text stringlengths 0 7.84M | meta dict |
|---|---|
Senator Youngblood of PenobscotRepresentative Beavers of South BerwickRepresentative Dunphy of EmbdenRepresentative Harvell of FarmingtonRepresentative Libby of WaterboroRepresentative Newendyke of Litchfield | {
"pile_set_name": "Pile-CC"
} |
It seems that Ubisoft has dead pay attention to lover feedback as with the modish housing on the loose representing Bravo’s Doctrine Trinity features something we own not so far seen. Connor attractive impoverished colonials. Whilst it should make as no dumfound to myriad of you, as the developers receive explicit on top of and another time that Connor is not 1 with either the Brits or Colonials, diverse refused to maintain that. Tho’ with the footage that had archaic shown up till now, it was a warranted chew one’s nails, but numerous masses prepared it non-standard like comparable a large emanation than it considered necessary to be. Check the current preview lower down.
LittleBigPlanet Karting is coming to a PlayStation 3 near you in November! Sony has announced the date you can get your hands on the next addition to Sackboy’s universe, and they’ve also given us some video snippets of the different game modes we’ll be able to experience upon release. | {
"pile_set_name": "Pile-CC"
} |
Q:
why the height of the out div is affected by vertical-align
in chrome, I thought the height of .wrap should be 24px.
it is 25px when the vertial-align is set to middle. can someone explain why?
answer in this article
body {
line-height: 1.5;
}
.wrap {
font-size:16px; /* 16*1.5= 24 */
}
.btn {
font-size: 14px;
padding: 4px;
line-height: 1;
box-sizing: border-box;
border: 1px solid blue;
vertical-align: middle;
}
<div class="wrap">
<button class="btn">
OK
</button>
</div>
A:
As It is explained Here
Aligns the middle of the element with the baseline plus half the
x-height of the parent.
The line-height of your .wrap element is by default 1.5 that inherits from the body, the vertical align property will render depending on your line-height, so if the line height is bigger than your wrapper element, you will see the effect. to fix it just put line-height in your .wrap class, you can play with it to see how the line-height affects the vertical alignment.
body {
line-height: 1.5;
}
.wrap {
line-height:1;
background:red;
}
.btn {
font-size: 14px;
padding: 4px;
line-height: 1;
box-sizing: border-box;
border: 1px solid blue;
vertical-align: middle;
}
<div class="wrap">
<button class="btn">
OK
</button>
</div>
| {
"pile_set_name": "StackExchange"
} |
Y-Stent-Assisted Coiling With Low-Profile Neuroform Atlas Stents for Endovascular Treatment of Wide-Necked Complex Intracranial Bifurcation Aneurysms.
Y-stent-assisted coiling is one of the eligible techniques for the treatment of complex bifurcation aneurysms. In majority of previous literature, Y-stenting has been performed using stents that could be delivered through large profile microcatheters that are often difficult to manipulate during navigation through sharply angled side branches. Attempts to navigate with these large profile catheters might cause serious complications during Y-stenting procedure. To investigate the safety, feasibility, and efficacy of Y-stent-assisted coiling procedure with Neuroform Atlas stents for the treatment of complex bifurcation aneurysms; Neuroform Atlas is a recently introduced open-cell stent that can be delivered though low-profile microcatheters. We identified the patients with intracranial bifurcation aneurysms treated by Y-stent-assisted coiling procedure with Neuroform Atlas stents. We assessed the immediate postoperative and follow-up clinical and angiographic outcomes. We also investigated the periprocedural and delayed complications. A total of 30 aneurysms in 30 patients were included in the study. Y-stenting was successfully performed without any technical complications in all cases (100%). Immediate postprocedural angiography revealed total aneurysm occlusion in 83.3% of patients. The mean angiographic follow-up time was 11.8 mo. The last follow-ups showed complete occlusion in 93.3% of patients. There was no mortality in this study. A procedure-related complication developed in 6.7% and resulted in permanent morbidity in 3.3% of patients. Neuroform Atlas stent combines the advantages of low-profile deployment microcatheters with an open-cell structure to achieve a successful Y-stenting procedure. Y-stent-assisted coiling with Neuroform Atlas stents provides a safe and effective endovascular treatment for wide-necked complex bifurcation aneurysms. | {
"pile_set_name": "PubMed Abstracts"
} |
Since the all-star game he has been absolutely dominant. I say he should be this years MVP by the way is playing right now. I say its his time to be recognized as the most valuable player in all of basketball.
Since the all-star game he has been absolutely dominant. I say he should be this years MVP by the way is playing right now. I say its his time to be recognized as the most valuable player in all of basketball.
But seriously, have you seen the way Kobe's been playing lately? Without him we would've been out of the playoffs a while ago. He's obviously our most valuable player.
I dont think this is such a ridiculous notion. He's been good for 20 pts, 15 boards, and three blocks a night since the all-star break. His production is only going to increase in future games also. Superman is back and he is right now the most dominant player in the NBA. I said it.
I dont think this is such a ridiculous notion. He's been good for 20 pts, 15 boards, and three blocks a night since the all-star break. His production is only going to increase in future games also. Superman is back and he is right now the most dominant player in the NBA. I said it. | {
"pile_set_name": "Pile-CC"
} |
00
Let z = -95874.9147146 + 96020.9147. Let i = 146 - z. Round i to five dps.
0.00001
Let c = -108 - -113. Let f(s) be the first derivative of -s**4/4 + s**3/3 + 5*s**2/2 + 7*s - 3. Let z be f(c). Round z to the nearest 10.
-70
Let w = -114.21 + 0.21. Let i = -2152969882.0000279 - -2152969996. Let y = w + i. Round y to 6 decimal places.
-0.000028
Let b = -2.6417 - -2.383. Let q = -0.254 - b. Round q to one dp.
0
Let f = 39.5 + 5.3. Let h = -6.2 - f. Let a = -51.0000092 - h. Round a to six decimal places.
-0.000009
Let v = 170821 - 170845.7357. Let s = v - -0.0357. Round s to the nearest 10.
-20
Let j = 0.3443 + 74.5957. Let z = j - -0.06. Let a = -64.6 + z. What is a rounded to the nearest integer?
10
Let m = -11.1 + 6.2. Let v = m + 53.9. Let f = v + -49.0276. What is f rounded to two dps?
-0.03
Let r(t) = -64643*t + 103. Let b(m) = 32322*m - 50. Let k(j) = 9*b(j) + 4*r(j). Let x be k(13). Round x to the nearest 100000.
400000
Let p(g) = -495*g - 9. Let q be p(-7). Suppose a - h - 2056 = -5*h, 2*a = 3*h + 4112. Let z = a - q. Round z to the nearest 100.
-1400
Suppose -130621 = 19*y + 24419. Let r be (y/(-20))/(6/(-2000)). Round r to the nearest 10000.
-140000
Let s = -30234821037835 - -30235267673819.000227. Let q = 446635717 - s. Let m = 267 + q. Round m to 4 dps.
-0.0002
Let k(s) = -163*s**3 - 16*s**2 + 4*s + 10 - 9*s**2 + 46*s**3. Let t be k(-20). Let g = t - 650930. What is g rounded to the nearest ten thousand?
280000
Let z(a) = 12622*a**3 + 12*a**2 - a - 408. Let v be z(-24). What is v rounded to the nearest 1000000?
-174000000
Let n = -285 + 278.3. Let p = n - -6.699981. What is p rounded to 5 decimal places?
-0.00002
Let g = -1067.94127005 - 0.10762995. Let l = g - -1068. Let x = l - -0.044. Round x to 3 decimal places.
-0.005
Let f = -111.3 + 136. Let j = 23.64 - f. What is j rounded to one decimal place?
-1.1
Let d = -378.93 + 377. Let k = -34.588 + -3.982. Let m = k + d. What is m rounded to the nearest 10?
-40
Let o = 872.203 + 1.797. Let i = 911.7 - o. What is i rounded to the nearest ten?
40
Let q = 118.814 + 0.186. Let r = -118.99999634 + q. Round r to 7 decimal places.
0.0000037
Let a = 14208.9999988693 + -14209. Round a to seven dps.
-0.0000011
Let d = -3257160.9191807 - -3255420.9191. Let c = 1740 + d. Round c to 5 dps.
-0.00008
Let o = -12.74624 + -0.13576. What is o rounded to the nearest integer?
-13
Let i = 1824641928555629.99999984 - 1824641439525637. Let x = i - 489030065. Let u = -72 - x. Round u to 7 dps.
0.0000002
Let u = -22.4595 + 0.1395. Let v = 33 + -11. Let w = v + u. Round w to one dp.
-0.3
Let z = 260657 + -260659.27522. Let u = 4387.28 - 4385. Let o = u + z. Round o to 4 decimal places.
0.0048
Let o = -105.09 - -105.096533. Round o to 4 decimal places.
0.0065
Let i = 12877.704 + -12650. Let r = -229 + i. Let h = r - 0.024. What is h rounded to one dp?
-1.3
Suppose 9 = -3*h + 15. Let a be ((-8)/2)/4 + (h - 0). Let s be -1 - (a/2 + 406/4). What is s rounded to the nearest 10?
-100
Suppose -r = 5*g - 6863560, 126544 = 5*g + 5*r - 6736996. Let p = g - 252713. Round p to the nearest one hundred thousand.
1100000
Let p = 49.5 - -9.5. Let y = -59.1 + p. Let d = -6.5 - y. What is d rounded to the nearest integer?
-6
Let v be (3*(-2010)/(-135))/(1/300). Round v to the nearest 10000.
10000
Let l = 10841 - 10841.29141. What is l rounded to two decimal places?
-0.29
Let a = 0.2536 + 0.0124. Let z = a - 11.326. What is z rounded to 0 dps?
-11
Let l = 0.169 - 43.469. Let x = l - -80. Round x to the nearest integer.
37
Let z(i) = 302*i + 2415. Let s be z(-31). Round s to the nearest 1000.
-7000
Let x = 4.4368379 - 4.439. What is x rounded to five dps?
-0.00216
Let c = 6136.71 + -6110. Let k = c - 26.715665. Round k to four dps.
-0.0057
Let o = -6.7 - 47.3. Let s = -266.29997428 - -212.2999729. Let z = o - s. Round z to 7 dps.
0.0000014
Let h = 2697700 - 2697814.99754. Let l = 115 + h. What is l rounded to four decimal places?
0.0025
Let u = 0.027742 - -357.202258. Let a = u + -1.23. Let h = a + -355.999771. What is h rounded to 4 dps?
0.0002
Let u = -22.1 + 24.775. Let t = -0.035 - u. What is t rounded to 1 decimal place?
-2.7
Suppose 110 = 11*q - 6*q. Suppose q*s + 1802500 = -3*s. What is s rounded to the nearest 10000?
-70000
Let o = -266 + 270. Suppose -3*g = o*j + 82816, 4*g = -5*j + 2*j - 110412. Round g to the nearest 10000.
-30000
Let i = 84.2 + -50.04. What is i rounded to the nearest one hundred?
0
Suppose 5*r = 0, -j - 9 = -4*j - 2*r. Let p be (-2)/j - (-654380)/12. Let n = -192531 + p. What is n rounded to the nearest ten thousand?
-140000
Let j = 212 + -203.3. Let t = 8.699998183 - j. Round t to 6 dps.
-0.000002
Let k(m) = m**3 - 2*m**2 - 14. Let l be k(0). Let x be (-7)/(l/580)*(-4 - 32). Let p = 1010440 + x. Round p to the nearest 1000000.
1000000
Let a = 8 - 3.1. Let i = a - 4.9566. Let o = 0.05660423 + i. What is o rounded to seven dps?
0.0000042
Let i = 3817.9961024 - 3818. What is i rounded to 4 decimal places?
-0.0039
Let q = 16096 - 16096.0000023819. Round q to 7 decimal places.
-0.0000024
Suppose -3*t - 6705397 = -w, -1 - 7 = -2*w. Let q = t - 824869. Round q to the nearest 100000.
-3100000
Suppose -5*k - 2*q = 349400 + 3383602, 0 = -3*k + 3*q - 2239797. What is k rounded to the nearest 100000?
-700000
Let j = -28275.0012377 - -28275. What is j rounded to four decimal places?
-0.0012
Let i = -1715 + 1721.311. Round i to zero decimal places.
6
Let w be ((-354)/(-21))/((-48)/(-168)). Suppose 57*r - w*r - 981400 = 0. Round r to the nearest 10000.
-490000
Let m be 4 - -8294 - (-28)/14. Round m to the nearest 100000.
0
Let q = 414 + -442.4. Let t = 188.3 - q. What is t rounded to the nearest 10?
220
Let n = 29943.38900072 + -29945.199. Let m = -1.81 - n. Round m to seven decimal places.
-0.0000007
Let a = 272.39 - 272.39024288. Round a to five decimal places.
-0.00024
Let z = 622614582.90000355 - 622614565. Let r = -17.9 + z. Round r to six decimal places.
0.000004
Let c = 63.96 + -0.96. Let p = 106 - c. Let h = p - 43.000019. What is h rounded to 5 dps?
-0.00002
Let t = -36.223 + 0.223. Let z = 35.99621 + t. Round z to 4 decimal places.
-0.0038
Let c = 4033 + -2353. Let n = -1602.9 + c. Round n to the nearest ten.
80
Suppose -17*s = -274510 + 793095. Round s to the nearest 1000.
-31000
Let i = -25513 - -11091. Let a = 23232 + i. Round a to the nearest 1000.
9000
Suppose 278*z = 264*z + 798. Let i = 52 - z. Round i to the nearest 10.
-10
Suppose -2*r + 7*f + 185920015 = 2*f, 3*r - 278880009 = 3*f. Round r to the nearest 1000000.
93000000
Let q = 6233.63 + -6278. Let i = -1.57 - q. Round i to the nearest ten.
40
Let h = -15.025 + 15.0266018. What is h rounded to four dps?
0.0016
Let r = -30 - -1542. Suppose -27488 = -m + r. Suppose 3*a = 2*a - m. What is a rounded to the nearest ten thousand?
-30000
Let j = -76.683 - -1.583. Let i = -2.9 + j. Let g = i + 78.0009. What is g rounded to three dps?
0.001
Let f = -14.00035 + -0.02065. Let y = f + -1.449. Round y to the nearest integer.
-15
Let k = 0.3049 + -0.30490699. What is k rounded to five dps?
-0.00001
Let m be (-217)/(-35) - 1/5. Let u be (m/(-8) - (-40873)/28)/(-1). Round u to the nearest one hundred.
-1500
Let n(b) = 112*b + 19. Let r(k) = 55*k + 9. Let o(h) = -6*n(h) + 13*r(h). Let j be o(-2). What is j rounded to the nearest 10?
-80
Suppose 8*r = 90 + 22. Suppose -r*x + 11*x - 6 = 0. Let k be ((-5)/x - 4) + 42006/4. What is k rounded to the nearest one thousand?
11000
Let c = 1353 - 1353.034724. What is c rounded to 4 dps?
-0.0347
Suppose -7459338 = -53*m - 1819608. What is m rounded to the nearest 1000?
106000
Let r = 1762.8242 - 1763. Let o = r + 0.204. Round o to 3 decimal places.
0.028
Let z = 11535 + -7914. Let q = -3622.683 + z. What is q rounded to 1 decimal place?
-1.7
Suppose 64*y - 47870644 + 4363444 = 0. What is y rounded to the nearest 100000?
700000
Suppose b - 192 + 112 = 0. Suppose -8*y = -10*y - b. Let t be (y/(-12) - 1/3) + -413. Round t to the nearest 100.
-400
Let p be (4/(-4))/(-2*1/4). Suppose 0*i = -p*j + i - 3, 0 = 4*j - i + 9. Let h be (j + 2)*28 - 18/(-6). Round h to the nearest ten.
-30
Let x = -2448272 + 41672. Round x to the nearest ten thousand.
