for all $z$ in the half-plane the following inequalities hold: $$\label{eq. 2.14}
\begin{array}{c}
\left| \partial ^{
{\cal A}_{n-1}}b_n\left( z;q_1,...,q_{n-1};q\right) \right| \leq \alpha
\left( \lambda _2(p)-\kappa \right) ^{-1}\cdot C\left( {\cal A}_{n-1}\right)
\cdot \prod\limits_{i=1}^{n-1}h\left( q_i\right) \\ \left| \partial ^{{\cal A}_n}d_n\left( z;q_1,...,q_n;q\right) \right| \leq \alpha \left( \lambda
_2(p)-\kappa \right) ^{-1}\cdot C\left( {\cal A}_n\right) \cdot h\left(
q\right) \prod\limits_{i=1}^nh\left( q_i\right)
\end{array}$$ $$\label{eq. 2.15}
\begin{array}{c}
\left| \frac d{dz}\partial ^{
{\cal A}_{n-1}}b_n\left( z;q_1,...,q_{n-1};q\right) \right| \leq \alpha
\left( \lambda _2(p)-\kappa \right) ^{-2}\cdot \tilde C\left( {\cal A}_{n-1}\right) \cdot \prod\limits_{i=1}^{n-1}h\left( q_i\right) \\ \left|
\frac d{dz}\partial ^{{\cal A}_n}d_n\left( z;q_1,...,q_n;q\right) \right|
\leq \alpha \left( \lambda _2(p)-\kappa \right) ^{-2}\cdot \tilde C\left(
{\cal A}_n\right) \cdot h\left( q\right) \prod\limits_{i=1}^nh\left(
q_i\right)
\end{array}$$ where $\partial ^{{\cal A}_n}=\left( \prod\limits_{i=1}^n\partial
_{q_i}^{\alpha _i}\right) \partial _q^\beta $. The vector $F_2^0\left( z;f_1\right) $ given by equation (\[eq. 2.8\]), having as coefficient functions the components $b_n,d_n$ of $\mu \left( z\right) $, belongs to ${\cal H}^{(\geq 2)}$ and is the unique solution of equation (\[eq. 2.1\]) for $L_2=0$.
*Proof*: Suppose $\mu \in {\cal M}$, $\left\| \mu \right\| =1$, i.e. $\left( b_n\right) _{n\geq 2},\left( d_n\right) _{n\geq 2}$ satisfy the estimates (\[eq. 2.10\]) with $M=1$. Then, $\Gamma (z)\mu
=\hat \mu $ of components (\[eq. 2.9b\]),(\[eq. 2.9d\]) satisfies the same estimates with $$\hat A=\alpha \cdot \max \limits_{n\geq 2}\frac{n+1+\left\| h\right\| ^2}{(n-2)c_o+\lambda _2(p)-\kappa }=\frac{\alpha \left( 3+\left\| h\right\|
^2\right) }{\lambda _2(p)-\kappa }.$$ Therefore, $\left\| \Gamma (z)\right\| <1/2$ for $\alpha $ sufficiently small. The estimate of $\left\| \mu _0\right\| $ is immediate, therefore $\left\| \mu (z)\right\| \leq 2\alpha \left( \lambda _2(p)-\kappa \right)
^{-1}$.
So, we are left with the proof of the smoothness of the coefficient functions, equations (\[eq. 2.14\]), (\[eq. 2.15\]). We shall consider only the first derivatives, i.e. $\left| {\cal A}_n\right| =1$. Consider the subspace ${\cal M}_1\subset {\cal M}$ of all $\mu $ with differentiable components $\left( b_n\right) _{n\geq 2},\left( d_n\right) _{n\geq 2}$ for which there exists $M_1>0$, such that$$\max \left\{ \max \limits_{1\leq i\leq n-1}\left| \nabla
_{q_i}b_n\left( q_1,...,q_{n-1};q\right) \right| ,\left| \nabla
_qb_n\left( q_1,...,q_{n-1};q\right) \right| \right\} \leq M_1
\prod\limits_{i=1}^{n-1}h\left( q_i\right) ,$$ $$\label{eq. 2.16}\max \left\{ \max \limits_{1\leq i\leq n}\left|
\nabla _{q_i}d_n\left( q_1,...,q_n;q\right) \right| ,\left| \nabla
_qd_n\left( q_1,...,q_n;q\right) \right| \right\} \leq M_1
h(q)\prod\limits_{i=1}^nh\left( q_i\right) ,$$ which is a Banach space with norm $\left\| \mu \right\| _1=\max
\left\{ \left\| \mu \right\| ,\inf M_1\right\} $, where $\inf $ is taken over all $ M_1$ fulfilling (\[eq. 2.16\]). We show that, for small $\alpha $, $\Gamma (z)$ is a contraction in ${\cal M}_1$, as well. Taking derivatives with respect, say, to $q_1$ in equation (\[eq. 2.9b\]), one obtains $$\begin{array}{c}
\nabla _{q_1}\hat b_n\left( q_1,...,q_{n-1};q_n\right)
\hfill \\ =-\alpha \left( e_{n,p}^0\left( q_1,...,q_n\right) -z\right)
^{-2}\nabla _{q_1}e_{n,p}^0\left( q_1,...,q_{n-1},q_n\right)
\hfill \\
\begin{array}{l}
\times \left[ \sum\limits_{i=1}^{n-1}c\left(
p-\sum\limits_{j=1}^nq_j;q_i\right) b_{n-1}\left( ...,\check
q_i,...;q_n\right) \right. \\
\left. +\int \bar c\left( p-\sum\limits_{j=1}^nq_j-q;q\right) b_{n+1}\left(
q_1,...,q_{n-1},q;q_n\right) dq\right]
\end{array}
\end{array}
\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;$$ $$\label{eq. 2.17}
\begin{array}[b]{r}
+\alpha \left( e_{n,p}^0\left( q_1,...,q_n\right) -z\right) ^{-1}
\hfill \\
\begin{array}{l}
\cdot \left[ \left( \nabla _qc\left( p-\sum\limits_{j=1}^nq_j;q_1\right)
-\sum\limits_{i=1}^{n-1}\nabla _pc\left( p-\sum\limits_{j=1}^nq_j;q_i\right)
\right) b_{n-1}\left( ...\check q_i...;q_n\right) \right. \\
-\int \nabla _p\bar c\left( p-\sum\limits_{j=1}^nq_j-q;q\right)
b_{n+1}\left( q_1,...,q_{n-1},q;q_n\right) dq
\end{array}
\\
\begin{array}{l}
+\sum\limits_{i=2}^{n-1}c\left( p-\sum\limits_{j=1}^nq_j;q_i\right) \nabla
_{q_1}b_{n-1}\left( q_1,...,\check q_i..,q_{n-1};q_n\right) \\
\left. +\int \bar c\left( p-\sum\limits_{j=1}^nq_j-q;q\right) \nabla
_{q_1}b_{n+1}\left( q_1,...,q_{n-1},q;q_n\right) dq\right] .
\end{array}
\hfill
\end{array}$$ Here, $\nabla _pc$ and $\nabla _qc$ denote the gradient of the function $c(p,q)$ with respect to the first, respectively the second, argument. Similar expressions are obtained for $\nabla _{q_i}\hat
d_n$, $\nabla _{q_n}\hat b_n$, and $\nabla _q\hat d_n$. Suppose that $\left\| \mu \right\| _1=1$. Then, using the simple estimate $$\label{eq. 2.18}\left| \frac{\nabla _{q_1}e_{n,p}^0\left(
q_1,...,q_{n-1},q_n\right) }{e_{n,p}^0\left( q_1,...,q_n\right) -z}\right|
\leq \bar R,$$ where $\bar R$ is a constant independent of $n$, and also the assumption (\[eq. 1.13\]), one obtains $$\label{eq. 2.19}\left\| \hat \mu \right\| _1\leq \frac{\alpha \left(
a+\left\| h\right\| ^2\right) \left( \bar R+\bar C+b\right) }{\lambda
_2(p)-\kappa },$$ where $a$ and $b$ are absolute constants and $\bar C=\max \left\{
\left| \nabla _pc(p,q)\right| ,\left| \nabla _qc(p,q)\right|
\right\} $. Equation (\[eq. 2.19\]) shows that $\Gamma \left(
z\right) $ leaves ${\cal M}_1$ invariant and that $\left\|
\Gamma (z)\right\| <1/2$ for $\alpha $ sufficiently small. Since $\mu _0\in {\cal M}_1$, and $$\left\| \mu _0\right\|
_1<2\alpha \left( \lambda _2(p)-\kappa \right) ^{-1}\max \left\{
\left( \bar R+\bar C\right) ,1\right\} ,$$ we see that the solution $\mu \left( z\right) $ of equation (\[eq. 2.12\]) belongs to ${\cal M}_1$ and has norm of the order of $\alpha /\left( \lambda _2(p)-\kappa \right) $. This finishes the proof of the inequalities (\[eq. 2.14\]) in the case $r=1$. The higher values of $r$ can be treated similarly, with stronger limitations on $\alpha $.
Finally, $\mu \left( z\right) $ and its derivatives are analytic in the half-plane $\xi \leq \kappa ^{\prime }$ for any $\kappa ^{\prime
}\in \left( \kappa ,\lambda _2(p)\right) $ and satisfy there inequalities like (\[eq. 2.14\]), implying (\[eq. 2.15\]) in $\xi \leq \kappa $. The lemma is proved. $\square$
Finally, going back to the system (\[eq. 1.20\]) with $L_2=0$, we remark that the solution $F_2^0\left( z;f_1\right) $ of the second equation enters the first equation only through its first ($n=2$) component, $f_2^0\left( z;f_1\right) $, which, in view of equation (\[eq. 2.8\]) has the form: $$\label{eq. 2.20}
\begin{array}{r}
f_2^0\left( z;f_1;q_1,q_2\right) =b_2\left( z;q_2;q_1\right) f_1\left( q_1\right)
+b_2\left( z;q_1;q_2\right) f_1\left( q_2\right) \\ +\int d_2\left( z;q_1,q_2;q\right)
f_1\left( q\right) dq.
\end{array}$$ Inserting this representation into the first equation (\[eq. 1.20\]) and using the notations: $$\label{eq. 2.21}m_p\left( z;q\right) =\alpha \int \overline{c\left( p-q-q^{\prime
};q^{\prime }\right) }b_2\left( z;q^{\prime };q\right) dq^{\prime },$$
$$\label{eq. 2.22}
\begin{array}{r}
D_p\left( z;q,q^{\prime }\right) =\frac 1\alpha \left[ c\left( p-q-q^{\prime
},q^{\prime }\right) b_2\left( z;q;q^{\prime }\right) \right. \\
\left. +\int \overline{c\left( p-q^{\prime }-q^{\prime \prime },q^{\prime
\prime }\right) }d_2\left( z;q,q^{\prime \prime };q^{\prime }\right)
dq^{\prime \prime }\right] ,
\end{array}$$
one arrives at the following system of equations for the $n=0,1$ components: $$\label{eq. 2.23}\left\{
\begin{array}{lll}
\left( e_{0,p}^0-z\right) f_0 & +\alpha \int \overline{c\left( p-q,q\right) }f_1\left( q\right) dq & =l_0 \\
\alpha c\left( p-q,q\right) f_0 & +\left[ a_p\left( z;q\right) -z\right]
f_1\left( q\right) +\alpha ^2\int D_p\left( z;q,q^{\prime }\right) f_1\left(
q^{\prime }\right) dq^{\prime } & =l_1
\end{array}
\right.$$ where $$\label{a-m-relation}
a_p\left( z;q\right) =e_{1,p}^0\left( q\right) +m_p\left( z;q\right)$$
\[C3.3\] For $z$ real, the function $a_p\left(
z;q\right) $ is real and the kernel $D_p\left( z;q,q^{\prime
}\right) $ is self-adjoint.
Indeed, the operator $V(z)$ defined by $$\left( V(z)f_1\right) \left(
q\right) =m_p\left( z;q\right) f_1\left( q\right) +\alpha ^2\int
D_p\left( z;q,q^{\prime }\right) f_1\left( q^{\prime }\right)
dq^{\prime }$$ is equal to $-A_{12}\left( A_{22}-zI\right)
^{-1}A_{21}$ appearing in equation (\[eq. 1.24\]), which is manifestly self-adjoint for real $z$.\
\[C3.4\] The following asymptotic formulae hold: $$\label{eq. 2.24}m_p\left( z;q\right) =-\alpha ^2\int \frac{\left| c\left(
p-q-q^{\prime };q^{\prime }\right) \right| ^2}{e_{2,p}^0\left( q,q^{\prime }\right)
-z}dq^{\prime }+O\left( \alpha ^3\right) ,$$ where $O\left( \alpha ^3\right) $ is a $C^1$-function of norm $\left\| O\left( \alpha ^3\right) \right\| _1\leq C\alpha ^3$ for some constant $C$ depending on $\kappa $; $$\label{eq. 2.25}D_p\left( z;q,q^{\prime }\right) =-\frac{\overline{c\left(
p-q-q^{\prime };q^{\prime }\right) }c\left( p-q-q^{\prime };q\right) }{e_{2,p}^0\left( q,q^{\prime }\right) -z}+ O\left( \alpha \right) ,$$ where $O\left( \alpha \right) $ is a smooth function bounded by $C\, \alpha \, h(q)h(q^{\prime })$ for some constant $C$ depending on $\kappa $ .
As a consequence of Lemma 3.2, the solution $\mu \left( z\right) $ has a series representation $\sum\limits_{n=0}^\infty \left( -\Gamma \left( z\right) \right)
^n\mu _0$ convergent in ${\cal M}_1$, the $n$-th term of which is of the order $\alpha ^n$, wherefrom the assertion.
Study of the reduced system (3.25)
==================================
The generalized Friedrichs model (a digression) {#sec:fried}
-----------------------------------------------
We collect here the needed information about the spectral representation of the generalized Friedrichs operator $A$ acting in ${\cal H}^{(\leq 1)}={\mathbb C}\oplus L^2({\mathbb R}^d,dq) $, equation (\[eq. 1.26\]). We shall study $A$ as a perturbation of $A_0=A\left( \alpha =0\right) $, so $\alpha >0$ is supposed sufficiently small to ensure the convergence.
In order to calculate the resolvent $R_A(z)$ of $A$, one has to solve $$\label{eq. 3.1}
\begin{array}[b]{r}
\left\{
\begin{array}{r}
\left( e^{(0)}-z\right) f_0 +\alpha \int \bar v\left( q\right)
f_1\left( q\right) dq=g_0 \\ \alpha v\left( q\right) f_0+\left(
a\left( q\right) -z\right) f_1\left( q\right) +\alpha ^2\int D\left(
q,q^{\prime }\right) f_1\left( q^{\prime }\right) dq^{\prime }=g_1
\end{array}
\right. \\
\end{array}$$ for all $\left( g_0,g_1\right) =G\in {\cal H}^{(\leq
1)}$.\
To this end the following assumptions are made:
1. \[cond.1\] $a\left( q\right) $ is a real, sufficiently smooth function, and there exist constants $C_1,C_2,C_3$, such that $$\label{eq. 3.2}
\begin{array}{c}
C_1\leq a\left( q\right) \leq C_2\left| q\right| ^2+C_3\,, \\
\left| \nabla a\left( q\right) \right| \leq C_2\left( \left| q\right|
+1\right)\,, \\
\left| \partial ^\alpha a\left( q\right) \right| \leq C_2,\left|
\alpha \right| \geq 2\,;
\end{array}$$ $a(q)$ has a unique nondegenerate minimum $\bar a$ at $\bar q_0$ and no other critical points. We denote $I=\left[ \bar a,\infty \right) \subset {\mathbb R}$ the range of the function $a$.
2. \[cond.2\] The function $v\left( q\right) $ is continuous and $\left| v\left(
q\right) \right| \leq h(q)$, for some bounded, rapidly decreasing, positive $h$;
3. \[cond.3\]$a\left( q\right) $ restricted to the $0$-level of $v$, $\left\{ q:v(q)=0\right\} $, is not constant;
4. \[cond.4\] The kernel $D\left( q,q^{\prime }\right) $ is sufficiently smooth and there exists a constant $N$, such that, for any multi-indices $\alpha ,\beta $ with $\left| \alpha \right| ,\left| \beta
\right| \leq r=\left[
d/2\right] +2$$$\label{eq. 3.3}\left| \partial _q^\alpha \partial _{q^{\prime }}^\beta
D\left( q,q^{\prime }\right) \right| \leq Nh(q)h(q^{\prime }).$$
In solving equation (\[eq. 3.1\]) we proceed like outlined in Section \[outline\] , i.e. we solve the second equation for $f_1$ in terms of $f_0$ and plug the solution in the first equation.
Let $B$ be the operator defined on its maximal domain in $L^2\left( {\mathbb R}^d,dq\right) $ by the formula: $$\label{eq. 3.4}Bf(q)=a\left( q\right) f\left( q\right) +\alpha ^2\int
D\left( q,q^{\prime }\right) f\left( q^{\prime }\right) dq^{\prime }.$$ We need its resolvent $R_B(z)=\left( B-zI\right) ^{-1}$. We denote by ${\cal B}_r$ the Banach space of all kernels $D\left( q,q^{\prime }\right) $ satisfying condition \[cond.4\], i.e. which are $r$ times differentable and satisfy (\[eq. 3.3\]) for some $N$, endowed with the norm $\left\|
D\right\| _r=\inf N$, where the infimum is taken over all $N$ for which (\[eq. 3.3\]) holds.
\[L4.1\] For $\alpha $ sufficiently small and $z\notin I $ the resolvent $R_B(z)=\left( B-zI\right) ^{-1}$ has the form $$\label{eq. 3.5}
\begin{array}[b]{l}
\left( R_B(z)g\right) \left( q\right) \\ =\left( a\left( q\right) -z\right)
^{-1}\left[ g\left( q\right) +\alpha ^2\int K\left( \alpha ,z;q,q^{\prime }\right)
g\left( q^{\prime }\right) \left( a\left( q^{\prime }\right) -z\right) ^{-1}dq^{\prime
}\right] , \\ \hfill g\in L^2\left( {\mathbb R}^d,dq\right) ,
\end{array}$$ where the kernel $K\left( \alpha ,z;\cdot ,\cdot \right) \in {\cal B}_r $ and its norm is bounded for $z\in {\mathbb C}\setminus I$. Moreover, $K$ is a ${\cal B}_r$-valued analytic function of $z$ on ${\mathbb C}\setminus I$ and its boundary values $$\label{eq. 3.6}K^{\pm }\left( \alpha ,x;q,q^{\prime }\right) =\lim
\limits_{\varepsilon \searrow 0}K\left( \alpha ,x\pm i\varepsilon
;q,q^{\prime }\right)$$ exist in ${\cal B}_r$ for all $x\in I$. Also, $K^{\pm }\left(
\alpha ,x;\cdot ,\cdot \right) $ are $\left[(d-1)/ 2\right]
-1$ times differentiable as a ${\cal B}_r$-valued function of $x\in
I$ and their last derivative with respect to $x$ is Hölder continuous of exponent $\gamma =1/3$ (actually of any $\gamma <1/2$ for even $d$ and any $\gamma <1$ for odd $d$).
\[R4.1\] We shall express the last property of $K^{\pm }$ by saying that $I\ni x\longmapsto K^{\pm }\left( \alpha ,x;\cdot ,\cdot
\right) \in {\cal B}_r$ is $s+1/3$ times differentiable, where we put $s=\left[
(d-1)/2\right] -1$. In order to prove it, one has to find a constant $\tilde N$, such that for all multi-indices $\alpha ,\beta $ with $\left|
\alpha \right| ,\left| \beta \right| \leq r=\left[d/2\right] +2$ and $k=0,1,...,s$: $$\label{eq. 3.7}\left| \partial _x^k\partial _q^\alpha \partial _{q^{\prime
}}^\beta K^{\pm }\left( \alpha ,x;q,q^{\prime }\right) \right| \leq \tilde
Nh(q)h(q^{\prime }),$$ and $$\label{eq. 3.8}\max \limits_{x,y\in I;\left| x-y\right| \leq 1}\frac{\left|
\partial _x^s\partial _q^\alpha \partial _{q^{\prime }}^\beta K^{\pm }\left(
\alpha ,x;q,q^{\prime }\right) -\partial _x^s\partial _q^\alpha \partial
_{q^{\prime }}^\beta K^{\pm }\left( \alpha ,y;q,q^{\prime }\right) \right| }{\left| x-y\right| ^{1/3}}\leq \tilde Nh(q)h(q^{\prime }).$$
*Proof of Lemma \[L4.1\]*: Let $B_0=B(\alpha =0)$, i.e. the operator of multiplication with $a(q)$ and $D$ the integral operator of kernel $D\left(
q,q^{\prime }\right) $. Then, denoting $$\label{eq. 3.9}M=\alpha ^2D\left( B_0-z\right) ^{-1}$$ which is an integral operator of kernel $\alpha ^2D\left( q,q^{\prime }\right) \left(
a(q^{\prime })-z\right) ^{-1}$, we have, formally, the expansion: $$\label{eq. 3.10}
\begin{array}{r}
R_B(z)=\left( B_0-z\right) ^{-1}\left( I+M\right) ^{-1}=\left( B_0-z\right)
^{-1} \\
+\sum\limits_{n=1}^\infty (-1)^n\left( B_0-z\right) ^{-1}M^n,
\end{array}$$ where $\left( B_0-z\right) ^{-1}M^n$, $n\geq 1$, are integral operators of kernels $$\left( a\left( q\right) -z\right) ^{-1}L_n\left( \alpha ,z;q,q^{\prime
}\right) \left( a\left( q^{\prime }\right) -z\right) ^{-1},$$ with $$\label{eq. 3.11}L_n\left( \alpha ,z;q,q^{\prime }\right) =\alpha ^{2n}\int
...\int \frac{D\left( q,q_1\right) D\left( q_1,q_2\right) ...D\left(
q_{n-1},q^{\prime }\right) }{\prod\limits_{i=1}^{n-1}\left( a\left(
q_i\right) -z\right) }dq_1...dq_{n-1}.$$ We shall prove the convergence of the series (\[eq. 3.10\]) in ${\cal B}_r$ and, hence, show that $K$ satisfies all the assertions of the Lemma, by checking (by induction) the following properties of the function (\[eq. 3.11\]):\
(i) $L_n\left(
\alpha ,z;\cdot ,\cdot \right) \in {\cal B}_r$ and $$\label{eq. 3.12}\left\| L_n\left( \alpha ,z;\cdot ,\cdot \right) \right\|
_r\leq \left( C\alpha ^2\right) ^{n-1},$$ where $C$ is a constant (to be specified later);\
(ii) The limits $$\label{eq. 3.13}\lim \limits_{\varepsilon \searrow 0}L_n\left( \alpha ,x\pm
i\varepsilon ;q,q^{\prime }\right) =L_n^{\pm }\left( \alpha ,x;q,q^{\prime
}\right)$$ exist in ${\cal B}_r$ for all $x\in I$;\
(iii) $L_n^{\pm }\left( \alpha ,x;\cdot ,\cdot \right) $ are $s+
1/3$ times differentiable, thereby they satisfy the estimates (\[eq. 3.7\]), (\[eq. 3.8\]) with $\tilde N=\left( C\alpha ^2\right) ^{n-1}$.
Indeed, for $n=1$, i.e. for $D\left( q,q^{\prime }\right) $ these assertions hold obviously. For $\mathfrak{Im} \,z\geq 0$, we represent $$\label{eq. 3.14}
\begin{array}[b]{r}
L_{n+1}\left( \alpha ,z;q,q^{\prime }\right) =\alpha ^2\int D\left( q,\bar
q\right) L_n\left( \alpha ,z;\bar q,q^{\prime }\right) \left( a\left( \bar
q\right) -z\right) ^{-1}d\bar q \\
\\
=i\alpha ^2\int_0^\infty dte^{izt}\int D\left( q,\bar q\right) L_n\left(
\alpha ,z;\bar q,q^{\prime }\right) e^{-ita\left( \bar q\right) }d\bar q,
\end{array}$$ wherefrom $$\label{eq. 3.15}
\begin{array}{l}
\partial _z^k\partial _q^\alpha \partial _{q^{\prime }}^\beta L_{n+1}\left(
\alpha ,z;q,q^{\prime }\right) = \\
\\
i\alpha ^2\int_0^\infty dt\left( it\right) ^ke^{izt}\int \partial _q^\alpha
D\left( q,\bar q\right) \partial _{q^{\prime }}^\beta L_n\left( \alpha
,z;\bar q,q^{\prime }\right) e^{-ita\left( \bar q\right) }d\bar q.
\end{array}$$ Using (\[eq. 3.3\]), the induction hypothesis and the *condition* \[cond.1\] for $a(q)$, the internal integral can be represented by the stationary phase method as $$\label{eq. 3.16}\hat C\frac{\partial _q^\alpha D\left( q,\bar q_0\right)
\partial _{q^{\prime }}^\beta L_n\left( \alpha ,z;\bar q_0,q^{\prime
}\right) e^{-ita\left( \bar q_0\right) }}{t^{d/2}+1}+\Delta _{\alpha \beta
}\left( t;q,q^{\prime }\right) ,$$ where $\hat C$ is an absolute constant, and the kernel $\Delta _{\alpha \beta }$ is bounded by $$\label{eq. 3.17}\left| \Delta _{\alpha \beta }\left( t;q,q^{\prime }\right)
\right| \leq \bar N\left( C\alpha ^2\right) ^{n-1}\left\| h\right\| _{L_2}^2\frac{h(q)h(q^{\prime })}{t^{d/2+1}+1}$$ with some constant $\bar N$ dependent on $d$ and on the function $a$. The integral$$\int_0^\infty dt\frac{\left( it\right) ^k}{t^{d/2}+1}e^{i(z-a\left( \bar q_0\right)
)t}$$ is absolutely convergent for all $k\leq s$ and defines a continuous function of $z$ in $\mathfrak{Im}\,z\geq 0$, which, for $k=s$, is Hölder continuous with respect to this variable. We have that the contribution to (\[eq. 3.15\]) of the first term in (\[eq. 3.16\]) has the estimate $$\label{eq. 3.18}
\begin{array}{r}
\left| i\alpha ^2\hat C\int_0^\infty dt \left( it\right)
^ke^{it(z-a\left( \bar q_0\right) )}(t^{d/2}+1)^{-1}
\partial _q^\alpha D\left( q,\bar q_0\right) \partial _{q^{\prime }}^\beta
L_n\left( \alpha ,z;\bar q_0,q^{\prime }\right) \right| \\ \leq {\tilde C}h\left( \bar
q_0\right) ^2\tilde N(C\alpha ^2)^{n-1}h(q)h(q^{\prime }),
\end{array}$$ where $\tilde C$ is a constant. One proves in the same way the Hölder condition (\[eq. 3.8\]) for $k=s$. A similar estimate holds for the integral of the second term in (\[eq. 3.16\]): $$\left| \int_0^\infty \left( it\right) ^ke^{izt}\Delta _{\alpha \beta }\left(
t;q,q^{\prime }\right) dt\right| \leq \tilde C\left\| h\right\| _{L_2}^2\bar
N(C\alpha ^2)^{n-1}h(q)h(q^{\prime }).$$ By taking $C=\max \left\{ N,\tilde C\left( \left| h\left( \bar
q_0\right) \right| ^2\tilde N+\left\| h\right\| _{L_2}^2\bar
N\right) \right\} $, one gets the estimate (\[eq. 3.12\]), the existence of the limit (\[eq. 3.13\]) and the assertion (iii) for $n$ replaced by $n+1$. $\square$\
Once we have $R_B(z)$, it is an easy matter to write down the solution of equation (\[eq. 3.1\]) for $z\in {\mathbb C}\setminus
I$ as $$\label{eq. 3.19}f_1=R_B(z)\left[ g_1-\alpha f_0v\right] ,$$ where $$\label{eq. 3.20}f_0=\frac 1{\Delta (z)}\left[ g_0-\alpha \left(
v,R_B(z)g_1\right) \right]$$ whenever $\Delta (z)\neq 0$. Here, $$\label{eq. 3.21}\Delta (z)=e^{\left( 0\right) }-z-\alpha ^2\left(
v,R_B(z)v\right)$$ Clearly, $\Delta (z)$ is analytic in ${\mathbb C}\setminus I$, has limits at the cut $I$: $$\label{eq. 3.22}\lim _{\varepsilon \searrow 0}\Delta \left( x\pm
i\varepsilon \right) =\Delta ^{\pm }\left( x\right) ,x\in I$$ and the limits $\Delta ^{\pm }\left( x\right) $ are $s+1/3$ times differentiable, by the same reasoning as in Lemma \[L4.1\]. More precisely,$$\left| \frac{d^k}{dx^k}\left( \Delta ^{\pm }\left( x\right) +x\right)
\right| \leq const,\;k=0,...,s+1/3.$$
As one can read from equations (\[eq. 3.19\]), (\[eq. 3.20\]), the continuous spectrum of the operator $A$ equals the interval $I$. Besides, the real zeroes of $\Delta (z)$ below $\bar
a$, if any, are eigenvalues of $A$. Since $-\alpha ^2\left(
v,R_B(x)v\right) $ is decreasing for $x<\bar a$, $\Delta (x)$ is strictly decreasing from +$\infty $ to $\Delta \left( \bar a\right)
$ on this interval, therefore $A$ has one simple eigenvalue $e<\bar
a$ with eigenvector $\psi _0=\left( f_0,f_1=-\alpha
f_0R_B(e)v\right)\in {\cal H}^{\left( \leq 1\right)}$, if, and only if, $\Delta \left( \bar a\right) <0$. As, for small $\alpha $
$$\pm \mathfrak{Im}\,\Delta ^{\pm }\left( x\right) =\alpha ^2\pi \int\limits_{a(q)=x}\left|
v(q)\right| ^2dq+0\left( \alpha ^4\right) >0,x\in I,$$ in view of *condition* \[cond.3\], it follows that there are no eigenvalues of $A$ embedded in the continuous spectrum (see [@citari; @Fried]).
\[R4.2\] It is easy to show using the explicit formulae for $R_A(z)$ that the general criteria of the absence of the singular continuous spectrum [@Reed] are met in our case, hence that the continuous spectrum $I$ is absolutely continuous. Therefore, we have $$\label{eq. 3.23}{\cal H}^{\left( \leq 1\right) }=\left\{
\begin{array}{ll}
{\cal H}^{ac}, & \Delta \left( \bar a\right) \geq 0 \\
\left\{ c\psi _0\right\} \oplus {\cal H}^{ac}, & \Delta \left( \bar a\right)
<0
\end{array}
\right.$$
We come now to the scattering theory for the pair of self-adjoint operators $(A,B_0)$, where we denoted $B_0$ the operator of multiplication with $a(q)$ acting in ${\cal H}^{\left( 1\right) }=L^2\left( {\bf
R}^d,dq\right) $. We denote $E:{\cal H}^{\left( 1\right)
}\rightarrow {\cal H}^{\left( \leq 1\right) }$ the injection $E\varphi =\left( 0,\varphi \right) \in \mathcal{H}^{\left( \leq
1\right) }$, $\varphi \in {\cal H}^{\left( 1\right) }$. Known existence criteria for the wave operators (see e.g.[@Reed]) can be applied to our case and ensure the existence of the strong limit: $$s-\lim _{t\rightarrow \infty }e^{itA}Ee^{-itB_0}=\Omega ^{+} ,$$ which is a unitary operator $\Omega ^{+}:{\cal H}^{\left( 1\right) }\rightarrow {\cal H}^{ac}\subset {\cal H}^{\left(
\leq 1\right) }$. The generalized eigenfunctions of the operator $B_0$ are $\delta _q(\cdot )=\delta \left( q-\cdot
\right) $, therefore, using known formulae in scattering theory, one can take $$\label{eq. 3.23a}\psi ^q=\Omega ^{+}\delta _q=\lim _{\varepsilon \searrow
0}i\varepsilon R_A\left( a\left( q\right) -i\varepsilon \right) E\delta _q$$ as generalized eigenvectors of $A$ corresponding to the eigenvalue $a(q)$. Explicitly, in view of (\[eq. 3.19\]), (\[eq. 3.20\]) and Lemma \[L4.1\], one gets for $\psi ^q=\left( f_0^q,f_1^q\left( \cdot \right) \right) $ the following expressions: $$\begin{aligned}
\label{eq. 3.24}&&f_0^q=-\frac{\alpha }{\Delta ^{-}\left( a\left(
q\right) \right) }\left[ v(q)+\alpha ^2\int \frac{K^{-}\left( \alpha
,a\left(
q\right) ;q^{\prime },q\right) \bar v\left( q^{\prime }\right) dq^{\prime }}{a\left( q^{\prime }\right) -a\left( q\right) +i0}\right],\\
\label{eq. 3.25} &&f_1^q\left( q^{\prime }\right) =\delta \left( q-q^{\prime }\right) +\frac{\alpha ^2K^{-}\left( \alpha ,a\left( q\right) ;q^{\prime },q\right) }{a\left( q^{\prime }\right) -a\left( q\right) +i0}-\\
\nonumber &&\alpha f_0^q\frac 1{a\left( q^{\prime }\right) -a\left(
q\right) +i0}\left[ v(q^{\prime })+\alpha ^2\int \frac{K^{-}\left(
\alpha ,a\left( q\right) ;q^{\prime },q^{\prime \prime }\right) \bar
v\left( q^{\prime \prime }\right) dq^{\prime \prime }}{a\left(
q^{\prime \prime }\right) -a\left( q\right) +i0}\right].\end{aligned}$$
This somewhat formal derivation of the formulas (\[eq. 3.24\]), (\[eq. 3.25\]) will be justified by the next lemma, which proves that $\psi ^q\in {\mathbb C}\oplus {\cal S}^{\prime }\left( {\mathbb R}^d\right) $ (where ${\cal S}^{\prime
}\left( {\mathbb R}^d\right) $ is the space of tempered distributions) and that it verifies the intertwining property of the wave-operator $\Omega ^{+}$.
\[L4.2\] Let $d\geq 3.$ Then\
1. For every fixed $q\in {\mathbb R}^d$, $f_0^q$ is finite and it is bounded and continuous as a function of $q$.\
2. For every fixed $q\in {\bf
R}^d$, $f_1^q\left( \cdot \right) \in {\cal S}^{\prime }\left( {\mathbb R}^d\right) $; moreover, for every fixed $q^{\prime }\in {\mathbb R}^d$, $f_1^q\left( q^{\prime }\right) \in {\cal S}^{\prime }\left( {\mathbb R}^d\right) $ with respect to $q$.\
3. For $\varphi \in
{\cal S}\left( {\mathbb R}^d\right) $, let us consider the vector $\psi _\varphi
=\left( C_{\varphi ,0},C_{\varphi ,1}\left( \cdot \right) \right) \in {\cal H}^{\left(
\leq 1\right) }$, where $$\label{eq. 3.26}C_{\varphi ,0}=\int f_0^q\varphi \left( q\right) dq,$$ $$\label{eq. 3.27}C_{\varphi ,1}\left( q^{\prime }\right) =\int f_1^q\left(
q^{\prime }\right) \varphi \left( q\right) dq.$$ Then, for any $\varphi _1,\varphi _2\in {\cal S}\left( {\mathbb R}^d\right) $, $$\label{eq. 3.28}\left( \psi _{\varphi _1},\psi _{\varphi _2}\right) _{{\cal H}^{\left( \leq 1\right) }}=\bar C_{\varphi _1,0}C_{\varphi _2,0}+\int \bar
C_{\varphi _1,1}\left( q\right) C_{\varphi _2,1}\left( q\right) dq=\left(
\varphi _1,\varphi _2\right) _{L_2},$$ therefore the application $\varphi \mapsto \psi _\varphi $ extends to an isometry $\Omega ^{+}:L^2\left( {\mathbb R}^d,dq\right) \rightarrow {\cal H}^{\left( \leq
1\right) }$.\
4. The range of the operator $\Omega ^{+}$ is ${\cal H}^{ac}$ and $A\Omega ^{+}=\Omega ^{+}B_0$.
\[R4.3\] The relation (\[eq. 3.28\]) may be written in the following formal way $$\label{eq. 3.28a}\left( \psi ^q,\psi ^{q^{\prime }}\right) _{{\cal H}^{\left( \leq 1\right) }}=\bar f_0^qf_0^{q^{\prime }}+\left(
f_1^q,f_1^{q^{\prime }}\right) _{{\cal H}^{\left( 1\right) }}=\delta \left(
q-q^{\prime }\right) ,$$ meaning the orthonormality of the generalized functions $\left\{ \psi ^q,\;q\in
{\mathbb R}^d\right\} $.
\[R4.4\] Usually, the generalized eigenvectors of a self-adjoint operator $A$ acting in the Hilbert space ${\cal H}$ are defined as derivatives $
{dE_\lambda \varphi }/{d\sigma _\varphi \left( \lambda \right)}$, where $ \varphi \in {\cal H}$ is an arbitrary vector, $\left\{
E_\lambda \right\} $ is the family of spectral projections of $A$, and $\sigma _\varphi \left( \lambda \right) $ is the spectral measure corresponding to $\varphi $. Moreover, if $A$ leaves invariant a certain dense linear subspace ${\cal H}_{+}\subset {\cal H}$ and ${\cal H}_{+}$ has a Hilbert space structure such that the inclusion is quasi-nuclear, then the derivative ${dE_\lambda \varphi }/{d\sigma _\varphi
\left( \lambda \right) }=\chi _\lambda $ exists as an element of the conjugate space ${\cal H}_{-}={\cal H}_{+}^{*}$ and it is an eigenvector with eigenvalue $\lambda $ of the adjoint: $\left( A\mid _{{\cal H}_{+}}\right) ^{*}$, of the restriction of $A$ to ${\cal H}_{+}$, which is an extension of $A$. The vectors $\chi _\lambda \in {\cal H}_{-}$ are usually called generalized eigenvectors of the operator $A$. It can be shown that the generalized vectors introduced above are generalized eigenvectors of $A$ in this sense. The same remark is valid for the generalized eigenvectors of the operator $H_p $ (which will be constructed farther on).
*Proof of Lemma \[L4.2\]*:\
1. This assertion follows easily from the representation $$\begin{aligned}
&& \int K^{-}\left( \alpha ,a\left( q\right) ;q^{\prime },q\right)
\bar v\left( q^{\prime }\right) [a\left( q^{\prime }\right) -a\left(
q\right) +i0]^{-1} dq^{\prime}= \\
&& i\int\limits_0^\infty dt\int e^{it\left( a\left( q^{\prime
}\right) -a\left( q\right) \right) }K^{-}\left( \alpha ,a\left(
q\right) ;q^{\prime },q\right) \bar v\left( q^{\prime }\right)
dq^{\prime }\end{aligned}$$ by applying the stationary phase method as done already in the proof of Lemma \[L4.1\].\
2. In order to prove the second assertion, we have to consider $C_{\varphi ,1}\left( q^{\prime }\right) $. To this aim, we represent the $q^{\prime \prime }$-integral in (\[eq. 3.25\]) as before, using the stationary phase method: $$\label{eq. 3.29}
\begin{array}{l}
I\left( x;q^{\prime }\right) :=i\int\limits_0^\infty dt\int e^{it\left(
a\left( q^{\prime \prime }\right) -x\right) }K^{-}\left( \alpha ,x;q^{\prime
},q^{\prime \prime }\right) \bar v\left( q^{\prime \prime }\right)
dq^{\prime \prime } \\
=i\int\limits_0^\infty dt\left[ \frac{\hat C}{t^{d/2}+1}e^{it\left( a\left(
\bar q_0\right) -x\right) }K^{-}\left( \alpha ,x;q^{\prime },\bar q_0\right)
\bar v\left( \bar q_0\right) +\Delta \left( x;q^{\prime },t\right) \right] ,
\end{array}$$ where the correction term $\Delta $ satisfies the estimates$$\left| \partial _x^k\partial _q^\alpha \Delta \left( x;q^{\prime },t\right)
\right| \leq \frac{\hat Nh\left( q^{\prime }\right) }{t^{d/2+1}+1}$$ for all multi-indices $\alpha $, $\left| \alpha \right| \leq \left[
d/2\right] +1$, and $k=0,...,s+1/3$, where $\hat N$ is a constant. Hence, $I\left( x;q^{\prime }\right) $ fulfills for $d\geq 3$ the estimates$$\left| \partial _x^k\partial _q^\alpha I\left( x;q^{\prime }\right) \right|
\leq \tilde Nh\left( q^{\prime }\right) ;\,\left| \alpha \right| \leq \left[
d/2\right] +1,k=0,...,s+1/3.$$ The contribution of this term to $C_{\varphi ,1}\left( q^{\prime }\right) $ is:$$\int dq\int dq^{\prime \prime }\frac{f_0^q\varphi \left( q\right)
K^{-}\left( \alpha ,a(q);q^{\prime },q^{\prime \prime }\right) \bar v\left(
q^{\prime \prime }\right) }{\left( a\left( q^{\prime }\right) -a\left(
q\right) +i0\right) \left( a\left( q^{\prime \prime }\right) -a\left(
q\right) +i0\right) }$$ $$\label{eq. 3.30}=\int dq\frac{f_0^q\varphi \left( q\right) I\left( a\left( q\right)
;q^{\prime }\right) }{a\left( q^{\prime }\right) -a\left( q\right) +i0}=\int_{{\mathbb
R}}dx\frac{m(x)I(x;q^{\prime })}{a\left( q^{\prime }\right) -x+i0},$$ where $$\label{eq. 3.31}m(x)=\int\limits_{a\left( q\right) =x}f_0^q\varphi \left(
q\right) dq.$$ As it follows from the proof of the point 1, $m(x)$ is $s+1/3$ times differentiable. The same property is shared by $I\left( x;q^{\prime
}\right) $ as a function of $x$ for every fixed $q^{\prime }$. Therefore, the integral over $x$ in ($\ref{eq. 3.30}$) converges. The convergence of the other terms entering $C_{\varphi ,1}\left(
q^{\prime }\right) $ can be proved similarly.\
3. Using the representation$$\varphi \left( q\right) =\int \varphi \left( q_0\right) \delta \left( q-q_0\right)
dq_0,\;\varphi \in {\cal S}\left( {\mathbb R}^d\right)$$ and the formula (\[eq. 3.23a\]) we find that $$\label{eq. 3.32}\Omega ^{+}\varphi =\int \varphi \left( q_0\right) \psi
^{q_0}dq_0=\left( C_{\varphi ,0},C_{\varphi ,1}\left( \cdot \right) \right) \in {\cal
H}^{ac}\subseteq {\cal H}^{\left( \leq 1\right) }.$$ In view of the unitarity of the application $\Omega ^{+}: L^2\left({\mathbb
R}^d\right) \rightarrow {\cal H}^{ac}$, one has $$\label{eq. 3.33}
\begin{array}{l}
\left( \varphi _1,\varphi _2\right) _{L^2({\mathbb R}^d) }=\left( \Omega ^{+}\varphi
_1,\Omega ^{+}\varphi _2\right)
\\ =\bar C_{\varphi _1,0}C_{\varphi _2,0}+\int \bar C_{\varphi _1,1}\left(
q\right) C_{\varphi _2,1}\left( q\right) dq.
\end{array}$$ 4. Since ${\cal S}\left( {\mathbb R}^d\right) $ is dense in $L^2\left( {\mathbb R}^d\right) ,$ the image $\Omega ^{+}{\cal S}\left( {\bf
R}^d\right) $ is dense in ${\cal H}^{ac}$, therefore, in view of the unitarity of $\Omega ^{+} $, $\Omega ^{+}L^2({\bf
R}^d) ={\cal H}^{ac}$. The intertwining property $A\Omega
^{+}=\Omega ^{+}B$ is obtained in the standard way. Lemma \[L4.2\] is proved. $\square$ This lemma implies in particular that any vector $\psi \in {\cal
H}^{ac}$ has a unique representation as$$\psi =\psi _f=\int_{{\mathbb R}^d}f\left( q_0\right) \psi ^{q_0}dq_0:=\lim
\limits_{\varphi _n\rightarrow f}\psi _{\varphi _n}\,\,,\,\,\,f\in L^2\left( {\mathbb R}^d\right) .$$ Here, the limit in the right-hand side is meant in ${\cal H}^{ac}$ and $\left\{ \varphi _n\right\} $ is a sequence of elements of ${\cal S}\left( {\mathbb
R}^d\right) $ converging to $f$ in $L_2.$
Construction of the one-boson subspace
--------------------------------------
As explained in Section \[outline\], the construction of the one-boson subspace of $H_p$ relies on the spectral representation of the operators $ \left\{A_p\left( \xi \right)\right\}_{\xi
\leq \kappa } $, see (\[eq. 1.25\]), entering the reduced system (\[eq. 2.23\]): $$\label{eq. 4.1}
\begin{array}{lll}
\left( A_p\left( \xi \right) F\right) _0 & =e_{0,p}^0f_0 & +\alpha \int
\overline{c\left( p-q,q\right) }f_1\left( q\right) dq \\ & & \\
\left( A_p\left( \xi \right) F\right) _1\left( q\right) & =\alpha c\left(
p-q,q\right) f_0 & +a_p\left( \xi ;q\right) f_1\left( q\right) \\
& & +\alpha ^2\int D_p\left( \xi ;q,q^{\prime }\right) f_1\left( q^{\prime
}\right) dq^{\prime }, \\
& & \\
& & F=\left( f_0,f_1\left( \cdot \right) \right) \in {\cal H}^{\left( \leq
1\right) }.
\end{array}$$ Since for any $\xi \leq \kappa $ the operator $A_p\left(
\xi \right)$ satisfies all the assumptions of the previous subsection, there exists a family $$\label{eq. 4.2}\left\{F_{\xi ,1}^q=\left( f_{\xi ,0}^q, f_{\xi ,1}^q\left( \cdot
\right) \right)\right\}_{q\in {\mathbb R}^d}$$ of generalized eigenvectors of $A_p\left( \xi \right) $ with eigenvalues $
\left\{a_p\left( \xi ;q\right)\right\}_{q\in {\mathbb R}^d}$, given by (\[eq. 3.24\]), (\[eq. 3.25\]), where $a\left( q\right) $ is replaced by $a_p\left( \xi ;q\right) $, and $\Delta ^{-}$, $K^{-}$ by the functions $\Delta _\xi ^{-}$, $K_\xi ^{-}$, entering the expression of the resolvent of $A_p\left( \xi \right) $. Let $F_{\xi ,2}^q$ be constructed in terms of $f_{\xi
,1}^q\left( \cdot \right) $ according to (\[eq. 2.8\]), i.e. $F_{\xi ,2}^q=S\left( \xi \right) f_{\xi ,1}^q$ where the application $S\left( \xi \right) $ was introduced in equation (\[eq. 2.7a\]) (more precisely, $S(\xi )$ is the extension of that operator to the space ${\cal B}_1^{(k)}$ defined below), where the coefficient functions are the solution of the fixed point equation (\[eq. 2.12\]). Then, the complete sequence $$\label{eq. 4.3}F_\xi ^q=\left( F_{\xi ,1}^q,F_{\xi ,2}^q\right) =\left(
f_{\xi ,0}^q,f_{\xi ,1}^q\left( q_1\right) ,f_{\xi ,2}^q\left(
q_1,q_2\right) ,...\right)$$ satisfies the equation $$\label{eq. 4.4}H_pF_\xi ^q=\xi F_\xi ^q+\left( a_p\left( \xi ;q\right) -\xi
\right) \hat F_\xi ^q,$$ where we denoted $\hat F_\xi ^q=\left( F_{\xi ,1}^q,0\right) $. Therefore, if $\xi \left( q\right) $ is a solution of equation $$\label{eq. 4.5}a_p\left( \xi ;q\right) -\xi =0,$$ then $F_{\xi (q)}^q$ is a generalized eigenvector of the operator $H_p$ with eigenvalue $\xi\left( q\right) \equiv \xi_{p} \left(
q\right) $, cf (\[eq. 1.27’\]) in Remark \[R2.1\].
We shall give below sense to the generalized eigenfunctions $F_\xi
^q$ as elements of the dual $\left( {\cal B}^{(k)}\right) ^{\prime
}$ of an auxiliary Banach space ${\cal B}^{(k)}$, $k=\left[
d/2\right] +2$, densely and continuously embedded in the Fock space ${\cal F}$.
\[D4.1\] Let us denote ${\cal B}_n^{(k)}$ the space of all symmetric functions $g$ of $n$ variables $q_1,...,q_n\in {\mathbb R}^d$, $k$ times continuously differentiable with respect to each $q_i$, and for which there exists a constant $C$ such that, for all multi-indices $\alpha =\left( \alpha _1,...,\alpha
_n\right) $, $\alpha _i=\left( \alpha _i^1,...,\alpha _i^d\right) $, $\left| \alpha
_i\right| =\sum\limits_{s=1}^d\alpha _i^s\leq k $, one has $$\label{eq. 4.7}\left| \partial_{q}^\alpha g\left( q_1,...,q_n\right) \right| \leq C
\prod\limits_{i=1}^n h\left( q_i\right) ,\;\forall q_1,...,q_n \in {\mathbb R}^d.$$ It is a Banach space if endowed with the norm $\left\|
g\right\| _n^{(k)}=\inf C$, where the infimum is taken over all $C$ for which the estimate (\[eq. 4.7\]) holds.
Clearly, the inclusion ${\cal B}_n^{(k)}\subset {\cal H}^{(n)}$ is continuous and ${\cal B}_n^{(k)}$ is dense in ${\cal H}^{(n)}$. Let next $$\label{eq. 4.8}{\cal B}^{(k)}={\mathbb{C}}+{\cal B}_1^{(k)}+...+{\cal B}_n^{(k)}+...\subset {\cal F}$$ be the space of sequences$$G=\left( g_0,g_1\left( q_1\right) ,...,g_n\left( q_1,...,q_n\right)
,...\right) ,\;g_0\in {\mathbb C},g_n\in {\cal B}_n^{(k)},$$ with norm $$\label{eq. 4.9}\left\| G\right\| _{{\cal B}^{(k)}}^{(k)}=\left[ \left|
g_0\right| ^2+\sum\limits_{n\geq 1}\frac 1{n!}\left( \left\| g_n\right\|
_n^{(k)}\right) ^2\right] ^{1/2}.$$ Obviously, ${\cal B}^{(k)}$ is continuously and densely embedded in the Fock space ${\cal F}
$, as required. The dual $\left( {\cal B}^{(k)}\right) ^{\prime }$ of ${\cal B}^{(k)}$ consists of sequences $F=\left( f_0,f_1,...,f_n,...\right)
$, where $f_0\in {\mathbb C}$, and $f_n\in \left( {\cal
B}_n^{(k)}\right) ^{\prime } $ are linear continuous functionals on ${\cal B}_n^{(k)}$; thereby, the value of $F$ at an element $G\in
{\cal B}^{(k)}$ is given by the series: $$\label{eq. 4.10}\left( F,G\right) =\left[ \bar f_0g_0+\sum\limits_{n\geq
1}\frac 1{n!}\left( f_n,g_n\right) \right] ^{1/2},$$ and the norm of $F$ is $$\label{eq. 4.11}\left\| F\right\| _{\left( {\cal B}^{(k)}\right) ^{\prime
}}^{(k)}=\left[ \left| f_0\right| ^2+\sum\limits_{n\geq 1}\frac 1{n!}\left(
\left\| f_n\right\| _{\left( {\cal B}_n^{(k)}\right) ^{\prime }}\right)
^2\right] ^{1/2}.$$ Clearly, ${\cal F}\subset \left( {\cal B}^{(k)}\right) ^{\prime }$ and the inclusion is continuous.
\[4.3\] For every $q\in {\mathbb R}^d$ and $\xi \leq
\kappa $ , $F_\xi ^q\in \left( {\cal B}^{(k)}\right) ^{\prime }$ and has the representation $$\label{eq. 4.12}F_\xi ^q=\hat \delta _q+\tilde F_\xi ^q,$$ where $\hat \delta _q=\left( 0,\delta _q,0,...\right) $ and $$\label{eq. 4.13}\left\| \tilde F_\xi ^q\right\| _{\left( {\cal B}^{(k)}\right) ^{\prime }}\leq M\alpha \,\, h\left( q\right)$$ for some constant $M$.
*Proof*: We prove this statement in three steps.\
I. The $n=0$ component of $\tilde{F}_\xi ^q$, $\tilde{f}_{\xi
,0}^q$, is given by equation (\[eq. 3.24\]), where $v(q)=c(p-q,q)$, $a(q)=a_p\left( \xi ,q\right) $ and $K^{-}=K_\xi
^{-}$. If *condition* \[cond.2\] in Section \[sec:fried\] is fulfilled for every $\xi \leq \kappa $ and $p$, we have $\Delta ^{-}\left( a\left( q\right) \right) \geq \tau >0$, therefore we obtain for the first term in (\[eq. 3.24\]) $$\label{eq. 4.14}\left|\frac{(-\alpha v(q))}{\Delta ^{-}\left(
a\left( q\right) \right) }\right| \leq \frac \alpha \tau h(q).$$ The second term in (\[eq. 3.24\]) is treated using as before the stationary phase method, which gives $$\label{eq. 4.15}
\begin{array}[b]{l}
\int K^{-}\left( \alpha ,a\left( q\right) ;q^{\prime },q\right) \bar v\left(
q^{\prime }\right) \left( a\left( q^{\prime }\right) -a\left( q\right)
+i0\right) ^{-1}dq^{\prime } \\
=i\int\limits_0^\infty dt\left[ \hat C\left( t^{d/2}+1\right)
^{-1}e^{it\left( a\left( \bar q_0\right) -a\left( q\right) \right)
}K^{-}\left( \alpha ,a\left( q\right) ;\bar q_0,q\right) \bar v\left( \bar
q_0\right) +\Delta \left( q,t\right) \right] ,
\end{array}$$ where $$\label{eq. 4.16}\left| \Delta \left( q,t\right) \right| \leq C
h(q)\left( t^{d/2+1}+1\right) ^{-1}.$$ for some constant $C$. Equations (\[eq. 4.14\]), (\[eq. 4.15\]), (\[eq. 4.16\]) provide $$\label{eq. 4.17}\left| \tilde{f}_{\xi ,0}^q\right| \leq B\alpha
\,\,h(q).$$ II. The $n=1$ component of $F_\xi ^q$, $f_{\xi ,1}^q=\delta _q+\tilde f_{\xi ,1}^q$, is given by equation (\[eq. 3.25\]), with the same assignments for $v$, $a$, and $K^{-}$. Again, reducing the estimate of every integral entering $\left( \tilde f_{\xi ,1}^q,g_1\right) $ for a generic $g_1\in {\cal B}_1^{(k)}$ to the estimate of the corresponding oscillatory integral, and using thereby the estimate (\[eq. 4.14\]), we obtain $$\label{eq. 4.18}\left\| \tilde f_{\xi ,1}^q\right\| _{\left( {\cal B}_1^{(k)}\right) ^{\prime }}\leq L\alpha ^2\,\, h\left( q\right) .$$ III. The higher components of $\tilde{F}_\xi ^q$, $\{\tilde{f}_{\xi
,n}^q \}_{n\geq 2}$ , are estimated using their representation (\[eq. 2.8\]) in terms of $f_{\xi ,1}^q$. We have $$\label{eq. 4.19}
\begin{array}[b]{l}
\left( \tilde{f}_{\xi ,n}^q,g_n\right) = \\ =\sum\limits_{i=1}^n\int
b_n\left( q_1,...,\check q_i..,q_n;q_i\right) f_{\xi
,1}^q\left( q_i\right) g_n\left( q_1,...,q_n\right) dq_1...dq_n \\
+\int d_n\left( q_1,...,q_n;q^{\prime }\right) f_{\xi ,1}^q\left(
q^{\prime }\right) g_n\left( q_1,...,q_n\right)
dq_1...dq_ndq^{\prime }.
\end{array}$$ Using the estimates for $b_n$, $d_n$ and their derivatives (see (\[eq. 2.10\]) and Lemma \[L3.2\]), and also the bound (\[eq. 4.18\]), we have that $$\begin{array}[b]{l}
\int \left| \int b_n\left( q_1,...,\check q_i..,q_n;q_i\right)
\tilde{f}_{\xi,1}^q\left( q_i\right) g_n\left( q_1,...,q_n\right) dq_i\right|
dq_1...d\check q_i...dq_n \\ \leq C_1\alpha \left( \lambda _2(p)-\kappa \right)
^{-1}\left\| g_n\right\| _{{\cal B}_n^{(k)}}\left( 1+L\alpha ^2\right) h\left(
q\right) \left( \int h(q^{\prime })dq^{\prime }\right) ^{n-1}
\end{array}$$ for $i=1,...,n$, and also that $$\begin{array}[b]{l}
\left| \int d_n\left( q_1,...,q_n;q^{\prime }\right) \tilde{f}_{\xi ,1}^q\left(
q^{\prime }\right) g_n\left( q_1,...,q_n\right) dq_1...dq_ndq\right| \\ \leq C_2\alpha
\left( \lambda _2(p)-\kappa \right) ^{-1}\left\| g_n\right\| _{{\cal B}_n^{(k)}}\left(
1+L\alpha ^2h\left( q\right) \right) h\left( q\right) \left( \int h(q^{\prime
})dq^{\prime }\right) ^n.
\end{array}$$ Hence, with suitable constants $\tilde C$, $\tilde L$, $$\label{eq. 4.20}\left\| \tilde{f}_{\xi ,n}^q\right\| _{\left( {\cal B}_n^{(k)}\right) ^{\prime }}\leq \tilde C\frac \alpha {\lambda
_2(p)-\kappa }\left( 1+\tilde L\alpha ^2\right) \cdot h\left(
q\right) \left( \int h(q^{\prime })dq^{\prime }\right) ^{n-1}.$$ Putting together equations (\[eq. 4.17\]), (\[eq. 4.18\]) and (\[eq. 4.20\]), we obtain (\[eq. 4.13\]). The lemma is proved. $\square$
Now we come back to the study of the generalized eigenvectors $F_{\xi (q)}^q$.
Let us remark that $a_p\left( \xi ;q\right) $ is, for every fixed $q$, a smooth, monotonously decreasing function of $\xi $ on $\left( -\infty
,\kappa \right] $. If $$\label{eq. 4.6}G_p^{(1),\kappa }=\left\{ q\in {\mathbb R}^d: \;a_p\left( \kappa
;q\right) -\kappa <0\right\} ,$$ then equation (\[eq. 4.5\]) has a unique solution $\xi \left( q\right) <\kappa $ if $q\in G_p^{(1),\kappa }$, and no solution if $q\notin G_p^{(1),\kappa }$, see Figure 1.
\[Rnew\] The function $\xi \left( q\right) \equiv \xi _p\left( q\right) $ can be represented in the form $$\label{eq. 4.55a}\xi _p\left( q\right) =\varepsilon \left( q\right) +\gamma \left(
p-q\right)$$ where the function $\gamma \left( k\right) $ is defined in the domain $\{
k: p-k\in G_p^{(1),\kappa }\} $.
*Proof*: Indeed, let us use the expansion $$\label{4.55b}
\mu =\mu _0-\Gamma \mu _0+\Gamma ^2\mu _0+...$$ for the solution of equation (\[eq. 2.12\]), and remark that the function $b_2^0\left( q_1;q\right) $ appearing in (\[eq. 2.13\]) can be written in the form $$\label{4.55c}
b_2^0\left( q_1;q\right) \equiv b_{2,p}^0\left( q_1;q\right) =\varphi ^0_{q_1}
\left( p-q;z-\varepsilon \left( q\right) \right)$$ with $\varphi ^0_{q_1}\left( k;w\right) $ defined for $k\in {\mathbb
R}^d, w\in {\mathbb C}$ such that $\mathfrak{Re}\,w<\kappa
-\varepsilon \left( q\right) $. One can prove by induction, using the formula (\[eq. 2.9b\]), that, in every term $\Gamma ^k\mu _0$ of the expansion (\[4.55b\]), the function $b_{n,p}^{(k)}\left(
z;q_1,...,q_{n-1};q\right) $ has, for fixed $q_1,...,q_{n-1}$, a form similar to (\[4.55c\]), i.e. $$\label{4.55d}
b_{n,p}^{(k)}\left( z;q_1,...,q_{n-1};q\right) = \varphi
^{(k)}_{q_1,...,q_{n-1}}
\left( p-q;z-\varepsilon \left( q\right) \right) .$$ Then, it follows that the coefficient functions $b_{n}\equiv
b_{n,p}$ of the solution $\mu $ given by (\[4.55b\]) are of the same form (\[4.55d\]), in particular, $$\label{4.55e}
b_{2,p}\left( q_1;q\right) =\varphi _{q_1}
\left( p-q;z-\varepsilon \left( q\right) \right)$$ Plugging this expression into (\[eq. 2.21\]), we find that $m_p$ depends only on the differences $p-q$ and $z-\varepsilon \left( q\right)$: $$\label{4.45f}
m_p\left( z,q\right) =\tau \left( p-q;z-\varepsilon \left( q\right) \right) .$$ Hence, by virtue of (\[eq. 1.10\]), ( \[a-m-relation\]) and (\[4.45f\]) the equation (\[eq. 4.5\]) $$\label{4.45h}
\frac{1}{2}{\left( p-q\right) }^2+ \varepsilon \left( q\right) + m_p\left(
\xi,q\right) =\xi$$ writes as $$\label{4.45g}
\frac{1}{2}\left( p-q\right) ^2+\tau \left( p-q;\gamma \right) =\gamma$$ This implies that $\gamma \equiv \xi - \varepsilon \left( q\right)$ is a function of $p-q$ alone.$\square $
Clearly, by the convexity of $e_{1,p}^0$ and the asymptotical properties of $m_p(\xi ,q)$ given in Corollary \[C3.4\], $G_p^{(1),\kappa }$ is a bounded domain, nonvoid for $\kappa
>\lambda _1(p)$, and $\min \limits_{q\in G_p^{(1),\kappa }}\xi \left( q\right) =\lambda _1(p)$.
By the smoothness of $a_p\left( \xi ,q\right) $ with respect to both arguments, the function $\xi \left( q\right) $ defined on $G_p^{\left( 1\right) ,\kappa }$ is also smooth. Moreover, for $\alpha $ sufficiently small, this function has a unique critical point (namely, a minimum), which is nondegenerate. In particular, it follows that on every level of $\xi
\left( q\right) $,$$\chi _x=\left\{ q\in G_p^{\left( 1\right) ,\kappa }:\;\xi \left( q\right)
=x\right\} ,$$ one can define a measure $\nu _x$ (the Gelfand-Leray measure, see [@Gelfand]), such that, for any integrable function $\varphi $ on $G_p^{\left( 1\right) ,\kappa }$, $$\label{eq. *}\int_{G_p^{\left( 1\right) ,\kappa }}\varphi \left( q\right)
dq=\int\limits_{\lambda _1\left( p\right) }^\kappa dx\int_{\chi _x}\varphi
_xd\nu _x,$$ where $\varphi _x=\varphi \mid _{\chi _x}$ is the restriction of $\varphi $ to the surface $\chi _x$. From (\[eq. \*\]) it follows that $L^2\left( G_p^{\left( 1\right) ,\kappa },dq\right) $ can be represented as a direct integral of Hilbert spaces: $$\label{eq. dir-int}L^2\left( G_p^{\left( 1\right) ,\kappa },dq\right)
=\int\limits_{\left[ \lambda _1(p),\kappa \right] }^{\oplus }{\mathcal{H}}_xdx,$$ with ${\mathcal{H}}_x:=L^2\left( \chi _x,\nu _x\right) $.
Let us now consider the family $\left\{ F_{\xi (q)}^q\right\}_{q \in
G_p^{(1),\kappa }} \subset \left( {\cal B}^{(k)}\right) ^{\prime }$ of generalized eigenvectors of $H_p$. The next lemma , which may be stated formally as an approximate orthonormality of this family, is an important element of our constructions. We denote $$F\left( \varphi \right):= \int\limits_{G_p^\kappa }F_{\xi
(q)}^q\varphi (q)dq\in \left( {\cal B}^{(k)}\right) ^{\prime } ,$$ for $\varphi \in {\cal D}\left( G_p^{(1),\kappa }\right)$, the space of infinitely differentable functions with support in $G_p^{(1),\kappa }$.
\[L4.4\] (i) For any $\varphi \in {\cal D}\left( G_p^{(1),\kappa }\right) $, one has $F\left( \varphi \right) \in {\cal F}$ .\
(ii) There exist functions $S(q)$ and $M(q,q^{\prime })$ defined for $q,q^{\prime }\in G_p^{(1),\kappa }$ , such that, for any $\varphi _1,\varphi _2\in {\cal D}\left( G_p^{(1),\kappa }\right)$, the following representation holds: $$\label{eq. 4.21}
\begin{array}[b]{r}
\left( F\left( \varphi _1\right) ,F\left( \varphi _2\right) \right) _{
{\cal F}}=\int\limits_{\lambda _1\left( p\right) }^\kappa dx\left[
\int_{\chi _x}\left( 1+S_x(q)\right) \left| \varphi _x(q)\right| ^2d\nu
_x\right. \\ \left. +\int_{\chi _x}\int_{\chi _x}\bar \varphi
_x(q)M_x(q,q^{\prime })\varphi _x(q^{\prime })d\nu _x\left( q\right) d\nu
_x\left( q^{\prime }\right) \right] .
\end{array}$$ Here, $\varphi _x,S_x$ and $M_x$ denote the restrictions of the functions $\varphi ,S$ and $M$ to $\chi _x$ and $\chi _x\times \chi _x$ , respectively.\
(iii) The following estimates hold with suitable constants $\bar C$, $\hat C$ : $$\label{eq. 4.33'}\left| S(q)\right| \leq \bar C \, \frac \alpha
{\lambda _2(p)-\kappa },$$ $$\label{eq. 4.33}\left| M(q,q^{\prime })\right| \leq \hat C
\,\,\alpha \, h(q)h(q^{\prime }),$$ implying that $F\left( \varphi \right) \in {\cal F}$, for $\varphi \in L^2\left( G_p^{(1),\kappa }\right) $ and $$\label{eq. 4.34}C_1\left\| \varphi \right\| _{L^2\left(
G_p^{(1),\kappa }\right) }\leq \left\| F(\varphi )\right\| \leq
C_2\left\| \varphi \right\| _{L^2\left( G_p^{(1),\kappa }\right) }.$$
*Proof*: (i) This assertion will follow from the calculations below.\
(ii) In the sense of distributions, equation (\[eq. 4.21\]) means that $$\label{eq. 4.21'}\left( F_{\xi (q)}^q,F_{\xi (q^{\prime })}^{q^{\prime
}}\right) _{{\cal F}}=\left( 1+S(q)\right) \delta \left( q-q^{\prime
}\right) +M(q,q^{\prime })\delta \left( \xi (q)-\xi (q^{\prime })\right)$$ Before we proceed, the following remarks are in order:\
$1^{\circ}$. We seemingly make an abuse in calculating the scalar product $\left( F_\xi ^q,F_{\xi ^{\prime }}^{q^{\prime }}\right)
_{{\cal F}}$ of two generalized functions. Such calculations can be justified in the following way. The Fourier transform $\tilde F_{\xi
,n}^q\left( \zeta _1,...,\zeta _n\right) $ of the generalized function $F_{\xi ,n}^q\left( q_1,...,q_n\right) $ is, as one can easily verify, a usual function of the variables $\left( \zeta
_1,...,\zeta _n\right) $ polynomially bounded at infinity in these variables. If, further, we view the scalar product $\left( F_{\xi
,n}^q,F_{\xi ^{\prime },n}^{q^{\prime }}\right) _{L^2\left( {\mathbb R}^{nd}\right) }$ as the limit of scalar products:$$\left( \tilde F_{\xi ,n}^q,\tilde F_{\xi ^{\prime },n}^{q^{\prime }}\right)
_{L^2\left( {\mathbb R}^{nd}\right) }:=\lim \limits_{\delta \searrow 0}\int_{{\mathbb R}^{nd}}\overline{\tilde F_{\xi ,n}^q\left( \zeta _1,...,\zeta _n\right)
}\tilde F_{\xi ^{\prime },n}^{q^{\prime }}\left( \zeta _1,...,\zeta _n\right)
\prod\limits_{i=1}^n\left( e^{-\delta \left| \zeta _i\right| }d\zeta _i\right) ,$$ then one can prove that this limit exists in the sense of convergence of generalized functions of the variables $q,q^{\prime }$. We shall not provide the details of this justifying procedure, and write instead directly its result entering our calculations.\
$2^{\circ}$. We shall exploit the ”orthogonality” of the generalized eigenfunctions $F_{\xi (q)}^q$, $q\in G_p^{(1),\kappa }$, corresponding to different eigenvalues $\xi (q)\neq \xi (q^{\prime })$, by supposing that the support of the generalized function$$Q\left( q,q^{\prime }\right) :=\left( F_{\xi (q)}^q,F_{\xi (q^{\prime
})}^{q^{\prime }}\right) _{{\cal F}}$$ is contained in the surface $\Sigma =\left\{ \left( q,q^{\prime }\right) \in
G_p^{(1),\kappa }\times G_p^{(1),\kappa }:\;\xi (q)=\xi (q^{\prime
})\right\} $: $$\label{eq. **}\text{supp}Q\subset \Sigma$$ and neglect in our calculation all terms which do not contribute to the factors in front of $\delta \left( \xi (q)-\xi (q^{\prime })\right) $ or $\delta \left( q-q^{\prime }\right) $. However, the relation (\[eq. \*\*\]) likewise needs a justification. Namely, if we did not skip these ”non-contributing” terms in the calculations, we would obtain a generalized function $\tilde Q\left( q,q^{\prime }\right) $, such that, for smooth functions $\varphi _i\left( q\right) $, $i=1,2$ with support contained in $G_p^{(1),\kappa }$, the scalar product$$\left( F\left( \varphi _1\right) ,F\left( \varphi _2\right) \right) _{{\cal F}}=\int\limits_{G_p^{(1),\kappa }\times G_p^{(1),\kappa }}\tilde Q\left(
q,q^{\prime }\right) \bar \varphi _1\left( q\right) \varphi _2\left(
q^{\prime }\right) dqdq^{\prime }$$ would be finite, in particular, $F\left( \varphi \right) \in {\cal F}$ for smooth $\varphi $. On the other hand, if the support of $\varphi $ was contained in an $\varepsilon $-neighbourhood of the level $\chi _x$, then $F\left( \varphi \right) \in E\left( x-\varepsilon ,x+\varepsilon \right)
{\cal F}$, where $\left\{ E\left( \Delta \right) \right\} $ denotes the family of spectral projections of $H_p$. Hence, for $\varphi _i\left(
q\right) $, $i=1,2$ with supports respectively contained in nonintersecting $\varepsilon $-neighbourhoods of the levels $\chi _{x_i}$, where $x_1\neq x_2$, the vectors $F\left( \varphi _i\right) $, $i=1,2,$ would be orthogonal. This proves in fact (\[eq. \*\*\]).
Keeping these remarks in mind, we proceed with the proof of (ii).\
One has $$\label{eq. 4.22}\left( F_{\xi (q)}^q,F_{\xi (q^{\prime })}^{q^{\prime
}}\right) _{{\cal F}}=\left( \Pi _1F_{\xi (q)}^q,\Pi _1F_{\xi (q^{\prime
})}^{q^{\prime }}\right) _{{\cal H}^{\left( \leq 1\right)
}}+\sum\limits_{n=2}^\infty \left( F_{\xi (q),n}^q,F_{\xi (q^{\prime
}),n}^{q^{\prime }}\right) _{{\cal H}^{\left( n\right) }}$$ As $H_p$ is self-adjoint and $F_{\xi (q)}^q$ are its generalized eigenfunctions with eigenvalue $\xi (q)$, the support of this distribution is contained in $\xi (q)=\xi (q^{\prime })$. As $\Pi
_1F_{\xi (q)}^q=\psi ^q$ and $\Pi _1F_{\xi (q^{\prime })}^{q^{\prime
}}=\psi ^{q^{\prime }}$ are generalized eigenvectors of the operator $A\left( \xi \right) $ for $\xi =\xi \left( q\right) =\xi \left(
q^{\prime }\right) $, we can use the relation (\[eq. 3.28a\]): $$\label{eq. 4.23}\left( \Pi _1F_{\xi (q)}^q,\Pi _1F_{\xi (q^{\prime
})}^{q^{\prime }}\right) _{{\cal H}^{\left( \leq 1\right) }}=\delta \left(
q-q^{\prime }\right) ,\;\left( \xi (q)=\xi (q^{\prime })\right) .$$ We are therefore left with calculating $\left( F_{\xi (q),n}^q,F_{\xi
(q^{\prime }),n}^{q^{\prime }}\right) _{{\cal H}^{\left( n\right) }}$ for $n\geq 2$. To this aim, use is made of the representation (\[eq. 2.8\]) $$\label{eq. 4.24}
\begin{array}[b]{r}
F_{\xi (q),n}^q=\sum\limits_{i=1}^nb_n\left( \xi (q);q_1,...,\check
q_i..,q_n;q_i\right) f_{\xi (q),1}^q\left( q_i\right) \\
+\int d_n\left( \xi (q);q_1,...,q_n;q^{\prime }\right) f_{\xi (q),1}^q\left(
q^{\prime }\right) dq^{\prime }.
\end{array}$$ The second term in (\[eq. 4.24\]) is a smooth function of $q_1,...,q_n$ and does not contribute to the terms containing $\delta \left( \xi (q)-\xi
(q^{\prime })\right) $ or $\delta \left( q-q^{\prime }\right) $. Likewise, it is not hard to see that the only contributions to such terms come from $$\label{eq. 4.25}
\begin{array}{r}
\int
\overline{b_n\left( \xi (q);q_1...\check q_i...q_n;q_i\right) f_{\xi
(q),1}^q\left( q_i\right) }b_n\left( \xi (q^{\prime });q_1...\check
q_i...q_n;q_i\right) f_{\xi (q^{\prime }),1}^{q^{\prime }}\left( q_i\right)
dq_1...dq_n \\ =\int g_n\left( \xi (q),\xi (q^{\prime });\hat q\right)
\overline{f_{\xi (q),1}^q\left( \hat q\right) }f_{\xi (q^{\prime
}),1}^{q^{\prime }}\left( \hat q\right) d\hat q,
\end{array}$$ where $$\label{eq. 4.26}g_n\left( \xi ,\xi ^{\prime };\hat q\right) =\int \overline{b_n\left( \xi ;q_1...q_{n-1};\hat q\right) }b_n\left( \xi ^{\prime
};q_1...q_{n-1};\hat q\right) dq_1...dq_{n-1}.$$
In the integral over $\hat q$ in the r.h.s. of equation (\[eq. 4.25\]), we separate the singular parts of $f_{\xi (q),1}^q$, $f_{\xi
(q^{\prime }),1}^{q^{\prime }}$ using the *Sokhotski formula*: $$\frac{1}{x+i0} = \mathcal{P}\left( \frac{1}{x}\right) +i\pi \delta
\left( x\right)$$ in their expression (\[eq. 3.25\]) and the fact that $a_p\left(
\xi \left( q\right) ,q^{\prime }\right) =\xi \left( q\right) $ implies $\xi \left( q\right) =\xi \left( q^{\prime }\right) $, hence also $a_p\left( \xi \left( q\right) ,q^{\prime }\right) =\xi \left(
q^{\prime }\right) $ (in view of the uniqueness of the solution of $a_p\left( \xi ,q\right) =\xi $): $$\label{eq. 4.27}
\begin{array}{r}
f_{\xi (q),1}^q\left( q^{\prime }\right) =\delta \left( q-q^{\prime }\right)
+i\pi R_{\xi (q)}\left( q,q^{\prime }\right) \delta \left( \xi (q)-\xi
(q^{\prime })\right) \\
+\,{\rm regular\;terms}
\end{array}$$ where $$\label{eq. 4.28}
\begin{array}{l}
R_\xi \left( q,q^{\prime }\right) =\alpha ^2K_\xi ^{-}\left( \xi
;q,q^{\prime }\right) -\alpha f_{\xi ,0}^qc(p-q,q) \\
+\alpha ^2f_{\xi ,0}^q\int K_\xi ^{-}\left( \xi ;q^{\prime },q^{\prime
\prime }\right) c(p-q^{\prime \prime },q^{\prime \prime })\left( a_p\left(
\xi ,q^{\prime \prime }\right) -\xi +i0\right) ^{-1}dq^{\prime \prime }.