-2410000
Let i = 97009387 + 11937967. Let w = 32352646 + i. Round w to the | {
"pile_set_name": "DM Mathematics"
} |
A major challenge to performance-based seismic design and engineering of buildings is to develop simple, yet effective, methods for designing, analyzing and checking the design of structures so that they reliably meet the selected performance objectives. Needed are analysis procedures that are capable of predicting the demands-forces and deformations-imposed by earthquakes on structures more realistically than has been incorporated in the ATC-40 and FEMA-274 documents (Applied Technology Council, 1996; FEMA, 1997) to determine the displacement demand imposed on a building expected to deform inelastically. | {
"pile_set_name": "Pile-CC"
} |
my mum was unemployed for a while I never had a babysitter till I was ten anyway. So my mum got a part time job cleaning and got her friend to look after me, I wasn't too close with my mum anyway but her friend was always nice to me when I seen her before anyway.So the time came where she babysat me she cooked tea and ... more
I came across this forum, and it got me reminiscing about the babysitting I did as a teen. There aren't as many male babysitters posting, so here I go ... When I was 15, my mom volunteered me to babysit for a friend of her's who was in a lurch. The boys, Aaron and Levi, were eight and six. I had never babysat before,... more
My brother and I were babysat for about 5 years starting when I was about 5 years old. My brother is a couple of years younger than me so he would of been about only 3. My mom and dad split at about that time and mom got a job working at night. She had a good friend who had a two daughters, I think at the time one was ... more
I found myself a... distinct (I guess) forum this evening. There's lot's for me to say (I read a lot of weird stuff), so I'm gonna tell what's probably going to be a very long story. This board is really taking me back to high school, the only point in my life where I had consistent babysitting gigs, two of them. All... more
Im a 13 year old girl and I recently started babysitting 2 boys, ages 4 and 6. Their mom wants to bathe them as well. I must admit it does turn me on a little as I wash their penises. Pulling the foreskin back and seeing the cute head pop out. I don't know if other girls out there feel the same way or not
how would the girls on this forum feel if they were being babysat by boys who bathed them and spanked them instead of the girls being the babysitters? also please no sexist comments that boys cant be babysitters
I have 2 brothers they are a year younger than me. Growing up we had lots of different babysitters. Some old and some young. Me and my brothers were always bathed together in a huge cast iron tub. At bathtime our sitter would take us to the bathroom and while she ran the water, we took off our clothes with help from... more
When I was growing up back in the 80's .. I was 7 years old .. and my mom was a hard working single mom . She found a sitter that did child care from her home . She was in her late 20's and very strict with kids . She was a firm believer in old fashion bare bottom switchings . My mom told her right in front of me ..... more
Welcome to the new babysitting discussion forum..Please post all of your experiences in babysitting from giving Baths for the first time to any punishments you gave and so on.. All post must be on topic and no fighting please,if you disagree with a post or comment look over it..i will be the one to delete and do any... more | {
"pile_set_name": "Pile-CC"
} |
Qtum Continues To Grow With New Partners and Dapps
Qtum is an open-source value transfer platform with a focus on dapps. The platform was designed to integrate the best parts of the Bitcoin and Ethereum platforms into a business-friendly blockchain. For more details on this project, read our Qtum guide.
It’s been one year since Qtum completed their wildly successful ICO, raising 11,156.766 BTC and 77,081.031 ETH—at the time, that was $15.7 million—in just 5 days. Since then, their ecosystem has been blooming with innovative projects. At the time of writing, Qtum is ranked #18 on CoinMarketCap, and is #34 on the Top 100 Blockchain Organizations list.
Let’s take a look at what the project has been up to recently.
Boosting Clean Energy Production in the Philippines
On April 8, the Qtum Foundation announced that Energo Labs, a project built on the Qtum platform, has partnered with First Gen, the largest producer of clean energy in the Philippines.
Utilizing Qtum’s blockchain platform, Energo and First Gen are working together to enable peer-to-peer exchange of electricity between buildings on the campus of De La Salle University in Manila, Philippines.
Kaikai Yang, CEO of Energo Labs, has high hopes for this cutting-edge technology:
Through combining the decentralization of blockchain with solar cells, energy storage and other hardware, we hope to accelerate the power reform in off-grid areas and devote itself towards making clean electricity more accessible to residents in remote areas in the near future. We are delighted to partner with De La Salle University on this case and wish to forge more partnerships with leading players in the cleantech industry.
Energo also donated a hardware system to the university that is expected to save up to 1.2 million Philippine pesos in electricity expenditures over the next 20 years.
It’s nice to see Qtum’s technology being used to make the world a greener place.
Bodhi Prediction Market Platform Is Now Live on Qtum Mainnet
On April 23, Bodhi announced they have deployed a live beta on the Qtum mainnet. Bodhi is a decentralized prediction market platform that allows users to more accurately predict the outcome of future events—including finance, sports, politics, and all kinds of global events.
Bodhi is the first dapp to successfully launch on the Qtum mainnet.
Xiahong Lin, founder of Bodhi, reported:
It’s a major milestone for us. While other prediction markets are still not live, we already have a fully-decentralized blockchain application for the public to use.
Bodhi users can now create new prediction events, stake tokens on the desired outcome of events, set/dispute results, and withdraw QTUM and BOT tokens into their personal wallets.
If you’re interested in giving it a try, watch this video tutorial on how to use the Bodhi platform and read Bodhi’s FAQ. Note that there are restrictions preventing users from the US, China, and Singapore from accessing the platform until further clarity on local regulations gets worked out.
New Dapps on Qtum Platform
Several projects have announced they will be developing dapps on the Qtum platform.
This includes a company called BINGO that runs an independent blockchain entertainment ecosystem for developers, publishers, and gamers. BINGO developed the very first cryptocurrency game on Qtum, called QTUM Heroes. This game is different from collectibles games like CryptoKitties—it’s a player-vs-player arena game where winners are rewarded in cryptocurrency payments. To learn more and start playing, go here.
Mithril, a social media blockchain project, has also announced that they will be developing social media dapps on Qtum.
Mithril founder Jeffrey Huang had this to say:
Qtum has provided great support for Mithril since the early days of our project. I believe Qtum’s security, reliability, and scalability will be instrumental to the future development of the Mithril ecosystem.
Stella Kung, Qtum’s head of marketing and public relations, will be advising Mithril as they develop their project.
Other Key Updates
Other than new partnerships and dapps coming on board Qtum, here are some key updates to note:
Qtum published a blog post on the status of their circulating supply for their 3rd year of operation. About 6 million additional tokens will be unlocked in March 2019 and 2020, bringing all 100 million tokens into circulation.
on the status of their circulating supply for their 3rd year of operation. About 6 million additional tokens will be unlocked in March 2019 and 2020, bringing all 100 million tokens into circulation. The Qtum wallet has been updated to v0.14.16 with big fixes and improvements. While it is an optional update, users are encouraged to update their wallets.
Qtum has launched a new wallet website: https://qtumeco.io/wallet
What the Future Holds for Qtum
Qtum fans can expect to see a new and updated Qtum roadmap in the near future, as the current roadmap’s tasks have all been completed. Having a new roadmap from the team will give us a glimpse into what the developers are working on next.
No matter what the new roadmap will outline, it’s a pretty safe bet to say that Qtum will continue to grow and become an even bigger player in the blockchain world as they continue to make new partnerships and more projects continue to be built upon their blockchain. | {
"pile_set_name": "OpenWebText2"
} |
Q:
Плавающий блок с position:fixed
На пальцах объяснить трудно, вот пикча, того что я хочу сделать:
Зеленые блоки это блоки с
position:fixed;
Красные полоски - границы экрана;
Желтые блоки - это области в которых
из которых не могут выйти зеленые
блоки. Если листать выше или ниже, то
зеленые блоки остаются на крайней
границе желтых;
Каким способом лучше сделать?
A:
Рабочий пример
html
<div id="railway_lines">
<div class="rails">
<div class="truck"></div>
</div>
<div class="rails">
<div class="truck"></div>
</div>
</div>
css
div#railway_lines {
background-color: #55c1ff;
height: 1200px;
position: relative;
}
div.rails, div.truck {
width: 80px;
}
div.rails {
background-color: #ffee33;
height: 800px;
position: absolute;
top: 100px;
}
div.rails:first-child {
left: 0;
}
div.rails:not(:first-child) {
right: 0;
}
div.truck {
background-color: #00ff00;
position: fixed;
height: 120px;
top: 100px;
}
javascript
var truck = $(".truck"),
rails = $(".rails"),
css_top_onmove = $(rails[0]).css('top'),
css_top_onhold = $(rails).height() - $(truck).height(),
css_left = $(rails[0]).css('left'),
css_right = $(rails[1]).css('right');
$(window).scroll(function () {
var pos_top = $(window).scrollTop();
if (pos_top > css_top_onhold) {
$(truck).css({
'position': 'absolute',
'top': css_top_onhold + 'px'
});
$(truck[0]).css('left', css_left);
$(truck[1]).css('right', css_right);
} else {
$(truck).css({
'position': 'fixed',
'top': css_top_onmove,
'left': '',
'right': ''
});
}
});
| {
"pile_set_name": "StackExchange"
} |
Introduction {#sec1-1}
============
Tuberculosis (TB) is a common infectious disease in the developing countries. Antitubercular therapy with the first line drugs is very effective and well-tolerated with only few major adverse reactions. Cutaneous adverse drug reactions (CADR) with antitubercular treatment (ATT) can make further management of TB challenging.\[[@ref1]\] Isoniazid is the first-line antitubercular drug par excellence and an essential component of all antitubercular regimens unless the patient is intolerant to it, or bacilli show resistance. Most common adverse effects of isoniazid are peripheral neuritis and hepatitis, which are more common in alcoholics and older patients, but CADR are rare with incidence of \<0.001% to maximum of 3/1000 patients treated.\[[@ref1][@ref2]\]
Case Report {#sec1-2}
===========
A 63-year-old Indian woman was diagnosed as a case of pulmonary TB when she was evaluated for fever and cough with expectoration. She was started on the first-line antitubercular drugs as per Directly Observed Treatment Short Course regimen for TB. After 8 weeks of ATT, she reported to dermatology department of our hospital, for complaints of acute onset erythema along with severe itching all over the body for the last 7--10 days.
Dermatological examination revealed generalized involvement of the body with extensive nonuniform dusky erythematous scaly plaques involving the scalp, face, nape of the neck, trunk, arms, legs, palms, and soles \[[Figure 1](#F1){ref-type="fig"}\]. Erythema and scaling were more pronounced over trunk and legs. Furthermore, the pruritic plaques were first noted on trunk and legs which increased in size and coalesced to involve the entire body in a few days. Scalp lesions formed red-yellow scales with hair loss \[[Figure 1](#F1){ref-type="fig"}\]. On palms and soles, the exfoliative eruption led to severe sloughing of the epidermis. No significant lymphadenopathy or hepatosplenomegaly was observed.
{#F1}
There was no history of any other drug intake, or history of jaundice, chest pain, palpitation, and dyspnea on exertion. There was no preexisting dermatosis or prior exposure to chemical precipitants of dermatitis or any other medical problem. Family history was negative for similar conditions or skin disorders. General physical examination was unremarkable while systemic examination revealed edema feet. Laboratory investigations were within normal limits. HIV-ELISA was nonreactive.
ATT was stopped immediately. Oral antihistaminics were started along with supportive therapy and topical emollients. The patient improved over a period of 1--2 weeks with decreased erythema and a significant reduction in scaling \[[Figure 2a](#F2){ref-type="fig"}\].
{#F2}
On rechallenge after 2 weeks of stopping ATT, individual drugs were reintroduced in a sequential manner starting with ethambutol, followed by pyrazinamide, then rifampicin, and isoniazid at last at an interval of 1 week between the drugs. Prior to isoniazid rechallenge, she did not develop any signs of CADR but on introducing isoniazid, she rapidly developed similar erythematous lesions with intense itching within 48 h \[[Figure 2b](#F2){ref-type="fig"}\]. Isoniazid was withdrawn and diagnosis of "isoniazid induced erythroderma" was made. At present, the patient was given symptomatic treatment with topical emollients and oral antihistaminics. The lesions subsided in 1 week, and the patient was prescribed alternative regimen of ATT excluding isoniazid. The causality assessment was "certain" on WHO-UMC causality assessment scale; whereas "probable" on Naranjo\'s scale (Score 7) for isoniazid. The severity of ADR was found to be "moderate (level 3)" as per the modified Hartwig and Siegel Scale.
Discussion {#sec1-3}
==========
Erythroderma is an intense generalized redness of the skin, first described by Von Hebra in 1868. It is an inflammatory disorder and an extreme state of dysmetabolism characterized by extensive erythema and scaling all over the body classically involving more than 90% of the body surface. It is of great concern because of significant risk of morbidity and mortality owing to dysmetabolism and its complications, in addition to the risks inherent to the underlying disease and its therapy.\[[@ref3]\]
Various causes of erythroderma in adults include pre-existing eczema, psoriasis, lymphoma, leukemia, and drugs such as phenylbutazone, hydantoin derivatives, carbamazepine, sulfonamides, penicillins, cimetidine, diltiazem, dapsone, allopurinol, gold salts, and lithium. Exposure to the causative drug may last for 2 weeks to several months before the reaction emerges. Drug-induced erythroderma has the best prognosis among all the causes of erythroderma often resolving in 2--6 weeks.\[[@ref4]\]
In the present case, the patient presented with erythema and scaling involving more than 90% of the body surface area along with itching within 8 weeks of ATT. ATT was stopped, and a significant improvement was noted within 1 week. However, the patient developed exfoliative dermatitis again after rechallenge test with isoniazid and improved after stopping it leading to the diagnosis of isoniazid-induced erythroderma. Prompt resolution of the lesions after withdrawal of the ATT and start of oral antihistaminics further supported the diagnosis. The patient was now prescribed rifampicin 450 mg, pyrazinamide 1500 mg, ethambutol 1000 mg, and levofloxacin 750 mg for a period of 2 months in intensive phase followed by levofloxacin 750 mg, rifampicin 450 mg for a period of 4 months in continuation phase.
The underlying pathogenesis of this hypersensitivity, whether immune-mediated and/or toxic in nature, is unclear. Predisposing factors for hypersensitivity reactions to ATT include HIV infection, polypharmacy, advanced age, autoimmune disease, and renal or liver impairment.\[[@ref5]\] In a large tertiary care center study on CADR with antitubercular drugs, pyrazinamide was the most common offending drug (2.38%), followed by streptomycin (1.45%), ethambutol (1.44%), rifampicin (1.23%), and isoniazid (0.98%).\[[@ref1]\] In contrast to the findings of the above-mentioned study, pyrazinamide, ethambutol, and rifampicin were well-tolerated by our patient; however, she developed reaction to isoniazid. There are many case reports of exfoliative dermatitis with other antitubercular drugs; but, to the best of our knowledge, only 3 cases of erythroderma induced by isoniazid alone is reported so far.\[[@ref6][@ref7][@ref8][@ref9][@ref10][@ref11][@ref12][@ref13]\]
Higher incidence of TB and CADR in HIV-infected persons poses a challenge for clinicians, particularly in high HIV-prevalence settings. It is important to recognize the CADRs to ATT so that severe and potentially life-threatening adverse reaction can be identified and managed early. It is equally important to continue ATT in minor CADRs so that patients suffering from TB can be cured and rendered noninfectious as early as possible from uninterrupted ATT along with prevention of development of drug resistance.
To conclude, erythroderma as a rare but potentially fatal drug reaction with isoniazid. Immediate withdrawal of offending drug alongwith supportive measures carries good prognosis. Hence, cautious use of isoniazid can help in early identification and management of this ADR.
{#sec2-1}
### Financial Support and Sponsorship {#sec3-1}
Nil.
### Conflicts of Interest {#sec3-2}
There are no conflicts of interest.
| {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-micromachines-10-00324}
===============
Tactile sensors, most commonly referred to as strain and pressure sensors, can collect mechanical property data from the human body and the local environment, and then provide valuable insights into the human health status or artificial intelligence systems \[[@B1-micromachines-10-00324],[@B2-micromachines-10-00324],[@B3-micromachines-10-00324]\]. Meanwhile, it can also be equipped on robots in order to be aware of their surroundings, keep away from potentially destructive effects and provide information for subsequent tasks such as in-hand manipulation \[[@B4-micromachines-10-00324],[@B5-micromachines-10-00324]\]. Change of resistance, capacitance, electrical charge and optical distribution can be used in various sensing systems \[[@B6-micromachines-10-00324]\], and the typical sensing mechanisms for tactile sensors includes piezo-resistive, capacitive, piezo-electric and optical. Compared with other types of tactile sensors, capacitive sensors have high sensitivity and fast frequency response \[[@B7-micromachines-10-00324],[@B8-micromachines-10-00324],[@B9-micromachines-10-00324]\]. Thus, many resonance capacitive sensors, which are very sensitive to small changes, are designed and optimized \[[@B10-micromachines-10-00324],[@B11-micromachines-10-00324],[@B12-micromachines-10-00324],[@B13-micromachines-10-00324]\].
The electrostatic actuation method is an important method of Micro electromechanical systems (MEMS). The system actuated by the electrostatic force is parametric excitation system \[[@B14-micromachines-10-00324],[@B15-micromachines-10-00324],[@B16-micromachines-10-00324]\]. Among the electrostatic actuation structures, parallel-plates configuration is widely used in MEMS \[[@B17-micromachines-10-00324],[@B18-micromachines-10-00324],[@B19-micromachines-10-00324],[@B20-micromachines-10-00324],[@B21-micromachines-10-00324],[@B22-micromachines-10-00324]\]. However, this actuation method can lead to instabilities like pull-in \[[@B23-micromachines-10-00324],[@B24-micromachines-10-00324],[@B25-micromachines-10-00324]\]. In order to obtain large amplitude and avoid the instabilities, the fringing-field actuation technique has got its attention. This actuation approach has several advantages, including the ability to obtain large amplitude displacements without the limitation of the proximity of the electrodes and the possibility of significantly tuning the resonant frequency response range \[[@B26-micromachines-10-00324]\]. This structure has attracted attention and has been studied by some communities. Experimental and theoretical analysis of micro-cantilevers actuated by fringing-field electrostatics was performed \[[@B26-micromachines-10-00324]\]. The different behaviors of curved micro beam with low initial elevation and relatively high initial elevation were studied when actuated by fringing-field electrostatic force \[[@B27-micromachines-10-00324]\]. A parametrically excited electrostatic resonator, which had a flexible support, used weaker electrostatic fringe fields to get higher vibrational amplitude \[[@B28-micromachines-10-00324]\]. These researches show that the device actuated by the fringing electrostatic force can reveal many new static and dynamic behaviors.
In the present work, researchers always care about the situations when the beam thickness is near the electrode thickness \[[@B26-micromachines-10-00324]\]. In these cases, the relationship between the electrostatic force and the initial displacement is linear when the beam vibrates near the middle of the electrode in the thickness direction. However, we find that the relationship between the electrostatic force and the initial displacement is nonlinear when the thickness of the electrode is much more than the thickness of the beam. This situation can reveal some new dynamic behaviors. Based on the dynamic investigations into the micro cantilevered beam actuated by fringing electrostatic force, the working principle and the usage patterns of a new micro tactile sensor are presented in this paper.
The paper is organized as follows. In [Section 2](#sec2-micromachines-10-00324){ref-type="sec"}, a new resonance tactile sensor is designed and the dynamic modeling of a micro cantilevered beam actuated by fringing electrostatic fields is given. This section consists of three parts: in [Section 2.1](#sec2dot1-micromachines-10-00324){ref-type="sec"}, the working principle of the micro tactile sensor is presented; in [Section 2.2](#sec2dot2-micromachines-10-00324){ref-type="sec"}, the fringing electrostatic force and the influences of geometric parameters on this force are found; in [Section 2.3](#sec2dot3-micromachines-10-00324){ref-type="sec"}, the governing equation of this new kind of fringing electrostatic actuation mode is outlined. In [Section 3](#sec3-micromachines-10-00324){ref-type="sec"}, the dynamic characteristics of the micro cantilevered beam which actuated by fringing electrostatic force are analyzed. In [Section 4](#sec4-micromachines-10-00324){ref-type="sec"}, an experiment is designed to observe the dynamic analysis of this structure. In [Section 5](#sec5-micromachines-10-00324){ref-type="sec"}, the dynamic behaviors of this structure are summarized and the usage patterns of this micro tactile sensor are presented.
2. Problem Formulation and Dynamic Modeling {#sec2-micromachines-10-00324}
===========================================
2.1. Working Principle {#sec2dot1-micromachines-10-00324}
----------------------
The proposed micro tactile sensor consists of a micro cantilevered beam and a pair of micro electrodes. The concept structure of the micro tactile sensor is shown in [Figure 1](#micromachines-10-00324-f001){ref-type="fig"}. One end of the micro cantilevered beam is fixed on the base. The edge of the micro electrode is also connected to the base. The base is nonconductive. The micro cantilevered beam and the micro electrode are conductive, but they are disconnected. When the electrostatic voltage is applied to the micro beam and the micro electrode is connected to the ground wire, the fringing electrostatic force appears between the micro beam and the micro electrode. Under the actuation of the electrostatic force, the micro beam vibrates. When the pressure *P* is applied to the micro electrode, the parts which link electrode and base deform linearly, the micro electrode moves from position 1 to position 2. Then the relative position between the micro cantilevered beam and the micro electrode changes $d_{p}$. This relative position change leads to the change of fringing electrostatic force, which effects the vibration behaviors of the micro beam. In this way the vibration behaviors of the micro beam can reflect the pressure applied to the micro electrode. Some obvious advantages are as following: a large deflection can be obtained without the limitation of the proximity of the electrodes; this structure which is compatible with the circuit can be designed to smaller scale; a smaller scale leads to a better sensitivity.
It is the key issue to grasp the relative position change effects the vibration behaviors of the micro cantilevered beam. The paper focuses on the influence of the relative position change in the vibration behaviors of the micro cantilevered beam. This can provide support for sensor design. [Figure 2](#micromachines-10-00324-f002){ref-type="fig"} is the schematic illustration of micro cantilevered beam and micro electrode. In this picture, $l_{b}$ $w_{b}$ and $t_{b}$ denote the length, width and thickness of the micro beam respectively; $l_{s}$ $w_{s}$ and $t_{s}$ denote the length, width and thickness of the micro electrode respectively; $d_{g}$ denotes the slit gap in the width direction; $d_{}$ denotes the initial displacement in the thickness direction, it is the placement position of the beam. In order to study the vibration behaviors of the micro beam, the geometric parameters of the structure are taken as $l_{b} = l_{s} = 5{\ {mm}}$, $w_{b} = 0.4{\ {mm}}$, $t_{b} = 0.01{\ {mm}}$, $w_{s} = 1.5{\ {mm}}$, $t_{s} = 0.3{\ {mm}}$ and $d_{g} = 0.04{\ {mm}}$. The range of the initial displacement is less than half of the electrode thickness.
2.2. Fringing Electrostatic Force {#sec2dot2-micromachines-10-00324}
---------------------------------
In this paper, the thickness of the electrode is much more than the thickness of the beam, as shown in [Figure 2](#micromachines-10-00324-f002){ref-type="fig"}. The distributed electrostatic force is $q_{e} = f_{e} \times v_{e}^{2}$, in which $f_{e}$ is electrostatic force on the beam per unit length per square voltage; $v_{e}\left( t \right)$ is a combined DC/AC voltage applied on the beam, i.e., $v_{e}\left( t \right) = v_{DC} + v_{AC}\cos\omega_{e}t$.
When the cantilevered beam is in a position of the fringing electrostatic actuation structure, the voltage applied to the cantilevered beam is defined as $+ v_{e}$, the voltage applied to the electrode is defined as $- v_{e}$, and the capacitance between the cantilevered beam and electrode is $4C_{e}$. Then, the charge on the cantilevered beam is $+ 8C_{e}v_{e}$, The charge on the electrode is $- 8C_{e}v_{e}$. Assume that the charges on the cantilevered beam are evenly distributed at the two points, and the charges on the electrode are evenly distributed at the eight points, as shown in [Figure 2](#micromachines-10-00324-f002){ref-type="fig"}. Then, the charge of each point on the cantilevered beam is $q_{b} = + 4C_{e}v_{e}$, and the charge of each point on the electrode is $q_{s} = - C_{e}v_{e}$. According to Coulomb's law and the geometric position of the plate, the electrostatic force acting on the cantilevered beam in the direction of thickness is $$F_{e} = 2k_{e}q_{b}q_{s}\left( \begin{array}{l}
{r_{11}{}^{- 2}\sin\theta_{11} + r_{21}{}^{- 2}\sin\theta_{21} + r_{12}{}^{- 2}\sin\theta_{12} + r_{22}{}^{- 2}\sin\theta_{22} +} \\
{r_{13}{}^{- 2}\sin\theta_{13} + r_{23}{}^{- 2}\sin\theta_{23} + r_{14}{}^{- 2}\sin\theta_{14} + r_{24}{}^{- 2}\sin\theta_{24}} \\
\end{array} \right)$$
See [Appendix A](#app1-micromachines-10-00324){ref-type="app"} for the symbolic meaning.
In the expression of electrostatic force---the proportion of $r_{12}{}^{- 2}\sin\theta_{12}$ and $r_{22}{}^{- 2}\sin\theta_{22}$ are the largest. When the fringing electrostatic force near *d* = 0 is concerned, the Taylor expansion of the above approximate expression near *d* = 0 is $$F_{e} = 2k_{e}q_{b}q_{s}\left\{ {\left\lbrack {\frac{C_{1}}{C_{2}} + \frac{1}{3}\frac{t_{s}\left( {6t_{s}/C_{2}{}^{5/2} - 1.75t_{s}C_{1}/C_{2}} \right)}{C_{2}}} \right\rbrack d^{3} + \left\lbrack {\frac{2}{C_{2}{}^{3/2}} - \frac{1.5t_{s}{}^{2}}{C_{2}{}^{5/2}}} \right\rbrack d} \right\}$$ in which $C_{1} = 3.75t_{s}{}^{2}/C_{2}{}^{5/2} - 3/C_{2}{}^{3/2}$, $C_{2} = d_{g}{}^{2} + 0.25t_{s}{}^{2}$.
From this Taylor expansion, we can see that the expression of fringing electrostatic force near *d* = 0 can be fitted by polynomials containing the first and third terms of the distance *d*.
By using the finite element software, [Figure 3](#micromachines-10-00324-f003){ref-type="fig"} shows the equipotential lines when actuated voltage of 1 Volt is applied across the two electrodes and the beam for $d = 0{\ {mm}}$, $d = 0.02{\ {mm}}$, $d = 0.04{\ {mm}}$, $d = 0.06{\ {mm}}$, respectively. When $d = 0{\ {mm}}$, the equipotential lines are symmetrical around the beam, When the initial displacement increases, the equipotential lines become unsymmetrical, which leads to the appearance of the fringing electrostatic force.
Under different electrode thickness, the values of fringing electrostatic force responding to initial displacement are calculated. In [Figure 4](#micromachines-10-00324-f004){ref-type="fig"}, the data points and fitted curves of fringing electrostatic force per unit length are recorded. When the thickness of the electrode is much greater than the thickness of the beam, the electrostatic force increases monotonically and nonlinearly. Since the thickness of the electrode dominates the deflection range of the beam, the thickness of the electrode should not be too small. Thus, the fit function of the fringing electrostatic force responding to initial displacement should consist of linear term and nonlinear term in this case. The polynomial fit function which includes linear and cubic parameters is proposed, and the fringing electrostatic force is approximated as $f_{e} = r_{1}d + r_{3}d^{3}$, in which $r_{1}$ and $r_{3}$ are fitting parameters. The assumption of the fringing electrostatic force can reflect the trend of electrostatic force change, and this assumption is convenient for analysis. The beam vibrates around the initial displacement *d*, the fringing electrostatic force responding to the vibration amplitude $u$ can be written as $f_{e} = r_{1}\left( {d + u} \right) + r_{3}\left( {d + u} \right)^{3} = e_{p}\left( {1 + e_{p1}u + e_{p2}u^{2} + e_{p3}u^{3}} \right)$, in which $e_{p} = r_{1}d + r_{3}d^{3}$, $e_{p1} = \left( {r_{1} + 3r_{3}d^{2}} \right)/\ e_{p}$, $e_{p2} = 3r_{3}d/\ e_{p}$, $e_{p3} = r_{3}/\ e_{p}$.
The fit function of electrostatic force in this paper is different from that in reference \[[@B26-micromachines-10-00324]\]. [Figure 5](#micromachines-10-00324-f005){ref-type="fig"} shows the fitted curves of electrostatic force based on different fit function when $t_{s} = 0.3{\ {mm}}$. In this figure, FC. 0 is the fitted curves which based on this paper, FC. 1 and FC. 2 are the fitted curves which based on reference \[[@B26-micromachines-10-00324]\]. As shown in [Figure 5](#micromachines-10-00324-f005){ref-type="fig"}, FC. 1 and FC. 2 cannot fit the data when ${d\ = \ 0\ {mm}\ –\ 0.30}{\ {mm}}$. The beam vibrates in the range of the thickness of the electrode, i.e., ${d\ = \ 0\ {mm}\ –\ 0.15}{\ {mm}}$, which is what we care about in this paper. FC. 0 can fit the data when ${d\ = \ 0\ {mm}\ –\ 0.15}{\ {mm}}$. It means that the fit functions, which based on reference \[[@B26-micromachines-10-00324]\], cannot fit the electrostatic force in this case. The fit function in this paper can reflect the change of the electrostatic force, when the vibration amplitude of the cantilevered beam is less than the thickness of the electrode.
2.3. Dynamic Modeling {#sec2dot3-micromachines-10-00324}
---------------------
The influences of the initial displacement change in the beam's dynamic behaviors are focused in this paper. By using the elastic beam theory, the equation of motion and the boundary conditions of the beam are written as \[[@B26-micromachines-10-00324]\] $$EI\frac{\partial^{4}u(x,t)}{\partial x^{4}} + \rho w_{b}t_{b}\frac{\partial^{2}u(x,t)}{\partial t^{2}} = q_{e} + q_{a}$$ $${u\left( {0,t} \right) = \frac{\partial u(0,t)}{\partial x} = 0}{,\ \frac{\partial^{2}u(l_{b},t)}{\partial x^{2}} = \frac{\partial^{3}u(l_{b},t)}{\partial x^{3}} = 0}$$ where $u\left( {x,t} \right)$ is the deflection of the beam in the thickness direction; *E* is the Young's modulus; $I = w_{b}t_{b}^{3}/12$ is the inertial moment of the beam cross section; $\rho$ is the mass density of the beam. The material parameters of the beam, which is made of brass, are taken as $E = 108{\ {GPa}}$ and $\rho = 8500{\ {kg}}/m^{3}$. Actuation force $q_{e}$ and damping force $q_{a}$ represent the fringing electrostatic force and the aerodynamic force per unit length respectively. The distributed aerodynamic force $q_{a}$ is \[[@B29-micromachines-10-00324],[@B30-micromachines-10-00324]\] $\left| q_{a} \right| = 0.5\rho_{a}w_{b}c_{a}\left( {\partial u/\partial t} \right)^{2}$, in which the direction of the aerodynamic force is opposite to the direction of the velocity; $c_{a}$ is the drag coefficient; $\rho_{a}$ is the density of the air.
For analytical convenience, we obtain the following non-dimensional equation of motion and the boundary conditions. $$\frac{\partial^{4}U}{\partial X^{4}} + \frac{\partial^{2}U}{\partial T^{2}} = \mathsf{Ε}_{0}\left( {1 + \mathsf{Ε}_{1}U + \mathsf{Ε}_{2}U^{2} + \mathsf{Ε}_{3}U^{3}} \right)\left( {1 + V_{AC}\cos W_{e}T} \right)^{2} - \mathsf{Α}\frac{\partial U}{\partial T}\left| \frac{\partial U}{\partial T} \right|$$ $${U\left( {0,T} \right) = \frac{\partial U(0,T)}{\partial X} = 0}{,\frac{\partial^{2}U(1,T)}{\partial X^{2}} = \frac{\partial^{3}U(1,T)}{\partial X^{3}} = 0}$$
See [Appendix B](#app2-micromachines-10-00324){ref-type="app"} for the symbolic meaning.
We use the Galerkin discretization method to transform the partial differential equation to the ordinary differential equations \[[@B31-micromachines-10-00324]\]. The model in this paper is based on the fundamental frequency vibration. The steady-state solution of the non-dimensional governing equation is written by $U\left( {X,T} \right) = \mathsf{\Phi}\left( X \right)\mathsf{\Theta}\left( T \right)$, and the mode function $\mathsf{\Phi}\left( X \right)$ for cantilevered beam is $\mathsf{\Phi}\left( X \right) = {ch}\lambda_{r}X - cos\lambda_{r}X + \xi_{r}\left( {{sh}\lambda_{r}X - \sin\lambda_{r}X} \right)$, in which $\lambda_{r} = 1.875$, $\xi_{r} = - \left( {{ch}\lambda_{r} + \cos\lambda_{r}} \right)/\left( {{sh}\lambda_{r} + \sin\lambda_{r}} \right)$. Substituting $U\left( {X,T} \right) = \mathsf{\Phi}\left( X \right)\mathsf{\Theta}\left( T \right)$ into the governing equation. Then multiplying the outcome by the mode function, and integrating the resultant equation from X = 0 to 1. An ordinary differential equation with respect to time is obtained as $$\begin{array}{l}
{\frac{\partial^{2}\mathsf{\Theta}}{\partial T^{2}} + \alpha_{k}\mathsf{\Theta} =} \\
{\alpha_{Ep}\left( {1 + \alpha_{ep1}\mathsf{\Theta} + \alpha_{ep2}\mathsf{\Theta}^{2} + \alpha_{ep3}\mathsf{\Theta}^{3}} \right)\left\lbrack {\left( {1 + \frac{V_{AC}{}^{2}}{2}} \right) + 2V_{AC}\cos W_{e}T + \frac{V_{AC}{}^{2}}{2}\cos 2W_{e}T} \right\rbrack - \alpha_{a}\frac{\partial\mathsf{\Theta}}{\partial T}\left| \frac{\partial\mathsf{\Theta}}{\partial T} \right|} \\
\end{array}$$
See [Appendix C](#app3-micromachines-10-00324){ref-type="app"} for the symbolic meaning.