\end{array}$$ The regular parts do not contribute to (\[eq. 4.25\]), which becomes, after performing the integration over $\hat q$: $$\label{eq. 4.29}
\begin{array}[b]{r}
g_n\left( \xi (q),\xi (q);q\right) \delta \left( q-q^{\prime }\right)
\hfill \\ +i\pi \delta \left( \xi (q)-\xi (q^{\prime })\right) \left[
g_n\left( \xi (q),\xi (q);q^{\prime }\right) R_{\xi (q)}\left( q,q^{\prime
}\right) \right.
\hfill \\ \left. -g_n\left( \xi (q),\xi (q);q\right) \bar R_{\xi (q)}\left(
q^{\prime },q\right) \right] \\
+\pi ^2\int\limits_{\xi (q^{\prime \prime })=\xi (q)}g_n\left( \xi (q),\xi
(q);q^{\prime \prime }\right) R_{\xi (q)}\left( q,q^{\prime \prime }\right)
\bar R_{\xi (q)}\left( q^{\prime },q^{\prime \prime }\right) dq^{\prime
\prime }.
\end{array}$$ Let us define the function: $$\label{eq. 4.30}T\left( \xi ,q^{\prime }\right) =\sum\limits_{n=2}^\infty
\frac 1{n!}ng_n\left( \xi ,\xi ;q^{\prime }\right) .$$ Then, one can see from equations (\[eq. 4.23\]), (\[eq. 4.29\]) that (\[eq. 4.21’\]) is fulfilled with $$\label{eq. 4.31}S(q)=T(\xi (q),q),$$ $$\label{eq. 4.32}
\begin{array}{c}
M(q,q^{\prime })=i\pi \left[ T(\xi (q),q^{\prime })R_{\xi (q)}\left(
q,q^{\prime }\right) -T(\xi (q),q)\bar R_{\xi (q)}\left( q^{\prime
},q\right) \right] \\
+\pi ^2\int T(\xi (q),q^{\prime \prime })R_{\xi (q)}\left( q,q^{\prime
\prime }\right) \bar R_{\xi (q)}\left( q^{\prime },q^{\prime \prime }\right)
dq^{\prime \prime }.
\end{array}$$ (iii) Using the estimates in Lemma \[L3.2\], one obtains for $T$:$$\left| T\left( \xi ,q^{\prime }\right) \right| \leq C \,\frac
{\alpha} {\lambda _2(p)-\kappa }\,\,\sum\limits_{n=2}^\infty
\,\,\frac{\left\| h\right\| _{L_2}^{2(n-1)}}{\left( n-1\right)
!}=\bar C \,\,\frac \alpha {\lambda _2(p)-\kappa } \,.$$ Also, from the inequalities (\[eq. 4.17\]) and (\[eq. 3.8\]) it follows that$$\left| R_{\xi (q)}\left( q,q^{\prime }\right) \right| \leq Ch(q)h(q^{\prime
}),$$ wherefrom (\[eq. 4.33’\]), (\[eq. 4.33\]) follow. Using these estimates in equation (\[eq. 4.21\]), one obtains that $F(\varphi )\in {\cal F}$ for any $\varphi \in L^2\left( G_p^{(1),\kappa }\right) $ and, moreover the estimate (\[eq. 4.34\]) holds. The lemma is proved. $\square$ Let now ${\cal H}_1^\kappa (p)\subset {\cal F}$ be the subspace spanned by $ \left\{ F(\varphi ),\varphi \in L^2\left(
G_p^{(1),\kappa }\right) \right\} $. Equation (\[eq. 4.34\]) implies that the application $\varphi \longmapsto
F\left( \varphi \right) $ is continuous and invertible. Thereby, ${\cal H}_1^\kappa (p)$ is $H_p$-invariant and $$\label{eq. 4.35}H_pF\left( \varphi \right) =F\left( \hat \xi \varphi \right)
,$$ where $$\label{eq. 4.36}\left( \hat \xi \varphi \right) (q)=\xi (q)\varphi (q).$$
\[4.5\] There exists a bounded, invertible operator $
B:L^2\left( G_p^{(1),\kappa }\right) \rightarrow L^2\left(
G_p^{(1),\kappa }\right) $ which commutes with $H_p$ and such that: $$\label{eq. 4.37}\left( F\left( B\varphi _1\right) ,F\left( B\varphi
_2\right) \right) _{{\cal F}}=\left( \varphi _1,\varphi _2\right)
_{L^2\left( G_p^{(1),\kappa }\right) }.$$
*Proof*: We use the representation (\[eq. dir-int\]) of $L^2\left( G_p^{(1),\kappa },dq\right) $ as a direct integral of the spaces ${\mathcal{H}}_x$ and write ${\cal H}_1^\kappa (p)$ as a direct integral: $$\label{eq. 4.38}{\cal H}_1^\kappa (p)=\int\limits_{\left[ \lambda
_1\left( p\right) ,\kappa \right] }^{\oplus }{\cal H}_{1,x}dx \,.$$ Here ${\cal H}_{1,x}$ is the image of ${\mathcal{H}}_x$ by the application of $L^2\left(
G_p^{(1),\kappa },dq\right) $ into ${\cal H}_1^\kappa (p)$ and consists of functionals $$\label{eq. 4.39}F_x\left( \varphi \right) =\int\limits_{\chi _x}F_{\xi
\left( q\right) }^q\varphi \left( q\right) d\nu _x(q).$$ By virtue of (\[eq. 4.21’\]), $$\label{eq. 4.40}
\begin{array}[b]{r}
\left( F_x\left( \varphi _1\right) ,F_x\left( \varphi _2\right) \right) _{
{\cal F}}=\int\limits_{\chi _x}\left( 1+S(q)\right) \bar \varphi
_1(q)\varphi _2(q)d\nu _x(q) \\ +\int\limits_{\chi _x\times \chi _x}\bar
\varphi _1(q)M(q,q^{\prime })\varphi _2(q^{\prime })d\nu _x(q)d\nu
_x(q^{\prime }) \\
=\left( \left( I_x+V_x\right) \varphi _1,\varphi _2\right) _{{\cal H}_{1,x}},
\end{array}$$ where $I_x$ is the unit operator in ${\cal H}_{1,x}$ and $V_x$ is a bounded operator with small norm (cf. equations (\[eq. 4.33’\]), (\[eq. 4.33\])). Also, $H_p$ acts in ${\cal
H}_{1,x}$ as $xI_x$.
Let $B_x=\left( I_x+V_x\right) ^{-1/2}$. Then, equation (\[eq. 4.40\]) reads as $$\left( F_x\left( B_x\varphi _1\right) ,F_x\left(
B_x\varphi _2\right) \right) _{{\cal F}}=\left( \varphi _1,\varphi
_2\right) _{{\cal H}_{1,x}}.$$ Finally, defining $B =
\int\nolimits_{\left[ \lambda _1(p),\kappa \right] }^{\oplus
}B_xdx$, one gets both that the operator $B$ commutes with $H_p$ and that equation (\[eq. 4.37\]) is satisfied . $\square$
The ground state of $H_p$
=========================
A detailed analysis of the ground state of $H_p$ is performed in arbitrary dimension in [@Minlos]. In this section we shall briefly show how the existence of the ground state follows from our considerations for $d\geq 3$.
As explained in Section \[outline\], $H_p$ has a ground state if, and only if, there exists $\xi <\lambda _1\left( p\right) $, such that operator $A_p\left( \xi \right) $ in ${\cal H}^{\left( \leq 1\right) }$ has the eigenvalue $\xi $. By the analysis done in Section \[sec:fried\], $A_p\left( \xi \right) $ has one simple eigenvalue $e_p\left( \xi \right) <\lambda _1\left( p\right) $ if, and only if, $\Delta _p\left( \lambda _1\left( p\right) \right) <0$ (where $\Delta_p\left( \xi \right) $ is the function defined by equation (\[eq. 3.21\]) for $A_p\left( \xi \right) $), in which case $e_p\left( \xi \right) $ equals the unique solution of the equation $\Delta _p\left( \xi \right) =0$. Since $e_p^{\left(
0\right) }-\lambda _1\left( p\right) \rightarrow \infty $ for $p\rightarrow \infty $, while $\left( v,R_B\left( \lambda _1\left( p\right) \right) v\right) $ (with $v$ and $B$ corresponding to $A_p\left( \xi \right) $) is bounded, $\left\{ p;\Delta _p\left(
\lambda _1\left( p\right) \right) <0\right\} $ is a bounded domain.
As seen from equation (\[eq. 1.25\]), $A_p\left( \xi \right) $ is a decreasing family (in the usual order of self-adjoint operators), implying that $e_p\left( \xi \right) $ is a decreasing function of $\xi \in \left( -\infty
,\lambda _1\left( p\right) \right) $. We conclude that the equation $e_p\left( \xi \right) =\xi $ has a solution $\xi _p^{\left( 0\right)
}$ if, and only if, $p$ belongs to the subdomain $$G^{\left( 0\right) }=\left\{ p:\;e_p\left( \lambda _1\left( p\right) \right)
<\lambda _1\left( p\right) \right\} .$$ For $p\in G^{\left( 0\right) }$, let $F_{\xi _p^{\left( 0\right)
},1}$ be an eigenvector of $A_p\left( \xi _p^{\left( 0\right) }\right) $, and $F_{\xi _p,2}\in {\cal H}^{\left( \geq 2\right) }$ be defined according to (\[eq. 1.50\]). Then, the vector $F_p^{\left( 0\right)
}=F_{\xi _p^{\left( 0\right) },1} + F_{\xi _p^{\left(
0\right) },2}$ is a ground state of the operator $H_p$.
Therefore, $H_p$ has a unique ground state if $p\in G^{\left(
0\right) }$, and no ground state if $p\notin G^{\left( 0\right) }$.
Concluding remarks
==================
The main result of the paper is the construction, in the weak coupling regime, of a manifold of states indexed by a phonon momentum $q$. The ground state describing a single polaron becomes unstable at a certain momentum threshold, above which it dissolves into this manifold. It is to be expected that at still higher momenta the latter states become themselves unstable and dissolve into two-phonon states, etc. The representation (\[eq. 4.55a\]) of the eigenvalue $\xi \left( q\right) $ strongly suggests the interpretation of the generalized eigenfunctions $F_{\xi \left(
q\right) }^q$ associated to it as scattering states of a free phonon and a certain particle with the dispersion law $\gamma \left(
k\right) $. We cannot yet decide whether the latter particle is a polaron defined in our Theorem \[T1.1\], i.e. whether $\gamma
\left( k\right) =\xi _k^{\left( 0\right) } $, although we checked that this equality is true in the first nontrivial order in coupling constant: $\sim \alpha^2$. In this case the ground state instability at high $k$ might be interpreted as emission of a phonon.
Unfortunately, we were not able to prove in the present paper two essential results in favour of the above heuristic physical picture:
1\. First of all, we did not construct the whole one-boson subspace ${\cal H}_1^{\kappa =\lambda _2\left( p\right) }$ up to the two-boson threshold $\lambda _2\left( p\right) $. The approach used here of eliminating the higher components of the eigenvectors can equally well be applied in the case of the decomposition ${\cal F}={\cal H}^{\leq 2}\oplus {\cal H}^{\geq 3}$, leading to a family of self-adjoint operators $\left\{ A\left( \xi
\right) ,\;\lambda _1\left( p\right) \leq \xi \leq \kappa \right\}
$, (where $\lambda _2\left( p\right) \leq \kappa <\lambda
_3\left( p\right) $, i.e. $\kappa $ is between the two-boson and the three-boson threshold, defined similarly with $\lambda _2\left(
p\right) $), acting in the space ${\cal H}^{\leq 2}$ of triples $\left( f_0,f_1\left( \cdot \right) ,f_2\left( \cdot ,\cdot \right)
\right) $. These operators have a more complicated structure than the Friedrichs operators in ${\cal H}^{\leq 1}$ and their spectral analysis and scattering theory is not available in such details as for the Friedrichs operators. If this theory was elaborated (e.g. using equations analogous to the Faddeev-Yakubovski equations for the resolvent of $n$-body Schrödinger operators, see [@Yakubovski] - [@Hepp]), then the approach of the present paper would provide the construction of the whole one-boson subspace and of a part of the two-boson subspace.
2\. Secondly, we did not prove the completeness of the constructed subspaces ${\cal H}_0\left( p\right) $ (generated by the ground state) and ${\cal H}_1^\kappa
\left( p\right) $, meaning that in $\left( {\cal H}_0\left( p\right) \oplus
{\cal H}_1^\kappa \left( p\right) \right) ^{\perp }$ the spectrum of $H_p$ has no point below $\kappa $. We are convinced that this assertion is true and hope to prove it in the future.
[**Acknowledgements**]{}
N.A. and R.A.M. acknowledge the warm hospitality of the C.P.T. Luminy-Marseille, where the project of this work was born. R.A.M. also acknowledges financial support from the Scientific Fund of the Russian Federation (Grant No. 02-01-00444) and the Presidential Fund for Support of Scientific Schools of Russia (Grant No. 934 2003.1).
[99]{}
H.Fröhlich, Electrons in lattice fields, *Adv.Phys.* [**3**]{}, 325-364 (1954).
R.A.Minlos, Lower branch of the spectrum of a fermion interacting with a bosonic gas (polaron), *Theor. Math. Phys.* [**92**]{}, 255-268 (1992).
H.Spohn, The polaron at large total momentum, *J.Phys.A* [**21**]{}, 1199-1212 (1988).
B.Gerlach, H.Löwen, Analytical properties of polaron systems or: Do polaronic phase transitions exist or not?, *Rev.Mod.Phys.* [**63**]{}, 63-90 (1991).
J.Fröhlich, Existence of dressed one electron states in a class of persistent models, *Fortschr.Phys.* [**22**]{}, 159-198 (1974).
K.O.Friedrichs, [*Perturbation of Spectra in Hilbert Space*]{}, Amer. Math. Soc., Providence, 1965.
D.R.Yafaev, [*Scattering Theory*]{}, St.-Petersburg University, 1994.
M.Reed and B.Simon, [*Methods of Modern Mathematical Physics Vol. IV* ]{}, Academic Press, New York, 1983.
I.M.Gelfand and G.E.Shilov, [*Generalized Functions, Vol.3*]{}, Nauka, Moscow, 1959.
Yu.M.Berezanski [*Eigenfunction Expansion of Self-Adjoint Operators*]{}, Naukova Dumka, Kiev, 1965.
O.A.Yakubovski, On the integral equations in the theory of N-particle scattering, *Yadernaya Fizika* [**5**]{}, 1312-1320 (1967).
L.D.Faddeev, Mathematical questions in the quantum theory of scattering for a system of three particles, *Trudy Mat. Inst. Steklov.* [**69**]{} 122pp (1963) K.Hepp, On the quantum-mechanical N-body problem, *Helv.Phys.Acta* [**42**]{}, 425-458 (1969).
| 2023-12-24T01:27:15.642919 | https://example.com/article/6171 |
Subtitles Brothers
Overview
An intense drama on the portrayal of brotherhood, BROTHERS depicts the mistrust and feud between two brothers through the eyes of an investigating police officer. Despite their close relationship, Yiu and Shun were separated at a young age due to a decision made by their father. Years later they meet again when the family runs into crisis where Yiu, inspired by his father's last words, manipulates a series of setups which endangers Shun's life, so as to achieve his goal. The crisis brings the two brothers back together again. However, a series of setups arranged by Yiu causes Shun to flee to Thailand, accompanied by confidantes Ching (Crystal Huang) and Ghostie (Wong Yat-wah). As Shun is caught between life and death, the trust between the brothers is put to a serious test. When Shun finally realizes the true intention of his brother, things are already beyond repair. | 2024-04-30T01:27:15.642919 | https://example.com/article/3642 |
16 May Ceanothus x pallidus ‘Roseus’
Looking for something unusual for your early summer garden? How about Ceanothus x pallidus ‘Roseus’?
An interesting quasi-native ceanothus, ‘Roseus’ is a cross between Ceanothus ovatus and another hybrid, Ceanothus x delilianus. Ceanothus x delilianus parents are the Eastern American, Ceanothus americanus and the Mexican, C. coeruleus.
The deciduous shrub reaches 3-4 feet in height and width, and does best in sunny locations with well-drained soil. photo credit: J. Coceano
With that twisted family tree, let’s see what great attributes that gives us as gardeners. It bears conical inflorescences of soft pink flowers on new wood in early summer. These muted colors make it great for casual and formal gardens alike.
It bears conical inflorescences of soft pink flowers on new wood in early summer. photo credit: J. Coceano
It also makes a perfect plant for the small garden where there is limited space. The deciduous shrub reaches 3-4 feet in height and width, and does best in sunny locations with well-drained soil.
Ceanothus x pallidus ‘Roseus’ and a choice of 3 equally delightful plants are the 2014 Scott Assoicates plant dividends. Members can pick up their dividend at the Unusual Tropicals and Annuals Sale on Saturday, May 17 from 10 am to 3 pm. | 2024-04-10T01:27:15.642919 | https://example.com/article/3989 |
Why Should I Reach Out for Help?
If you’ve been struggling with addiction, chances are you’ve tried to quit and haven’t been able to. It’s a reality for many of us. As much as we want to stop, we can’t seem to make ourselves. Some of us will try to convince ourselves that our problem isn’t so serious. We don’t want to have to admit to ourselves or to other people that we need help. We might see this as a sign of failure or weakness on our part. The more we learn about ourselves and addiction, however, we see that reaching out for help is actually a sign of strength. It shows we have the humility to ask for help when we need it, the courage to take that step, and the conviction to want to get better.
There aren’t many things in life that we can do completely on our own. We’re meant to work with other people – to learn, teach and share with others. Human life is about exchange, communication, cooperation and partnership. Our individualistic approach to life makes many of us strive to build our homes, careers and lives completely alone, as individuals. We think that success hinges on our total independence. Some cultures operate differently and function communally, allowing everyone to have access to the help and resources they need. Some families and communities work together. We can have much more success with our recovery when we work together. We have so much to learn from the people who have come before us, who have tried different recovery and treatment programs, who can offer guidance and wisdom.
For many of us, the more we isolate, the more depressed we feel. Our isolation causes us to be alone in our pain, where we can stay trapped in our minds and get lost in overthinking and obsessing, worrying and panicking. Our emotions and toxic thought patterns can fester and grow worse. When we’re alone too much without processing our emotions in healthy ways, we can become increasingly more anxious, sad and self-destructive. To break our patterns of self-isolation, we can take that very important step of reaching out for help – asking someone to come check on us, inquiring about treatment programs, starting therapy, finding a support group. Every step you make to connect and reach out opens you up to receive the resources and emotional support available to you.
Vista Taos is a nationally-accredited, family-owned substance abuse treatment center that offers individuals, who are suffering from addiction, a clear path to recovery by providing a comprehensive Medical, Psychological and Spiritual approach. Privacy Policy | 2024-07-29T01:27:15.642919 | https://example.com/article/1826 |
Almost four out of five people in Northern Ireland who voted Leave in the British EU referendum would view the collapse of the Northern peace process as a price worth paying for Brexit, a new survey has found.
The new research from the universities of Edinburgh and Cardiff found that “self-professed unionists, most notably Leave-voting Conservatives, were largely unconcerned about the risks to the union posed by Brexit”.
The survey, which was conducted under The Future of England Study, the largest and longest-running study of English constitutional attitudes available, uncovered what the researchers described as “attitudes to the union marked principally by rivalry and mutual indifference”.
The findings were published as DUP leader Arlene Foster prepares to meet the European Union’s chief negotiator Michel Barnier in Brussels on Tuesday. Ahead of the meeting Ms Foster said the Brexit poll result “must be respected”.
The Ulster Unionist Party leader Robin Swann is to hold a separate meeting with Mr Barnier on Tuesday.
The surveys found that 87 per cent of Leave voters in Northern Ireland, who are overwhelmingly unionist, see the collapse of the peace process as an acceptable price for Brexit. Northern Ireland voted to remain in the EU by a majority of 56 per cent to 44 per cent.
The surveys were conducted for the two universities by YouGov in England, Wales and Scotland and Lucid Talk in Northern Ireland between May 30th and June 4th this year. A total of 1,089 adults were surveyed in Northern Ireland, 2,741 in England, 2,016 in Wales and 1,502 in Scotland.
Highest percentage
Northern Ireland recorded the highest percentage of Leavers as favouring Brexit above the peace. The question posed was, “Price worth paying for Brexit: peace in NI”.
The surveys found that 84 per cent of Leavers in Wales, 83 per cent in England and 73 per cent in Scotland put Brexit ahead of the peace process.
The same question was posed to those who voted to stay in the EU.
Just one in 100 of Northern Ireland Remainers viewed Brexit as more important than peace, while 10 per cent of Remainers in England and Wales and 12 per cent in Scotland put implementing Brexit about the peace process.
The surveys also found that clear majorities of English Conservatives would support Scottish independence (79 per cent) or the collapse of the peace process (75 per cent) as the price of Brexit. | 2024-05-26T01:27:15.642919 | https://example.com/article/4738 |
Q:
My state changes when the component is re-rendered
I have a web app that fetches recipe from a backend API. When the feed component mounts, I set an axios get method to receive data from the API and update my redux store and then update the components state to the props matched to state of the redux store using mapPropsToState.
It works when the component is rendered initially, but moving to another component, say Create Recipe and then switching back to the Feed component, the content flashes for a mini second ad then disappears. And shows 'No Recipes To Show' which is what I set to display when there are no recipes.
I have tried using the setState in the componentDidMount method and then also in the .then method of axios, and also in both, simultaneously. Still same result. I have also tried logging the state to the console and it shows that it received the data well all the times that I switched back and forth between components, but the data wont display on screen.
FEED.JS
import React, {Component} from 'react';
import RecipeCard from './RecipeCard';
import {connect} from 'react-redux';
import {updateRecipes} from '../actions/recipeActions'
import axios from 'axios'
class Feed extends Component {
state = {
recipes: []
};
feedTitleStyle = {
color: 'rgba(230, 126, 34, 1)',
margin: '28px 0'
};
componentDidMount() {
axios.get('http://127.0.0.1:8000/api/recipes/')
.then(res =>{
console.log(res);
this.props.updateRecipesFromAPI(res.data);
this.setState({
recipes: this.props.recipes
})
})
.catch(err => {
console.log(err)
});
let recipes = [...this.state.recipes, this.props.recipes];
this.setState({
recipes
})
}
render() {
const {recipes} = this.state;
console.log(this.props.recipes);
console.log(recipes);
const recipesList = recipes.length ? (
recipes.map(recipe => {
return (
<div className="container" key={recipe.id}>
<div className='col-md-10 md-offset-1 col-lg-9 mx-auto'>
<div className="row">
<div className="col s12 m7">
<RecipeCard recipe={recipe}/>
</div>
</div>
</div>
</div>
)
})
) : (
<div className='center'>No recipes yet</div>
);
return (
<div>
<div className='container'>
<h4 style={this.feedTitleStyle} className='center feed-title'>Feed</h4>
{recipesList}
</div>
</div>
)
}
}
const mapStateToProps = (state) => {
return{
recipes: state.recipes
}
};
const mapDispatchToProps = (dispatch) => {
return {
updateRecipesFromAPI: (recipes) => {dispatch({
type: 'UPDATE_RECIPES',
recipes
}}
}
};
export default connect(mapStateToProps, mapDispatchToProps)(Feed)
Here is my reducer:
const initialState = {
recipes: [],
};
const recipeReducer = (state = initialState, action) => {
switch (action.type) {
case 'UPDATE_RECIPES':
let updatedRecipes = [...state.recipes, action.recipes];
console.log(updatedRecipes[0]);
return {
...state,
recipes: updatedRecipes[0]
};
default:
return state
}
};
export default recipeReducer
A:
You are juggling between REDUX and State which is wrong, you should not be doing this, instead, the ideal solution would be to stick on with REDUX and let REDUX do the async call and fill in the store, and make use of the mapStateToProps to get it into props.
use Action Creators ( Async ) to solve this, you should be using middleware like thunk (Thunk) to do this.
Action creators:
export const updateRecipesFromAPI_Async = () => { // async action creator
return dispatch => {
axios.post('http://127.0.0.1:8000/api/recipes/')
.then(response => {
console.log(response.data);
dispatch(updateRecipesFromAPI_Success(response.data.name, orderData)); // calls a sync action creator
})
.catch(error => {
console.log(error);
});
}
}
export const updateRecipesFromAPI_Success = (recipes) => { // sync action creator
return {
type: 'UPDATE_RECIPES',
orderData: recipes
}
}
| 2023-10-02T01:27:15.642919 | https://example.com/article/9912 |
Rossendale Branch are sorry to have to announce the death, at 103 years of age, of their of our founder members, Edna May Trickett. Edna died ‘peacefully and snug’ with her family on 21st February after her health started to fail shortly after the New Year.
A truly beautiful and emotional video, this is how the journey was for one family travelling from Hungary to Germany followed by how you can help refugee children and the #helpiscoming video featuring Benedict Cumberbatch
The Rossendale branch of Save The Children held its 52nd Annual General Meeting on May 11th and heard that another successful year of fundraising had seen almost £8,000 sent to the charity’s national headquarters to help with its work overseas and in the UK. | 2023-08-18T01:27:15.642919 | https://example.com/article/4060 |
The 1999 French Venous Disease Survey: epidemiology, management, and patient profiles.
A recent (1999) Sofres survey of representative samples of the adult French population aged 15 and over showed that almost half this population suffered from lower limb venous complaints and that 43% of them were untreated. Of those treated, 24.2% received venotropics, including 21.5% by prescription, while 6.0% practiced self-medication. Venous disease sufferers form a relatively underprivileged sector of the population in terms not only of age, income, work and living conditions, but also of general health and medical history. Despite its clinical efficacy and potential social utility, venotropic treatment is possible only if backed by adequate state health insurance coverage supplemented by mutual and private insurance schemes. Any restriction to such coverage will only decrease access to prescription venotropics. | 2024-07-18T01:27:15.642919 | https://example.com/article/5967 |
This Month's Hottest Advertisements Do More Than Amuse
We live in an increasingly digital world in which experiences, ideas, and opinions can be shared in an instant. It's never been easier to record and share photos and videos online, thanks to advances in mobile technology. In fact, 72 hours of video are uploaded to Google's (NASDAQ: GOOGL) YouTube every minute. As a result, companies have turned to viral advertising. Let's look at the brands behind this month's top viral video ads, as ranked by AdAge.com, and why they work.
Great ads breed winning brandsTopping the chart this week is a video called "Real Beauty Sketches," for Unilever's (NYSE: UL) Dove brand. With the help of a forensic artist, the video sets out to prove that women are more beautiful than they think. Equal parts inspiration and enlightenment, the video is part of a "Real Beauty" campaign that Unilever launched in 2004. The video, which launched earlier this month, went viral with tens of millions of online views, more than 8,000 comments on YouTube, and more than 660,000 Facebook shares, according to Visible Measures.
Earlier this month, Google generated buzz around its YouTube brand when it released a video in which YouTube's CEO Salar Kamangar announces that the video site has found its "winning video" and will be shutting down for good. While the clip ended up being a prank for April Fool's Day, Google was able to capture the attention of curious viewers around the world. The video attracted more than 10 million hits on YouTube this month and more than 80,000 viewer comments.
Google's YouTube prank may have created buzz, but another one of its videos-gone-viral this month is actually attracting users to install its new Chrome browser. With the help of Stewie's character from Family Guy, Google's new Chrome ad is both relatable and to the point.
PepsiCo (NYSE: PEP) is another company that's succeeding with viral video advertising. This time, Pepsi's "Gordon Test Drive" commercial stole the spotlight. In the video, NASCAR icon Jeff Gordon takes an unsuspecting car salesman on a wild wide. The video was part of a campaign to promote the soda and snack giant's Pepsi Max brand, and by Visible Measures calculations, the ad was quite effective. In fact, during the first week in April Pepsi's video was watched more than 2 million times online, according to Visible Measures.
Why it matters In addition to being entertaining, these share-worthy videos build brand awareness for the companies that sponsor them. Effective advertising, particularly when viral, helps connect products and brands to consumers. Ultimately, this allows companies like Unilever, Google, and Pepsi to create and profit from loyal customers.
In addition to being fun to watch, viral videos can give you leads on investing ideas. Unilever, Google, and Pepsi, for example, each boast multinational brands and solid balance sheets.
In fact, PepsiCo has quenched consumers' thirst for more than a century. But recently, the company has left shareholders craving more. With increased competition and loss of market share, many investors wonder if this global snack food and beverage giant is simply fizzling out. Are more bland results ahead for PepsiCo? The Motley Fool's premium report on the company guides you through everything you need to know about PepsiCo, including the key opportunities and threats facing the company's future. Simply click here now to claim your copy today.
Comments from our Foolish Readers
Help us keep this a respectfully Foolish area! This is a place for our readers to discuss, debate, and learn more about the Foolish investing topic you read about above. Help us keep it clean and safe. If you believe a comment is abusive or otherwise violates our Fool's Rules, please report it via the Report this Comment icon found on every comment. | 2024-03-07T01:27:15.642919 | https://example.com/article/2221 |
Current evidence on transcranial magnetic stimulation and its potential usefulness in post-stroke neurorehabilitation: Opening new doors to the treatment of cerebrovascular disease.
Repetitive transcranial magnetic stimulation (rTMS) is a therapeutic reality in post-stroke rehabilitation. It has a neuroprotective effect on the modulation of neuroplasticity, improving the brain's capacity to retrain neural circuits and promoting restoration and acquisition of new compensatory skills. We conducted a literature search on PubMed and also gathered the latest books, clinical practice guidelines, and recommendations published by the most prominent scientific societies concerning the therapeutic use of rTMS in the rehabilitation of stroke patients. The criteria of the International Federation of Clinical Neurophysiology (2014) were followed regarding the inclusion of all evidence and recommendations. Identifying stroke patients who are eligible for rTMS is essential to accelerate their recovery. rTMS has proven to be safe and effective for treating stroke complications. Functional brain activity can be optimised by applying excitatory or inhibitory electromagnetic pulses to the hemisphere ipsilateral or contralateral to the lesion, respectively, as well as at the level of the transcallosal pathway to regulate interhemispheric communication. Different studies of rTMS in these patients have resulted in improvements in motor disorders, aphasia, dysarthria, oropharyngeal dysphagia, depression, and perceptual-cognitive deficits. However, further well-designed randomized controlled clinical trials with larger sample size are needed to recommend with a higher level of evidence, proper implementation of rTMS use in stroke subjects on a widespread basis. | 2024-01-01T01:27:15.642919 | https://example.com/article/4363 |
As is well known, surge or stall is a phenomenon that is characteristic to all types of axial flow compressors and occurs at a given engine operating condition and that if gone unattended could be deleterious or harmful to not only the engine's performance but to the engine itself.
Hence, throughout the entire evolution from the original design through the development and the improvement stages of a gas turbine engine, those involved in this technology pay great heed to the surge characteristics of the rotating machinery to assure that the compromise between the safe operation of the engine and its performance is optimized.
Since the point at which stall may occur limits the blades operating pressure ratio for a given corrected air weight flow and since higher pressure ratios enhance its performance, the engine's operating line is dictated by a compromise between the stall line and performance. Hence, it is always desirable to be able to raise the stall line to a higher pressure ratio for a given engine operation. For example, raising the stall line can increase the stall margin between the engine's operating line, or raising the stall line permits raising of the operating line without changing the stall margin, which obviously would result in an increase in engine's performance. Other alternatives can use up the increased stall margin with reduced rotor speed, reduced blade count, reduced rotor chord length, or eliminated variable geometry to improve component efficiency or lower component weight and complexity.
Experience has shown that beoause there are so many factors affecting stall it is not surprising that the stall line may not match its design point. In these situations the engine's hardware is typically modified to satisfy the stall margin requirement so as to meet engine specifications. It is also not surprising that this cannot always be done without degrading engine performance. This is not to say that there aren't other advantages that are attendant an increase in stall margin.
Thus, it is ideal to be able to increase the stall margin and at the same time obtain corresponding increase in engine performance. 0f course, the next best would be to be able to increase stall margin without incurring an engine performance deficit.
As is well known, and as to be understood for purposes of understanding the invention, rotating stall is a phenomenon that occurs whenever sufficient blades or regions of the blades stall so as to occasion a complete blockage or reversal of flow of air through the compressor. Also flow separation on the airfoils can lead to compressor stall or rotation stall which, in turn, can lead to an overall system breakdown of the flow, i.e., surge.
Hence, whenever stall occurs and is allowed to propagate throughout the entire or nearly entire blading, surge can ensue. It is important to understand that the surge problem can be corrected by either providing means for handling an incipient surge or design the engine so that the engine never operates where a stall can manifest. For example, an incipient stall may be corrected simply by reducing engine power as compared to designing the engine so that its operating parameters assure that the engine always operates below a given stall line.
Also, it is well-known in the art that surge may manifest in many different forms and stall may occur in one or more blades and at different regions. The most limiting stall characteristics often occur at the tip of the blade which essentially is the type of stall being addressed by this invention. More particularly, this invention is directed to enhance the stall line so as to avoid the manifestation of an incipient stall. This will serve to prevent compressor stall although it will be understood that the treatment of the casing does not affect whether or not a rotating stall could degenerate into a surge condition.
Treatment of the casing, which sometimes is referred to as shroud or tip seal or outer air seal, to enhance the stall line is exemplified in the prior art, for example, by U.S. Pat. No. 4,239,452 granted to F. Roberts, Jr. on Dec. 16, 1980, and assigned to the assignee of this patent application. This patent discloses that axially extending skewed grooves and circumferentially extending grooves in the blade tip shroud enhance stall characteristics and is particularly efficacious in use with a fan.
U.S. Pat. No. 3,580,692 granted to A. Mikolajczak on May 25, 1971 also assigned to the assignee common to this patent application teaches a honeycomb structure casing treatment for enhancing the stall characteristics.
Other casing treatments that are known in the prior art are, for example, disclosed in the ASME paper reported in the Journal of Fluid Engineering Vol. 109 dated May 1987 entitled "Improvement of Unstable Characteristics of an Axial Flow Fan by Air-Separator Equipment" authored by Y. Mijake, T. Inola and T. Kato, and in a paper from The School of Mechanical Engineering, Cranfield Institute of Technology in Great Britain entitled "Application of Recess Vaned Casing Treatment to Axial Flow Compressor", dated Feb. 1988 and authored by A. R. Aziman, R. L. Elder and A. B. McKenzie. The work presented in these papers is based in part on earlier work of S. K. Ivanov disclosed in his U.S. Pat. No. 3,189,260 granted on Jun. 15, 1965.
The Ivanov patent and the Miyski et al paper, supra, both investigate properties of air separators for industrial fans that operate at relatively low speeds and low aerodynamic loadings while the Aziman et al paper, supra, investigates properties of air separators operating at similar low speeds but with aerodynamic loadings that are encountered in aerospace applications.
In the main, the teachings disclosed in the two papers and the Ivanov patent, supra, relate to mechanisms that collect rotating stall cells in post-stall operation in a significantly large recess formed in the casing, turn and reorient the flow and then reintroduce the collected air back into the main compressor flow upstream of the rotor.
Obviously, since rotating stall is a mass of cells of stalled and highly turbulent air that processes around the rotor at a rate that is nearly half the rotating speed of the rotor and extends upstream of the rotor a significant axial distance, one skilled in the art armed with these teachings is led to believe that in order to enhance the stall line it follows that the recess should be large enough to swallow the rotating stall. Hence, knowing that rotating stall extends a significant distance upstream of the rotor and since it is a collection of a large mass of stalled air cells, a significantly large recess would be necessary in order to swallow the rotating stall. These teachings, while particularly relevant to industrial types of fans and compressors are not relevant to aircraft application inasmuch as a large recess in the casing at the inlet of the engine or in front of a compressor is intolerable. In a sense, these papers teach away from the present invention, notwithstanding the fact that both the prior art and the present invention teach means for enhancing the stall line.
A particular problem inherent in axial compressor design is the limited space available for treatment of the case. It should be understood that the amount of air removed from the compressor is significantly different, percentage wise, than the amount of air for treatment of the fan, and the amount is deemed critical. It was found that a suitable amount of air used for treatment is substantially up to 12 percentage of the total air ingested by the compressor blades in a given compression stage. The amount of air recirculated depends on the ratio of the hub radius to the tip radius; and a larger percentage of the total air ingested is required for the higher hub-to-tip radius ratios found in high pressure compressors. Moreover, it was found that it was abundantly important to remove or even reverse the swirl in a single turning of the treated air. In this light, the passage used for treating the air is judiciously oriented so that the air flows angularly relative to the main flow stream through the blading. | 2024-05-11T01:27:15.642919 | https://example.com/article/2124 |
A UNITED STATES senator preached a sermon in a Methodist pulpit in Los Angeles, Calif. Of all things, imagine a well known senator saying that patriotism is a false god to many people! And he was right. "Love of country can transcend the love of God," he said, "and we must, in time of stress, avoid making patriotism a religion." He said a number of other things I could have said, myself. Among the idols professing Christians worship, he cited prosperity, science, patriotism, peace — and some people actually make an idol of the Bible, strange as that may sound. Some, he said, worship the Bible for itself, NOT as containing TRUTHS necessary for salvation, and, I add, as a GUIDE to a WAY OF LIFE. What is your idol? What are YOU really dedicated to? Is it earning a living — making money? What absorbs your mind, your thoughts, your time — what are you really devoted to? Is it GOD — above all else? Or is it your hobby, your wife or husband, your children, your home, your sports — or amusements and entertainments? What do you keep your MIND on most of the time? What most occupies your INTEREST? Is it friends — society? Is it PEOPLE — or is it THINGS? It surely couldn't be GOD, could it? Probably not. And, if not, then it is an IDOL. You are breaking the First Commandment. You have this other god before Him. Just WHAT IS RELIGION? Religion is your CONNECTION WITH GOD — your relationship with Him. Religion is realizing the PURPOSE of your life — the reason why God had you to be born — the reason you draw the breath of air and exist — the PURPOSE or end GOAL of your life, and HOW to live that life so as to arrive there. I have written of the seven laws of SUCCESS. You may have the free booklet on The Seven Laws Of Success. They are really the seven laws of LIFE. They are the seven laws of RELIGION. Yet most people do not know or practice or apply a single one of them. The first is to have the RIGHT GOAL. That GOAL — God's PURPOSE for having put the breath of life in you — is that you be born of GOD, to share with Him the GLORY of creation, to inherit His divine NATURE, to be LIKE HIM — to do what He does, to accomplish what He accomplishes, enjoy what He ENJOYS — peace, happiness, joy, resplendent GLORY in LIFE EVERLASTING. No other goal could be as great. It is superlative. But what are you, now? Just a mass of matter, put together like a machine. Your present existence has to be constantly SUSTAINED. You have to keep drawing a breath of air into your lungs about every four or five seconds. You have to eat food on the average of at least three times every day. You have to take care of eliminating the impurities from food, and of bathing and cleansing your body. Maybe you don't really have to "brush your teeth after every meal" as a certain toothpaste TV commercial keeps repeating like a phonograph record that got stuck. But you do have to maintain and sustain your physical anatomy to keep on existing — and even then you are aging and degenerating every day and every year — and the most certain thing in this existence we call "life" is that this machine process is going to run down — YOU ARE GOING TO DIE. Actually, we have to simply keep pumping life into ourselves constantly — daily — to continue existing — to continue consciousness. Yet most people keep on, day after day, year after year, pumping that existence into themselves, with NO MORE PURPOSE than to try to be comfortable, free from pain, and to be pleasing the five senses — with their minds on the passing physical and material things of the moment — things that are not lasting, and are soon gone. Unless God's own CHARACTER is being formed and developed in your mind and your life, replacing the carnality that is there now, you shall have missed your GOAL. God's PURPOSE is to CREATE within you, during this life, a new and perfect CHARACTER, so that you may be given eternal life — self-containing, inherent life. If you are converted — that is, if you do once establish actual contact with God — He supernaturally puts within you His HOLY SPIRIT. This impregnates you with HIS LIFE — begets you as His child, actually yet unborn. Actually, what many professing Christians call "being born again" should be termed "being begotten." Technically, to be "born of God" means to be changed in composition from flesh and blood matter to SPIRIT — no longer mortal, no longer human. But it does put within you a NEW NATURE, entirely opposite to HUMAN NATURE with which you were first born. You are, as Scripture says, given "exceeding great and precious promises: that by these ye might be PARTAKERS OF THE DIVINE NATURE" (II Pet. 1:4). Of course the old human nature remains, and your mind makes the continual decisions whether to yield to the downward pull and appetites and established habits of human nature, or to resist it by yielding to the new divine nature — to BE LED BY GOD'S HOLY SPIRIT. This, then, BECOMES your very life! You can only succeed if your GOAL is kept constantly — continually — before your eyes. When you drive a car, if you take your eyes and attention off what is in front of you (and sometimes coming from the side or behind) even for two or three seconds, you may find yourself "coming to" in a hospital, dying and saying " It all happened so suddenly!" Driving carefully means BEING ALERT — being DILIGENT every second — KEEPING YOUR EYE and your mind and attention on the matter of DRIVING — not on conversation or other things. In the same manner, if you let other interests, material pursuits, steal first place in your mind and heart and interest, even for a few days, you are in danger of a SPIRITUAL SMASHUP that will let you wake up being plunged into the LAKE OF FIRE, which will mean eternal DEATH. That's why God doesn't want you to have these other gods BEFORE Him. For your own sake — in your own interest — you must keep Him enthroned and enshrined constantly ABOVE ALL. You must study HIS WORD in order to be instructed by Him. Instructed in what? Instructed in true KNOWLEDGE — knowledge of God's PURPOSE for you — knowledge of and about God — and knowledge of HOW TO LIVE. Jesus Christ said you must actually LIVE BY the words of the Bible. It is your GUIDE TO LIVING — your INSTRUCTION BOOK the Maker sent along to instruct you HOW to OPERATE this mechanism that is YOU. More, you must study His Word — your BIBLE — to find what you now believe that is wrong, and what you are now DOING that is wrong — to be CORRECTED and reproved by it. You must study it to let it INSTRUCT you in the ways of God's RIGHTEOUSNESS — His WAY OF LIFE. And then you must devote yourself to LIVING IT! Still, without regular and constant PRAYER, you cannot maintain CONTACT with God. And when that contact is broken, you are CUT OFF from Him — and His spiritual LIFE, LOVE and very NATURE cease flowing into you. For, understand, these divine attributes of His Spirit DO FLOW! They are IN MOTION. They do not stagnate. You either GROW spiritually — in knowledge — in grace — in God's character — or you deteriorate back toward becoming a mere physical animal, to die in ETERNAL PUNISHMENT in the lake of fire! But if God, and the things of God — His revealed knowledge — His law — His love — His WAY for you to live — are constantly foremost in your mind, your thoughts, your interest, then you are PRAYING ALWAYS — that is, in a constant SPIRIT OF PRAYER — a constant MENTAL ATTITUDE of prayer. The contact with God must be perpetual! This kind of Christian life — the only kind that truly IS Christian — requires, as the Bible emphasizes repeatedly, zealous DILIGENCE. You must CONCENTRATE on it. You must be DEDICATED to it. It requires utter CONSECRATION. It requires total EARNESTNESS. Yes, it requires the application of the other six laws of SUCCESS — education, in which the Bible is the main textbook ; good physical health; DRIVE, or concentrated DILIGENCE and EFFORT; resourcefulness; sticking to it — enduring; and continual contact with, and the guidance, help and power of, GOD. True spiritual mindedness is not a sticky sentimentalism. It is NOT a certain emotional mood. It is not the use of a certain religious phraseology, saying constantly, "Praise the Lord," or, "Glory, hallelujah." I have known many people whose TALK is so very "spiritual" — but whose hearts were as far from God as the prophet Isaiah described (Isa. 29:13). Jesus Christ was a perfectly SPIRITUAL man. But He did not go about using such mushy language. He was not a girlish, effeminate, sentimental or emotional weakling. He was a strong, virile, masterful, yet kind and gentle, MAN. He possessed LEADERSHIP, STRENGTH, PURPOSE, SUPREME STRONG WILL — and yet these masculine qualities of strength and power were perfectly blended with wisdom, judgment, knowledge, understanding, justice and also patience, compassion and mercy. He was filled with PEACE, LOVE, FAITH. And His WILL, strong as it was, was totally yielded and obedient to GOD. All this was the character of GOD. He is our PATTERN. We must imitate Him — copy Him. Look at the men of God in the Old Testament — Abraham, Noah, Joseph, David, Daniel, Elijah. They were all different from Christ in one respect — in which you and I must also be different — they had human weaknesses, and all did sin, yet these men all repented and strove to overcome. But they were all men of strong PURPOSE, strong WILL guided by God; all possessed leadership, but also love and faith and a consecrated OBEDIENCE to the will of GOD. But they were not effeminate, sentimental men indulging in an affected, put-on, religious-sounding way of talking. Look at the apostles Peter and Paul. They were the same. You don't find any of this pseudo "spirituality" in them — yet they were truly SPIRITUAL men, devoted to obeying God and serving the needs of the people. But one thing to watch and guard against every second, in the way of attitude, is resentment, bitterness, hatred. Don't let ANYTHING, no matter how unjust, make you sour and bitter. That is the deadliest mental and spiritual POISON. We must LOVE even our enemies who perpetrate the greatest outrages — though we do not condone their evils. If you ever think I'M wrong about anything, don't get sour or bitter about it — let GOD correct and punish me — vengeance is HIS, you know. Resentment against me won't either punish me or benefit you, but it could consign YOU to eternal punishment! Whether YOU believe it or not, I have come, by years of experience learning the HARD WAY, to have supreme faith that GOD will never neglect to correct or punish me wherever I deserve it! You may TRUST HIM to do it! Remember what a GLORIOUS GOAL we have before us! How GRATEFUL we ought to be! How our hearts ought to be FLOODED with love and gratitude to the great God for His matchless LOVE toward us. I'm sure we don't grasp what a supreme price He paid to make it possible. He wants us to be CHANGED — to overcome and root out this debasing, rotten carnality we all have in us — and to GROW into His righteousness, that we may SHARE His GLORY. And, you know, I believe God wants and longs to share the supreme GLORY that He has with you! Make it your supreme overall life VOCATION, and WORK HARD AT IT! The Japanese spy who stealthily and secretly obtained all the information the Japanese needed to bomb Pearl Harbor said that he was not a very brilliant man, and learning came hard to him, BUT HE WORKED HARD AT IT, relentlessly, with zeal, and with purpose, and with diligence. He SUCCEEDED — in terrible DESTRUCTION — in plunging the United States into World War II — and, finally, in the ignominious defeat of his own nation. Let us work hard at our calling and mission of being real Christians. We shall succeed, with God's help in final and eternal GLORY! | 2024-05-30T01:27:15.642919 | https://example.com/article/1064 |
Contributions of fixational eye movements to the discrimination of briefly presented stimuli.
Although it is known that images tend to disappear when they are stabilized on the retina for tens of seconds or minutes, the possible functions of fixational movements during the brief periods of visual fixation that occur during natural viewing remain controversial. Studies that investigated the retinal stabilization of stimuli presented for less than a few seconds have observed neither decrement in contrast sensitivity nor image fading. In this study, we analyzed the effect of retinal stabilization on discriminating the orientation of a low-contrast and noisy small bar that was displayed for either 500 ms or 2 s. The bar was randomly tilted by 45 degrees either clockwise or counterclockwise. For both exposure durations, percentages of correct discrimination were significantly lower under conditions of visual stabilization than in the presence of the normally moving retinal image. These results are consistent with the predictions of recent computational models that simulated neuronal responses in the early visual system during oculomotor activity and support the hypothesis that visual processes deteriorate rapidly in the absence of retinal image motion. | 2023-10-09T01:27:15.642919 | https://example.com/article/1339 |
Fun Fact: Anchor Cafe
Mike Cain has published this photo on Facebook several times. This was a long standing Wiggins landmark. My guess today it could be featured on Food Network’s Diners, Drive-Ins, and Dives! My specific memories of this place were when Jack McHenry owned it. He made awesome stuffed crabs, gumbo, and my staple – hamburger steak with onions and gravy! | 2024-06-16T01:27:15.642919 | https://example.com/article/4215 |
Hospital volume influences the choice of operation for thyroid cancer.
Many authors advocate total or near-total thyroidectomy for thyroid carcinoma. This study examined the relationship between hospital volume of thyroidectomies and choice of bilateral thyroidectomy for thyroid carcinoma. Data were extracted from the administrative databases of all hospital discharge abstracts in the Rhône-Alpes area of France. The study population included inpatient stays from 1999 to 2004 with a diagnosis of thyroid disease (benign or malignant) and a procedural code for thyroid surgery. Multivariable logistic regression analyses were performed to determine factors associated with the extent of surgery (unilateral versus bilateral) for thyroid carcinoma. A total of 20 140 thyroidectomies were identified, including 4006 procedures for cancer. Compared with hospitals performing a high volume of procedures for all thyroid diseases (at least 100 annually), the risk of a unilateral procedure for thyroid cancer increased by 2.46 (95 per cent confidence interval 1.63 to 3.71) in low-volume hospitals (fewer than ten operations per year) and by 1.56 (1.27 to 1.92) in medium-volume centres (ten to 99 per year). There is a significant relationship between hospital volume and the decision to perform bilateral surgery for thyroid carcinoma. Thyroid cancer surgery should be performed by experienced surgical teams in high-volume centres. | 2024-02-03T01:27:15.642919 | https://example.com/article/3107 |
The expansion of cloud computing services has led to collections of servers to provide computing capacity to run various client applications. Some client-server connections use private networks. Other client-server connections use virtual private networks to exchange data over a public network as if they were directly connected by private networks. With the expansion of cloud computing services has come an expansion of datacenters to host servers. Some hosted servers are housed in multi-tenant datacenters, and share resources with other, potentially unrelated servers.
Data security and monitoring network traffic is a requirement in such datacenters. Data traveling between servers and client applications needs to be monitored for security. One problem to be addressed in monitoring data flow in such a datacenter, including in a multi-tenant scenario, is how to route data to the correct server in the multi-tenant security system. Conflicts can arise among multiple servers having the same IP and MAC addresses. Another problem to be addressed in such a datacenter is how to route packets through the correct security microservices in a hierarchy of security microservices. | 2024-06-16T01:27:15.642919 | https://example.com/article/5123 |
Considerations To Know About blockchain
Considerations To Know About blockchain
AirDrop is incredibly neat and handy, but is a kind of features many people Will not understand about. Not mainly because it is difficult to use (it's not) but because a lot of people Do not Feel to search for it.
Go through the checklist, learn more about the ICOs and be a part of those that you believe may need likely. Be amongst the 1st ones to acquire totally free airdrop tokens from these tasks.
For those who favored this post and have an interest in topics connected to cryptocurrency and cryptocurrency investing, give me a follow on Medium:
To share involving a Mac and an iPhone, iPad, or iPod contact, you need any of these units and operating devices:
Trusted by thirty million wallet buyers and counting in over 140 nations to keep digital currencies in a safe, non-custodial wallet. With Blockchain Wallet, only you have usage of your private keys (we don't shop them).
The actions beneath has to be concluded by Thursday, August 16th at 11:59pm PST. We cannot airdrop tokens to registrants who would not have an active Common Wallet, so This really is mandatory for participation.
* Eligibility for our inaugural fall was presented to all who pre-registered for the Common Wallet (prior to July 2nd, 2018 – which marked the main day of our Global Rollout).
Each Pc during the blockchain community has its have copy with the blockchain, meaning there are countless numbers, or in the case go to this web-site of Bitcoin, an incredible number of copies of the exact same blockchain. While Just about every copy on the blockchain is identical, spreading that details across a network of personal computers would make the data more challenging to govern.
Does that seem sensible? A coin that just supposedly lifted 8m euros has only tweeted for twenty-four hrs? If the story seems fishy, You will find there's disgusting, rotting corpse somewhere. Don’t believe it.
TCP/IP empowers a lot of economical purposes which might be controlled, click over here now but TCP/IP isn't regulated like a economical instrument. The Blockchain must get similar thing to consider. While the predominant use scenario for your Blockchain currently is bitcoin currency Trade read this article which will require regulation, this may change eventually.
Blockchain @blockchain 14h What’s far more enjoyment than making a gift of $125M in Stellar XLM? Seeing people today #getcrypto. Thanks to many of the #WebSummit2018 attendees that submitted their giveaway photos. Continue to be tuned, we will be asserting the winner shortly! pic.twitter.com/gDhD2QeLsO
Should you have any cryptocurrency, what you truly have is definitely the non-public crucial (essentially just a lengthy password) to its address on the blockchain.
Wanting more than the Bitcoin blockchain, having said that, you will observe that you simply do not need usage of identifying information about the end users making transactions.
Despite the fact that transactions are publicly recorded on the blockchain, consumer information just isn't — or, no less than not in full. In order to carry out transactions around the Bitcoin network, contributors ought to operate a application named a “wallet. | 2023-08-10T01:27:15.642919 | https://example.com/article/2583 |
Hydraulic Flange Caps - manufacturer, factory, supplier from China
HOB hydraulic cylinders are now widely used in more and more fields But for how it works very few people know Here let us make a preliminary understanding of its working principle and structure The HOB hydraulic oil cylinder is usually composed of a cylinder body a cylinder rod piston rod and a seal The interior of...
Dongguan Jinzhuang Hydraulic Technology Co Ltd limited liability company was established in 2003 It is an enterprise specializing in the research and development of hydraulic fluid technology and the integration of production sales and service The hydraulic system manufacturer covers an area of 6600 square meters has...
Dongguan Jinzhuang Hydraulic Technology Co Ltd limited liability company was established in 2003 It is an enterprise specializing in the research and development of hydraulic fluid technology and the integration of production sales and service The hydraulic system manufacturer covers an area of 6600 square meters has...
Dongguan Jinzhuang Hydraulic Technology Co Ltd limited liability company was established in 2003 It is an enterprise specializing in the research and development of hydraulic fluid technology and the integration of production sales and service The hydraulic system manufacturer covers an area of 6600 square meters has...
Dongguan Jinzhuang Hydraulic Technology Co Ltd limited liability company was established in 2003 It is an enterprise specializing in the research and development of hydraulic fluid technology and the integration of production sales and service The hydraulic system manufacturer covers an area of 6600 square meters has...
Product description Cylinder molds are highly useful in building and restructuring projects that require large volumes of concrete blocks and cylinders Take a look at the features for Humboldt Cylinder Mold Height 4 Material Of Construction Plastic Includes Lid Stripping Tools for Concrete Cylinder Molds Plastic...
Product description Cylinder molds are highly useful in building and restructuring projects that require large volumes of concrete blocks and cylinders Take a look at the features for Humboldt Cylinder Mold Height 4 Material Of Construction Plastic Includes Lid Stripping Tools for Concrete Cylinder Molds Plastic...
High Pressure Hydraulic Electric Oil Pump the same transmission shaft drives the rotors of two pumps to rotate which are connected and driven by a motor The suction port of the pump is public and the pressure ports are separated The two flows output by the pump can be used separately or in parallel Hydraulic...
Heavy duty hydraulic oil cylinder are powered by pressurized hydraulic fluids usually oil The hydraulic cylinder consists of a cylinder in which the piston connected to the piston rod moves back and forth One end of the cylinder pipe is closed by the bottom of the cylinder also known as cap the other end is closed by...
The oil cooler can be divided into vertical oil cooler and horizontal oil cooler according to different installation methods The vertical oil cooler has the characteristics of small installation area and convenient installation The horizontal oil cooler has the characteristics of small pressure drop and strong water...
Dongguan Jinzhuang Hydraulic Technology Co Ltd limited liability company was established in 2003 It is an enterprise specializing in the research and development of hydraulic fluid technology and the integration of production sales and service The hydraulic system manufacturer covers an area of 6600 square meters has...
Since its establishment Dongguan Huizhong Hydraulic Machinery Co Ltd specializes in the design and production of hydraulic system and hydraulic cylinder as well as the sales of various hydraulic pumps hydraulic valves and other hydraulic products Many years of experience in hydraulic design and manufacturing and fully...
The liquid filling valve is a kind of hydraulic control one way valve which can stop flow in one direction and circulate freely in the other The pilot action is realized by the hydraulic pressure of the control valve core supplied by the oil port thus directly opening the main valve This kind of valve is designed for...
High pressure Hydraulic Oil Gear Pumps is suitable for conveying medium also known as KCB series strong type requiring stable working pressure Product introduction The pressure of high pressure gear pump is generally 35kg 40kg The high pressure gear pump has an automatic adjustment structure in the gap and its parts...
The pressure oil of the variable displacement piston pump enters the lower cavity of the variable displacement housing through the through hole in the pump body and the variable displacement housing through the one way valve When the pull rod moves downward it pushes the servo piston to move downward the upper valve...
Working principle of servo special oil cylinder The electro hydraulic pulse servo cylinder is composed of a stepping motor a three position four way servo valve a mechanical feedback device wire carrying pair and an oil bar When the stepping motor gets a pulse signal its output shaft rotates 1 5 or 3 degrees the servo...
High Precision Digital Hydraulic Oil Pressure Gauge An instrument for measuring fluid pressure Generally the measured pressure is compared with a reference pressure such as atmospheric pressure or other given pressure so the relative pressure or pressure difference is measured Packaging Delivery Single blank box...
Throttle valve is a valve that controls the flow of fluid by changing the throttle section or length If a throttle valve and a check valve are connected in parallel they can be combined into a check throttle valve Throttle valve and one way throttle valve are simple flow control valves In the quantitative pump...
The liquid filling valve is a kind of hydraulic control one way valve which can stop flow in one direction and circulate freely in the other The pilot action is realized by the hydraulic pressure of the control valve core supplied by the oil port thus directly opening the main valve This kind of valve is designed for...
hydraulic power pack high pressure gear pump Scope and purpose The high pressure gear pump is applicable to the heavy oil diesel oil coal tar and other low grade and inferior combustion oil with medium temperature not higher than 200 viscosity not greater than 1500mm2 s and containing non metallic impurities It is...
Welded Hydraulic Oil Cylinder The oil cylinder is made of cast iron and j506 welding requires hot welding process It is welded after preheating and heat preservation after welding However it is difficult to have such welding conditions in actual maintenance otherwise it is easy to produce small cracks and tear them...
"To create a lot more value for prospects is our business enterprise philosophy; buyer growing is our working chase for Hydraulic Flange Caps , Hydraulic Plunger Pumps , Hydraulic Vane Pump , We've exported our items all over the world especially the USA and European countries. Furthermore all of our merchandise are manufactured with advanced equipment and strict QC procedures to ensure high quality.If you are interested in any of our solutions please don't hesitate to contact us. We are going to try our best to meet your needs.
Send Us a Message
We didn't put all products on website. If you can't find the product you're looking for, please contact us for more information. | 2023-11-22T01:27:15.642919 | https://example.com/article/3448 |
Winter snowstorm shuts down Columbia
Jeff Hargrove, left, and Bryan Simmons help push Shanon Reineke's car out of a snow bank Thursday on Providence Road. Hargrove came from across the road to help. "This is like the 23rd car I've pushed today," Hargrove said.
|Elizabeth Cardwell
Snow covers the cars in the Nissan dealership on Providence Road in the aftermath of the snowstorm Thursday.
|Elizabeth Cardwell
Traffic stalls to a stop Thursday on Interstate 70. The line of stopped vehicles stretched all the way up tthe Rangeline Street entrance ramp as cars attempting to merge onto I-70 continued to pile up.
|Elizabeth Cardwell
David Calandro, left, sits with Jonathon Myrick, back right, Matthew Yarick and Matthew Myrick in the bed of a stopped truck Thursday on Interstate 70. The four MU students had been snowed in at their houses, and were attempting to get a ride back to campus.
|Elizabeth Cardwell
A winter storm brought more than 9 inches of snow to Columbia on Thursday.¦Elizabeth Cardwell
COLUMBIA — A vast snowstorm swept across mid-Missouri on Thursday, shutting down businesses, major roadways and schools, including MU.
By about 4 p.m., 11 inches of snow had accumulated downtown, and 9.7 inches were reported at Columbia Regional Airport at 7 p.m., according to the National Weather Service.
MoreStory
Related Media
Snow began falling around 8 a.m. Thursday in Columbia. Many area schools have been canceled for the day, and city buses planned to switch to an emergency schedule at 10 a.m.
Fred Glass, a meteorologist with the service in St. Louis, said the totals were among the highest in central to eastern Missouri.
Early in the morning, Columbia’s roads were clear enough for many residents to make it to work. Heavy snow started to fall about 8 a.m., and loud thunder could be heard throughout the morning.
Gov. Jay Nixon declared a state of emergency just before 10 a.m.
Many local businesses, including The Blue Note, shut down and sent their employees home for the day.
By noon, Columbia College, Stephens College, William Woods University in Fulton, and MU had all canceled classes. Columbia Public Schools canceled Thursday and Friday classes.
MU canceled classes at 11:58 a.m., and eventually closed the campus for the first time since the "Snowpocalypse" storm of February 2011. It was only the second full campus closure since 1949.
MU announced late Thursday evening that the campus would remain closed on Friday..
Students, faculty and employees took to snow-covered roads during the afternoon, slowing traffic to a standstill on Providence Road, College Avenue, Broadway and Stadium Boulevard, among other places.
During the afternoon, ad hoc crews of Columbia residents could be seen all over downtown helping neighbors push stalled cars. Some wielded snow shovels. Many used gloves and boots to clear snow away from tires.
Fire and ambulance crews responded to 11 injury accidents between 8 a.m. and 6:45 p.m. None of the accidents involved serious injuries, and no transports to medical facilities were reported, Boone County Fire Protection District shift supervisor Chuck Mastalski said.
Interstate 70 was partially or completely closed for a series of weather-related accidents since about 11:30 a.m. Thursday.
All four lanes of the interstate between U.S. 63 and the Lake of the Woods exit were closed from 3 p.m. until 6:05 p.m., when the westbound lane opened. The eastbound lane was still closed at that time.
Two tractor-trailers had stalled in the area, which also stopped traffic on U.S. 63 near the interstate, said Travis Koestner, assistant district engineer for the Missouri Department of Transportation's central district.
“It all centers around that area,” Koestner said.
The department also closed a portion of Route WW near the border between Boone and Callaway counties after a tractor-trailer turned sideways. Another semitrailer was blocking Route Z near St. Charles Road at 7 p.m., according to an advisory from Columbia-Boone County Joint Communications.
Crews continued to plow major roads throughout the evening, though sleet and freezing rain made work difficult, according to a statement from the Public Works Department. | 2024-06-01T01:27:15.642919 | https://example.com/article/9688 |
/*
Fontname: -Adobe-New Century Schoolbook-Bold-R-Normal--17-120-100-100-P-99-ISO10646-1
Copyright: Copyright (c) 1984, 1987 Adobe Systems Incorporated. All Rights Reserved. Copyright (c) 1988, 1991 Digital Equipment Corporation. All Rights Reserved.
Glyphs: 191/756
BBX Build Mode: 0
*/
const uint8_t u8g2_font_ncenB12_tf[3953] U8G2_FONT_SECTION("u8g2_font_ncenB12_tf") =
"\277\0\3\3\5\5\4\5\6\22\23\376\375\14\375\14\376\2\70\5\21\17T \6\0d$\1!\15\203"
"%,\23\71TB\321\210%\2\42\14\245\340\65!a\31EB\21\0#\32\212!T'\22\212\204\42"
"\321Ar\20)\212D\7\311A\244(\22\212d\0$\35\351\341S\31\207\204k\222PD\24)\245\30"
"\217\226P\250\22\42\205$\222\210\254\34\4%%\214%t\65\13N\210\242HP\26\11\212\42QQ$"
"\62\232D&\321\210(\30\221\5#\242`H\24\214\215\0&\35\214%tI\7\210\304\42\261(\16\240"
"\3H\24\311H\62\232\204d\264\245\222\245\64\1'\10\242\344%q\211\0(\16\304\245\63\27\12\251\210"
"\364&\222\5\3)\17\304\241\63\21\214\211d\42\275\210Di\0*\21\347`E\27\214\244H\42\242\221"
"$\42\311\30\3+\15\10%T'V;\34db\65\0,\14\304`+#\241\214B\222\30\0-\7"
"D\340,q\10.\11d ,#\241H\0/\17\205!,\231\26L\13\306\202i\301 \0\60\24\211"
"!T\67\225\310\224d\222\231\267\211L$S\221\316\0\61\12\207%T'*\356\237\16\62\23\210%T"
"E\213IF\246Il\70\325\26\21\36\16\3\63\25\211!TU\23-\311bbiy\16\230\310N\23"
"\321\254\4\64\25\211!T\35\7\210\247\304\310\60\62\13\215b\243\203p<<\65\24\210%Ts\61\305"
"\1q@-\64\236\304L\246\322\250\4\66\26\211!TW\23MD\24\231d<\31Q\326l\23\331d"
"\221\4\67\22\210%T\361\20\11J\202\222`XU,]\16\2\70\25\210%TE\23IF\246\211H"
"F\23IFN\23\221\214\4\71\27\211!TE\234\254If\266\311\204\64\31Od\22\222d$\253\1"
":\15\4!,#\241\310a\22\212\4\0;\17da+#\241\310a\22\312($\211\1<\13\10e"
"T-$\61\222\231\5=\13\310dT\361 G:\34\4>\13\10eT!\346Hb\24\3\77\24\210"
"!DE\23I(\23\321p*\215\243\204\247\343 \0@\36\254\341cY\235\215\344\200PL\22!I"
"D\372\27\212d\22\12\311br\200h\66\255\1A\34\215!l+\7\316as\20\35\24\231\3$s"
"@lz\210\312\246\321\231tD\63B\32\214!lq\30\316\26G\303\321lv\10\316\26G\303\321p"
"\64\233\34F\0C\33\213%lY\11\315&S\311\230\16\240C\346\220\71 \62\216Lc\63)\15\0"
"D\32\215!tq\20\317\206k\303\331t\64\35MG\323\321p\66\234-\35\204\0E\31\213!dq"
" \15EC\321(i\42\265N\244\243\244ih(\32\36\14F\31\213!dq \15EC\321(i"
"\42\265N\244\243\350\34\62\207\214\217\0G\33\215%tY\11\316Ve\343\320\34\20\232\303f\207\351l"
"\70\33.\221I!\0H\17\216!|q\61\15\367\343a\270\377t\61I\12\207!<q\32\356\237\16"
"J\30\212!\134w\235\3\346\200\71`\16\230\211F\224\321Rp$\32\26\1K\34\216!lq\251\15"
"\245\63\361H\16\230\310!w\300\35\60!\217\250\63\342\220r\61L\31\213!dq\236C\346\220\71d"
"\16\231C\346\220ih\32\32\212\206\7\3M%\220!\204a\64\21\211\221\31\61\62\212\14#\243\310\60"
"\64\211\14C\244a\210\64\214\215\206\61\331\60mT\12\31N\36\216!tA-\215\203\324`\61\205\26"
"\14\221\202\61J\60X\214\22\303\303\70@T\16\1O\26\214%tI\36\315\206\243\341d\354y\62\34"
"\15g\243\61\21\0P\32\214!lq\30\316\26G\303\321p\64\233\35\202s\320\34\64\7\315\1W\0"
"Q\36\354esI\36\315\206\243\341d\354I\64\221\204\42\42\266\321\270\16\233\304\1u\310\4\0R\33"
"\215!tq\230\316\206k\303\331\342!:\22\217\246\263\341l\22\232\35h\23\0S\24\211%\134UI"
"\254\222m\21\243%f\246\26#\221\22\0T\31\213!dq\60\255\315d\263\340\34\62\207\314!s\310"
"\34\62\207\214O\0U\33\216!tq*\215\203\343\340\70\70\16\216\203\343\340\70\70\216\16\303$\71\204"
"\12V\35\215\35lq\42Me\304\350\60:\213\3Fq\300$\16\251\203\350\240\71P\16\224\2W\42"
"\217!\204Qa\231\351\26\34\215\202\243\211pB\11K\42\222\60\205<\232Cdr\210L\16\221\11\1"
"X\32\214!dQ\252Le\303\350(\134\207\320!tH\71D\14\316\244\223R\1Y\34\215\35dq"
")\15\245\263\360(\16\231\304!t\330\34\66\207\315as\330\34r\3Z\24\211%\134q \22'\301"
"\351\362t\26\31Ff\265C\1[\11\304\245\63a\322\377D\134\20\207%T!\25K\305R\261T,"
"\25K\5]\11\304\245;A\322\377d^\15\350dU'\226\322DZ\204D\1_\7H\240C\361 "
"`\10d`\66!\232\11a\21\11!TcZ\221\15K\242\311h\62!M\10b\33\213\35\134Q\207"
"\314!s\310\34\262H\231-\315F\263\321lD\231E\42#\0c\16\10!LU\32\225\254k\222\211"
"\214\4d\32\213!\134K\207\314!s\310p\62\233\220f\243\331h\66\232\255\20'\221\1e\20\11!"
"TU\233\254\35\16\341\241d$+\1f\20\211\35<I\224\214&\262\341q\274\307\23\0g\24\211a"
"S\17\20]\266\331.\243\242\34p\71\20\17\24\0h\31\213\35\134A\207\314!s\310\34\62\241\221F"
"\244\265\321l\64\33\315&\15i\14\205!\64#\42\311\1\244})j\20\346Y\63'\243\311!\265}"
"\253TD#\0k\27\213!\134A\207\314!s\310\34\62)\255M\206\326\343h\266\322\0l\11\205!"
"\64A\332\177)m\20\17!\204A\31\315(\224\321\376\177\251L\12n\22\13\35\134A\241\221\326F\263"
"\321l\64\33\315&\15o\17\12!\134G\34M\206\36'\243!\15\0p\30j][A\231QF\263"
"\311l\62\233\314&\224\321d\66\7\214\253\0q\26j]SU\11\255\314&\263\311l\62\33\255\335\1"
"s\300\270\0r\16\11!LA\31Q\226D\343\255E\0s\15\7!DC\231\325N\267\332\204\2t"
"\17f!<\27\15\212,\263]\42\245\11\0u\24\13\35\134A\42\315F\263\321l\64\33\315F\24Z"
"e\0v\23\12!TQ\241\314D#\341D\70\11\223\347\20!\0w\30\17!|Qa\231\251\215F"
"\301\11EJ!S\350\0\231\34\42\23\2x\17\11!TQY\213U\307\323Zl\62)y\27j]"
"SQ\241\314d#\331(Z\236\3\346\20\251$:\11O\1z\17\7!Lq\20IB\263\241pD"
":\10{\15\304\245\63%\21\351\42\23\351M\0|\10\202\61T\361a\0}\15\304\241\63!\23\351&"
"\21\351E\4~\14h\344T\63\212\34\42\241\11\0\240\6\0d$\1\241\15\203e+\23\261DC\221"
"C%\2\242\25\210\241S\17\10\307J\243\222Kl\22\212\214b\304p\30\0\243\27\211!TW\33I"
"F\223\321d\26\33^\345\0)Mb\222\214\0\244\25\10\245T\23\221D\16\21\221DH\224\210$\207"
"HD\22\1\245\25\212!TQ\241\314\324\202\23\251$L\65\213\315r\210\330\4\246\11\202\61Tq\30"
"\36\6\247\30\346eK\65\12IB\22\251\214\22\33\316\42\64\251D\24\21\205F\0\250\10E`\66!"
"\241\10\251\34\214!dg\35\315\304\22Q\205\42\12\215\304\42\361D$!\221$b\331hj\3\252\16"
"\346`\65\63\12\211(J\22q\5\0\253\14\246\244D\225\42\241\210$\242\4\254\11\250\240T\361 \326"
"\0\255\7D\340,q\10\256\34\214!dg\35\315\304\22I\211\224\64\33\312\42\262QHB\231T\304"
"\262\321\324\6\257\6%\240\66Q\260\14\245\344=\63\221\314&\222\11\0\261\17(%T'\226\35\16\62"
"\261\34x\70\10\262\14\345`\65\63\11Qdi\7\1\263\17\346`\65C\21IB\62Q\210$\241\0"
"\264\10dd\66%)\1\265\31ka[A\42\315F\263\321l\64\33\315F\24\222dE\16\232C\346"
"\0\266\33\213!ds\70\204D%QIT\222\221\244\42\251H*\222\212\244\42\331a\0\267\11d\340"
",#\241H\0\270\11\204`\63\23\223U\0\271\11\344d\65\25\31\351B\272\13\345`\65\63\221\260H"
"\306\5\273\16\246\244D\21\12ID\22\212$\24\2\274\33\214%t\25\16MeB\305\250L*K\241"
"\210\244\242i(Qb\222\312\242\4\275\34\214%t\25\16MeB\305\250L*\213L(#\241D\61"
"\32\24\6\205\244`\1\276\36\215!tC\15\251\311B\312\262hH\42\24Ib!\212H,\32\207R"
"%\66\251\60J\277\24\210aC\31\236\216\343(Q\351p$\231PD\62\22\0\300\42\15\42l'\7"
"\316\241rlr\340\34\66\7\321A\221\71@\62\7\304\246\207\250l\32\235IG\64\3\301#\15\42l"
"\17\220\303\346 \71\66\71p\16\233\203\350\240\310\34 \231\3b\323CT\66\215\316\244#\232\1\302#"
"\15\42l\35\7\316A\22\71\26\71p\16\233\203\350\240\310\34 \231\3b\323CT\66\215\316\244#\232"
"\1\303\42\355!l\71\211\3\42sLr\340\34\66\7\321A\221\71@\62\7\304\246\207\250l\32\235I"
"G\64\3\304\42\355!l'\222\3Dr,r\340\34\66\7\321A\221\71@\62\7\304\246\207\250l\32"
"\235IG\64\3\305#\15\42l+\207E\344\60\71\66\71p\16\233\203\350\240\310\34 \231\3b\323C"
"T\66\215\316\244#\232\1\306!\220\35\204w\260\26\245\221\241\64\62J\14M\344\200\220\71\66\21\237\62"
"NC\301\241D\70\264\34\10\307 \353ekY\11\315&S\311\230\16\240C\346\220\71 \62\216Lc"
"\63)\35 \207\311\1S\0\310\36\13\42d'\7\315ar\224\3i(\32\212FI\23\251u\42\35"
"%MCC\321\360`\311\37\13\42d\17\220C\346\0\71\312\201\64\24\15E\243\244\211\324:\221\216\222"
"\246\241\241hx\60\312\37\13\42d\35\7\315\1\22\71\370@\32\212\206\242Q\322Dj\235HGI\323"
"\320P\64<\30\313\35\353!d'\222\212\344\340\3i(\32\212FI\23\251u\42\35%MCC\321"
"\360`\314\16\7\42<#\35\313A\247\341\376\351\0\315\16\7\42<)\234\311a\247\341\376\351\0\316\16"
"\7\42<\27\235I\344\220\323p\377t\317\16\347!<\243$\221CN\303\375\323\1\320\32\215!tq"
"\20\317\206k\303\331tb\33MG\323\321p\66\234-\35\204\0\321$\356!t;\211C\42sTj"
"i\34\244\6\213)\264`\210\24\214Q\202\301b\224\30\36\306\1\242r\10\0\322\33\14&t'\207\315"
"\201r\14\344\321l\70\32N\306\236'\303\321p\66\32\23\1\323\34\14&t\17\220\203\346\20\71\6\362"
"h\66\34\15'c\317\223\341h\70\33\215\211\0\324\34\14&t+\7\321\1\42\71*y\64\33\216\206"
"\223\261\347\311p\64\234\215\306D\0\325\32\354%t\71\11G\346\310\344\321l\70\32N\306\236'\303\321"
"p\66\32\23\1\326\32\354%t'\22\213\344\250\344\321l\70\32N\306\236'\303\321p\66\32\23\1\327"
"\21\10%T\23\214\214&\266\361\314\62\232\4#\0\330 \314\345s\17\14\222b\243\331p\64\234\14#"
"\266\220)f\11N\206\243\341l\64\13\21\343@\0\331!\16\42t+\207\316\301r\324Si\34\34\7"
"\307\301qp\34\34\7\307\301qt\30&\311!T\0\332\42\16\42t\17\222\3\347\60\71\352\251\64\16"
"\216\203\343\340\70\70\16\216\203\343\340\70:\14\223\344\20*\0\333\42\16\42t\17\220\3\351 u\264S"
"i\34\34\7\307\301qp\34\34\7\307\301qt\30&\311!T\0\334!\356!t+\222CDr\264"
"Si\34\34\7\307\301qp\34\34\7\307\301qt\30&\311!T\0\335#\15\36d\17\221\303\346 "
"\71\342\245\64\224\316\302\243\70d\22\207\320as\330\34\66\207\315as\310\15\0\336\32\214!lq\7"
"\314A\207\340lq\64\34\15G\263\331!\70\7\315\1W\0\337\27\212!TW\24\355\223l\62\233\211"
"f\223\331d\66\241L(#\0\340\26\211!T#\7\314!r\4\323\212lX\22MF\223\11iB"
"\341\25\211!T+\236\312\21L+\262aI\64\31M&\244\11\1\342\26\211!T\27\7L%r\260"
"iE\66,\211&\243\311\204\64!\343\25i!T\65\211E\346`\323\212lX\22MF\223\11iB"
"\344\25i!T\243(\221\203M+\262aI\64\31M&\244\11\1\345\26\211!T'\216\210\345\10\246"
"\25\331\260$\232\214&\23\322\204\0\346\26\15!|S!-Id\243\321\201\42\232\216f\25\222\210R"
"\2\347\23haKU\32\225l\325\231d\42\243\312\1\302\31\0\350\26\211!T%\7\314!r\204\332"
"d\355p\10\17%#Y\11\0\351\24\211!T+\236\312Qj\223\265\303!<\224\214d%\0\352\25"
"\211!T\31\7L%rpm\262v\70\204\207\222\221\254\4\353\25i!T%\21J\344\340\332d\355"
"p\10\17%#Y\11\0\354\13\205!\64!\33\212I\373R\355\14\205!\64'\232\310\1\244})\356"
"\14\205!\64\25\233\250\222\366\245\0\357\13e!\64!\241HI\373R\360\25\251!\134#\207L\204S"
"\211\34\60,Mn\336&\213\63\0\361\27k\35\134\71\211F\346\10\24\32im\64\33\315F\263\321l"
"\322\0\362\24\212!\134'\207\314Ar\24\333h\62\364\70\31\315L\0\363\23\212!\134-\7\214\345H"
"\266\321d\350q\62\232\231\0\364\24\212!\134)\7PEr\4\333h\62\364\70\31\315L\0\365\23j"
"!\134\67\11F\346(\266\321d\350q\62\232\231\0\366\23j!\134%\221J\344(\266\321d\350q\62"
"\232\231\0\367\16\10%T'\226\3\17\7\71P,\3\370\31\211\241S\17\211\3\202\264\221dt\211X"
"\42\247\211hF\214\3\342\20\0\371\31\213\35\134'\7\315ar\24\22i\66\232\215f\243\331h\66\242"
"\320*\3\372\30\213\35\134-\207\314\1r$\246\331h\66\232\215f\243\331\210B\253\14\373\32\213\35\134"
"\33\7\315\1\22\71\2\211\64\33\315F\263\321l\64\33Qh\225\1\374\30k\35\134'\21K\344\10$"
"\322l\64\33\315F\263\321lD\241U\6\375\37\353]S-\207\314\1r\244Je(\233EE\322I"
"\34@\7\314AbIx\22\7\214\1\376\37\352][A\7\314\1s\300\34\60\231QF\263\311l\62"
"\233\314&\224\321d\66\7\214\215\0\377\36\313]S'\21K\344\10\225\222P\66\213\212\244\223\70\200\16"
"\230\203\304\222\360$\16\30\3\0\0\0\4\377\377\0";
| 2024-01-05T01:27:15.642919 | https://example.com/article/2074 |
I love cupcakes, and I always have. For my ninth birthday I found a recipe for cupcakes that you bake inside of ice cream cones, and I begged and pleaded with my mom to try it out—it didn’t work out very well, but I think it sparked a lifelong love for adorable little personal-sized cakes (particularly when baked in a unique way!).