The deflection splits into a static deflection and a dynamic deflection, i.e., $\mathsf{\Theta}\left( T \right) = \mathsf{\Theta}_{0p} + \vartheta_{p}\left( T \right)$, then we obtain static equation and dynamic equation. $$S_{0} + S_{1}\mathsf{\Theta}_{0p} + S_{2}\mathsf{\Theta}_{0p}^{2} + S_{3}\mathsf{\Theta}_{0p}^{3} = 0$$ $$\vartheta_{p}^{''} + K_{1}\vartheta_{p} + K_{2}\vartheta_{p}{}^{2} + K_{3}\vartheta_{p}{}^{3} + \alpha_{a}\vartheta_{p}^{\prime}\left| \vartheta_{p}^{\prime} \right| = \left\lbrack \begin{array}{l}
{\left( {F_{E1}\cos W_{e}T + F_{E2}\cos 2W_{e}T} \right) +} \\
{\left( {K_{E1P1}\vartheta_{p} + K_{E1P2}\vartheta_{p}{}^{2} + K_{E1P3}\vartheta_{p}{}^{3}} \right)\cos W_{e}T +} \\
{\left( {K_{E2P1}\vartheta_{p} + K_{E2P2}\vartheta_{p}{}^{2} + K_{E2P3}\vartheta_{p}{}^{3}} \right)\cos 2W_{e}T} \\
\end{array} \right\rbrack$$ where (′) denotes the derivate with respect to $T$. See [Appendix D](#app4-micromachines-10-00324){ref-type="app"} for the symbolic meaning.
3. Dynamic Analysis {#sec3-micromachines-10-00324}
===================
The static equation is a one variable cubic equation, which can be solved by using the method of reference \[[@B32-micromachines-10-00324]\]. The nonlinear dynamic equation is solved by using the Method of Multiple Scales (MMS). Then the dynamic equation can be written by $$\vartheta_{p}^{''} + K_{1}\vartheta_{p} + \varepsilon K_{2}\vartheta_{p}{}^{2} + \varepsilon K_{3}\vartheta_{p}{}^{3} + \varepsilon\alpha_{a}\vartheta_{p}^{\prime}\left| \vartheta_{p}^{\prime} \right| = \varepsilon\left\lbrack \begin{array}{l}
{\left( {F_{E1}\cos W_{e}T + F_{E2}\cos 2W_{e}T} \right) +} \\
{\left( {K_{E1P1}\vartheta_{p} + K_{E1P2}\vartheta_{p}{}^{2} + K_{E1P3}\vartheta_{p}{}^{3}} \right)\cos W_{e}T +} \\
{\left( {K_{E2P1}\vartheta_{p} + K_{E2P2}\vartheta_{p}{}^{2} + K_{E2P3}\vartheta_{p}{}^{3}} \right)\cos 2W_{e}T} \\
\end{array} \right\rbrack$$ where $\varepsilon$ is regarded as a small non-dimensional bookkeeping parameter, $\sigma$ is a detuning parameter, $W_{e}{}^{2} = K_{1}{+ \mathsf{\varepsilon}}\sigma$.
Introduce $W_{0}^{2} = \alpha_{k}$, when the static deflection is small and $\mathsf{\sigma} = 0$, the resonance frequency ratio is $$W_{e}{}^{2}/W_{0}{}^{2} = {K_{1}/\alpha_{k}} = \mathsf{Κ}_{w0} - \mathsf{Κ}_{w2}d^{2}$$ in which the coefficients are $${\mathsf{Κ}_{w0} = 1 - r_{1}\frac{\left( {\int_{0}^{1}\mathsf{\Phi}dX} \right)^{2}}{\int_{0}^{1}\frac{\partial^{4}\mathsf{\Phi}}{\partial X^{4}}\mathsf{\Phi}dX}\frac{l_{b}{}^{4}v_{DC}^{2}}{EI}\left\lbrack {1 + \frac{1}{2}\left( \frac{v_{AC}}{v_{DC}} \right)^{2}} \right\rbrack}{,\ \mathsf{Κ}_{w2} = 3r_{3}\frac{\left( {\int_{0}^{1}\mathsf{\Phi}dX} \right)^{2}}{\int_{0}^{1}\frac{\partial^{4}\mathsf{\Phi}}{\partial X^{4}}\mathsf{\Phi}dX}\frac{l_{b}{}^{4}v_{DC}^{2}}{EI}\left\lbrack {1 + \frac{1}{2}\left( \frac{v_{AC}}{v_{DC}} \right)^{2}} \right\rbrack}$$
The primary resonance of nonlinear dynamic equation is analyzed, yields $$\begin{array}{l}
{- W_{e}\alpha_{0}\beta_{0}{}^{\prime} = \frac{1}{2}\sigma\alpha_{0} - \frac{1}{4}K_{3}\alpha_{0}{}^{3} +} \\
{\left( {\frac{1}{2}F_{E1} + \frac{1}{4}K_{E1P2}\alpha_{0}{}^{2}} \right)\cos\beta_{0} + \left( {\frac{1}{4}K_{E2P1}\alpha_{0} + \frac{1}{4}K_{E2P3}\alpha_{0}{}^{3}} \right)\cos 2\beta_{0}} \\
\end{array}$$ $$- W_{e}\alpha_{0}{}^{\prime} = - \frac{W_{e}^{2}}{\pi}\alpha_{a}\alpha_{0}{}^{2} + \frac{1}{2}F_{E1}\sin\beta_{0} + \left( {\frac{1}{4}K_{E2P1}\alpha_{0} + \frac{1}{8}K_{E2P3}\alpha_{0}{}^{3}} \right)\sin 2\beta_{0}$$ where $\alpha_{0}$ is the amplitude of $\vartheta_{p}$, $\beta_{0}$ is the phase difference with $W_{e}$, (′) denotes the derivate with respect to $T_{1} = \varepsilon T$. The complete proof is given in [Appendix E](#app5-micromachines-10-00324){ref-type="app"}.
The steady-state periodic motion corresponds to the solution of the system of equations, by conditions $\alpha_{0}^{\prime} = 0$ and $\beta_{0}^{\prime} = 0$. Finally, the frequency response equation of the primary resonance can be derived as $$\left\lbrack \frac{- P_{C1} - \sqrt{P_{C1}{}^{2} - 8P_{C2}\left( {P_{C0} - P_{C2}} \right)}}{4P_{C2}} \right\rbrack^{2} + \left\lbrack \frac{- 4P_{C2}P_{S0}}{4P_{C2}P_{S1} - 2P_{C1}P_{S2} - 2P_{S2}\sqrt{P_{C1}{}^{2} - 8P_{C2}\left( {P_{C0} - P_{C2}} \right)}} \right\rbrack^{2}{= 1}$$ in which the coefficients are$P_{C0} = \frac{1}{2}\sigma\alpha_{0} - \frac{1}{4}K_{3}\alpha_{0}{}^{3}$, $P_{C1} = \frac{1}{2}F_{E1} + \frac{1}{4}K_{E1P2}\alpha_{0}{}^{2}$, $P_{C2} = \frac{1}{4}K_{E2P1}\alpha_{0} + \frac{1}{4}K_{E2P3}\alpha_{0}{}^{3}$,$P_{S0} = - \frac{W_{e}^{2}}{\pi}\alpha_{a}\alpha_{0}{}^{2}$, $P_{S1} = \frac{1}{2}F_{E1}$, $P_{S2} = \frac{1}{4}K_{E2P1}\alpha_{0} + \frac{1}{8}K_{E2P3}\alpha_{0}{}^{3}$.
The relationship between the electrostatic force and the initial displacement is nonlinear. It can reveal nonlinear dynamic behaviors of the vibration beam. When $v_{DC} = 30{\ V}$ and $v_{AC} = 0.5{\ V}$, based on the frequency response equation, the frequency response curve of the primary resonance is shown in [Figure 6](#micromachines-10-00324-f006){ref-type="fig"}. It exhibits linear behavior. Based on Equation (11) and setting σ = 0, i.e., when the vibration beam resonates, the relationship between the square of resonance frequency and that of initial displacement is linear, as shown in [Figure 7](#micromachines-10-00324-f007){ref-type="fig"}. From [Figure 7](#micromachines-10-00324-f007){ref-type="fig"}, the resonance frequency rises, with the increase of the initial displacement and the decrease of the slit gap. In the same range of the initial displacement, a smaller slit gap makes marked change of the resonance frequency. So, the initial displacement can be obtained from resonance frequency measurement. What's more, decreasing the slit gap can enhance the sensitivity of the sensor to the initial displacement.
The vibration peak value can be found by the frequency response equation, [Figure 8](#micromachines-10-00324-f008){ref-type="fig"} shows the effects of initial displacement and slit gap on the vibration amplitude of the primary resonance. Increase of the vibration amplitude is linear, with the increase of the initial displacement. Linearity is an important parameter for sensors because linearity indicates a directly proportional relationship between output and input signals of a sensing system \[[@B1-micromachines-10-00324]\]. So, it is available that the initial displacement is obtained from vibration amplitude measurement of the primary resonance.
When $v_{DC} = 300{\ V}$ and $v_{AC} = 5{\ V}$, the nonlinear dynamic equation Equation (9) is solved by using the MMS and the Fourth-Order Runge--Kutta Method (RK4) \[[@B33-micromachines-10-00324]\], and the effect of the initial displacement on the vibration amplitude is shown in [Figure 9](#micromachines-10-00324-f009){ref-type="fig"}. The results of the MMS and the RK4 are in a good agreement when the amplitude is small. The error between the results of the MMS and the RK4 increases, when the vibration amplitude increases. [Figure 9](#micromachines-10-00324-f009){ref-type="fig"} proves the results of the MMS verified. As shown in [Figure 9](#micromachines-10-00324-f009){ref-type="fig"}, when *d* = 0.03 mm, there are two values of the vibration amplitude when *W~e~ / W~0~* = 1.0750 and 1.0775. The jump phenomenon has been found, when the initial displacement increases, the jump frequency increases.
Primary resonance's vibration amplitude versus initial displacement under different excitation frequency ratio is shown in [Figure 10](#micromachines-10-00324-f010){ref-type="fig"}. In [Figure 10](#micromachines-10-00324-f010){ref-type="fig"}, the frequency ratio is 1.0750, 1.0775 and 1.0800 respectively. Within the range of initial displacement \[0.01 mm, 0.05 mm\], the amplitude is calculated once every 0.002 mm interval, and the bifurcation diagram of amplitude with respect to initial displacement is drawn. It can be clearly observed that the number of equilibrium points of parameter *u* changes with the change of parameter *d*. For the case of frequency ratio 1.0750, parameter *u* has three equilibrium points when parameter *d* = 0.03; for the case of frequency ratio 1.0775, parameter *u* has three equilibrium points when parameter *d* = 0.032 and 0.034; for the case of frequency ratio 1.0800, parameter *u* has three equilibrium points when parameter *d* = 0.034 and 0.036. With the change of parameter *d*, there is a jump phenomenon in parameter *u*. When the jump phenomenon occurs, the corresponding excitation frequency is the resonance frequency of the vibration system.
By comparing the frequencies of the three equilibrium points, it is found that with the increase of initial displacement, the smaller excitation frequencies first appear three equilibrium points. Because there is a corresponding relationship between the excitation frequency ratio and the initial displacement of the cantilever beam when there are three equilibrium points in the vibration system. Therefore, the initial displacement of the cantilever beam can be described by measuring the excitation frequency of the three equilibrium points. So, jump phenomenon can be used to locate the demand initial displacement. The excitation frequency can be changed to adjust the change of the demand initial displacement.
When *d* = 0.03 mm and $W_{e}/W_{0}$ = 1.075, phase trajectory is drawn in [Figure 11](#micromachines-10-00324-f011){ref-type="fig"}. It can be seen from the figure that the amplitude of the cantilever beam is related to its initial state, that is, when the initial state energy is high, the amplitude of the cantilever beam corresponds to the higher equilibrium point S1; when the initial state energy is low, the amplitude of the cantilever beam corresponds to the lower equilibrium point S3. The equilibrium point S2 is unstable saddle.
The jumping amplitude change can be detected more easily and more quickly. In the following, the jump phenomenon is studied, based on the frequency response equation. And the impact of the different parameters, which include the material parameters, the beam length and the actuated voltage, on the nonlinear dynamic characteristic is presented.
The effects of the initial displacement and the material parameters on the frequency response curve of the primary resonance are shown in [Figure 12](#micromachines-10-00324-f012){ref-type="fig"}. The frequency ratio $W_{e}/W_{0}$ of the vibration peak value of the aluminum beam, whose Young's modulus is the least, is the biggest. That because that when the Young's modulus decreases, the value of the parameter $E_{0}$ increases, which leads the increase of the frequency ratio $W_{e}/W_{0}$. It means that the fringing electrostatic force has a largest impact on the resonance frequency of the aluminum beam. As show in this figure, the amplitude $u$ of the brass beam, whose density is the largest, is the biggest. The nonlinear response of the brass beam is obvious. That because that when the density increases, the value of the parameter $\alpha_{a}$ decreases, which leads the decrease of the damping and the increase of the vibration amplitude. To increase the vibration amplitude, we use the brass beam.
When $l_{s} = 6{\ {mm}}$, the effects of the initial displacement on the frequency response curve of the primary resonance are shown in [Figure 13](#micromachines-10-00324-f013){ref-type="fig"}. Compared with [Figure 9](#micromachines-10-00324-f009){ref-type="fig"}, the vibration amplitude $u$ and frequency ratio $W_{e}/W_{0}$ of the vibration peak value are larger, the nonlinear behavior is more obvious. Meanwhile, with the increase of the initial displacement, the increase of the jump frequency changes is more obviously. It means that the fringing electrostatic force has a larger impact on the frequency response, when the length of beam is larger.
When $v_{DC} = 350{\ V}$ $v_{AC} = 5{\ V}$ and $v_{DC} = 300{\ V}$ $v_{AC} = 10{\ V}$, [Figure 14](#micromachines-10-00324-f014){ref-type="fig"} shows the frequency response curve of the primary resonance under different initial displacement. Compared with [Figure 9](#micromachines-10-00324-f009){ref-type="fig"}, when DC/AC voltage are big enough, the electrostatic force can lead to obvious nonlinear vibration. Furthermore, as the increase of the actuated voltage, the nonlinear vibration strengthens. When a larger amplitude is expected, the actuated voltage is always set big enough, and the nonlinear vibration must be considered.
4. Experimental Setup and Results {#sec4-micromachines-10-00324}
=================================
An experiment is designed to observe the dynamic analysis of this structure. The experimental setup for the dynamic tests consists of excitation powers (high voltage power and waveform generation), mechanical parts (cantilevered beam and electrode) and detection parts (laser displacement sensor and oscilloscope). The schematic of experimental setup is depicted in [Figure 15](#micromachines-10-00324-f015){ref-type="fig"}. Because the experimental conditions are limited, the geometric parameters of the structure are magnified, which are taken as $l_{b} = 50{\ {mm}}$, $w_{b} = 4{\ {mm}}$, $t_{b} = 0.1{\ {mm}}$, $l_{s} = 50{\ {mm}}$, $w_{s} = 15{\ {mm}}$, $t_{s} = 3{\ {mm}}$, $d_{g} = 0.5{\ {mm}}$ and $v_{DC} = 300{\ V}$, $v_{AC} = 5{\ V}$.
The cantilevered beam is directly actuated by a periodic wave produced from a waveform generator, while DC voltage produced by high voltage power is applied to the cantilevered beam at the same time. The electrode is connected with ground. In this way, both DC voltage and AC voltage are applied between the cantilevered beam and electrode. The moving platform can change the initial displacement between the cantilevered beam and electrode.