Here’s some of the latest and greatest charming cupcake ideas to help inspire your next baking experiment: | 2024-06-21T01:27:15.642919 | https://example.com/article/2688 |
Police said a man shot and killed in North Philadelphia during a traffic stop leveled a gun at police when a sergeant smelled marijuana coming from his car and called for backup.
Matthew Henderson, 28, of the 4500 block of Roosevelt Boulevard, was seen by a sergeant in the 25th District blowing through a red light at 2nd Street and West Erie Avenue in a 2007 BMW 750, Lt. Ray Evers said. The sergeant pulled him over on the 4400 block of Rising Sun Avenue in Feltonville.
When the uniformed sergeant, who was driving a marked patrol car, approached Henderson's vehicle, he allegedly smelled marijuana coming from the car's compartment area. He waited for backup to ask Henderson to step out of the vehicle.
"When they approach the vehicle – the sergeant and the two others, there's three officers approaching – the male gets out of driver's door, has a gun in his hand and points at officers," Evers said. Two of the three officers fired, striking Henderson three to four times. He died on the scene.
Evers said that police recovered next to his body a .40 Taurus that was stolen during a South Philadelphia burglary in January. He said they also found a small amount of marijuana in the ashtray of Henderson's car and on his person, along with three packages of crack cocaine in his pocket. Henderson had 14 prior arrests, Evers said.
Those include manufacturing, delivering or possessing a controlled substance with the intent to deliver and possession of a firearm by a person convicted of a violent crime, for which he was sentenced to four to eight years' imprisonment in 2005, witness intimidation, gun charges and reckless endangerment, for which he was sentencedto six to seven years' confinement in 2004, simple assault and weapons charges, for which he in 2003 received a years' probation, drug offenses, for which he was in 2003 sentenced to nine to 18 months in prison and driving under the influence in 2002, according to court documents.
The two officers who discharged their guns are on administrative duties pending an investigation by Internal Affairs and the District Attorney's Office, Evers said. | 2024-04-08T01:27:15.642919 | https://example.com/article/5088 |
Q:
How can I use Display Name attribute with GridView when exporting to Excel?
I want to set the Column header text with [DisplayName()] attribute when I export the List to Excel file.
any solution ?
GridView gv = new GridView();
gv.DataSource = ExportList;
gv.DataBind();
System.Web.HttpContext.Current.Response.ClearContent();
System.Web.HttpContext.Current.Response.Buffer = true;
System.Web.HttpContext.Current.Response.AddHeader("content-disposition", "attachment; filename=Rapor.xls");
System.Web.HttpContext.Current.Response.ContentType = "application/ms-excel";
System.Web.HttpContext.Current.Response.ContentEncoding = System.Text.Encoding.Unicode;
System.Web.HttpContext.Current.Response.BinaryWrite(System.Text.Encoding.Unicode.GetPreamble());
StringWriter sw = new StringWriter();
HtmlTextWriter htw = new HtmlTextWriter(sw);
gv.RenderControl(htw);
System.Web.HttpContext.Current.Response.Output.Write(sw.ToString());
System.Web.HttpContext.Current.Response.Flush();
System.Web.HttpContext.Current.Response.End();
A:
You must use RowDataBound event of grid like this:
First put this line after creating gv:
gv.RowDataBound+=GvOnRowDataBound;
Then follow this code:
private void GvOnRowDataBound(object sender, GridViewRowEventArgs e)
{
if (e.Row.RowType == DataControlRowType.Header)
{
for (int i = 0; i < e.Row.Cells.Count;i++)
{
var customAttributes =
typeof (YourClass).GetProperty(e.Row.Cells[i].Text).CustomAttributes.ToList();
var displayNameAttribute =
customAttributes.FirstOrDefault(
aa => aa.AttributeType.FullName.Equals("System.ComponentModel.DisplayNameAttribute"));
if (displayNameAttribute != null)
e.Row.Cells[i].Text = displayNameAttribute.ConstructorArguments[0].ToString();
}
}
}
Remember change YourClass to the name of your class.
| 2023-12-26T01:27:15.642919 | https://example.com/article/2073 |
1. Field of the Invention
The present invention relates to an action part for a piano, which is pivotally moved along with depression of a key to thereby transmit key depression energy generated by depression of the key, to a hammer.
2. Description of the Related Art
In general, a wippen, which is one of action parts of a grand piano, is made of wood, and pivoted at a rear end thereof for pivotal motion thereabout (hereinafter, a forward side as viewed from the player is referred to as “the rear”). The wippen is placed on a rear part of a key. When pushed up by the key depressed, the wippen is pivotally moved upward, and causes other action parts, such as a jack, to be moved in an interlocked manner, thereby causing the hammer to pivotally move upward for striking a string stretched thereabove. After that, the wippen is pivotally moved downward by gravity, and brought into abutment with the rear part of the key, whereby the key is made ready for next depression. As described above, the wippen is one of essential action parts for transmitting key depression energy generated by depressing the key to the hammer. Further, an action is placed on the key via the wippen, as part of the action, so that the weight of the action is closely related to the touch weight of the key. The touch weight of the key is adjusted by a balance between a weight attached to a front portion of the key and the weight of the action.
An example of the wippen described above has been conventionally proposed e.g. in Japanese Laid-Open Utility Model Publication (Kokai) No. 62-146194. This wippen is made of a metal or a synthetic resin, or has a weight attached thereto, so as to increase the weight thereof. After once pivotally moved upward, the wippen increased in weight due to the above construction descends at an increased speed, whereby it is promptly brought into abutment with the key.
As described above, the wippen plays the role of a transmitter of key depression energy. In general, the wippen is made of wood, because wood is light in weight and high in rigidity, and hence is suitable for transmitting key depression energy. However, when compared with a synthetic resin, wood is inferior in machining accuracy, which makes troublesome the adjusting operations required in the manufacturing of actions. Further, wood has a larger dimensional change due to drying and wetting, which makes the wippen made of wood liable to be displaced in positional relationship with the other action parts. This makes it difficult to maintain normal motion of the action.
On the other hand, the wippen made of a synthetic resin does not suffer from the above inconveniences caused by the use of the wippen made of wood, but since the rigidity of synthetic resin is lower than that of wood, the pivotal motion of the hammer is reduced in speed. As a result, to obtain the same sound volume, a larger key depression energy is necessitated. Further, since synthetic resin has a larger specific gravity than that of wood, the motion of the wippen becomes slow, which lowers responsiveness of the action, resulting in the delayed timing for hammering the string. Further, the larger specific gravity of synthetic resin increase the weight of the whole action including the wippen, and hence to obtain the same touch weight as that of the wippen made of wood, it is necessary to increase the amount of the above-mentioned weight attached to the key.
The wippen made of metal does not suffer from the inconveniences causes by the use of the wippen made of wood, similarly to that made of synthetic resin, but since metal has a still larger specific gravity than that of synthetic resin, delay of the string-hammering timing and increase in the weight for the key become significant. This is also true in the case of the weight being attached to the wippen. | 2024-03-07T01:27:15.642919 | https://example.com/article/2931 |
#include "interface/usb.h"
#include <stdio.h>
#include "LPC17xx.h"
#include "lpc17xx_pinsel.h"
#include "util/log.h"
#include "util/bytebuffer.h"
#include "gpio.h"
#include "usb_config.h"
#include "config.h"
#include "emqueue.h"
#include "commands/commands.h"
extern "C" {
#include "bsp.h"
}
#define VBUS_PORT 1
#define VBUS_PIN 30
#define VBUS_FUNCNUM 2
#define USB_DM_PORT 0
#define USB_DM_PIN 30
#define USB_DM_FUNCNUM 1
#define USB_HOST_DETECT_INACTIVE_VALUE 400
#define USB_HOST_DETECT_ACTIVE_VALUE 50
#define USB_CONNECT_PORT 2
#define USB_CONNECT_PIN 9
namespace gpio = openxc::gpio;
namespace commands = openxc::commands;
namespace usb = openxc::interface::usb;
using openxc::config::getConfiguration;
using openxc::util::log::debug;
using openxc::interface::usb::UsbDevice;
using openxc::interface::usb::UsbEndpoint;
using openxc::interface::usb::UsbEndpointDirection;
using openxc::util::bytebuffer::processQueue;
using openxc::gpio::GPIO_VALUE_HIGH;
using openxc::gpio::GPIO_VALUE_LOW;
void configureEndpoints() {
for(int i = 0; i < ENDPOINT_COUNT; i++) {
UsbEndpoint* endpoint = &getConfiguration()->usb.endpoints[i];
Endpoint_ConfigureEndpoint(endpoint->address,
EP_TYPE_BULK,
endpoint->direction == UsbEndpointDirection::USB_ENDPOINT_DIRECTION_OUT ?
ENDPOINT_DIR_OUT : ENDPOINT_DIR_IN,
endpoint->size, ENDPOINT_BANK_DOUBLE);
}
}
extern "C" {
void EVENT_USB_Device_Disconnect() {
getConfiguration()->usb.configured = false;
}
void EVENT_USB_Device_ControlRequest() {
if(!(Endpoint_IsSETUPReceived())) {
return;
}
QUEUE_TYPE(uint8_t) payloadQueue;
QUEUE_INIT(uint8_t, &payloadQueue);
// Only read payload of our app's control requests, not USB system's
if((USB_ControlRequest.bmRequestType >> 7 == 0) &&
USB_ControlRequest.bRequest == CONTROL_COMMAND_REQUEST_ID) {
Endpoint_ClearSETUP();
int bytesReceived = 0;
while(bytesReceived < USB_ControlRequest.wLength) {
while(!Endpoint_IsOUTReceived());
while(Endpoint_BytesInEndpoint()) {
uint8_t byte = Endpoint_Read_8();
if(!QUEUE_PUSH(uint8_t, &payloadQueue, byte)) {
debug("Dropped control request from host -- queue is full");
break;
}
++bytesReceived;
}
Endpoint_ClearOUT();
}
Endpoint_ClearStatusStage();
}
int length = QUEUE_LENGTH(uint8_t, &payloadQueue);
uint8_t snapshot[length];
if(length > 0) {
QUEUE_SNAPSHOT(uint8_t, &payloadQueue, snapshot, length);
openxc::interface::usb::handleIncomingMessage(snapshot, length);
}
}
void EVENT_USB_Device_ConfigurationChanged(void) {
getConfiguration()->usb.configured = false;
configureEndpoints();
// Don't use debug() in here, because if UART logging is enabled, that
// breaks most if not all USB control commands because we don't response
// fast enough.
getConfiguration()->usb.configured = true;
}
}
/* Private: Flush any queued data out to the USB host. */
static void flushQueueToHost(UsbDevice* usbDevice, UsbEndpoint* endpoint) {
if(!usb::connected(usbDevice) || QUEUE_EMPTY(uint8_t, &endpoint->queue)) {
return;
}
uint8_t previousEndpoint = Endpoint_GetCurrentEndpoint();
Endpoint_SelectEndpoint(endpoint->address);
if(Endpoint_IsINReady()) {
// get bytes from transmit FIFO into intermediate buffer
int byteCount = 0;
while(!QUEUE_EMPTY(uint8_t, &endpoint->queue)
&& byteCount < USB_SEND_BUFFER_SIZE) {
endpoint->sendBuffer[byteCount++] = QUEUE_POP(uint8_t,
&endpoint->queue);
}
if(byteCount > 0) {
Endpoint_Write_Stream_LE(endpoint->sendBuffer, byteCount, NULL);
Endpoint_ClearIN();
}
}
Endpoint_SelectEndpoint(previousEndpoint);
}
/* Private: Detect if USB VBUS is active.
*
* This isn't useful if there's no diode between an external 12v/9v power supply
* (e.g. vehicle power from OBD-II) and the 5v rail, because then VBUS high when
* the power is powered on regardless of the status of USB. In that situation,
* you can fall back to the usbHostDetected() function instead.
*
* Returns true if VBUS is high.
*/
static bool vbusDetected() {
return gpio::getValue(VBUS_PORT, VBUS_PIN) != GPIO_VALUE_LOW;
}
/* Private: Detect if a USB host is actually attached, regardless of VBUS.
*
* This is a bit hacky, as normally you should rely on VBUS to detect if USB is
* connected. See vbusDetected() for reasons why we need this workaround on the
* current prototype.
*
* Returns true of there is measurable activity on the D- USB line.
*/
static bool usbHostDetected(UsbDevice* usbDevice) {
static int debounce = 0;
static float average = USB_HOST_DETECT_INACTIVE_VALUE / 2;
if(gpio::getValue(USB_DM_PORT, USB_DM_PIN) == GPIO_VALUE_LOW) {
++debounce;
} else {
average = average * .9 + debounce * .1;
debounce = 0;
}
bool hostDetected = true;
if(!usb::connected(usbDevice) && average < USB_HOST_DETECT_ACTIVE_VALUE) {
EVENT_USB_Device_ConfigurationChanged();
}
if(debounce > USB_HOST_DETECT_INACTIVE_VALUE * 2 ||
average > USB_HOST_DETECT_INACTIVE_VALUE) {
debounce = 0;
average = USB_HOST_DETECT_INACTIVE_VALUE / 2;
hostDetected = false;
}
return hostDetected;
}
/* Private: Configure I/O pins used to detect if USB is connected to a host. */
static void configureUsbDetection() {
PINSEL_CFG_Type vbusPinConfig;
vbusPinConfig.Funcnum = VBUS_FUNCNUM;
vbusPinConfig.Portnum = VBUS_PORT;
vbusPinConfig.Pinnum = VBUS_PIN;
vbusPinConfig.Pinmode = PINSEL_PINMODE_TRISTATE;
PINSEL_ConfigPin(&vbusPinConfig);
PINSEL_CFG_Type hostDetectPinConfig;
hostDetectPinConfig.Funcnum = USB_DM_FUNCNUM;
hostDetectPinConfig.Portnum = USB_DM_PORT;
hostDetectPinConfig.Pinnum = USB_DM_PIN;
hostDetectPinConfig.Pinmode = PINSEL_PINMODE_TRISTATE;
PINSEL_ConfigPin(&hostDetectPinConfig);
}
void openxc::interface::usb::processSendQueue(UsbDevice* usbDevice) {
USB_USBTask();
if(!usb::connected(usbDevice)) {
usbHostDetected(usbDevice);
}
if(usb::connected(usbDevice)) {
if((USB_DeviceState != DEVICE_STATE_Configured || !vbusDetected())
|| !usbHostDetected(usbDevice)) {
// On Windows the USB device will be configured when plugged in for
// the first time, regardless of if you are actively using it in an
// application. Windows will *not* send the USB configured event
// when an application connects.
//
// On Linux and Mac, the USB configured event triggers each time a
// new connection is made to the device.
//
// This means that if vbus is high (i.e. USB *might* be connected),
// that's the only time we should check the usbHostDetected()
// workaround. If we call that on Windows when USB is attached, it
// will *unconfigure* the USB device from the VI side but not
// reconfigure it until you disconnect and reconnect the device to
// the PC! If the debounce value is small (which is ideal...) that
// could happen even before your app has a chance to load the
// device.
EVENT_USB_Device_Disconnect();
} else {
for(int i = 0; i < ENDPOINT_COUNT; i++) {
UsbEndpoint* endpoint = &usbDevice->endpoints[i];
if(endpoint->direction == UsbEndpointDirection::USB_ENDPOINT_DIRECTION_IN) {
flushQueueToHost(usbDevice, endpoint);
}
}
}
}
}
void openxc::interface::usb::initialize(UsbDevice* usbDevice) {
usb::initializeCommon(usbDevice);
USB_Init();
::USB_Connect();
configureUsbDetection();
}
void openxc::interface::usb::read(UsbDevice* device, UsbEndpoint* endpoint,
openxc::util::bytebuffer::IncomingMessageCallback callback) {
uint8_t previousEndpoint = Endpoint_GetCurrentEndpoint();
Endpoint_SelectEndpoint(endpoint->address);
bool receivedData = false;
while(Endpoint_IsOUTReceived()) {
while(Endpoint_BytesInEndpoint()) {
if(!QUEUE_PUSH(uint8_t, &endpoint->queue, Endpoint_Read_8())) {
debug("Dropped write from host -- queue is full");
}
receivedData = true;
}
Endpoint_ClearOUT();
}
if(receivedData) {
while(processQueue(&endpoint->queue, callback)) {
continue;
}
}
Endpoint_SelectEndpoint(previousEndpoint);
}
void openxc::interface::usb::deinitialize(UsbDevice* usbDevice) {
usb::initializeCommon(usbDevice);
// Turn off USB connection status LED
gpio::setValue(USB_CONNECT_PORT, USB_CONNECT_PIN, GPIO_VALUE_HIGH);
}
| 2024-05-20T01:27:15.642919 | https://example.com/article/3048 |
Epidural analgesia in the surgery of congenital tracheal stenosis: slide tracheoplasty on cardiopulmonary bypass.
Epidural analgesia in children is highly effective and safe; however, it has not enjoyed great popularity in surgery that requires cardiopulmonary bypass. A major concern is the possibility of damage to blood vessels with the epidural needle or catheter and epidural hematoma formation. There seems to be a low incidence of epidural hematoma if certain guidelines are followed, so that in children, epidural analgesia can be used in selected patients, with safety, when surgical repair requires cardiopulmonary bypass. Epidural morphine has been used for clinical pain relief in pediatric cardiac surgery. Improved pulmonary function, suppressed hormonal and metabolic stress responses, easy early tracheal extubation, and good analgesia and sedation that allows neurological examination to alert any possibles hidden complications, are the advantages. A dedicated medical team is essential in the perioperative management to achieve maximum benefit for these patients. | 2023-12-11T01:27:15.642919 | https://example.com/article/8227 |
Archives
Veteran reporter Stuart Watson of WCNC TV in Charlotte has been following North Carolina’s coal ash story for years and it shows in an excellent 30 minute documentary that ran Sunday in an episode of the station’s “FlashPOINT” series. Click below to check it out.
In case you missed it over the weekend, be sure to check out reporter Trip Gabriel’s excellent story in the New York Times about how the recent Dan River coal ash spill has served to expose the ways in which the McCrory administration has “defanged” the Department of Environment and Natural Resources. Here’s how it begins:
“Last June, state employees in charge of stopping water pollution were given updated marching orders on behalf of North Carolina’s new Republican governor and conservative lawmakers.
‘The General Assembly doesn’t like you,’ an official in the Department of Environment and Natural Resources told supervisors called to a drab meeting room here. ‘They cut your budget, but you didn’t get the message. And they cut your budget again, and you still didn’t get the message.’
From now on, regulators were told, they must focus on customer service, meaning issuing environmental permits for businesses as quickly as possible. Big changes are coming, the official said, according to three people in the meeting, two of whom took notes. ‘If you don’t like change, you’ll be gone.’”
Remember the $99,000 settlement the state Department of Environment and Natural Resources tried to push in the coal ash spill lawsuits, but then pulled from court consideration after the media exposed it as a sweetheart deal with Duke Energy?
That settlement — and then some — may be back on the table, according to a letter sent to Superior Court Judge Paul Ridgeway on February 20.
In that letter (below) DENR indicates that it may add other Duke Energy coal ash sites, including the Dan River plant, or propose other modifications to the settlement — a decision it expects to reach by March 21, 2014.
As part of announcing her candidacy for reelection yesterday, Senator Kay Hagan weighed in on the ongoing Duke Energy coal ash disaster that continues to unfold just a few miles down the road from her Greensboro home. You would have thought it would have been a moment on which the embattled Senator would have seized in order to pillory her Republican critics. Heck, it’s not that hard to envision a scenario in which she would have announced her campaign wearing waders in some Dan River muck!
“We’ve got to have oversight on the handling, the disposal and the storage of coal ash. When you think that just a broken pipe has caused this amount of leakage, and we know that we have 36 coal ash ponds in North Carolina, it is a serious issue, and we need to study it.”
I’m sorry, Senator. Did you say we need to study the matter? Study??!!
Earth to Kay Hagan: We know what to do about this problem. It’s already being done in South Carolina for Pete’s sake! North Carolina doesn’t need more study; it needs immediate action and leadership from public officials who care more about the people and environment of the state than the big money campaign contributions of Duke Energy.
One would have thought that a veteran politician like Senator Hagan — someone who’s been in public office for 15 years — would have at least grasped the politics of the current situation (even if the science and policy matters escaped her). Unfortunately (and quite amazingly), this does not appear to be the case. | 2023-12-02T01:27:15.642919 | https://example.com/article/2502 |
In vitro analysis of radiation-induced dermal wounds.
To investigate the pathophysiology of radiation-induced wounds of the head and neck at a molecular level. Basic science, prospective study. The study was conducted at the Department of Otolaryngology-Head and Neck Surgery, Ruprecht Karls-University Heidelberg, Faculty of Medicine Mannheim, Mannheim, Germany. Keratinocytes from chronic nonhealing ulcers in irradiated areas as well as from healthy skin areas in the same patients (n = 3) were harvested during surgical procedures and isolated in cell culture. First, a proliferation assay was performed. Gene expression was analyzed by microarray, protein expression by immunohistochemistry. Keratinocytes from radiogenic wounds showed a shift from the high molecular keratins 1 and 10 to the low molecular keratins 5 and 14 compared to normal control skin. Keratinocytes from nonhealing wounds showed a decreased expression of transforming growth factor alpha and beta 1, fibroblast growth factor 1 and 2, keratinocyte growth factor, vascular endothelial growth factor, and hepatocyte growth factor. The matrix metalloproteinases 2, 12, and 13 showed increased expression in irradiated keratinocytes and fibroblasts. Our data showed a change of keratinocytes to a less differentiated state due to radiation. Additionally, it seems that radiation-induced dermal injuries often fail to heal because of decreased proliferation, impaired angiogenesis, and persistently high concentrations of matrix metalloproteinases. | 2023-09-28T01:27:15.642919 | https://example.com/article/5484 |
the guardian “Sequenced palm oil genome paves the way for sustainable plantations”
Researchers pinpoint a gene that could be used to boost yields and reduce competition between forests and oil palms a duo of papers just published in Nature moves a step in that direction, suggesting that breeders could further boost oil palm yields, and in that way significantly reduce the competition between rainforests and palm oil plantations around the world. | 2024-07-14T01:27:15.642919 | https://example.com/article/5927 |
Akron Gymnasium
The Akron Gymnasium, at W. 4th St. & Custer Ave. in Akron, Colorado, was built during 1938-40. It was designed by Eugene G. Groves and built by the Works Progress Administration. It has also been known as the Washington County High School Gymnasium. It was listed on the National Register of Historic Places in 2008.
It was abandoned for many years, but was deemed significant for its association with the WPA and with the community of Akron, a small town of 1,400 population in 1940.
References
Category:Gyms in the United States
Category:Sports venues on the National Register of Historic Places in Colorado
Category:Late 19th and Early 20th Century American Movements architecture
Category:Sports venues completed in 1940
Category:Buildings and structures in Washington County, Colorado
Category:1940s architecture in the United States
Category:Works Progress Administration in Colorado
Category:National Register of Historic Places in Washington County, Colorado | 2024-07-26T01:27:15.642919 | https://example.com/article/1925 |
Brain death, religious freedom, and public policy: New Jersey's landmark legislative initiative.
"Whole brain death" (neurological death) is well-established as a legal standard of death across the country. Recently, New Jersey became the first state to enact a statute recognizing a personal religious exemption (a conscience clause) protecting the rights of those who object to neurological death. The Act also mandates adoption through the regulatory process of uniform and up-to-date clinical criteria for determining neurological death. | 2023-11-27T01:27:15.642919 | https://example.com/article/6488 |
Nicole Baylies
Reader submitted
Jersey Shore Roller Girls (JSRG) hosts a night filled with hard hitting roller derby for their last home bout of the season. On October 8th, 2016 your favorite skaters close out the season at the Winding River Skating Center in Toms River with an intense doubleheader. JSRG All Stars and Beat Down face off against teams from Hatfield, PA and Madison County, NY. Doors open at 5:00 p.m., and the first game starts at 5:30 p.m. Tickets are $10 adults/$6 kids in advance, and $13 adults/$8 kids at the door. Children 5 and under are free. Send PayPal payments to JSRGPayPal@yahoo.com with the name you want the tickets held under at WILL CALL. If you are friends or family of a skater/official, please add that as well.
JSRG is the Shore’s longest-established, all-women, flat track roller derby league, with members coming from Central NJ and the Shore area. The league consists of approximately 40 skaters comprising two traveling teams: the JSRG All-Stars and the JSRG Beat Down. JSRG follows the guidelines and standards set forth by Women’s Flat Track Derby Association (WFTDA). For more information, visit us on the Web at http://www.jerseyshorerollergirls.net, or on our Facebook page.
Roller derby has experienced a revival in the past few years, with almost 1500 teams around the world. It is a full-contact sport played in traditional quad roller skates on a flat surface, such as a the floor of a roller rink. Roller derby games are called bouts, which are divided into two 30-minute periods. Each period consists of a number of jams, which can last up to two minutes.
In a jam, each team puts five players on the track: four blockers and a jammer. The jammers are the point-scorers, and attempt to earn points by lapping the pack and successfully passing the opposing team’s blockers. The blockers’ main objective is to impede the progress of the opposite team’s jammer through the pack. Blockers can use shoulder and hip checks, as well as booty blocks, but penalties are given to skaters who block illegally, behave in an unsportsmanlike manner, or otherwise break the rules.
Roller derby is a full contact sport; while bouts may be tough and action-packed, they are family-friendly and enjoyable for fans of all ages. For more information, visit wftda.com. | 2024-06-22T01:27:15.642919 | https://example.com/article/9980 |
Q:
C#/XNA - RenderTarget2D.GetData(), RenderTarget2D.SetData(): is it efficient for cloning textures per frame?
So, since the last question, I found that my solution is to duplicate the texture to prevent reference issues. However, I'm questioning:
Color[] color = new Color[screen.Width * screen.Height];
InputRenderTarget2D.GetData(Color);
OutputRenderTarget2D.SetData(color);
For one, is this efficient when ran 60 times per second? Although it's setting 1 texture, I'm performance-paranoid and WANT to keep performance at its decent or best. Will it cause "majorly-noticable framedrops" and the like?
Second, will it boost performance that instead of creating a new Color array, I recycle one?
A:
I believe this will harm performance because the GetData()/SetData() calls will transfer the rendertarget data to main memory. IMO, the better alternative would be to render InputRenderTarget2D to OutputRenderTarget2D using a quad of the same size. This will prevent CPU-GPU data transfer.
| 2024-06-12T01:27:15.642919 | https://example.com/article/2751 |
THE Azteca Stadium in Mexico is one of the most iconic stadiums in football. The third largest stadium in the world, with a capacity of 95,500, it was the first ground to have hosted two World Cup finals and was the venue for Diego Maradona’s ‘Hand of God’ goal against England in the 1986 World Cup.
So for a proud Scot to be potentially making one of his first international appearances there is ‘unbelievable’, as Scott Arfield describes it.
That his international debut won’t be coming for Scotland, the country of his birth, is something he has accepted, and the Clarets midfielder can’t wait to get started with Canada in March, providing his passport application goes through smoothly.
Arfield qualifies for the Canucks, as Canada’s national team is known, through dad Harry, who was born in Toronto while his dad was serving in the Army there.
The former Scotland Under-21 international might have been born in Livingston, but he is proud of his family’s Canadian roots, and having accepted a Tartan Army call is not going to come, he has made the decision to switch allegiance, and the paperwork should be processed in time for the World Cup qualifying double-header with Mexico at the end of March.
Arfield has been consistently overlooked for Gordon Strachan’s Scotland squads, despite playing regularly in the Premier League last season and impressing in two Championship campaigns with Burnley.
But it is not something he is dwelling on, instead choosing to focus on the chance of a lifetime with Canada, who count former Burnley defender David Edgar amongst their number.
“I wouldn’t say Scotland broke my heart,” said Arfield. “When I first came to England I was always dying to go back up to play for Scotland, it was the only time I wanted to go back, I didn’t want to go back to Scottish football, I wanted to go there and play for Scotland.
“I’ve spoken to the manager of Canada and the manager of Scotland and reiterated my feelings and my decision. I think it’s the best one for me and my family.
“(Strachan) gave me a call and he wished me all the best. He never tried to change my mind.
“He wanted to touch base since the paperwork came through to Scotland. I told him my decision and it’s one I’m glad I took.”
Arfield said his dad was “buzzing” about his decision to represent Canada, coached by Spaniard Benito Floro, and that he was hoping to watch Arfield in action, with Canada at home to Mexico on March 26 in Vancouver, before the return at the Azteca four days later.
“My dad moved quite early so he never had that much connection, but he feels he was born there, there his roots, and I’m delighted to contribute to that,” said Arfield, who has six goals for the Clarets this season.
He says playing for Canada will offer him far more than an experience in international football, and he can’t wait for his first trip to the land of the Maple Leaf.
“It’s something I’m dying to do,” he said. “It’s one I was going to do in the summer but things changed, then we were going to do it soon but my partner is pregnant now so she can’t fly.
“We’re definitely going to go over and see Canada to its full extent, but it’s on hold for now. They play home games in Vancouver. I’ve been told it’s beautiful.
“It’s not just football. That opens doors but it’s a life experience as well, to jump on a plane and see things you wouldn’t have seen and meet people you wouldn’t have met.” | 2023-12-02T01:27:15.642919 | https://example.com/article/8860 |
index_title=Generador d'Informes de Squid
index_econf=No s'ha trobat al sistema el fitxer de configuració $1 de Sarg. Pot ser que Sarg no estigui instal·lat, o bé que la <a href='$2'>configuració del mòdul</a> sigui incorrecta.
index_ecmd=No s'ha trobat al sistema el programa $1 de Sarg. Pot ser que no estigui instal·lat, o bé que la <a href='$2'>configuració del mòdul</a> sigui incorrecta.
index_eversion=No s'ha pogut obtenir la versió de Sarg amb l'ordre $1: $2
index_version=Sarg versió $1
index_generate=Genera Ara l'Informe
index_generatedesc=Fes clic sobre aquest botó per generar immediatament un informe Sarg a $1 utilitzant la configuració actual.
index_clear=Suprimeix l'informe existent al directori
index_range=Genera l'informe per al rang de dates
index_view=Visualitza l'Informe Generat
index_viewdesc=Visualitza l'informe generat més recent al directori $1.
index_return=a l'índex del mòdul
log_title=Origen del Registre i Destinació de l'Informe
log_header=Opcions del fitxer de registre de Squid origen i de l'informe generat
log_access_log=Fitxer de registre de Squid origen
log_squid=Registre actual del servidor Squid ($1)
log_other=Un altre fitxer
log_output_dir=Directori de destinació de l'informe
log_output_email=Envia l'informe a
log_nowhere=Enlloc
log_useragent_log=Fitxer de registre de l'agent d'usuari
log_lastlog=Nombre d'informes a mantenir
log_unlimit=Il·limitat
log_mail_utility=Ordre per enviar el correu
log_remove_temp_files=Suprimeix els fitxers temporals després de fer l'informe
log_err=No s'han pogut desar les opcions del fitxer de registre origen
log_efile=El fitxer no existeix
log_edir=El directori no existeix
log_elastlog=Hi falta el nombre o bé no és un número
log_eemail=Hi falta l'adreça de correu o bé és aparentment invàlida
log_emailx=Hi falta el programa de correu o bé no existeix
log_squidguard_log_path=Fitxer de registre de SquidGuard
style_title=Estil de l'Informe
style_header=Opcions HTML de l'estil i el color de l'informe
style_title2=Títol de l'informe
style_font_face=Tipografia del cos de l'informe
style_header_color=Color de la capçalera
style_header_bgcolor=Color de fons de la capçalera
style_header_font_size=Mida de la tipografia de la capçalera
style_background_color=Color del fons
style_text_color=Color del text
style_text_bgcolor=Color de fons del text
style_title_color=Color del títol
style_logo_image=Referència de la imatge del logotip
style_image_size=Mida de la imatge (amplada i alçada)
style_logo_text=Text del logotip
style_logo_text_color=Color del text del logotip
style_background_image=Referència de la imatge de fons
style_err=No s'han pogut desar les opcions d'estil de l'informe
style_etitle=Hi falta el títol de l'informe
style_ecolour=Hi falta el nom o codi RRGGBB del color o bé és invàlid
style_efontsize=Hi falta la mida de la tipografia o bé és invàlida
style_efont=Hi falta el nom de la tipografia o bé és invàlid
style_esize=Hi falta l'amplada i alçada de la imatge o bé és invàlida
style_language=Idioma de l'informe
style_charset=Joc de caràcters de l'informe
report_title=Opcions de l'Informe
report_header=Contingut de l'informe i opcions de generació
report_resolve_ip=Resol les adreces IP
report_user_ip=Utilitza adreces IP en lloc d'IDs d'usuari
report_user_sort_field=Ordenació de l'informa d'usuaris
report_topuser_sort_field=Ordenació de l'informe d'usuaris principals
report_reverse=Ordre invers
report_forward=Ordre normal
report_by_user=Per nom d'usuari
report_by_connect=Per hora de connexió
report_by_bytes=Pels bytes
report_by_time=Per l'hora
report_by_site=Pel lloc
report_exclude_users=Fitxer que llista els usuaris a excloure
report_exclude_hosts=Fitxer que llista els hosts a excloure
report_index=Torna a generar el fitxer <tt>index.html</tt>
report_only=Només genera el fitxer <tt>index.html</tt>
report_overwrite_report=Sobreescriu l'informe amb data
report_overno=No, reanomena'l amb .1
report_records_without_userid=Acció per als registres sense usuari
report_ignore=Ignora'ls totalment
report_ip=Utilitza l'adreça IP en lloc seu
report_everybody=Utilitza el nom d'usuari <tt>everybody</tt>
report_use_comma=Utilitza la coma en lloc del punt als números
report_topsites_num=Nombre de llocs principals a llistar
report_topsites_sort_order=Ordenació de l'informe de llocs principals
report_sorta=Ascendent
report_sortd=Descendent
report_index_sort_order=Ordenació dels enllaços de <tt>index.html</tt>
report_exclude_codes=Fitxer que llista els codis HTTP a excloure
report_max_elapsed=Temps màxim transcorregut (ms)
report_report_type=Seccions de l'informe a generar
report_topsites=Llocs principals
report_topusers=Usuaris principals
report_sites_users=Llocs per usuari
report_users_sites=Usuaris per lloc
report_date_time=Ús per dia i hora
report_denied=Llocs denegats
report_downloads=Descàrregues
report_auth_failures=Autenticacions fallides
report_site_user_time_date=Llocs, dates, hores i bytes
report_all=Tots els informes
report_below=Els seleccionats a sota...
report_usertab=Fitxer de mapejat de noms d'usuari
report_long_url=Mostra els URLs complets en l'informe
report_date_time_by=Ordena l'informe de dates/hores per
report_bytes=Bytes
report_elap=Temps transcorregut
report_user_invalid_char=Caràcters invàlids als noms dels usuaris
report_privacy=Amaga els llocs visitats
report_privacy_string=Text de substitució dels llocs visitats
report_privacy_string_color=Color del text de substitució
report_below2=Introduït a sota...
report_include_users=Genera només l'informe d'usuaris
report_exclude_string=Exclou les línies del registre que contenen
report_allusers=Tots els usuaris
report_nostrings=No n'excloguis cap
report_topuser_num=Nombre d'usuaris principals a mostrar
report_site_user_time_date_type=Format de la taula del lloc, usuari, data i hora
report_table=Taula HTML
report_list=Llista de text
report_displayed_values=Mostra el trànsit
report_bytes2=En bytes
report_abbrev=Abreujat (K, M, G)
report_weekdays=Dies de la setmana a incloure en l'informe
report_weekdays0=Dg
report_weekdays1=Dl
report_weekdays2=Dm
report_weekdays3=Dc
report_weekdays4=Dj
report_weekdays5=Dv
report_weekdays6=Ds
report_hours=Hores a incloure en l'informe
report_err=No s'han pogut desar les opcions de l'informe
report_efile=El fitxer no existeix
report_enum=No és un número
report_echar=Els espais no estan permesos
report_estring=Hi falta el text de substitució o bé és invàlid
report_eselect=No has seleccionat res
report_eenter=No has introduït res
sched_title=Generació Planificada d'Informes
sched_header=Opcions dels informes planificats
sched_sched=Informe planificat activat
sched_yes=Sí, a les hores seleccionades a sota...
sched_clear=Buida cada vegada el directori d'informes
sched_dir=Directori d'informes
sched_edir=No has definit cap directori de destí dels informes a la pàgina <a href='$1'>Origen del Registre i Destinació de l'Informe</a>. Cal configurar això abans d'activar els informes planificats.
sched_esfile=No s'ha definit cap fitxer de registre de squid a la pàgina <a href='$1'>Origen del Registre i Destinació de l'Informe</a>. Això s'ha de configurar abans de poder activar l'informe planificat.
sched_range=Genera l'informe per al rang de dates
sched_rall=Tots els registres del fitxer de registre
sched_rsel=Des de fa $1 dies fins fa $2 dies
sched_err=No s'ha pogut desar la generació planificada de l'informe
sched_erfrom=Hi falta el nombre de dies inicial o bé és invàlid
sched_erto=Hi falta el nombre de dies final o bé és invàlid
view_title=Informe Sarg
view_efile=Nom de fitxer invàlid!
view_eopen=No s'ha pogut obrir el fitxer d'informe
gen_title=Generació d'Informe
gen_header=S'està generant l'informe Sarg a partir del fitxer $1 de registre de Squid i totes les versions rotades...
gen_done=... fet
gen_failed=... Sarg ha fallat! Mira la sortida anterior per a més detalls.
gen_nothing=... Sarg ha acabat, però no s'ha generat cap informe. Mira la sortida anterior per a més detalls.
gen_view=Visualitza l'informe completat.
gen_err=No s'ha pogut generar l'informe
gen_efrom=Hi falta el dia inicial o bé és invàlid
gen_eto=Hi falta el dia final o bé és invàlid
webmin_log_log=S'han actualitzat les opcions del registre origen i destinació de l'informe
webmin_log_report=S'han actualitzat les opcions de l'informe
webmin_log_style=S'han actualitzat les opcions d'estil de l'informe
webmin_log_sched_create=S'ha activat la planificació d'informes
webmin_log_sched_delete=S'ha desactivat la planificació d'informes
webmin_log_sched_update=S'ha actualitzat la planificació d'informes
webmin_log_sched_nothing=S'ha deixat la planificació d'informes desactivada
webmin_log_generate=S'ha generat l'informe
| 2023-08-21T01:27:15.642919 | https://example.com/article/5033 |
"use strict";
/*
* Copyright 2017 Google Inc.
*
* Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except
* in compliance with the License. You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software distributed under the
* License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either
* express or implied. See the License for the specific language governing permissions and
* limitations under the License.
*/
var __spreadArrays = (this && this.__spreadArrays) || function () {
for (var s = 0, i = 0, il = arguments.length; i < il; i++) s += arguments[i].length;
for (var r = Array(s), k = 0, i = 0; i < il; i++)
for (var a = arguments[i], j = 0, jl = a.length; j < jl; j++, k++)
r[k] = a[j];
return r;
};
Object.defineProperty(exports, "__esModule", { value: true });
exports.profile = exports.log = void 0;
var flags_1 = require("./flags");
function log(message) {
var args = [];
for (var _i = 1; _i < arguments.length; _i++) {
args[_i - 1] = arguments[_i];
}
if (flags_1.IS_LOG) {
var length_1 = args ? args.length : 0;
if (length_1 > 0) {
console.log.apply(console, __spreadArrays([message], args));
}
else {
console.log(message);
}
}
}
exports.log = log;
;
// check to see if native support for profiling is available.
var NATIVE_PROFILE_SUPPORT = typeof window !== 'undefined' && !!window.performance && !!console.profile;
/**
* A decorator that can profile a function.
*/
function profile(target, propertyKey, descriptor) {
if (flags_1.IS_PROFILE) {
return performProfile(target, propertyKey, descriptor);
}
else {
// return as-is
return descriptor;
}
}
exports.profile = profile;
function performProfile(target, propertyKey, descriptor) {
var originalCallable = descriptor.value;
// name must exist
var name = originalCallable.name;
if (!name) {
name = 'anonymous function';
}
if (NATIVE_PROFILE_SUPPORT) {
descriptor.value = function (args) {
console.profile(name);
var startTime = window.performance.now();
var result = originalCallable.call.apply(originalCallable, __spreadArrays([this || window], args));
var duration = window.performance.now() - startTime;
console.log(name + " took " + duration + " ms");
console.profileEnd();
return result;
};
}
else {
descriptor.value = function (args) {
log("Profile start " + name);
var start = Date.now();
var result = originalCallable.call.apply(originalCallable, __spreadArrays([this || window], args));
var duration = Date.now() - start;
log("Profile end " + name + " took " + duration + " ms.");
return result;
};
}
return descriptor;
}
//# sourceMappingURL=data:application/json;base64,eyJ2ZXJzaW9uIjozLCJmaWxlIjoibG9nZ2VyLmpzIiwic291cmNlUm9vdCI6IiIsInNvdXJjZXMiOlsiLi4vc3JjL2xvZ2dlci50cyJdLCJuYW1lcyI6W10sIm1hcHBpbmdzIjoiO0FBQUE7Ozs7Ozs7Ozs7OztHQVlHOzs7Ozs7Ozs7O0FBRUgsaUNBQTJDO0FBRTNDLFNBQWdCLEdBQUcsQ0FBQyxPQUFlO0lBQUUsY0FBYztTQUFkLFVBQWMsRUFBZCxxQkFBYyxFQUFkLElBQWM7UUFBZCw2QkFBYzs7SUFDakQsSUFBSSxjQUFNLEVBQUU7UUFDVixJQUFJLFFBQU0sR0FBRyxJQUFJLENBQUMsQ0FBQyxDQUFDLElBQUksQ0FBQyxNQUFNLENBQUMsQ0FBQyxDQUFDLENBQUMsQ0FBQztRQUNwQyxJQUFJLFFBQU0sR0FBRyxDQUFDLEVBQUU7WUFDZCxPQUFPLENBQUMsR0FBRyxPQUFYLE9BQU8sa0JBQUssT0FBTyxHQUFLLElBQUksR0FBRTtTQUMvQjthQUFNO1lBQ0wsT0FBTyxDQUFDLEdBQUcsQ0FBQyxPQUFPLENBQUMsQ0FBQztTQUN0QjtLQUNGO0FBQ0gsQ0FBQztBQVRELGtCQVNDO0FBQUEsQ0FBQztBQUVGLDZEQUE2RDtBQUM3RCxJQUFNLHNCQUFzQixHQUN4QixPQUFPLE1BQU0sS0FBSyxXQUFXLElBQUksQ0FBQyxDQUFDLE1BQU0sQ0FBQyxXQUFXLElBQUksQ0FBQyxDQUFDLE9BQU8sQ0FBQyxPQUFPLENBQUM7QUFFL0U7O0dBRUc7QUFDSCxTQUFnQixPQUFPLENBQUMsTUFBVyxFQUFFLFdBQW1CLEVBQUUsVUFBOEI7SUFDdEYsSUFBSSxrQkFBVSxFQUFFO1FBQ2QsT0FBTyxjQUFjLENBQUMsTUFBTSxFQUFFLFdBQVcsRUFBRSxVQUFVLENBQUMsQ0FBQztLQUN4RDtTQUFNO1FBQ0wsZUFBZTtRQUNmLE9BQU8sVUFBVSxDQUFDO0tBQ25CO0FBQ0gsQ0FBQztBQVBELDBCQU9DO0FBRUQsU0FBUyxjQUFjLENBQ25CLE1BQVcsRUFBRSxXQUFtQixFQUFFLFVBQThCO0lBQ2xFLElBQUksZ0JBQWdCLEdBQUcsVUFBVSxDQUFDLEtBQUssQ0FBQztJQUN4QyxrQkFBa0I7SUFDbEIsSUFBSSxJQUFJLEdBQUcsZ0JBQWdCLENBQUMsSUFBSSxDQUFDO0lBQ2pDLElBQUksQ0FBQyxJQUFJLEVBQUU7UUFDVCxJQUFJLEdBQUcsb0JBQW9CLENBQUM7S0FDN0I7SUFDRCxJQUFJLHNCQUFzQixFQUFFO1FBQzFCLFVBQVUsQ0FBQyxLQUFLLEdBQUcsVUFBUyxJQUFXO1lBQ3JDLE9BQU8sQ0FBQyxPQUFPLENBQUMsSUFBSSxDQUFDLENBQUM7WUFDdEIsSUFBSSxTQUFTLEdBQUcsTUFBTSxDQUFDLFdBQVcsQ0FBQyxHQUFHLEVBQUUsQ0FBQztZQUN6QyxJQUFJLE1BQU0sR0FBRyxnQkFBZ0IsQ0FBQyxJQUFJLE9BQXJCLGdCQUFnQixrQkFBTSxJQUFJLElBQUksTUFBTSxHQUFLLElBQUksRUFBQyxDQUFDO1lBQzVELElBQUksUUFBUSxHQUFHLE1BQU0sQ0FBQyxXQUFXLENBQUMsR0FBRyxFQUFFLEdBQUcsU0FBUyxDQUFDO1lBQ3BELE9BQU8sQ0FBQyxHQUFHLENBQUksSUFBSSxjQUFTLFFBQVEsUUFBSyxDQUFDLENBQUM7WUFDM0MsT0FBTyxDQUFDLFVBQVUsRUFBRSxDQUFDO1lBQ3JCLE9BQU8sTUFBTSxDQUFDO1FBQ2hCLENBQUMsQ0FBQztLQUNIO1NBQU07UUFDTCxVQUFVLENBQUMsS0FBSyxHQUFHLFVBQVMsSUFBVztZQUNyQyxHQUFHLENBQUMsbUJBQWlCLElBQU0sQ0FBQyxDQUFDO1lBQzdCLElBQUksS0FBSyxHQUFHLElBQUksQ0FBQyxHQUFHLEVBQUUsQ0FBQztZQUN2QixJQUFJLE1BQU0sR0FBRyxnQkFBZ0IsQ0FBQyxJQUFJLE9BQXJCLGdCQUFnQixrQkFBTSxJQUFJLElBQUksTUFBTSxHQUFLLElBQUksRUFBQyxDQUFDO1lBQzVELElBQUksUUFBUSxHQUFHLElBQUksQ0FBQyxHQUFHLEVBQUUsR0FBRyxLQUFLLENBQUM7WUFDbEMsR0FBRyxDQUFDLGlCQUFlLElBQUksY0FBUyxRQUFRLFNBQU0sQ0FBQyxDQUFDO1lBQ2hELE9BQU8sTUFBTSxDQUFDO1FBQ2hCLENBQUMsQ0FBQztLQUNIO0lBQ0QsT0FBTyxVQUFVLENBQUM7QUFDcEIsQ0FBQyIsInNvdXJjZXNDb250ZW50IjpbIi8qXG4gKiBDb3B5cmlnaHQgMjAxNyBHb29nbGUgSW5jLlxuICpcbiAqIExpY2Vuc2VkIHVuZGVyIHRoZSBBcGFjaGUgTGljZW5zZSwgVmVyc2lvbiAyLjAgKHRoZSBcIkxpY2Vuc2VcIik7IHlvdSBtYXkgbm90IHVzZSB0aGlzIGZpbGUgZXhjZXB0XG4gKiBpbiBjb21wbGlhbmNlIHdpdGggdGhlIExpY2Vuc2UuIFlvdSBtYXkgb2J0YWluIGEgY29weSBvZiB0aGUgTGljZW5zZSBhdFxuICpcbiAqIGh0dHA6Ly93d3cuYXBhY2hlLm9yZy9saWNlbnNlcy9MSUNFTlNFLTIuMFxuICpcbiAqIFVubGVzcyByZXF1aXJlZCBieSBhcHBsaWNhYmxlIGxhdyBvciBhZ3JlZWQgdG8gaW4gd3JpdGluZywgc29mdHdhcmUgZGlzdHJpYnV0ZWQgdW5kZXIgdGhlXG4gKiBMaWNlbnNlIGlzIGRpc3RyaWJ1dGVkIG9uIGFuIFwiQVMgSVNcIiBCQVNJUywgV0lUSE9VVCBXQVJSQU5USUVTIE9SIENPTkRJVElPTlMgT0YgQU5ZIEtJTkQsIGVpdGhlclxuICogZXhwcmVzcyBvciBpbXBsaWVkLiBTZWUgdGhlIExpY2Vuc2UgZm9yIHRoZSBzcGVjaWZpYyBsYW5ndWFnZSBnb3Zlcm5pbmcgcGVybWlzc2lvbnMgYW5kXG4gKiBsaW1pdGF0aW9ucyB1bmRlciB0aGUgTGljZW5zZS5cbiAqL1xuXG5pbXBvcnQge0lTX0xPRywgSVNfUFJPRklMRX0gZnJvbSAnLi9mbGFncyc7XG5cbmV4cG9ydCBmdW5jdGlvbiBsb2cobWVzc2FnZTogc3RyaW5nLCAuLi5hcmdzOiBhbnlbXSkge1xuICBpZiAoSVNfTE9HKSB7XG4gICAgbGV0IGxlbmd0aCA9IGFyZ3MgPyBhcmdzLmxlbmd0aCA6IDA7XG4gICAgaWYgKGxlbmd0aCA+IDApIHtcbiAgICAgIGNvbnNvbGUubG9nKG1lc3NhZ2UsIC4uLmFyZ3MpO1xuICAgIH0gZWxzZSB7XG4gICAgICBjb25zb2xlLmxvZyhtZXNzYWdlKTtcbiAgICB9XG4gIH1cbn07XG5cbi8vIGNoZWNrIHRvIHNlZSBpZiBuYXRpdmUgc3VwcG9ydCBmb3IgcHJvZmlsaW5nIGlzIGF2YWlsYWJsZS5cbmNvbnN0IE5BVElWRV9QUk9GSUxFX1NVUFBPUlQgPVxuICAgIHR5cGVvZiB3aW5kb3cgIT09ICd1bmRlZmluZWQnICYmICEhd2luZG93LnBlcmZvcm1hbmNlICYmICEhY29uc29sZS5wcm9maWxlO1xuXG4vKipcbiAqIEEgZGVjb3JhdG9yIHRoYXQgY2FuIHByb2ZpbGUgYSBmdW5jdGlvbi5cbiAqL1xuZXhwb3J0IGZ1bmN0aW9uIHByb2ZpbGUodGFyZ2V0OiBhbnksIHByb3BlcnR5S2V5OiBzdHJpbmcsIGRlc2NyaXB0b3I6IFByb3BlcnR5RGVzY3JpcHRvcikge1xuICBpZiAoSVNfUFJPRklMRSkge1xuICAgIHJldHVybiBwZXJmb3JtUHJvZmlsZSh0YXJnZXQsIHByb3BlcnR5S2V5LCBkZXNjcmlwdG9yKTtcbiAgfSBlbHNlIHtcbiAgICAvLyByZXR1cm4gYXMtaXNcbiAgICByZXR1cm4gZGVzY3JpcHRvcjtcbiAgfVxufVxuXG5mdW5jdGlvbiBwZXJmb3JtUHJvZmlsZShcbiAgICB0YXJnZXQ6IGFueSwgcHJvcGVydHlLZXk6IHN0cmluZywgZGVzY3JpcHRvcjogUHJvcGVydHlEZXNjcmlwdG9yKTogUHJvcGVydHlEZXNjcmlwdG9yIHtcbiAgbGV0IG9yaWdpbmFsQ2FsbGFibGUgPSBkZXNjcmlwdG9yLnZhbHVlO1xuICAvLyBuYW1lIG11c3QgZXhpc3RcbiAgbGV0IG5hbWUgPSBvcmlnaW5hbENhbGxhYmxlLm5hbWU7XG4gIGlmICghbmFtZSkge1xuICAgIG5hbWUgPSAnYW5vbnltb3VzIGZ1bmN0aW9uJztcbiAgfVxuICBpZiAoTkFUSVZFX1BST0ZJTEVfU1VQUE9SVCkge1xuICAgIGRlc2NyaXB0b3IudmFsdWUgPSBmdW5jdGlvbihhcmdzOiBhbnlbXSkge1xuICAgICAgY29uc29sZS5wcm9maWxlKG5hbWUpO1xuICAgICAgbGV0IHN0YXJ0VGltZSA9IHdpbmRvdy5wZXJmb3JtYW5jZS5ub3coKTtcbiAgICAgIGxldCByZXN1bHQgPSBvcmlnaW5hbENhbGxhYmxlLmNhbGwodGhpcyB8fCB3aW5kb3csIC4uLmFyZ3MpO1xuICAgICAgbGV0IGR1cmF0aW9uID0gd2luZG93LnBlcmZvcm1hbmNlLm5vdygpIC0gc3RhcnRUaW1lO1xuICAgICAgY29uc29sZS5sb2coYCR7bmFtZX0gdG9vayAke2R1cmF0aW9ufSBtc2ApO1xuICAgICAgY29uc29sZS5wcm9maWxlRW5kKCk7XG4gICAgICByZXR1cm4gcmVzdWx0O1xuICAgIH07XG4gIH0gZWxzZSB7XG4gICAgZGVzY3JpcHRvci52YWx1ZSA9IGZ1bmN0aW9uKGFyZ3M6IGFueVtdKSB7XG4gICAgICBsb2coYFByb2ZpbGUgc3RhcnQgJHtuYW1lfWApO1xuICAgICAgbGV0IHN0YXJ0ID0gRGF0ZS5ub3coKTtcbiAgICAgIGxldCByZXN1bHQgPSBvcmlnaW5hbENhbGxhYmxlLmNhbGwodGhpcyB8fCB3aW5kb3csIC4uLmFyZ3MpO1xuICAgICAgbGV0IGR1cmF0aW9uID0gRGF0ZS5ub3coKSAtIHN0YXJ0O1xuICAgICAgbG9nKGBQcm9maWxlIGVuZCAke25hbWV9IHRvb2sgJHtkdXJhdGlvbn0gbXMuYCk7XG4gICAgICByZXR1cm4gcmVzdWx0O1xuICAgIH07XG4gIH1cbiAgcmV0dXJuIGRlc2NyaXB0b3I7XG59XG4iXX0= | 2024-03-12T01:27:15.642919 | https://example.com/article/2677 |
The issue has drawn new attention since the Globe reported that the state was resisting orders from judges who charged that officials had overstepped their legal authority by urging local officials to pull the gun licenses of roughly 340 people, some of whom were convicted of misdemeanors decades ago.
But the stance continues to meet resistance at the district court level, where at least seven judges — including two last week — have ordered that gun licenses be reinstated, with one dismissing the reliance on the state’s legal position as “capricious.”
Governor Charlie Baker on Monday defended his administration’s role in a legal battle over firearm licenses, arguing the state was required to tell local police chiefs that hundreds of people should have their permits revoked at the urging of federal officials.
Despite the court orders, the administration has refused to reinstate the licenses, potentially exposing the state to litigation.
The complicated legal fight began in May, when administration officials said the state’s Firearm Licensing Review Board, created in 2004 to consider whether people with misdemeanor convictions could have a firearms license, had been approving applicants who they say should have been disqualified under federal rules.
The state action was prompted by officials from the US Bureau of Alcohol, Tobacco, Firearms, and Explosives, who met with state officials in April.
On Monday, Baker, calling the situation troubling “for everyone who is involved,” stressed that federal officials “made very clear to us” that the licensing board’s decisions should be voided. He said that required the state to notify local officials “that we were getting an interpretation from the feds that was different than the one that had been in place here in Massachusetts.”
Critics contend the stance is perplexing, given the state’s decision to uphold state law in other areas, such as marijuana legalization, even when it directly contradicts federal law. But Baker rejected the comparison.
“The US attorney made very clear that he was not going to pursue prosecution with respect to marijuana. The ATF – the federal entity that oversees gun laws – had a very different point of view with respect to this issue,” Baker said, arguing that state law also requires gun owners to meet both state and federal standards.
“It’s a different set of statutes, a different set of requirements,” he said.
But courts have repeatedly rebuffed the state’s arguments. Last week, judges in Gloucester and Taunton joined their counterparts in five other district courts in ordering that a gun license be reinstated.
In one case, a Seekonk man had been disqualified because he pleaded guilty in 1983 to receiving stolen property under $100. Gerald Arata successfully petitioned to the licensing board to have his right to a license restored in 2013, only to have the permit revoked by Seekonk police after the state’s directive in May.
Judge Michael D. Brennan, a Baker appointee, ruled last week that the state and federal officials’ legal position was an “error” and that “Seekonk’s licensing authority’s reliance on it was erroneous, arbitrary and capricious.”
In Gloucester, Judge Michael A. Patten also sided with a petitioner, ruling on Friday that “there are no reasonable grounds for suspending” the license of John T. McDonough since the licensing board had restored McDonough’s rights after a 2006 drunk-driving conviction.
Representative Harold P. Naughton, a Clinton Democrat who cochairs the Legislature’s public safety committee, said he’s willing to explore legislation addressing the issues raised by the differences in state and federal law. But with weeks until a new legislative session begins and potentially more litigation to follow, action on Beacon Hill doesn’t appear imminent.
“We’re almost in a response mode at this stage of the game,” Naughton said of cases still working through the court system. But he did express concern for the 340 people who’ve lost their licenses.
“There should be some mechanism by which those people, who are otherwise law-abiding citizens, should be able to exercise their right” to own a gun, he said.
Reach Matt Stout at matt.stout@globe.com. Follow him on Twitter @mattpstout | 2024-01-30T01:27:15.642919 | https://example.com/article/1366 |
Abstract: In many contexts we are warned against engaging in risky behavior only after having past safe experience. We examine the effect of safe experience on a warning's impact by comparing warnings received after having safe personal experience with those received before people start making choices. A series of five experiments studies this question with a paradigm that combines both descriptive information (i.e. the warning) and experiential information (safe outcomes). The results demonstrate two separate advantages to an early warning that go beyond the warning's mere informational content. When an early warning coincides with the beginning of a decision-making process, the warning is both weighted more heavily in future decisions (the Primacy Effect) and induces safer behavior that becomes the status quo for future choices (the Initial History Effect). While both effects operate indirectly through choice inertia, the primacy effect also operates directly on choices. This pattern of behavior is inconsistent with the "ideal" Bayesian for whom the order of information revelation does not influence subsequent behavior. The effect was robust across settings with and without forgone payoffs and when the consequences for risk taking are delayed until the end of the experiment. The results imply that, even after being adequately warned, some people may continue to take risks simply because they incurred good outcomes from the same choice in the past. Implications for policy and theory are discussed.
Abstract: We conduct online field experiments in large real-world social networks in order to decompose prosocial giving into three components: (1) baseline altruism toward randomly selected strangers, (2) directed altruism that favors friends over random strangers, and (3) giving motivated by the prospect of future interaction. Directed altruism increases giving to friends by 52 percent relative to random strangers, while future interaction effects increase giving by an additional 24 percent when giving is socially efficient. This finding suggests that future interaction affects giving through a repeated game mechanism where agents can be rewarded for granting efficiency enhancing favors. We also find that subjects with higher baseline altruism have friends with higher baseline altruism.
Abstract: We conduct a field experiment in a large real-world social network to examine how subjects expect to be treated by their friends and by strangers who make allocation decisions in modified dictator games. While recipients' beliefs accurately account for the extent to which friends will choose more generous allocations than strangers (i.e. directed altruism), recipients are not able to anticipate individual differences in the baseline altruism of allocators (measured by giving to an unnamed recipient, which is predictive of generosity towards named recipients). Recipients who are direct friends with the allocator, or even recipients with many common friends, are no more accurate in recognizing intrinsically altruistic allocators. Recipient beliefs are significantly less accurate than the predictions of an econometrician who knows the allocator's demographic characteristics and social distance, suggesting recipients do not have information on unobservable characteristics of the allocator.
Abstract: Recent papers have demonstrated that the way people acquire information about a decision problem, by experience or by abstract description, can affect their behavior. We examined the role of experience over time in the emergence of the Gambler's Fallacy in binary prediction tasks. Theories of the Gambler's Fallacy and models of binary prediction suggest that recency bias, elicited by experience over time, may play a significant role. An experiment compared a condition where participants sequentially predicted the colored outcomes of a virtual roulette wheel spin with a condition where the wheel's past outcomes were presented all at once. In a third condition outcomes were presented sequentially in an automatic fashion without intervening predictions. Subjects were yoked so that the same history of outcomes was observed in all conditions. The results revealed the Gambler's Fallacy when outcomes were experienced (with or without predictions). However, the Gambler's Fallacy was attenuated when the same outcomes were presented all at once. Observing the Gambler's Fallacy in the third condition suggests that the presentation of information over time is a significant antecedent of the bias. A second experiment demonstrated that, while the bias can emerge with an all-at-once presentation that makes recent outcomes salient (Burns and Corpus, 2004), the bias did not emerge when the presentation did not draw attention to recent outcomes.
Abstract: The shortage of transplant kidneys has spurred debate about legalizing monetary payments to donors to increase the number of available kidneys. However, buying and selling organs faces widespread disapproval. We survey a representative sample of Americans to assess disapproval for several forms of kidney market, and to understand why individuals disapprove by identifying factors that predict disapproval, including disapproval of markets for other body parts, dislike of increased scope for markets and distrust of markets generally. Our results suggest that while the public is potentially receptive to compensating kidney donors, among those who oppose it, general disapproval toward certain kinds of transactions is at least as important as concern about specific policy details. Between
51% and 63% of respondents approve of the various potential kidney markets we investigate, and between 42% and 58% want such markets to be legal. A total of 38% of respondents disapprove of at least one market. Respondents who distrust markets generally are not more disapproving of kidneymarkets; howeverwe find significant correlations between kidney market disapproval and attitudes reflecting disapproval toward certain transactions - including both other body markets andmarket encroachment into traditionally nonmarket exchanges, such as food preparation.
Abstract: We argue that very incomplete contracts do more than their enforceable components imply, they can also induce relationship-specific norms. We find experimentally, across four games, that the most effective contract always includes an unenforceable "handshake" agreement to take the first best action. In three games, a totally unenforceable contract consisting of only a handshake agreement is (at least weakly) optimal. These results are particularly strong in games with strategic complements, where even selfish subjects increase their actions. Our results highlight an alternative explanation for contractual incompleteness: establishing a norm can effectively substitute for weak enforceable restrictions.
Abstract: Empirically, compensation systems generate substantial effort despite weak monetary incentives. We consider reciprocal motivations as a source of incentives. We solve for the optimal contract in the basic principal-agent problem and show that reciprocal motivations and explicit performance-based pay are substitutes. A firm endogenously determines the mix of the two sources of incentives to best induce effort from the agent. Analyzing extended versions of the model allows us to examine how organizational structure impacts the effectiveness of reciprocity and to derive specific empirical predictions. We use the UK-WERS workplace compensation data set to confirm the predictions of our extended model.
Abstract: Non-linear incentive schemes are commonly used to determine employee pay, despite their distortionary impact. We investigate possible reasons for their widespread use by examining the relationship between convex pay schemes and overconfidence. In a laboratory experiment, subjects chose between a piece rate and a convex pay scheme. We find that overconfident subjects are more likely than others to choose the convex scheme, even when it leads to lower pay. Overconfident subjects also persist in making the mistake despite clear feedback. These results suggest non-linear pay schemes may help companies select and retain overconfident workers, and may reduce the wage bill.
Abstract: We study theoretically and empirically the consumption of access services. We demonstrate that consumption is affected by contract structure (pay-per-use vs. three part tariffs) even if the optimal consumption plans are identical. We find that a majority of individuals correctly use a threshold policy that is similar to a nearly optimal heuristic, however they use the free units too quickly leading to overconsumption and lost surplus. These errors are partially driven by mistaken beliefs about the value distribution. We also measure subjects' willingness to pay for a contract with free access units, and we find that nearly half of subjects are willing to pay at least the full per-unit price, with a substantial fraction willing to overpay. In response, the optimal firm strategy offers a three-part tariff at a very small discount, which increases revenue by 8-15% compared to only offering a pay-per-use contract.
Abstract: We test the predictions of a behavioral model of transactional electoral politics in the context of a randomized anti-vote-selling intervention in the Philippines. We model selling one’s vote as a temptation good: it creates positive utility for the future self at the moment of voting, but not for past selves who anticipate the vote-sale. We also allow keeping or breaking promises regarding vote-selling to affect utility. Voters who are at least partially sophisticated about their vote-selling temptation can thus use promises not to vote-sell as a commitment device. An invitation to promise not to vote-sell is taken up by a majority of respondents, reduces vote-selling, and has a larger effect in electoral races with smaller vote-buying payments. The more effective promise treatment reduces vote-selling in the smallest-stakes election by 10.9 percentage points. Inviting voters to make another type of promise – to accept vote-buying payments, but to nonetheless “vote your conscience” – is significantly less effective. The results are consistent with voters being partially (but not fully) sophisticated about their vote-selling temptation.
Abstract: Suppliers are often reluctant to invest in capacity if they feel that they will be unable to recover their initial investment costs in subsequent negotiations with buyers. In theory, a number of different coordinating contracts can solve this form of hold-up problem and induce first best investment levels by the supplier. In this study, we experimentally evaluate the performance of these contracts in a two-stage supply chain. We develop a novel experimental design where retailers and suppliers bargain over contract terms, and both roles have the ability to make multiple back-and-forth offers while also providing feedback on the offers they receive. Our main result suggests that an option contract is best at increasing investment levels, and thus increasing overall supply chain profits. Furthermore, after investigating the evolution of offers during bargaining, we observe that participants tend to place particular emphasis on "superficial fairness." Specifically, participants focus more on setting a wholesale price that is in the middle of the available contracting space, while largely ignoring the coordinating contract parameter. We show that this behavioral tendency drives the favorable performance of the option contract, as there is a large set of coordinating terms which, conditional on having a superficially fair wholesale price, generate the proper incentives for suppliers to invest, and thus increase the total expected supply chain profit.
Abstract: A large and growing literature has demonstrated that imposing control on agents has the potential to backfire, leading agents to withhold effort. Consistent with principles of procedural fairness, we find that the way in which control is imposed — in particular whether control is imposed symmetrically on both principals and agents and whether both parties have a say in whether control is imposed — affects how agents respond to control. In our setting, control leads agents to withhold effort only when control is imposed unilaterally with an asymmetric affect on the agent.
Abstract: Using coordination games we elicit social norms directly for two different games where either an agreement to take the first best action has been reached or where no such agreement exists. We combine the norms and choice data to predict changes in behavior and demonstrate that including social norms as a utility component significantly improves predictive performance. We estimate that honoring an agreement in the Double Dictator Game is worth giving up approximately 20% of their earnings, and more than 300% in the Bertrand Game. We show that informal agreements affect behaviour through their effect on social norms.
Abstract: We study experimentally bargaining in a multiple-tier supply chain with horizontal competition and sequential bargaining between tiers. Our treatments vary the cost difference between firms in tiers 1 and 2, with larger cost differences reflecting increased bargaining power. We measure how these underlying costs influence the efficiency, negotiated prices and profit distribution across the supply chain, and the extent to which these outcomes are influenced by personal characteristics such as risk aversion, altruism, selfishness, inequity aversion and social welfare concerns. We find that Retailer profits are hurt by decreased competition in either the Manufacturer or the Supplier tier. Additionally, Manufacturers and Suppliers benefit by decreased competition in their tier, while Manufacturers are hurt by decreased competition in the Supplier tier. We find that the Balanced Principal model of supply chain bargaining does a good job explaining our data, and significantly out performs the common assumption of leader-follower negotiations. Finally, we find that the structural issue of cost differentials dominates personal characteristics in explaining outcomes.
Abstract: An important aspect in determining the effectiveness of gift exchange relations is the ability of the worker to "repay the gift" to the employer. To test this hypothesis, we conduct a real effort laboratory experiment where we vary the wage and the effect of the worker's effort on the manager's payoff. Furthermore we collect additional information that allows us to control for the workers' ability and whether they can be classified as reciprocal or not. Our agency model of reciprocal motivation predicts high and low ability workers are differently affected by our experimental variations. These predictions are borne out by our results. Furthermore, we document that exactly those individuals we classify as reciprocal are the ones driving these results.
Abstract: We conduct a field experiment where we vary both the presence of a gift exchange wage and the effect of the worker's effort on the manager's payoff. The results indicate a strong complementarity between the initial wage gift and the agent's ability to "repay the gift". We collect information on ability to control for differences and on reciprocal inclination to show that gift exchange is more effective with more reciprocal agents. We present a simple principal-agent model with reciprocal subjects that motivates our empirical findings. Our results offer an avenue to reconcile the recent conflicting evidence on the efficacy of gift exchange outside the lab; we suggest that the significance of gift exchange relations depends on details of the environment. | 2024-01-29T01:27:15.642919 | https://example.com/article/5097 |
18 jobs found
Two Tenure Track Assistant Professor in Clinical Psychology positions at Syracuse University. As part of our multiyear hiring plan, the Department of Psychology at Syracuse University invites applications for two full time tenure-track positions at the rank of assistant professor to support the APA -accredited Clinical Psychology doctoral program. This recruitment is part of an ambitious Invest Syracuse Cluster Hire Initiative in the broad area of Aging, Behavioral Health, and Neuroscience. As an integral part of this investment, Syracuse University will recruit multiple candidates for faculty positions for a research cluster in the focus area of innovative personalized approaches to technology & health. Faculty hired into these positions will build on our existing strengths in the focus area and will participate in an organized research cluster that spans multiple departments in the Colleges of Arts and Sciences and the College of Engineering and Computer Science.
Candidates for both positions must have a program of research with potential to attract extramural funding and be committed to excellence in teaching at the graduate and undergraduate levels, mentorship, and clinical training. The Department is especially interested in candidates with research programs focused on clinical intervention methods and health disparities.
The ideal candidate for the Intervention Methods position is a licensed clinical psychologist (or license-eligible) whose scholarship is focused on health-related intervention and/or novel methodologies for addressing health-related behaviors (e.g., telehealth, smartphone applications, sensor monitoring, etc.).
The ideal candidate for the Health Disparities position is a licensed clinical psychologist (or license-eligible) whose scholarship aims to reduce mental and physical disparities, promote equity, and/or address the needs of underserved populations.
In addition, candidates for both positions should demonstrate excellence in cultural competence, including the ability to effectively communicate across cultures.
Candidates for both positions will be expected to teach graduate and undergraduate courses, mentor undergraduate and doctoral students, provide supervision of clinical training, and engage in department, college, and university-level service activities. More information about the department may be found at http://psychology.syr.edu/ Applications will be reviewed beginning October 1, 2019 and will continue until the position is filled.
Qualifications
Ph.D. in Clinical Psychology preferred, a Ph.D. in in Psychology or a related filed is required. Candidates must have completed an APA -accredited pre-doctoral internship or be a licensed clinical psychologist (or license-eligible).
Job Specific Qualifications
The successful candidate will: 1. Develop a program of research able to secure sponsored funding 2. Teach graduate and undergraduate courses, mentor graduate and undergraduate students, and supervise clinical training 3. Engage in committee work and service activities in the doctoral program, department, college, & university
Responsibilities
Responsibilities include maintaining an active program of research, teaching and advising at the graduate and undergraduate levels, and service to the university. Information about the department may be found at http://psychology.syr.edu/.
Application Instructions
Applications will be reviewed beginning October 1, 2019 and will continue until the position is filled.
In addition to the completing the online faculty application http://www.sujobopps.com/postings/80596 , please attach electronic copies of: 1. a cover letter 2. curriculum vitae 3. a statement of research interests 4. a statement of teaching interests and philosophy 5. a statement of how the applicant will further Syracuse University’s commitment to build a culturally diverse and inclusive educational environment http://inclusion.syr.edu/diversity-inclusion/ 6. contact information for three letters of recommendation
About Syracuse University
Syracuse University is a private, international research university with distinctive academics, diversely unique offerings and an undeniable spirit. Located in the geographic heart of New York State, with a global footprint, and nearly 150 years of history, Syracuse University offers a quintessential college experience. The scope of Syracuse University is a testament to its strengths: a pioneering history dating back to 1870; a choice of more than 200 majors and 100 minors offered through 13 schools and colleges; nearly 15,000 undergraduates and 5,000 graduate students; more than a quarter of a million alumni in 160 countries; and a student population from all 50 U.S. states and 123 countries. For more information, please visit www.syracuse.edu.
About the Syracuse area
Syracuse is a medium-sized city situated in the geographic center of New York State approximately 250 miles northwest of New York City. The metro-area population totals approximately 500,000. The area offers a low cost of living and provides many social, cultural, and recreational options, including parks, museums, festivals, professional regional theater, and premier shopping venues. Syracuse and Central New York present a wide range of seasonal recreation and attractions ranging from water skiing and snow skiing, hiking in the Adirondacks, touring the historic sites, visiting wineries along the Finger Lakes, and biking on trails along the Erie Canal.
EEOC
Syracuse University is an equal-opportunity, affirmative-action institution. The University prohibits discrimination and harassment based on race, color, creed, religion, sex, gender, national origin, citizenship, ethnicity, marital status, age, disability, sexual orientation, gender identity and gender expression, veteran status, or any other status protected by applicable law to the extent prohibited by law. This nondiscrimination policy covers admissions, employment, and access to and treatment in University programs, services, and activities.
Commitment to Supporting and Hiring Veterans
Syracuse University has a long history of engaging veterans and the military-connected community through its educational programs, community outreach, and employment programs. After World War II, Syracuse University welcomed more than 10,000 returning veterans to our campus, and those veterans literally transformed Syracuse University into the national research institution it is today. The University’s contemporary commitment to veterans builds on this historical legacy, and extends to both class-leading initiatives focused on making an SU degree accessible and affordable to the post-9/11 generation of veterans, and also programs designed to position Syracuse University as the employer of choice for military veterans, members of the Guard and Reserve, and military family members.
Commitment to a Diverse and Inclusive Campus Community
Syracuse University maintains an inclusive learning environment in which students, faculty, administrators, staff, curriculum, social activities, governance, and all other aspects of campus life reflect a diverse, multi-cultural, and international worldview. The University community recognizes and values the many similarities and differences among individuals and groups. At Syracuse, we are committed to preparing students to understand, live among, appreciate, and work in an inherently diverse country and world made up of people with different ethnic and racial backgrounds, military backgrounds, religious beliefs, socio-economic status, cultural traditions, abilities, sexual orientations and gender identities. To do so, we commit ourselves to promoting a community that celebrates and models the principles of diversity and inclusivity.
The University of New Mexico (UNM) is seeking a dynamic, innovative, results-oriented, addiction scientist for the position of Director of the Center on Alcoholism, Substance Abuse and Addictions (CASAA) , one of UNM’s premier strategic research centers. The selected candidate will report directly to the Vice President for Research (VPR), and will become a tenured faculty member of the College of Arts and Sciences with full academic year University salary support.
Established in 1989, CASAA has developed an outstanding international reputation as a center for research on the epidemiology, prevention and treatment of alcohol and drug use disorders and the adverse consequences of use. CASAA’s 80 staff, faculty, and affiliated members have the mission of generating, conveying, and applying knowledge to reduce the suffering related to addiction. The center is a multi-million dollar entity.
A full description of the current research of CASAA-affiliated faculty is available at http://casaa.unm.edu . CASAA investigators have a long history of successful NIH funding. CASAA also supports students at all levels in research and maintains an NIH Institutional Research Training Grant to support pre- and post-doctoral trainees. Finally, CASAA investigators support the research mission of the University through service on university-wide committees and by providing proposal-writing training through a formal annual seminar and individualized mentoring.
CASAA’s work is multidisciplinary and includes collaborations with multiple UNM Main Campus and Health Sciences Center departments as well as with investigators at institutions throughout the US and internationally. The ability to navigate the intricacies of a complex institutional environment is critical. CASAA researchers are leaders in one of UNM’s Research Grand Challenges (grandchallenges.unm.edu), a University Presidential initiative. The Substance Use Disorders Challenge brings together nearly 100 researchers and community partners in a strategic, coordinated and integrated approach to improve outcomes for communities within New Mexico and to advance UNM’s standing as an incubator for substance use research innovation. The Grand Challenges initiative further enables researchers to work across disciplinary boundaries and provides institutional investments and support for pilot projects that will lead to additional extramural funding.
The University of New Mexico is classified as a Carnegie Doctoral/Highest Research Activity University, and is one of a few such universities that is also an Hispanic Serving Institution. UNM's eleven colleges and schools serve a diverse student population of over 26,000. UNM provides an excellent research environment and a unique demographic of superbly trained researchers.
The programmatic research focus of the successful candidate may deepen current areas of expertise or broaden the existing CASAA research portfolio. Additional qualifications include a publication record commensurate with that of a successful scientist/faculty member, good interpersonal and leadership skills, solid grant management experience, and willingness to assume limited departmental responsibilities in the candidate’s home department. Departmental affiliation will be consistent with the candidate’s training and expertise; we envision that the successful candidate will have a record sufficient to merit appointment at the Associate or Full Professor rank.
The successful candidate will:
Be responsible for the scientific leadership of CASAA as well as oversight of administrative and financial operations
Maintain an active program of externally funded research
Prepare and implement a strategic vision and plan for CASAA
Enhance CASAA’s portfolio of external funding by facilitating and catalyzing the acquisition of grants and contracts awarded to CASAA faculty and oversee the staff to ensure proper and efficient administration and execution of those grants and contracts as well as unfunded research
Manage CASAA portfolio and activities
Fully integrate CASAA’s research mission with graduate and undergraduate educational programs across UNM
Establish active collaborative research partnerships both within the University (with other departments, centers and institutes) and with strategic partners outside the university
Prepare, oversee and serve as the responsible agent for CASAA’s budget
Provide monthly operational and planning reports to the VPR and biannual reports to CASAA’s internal and external advisory boards
Minimum Qualifications:
D., M.D., DrPH (or comparable terminal degree) in a field relevant to addictions research
Rank of Associate or Full Professor (or equivalent if not currently employed in an academic setting)
Record of research publications in the addictions area
Record of externally funded research in the addictions field
Preferred Qualifications:
Demonstrated leadership and management skills in a highly productive research setting
Ability to articulate a vision for the future of addictions research
Record of substantial, independent, externally funded research in the addictions field
Publication record commensurate with an established scientist/faculty member
Solid plans for continuing an active program of research
Record of successfully recruiting and mentoring investigators
Record of successfully mentoring and/or teaching students
Record of engagement with and leadership in the addictions field through, for example, editorial service, service on federal review committees, service on advisory panels or engagement with professional societies
History of working collaboratively in partnership with colleagues across disciplines and/or sites
A demonstrated commitment to diversity, equity, inclusion and student success, as well as, working with broadly diverse communities
Requested Application Materials
Cover Letter that describes how the candidate’s background has prepared them for the position and addresses the preferred qualifications.
CV
Professional references will be requested of all candidates considered for on-campus interviews
For complete details of this position, please visit http://casaadirectorsearch.unm.edu .
To apply, visit: https//unmjobs.unm.edu/ and reference: REQ10141
Best consideration date for applications: October 15, 2019
The University of New Mexico is an Equal Opportunity/Affirmative Action employer and educator.
UNM Center for Alcoholism, Substance Abuse, and Addiction
Albuquerque, NM, USA
Full time
HARVARD UNIVERSITY . The Department of Psychology anticipates making a tenure-track appointment at the assistant professor level to begin July 1, 2020. We seek candidates with core expertise in clinical psychology/clinical science whose research programs also bridge to other domains in psychology, neuroscience, or related disciplines. Our interest is less in specific areas than it is in innovation and excellence. The appointment is expected to begin on July 1, 2020. Candidates at all levels are encouraged to apply.
Candidates must have a strong doctoral record and have completed their Ph.D. Candidates should have demonstrated a promise of excellence in both research and teaching. Teaching duties will include offerings at both undergraduate and graduate levels.
Please submit a cover letter, curriculum vitae, research and teaching statements, up to three representative reprints, and names and contact information of three to five references. Also required is a statement describing efforts to encourage diversity, inclusion, and belonging, including past, current, and anticipated future contributions in these areas. In addition, please arrange for three letters of recommendation to be submitted to http://academicpositions.harvard.edu/postings/9136 The application will be complete only when all three letters have been submitted.
Questions regarding this position can be addressed to Jill Hooley at jmh@wjh.harvard.edu . The committee will consider completed applications starting immediately on a rolling basis through October 1. We expect to begin conducting interviews in October and November.
We are an equal opportunity employer and all qualified applicants will receive consideration for employment without regard to race, color, religion, sex, national origin, disability status, protected veteran status, gender identity, sexual orientation, pregnancy and pregnancy-related conditions or any other characteristic protected by law.
The Department of Psychology, University of Toronto Mississauga (UTM) invites applications for a tenure stream appointment at the rank of Assistant Professor in the area of Cognitive Psychology, focusing on Human-Technology Interaction. The successful applicant will join the Perception, Cognition, and Language Cluster. The appointment will begin July 1, 2020, or shortly thereafter.
The successful candidate will have received a Ph.D. in Psychology or related field by the start date of the appointment, or shortly thereafter. The applicant must demonstrate evidence of excellence in both teaching and research in an area that expands and complements the breadth of our department. Candidates must have a research program that demonstrates strengths in both theory and methodology in the general area of Human-Technology Interaction. Example research topics include but are not limited to brain-computer interfaces, human-robot interaction, and sensory-motor behaviour in the context of augmented reality.
A record of excellence in research will be demonstrated by high quality contributions in top-ranked and field-relevant academic journals, the submitted research statement, presentations at significant conferences, awards, and other honours, as well as strong endorsements from referees of high standing. Evidence of excellence in teaching will be demonstrated through a teaching dossier documenting the candidate's contributions to teaching and learning, which includes a teaching statement, sample syllabi, and teaching evaluations, as well as strong letters of reference.
The successful applicant will be expected to develop and maintain an internationally competitive, active, innovative, independent, externally funded program of research and to contribute to the education and training of undergraduate students as well as graduate students enrolled in the tri-campus University of Toronto Psychology Graduate Program. There will be opportunities to collaborate with UTM psychologists exploring Perception, Cognition, and Language across the lifespan, as well as with psychologists in other clusters (Behavioural Neuroscience, Developmental Science, and/or Health, Adaptation and Well-being), and other researchers on all three campuses of the University of Toronto.
Salary to be commensurate with qualifications and experience.
For more information on the Department of Psychology, UTM please visit us at http://www.utm.utoronto.ca/psychology/welcome-psychology-utm
Application Information: All qualified candidates are invited to apply online via: https://utoronto.taleo.net/careersection/10050/jobdetail.ftl?job=1903326&tz=GMT-04%3A00&tzname=America%2FNew_York .
Applications should include a cover letter, curriculum vitae, teaching dossier (including a statement of teaching philosophy, sample syllabi, and teaching evaluations), a statement outlining current and future research interests, and no more than three copies of representative publications.
Equity and diversity are among UTM’s core values and are essential to academic excellence. We seek candidates who value diversity and whose research, teaching and service bear out our commitment to equity. Candidates are therefore also asked to submit a 1-2 page statement of contributions to equity and diversity, which might cover topics such as (but not limited to): research or teaching that incorporates a focus on underrepresented groups, the development of inclusive pedagogies, or the mentoring of students from underrepresented groups.
All application materials must be submitted online. Please direct questions to: psychair.admin@utoronto.ca. The application deadline is October 17, 2019.
Submission guidelines can be found at: http://uoft.me/how-to-apply . We recommend combining attachments into one or two files in PDF/MS Word format.
Applicants must also ask at least three referees to send letters (dated, signed, and on letterhead), directly to the department via e-mail to psychair.admin@utoronto.ca by the closing date. We encourage applicants to use Interfolio http://www.interfolio.com/services/dossier/ for their letters of reference only.
The University of Toronto is strongly committed to diversity within its community and especially welcomes applications from racialized persons/persons of colour, women, Indigenous/Aboriginal People of North America, persons with disabilities, LGBTQ persons, and others who may contribute to the further diversification of ideas.
As part of your application, you will be asked to complete a brief Diversity Survey. This survey is voluntary. Any information directly related to you is confidential and cannot be accessed by search committees or human resources staff. Results will be aggregated for institutional planning purposes. For more information, please see http://uoft.me/UP.
All qualified candidates are encouraged to apply; however, Canadians and permanent residents will be given priority.
University of Toronto Mississauga
University of Toronto Mississauga, Mississauga Road, Mississauga, ON, Canada
Full time
The University of Kansas seeks a tenure-track assistant professor in the Department of Psychology expected to begin as early as August 18, 2020. The desired candidate will have a program of research and a teaching portfolio that can contribute to at least one of the unit’s programs: Brain, Behavior and Quantitative Science, Clinical Psychology, and/or Social Psychology. The candidate must also have research and teaching expertise in advanced quantitative or computational methods. An ideal candidate will have expertise developing or using quantitative and/or computational models that can address theory-driven questions. A Ph.D., ABD, or terminal degree is expected by the start date of appointment. In a continuing effort to enrich its academic environment and provide equal educational and employment opportunities, the University of Kansas actively encourages applications from members of underrepresented groups in higher education. The successful applicant must have appropriate authorization to work in the U.S. before employment begins.
DEPARTMENT OF PSYCHOLOGY, OKLAHOMA STATE UNIVERSITY is seeking an outstanding scientist to fill a full-time, Assistant Professor , tenure track position in Psychology beginning August, 2020, with an area of specialization in Social Psychology . Successful candidates will be social psychologists with research programs on social emotions and/or social cognition, whose work has implications for health (e.g., mental health, physical health, health disparities). Candidates are expected to have a strong background in and dedication to scholarly activity, and to interact well with colleagues and students. They must also demonstrate the capacity to maintain a high-quality research program leading to scholarly productivity in the form of professional publications, presentations, and grantsmanship. Competitive salary and start-up funds are available. For full consideration, application materials must be received by October 15, 2019. However, applications will be accepted until the position is filled. For full details or to submit an application, please visit: http://apply.interfolio.com/68105
As part of a multi-year strategic hiring and growth initiative in Applied Psychological Science, the Department of Psychology at The University of Oklahoma is seeking applications for two (2) faculty openings at the rank of Assistant Professor (tenure-track) in Quantitative/Data Analytics Psychology. The ideal candidates for both positions will have expertise in the development and application of quantitative methods to University initiatives in data science and/or decision-making and risk. Moreover, the ideal candidate for the first position will be able to contribute also to University initiatives concerning health-related outcomes in youth, whereas the ideal candidate for the second position will be able to contribute also to University initiatives concerning education-related outcomes in youth. Ideal candidates will have expertise and interest in teaching courses in introductory and advanced statistics, graduate quantitative research methods, and substantive topics in the candidate’s area of expertise. The assigned teaching load will be two courses per semester. Additionally, candidates should have an established reputation for or evidence of capacity for high-quality scholarship in Quantitative/Data Analytics Psychology as evidenced by (a) published and/or funded collaborative research, (b) effective graduate and undergraduate teaching and program development, (c) inclusive service and professional outreach, as well as the potential to (d) contribute to the department’s growing national reputation for excellence in Applied Psychological Science. The Department of Psychology and The University of Oklahoma are dedicated to celebrating and promoting respect for the contributions of all. We strongly encourage applications from women, members of minority groups, veterans, those with disabilities, the LGBTQ community, and all others who are committed to excellence, inclusion, and diversity. The department is also aware of, and works to be responsive to, the needs of dual-career couples. About The University of Oklahoma: Established in 1890, The University of Oklahoma is the flagship public research university in the state of Oklahoma (Carnegie Classification R1: highest research activity), with over 30,000 students and more than 2,700 full-time faculty members offering nearly 500 different graduate and undergraduate degrees programs on three campuses (Norman, Oklahoma City, and Tulsa). OU has one of the oldest comprehensive colleges of fine arts in the Great Plains states, with highly regarded schools of Music, Musical Theatre, Drama, Art and Dance, and programs in opera and sculpture. The OU College of Law is Oklahoma’s premiere law school and The Michael F. Price College is ranked as one of the nation’s top business schools. The OU Health Sciences Center is one of only four comprehensive academic health centers in the nation with seven professional schools, including more than 660 doctors practicing in nearly every adult and child specialty. OU’s Department of Psychology is one of the university’s largest departments by enrollment, with 30+ faculty and affiliates serving more than 1,300 diverse and engaged undergraduate majors and minors, and 60+ fully-funded PhD students. OU Research & Innovation: In 2013, the Norman Research campus was named the No.1 research campus in the nation by the Association of Research Parks. Adjacent to the beautiful and historic Main campus in Norman, with 277 acres and over 1 million square feet of high-tech facilities located along the Oklahoma Technology Corridor, the research campus hosts the National Weather Center and affiliated organizations, the National Institute for Risk & Resilience, the South Central Climate Science Center, the Center for Applied Social Research, the K20 Center, and the FAA Center of Excellence for Technical Training & Human Performance, among numerous others. By synergistically co-locating State and Federal agency research and operational organizations, along with more than a dozen private companies and several University centers and academic programs, the Norman research campus creates a uniquely rich environment for collaboration, innovation, and commercialization. Over the last 20 years, OU’s Office of Technology Development has helped faculty and other partners launch dozens of new companies that have generated more than $75 million in capital. Local Community & Culture: The city of Norman, Oklahoma, is a perennial contender on “best place to live” rankings with outstanding schools, amenities, a low cost of living, small town charm, a variety of recreational opportunities, four distinct seasons, and more than 225 days of sunshine each year. Norman is located 20 miles south of Oklahoma City, the Capital and economic hub of the state of Oklahoma. The Oklahoma City Metroplex, including Norman and several other suburban cities, is home to about 1.5 million residents, offering all the amenities of a major modern metropolitan community, including rich cultural diversity and heritage, an abundance of the arts, superb dining and night-life, major sporting and concert events, family entertainment, recreational adventure activities, and much more. Qualifications: To be considered for this position, candidates must have a Ph.D. in Psychology with broad expertise in Quantitative Psychology or a closely-related discipline, with a strong preference for candidates who will contribute to multiple campus-wide initiatives at the intersection of health-related and education-related outcomes in youth, decision-making and risk, and data science/data scholarship. The precise area of specialization is open, but desirable areas of research include psychometrics, Bayesian methods, machine learning, causal inference, and item response theory. Candidates must also have the potential for excellence in undergraduate and graduate teaching in statistics and quantitative methods and be prepared to expand course offerings in their area of specialization. Experience or evidence of capacity for collaboration on funded research in health-related or education-related outcomes in youth involving multidisciplinary teams is a highly preferred qualification. The University of Oklahoma is committed to investing in the success of its faculty at all stages of their careers. The department and college offer unique and essential research and professional development resources characteristic of a Flagship Public Research University (e.g., well-equipped dedicated and shared laboratory space; shared supercomputer access; considerable graduate student funding and recruiting support; large and diverse research participant pools; flexible and innovative instructional, service, and leadership opportunities). By mutual agreement, the successful candidate may also affiliate with University-wide strategic research organizations and centers (e.g., the National Institute for Risk & Resilience, the Center for Applied Social Research, the K20 Center, the Zarrow Center for Learning Enrichment, and the OU Health Sciences Center). Salary, benefits, and and start-up packages are highly competitive and commensurate with qualifications and experience. Application Instructions: To apply, please submit the following materials at https://apply.interfolio.com/67520: 1. a cover letter specifically addressing position fit, qualifications, and background 2. a curriculum vitae 3. three confidential letters of recommendation 4. up to 3 reprints/preprints 5. evidence of teaching effectiveness (course/teaching evaluations) 6. a brief statement of research interests (e.g., 300-2000 words) 7. a brief statement of teaching philosophy and interests (e.g., 300-2000 words) For full consideration, please submit your application materials by October 15th, 2019. Application review will begin immediately, and the position will remain open until filled. All application materials must be submitted electronically using the OU Career web site [https://apply.interfolio.com/67520]. Please send inquiries and other suggestions or comments to the chair of the search committee, Dr. Robert Terry (rterry@ou.edu). Application Process: This institution is using Interfolio's Faculty Search to conduct this search. Applicants to this position receive a free Dossier account and can send all application materials, including confidential letters of recommendation, free of charge. Equal Employment Opportunity Statement: The University of Oklahoma, in compliance with all applicable federal and state laws and regulations does not discriminate on the basis of race, color, national origin, sex, sexual orientation, genetic information, gender identity, gender expression, age, religion, disability, political beliefs, or status as a veteran in any of its policies, practices, or procedures. This includes, but is not limited to: admissions, employment, financial aid, housing, services in educational programs or activities, or health care services that the University operates or provides.
University of Oklahoma
University of Oklahoma OU, Parrington Oval, Norman, OK, USA
Full time
The Department of Psychology at Rosalind Franklin University of Medicine and Science (RFUMS) invites applications for two tenure-track faculty positions at the rank of Assistant or Associate Professor. These are full-time, 12-month academic appointments for research-focused faculty members. We seek applications from individuals with programs of research that can contribute to our Neuropsychology or Health Psychology tracks. Candidates with either an established track record of extramural funding or strong potential to obtain extramural funding within the next 5 years are especially encouraged to apply. Competitive salary, space and start-up packages will be provided.
Expectations include obtaining external research funding, as well as teaching and mentoring doctoral students within our PhD program in clinical psychology. Additional clinical supervision, and service opportunities will be secondary to research-related activities. The successful candidate will have a doctorate, postdoctoral training experience, and a demonstrated track record of research productivity, with strong potential for developing an extramurally funded innovative research program. We are particularly interested in candidates whose research interests focus on issues related to diversity and those that have direct relevance to clinical neuropsychology or clinical health psychology. Applicants whose programs of research may complement other areas of strength within the University including neurodegenerative disorders, stress and psychiatric disorders, substance abuse, and the intersection of neuropsychology and behavioral health are also encouraged to apply. Candidates with a Ph.D. in clinical psychology, experimental psychology, or related fields are also encouraged to apply.
The Department of Psychology at RFUMS houses an APA-accredited doctoral program in clinical psychology with specialization tracks in Neuropsychology, Health Psychology, and Psychopathology, as well as an MS program in Clinical Counseling. The Department is comprised of eight full time faculty and is strongly committed to the Boulder Model of training. The Department of Psychology is uniquely situated to collaborate with active research groups within the College of Health Professions, the Chicago Medical School, the School of Graduate and Postdoctoral Studies, the College of Pharmacy, and Scholl College of Podiatric Medicine. RFUMS is committed to maintaining a strong research reputation and facilitating research through state of the art research facilities in the new Innovation and Research Park which houses the Brain Science Institute and its three aligned research centers: The Center for Neurodegenerative Diseases and Therapeutics, The Center for Brain Function and Repair, and The Center for Stress Resilience and Psychiatric Disorders. Moreover, there are ample opportunities to develop research collaborations in Chicago (35 miles to the south) and Milwaukee (50 miles to the north). The RFUMS campus is adjacent to the James A. Lovell Federal Health Care Center and the Great Lakes Naval Training Center, both of which provide the Department with additional research and clinical training resources. The Department of Psychology also plays a key role in ongoing community-based research collaborations focused on enhancing health and reducing substance use in the surrounding communities.
RFUMS recognizes the value of diversity within the Department, College, and University. It seeks to diversify its faculty along multiple dimensions, including via recruitment of faculty from groups that have been historically marginalized or excluded. Individuals from historically underrepresented groups are strongly encouraged to apply. Applications will be reviewed continuously until the position is filled. It is expected that initial interviews will begin in late November 2019, and for full consideration, applications should be received no later than November 1, 2019. To apply, please email (in a single pdf packet): a cover letter, curriculum vitae, statement of research interests, statement of teaching/mentoring philosophy, and 3 letters of recommendation to rachel.greenley@rosalindfranklin.edu .
The job posting can be viewed at:
https://workforcenow.adp.com/mascsr/default/mdf/recruitment/recruitment.html?cid=395a4546-652f-4dd9-832f-b02e894ced6e&ccId=19000101_000001&jobId=292944&lang=en_US&source=CC4
Rosalind Franklin University of Medicine and Science
North Chicago, IL
Full time
The Department of Psychology at Skidmore College invites applications for a tenure-track Assistant Professor position in the area of Health Psychology beginning Fall 2020. The faculty member in this position will teach core courses (i.e., Statistics and Research Methods I and II, Introduction to Psychological Science) and courses in their area of expertise, and will supervise undergraduate research. Within the context of an 18-credit teaching load (generally five courses), the position also occasionally includes teaching a first-year interdisciplinary seminar (topic open).
We encourage applications from members of underrepresented groups as well as individuals who have experience working with diverse student populations and who can contribute to the diversity and excellence of the academic community through their teaching, scholarship, and/or service. Enthusiasm for advising, teaching, and mentoring a diverse population of students is essential. We seek candidates who are firmly committed to undergraduate education, including the involvement of undergraduates in research programs that are theoretically and methodologically sophisticated. Excellent teaching and research facilities support faculty/student collaborative work in the classroom, lab, and field.
Skidmore College is a highly selective liberal arts college in Saratoga Springs, New York that fosters creative approaches to teaching and learning. With its relatively small size and low student-faculty ratio, the College is a close-knit academic community. Skidmore’s faculty of teacher-scholars are devoted to the instruction and mentoring of approximately 2,400 talented undergraduate students from almost 50 states and over 40 countries.
Candidates should submit all materials online by September 10, 2019, including cover letter, vita, selected reprints, research statement, teaching statement, and teaching evaluations. Applicants should describe in their cover letter how they will teach to diverse students and how they will enhance the diversity of offerings and educational experiences at Skidmore College through their teaching, research, and/or service. The application system will prompt you to submit three email addresses for letters of recommendation. All referees will be emailed once you have completed the application process.
All documents must be attached through the online application system to complete the application process and to receive your confirmation code. If you have questions please contact Human Resources at: careers@skidmore.edu or (518) 580-5800.
To be considered, candidates must have teaching experience and a Ph.D. in psychology by Fall 2020.
The Psychology Department at the University of Nebraska-Lincoln is recruiting a tenure-track Assistant Professor with expertise in quantitative methods to begin August 2020. Qualifications include a Ph.D. or equivalent in any area of psychology or a related field, and a record of achievement in research and teaching. Applicants should have quantitative and computational skills to build on strengths in the Department of Psychology and the newly established Rural Drug Abuse Research (RDAR) Center. We particularly welcome applicants with expertise in cutting-edge methodologies including network analysis, simulation techniques, Bayesian methods, big data analytics, complex power analysis, and Item Response Theory. Knowledge of programming in packages such as R and Python is desirable as well.
Responsibilities include maintaining an active program of research, including pursuit of external funding, teaching quantitative courses, and a willingness to serve as a quantitative consultant to Department and Center faculty and students. The Department of Psychology has a strong commitment to principles of diversity and actively encourages applications from groups underrepresented in higher education.
Review of applications will begin September 17, 2019 and continue until the position is filled. To be considered for the position, please go to: http://employment.unl.edu , requisition F_190134, and click on “Apply to this job.” Candidates should attach a cover letter expressing interest in the position, their curriculum vitae, research and teaching statements, up to three relevant publications, and contact information for three references. The University of Nebraska-Lincoln is committed to a pluralistic campus community through affirmative action, equal opportunity, work-life balance, dual careers, and does not discriminate based on race, color, ethnicity, national origin, sex, pregnancy, sexual orientation, gender identity, religion, disability, age, genetic information, veteran status, marital status, and/or political affiliation in its programs, activities, or employment. http://www.unl.edu/equity/notice-nondiscrimination .
Professor of Management & Organizations (Open Rank)
The Management and Organizations Department of the Kellogg School of Management at Northwestern University invites applications for tenure-track faculty positions. We are primarily interested in applications at the rank of Assistant Professor, but we will also consider outstanding candidates at the rank of Associate or Full Professor. Applicants should demonstrate an interest in topics relevant to management or organizations and provide evidence of outstanding research potential and an ability to enhance the department’s research and teaching portfolio. The department supports diverse approaches to research, grounded in psychology, sociology, organizational behavior and theory, strategic management and behavioral data science. A PhD or equivalent degree must be in hand or expected by employment start date.
Information about the department can be found on our website . Further inquiries about the position can be directed to MORSrecruiting@kellogg.northwestern.edu .
Please apply at: https://facultyrecruiting.northwestern.edu/apply/NTA2
To apply, please submit the following: A brief cover letter, a current CV, a research statement, one to three publications or working papers, and three letters of recommendation.
For full consideration, all application materials must be received by October 1, 2019.
Northwestern University is an Equal Opportunity, Affirmative Action Employer of all protected classes, including veterans and individuals with disabilities. Women, racial and ethnic minorities, individuals with disabilities, and veterans are encouraged to apply. Hiring is contingent upon eligibility to work in the United States.
Kellogg School of Management at Northwestern University
Evanston, IL, USA
Full time
UNIVERSITY OF VERMONT POSTDOCTORAL RESEARCH FELLOWSHIP
The Vermont Center on Behavior and Health in the UVM College of Medicine announces an NIH postdoctoral research fellowship opportunity with Dr. Stacey Sigmon in our internationally recognized center of excellence for drug abuse research. The fellow will help to lead ongoing randomized clinical trials evaluating low-barrier, technology-assisted buprenorphine treatment for individuals with opioid use disorder (OUD), as well as develop new research opportunities aimed at expanding OUD treatment access in rural, underserved areas. Dr. Sigmon, VCBH colleagues and our 29-year training program have an exceptional track record of helping fellows to establish successful careers as independent investigators.
Eligibility: Applicants must have completed their training in psychology or a related discipline and be U.S. citizens or permanent residents. Outstanding trainees are selected on the basis of scholastic record, productivity and commitment to a career in drug abuse research. Individuals must be highly motivated, possess initiative and a strong desire to learn and expand their interests and expertise.
Appointment: 2-3 yrs.
Benefits: Stipend, medical insurance coverage, and travel funds supported by NIH Institutional Training Awards.
To apply: Send application form (downloaded from VCBH website), a cover letter, curriculum vitae, statement of research interests, and 3 letters of reference to: Dr. Stacey Sigmon c/o Ms. Marissa Palmer ( marissa.palmer@uvm.edu ).
About us: The VCBH was established in 2013 with the primary aim of investigating relationships between personal behaviors and risk for chronic disease and premature death, with a specific focus on understanding mechanisms underpinning risk, and developing effective interventions and policies to promote healthy behavior. The VCBH resides within the UVM Department of Psychiatry, with additional investigators, collaborators, and advisors across 15 academic departments across the UVM College of Medicine, 7 UVM colleges, and 5 other universities. The VCBH is further strengthened by interdisciplinary collaborations with key community healthcare leaders and distinguished scientific advisory panels.
For more information: Contact Ms. Marissa Palmer, marissa.palmer@uvm.edu or see our website.
Burlington, Vermont is located in the beautiful Lake Champlain region, surrounded by the Green and Adirondack Mountains. Burlington is home to a thriving arts scene, creative entrepreneurship, great shopping, three colleges and a university, and a full range of four-season outdoor pursuits (www.vermontvacation.com). Montreal and Boston are also within easy driving distances.
The School of Statistics and Department of Psychology at the University of Minnesota invite applications for a full-time, tenure-track position at the rank of assistant professor in the area of statistics/quantitative psychology, to begin fall semester 2020 (August 31, 2020).
Appointment will be 100% time over the nine-month academic year (late-August to late-May) at the rank of tenure-track assistant professor, depending on qualifications and experience and consistent with collegiate and University policy.
REQUIRED QUALIFICATIONS: A Ph.D. in Statistics, Quantitative Psychology/Psychometrics, or a related field is required by the start date of the appointment.
PREFERRED QUALIFICATIONS: Candidates with an established research record and college/university-level teaching experience are preferred. Candidates with advanced training in both Statistics and Psychology (e.g., graduate degrees in both) are preferred. Our student body is increasingly diverse (across gender, race/ethnicity, first generation college, income), and candidates with a demonstrated interest in teaching and mentoring a diverse student body are preferred.
Candidates will be evaluated according to the overall quality of their academic preparation and scholarly work and relevance to the position, evidence of research ability, evidence of commitment to teaching students from a variety of cultures and skills as a teacher, and strength of recommendations.
ABOUT THE JOB: This position will be a joint appointment in the School of Statistics and Department of Psychology, with tenure home in the School of Statistics. The holder of this position will join a strong core of statisticians in the School with interests in quantitative psychology as well as be a member of the Quantitative/ Psychometric Methods group in the Department of Psychology. The precise area of specialization is open, but some areas of interest include statistics of neuroimaging, multivariate analysis, behavioral genetics, psychometrics, Bayesian methods, experimental design, causal inference, and item response theory. The percentage of work effort devoted to each unit will be determined in consultation with the candidate but is expected to be approximately 50% in each, although it may vary from year to year. We are committed to attracting candidates from historically under-represented groups knowing that diversity enriches the academic experience and provides a base for innovation.
Faculty in the College of Liberal Arts are expected to maintain an active research program, develop and teach undergraduate and graduate courses, advise undergraduate and graduate students, and contribute service appropriate for the rank of the appointment to the department, college, University, and profession.
The Standards for Promotion and Tenure in the School of Statistics and the Department of Psychology are available at https://faculty.umn.edu/sites/faculty.umn.edu/files/statistics.pdf and
https://faculty.umn.edu/sites/faculty.umn.edu/files/psych.pdf respectively. The position has tenure home in Statistics, so the School of Statistics standards are primary. The Workload Principles and Guidelines for Regular Faculty in the College of Liberal Arts are available at: https://neighborhood.cla.umn.edu/college-knowledge/workload-principles-and-guidelines .
The University seeks to offer a family-friendly environment, including parental leave, and tenure policy allows extension of the tenure probationary period for the birth/adoption of a child.
ABOUT THE DEPARTMENTS: The Department of Psychology and the School of Statistics continue to rank among the top academic departments in the nation and throughout the world. Psychology has 44 core faculty members and graduate programs in Clinical Science and Psychopathology Research; Cognitive and Brain Sciences; Counseling Psychology; Industrial/Organizational Psychology; Personality Individual Differences Behavioral Genetics; Quantitative/Psychometric Methods; and Social Psychology. The School of Statistics has 19 faculty members with strengths in theoretical, applied and computational statistics. The School of Statistics offers programs leading to B.A., B.S., M.S., and Ph.D. degrees, and the Department of Psychology offers programs leading to B.A., B.S., and Ph.D. degrees. Both departments are strongly committed to diversity and providing a productive and supportive environment for all faculty, staff, and students. For more information, please visit the departmental websites: https://cla.umn.edu/statistics or https://cla.umn.edu/psychology .
ABOUT THE COLLEGE OF LIBERAL ARTS: Established in 1868, the College of Liberal Arts supports the University of Minnesota's land-grant mission as home to disciplines in the arts, humanities, and social sciences. The College of Liberal Arts values diverse cultures, experiences, and perspectives as key to innovation and excellent education: https://cla.umn.edu . The College of Liberal Arts is committed to intellectual freedom, the pursuit of new knowledge, and the belief that the liberal arts are the foundation of academic learning. CLA prepares students to be independent and original thinkers, innovators in their chosen fields; to create meaning in their lives and in their life's work; and to become productive citizens and leaders in their communities and the world
APPLICATION INSTRUCTIONS: Applications must be submitted online; go to https://employment.umn.edu and search for 331887. Select the position, click on the "Apply,” and follow the instructions. You will have an opportunity to complete an online application for the position and attach a cover letter and CV. Additional documents may be attached after application by accessing your “My Activities” page and uploading documents there. The following materials must be attached to your online application: 1) a cover letter; 2) curriculum vitae; 3) samples of written work; 4) evidence of teaching effectiveness or a commitment to teaching; 5) a statement of research interests; and 6) a statement of teaching philosophy. Applicants are invited to describe in the cover letter their experiences with a diverse student body. In addition to the material submitted electronically, applicants are asked to arrange for THREE letters of recommendation to be sent directly to the School of Statistics. The letters of recommendation may be e-mailed to statsoffice@umn.edu or mailed directly to:
Professor Gary W. Oehlert, Search Committee Chair
School of Statistics, University of Minnesota
313 Ford Hall
224 Church St SE
Minneapolis, MN 55455
Additional materials may be requested from candidates at a future date.
Application review will begin October 15, 2019, but we will continue to review applications until the position is filled.
DIVERSITY: The University recognizes and values the importance of diversity and inclusion in enriching the employment experience of its employees and in supporting the academic mission. The University is committed to attracting and retaining employees with varying identities and backgrounds.
The University of Minnesota provides equal access to and opportunity in its programs, facilities, and employment without regard to race, color, creed, religion, national origin, gender, age, marital status, disability, public assistance status, veteran status, sexual orientation, gender identity, or gender expression. To learn more about diversity at the U: http://diversity.umn.edu .
BACKGROUND CHECK: Any offer of employment is contingent upon the successful completion of a background check. Our presumption is that prospective employees are eligible to work here. Criminal convictions do not automatically disqualify finalists from employment.
ABOUT THE UNIVERSITY: The University of Minnesota, Twin Cities (UMTC), is among the largest public research universities in the country, offering undergraduate, graduate, and professional students a multitude of opportunities for study and research. Located at the heart of one of the nation's most vibrant, diverse metropolitan communities, students on the campuses in Minneapolis and St. Paul benefit from extensive partnerships with world-renowned health centers, international corporations, government agencies, and arts, nonprofit, and public service organizations.
Assistant Professor - Psychology
The Psychology Department and Neuroscience Program invite applications for a tenure track assistant professor position with advanced statistical training beginning August 2020. Doctoral degree in Psychology, or closely-related discipline, required by start date. Candidate must demonstrate: (1) a commitment to (a) undergraduate teaching, (b) the active involvement of undergraduate students in research, and (c) diversity, equity, and inclusion, and (2) expertise in psychological/neuroscientific research design and analysis including proficiency with either R, SAS, STATA or JMP. Area of expertise is open. Teaching load is typically 6 courses per academic year, may vary depending on Senior Project advising, and will include Statistical Methods, Research Methods, and other courses in the candidate’s area of expertise. Teaching load may be reduced for institutional research design and quantitative consulting. All faculty are expected to participate in delivering college-wide first-year/sophomore seminars as part of their teaching load. The successful candidate will provide evidence of excellence in teaching, ongoing scholarship, and professional development.
Allegheny College is a highly selective private liberal arts college in NW Pennsylvania with an increasingly diverse student body and a dedicated faculty of teacher-scholars. Allegheny College is deeply committed to creating an inclusive community that actively challenges racism, sexism, heterosexism, religious bigotry, and other forms of bias (see Allegheny College Statement of Community ). Women, racial and ethnic minorities, and members of other underrepresented groups are strongly encouraged to apply.
Excellent teaching and research facilities are available, as are start-up funds. Please submit the following in PDF form by October 1, 2019 to psychdept@allegheny.edu: (a) letter of application, (b) cv, (c) teaching statement, (d) list and description of courses of interest, (e) research statement, (f) diversity statement (describing how you have/could incorporate diversity, equity, and inclusion into your teaching, research, and/or service), and (g) three recommendation letters. Allegheny College is an Equal Opportunity Employer with a strong commitment to diversity, inclusion, and equity. Allegheny does not discriminate on the basis of race, color, religion, gender, gender identity, gender expression, sexual orientation, age, or national origin.
Two tenure-track, 10-month Assistant Professor positions in Research Design and Analysis, beginning August 2020. Doctorate in Psychology is required. ABD applicants will be considered, but appointment will be at the Instructor rank and all degree requirements must be completed by February 1, 2021. Faculty assigned an instructional workload of six (6) course units per academic year for the first year. Beginning the second year, the workload will be the standard instructional workload of seven (7) course units per academic year. Teach graduate (M.A. level) and undergraduate courses in research methods and statistics as well as courses in one’s area of expertise. Possess and demonstrate commitment to teaching, research and service. Demonstrate research competency as well as evidence of continued growth of one’s research agenda, leading to publications in peer-reviewed journals. Area of research is open, but applications from candidates with expertise in biological, health, and industrial/organizational psychology are encouraged. Mentoring of student research, advising, and participation on department and university committees are also expected. A successful candidate must have the ability to work with a diverse population and be sensitive to the education needs of all students. Review of applications begins October 1 and will continue until the positions are filled. For more information, go to https://www.towson.edu/provost/prospective/assistant-professor-research-design-analysis-cla-3306.html
The Department of Psychology at Emory University invites applications for three faculty lines, including a tenure-track position at the Assistant Professor level in developmental science ( https://apply.interfolio.com/64756 ) a tenure-track position at the Assistant Professor level in human cognition ( https://apply.interfolio.com/65505 ), and a lecture-track position in social/cross cultural psychology ( https://apply.interfolio.com/65508 ). Please consult the individual links for details specific to each position. Anticipated start date for all positions is Fall 2020. Ph.D. required. Emory University (Atlanta, GA) is an equal employment opportunity and affirmative action employer. Women, minorities, people with disabilities and veterans are strongly encouraged to apply.
The Department of Psychology of Boston College invites applications for a tenure-track position as Assistant Professor in Quantitative and Computational Psychology to begin prior to the fall 2020 semester. For an outstanding candidate, appointment at the Associate or Full Professor level is possible. Applicants will be evaluated on their potential to establish a prominent research program and to excel in teaching at both the graduate and undergraduate levels. The ideal candidate will be able to provide first-rate instruction to our students in advanced quantitative/computational methods while developing a research program that provides a natural bridge to areas of interest and expertise already represented on our faculty. Applicants should apply at http://apply.interfolio.com/65381 and provide PDFs of a cover letter, CV, research statement, and teaching statement outlining teaching experience and philosophy. Applicants should also arrange to have three letters of reference submitted directly by their letter writers, using the "request recommendations" link on Interfolio. These letter writers should be named in the cover letter. All materials must be submitted on or before October 1, 2019 for full consideration. Review of applications will continue until the position is filled. For inquiries about the position, please contact Ehri Ryu (ehri.ryu@bc.edu). For assistance with submitting your application please email psychoffice@bc.edu. | 2024-03-29T01:27:15.642919 | https://example.com/article/2570 |
The president of the European Central Bank (ECB), Christine Lagarde, supports the bank’s active involvement in the development of a central bank digital currency (CBDC) to address the demand for faster and cheaper cross-border payments.
In an interview with French business magazine Challenges published on Jan. 8, Lagarde discussed the most likely threats to the global economy in 2020, among which she named a downturn in trade and a range of uncertainties, geopolitical risks and climate change. Going further, Lagarde noted that “the EU is still the most powerful economic and trading area in the world, with enormous potential.”
Not to act as observers of a changing world
When asked about ECB’s dedication to the exploration and development of a CBDC, Lagarde emphasized the urgent demand for fast and low-cost payments, the field where she sees the taking a leading position, rather than remaining observers of a changing world. As such, Lagarde said:
“ECB will continue to assess the costs and benefits of issuing a central bank digital currency that would ensure that the general public remains able to use central bank money even if the use of physical cash eventually declines.”
Lagarde recalled that the bank continues examining the feasibility and merits of a CBDC as such means of payment could exert influence on the financial sector and transmission of monetary policy. She stipulated that the ECB formed an expert task force set to work closely with national central banks to examine the feasibility of a euro area CBDC.
When asked about current initiatives to launch a CBDC at the ECB, a representative told Cointelegraph in somewhat vague terms that:
“We are working on all aspects of CBDC, with in-depth analysis of costs and benefits of such a new form of central bank money. It will take a while before we will communicate on our conclusions.”
Crypto-friendly approach
Lagarde has previously demonstrated a friendly stance towards digital currencies, having said in December last year that ECB should be ahead of the curve regarding the demand for stablecoins.
Last September, when Lagarde was still the head of the International Monetary Fund (IMF) and nominee to be the next president of the ECB, she claimed that she would focus on making sure that institutions promptly adapt to the rapidly changing financial environment.
In the meantime, ECB remains open to the idea of a digital euro equivalent but would want to stop citizens holding too much of it.
UPDATE Jan. 9 19:00 UTC: This article has been updated to include commentary from a representative of the ECB that we received after initial publication. | 2024-03-19T01:27:15.642919 | https://example.com/article/7767 |
838 F.2d 1222Unpublished Disposition
NOTICE: Federal Circuit Local Rule 47.8(b) states that opinions and orders which are designated as not citable as precedent shall not be employed or cited as precedent. This does not preclude assertion of issues of claim preclusion, issue preclusion, judicial estoppel, law of the case or the like based on a decision of the Court rendered in a nonprecedential opinion or order.Antoni NIEMIERKO, Petitioner,v.OFFICE OF PERSONNEL MANAGEMENT, Respondent.
No. 87-3409.
United States Court of Appeals, Federal Circuit.
Jan. 11, 1988.
Before BISSELL, Circuit Judge, BALDWIN, Senior Circuit Judge, and ARCHER, Circuit Judge.
PER CURIAM.
1
The final decision of the Merit Systems Protection Board, Docket No. DC08318610506, affirming Niemierko's ineligibility for an annuity under the Civil Service Retirement System is affirmed.
OPINION
2
The Board clearly considered all the grounds for relief presented by Niemierko, including the fact that Niemierko worked for the American Consulate in Gdnask, Poland, from November 3, 1946 until August 12, 1948, and that on October 19, 1948, he received a refund of $53.05 representing the total amount of retirement deductions withheld from his salary during that period of employment. In addition, the administrative judge found that Niemierko never held another position in the federal service, and that there is no evidence in the record to show that he had any other periods of employment creditable under the Civil Service Retirement System. Although Niemierko asserts that the Board failed to question any witnesses concerning his claim, the record reflects that by Order dated October 17, 1986, the Board offered Mr. Niemierko the opportunity to present oral testimony in support of his appeal by telephone, at Board expense, and the record further demonstrates that petitioner failed to respond to the Board's Order. Thus, after reviewing the submissions of the parties, we find no basis under our statutorily prescribed scope of review for setting aside the Board's final decision. 5 U.S.C. Sec. 7703(c) (1982).
3
Although the loss of Niemierko's home and the dissolution of his family in Poland were tragic events in his life, neither this court, the Board nor the Office of Personnel Management has any discretion to waive the statutory requirements in determining whether he is entitled to benefits under the Civil Service Retirement Act. Indeed, if the requirements set by Congress result in an injustice, it is for Congress, and Congress alone, to amend those requirements. Cf. Denkler v. United States, 782 F.2d 1003, 1007-08 (Fed. Cir.1986).
| 2024-06-22T01:27:15.642919 | https://example.com/article/3672 |
Q:
Proving that $\int_{0}^{1}\ln^{2n}\left(\ln\left({1-\sqrt{1-x^2}\over x}\right)\over \ln\left({1+\sqrt{1-x^2}\over x}\right)\right)dx=(-\pi^2)^n$
I was observing this question and was able to conjecture
$$\int_{0}^{1}\ln^{2n}\left(\ln\left({1-\sqrt{1-x^2}\over x}\right)\over \ln\left({1+\sqrt{1-x^2}\over x}\right)\right)\mathrm dx=(-\pi^2)^n\tag1$$
Where $n\ge1$.
Making an attempt:
$$x=\sin u \implies dx=\cos udu$$
$$\int_{0}^{\pi/2}\ln^{2n}\left(\ln\left({1-\cos u\over \sin u}\right)\over \ln\left({1+\cos u\over \sin u}\right)\right)\cos u\,du\tag2$$
simplify further to
$$\int_{0}^{\pi/2}\ln^{2n}\left(\ln\tan\left({u\over 2}\right)\over \ln\cot\left({u\over 2}\right)\right)\cos u\,du\tag3$$
$$\int_{0}^{\pi/2}\ln^{2n}(-1)\cos u\,du\tag4$$
This is not making any sense here!
How can we prove $(1)?$
A:
Since the principal value of $\ln(-1)$ is $i\pi$:
$$\int_0^{\pi/2}\ln^{2n}(-1)\cos u\,du$$
$$=\int_0^{\pi/2}(i\pi)^{2n}\cos u\,du$$
$$=(i\pi)^{2n}\int_0^{\pi/2}\cos u\,du$$
$$=(i\pi)^{2n}=(-\pi^2)^n$$
However, as the complex logarithm is multivalued, this answer is not well-defined (as mentioned by Chappers in the comments).
| 2023-11-19T01:27:15.642919 | https://example.com/article/6344 |
Q:
Why does this happen with Datagrid?
I've a Silverlight app (Silverlight 4 in VS2010) wherein I've a datagrid. I wanted to set the border for the datagrid rows. So in the <DataTemplate> I wrote this:
<Border BorderBrush="Black" BorderThickness="1"></Border>
This worked. Now I wanted to draw border only in the bottom and right and I did this:
<Border BorderBrush="Black">
<Border.BorderThickness>
<Thickness Bottom="1" Left="0" Top="0" Right="1"/>
</Border.BorderThickness>
</Border>
But this throws a XAML parsing error - Cannot set the read-only property Bottom
Why would this happen? Is there any alternatives to do the same?
A:
<Border BorderBrush="Black" BorderThickness="0,0,1,1" />
| 2023-08-13T01:27:15.642919 | https://example.com/article/5233 |
<?xml version="1.0" encoding="utf-8"?>
<RelativeLayout xmlns:android="http://schemas.android.com/apk/res/android"
android:id="@+id/tutorialContainer"
android:layout_width="match_parent"
android:layout_height="match_parent"
android:alpha="0"
android:visibility="gone" /> | 2024-07-08T01:27:15.642919 | https://example.com/article/4693 |
//
// Copyright (c) 2018 Google Inc.
//
// Licensed under the Apache License, Version 2.0 (the "License");
// you may not use this file except in compliance with the License.
// You may obtain a copy of the License at
//
// http://www.apache.org/licenses/LICENSE-2.0
//
// Unless required by applicable law or agreed to in writing, software
// distributed under the License is distributed on an "AS IS" BASIS,
// WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
// See the License for the specific language governing permissions and
// limitations under the License.
//
#import "ViewController.h"
#import "UIImage+VisionDetection.h"
#import "UIUtilities.h"
@import Firebase;
NS_ASSUME_NONNULL_BEGIN
static NSArray *images;
static NSString *const detectionNoResultsMessage = @"No results returned.";
static NSString *const sparseTextModelName = @"Sparse";
static NSString *const denseTextModelName = @"Dense";
static CGColorRef lineColor;
static CGColorRef fillColor;
static int const rowsCount = 5;
static int const componentsCount = 1;
/**
* @enum DetectorPickerRow
* Defines the Firebase ML SDK vision detector types.
*/
typedef NS_ENUM(NSInteger, DetectorPickerRow) {
/** Cloud vision text vision detector (Sparse). */
DetectorPickerRowDetectTextInCloudSparse,
/** Cloud vision text vision detector (Dense). */
DetectorPickerRowDetectTextInCloudDense,
/** Cloud vision document text vision detector. */
DetectorPickerRowDetectDocumentTextInCloud,
/** Cloud vision label vision detector. */
DetectorPickerRowDetectImageLabelsInCloud,
/** Cloud vision landmark vision detector. */
DetectorPickerRowDetectLandmarkInCloud
};
@interface ViewController () <UINavigationControllerDelegate,
UIPickerViewDelegate,
UIPickerViewDataSource,
UIImagePickerControllerDelegate>
@property(nonatomic) FIRVision *vision;
/** A string holding current results from detection. */
@property(nonatomic) NSMutableString *resultsText;
/** An overlay view that displays detection annotations. */
@property(nonatomic) UIView *annotationOverlayView;
/** An image picker for accessing the photo library or camera. */
@property(nonatomic) UIImagePickerController *imagePicker;
@property(weak, nonatomic) IBOutlet UIBarButtonItem *detectButton;
// Image counter.
@property(nonatomic) NSUInteger currentImage;
@property(weak, nonatomic) IBOutlet UIPickerView *detectorPicker;
@property(weak, nonatomic) IBOutlet UIImageView *imageView;
@property(weak, nonatomic) IBOutlet UIBarButtonItem *photoCameraButton;
@end
@implementation ViewController
- (NSString *)stringForDetectorPickerRow:(DetectorPickerRow)detectorPickerRow {
switch (detectorPickerRow) {
case DetectorPickerRowDetectTextInCloudSparse:
return @"Text in Cloud (Sparse)";
case DetectorPickerRowDetectTextInCloudDense:
return @"Text in Cloud (Dense)";
case DetectorPickerRowDetectDocumentTextInCloud:
return @"Document Text in Cloud";
case DetectorPickerRowDetectImageLabelsInCloud:
return @"Image Labeling in Cloud";
case DetectorPickerRowDetectLandmarkInCloud:
return @"Landmarks in Cloud";
}
}
- (void)viewDidLoad {
[super viewDidLoad];
images = @[
@"grace_hopper.jpg", @"beach.jpg", @"image_has_text.jpg",
@"liberty.jpg"
];
lineColor = UIColor.yellowColor.CGColor;
fillColor = UIColor.clearColor.CGColor;
// [START init_vision]
self.vision = [FIRVision vision];
// [END init_vision]
self.imagePicker = [UIImagePickerController new];
self.resultsText = [NSMutableString new];
_currentImage = 0;
_imageView.image = [UIImage imageNamed:images[_currentImage]];
_annotationOverlayView = [[UIView alloc] initWithFrame:CGRectZero];
_annotationOverlayView.translatesAutoresizingMaskIntoConstraints = NO;
[_imageView addSubview:_annotationOverlayView];
[NSLayoutConstraint activateConstraints:@[
[_annotationOverlayView.topAnchor constraintEqualToAnchor:_imageView.topAnchor],
[_annotationOverlayView.leadingAnchor constraintEqualToAnchor:_imageView.leadingAnchor],
[_annotationOverlayView.trailingAnchor constraintEqualToAnchor:_imageView.trailingAnchor],
[_annotationOverlayView.bottomAnchor constraintEqualToAnchor:_imageView.bottomAnchor]
]];
_imagePicker.delegate = self;
_imagePicker.sourceType = UIImagePickerControllerSourceTypePhotoLibrary;
_detectorPicker.delegate = self;
_detectorPicker.dataSource = self;
BOOL isCameraAvailable =
[UIImagePickerController isCameraDeviceAvailable:UIImagePickerControllerCameraDeviceFront] ||
[UIImagePickerController isCameraDeviceAvailable:UIImagePickerControllerCameraDeviceRear];
if (!isCameraAvailable) {
[_photoCameraButton setEnabled:NO];
}
int defaultRow = (rowsCount / 2) - 1;
[_detectorPicker selectRow:defaultRow inComponent:0 animated:NO];
}
- (void)viewWillAppear:(BOOL)animated {
[super viewWillAppear:animated];
[self.navigationController.navigationBar setHidden:YES];
}
- (void)viewWillDisappear:(BOOL)animated {
[super viewWillDisappear:animated];
[self.navigationController.navigationBar setHidden:NO];
}
- (IBAction)detect:(id)sender {
[self clearResults];
NSInteger rowIndex = [_detectorPicker selectedRowInComponent:0];
switch (rowIndex) {
case DetectorPickerRowDetectTextInCloudSparse:
[self detectTextInCloudInImage:_imageView.image withOptions:nil];
break;
case DetectorPickerRowDetectTextInCloudDense: {
FIRVisionCloudTextRecognizerOptions *options = [FIRVisionCloudTextRecognizerOptions new];
options.modelType = FIRVisionCloudTextModelTypeDense;
[self detectTextInCloudInImage:_imageView.image withOptions:options];
break;
}
case DetectorPickerRowDetectDocumentTextInCloud:
[self detectDocumentTextInCloudInImage:_imageView.image];
break;
case DetectorPickerRowDetectImageLabelsInCloud:
[self detectCloudLabelsInImage:_imageView.image];
break;
case DetectorPickerRowDetectLandmarkInCloud:
[self detectCloudLandmarksInImage:_imageView.image];
break;
}
}
- (IBAction)openPhotoLibrary:(id)sender {
_imagePicker.sourceType = UIImagePickerControllerSourceTypePhotoLibrary;
[self presentViewController:_imagePicker animated:YES completion:nil];
}
- (IBAction)openCamera:(id)sender {
if (![UIImagePickerController isCameraDeviceAvailable:UIImagePickerControllerCameraDeviceFront] &&
![UIImagePickerController isCameraDeviceAvailable:UIImagePickerControllerCameraDeviceRear]) {
return;
}
_imagePicker.sourceType = UIImagePickerControllerSourceTypeCamera;
[self presentViewController:_imagePicker animated:YES completion:nil];
}
- (IBAction)changeImage:(id)sender {
[self clearResults];
self.currentImage = (_currentImage + 1) % images.count;
_imageView.image = [UIImage imageNamed:images[_currentImage]];
}
/// Removes the detection annotations from the annotation overlay view.
- (void)removeDetectionAnnotations {
for (UIView *annotationView in _annotationOverlayView.subviews) {
[annotationView removeFromSuperview];
}
}
/// Clears the results text view and removes any frames that are visible.
- (void)clearResults {
[self removeDetectionAnnotations];
self.resultsText = [NSMutableString new];
}
- (void)showResults {
UIAlertController *resultsAlertController =
[UIAlertController alertControllerWithTitle:@"Detection Results"
message:nil
preferredStyle:UIAlertControllerStyleActionSheet];
[resultsAlertController
addAction:[UIAlertAction actionWithTitle:@"OK"
style:UIAlertActionStyleDestructive
handler:^(UIAlertAction *_Nonnull action) {
[resultsAlertController dismissViewControllerAnimated:YES
completion:nil];
}]];
resultsAlertController.message = _resultsText;
resultsAlertController.popoverPresentationController.barButtonItem = _detectButton;
resultsAlertController.popoverPresentationController.sourceView = self.view;
[self presentViewController:resultsAlertController animated:YES completion:nil];
NSLog(@"%@", _resultsText);
}
/// Updates the image view with a scaled version of the given image.
- (void)updateImageViewWithImage:(UIImage *)image {
CGFloat scaledImageWidth = 0.0;
CGFloat scaledImageHeight = 0.0;
switch (UIApplication.sharedApplication.statusBarOrientation) {
case UIInterfaceOrientationPortrait:
case UIInterfaceOrientationPortraitUpsideDown:
case UIInterfaceOrientationUnknown:
scaledImageWidth = _imageView.bounds.size.width;
scaledImageHeight = image.size.height * scaledImageWidth / image.size.width;
break;
case UIInterfaceOrientationLandscapeLeft:
case UIInterfaceOrientationLandscapeRight:
scaledImageWidth = image.size.width * scaledImageHeight / image.size.height;
scaledImageHeight = _imageView.bounds.size.height;
break;
}
dispatch_async(dispatch_get_global_queue(QOS_CLASS_USER_INITIATED, 0), ^{
// Scale image while maintaining aspect ratio so it displays better in the UIImageView.
UIImage *scaledImage =
[image scaledImageWithSize:CGSizeMake(scaledImageWidth, scaledImageHeight)];
if (!scaledImage) {
scaledImage = image;
}
if (!scaledImage) {
return;
}
dispatch_async(dispatch_get_main_queue(), ^{
self->_imageView.image = scaledImage;
});
});
}
- (CGAffineTransform)transformMatrix {
UIImage *image = _imageView.image;
if (!image) {
return CGAffineTransformMake(0, 0, 0, 0, 0, 0);
}
CGFloat imageViewWidth = _imageView.frame.size.width;
CGFloat imageViewHeight = _imageView.frame.size.height;
CGFloat imageWidth = image.size.width;
CGFloat imageHeight = image.size.height;
CGFloat imageViewAspectRatio = imageViewWidth / imageViewHeight;
CGFloat imageAspectRatio = imageWidth / imageHeight;
CGFloat scale = (imageViewAspectRatio > imageAspectRatio) ? imageViewHeight / imageHeight
: imageViewWidth / imageWidth;
// Image view's `contentMode` is `scaleAspectFit`, which scales the image to fit the size of the
// image view by maintaining the aspect ratio. Multiple by `scale` to get image's original size.
CGFloat scaledImageWidth = imageWidth * scale;
CGFloat scaledImageHeight = imageHeight * scale;
CGFloat xValue = (imageViewWidth - scaledImageWidth) / 2.0;
CGFloat yValue = (imageViewHeight - scaledImageHeight) / 2.0;
CGAffineTransform transform =
CGAffineTransformTranslate(CGAffineTransformIdentity, xValue, yValue);
return CGAffineTransformScale(transform, scale, scale);
}
- (void)process:(FIRVisionImage *)visionImage
withTextRecognizer:(FIRVisionTextRecognizer *)textRecognizer {
// [START recognize_text]
[textRecognizer
processImage:visionImage
completion:^(FIRVisionText *_Nullable text, NSError *_Nullable error) {
if (text == nil) {
// [START_EXCLUDE]
self.resultsText = [NSMutableString
stringWithFormat:@"Text recognizer failed with error: %@",
error ? error.localizedDescription : detectionNoResultsMessage];
[self showResults];
// [END_EXCLUDE]
return;
}
// [START_EXCLUDE]
// Blocks.
for (FIRVisionTextBlock *block in text.blocks) {
CGRect transformedRect =
CGRectApplyAffineTransform(block.frame, [self transformMatrix]);
[UIUtilities addRectangle:transformedRect
toView:self.annotationOverlayView
color:UIColor.purpleColor];
// Lines.
for (FIRVisionTextLine *line in block.lines) {
CGRect transformedRect =
CGRectApplyAffineTransform(line.frame, [self transformMatrix]);
[UIUtilities addRectangle:transformedRect
toView:self.annotationOverlayView
color:UIColor.orangeColor];
// Elements.
for (FIRVisionTextElement *element in line.elements) {
CGRect transformedRect =
CGRectApplyAffineTransform(element.frame, [self transformMatrix]);
[UIUtilities addRectangle:transformedRect
toView:self.annotationOverlayView
color:UIColor.greenColor];
UILabel *label = [[UILabel alloc] initWithFrame:transformedRect];
label.text = element.text;
label.adjustsFontSizeToFitWidth = YES;
[self.annotationOverlayView addSubview:label];
}
}
}
[self.resultsText appendFormat:@"%@\n", text.text];
[self showResults];
// [END_EXCLUDE]
}];
// [END recognize_text]
}
- (void)process:(FIRVisionImage *)visionImage
withDocumentTextRecognizer:(FIRVisionDocumentTextRecognizer *)documentTextRecognizer {
// [START recognize_document_text]
[documentTextRecognizer
processImage:visionImage
completion:^(FIRVisionDocumentText *_Nullable text, NSError *_Nullable error) {
if (text == nil) {
// [START_EXCLUDE]
self.resultsText = [NSMutableString
stringWithFormat:@"Document text recognizer failed with error: %@",
error ? error.localizedDescription : detectionNoResultsMessage];
[self showResults];
// [END_EXCLUDE]
return;
}
// [START_EXCLUDE]
// Blocks.
for (FIRVisionDocumentTextBlock *block in text.blocks) {
CGRect transformedRect =
CGRectApplyAffineTransform(block.frame, [self transformMatrix]);
[UIUtilities addRectangle:transformedRect
toView:self.annotationOverlayView
color:UIColor.purpleColor];
// Paragraphs.
for (FIRVisionDocumentTextParagraph *paragraph in block.paragraphs) {
CGRect transformedRect =
CGRectApplyAffineTransform(paragraph.frame, [self transformMatrix]);
[UIUtilities addRectangle:transformedRect
toView:self.annotationOverlayView
color:UIColor.orangeColor];
// Words.
for (FIRVisionDocumentTextWord *word in paragraph.words) {
CGRect transformedRect =
CGRectApplyAffineTransform(word.frame, [self transformMatrix]);
[UIUtilities addRectangle:transformedRect
toView:self.annotationOverlayView
color:UIColor.greenColor];
// Symbols.
for (FIRVisionDocumentTextSymbol *symbol in word.symbols) {
CGRect transformedRect =
CGRectApplyAffineTransform(symbol.frame, [self transformMatrix]);
[UIUtilities addRectangle:transformedRect
toView:self.annotationOverlayView
color:UIColor.cyanColor];
UILabel *label = [[UILabel alloc] initWithFrame:transformedRect];
label.text = symbol.text;
label.adjustsFontSizeToFitWidth = YES;
[self.annotationOverlayView addSubview:label];
}
}
}
}
[self.resultsText appendFormat:@"%@\n", text.text];
[self showResults];
// [END_EXCLUDE]
}];
// [END recognize_document_text]
}
#pragma mark - UIPickerViewDataSource
- (NSInteger)numberOfComponentsInPickerView:(nonnull UIPickerView *)pickerView {
return componentsCount;
}
- (NSInteger)pickerView:(nonnull UIPickerView *)pickerView
numberOfRowsInComponent:(NSInteger)component {
return rowsCount;
}
#pragma mark - UIPickerViewDelegate
- (nullable NSString *)pickerView:(UIPickerView *)pickerView
titleForRow:(NSInteger)row
forComponent:(NSInteger)component {
return [self stringForDetectorPickerRow:row];
}
- (void)pickerView:(UIPickerView *)pickerView
didSelectRow:(NSInteger)row
inComponent:(NSInteger)component {
[self clearResults];
}
#pragma mark - UIImagePickerControllerDelegate
- (void)imagePickerController:(UIImagePickerController *)picker
didFinishPickingMediaWithInfo:(NSDictionary<NSString *, id> *)info {
[self clearResults];
UIImage *pickedImage = info[UIImagePickerControllerOriginalImage];
if (pickedImage) {
[self updateImageViewWithImage:pickedImage];
}
[self dismissViewControllerAnimated:YES completion:nil];
}
#pragma mark - Vision Cloud Detection
/// Detects text on the specified image and draws a frame around the recognized text using the
/// Cloud text recognizer.
///
/// - Parameter image: The image.
- (void)detectTextInCloudInImage:(UIImage *)image
withOptions:(nullable FIRVisionCloudTextRecognizerOptions *)options {
if (!image) {
return;
}
// Define the metadata for the image.
FIRVisionImageMetadata *imageMetadata = [FIRVisionImageMetadata new];
imageMetadata.orientation =
[UIUtilities visionImageOrientationFromImageOrientation:image.imageOrientation];
// Initialize a VisionImage object with the given UIImage.
FIRVisionImage *visionImage = [[FIRVisionImage alloc] initWithImage:image];
visionImage.metadata = imageMetadata;
FIRVisionTextRecognizer *cloudTextRecognizer;
NSString *modelTypeString = sparseTextModelName;
if (options != nil) {
modelTypeString = (options.modelType == FIRVisionCloudTextModelTypeDense) ? denseTextModelName
: modelTypeString;
// [START init_text_cloud]
cloudTextRecognizer = [_vision cloudTextRecognizerWithOptions:options];
// [END init_text_cloud]
} else {
cloudTextRecognizer = [_vision cloudTextRecognizer];
}
[_resultsText
appendString:[NSString stringWithFormat:@"Running Cloud Text Recognition (%@ model)...\n",
modelTypeString]];
[self process:visionImage withTextRecognizer:cloudTextRecognizer];
}
/// Detects document text on the specified image and draws a frame around the recognized text
/// using the Cloud document text recognizer.
///
/// - Parameter image: The image.
- (void)detectDocumentTextInCloudInImage:(UIImage *)image {
if (!image) {
return;
}
// [START init_document_text_cloud]
FIRVisionDocumentTextRecognizer *cloudDocumentTextRecognizer =
[_vision cloudDocumentTextRecognizer];
// [END init_document_text_cloud]
// Define the metadata for the image.
FIRVisionImageMetadata *imageMetadata = [FIRVisionImageMetadata new];
imageMetadata.orientation =
[UIUtilities visionImageOrientationFromImageOrientation:image.imageOrientation];
// Initialize a VisionImage object with the given UIImage.
FIRVisionImage *visionImage = [[FIRVisionImage alloc] initWithImage:image];
visionImage.metadata = imageMetadata;
[_resultsText appendString:@"Running Cloud Document Text Recognition...\n"];
[self process:visionImage withDocumentTextRecognizer:cloudDocumentTextRecognizer];
}
/// Detects landmarks on the specified image and draws a frame around the detected landmarks using
/// cloud landmark API.
///
/// - Parameter image: The image.
- (void)detectCloudLandmarksInImage:(UIImage *)image {
if (!image) {
return;
}
// Create a landmark detector.
// [START config_landmark_cloud]
FIRVisionCloudDetectorOptions *options = [FIRVisionCloudDetectorOptions new];
options.modelType = FIRVisionCloudModelTypeLatest;
options.maxResults = 20;
// [END config_landmark_cloud]
// [START init_landmark_cloud]
FIRVisionCloudLandmarkDetector *cloudDetector =
[_vision cloudLandmarkDetectorWithOptions:options];
// Or, to use the default settings:
// FIRVisionCloudLandmarkDetector *cloudDetector = [_vision cloudLandmarkDetector];
// [END init_landmark_cloud]
// Define the metadata for the image.
FIRVisionImageMetadata *imageMetadata = [FIRVisionImageMetadata new];
imageMetadata.orientation =
[UIUtilities visionImageOrientationFromImageOrientation:image.imageOrientation];
// Initialize a VisionImage object with the given UIImage.
FIRVisionImage *visionImage = [[FIRVisionImage alloc] initWithImage:image];
visionImage.metadata = imageMetadata;
// [START detect_landmarks_cloud]
[cloudDetector
detectInImage:visionImage
completion:^(NSArray<FIRVisionCloudLandmark *> *_Nullable landmarks,
NSError *_Nullable error) {
if (!landmarks || landmarks.count == 0) {
// [START_EXCLUDE]
NSString *errorString = error ? error.localizedDescription : detectionNoResultsMessage;
self.resultsText = [NSMutableString
stringWithFormat:@"Cloud landmark detection failed with error: %@", errorString];
[self showResults];
// [END_EXCLUDE]
return;
}
// Recognized landmarks
// [START_EXCLUDE]
[self.resultsText setString:@""];
for (FIRVisionCloudLandmark *landmark in landmarks) {
CGAffineTransform transform = [self transformMatrix];
CGRect transformedRect = CGRectApplyAffineTransform(landmark.frame, transform);
[UIUtilities addRectangle:transformedRect
toView:self.annotationOverlayView
color:UIColor.greenColor];
[self.resultsText
appendFormat:@"Landmark: %@, Confidence: %@, EntityID: %@, Frame: %@\n",
landmark.landmark, landmark.confidence, landmark.entityId,
NSStringFromCGRect(landmark.frame)];
}
[self showResults];
// [END_EXCLUDE]
}];
// [END detect_landmarks_cloud]
}
/// Detects labels on the specified image using cloud label API.
///
/// - Parameter image: The image.
- (void)detectCloudLabelsInImage:(UIImage *)image {
if (!image) {
return;
}
// [START init_label_cloud]
FIRVisionImageLabeler *cloudLabeler = [_vision cloudImageLabeler];
// Or, to change the default settings:
// FIRVisionImageLabeler *cloudLabeler = [_vision cloudImageLabelerWithOptions:options];
// [END init_label_cloud]
// Define the metadata for the image.
FIRVisionImageMetadata *imageMetadata = [FIRVisionImageMetadata new];
imageMetadata.orientation =
[UIUtilities visionImageOrientationFromImageOrientation:image.imageOrientation];
// Initialize a VisionImage object with the given UIImage.
FIRVisionImage *visionImage = [[FIRVisionImage alloc] initWithImage:image];
visionImage.metadata = imageMetadata;
// [START detect_label_cloud]
[cloudLabeler
processImage:visionImage
completion:^(NSArray<FIRVisionImageLabel *> *_Nullable labels, NSError *_Nullable error) {
if (!labels || labels.count == 0) {
// [START_EXCLUDE]
NSString *errorString = error ? error.localizedDescription : detectionNoResultsMessage;
self.resultsText = [NSMutableString
stringWithFormat:@"Cloud label detection failed with error: %@", errorString];
[self showResults];
// [END_EXCLUDE]
return;
}
// Labeled image
// [START_EXCLUDE]
[self.resultsText setString:@""];
for (FIRVisionImageLabel *label in labels) {
[self.resultsText appendFormat:@"Label: %@, Confidence: %@, EntityID: %@\n", label.text,
label.confidence, label.entityID];
}
[self showResults];
// [END_EXCLUDE]
}];
// [END detect_label_cloud]
}
@end
NS_ASSUME_NONNULL_END
| 2024-06-19T01:27:15.642919 | https://example.com/article/3211 |
After Batgirl faces off against a second villain with the mark of “The Student,” she must set off to Korea to get to the bottom of the mysterious attacks before someone close to her gets caught in the crossfire! | 2024-05-20T01:27:15.642919 | https://example.com/article/8984 |
Q:
Want to add more drops to my mining function
So I have a working button that adds exp to my total exp then has a chance to give you 1 bronze on click. I want when my mininglv >=10 for silver to be added to that.
I've tried making another if statement (probably formatted it wrong) that is if (mininglv >=10 && mininglv < 20) then repeating the lines for bronze and mining exp then adding a silver random thing. I cant figure out how to add silver to the chance to get from the click of the button and give it a chance of 0.25.
This is my javaScript code:
var Bronzechance = 0.5
var Silverchance = 0.25
function Miningaction() {
if (MiningCexp < NextMaxMiningExp && Mininglv >= 1) {
MiningCexp = MiningCexp + 1;
if (Math.random() < Bronzechance)
Bronze = Bronze + 1
document.getElementById("Bronze").innerHTML = Bronze;
document.getElementById("MiningCexp").innerHTML = MiningCexp;
}
if(Mininglv >=10 && Mininglv <20){
MiningCexp = MiningCexp + 1;
if (Math.random() < Silverchance){
Silver = Silver + 1;
}
document.getElementById("Bronze").innerHTML = Bronze;
document.getElementById("Silver").innerHTML = Silver;
document.getElementById("MiningCexp").innerHTML = MiningCexp;
} else {
Mininglv = Mininglv + 1
MiningCexp = 0
Mining = Mining + 1
NextMaxMiningExp = NextMaxMiningExp * 1.5;
document.getElementById('MiningMexp').innerHTML = NextMaxMiningExp;
document.getElementById('Mininglv').innerHTML = Mininglv;
document.getElementById('MiningCexp').innerHTML = MiningCexp;
document.getElementById('Mining').innerHTML = Mining;
}
}
Html code :
Bronze: <span id="Bronze">0</span>
<br />
Silver: <span id="Bronze">0</span>
<button onclick="Miningaction()"><img src="cave.png" alt="cave"
height="45" width="45"> </button>
I expect when button clicked when mining level is 10 or higher but not higher then 20 to have a chance to give you silver. But the actual output I can't get silver to drop.
A:
Is this what you're looking for?
var Bronzechance = 0.5;
var Silverchance = 0.25;
var Bronze = 0;
var Silver = 0;
function Miningaction() {
MiningCexp = MiningCexp + 1;
if (Mininglv >= 1) {
if (Math.random() < Bronzechance)
Bronze = Bronze + 1;
document.getElementById("Bronze").innerHTML = Bronze;
document.getElementById("MiningCexp").innerHTML = MiningCexp;
}
if(Mininglv >=10 && Mininglv < 20){
if (Math.random() < Silverchance){
Silver = Silver + 1;
}
document.getElementById("Silver").innerHTML = Silver;
document.getElementById("MiningCexp").innerHTML = MiningCexp;
if(MiningCexp >= NextMaxMiningExp)
Mininglv = Mininglv + 1;
MiningCexp = 0;
Mining = Mining + 1;
NextMaxMiningExp = NextMaxMiningExp * 1.5;
document.getElementById('MiningMexp').innerHTML = NextMaxMiningExp;
document.getElementById('Mininglv').innerHTML = Mininglv;
document.getElementById('MiningCexp').innerHTML = MiningCexp;
document.getElementById('Mining').innerHTML = Mining;
}
}
| 2024-05-08T01:27:15.642919 | https://example.com/article/2943 |
The World Health Organisation recognises tobacco use as the major preventable cause of adult death from cancer. Approximately 80% of male and 45% of female lung cancer cases worldwide are attributable to smoking ([@bib2]). Evidence from epidemiological studies indicates that within 10 years of quitting smoking, there is a 40--90% reduction in lung cancer risk, and that the magnitude of risk reduction varies with the intensity of smoking, time since stopping and age at cessation ([@bib17]; [@bib3]; [@bib20]; [@bib19]; [@bib10]; [@bib4]; [@bib9]; [@bib18]).