The vibration of the cantilevered beam is more obvious, when the excitation frequency is close to the resonance frequency. And the vibration amplitude is the largest, when the excitation frequency equals to the resonance frequency. The laser displacement sensor is used to detect the vibration amplitude, by transforming the amplitude change to voltage change. Then this voltage change signal is given to the oscilloscope. The oscilloscope is used to display and record the data of both frequency and amplitude. It means that the resonance frequency change can be detected by using both the laser displacement sensor and the oscilloscope.
When $v_{DC} = 300{\ V}$ and $v_{AC} = 5{\ V}$, [Figure 16](#micromachines-10-00324-f016){ref-type="fig"} shows that the resonance frequency rises with the increase in initial displacement, in which *d* = 0 mm -- 0.8 mm. As the same as the theory analysis, it is expected that relationship between the input (the square of initial displacement) and the output (the square of resonance frequency) is linear, when the beam is far from the middle and the end of the electrode in the thickness direction. In this range, the initial displacement can be obtained from resonance frequency measurement.
The vibration amplitude of the cantilevered beam is relatively small, when the cantilevered beam is near the middle of the electrode in the thickness direction. It is not easy to find the resonance frequency. So, the error is large near this point in [Figure 16](#micromachines-10-00324-f016){ref-type="fig"}.
When the beam is near the end of the electrode in the thickness direction, the frequency response curves are shown in [Figure 17](#micromachines-10-00324-f017){ref-type="fig"}. When $v_{DC} = 100{\ V\ {and}\ }200{\ V}$, the frequency response curve is linear., while the amplitude of the beam is relatively small. But when $v_{DC} = 300{\ V}$, the frequency response curve is nonlinear, while the nonlinearity of the system is of the softening type, as shown in \[[@B26-micromachines-10-00324]\]. If the amplitude of the beam is large enough, the electrostatic force does not agree with linear and cubic fit function at all, when the beam is near the end of the electrode in the thickness direction. So, it causes an error near the end of the electrode in [Figure 16](#micromachines-10-00324-f016){ref-type="fig"}.
When the excitation frequency equals to the resonance frequency, the vibration amplitude is the largest. The largest vibration amplitude values responding to different initial displacement are recorded by the test. When the initial displacement is 0.4 mm to 0.8 mm, the vibration amplitudes which are given by the MMS and the TEST are shown in [Figure 18](#micromachines-10-00324-f018){ref-type="fig"}. When the initial displacement is 0.4 mm to 0.8 mm, the increase in the vibration amplitude is linear, and the initial displacement can be obtained from amplitude measurement. As show in [Figure 18](#micromachines-10-00324-f018){ref-type="fig"}, the result of the MMS agrees well with the experimental result. Base on [Figure 8](#micromachines-10-00324-f008){ref-type="fig"}, the measurement error of slit gap leads the error between the results of the MMS and the TEST in [Figure 18](#micromachines-10-00324-f018){ref-type="fig"}.
In the above test, the hardening effect is not obvious, since the cubic fitting parameter is relatively small. [Figure 13](#micromachines-10-00324-f013){ref-type="fig"} shows that the fringing electrostatic force has a larger impact on the frequency response, when the length of beam is larger. To increase cubic fitting parameter, the slit gap is reduced to 0.3 mm, and another beam with $l_{b} = 100{\ {mm}}$ is used. The frequency response curve exhibits hardening behavior, and there is a jump in 5.140 Hz, as shown in [Figure 19](#micromachines-10-00324-f019){ref-type="fig"}.
5. Conclusions {#sec5-micromachines-10-00324}
==============
In this paper, a new fringing electrostatic actuation mode is developed. Some obvious advantages of this new actuation mode are as following: a large deflection can be obtained without the limitation of the proximity of the electrodes; this structure which is compatible with the circuit can be designed to smaller scale; a smaller scale leads to better sensitivity. Through the combination of theoretical modeling, analytical calculation, numerical verification and experimental research, the mechanism of fringing electrostatic force and the complex response law of fringing electrostatic actuation vibration system are revealed, the relationship between system parameters and vibration response is analyzed, the application scheme of this actuation mode is put forward.
The fringing electrostatic force and the dynamic investigations into the micro cantilevered beam actuated by fringing electrostatic force are of great concern. Through analysis, the expression of fringing electrostatic force is found; the effects of the some parameters on the dynamic behaviors are investigated. Results shows that the fringing electrostatic force is nonlinear, which leads to nonlinear vibration of the micro-cantilevered beam; the resonance frequency rises with the increase of the initial displacement and the decrease of the slit gap; in the same range of the initial displacement, a smaller slit gap makes marked change of the resonance frequency; with the increase of the initial displacement, the increase of the vibration amplitude is linear; when the initial displacement increases, the jump frequency increases; the fringing electrostatic force has a larger impact on the frequency response, when the length of beam is larger; as the increase of the actuated voltage, the nonlinear vibration strengthens.
Moreover, that are the influences of initial displacement change in the dynamic behaviors of the micro cantilevered beam that helps us to design a new micro tactile sensor. This sensor can measure the pressure based on the initial displacement change. The initial displacement can be derived by measuring resonance frequency and vibration amplitude of the micro cantilevered beam. And the jump phenomenon can be used to locate the initial displacement.
Z.W. and Q.Z. conceived and designed the model; Z.W. and W.W. contributed theoretical analysis; Z.W. and J.H. analyzed the data; Z.W. wrote the paper.
This work is supported by the National Natural Science Foundation of China (Grant Nos. 11772218, 11872044 and 11702192).
The authors declare no conflict of interest.
$r_{11}{}^{2} = \left( {w_{s} + d_{g}} \right)^{2} + \left( {d - 0.5t_{s}} \right)^{2}$, $r_{21}{}^{2} = \left( {w_{s} + d_{g}} \right)^{2} + \left( {d + 0.5t_{s}} \right)^{2}$,
$r_{12}{}^{2} = d_{g}{}^{2} + \left( {d - 0.5t_{s}} \right)^{2}$, $r_{22}{}^{2} = d_{g}{}^{2} + \left( {d + 0.5t_{s}} \right)^{2}$,
$r_{13}{}^{2} = \left( {w_{b} + d_{g}} \right)^{2} + \left( {d - 0.5t_{s}} \right)^{2}$, $r_{23}{}^{2} = \left( {w_{b} + d_{g}} \right)^{2} + \left( {d + 0.5t_{s}} \right)^{2}$,
$r_{14}{}^{2} = \left( {w_{s} + w_{b} + d_{g}} \right)^{2} + \left( {d - 0.5t_{s}} \right)^{2}$, $r_{24}{}^{2} = \left( {w_{s} + w_{b} + d_{g}} \right)^{2} + \left( {d + 0.5t_{s}} \right)^{2}$,
$\sin\theta_{11} = \left( {d - 0.5t_{s}} \right)/r_{11}$, $\sin\theta_{21} = \left( {d + 0.5t_{s}} \right)/r_{21}$,
$\sin\theta_{12} = \left( {d - 0.5t_{s}} \right)/r_{12}$, $\sin\theta_{22} = \left( {d + 0.5t_{s}} \right)/r_{22}$,
$\sin\theta_{13} = \left( {d - 0.5t_{s}} \right)/r_{13}$, $\sin\theta_{23} = \left( {d + 0.5t_{s}} \right)/r_{23}$,
$\sin\theta_{14} = \left( {d - 0.5t_{s}} \right)/r_{14}$, $\sin\theta_{24} = \left( {d + 0.5t_{s}} \right)/r_{24}$.
$U = u/\left( {0.5t_{s} - d} \right)\ $,
$X = x/l_{b}$,
$T = \omega t$,
$\omega = \sqrt{EI/\left( {\rho w_{b}t_{b}l_{b}^{4}} \right)}$,
$W_{e} = \omega_{e}/\omega$,
$V_{AC} = v_{AC}/v_{DC}$,
$\mathsf{Ε}_{0} = l_{b}^{4}e_{p}v_{DC}^{2}/\left\lbrack {EI\left( {0.5t_{s} - d} \right)} \right\rbrack$,
$\mathsf{Ε}_{1} = e_{p1}\left( {0.5t_{s} - d} \right)$,
$\mathsf{Ε}_{2} = e_{p2}\left( {0.5t_{s} - d} \right)^{2}$,
$\mathsf{Ε}_{3} = e_{p3}\left( {0.5t_{s} - d} \right)^{3}$,
$\mathsf{Α} = \rho_{a}c_{a}\left( {0.5t_{s} - d} \right)/\left( {2\rho t_{b}} \right)$.
$\alpha_{k} = \int_{0}^{1}\frac{\partial^{4}\mathsf{\Phi}}{\partial X^{4}}{\mathsf{\Phi}d}X$, $\alpha_{Ep} = \mathsf{Ε}_{0}\int_{0}^{1}{\mathsf{\Phi}d}X$, $\alpha_{ep1} = \mathsf{Ε}_{1}\int_{0}^{1}{\mathsf{\Phi}d}X$, $\alpha_{ep2} = \mathsf{Ε}_{2}\int_{0}^{1}\mathsf{\Phi}^{2}dX$, $\alpha_{ep3} = \mathsf{Ε}_{3}\int_{0}^{1}\mathsf{\Phi}^{3}dX$,
$\alpha_{a} = \mathsf{Α}\int_{0}^{1}\mathsf{\Phi}^{3}dX$.
$S_{0} = \left( {1 + \frac{V_{AC}^{2}}{2}} \right)\alpha_{Ep}$, $S_{1} = \left( {1 + \frac{V_{AC}^{2}}{2}} \right)\alpha_{Ep}\alpha_{ep1} - \alpha_{k}$, $S_{2} = \left( {1 + \frac{V_{AC}^{2}}{2}} \right)\alpha_{Ep}\alpha_{ep2}$, $S_{3} = \left( {1 + \frac{V_{AC}^{2}}{2}} \right)\alpha_{Ep}\alpha_{ep3}$,
$C_{0} = 1 + \alpha_{ep1}\mathsf{\Theta}_{0p} + \alpha_{ep2}\mathsf{\Theta}_{0p}^{2} + \alpha_{ep3}\mathsf{\Theta}_{0p}^{3}$, $C_{1} = \alpha_{ep1} + 2\alpha_{ep2}\mathsf{\Theta}_{0p} + 3\alpha_{ep3}\mathsf{\Theta}_{0p}^{2}$,
$C_{2} = \alpha_{ep2} + 3\alpha_{ep3}\mathsf{\Theta}_{0p}$, $C_{3} = \alpha_{ep3}$,
$K_{1} = \alpha_{k} - \alpha_{Ep}\left( {1 + \frac{V_{AC}^{2}}{2}} \right)C_{1}$, $K_{2} = - \alpha_{Ep}\left( {1 + \frac{V_{AC}^{2}}{2}} \right)C_{2}$, $K_{3} = - \alpha_{Ep}\left( {1 + \frac{V_{AC}^{2}}{2}} \right)C_{3}$,
$F_{E1} = 2V_{AC}\alpha_{Ep}C_{0}$, $F_{E2} = 0.5V_{AC}^{2}\alpha_{Ep}C_{0}$,
$K_{E1P1} = 2V_{AC}\alpha_{Ep}C_{1}$, $K_{E1P2} = 2V_{AC}\alpha_{Ep}C_{2}$, $K_{E1P3} = 2V_{AC}\alpha_{Ep}C_{3}$,
$K_{E2P1} = 0.5V_{AC}^{2}\alpha_{Ep}C_{1}$, $K_{E2P2} = 0.5V_{AC}^{2}\alpha_{Ep}C_{2}$, $K_{E2P3} = 0.5V_{AC}^{2}\alpha_{Ep}C_{3}$.
The nonlinear dynamic equation is solved using the MMS. The solution can be represented by an expansion having the form as $$\vartheta_{p} = \vartheta_{0}(T_{0},T_{1}) + \varepsilon\vartheta_{1}(T_{0},T_{1})$$ where, $T_{n} = \varepsilon^{n}T$.
A detuning parameter σ is introduced and defined by $K_{1} = W_{e}^{2} - \varepsilon\sigma$, then equating coefficients of like powers of $\varepsilon$, yield $${\mathsf{Ο}(\varepsilon^{0}):}{D_{0}^{2}\vartheta_{0} + W_{e}{}^{2}\vartheta_{0} = 0}$$ $${\mathsf{Ο}(\varepsilon^{1}):}\begin{array}{l}
{D_{0}^{2}\vartheta_{1} + 2D_{0}D_{1}\vartheta_{0} - \sigma\vartheta_{0} + W_{e}{}^{2}\vartheta_{1} + K_{2}\vartheta_{0}^{2} + K_{3}\vartheta_{0}^{3} + \alpha_{a}D_{0}\vartheta_{0}\left| {D_{0}\vartheta_{0}} \right| =} \\
{F_{E1}\cos W_{e}T_{0} + \left( {K_{E1P1}\vartheta_{0} + K_{E1P2}\vartheta_{0}^{2} + K_{E1P3}\vartheta_{0}^{3}} \right)\cos W_{e}T_{0} +} \\
{F_{E2}\cos 2W_{e}T_{0} + \left( {K_{E2P1}\vartheta_{0} + K_{E2P2}\vartheta_{0}^{2} + K_{E2P3}\vartheta_{0}^{3}} \right)\cos 2W_{e}T_{0}} \\
\end{array}$$ when $D_{n} = \frac{\partial}{\partial T_{n}}$.
The general solution of Equation $O\left( \varepsilon^{0} \right)$ can be written as $$\vartheta_{0} = \alpha\left( T_{1} \right)\exp\left( {iW_{e}T_{0}} \right) + {cc}$$ where cc represents the complex conjugate terms.
Substituting the solution of Equation $O\left( \varepsilon^{0} \right)$ into Equation $O\left( \varepsilon^{1} \right)$, yields $${\mathsf{Ο}(\varepsilon^{1}):}\begin{array}{l}
{D_{0}^{2}\vartheta_{1} + W_{e}{}^{2}\vartheta_{1} = \sigma\alpha e^{iW_{e}T_{0}} - 2iW_{e}D_{1}\alpha e^{iW_{e}T_{0}}} \\
{- K_{2}\left( {\alpha e^{iW_{e}T_{0}} + \overline{\alpha}e^{- iW_{e}T_{0}}} \right)\alpha e^{iW_{e}T_{0}} - K_{3}\left( {\alpha e^{iW_{e}T_{0}} + \overline{\alpha}e^{- iW_{e}T_{0}}} \right)^{2}\alpha e^{iW_{e}T_{0}}} \\
{- \alpha_{a}\left( {iW_{e}\alpha e^{iW_{e}T_{0}}} \right)\left| {iW_{e}\alpha e^{iW_{e}T_{0}} - iW_{e}\overline{\alpha}e^{- iW_{e}T_{0}}} \right|} \\
{+ \frac{1}{2}F_{E1}e^{iW_{e}T_{0}} + \left\lbrack \begin{array}{l}
{K_{E1P1}\alpha e^{iW_{e}T_{0}} + K_{E1P2}\left( {\alpha e^{iW_{e}T_{0}} + \overline{\alpha}e^{- iW_{e}T_{0}}} \right)\alpha e^{iW_{e}T_{0}}} \\
{+ K_{E1P3}\left( {\alpha e^{iW_{e}T_{0}} + \overline{\alpha}e^{- iW_{e}T_{0}}} \right)^{2}\alpha e^{iW_{e}T_{0}}} \\
\end{array} \right\rbrack\frac{e^{iW_{e}T_{0}} + e^{- iW_{e}T_{0}}}{2}} \\
{+ \frac{1}{2}F_{E2}e^{2iW_{e}T_{0}} + \left\lbrack \begin{array}{l}
{K_{E2P1}\alpha e^{iW_{e}T_{0}} + K_{E2P2}\left( {\alpha e^{iW_{e}T_{0}} + \overline{\alpha}e^{- iW_{e}T_{0}}} \right)\alpha e^{iW_{e}T_{0}}} \\
{+ K_{E2P3}\left( {\alpha e^{iW_{e}T_{0}} + \overline{\alpha}e^{- iW_{e}T_{0}}} \right)^{2}\alpha e^{iW_{e}T_{0}}} \\
\end{array} \right\rbrack\frac{e^{2iW_{e}T_{0}} + e^{- 2iW_{e}T_{0}}}{2}} \\
{+ {cc}} \\
\end{array}$$
At this point, it is convenient to express $\mathsf{\alpha}$ in the polar form $$\alpha = \frac{1}{2}\alpha_{0}e^{i\beta_{0}}$$ where $\alpha_{0}$ and $\beta_{0}$ are real functions of $T_{1}$.