Estimates of the benefits of smoking cessation are expected to be largest in countries where the majority of smokers have been exposed for a long period of time ([@bib7]). This is the case in Western populations, which are at a more advanced phase of the 'tobacco epidemic\' ([@bib6]). In Asia, where the maximal impact is yet to be felt, the full magnitude of the effect, and its relation to time since quitting, has yet to be well documented.
In Singapore, lung cancer remains the most frequent cancer among men and the third most frequent among women ([@bib15]). Smoking prevalence stood at 21.8 and 3.5%, respectively, in 2004 ([@bib13]); these rates are among the lowest globally ([@bib8]; [@bib16]). Active measures by the government include laws restricting smoking in public places, prohibition of tobacco advertisements and promotion of healthy lifestyles ([@bib1]). We used data from a prospective population-based cohort of middle-aged to elderly Chinese in Singapore to evaluate the effect of cessation on lung cancer risk, and the potential impact of measures to reduce the harmful effect of tobacco in Asian populations.
Materials and methods
=====================
Study population
----------------
The Singapore Chinese Health Study is a prospective cohort study, and the design and methodology have been described previously ([@bib5]). Briefly, the cohort was drawn from permanent residents or citizens of Singapore who live in government-built housing estates. Recruitment was restricted only to men and women of Chinese ethnicity (from the two major dialect groups, Hokkiens and Cantonese) aged between 45 and 74 years. The population was enrolled between April 1993 and December 1998, and subsequently re-interviewed in 1999--2004.
Exposure assessment
-------------------
A face-to-face interview was conducted in the subject\'s home at the time of recruitment by a trained interviewer using a structured questionnaire, which requested information on demographics, educational attainment, lifetime use of tobacco, current use of alcohol, current level of physical activity, medical history and family history of cancer. The questionnaire included a validated, semi-quantitative food frequency section listing 165 food items commonly consumed in the study population. The second re-interview, which assessed cigarette smoking as well as other selected lifestyle factors and medical histories, was conducted from 1999 to 2004, either in-person or over the telephone, using standardised questionnaire and method.
In both surveys, we obtained information on smoking habits -- participants were asked whether they smoked, average number of cigarettes smoked per day, age they started smoking regularly and years since quitting for ex-smokers. Although the style of the questions differed slightly between the two surveys, all these variables were included in both questionnaires.
In the baseline questionnaire, subjects were grouped into three groups according to the answers given to the following question, 'Have you ever smoked at least 1 cigarette a day for 1 year or longer?\' Subjects who answered 'no\' were classified as 'never smokers\', those who answered 'yes, but I quit smoking\' were classified as 'former smokers\' and those who answered 'yes, and I currently smoke\' were classified as 'current smokers\'. At the second assessment, the population was again grouped based on the following two questions, 'Have you ever smoked more than 100 cigarettes in your lifetime?\' and divided into three groups; those who answered 'no\' were classified as 'never smokers\' and those who answered 'yes\' were further classified by a second question: 'Have you smoked at least one cigarette in the past 30 days?\' Those answering 'no\' were classified as 'former smokers\' and those answering 'yes\' were classified as 'current smokers\'.
Categories of participants
--------------------------
The grouping criteria were based on the combined answers from baseline and second survey, and resulted in the following categories: current smokers, participants stated they were current smokers at both interviews; new quitters, those who stated they were smokers at baseline and had quit smoking before the second interview; continuing ex-smokers, who stated they were former smokers at both interviews; and never smokers, those who stated they were never smokers at both interviews.
Case ascertainment
------------------
Incident cases of lung cancer occurring between the second interview and the end of the follow-up period were identified by linkage with the Singapore Cancer Registry using unique national identification numbers. A total of 517 incident lung cancer cases were diagnosed among cohort members between the second interview and 31 December 2007. The majority (440 or 85.1%) of these were based on histological diagnoses, 52 (10.1%) cases were diagnosed clinically, and these were confirmed by manual review of pathology reports by trained research staff. A total of 25 (4.8%) cases were identified through death records. The site of origin and histological subtypes were categorised according to ICD-O (International Classification of Diseases for Oncology) code. Included in this study are the following subtypes: adenocarcinoma, squamous cell carcinoma, small-cell lung cancer and primary lung cancer with other or unspecified histology.
Data analysis
-------------
A total of 63 257 subjects were interviewed at baseline. On the second survey, ∼17% were not contactable because of death or physical disability, or could not be reached after three attempts by mail, phone call or house visit. A total of 52 324 subjects were successfully re-contacted, and the mean period between interviews was 5.8 years. Any subject with existing cancer diagnosed before second survey was excluded (*n*=2519). Participants who started smoking after baseline interview (*n*=1502) and those whose responses on both occasions were deemed inconsistent (*n*=2403) were also excluded, leaving a final study population of 45 900 subjects, among whom 463 incident cases of lung cancer were identified.
For each subject, person-years of follow-up were counted from the date of the second interview to the date of diagnosis of lung cancer, death or 31 December 2007, whichever occurred first. Proportional hazards (Cox) regression methods were used to examine the association between smoking cessation and risk of lung cancer. We adjusted simultaneously for age at interview (years), gender, dialect group (Hokkien, Cantonese), body mass index (BMI), year of recruitment, level of education (no formal education, primary school, secondary school or above) and daily intakes of ethanol (grams), fruits, vegetables and juices (grams), as well as daily dietary intakes of *β*-cryptoxanthin (*μ*g) and isothiocyanates (*μ*mol). The proportionality assumption was tested in the final model and found to be satisfied (*P*=0.45). Statistical computing was conducted using SAS version 9.1 (SAS Institute Inc., Cary, NC, USA) statistical software package. All *P*-values quoted were two sided, and *P*-values \<0.05 were considered statistically significant.
Results
=======
Among 45 900 subjects in this analysis (18 688 men and 27 212 women), the prevalence rates of current and former smokers were 31.0 and 26.7% among men, and 4.2 and 2.4% for women, respectively. Ever smokers were older than never smokers. The results showed that current smokers and recent quitters had lower BMI at baseline. They were more likely to consume alcohol and reported lower consumption of vegetables and fruits compared with continuous ex-smokers and never smokers. Ever smokers were also less likely than never smokers to have no formal education (18.5 *vs* 28.2%) ([Table 1](#tbl1){ref-type="table"}). At baseline interview, continuous ex-smokers also reported the highest intensity of smoking in the past (32.6% reported \>23 cigs/day) compared to current smokers (19.0%) and new quitters (15.9%) data not shown.
As of 31 December 2007, 463 cases of lung cancer were identified (314 male and 149 female). There were 177 adenocarcinomas (38.2%), 74 squamous cell carcinomas (16.0%), 47 small cell carcinomas (10.2%) and 165 cases (35.6%) which were either of other histological subtypes (24.4%) or of unknown histology (11.2%). Compared with current smokers ([Table 2](#tbl2){ref-type="table"}), individuals who quit smoking before the second survey had a 28% decrease in risk of lung cancer (adjusted hazard ratio (HR) 0.72; 95% confidence interval (95% CI): 0.53--0.98). Those who quit before baseline and maintained their status had less than half the risk of current smokers (HR 0.42; 95% CI: 0.32--0.56). The relative risk of lung cancer among never smokers was 0.14 (95% CI: 0.11--0.18). When the analysis was limited to smokers and further adjusted for smoking intensity and duration at baseline, the estimates were not materially changed (OR for new quitters 0.75, 95% CI 0.55--1.03; continuous ex-smokers 0.54, 95% CI 0.39--0.74). When stratified by gender, the reduction in risk remained strong and statistically significant among males. The numbers of female smokers and ex-smokers in this population were too small for a separate analysis to be meaningful.
Discussion
==========
From the perspective of cancer prevention, our results confirm that quitting smoking and maintaining that status is associated with a significant reduction in lung cancer risk in this Asian population. Importantly, this benefit can be observed within 6 years of quitting. Evidence from this, and other studies is therefore consistent with the understanding that although some of the genetic damage caused by smoking is irreversible and accounts for the higher risk that persists among ex-smokers, cessation of smoking reduces the period of time for which the bronchial epithelium is exposed to mutagens, and to the chronic inflammatory state which promotes carcinogenesis ([@bib11]).
Although we did not attempt to verify smoking (and quitting) status by measuring cotinine levels or through other means, an important feature of the current study is the use of repeated measurements and the application of stringent criteria for classification of smoking status. Smoking behaviour, being dynamic, may change in an unpredictable manner, and reliance on one measurement time point may obscure true effects on disease risk.
The short-term (\<5 years) benefits of smoking cessation are arguably more difficult to demonstrate because of the possibility that individuals may quit because of health problems that may pre-date a subsequent diagnosis of lung cancer. Earlier studies, both cohort and case--control, have been inconclusive with respect to short-term benefits, although the long-term reduction in risk is clear ([@bib7]). Such a bias may indeed be present in this study, and may have led to an underestimation of the true effect.
Among the limitations of this analysis are that the information collected as baseline was categorical in nature, and that the actual changes in the intensity of smoking could not be computed in a quantitative manner. The relatively short period for ascertainment of incident cases precluded a more detailed analysis by gender, or by histological subtype, both of which could yield important and relevant information.
Although the prevalence of smoking is decreasing in developed countries, there are worrying observations that in developing countries such as China ([@bib21]; [@bib12]) and India ([@bib14]), individuals are smoking higher doses and also starting at an earlier age. Hence, the estimated lung cancer mortality attributed to smoking in developing Asian countries can be expected to increase rapidly. Our data confirm that the beneficial effect of smoking cessation in Asian populations is likely to be substantial and can be demonstrated within a relatively short time after quitting. These findings are relevant for Asian populations at a similar stage in the tobacco epidemic curve, and underscore the importance of public health measures not only to prevent initiation of smoking but also to find effective means of helping current smokers to quit.
We thank Siew-Hong Low of the National University of Singapore for supervising the field work of the Singapore Chinese Health Study, and Kazuko Arakawa and Renwei Wang of the University of Minnesota for the development and maintenance of the cohort study database. We also thank the Ministry of Health in Singapore for assistance with the identification of cancer and mortality outcomes via database linkages. This study was funded by the National Institutes of Health (NCI R01 CA55069, R35 CA53890 and R01 CA80205).
###### Baseline characteristics of 45 900 participants (mean and s.d. or number and %) by smoking category in the Singapore Chinese Health Study (1993--2007)
**Smoking category**
----------------------------------------- ---------------- ---------------------- --------------- --------------- ---------------
Men 18 688 (40.7%) 5802 (83.4%) 1495 (84.7%) 3503 (90.1%) 7888 (23.7%)
Age (years) 55.5 (7.7) 56.2 (7.5) 57.7 (7.6) 59.0 (7.9) 54.9 (7.5)
Body mass index 23.1 (3.3) 22.4 (3.2) 22.9 (3.3) 23.5 (3.4) 23.3 (3.3)
Dialect group, Cantonese 22 219 (48.4%) 2714 (39.0%) 719 (40.7%) 1988 (51.1%) 16798 (50.5%)
No formal education 11 731 (25.6%) 1467 (21.1%) 340 (19.3%) 523 (13.5%) 9401 (28.2%)
Alcohol intake, g per day 1.6 (7.3) 5.2 (13.5) 3.1 (10.3) 3.0 (10.5) 0.7 (3.6)
Vegetable intake, g per day 112.9 (63.3) 104.4 (61.5) 105.7 (61.7) 114.6 (65.7) 114.9 (63.2)
Fruit intake, g per day 207.0 (168.6) 170.7 (159.7) 186.1 (155.0) 219.8 (172.4) 214.2 (196.6)
Mean time between two interviews, years 5.8 (1.5) 6.0 (1.5) 6.3 (1.5) 5.6 (1.5) 5.7 (1.5)
###### Lung cancer risk by smoking category among 45 900 participants in the Singapore Chinese Health Study (1993--2007)
**Smoking category**
------------------------------------------------------------- ----------- ---------------------- ------------------- ------------------- -------------------
No. at risk (%) 45 900 6955 (15.1%) 1765 (3.9%) 3888 (8.5%) 33 292 (72.5%)
Person-years of follow-up 290 832 41 798 10 588 23 573 214 873
Follow-up years, mean (s.d.) 6.3 (1.5) 6.0 (1.7) 6.0 (1.8) 6.1 (1.6) 6.5 (1.4)
*Lung cancer risk*
*All cases*
No. of cases (% of total cases) 463 234 (50.5%) 48 (10.4%) 63 (13.6%) 118 (25.5%)
Crude hazard ratio (95% CI) 1.0 (reference) 0.81 (0.59--1.10) 0.48 (0.36--0.63) 0.10 (0.08--0.12)
Adjusted hazard ratio[a](#t2-fn2){ref-type="fn"} (95% CI) 1.0 (reference) 0.72 (0.53--0.98) 0.42 (0.32--0.56) 0.14 (0.11--0.18)
*Male only*
No. of cases (% in each smoking category) 314 199 (63.4%) 38 (12.1%) 53 (16.9%) 24 (7.6%)
Crude hazard ratio (95% CI) 1.0 (reference) 0.74 (0.52--1.05) 0.44 (0.32--0.59) 0.08 (0.06--0.13)
Adjusted hazard ratio[a](#t2-fn2){ref-type="fn"} (95% CI) 1.0 (reference) 0.64 (0.45--0.91) 0.38 (0.28--0.52) 0.11 (0.07--0.17)
Abbreviations: BMI=body mass index; CI=confidence interval.
Multivariate model adjusted for gender (male, female), dialect group (Cantonese, Hokkien), age at recruitment (continuous), year at interview (continuous), BMI at baseline (continuous), education (no formal education, primary, secondary and above), ethanol intake (continuous), vegetable intake (continuous), fruit intake (continuous), dietary intake of *β*-cryptoxanthin (continuous) and isothiocyanates (continuous).
| 2024-06-30T01:27:15.642919 | https://example.com/article/5252 |
1
xy =cmr8 =cmcsc10 =msbm10 =msbm7 =msbm5 =127 =127 =127 === =msam10 =msam7 =msam5 =127 =127 =127 === ="2903 \#1[[\[\#1\]]{}]{} \#1[[(\#1)]{}]{} \#1 \#1. \#2
[\[\#1\]]{}\#2
\#1. \#2
[**\#1.**]{} \#2
\#1[[*\#1*]{}.]{}
[H]{} Ł[[L]{}]{} ¶[[P]{}]{} Å[[A]{}]{} .
\#1\#2\#3[[\#1]{}\_[\#2]{},…,[\#1]{}\_[\#3]{}]{} \#1 \#1[{\#1}]{} \#1[[*\#1*]{}]{} \#1[\#\#1[by 1 \#\#1]{}\#1]{}
**On the antipode of Kreimer’s Hopf algebra**
Héctor Figueroa
*Department of Mathematics, Universidad de Costa Rica, 2060 San José, Costa Rica*
José M. Gracia–Bonda
*Department of Physics, Universidad de Costa Rica, 2060 San José, Costa Rica*
=9.5pt We give a new formula for the antipode of the algebra of rooted trees, directly in terms of the bialgebra structure. The equivalence, proved in this paper, among the three available formulae for the antipode, reflects the equivalence among the Bogoliubov–Parasiuk–Hepp, Zimmermann, and Dyson–Salam renormalization schemes.
[*Keywords*]{}: Antipode, rooted tree, renormalization.
[**1. Introduction**]{}
More than two years ago, Kreimer discovered that there is a Hopf algebra structure encoding Zimmermann’s forest formula in perturbative renormalization theory. Shortly afterwards, an essential coincidence was found between Kreimer’s algebra and the Hopf algebras introduced by Connes and Moscovici in connection with the index problem for $K$-cycles on foliations .
A unified treatment in terms of the algebra of rooted trees $H_R$ was developed in : there to each (superficially divergent) Feynman diagram a sum of rooted trees is assigned; the assignment is straightforward when the diagram contains only disjoint or nested subdivergences (as it then leads to a single tree), but it does not work smoothly for overlapping divergences .
The central role in the application of Kreimer–Connes–Moscovici algebras is played by the *antipode*. In two equivalent definitions of the antipode in $H_R$ were given, representing respectively —in the framework of the algebra of rooted trees— the recursive Bogoliubov–Parasiuk–Hepp procedure for renormalizing Feynman integrals with subdivergences, and Zimmermann’s forest formula which solves that recursion; that indeed they correspond to the antipode of the Hopf algebra of rooted trees is implied rather than proven.
Here we *construct* the antipode for $H_R$, giving a new formula for computing it in terms of the coproduct; and then we show its equivalence to each of the formulae by Connes and Kreimer. It turns out that this new formula corresponds to the Dyson–Salam procedure for renormalization.
[**2. The antipode of the Hopf algebra of rooted trees**]{}
To establish the notation, we briefly recall some basic facts concerning the antipode of a Hopf algebra (consult for proofs), and then the algebra of rooted trees.
Given a unital algebra $(A,m,u)$ and a counital coalgebra $(C,\Dl,\eps)$ over a field $\FF$, the *convolution* of two elements $f,g$ of the vector space of $\FF$-linear maps $\Hom(C,A)$ is defined as the map $f * g \in \Hom(C,A)$ given by the composition $$C \longto^\Dl C \ox C \longto^{f\ox g} A \ox A \longto^m A.$$ This product turns $\Hom(C,A)$ into a unital algebra, where the unit is the map $u \circ \eps$. In this paper $\FF$ is the field of real numbers $\R$.
A bialgebra $H = (A,m,u,\Dl,\eps)$ in which the identity map $\id_H$ is invertible under convolution is a *Hopf algebra*, and its (necessarily unique) convolution inverse $S$ is called the *antipode*. The property $\id_H * S = S * \id_H = u \circ \eps$ boils down to the commutativity of the diagram: $$\vcenter{\hbox{
\xymatrix{
H \ox H \ar[d]_{\id\ox S} & H \ar[l]_(.4)\Dl \ar[r]^(.4)\Dl
& H \ox H \ar[d]^{S\ox \id} \\
H \ox H \ar[r]^(.6)m & H \ar[u]_{u\circ\eps} & H \ox H \ar[l]_(.6)m.}
}}
\eqno (2.1)$$ In particular, if $\Dl(a) = \sum_j a'_j \ox a''_j$, then $$\eps(a) 1_H = u \circ \eps(a) = m \circ (\id \ox S) \circ \Dl(a)
= \tsum_j a'_j S(a''_j),
\eqno (2.2)$$ and likewise $\eps(a) 1_H = \sum_j S(a'_j) a''_j$.
The antipode is always a unital algebra and a counital coalgebra antihomomorphism. When H is either commutative or cocommutative, $S^2 = \id$; in particular, $S$ is bijective in such cases. Another important property is that a bialgebra morphism $\ell\: H \to H'$ between Hopf algebras is automatically compatible with the antipodes: $\ell \circ S = S' \circ \ell$ .
A *rooted tree* is a finite set of points, called vertices, joined by oriented lines that do not intersect, so that all the vertices have exactly one incoming line, except the root which has only outgoing lines. In particular, there is a unique branch that joins the root with any other vertex. One actually works with isomorphic classes of trees. Two rooted trees are isomorphic if the number of vertices with given length and fertility is the same for all possible choices of lengths and fertilities, where the *fertility* of a vertex is the number of its outgoing lines and its *length* is the number of lines that make up the unique branch joining it to the root.
For concrete examples, it will be convenient to have a list of a few isomorphic classes of rooted trees, say with four vertices or fewer: $$\5 \quad t_1
\quad
\xy 0;<18pt,0pt>: *{t_2} ;
(0,0)*{\5}; (0,-1)*{\8} **@{-} \endxy
\quad
\xy 0;<18pt,0pt>: *{t_{31}} ;
(0,0)*{\5}; (0,-1)*{\8} **@{-} ;
(0,-2)*{\8} **@{-}
\endxy
\quad
\xy 0;<18pt,0pt>: *{t_{32}} ;
(0,0)*{\5} ;
(.8,-1)*{\8} **@{-} , (-.8,-1)*{\8} **@{-}
\endxy
\quad
\xy 0;<18pt,0pt>: *{t_{41}} ;
(0,0)*{\5} ; (0,-1)*{\8} **@{-} ;
(0,-2)*{\8} **@{-} ; (0,-3)*{\8} **@{-}
\endxy
\quad
\xy 0;<18pt,0pt>: *{t_{42}} ;
(0,0)*{\5} ; (.8,-1)*{\8} **@{-}, (-.8,-1)*{\8} **@{-} ;
(-.8,-2)*{\8}
**@{-}
\endxy
\quad
\xy 0;<18pt,0pt>: *{t_{43}} ; (0,0)*{\5} ;
(-.8,-1)*{\8} **@{-} , (0,-1)*{\8} **@{-}, (.8,-1)*{\8} **@{-}
\endxy
\quad
\xy 0;<18pt,0pt>: *{t_{44}} ;
(0,0)*{\5} ; (0,-1)*{\8} **@{-} ;
(-.8,-2)*{\8} **@{-} , (.8,-2)*{\8} **@{-}
\endxy$$
A *simple cut* $c$ of a tree $T$ is a subset of its lines such that the path from the branch to any other vertex includes at most one line of $c$. Deleting the cut branches produces several subtrees; the component containing the original root (the trunk) is denoted $R_c(T)$. The remaining branches also form rooted trees, where in each case the new root is the vertex immediately below the deleted line; $P_c(T)$ denotes the set of these pruned branches. Here, for instance, are the possible simple cuts of $t_{42}$: $$\xy 0;<18pt,0pt>:
(0,0)*{\5} ; (.8,-1)*{\8} **@{-} ,
(-.8,-1)*{\8} **@{-} ; (-.8,-2)*{\8} **@{-} ?*{\equiv}
\endxy
\qquad
\xy 0;<18pt,0pt>:
(0,0)*{\5} ; (.8,-1)*{\8} **@{-} ,
(-.8,-1)*{\8} **@{-} ?*{\equiv} ?(1) ; (-.8,-2)*{\8}
**@{-}
\endxy
\qquad
\xy 0;<18pt,0pt>:
(0,0)*{\5} ; (.8,-1)*{\8} **@{-} ?*{\equiv} ?(1) ,
(-.8,-1)*{\8} **@{-} ; (-.8,-2)*{\8} **@{-}
\endxy
\qquad
\xy 0;<18pt,0pt>:
(0,0)*{\5} ; (.8,-1)*{\8} **@{-} ?*{\equiv} ?(1) ,
(-.8,-1)*{\8} **@{-} ?*{\equiv} ?(1) ; (-.8,-2)*{\8} **@{-}
\endxy
\qquad
\xy 0;<18pt,0pt>:
(0,0)*{\5} ; (.8,-1)*{\8} **@{-} ?*{\equiv} ?(1) ,
(-.8,-1)*{\8} **@{-} ; (-.8,-2)*{\8} **@{-} ?*{\equiv}
\endxy$$
The set of nontrivial simple cuts of a tree $T$ will be denoted by $C(T)$; we consider also the “empty cut” $c = \emptyset$, for which $R_\emptyset(T) = T$ and $P_\emptyset(T) = \emptyset$.
The *algebra of rooted trees* $H_R$ is the commutative algebra generated by symbols $T$, one for each isomorphism class of rooted trees, plus a unit $1$ corresponding to the empty tree; the product of trees is written as the juxtaposition of their symbols. The counit $\eps: H_R \to \R$ is the linear map defined by $\eps(1) := 1_\R$ and $\eps(T_1T_2\dots T_n) = 0$ if $\row T1n$ are trees. Kreimer defined a map $\Dl \: H_R \to H_R \ox H_R$ on the generators, extending it as an algebra homomorphism, as follows: $$\Dl 1 := 1 \ox 1; \quad
\Dl T := T \ox 1 + 1 \ox T + \sum_{c\in C(T)} P_c(T) \ox R_c(T).
\eqno (2.3)$$ Notice that $P_c(T)$ is the product of the several subtrees pruned by the cut $c$. For instance, $$\eqalignno{
\Dl(t_1) &= t_1 \ox 1 + 1 \ox t_1,
\cr
\Dl(t_2) &= t_2 \ox 1 + 1 \ox t_2 + t_1 \ox t_1,
\cr
\Dl(t_{31}) &= t_{31} \ox 1 + 1 \ox t_{31} + t_2 \ox t_1 + t_1 \ox t_2,
\cr
\Dl(t_{32}) &= t_{32} \ox 1 + 1 \ox t_{32} + 2t_1 \ox t_2
+ t_1^2 \ox t_1,
\cr
\Dl(t_{41}) &= t_{41} \ox 1 + 1 \ox t_{41} + t_{31} \ox t_1
+ t_2 \ox t_2 + t_1 \ox t_{31},
\cr
\Dl(t_{42}) &= t_{42} \ox 1 + 1 \ox t_{42} + t_1 \ox t_{32}
+ t_2 \ox t_2 + t_1 \ox t_{31} + t_2 t_1 \ox t_1 + t_1^2 \ox t_2,
\cr
\Dl(t_{43}) &= t_{43} \ox 1 + 1 \ox t_{43} + 3t_1 \ox t_{32}
+ 3t_1^2 \ox t_2 + t_1^3 \ox t_1,
\cr
\Dl(t_{44}) &= t_{44} \ox 1 + 1 \ox t_{44} + t_{32} \ox t_1
+ 2 t_1 \ox t_{31} + t_1^2 \ox t_2.
& (2.4) \cr}$$
A most useful tool is the sprouting of a new root; namely the morphism $L\: H_R \to H_R$ given by the linear map defined by $$L(T_1 \dots T_k) := T,$$ where $T$ is the rooted tree obtained by conjuring up a new vertex as its root and extending lines from this vertex to each root of $\row T1k$. For instance, $$L\Bigl( \vcenter{
\xy 0;<10pt,0pt>: (0,0)*{\5} ; (.8,-1)*{\8} **@{-},
(-.8,-1)*{\8} **@{-} \endxy} \Bigr)
= \vcenter{ \xy 0;<10pt,0pt>: (0,0)*{\5}; (0,-1)*{\8} **@{-};
(-.8,-2)*{\8} **@{-}, (.8,-2)*{\8} **@{-}\endxy}
\sepword{and}
L\Bigl( \vcenter{\xy 0;<10pt,0pt>: (0,0)*{\5};
(0,-1)*{\8} **@{-} \endxy} \
\vcenter{\xy 0;<10pt,0pt>: (0,0)*{\5};
(0,-1)*{\8} **@{-} \endxy} \Bigr)
= \vcenter{ \xy 0;<10pt,0pt>: (0,0)*{\5} ;
(-.8,-1)*{\8} ="2" **@{-}, (.8,-1)*{\8} **@{-};
(.8,-2)*{\8} **@{-}; (-.8,-2)*{\8}; "2" **@{-}
\endxy}
\eqno (2.5)$$
The proof that $\Dl$ is indeed a coproduct is based on the formula $$\Dl \circ L = L \ox 1 + (\id \ox L) \circ \Dl.
\eqno (2.6)$$ For details see or .
When dealing with particular Hopf algebras, the antipode is often determined by specific properties of the algebras in question, and the defining property of the antipode is scarcely used. The latter turns out to be extremely useful in our context, however. We compute the antipode $S\: H_R \to H_R$ by exploiting its very definition as the convolution inverse of the identity in $H_R$, via a geometric series: $$S := (\id)^{*-1} = (u \circ \eps -(u \circ \eps -\id))^{*-1}
= u \circ \eps + (u \circ \eps -\id) + (u \circ \eps -\id)^{*2}
+ \cdots$$
Lemma 2.1. If $T$ is a rooted tree with $n$ vertices, the geometric series expansion of $S(T)$ has at most $n + 1$ terms.
The claim is certainly true for $t_1$. Assume that it holds for all trees with $n$ vertices. Let $T$ be a rooted tree with $n + 1$ vertices; then $$\eqalign{
(u \circ \eps -\id)^{*(n+2)}(T)
&= (u \circ \eps -\id) * (u \circ \eps -\id)^{*(n+1)}(T)
\cr
&= m \circ [(u \circ \eps -\id) \ox (u \circ \eps -\id)^{*(n+1)}]
\circ \Dl(T)
\cr
&= m \circ [(u \circ \eps -\id) \ox (u \circ \eps -\id)^{*(n+1)}]
\cr
&\qquad\qquad \biggl( T \ox 1 + 1 \ox T
+ \sum_{c\in C(T)} P_c(T) \ox R_c(T) \biggr).
\cr}$$ The first and second term vanish because $(u \circ \eps - \id)1 = 0$. By the induction hypothesis the third term is zero.
As an immediate corollary we obtain that $S$ so defined is indeed the antipode.
One of the advantages of this formulation is that we obtain a fully explicit formula for $S$ from the coproduct table. If $a \in H^n$, $\Dl(a) = \sum_{i_1} a'_{i_1} \ox a''_{i_1}$, $\Dl(a''_{i_1}) =
\sum_{i_2} a'_{i_1i_2} \ox a''_{i_1i_2}$ and in general $\Dl(a''_{\row
i1k}) = \sum_{i_{k+1}} a'_{\row i1{k+1}} \ox a''_{\row i1{k+1}}$, then $$(u \circ \eps -\id)^{*k+1}(a) = (-1)^{k+1} \sum_{\row i1k}
b'_{i_1} b'_{i_1 i_2} \cdots b'_{\row i1k} b''_{\row i1k},$$ where $$\eqalignno{
b'_{\row i1j} &:= \cases{
0 & if $a'_{\row i1j} = 1$ or $a''_{\row i1j} = 1$, \cr
a'_{\row i1j} & otherwise, \cr}
\cr
\noalign{\hbox{and}}
b''_{\row i1j} &:= \cases{ 0 & if $a''_{\row i1j} = 1$, \cr
a''_{\row i1j} & otherwise. \cr}
\cr}$$ For instance, using , $$\eqalignno{
S(t_{42})
&= - t_{42} + (t_1t_{32} + t_2^2 + t_1t_{31} + 2 t_1^2t_2)
- (5 t_1^2t_2 + 2 t_1^4) + 3 t_1^4
\cr
&= - t_{42} + t_1 t_{32} + t_2^2 + t_1 t_{31} - 3t_1^2 t_2 + t_1^4.
& (2.7) \cr}$$ Similarly, if we denote by $t'$ the rooted tree in with 5 vertices, then $$\eqalignno{
S(t') &= - t' + (2 t_1t_{42} + 2 t_2t_{31} + t_1^2t_{32} + 3 t_1t_2^2)
\cr
&\qquad
-(2 t_1^2t_{32} +6 t_1t_2^2 + 2 t_1^2t_{31} + 8 t_1^3t_2 + t_1^5)
+ (12 t_1^3 t_2 + 6 t_1^5) - 6 t_1^5
\cr
&= - t' + 2 t_1t_{42} + 2 t_2t_{31} - t_1^2t_{32} - 3 t_1t_2^2
- 2 t_1^2t_{31} + 4 t_1^3t_2 - t_1^5.
\cr}$$
The reader will find without difficulty that these formulae correspond to the original Dyson–Salam procedure for renormalizing Feynman graphs with subdivergences: see, for instance, .
In correspondence with Bogoliubov’s recursive formula for renormalization, equations $m \circ (S \ox \id) \circ \Dl(T) = 0$ and suggest to define the antipode recursively, as indeed done by Connes and Kreimer: $$S_B(T) := - T - \sum_{c\in C(T)} S_B(P_c(T)) R_c(T).$$ For instance, $$S_B(t_{42}) = -t_{42} - S_B(t_1) t_{32} - S_B(t_2) t_2
- S_B(t_1) t_{31} - S_B(t_2t_1) t_1 - S_B(t_1^2) t_2,$$ which gives again . We next check that $S_B$ is indeed the antipode.
Proposition 2.2. If $T$ is any rooted tree, then $S(T) = S_B(T)$.
For convenience, we abbreviate $\eta := u\circ\eps - \id$. The statement holds, by a direct check, if $T$ has $1,2$ or $3$ vertices. If it holds for all rooted trees with at most $n$ vertices and if $T$ is a rooted tree with $n+1$ vertices, then $$\eqalignno{
S(T) &= \eta(T) + \sum_{j=1}^n \eta^{*j} * \eta(T)
= -T + m \circ \biggl( \sum_{j=1}^n \eta^{*j} \ox \eta \biggr)
\circ \Dl(T)
\cr
&= -T + m \circ \sum_{j=1}^n \eta^{*j} \ox \eta
\biggl(T \ox 1 + 1\ox T + \sum_{c\in C(T)} P_c(T) \ox R_c(T)\biggr)
\cr
&= -T - \sum_{c\in C(T)} \sum_{j=1}^n \eta^{*j} (P_c(T)) \, R_c(T)
\cr
&= -T - \sum_{c\in C(T)} S_B(P_c(T)) \,R_c(T) = S_B(T),
\cr}$$ where the penultimate equality uses the inductive hypothesis.
Zimmermann’s forest formula corresponds to the following nonrecursive formula for the antipode: $$S_Z(1) := 1,\quad S_Z(T) := - \sum_{d\in D(T)} (-1)^{\#d} P_d(T) R_d(T),$$ where $D(T)$ is the set of all cuts, not necessarily simple, including the empty cut, and $\#d$ is the cardinality of $d$.
Proposition 2.3. If $T$ is any rooted tree, then $S(T) = S_Z(T)$.
First we prove that, for an arbitrary rooted tree $T$, $$S(L(T)) = - L(T) - S(T)\,t_1 - \sum_{c\in C(T)} S(P_c(T))\,L(R_c(T)).
\eqno (2.8)$$ Indeed, if $T$ has $n$ vertices, then, by Lemma 2.1 and , $$\eqalignno{
S(L(T))
&= - L(T) + m \circ \biggl( \sum_{j=1}^n \eta^{*j} \ox \eta \biggr)
\circ \Dl(L(T))
\cr
&= - L(T) + m \circ \sum_{j=1}^n \eta^{*j} \ox \eta
\bigl( L(T) \ox 1 + (\id \ox L) \circ \Dl(T) \bigr)
\cr
&= - L(T) + m \circ \sum_{j=1}^n \eta^{*j} \ox \eta
\cr
&\qquad\qquad \biggr( L(T) \ox 1 + T \ox t_1 + 1 \ox L(T)
+ \sum_{c\in C(T)} P_c(T) \ox L(R_c(T)) \biggl)
\cr
&= - L(T) - S(T)\,t_1 - \sum_{c\in C(T)} S(P_c(T))\,L(R_c(T)).
\cr}$$
Suppose that $S_Z$ were also to satisfy . Since any rooted tree can be written as an image of $L$, and on the right side $S$ is applied only to rooted trees of strictly fewer vertices, the proposition will follow by induction on the number of the vertices. It remains, therefore, to prove that holds for $S_Z$.
For a given rooted tree $T$, let $\ell_0$ be the new line in $L(T)$, and $\row v1k$ the vertices of length one with respect to the root of $T$. Now $D(L(T)) = A \uplus B$ where $d \in A$ or $B$ according as $\ell_0 \in d$ or not. Thus, $$S_Z(L(T)) = - \biggl( \sum_{d\in A} + \sum_{d\in B} \biggr)
(-1)^{\#d} P_d(L(T))\,R_d(L(T)).
\eqno (2.9)$$ If $d \in A$, then $e = d \less \{\ell_0\}$ is a cut of $T$; moreover, $R_d(L(T)) = t_1$, $P_d(L(T)) = P_e(T) R_e(T)$ and $\#d = \#e + 1$, so that the first sum of equals $-S(T)\,t_1$.
For a given $d \in B \less \{\emptyset\}$ and each $j \in K =:
\set{1,\dots,k}$, let $\ell_j$ be the line in $d$ closer to the root that is linked to $v_j$ (if any). Then $c' := \set{\ell_j \: j \in K}$ is a simple cut of $T$. If $\#c'$ is odd, we set $c := c'$, whereas if $\#c'$ is even, we set $c := c' \less \{\ell_s\}$, where $s$ is the smallest integer in $K$ for which there is a line with the required property. In either case, we take $e := d \less c$. Clearly $R_d(L(T))
= L(R_c(T))$, $(-1)^{\#d+1} = (-1)^{\#e}$, and $P_d(L(T)) = P_e(T_c)
R_e(T_c)$, where we use the temporary notation $T_c := P_c(T)$. It follows that the second sum of equals $$\sum_{c\in C(T)} \sum_{e\in D(T_c)} (-1)^{\#e}
P_e(T_c)\, R_e(T_c)\, L(R_c(T))
= - \sum_{c\in C(T)}S_Z(P_c(T))\, L(R_c(T)).$$ Finally, since the summand for the empty cut is $-L(T)$, the proposition is proved.
In summary, modulo the distiction between the antipode and the “twisted” or “renormalized” antipode , Kreimer’s algebraic approach reflects, within the framework of the algebra of rooted trees, the equivalence of the Dyson–Salam, the Bogoliubov–Parasiuk–Hepp and the Zimmermann procedures for renormalizing Feynman diagrams.
[**Acknowledgements**]{}
The geometric series trick was pointed out to us by Earl Taft; we are greatly indebted to him. We thank Stephen A. Fulling for a good suggestion and Joseph C. Várilly for illuminating discussions and TeXnical help. We acknowledge support from the Vicerrectora de Investigación de la Universidad de Costa Rica.
[**References**]{}
. V. Chari and A. Pressley, *A Guide to Quantum Groups*, Cambridge University Press, Cambridge, 1994.
. A. Connes and D. Kreimer, “Hopf algebras, renormalization and noncommutative geometry”, Commun. Math. Phys. [**199**]{} (1998), 203–242.
. A. Connes and D. Kreimer, “Renormalization in quantum field theory and the Riemann–Hilbert problem”, hep-th/9909126, IHES, Bures-sur-Yvette, 1999.
. A. Connes and D. Kreimer, “Renormalization in quantum field theory and the Riemann–Hilbert problem I: the Hopf algebra structure of graphs and the main theorem”, hep-th/9912092, IHES, Bures-sur-Yvette, 1999.
. A. Connes and H. Moscovici, “Hopf algebras, cyclic cohomology and the transverse index theorem”, Commun. Math. Phys. [**198**]{} (1998), 198–246.
. J. M. Gracia–Bonda, J. C. Várilly and H. Figueroa, *Elements of Noncommutative Geometry*, Birkhäuser, Boston, 2000, forthcoming.
. M. Hazewinkel, *Formal Groups and Applications*, Academic Press, New York, 1978.
. C. Kassel, *Quantum Groups*, Springer, Berlin, 1995.
. D. Kreimer, “On the Hopf algebra structure of perturbative quantum field theories”, Adv. Theor. Math. Phys. [**2**]{} (1998), 303–334.
. D. Kreimer, “Chen’s iterated integral represents the operator product expansion”, Adv. Theor. Math. Phys. [**3**]{} (1999), 3; hep-th/9901099.
. E. B. Manoukian, *Renormalization*, Academic Press, London, 1983.
. M. E. Sweedler, *Hopf algebras*, Benjamin, New York, 1969.
. R. Wulkenhaar, “On Feynman graphs as elements of a Hopf algebra”, hep-th/9912220, Luminy, 1999.
. W. Zimmermann, “Convergence of Bogoliubov’s method of renormalization in momentum space”, Commun. Math. Phys. [**15**]{} (1969), 208–234.
| 2024-05-05T01:27:15.642919 | https://example.com/article/2918 |
Saturday, November 3, 2012
Lakeon's Pregnancy Journal: Week 16
Doctor Appointments:Nov.15-- NEXT APPOINTMENT.Food cravings:Dr. Pepper is my weakness, even though It's bad for the baby and I. Weird, I didn't like Dr. pepper before pregnancy. Also, salt and vinegar chips. Yum!!
Symptoms: Baby has been moving a little more than usual.
Weight gain:I'm now at 8 pounds more than pre-pregnancy weight. Although, I did get weighed after eating a huge plate of food.
Gender prediction tests:Baking soda (at 15w)-[BOY]
My thoughts on gender: I have a strong feeling this baby is a girl. I would REALLY love to have a little boy, but I would be just as happy with another baby girl.Sleep: I sleep just fine and I even go most nights without having to go to the bathroom.
Chloe's thoughts: This week Chloe said she would be happy if the baby is a boy, and now she thinks baby is a boy. She's been getting on to me anytime I carry laundry or anything heavy and tells me I have to put it down or It'll hurt baby. I'm glad she's being thoughtful. | 2024-02-16T01:27:15.642919 | https://example.com/article/4618 |
Neonatologists can impede or support parents' participation in decision-making during medical rounds in neonatal intensive care units.
We explored the dynamics of neonatologist-parent communication and decision-making during medical rounds in a level three neonatal intensive care unit. This was a qualitative study, with an ethnographic approach, that was conducted at Turku University Hospital, Finland, from 2013 to 2014. We recruited eight mothers and seven couples, their 11 singletons and four sets of twins and two neonatologists and observed and video recorded 15 medical rounds. The infants were born at 23 + 5 to 40 + 1 weeks, and the parents were aged 24-47. The neonatologists and parents were interviewed separately after the rounds. Four patterns of interaction emerged. The collaborative pattern was most consistent, with the ideal of shared decision-making, as the parents' preferences were genuinely and visibly integrated into the treatment decisions. In the neonatologist-led interactional pattern, the decision-making process was only somewhat inclusive of the parents' observations and preferences. The remaining two patterns, emergency and disconnected, were characterised by a paternalistic decision-making model where the parents' observations and preferences had minimal to no influence on the communication or decision-making. The neonatologists played a central role in facilitating parental participation and their interaction during medical rounds were characterised by the level of parent participation in decision-making. | 2024-06-20T01:27:15.642919 | https://example.com/article/4029 |
Every once in a while we come across a thread that well and truly speaks for itself, and this thread from @Techno_Fog from May of 2018, is one of those threads.
And a possible connection between Jeffrey Epstein and Mueller’s FBI could be more important now than ever … take a look.
Wait. Was pedophile Jeffrey Epstein an informant for Mueller's FBI? From the 5/24/18 FBI Vault release: "Epstein has also provided information to the FBI as agreed upon." Is that why he escaped serious charges for molesting over twenty girls? pic.twitter.com/K4suAumD85 — Techno Fog (@Techno_Fog) May 24, 2018
*twiddles thumbs*
Eek.
Here's the thing: I'm seeing nothing in Epstein's 2007 plea deal with the DOJ that required him to provide information to the FBI. (see pics) This begs the question of whether there was a separate agreement – still undisclosed – with the FBI. pic.twitter.com/fLQ00Q50jc — Techno Fog (@Techno_Fog) May 25, 2018
What a tangled web they weaved …
It's not a conspiracy if it fits the behavior of the parties involved. Remember, subsequent civil suits uncovered efforts by the DOJ to keep the plea deal secret from the public and the girls Epstein molested. pic.twitter.com/0jCwhng3RH — Techno Fog (@Techno_Fog) May 25, 2018
If we learn nothing else from this disaster of an investigation let it be that our intelligence community can be dirty and shady AF.
Hugely important dates: 9/27/2007: Epstein signs the non-prosecution agreement 10/31/2007: Internal emails show that FBI agents still had not interviewed all the victims. pic.twitter.com/xKI6fk09dj — Techno Fog (@Techno_Fog) May 25, 2018
2/2018: Five months after the plea deal was reached, FBI agents still haven't interviewed all the victims/witnesses. FBI agents haven't even seen all the physical evidence. pic.twitter.com/tojewQUWHx — Techno Fog (@Techno_Fog) May 25, 2018
Ok Techno, what does this have to do with Mueller? The case was being run from DC. Spring of 2008: Emails between FBI agents and the local ass't US attorneys reveal "continued delays" in getting the case to a grand jury "due to the failure to receive decision from DC" pic.twitter.com/u7AQPXuuhz — Techno Fog (@Techno_Fog) May 25, 2018
Here’s the most interesting part.
Yet more records. 1/23/2008: The FBI was directly involved in the DC meetings with the DOJ about Epstein. Did Mueller attend? pic.twitter.com/0XOBewTW6w — Techno Fog (@Techno_Fog) May 25, 2018
Whoa.
Looks like we have an answer on Epstein's cooperation with the FBI/DOJ, thanks to great reporting by @MiamiHerald The DOJ wanted to prosecute executives instead of a child molester. DOJ priorities. pic.twitter.com/G5wzyac5aK — Techno Fog (@Techno_Fog) November 29, 2018
And now that Epstein has been arrested what will we learn?
*popcorn*
Related:
DESPERATE for attention and FAILED Dem candidate Pam Keith makes A*S of herself picking a fight with the GOP and YIKES
Honey, YOU WISH: Alyssa Milano writes a check her butt can’t CASH with hateful tweet about choosing between political parties
Like, she’s so MAD! AOC’s late-night temper tantrum after Nancy Pelosi throws SERIOUS shade her way only makes her look WORSE | 2024-05-02T01:27:15.642919 | https://example.com/article/3613 |
Critics of the House of Representatives’ Benghazi investigation have recently begun to make a strong claim -- that it is officially the longest congressional investigation in history.
The Select Committee on Benghazi came into existence in May 2014, charged with investigating the 2012 terrorist attack on a U.S. diplomatic compound in the Libyan city that left four Americans dead. Costing $4.5 million so far, with no final report in sight, critics see the committee as a waste of taxpayer dollars and a partisan witch hunt aimed at Democratic presidential candidate and former Secretary of State Hillary Clinton. Clinton is slated to testify before the committee later in October.
In recent days, the claim that this is the longest-running investigation ever has gone somewhat viral. We saw it in The Hill, Salon, The New York Times, Esquire, MSNBC, ABC News and, notably, a Twitter account belonging to Clinton’s campaign.
The Briefing -- an arm of the Clinton campaign that aims to counter what it considers misinformation in the public sphere -- tweeted on Sept. 30 from its account: "It's the longest-running congressional investigation ever. It's cost taxpayers $4 million. And what's it about?"
Most outlets reporting this factoid have measured the length of the Benghazi investigation by how long the select committee has been in existence -- 72 weeks, or roughly 17 months. They note in particular that this is now longer than the Watergate investigation in the 1970s -- that committee existed for about 16 months -- and also longer than probes into Pearl Harbor and Hurricane Katrina. When we contacted the Clinton campaign, they pointed to some of those news reports as evidence.
However, we found numerous examples of congressional committee investigations that have lasted much longer than the Benghazi panel's 17 months. Here are some examples, covering the period from when the investigation was launched to when a final report was issued:
• House Select Committee on Assassinations, 30 months: In September 1976, the House established this committee to investigate the assassinations of President John F. Kennedy and civil rights leader Martin Luther King Jr., as well as the government's response. The committee issued its report January 1979.
• Senate Select Committee on Improper Activities in Labor-Management Relations, 38 months: This committee looked into racketeering in the labor industry from January 1957 to March 1960.
• Joint Committee on the Conduct of the War, 40 months: This committee had a broad charge to investigate the conduct of the Civil War, starting December 1861 and producing a final report May 1865.
• Senate Special Committee to Investigate the National Defense Program, 90 months: This committee examined questions about the awarding of defense contracts during World War II, running from 1941 to 1948. This panel brought national attention to a previously obscure Democratic senator, Harry Truman.
These four investigations were -- like the one on Benghazi -- conducted by a special committee dedicated solely to that investigation.
We found other investigations that also lasted longer than Benghazi but were conducted by permanent committees rather than special panels. For example: The Senate’s permanent government affairs committee spent nearly 30 months investigating the 2007-08 financial crisis. The House ethics committee spent about two years -- from 2008 to 2010 -- looking into allegations of misconduct by Rep. Charles Rangel, D-N.Y. And a former permanent Senate panel, the Committee on Public Lands, spent more than two years, from 1922-24, investigating the infamous Teapot Dome scandal.
The difference between select (or special) committees and permanent committees is important, because the latter have a variety of responsibilities that can affect how long it takes them to finish a single investigation, said Joshua Huder, a senior fellow at Georgetown University’s Government Affairs Institute and an expert in congressional procedure.
There’s also some room for disagreement over when an investigation actually starts and ends, said Douglas Kriner, a Boston University political science professor writing a book on congressional oversight. For example, the 1940s National Defense Program committee investigation could have several possible end dates, including the committee’s official closing in 1948 or the date that its first chair, Truman, was elevated to vice president in 1944.
It’s also worth noting that before the Benghazi committee started the official probe, Congress held a variety of hearings on the attacks. But this is the case for many of these investigations -- and even if you take the questionable step of starting the clock with some of the earlier congressional Benghazi investigations, several probes through history still lasted longer than the ones on Benghazi.
"On most metrics, reasonable people can agree that other investigations have been longer than (Benghazi)," Kriner said.
Our ruling
Clinton’s campaign said the Benghazi probe is "the longest-running congressional investigation ever."
The clearest way to measure this is to look at when a special congressional committee dedicated to a specific investigation officially began and ended. By this measure, this claim is wrong. While the Benghazi investigation has lasted about 17 months, we found other investigations that lasted 30, 40 and even 90 months. And the number of longer investigations only goes up once probes by permanent committees are included. We rate the claim False. | 2023-12-07T01:27:15.642919 | https://example.com/article/4806 |
--- a/Makefile
+++ b/Makefile
@@ -4,7 +4,7 @@
OBJS = main.o copyall.o copy.o screen.o log.o path.o misc.o color.o
all: $(OBJS)
- $(CC) $(CFLAGS) -o vcp $(OBJS) -lcurses
+ $(CC) $(CFLAGS) $(LDFLAGS) -o vcp $(OBJS) $(shell $(PKG_CONFIG) --libs ncurses)
.c.o:
$(CC) $(CFLAGS) -c -I/usr/include/ -o $@ $<
| 2023-09-07T01:27:15.642919 | https://example.com/article/5251 |
Taylor Wimpey
Elite are proud to be contracted to one of the largest homebuilders in the UK, assisting them with providing outstanding customer care repair and remedial service across their central England regions.
Mr & Mrs Mathars - October 2019
"The guys were really helpful & better that I could have asked. They created a detailed report to send back to my house builder & even put their cups in the dishwasher after they had finished which was really thoughtful!"
Ms Thomson - September 2019
"Excellent all round service! Always on time, high standard of work & always clean up afterwards. Very polite & friendly staff. Really really impressed with the service provided."
Mr & Mrs Paskin - August 2019
“Yes we are happy with the door fitted, everything is sorted now.”
Mr Smith - August 2019
“I am very pleased with everything - everything is in & works. The lads cleaned everything once finished and re-installed everything which works perfectly. Wouldn't have known they were there.”
Miss Fowler - August 2019
“I’m happy with the new loft hatch fitted. He was on time, polite & cleaned up once finished - he even cleaned the other rooms that didn't need doing!”
Mr Karim - July 2019
"Your man was fabulous he came along and sorted everything out - and is all still working."
Mr & Mrs Harris - July 2019
"YHappy with the work. Scott was very kind and got everything put in correctly."
Mr Britland - July 2019
"Happy with the works completed. It was great. He was on time, polite and tidied up once finished. "
Mrs Metcalfe - June 2019
"I just wanted to take the opportunity to highlight the very high standards of work and customer service that Elite Maintenance deliver.
I am one of these people that likes everything to be organised, in control of and for my house to be kept clean, but with the prospect of what was to happen caused me a lot of stress and with pregnancy hormones in the mix was not good.
However from the start of the whole process whereby the manager of Elite Maintenance, Carl Burgess, came to my address to assess the works and to explain in full detail of what was to happen. I could not have asked for a better service; I truly couldn’t.
Carl’s professionalism and patience to take the time to explain things in simple terms needs to be recognised.
Also not forgetting the lads that carried out the works - I only got chance to meet Scott Gidman and same again, I cannot speak any more highly of his level of work, customer service that he delivers and not forgetting his patience - nothing was ever too much trouble. He was polite, friendly. made me feel comfortable in my own house and very trustworthy. I usually would not want to leave workmen in my house whilst I wasn’t here but I had no qualms in doing so.
I look at my kitchen now and I really could not be any happier with it and would not have asked for another company to have carried these works out. To the point that I cannot even tell that it’s been changed. I was worried that the small extension of the wall would cause issues but as I said to Scott - I can’t even notice! That in itself speaks highly of the level of works carried out.
Elite Maintenance have completed a small number of jobs now and every time I am 100% happy - from the minute the office call you to book the works in, to the final process of calling you afterwards to check that you are satisfied with everything.
I deal with members of the public in my job and I know that it is very difficult to please people to 100% customer satisfaction - Elite Maintenance have got a great team and do deliver this."
Mr Mitchell - June 2019
“I am happy with everything. They were on time polite and cleaned up once finished.”
Miss Ball - June 2019
“He was really helpful and lovely. He even gave me some paint to do any touchups if my kids get their hand prints on the walls!”
Mrs O'Connor - June 2019
“Happy with the works. The operative was lovely.”
Mr Stephen - June 2019
"I am really happy with Lee's works he did a really good job."
Mr Carr - June 2019
"The operative was perfect."
Mr Yee - June 2019
“We are very happy with the painting of the front door door he did a brilliant job.”
Ms Revell - June 2019
“I am so happy with everything. All is back to normal. It was a pleasure to have James at the property, he was respectful & polite.”
Ms Cachia - June 2019
“Yes I am happy with the adjustments made to my door. Everything was wonderful - he resolved the issue quickly.”
Mr Plum - June 2019
“He was brilliant, turned up 10 mins prior to the appointment, polite & cleaned up once finished.”
Miss Longmore - June 2019
“Happy with the works, the lads were awesome!”
Ms Cefar - June 2019
“Happy with the works completed.”
Mr Fisher - May 2019
“Very happy with the tiling works completed. He was on time, polite & cleaned up once finished.”
Mr Arun - May 2019
“Yes I am happy with the works completed. He was great. On time & cleaned up once finished.”
Mr Oladini - May 2019
“Happy with the works completed.”
Ms Craddock - May 2019
“The guys were really nice, polite & on time.”
Miss Moore - May 2019
“Happy with the works completed. Everything is perfect. He was polite, on time and tidied up once finished.”
Mr Suleman - May 2019
“Chap was good, on time, polite and tidied up once finished - perfect.”
Mr Moore - April 2019
"Oh yes we are happy with the works. He was one of the politest trades I have met. He was lovely, professional and a perfectionist with his work."
Mr & Mrs Naylor - April 2019
"The lads did an amazing job, they were really nice and professional. They did a great job, I came home thinking I would have to clean up and tidy, but the area was lovely. I have had a representative from our house builder over and told them what a great job they did compared to before. Please pass my thanks to your operatives."
Mr Blackburn & Miss Yeomans - April 2019
"Top marks. We are really happy with the works. He went above and beyond."
Ms Lynn - April 2019
"I am happy with the works, he was lovely on time and polite. He even watched the kitten for me."
Mrs Berry - April 2019
"Work was top notch."
Mr Thomas - March 2019
"Yes we are happy with the completed works. He was on time, polite and cleaned up once finished."
Mr Norman - March 2019
"The operative was a polite & friendly man. He cleaned when finished & are happy with the works."
Mrs Morris - March 2019
"He did a superb job. He was polite, on time and cleaned up."
Mrs Metcalfe - March 2019
"We are happy with the works completed. We can now have people in the house without being embarrassed."
Mr & Mrs Williams - January 2019
“We are happy with the works. He was a pleasure to have at the property and was superb and charming.”
Mr Johnson - January 2019
“I am happy with the garage ceiling painting. He was polite and cleaned up once finished.”
Mr & Mrs Treacy - January 2019
“Please pass our compliments to your chap he was good.”
Mrs Waldron - January 2019
“Neil did a god job, he was polite an on time no concerns at all. I am happy with the works completed.”
Mr & Mrs Bedward - January 2019
“He was good, very impressed. Much better than other companies who attended.”
Mr Bulman - January 2019
“He was polite and on time did a good job, everything is fine and dandy.”
Mr Millard - January 2019
“Pleased with the tiling and he left everything clean and tidy afterwards.”
Miss Lole - January 2019
“The lad who fitted the dining room was lovely and professional.”
Mr Laughton & Miss Nicholls - January 2019
“We are happy with the tiling works completed. He was a nice chap and cleaned up once finished.”
Mr Smith - January 2019
“They did a fantastic job and were great.”
Mr & Mrs Fell - January 2019
“Experience was good. the workmen came and did the jobs efficiently.”
Ms Revell - December 2018
"The lads were fabulous, they were lovely in horrid weather conditions and left everything lovely and clean."
Miss Edwards - December 2018
"Yes am very happy with the works, he was polite, on time and sorted the door."
Mr Ryan - December 2018
"Oh yes the pointing completed was great. He was courteous and punctual."
Mr Greenfield - December 2018
"The operatives and the man who did the nail pops were good."
Mr Ghinet - December 2018
"Yes we are happy with the works. He was tidy and polite, all perfect."
Mr Turvey - December 2018
"I'm happy with the works completed, they are good. Your operatives turned up on time and left everything clean and tidy."
Mrs Wormstone - November 2018
"I just wanted to say that I was very impressed with the work carried out and how the maintenance men you sent cleaned up after each job.
In particular Jamie was efficient, well mannered and hard working. I will also say I am impressed with the efficiency and consideration I have had from Paige (Customer Care Administrator)."
Mr Davis - November 2018
"We are happy with the works. Your operative was polite, on time and cleaned up when finished."
Ms Walsh - November 2018
"I just wanted to say how pleased we are with the chap who has turned up today, he is so polite and has been moving from one job to the next. The ladies on site have come to me to say how polite he is. Many thanks."
Mrs McClelland - October 2018
"I would just like to inform you of the extremely professional service I received today from Neil, the gentleman who attended my property to fix the creaking floors boards.
He completed a thorough and careful job, and was happy to answer any questions I might have in a pleasant and jovial manner and left my property as he found it.
I do believe we live in a society where people too readily complain, but forget to accolade. Please ensure my sentiments are passed on to his senior management team."
Mr Williamson - October 2018
"I am happy, they went above and beyond, were on time and even vacuumed up after they had finished."
Mr Stafford - October 2018
"The young lads who attend were amazing. They were polite, friendly and got on with everything."
Mrs Beeby - October 2018
"We are happy with the works completed. I have no complaint where the lads are concerned - they we lovely, polite and cleaned up."
Mr Braimbridge - October 2018
"Happy with the work. We were told he would arrive between 08:00 -08:30 and he turned up at 8 am on the dot. He was very polite and cleaned and tidied up afterward."
Mrs Lovatt - October 2018
"Happy with the new door. the operative was polite and courteous."
Mr Brotheridge - October 2018
"He was a good bloke, he was on time and cleaned up when finished."
Mr Yardley - August 2018
"He is a good chap, we are happy with the decorating works. He turned up on time and left the property clean and tidy."
Mr Parker - July 2018
“Hi I would like to provide some positive feedback regarding one of your technicians - Rob Lewtas.
Rob called at our house last Friday (13th July) on behalf of Taylor Wimpey to fix some snagging issues. Rob was excellent during his visit. He did everything to a high standard and explained to me what he was going to do and why - he took his time and didn't rush.
He was polite and respectful and was also able to provide some valuable advice on other matters as well. He is a credit to your company. I would appreciate if this could be passed on to his management team.
Many thanks.”
Mr Robert & Mrs Levin - May 2018
"The operative was amazing."
Mr Davis - May 2018
"I am extremely happy with the works that were completed."
Mr Davidson-Potter - May 2018
"I am happy with the works. The operative was perfect."
Mr Williams & Miss Stanyer - May 2018
"I am pleased with all the works. The operative was early and ready to go from arrival."
Mr Allen - May 2018
"I am pleased with the works the operative completed."
Mr Heaney - May 2018
"I just want to say how professional and polite Lee and Santino were. I was very impressed."
Mr Roberts - April 2018
"I just wanted to drop you an email to pass on my thanks for the work carried out at my home over the last three days. In particular I want to mention Reece and Bjorn who have been here for the last two days & have worked through their lunch today to complete everything. Their work is flawless.
All members of team were highly professional, the work has been carried out to a very high standard and is exactly what I was hoping for."
Mrs Giles - April 2018
"Good Morning,
I am just writing to compliment the work carried out at my home on Friday by Santino Crescenzo and Adam Stone.
It is very refreshing to have someone polite, happy, who takes pride in their work and also goes above and beyond what they have been asked to do.
Nothing was too much trouble and all work carried out was absolutely perfect.
We are very happy thank you both for all your hard work on Friday!
We have had other Elite staff here before and all other staff were also very friendly and work carried out was to high standards.
Speaks volumes as a company for Elite as i feel we would highly recommended Elite to others in the future.
Thank you again."
Mr Hayward and Miss Seafield - February 2018
"Ashley is a lovely guy who did an excellent job, very pleased to say the least."
Mr Ridley - February 2018
"Elite were brilliant, the operatives were polite and I am happy with the service that was provided."
Mr Matthews - February 2018
"Really happy, Santino is a great guy and did a really good job."
Mr Saggu - February 2018
"Pleased with the works, thanks for everything."
Ms Law - February 2018
"Very good. Very happy with the work!"
Mr Jackson - February 2018
"Everything was completed to a good standard, very happy."
Mr Moore - February 2018
"Could not be more impressed with the works Russell did - he went over and beyond."
Miss Aucott - January 2018
"Jason did a fantastic job, very pleased with everything."
Mrs Gruber - November 2017
"Ian did a good job - work looks great."
Mr Hayles - July 2017
"The guy did a great job, looks brilliant and if anything its tidier after he left!"
Mr Wahiwala - June 2017
"He’s done a great job it looks lovely, not left a single bit of mess and I am very happy with it."
Our Accreditations
Our Clients
Kendrick Homes
"Everything thing was fine, Elite sent a great contractor - his remediation work was really good and he left everywhere spotless." | 2023-12-04T01:27:15.642919 | https://example.com/article/9459 |
[Monitoring and oxygen therapy during gastrointestinal endoscopy].
Gastroenterological Societies in Britain and USA have published recommendations for sedation, monitoring and oxygen therapy during gastrointestinal endoscopy. No scientific basis for the introduction of recommendations such as these is, however, present as it has not yet been proved that hypoxaemia is responsible for morbidity and mortality on gastrointestinal endoscopy. The pathogenesis of the development of myocardial ischaemia during gastrointestinal endoscopy is considered by many to be the simultaneous arterial hypoxaemia but recent investigations suggest that tachycardia is a more important factor. The scientific data available at present in this field is not conclusive. Introduction of recommendations for monitoring and oxygen therapy during gastrointestinal endoscopy in Denmark should be delayed until elucidation of the mechanisms involved has been undertaken. | 2024-01-11T01:27:15.642919 | https://example.com/article/7075 |
Importance of Getting the Best CBD Shop for Your Supplies
Having the best of health is a practice that you can add to be part of your life today. The use of the right substances is what you will need to consider your overall health. You should know that getting the pain away, stress and the other issues that might come from the same will be a big way to avoid some problems that life will bring at your side. Be excited to our most important info about cbd oil.
It is essential to know that the use of the perfect alternatives for regular medicines will also be a good thing to consider. It will be a crucial thing if you will be able to have the best remedies that you can use for your health issues. One of the best items that you can use in the world of today is the CBD. It is essential to grasp some ideas that the use of the CBD is acting as one of the perfect alternatives for most of the drugs and medication that most of the people have to use.
It is a perfect remedy for most of the ailments that would take a lot of drugs combination and prescriptions from the medical centers today. There are different ailments and the condition that the use of the CBD can help in today. Also, the use of the CBD hemp products is legal and readily available to all of the states in the country. If you are interested in cbd oil products, please click here.
All that you will need to consider is the perfect kind of the shop that will have the right legalization for the ideal sale of the CBD today. Thus, you should do a reasonable search for easy knowing of the place that you will be able to help with the needs that you have. You should know that with the many benefits that the CBD offers it will be something worth your time and health. So, finding a great shop such as MRJ Wellness will have the following gains at your side. Seek more info about cbd oil https://simple.wikipedia.org/wiki/CBD_oil_Cannabidiol.
One of the gains that the shop will offer is access to the CBD products of your choice. You need to have the right CBD items that will be able to take care of your issues in an effective manner. A good store will offer quality and not quantity. You will be sure of proper sourcing of the hemp CBD from registered farmers in the country today. Moreover, the price will be an eye-opener with the perfect store as it will bring the most competitive in the market. If you want to keep your health in check, then it will be time to consider CBD products today. | 2023-11-03T01:27:15.642919 | https://example.com/article/3578 |
Cessationism and Charismaticism
Jollyblogger is as much a hero to me in the blogdom as C.J.Mahaney is as a preacher! He is much wiser than I am, much more measured in his comments, and brings out the best in me. It is fantastic to have a great conversation going on between two very different schools of Christian thought – even if on most points he and I would definitely agree!
At risk of boring some of you, I intend to carry this on in our fast becoming inimitable style- measured, relaxed, often with a day or two in between posts to allow for time to reflect, and with liberal smatterings of kindness to one another. This is still a place for godly debate in Christian circles!!!
What I also love about this is it is an example of people from rather different backgrounds moving closer together, and approaching the truth from different vantage points.
There is no doubt that we have clearly demonstrated two things, just in the nature of this conversation. Firstly not every cessationist denies the validity of any experience of God. Secondly not every charismatic denies the primacy of biblical authority over subjective impressions.
What I mean by that is, people can believe that the gifts of the Holy Spirit have stopped, but still either long for or actively experience the presense and power of the God who acts. People who claim to experience the gifts of the Holy Spirit can also be bible scholars.
So yes, there is much agreement. Agreement that Spurgeon is an amazing character, and recognition that “if Spurgeon was a Cessationist he was far more open to supernatural manifestations than are the cessationists of today are.”
But perhaps where I might differ from Jollyblogger is that I would advocate the seeking after an experience of the supernatural God.
To quote the Doctor again “We must not be content until we have had some manifestation of the activity of God. We must concentrate on this. This is my plea, that we concentrate on this, because it is the great message of the Bible……. Let us put it like this: Do we really believe that God can still act? That is the question; that is the ultimate challenge. Or have we, for theological or some other reasons, excluded the very possibility?”
You see, I would advocate the need to consciously receive the Holy Spirit, and whether the cessationist Matthew Henry means quite the same thing as this or not when he says “many are deceived in this matter, thinking they have received the Holy Ghost when really they have not.”, the sentiment is clearly there.
It is as we know the communion of the Holy Spirit that our Christian lives can be transformed. Right now, I feel that there are many in the church- myself included- who could use some more of the Holy Spirit. In fact who couldnt? Please pray for me that I might be full of the Holy Spirit.
“We need to ask ourselves, first, what does it mean to say that ‘God speaks today’? Keeping in mind the traditional meaning that ‘God speaks today through the Bible,’ the phrase has come to be used in two other senses. For some, the words ‘God speaks today’ are simply a popular, if misleading, way of describing the fact that God guides and directs His people by His Spirit in the application of His written word through promptings, impressions, insights, and the like. Most non-Pentecostals and noncharismatics have explained these (more or less) intuitive experiences in terms of the Spirit’s works of illumination, leading, and conviction. A few would even acknowledge that, among those who fit a given psycho-spiritual profile, these experiences might be accompanied by things seen or heard. All of these experiences are, however, carefully distinguished from the Spirit’s work of revelation.6 Hence, though the Spirit’s illumination and guidance may sometimes focus on phenomena such as promptings or impressions, those phenomena are not specifically interpreted as involving the biblical ministry-gifts of revelation, such as prophecy and tongues or their correlates (e.g., visions, dreams, auditions).”
Now this seems to me to be having your cake and eating it! Either God doesnt speak today at all, or he can speak through impressions which are equivalent to the New Testament gifts. What exactly is this third way that is being suggested? I velieve that what is happening here is that people are nervous of identifying fallible modern impressions with those that we are assuming are infallible in Scripture.
In the article that Dave recommends (Which I have in libronix form) in the Journal of Evangelical Theology, (39/1) of March 1996, by Vern Poythress of Westminster Seminary, called Modern Spiritual Gifts As Analogous To Apostolic Gifts: Affirming Extraordinary Works Of The Spirit Within Cessationist Theology, Vern Poythress is clearer in what he is saying.
I maintain that modern spiritual gifts are analogous to but not identical with the divinely authoritative gifts exercised by the apostles. Since there is no strict identity, apostolic teaching and the Biblical canon have exclusive divine authority. On the other hand, since there is analogy, modern spiritual gifts are still genuine and useful to the Church. Hence there is a middle way between blanket approval and blanket rejection of modern charismatic gifts.
But I dont believe that New Testament gifts were always authoritive, nor do I believe that they were only excercised by the apostles. 1 Corinthians is proof enough of both ascertions!
A fundemental question for me which cuts right to the heart of this issue is ‘When were biblical apostles and prophets infallible?’ Was it only when writing scripture or was it at all times? Well clearly the apostles made mistakes- they are documented in the bible. I also remain unconvinced that Agabus prophecy about Pauls capture was 100% accurate in all its detail- and certainly the application sought by many ‘Don’t go’ was not correct!
Lets put my question another way. Suppose we could identify a letter from Paul to one of the churches that had been lost since biblical times. Suppose we could prove 100% that it was from him. Would we add it to the bible? Would we treat it as authoritive? Or would we see it as an interesting example of literature that might illumine the rest of the bible, but is clearly not inspired or else it would have been in the bible. Could it have contained a mistake and therefore God arranged for it to be lost? I think our answer to a question like this reveals much about our attitude to apostles in the bible.
Dare I say it I dont believe that apostles were always infallible- only when writing scripture. Thus it is entirely plausible for me that ministry gifts and even the offices of apostle and prophet could exist today in a fallible way. I believe that we should not make biblical gifts into something they were not intended to be.
And Dave, let me say, I dont blame you for wheeling out the dodgy examples of charismatic folly- I could share loads! But what I would say is lets be careful not to advocate not using real money just because we found a few counterfeit notes.
I would argue that the apostles, prophets and others mentioned in Ephesians 4 are all ongoing fallable gifts given to the church throughout all ages UNTIL we are all perfect and mature. Since we havent got there yet, they must continue. Actually I am not convinced even that Ephesians 2 is talking about something that happened in the past to all the church- what is true of The Church as a whole is usually true of local expressions of it in my view.
Matthew Henry in my view clearly fudges this issue, but does so in a most illumining way. He is quite clear that in his view some of the Eph 4 gifts continue to today. But who is to read into Eph 4 which of them continue and which stop? And just where in the passage does this idea of some of these gifts stopping come from? To me Eph 4 is quite clear if read without our traditional spectacles on, all of these gifts are there for all of our good for all time in the church.
I do believe we need to see more of the gifts that God gives us, and more of the filling of the Holy Spirit in this day. Why not pray now for an outpouring of God’s Spirit on his church at this time! | 2023-11-20T01:27:15.642919 | https://example.com/article/4506 |
// Copyright (c) 2012 The Chromium Authors. All rights reserved.
// Use of this source code is governed by a BSD-style license that can be
// found in the LICENSE file.
#include "chrome/browser/extensions/api/declarative/url_matcher.h"
#include "base/string_util.h"
#include "googleurl/src/gurl.h"
#include "testing/gtest/include/gtest/gtest.h"
namespace extensions {
//
// URLMatcherCondition
//
TEST(URLMatcherConditionTest, Constructors) {
SubstringPattern pattern("example.com", 1);
URLMatcherCondition m1(URLMatcherCondition::HOST_SUFFIX, &pattern);
EXPECT_EQ(URLMatcherCondition::HOST_SUFFIX, m1.criterion());
EXPECT_EQ(&pattern, m1.substring_pattern());
URLMatcherCondition m2;
m2 = m1;
EXPECT_EQ(URLMatcherCondition::HOST_SUFFIX, m2.criterion());
EXPECT_EQ(&pattern, m2.substring_pattern());
URLMatcherCondition m3(m1);
EXPECT_EQ(URLMatcherCondition::HOST_SUFFIX, m3.criterion());
EXPECT_EQ(&pattern, m3.substring_pattern());
}
TEST(URLMatcherSchemeFilter, TestMatching) {
URLMatcherSchemeFilter filter1("https");
std::vector<std::string> filter2_content;
filter2_content.push_back("http");
filter2_content.push_back("https");
URLMatcherSchemeFilter filter2(filter2_content);
GURL matching_url("https://www.foobar.com");
GURL non_matching_url("http://www.foobar.com");
EXPECT_TRUE(filter1.IsMatch(matching_url));
EXPECT_FALSE(filter1.IsMatch(non_matching_url));
EXPECT_TRUE(filter2.IsMatch(matching_url));
EXPECT_TRUE(filter2.IsMatch(non_matching_url));
}
TEST(URLMatcherPortFilter, TestMatching) {
std::vector<URLMatcherPortFilter::Range> ranges;
ranges.push_back(URLMatcherPortFilter::CreateRange(80, 90));
ranges.push_back(URLMatcherPortFilter::CreateRange(8080));
URLMatcherPortFilter filter(ranges);
EXPECT_TRUE(filter.IsMatch(GURL("http://www.example.com")));
EXPECT_TRUE(filter.IsMatch(GURL("http://www.example.com:80")));
EXPECT_TRUE(filter.IsMatch(GURL("http://www.example.com:81")));
EXPECT_TRUE(filter.IsMatch(GURL("http://www.example.com:90")));
EXPECT_TRUE(filter.IsMatch(GURL("http://www.example.com:8080")));
EXPECT_FALSE(filter.IsMatch(GURL("http://www.example.com:79")));
EXPECT_FALSE(filter.IsMatch(GURL("http://www.example.com:91")));
EXPECT_FALSE(filter.IsMatch(GURL("https://www.example.com")));
}
TEST(URLMatcherConditionTest, IsFullURLCondition) {
SubstringPattern pattern("example.com", 1);
EXPECT_FALSE(URLMatcherCondition(URLMatcherCondition::HOST_SUFFIX,
&pattern).IsFullURLCondition());
EXPECT_TRUE(URLMatcherCondition(URLMatcherCondition::HOST_CONTAINS,
&pattern).IsFullURLCondition());
EXPECT_TRUE(URLMatcherCondition(URLMatcherCondition::PATH_CONTAINS,
&pattern).IsFullURLCondition());
EXPECT_TRUE(URLMatcherCondition(URLMatcherCondition::QUERY_CONTAINS,
&pattern).IsFullURLCondition());
EXPECT_TRUE(URLMatcherCondition(URLMatcherCondition::URL_PREFIX,
&pattern).IsFullURLCondition());
EXPECT_TRUE(URLMatcherCondition(URLMatcherCondition::URL_SUFFIX,
&pattern).IsFullURLCondition());
EXPECT_TRUE(URLMatcherCondition(URLMatcherCondition::URL_CONTAINS,
&pattern).IsFullURLCondition());
EXPECT_TRUE(URLMatcherCondition(URLMatcherCondition::URL_EQUALS,
&pattern).IsFullURLCondition());
}
TEST(URLMatcherConditionTest, IsMatch) {
GURL url1("http://www.example.com/www.foobar.com/index.html");
GURL url2("http://www.foobar.com/example.com/index.html");
SubstringPattern pattern("example.com", 1);
URLMatcherCondition m1(URLMatcherCondition::HOST_SUFFIX, &pattern);
std::set<SubstringPattern::ID> matching_substring_patterns;
// matches = {0} --> matcher did not indicate that m1 was a match.
matching_substring_patterns.insert(0);
EXPECT_FALSE(m1.IsMatch(matching_substring_patterns, url1));
// matches = {0, 1} --> matcher did indicate that m1 was a match.
matching_substring_patterns.insert(1);
EXPECT_TRUE(m1.IsMatch(matching_substring_patterns, url1));
// For m2 we use a HOST_CONTAINS test, which requires a post-validation
// whether the match reported by the SubstringSetMatcher occurs really
// in the correct url component.
URLMatcherCondition m2(URLMatcherCondition::HOST_CONTAINS, &pattern);
EXPECT_TRUE(m2.IsMatch(matching_substring_patterns, url1));
EXPECT_FALSE(m2.IsMatch(matching_substring_patterns, url2));
}
TEST(URLMatcherConditionTest, Comparison) {
SubstringPattern p1("foobar.com", 1);
SubstringPattern p2("foobar.com", 2);
// The first component of each test is expected to be < than the second.