In order to eliminate the secular term, one needs $$\begin{array}{l}
{\sigma\alpha - 2iW_{e}D_{1}\alpha - 2K_{3}\alpha^{2}\overline{\alpha} + \frac{1}{2}F_{E1} + \frac{1}{2}K_{E1P2}\left( {\alpha^{2} + \alpha\overline{\alpha}} \right) +} \\
{\left\lbrack {\frac{1}{2}K_{E2P1}\overline{\alpha} + \frac{1}{2}K_{E2P3}\left( {\alpha^{3} + 3\alpha{\overline{\alpha}}^{2}} \right)} \right\rbrack +} \\
{- \frac{W_{e}}{2\pi}{\int_{0}^{2\pi/W_{e}}{\alpha_{a}\left( {iW_{e}\alpha e^{iW_{e}T_{0}}} \right)\left| {iW_{e}\alpha e^{iW_{e}T_{0}} - iW_{e}\overline{\alpha}e^{- iW_{e}T_{0}}} \right|e^{- iW_{e}T_{0}}dT_{0}}} = 0} \\
\end{array}$$
Substituting $\mathsf{\alpha}$ into the secular term and separating the result into real and imaginary parts, we obtain Equation (12) and Equation (13).
{#micromachines-10-00324-f001}
{#micromachines-10-00324-f002}
{#micromachines-10-00324-f003}
{#micromachines-10-00324-f004}
{#micromachines-10-00324-f005}
{#micromachines-10-00324-f006}
{#micromachines-10-00324-f007}
{#micromachines-10-00324-f008}
{#micromachines-10-00324-f009}
{#micromachines-10-00324-f010}
{#micromachines-10-00324-f011}
{#micromachines-10-00324-f012}
{#micromachines-10-00324-f013}
{#micromachines-10-00324-f014}
{#micromachines-10-00324-f015}
{#micromachines-10-00324-f016}
{#micromachines-10-00324-f017}
{#micromachines-10-00324-f018}
{#micromachines-10-00324-f019}
| {
"pile_set_name": "PubMed Central"
} |
Q:
How do cursors work in Python's DB-API?
I have been using python with RDBMS' (MySQL and PostgreSQL), and I have noticed that I really do not understand how to use a cursor.
Usually, one have his script connect to the DB via a client DB-API (like psycopg2 or MySQLdb):
connection = psycopg2.connect(host='otherhost', etc)
And then one creates a cursor:
cursor = connection.cursor()
And then one can issue queries and commands:
cursor.execute("SELECT * FROM etc")
Now where is the result of the query, I wonder? is it on the server? or a little on my client and a little on my server? And then, if we need to access some results, we fetch 'em:
rows = cursor.fetchone()
or
rows = cursor.fetchmany()
Now lets say, I do not retrieve all the rows, and decide to execute another query, what will happen to the previous results? Is their an overhead.
Also, should I create a cursor for every form of command and continuously reuse it for those same commands somehow; I head psycopg2 can somehow optimize commands that are executed many times but with different values, how and is it worth it?
Thx
A:
ya, i know it's months old :P
DB-API's cursor appears to be closely modeled after SQL cursors. AFA resource(rows) management is concerned, DB-API does not specify whether the client must retrieve all the rows or DECLARE an actual SQL cursor. As long as the fetchXXX interfaces do what they're supposed to, DB-API is happy.
AFA psycopg2 cursors are concerned(as you may well know), "unnamed DB-API cursors" will fetch the entire result set--AFAIK buffered in memory by libpq. "named DB-API cursors"(a psycopg2 concept that may not be portable), will request the rows on demand(fetchXXX methods).
As cited by "unbeknown", executemany can be used to optimize multiple runs of the same command. However, it doesn't accommodate for the need of prepared statements; when repeat executions of a statement with different parameter sets is not directly sequential, executemany() will perform just as well as execute(). DB-API does "provide" driver authors with the ability to cache executed statements, but its implementation(what's the scope/lifetime of the statement?) is undefined, so it's impossible to set expectations across DB-API implementations.
If you are loading lots of data into PostgreSQL, I would strongly recommend trying to find a way to use COPY.
| {
"pile_set_name": "StackExchange"
} |
Travel from Sweden to Morocco, Travel to Morocco from Sweden, Visit Morocco from Sweden, Holidays in Morocco for a national of Sweden, Vacation in Morocco for a citizen of Sweden, Going to Morocco from Sweden | {
"pile_set_name": "Pile-CC"
} |
Metyrapone pretreatment prevents the behavioral and neurochemical sequelae induced by stress.
In the present study, we examined the effect of metyrapone, an inhibitor of corticosterone (CS) synthesis, on the behavioral and neurochemical sequelae induced by a brief restraint session. A 15-min stress period induced an anxiogenic-like behavior on the elevated plus-maze (EPM), which was reversed with metyrapone (75 mg/kg i.p.) injected 3 h prior to the stress event. It was further demonstrated that metyrapone pretreatment normalized the decrease in maximal chloride uptake following GABA stimulation observed in brain cortex tissue obtained from animals exposed to both restraint and the EPM. In addition, plasma CS levels were assessed both after restraint and following EPM exposure. Furthermore, the administration of both CS (2.5 mg/kg s.c. at a dose that mimics CS levels induced by restraint) or dexamethasone (DEXA, 1.25 microg/kg s.c) resulted in an anxiogenic response in the EPM comparable to that induced by restraint. Taken together, all these evidence suggest that CS released in response to stress seems to be associated with functional changes at the GABAergic supramolecular complex which could underlie the enhanced anxiety observed following the exposure to an aversive experience. | {
"pile_set_name": "PubMed Abstracts"
} |
Which Rental Place Offers a Next-Gen Game System at the Lowest Price?
By Rob Cockerham | April 21, 2014
How much is an Xbox One at Rent a Center? How much is a PS4?
How much is an Xbox One at Aarons? How much is a PS4?
Not everyone can afford to pay cash for the latest new game console. If this is your situation, my advice is to NOT BUY a game console. Using a credit card, and paying it off over time is an option, but this option is expensive. Using a credit card with 18% annual percentage rate (APR)(interest), you might end up paying an extra $30 in interest.
If your credit score is in the toilet, and you can't get a Visa or Mastercard, try your luck at Best Buy. They have an in-store credit card.
You shouldn't buy a game console at Aaron's or Rent a Center. Their prices are crazy.
On March 15th, I visited both stores and asked about the PS4 and the Xbox One. Here are the numbers:
Rent-a-Center
At Rent-a-Center, you pay for purchases based on how frequently you get paid. If you get paid once a week, you pay each week, if you get paid once a month, you pay once a month. For most customers, this means paying every two weeks.
For the PS4, Rent a Center charges $70 per two-weeks, or $35 per week. That's designed to be affordable, but it will be a long time before you own it. The PS4 takes 53 weeks to pay off at that rate, for a total price of $1,854.47.
For the Xbox One, the bi-weekly price at Rent-a-Center is the same, $70 per two weeks, but it takes a few more weeks to pay off: 58 weeks, or $2,029.42 total.
Aaron's is a little less! or a little more...
At Aaron's, if you can pay that much, you'd opt for the 12-month lease-to-own plan, paying $129 per month for a PS4. Now, assuming you didn't tack on another 10% for Aaron's Service PLUS, you'd pay $129/month for 12 months, plus tax, for a total of $1,692.48.
Aaron's has plans which charge a little less per month, some as low as $80, but those plans cost much more in the long run, taking 24 months to pay, for a total price of $2,082.96.
For the Xbox One with Kinect, the pricing is the same as the PS4. A 12-month lease is $141 per month, for a total of $1,692. A 24-month lease is $86 per month for two years, a total of $2,082.
$2,082 for a game console? Have you lost your mind?
This is a ridiculous retail proposition. What fool would sign up for this?
Not me, but I couldn't help noticing that Aaron's Xbox price ($79/month for 24 months) is the exact price and duration of my AT&T wireless contract which I signed to take delivery of my fancy new Galaxy Note smartphone.
This is embarrassing. | {
"pile_set_name": "OpenWebText2"
} |
Endovascular treatment of popliteal artery aneurysms: preliminary results.
Popliteal artery aneurysms (PAAs) are a rare condition with an incidence <0.1%. The objective of this study was to evaluate the effectiveness of endovascular treatment of PAA with a covered stent-graft. Between January 2009 and July 2010, ten patients (nine men and one woman, mean age 69 ± 12 years) with PAA were treated by endovascular placement of a heparin-coated stent-graft. All procedures were evaluated in terms of technical success, patency at 1, 6 and 12 months as assessed by colour Doppler ultrasound, complications, procedure duration and length of postoperative hospital stay. We obtained 100% technical success, with no peri- or postprocedural complications. Average duration of the procedure was 40 min, and mean hospital stay was 3 days. Primary and secondary patency rates at 1, 6 and 12 months were 100% and 100%, 90% and 100%, and 90% and 100%, respectively. Only one case of endoleak occurred. In keeping with the literature, our study demonstrates the effectiveness of endovascular repair of PAA, with short- and mid-term patency rates comparable to those of open surgery. Larger series and longer follow-up periods are needed to confirm these preliminary results. | {
"pile_set_name": "PubMed Abstracts"
} |
Virginia State Route 239 (1942)
REDIRECT U.S. Route 258 | {
"pile_set_name": "Wikipedia (en)"
} |
Author Morven Westfield comments on writing, vampires, the wildlife outside her window, and the writing life.
Sunday, October 25, 2015
Full Moons and Vampires
Most of us are familiar with the effect that full moons have on werewolves, but what about the effect on vampires? Unlike their furry friends, vampires don't turn into a deadly creature only at the full of the moon. A vampire is active any night. Why, then, do we associate the full moon with vampires?
One association has to do with the way a vampire is made. It was believed that even without another vampire's involvement, a human could be turned into a vampire through a witch's curse or through improper burial. If a cat jumped over the corpse or the full moon shone upon it through a window before it was buried, the person would return from the grave as a vampire.
The full moon could also restore a wounded vampire to undead health. The vampire's body would be spread out where it could be bathed in the light of the full moon and left to revive. In Polidori’s “The Vampyre,” Lord Ruthven is shot by bandits and asks that his body be laid out where the first rays of moonlight will strike it. The body disappears. Lord Ruthven has been restored.
Inanna Arthen, author of the New England Vampire series (Mortal Touch, The Longer the Fall, All the Shadows of the Rainbow) and owner of the small press By Light Unseen Media, reminds us of another example in vampire literature. "In the penny-dreadful Varney the Vampyre, Lord Varney is unkillable because moonlight will revive him every time he’s killed. He finally flings himself into an erupting volcano to end it all."
There's even an example of a vampire needing moonlight to survive, in “When It was Moonlight,” by Manly Wade Wellman. Arthen tells me that in this 1940 short story, "Edgar Allen Poe meets a vampire who is animated entirely by the moonlight; he defeats her by locking her into a dark windowless cellar where she’s cut off from the light."
Two examples where, in literature -- not folklore, but literature -- vampires appear in full moonlight are Dracula and the legend of the Vampire of Croglin Grange. Again, Arthen, a veritable font of vampire knowledge, tells me, "In Dracula, Jonathan Harker first sees the three vampire women standing in moonlight, and they appear able to almost dissolve into the moonlight and travel along with it. In the allegedly true 'Vampire of Croglin Grange' story reported by August Derleth, the vampire first appears on a brilliant moonlit night."
Probably the strongest reason that we associate the full moon with vampires, though, has nothing to do with these legends. It has everything to do with visual arts. F.W. Murnau, who gave us Nosferatu, the first film adaptation of Dracula, also gave us the idea that vampires are destroyed by sunlight. Vampires in European folklore had no such vulnerability.
But after Nosferatu, the idea of vampires being destroyed by sunlight caught on and became canon. This presented a problem. If your movie scenes can't be set in daylight (because your vampires can't survive in daylight), you need some light to film in, and that light must therefore be moonlight.
In my two vampire novels, Darksome Thirst and The Old Power Returns, the full moon makes an appearance for a different reason. It's the late 1970s and a new coven of trainees has formed. They're taught that psychic power is stronger at the full moon and use that time to practice divination and other magical techniques. Soon they begin to sense something, an evil something.
Using each full moon to strengthen their powers to battle against the evil presence, the coven eventually finds the source.
Yes, the source of the evil is a vampire. Or two.