URLMatcherCondition test_smaller[][2] = {
{URLMatcherCondition(URLMatcherCondition::HOST_PREFIX, &p1),
URLMatcherCondition(URLMatcherCondition::HOST_SUFFIX, &p1)},
{URLMatcherCondition(URLMatcherCondition::HOST_PREFIX, &p1),
URLMatcherCondition(URLMatcherCondition::HOST_PREFIX, &p2)},
{URLMatcherCondition(URLMatcherCondition::HOST_PREFIX, NULL),
URLMatcherCondition(URLMatcherCondition::HOST_PREFIX, &p2)},
{URLMatcherCondition(URLMatcherCondition::HOST_PREFIX, &p1),
URLMatcherCondition(URLMatcherCondition::HOST_SUFFIX, NULL)},
};
for (size_t i = 0; i < arraysize(test_smaller); ++i) {
EXPECT_TRUE(test_smaller[i][0] < test_smaller[i][1])
<< "Test " << i << " of test_smaller failed";
EXPECT_FALSE(test_smaller[i][1] < test_smaller[i][0])
<< "Test " << i << " of test_smaller failed";
}
URLMatcherCondition test_equal[][2] = {
{URLMatcherCondition(URLMatcherCondition::HOST_PREFIX, &p1),
URLMatcherCondition(URLMatcherCondition::HOST_PREFIX, &p1)},
{URLMatcherCondition(URLMatcherCondition::HOST_PREFIX, NULL),
URLMatcherCondition(URLMatcherCondition::HOST_PREFIX, NULL)},
};
for (size_t i = 0; i < arraysize(test_equal); ++i) {
EXPECT_FALSE(test_equal[i][0] < test_equal[i][1])
<< "Test " << i << " of test_equal failed";
EXPECT_FALSE(test_equal[i][1] < test_equal[i][0])
<< "Test " << i << " of test_equal failed";
}
}
//
// URLMatcherConditionFactory
//
namespace {
bool Matches(const URLMatcherCondition& condition, std::string text) {
return text.find(condition.substring_pattern()->pattern()) !=
std::string::npos;
}
} // namespace
TEST(URLMatcherConditionFactoryTest, GURLCharacterSet) {
// GURL guarantees that neither domain, nor path, nor query may contain
// non ASCII-7 characters. We test this here, because a change to this
// guarantee breaks this implementation horribly.
GURL url("http://www.föö.com/föö?föö#föö");
EXPECT_TRUE(IsStringASCII(url.host()));
EXPECT_TRUE(IsStringASCII(url.path()));
EXPECT_TRUE(IsStringASCII(url.query()));
EXPECT_FALSE(IsStringASCII(url.ref()));
}
TEST(URLMatcherConditionFactoryTest, TestSingletonProperty) {
URLMatcherConditionFactory factory;
URLMatcherCondition c1 = factory.CreateHostEqualsCondition("www.google.com");
URLMatcherCondition c2 = factory.CreateHostEqualsCondition("www.google.com");
EXPECT_EQ(c1.criterion(), c2.criterion());
EXPECT_EQ(c1.substring_pattern(), c2.substring_pattern());
URLMatcherCondition c3 = factory.CreateHostEqualsCondition("www.google.de");
EXPECT_EQ(c2.criterion(), c3.criterion());
EXPECT_NE(c2.substring_pattern(), c3.substring_pattern());
EXPECT_NE(c2.substring_pattern()->id(), c3.substring_pattern()->id());
EXPECT_NE(c2.substring_pattern()->pattern(),
c3.substring_pattern()->pattern());
// Check that all SubstringPattern singletons are freed if we call
// ForgetUnusedPatterns.
SubstringPattern::ID old_id_1 = c1.substring_pattern()->id();
factory.ForgetUnusedPatterns(std::set<SubstringPattern::ID>());
EXPECT_TRUE(factory.IsEmpty());
URLMatcherCondition c4 = factory.CreateHostEqualsCondition("www.google.com");
EXPECT_NE(old_id_1, c4.substring_pattern()->id());
}
TEST(URLMatcherConditionFactoryTest, TestComponentSearches) {
GURL gurl("https://www.google.com/webhp?sourceid=chrome-instant&ie=UTF-8"
"&ion=1#hl=en&output=search&sclient=psy-ab&q=chrome%20is%20awesome");
URLMatcherConditionFactory factory;
std::string url = factory.CanonicalizeURLForComponentSearches(gurl);
// Test host component.
EXPECT_TRUE(Matches(factory.CreateHostPrefixCondition(""), url));
EXPECT_TRUE(Matches(factory.CreateHostPrefixCondition("www.goog"), url));
EXPECT_TRUE(
Matches(factory.CreateHostPrefixCondition("www.google.com"), url));
EXPECT_TRUE(
Matches(factory.CreateHostPrefixCondition(".www.google.com"), url));
EXPECT_FALSE(Matches(factory.CreateHostPrefixCondition("google.com"), url));
EXPECT_FALSE(
Matches(factory.CreateHostPrefixCondition("www.google.com/"), url));
EXPECT_FALSE(Matches(factory.CreateHostPrefixCondition("webhp"), url));
EXPECT_TRUE(Matches(factory.CreateHostSuffixCondition(""), url));
EXPECT_TRUE(Matches(factory.CreateHostSuffixCondition("com"), url));
EXPECT_TRUE(Matches(factory.CreateHostSuffixCondition(".com"), url));
EXPECT_TRUE(
Matches(factory.CreateHostSuffixCondition("www.google.com"), url));
EXPECT_TRUE(
Matches(factory.CreateHostSuffixCondition(".www.google.com"), url));
EXPECT_FALSE(Matches(factory.CreateHostSuffixCondition("www"), url));
EXPECT_FALSE(
Matches(factory.CreateHostSuffixCondition("www.google.com/"), url));
EXPECT_FALSE(Matches(factory.CreateHostSuffixCondition("webhp"), url));
EXPECT_FALSE(Matches(factory.CreateHostEqualsCondition(""), url));
EXPECT_FALSE(Matches(factory.CreateHostEqualsCondition("www"), url));
EXPECT_TRUE(
Matches(factory.CreateHostEqualsCondition("www.google.com"), url));
EXPECT_FALSE(
Matches(factory.CreateHostEqualsCondition("www.google.com/"), url));
// Test path component.
EXPECT_TRUE(Matches(factory.CreatePathPrefixCondition(""), url));
EXPECT_TRUE(Matches(factory.CreatePathPrefixCondition("/web"), url));
EXPECT_TRUE(Matches(factory.CreatePathPrefixCondition("/webhp"), url));
EXPECT_FALSE(Matches(factory.CreatePathPrefixCondition("webhp"), url));
EXPECT_FALSE(Matches(factory.CreatePathPrefixCondition("/webhp?"), url));
EXPECT_TRUE(Matches(factory.CreatePathSuffixCondition(""), url));
EXPECT_TRUE(Matches(factory.CreatePathSuffixCondition("webhp"), url));
EXPECT_TRUE(Matches(factory.CreatePathSuffixCondition("/webhp"), url));
EXPECT_FALSE(Matches(factory.CreatePathSuffixCondition("/web"), url));
EXPECT_FALSE(Matches(factory.CreatePathSuffixCondition("/webhp?"), url));
EXPECT_TRUE(Matches(factory.CreatePathEqualsCondition("/webhp"), url));
EXPECT_FALSE(Matches(factory.CreatePathEqualsCondition("webhp"), url));
EXPECT_FALSE(Matches(factory.CreatePathEqualsCondition("/webhp?"), url));
EXPECT_FALSE(
Matches(factory.CreatePathEqualsCondition("www.google.com"), url));
// Test query component.
EXPECT_TRUE(Matches(factory.CreateQueryPrefixCondition(""), url));
EXPECT_TRUE(Matches(factory.CreateQueryPrefixCondition("?sourceid"), url));
EXPECT_FALSE(Matches(factory.CreatePathPrefixCondition("sourceid"), url));
EXPECT_TRUE(Matches(factory.CreateQuerySuffixCondition(""), url));
EXPECT_TRUE(Matches(factory.CreateQuerySuffixCondition("ion=1"), url));
EXPECT_FALSE(Matches(factory.CreatePathPrefixCondition("?sourceid"), url));
EXPECT_FALSE(Matches(factory.CreateQuerySuffixCondition("www"), url));
EXPECT_TRUE(Matches(factory.CreateQueryEqualsCondition(
"?sourceid=chrome-instant&ie=UTF-8&ion=1"), url));
EXPECT_FALSE(Matches(factory.CreateQueryEqualsCondition(
"sourceid=chrome-instant&ie=UTF-8&ion="), url));
EXPECT_FALSE(
Matches(factory.CreateQueryEqualsCondition("www.google.com"), url));
// Test adjacent components
EXPECT_TRUE(Matches(factory.CreateHostSuffixPathPrefixCondition(
"google.com", "/webhp"), url));
EXPECT_TRUE(Matches(factory.CreateHostSuffixPathPrefixCondition(
"", "/webhp"), url));
EXPECT_TRUE(Matches(factory.CreateHostSuffixPathPrefixCondition(
"google.com", ""), url));
EXPECT_FALSE(Matches(factory.CreateHostSuffixPathPrefixCondition(
"www", ""), url));
}
TEST(URLMatcherConditionFactoryTest, TestFullSearches) {
GURL gurl("https://www.google.com/webhp?sourceid=chrome-instant&ie=UTF-8"
"&ion=1#hl=en&output=search&sclient=psy-ab&q=chrome%20is%20awesome");
URLMatcherConditionFactory factory;
std::string url = factory.CanonicalizeURLForFullSearches(gurl);
EXPECT_TRUE(Matches(factory.CreateURLPrefixCondition(""), url));
EXPECT_TRUE(Matches(factory.CreateURLPrefixCondition("www.goog"), url));
EXPECT_TRUE(Matches(factory.CreateURLPrefixCondition("www.google.com"), url));
EXPECT_TRUE(
Matches(factory.CreateURLPrefixCondition(".www.google.com"), url));
EXPECT_TRUE(
Matches(factory.CreateURLPrefixCondition("www.google.com/"), url));
EXPECT_FALSE(Matches(factory.CreateURLPrefixCondition("webhp"), url));
EXPECT_TRUE(Matches(factory.CreateURLSuffixCondition(""), url));
EXPECT_TRUE(Matches(factory.CreateURLSuffixCondition("ion=1"), url));
EXPECT_FALSE(Matches(factory.CreateURLSuffixCondition("www"), url));
EXPECT_TRUE(Matches(factory.CreateURLContainsCondition(""), url));
EXPECT_TRUE(Matches(factory.CreateURLContainsCondition("www.goog"), url));
EXPECT_TRUE(Matches(factory.CreateURLContainsCondition(".www.goog"), url));
EXPECT_TRUE(Matches(factory.CreateURLContainsCondition("webhp"), url));
EXPECT_TRUE(Matches(factory.CreateURLContainsCondition("?"), url));
EXPECT_TRUE(Matches(factory.CreateURLContainsCondition("sourceid"), url));
EXPECT_TRUE(Matches(factory.CreateURLContainsCondition("ion=1"), url));
EXPECT_FALSE(Matches(factory.CreateURLContainsCondition("foobar"), url));
EXPECT_FALSE(Matches(factory.CreateURLContainsCondition("search"), url));
EXPECT_TRUE(Matches(factory.CreateURLEqualsCondition(
"www.google.com/webhp?sourceid=chrome-instant&ie=UTF-8&ion=1"), url));
EXPECT_FALSE(
Matches(factory.CreateURLEqualsCondition("www.google.com"), url));
}
//
// URLMatcherConditionSet
//
TEST(URLMatcherConditionSetTest, Constructor) {
URLMatcherConditionFactory factory;
URLMatcherCondition m1 = factory.CreateHostSuffixCondition("example.com");
URLMatcherCondition m2 = factory.CreatePathContainsCondition("foo");
std::set<URLMatcherCondition> conditions;
conditions.insert(m1);
conditions.insert(m2);
scoped_refptr<URLMatcherConditionSet> condition_set(
new URLMatcherConditionSet(1, conditions));
EXPECT_EQ(1, condition_set->id());
EXPECT_EQ(2u, condition_set->conditions().size());
}
TEST(URLMatcherConditionSetTest, Matching) {
GURL url1("http://www.example.com/foo?bar=1");
GURL url2("http://foo.example.com/index.html");
GURL url3("http://www.example.com:80/foo?bar=1");
GURL url4("http://www.example.com:8080/foo?bar=1");
URLMatcherConditionFactory factory;
URLMatcherCondition m1 = factory.CreateHostSuffixCondition("example.com");
URLMatcherCondition m2 = factory.CreatePathContainsCondition("foo");
std::set<URLMatcherCondition> conditions;
conditions.insert(m1);
conditions.insert(m2);
scoped_refptr<URLMatcherConditionSet> condition_set(
new URLMatcherConditionSet(1, conditions));
EXPECT_EQ(1, condition_set->id());
EXPECT_EQ(2u, condition_set->conditions().size());
std::set<SubstringPattern::ID> matching_substring_patterns;
matching_substring_patterns.insert(m1.substring_pattern()->id());
EXPECT_FALSE(condition_set->IsMatch(matching_substring_patterns, url1));
matching_substring_patterns.insert(m2.substring_pattern()->id());
EXPECT_TRUE(condition_set->IsMatch(matching_substring_patterns, url1));
EXPECT_FALSE(condition_set->IsMatch(matching_substring_patterns, url2));
// Test scheme filters.
scoped_refptr<URLMatcherConditionSet> condition_set2(
new URLMatcherConditionSet(1, conditions,
scoped_ptr<URLMatcherSchemeFilter>(
new URLMatcherSchemeFilter("https")),
scoped_ptr<URLMatcherPortFilter>(NULL)));
EXPECT_FALSE(condition_set2->IsMatch(matching_substring_patterns, url1));
scoped_refptr<URLMatcherConditionSet> condition_set3(
new URLMatcherConditionSet(1, conditions,
scoped_ptr<URLMatcherSchemeFilter>(
new URLMatcherSchemeFilter("http")),
scoped_ptr<URLMatcherPortFilter>(NULL)));
EXPECT_TRUE(condition_set3->IsMatch(matching_substring_patterns, url1));
// Test port filters.
std::vector<URLMatcherPortFilter::Range> ranges;
ranges.push_back(URLMatcherPortFilter::CreateRange(80));
scoped_ptr<URLMatcherPortFilter> filter(new URLMatcherPortFilter(ranges));
scoped_refptr<URLMatcherConditionSet> condition_set4(
new URLMatcherConditionSet(1, conditions,
scoped_ptr<URLMatcherSchemeFilter>(NULL), filter.Pass()));
EXPECT_TRUE(condition_set4->IsMatch(matching_substring_patterns, url1));
EXPECT_TRUE(condition_set4->IsMatch(matching_substring_patterns, url3));
EXPECT_FALSE(condition_set4->IsMatch(matching_substring_patterns, url4));
}
//
// URLMatcher
//
TEST(URLMatcherTest, FullTest) {
GURL url1("http://www.example.com/foo?bar=1");
GURL url2("http://foo.example.com/index.html");
URLMatcher matcher;
URLMatcherConditionFactory* factory = matcher.condition_factory();
// First insert.
URLMatcherConditionSet::Conditions conditions1;
conditions1.insert(factory->CreateHostSuffixCondition("example.com"));
conditions1.insert(factory->CreatePathContainsCondition("foo"));
const int kConditionSetId1 = 1;
URLMatcherConditionSet::Vector insert1;
insert1.push_back(make_scoped_refptr(
new URLMatcherConditionSet(kConditionSetId1, conditions1)));
matcher.AddConditionSets(insert1);
EXPECT_EQ(1u, matcher.MatchURL(url1).size());
EXPECT_EQ(0u, matcher.MatchURL(url2).size());
// Second insert.
URLMatcherConditionSet::Conditions conditions2;
conditions2.insert(factory->CreateHostSuffixCondition("example.com"));
const int kConditionSetId2 = 2;
URLMatcherConditionSet::Vector insert2;
insert2.push_back(make_scoped_refptr(
new URLMatcherConditionSet(kConditionSetId2, conditions2)));
matcher.AddConditionSets(insert2);
EXPECT_EQ(2u, matcher.MatchURL(url1).size());
EXPECT_EQ(1u, matcher.MatchURL(url2).size());
// This should be the cached singleton.
int patternId1 = factory->CreateHostSuffixCondition(
"example.com").substring_pattern()->id();
// Removal of last insert.
std::vector<URLMatcherConditionSet::ID> remove2;
remove2.push_back(kConditionSetId2);
matcher.RemoveConditionSets(remove2);
EXPECT_EQ(1u, matcher.MatchURL(url1).size());
EXPECT_EQ(0u, matcher.MatchURL(url2).size());
// Removal of first insert.
std::vector<URLMatcherConditionSet::ID> remove1;
remove1.push_back(kConditionSetId1);
matcher.RemoveConditionSets(remove1);
EXPECT_EQ(0u, matcher.MatchURL(url1).size());
EXPECT_EQ(0u, matcher.MatchURL(url2).size());
EXPECT_TRUE(matcher.IsEmpty());
// The cached singleton in matcher.condition_factory_ should be destroyed to
// free memory.
int patternId2 = factory->CreateHostSuffixCondition(
"example.com").substring_pattern()->id();
// If patternId1 and patternId2 are different that indicates that
// matcher.condition_factory_ does not leak memory.
EXPECT_NE(patternId1, patternId2);
}
} // namespace extensions
| 2024-07-25T01:27:15.642919 | https://example.com/article/1798 |
Q:
Why is NHibernate generating schema with the class name as a column?
I'm trying to generate my database from classes using NHibernate, but the schema that's being created contains a column for the class. For the most part this wouldn't matter but one class in particular is causing this to fail... my Order class (because order is a reserved keyword in SQL - yes maybe I should have used a word that wasn't a keyword but that's another issue)
The following mapping file:
<?xml version="1.0" encoding="utf-8" ?>
<class name="Order" table="Orders">
<id name="_persistenceID" column="ID" type="Guid" access="field" unsaved-value="00000000-0000-0000-0000-000000000000">
<generator class="guid.comb" />
</id>
<version name="_persistenceVersion" column="Version" access="field" type="int" unsaved-value="0" />
<property name="DateDeleted" column="DateDeleted" type="DateTime" />
<property name="ChangeReason" column="ChangeReason" type="String" not-null="true" />
<property name="CompletedDate" column="CompletedDate" type="DateTime" />
<property name="IsDeleted" column="IsDeleted" type="Boolean" />
<property name="Notes" column="Notes" type="String" />
<property name="OrderDate" column="OrderDate" type="DateTime" not-null="true" />
<property name="OrderTotal" column="OrderTotal" type="Decimal" />
<property name="RequiredDate" column="RequiredDate" type="DateTime" />
<many-to-one name="Customer" column="Customer" class="Customer" not-null="true" />
<bag name="OrderDetails" table="OrderDetails" generic="true" cascade="all">
<key column="OrderDetail" foreign-key="FK_OrderOrderDetails" />
<one-to-many class="OrderDetail" />
</bag>
</class>
produces the following SQL:
create table Orders (
ID UNIQUEIDENTIFIER not null,
Version INT not null,
DateDeleted DATETIME null,
ChangeReason NVARCHAR(255) not null,
CompletedDate DATETIME null,
IsDeleted BIT null,
Notes NVARCHAR(255) null,
OrderDate DATETIME not null,
OrderTotal DECIMAL(19,5) null,
RequiredDate DATETIME null,
Customer UNIQUEIDENTIFIER not null,
Order UNIQUEIDENTIFIER null,
primary key (ID)
)
It's that 2nd to last column (Order) that's causing this to be invalid and highlighted the issue. It is happening on all my other classes - but I've no idea why. What can I do about it?
Edit: 30/11/2010 - The other end of the mapping file:
<hibernate-mapping xmlns="urn:nhibernate-mapping-2.2" assembly="TheWorkshop.DomainModel" namespace="TheWorkshop.DomainModel" default-access="field.camelcase-underscore" default-lazy="true">
<class name="OrderDetail" table="OrderDetails">
<id name="_persistenceID" column="ID" type="Guid" access="field" unsaved-value="00000000-0000-0000-0000-000000000000">
<generator class="guid.comb" />
</id>
<version name="_persistenceVersion" column="Version" access="field" type="int" unsaved-value="0" />
<property name="AdjustedPrice" column="AdjustedPrice" type="Decimal" not-null="true" />
<property name="LineCost" column="LineCost" type="Decimal" not-null="true" />
<property name="Notes" column="Notes" type="String" />
<property name="Photo" column="Photo" type="String" />
<property name="Price" column="Price" type="Decimal" not-null="true" />
<property name="Quantity" column="Quantity" type="int" />
<many-to-one name="`Order`" column="`Order`" class="Order" not-null="true" />
<many-to-one name="Product" column="Product" class="Product" not-null="true" />
</class>
and that generates the following:
create table OrderDetails (
ID UNIQUEIDENTIFIER not null,
Version INT not null,
AdjustedPrice DECIMAL(19,5) not null,
LineCost DECIMAL(19,5) not null,
Notes NVARCHAR(255) null,
Photo NVARCHAR(255) null,
Price DECIMAL(19,5) not null,
Quantity INT null,
[Order] UNIQUEIDENTIFIER not null,
Product UNIQUEIDENTIFIER not null,
primary key (ID)
)
A:
I think the problem is the key column is set to OrderDetail. The column attribute should contain the name of the foreign key column from the Order table in OrderDetail and I doubt you've named that column OrderDetail. My guess is that it should be OrderID. It may be a bug in schema generation that occurs when a class name is supplied instead of the column name.
<key column="OrderDetail" foreign-key="FK_OrderOrderDetails" />
| 2023-09-23T01:27:15.642919 | https://example.com/article/9579 |
Many types of voting apparatuses and systems exist. Examples of existing voting machines and systems include paper ballot systems, mechanical lever voting systems, punchcard systems, and DRE (direct recording electronic) systems.
Paper ballot systems use paper ballots listing the names of the candidates and issues for voting. A voter records a choice, in private, by marking the box next to a candidate or issue they want to select, and the marked ballot is deposited in a sealed ballot box.
Mechanical lever voting machines have also been used to record votes. In these machines, the name of each candidate or ballot issue choice is assigned a particular lever in a rectangular array of levers on the front of the machine. A set of printed strips visible to the voters identifies the lever assignment for each candidate and issue choice. The levers are horizontal in their unvoted positions. In a private enclosure, the voter manipulates one or more levers corresponding to the voter's choices to vote. When the voter exits the booth by opening a privacy curtain with the handle, the voted levers automatically return to their original horizontal position. As each lever returns, it causes a connected counter wheel within the machine to turn one-tenth of a full rotation. The counter wheel, serving as the “ones” position of the numerical count for the associated lever, drives a “tens” counter one-tenth of a rotation for each of its full rotations. The “tens” counter similarly drives a “hundreds” counter. If all mechanical connections are fully operational during the voting period, and the counters are initially set to zero, the position of each counter at the close of the polls indicates the number of votes cast on the lever that drives it. Interlocks in the machine prevent the voter from voting for more choices than are permitted.
Punchcard systems employ a card and a small clipboard-sized device for recording votes. A voter punches a hole in the card (with a supplied punch device) opposite a candidate or ballot issue of the voter's choice. After voting, the voter may place the ballot in a ballot box for later tabulation. Alternatively or additionally, the ballot may be fed into a computer vote-tabulating device at the voter's precinct.
One common type of punchcard is the “votomatic” card. In a votomatic card, the locations at which holes may be punched to indicate votes are assigned numbers. These locations are referred to as “chads” and are perforated regions that can be punched out. The number of each hole is the only information printed on the card. The list of candidates or ballot issue choices, and directions for punching the perforated regions are printed in a separate booklet that is on top of the votomatic card.
The year 2000 presidential election between Al Gore and George Bush, Jr. highlighted the problems associated with votomatic voting machines. These problems are well documented For example, in a votomatic machine, the appropriate holes in the ballots may not be punched cleanly resulting in hanging chads or pregnant chads. The voter's intent is not easily discernable unless the chads are cleanly punched. Also, voters sometimes find the votomatic machines confusing. In the year 2000 presidential election, for example, many voters complained that they had intended to vote for one candidate, but ended up voting for another because the votomatic machine was confusing. Lastly, as evident from the long vote counting process in the 2000 presidential election, counting votomatic ballots can be laborious and slow if the counting is performed manually.
DRE systems are an electronic implementation of the old mechanical lever systems. As with the lever machines, there is no ballot. In a DRE system, the possible choices are visible to the voter on the front of the machine The voter directly enters choices into electronic storage with the use of a touch-screen, push buttons, or similar device. An alphabetic keyboard is often provided with the entry device to allow for the possibility of write-in votes. Since votes are stored electronically, votes can be quickly tabulated.
While conventional DRE voting systems address many of the problems associated with votomatic voting machines, improvements could be made. For example, conventional DRE voting systems such as touch screen voting machines are purely electronic and are essentially paperless systems. In some Jurisdictions (e.g., New Hampshire), paper ballots are required by law so that conventional DRE systems may not be appropriate for these jurisdictions. Also, although the use of electronics in society increases every day, many voters may still feel more comfortable using paper as a voting medium. For example, even if all votes are recorded electronically, some voters may fear that it is easier to electronically alter an electronic ballot than a paper ballot. Also, print media is easier to read than electronic media (e.g., on computer screens). Consequently, although such DRE systems are currently being used in some jurisdictions, such conventional DRE systems may not gain widespread acceptance. Thus, while purely electronic voting methods have advantages, they also have disadvantages.
Accordingly, embodiments of the invention address these and other problems, individually and collectively. | 2023-12-09T01:27:15.642919 | https://example.com/article/8800 |
Background {#Sec1}
==========
The proliferation and differentiation of mesenchymal stem cells toward osteoblasts is important for bone development and formation. The process involves in multiple regulatory signaling pathways and transcription factors \[[@CR1], [@CR2]\]. Both canonical and non-canonical Wnt signaling pathways play essential roles in mesenchymal stem cells differentiation into osteoblasts along with their proliferation and mineralization \[[@CR1], [@CR3], [@CR4]\].
The extracellular region of receptor tyrosine kinase-like orphan receptor 2 (Ror2) contains a cysteine-rich domain (CRD), which exhibits similarities to the CRDs found in the Frizzled (Fzd) family of seven transmembrane Wnt receptors \[[@CR5]--[@CR7]\]. Previous studies have identified Ror2 functions as a Wnt receptor/coreceptor regulated by canonical and non-canonical Wnt signaling pathways \[[@CR8]--[@CR12]\]. Mice with Ror2 homozygous mutation displayed shortened mandible, defects of derivatives of Meckel's cartilage, and notably shortening of the long bones of the appendicular skeleton \[[@CR13], [@CR14]\]. Ror2 mutation in humans accounts for recessive Robinow syndrome, which is characterized by macrocephaly, short stature, and mesomelic limb shortening, mostly in the forearms and brachydactyly \[[@CR15], [@CR16]\]. The severe skeletal phenotypes in both Ror2 mutation mice and Robinow patients suggested a significant role of Ror2 in bone development and formation \[[@CR11], [@CR13]--[@CR16]\]. Available in vitro studies have proven that Ror2 can promote the osteogenic differentiation of mesenchymal stem cells \[[@CR3], [@CR17], [@CR18]\]. Nevertheless, direct evidence demonstrating the participation of Ror2 in osteogenesis of osteoblastic cell lineages in vivo is still required. The Ror2-mediated signaling pathways in osteogenesis of osteoblastic cell lineages are not completely understood. The Prrx1-Cre mice express Cre recombinase under the regulation of the paired related homeobox gene-1(Prx1)-derived regulatory element \[[@CR19], [@CR20]\]. When Prrx1-Cre transgenic mice are crossed with a strain containing a loxp site-flanked sequence of interest, Cre-mediated recombination results in deletion of the floxed sequence in all mesenchyme-derived cells in the limbs and craniofacial tissue \[[@CR19]--[@CR22]\]. Therefore, in order to elucidate the role of Ror2 in osteogenesis of osteoblastic cell lineages in vivo, Ror2^f/f^ transgenic mice which possess loxp sites flanking exons 3--4 of Ror2 gene \[[@CR23]\] and the Prrx1-Cre transgenic mice were used to generate mice with Ror2 gene-specific deletion in mesenchymal progenitors.
The *cytoplasmic* transcription factor signal transducer and activator of transcription 3 (Stat3) activated by various cytokines and growth factors participated in cell proliferation, differentiation, and apoptosis \[[@CR24], [@CR25]\]. Activated Stat3 proteins translocated into the nucleus and then exerted transcriptional functions, thus taking part in tumorigenesis, self-renewal, and pluripotency of stem cells \[[@CR26]\]. Mice with selective disruption of Stat3 in osteoblasts or osteocytes showed reduced bone formation \[[@CR27], [@CR28]\]. High level of Ror2 expression in platinum-resistant ovarian tumor was found to be coupled with upregulation of Stat3, suggesting that Stat3 might act as the signaling downstream of Ror2 \[[@CR29]\]. IL-6 induced the transcription of Ror2 to accelerate osteoblast-like differentiation and calcification in human adipose tissue-derived mesenchymal stem cell (hADSCs), while suppression of Stat3 in hADSCs inhibited IL-6-mediated Ror2 expression and mineralization \[[@CR30]\]. However, the role of Stat3 in Ror2-mediated osteogenesis of mBMSCs has not been unveiled.
In this study, we investigated the role of Ror2 in embryonic and neonatal bone formation though transgenic mice of limb bud mesenchyme and craniofacial mesenchyme-specific Ror2 deficiency. In addition, the effect of Stat3 on Ror2-mediated osteogenesis of mBMSCs was explored in vitro.
Methods {#Sec2}
=======
Mouse lines {#Sec3}
-----------
Mice were used according to federal guidelines and as approved by the Animal Ethical and Welfare Committee of Sun Yat-sen University (approval number SYSU-IACUC-2018-000275). Mice were described in the literature and purchased from the Jackson Laboratory: Prrx1-Cre (stock no. 005584) and Ror2^f/f^ (stock no. 018354) \[[@CR20], [@CR23]\]. To generate Ror2 conditional knockout mice, Ror2^f/f^ mice were first crossed with Prrx1-Cre transgenic mice to obtain Prrx1-Cre; Ror2^f/+^ mice. Then, Prrx1-Cre; Ror2^f/+^ mice were crossed with Ror2^f/f^ mice to get Prrx1-Cre; Ror2^f/f^ (hereafter called *Ror2* CKO) mice. For embryos or neonatal mice, both male and female were used in the analyses as sex could not be clearly identified in embryos or neonatal mice. Three or more littermate mice per group were examined, and representative images were shown in Fig. [1](#Fig1){ref-type="fig"}. Genotyping was conducted by polymerase chain reaction (PCR) of tail lysate. Primer sequences were provided in Table [1](#Tab1){ref-type="table"}. Fig. 1The dwarfism phenotype of *Ror2* CKO mice. Compared with the littermate control (Con) mice, the limbs were significantly shortened in Prrx1-Cre; Ror2^f/f^ (*Ror2* CKO) mice at both embryonic (E14.5) and neonatal (P0) stage. **a**, **b** Ex vivo observation of *Ror2* CKO and control mice at E14.5 (**a**) and P0 (**b**), scale bar = 1500 μm. **c**--**f** Whole-mount skeletal staining of *Ror2* CKO and Con mice at E14.5 (**c**, **d**), scale bar = 5000 μm, and P0 (**e**, **f**), scale bar = 4 mm, respectively. The boxed region is enlarged in the right panel, scale bar = 2000 μmTable 1Primers for PCR and qRT-PCRGeneForwardReverseApplicationPrrx1GCG GTC TGG CAG TAA AAA CTA TCGTG AAA CAG CAT TGC TGT CAC TTPCRRor2TGC AGG TTT TGA GCC CTA ACCGA GAA TGA CTT CCC TGT CCPCRGAPDHCCTTCCGTGTTCCTACCCCAACCTGGTCCTCAGTGTAGqRT-PCRRor2ACGCAATGTGCTGGTGTACTGTCAGAGTCGATGGAGAACqRT-PCRStat3CATCCTGAAGCTGACCCAGGTATTGCTGCAGGTCGTTGGTqRT-PCRRunx2CCGTCACCTCCATCCTCTTTCAATACGCATCACAACAGCCACAqRT-PCROSXACCCTTCCCTCACTCATTTCCTGTGCCTTGTACCACGAGCCATAGqRT-PCROPNCTCCAATCGTCCCTACAGTCGCCAAGCTATCACCTCGGCCqRT-PCRCOL1A1CCCAAGGAAAAGAAGCACGTCACATTAGGCGCAGGAAGGTCAqRT-PCROCNGCTGCCCTAAAGCCAAACTCTAGAGGACAGGGAGGATCAAGTTCqRT-PCR
Skeletal staining {#Sec4}
-----------------
According to the standard protocol, skeletons from embryonic (E14.5) and neonatal (P0) mice were processed for Alizarin Red and Alcian Blue staining to visualize bone and cartilage \[[@CR31]\].
Histology and immunohistofluorescence (IHF) staining {#Sec5}
----------------------------------------------------
Forelimbs of P0 newborn mice were isolated, fixed overnight in 4% paraformaldehyde (PFA, Servicebio, Wuhan, China), and were embedded in optimal cutting temperature (OCT) compound (Tissue-Tek). Ulna longitudinal sections (8 μm) using the elbow joint as landmark were cut and stained for both histology and IHF staining.
To assess the general histology and mineralized tissue in the region of interest, the histological stainings including hematoxylin-eosin (H&E) and Von Kossa were applied.
Using a standard protocol, IHF staining was performed with the appropriate primary antibodies and secondary antibodies (Table [2](#Tab2){ref-type="table"}). Cryostat sections were mounted in mounting medium with DAPI from Vector Laboratories (H-1200). The images were captured by an inversion fluorescence microscope (Zeiss, Oberkochen, Germany). Table 2Antibodies used for immunoblottingMarker (species)DilutionDistributor/source (catalog number)**Primary antibody** RANKL mouse mAb1:100Novus Biologicals (12A380) OSX rabbit mAb1:70(IHF)Santa Cruz (A13) OSX rabbit mAb1:1000(WB)Abcam (ab22552) OPN goat mAb1:200(IHF)R&D (af808) OPN rabbit pAb1:1000(WB)ZEN BIO(380437) COL1A1 goat pAb1:200Santa Cruz (sc-8784-R) CD31 rabbit mAb1:200Biolegend (102502) SOX9 rabbit mAb1:300Millipore (ab-5535) Ror2 rabbit pAb1:1000CST (4105) Stat3 mouse mAb1:1000(WB)CST (9139) Stat3 mouse mAb1:100(ICF)CST (9139) Runx2 rabbit mAb1:1000CST (8486) pStat3 mouse mAb1:2000CST (4113)**Secondary antibody** Anti-rabbit IgG (Fluor® 488 Conjugate)1:500 (IHF)Yeasen Biotech (33106ES60) Anti-mouse IgG (Fluor® 568 Conjugate)1:500 (IHF)Abcam (ab175473) Anti-rat IgG (Fluor® 594 Conjugate)1:500 (IHF)Yeasen Biotech (34412ES60) Anti-mouse IgG (Fluor® 564 Conjugate)1:300 (ICF)Yeasen Biotech (33212ES60) Anti-mouse IgG HRP-linked Ab1:2000 (WB)CST (7076) Anti-rabbit IgG HRP-linked Ab1:2000 (WB)CST (7074)*IHF* immunohistofluorescence, *WB* western blot, *ICF* immunocytofluorescence
Cell culture {#Sec6}
------------
Mouse bone marrow mesenchymal stem cells (mBMSCs) isolated from the bone marrow of C57BL/6 mice were provided by Cyagen Biosciences, Inc. (Guangzhou, China). Identification of the cells according to the cell surface phenotypes and multipotency was performed by the supplier. mBMSCs were cultured in alpha-MEM (Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco) and incubated at 37 °C in a humidified atmosphere of 5% CO~2~. mBMSCs in passages 6--9 were used in this study.
Lentiviral vector construction and transduction {#Sec7}
-----------------------------------------------
The recombinant lentivirus vector downregulation of mouse Ror2 gene and overexpression of mouse Stat3 gene were generated by Cyagen Biosciences, Inc. (Guangzhou, China) and iGeneBio Biotechnology (Guangzhou, China), respectively.
According to the manufacturer's instructions, mBMSCs were infected with lentivirus-based shRNA vector downregulation of Ror2 (sh-Ror2) and lentivirus-based shRNA vector overexpression of Stat3 (sh-Stat3). Briefly, mBMSCs were plated at 1.5 × 10^4^ cells/cm^2^ in 12-well plates overnight and then infected with lentivirus in the presence of 5 μg/mL polybrene (iGeneBio Biotechnology, Guangzhou, China) for 8 h. After 72 h, mBMSCs infected with sh-Ror2 were selected with 1 μg/mL puromycin (Solarbio, Beijing, China). Those mBMSCs infected with sh-Ror2 and sh-Stat3 were selected with 1 μg/mL puromycin and 50 μg/mL hygromycin B (Solarbio, Beijing, China). The expression of Ror2 and Stat3 was assessed by quantitative real-time polymerase chain reaction (qRT-PCR) and western blot analysis.
Osteogenic differentiation and calcium deposition determination {#Sec8}
---------------------------------------------------------------
For osteogenic differentiation, the cells were plated at 2 × 10^4^ cells/cm^2^ in 6-well plates and cultured in 2 ml of alpha-MEM containing 10% FBS. When cells reached approximately 60--70% confluence, they were switched to the osteogenic induction medium, which consisted of alpha-MEM supplemented with 10% (vol/vol) FBS, 10^−7^ M dexamethasone (Sigma, USA), 10 mM β-glycerol phosphate (Solarbio, Beijing, China), and 50 μM ascorbate-2-phosphate (Solarbio, Beijing, China) for 3 weeks. The calcium deposition was assessed by staining with 40 mM Alizarin Red S solution (Cyagen Biosciences, Guangzhou, China) at room temperature for 15 min. The Alizarin Red S concentrations were determined by a quantitative destaining procedure using 10% cetylpyridinium chloride (CPC) (Sigma, USA) for 15 min at room temperature. The absorbance value at 562 nm was then measured by microplate spectrophotometer (Bio-Tek, UK).
RNA isolation, reverse transcription, and qRT-PCR analysis {#Sec9}
----------------------------------------------------------
Total RNA of mouse forelimbs and mBMSCs was extracted using an Eastep Super total RNA extraction kit (Promega, Shanghai, China) according to the manufacturer's instructions and then was reverse transcribed using a PrimeScriptTM RT Master Mix (Takara Bio, Ohtsu, Japan). The quantification was performed using the TB Green™ Premix Ex Taq™ II (Tli RNaseH Plus) reagent (Takara Bio, Ohtsu, Japan). The relative expression of target gene was normalized in relative to the level of GAPDH using the 2^−ΔΔCT^ method. Primer sequences were provided in the Table [1](#Tab1){ref-type="table"}.
Western blot {#Sec10}
------------
Total protein and nucleoprotein lysates from cells were extracted using the RIPA lysis buffer (CWBIOTECH, Beijing, China) according to the manufacturer's instructions. The proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE, Genscript, Nanjing, China) and transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, Bedford, MA, USA). The membrane was then blocked with 5% bovine serum albumin (BSA, Biofroxx, Germany) for 2 h, incubated with relevant primary antibodies (Table [2](#Tab2){ref-type="table"}) at 4 °C overnight, and then incubated with corresponding secondary antibodies (Table [2](#Tab2){ref-type="table"}) for 1 h at room temperature. Bands were detected with a chemiluminescence kit (Millipore, Bedford, MA, USA).
Immunocytofluorescence (ICF) staining {#Sec11}
-------------------------------------
Approximately 0.2 × 10^4^ cells/cm^2^ cells were seeded in 24-well plates with cover slides. When reached approximately 60% confluence, they were switched to the osteogenic induction medium for 24 h. The cells were fixed in 4% PFA for 10 min and then permeabilized in 0.1% Triton X-100 (CWBIOTECH, Beijing, China) for 5 min at room temperature. Next, the cells were blocked with 5% BSA at room temperature for 1 h and then incubated with Stat3 antibodies (Table [2](#Tab2){ref-type="table"}) at 4 °C overnight. After a PBS wash for 15 min, the cells were incubated with corresponding secondary antibodies (Table [2](#Tab2){ref-type="table"}) diluted in 5% BSA at room temperature for 1 h. Finally, the cells were washed for 15 min with PBS, followed by nuclear staining with DAPI (Telenbiotech, Guangzhou, China). Confocal laser scanning fluorescence microscopy (Nikon Eclipose Ni-E, Japan) was employed to analyses Stat3 staining in cells.
Statistical analysis {#Sec12}
--------------------
The data were presented as means ± standard deviation (SD). Comparisons among groups were performed by one-way ANOVA followed by Bonferroni's post hoc test with GraphPad Prism 7.0 software. The significance was set at *P* \< .05.
Results {#Sec13}
=======
The dwarfism phenotype of *Ror2* CKO mice {#Sec14}
-----------------------------------------
The embryonic (E14.5) and neonatal (P0) *Ror2* CKO mice displayed dwarfism where shortened bone was found in limbs (Fig. [1](#Fig1){ref-type="fig"}a, b). Whole-mount skeletal staining by Alizarin Red and Alcian Blue showed that the length of forelimb and hindlimb was distinctly reduced in *Ror2* CKO mice (Fig. [1](#Fig1){ref-type="fig"}c, e) when compared with littermate controls (Fig. [1](#Fig1){ref-type="fig"}d, f).
Impaired osteogenesis in neonatal *Ror2* CKO mice {#Sec15}
-------------------------------------------------
Remarkably reduced mineralization in ulna proximal epiphysis was detected by Von Kossa staining in *Ror2* CKO mice (Fig. [2](#Fig2){ref-type="fig"}). IHF staining and qRT-PCR were performed with ulna proximal epiphysis of P0 mice. IHF staining showed that the osteogenic differentiation markers osterix (OSX), osteopontin (OPN), collagen I (COL1A1), and Sox9 were dramatically diminished in *Ror2* CKO mice (Fig. [3](#Fig3){ref-type="fig"}a). Consistent with IHF staining results, the mRNA expression of osteocalcin (OCN), OPN, and COL1A1 was significantly reduced in *Ror2* CKO mice compared with controls (*P* \< 0.05; Fig. [3](#Fig3){ref-type="fig"}b). Fig. 2Histology staining of ulna proximal epiphysis presented an impaired osteogenesis in neonatal *Ror2* CKO mice (P0) compared with the littermate control (Con). Hematoxylin-eosin (H&E) and Von Kossa staining were used to observe the general histology and mineralized tissue, respectively. Scale bar = 300 μm. Compared with the control, mineralized tissue visualized in brown by Von Kossa staining was significantly decreased in *Ror2* CKO miceFig. 3Reduced expression of osteogenic markers in neonatal *Ror2* CKO mice (P0) compared with the littermate control (Con). **a** Immunohistofluorescence staining of ulna proximal epiphysis showed that less OSX, OPN, COLlA1, and Sox9 were found in *Ror2* CKO samples. Scale bar = 250 μm. **b** RNAs were extracted from ulna proximal epiphysis. Quantitative real-time PCR revealed a significant decrease of mRNA expression of OCN, OPN, and COLlA1 in *Ror2* CKO compared with controls (*n* = 3, \**P* \< 0.05 vs. Con)
Knockdown of Ror2 in mBMSCs led to reduced osteogenic markers and Stat3 expression {#Sec16}
----------------------------------------------------------------------------------
Transfected with recombinant lentivirus vectors, the downregulation of Ror2 into mBMSCs was performed to investigate the effect of Ror2 on osteogenic differentiation from mBMSCs (Fig. [4](#Fig4){ref-type="fig"}a--d). After osteogenic induction for 3 weeks, less calcium deposit was observed in the mBMSC-sh-Ror2 cells when compared with mBMSC-mock1 cells examined by Alizarin Red staining (Fig. [6](#Fig6){ref-type="fig"}a) and quantitative Alizarin Red concentration measurements (Fig. [6](#Fig6){ref-type="fig"}b). The western blot results revealed that knockdown of Ror2 significantly suppressed the expression of Runx2, OSX, and OPN in mBMSCs in response to osteogenic induction (*P* \< 0.05; Fig. [7](#Fig7){ref-type="fig"}a, b). No significant difference between mBMSC and mBMSC-mock1 was observed. Meanwhile, the expression of total Stat3 was significantly decreased in mBMSC-sh-Ror2 cells after osteogenic induction determined by qRT-PCR and western blot (*P* \< 0.05; Fig. [5](#Fig5){ref-type="fig"}a--c). Fig. 4Knockdown of Ror2 in mBMSCs by the use of recombinant lentivirus vectors. **a** mBMSCs transfected with empty lentiviral vector (mBMSC-mock1) and shRNA targeting Ror2 (mBMSC-sh-Ror2) were observed with light microscopy (top) and fluorescent microscopy (below). Scale bar = 100 μm. **b** Quantitative real-time PCR analysis showed Ror2 mRNA expression in mBMSCs after transduction. **c**, **d** The expression of Ror2 protein in mBMSCs after transduction were evaluated using western blot analysis. *n* = 3, \**P* \< 0.05 vs. mBMSC-mock1Fig. 5In Ror2-knockdown mBMSCs, the expression of Stat3 was decreased. **a**--**c** Quantitative real-time PCR (**a**) and western blot (**b**, **c**) analysis of the expression of Stat3 after osteogenic induction for 3 weeks. *n* = 3, \**P* \< 0.05 vs. mBMSC-mock1. **d** Immunocytofluorescence staining showed the distribution of Stat3 after osteogenic induction for 24 h. Scale bar = 50 μm. **e** Western blot analysis revealed the expression of nuclear Stat3 and pStat3 after osteogenic induction for 24 h. **f**, **g** Overexpression of Stat3 in Ror2-knockdown mBMSCs. Stat3 protein expression was evaluated using western blot analysis. *n* = 3, ^\$^*P* \< 0.05 vs. mBMSC-sh-Ror2
Furthermore, ICF also showed that in comparison with mBMSC-mock1 cells, knockdown of Ror2 in mBMSCs caused a decrease of intracellular accumulation of Stat3 (Fig. [5](#Fig5){ref-type="fig"}d). At the same time, nuclear phosphorylated Stat3 (pStat3) was obviously reduced in mBMSC-sh-Ror2 cells after osteogenic induction for 24 h monitored by western blot (Fig. [5](#Fig5){ref-type="fig"}e).
Reduced osteogenic differentiation in Ror2-knockdown mBMSCs was restored by overexpression of Stat3 {#Sec17}
---------------------------------------------------------------------------------------------------
In Ror2-knockdown mBMSCs, overexpression of Stat3 was conducted through utilizing recombinant lentivirus vectors (Fig. [5](#Fig5){ref-type="fig"}f, g). Alizarin Red staining demonstrated that similar amount of calcium deposits was observed in the mBMSC-sh-Ror2-Stat3 cells when compared with controls (mBMSC-mock1 and mBMSC-mock2) (Fig. [6](#Fig6){ref-type="fig"}a). Overexpression of Stat3 in mBMSC-sh-Ror2 cells caused a recovery of osteogenic ability to a level comparable to controls (mBMSC-mock1 and mBMSC-mock2) after 3 weeks of osteogenic induction, which was proven by the increased expression of osteogenic markers (Runx2, OSX, and OPN) (Fig. [7](#Fig7){ref-type="fig"}a, b). Thus, it was logical to speculate that Ror2 might facilitate osteogenic differentiation through Stat3. Fig. 6In response to osteogenic induction, the Ror2-knockdown mBMSCs showed decreased mineralization, which was rescued by overexpression of Stat3. **a** The cells were stained with Alizarin Red after osteogenic induction for 3 weeks. Scale bar = 100 μm. **b** Alizarin Red concentrations were determined by a quantitative destaining procedure using CPC. *n* = 3, \**P* \< 0.05 vs. mBMSC-mock1; ^\$^*P* \< 0.05 vs. mBMSC-mock2; ^\#^*P* \< 0.05 vs. mBMSC-sh-Ror2Fig. 7In response to osteogenic induction, the less expressed osteogenic makers in Ror2-knockdown mBMSCs were restored by overexpression of Stat3. **a**, **b** Western blot analysis of the expression of osteogenic specific markers after osteogenic induction for 3 weeks. *n* = 3, \**P* \< 0.05 vs. mBMSC-mock1; ^\$^*P* \< 0.05 vs. mBMSC-mock2; ^\#^*P* \< 0.05 vs. mBMSC-sh-Ror2
Discussion {#Sec18}
==========
In the present study, a significantly short limb phenotype was observed on *Ror2* CKO mice, where Ror2 was specifically knock out from limb bud mesenchyme and craniofacial mesenchyme. In comparison with the global Ror2 knockout mice which were neonatal dead due to forced respiration and severe cyanosis \[[@CR11], [@CR14]\], no difference of survival rate and lifespan was found between the *Ror2 CKO* mice and their littermate siblings. In the observation period of 4 postnatal weeks, the *Ror2 CKO* mice were alive with more conspicuous dwarfism over time. In our study, loss of Ror2 in limb bud mesenchyme resulted in considerably reduced mineralization in ulna proximal epiphysis. Our observation was in line with that of Takeuchi et al., which reported that a lack of calcification were observed in enchondral ossification centers when Ror2 was disrupted in mice \[[@CR14]\]. The diminished expression of osteogenic markers in our study indicated that deletion of Ror2 in limb mesenchyme indeed impaired the ossification. As known, OCN and OPN, which are produced during bone formation and late in the mineralization process, play synergistic roles in determining bone size and shape \[[@CR32]\]. The decreased expression of OCN and OPN in *Ror2* CKO mice indicated that Ror2 might be necessary for bone formation and morphology. In addition, during limb development, Sox9 was involved in the determination of both osteogenic and chondrogenic cell lineages. Neither mesenchymal condensations nor osteoblast lineage and its differentiation was observed in early limb buds of Sox9 depletion \[[@CR33], [@CR34]\]. Thus, the effect of Ror2 on bone formation might partly rely on regulating Sox9 signaling.
To gain insight into the cellular mechanisms of Ror2-mediated osteogenesis, we studied the effect of downregulation of Ror2 on osteogenic differentiation of mBMSCs in vitro. Available literature reported that the Ror2 expression was increased during early stages of osteoblast differentiation and was peaked in committed proliferating preosteoblasts, contributing to osteoblastogenesis \[[@CR3], [@CR10], [@CR17]\]. Runx2 and OSX are expressed in preosteoblasts and play essential roles in the differentiation of preosteoblasts to immature osteoblasts \[[@CR35]\]. In our study, when Ror2 was knockdown in mBMSCs, the osteogenic markers of mBMSCs, including Runx2, OSX, and OPN, were significantly decreased, which suggested the inhibition effect of Ror2 knockdown on mBMSCs' osteogenesis. Our results were in accordance with previous reports, in which the overexpression of Ror2 in mesenchymal stem cells promoted the formation of mineralized extracellular matrix and expression of osteogenic transcription factors, whereas the downregulation of Ror2 resulted in the opposite \[[@CR17], [@CR36]\]. In addition, in preosteoblast cell line MC3T3-E1 and a mouse calvariae ex vivo organ culture model, Ror2 also strongly promoted matrix mineralization and increased bone formation \[[@CR17], [@CR37]\]. Collectively, it was proven that Ror2 played a promotive role in osteogenesis.
The expressions of Stats family have been found in bone tissues, which were believed to take part in activities of both osteoblasts and osteoclasts \[[@CR24]\]. The increased bone mass and accelerated healing of bone fracture were observed in Stat1-deficient mice \[[@CR38], [@CR39]\]. The mechanism might be that Stat1 negatively regulated osteoblast differentiation by suppressing transcription of Runx2 and OSX. Stat4 and Stat6 were found involved in osteoclastogenesis and arthritis \[[@CR40], [@CR41]\]. Notably, Stat3 took part in a series of biological process of the bone, including cell growth, apoptosis, and motility. Furthermore, Stat3 was believed to be most important in osteoblasts and osteoclasts compared with other Stats \[[@CR24]\]. Ror2 promoter region contained a GAS motif, which is speculated as a *cis* element for Stats \[[@CR29], [@CR42]\]. Inhibition of Stat3 in hADSCs reduced the ability of IL-6 to induce Ror2 mRNA expression and osteoblast-like differentiation and calcification \[[@CR30]\]. These findings hinted a question that whether or not Stat3 was involved in the Ror2-mediated osteogenic differentiation of mBMSCs. In the current study, a significant decrease of Stat3 expression was observed in Ror2-knockdown mBMSCs in response to osteogenic induction at both mRNA and protein levels. Except cytokine receptors associated with JAKs, Stat3 can be activated by receptor tyrosine kinases and G protein-coupled receptors \[[@CR43]\]. Upon ligand binding, Ror2 was found to form receptor complex with other components, including Src and CK1ε, then stimulates Stat3 activation, ultimately leading to cell invasion \[[@CR44]\]. In our study, the overexpression of Stat3 in Ror2-knockdown mBMSCs rescued the decreased osteogenic differentiation of Ror2-knockdown mBMSCs. A possible explanation might be that the intracellular accumulation of Stat3 could promote the osteogenic gene transcription in mBMSCs cultured in osteogenic induction medium. However, whether or not Ror2 directly interacts with Stat3 in mBMSCs' osteogenesis requires further study.
Conclusions {#Sec19}
===========
Taken together, our study suggested a potential role and mechanism of Ror2 in mBMSCs' osteogenic differentiation. Ror2 and Stat3 were essential for skeleton development by regulating mBMSCs' osteogenesis and osteoblast differentiation. The impaired osteogenesis by knockdown of Ror2 was rescued by increased Stat3.
Supplementary information
=========================
{#Sec20}
**Additional file 1: Figure S1.** The PCR results of genotyping *Ror2 CKO* mice. The protocol of genotyping was performed according to the Jackson Lab instructions. Lane 1: blank control (no DNA), Lane 2: negative control (DNA from wild-type mouse), Lane 3: Prrx1-cre; Ror2 ^c/+^, Lane 4: Prrx1-Cre; Ror2 ^c/c^(e.g. *Ror2 CKO*), Lane 5: Ror2 ^c/+^, Lane 6: Ror2 ^c/c^. **Figure S2.** The mBMSCs characterizations by flow cytometry.
Ror2
: Receptor tyrosine kinase-like orphan receptor 2
Stat3
: Signal transducer and activator of transcription 3
BMSCs
: Bone marrow mesenchymal stem cells
OPN
: Osteopontin
hADSCs
: Human adipose tissue-derived mesenchymal stem cells
CKO
: Conditional knockout
PCR
: Polymerase chain reaction
IHF
: Immunohistofluorescence
H&E
: Hematoxylin-eosin
mBMSCs
: Mouse bone marrow mesenchymal stem cells
qRT-PCR
: Quantitative real-time polymerase chain reaction
FBS
: Fetal bovine serum
BSA
: Bovine serum albumin
ICF
: Immunocytofluorescence
OSX
: Osterix
COL1A1
: Collagen I
OCN
: Osteocalcin
Stats
: Signal transducers and activators of transcription
**Publisher's Note**
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
=========================
**Supplementary information** accompanies this paper at 10.1186/s13287-020-01646-2.
Not applicable.
LZL and XLZ designed the experiments. LZL, JYF, and ZJH performed the experiments. LZL, ZWH, and YWT analyzed the data. LZL wrote the manuscript. XLH and XLZ participated in the critical revision of the paper. All authors read and approved the final manuscript.
This work was supported by the National Natural Science Foundation of China (grant no. 11772361, 81470731).
All datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
Mice were used according to federal guidelines and as approved by the Animal Ethical and Welfare Committee of Sun Yat-sen University (approval number SYSU-IACUC-2018-000275).
Not applicable.
The authors declare that they have no competing interests.
| 2024-03-13T01:27:15.642919 | https://example.com/article/6955 |
Q:
How do I associate my user's spending with their profile in firebase?
I am currently working on a Money Tracking app and I want to associate each user's spending activity with their profile, i.e. how do I store their expenses according to date and associate it with their profile? I am using Firebase Realtime Database. Currently, my user tree looks something like this.
A:
its pretty simple. All you can do is Create a separate node spending and save your data using Firebase User Id as parent Node and then date as child node with spending record of that current date so , later you can few record for each separate date as well.
and for clean code you can use MyFirebase Helper Classes Kotlin & MyFirebase Helper Class java
| 2023-11-08T01:27:15.642919 | https://example.com/article/9444 |
Q:
How to add extension attributes to Customer entity in Magento2?
I am trying to add extension attributes to customer entity.
I set extension_attributes.xml as follows:
<?xml version="1.0"?>
<config xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:noNamespaceSchemaLocation="urn:magento:framework:Api/etc/extension_attributes.xsd">
<extension_attributes for="Magento\Customer\Api\Data\CustomerInterface">
<attribute code="my_attribute" type="Text">
<join reference_table="my_entity"
reference_field="customer_id"
join_on_field="entity_id">
<field>my_entity_attribute</field>
</join>
</attribute>
</extension_attributes>
</config>
The table my_entity exists and it has a column called customer_id and I want to join this field to the entity_id field in the customer_entity table, and add my_entity_attribute value as the ultimate extension attribute to customer.
What am I doing wrong?
To test this, I am doing a GET rest api call to endpoint customers/me and debugging $this->_getExtensionAttributes() inside \Magento\Customer\Model\Data\Customer::getExtensionAttributes(), but it gives null.
A:
Type Text is not valid, use string instead. Then remember to clear var/generation, var/cache and var/di, to have changes applied.
Also see this answer to get understanding what actions are required to get extension attribute loaded during get and getList. Join directive will work for getList only.
| 2024-02-25T01:27:15.642919 | https://example.com/article/7851 |
Switched capacitor circuits are used in a variety of applications ranging from audio A/D converters to analog filter circuits. At its most basic level, switched capacitor circuits perform analog signal processing in the charge domain by sampling charge on capacitors. By using a combination of feedback amplifiers, switching devices and ratioed capacitors, various sampled analog transfer functions may be accurately represented even in the presence of a high amount of component value variation.
As the geometry of semiconductor processes has been shrinking, and as the demand for low power devices has been increasing, there has been a corresponding decrease in supply voltages for the purpose of preventing device breakdown and damage in smaller geometry devices and to reduce power consumption. In order to maintain headroom in switched capacitor circuits, various supply and clock boosting techniques have been employed to operate switching transistors. For example, given a 1.2 V supply voltage and a 0.7 V transistor threshold, an NMOS switching transistor would only have a compliance range of about 0.5 V if the full supply voltage of 1.2V were used to turn-on the transistor. If, on the other hand, a boosted supply or boosted gate signal is used, for example, to produce a 2V gate drive, the switching transistor may operate over a compliance range encompasses the entire 1.2 V power supply range.
Even with lower power supply voltages, however, there is still a need for switched capacitor circuits that are operable in the presence of input signals having voltages that may exceed the provided supply voltage, for example, in industrial and in automotive applications. | 2024-04-22T01:27:15.642919 | https://example.com/article/2855 |
index
Tag archives for index
So what’s worse than buying powdered black rhino horn from a back alley Shenzen apothecary to cure your impotence? Paying too much for black rhino horn at aforementioned back alley apothecary! Luckily, I came upon an interesting table at Havocscope, which provides indexes of black market industries, including animal trafficking. While these metrics are certainly… | 2024-03-04T01:27:15.642919 | https://example.com/article/9255 |
`Unethical for TDP to poach on YSRC leaders`
Alleging that TDP was indulging in "unethical practices of poaching" on its MPs, YSR Congress on Sunday said the TDP Chief N Chandrababu Naidu should instead concentrate on ways and means to implement his poll promises.
Hyderabad: Alleging that TDP was indulging in "unethical practices of poaching" on its MPs, YSR Congress on Sunday said the TDP Chief N Chandrababu Naidu should instead concentrate on ways and means to implement his poll promises.
"It is immoral and unethical for TDP to poach on YSRCP turf despite having a comfortable majority and even before the swearing-in ceremony Chandrababu Naidu encouraging defections shows the values and democratic principles he has," YSRC MP Mekapati Rajamohan Reddy told reporters here.
He was responding to its Nandyal MP S P Y Reddy joining the TDP in Delhi today and speculation that some other YSRC leaders may follow suit.
Rajamohan Reddy warned that anyone crossing the floor will attract the provisions of anti-defection law.
In a democracy, anyone can opt for any party, but if the reports of TDP luring our party MPs and MLAs into its fold should be true, they must quit the post and seek a fresh mandate to jump the line, failing which their election will be null and void, he said.
"TDP must be in a hurry and wants to swell its strength by luring elected representatives from our party stating the status of recognised party and registered party, but with the percentage of votes we have acquired anyone crossing the floor will face the anti-defection law and have to seek a re-election.
"Even I have crossed over from Congress to YSRCP and quit my post immediately. My resignation was kept pending for a long time and I was elected from the party which I moved over and this is a fair democratic practice," Rajamohan Reddy said.
Even ten days have not passed after the results were announced and Naidu should be working out on the logistics to implement his poll promises of waiver of agriculture and self-help group loans, he said. | 2024-02-28T01:27:15.642919 | https://example.com/article/8830 |
As information and telecommunication technologies improve, the semiconductor industry also makes improvements. To provide increased functionalities, a semiconductor device may be required to provide higher operating speeds and/or increased storage capacities. Semiconductor technologies have thus been developed to improve integration densities, reliability, and/or response speeds of semiconductor devices.
A conventional manufacturing process for a semiconductor device may include forming a wafer and processing the wafer. Single crystalline silicon of high purity may be formed on the wafer, and a plurality of processes may be performed on the wafer, thereby manufacturing semiconductor devices. Examples of semiconductor manufacturing processes include photo processes, etching processes, diffusion processes, deposition processes, etc.
A semiconductor substrate including silicon (Si), germanium (Ge), and/or silicon germanium (SiGe) may be etched away, or a thin layer on the substrate (such as a silicon (Si) layer, a germanium (Ge) layer, and/or a silicon germanium (SiGe) layer) may be etched away during the etching process.
In particular, an etching technology used to etch a substrate including silicon or a silicon layer (hereinafter referred to as an Si etching technology) has been widely used in processes for manufacturing semiconductor devices. For example, when a surface of a silicon substrate or a silicon layer is damaged or defective, the Si etching technology may be used to remove damaged or defective surface portions of the silicon substrate or the silicon layer. The Si etching technology may also be used to reduce a silicon (Si) thickness of a silicon-on-insulator (SOI) substrate. Furthermore, a local etching against a silicon (Si) area may be used to manufacture a semiconductor device.
An example of a local etching against a silicon (Si) area to manufacture a semiconductor device is disclosed in Korean Patent Laid-Open Publication No. 2004-13300, the disclosure of which is hereby incorporated herein in its entirety by reference. According to the above identified Korean patent publication, a portion of a silicon substrate corresponding to an active region may be etched away to a predetermined depth at a temperature in the range of about 600 degrees C. to about 800 degrees C. using a mixture of HCl (hydrogen chloride) gas and H2 (hydrogen) gas as an etching gas, so that the active region is formed at a lower position than a field region with a stepped portion.
Another example of the local etching against a silicon (Si) area to manufacture a semiconductor device is disclosed in Japanese Patent Laid-Open Publication No. 1988-062315, the disclosure of which is hereby incorporated herein in its entirety by reference. According to the above referenced Japanese patent publication, an epitaxial layer may be formed using a first process and a second process performed in the same chamber as the first process. A silicon (Si) epitaxial layer may be grown to a predetermined thickness on a substrate in the first process, and the Si epitaxial layer may be selectively dry-etched using a mixture of HCl gas and H2 gas as an etching gas in the second process. In addition, U.S. Patent Application Publication No. 2002-192930 discloses a method of forming a single crystalline silicon pattern, the disclosure of which is hereby incorporated herein in its entirety by reference. More particularly, a polycrystalline silicon layer on an insulation pattern is selectively etched at a temperature in the range of about 700 degrees C. to about 800 degrees C. using a mixture gas of HCl gas and H2 gas as an etching gas. An example of the local etching against a silicon (Si) area to manufacture a semiconductor device is also disclosed in Japanese Patent Laid-Open Publication No. 1988-321533, the disclosure of which is hereby incorporated herein in its entirety by reference. More particularly, a distorted portion of a crystal, (caused by a curing used to remove crystal defects in a crystal growing process) may be removed by an Si etching technology using a mixture of H2 gas and HCl gas remaining in a vapor growth furnace.
A chemical vapor etching (CVE) process using HCl gas may be performed in-situ with an epitaxial growth process, so that defective growth is reduced using the CVE process. Si etching during the CVE process, however, may require a high temperature. Since the HCl gas chemically dissolves at a temperature of about 800 degrees C., a high temperature of about 800 degrees C. may be required for the Si etching process. A high temperature of about 800 degrees C., however, may excessively accelerate electron diffusion in a semiconductor substrate, and device characteristics of a semiconductor device may thus deteriorate. A short channel effect in a transistor of an integrated circuit (IC) is an example of the resulting deterioration. In addition, a metal curing process used to cure damage in a metal layer may follow a metal deposition process. The metal curing process may be a low-temperature process and the Si etching process may thus be inapplicable to the metal curing process. | 2023-08-17T01:27:15.642919 | https://example.com/article/4295 |
the trials, travails, and tribulations of Dustin Heveron and his Quest for…something.
The 2009 Dustins
With the 2009 Oscars having just wrapped up, it’s only fair that the world be exposed to a heavily-biased, illogical, inaccurate and incomplete review of the things that 2008 brought us. And everyone knows that when you think of heavily-biased, illogical, inaccurate and incomplete reviews, you think of Dustin Heveron. I don’t have a garish opening song and dance number, an Australian accent, or the tendency to openly weep during my acceptance speeches…so I think that already makes my awards show better than its gilded-statuette-loving predecessor.
And now, on with the show.
+Best Picture+Why does The Academy of Motion Picture Arts & Sciences make you sit through three hours of bad jokes, awkward celebrity interactions and lame commercials when all you really care about is the final four awards given? Because they can, that’s why. And it makes them a lot of money to do it that way. On the other hand, since we at the Academy of Dustin Heverons & Dustin-Lovers have no such revenue to worry about, we can just blow our wad right out of the gate (crass metaphors are a great way to get your point across while simultaneously alienating your readership. And they said LA hadn’t taught me anything). That said, the nominees for Best Picture are:-Iron Man-Wanted-The Dark Knight-Wall•E-Quantum of Solace
…And the Dustin goes to…
[dramatic pause, cut to some chicks looking anxious]
…THE DARK KNIGHT!There’s no question that ’08 gave us some heavy hitters, and while I loved all the above movies, The Dark Knight kicked all their asses (both literally and figuratively). The acting was top-notch, the effects were awesome without being intrusive, and the story was compelling enough to keep you interested for well-past the typical 90-minute length of your average superhero movie. The director should find whoever talked him into keeping the “epilepsy vision” gadget Batman uses at the end of the film and have Chrstian Bale shoot him execution-style at the Terminator: Salvation premiere this summer (and those of you who’ve heard his now-infamous youtube clip know he’s capable of doing all that and more if you get him angry), but other than that, I really have no complaints about this movie. It’s great. This past year was the first where the “superhero movie” truly solidified its spot as a bankable genre unto itself, so it’s only fitting that a superhero movie take home the year’s top award. As someone who’s been pretending to be a superhero since he was old enough to fall off the living room coffee table with a blanket tied around his neck, it makes the über-nerd side of me extra extra giddy to see my favorite heroes getting the big-budget treatment they deserve; however, it makes the non-über-nerd side of me…wait a second, I just remembered, there is no non-über-nerd side of me. So everyone’s happy. Moving on.
+Best Actress+For this award, let’s keep in mind that “best” really just translates into “hottest” or “actress whose bed I would most like to find myself handcuffed to.” However, it’s hard to engrave all of that onto the base of a handheld gold trophy, so we’ll stick with “best” for now. And the nominees are:-Rachel Bilson-Kristen Kreuk-The Olsen Twins (mostly Ashley)-Hayden Panettiere-Cameron Diaz
…And the Dustin goes to…
[not very dramatic pause, camera cuts between the five (six?) visibly uncomfortable nominees…many of whom can be seen mouthing the words “dear God, I hope it’s not me” to themselves]
…RACHEL BILSON!Dude, she’s so hot you guys. Seriously, this is always a pretty competitive category, and this year was no exception. In the end, the winner was chosen via process of elimination more than anything else. Cameron Diaz (age 36) is getting kind of old and played out, Hayden Panettiere (age 19) is a bit too young for my liking (haha, yeah right! But I have to say that kind of thing or else people judge me), and Ashley Olsen won’t return my calls (or texts or emails or myspaces or smoke signals or bomb threats). That leaves Kristen Kreuk and Rachel Bilson. Originally the esteemed honor was going to go Ms. Kreuk, but when I googled her (wink!) about 47 seconds ago I found out that she is Canadian! And while that kind of thing doesn’t really matter in the big picture, in a contest this close, every little factor counts. Also, Rachel Bilson lives in Los Angeles, which means technically there’s a better chance that we could run into each other and she would pity-makeout with me. Hey, stupider things have happened in LA.
+Best Actor+Typically the award for the continent’s awesomest dude who has the most kickass fighting moves, makes me laugh the hardest, or who just encompasses the epitome of badassness with wicked cool style and sensibility, this year’s nominees are:-Brad Pitt-Bugs Bunny-Edward Norton-Philip Seymour Hoffman-Jim Carrey
…And the Dustin goes to…
[captivated silence as we slowly zoom in on Edward Norton’s closed eyes…then right at the last second…HIS EYES SHOOT OPEN AND THEY’RE GLOWING GREEN! AHHH!! Then we cut to black, implying a sequel. …Ooo, I just got chills, didn’t you?]
…DUSTIN HEVERON! In a surprising (unsurprising) turn of events, Dustin Heveron wins the Dustin for Best Actor for an unprecedented 25th year in a row! All those actors kick ass, but come on, you really think I’m gonna give my award for favorite anything to someone else if I’m at all eligible? Get real. Mad props to those gentlemen, since they’re probably my top five favorite non-me actors, but I think I really deserved this award year, and I’m glad to see that The Academy did the right thing here in honoring me for the 25th consecutive time. But oh my, listen to me prattle on when I have so many people to thank. Ahem. First off, I’d like to thank me. There’s no way I could have achieved this level of awesomeness without myself. I was always there to support myself through the hard times, and it really paid off. I’d also like to thank Jesus for spending a weekend in Hell so that we can rock out in Heaven (aka life’s afterparty) once I’m done rocking out on Earth. And finally, I’d like to thank myself again, because apparently no one else is going to do it. Seriously, good job, me. Don’t be afraid to congratulate/hug me next time you see me.
+Best Duo of New Zealand Musical Entertainers Playing Loosely Caricaturized Versions of Themselves on a Popular HBO Sitcom+Always one of the most hotly-contested awards The Academy hands out each year, this year’s nominees are:-Bret McKenzie and Jemaine Clement, of Flight of the Conchords
…And the Dustin goes to…?
[…slightly confused pause as presenter scans rest of card and envelope, then checks the back of the envelope as well to make sure that they didn’t miss any additional nominee names written on the back or something]
…Jemaine Clement and Bret McKenzie. I guess.After so many years of not having anyone to give this award to, it’s nice to finally be able to have a pair of entertainers who fit this category. And for realsies, if you haven’t seen any Flight of the Conchords stuff before, do yourself a favor and break up with your boyfriend/girlfriend, quit your job, disown your family, buy enough food to last you for several weeks, and lock yourself in your house/apartment and watch their show and listen to their music plus whatever else of theirs you can find on youtube, and don’t leave until you can quote it all verbatim, complete with your best New Zealand accent. Your life won’t be complete until you do.
+Best Re-Release of an Album with a Song Referencing Twilight on it+No time for preamble here, because it’s too vital that I command you to GO AND BUY HOUSE OF HEROES’ NEW ALBUM, THE END IS NOT THE END!!! In stores, online, at a show — it doesn’t matter how you get access to this album (as long as you’re shelling out some $$$ for it…these guys aren’t your standard corporate sellout band and they’re not getting nine-figure checks from The Man every week (I’m looking at you, Jonas Bros.), they need your support to keep making the modern era’s greatest music), but trust me when I say that you will not be able to forgive yourself if you waste even one second before buying this album. These guys are like Queen for generation teXt, and they literally have something for everyone on their album — without being the broad, simple, depth-less crap you primarily hear on the radio. I seriously can’t endorse these guys enough, and if that’s not plenty of motivation, in July of ’09 I’ll be starting a nationwide tour where I go door-to-door to every single home in America and personally teabag anyone who hasn’t purchased this album by then. Go ahead, call my bluff…I dare you.
And the last (and definitely least) award for the evening,
+Best Time for Dustin to Go to Sleep+A largely debated award, the Academy seems to rarely unanimously agree on who the winner should be, which always makes for good water-cooler conversation the day after the awards. This year’s nominees are:-Before 11pm-Anytime after 10 o’clock-1:39am-Whenever he damn well feels like it-Between 1am-3am
…And the Dustin goes to…
[long, drawn-out pause…and then the pause continues…for too long. More pause. Slowly the music fades, the lights go out and there is silence as Dustin has fallen asleep before the award can be revealed. Oh well, I guess this one will just have to remain a surprise until next year. Don’t wanna wake the big guy…he looks so peaceful when he sleeps, and let’s be honest, it’s the only time you can get him to shut up for a change. Yeesh. Have a great night folks, and be sure to tip your bartenders.Much love,Dustin] | 2024-05-30T01:27:15.642919 | https://example.com/article/2201 |
Ed Snowden, divulger of the current, United States agency and NSA spying program upon tens millions of influential as well as ordinary “Joe” people around the world, has had a film made about him and his exploits.
The film is titled Citizenfour. It is the code name Snowden used in his initial, surreptitious communications with Laura Poitras’, director of celebrated documentary films.
Poitras’ rendition of the film has been victorius, and shows Snowden vindicated of what the United States government call treason.
The film tells the story in Ed Snowden’s own words of his involvment with the NSA program. It continues to the present in Russia, where he as been given a home to stay and a residence permit.
This will keep Snowden safe from capture by the U.S. government agencies, including the NSA, who desire his return to the United States, where he would probably be tried for treason.
Throughout Snowden’s stay in Russia, he has released step by step the troubling documents on how the spying by NSA was conducted and on whom. The releases have been difficult if not impossible for the NSA to handle efficiently.
Spencer Ackerman of The Guardian has the story.
Edward Snowden in Moscow.Photograph: Alan Rusbridger/The Guardian
Citizenfour must have been a maddening documentary to film. Its subject is pervasive global surveillance, an enveloping digital act that spreads without visibility, so its scenes unfold in courtrooms, hearing chambers and hotels. Yet the virtuosity of Laura Poitras, its director and architect, makes its 114 minutes crackle with the nervous energy of revelation.
Poitras, the first journalist contacted by National Security Agency whistleblower Edward Snowden, mirrors her topic. She rarely appears on news programs or chat shows. She is a mysterious character in her own movie, heard more than she is seen.
But surreptitiously, Poitras has been a commander of a stream of disclosures for 16 months that have forced the NSA into a new and infamous era. Citizenfour demonstrates to the public the prowess that those of us who have worked with her on the NSA stories encountered. Her movie, the culmination of a post-9/11 trilogy that spans a dark horizon from Iraq to Guantánamo, is a triumph of journalism and a triumph for journalism.
At its heart, Citizenfour is the story of how Snowden’s disclosures unfolded through Poitras’ eyes, from the first communications Snowden sends Poitras, hinting at what is to come, until Snowden sees himself vindicated through emulation. (The film is named for a pseudonym Snowden used with Poitras.) The time before Poitras meets Snowden is symbolized by a car travelling through a pitch-black tunnel, barely illuminated by the glowing red lights on the ceiling, until sunlight bursts in when she and her colleagues Glenn Greenwald and the Guardian’s Ewen MacAskill arrive in Hong Kong for their fateful encounter.