Special thanks go to Inanna Arthen for her generous sharing of knowledge for this post. If you love vampires, please visit her site at www.bylightunseenmedia.com. | {
"pile_set_name": "Pile-CC"
} |
"Many of the pilots did not know what it was a strategical bombing." "We, as many others, we sign up in them in the Air Force, because we were in war and it had attraction associated with the Air Force." "If it was not obtained to reach the Germans in the plants, it was more easy atingiz them in the proper bed." "E if fell a bomb in old of the street to the side, bad luck." "It has who says that bombings they never gain the war." "I answer that not yet he was attemped." "Soon it will be seen." "The World in War" "Eddy" "Bombing of Germany September of 1939" " April of 1944" "After the Battle of England, the RAF had reasons to celebrate." "The command of the huntings had shown as it was difficult the bombers to destroy a capable country of if defending." "A lesson that the Air Force apparently it had not learned." "Lord Trenchardt had established the RAF as a force of strategical bombers." "The huntings for the defense were secondary." "It was said in years 30, that the bombers long-range they could gain wars, without battles in the ground, that was dispendiosas." "They would bomb industrial heart of the enemy, destroying completely the moral of the civil population." "In 1939, the RAF was not equipped to test this thesis, but after Dunquerque, she was the only one force capable to attack Germany." "E the British people needed desesperadamente of one it has attacked." "The British are constructing a great force of bombers, conceived as one dangerous weapon to jam the heart of Germany." "The first incursions of day they had been disastrous." "The bombers had been imprisoned easy for the Luftwaffe." "Exactly thus, the RAF continued although the losses to be great." "The low weighed ones had forced the bombers to fly of night." "Very well, youngsters, we there go." " It is seeing the same that I?" " You see, Scottish friend?" "Fog, a horrible yellow fog." "For the trained pilots to fly of day, it was difficult to fly at night." "To find a target in Germany in the way of the night, in reasonable atmospheric conditions, it was beyond the capacity of crews of the bombers." "We are in the dutch coast." "Too much fog to see where." "The patriotic films did not have difficulty in giving the impression of that the courage and determination, e a diet of raw carrots, they could surpass the law that says:" ""it is not seen in the dark one"." "I do not obtain to see nothing beyond rain." " I wait that it is not the Danube." " It continues." "Either perhaps capable to catch another thing." "If it obtained to have visual marks for the way, it could be arrived 8 or 10 km of the target." " Open Doors." " It is even." "Clearly that as soon as if it reached the target, was easy." "Bombs plays." "Since that one was only breaking a studio model." " I wait not to have it done to wait." " Clearly that not." "It is felt." "Then, as it was?" "It provoked a great fire, smoke columns, visible the 80 km!" "It says me to what of eggs with bacon?" "The truth was different." "In the truth, at that time, e this was proven, but three bombs in 100 the 8 fell km of the target." "In this dormitory, they had been deceased 9 children and 5 seriously wounds." "The inexact bombings they could be embarrassing." "The Ministry of the German Propaganda he was fast to show the destruction of this hospital of children." "These are the victims of the British assassins, that they had killed, conscientiously, this community." "This was an infamy." "But in the opinion of the Cabinet of War" "Germany had that to be bombed." "E this age the only strategical bombing that Great-Britain could lead ahead." "Coventry and Liverpool had indicated that the German industry would suffer if its workers they were bombed." "Lindemann Professor said Churchill that to dislodge 1/3 of the workers Germans would stop the industrial production." "E had the popular pressure to avenge the Blitz." "We do not ask for favors to the enemy." "We do not ask for repentance to them." "For the opposite." "If today it was asked for to the people of London to vote if it would have to be stipulated the suspension of the bombardeamentos, an smashing majority would say "not"." "We will give to the Germans the same and still more of what they had given in them!" "The Germans were now punishing the British bombers." "In the end of 1941, Great-Britain it had lost 700 airplanes." "The navy and the army demanded bombers for the Atlantic and the desert." "The command of the bombers almost finished." "Taking in account the voluminous losses, the government commanded that the bombings diminished to preserve the division of the bombers." "During the truce, in February of 1942, Sir Arthur Harris commander-head became of the command of the bombers." "It was determined to be successful with new tactics e new bombing." "The Nazistas had entered in the war with the impression in such a way infantile one of that they went to bomb the whole world e that nobody to bomb went them." "In Roterdan, London, Warsaw and 50 other places, they had put this naive theory in practical." "They had sown the wind now and they go spoon the storm." "I played them in the ports German of the north, in the Baltic sea, because, already having made many nocturnal flights," "I repaired that the targets most easy to reach they were of the coast, because some thing is had that of the one to see it is the coast." "If it obtains to see the coast, with its strange forms, the way obtains to see itself until the ports and to recognize them." "Lübeck and Rostock had been first important targets." "Being ports, they were easy to find." "e burnt well." "In March of 1942, 230 bombers they had destroyed half of Lübeck." "In April, Rostock was bombed." "The style was defined:" "nocturnal bombings." "This if would become the standard for the three following years." "He was terrifying; he was indiscriminate;" "but in the opinion of the command of bombers, did not have alternative." "In how many occasions, looking at for the window or taking a walk in the garden, if it obtained to see up to 18 or 20 a thousand feet of altitude?" "Perhaps in two or three days, the maximum." "In how many occasions if it could to guarantee that, seeing itself here so well, if it could see 650 or 800 well km of distance in the other side of the Europe?" "The situation was this." "It did not have possibility of if reaching of continued form white small, until terms it helps navigation electronics, that in it would show these targets to them, in the blackout or through clouds." "The first electronic aid of navigation entered now in service." "Gee was called." "Three radiotransmitters in England they sent an invisible net of signals through the Europe Occidental person." "Monitoring signals e representing them in a map, a navigator could say where it was the airplane." "The Gee was used by first time in the Colony." "Harris sent all the bombers available, in one it has attacked monumental." "In its hands they have the half ones stops to destroy great part of the resources that they keep the enemy effort of war." "They inflict its attack." "If each one of vocês will be successful, they will have brandished the blow more devastador in the vital force of the enemy." "They make right exactly. in the chin." "They send this message to all the groups and position." "It tried to show what if it could to reach with an adequate force." "E that would be reached without great decreases." "The nocturnal hours in Germany of Hitler is gives to be péssimas." "The youngsters of the bombers they know well what they must make." "A calm night, of moonlight;" "it is everything ready and to the wait, of the airplanes to the carrier pigeon." "It seems that they know that probabilities are favorable:" "We go there, youngsters, advance!" "All the day with the RAF." "In all the positions have great airplanes, including Lancasters, the bomber heavy of the moment, ready for this night." "Therefore the night goes to be interesting:" "a night of a thousand bombers." "In this night, 30 of May of 1942, 1046 bombers had taken off route the Colony." "We hear the noise of the bombers e we guess that they were many." "Shortly afterwards, the first ones bombs had fallen." "All we trembled with fear." "Some people had almost fainted." "Many of the sick people cried." "The noise and the explosions they came close each time more." "We think that it was a pandemonio." "Our part of the city was in flames." "The people left running of the bilges and the houses." "Some had been embedded in the destroços." "Others had been handles for buildings that fell." "Many people were in flames e ran all for the side as archotes livings creature." "About 1942, we did not think that it had a so great attack." "We were accustomed the lesser attacks, e when it knew that a thousand bombers attacked Colony, it was incredible." "The moral of the people was very not affected." "It was plus a shock, that finished passing." "The German industry remained capable to recoup, although the Ruhr, the industrial heart, to be attacked during 1942." "The damages had been extensive, but still it had recess in the economy that it could be used in the war production." "The machine of nazista war age good to raise the civil moral." "To measure the speed of 0515 again." "E the Germans also gave, as much how much they received." "The Luftwaffe wise person well the lesson that huntings of the controlled RAF for radar it had taught to them, during the Battle of England." "The head of the aerial defense, general Kammhuber, it created an efficient system." "In all the coast of the Sea of the North it extended a radar net of alert:the Kammhuber Line." "This net was divided in sections." "In each section it waited one hunting, as the spider it waits the fly." "Alcançavamos the airplane for the side, of form that it thought:"It did not see me."" "Exactly thus, still it made piruetas and it balanced." "I inclined a little, stops the artillerymen to be able to see underneath." "I moved myself about 10 degrees in direction to the port and the starboard, during this maneuver, but she was not brusque in no direction." "Later, I went off in this direction e I dived directly, or with. we called to it "Schregenmusik", cannons of 2 cm, we made the same, but we filed underneath and we waited." "We moved in them with calm, to the side one of the other, going off." "Between the engines it had 5 a thousand liters of fuel e this set on fire easily." "The Kammhuber Line and everything what it implied something was frightful with that we were collated, because the German nocturnal defenses they had abated many British airplanes." "But now the RAF already was not alone." "Olá, friends, are the canary seed here for the Hitler." "They come to search it!" "During 1942, the aerial unit of 8º Army of the United States it was increasing in Great-Britain." "The heads of American aviation they believed to be able to attack of day, without suffering the decreases from Great-Britain." "They were vain of whom they could to bomb efficiently of day." "It has that way German to mounts." "Who gives to me to have one things of these to play." "They would not know what to make with this." "They had taken six months learning to press the trigger." " Well, it teaches in them exactly thus." " Very well, friends." "The airplanes of them were very well armed." "Some had up to 12 machine guns e was trained stops to fly in closed formation." "The motto of the aerial unit of 8º it was to fly in closed formation." "Never a thing of these it happened before or later and." "They went making the proper rules to the measure that was necessary, because it was a new concept total." "A power became possible of fire more concentrate, due to position of the artillerymen of all the airplanes." "The fact of if being able to depend of a good closed formation, it not only helped in the defense of one it has attacked of huntings," "as it increased the hypotheses of a good bombing." "Because when it was bombed it was the entire squadron made that it, e the standard was good and open pasture," "e soon the results also they would have to be good." "The first incursions in France they supported the optimism American." "Later, in Germany, history was different." "They had discovered that, at the beginning, bombers aguentavam the huntings e the losses were acceptable, if penetrations were not deep e the bombers kept the formation and if defended." "But, with the time, Germans had also learned." "E thus, had learned as to attack e as to penetrate in the formations." "They had started to attack of front, trying to apanhar the leader e to break the formation, and if they obtained to break the formation, then they could reach the bombers easily." "But it was very early to admit the defeat." "At night, the bombers British had continued its flight, hundreds of each time, but each one for itself." "We saw when them to pass for top of us, to tardinha, in line," "I would not have changed of place with them." "It preferred the formation closed, the fire power, to have that to go as they." "When it was flied with the RAF, he was each one for itself." "After terms last the coast dutch I felt a blow in the face, the windshield arrebentou e I was wounded, in the arm, in the shoulders and the head." "E the airplane uncontrolled momentarily." "Vi reason not to say that it was wounded, so that they did not think:" ""It goes to die at any time."" "The weapon blew up of new in the front of the airplane, to our side, and the bullet reached the arm of the officer to my side," "I was with splinters in the leg that they had pulled out me the skin of the hand." "The elevator had blown up." "It is the helm that keeps the airplane leveled rectum and, of each side of the tail." "E the elevator he had been broken the shot, what it means that had that to pull the stick it stops backwards, everything stops backwards, to keep the straight and leveled airplane." "The navigator also had that to help to push it stops backwards, because my shoulder." "This hand she was weak, had been reached e had that to keep the stick it stops backwards, putting the hands for front." "The officer held it with another hand, of the good arm." "Thus, in set we kept, it stops backwards, to keep the straight and leveled airplane." "E was not a question to go in front." "The truth is that the four engines still functioned." "If one of them had failed, I had thought "we cannot continue"." "Another factor it was that had been turned behind, it had more 600 or 700 airplanes, more or less in the same route, extending itself for 10 the 15 km for the sides, e perhaps with about 4 the 6 a thousand feet," "it had that to capsize front for them e to enter in the way of them to come back." "E more, if had deviated me 90 degrees for prevent them, exactly thus it had that to pass for many." "Later, I observed the target pointer, April the doors of the bombs," "I kept the most steady airplane possible in relation to the target e I remained leveled rectum and." "I find that it was for that that excitement had all, for terms a photograph of the target, in the way of that confusion." "But as soon as we take off the photograph, I capsized I directed and me for the base." "Something of that I remember to feel in this trip in particular, it was that we had that to come back, because wise person that we were wounded." "None of the others obtained to make it, exactly straight and been even, therefore, to fly of night without a helm, with the stick in the belly and without instruments, as were the case, it would have been impossible." "Some had gone off against us times when we return, but we do not come back to be reached." "E we finish arriving at England e vi the searchlights shining." "When aterrisei, the train of landing it broke e we slide of belly about 45 meters." "Later he stopped and I disconnect the engines to prevent the fire." "Then it only knew that the navigator it dies, because it fell to my side." "THE BLOOD CONGEALED, BUT THE BOMBER CONTINUED" "THE SON OF THE BLACKSMITH" "WOUNDED, BOMBED TARGET IN A DESTROYED AIRPLANE" "E GAINED THE CROSS OF THE VICTORY" "How many enemy huntings saw?" "I did not obtain to count all, but at least 65." "I left to count them when I arrived at the 50." "Everybody wise person who the incumbency of combat they were 25 missions, because he would be died in the end of this period." "Therefore, it did not make sensible to ask for to be more time." "The teams of the bombers they lived a curious war:" "one day in action, the day following in the city." "When our group was not flying, generally they went London, they passed the day there e, for times, if still they had money, they telephoned to know if it would have mission in the following day," "e, if did not have, they were in the city." "The antiaircraft artillery goes to be weighed necessary e." "Already they had passed for worse situation." "They remember that its worse enemy is the single-engine hunting." "I remember a night, in the club of the officers, our officer of operations was spilling whiskey in a machine, one of those where if it puts 25 cents, trying to convince it to give the prize." "We tried to live the life optimum possible." "The things go to be hard." "They have to put the neck there, to be there and to mark." "All vocês." "I find that to fly is so impersonal, that is the combat flights, that feeling is not had the same of loss when an airplane is abated, that it would be had when it is in the battlefield" "e the friend to our side is died." "Young had come of Great-Britain, of America, the busy Europe e of the Commonwealth to fight and to die in the offensive one of aviation more determined until then." "In January of 1943, in Casablanca," "The Churchills and the Roosevelts had combined efforts of the bombers, in the preparation of the Europe Nazista for Day D." "Dock berths of submarines." "plants of airplanes." "armament plants." "oil refineries." "e transports was white with priority for the bombings of precision." "But the bombing of precision at night it was impossible for Harris." "The attempt to blow up barrages of the Ruhr with bombs special it had partial success and only it cost the life several of the best pilots." "Although the incursion to have led to a bigger precision, nor all the levees they had been reached." "The production of weapons of the Ruhr it was not affected." "Harris thought that only the increasing onslaught of the nocturnal bombings it would go to jam the capacity German industrial." "At this time we had airplanes better, it had much Lancaster." "We were finishing with the Stirling e Halifax, less efficient." "We had radar equipment better, e we had excellent navigators, chosen teams, e this age the essence of that." "These navigators were capable to arrive more close to the targets of what previously." "Later, we launched rockets, hundreds of rockets, same e that we errássemos the target, we could identify some very important things in the ground, as lakes or curves in the river." "E from there, we could arrive at the target e to launch rockets of diverse colors." "E, later, we had target pointers that were." "a cluster enormous of grapes imagines incandescent, falling the 2 or 4 a thousand feet, where it wants that we wanted to detonate them." "In the end of July of 1943," "Harris deflagrou the improved technology with effect devastadores, in Hamburg." "The efficiency of the first incursion in Hamburg it had, finally, terms permission to use something that we had has much time, e that was known as "window"," "that it consisted of launching clouds of aluminum leaf ribbons, that they not only harmed the devices of German localization, but also its antiaircraft ones." "None of us, civilians or firemen, he knew what he transferred himself in this night." "It was an incursion very weighed, but we had had almost the same one year before." "We were not prepared for the fire storm that half hour blew up after the incursion." "The bombing, combined with the wave of heat of the Summer, a Tornado of flames would create, a fire storm." "I was for an area at the beginning of the dock berths." "She was crossed for canals." "The people tried to jump for there to run away to the fire, but the also ardia water." "It is difficult to explain because the water was in flames." "It had many boats, small, that they came alongside in the canals." "They had blown up and the oil catching fire had IDO to stop in the water." "E the people, also in flames, they jumped for there, e. and ardiam." "They swam, they ardiam and they sank." "The majority of the people died had to the insuportável heat." "Not burnt, suffocated or intoxicadas for carbon monoxide." "We think that, in some places, the temperature it reached a thousand centigrade degrees." "The nocturnal British attacks e the American incursions diurnas they had lasted one week almost." "died 30 a thousand." "In Hamburg we discover for the first time, that the moral of the German people it could so be destroyed that the work in the industry, in armament industry, would go to fall down." "At the time, Speer said that more 6 incursions of these and the war finished." "The Allies not they had had this capacity." "The shock passed." "At the same time, the unit aerial of 8º Army it increased the power of the incursions diurnas against necessary targets." "This group will go to bomb of an altitude of 13 a thousand feet." "We find that low the altitude will be compensated for the element surprise." "Two weeks after Hamburg, they planned the final blow against the German industry." "Light, please." "This group of buildings is the target." "This will be the target." "If the bombing if to concentrate in this area, it must destroy the plant." "The target was the production plants of rolamentos in Schweinfurt, that they supplied most of the necessities of Germany." "The offensive force it would be divided in two." "The first wave would go for a secondary target, the plant of Messerschmidts in Regensburg." "Later, it would continue without barriers northward of Africa." "The second wave, 10 minutes after the first one, the Schweinfurt would arrive while the huntings German replenished." "Its battle would be in the return for house." "We enter, I we entered without escort of huntings e I crossed the Europe without escort of huntings, with about 125 airplanes that they were in the division, at the time." "Haunted, the antiaircraft German she traced the way of the first wave, when it passed, penetrating in Germany." "They did not know that plan was going badly." "The British time helped to ruin the careful plan of the Americans." "Unexpected low clouds they had delayed the take-off of 2ª wave." "Result:the Luftwaffe, replenished and with new weapons, it was to the wait of it." "We did not wait an attack so inside of the country without escort of huntings, e we are very frightened." "Schweinfurt resulted of conditions favorable to the huntings German e of the fact to be able to bring all the huntings for the combat, to intercept the bombers;" "everything this favored our results." "21 flying ortalezas if had lost before falling the first bomb in Schweinfurt." "1ª division, that arrived later, it more had the weighed decreases, because they had had that to come back, after already having entered." "I find that we finish the day losing about 60 airplanes, thing that did not cheer nobody." "The cost was high." "the production of rolamentos was interrupted during six weeks." "When vocês they had attacked Schweinfurt, at the beginning, it was a nightmare to exceed this." "But later I had one very good representative, Kessler, e it made everything, not only the repair, but also it substituted rolamentos for other parts that also they served;" "they were not so good, but they served." "In the attack of the two waves, 120 airplanes had been lost more than or they had been damaged without I fix." "To show that they had reason in Schweinfurt, the Americans would have that to come back." "Of course, I was disappointed, to a large extent because, ordering my crews for there, wise person that would suffer decreases you add, e if we had made a good one work, these would be prevented." "But nobody always makes right in the target." "We come back there because we had a period of good time e because it was our target of bigger priority." "Therefore we come back." "In day 14 of October, it had surrounds of 300 bombers in England." "England had airplanes for all, it seemed an airport." "E this very difficult age." "It took some time to group bombers in closed formation." "These complicated maneuvers they alerted the Luftwaffe on the power and the direction of an attack force." "Two terços of the huntings German they were concentrated against the aerial unit of 8º." "The pilot of the hunting was the animal papão." "The hunting had eyes e, in many aspects," "it had a competent man in the command e when it concentrated itself in us, we had many times problems." "I was so close that he could see the artilleryman of the rear, e I saw scared it so as." "They communicated the position of the huntings for the intercom." "For times, they scared as much that they continued holding the microphone e crying out for it." "They had started a thousand meters, with the almost continuous shots it stops scaring in them." "E I said my pilots more new, that they did not have experience, to close the eyes when they attacked for backwards." "It did not have much time to think." "it was pointed weapon with respect to they, it was always looked at for all sides to the search of enemy huntings e we keep the weapons pointed with respect to them." " Navigating, as it is this?" " Well." "We go there." "The worse part of the incursion was exactly before if reaching the target." "We were folloied by huntings that they took in them until the white o e they later went even so e we launched the bombs." "To follow, they folloied in them after the target." "In Schweinfurt, more was destroyed of 60% of the production of rolamentos." "The Americans had lost 60 flying ortalezas." "If vocês they had repeated the incursions shortly afterwards e in had not given time to them to reconstruct, the result would have been disastrous." "We could accept the decreases that we suffer without knowing if we went or not to obtain, when we thought that rolamentos came of Sweden, possibly through Switzerland?" "If it is not known, not if they continue these things." "Thus, the strategy was turned aside from individual targets as Schweinfurt, for another offensive nocturnal one:" "Berlin." "With the American support, Harris thought to be able to destroy Berlin in six months e to gain the war." "But the weakened aerial unit of 8º it could not be joined it." "It sent the signals most amazing." "One that I always remember, e is the type of thing that if reads to the crews in the meetings, it said the following one:" ""This night goes to the great city", that is, Berlin." "They have the chance to light a fogueira in the belly of the enemy e of it to burn the black heart." "The crews, after to applaud a thing of these, they did not want an airplane." "If they fulled its pockets of bombs and they indicated Berlin, they would go alone." "The command of bombers it had that to continue alone." "It was very far and the time, in the end of 1943, were particularly bad." "But all the nights, the bombers went Berlin e to other cities in the interior of Germany." "The crews of Harris they had made terrible estragos." "Berlin is living true total war." "The incredible weight of the attack of the RAF in the capital of the nazista country it made the Huno to cambalear." "As it must be repented of impious attacks Warsaw," "Roterdã, Belgrade, London, Coventry and to all the others." "The day and the night of adjustment of accounts arrived." "What he finds of this, Keith?" "I find that, of this time, the Germans they had suffered well." "We make right in full." "However, many of the offices e plants of Berlin they had obtained to continue working." "The experience that I have is that the people had been insensitive." "They covered the streets as shades, but still they worked as automatons." "We did not have difficulty in arriving there, but I repaired that each German city makes fire antiaircraft indiscriminately." "The technological advantages that they had prevailed in Hamburg already they were not applied." "The German antiaircraft defense, one more time, it was had in advance." "Berlin seemed that it would go to remain Berlin." "At the beginning of the Spring of 1944, Harris had not destroyed the city." "The command of bombers had been well damaged for the Germans." "In the four months of incursions against Berlin and other targets, a thousand airplanes had been lost, the force of first line of the command." "But Harris did not yield, nor it yields, the defeat." "The decreases in the Battle of Berlin not they had been more than what the ones that we would have if we had IDO to another place in the interior of Germany." "The people seem to forget themselves that the command of bombers it fought a thousand battles during the war:" "if it cannot have success in all." "I do not say that the Battle of Berlin it was a defeat, or something seemed." "I think that it was a great aid for the defeat of Germany." "It had thousand of cannons antiaircraft weighed, ammunition millions for them e hundreds of thousand of soldiers that they had been deviated of the fight in the front of the east." "Therefore, I must say that with the aerial attacks to Germany at the beginning of 1943, we had, in the truth, one second front." "Although the devastação, the Germans had followed in front." "The German industry continued to supply to the armies that they fought fierce in the East and Italy." "The thesis of the strategical bombing it remained to prove." "The lições of Schweinfurt had been learned well for the Americans." "Reequipped, the RAF had been joined it against Berlin, in March of 1944." "But now they were escorted for the Mustang, an extraordinary airplane, that it would change everything." "It had the reach of a bomber e the performance of one hunts." "The German diurne hunting had found an adversary to the height." "In the end of the Spring of 1944, the German hunting had lost space for the Spitfire and the Hurricane." "The Americans, finally, they had looser the Luftwaffe in the Europe, during the day, with the huntings long-range." "We did not have nothing of sort the same e I find that they in they had scared sufficiently." "The main concern was the amount with that they appeared." "The Germans had lost the control of the diurne airspace." "Now, the Allies could launch incursions diurnas when they wanted." "But, in March of 1944, both the forces of bombers they had been placed under the command of Eisenhower, to prepare Day D." "It would have a truce of six months, before the bombers allies to be able to come back to fly, one more time, to break the will of the German people." | {
"pile_set_name": "OpenSubtitles"
} |
Western diet in ApoE-LDLR double-deficient mouse model of atherosclerosis leads to hepatic steatosis, fibrosis, and tumorigenesis.