Edward Snowden, left, with Glenn Greenwald, second from right, David Miranda and Laura Poitras. David MirandaPhotograph: David Miranda
The outlines of that story are now familiar. Snowden, an NSA contractor, provides the journalists with voluminous evidence of industrial-scale surveillance covering much of the planet’s communications, and forecloses on a normal life in the process. Poitras trains her camera on contextualizing both aspects of Snowden’s decision.
Accessibly explaining how surveillance works, and why it matters, only gets more challenging the deeper you dig into the NSA trove. At the Guardian, it consumed exhausting months’ worth of background reporting, verification and endless revisions. Poitras, through Snowden, employs minimal jargon about “selectors” (email accounts, IP addresses, phone numbers, etc). One deft way she demonstrates the breadth of NSA’s reach is to film the security researcher and journalist Jacob Applebaum teaching an Occupy Wall Street crowd about life patterns displayed through their their credit cards, transit passes and phone records – the web of metadata that shows our associations and choices which, out of context, can make us look suspicious. Anyone engaging in modern communications has unsuspectingly provided the NSA with valuable information.
Since June 2013, Snowden has been a cipher to the world, often yielding paranoid reactions (Russian spy! Chinese dupe!) from people understandably curious about his motives. It may be too late to change people’s minds about Snowden, at least so soon after his leaks. But the Snowden who Poitras shows – hair tousled, resisting his attempts at styling it – is determined, sincere and human.
While often portrayed as arrogant, especially by self-interested surveillance bureaucrats, Snowden tells Poitras, Greenwald and MacAskill that he wants journalists and not himself to decide what ought to be public. He is possessed with an uncanny calm as he is about to become forever targeted. Yet Snowden’s eyes redden and his shoulders stoop when he grasps the burden he is placing on his family and girlfriend – with whom he is now reunited in Russia, a place in which he never intended to live.
The film leaves many questions unanswered, such as Wikileaks’ role in Snowden’s drama – Julian Assange is briefly on camera – and Snowden’s circumstances in the authoritarian Russia that has granted him asylum. But Citizenfour shows Snowden vindicated when the film confirms that Greenwald, Poitras and their investigative partner Jeremy Scahill are working with a new security whistleblower, one apparently inspired by Snowden. While understated, Snowden appears thrilled, even moved.
Given the passions that the NSA disclosures have generated, it’s remarkable how tempered Citizenfour comes across. Reflecting a style Poitras seems to share with Snowden, it’s a quiet movie, its soundtrack a sinister digital throb, packed tight with questions about how we live freely in an unseen dragnet. One of its only boisterous moments comes when Snowden and Greenwald discuss the spirit animating both the reporting and Snowden’s decision to reveal himself. Greenwald describes it as “the fearlessness and the fuck-you”.
That fearlessness attracted Snowden to Poitras, and it shows through her camera. | 2023-12-26T01:27:15.642919 | https://example.com/article/8311 |
Evaluating natural infrastructure for flood management within the watersheds of selected global cities.
Cities are dependent on their upstream watersheds for storage and gradual release of water into river systems. These watersheds act as important flood mitigation infrastructure, providing an essential ecosystem service. In this paper we use metrics from the WaterWorld model to examine the flood management-relevant natural infrastructure of the upstream watersheds of selected global cities. These metrics enable the characterisation of different types, magnitudes and geographical distributions of potential natural flood storage. The storages are categorised as either green (forest canopy, wetland and soil) or blue (water body and floodplain) storages and the proportion of green to blue indicates how different city upstream basin contexts provide different types and levels of storage which may buffer flood risk. We apply the WaterWorld method for examining flood risk as the ratio of accumulated modelled annual runoff volume to accumulated available green and blue water storage capacity. The aim of these metrics is to highlight areas where there is more runoff than storage capacity and thus where the maintenance or restoration of further natural infrastructure (such as canopy cover, wetlands and soil) could aid in storing more water and thus better alleviate flood risks. Such information is needed by urban planners, city authorities and governments to help prepare cities for climate change impacts. | 2024-01-14T01:27:15.642919 | https://example.com/article/3605 |
To receive the Newsletter "INVEST IN THE EARTH" ENTER YOUR EMAIL ADDRESS in the box
Compost Leachate
DALTONS (expressed as: 'Da')
Dalton is the measurement standard used to measure the size of atoms. More on Dalton later...
DISSOLVED ORGANIC MATTER (expressed as DOM)
DOM does not include suspended/colloidal particulate matter. More on DOM and OM later...
This topic begins by first presenting a scientific report about leachate - mainly becauseALL composters should be able to say that they have 'reviewed' a scientific report about "leachate" - about which, this report is 'typical'.
Secondly, ONLY quickly scan pages 27-39 of the following scientific report.
Do not attempt to actually read it, for several reasons: 1) because unless you made straight A's in advanced chemistry, it may make you permanently 'cross-eyed'. 2) as the first sentence of the Executive Summary states: it's only a RE-HASH of their selection of previously-published information - meaning that there is no new scientific evidence in this report. 3) this study (as in almost all research studies about leachate) is mainly concerned with 'heavy metals' and synthetic Ag chemical pesticides that might leach into soil and/or water tables - i.e., bad things - so the report contains not even one mention of the benefits of leachate derived from high-quality compost. 4) the compost used for testing was commercially-produced (meaning poor quality) using Municipal Solid Waste and sewage sludge known to contain high amounts of heavy metals (which few 'backyard' composters have access to) - and also, in this case - the compost feedstock recipe also contained 15% tobacco plant residues - which again, is NOT available to persons who produce high-quality compost via intensive management. 5) this report is not correlated with any plant-growth parameters - which is what GOOD compost leachate is all about. Nature has a rule: "plants can not lie - so if one wants to know how a plant responds to a given product - give it some. It will tell you, IF' you know it's 'language'...
Having scanned those 13 pages, you should "have a better idea" of what one group of researchers from Washington University, has to say about BAD compost leachate.
If you are really 'into' scientific reports, then sure, go ahead and read the entire scientific study - I highly recommend doing so IF you have any intention of selling some of your leachate to anyone.
For the readers who don't appreciate such "technical report" writing style - I'll do my best to explain it to you without most of the technical jargon (except the ones you need to know) - and apply that information to HOW a leachate blend is made correctly and HOW to use it properly - information that you won't find in any existing scientific report.
So why is compost leachate not promoted more?
If you have been composting for awhile - and are fairly "well-read" on the subject, don't you find it interesting that you almost never read about the benefits of compost leachate(as Nature's plant fertilizer) in mainstream books, articles and even by state Agricultural Extension Services?
Ever wonder why?
As indicative of this scientific report, it's mostly because in both the commercial and Municipal Solid Waste (MSW) industry - the word "leachate" is a 'bad word'. Negative reputation. Why? Because leachate, in the MSW industry - is, scientifically - AWFUL stuff. Landfill leachate being the worst. And leachate from raw sewage waste (Oh - excuse me - 'bio-solids' is the 'new name' so people won't think the U.S. Composting Council is 'pushing' a bad product on the public...) is not far behind.
Leachate is something the MSW industry (regulated by a state environmental agency) does not talk about to "the public" unless 'forced' to do so.
And the Agricultural Extension Service (being a state agency pawn), doesn't want to "step on any MSW toes"...
And same goes for the global pollution and erosion woes created by the greedy Ag synthetic chemical companies that donate $$millions annually into land grant (& other) university coffers to keep them 'resistant' to researching and promulgating large-scale organic Ag practices.
All of which, is the main basis of state government's penchant to "play politics" - to 'cover their own ass' for failure to be more proactive about ensuring citizen health.
If agencies talked about GOOD leachate - they'd also raise questions about BAD leachate - from their own poor waste management practices - that endanger human health. Go figure...
I've spent over 60 years engendering highest-quality composting (quality expressed as the health of Nature's synergistic microbiological community that performs 95+% of the feedstock decomposition (nutrient-cycling & disease control) process. I'm not one of the scientists that knows the most about who those tiny critters are - or what they can do as a synergistic community - but I am one of the very few that knows enough about that community - and Nature's 'rules' - to take Nature's microbial benefits out of the lab and into the field - at 500 hectares/day - to bring microbial health back to 'bad dirt' quickly and cost-effectively - to grow thriving plants in that dirt again.
As a scientist/researcher/inventor/product developer, I focus attention on the scientific community pertaining to this realm. And have yet to see anycomplete scientific report about the benefits of good compost/vermicompost leachate from a microorganism or edible plant perspective.
Mostly because such studies are very expensive - to the point only the government (via USDA grant) or a pentamillionaire can pay for a full study. So until I meet a super-wealthy person who cares to fund a portion of such study, I will continue to seek award of a federal grant to make it happen, in conjunction with an organically-minded university Ag department leader such as Texas State University's Dr. Tina Cade.
When that happens, it will change the face of the commercial and private composting industries - because it will change the mentality of the organic product consumers toward understanding how Nature functions to grow enough food for this planet's human/livestock populations.
Even more reason - that the SoilGuy's science-based; no BS; "get-down-n'dirty" / "plants can't lie" 'how-to' approach - should the reasons you should commit to learning and following the guidelines posted on this site.
And because intensively-managed composting achieves the 1) highest quality, via the 2) easiest methods, in the 3) shortest time and at the 4) least cost.
And that's just for starters...
GOOD leachate from compost (and vermicompost) is an essential part of composting science and the art of organically feeding plants - so they can achieve their highest genetic potential (thrive).
Another focus of intensive compost management by 'state of the art' leaders is the continuous striving to cost-effectively automate the process (as much as possible). I am proud to be one of those leaders. | 2023-11-12T01:27:15.642919 | https://example.com/article/6471 |
//
// HMAlbum.m
// HMImagePicker
//
// Created by 刘凡 on 16/1/26.
// Copyright © 2016年 itheima. All rights reserved.
//
#import "HMAlbum.h"
@implementation HMAlbum {
/// 当前相册资源集合
PHAssetCollection *_assetCollection;
/// 当前相册内的资源查询结果
PHFetchResult *_fetchResult;
}
@synthesize desc = _desc;
#pragma mark - 构造函数
+ (instancetype)albumWithAssetCollection:(PHAssetCollection *)assetCollection {
return [[self alloc] initWithAssetCollection:assetCollection];
}
- (instancetype)initWithAssetCollection:(PHAssetCollection *)assetCollection {
self = [super init];
if (self) {
// 设置查询选项
PHFetchOptions *options = [[PHFetchOptions alloc] init];
// 仅搜索照片
options.predicate = [NSPredicate predicateWithFormat:@"mediaType = %d", PHAssetMediaTypeImage];
// 按照创建日期降序排列照片
options.sortDescriptors = @[[NSSortDescriptor sortDescriptorWithKey:@"creationDate" ascending:NO]];
_assetCollection = assetCollection;
_fetchResult = [PHAsset fetchAssetsInAssetCollection:assetCollection options:options];
}
return self;
}
#pragma mark - 只读属性
- (NSString *)title {
return _assetCollection.localizedTitle;
}
- (NSInteger)count {
return _fetchResult.count;
}
- (NSAttributedString *)desc {
if (_desc == nil) {
NSMutableAttributedString *attributedString = [[NSMutableAttributedString alloc] init];
[attributedString appendAttributedString:
[[NSAttributedString alloc] initWithString:_assetCollection.localizedTitle]
];
[attributedString appendAttributedString:
[[NSAttributedString alloc]
initWithString:[NSString stringWithFormat:@"\n%zd", _fetchResult.count]
attributes:@{NSFontAttributeName: [UIFont systemFontOfSize:14]}]
];
_desc = attributedString.copy;
}
return _desc;
}
#pragma mark - 相册列表调用方法
- (UIImage *)emptyImageWithSize:(CGSize)size {
UIGraphicsBeginImageContext(size);
[[UIColor whiteColor] setFill];
UIRectFill(CGRectMake(0, 0, size.width, size.height));
UIImage *result = UIGraphicsGetImageFromCurrentImageContext();
UIGraphicsEndImageContext();
return result;
}
- (void)requestThumbnailWithSize:(CGSize)size completion:(void (^)(UIImage * _Nonnull))completion {
dispatch_group_t group = dispatch_group_create();
// 加载 3 张图像,生成缩略图
NSMutableArray *images = [NSMutableArray array];
CGSize imageSize = [self sizeWithScale:size];
PHImageRequestOptions *options = [self imageRequestOptions];
for (NSInteger i = 0; i < 3 && i <= (_fetchResult.count - 1); i++) {
PHAsset *asset = _fetchResult[i];
dispatch_group_enter(group);
[[PHImageManager defaultManager]
requestImageForAsset:asset
targetSize:imageSize
contentMode:PHImageContentModeAspectFill
options:options
resultHandler:^(UIImage * _Nullable result, NSDictionary * _Nullable info) {
[images addObject:result];
dispatch_group_leave(group);
}];
}
dispatch_group_notify(group, dispatch_get_global_queue(0, 0), ^{
UIImage *result = [self thumbnailWithImages:images size:imageSize];
dispatch_async(dispatch_get_main_queue(), ^ { completion(result); });
});
}
- (void)requestThumbnailWithAssetIndex:(NSInteger)index Size:(CGSize)size completion:(void (^)(UIImage * _Nonnull))completion {
PHAsset *asset = _fetchResult[index];
[[PHImageManager defaultManager]
requestImageForAsset:asset
targetSize:[self sizeWithScale:size]
contentMode:PHImageContentModeAspectFill
options:[self imageRequestOptions]
resultHandler:^(UIImage * _Nullable result, NSDictionary * _Nullable info) {
completion(result);
}];
}
/// 使用图像数组生成层叠的缩略图
///
/// @param images 图像数组
/// @param size 图像尺寸
///
/// @return 层叠缩略图
- (UIImage *)thumbnailWithImages:(NSArray <UIImage *> *)images size:(CGSize)size {
UIGraphicsBeginImageContext(size);
CGContextRef ctx = UIGraphicsGetCurrentContext();
CGFloat margin = 3.0 * [UIScreen mainScreen].scale;
NSInteger index = 0;
for (UIImage *image in images.reverseObjectEnumerator) {
CGContextSaveGState(ctx);
CGFloat top = index * margin;
index++;
CGFloat left = (images.count - index) * margin;
UIRectClip(CGRectMake(left, top, size.width - left * 2, size.height - top));
CGFloat x = (size.width - image.size.width) * 0.5;
CGFloat y = (size.height - image.size.height) * 0.5;
CGRect rect = CGRectMake(x, y, image.size.width, image.size.height);
[image drawInRect:rect];
CGContextRestoreGState(ctx);
}
UIImage *result = UIGraphicsGetImageFromCurrentImageContext();
UIGraphicsEndImageContext();
return result;
}
- (PHAsset *)assetWithIndex:(NSInteger)index {
if (index >= _fetchResult.count || index < 0) {
return nil;
}
return _fetchResult[index];
}
- (NSUInteger)indexWithAsset:(PHAsset *)asset {
return [_fetchResult indexOfObject:asset];
}
- (CGSize)sizeWithScale:(CGSize)size {
CGFloat scale = [UIScreen mainScreen].scale;
return CGSizeMake(size.width * scale, size.height * scale);
}
/// 图像请求选项
- (PHImageRequestOptions *)imageRequestOptions {
PHImageRequestOptions *options = [[PHImageRequestOptions alloc] init];
// 设置 resizeMode 可以按照指定大小缩放图像
options.resizeMode = PHImageRequestOptionsResizeModeFast;
// 只回调一次缩放之后的照片,否则会调用多次
options.deliveryMode = PHImageRequestOptionsDeliveryModeHighQualityFormat;
return options;
}
@end
| 2023-08-24T01:27:15.642919 | https://example.com/article/4571 |
1. Field of the Invention
The present invention relates to a plotter which automatically depicts figures, characters etc. on the surface of a sheet or automatically cuts the contours of figures, characters etc. in the surface of a sheet while moving the sheet on a recording surface. More particularly, it relates to improvements in a sheet feed mechanism which moves the sheet, such as a roll of paper, on the recording surface.
2. Description of the Related Art
There has been well known a plotter called the paper moving type wherein, a sheet is placed on a laterally-long recording surface having a vertical section substantially in the shape of a circular arc and in which a pen or the like type of writing utensil or a cutter grasped by a pen carriage is touched down to the surface of the sheet placed on the recording surface. The pen carriage is moved in the lateral direction, namely, X direction of the recording surface on the sheet while the sheet is being moved in the widthwise direction, namely, Y direction of the recording surface on this recording surface, thereby to automatically depict a figure, a character or the like on the sheet surface with the writing utensil or to automatically cut the contours of a figure, a character or the like in the sheet surface with the cutter.
In the plotter, sets of rollers in each of which a drive roller and a pinch roller are opposed to each other are respectively mounted at both the sideward parts of the recording surface so as to be rotatable in the Y direction. Herein, in the state in which both the side edges of the sheet are held between the drive rollers and the corresponding pinch rollers at both the sideward parts of the recording surface, the drive rollers are rotated in the Y direction, thereby to move the sheet in the Y direction on the recording surface.
However, in the case where the sheet is moved in the Y direction on the recording surface in the above way, it wobbles or meanders rightwards and leftwards on the recording surface. Then, the figure, the character or the like depicted on the sheet surface or the contours of the figure, the character or the like cut in the sheet surface become(s) distorted. The appearance of the distortion is conspicuous especially on the occasion that the sheet is a roll of elongated paper and that it is moved in the Y direction on the recording surface over a long distance.
This drawback is ascribable to the fact that the substantial outer diameter of the drive roller mounted at each sideward part of the recording surface is subtly different in the individual places of the peripheral surface of the drive roller, or that either or both the side edges of the sheet held between the drive rollers and the corresponding pinch rollers mounted at both the sideward parts of the recording surface undergoes a slip or the like on the peripheral surface of the drive roller due to any cause.
Incidentally, there has been a plotter wherein, in order to prevent a sheet from wobbling and moving on a recording surface as stated above, small holes are formed at predetermined pitches in both the side edges of the sheet, while sprockets for feeding the sheet are mounted at both the sideward parts of the recording surface so as to be rotatable in a Y direction (the feed direction of the sheet). Herein, the sprockets are rotated in the Y direction while their teeth are being brought into engagement with the small holes in both the side edges of the sheet, whereby the sheet is moved in the Y direction on the recording surface without wobbling.
The plotter, however, can use only the special sheet which is formed with the small holes in both the side edges thereof. Moreover, since the sheet requires a greater width and a stage of work for forming the feeding small holes in both the side edges thereof, it becomes costly to those extents. | 2024-03-25T01:27:15.642919 | https://example.com/article/8837 |
The Heterogeneity of Oral Immunotherapy Clinical Trials: Implications and Future Directions.
Food allergy is a potentially life-threatening disease which affects up to 8% of children and 2-3% of adults. Increasing food allergy prevalence poses a major public health concern. Induction of desensitization to food allergens through oral immunotherapy (OIT) is an expanding area of study encompassing peanut, egg, milk, and other food allergens. OIT consists of administering incremental doses of food allergen to food-allergic patients, to induce a state of desensitization. Safety, tolerability, and efficacy all remain ongoing concerns. Clinical trials for oral immunotherapy have encompassed many variations, including differences in dosage sizes and frequency, duration of build-up, type of allergen used, patient characteristics, and adjuvant therapies. Consequently, studies have also shown variation in rates of adverse effects, and successful desensitization. Here, we provide an overview of the key studies and discuss the implications of this heterogeneity. While desensitization is successful in the majority of patients, only a minority appear to develop sustained unresponsiveness even after years of therapy. Much larger and longitudinal studies using more homogenous protocols are needed in order to evaluate the clinical applicability of OIT, its long-term effectiveness, and effect on quality of life. The role of adjunctive therapies, including omalizumab and probiotics, requires further evaluation. | 2024-06-07T01:27:15.642919 | https://example.com/article/4599 |
Introduction
With Codeforces API you can get access to some of our data in machine-readable JSON format.
To access the data you just send a HTTP-request to address http://codeforces.com/api/{methodName} with method-specific parameters. Each method description has an example URL.
Each method call returns a JSON-object with three possible fields: status, comment and result.
Status is either "OK" or "FAILED".
If status is "FAILED" then comment contains the reason why the request failed. If status is "OK", then there is no comment.
If status is "OK" then result contains method-dependent JSON-element which will be described for each method separately. If status is "FAILED", then there is no result.
API may be requested at most 5 times in one second. If you send more requests, you will receive a response with "FAILED" status and "Call limit exceeded" comment.
Language-depended fields like names or descriptions will be returned in the default language. Also, you can pass additional parameter lang with values en and ru to select the language of the result.
Authorization
All methods can be requested anonymously. This way only public data will be accessable via API. To access data, private for some user (e.g. hacks during the contest), API key must be generated on http://codeforces.com/settings/api page. Each API key has two parameters: key and secret. To use the key you must add following parameters to your request.
apiKey — it must be equal to key
time — current time in unix format (e.g., System.currentTimeMillis()/1000). If the difference between server time and time, specified in parameter, will be greater than 5 minutes, request will be denied.
apiSig — signature to ensure that you know both key and secret. First six characters of the apiSig parameter can be arbitrary. We recommend to choose them at random for each request. Let's denote them as rand. The rest of the parameter is hexadecimal representation of SHA-512 hash-code of the following string: <rand>/<methodName>?param1=value1¶m2=value2...¶mN=valueN#<secret> where (param_1, value_1), (param_2, value_2),..., (param_n, value_n) are all the request parameters (including apiKey, time, but excluding apiSig) with corresponding values, sorted lexicographically first by param_i, then by value_i.
For example:
If your key is xxx, secret is yyy, chosen rand is 123456 and you want to access method contest.hacks for contest 566, you should compose request like this: http://codeforces.com/api/contest.hacks?contestId=566&apiKey=xxx&time=1548105086&apiSig=123456<hash>, where <hash> is sha512Hex(123456/contest.hacks?apiKey=xxx&contestId=566&time=1548105086#yyy)
JSONP
JSONP is supported. Add jsonp parameter to the query and the result will be returned as JavaScript function call.
For example, if jsonp parameter is parseResponse and method returned object {"status":"OK","response":"..."}, then final result is parseResponse({"status":"OK","response":"..."});. | 2023-08-11T01:27:15.642919 | https://example.com/article/7744 |
News
Water and Catchment Legislation Amendment Bill 2017
14 December 2017
It is a pleasure to rise today to speak on the Water and Catchment Legislation Amendment Bill 2017. The coalition has two primary concerns with this bill, the first being the decision by the government to delay the long-term water resource assessment for northern Victoria. Our second concern is the government's decision to legislate changes to the salinity impact charges in the Mallee region without conducting a regulatory impact statement. I will go into those two issues in more detail, but I do wish to advise that the Liberals and Nationals are moving a reasoned amendment to the effect that the bill should be withdrawn until those two issues are addressed.
I move:
That all the words after 'That' be omitted with the view of inserting in their place the words 'this house refuses to read this bill a second time until there is a regulatory impact statement completed on the bill's proposed regime for salinity impact, and until the government agrees to revert to the original time frame with respect to reviewing northern Victoria's long-term water assessment plan for 2018'.
Firstly, I would like to address some of the context around this bill. I do note that this is the first bill within the water space in three years that the government has in fact brought forward. I certainly reflect on the fact that the Minister for Water has other portfolios and no doubt is quite busy, but I do think it reflects a real lack of emphasis or care from the Andrews government in addressing water issues. I do want in particular to acknowledge the departmental officials who took the time to brief me on the details of this bill. I appreciate the work and the effort that have gone into preparing this and preparing the government's plan Water for Victoria.
It is perhaps particularly relevant to note that when the Liberals and Nationals were in government we undertook a complete rewrite of the Water Act 1989. It was a huge undertaking and one that was quite exhaustive. It was actually sitting there ready to go when the minister was first elected. I think it is somewhat disappointing that Labor actually shelved that work rather than bringing it forward, and as a consequence a lot of time and energy has been wasted. Essentially I think for three years we have not really been going anywhere.
Of course the government took a full two years to write its strategy Water for Victoria, which it released in October 2016, and it has taken more than a year from that point for us to actually see the first tranche of legislation be brought forward to implement its priorities. I understand that this is the first bill of several that will be seeking to implement the 69 actions that the government has identified under its Water for Victoria plan, but even then, when there is a debate raging, particularly in northern Victoria about the future of those communities and about the Murray-Darling Basin plan and its implementation, I would question the comparative importance of some of the issues that are being brought forward by the government in this bill.
I will give what I think is a tangible example of this: the recent coverage we have seen of water theft within the basin. On Saturday the Murray-Darling Basin Authority (MDBA) released its review into compliance within the basin, which was sparked by the Four Corners report back in July which revealed some awful practices in the upstream states, where people have illegally been taking water. The minister has, I see in Monday's Australian, flagged that she sees a need for tougher penalties. After the compliance review, the Australian reported that:
Victoria was found to have better compliance but insufficient penalties for those who break the rules. Tougher penalties are being drafted.
Given that the minister has flagged the need for tougher penalties, I would have thought that she would perhaps have considered going back to the vast amount of work that the Liberals and Nationals actually did in government around the rewrite of the Water Act, which in fact would have enforced a tougher compliance regime. If she had picked up that work upon coming to government, we would have already had a regime in place that addressed the substance of the issues in the compliance review.
I certainly note that the findings of the compliance review showed that Goulburn-Murray Water has a very strong commitment to compliance and that their compliance is underpinned by sound governance arrangements. The MDBA in particular pointed to the fact that within the Goulburn Murray irrigation district we are dealing largely with a networked system where water theft is not just something that I suppose an individual might be seen as committing against the state; it is actually seen as a crime against the neighbour because everybody relies so heavily on the resources within that networked system. So I do want to point out the fact that there was a stark difference between states within that compliance review. The MDBA noted that in 2016–17 New South Wales issued about 44 warning letters and notices, Queensland issued 14 and South Australia issued 355, but in Victoria there were 562 issued. So it is apparent that Victoria and Victorian irrigators are doing the work that is required, but I feel that our reputation has somewhat been unfairly tarnished because the actual penalties that are in place were criticised by the MDBA.
Had the minister actually picked up the review of the Water Act when she came to government, we would found that that enforcement regime and those penalties would in fact already be in place. Chapter 13 of that bill — we had gone through the process of undertaking the exposure draft for that bill; it was virtually ready for introduction into Parliament — would have introduced new remedial action notices and infringement notices which could apply to a broad range of offences under the bill and regulations as well as body corporate penalties.
Part 13.3 specified that an authority or an authorised water officer could serve a remedial action notice on an owner or occupier of land if there was a specified risk, including, and I particularly note this, a risk of an adverse impact on the quality or availability of water, a risk of an adverse impact upon the environment or indeed a risk of damage to neighbouring properties. They are the very issues we have seen through that Four Corners report and the illegal theft of water in upstream states. So I do make the point that it has taken us a very long time, I think, to get to the point of having legislation in the space being brought forward. I think that the minister should be held to account for actually shelving that work for purely partisan reasons.
I do note that the government even in its plan, Water for Victoria, at page 129, actually acknowledges that Victoria's compliance and enforcement regime is outdated. Action 8.5 says quite a lot about consistency and best practice regulation, but it does not actually say a lot about what the government intends to do. So I think we have a situation now where the minister is in fact scrambling to catch up. That is disappointing, particularly for Victorian irrigators whose reputations have been affected by that.
One of the substantial aspects of this bill is the fact that it seeks to include Aboriginal values and knowledge in water resources and waterway planning. The bill includes specific requirements about how water authorities and the department actually go about consulting with Aboriginal Victorians in its water resource planning. That is done in a number of ways, depending on the instrument that is being prepared by the department or the water authority at the time. The bill requires that the minister give notice to a representative of relevant specified Aboriginal parties and invites written submissions when they are preparing a regional water strategy, which is set out in clause 45; when they are preparing a sustainable water strategy, which is set out in clauses 7 and 9; and when they are preparing a regional catchment strategy or a special plan, under clauses 85 and 86.
When the department is seeking to prepare a supply protection plan, the bill specifies that a consultative committee must include one person who represents all specified Aboriginal parties under clause 19 of the bill. Clauses 13 and 18 state that consultative committees must consist of one Aboriginal Victorian with knowledge or experience in water management when providing advice on either a sustainable water strategy or a long-term water resource assessment.
I can see how those consultation requirements could be of particular benefit in places like Kow Swamp. I remember visiting Kow Swamp a lot as a teenager. It is an off-stream water storage operated by Goulburn-Murray Water between Gunbower and Leitchville, south of the Murray, which has been used as a water storage since 1900. It is an important part of the Torrumbarry system and it is of great value to Torrumbarry irrigators, particularly because as one of those mid-Murray storages it enables the timely delivery of water to the western part of the Goulburn-Murray irrigation district (GMID).
Delivery of water from the Hume Dam takes quite some time if you are in the western reaches of the GMID, and storages like Kow Swamp ensure that there is timely delivery and give flexibility to those irrigators. Over the years it has been modified significantly, particularly since the construction of Torrumbarry Weir where I spent many a summer waterskiing as a teenager. It is also very important to note that Kow Swamp has an important Aboriginal history as a sacred resting place for ancestors of the Yorta Yorta people. The remains there were discovered between 1968 and 1972. They are the remains of Pleistocene-era Aboriginal people and are believed to be more than 20 000 years old.
So there are sites within the water space of Victoria which remain important for Aboriginal people and I think it makes sense for them to have input into the management of a site such as Kow Swamp. I think that also needs to be balanced against the fact that water policy is incredibly complex. There are of course livelihoods that depend on the management of water and the primacy of entitlements must always be respected and managed accordingly. Those two things certainly need to be balanced, but I think the inclusion of Aboriginal people in determining and providing an input into those plans can be seen as a good thing in places like Kow Swamp, where there is a very strong interest in ensuring that those sites are preserved and their significance is recognised.
In terms of the Victorian environmental water holder, this bill adds a legislative obligation that they will also now be required to consider opportunities to provide for Aboriginal cultural values and the uses of waterways as well as social and recreational uses. That is the other major aspect of this bill — that water authorities will now have to recognise the recreational possibilities of the water they manage. I think that represents quite a major shift in how water is managed in Victoria. I do not doubt that there are some places where water can be managed more effectively. One that springs to mind for me is the pondage at Eildon, where there are tourism operators who certainly derive great value from the GMID asset there.
Whilst I think it is a good thing for our water authorities to be more public-facing in many ways, I think the government needs to be very careful that it does not set a lot of our water authorities on a path of conflict in the longer term with communities. I can see that there is a potential for that to occur with some of these changes. The issue that perhaps comes to mind for me is Lake Eppalock, which is in my own electorate. In 2016 there were significant issues for the communities around Lake Eppalock, in particular Heathcote and Axedale, where the needs of tourism operators and indeed business owners in the town came into conflict with the environmental needs and the call that irrigators had for the water within that storage. There was an article published in the Bendigo Advertiser titled 'Dry Lake Eppalock spells trouble for traders' which told the story of Tracey Westhorpe. She described how she had moved from Melbourne and how Eppalock had been a great source of revenue for her with her store, particularly over the summer months, but when water was low in Eppalock that business disappeared.
There is a fundamental issue there, I think. It presents a very difficult problem for those communities, who are not always aware that the water that is held in storage, like at Lake Eppalock, is held under entitlement and is owned by people who do have the right to make a call on those entitlements. I acknowledge the fact that the government has addressed the fact that entitlements maintain their primacy, but there is a danger of encouraging tourism and encouraging business to grow around the recreational values of a lake or waterway when people do not always understand that that water may not be there. So I would certainly urge the government to think about how it goes about communicating that.
The other issue I have is that I think it runs the risk of dragging water authorities away from their core business, which is delivering water efficiently and at a low cost. We need to remember that livelihoods depend on the delivery of water. It is incumbent upon water authorities to maintain that firmly as their primary mission. By placing a whole new set of obligations on them we run the risk of them taking their eye off the ball.
I moved the reasoned amendment earlier in my contribution. As far as the long-term water resource assessments go, the bill extends the assessment for northern Victoria out to 2026. Clause 14 extends the time to conduct the assessment from 12 months to 18 months. I am not so fussed about the extension of time — I think it is important that we take the time to get that right — but the Water Act does specify that those resource assessments are required every 15 years. They are important because they take stock of our water resources and they are designed to use the best available data to determine what the long-term availability of water is in those communities.
Presently that process is due to commence next year in both northern and southern Victoria, and the government's rationale for moving that assessment back is that the Murray-Darling Basin Authority (MDBA) is due to undertake its review of the southern basin in 2026. My concern about that is that we are kicking the can down the road on that assessment. I think that rather than simply accepting that the MDBA is not going to review the southern basin until 2026, we should in fact be positioning ourselves to have the best available data early and we should perhaps be acting in the interests of Victorians and calling for that review to be undertaken before 2026. My understanding of the act is that the review is required by 2026, but that does not mean it has to be pushed out for another eight years.
I have had conversations with irrigators across the southern basin, and many of them are calling for us to take stock of where we are at. I think we abrogate ourselves of our responsibility. Whilst it might be the politically easy option, we are taking our eyes off the ball if we just push that assessment out for another seven years. We are going through one of the greatest changes in the history of water in this country. We are implementing one of the most complex pieces of legislation, and we need to make sure it is done correctly. We need to make sure that we have the data that is required for us to position Victoria's interests and to ensure that we can make the socio-economic case for not losing more water from the basin. My concern is that if we simply say, 'Okay, MDBA are not going to undertake this review until 2026, and we'll push our assessment out until then as well', we disadvantage ourselves by effectively shutting our eyes and hoping that all will be well when the time comes for the MDBA to undertake that review. We need to know where we stand ahead of the evaluation of the southern basin.
The second major issue we have with this bill is the decision to legislate the salinity impact charges in the Mallee to allow those charges to be collected by the water authority or by the catchment management authority (CMA). Water for Victoria I see acknowledges the salinity issues in the Mallee, but it makes no mention of the amendment that the government has proposed to actually give the CMA or the water authority the power to collect those salinity impact charges on behalf of the minister.
The salinity impact zones were first set up in 1993. There was a Nyah to South Australian border salinity management plan that was implemented then, and it was reviewed in 2002. But there is a lot that has changed within the lower reaches of the Murray in the Sunraysia district since those salinity impact zones were first created. There has been a vast amount of water that has moved downstream, and perhaps most significantly we now have environmental flows on a scale that was not there when those charges were first brought in. So I think it is somewhat short-sighted of the government to just legislate these charges into perpetuity. I think a better approach would be to stop and actually review the charges to ensure that they are current, are necessary and are doing what they were set up to do.
Primarily I think the government should be undertaking a regulatory impact statement (RIS) before it moves to legislate those charges. My understanding is that the department are not yet certain whether a RIS is required, but their advice was that they would seek to undertake a RIS should one be required after the bill passes. Fundamentally I think that is poor public policy. I think a RIS should be undertaken first and then that should be brought forward when we have a full understanding of what the impact of that might be. I do understand that the salinity impact zones already exist, but there is no sense in simply legislating that when there is so much that has changed in the Mallee in the last 10 years since those charges were reviewed in 2002.
In conclusion, I know that to the majority of people a lot of these changes might seem bureaucratic, but I think when it comes to the implementation of the basin plan we cannot afford to get it wrong. The basin is home to more than 2 million Australians. It produces 40 per cent of the nation's agricultural produce in dollar terms. It is a critical environment to much of our native flora and fauna, and it is incumbent upon on us to address the health of the basin and to address the risks of climate change. Getting right the balance between that and the needs of our productive communities and the people who live within the basin is not always an easy thing to do, but I think that the best way for us to move forward is to undertake that water resource assessment according to our regional time frame. Perhaps that assessment will also consider the implementation of salinity charges as well. So there is the prospect, perhaps, that the government might kill two birds with one stone if it goes ahead and maintains the long-term water resource assessment in line with its original plan for 2019.
With those comments I urge those on the opposite side to give consideration to the reasoned amendment. I recognise that the Murray-Darling Basin is a long way from many of their electorates, but it is fundamentally an issue that is critical not just to the future of the communities that live there but also to the future of our state and of our nation. | 2023-08-05T01:27:15.642919 | https://example.com/article/6034 |
Scott Pixley sits in his home with his parents Marvin and Kandy Pixley in Strafford, Vt., on Wednesday, Oct. 31, 2018. Pixley, who works as a dishwasher at Kendal at Hanover, lives with his parents and says most of his savings go toward taking care of them and their home. (Valley News - August Frank) Copyright Valley News. May not be reprinted or used online without permission. Send requests to permission@vnews.com.
Scott Pixley chuckles at the situation he's found himself in as he sits with his father, Marvin Pixley, at his home in Strafford, Vt., on Wednesday, Oct. 31, 2018. Pixley was arrested by Hartford police on suspicion of driving under the influence of drugs. Blood tests that came back recently found the only drugs in his system were caffeine and a prescribed antidepressant he's been taking for 10 years. (Valley News - August Frank) Copyright Valley News. May not be reprinted or used online without permission. Send requests to permission@vnews.com.
Scott Pixley stands outside his home in Strafford, Vt., on Wednesday, Oct. 31, 2018, while his dog Dash watches from the window. (Valley News - August Frank) Copyright Valley News. May not be reprinted or used online without permission. Send requests to permission@vnews.com.
One morning in July, Scott Pixley left the aging mobile home he shares with his parents in the back hills of Strafford a bit earlier than usual.
Before starting his shift as a dishwasher at Kendal, the upscale senior living community in Hanover, Pixley needed to run an errand. His parents — both disabled and unable to drive — had prescriptions at the Walmart pharmacy in West Lebanon ready for pickup.
At about 10 a.m., Pixley was driving his 2007 Chrysler minivan on Route 14 between Sharon and Hartford. Unbeknownst to Pixley, the driver in the car behind him was videotaping him.
The driver, James Bean, of Enfield, called 911 to report Pixley for “erratic driving.” In his statement to Hartford police, Bean wrote, “on several occasions the van crossed the center line. More than once the van was more than halfway into the oncoming lane.” (Bean later showed his recording to Hartford police.)
Bean, 49, said he lost sight of the minivan when it turned onto the VA Cutoff Road. Hartford Officer Aleya Leombruno happened to be patrolling nearby when she saw a blue minivan “cross over the center line.”
She flipped on her cruiser’s blue lights and pulled Pixley over in the parking lot of Airgas, a welding supply store, not far from the Hartford police station. Another officer, acting Sgt. Sean Fernandes, arrived on the scene shortly thereafter.
This is when Pixley made the mistake that many people do when stopped by police — he answered the officers’ questions without consulting a lawyer. According to Leombruno’s affidavit, Pixley told her that he was tired from working a lot and caring for his parents. “He also reported getting approximately 4-5 hours of sleep a night,” she wrote.
When Leombruno, who has worked in Hartford for five years, asked about any medications that he was taking, Pixley volunteered the brand names. At the top of his list was the antidepressant Effexor.
Pixley, 42, is among millions of Americans (1 in 13 people age 12 and older, according to a 2017 report from the National Center for Health Statistics) who are prescribed medication to treat depression as well as anxiety.
Pixley was diagnosed with depression as a teenager and has been taking Effexor for about 10 years under the care of the same Dartmouth-Hitchcock internal medicine physician.
On the day he was pulled over, Pixley had taken his daily dose of two pills like he does at about 8 every morning. The medication “keeps me at a level that I can function,” he told me. “I’m not so anxious.”
After being stopped, Pixley agreed to a series of field sobriety tests. He said that he told the officers about having trouble with his balance. Years ago, when working at an auto parts shop, a car backed over his left foot. Standing on one foot, would be hard for him, he said. Leombruno didn’t mention the injury in her report.
After completing the field tests, Leombruno asked Pixley to provide a breath sample to “rule out any intoxicating liquors.” Again, he obliged. In her affidavit, Leombruno stated the roadside Breathalyzer test showed a reading of .000 percent.
With the results of the Breathalyzer test clearly indicating that he had not been drinking, Pixley figured his biggest problems were behind him. He had already acknowledged that he was driving without insurance on his vehicle.
“I didn’t have the money for insurance, but that’s no excuse,” he told me. He expected to be issued a ticket and maybe even have his vehicle impounded.
“But the next thing I knew, they were putting my hands behind my back in handcuffs and stuffing me in the police car,” Pixley said.
He was arrested on suspicion of driving under the influence.
At the Hartford police station, Pixley, still in handcuffs, was placed in a holding cell.
“I felt like I had done nothing wrong, but here I was sitting in a cell,” he said. “All I could think was that seven years of working (at Kendal) was going out the window.”
Later in the day (Leombruno’s affidavit doesn’t give a time), State Police Trooper Jesse Robson arrived at the station to put Pixley through another round of sobriety tests.
Robson is among about 60 police officers in the state who are known as police drug recognition experts. It’s puzzling how anyone qualifies as an “expert” after only 72 hours of classroom instruction, but that’s all Vermont requires. (More on that in a bit.)
Among other things, Robson checked Pixley’s vital signs and examined his eyes, which would supposedly help determine whether he’d been using drugs. He was also checked for needle marks.
Pixley was then asked to provide a blood sample. Once more, he went along with the cops’ request. A handcuffed Pixley was again placed in the back of the cruiser — this time bound for Mt. Ascutney Hospital in Windsor.
His blood would be tested for, among other things, cocaine, fentanyl and cannabinoids — the chemicals found in marijuana. But the results of the lab tests wouldn’t be available for a while — months, in fact.
Back at the Hartford station, Pixley waited in the lobby for his sister, who picked him up around 3 p.m. It was too late for him to go to work, and he’d miss the next day, as well, to get his car out of the impound lot.
The fee was $220 — money he didn’t have. But when a Strafford couple heard of his predicament, they offered to help. (The same couple told me about Pixley’s arrest.)
I met Pixley, who at 6 feet tall and 265 pounds is a big guy, in early August. He told me that growing up in Strafford, he had struggled in school from any early age.
“I’ve always had learning issues,” he said. “I got held back in kindergarten.”
When he was in third grade, his mother, Kandy, received a call from an irate teacher. During a spelling bee, Pixley was asked to spell “shirt” in front of the class. He left out a key letter. The teacher was sure he’d done it intentionally.
Starting in elementary school, Pixley was diagnosed with severe learning disabilities that qualified him for an individual educational program, better known as an IEP.
At 16, he quit high school. “Everything was so hard,” he said. “I just stopped caring.”
His mother suspected that he could be suffering from depression. “It’s something that runs in the family,” she said. She had a brother who had killed himself in 1992 — a few years before her son dropped out of school.
Her son would “go into his room and stay there,” she said.
“I’d play video games for hours,” he told me. “It was my escape.”
Kandy Pixley took her son to the Clara Martin Center, a nonprofit that provides mental health services, where he was diagnosed with depression. He also started counseling. By the time he was 18, he felt well enough to return to school.
He took vocational classes at the Hartford Area Career and Technology Center, earning his degree from Hartford High in 1997 at age 21.
Pixley bounced around from one low-paying job to another. In his early 20s, he was a janitor at J.C. Penney in West Lebanon. One day while sweeping floors, he recalled, he suddenly felt “like everything was closing in” on him. “I just had to get out of there,” he said.
Pixley dropped his broom and headed for the door. His parents, who still drove back then, had dropped him off at work. The panic attack was so severe, Pixley couldn’t wait for them to pick him up.
He started walking, making it all the way into Vermont before a Strafford resident recognized him and gave him a ride. “That was when my depression was really bad,” he said, adding that he’d been taking a different medication at the time.
In 2011, Pixley was hired to wash dishes at Kendal. He works the noon-to-8:30 p.m. shift, and he recently earned a raise to $12.50 an hour. The job includes health insurance benefits, which makes his antidepressant medication affordable.
“It took 20 years, but I was finally feeling pretty good about life,” he said.
With his parents’ help, he scraped up enough money to get his car insured and pay the $182 traffic fine for driving without insurance.
On Oct. 13 — 2½ months after his traffic stop — Pixley received a call from Hartford police. The cops had received results of his lab tests. The next day, a Sunday, he drove to the station to be fingerprinted and have his mugshot taken. He was handed a citation for driving under the influence of drugs.
And what drugs would those be?
Three substances were found in Pixley’s blood — caffeine, Velafaxine (another name for the antidepressant Effexor) and O-Desmethylvenlafaxine —a byproduct of Effexor.
That’s correct.
Pixley was arrested for driving while under the influence of an antidepressant that was prescribed by his physician and that he’s been taking for 10 years. If convicted, he faces a hefty fine and suspension of his driver’s license for 90 days.
He’s scheduled to be arraigned in Vermont Superior Court in White River Junction on Nov. 20. He said he plans to plead not guilty.
Windsor County State’s Attorney David Cahill told me that he couldn’t talk about an ongoing case, but generally speaking, a charge of driving under the influence of drugs can be applied to antidepressants.
“It is possible although unusual,” Cahill said.
Being under the influence of prescription drugs can “compound the problem” if a driver is already drowsy, said Hartford Police Chief Phil Kasten. “This is a problem across the country, not just here.”
I recently told Pixley’s story to Diane Roston. She’s the medical director at West Central Behavioral Health, a nonprofit community mental health care provider, and an assistant professor in the psychiatry department at Dartmouth’s Geisel School of Medicine.
She’s been a psychiatrist in the Upper Valley for nearly 30 years.
I mentioned to Roston, who said she doesn’t know Pixley, that Leombruno had written in her affidavit about finding on WebMD.com that drowsiness could be a side effect of Effexor.
“It’s true that sedation is a possible side effect,” Roston said. “But unless there was a recent dosage change, it’s not likely the medication was the cause of his drowsiness.”
After talking with Roston, I called Pixley. He’s been taking the same dosage for years, he said.
The medication Pixley’s primary care physician prescribed him has been “around a long time and it’s been very effective for lots of people,” Roston aid.
A criminal case such as this could set an alarming precedent, Roston said. I knew what she meant. The impact on people dealing with depression could be enormous. Will the threat of being arrested force them to choose between driving to work and taking their medication?
Pixley is a persuasive example of just how unfair our criminal justice system can be. He can’t afford a decent lawyer, and since a first-time DUI offense doesn’t carry the potential of jail time, a judge is unlikely to grant him a public defender.
Instead of exercising his constitutional right to a trial, Pixley — and poor people in general — has little choice but to plead guilty. Meanwhile, the state continues to collect hefty fines and court fees from people who can least afford it.
I brought up Pixley’s case to George Ostler, a criminal defense lawyer in Norwich who has been practicing for 35 years. Now that Vermont is bolstering its cadre of so-called drug recognition experts, or DREs for short, “there’s a real pressure to prosecute driving under the influence of drugs,” he said.
In other words, Vermont’s DREs need something to do. In 2017, they were called upon to evaluate 263 motorists — a 12 percent increase from the previous year.
Vermont has employed DREs since 2005. But during the three-year debate in Montpelier over legalizing marijuana, the law enforcement community sold the Legislature on the need to beef up its ranks. Nine were added in September alone, bringing the total to about 60. (New Hampshire has nearly 100 DREs.)
Recreational marijuana use became legal in Vermont on July 1. Unlike with alcohol, however, states have been unable to establish quantitative measures that signal what amount of marijuana — or for that matter, any drug — constitutes legal impairment.
In an in-depth story in September written by Valley News staff writer Jordan Cuddemi, criminal defense attorneys from across the state questioned the science behind the DREs’ work.
In judging whether a driver is impaired, DREs often have little to go on beyond what a suspect tells them about their drug use. “When you don’t have that self-reporting, I am not certain that this is a reliable form of testing,” said Brattleboro lawyer Dan Davis, a former state trooper and Windham County prosecutor.
In Pixley’s case, he didn’t hide anything. He told police about the prescription medication he had taken that morning before getting into his car. Now they’re using that information to build a case against him.
“The state is making the assumption that the same investigative tools and field sobriety tests they use for alcohol work for prescribed drugs,” Ostler said.
In DUI-drug cases, “if there is no alcohol involved and you’re taking your medication as prescribed and it comes with no restrictions on driving,” the state has its work cut out, Ostler said. “It must prove impairment beyond a reasonable doubt.”
I asked to see the report written by Robson, the DRE who evaluated Pixley, but Hartford police had not yet received a copy, Kasten told me last week.
Mounting a strong defense for someone in Pixley’s situation, however, often requires hiring expert witnesses. Depositions, including those of the DRE and Hartford officers, would be needed.
“All those things are expensive,” said Ostler, estimating that the legal bills for a DUI-drug case could run $10,000 to $15,000.
Meanwhile police and prosecutors play with house money. Taxpayers foot their bill.
Police and prosecutors in Vermont currently hold another big advantage in DUI-drug cases. Ordinarily, a defense attorney might want to question the lab workers who tested a suspect’s blood samples. How the tests were conducted could be useful information.
In Pixley’s case, that would mean traveling to Willow Grove, Pa., or bringing the lab workers who conducted the tests to Vermont.
Why’s that?
The Vermont Forensic Laboratory in Waterbury doesn’t have the space or the “necessary equipment” to conduct DUI drug tests, said Adam Silverman, spokesman for the Department of Public Safety.
The state uses a private company called NMS Labs to conduct the testing, which on average runs nearly $250 per case. (And I thought Vermont only exported some of its prison inmates. Who knew that it also farms out vital pieces of criminal investigations to private out-of-state companies with little accountability as well?)
Considering Pixley’s lab tests showed only a prescribed antidepressant (and, oh yes, caffeine) in his system, he would seem to benefit from having lab workers testify on his behalf. But they’re 350 miles away in suburban Philadelphia.
How convenient — for prosecutors.
“The scientific proof isn’t there that links his antidepressant medication to his behavior that day,” Ostler said. “He could have been having a bad day, physically.
“Being a lousy driver isn’t illegal. There are lots of those.”
Although he’s not looking at jail time if convicted, Scott Pixley still has a lot riding on his case’s outcome.
Kandy and Marvin Pixley do as well.
Last month, I sat down with Pixley and his parents in the living room of their mobile home in Strafford. Kandy Pixley, 63, was in a wheelchair. Diabetes had claimed her left leg just below the knee.
The day before our visit, Scott Pixley had picked up his 78-year-old father at the hospital, where he’d spent a couple of nights for a heart ailment. Marvin Pixley, an Army veteran who was a truck driver for 40 years, has had declining health for a while.
“Scott has been our rock,” Kandy Pixley told me. “He picks up our medications and takes us to doctors’ appointments. He takes us shopping. We couldn’t do it without him.
“If he loses his license, I don’t know what we’ll do.”
The Pixleys get by on their monthly Social Security checks and a small pension that Marvin earned for working with the state highway department for 10 years.
Their living room has a new pellet stove — or at least it’s new to them — which Scott recently bought from a co-worker at Kendal. Now he’s saving up to buy the pellets to burn in it.
The home’s outdoor oil tank needs replacing. Once that’s paid for, the family will have to come up with the money to fill the new tank.
In the meantime, Scott is picking up all the extra hours he can at Kendal. “When you’re poor, you just have to work harder,” he said.
I figured it couldn’t hurt to give Kasten, Hartford’s police chief, an idea of what Pixley and his parents are up against. I’ve always found Kasten willing to listen.
“The human aspect of what we do as law enforcement officers is always the greatest challenge,” he said. “Every person we deal with has a story. We work hard to be fair.”
But in the end, it’s not up to police, he said. Which is what many cops say — they make the arrests, and what happens to cases after that is in the hands of prosecutors and judges. But cops do have the discretion not to make an arrest, which makes me wonder why Pixley ended up in handcuffs after a Breathalyzer test showed he hadn’t been drinking.
If Pixley can’t afford a lawyer, I imagine there’s a good chance he’ll end up pleading guilty. He’ll pay a fine, and if he’s lucky, might only lose his driving privileges for 30 days or so.
But the last time I checked, there’s no public transportation that runs the 20 miles from Strafford to Hanover. So I’m not sure how he’d keep his dishwashing job that pays the bills and provides the health insurance that covers his medications.
Is Pixley the victim of a criminal justice system that’s being malicious or merely indifferent?
It’s probably the latter, although it’s a distinction that won’t have much significance to him if he’s forced to quit his job because he can’t drive for a while. What’s indisputable, though, is that Pixley’s real sin is his poverty: He doesn’t have the resources to demand that the system treat him fairly.
Jim Kenyon can be reached at jkenyon@vnews.com. | 2024-02-04T01:27:15.642919 | https://example.com/article/4844 |
Forums
The BP oil spill has just about everyone upset at the government and President Obama. The liberals are mad that he isn't doing enough and the environment is being ruined and the conservatives are upset that he isn't doing enough and plans to drill more oil wells are being ruined. Dolphins are probably the most upset, but they don't reliably vote and they tend to sink their money into weird PAC lobbying for marine hamster tubes and saltwater channels to be dug all over America. Nobody listens to them much after the Iraq war anyway.
On an emotional level I can understand why everyone is frustrated: the last time something this bad happened to the Gulf region HBO's Sunday lineup was punished with Treme. I don't know if the DVR ecosystem will be able to survive another blow like that if it creates a "TV desert."
On a rational level I just don't get it. There isn't much Obama can do that he isn't doing. The oil companies are the only people who have the creepy deep sea robots and streaming webcams and buckets full of mud to handle a situation like this. We have awesome nuclear submarines, but all of our enemies are on the surface, so unless Admiral J.J. Navy can figure out how to flip a submarine and shoot missiles straight down into the oil hole I don't think the US government can help.
Obama could fly down to Louisiana and towel off a beach, but this isn't like Katrina where there were a bunch of obvious things that needed to be done, like giving people bottles of water and asking sheriffs to stop shooting refugees on bridges. Obama could row a boat around and brush a turtle's teeth and it's not going to make a bit of difference. People will see him in hip waders frowning and massaging an otter's breasts and they'll say it's a cinical photo-op. And it would be.
That was my thinking until about a day ago, when I remembered an experience from when I was about ten. I was playing Peewee football at the time and I was a fullback. Not a fast runner, but I didn't cry quite as much as the other kids when I got hit. Coach Warsaw pushed me hard, but I was really bad at football. I would run through the wrong holes, ignore the blocking, and generally get distracted while I was playing. Coach Warsaw constantly yelled at me to "Focus!"
"You've got to focus," he would say. "Pay attention to where the ball is in relation to you."
During scrimmages it got to the point that coach would yell "Focus!" at me while we were playing. Was it embarrassing? Maybe in hindsight, but in the late 1980s everyone was busy being constantly embarrassed by how terrible everything was. Eventually, I learned where to run and how to pay attention, and I would like to think that my coach screaming "Focus!" at me was the most important factor.
What we need in the Gulf right now isn't a Presidential photo-op, it's a coach yelling, "Focus!" That is why I am proposing President Obama put on a track suit, Blublockers, and a pair of British Knights shoes and get a stop-watch, a whistle, and a baseball hat from a storm window company (this worked for Coach Warsaw), and have his Secret Service bring a couple mesh bags full of footballs.
Fly down to the Gulf of Mexico, take a helicopter tour of the problem areas, and whenever something important is happening he needs to land and start coaching. He can fly down to the BP ship where they're doing the "top kill" procedure, blow his coach whistle, and then start yelling "Focus!" at all the guys working on the mud cannons and buckets and whatever else.
No reason Obama should limit himself to "Focus!", Coach Warsaw had plenty of other great phrases and coaching techniques that Obama could employ in the Gulf of Mexico.
If a BP drilling engineer is talking on his cell phone, Obama can grab him by his shoulder pads and shake him and scream, "What the hell, Brian? You're going to talk while everyone else is out there working their asses off? What would your dad say? Save it for the break if you want to play this weekend."
Obama needs to pick one BP worker to make his kid. Coach Warsaw's kid was named Teddy and he was a good player, but Coach Warsaw used him as an example and practically drove him until his heart exploded. The one time Teddy said something back to Coach he made Teddy sit in the hot car with the windows rolled up for the entire half hour of practice we had left. That is the same as Ho Chi Minh sticking a POW in the sweat box and sure to humiliate the player and strike fear into all other players. After all, if he'd practically kill his own "kid," then you know Obama is crazy enough to kill you for flubbing the hike.
If the BP crew starts slacking off to 105% effort and generally not focusing Obama can take it to the next level and blow his whistle super hard so veins start popping out on his head. Then he can make everyone stand in a line and walk along the line blowing his whistle in their face. Whistles are cool in theory, but when you've got a pissed off coach/POTUS with one constantly clenched in his teeth you might as well be working at gunpoint.
The ultimate punishment for a bad BP worker would be for Obama to tell them to go long and as they're running drill them right in the back with a laser pass. Coach Warsaw dropped so many kids into bawling heaps for being idiots that people were afraid to take passes from him over five yards. I would imagine the dual humiliation of being blasted off your feet by Obama's nightmare cannon arm and having it happen aboard some lame oil cleanup boat would be enough to set the worst worker straight.
Whenever Obama is getting a pass from the media (he's not anymore) a lot of Republicans like to indignantly say, "If that were President Bush the media would be going nuts."
I don't know if that's true, but it makes me think that maybe we had the wrong president for the wrong disaster. Maybe they should have been reversed. Obama would have taken care of people stranded during Katrina and, as for Bush, no president has ever reminded me more of an asshole football coach.
You can bet he would have been down there in the Gulf three weeks ago, jumping at the chance to throw helmets at people and make up nicknames like "Legs" for the guy who lost his legs to diabetes and "Look Who's Talkin'" for the pre-op with the soft, high voice. | 2024-04-17T01:27:15.642919 | https://example.com/article/7712 |
import { Operation } from 'express-openapi';
import { StreamsModelInterface } from '../../../Model/Api/StreamsModel';
import factory from '../../../Model/ModelFactory';
import * as api from '../../api';
export const del: Operation = async(_req, res) => {
const streams = <StreamsModelInterface> factory.get('StreamsModel');
try {
await streams.forcedStopAll();
api.responseJSON(res, 200, { code: 200 });
} catch (err) {
api.responseServerError(res, err.message);
}
};
del.apiDoc = {
summary: 'すべてのストリームを強制停止',
tags: ['streams'],
description: 'すべてのストリームを強制停止する',
responses: {
200: {
description: 'すべてのストリームを強制停止しました',
},
default: {
description: '予期しないエラー',
schema: {
$ref: '#/definitions/Error',
},
},
},
};
| 2024-02-10T01:27:15.642919 | https://example.com/article/7059 |
Watch 'Conversation with the Candidate' with Elizabeth Warren
Sen. Elizabeth Warren, D-Massachusetts, answered questions from New Hampshire voters in the latest "Conversation with the Candidate" forum.A special online-only portion of this conversation can be watched below.>> Watch Part 1>> Watch Part 2>> Watch online exclusiveKey headlines:-- Elizabeth Warren says that as president, she’ll think ‘globally’ about addressing climate change-- Warren answers broad range of questions from NH voters
Sen. Elizabeth Warren, D-Massachusetts, answered questions from New Hampshire voters in the latest "Conversation with the Candidate" forum.
A special online-only portion of this conversation can be watched below.
>> Watch Part 1
>> Watch Part 2
>> Watch online exclusive
Key headlines:
-- Elizabeth Warren says that as president, she’ll think ‘globally’ about addressing climate change
-- Warren answers broad range of questions from NH voters | 2023-12-31T01:27:15.642919 | https://example.com/article/7374 |
/-- Do not use the \x{} construct except with patterns that have the --/
/-- /8 option set, because PCRE doesn't recognize them as UTF-8 unless --/
No match
/-- that option is set. However, the latest Perls recognize them always. --/
No match
/a.b/8
acb
0: acb
a\x7fb
0: a\x{7f}b
a\x{100}b
0: a\x{100}b
*** Failers
No match
a\nb
No match
/a(.{3})b/8
a\x{4000}xyb
0: a\x{4000}xyb
1: \x{4000}xy
a\x{4000}\x7fyb
0: a\x{4000}\x{7f}yb
1: \x{4000}\x{7f}y
a\x{4000}\x{100}yb
0: a\x{4000}\x{100}yb
1: \x{4000}\x{100}y
*** Failers
No match
a\x{4000}b
No match
ac\ncb
No match
/a(.*?)(.)/
a\xc0\x88b
0: a\xc0
1:
2: \xc0
/a(.*?)(.)/8
a\x{100}b
0: a\x{100}
1:
2: \x{100}
/a(.*)(.)/
a\xc0\x88b
0: a\xc0\x88b
1: \xc0\x88
2: b
/a(.*)(.)/8
a\x{100}b
0: a\x{100}b
1: \x{100}
2: b
/a(.)(.)/
a\xc0\x92bcd
0: a\xc0\x92
1: \xc0
2: \x92
/a(.)(.)/8
a\x{240}bcd
0: a\x{240}b
1: \x{240}
2: b
/a(.?)(.)/
a\xc0\x92bcd
0: a\xc0\x92
1: \xc0
2: \x92
/a(.?)(.)/8
a\x{240}bcd
0: a\x{240}b
1: \x{240}
2: b
/a(.??)(.)/
a\xc0\x92bcd
0: a\xc0
1:
2: \xc0
/a(.??)(.)/8
a\x{240}bcd
0: a\x{240}
1:
2: \x{240}
/a(.{3})b/8
a\x{1234}xyb
0: a\x{1234}xyb
1: \x{1234}xy
a\x{1234}\x{4321}yb
0: a\x{1234}\x{4321}yb
1: \x{1234}\x{4321}y
a\x{1234}\x{4321}\x{3412}b
0: a\x{1234}\x{4321}\x{3412}b
1: \x{1234}\x{4321}\x{3412}
*** Failers
No match
a\x{1234}b
No match
ac\ncb
No match
/a(.{3,})b/8
a\x{1234}xyb
0: a\x{1234}xyb
1: \x{1234}xy
a\x{1234}\x{4321}yb
0: a\x{1234}\x{4321}yb
1: \x{1234}\x{4321}y
a\x{1234}\x{4321}\x{3412}b
0: a\x{1234}\x{4321}\x{3412}b
1: \x{1234}\x{4321}\x{3412}
axxxxbcdefghijb
0: axxxxbcdefghijb
1: xxxxbcdefghij
a\x{1234}\x{4321}\x{3412}\x{3421}b
0: a\x{1234}\x{4321}\x{3412}\x{3421}b
1: \x{1234}\x{4321}\x{3412}\x{3421}
*** Failers
No match
a\x{1234}b
No match
/a(.{3,}?)b/8
a\x{1234}xyb
0: a\x{1234}xyb
1: \x{1234}xy
a\x{1234}\x{4321}yb
0: a\x{1234}\x{4321}yb
1: \x{1234}\x{4321}y
a\x{1234}\x{4321}\x{3412}b
0: a\x{1234}\x{4321}\x{3412}b
1: \x{1234}\x{4321}\x{3412}
axxxxbcdefghijb
0: axxxxb
1: xxxx
a\x{1234}\x{4321}\x{3412}\x{3421}b
0: a\x{1234}\x{4321}\x{3412}\x{3421}b
1: \x{1234}\x{4321}\x{3412}\x{3421}
*** Failers
No match
a\x{1234}b
No match
/a(.{3,5})b/8
a\x{1234}xyb
0: a\x{1234}xyb
1: \x{1234}xy
a\x{1234}\x{4321}yb
0: a\x{1234}\x{4321}yb
1: \x{1234}\x{4321}y
a\x{1234}\x{4321}\x{3412}b
0: a\x{1234}\x{4321}\x{3412}b
1: \x{1234}\x{4321}\x{3412}
axxxxbcdefghijb
0: axxxxb
1: xxxx
a\x{1234}\x{4321}\x{3412}\x{3421}b
0: a\x{1234}\x{4321}\x{3412}\x{3421}b
1: \x{1234}\x{4321}\x{3412}\x{3421}
axbxxbcdefghijb
0: axbxxb
1: xbxx
axxxxxbcdefghijb
0: axxxxxb
1: xxxxx
*** Failers
No match
a\x{1234}b
No match
axxxxxxbcdefghijb
No match
/a(.{3,5}?)b/8
a\x{1234}xyb
0: a\x{1234}xyb
1: \x{1234}xy
a\x{1234}\x{4321}yb
0: a\x{1234}\x{4321}yb
1: \x{1234}\x{4321}y
a\x{1234}\x{4321}\x{3412}b
0: a\x{1234}\x{4321}\x{3412}b
1: \x{1234}\x{4321}\x{3412}
axxxxbcdefghijb
0: axxxxb
1: xxxx
a\x{1234}\x{4321}\x{3412}\x{3421}b
0: a\x{1234}\x{4321}\x{3412}\x{3421}b
1: \x{1234}\x{4321}\x{3412}\x{3421}
axbxxbcdefghijb
0: axbxxb
1: xbxx
axxxxxbcdefghijb
0: axxxxxb
1: xxxxx
*** Failers
No match
a\x{1234}b
No match
axxxxxxbcdefghijb
No match
/^[a\x{c0}]/8
*** Failers
No match
\x{100}
No match
/(?<=aXb)cd/8
aXbcd
0: cd
/(?<=a\x{100}b)cd/8
a\x{100}bcd
0: cd
/(?<=a\x{100000}b)cd/8
a\x{100000}bcd
0: cd
/(?:\x{100}){3}b/8
\x{100}\x{100}\x{100}b
0: \x{100}\x{100}\x{100}b
*** Failers
No match
\x{100}\x{100}b
No match
/\x{ab}/8
\x{ab}
0: \x{ab}
\xc2\xab
0: \x{ab}
*** Failers
No match
\x00{ab}
No match
/(?<=(.))X/8
WXYZ
0: X
1: W
\x{256}XYZ
0: X
1: \x{256}
*** Failers
No match
XYZ
No match
/X(\C{3})/8
X\x{1234}
0: X\x{1234}
1: \x{1234}
/X(\C{4})/8
X\x{1234}YZ
0: X\x{1234}Y
1: \x{1234}Y
/X\C*/8
XYZabcdce
0: XYZabcdce
/X\C*?/8
XYZabcde
0: X
/X\C{3,5}/8
Xabcdefg
0: Xabcde
X\x{1234}
0: X\x{1234}
X\x{1234}YZ
0: X\x{1234}YZ
X\x{1234}\x{512}
0: X\x{1234}\x{512}
X\x{1234}\x{512}YZ
0: X\x{1234}\x{512}
/X\C{3,5}?/8
Xabcdefg
0: Xabc
X\x{1234}
0: X\x{1234}
X\x{1234}YZ
0: X\x{1234}
X\x{1234}\x{512}
0: X\x{1234}
/[^a]+/8g
bcd
0: bcd
\x{100}aY\x{256}Z
0: \x{100}
0: Y\x{256}Z
/^[^a]{2}/8
\x{100}bc
0: \x{100}b
/^[^a]{2,}/8
\x{100}bcAa
0: \x{100}bcA
/^[^a]{2,}?/8
\x{100}bca
0: \x{100}b
/[^a]+/8ig
bcd
0: bcd
\x{100}aY\x{256}Z
0: \x{100}
0: Y\x{256}Z
/^[^a]{2}/8i
\x{100}bc
0: \x{100}b
/^[^a]{2,}/8i
\x{100}bcAa
0: \x{100}bc
/^[^a]{2,}?/8i
\x{100}bca
0: \x{100}b
/\x{100}{0,0}/8
abcd
0:
/\x{100}?/8
abcd
0:
\x{100}\x{100}
0: \x{100}
/\x{100}{0,3}/8
\x{100}\x{100}
0: \x{100}\x{100}
\x{100}\x{100}\x{100}\x{100}
0: \x{100}\x{100}\x{100}
/\x{100}*/8
abce
0:
\x{100}\x{100}\x{100}\x{100}
0: \x{100}\x{100}\x{100}\x{100}
/\x{100}{1,1}/8
abcd\x{100}\x{100}\x{100}\x{100}
0: \x{100}
/\x{100}{1,3}/8
abcd\x{100}\x{100}\x{100}\x{100}
0: \x{100}\x{100}\x{100}
/\x{100}+/8
abcd\x{100}\x{100}\x{100}\x{100}
0: \x{100}\x{100}\x{100}\x{100}
/\x{100}{3}/8
abcd\x{100}\x{100}\x{100}XX
0: \x{100}\x{100}\x{100}
/\x{100}{3,5}/8
abcd\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}XX
0: \x{100}\x{100}\x{100}\x{100}\x{100}
/\x{100}{3,}/8
abcd\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}XX
0: \x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}
/(?<=a\x{100}{2}b)X/8+
Xyyya\x{100}\x{100}bXzzz
0: X
0+ zzz
/\D*/8
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
0: aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
/\D*/8
\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}
0: \x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}\x{100}
/\D/8
1X2
0: X
1\x{100}2
0: \x{100}
/>\S/8
> >X Y
0: >X
> >\x{100} Y
0: >\x{100}
/\d/8
\x{100}3
0: 3
/\s/8
\x{100} X
0:
/\D+/8
12abcd34
0: abcd
*** Failers
0: *** Failers
1234
No match
/\D{2,3}/8
12abcd34
0: abc
12ab34
0: ab
*** Failers
0: ***
1234
No match
12a34
No match
/\D{2,3}?/8
12abcd34
0: ab
12ab34
0: ab
*** Failers
0: **
1234
No match
12a34
No match
/\d+/8
12abcd34
0: 12
*** Failers
No match
/\d{2,3}/8
12abcd34
0: 12
1234abcd
0: 123
*** Failers
No match
1.4
No match
/\d{2,3}?/8
12abcd34
0: 12
1234abcd
0: 12
*** Failers
No match
1.4
No match
/\S+/8
12abcd34
0: 12abcd34
*** Failers
0: ***
\ \
No match
/\S{2,3}/8
12abcd34
0: 12a
1234abcd
0: 123
*** Failers
0: ***
\ \
No match
/\S{2,3}?/8
12abcd34
0: 12
1234abcd
0: 12
*** Failers
0: **
\ \
No match
/>\s+</8+
12> <34
0: > <
0+ 34
*** Failers
No match
/>\s{2,3}</8+
ab> <cd
0: > <
0+ cd
ab> <ce
0: > <
0+ ce
*** Failers
No match
ab> <cd
No match
/>\s{2,3}?</8+
ab> <cd
0: > <
0+ cd
ab> <ce
0: > <
0+ ce
*** Failers
No match
ab> <cd
No match
/\w+/8
12 34
0: 12
*** Failers
0: Failers
+++=*!
No match
/\w{2,3}/8
ab cd
0: ab
abcd ce
0: abc
*** Failers
0: Fai
a.b.c
No match
/\w{2,3}?/8
ab cd
0: ab
abcd ce
0: ab
*** Failers
0: Fa
a.b.c
No match
/\W+/8
12====34
0: ====
*** Failers
0: ***
abcd
No match
/\W{2,3}/8
ab====cd
0: ===
ab==cd
0: ==
*** Failers
0: ***
a.b.c
No match
/\W{2,3}?/8
ab====cd
0: ==
ab==cd
0: ==
*** Failers
0: **
a.b.c
No match
/[\x{100}]/8
\x{100}
0: \x{100}
Z\x{100}
0: \x{100}
\x{100}Z
0: \x{100}
*** Failers
No match
/[Z\x{100}]/8
Z\x{100}
0: Z
\x{100}
0: \x{100}
\x{100}Z
0: \x{100}
*** Failers
No match
/[\x{100}\x{200}]/8
ab\x{100}cd
0: \x{100}
ab\x{200}cd
0: \x{200}
*** Failers
No match
/[\x{100}-\x{200}]/8
ab\x{100}cd
0: \x{100}
ab\x{200}cd
0: \x{200}
ab\x{111}cd
0: \x{111}
*** Failers
No match
/[z-\x{200}]/8
ab\x{100}cd
0: \x{100}
ab\x{200}cd
0: \x{200}
ab\x{111}cd
0: \x{111}
abzcd
0: z
ab|cd
0: |
*** Failers
No match
/[Q\x{100}\x{200}]/8
ab\x{100}cd
0: \x{100}
ab\x{200}cd
0: \x{200}
Q?
0: Q
*** Failers
No match
/[Q\x{100}-\x{200}]/8
ab\x{100}cd
0: \x{100}
ab\x{200}cd
0: \x{200}
ab\x{111}cd
0: \x{111}
Q?
0: Q
*** Failers
No match
/[Qz-\x{200}]/8
ab\x{100}cd
0: \x{100}
ab\x{200}cd
0: \x{200}
ab\x{111}cd
0: \x{111}
abzcd
0: z
ab|cd
0: |
Q?
0: Q
*** Failers
No match
/[\x{100}\x{200}]{1,3}/8
ab\x{100}cd
0: \x{100}
ab\x{200}cd
0: \x{200}
ab\x{200}\x{100}\x{200}\x{100}cd
0: \x{200}\x{100}\x{200}
*** Failers
No match
/[\x{100}\x{200}]{1,3}?/8
ab\x{100}cd
0: \x{100}
ab\x{200}cd
0: \x{200}
ab\x{200}\x{100}\x{200}\x{100}cd
0: \x{200}
*** Failers
No match
/[Q\x{100}\x{200}]{1,3}/8
ab\x{100}cd
0: \x{100}
ab\x{200}cd
0: \x{200}
ab\x{200}\x{100}\x{200}\x{100}cd
0: \x{200}\x{100}\x{200}
*** Failers
No match
/[Q\x{100}\x{200}]{1,3}?/8
ab\x{100}cd
0: \x{100}
ab\x{200}cd
0: \x{200}
ab\x{200}\x{100}\x{200}\x{100}cd
0: \x{200}
*** Failers
No match
/(?<=[\x{100}\x{200}])X/8
abc\x{200}X
0: X
abc\x{100}X
0: X
*** Failers
No match
X
No match
/(?<=[Q\x{100}\x{200}])X/8
abc\x{200}X
0: X
abc\x{100}X
0: X
abQX
0: X
*** Failers
No match
X
No match
/(?<=[\x{100}\x{200}]{3})X/8
abc\x{100}\x{200}\x{100}X
0: X
*** Failers
No match
abc\x{200}X
No match
X
No match
/[^\x{100}\x{200}]X/8
AX
0: AX
\x{150}X
0: \x{150}X
\x{500}X
0: \x{500}X
*** Failers
No match
\x{100}X
No match
\x{200}X
No match
/[^Q\x{100}\x{200}]X/8
AX
0: AX
\x{150}X
0: \x{150}X
\x{500}X
0: \x{500}X
*** Failers
No match
\x{100}X
No match
\x{200}X
No match
QX
No match
/[^\x{100}-\x{200}]X/8
AX
0: AX
\x{500}X
0: \x{500}X
*** Failers
No match
\x{100}X
No match
\x{150}X
No match
\x{200}X
No match
/a\Cb/
aXb
0: aXb
a\nb
0: a\x0ab
/a\Cb/8
aXb
0: aXb
a\nb
0: a\x{0a}b
*** Failers
No match
a\x{100}b
No match
/[z-\x{100}]/8i
z
0: z
Z
0: Z
\x{100}
0: \x{100}
*** Failers
No match
\x{102}
No match
y
No match
/[\xFF]/
>\xff<
0: \xff
/[\xff]/8
>\x{ff}<
0: \x{ff}
/[^\xFF]/
XYZ
0: X
/[^\xff]/8
XYZ
0: X
\x{123}
0: \x{123}
/^[ac]*b/8
xb
No match
/^[ac\x{100}]*b/8
xb
No match
/^[^x]*b/8i
xb
No match
/^[^x]*b/8
xb
No match
/^\d*b/8
xb
No match
/(|a)/g8
catac
0:
1:
0:
1:
0: a
1: a
0:
1:
0:
1:
0: a
1: a
0:
1:
0:
1:
a\x{256}a
0:
1:
0: a
1: a
0:
1:
0:
1:
0: a
1: a
0:
1:
/^\x{85}$/8i
\x{85}
0: \x{85}
/^ሴ/8
ሴ
0: \x{1234}
/^\ሴ/8
ሴ
0: \x{1234}
"(?s)(.{1,5})"8
abcdefg
0: abcde
1: abcde
ab
0: ab
1: ab
/a*\x{100}*\w/8
a
0: a
/\S\S/8g
A\x{a3}BC
0: A\x{a3}
0: BC
/\S{2}/8g
A\x{a3}BC
0: A\x{a3}
0: BC
/\W\W/8g
+\x{a3}==
0: +\x{a3}
0: ==
/\W{2}/8g
+\x{a3}==
0: +\x{a3}
0: ==
/\S/8g
\x{442}\x{435}\x{441}\x{442}
0: \x{442}
0: \x{435}
0: \x{441}
0: \x{442}
/[\S]/8g
\x{442}\x{435}\x{441}\x{442}
0: \x{442}
0: \x{435}
0: \x{441}
0: \x{442}
/\D/8g
\x{442}\x{435}\x{441}\x{442}
0: \x{442}
0: \x{435}
0: \x{441}
0: \x{442}
/[\D]/8g
\x{442}\x{435}\x{441}\x{442}
0: \x{442}
0: \x{435}
0: \x{441}
0: \x{442}
/\W/8g
\x{2442}\x{2435}\x{2441}\x{2442}
0: \x{2442}
0: \x{2435}
0: \x{2441}
0: \x{2442}
/[\W]/8g
\x{2442}\x{2435}\x{2441}\x{2442}
0: \x{2442}
0: \x{2435}
0: \x{2441}
0: \x{2442}
/[\S\s]*/8
abc\n\r\x{442}\x{435}\x{441}\x{442}xyz
0: abc\x{0a}\x{0d}\x{442}\x{435}\x{441}\x{442}xyz
/[\x{41f}\S]/8g
\x{442}\x{435}\x{441}\x{442}
0: \x{442}
0: \x{435}
0: \x{441}
0: \x{442}
/.[^\S]./8g
abc def\x{442}\x{443}xyz\npqr
0: c d
0: z\x{0a}p
/.[^\S\n]./8g
abc def\x{442}\x{443}xyz\npqr
0: c d
/[[:^alnum:]]/8g
+\x{2442}
0: +
0: \x{2442}
/[[:^alpha:]]/8g
+\x{2442}
0: +
0: \x{2442}
/[[:^ascii:]]/8g
A\x{442}
0: \x{442}
/[[:^blank:]]/8g
A\x{442}
0: A
0: \x{442}
/[[:^cntrl:]]/8g
A\x{442}
0: A
0: \x{442}
/[[:^digit:]]/8g
A\x{442}
0: A
0: \x{442}
/[[:^graph:]]/8g
\x19\x{e01ff}
0: \x{19}
0: \x{e01ff}
/[[:^lower:]]/8g
A\x{422}
0: A
0: \x{422}
/[[:^print:]]/8g
\x{19}\x{e01ff}
0: \x{19}
0: \x{e01ff}
/[[:^punct:]]/8g
A\x{442}
0: A
0: \x{442}
/[[:^space:]]/8g
A\x{442}
0: A
0: \x{442}
/[[:^upper:]]/8g
a\x{442}
0: a
0: \x{442}
/[[:^word:]]/8g
+\x{2442}
0: +
0: \x{2442}
/[[:^xdigit:]]/8g
M\x{442}
0: M
0: \x{442}
/[^ABCDEFGHIJKLMNOPQRSTUVWXYZÀÁÂÃÄÅÆÇÈÉÊËÌÍÎÏÐÑÒÓÔÕÖØÙÚÛÜÝÞĀĂĄĆĈĊČĎĐĒĔĖĘĚĜĞĠĢĤĦĨĪĬĮİIJĴĶĹĻĽĿŁŃŅŇŊŌŎŐŒŔŖŘŚŜŞŠŢŤŦŨŪŬŮŰŲŴŶŸŹŻŽƁƂƄƆƇƉƊƋƎƏƐƑƓƔƖƗƘƜƝƟƠƢƤƦƧƩƬƮƯƱƲƳƵƷƸƼDŽLJNJǍǏǑǓǕǗǙǛǞǠǢǤǦǨǪǬǮDZǴǶǷǸǺǼǾȀȂȄȆȈȊȌȎȐȒȔȖȘȚȜȞȠȢȤȦȨȪȬȮȰȲȺȻȽȾɁΆΈΉΊΌΎΏΑΒΓΔΕΖΗΘΙΚΛΜΝΞΟΠΡΣΤΥΦΧΨΩΪΫϒϓϔϘϚϜϞϠϢϤϦϨϪϬϮϴϷϹϺϽϾϿЀЁЂЃЄЅІЇЈЉЊЋЌЍЎЏАБВГДЕЖЗИЙКЛМНОПРСТУФХЦЧШЩЪЫЬЭЮЯѠѢѤѦѨѪѬѮѰѲѴѶѸѺѼѾҀҊҌҎҐҒҔҖҘҚҜҞҠҢҤҦҨҪҬҮҰҲҴҶҸҺҼҾӀӁӃӅӇӉӋӍӐӒӔӖӘӚӜӞӠӢӤӦӨӪӬӮӰӲӴӶӸԀԂԄԆԈԊԌԎԱԲԳԴԵԶԷԸԹԺԻԼԽԾԿՀՁՂՃՄՅՆՇՈՉՊՋՌՍՎՏՐՑՒՓՔՕՖႠႡႢႣႤႥႦႧႨႩႪႫႬႭႮႯႰႱႲႳႴႵႶႷႸႹႺႻႼႽႾႿჀჁჂჃჄჅḀḂḄḆḈḊḌḎḐḒḔḖḘḚḜḞḠḢḤḦḨḪḬḮḰḲḴḶḸḺḼḾṀṂṄṆṈṊṌṎṐṒṔṖṘṚṜṞṠṢṤṦṨṪṬṮṰṲṴṶṸṺṼṾẀẂẄẆẈẊẌẎẐẒẔẠẢẤẦẨẪẬẮẰẲẴẶẸẺẼẾỀỂỄỆỈỊỌỎỐỒỔỖỘỚỜỞỠỢỤỦỨỪỬỮỰỲỴỶỸἈἉἊἋἌἍἎἏἘἙἚἛἜἝἨἩἪἫἬἭἮἯἸἹἺἻἼἽἾἿὈὉὊὋὌὍὙὛὝὟὨὩὪὫὬὭὮὯᾸᾹᾺΆῈΈῊΉῘῙῚΊῨῩῪΎῬῸΌῺΏabcdefghijklmnopqrstuvwxyzªµºßàáâãäåæçèéêëìíîïðñòóôõöøùúûüýþÿāăąćĉċčďđēĕėęěĝğġģĥħĩīĭįıijĵķĸĺļľŀłńņňʼnŋōŏőœŕŗřśŝşšţťŧũūŭůűųŵŷźżžſƀƃƅƈƌƍƒƕƙƚƛƞơƣƥƨƪƫƭưƴƶƹƺƽƾƿdžljnjǎǐǒǔǖǘǚǜǝǟǡǣǥǧǩǫǭǯǰdzǵǹǻǽǿȁȃȅȇȉȋȍȏȑȓȕȗșțȝȟȡȣȥȧȩȫȭȯȱȳȴȵȶȷȸȹȼȿɀɐɑɒɓɔɕɖɗɘəɚɛɜɝɞɟɠɡɢɣɤɥɦɧɨɩɪɫɬɭɮɯɰɱɲɳɴɵɶɷɸɹɺɻɼɽɾɿʀʁʂʃʄʅʆʇʈʉʊʋʌʍʎʏʐʑʒʓʔʕʖʗʘʙʚʛʜʝʞʟʠʡʢʣʤʥʦʧʨʩʪʫʬʭʮʯΐάέήίΰαβγδεζηθικλμνξοπρςστυφχψωϊϋόύώϐϑϕϖϗϙϛϝϟϡϣϥϧϩϫϭϯϰϱϲϳϵϸϻϼабвгдежзийклмнопрстуфхцчшщъыьэюяѐёђѓєѕіїјљњћќѝўџѡѣѥѧѩѫѭѯѱѳѵѷѹѻѽѿҁҋҍҏґғҕҗҙқҝҟҡңҥҧҩҫҭүұҳҵҷҹһҽҿӂӄӆӈӊӌӎӑӓӕӗәӛӝӟӡӣӥӧөӫӭӯӱӳӵӷӹԁԃԅԇԉԋԍԏաբգդեզէըթժիլխծկհձղճմյնշոչպջռսվտրցւփքօֆևᴀᴁᴂᴃᴄᴅᴆᴇᴈᴉᴊᴋᴌᴍᴎᴏᴐᴑᴒᴓᴔᴕᴖᴗᴘᴙᴚᴛᴜᴝᴞᴟᴠᴡᴢᴣᴤᴥᴦᴧᴨᴩᴪᴫᵢᵣᵤᵥᵦᵧᵨᵩᵪᵫᵬᵭᵮᵯᵰᵱᵲᵳᵴᵵᵶᵷᵹᵺᵻᵼᵽᵾᵿᶀᶁᶂᶃᶄᶅᶆᶇᶈᶉᶊᶋᶌᶍᶎᶏᶐᶑᶒᶓᶔᶕᶖᶗᶘᶙᶚḁḃḅḇḉḋḍḏḑḓḕḗḙḛḝḟḡḣḥḧḩḫḭḯḱḳḵḷḹḻḽḿṁṃṅṇṉṋṍṏṑṓṕṗṙṛṝṟṡṣṥṧṩṫṭṯṱṳṵṷṹṻṽṿẁẃẅẇẉẋẍẏẑẓẕẖẗẘẙẚẛạảấầẩẫậắằẳẵặẹẻẽếềểễệỉịọỏốồổỗộớờởỡợụủứừửữựỳỵỷỹἀἁἂἃἄἅἆἇἐἑἒἓἔἕἠἡἢἣἤἥἦἧἰἱἲἳἴἵἶἷὀὁὂὃὄὅὐὑὒὓὔὕὖὗὠὡὢὣὤὥὦὧὰάὲέὴήὶίὸόὺύὼώᾀᾁᾂᾃᾄᾅᾆᾇᾐᾑᾒᾓᾔᾕᾖᾗᾠᾡᾢᾣᾤᾥᾦᾧᾰᾱᾲᾳᾴᾶᾷιῂῃῄῆῇῐῑῒΐῖῗῠῡῢΰῤῥῦῧῲῳῴῶῷⲁⲃⲅⲇⲉⲋⲍⲏⲑⲓⲕⲗⲙⲛⲝⲟⲡⲣⲥⲧⲩⲫⲭⲯⲱⲳⲵⲷⲹⲻⲽⲿⳁⳃⳅⳇⳉⳋⳍⳏⳑⳓⳕⳗⳙⳛⳝⳟⳡⳣⳤⴀⴁⴂⴃⴄⴅⴆⴇⴈⴉⴊⴋⴌⴍⴎⴏⴐⴑⴒⴓⴔⴕⴖⴗⴘⴙⴚⴛⴜⴝⴞⴟⴠⴡⴢⴣⴤⴥfffiflffifflſtstﬓﬔﬕﬖﬗ\d-_^]/8
/^[^d]*?$/
abc
0: abc
/^[^d]*?$/8
abc
0: abc
/^[^d]*?$/i
abc
0: abc
/^[^d]*?$/8i
abc
0: abc
/(?i)[\xc3\xa9\xc3\xbd]|[\xc3\xa9\xc3\xbdA]/8
/ End of testinput4 /
| 2024-06-23T01:27:15.642919 | https://example.com/article/2187 |
UNITED STATES COURT OF APPEALS
For the Fifth Circuit
No. 99-31245
CHEVRON CHEMICAL COMPANY,
Plaintiff-Appellee,
VERSUS
OIL, CHEMICAL AND ATOMIC WORKERS INTERNATIONAL UNION, AFL-CIO,
Local 4-447,
Defendant-Appellant
___________________________________________________________________
OIL, CHEMICAL AND ATOMIC WORKERS INTERNATIONAL UNION; ET AL.,
Plaintiffs,
VERSUS
CHEVRON CHEMICAL COMPANY; Etc; ET AL.,
Defendant.
Appeal from the United States District Court
For the Eastern District of Louisiana
98-CV-2372-B
July 17, 2000
Before DAVIS, JONES and STEWART, Circuit Judges.
PER CURIAM:*
The judgment of the district court is affirmed essentially for
the reasons stated in the district court’s November 4, 1999 Order
and Reasons. This case is controlled by International Union of
Operating Engineers, Local 351 v. Cooper Natural Resources, Inc.,
163 F.3d 916 (5th Cir. 1989).
AFFIRMED.
*
Pursuant to 5TH CIR. R. 47.5, the Court has determined that this
opinion should not be published and is not precedent except under
the limited circumstances set forth in 5TH CIR. R. 47.5.4.
2
| 2023-11-16T01:27:15.642919 | https://example.com/article/6971 |
Mindful Homekeeping: Ditching Plastic Bottled Water
A few months ago we started a series called Mindful Homekeeping in order to share simple homekeeping practices, DIYs, and products that we feel are mindful of the environment, body, and soul as we journey toward a more sustainable lifestyle. Because we live in a time where convenience and cost drive consumption, we really wanted a space to think critically about our practices and what we can do to make healthy, meaningful but also economical choices. Many of the topics we will cover are changes that we successfully implemented and wanted to share in the hopes of motivating you to consider making them too. In this post we will be addressing a practice that is commonplace in American households: buying and drinking bottled water. Now before you go off thinking that this is such an insignificant part of your life it isn’t worth examining…you are mistaken. Your actions can absolutely make a difference.
*This post contains affiliate links for your convenience.*
Bottled water has always secretly angered me. In an environmental anthropology class I took back in undergrad, we read and talked a lot about the environmental impact of Nestle and other companies that turned a free natural resource into a multi-billion dollar industry. It especially hit home for me because we live in the Great Lakes region and I was beyond bothered that a corporation could just own something that should belong to all people. And then the whole Flint water crisis and Dakota pipeline happened and it really brought the issue of clean, accessible water to the forefront. We pledged then that we would no longer purchase bottled water except on rare occasions {read as “never if we can help it”}. While we have always kept glass bottles filled in the fridge for ourselves, we were still keeping bottled water on hand for visitors. After our pledge, we invested in a larger collection of glass bottles to accommodate guests as well. Most of our collection is from IKEA and the carafes range anywhere from $1.99-$4.99.
Why are we telling you this? Because with the cost being so cheap there’s really no reason not to completely make the switch. All you need to do is make a small investment in reusable bottles/carafes/pitchers {the cost will depend on the size of your family, we spent around $10} and then make a habit of filling them regularly. When one empties, you clean and refill it while you enjoy the next bottle. Expecting company? Fill a pitcher ahead of time and put it in the fridge. Going for a run? Fill up your canteen with cold water from the refrigerated carafes and refill the carafes for later. These simple practices can easily become habits that eliminate the need for drinking plastic bottled water. Heck you don’t even need to necessarily buy anything. I can think of plenty of glass you can upcyle {think milk jugs, cold-brew coffee, juice bottles} to use for the purposes outlined here. The best part about filling your own glass bottles ahead of time is that you can switch things up by making colorful and refreshing fruit waters. There’s no limit to what you can create once you start mixing up fruit, herbs, and citrus. I recently made a cherry, lime, mint water and it was DELICIOUS. Definitely beats boring plastic bottled water any day!
If you are still not convinced, here are just some of the many reasons you should give up bottled water. You can read the sources for these facts in-depth here and here.
The recommended eight glasses of water a day, at U.S. tap rates equals about $.49 per year; that same amount of bottled water is about $1,400.
Eighty percent of the water bottles we buy end up in landfills, the absolute worst place for them to be.
Plastic leaches into the water it holds, which has been linked to health issues like reproductive problems and different types of cancer.
Of course we don’t want to be too rigid. Plastic bottled water can have its time and place. We just don’t think it should be every time you reach for a drink of water. To conclude we will leave you with a goal and two action items that you can work toward:
Goal: Reduce plastic bottled-water consumptionAction item 1: Remove plastic bottled water from your grocery listsAction item 2: Build collection of sustainable water bottles that you can refill over and over again
If you’re still thinking “it’s too hard to make the transition,” try starting with one glass bottle in your fridge and reach for that instead of your plastic bottle. Then as your plastic bottle supply depletes you can slowly build your collection of sustainable water bottles. We know that making these changes are not easy but they definitely make a difference and that is something you can feel good about.
Post navigation
12 thoughts on “Mindful Homekeeping: Ditching Plastic Bottled Water”
We don’t do plain old bottled water in this house. Unless we lose water for some reason (like when the pipes froze this past winter). It just makes me angry. I do love me some flavored sparkling water, but my brand and flavor comes in cans (cans that I save for recycling). My big problem that I’ve noticed lately is storage. I use a lot of plastic storage containers and I hate myself for it. I’m checking ikea for glass containers so I can recycle or donate my plastic storage containers (thanks for the tip!)
Horrors can you imagine how much this companies are making selling a God given natural resource? I don’t normally drink bottled water. I keep a few in my cold room for some of my sceptical visitors who don’t want to drink tap water. Our city has clean water but “clean” is relative. I always add fresh lemon or lime juice to my designated 8 glasses of water. Tastes so good and fresh. Thanks for sharing.
Love this post! I swore off bottled-water a few years ago when I heard it could cause breast cancer, but it’s the only water my dad and sister drink. They’ll literally walk past the sink and out of the house to the garage to get a bottle instead of filling up a cup. If only we could go back in time and help people see how much bigger of a problem than a solution bottled-water would become…
It’s a sad mentality, people have been so conditioned to it, I have similar family members, they swear about the health benefits of water bottle and it’s cleanliness. Time will teach us all a lesson regarding this 😑😢
I wish I had come up with the idea of bottling tap water and selling it, but then again, I have a conscience. I’ll toss some sliced cucumber and lime into a carafe every now and again, get some good electrolytes and it tastes good too. Better than Gatorade, that’s for sure!
Bottled and sold. The biggest issue worldwide. A brilliant girl from India is even perusing her PhD in this research area. Water is not a commodity, it is a basic human right, would be great if u look up at her account here too. https://ideologicalstartups.wordpress.com
Follow us on Twitter
Amazon Affiliates Disclosure
The Cozy Home Chronicles is a participant in the Amazon Services LLC Associates Program, an affiliate advertising program designed to provide a means for sites to earn advertising fees by advertising and linking to Amazon.com. | 2024-04-08T01:27:15.642919 | https://example.com/article/9905 |
FILED
NOT FOR PUBLICATION MAR 23 2016
MOLLY C. DWYER, CLERK
UNITED STATES COURT OF APPEALS U.S. COURT OF APPEALS
FOR THE NINTH CIRCUIT
MICHELLE LANDER, No. 12-55674
Plaintiff - Appellant, D.C. No. 2:11-cv-08613-GHK-E
v.
MEMORANDUM*
BANK OF AMERICA CORPORATION,
a Delaware corporation,
Defendant - Appellee.
Appeal from the United States District Court
for the Central District of California
George H. King, Chief Judge, Presiding
Submitted March 15, 2016**
Before: GOODWIN, LEAVY, and CHRISTEN, Circuit Judges.
Michelle Lander appeals pro se from the district court’s judgment dismissing
her diversity action alleging a quiet title claim. We have jurisdiction under 28
U.S.C. § 1291. We review for an abuse of discretion a district court’s decision to
*
This disposition is not appropriate for publication and is not precedent
except as provided by 9th Cir. R. 36-3.
**
The panel unanimously concludes this case is suitable for decision
without oral argument. See Fed. R. App. P. 34(a)(2).
dismiss without leave to amend. Lopez v. Smith, 203 F.3d 1122, 1130 (9th Cir.
2000) (en banc). We affirm.
The district court did not abuse its discretion by dismissing without leave to
amend because the deficiencies identified by the district court in Lander’s quiet
title claim could not be cured by amendment. See Weilburg v. Shapiro, 488 F.3d
1202, 2015 (9th Cir. 2007) (“Dismissal of a pro se complaint without leave to
amend is proper only if it is absolutely clear that the deficiencies of the complaint
could not be cured by amendment.”); see also Lueras v. BAC Home Loans
Servicing, LP, 163 Cal. Rptr. 3d 804, 835 (2013) (“A borrower may not . . . quiet
title against a secured lender without first paying the outstanding debt on which the
mortgage or deed of trust is based.”); Fontenot v. Wells Fargo Bank, N.A., 129 Cal.
Rptr. 3d 467, 479-80 (2011), disapproved of on other grounds by Yvanova v. New
Century Mortg. Corp., — P.3d — (Cal. 2016) (rejecting argument that MERS
lacked the authority to assign a promissory note because it was merely a nominee
of the lender and had no interest in the note).
Bank of America Corporation’s motion to strike a portion of Lander’s reply
brief is denied.
AFFIRMED.
2 12-55674
| 2024-07-28T01:27:15.642919 | https://example.com/article/8680 |
<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN" "http://www.w3.org/TR/html4/loose.dtd">
<!--NewPage-->
<HTML>
<HEAD>
<!-- Generated by javadoc (build 1.4.2_05) on Mon Jan 16 12:55:56 PST 2006 -->
<TITLE>
XMLAttrVector
</TITLE>
<META NAME="keywords" CONTENT="org.eigenbase.xom.XMLAttrVector class">
<LINK REL ="stylesheet" TYPE="text/css" HREF="../../../stylesheet.css" TITLE="Style">
<SCRIPT type="text/javascript">
function windowTitle()
{
parent.document.title="XMLAttrVector";
}
</SCRIPT>
</HEAD>
<BODY BGCOLOR="white" onload="windowTitle();">
<!-- ========= START OF TOP NAVBAR ======= -->
<A NAME="navbar_top"><!-- --></A>
<A HREF="#skip-navbar_top" title="Skip navigation links"></A>
<TABLE BORDER="0" WIDTH="100%" CELLPADDING="1" CELLSPACING="0" SUMMARY="">
<TR>
<TD COLSPAN=3 BGCOLOR="#EEEEFF" CLASS="NavBarCell1">
<A NAME="navbar_top_firstrow"><!-- --></A>
<TABLE BORDER="0" CELLPADDING="0" CELLSPACING="3" SUMMARY="">
<TR ALIGN="center" VALIGN="top">
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../../overview-summary.html"><FONT CLASS="NavBarFont1"><B>Overview</B></FONT></A> </TD>
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="package-summary.html"><FONT CLASS="NavBarFont1"><B>Package</B></FONT></A> </TD>
<TD BGCOLOR="#FFFFFF" CLASS="NavBarCell1Rev"> <FONT CLASS="NavBarFont1Rev"><B>Class</B></FONT> </TD>
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="package-tree.html"><FONT CLASS="NavBarFont1"><B>Tree</B></FONT></A> </TD>
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../../deprecated-list.html"><FONT CLASS="NavBarFont1"><B>Deprecated</B></FONT></A> </TD>
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../../index-all.html"><FONT CLASS="NavBarFont1"><B>Index</B></FONT></A> </TD>
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../../help-doc.html"><FONT CLASS="NavBarFont1"><B>Help</B></FONT></A> </TD>
</TR>
</TABLE>
</TD>
<TD ALIGN="right" VALIGN="top" ROWSPAN=3><EM>
</EM>
</TD>
</TR>
<TR>
<TD BGCOLOR="white" CLASS="NavBarCell2"><FONT SIZE="-2">
<A HREF="../../../org/eigenbase/xom/WrapperElementDef.html" title="class in org.eigenbase.xom"><B>PREV CLASS</B></A>
<A HREF="../../../org/eigenbase/xom/XMLOutput.html" title="class in org.eigenbase.xom"><B>NEXT CLASS</B></A></FONT></TD>
<TD BGCOLOR="white" CLASS="NavBarCell2"><FONT SIZE="-2">
<A HREF="../../../index.html" target="_top"><B>FRAMES</B></A>
<A HREF="XMLAttrVector.html" target="_top"><B>NO FRAMES</B></A>
<SCRIPT type="text/javascript">
<!--
if(window==top) {
document.writeln('<A HREF="../../../allclasses-noframe.html"><B>All Classes</B></A>');
}
//-->
</SCRIPT>
<NOSCRIPT>
<A HREF="../../../allclasses-noframe.html"><B>All Classes</B></A>
</NOSCRIPT>
</FONT></TD>
</TR>
<TR>
<TD VALIGN="top" CLASS="NavBarCell3"><FONT SIZE="-2">
SUMMARY: NESTED | FIELD | <A HREF="#constructor_summary">CONSTR</A> | <A HREF="#method_summary">METHOD</A></FONT></TD>
<TD VALIGN="top" CLASS="NavBarCell3"><FONT SIZE="-2">
DETAIL: FIELD | <A HREF="#constructor_detail">CONSTR</A> | <A HREF="#method_detail">METHOD</A></FONT></TD>
</TR>
</TABLE>
<A NAME="skip-navbar_top"></A>
<!-- ========= END OF TOP NAVBAR ========= -->
<HR>
<!-- ======== START OF CLASS DATA ======== -->
<H2>
<FONT SIZE="-1">
org.eigenbase.xom</FONT>
<BR>
Class XMLAttrVector</H2>
<PRE>
<A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/Object.html" title="class or interface in java.lang">java.lang.Object</A>
<IMG SRC="../../../resources/inherit.gif" ALT="extended by"><B>org.eigenbase.xom.XMLAttrVector</B>
</PRE>
<HR>
<DL>
<DT>public class <A HREF="../../../src-html/org\eigenbase\xom\XMLAttrVector.html#line.34"><B>XMLAttrVector</B></A><DT>extends <A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/Object.html" title="class or interface in java.lang">Object</A></DL>
<P>
XMLAttrVector is an class which assists in writing XML attributes to a
stream.
<P>
<P>
<HR>
<P>
<!-- ======== NESTED CLASS SUMMARY ======== -->
<!-- =========== FIELD SUMMARY =========== -->
<!-- ======== CONSTRUCTOR SUMMARY ======== -->
<A NAME="constructor_summary"><!-- --></A>
<TABLE BORDER="1" WIDTH="100%" CELLPADDING="3" CELLSPACING="0" SUMMARY="">
<TR BGCOLOR="#CCCCFF" CLASS="TableHeadingColor">
<TD COLSPAN=2><FONT SIZE="+2">
<B>Constructor Summary</B></FONT></TD>
</TR>
<TR BGCOLOR="white" CLASS="TableRowColor">
<TD><CODE><B><A HREF="../../../org/eigenbase/xom/XMLAttrVector.html#XMLAttrVector()">XMLAttrVector</A></B>()</CODE>
<BR>
Construct an empty XMLAttrVector.</TD>
</TR>
</TABLE>
<!-- ========== METHOD SUMMARY =========== -->
<A NAME="method_summary"><!-- --></A>
<TABLE BORDER="1" WIDTH="100%" CELLPADDING="3" CELLSPACING="0" SUMMARY="">
<TR BGCOLOR="#CCCCFF" CLASS="TableHeadingColor">
<TD COLSPAN=2><FONT SIZE="+2">
<B>Method Summary</B></FONT></TD>
</TR>
<TR BGCOLOR="white" CLASS="TableRowColor">
<TD ALIGN="right" VALIGN="top" WIDTH="1%"><FONT SIZE="-1">
<CODE> <A HREF="../../../org/eigenbase/xom/XMLAttrVector.html" title="class in org.eigenbase.xom">XMLAttrVector</A></CODE></FONT></TD>
<TD><CODE><B><A HREF="../../../org/eigenbase/xom/XMLAttrVector.html#add(java.lang.String, boolean)">add</A></B>(<A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/String.html" title="class or interface in java.lang">String</A> attrName,
boolean attrVal)</CODE>
<BR>
Add a new attribute/value pair based on a boolean value.</TD>
</TR>
<TR BGCOLOR="white" CLASS="TableRowColor">
<TD ALIGN="right" VALIGN="top" WIDTH="1%"><FONT SIZE="-1">
<CODE> <A HREF="../../../org/eigenbase/xom/XMLAttrVector.html" title="class in org.eigenbase.xom">XMLAttrVector</A></CODE></FONT></TD>
<TD><CODE><B><A HREF="../../../org/eigenbase/xom/XMLAttrVector.html#add(java.lang.String, double)">add</A></B>(<A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/String.html" title="class or interface in java.lang">String</A> attrName,
double attrVal)</CODE>
<BR>
Add a new attribute/value pair based on a double value.</TD>
</TR>
<TR BGCOLOR="white" CLASS="TableRowColor">
<TD ALIGN="right" VALIGN="top" WIDTH="1%"><FONT SIZE="-1">
<CODE> <A HREF="../../../org/eigenbase/xom/XMLAttrVector.html" title="class in org.eigenbase.xom">XMLAttrVector</A></CODE></FONT></TD>
<TD><CODE><B><A HREF="../../../org/eigenbase/xom/XMLAttrVector.html#add(java.lang.String, int)">add</A></B>(<A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/String.html" title="class or interface in java.lang">String</A> attrName,
int attrVal)</CODE>
<BR>
Add a new attribute/value pair based on an int value.</TD>
</TR>
<TR BGCOLOR="white" CLASS="TableRowColor">
<TD ALIGN="right" VALIGN="top" WIDTH="1%"><FONT SIZE="-1">
<CODE> <A HREF="../../../org/eigenbase/xom/XMLAttrVector.html" title="class in org.eigenbase.xom">XMLAttrVector</A></CODE></FONT></TD>
<TD><CODE><B><A HREF="../../../org/eigenbase/xom/XMLAttrVector.html#add(java.lang.String, java.lang.Object)">add</A></B>(<A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/String.html" title="class or interface in java.lang">String</A> attrName,
<A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/Object.html" title="class or interface in java.lang">Object</A> attrVal)</CODE>
<BR>
Add a new attribute/value pair based on a String value.</TD>
</TR>
<TR BGCOLOR="white" CLASS="TableRowColor">
<TD ALIGN="right" VALIGN="top" WIDTH="1%"><FONT SIZE="-1">
<CODE> void</CODE></FONT></TD>
<TD><CODE><B><A HREF="../../../org/eigenbase/xom/XMLAttrVector.html#display(java.io.PrintWriter, int)">display</A></B>(<A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/io/PrintWriter.html" title="class or interface in java.io">PrintWriter</A> out,
int indent)</CODE>
<BR>
Displays the entire attribute/value pair list, given a PrintWriter
to which to display and an indentation level.</TD>
</TR>
<TR BGCOLOR="white" CLASS="TableRowColor">
<TD ALIGN="right" VALIGN="top" WIDTH="1%"><FONT SIZE="-1">
<CODE> int</CODE></FONT></TD>
<TD><CODE><B><A HREF="../../../org/eigenbase/xom/XMLAttrVector.html#size()">size</A></B>()</CODE>
<BR>
Returns the number of attributes.</TD>
</TR>
</TABLE>
<A NAME="methods_inherited_from_class_java.lang.Object"><!-- --></A>
<TABLE BORDER="1" WIDTH="100%" CELLPADDING="3" CELLSPACING="0" SUMMARY="">
<TR BGCOLOR="#EEEEFF" CLASS="TableSubHeadingColor">
<TD><B>Methods inherited from class java.lang.<A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/Object.html" title="class or interface in java.lang">Object</A></B></TD>
</TR>
<TR BGCOLOR="white" CLASS="TableRowColor">
<TD><CODE><A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/Object.html#clone()" title="class or interface in java.lang">clone</A>, <A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/Object.html#equals(java.lang.Object)" title="class or interface in java.lang">equals</A>, <A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/Object.html#finalize()" title="class or interface in java.lang">finalize</A>, <A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/Object.html#getClass()" title="class or interface in java.lang">getClass</A>, <A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/Object.html#hashCode()" title="class or interface in java.lang">hashCode</A>, <A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/Object.html#notify()" title="class or interface in java.lang">notify</A>, <A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/Object.html#notifyAll()" title="class or interface in java.lang">notifyAll</A>, <A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/Object.html#toString()" title="class or interface in java.lang">toString</A>, <A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/Object.html#wait()" title="class or interface in java.lang">wait</A>, <A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/Object.html#wait(long)" title="class or interface in java.lang">wait</A>, <A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/Object.html#wait(long, int)" title="class or interface in java.lang">wait</A></CODE></TD>
</TR>
</TABLE>
<P>
<!-- ============ FIELD DETAIL =========== -->
<!-- ========= CONSTRUCTOR DETAIL ======== -->
<A NAME="constructor_detail"><!-- --></A>
<TABLE BORDER="1" WIDTH="100%" CELLPADDING="3" CELLSPACING="0" SUMMARY="">
<TR BGCOLOR="#CCCCFF" CLASS="TableHeadingColor">
<TD COLSPAN=1><FONT SIZE="+2">
<B>Constructor Detail</B></FONT></TD>
</TR>
</TABLE>
<A NAME="XMLAttrVector()"><!-- --></A><H3>
XMLAttrVector</H3>
<PRE>
public <A HREF="../../../src-html/org\eigenbase\xom\XMLAttrVector.html#line.59"><B>XMLAttrVector</B></A>()</PRE>
<DL>
<DD>Construct an empty XMLAttrVector. Attribute/value pairs may be added
with the add() functions below.
<P>
</DL>
<!-- ============ METHOD DETAIL ========== -->
<A NAME="method_detail"><!-- --></A>
<TABLE BORDER="1" WIDTH="100%" CELLPADDING="3" CELLSPACING="0" SUMMARY="">
<TR BGCOLOR="#CCCCFF" CLASS="TableHeadingColor">
<TD COLSPAN=1><FONT SIZE="+2">
<B>Method Detail</B></FONT></TD>
</TR>
</TABLE>
<A NAME="size()"><!-- --></A><H3>
size</H3>
<PRE>
public int <A HREF="../../../src-html/org\eigenbase\xom\XMLAttrVector.html#line.67"><B>size</B></A>()</PRE>
<DL>
<DD>Returns the number of attributes.
<P>
<DD><DL>
</DL>
</DD>
</DL>
<HR>
<A NAME="add(java.lang.String, java.lang.Object)"><!-- --></A><H3>
add</H3>
<PRE>
public <A HREF="../../../org/eigenbase/xom/XMLAttrVector.html" title="class in org.eigenbase.xom">XMLAttrVector</A> <A HREF="../../../src-html/org\eigenbase\xom\XMLAttrVector.html#line.79"><B>add</B></A>(<A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/String.html" title="class or interface in java.lang">String</A> attrName,
<A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/Object.html" title="class or interface in java.lang">Object</A> attrVal)</PRE>
<DL>
<DD>Add a new attribute/value pair based on a String value. Note that
attrVal may be null, in which case no attribute/value pair is added.
<P>
<DD><DL>
<DT><B>Parameters:</B><DD><CODE>attrName</CODE> - the name of the attribute.<DD><CODE>attrVal</CODE> - the String value of the attribute.
<DT><B>Returns:</B><DD>this (to allow chaining)</DL>
</DD>
</DL>
<HR>
<A NAME="add(java.lang.String, int)"><!-- --></A><H3>
add</H3>
<PRE>
public <A HREF="../../../org/eigenbase/xom/XMLAttrVector.html" title="class in org.eigenbase.xom">XMLAttrVector</A> <A HREF="../../../src-html/org\eigenbase\xom\XMLAttrVector.html#line.92"><B>add</B></A>(<A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/String.html" title="class or interface in java.lang">String</A> attrName,
int attrVal)</PRE>
<DL>
<DD>Add a new attribute/value pair based on an int value.
<P>
<DD><DL>
<DT><B>Parameters:</B><DD><CODE>attrName</CODE> - the name of the attribute.<DD><CODE>attrVal</CODE> - the int value of the attribute.
<DT><B>Returns:</B><DD>this (to allow chaining)</DL>
</DD>
</DL>
<HR>
<A NAME="add(java.lang.String, double)"><!-- --></A><H3>
add</H3>
<PRE>
public <A HREF="../../../org/eigenbase/xom/XMLAttrVector.html" title="class in org.eigenbase.xom">XMLAttrVector</A> <A HREF="../../../src-html/org\eigenbase\xom\XMLAttrVector.html#line.104"><B>add</B></A>(<A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/String.html" title="class or interface in java.lang">String</A> attrName,
double attrVal)</PRE>
<DL>
<DD>Add a new attribute/value pair based on a double value.
<P>
<DD><DL>
<DT><B>Parameters:</B><DD><CODE>attrName</CODE> - the name of the attribute.<DD><CODE>attrVal</CODE> - the double value of the attribute.
<DT><B>Returns:</B><DD>this (to allow chaining)</DL>
</DD>
</DL>
<HR>
<A NAME="add(java.lang.String, boolean)"><!-- --></A><H3>
add</H3>
<PRE>
public <A HREF="../../../org/eigenbase/xom/XMLAttrVector.html" title="class in org.eigenbase.xom">XMLAttrVector</A> <A HREF="../../../src-html/org\eigenbase\xom\XMLAttrVector.html#line.117"><B>add</B></A>(<A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/lang/String.html" title="class or interface in java.lang">String</A> attrName,
boolean attrVal)</PRE>
<DL>
<DD>Add a new attribute/value pair based on a boolean value.
True is represented as "true", and false as "false".
<P>
<DD><DL>
<DT><B>Parameters:</B><DD><CODE>attrName</CODE> - the name of the attribute.<DD><CODE>attrVal</CODE> - the boolean value of the attribute.
<DT><B>Returns:</B><DD>this (to allow chaining)</DL>
</DD>
</DL>
<HR>
<A NAME="display(java.io.PrintWriter, int)"><!-- --></A><H3>
display</H3>
<PRE>
public void <A HREF="../../../src-html/org\eigenbase\xom\XMLAttrVector.html#line.133"><B>display</B></A>(<A HREF="http://java.sun.com/j2se/1.4.2/docs/api/java/io/PrintWriter.html" title="class or interface in java.io">PrintWriter</A> out,
int indent)</PRE>
<DL>
<DD>Displays the entire attribute/value pair list, given a PrintWriter
to which to display and an indentation level.
This function is typically called from XMLOutput.
<P>
<DD><DL>
<DT><B>Parameters:</B><DD><CODE>out</CODE> - PrintWriter to which to write output.<DD><CODE>indent</CODE> - indentation level.</DL>
</DD>
</DL>
<!-- ========= END OF CLASS DATA ========= -->
<HR>
<!-- ======= START OF BOTTOM NAVBAR ====== -->
<A NAME="navbar_bottom"><!-- --></A>
<A HREF="#skip-navbar_bottom" title="Skip navigation links"></A>
<TABLE BORDER="0" WIDTH="100%" CELLPADDING="1" CELLSPACING="0" SUMMARY="">
<TR>
<TD COLSPAN=3 BGCOLOR="#EEEEFF" CLASS="NavBarCell1">
<A NAME="navbar_bottom_firstrow"><!-- --></A>
<TABLE BORDER="0" CELLPADDING="0" CELLSPACING="3" SUMMARY="">
<TR ALIGN="center" VALIGN="top">
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../../overview-summary.html"><FONT CLASS="NavBarFont1"><B>Overview</B></FONT></A> </TD>
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="package-summary.html"><FONT CLASS="NavBarFont1"><B>Package</B></FONT></A> </TD>
<TD BGCOLOR="#FFFFFF" CLASS="NavBarCell1Rev"> <FONT CLASS="NavBarFont1Rev"><B>Class</B></FONT> </TD>
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="package-tree.html"><FONT CLASS="NavBarFont1"><B>Tree</B></FONT></A> </TD>
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../../deprecated-list.html"><FONT CLASS="NavBarFont1"><B>Deprecated</B></FONT></A> </TD>
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../../index-all.html"><FONT CLASS="NavBarFont1"><B>Index</B></FONT></A> </TD>
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../../help-doc.html"><FONT CLASS="NavBarFont1"><B>Help</B></FONT></A> </TD>
</TR>
</TABLE>
</TD>
<TD ALIGN="right" VALIGN="top" ROWSPAN=3><EM>
<a href=http://sourceforge.net><img src=http://sourceforge.net/sflogo.php?group_id=127783&type=1 width=88 height=31 border=0 alt=SourceForge.net_Logo></a></EM>
</TD>
</TR>
<TR>
<TD BGCOLOR="white" CLASS="NavBarCell2"><FONT SIZE="-2">
<A HREF="../../../org/eigenbase/xom/WrapperElementDef.html" title="class in org.eigenbase.xom"><B>PREV CLASS</B></A>
<A HREF="../../../org/eigenbase/xom/XMLOutput.html" title="class in org.eigenbase.xom"><B>NEXT CLASS</B></A></FONT></TD>
<TD BGCOLOR="white" CLASS="NavBarCell2"><FONT SIZE="-2">
<A HREF="../../../index.html" target="_top"><B>FRAMES</B></A>
<A HREF="XMLAttrVector.html" target="_top"><B>NO FRAMES</B></A>
<SCRIPT type="text/javascript">
<!--
if(window==top) {
document.writeln('<A HREF="../../../allclasses-noframe.html"><B>All Classes</B></A>');
}
//-->
</SCRIPT>
<NOSCRIPT>
<A HREF="../../../allclasses-noframe.html"><B>All Classes</B></A>
</NOSCRIPT>
</FONT></TD>
</TR>
<TR>
<TD VALIGN="top" CLASS="NavBarCell3"><FONT SIZE="-2">
SUMMARY: NESTED | FIELD | <A HREF="#constructor_summary">CONSTR</A> | <A HREF="#method_summary">METHOD</A></FONT></TD>
<TD VALIGN="top" CLASS="NavBarCell3"><FONT SIZE="-2">
DETAIL: FIELD | <A HREF="#constructor_detail">CONSTR</A> | <A HREF="#method_detail">METHOD</A></FONT></TD>
</TR>
</TABLE>
<A NAME="skip-navbar_bottom"></A>
<!-- ======== END OF BOTTOM NAVBAR ======= -->
<HR>
</BODY>
</HTML>
| 2024-06-25T01:27:15.642919 | https://example.com/article/8486 |
// Created on: 2011-07-13
// Created by: Sergey ZERCHANINOV
// Copyright (c) 2011-2013 OPEN CASCADE SAS
//
// This file is part of Open CASCADE Technology software library.
//
// This library is free software; you can redistribute it and/or modify it under
// the terms of the GNU Lesser General Public License version 2.1 as published
// by the Free Software Foundation, with special exception defined in the file
// OCCT_LGPL_EXCEPTION.txt. Consult the file LICENSE_LGPL_21.txt included in OCCT
// distribution for complete text of the license and disclaimer of any warranty.
//
// Alternatively, this file may be used under the terms of Open CASCADE
// commercial license or contractual agreement.
#ifndef OpenGl_Text_Header
#define OpenGl_Text_Header
#include <OpenGl_Element.hxx>
#include <OpenGl_AspectText.hxx>
#include <OpenGl_TextParam.hxx>
#include <OpenGl_TextFormatter.hxx>
#include <TCollection_ExtendedString.hxx>
#include <Graphic3d_Vertex.hxx>
#include <Graphic3d_HorizontalTextAlignment.hxx>
#include <Graphic3d_VerticalTextAlignment.hxx>
class Handle(OpenGl_PrinterContext);
//! Text rendering
class OpenGl_Text : public OpenGl_Element
{
public:
//! Main constructor
Standard_EXPORT OpenGl_Text (const Standard_Utf8Char* theText,
const OpenGl_Vec3& thePoint,
const OpenGl_TextParam& theParams);
//! Setup new string and position
Standard_EXPORT void Init (const Handle(OpenGl_Context)& theCtx,
const Standard_Utf8Char* theText,
const OpenGl_Vec3& thePoint);
//! Setup new string and parameters
Standard_EXPORT void Init (const Handle(OpenGl_Context)& theCtx,
const Standard_Utf8Char* theText,
const OpenGl_Vec3& thePoint,
const OpenGl_TextParam& theParams);
//! Setup new position
Standard_EXPORT void SetPosition (const OpenGl_Vec3& thePoint);
//! Setup new font size
Standard_EXPORT void SetFontSize (const Handle(OpenGl_Context)& theContext,
const Standard_Integer theFontSize);
Standard_EXPORT virtual void Render (const Handle(OpenGl_Workspace)& theWorkspace) const;
Standard_EXPORT virtual void Release (OpenGl_Context* theContext);
public: //! @name methods for compatibility with layers
//! Empty constructor
Standard_EXPORT OpenGl_Text();
//! Create key for shared resource
Standard_EXPORT static TCollection_AsciiString FontKey (const OpenGl_AspectText& theAspect,
const Standard_Integer theHeight);
//! Find shared resource for specified font or initialize new one
Standard_EXPORT static Handle(OpenGl_Font) FindFont (const Handle(OpenGl_Context)& theCtx,
const OpenGl_AspectText& theAspect,
const Standard_Integer theHeight,
const TCollection_AsciiString theKey);
//! Compute text width
Standard_EXPORT static void StringSize (const Handle(OpenGl_Context)& theCtx,
const NCollection_String& theText,
const OpenGl_AspectText& theTextAspect,
const OpenGl_TextParam& theParams,
Standard_ShortReal& theWidth,
Standard_ShortReal& theAscent,
Standard_ShortReal& theDescent);
//! Setup new string and parameters
Standard_EXPORT void Init (const Handle(OpenGl_Context)& theCtx,
const TCollection_ExtendedString& theText,
const OpenGl_Vec2& thePoint,
const OpenGl_TextParam& theParams);
//! Perform rendering
Standard_EXPORT void Render (const Handle(OpenGl_PrinterContext)& thePrintCtx,
const Handle(OpenGl_Context)& theCtx,
const OpenGl_AspectText& theTextAspect) const;
protected:
//! Destructor
Standard_EXPORT virtual ~OpenGl_Text();
friend class OpenGl_Trihedron;
friend class OpenGl_GraduatedTrihedron;
private:
//! Release cached VBO resources
void releaseVbos (OpenGl_Context* theCtx);
//! Setup matrix.
void setupMatrix (const Handle(OpenGl_PrinterContext)& thePrintCtx,
const Handle(OpenGl_Context)& theCtx,
const OpenGl_AspectText& theTextAspect,
const OpenGl_Vec3 theDVec) const;
//! Draw arrays of vertices.
void drawText (const Handle(OpenGl_PrinterContext)& thePrintCtx,
const Handle(OpenGl_Context)& theCtx,
const OpenGl_AspectText& theTextAspect) const;
//! Main rendering code
void render (const Handle(OpenGl_PrinterContext)& thePrintCtx,
const Handle(OpenGl_Context)& theCtx,
const OpenGl_AspectText& theTextAspect,
const TEL_COLOUR& theColorText,
const TEL_COLOUR& theColorSubs) const;
protected:
mutable Handle(OpenGl_Font) myFont;
mutable NCollection_Vector<GLuint> myTextures; //!< textures' IDs
mutable NCollection_Vector<Handle(OpenGl_VertexBuffer)> myVertsVbo; //!< VBOs of vertices
mutable NCollection_Vector<Handle(OpenGl_VertexBuffer)> myTCrdsVbo; //!< VBOs of texture coordinates
mutable Font_FTFont::Rect myBndBox;
protected:
mutable OpenGl_Mat4d myProjMatrix;
mutable OpenGl_Mat4d myModelMatrix;
mutable GLint myViewport[4];
mutable GLdouble myWinX;
mutable GLdouble myWinY;
mutable GLdouble myWinZ;
mutable GLdouble myScaleHeight;
mutable GLdouble myExportHeight;
protected:
OpenGl_TextParam myParams;
NCollection_String myString;
OpenGl_Vec3 myPoint;
bool myIs2d;
public:
DEFINE_STANDARD_ALLOC
};
#endif //OpenGl_Text_Header
| 2024-01-01T01:27:15.642919 | https://example.com/article/4905 |
<?xml version="1.0" encoding="UTF-8"?>
<Workspace
version = "1.0">
<FileRef
location = "self:Digger.xcodeproj">
</FileRef>
</Workspace>
| 2024-05-24T01:27:15.642919 | https://example.com/article/1490 |
Parallel Bible results for Judges 6:11-24
Scripture Formatting
Font Size
Extra Small
Small
Medium
Large
Font
Helvetica
Open Sans
Merriweather
New International Version
New International Version
Judges 6:11-24
NIV 11
The angel of the LORD came and sat down under the oak in Ophrah that belonged to Joash the Abiezrite, where his son Gideon was threshing wheat in a winepress to keep it from the Midianites.
NIV 11
The angel of the LORD came and sat down under the oak in Ophrah that belonged to Joash the Abiezrite, where his son Gideon was threshing wheat in a winepress to keep it from the Midianites.
NIV 12
When the angel of the LORD appeared to Gideon, he said, "The LORD is with you, mighty warrior."
NIV 12
When the angel of the LORD appeared to Gideon, he said, "The LORD is with you, mighty warrior."
NIV 13
"But sir," Gideon replied, "if the LORD is with us, why has all this happened to us? Where are all his wonders that our fathers told us about when they said, 'Did not the LORD bring us up out of Egypt?' But now the LORD has abandoned us and put us into the hand of Midian."
NIV 13
"But sir," Gideon replied, "if the LORD is with us, why has all this happened to us? Where are all his wonders that our fathers told us about when they said, 'Did not the LORD bring us up out of Egypt?' But now the LORD has abandoned us and put us into the hand of Midian."
NIV 14
The LORD turned to him and said, "Go in the strength you have and save Israel out of Midian's hand. Am I not sending you?"
NIV 14
The LORD turned to him and said, "Go in the strength you have and save Israel out of Midian's hand. Am I not sending you?"
NIV 15
"But Lord, " Gideon asked, "how can I save Israel? My clan is the weakest in Manasseh, and I am the least in my family."
NIV 15
"But Lord, " Gideon asked, "how can I save Israel? My clan is the weakest in Manasseh, and I am the least in my family."
NIV 16
The LORD answered, "I will be with you, and you will strike down all the Midianites together."
NIV 16
The LORD answered, "I will be with you, and you will strike down all the Midianites together."
NIV 17
Gideon replied, "If now I have found favor in your eyes, give me a sign that it is really you talking to me.
NIV 17
Gideon replied, "If now I have found favor in your eyes, give me a sign that it is really you talking to me.
NIV 18
Please do not go away until I come back and bring my offering and set it before you." And the LORD said, "I will wait until you return."
NIV 18
Please do not go away until I come back and bring my offering and set it before you." And the LORD said, "I will wait until you return."
NIV 19
Gideon went in, prepared a young goat, and from an ephah of flour he made bread without yeast. Putting the meat in a basket and its broth in a pot, he brought them out and offered them to him under the oak.
NIV 19
Gideon went in, prepared a young goat, and from an ephah of flour he made bread without yeast. Putting the meat in a basket and its broth in a pot, he brought them out and offered them to him under the oak.
NIV 20
The angel of God said to him, "Take the meat and the unleavened bread, place them on this rock, and pour out the broth." And Gideon did so.
NIV 20
The angel of God said to him, "Take the meat and the unleavened bread, place them on this rock, and pour out the broth." And Gideon did so.
NIV 21
With the tip of the staff that was in his hand, the angel of the LORD touched the meat and the unleavened bread. Fire flared from the rock, consuming the meat and the bread. And the angel of the LORD disappeared.
NIV 21
With the tip of the staff that was in his hand, the angel of the LORD touched the meat and the unleavened bread. Fire flared from the rock, consuming the meat and the bread. And the angel of the LORD disappeared.
NIV 22
When Gideon realized that it was the angel of the LORD, he exclaimed, "Ah, Sovereign LORD! I have seen the angel of the LORD face to face!"
NIV 22
When Gideon realized that it was the angel of the LORD, he exclaimed, "Ah, Sovereign LORD! I have seen the angel of the LORD face to face!"
NIV 23
But the LORD said to him, "Peace! Do not be afraid. You are not going to die."
NIV 23
But the LORD said to him, "Peace! Do not be afraid. You are not going to die."
NIV 24
So Gideon built an altar to the LORD there and called it The LORD is Peace. To this day it stands in Ophrah of the Abiezrites.
NIV 24
So Gideon built an altar to the LORD there and called it The LORD is Peace. To this day it stands in Ophrah of the Abiezrites.
New International Version
Judges 6:11-24
NIV 11
The angel of the LORD came and sat down under the oak in Ophrah that belonged to Joash the Abiezrite, where his son Gideon was threshing wheat in a winepress to keep it from the Midianites.
NIV 12
When the angel of the LORD appeared to Gideon, he said, "The LORD is with you, mighty warrior."
NIV 13
"But sir," Gideon replied, "if the LORD is with us, why has all this happened to us? Where are all his wonders that our fathers told us about when they said, 'Did not the LORD bring us up out of Egypt?' But now the LORD has abandoned us and put us into the hand of Midian."
NIV 14
The LORD turned to him and said, "Go in the strength you have and save Israel out of Midian's hand. Am I not sending you?"
NIV 15
"But Lord, " Gideon asked, "how can I save Israel? My clan is the weakest in Manasseh, and I am the least in my family."
NIV 16
The LORD answered, "I will be with you, and you will strike down all the Midianites together."
NIV 17
Gideon replied, "If now I have found favor in your eyes, give me a sign that it is really you talking to me.
NIV 18
Please do not go away until I come back and bring my offering and set it before you." And the LORD said, "I will wait until you return."
NIV 19
Gideon went in, prepared a young goat, and from an ephah of flour he made bread without yeast. Putting the meat in a basket and its broth in a pot, he brought them out and offered them to him under the oak.
NIV 20
The angel of God said to him, "Take the meat and the unleavened bread, place them on this rock, and pour out the broth." And Gideon did so.
NIV 21
With the tip of the staff that was in his hand, the angel of the LORD touched the meat and the unleavened bread. Fire flared from the rock, consuming the meat and the bread. And the angel of the LORD disappeared.
NIV 22
When Gideon realized that it was the angel of the LORD, he exclaimed, "Ah, Sovereign LORD! I have seen the angel of the LORD face to face!"
NIV 23
But the LORD said to him, "Peace! Do not be afraid. You are not going to die."
NIV 24
So Gideon built an altar to the LORD there and called it The LORD is Peace. To this day it stands in Ophrah of the Abiezrites. | 2024-03-29T01:27:15.642919 | https://example.com/article/4263 |
Introduction {#s1}
============
Cervical cancer incidence has been declining for the past several decades worldwide because of the successful implementation of screening programs ([@B1], [@B2]). However, the proportion of young patients with early stage cervical cancer, especially adenocarcinoma, is increasing greatly ([@B3]). According to the report of the American Cancer Society ([@B4]), cervical cancer continues to be the second leading cause of cancer death in women aged 20--39 years (nine deaths per week were recorded in this age group). Adenocarcinoma accounts for \~28% of all cervical cancer cases ([@B5]). Adenocarcinoma in cervical cancer even reached to 40% in women aged ≤25 years in a recently published study ([@B6]). Conservation of ovarian endocrine function or fertility sparing is greatly desirable in this group of young patients.
Unlike squamous cell carcinoma (SCC), cervical adenocarcinoma is believed to be more aggressive and may have an inclination of blood vessel invasion, deep stromal invasion (DSI), and lymph node metastases (LNM) ([@B7]). Nevertheless, a recent study showed that early stage cervical adenocarcinoma has a good prognosis, and the 5-year survival rate is \>80% ([@B8]). In the study of Kasamatsu et al. ([@B9]), no significant difference in survival or relapse between SCC and adenocarcinoma was found.
Ovarian preservation in early stage SCC has been well-established since McCall et al. ([@B10]) firstly presented it in 1958. However, no consensus about the safety of ovarian preservation in cervical adenocarcinoma exists. Studies showed that the incidence of ovarian metastases in early stage adenocarcinoma is higher than that in SCC, but mostly lower than 5% ([@B11]--[@B15]), and a few studies reported slightly high, which were 10.2% ([@B16]) and 12.9% ([@B17]). Radical bilateral salpingo-oophorectomy sacrifices endocrine function while possibly eliminating the concealed lesions in the ovaries. Young patients experience menopausal symptoms including immediate hot flashes, vaginal atrophy, osteoporosis, and emotional problems, earlier than expected ([@B18]). Performing the least aggressive procedure without sacrificing oncologic safety is vital for young women diagnosed with early stage cervical adenocarcinoma.
In this study, we systematically reviewed all available relevant studies and conducted a meta-analysis to evaluate the oncological outcomes and safety of ovarian preservation. In addition, we summarized the prognostic factors for cervical adenocarcinoma and risk factors for ovarian metastases.
Materials and Methods {#s2}
=====================
Search Strategy
---------------
PubMed, Embase, and Cochranes database were searched for publications up to January 2019. We used the following search terms in the title or abstract: "cervical neoplasm," "adenocarcinoma," "ovarian preservation," and "ovarian conservation." Both free words and Emtree terms were applied in the search. The language was limited to "English" and the object to "human" ([Supplementary Data Sheet 1](#SM1){ref-type="supplementary-material"}).
Inclusion and Exclusion Criteria
--------------------------------
Studies were included in this meta-analysis if: (1) the diagnosis of cervical adenocarcinoma based on International Federation of Gynecology and Obstetrics (FIGO) stage I or II adenocarcinoma of cervix; (2) they were prospective, retrospective cohort, or cross-sectional original studies; (3) they included at least 10 patients; (4) at least one outcome, such as overall survival (OS) or progression-free survival (PFS) was assessed; (5) the odds ratios (ORs) and their 95% confidence intervals (95% CIs), or the number of events used to calculate them was reported.
The inclusion criteria for the review of prognostic factors for cervical adenocarcinoma and risk factors for ovarian metastases were as follows: (1) original studies that reported the ovarian metastasis rate of FIGO stage I or II cervical adenocarcinoma; (2) studies that evaluated the prognostic factors for cervical adenocarcinoma or risk factors for ovarian metastases using a statistical analysis.
Studies were excluded if they meet following criteria: (1) review articles or case reports with fewer than 10 cases; (2) lack of sufficient data to estimate OR and 95% CI; (3) reporting duplicate or overlapping data; (4) without full text.
Data Extraction
---------------
The following information was extracted from each eligible study: first author\'s name, published year, study design, country, patients\' mean age, FIGO stage, number of patients, number of patients who underwent hysterectomy and oophorectomy/ovarian preservation, incidence of ovarian metastases, and data on OS and/or PFS. Two investigators (CHY and ZLJ) extracted the data independently, and any discrepancies and disagreements were discussed and resolved by the adjudicating senior author (YJJ).
Quality Assessment
------------------
The Newcastle-Ottawa Quality Assessment Scale for case-control studies was used to evaluate the included studies. Selection, comparability, and exposure were measured. A maximum of nine stars was assigned to each study: 4 for selection, 2 for comparability, and 3 for exposure. A final score \> 6 was considered as a high quality ([@B19], [@B20]). Two authors (KYJ and HLQ) independently assessed the quality of the included studies and disagreements were resolved by discussion ([Supplementary Table 1](#SM2){ref-type="supplementary-material"}).
Statistical Analysis
--------------------
Survival data, including OS, PFS, and time-to-event were calculated as dichotomous data. STATA statistical software version 19.0 (Stata Corp. LLC, College Station, TX, USA) was used to pool the study-specific ORs and 95% CIs and generate forest plots. Cochran\'s-Q test and *I*^2^ statistics were used to evaluate heterogeneity ([@B21]). Heterogeneity was considered significant when the *P*-value \<0.05 in Cochran\'s-Q test and when *I*^2^ \> 50% in *I*^2^ statistics. If so, random-effects model was used. Otherwise, a fixed-effects model was used. Publication bias was evaluated by funnel plots. Sensitivity analysis was performed by omitting one study at a time to assess its effect on the final result.
Results {#s3}
=======
Search Results and Study Characteristics
----------------------------------------
In total, 68 unique manuscripts were identified through the search strategy, and 10 studies were included in the meta-analysis of the safety of ovarian preservation. The reasons for excluding records are depicted in [Figure 1](#F1){ref-type="fig"}. A total of 19 studies were included in the review of prognostic factors for cervical adenocarcinoma and risk factors for ovarian metastases based on the inclusion and exclusion criteria. The included studies were all retrospective in nature, and detailed characteristics of the 10 studies are presented in [Table 1](#T1){ref-type="table"} ([@B7], [@B9], [@B12], [@B13], [@B22]--[@B28]).
{#F1}
######
Characteristics of studies included in the meta-analysis.
**Author** **Year** **Study period** **Country** **Mean age (Y)** **FIGO stage** **No. patients** **Ovarian preservation (*n*)** **Oophorectomy (*n*)** **Rate of ovarian metastases** **Survival outcome reported**
------------------------------- ---------- ------------------ ------------- ------------------ ---------------- ------------------ -------------------------------- ------------------------ -------------------------------- -------------------------------
Hopkins et al. ([@B22]) 1987 1970--1984 US NA I 24 8 16 0/16 OS
Angel et al. ([@B12]) 1992 1966--1990 US 47 I 59 41 18 0/41 OS, PFS
Sutton et al. ([@B13]) 1992 1981--1984 GOG NA I 121 41 80 2/80 (2.5%) PFS
Kasamatsu et al. ([@B9]) 2009 1984--2003 Japan 48 I-II 123 22 100 6/100 (6%) OS, PFS
Chen et al. ([@B7]) 2016 1999--2013 China 43.6 I-II 194 33 153 5/153 (3.3%) OS, PFS
Ruengkhachorn et al. ([@B23]) 2016 2006--2013 Thailand 44.9 I 35 16 19 0/19 PFS
Matsuo et al. ([@B24]) 2017 1983--2012 SEER 45.3 I 4,019 960 3,059 NA OS
Hu et al. ([@B25]) 2017 1994--2015 China 46.2 I--II 105 19 86 3/86 (3.5%) OS
Xie et al. ([@B26]) 2018 2003--2015 China 44.3 I--II 128 15 113 1/113 (0.9%) OS
Guo et al. ([@B27]) 2018 1995--2017 China NA I--II 267 44 223 13/223 (5.8%) PFS
Total -- -- -- 45.6 -- 5,075 1,199 3,867 30/831 (3.61%) --
*FIGO, International Federation of Gynecology and Obstetrics; GOG, Gynecologic Oncology Group; NA, not available; OS, overall survival; PFS, progression free survival*.
Oncological Outcomes
--------------------
In the meta-analysis, no heterogeneity in OS and PFS among the studies was found, thus, a fixed-effects model was used. Based on the pooled results from the included studies, ovarian preservation is not associated with a statistically significant OS (OR 1.00, 95% CI 0.64--1.56, *I*^2^ = 25.7%; [Figure 2](#F2){ref-type="fig"}) or PFS (OR 0.98, 95% CI 0.57--1.66, *I*^2^ = 0%; [Figure 3](#F3){ref-type="fig"}) in early stage cervical adenocarcinoma. Subgroup analysis ([Figures 4](#F4){ref-type="fig"}, [5](#F5){ref-type="fig"}) and funnel plot results ([Figures 6](#F6){ref-type="fig"}, [7](#F7){ref-type="fig"}) showed that our study has a low risk of publication bias. No significant changes in the final result, after each study was omitted sequentially, were observed ([Figure 8](#F8){ref-type="fig"}).
{#F2}
{#F3}
{#F4}
{#F5}
{#F6}
{#F7}
{#F8}
Prognostic Factors for Cervical Adenocarcinoma and Risk Factors for Ovarian Metastases
--------------------------------------------------------------------------------------
[Table 2](#T2){ref-type="table"} shows the results of the literature review. The incidence of ovarian metastases was 0% in stage IA, 2.8% in stage IB, 3.4% in stage IIA, and 11.8% in stage IIB cervical adenocarcinoma. Five studies ([@B7], [@B9], [@B12], [@B22], [@B26]) showed that FIGO stage, tumor size, DSI, LNM, and vaginal invasion are significantly related to poor prognosis. Nine studies ([@B7], [@B14], [@B16], [@B17], [@B29]--[@B34]) reported that age, FIGO stage, tumor size, DSI, parametrial invasion (PMI), corpus uteri invasion (CUI), LNM, vaginal invasion, and blood vessel invasion are significantly associated with ovarian metastases.
######
Overview of prognostic factors for cervical adenocarcinoma and risk factors for ovarian metastases reported in the studies.
**Author** **Year** **No. of patients** **Stage** **Rate of ovarian metastases** **Variables included in multivariate analysis**
------------------------------- ---------- --------------------- ----------- -------------------------------- ------------------------------------------------- ------------------------------------- ------------------------------------- ------------------------------------------------------------------------- ------------------------------------- ------------------------------------- ------------------------------------------------------------------------- ------------------------------------- -------------------------------------
Xie et al. ([@B26]) 2018 128 IA-IIB 1/113 (0.9%) [^\*^](#TN2-1){ref-type="table-fn"} [^\*^](#TN2-1){ref-type="table-fn"}
Kasamatsu et al. ([@B9]) 2009 123 IB 1/87 (1.15%) [^\*^](#TN2-1){ref-type="table-fn"} [^\*^](#TN2-1){ref-type="table-fn"} [^\*^](#TN2-1){ref-type="table-fn"}
IIA 0
IIB 3/22 (13.6%)
Angel et al. ([@B12]) 1992 59 I 0/41 [^\*^](#TN2-1){ref-type="table-fn"}
Hopkins et al. ([@B22]) 1987 24 I 0/16 [^\*^](#TN2-1){ref-type="table-fn"}
Chen et al. ([@B7]) 2016 194 IA 0/9 [^\*^](#TN2-1){ref-type="table-fn"} [^\*^](#TN2-1){ref-type="table-fn"} [^\#^](#TN2-2){ref-type="table-fn"} [^\#^](#TN2-2){ref-type="table-fn"} [^\*^](#TN2-1){ref-type="table-fn"} [^\#^](#TN2-2){ref-type="table-fn"}
IB 2/100 (2%)
IIA 2/26 (7.7%)
IIB 1/18 (5.6%)
Nakanishi et al. ([@B29]) 2000 240 IA 0/15 [^\#^](#TN2-2){ref-type="table-fn"} [^\#^](#TN2-2){ref-type="table-fn"}
IB 7/178 (3.9%)
IIA 0/11
Hu et al. ([@B30]) 2013 183 IB 1/130 (0.8%) [^\#^](#TN2-2){ref-type="table-fn"} [^\#^](#TN2-2){ref-type="table-fn"} [^\#^](#TN2-2){ref-type="table-fn"} [^\#^](#TN2-2){ref-type="table-fn"}
IIA 3/39 (7.7%)
IIB 1/14 (7.1%)
Natsume et al. ([@B17]) 1999 62 IB 1/31 (3.2%) [^\#^](#TN2-2){ref-type="table-fn"} [^\#^](#TN2-2){ref-type="table-fn"}
IIA 1/3 (33.3%)
IIB 6/28 (21.4%)
Shimada et al. ([@B31]) 2006 546 IB 14/376 (3.7%) [^\#^](#TN2-2){ref-type="table-fn"}
IIA 2/38 (5.3%)
IIB 13/132 (9.8%)
Zhou et al. ([@B32]) 2017 312 IA 0/9 [^\#^](#TN2-2){ref-type="table-fn"} [^\#^](#TN2-2){ref-type="table-fn"} [^\#^](#TN2-2){ref-type="table-fn"}
IB 5/217 (2.3%)
IIA 8/74 (10.8%)
IIB 1/12 (8.3%)
Yamamoto et al. ([@B16]) 2001 89 IB 1/50 (2%) [^\#^](#TN2-2){ref-type="table-fn"}
IIA 0/2
IIB 6/37 (16.2%)
Landoni et al. ([@B14]) 2007 380 IA-IIA 9/380 (2.4%) [^\#^](#TN2-2){ref-type="table-fn"} [^\#^](#TN2-2){ref-type="table-fn"} [^\#^](#TN2-2){ref-type="table-fn"}
Lu et al. ([@B33]) 2016 101 IA 0/1 [^\#^](#TN2-2){ref-type="table-fn"}
IB 4/88 (4.6%)
IIA 1/12 (8.3%)
Toki et al. ([@B11]) 1991 36 IB-IIB 2/36 (5.6%)
Tabata et al. ([@B34]) 1987 48 IB 2/26 (7.7%)
IIA 0/2
IIB 2/13 (15.4%)
Kjorstad et al. ([@B15]) 1984 150 IB 2/150 (1.3%)
Guo et al. ([@B27]) 2018 267 I-II 13/223 (5.8%)
Sutton et al. ([@B13]) 1992 121 IB 2/80 (2.5%)
Ruengkhachorn et al. ([@B23]) 2016 35 IA 0/19
Total 3,098 OM: IA 0/53 IB 42/1513 (2.8%) IIA 17/208 (3.4%) IIB 30/254 (11.8%)
*No., number; FIGO, International Federation of Gynecology and Obstetrics*.
*Prognostic factors for cervical adenocarcinoma*.
*Risk factors for ovarian metastases*.
Discussion {#s4}
==========
In this review and meta-analysis on the prognostic significance of ovarian preservation in early stage cervical adenocarcinoma, we found that ovarian preservation is not associated with a statistically significant OS or PFS in early stage cervical adenocarcinoma. Ovarian preservation has no adverse effect on the prognosis in early stage cervical adenocarcinoma ([@B7], [@B24], [@B28]). Moreover, the overall incidence of ovarian metastases is 0% in stage IA, 2.8% in stage IB, 3.4% in stage IIA, and 11.8% in stage IIB cervical adenocarcinoma, which are extremely low except that in stage IIB disease. Although some studies ([@B11], [@B14], [@B17]) proved that ovarian metastases are more common in cervical adenocarcinoma than in SCC, patients with early stage adenocarcinoma or SCC who underwent radical hysterectomy have a similar prognosis and spread pattern according to the study of Kasamatsu et al. ([@B18]). A consensus that ovarian preservation is safe in stage IA cervical adenocarcinoma was reached because the rate of ovarian metastases was 0% in numerous studies ([@B7], [@B23], [@B29], [@B32], [@B33]). In addition, ovarian preservation also appears safe in patients with cervical adenocarcinoma that is earlier than stage IIA because ovarian metastases are rare (2.8% in stage IB, and 3.4% in stage IIA in our review). Furthermore, previous studies reported no significant difference in OS after ovarian preservation among patients with SCC and adenocarcinoma whose disease stage is earlier than stage IIA ([@B13], [@B15]). Notably, ovarian preservation must be performed carefully in stages IB and IIA because studies showed that tumor size \>4 cm is related to a poorer prognosis ([@B7], [@B9]). For stage IIB cervical adenocarcinoma, ovarian preservation is inappropriate because of a high risk of ovarian metastases (11.8% in this review). These cases probably accompanied with other factors that are related to poor prognosis, included LNM, CUI, PMI, and DSI ([@B7], [@B9]).
The FIGO clinical staging system of cervical cancer has been constantly updated. Imaging and pathology have been recently used to supplement clinical findings with respect to tumor size and extent ([@B35]). The most obvious change in the different versions of the staging system are related to tumor size (≤2 cm, 2--4 cm, and \>4 cm), which could be because numerous studies showed that tumor size is an independent prognostic factor for OS in cervical cancer ([@B7], [@B9], [@B36]). In the retrospective study and meta---analysis of Hu et al. ([@B30]), they suggested that tumor size \>4 cm are associated with ovary metastasis. Notably, according to the latest 2018 FIGO staging system, the risk in cervical cancer mortality in stage IB2 disease increased by nearly 2-fold compared to that in IB1 disease, which suggests that identifying the tumor size (i.e., ≥2 or \<2 cm) is necessary when deciding whether to preserve ovaries or not ([@B35]).
For many years, ovaries were sacrificed in radical surgery for cervical cancer. However, there has been increasing awareness of the value of retaining the ovaries maintain a sense of well-being among young women. Premenopausal castration could cause immediate menopause, early hot flashes, and vaginal atrophy, as well as a number of long-term consequences, including an increased risk of cardiovascular disease, osteoporosis, hip fracture, Alzheimer\'s disease, and emotional problems ([@B37]). Hence, patients would need long-term menopause hormonal therapy (MHT) to alleviate the symptoms, let alone the poor compliance and high expense of MHT ([@B38]). Maintenance of ovarian function is beneficial to the physiologic and psychosexual health of young patients without significantly increasing their risk of relapse.
Another concern of ovarian preservation is its safety. In our review, the incidence of ovarian metastases is extremely low in patients who underwent oophorectomy, except that in stage IIB cervical adenocarcinoma. A study of Greer et al. ([@B39]) including 45 patients with stage IB cervical adenocarcinoma who had ovarian conservation showed that none of the patients with recurrence have ovarian involvement. Ranney et al. ([@B40]) conducted a study of 2,132 patients who underwent hysterectomy (1,557 of the patients had their ovarian tissue retained) and suggested that the incidence of primary ovarian cancer following a hysterectomy is \~0.2%. Moreover, pelvic radiation therapy is often indicated in patients after surgery. However, it may result in premature ovarian insufficiency (POI). One of the options to prevent POI is ovarian transposition, in which the ovaries are placed outside the radiation field thereby reducing the exposure to radiation and total dose of irradiation. A recent review demonstrated that the ovarian survival after ovarian transposition ranges from 63.6 to 100% ([@B41]).
Furthermore, our results showed that oophorectomy has no prognostic benefit in early stage cervical adenocarcinoma. Studies demonstrated that all patients with ovarian metastases have at least one of the following risk factors: large tumor size, DSI, positive lymph node, and vaginal invasion ([@B12]). Ovarian metastases in cervical adenocarcinoma are more likely visible and present in both ovaries ([@B14]). Although the rate of ovarian metastases in cervical adenocarcinoma is slightly higher than that in SCC, no difference in nodal metastases, recurrence, or OS between the two histologic subtypes was observed ([@B9], [@B12], [@B13], [@B29]).
On the contrary, Shimada et al. ([@B31]) demonstrated that the outcomes of patients with ovarian metastases are extremely poor and not related to FIGO stage and histological type. Landoni et al. ([@B14]) retrospectively analyzed 380 patients with stage IA2-IIA cervical adenocarcinoma and found that the incidence of ovarian metastases was 2.3%; they suggested that oophorectomy be performed in all patients with adenocarcinoma. Balancing the risk and benefit of ovarian preservation is crucial for gynecologists. Thus, some researchers summarized the following selection criteria for ovarian preservation in patients with cervical adenocarcinoma: age \< 45 years, stage \< IB, tumor size \< 4 cm, no DSI, no PMI, no CUI, no LNM (MRI, CT-scan, or PET-scan), and no lymphatic vascular space invasion ([@B33], [@B42]). In our study, we found that FIGO stage, tumor size, DSI, LNM, and vaginal invasion are significantly related to poor prognosis in cervical adenocarcinoma. In addition, the following risk factors were significantly related to ovarian metastases: age, FIGO stage, tumor size, DSI, PMI, CUI, LNM, vaginal invasion, and blood vessel invasion. Hopefully, which could potentially provide reference for clinical decision. Gynecologists should meticulously examine adjacent organs, intra-operative specimen opening, and frozen section in suspicious cases before making a decision on whether to perform ovarian preservation or not.
This study has several limitations. Firstly, the long time span among included studies might cause bias because the staging system is updating with time. Second, the nature of retrospective chart reviews is undeniable. Lastly, different methodologies were used in the included studies, which may cause heterogeneity. Nevertheless, our result suggests that ovarian preservation is not associated with a statistically significant OS or PFS in early stage cervical adenocarcinoma. Further prospective and randomized trials are required to validate our findings.
Conclusions {#s5}
===========
Ovarian preservation in young patients with early stage cervical adenocarcinoma is safe and has no significant effect on OS or PFS. Preserving ovaries in patients with FIGO stage IIB seems not reasonable because of the high rate of ovarian metastasis.
Author Contributions {#s6}
====================
HC, YX, JY, LZ, YK, and LH: study conception and design and manuscript review. HC, LZ, and JY: literature review and data extraction. YK and LH: quality control. HC and YK: statistical analysis. HC and LZ: manuscript preparation.
Conflict of Interest Statement
------------------------------
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
**Funding.** This work was supported by grants from the National Natural Science Foundation of China (No. 81772783 and No. 81472446) and the Chinese Academy of Medical Sciences Initiative for Innovative Medicine (CAMS-2017-I2M-1-002) to YX.
Supplementary Material {#s7}
======================
The Supplementary Material for this article can be found online at: <https://www.frontiersin.org/articles/10.3389/fonc.2019.00777/full#supplementary-material>
######
Search strategy detail.
######
Click here for additional data file.
######
Quality assessment of included studies.
######
Click here for additional data file.
[^1]: Edited by: Rebecca Stone, Johns Hopkins Medicine, United States
[^2]: Reviewed by: Sarah M. Temkin, Virginia Commonwealth University, United States; Umberto Malapelle, University of Naples Federico II, Italy
[^3]: This article was submitted to Women\'s Cancer, a section of the journal Frontiers in Oncology
| 2023-08-07T01:27:15.642919 | https://example.com/article/8978 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.