Nonalcoholic fatty liver disease has been linked to cardiovascular diseases and atherosclerosis. The aim of the current study was to characterize the hepatic pathology leading to fibrosis and tumors in a murine model of atherosclerosis. Male apolipoprotein E/low-density lipoprotein receptor double-knockout mice (AL) mice were fed with a high fat and high cholesterol western diet for 35 weeks (AL mice on WD). Protein and mRNA analysis as well as micro-computed tomography (micro-CT) were performed to assess oxidative stress, liver damage, inflammation, fibrosis, signaling pathways, vascularization, and tumorigenesis. Controls were chosen to distinguish between genetically and dietary effects in steatohepatitis and associated tumorigenesis. Hepatic inflammation and dyslipidemia were increased in AL mice on WD compared with wild-type mice on WD. Uniquely, AL mice on WD showed a spontaneous development of tumors (30% of cases) and thickening of intrahepatic vessel walls. Functionally relevant underlying signaling pathways such as NF-κB, Stat3, JNK, and AKT were differentially regulated between AL and wild-type mice on WD. Micro-CT was capable of visualizing and quantitatively distinguishing tumor neovascularization from vascularization in non-neoplastic liver tissue. AL mice on WD diet represent a novel model combining atherosclerosis and nonalcoholic fatty liver disease. Signaling pathways of liver cell damage and compensatory liver regeneration in combination with enhanced inflammation appear to be crucial for the spontaneous development of tumors in AL mice on WD. Micro-CT represents a new and powerful technique for the ultrastructural and three-dimensional assessment of the vascular architecture of liver tumors. | {
"pile_set_name": "PubMed Abstracts"
} |
rem -----------------------------------------------------------------------
rem URL: http://www.orafaq.com/scripts/plsql/hex2dec.txt
rem Filename: hex2dec.sql
rem Purpose: Functions to convert Hex to Decimal and vice versa
rem Author: Mark Malakanov, Feb-1999 + Anonymous
rem -----------------------------------------------------------------------
CREATE OR REPLACE FUNCTION hex2dec (hexnum in char) RETURN number IS
i number;
digits number;
result number := 0;
current_digit char(1);
current_digit_dec number;
BEGIN
digits := length(hexnum);
for i in 1..digits loop
current_digit := SUBSTR(hexnum, i, 1);
if current_digit in ('A','B','C','D','E','F') then
current_digit_dec := ascii(current_digit) - ascii('A') + 10;
else
current_digit_dec := to_number(current_digit);
end if;
result := (result * 16) + current_digit_dec;
end loop;
return result;
END hex2dec;
/
show errors
CREATE OR REPLACE FUNCTION num2hex (N in number) RETURN varchar2 IS
H varchar2(64) :='';
N2 integer := N;
BEGIN
loop
select rawtohex(chr(N2))||H
into H
from dual;
N2 := trunc(N2 / 256);
exit when N2=0;
end loop;
return H;
END num2hex;
/
show errors
-- Examples:
select hex2dec('FF') from dual;
select num2hex(10) from dual;
| {
"pile_set_name": "Github"
} |
The Story of this Striped T! New From My Closet
What you seek is seeking you!
No! It’s not some life goals post designed around a striped T, but I quoted these infamous words for encouraging you to keep running after what you really want; because you are an unapologetically obsessive soul and I am proud of you!
I can’t remember for how long I had been looking for a perfect stripped T, looked around online stores, visited the malls, and gave all the rights to my friends to spam my social media feeds whenever they spot one. So it happened last month when I stumbled upon this chic T at Outfitters, and so wanted to share my happiness with you.
I spotted it at Dolmen mall Clifton outfitters in black stripes, asked for a small size which of course was already out of stock! Knew it! The good ones for me are always taken *talking about the Tshirt here*. Mumbling a few curses I headed out and thought of checking it at Outfitter’s store at Tariq Road. The small size was available but only in teal! Hence, I compromised on the color and got back home with it!
Now, let’s talk about the shirt!
It’s a very soft and comfortable linen shirt! The cool, quirky phrase “Out of order” was something that specially made me pick it, because maybe I can relate to it in a few ways. Let’s talk about it some other day. The only downside is I have to wear a slip inside it as the fabric is a bit light! In any case, it’s meant for the hot, sultry Karachi summers so I am fine with this little inconvenience. The phrase is embossed in different colors and looks quite funky. A pair of jeans is perfect to go with it and I also tried pairing it with caprice, but it didn’t look really fancy, so I am sticking with denims here!
That was the short, trivial, not so exciting account of this shirt, I don’t even regret wasting your time, and I will continue doing it! Have a happy weekend!
Hina is the founder and editor of Hashtagged-a lifestyle blog. She also runs a virtual management agency "The Virtual Nut" that provide digital marketing solutions to businesses. By heart, she is a digital content and fashion enthusiast, writer, social media nut, animal’s rights activist, a serial game of thrones lover, movie, ads and media junkie, mom to countless cats and yet more to come! She can be reached at hina.ilyas4@gmail.com | {
"pile_set_name": "Pile-CC"
} |
UX Designers vs Web Designers | Visual.ly
Pin enviado desde
Mapping the Journey – Experience Beyond the Screen. THE CHALLENGE: How do we use our design skills to help organizations understand the experiences and interactions beyond the screen? A journey map describes the journey of a user by representing the different touch points that characterize interaction with the service. | {
"pile_set_name": "Pile-CC"
} |
Q:
Pass method calls to object
I am trying to create a custom swipe gesture recognizer to set allowed angles and distances.
So far it works really well but needs a lot of code in the view controller. So my question is wether it is possible to somehow pass a method call like:
- (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event
in the view controller to my gesture recogniser object so that I don't have to write something like this
- (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event
{
[self.swipeGestureRecognizer touchesBegan:touches withEvent:event];
}
into my view controller. I think the build in UIGestureRecognizer does this somehow but I could not figure out how it works.
I really would appreciate your help.
[EDIT]
Generic example: I have an object A which creates an object B. A has a method c that gets called sometimes. What I want to achieve is that a method d of B gets called when c in A gets called. So to somehow forward or pass this method call.
Specific example: The following method gets called in my view controller every time there is a touch on the screen:
- (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event
but I actually want my GestureRecognizer object to process this information so I have the same method in my GestureRecognizer object and I want this method to get called every time the counterpart in the view controller gets called.
A:
Sub class UIGestureRecognizer and create a class called CustomGestureRecognizer.
Its .m file will look like this
@implementation CustomGestureRecognizer
- (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event {
// do your code here
}
@end
Some where in the subclass you have to change the state of the recognizer to
UIGestureRecognizerStateRecognized
when the current gesture is registered, else change to
UIGestureRecognizerStateFailed
.
Now in the view controller where you want to use this recognizer do :
CustomGestureRecognizer * recognizer = [[CustomGestureRecognizer alloc] initWithTarget:self action:@selector(handleChange:)];
recognizer.delegate = self;
[self.view addGestureRecognizer:recognizer];
Detailed explanation is given here Apple doc, under subclassing.
| {
"pile_set_name": "StackExchange"
} |
[A meta-analysis of surgery treatment of chronic pancreatitis with an inflammatory mass in the head of pancreas: duodenum-preserving pancreatic head resection versus pancreatoduodenectomy].
To compare the safety and effectiveness of DPPHR with PPPD/PD for treating chronic pancreatitis with an inflammatory mass in the head of pancreas. The relative data bases such as Medline, EMBase, Biosis, COCHRANE Library, Science Citation Index, SinoMed, Chinese Journal Full-text Database, Wangfang, CNKI were searched systematically, researchers selected randomized controlled trials (RCT) and prospective clinical controlled trials (CCT) . The assessment of the bias risk of the included trials was according to the assessing tools suggested by Cochrane Handbook 5.1. The Review Manage 5.2 was used to perform the statistical analysis. In total, 5 RCTs and 2 CCTs were included, 381 patients involved. Comparing with PPPD/PD procedure, DPPHR has no significant difference in terms of the mortality of perioperative period (RD = 0.01, P = 0.51), the incidence of bleeding (RD = -0.01, P = 0.72), pancreatic fistula(RD = -0.01, P = 0.59) and delayed gastric emptying (RD = -0.15, P = 0.10), the ration of complete pain relief after operation (RR = 1.06, P = 0.32) and the score of global quality of life (WMD = 10.31, P = 0.19).While DPPHR had significant superiorities in terms of the total morbidity of perioperative period (RR = 0.60, P = 0.008), the duration of the operations(WMD = -71.60, P = 0.03), the postoperative hospitalization duration(WMD = -3.95, P < 0.01), weight gain(WMD = 3.68, P < 0.01), occupational rehabilitation after the operations (RR = 1.38, P = 0.008). In terms of reducing the morbidity of perioperative period, shortening the duration of the operations and the postoperative hospitalization duration, weight gain, occupational rehabilitation after the operations, the DPPHR is more favorable for improving patients' life qualities comparing with PPPD/PD. | {
"pile_set_name": "PubMed Abstracts"
} |
Please reserve a conference room for up to 7 people for 1 hour on Wednesday,
April 12th around 2:30pm.
thanks | {
"pile_set_name": "Enron Emails"
} |
ARTISTS /
contact:
biography
Born in Tokyo. Studied in the Conducting Department at the Tokyo College of Music. Won the first Kondrashin International Conducting Competition in Amsterdam in September 1984 at age 26.
Following upon this success, he went on to conduct the National French Orchestra, the Berlin Radio Symphony Orchestra, the Royal Concertgebouw Orchestra, the Montreal Symphony Orchestra, the Israel Philharmonic Orchestra, the London Symphony Orchestra and the Vienna Symphony Orchestra. Between 1991 and 1995 he led the Norrkoping Symphony Orchestra, the Limburg Symphony Orchestra and the Royal Liverpool Philharmonic Orchestra, and in 1994 he brought the Norrkoping Symphony Orchestra to Japan. From 1991 to 2000, he was Chief Conductor of the Japan Philharmonic Orchestra, during which time the group toured Europe in 1996, as well as delivering many fresh and magnificent performances of pieces such as Richard Strauss' Ein Heldenblen and the symphonies of Haydn.
In recent years, he has been a guest conductor of orchestras which include the Vancouver Symphony Orchestra, L'Orchestra Sinfonica di Milano Giuseppe Verdi, the Orchestra della Svizzera italiana, the Saint Petersburg Philharmonic Orchestra, the Baltimore Symphony Orchestra, the Cincinnati Symphony Orchestra, the Calgary Philharmonic Orchestra, the Stavanger Symphony Orchestra, Gewandhausorchester Leipzig, the Polish National Radio Symphony Orchestra, the Slovenian Philharmonic Orchestra, the Bilbao Symphony Orchestra, and the Sao Paulo State Symphony. He was Music Director of the Columbus Symphony Orchestra from 2006 to 2008, bringing fantastic soloists like Yo-Yo Ma and Midori to perform.
In 2007 he was invited to Saito Kinen Festival Matsumoto where he conducted Haydn and Rachmaninoff. He also received great acclaim for his appearance with the Mito Chamber Orchestra, where he replaced Seiji Ozawa at the last minute and led the group in a program centered on Mozart and Beethoven.
He is prolific in opera as well, having led celebrated performances in 1989 and 1990 of Un ballo in maschera and Rigoletto at the the Sydney Opera House, and his most recent triumphs include La traviata at the Fujiwara Opera, and Orfeo ed Euridice at the Nissay Theatre. In February 2011, he made his debut at the New National Theatre conducting La traviata.
Since April 2008, he has served as Chief Conductor of the Kyoto Symphony Orchestra.
March 2015 - Not to be altered without permission. Please contact us if this biography is out of date or if you need a reduced version. | {
"pile_set_name": "Pile-CC"
} |
Asked about Bitcoin last week, economics Nobel laureate and Columbia University professor Joseph Stiglitz said, among other gems, “It ought to be outlawed. It doesn’t serve any socially useful function.”
His views have been widely panned by supporters of cryptocurrency, of course, and this post will be another example.
Stiglitz’s statement illustrates a subtle but very important slippage in the function of economics and economists, from students of human action to dictators of human behavior. The slip happens with concepts like “utility” or, as Stiglitz says, “socially useful function.”
Things are useful if they promote certain ends, and they are not useful if they don’t. The question is always what the ends are. Sometimes, economists switch from embracing the ends people seek, as exhibited by their actions, and they adopt a different set of ends.
It’s understandable when economists do that, because each person’s ends are their own to decide—they’re often known only to themselves, and sometimes they’re not known at all. Economists tend to aggregate real humans’ ends into things that are easily measured.
Gross Domestic Product is an example. Most people want to be, or have to be, productive in order to pay for things they want. So GDP is a decent measure of people’s success with pursuing their ends.
But what happens when “leisure” comes along as a suitable aim for many people? Suddenly, a slowdown in GDP growth might signal that people are getting what they want. Most economists reflexively treat it like it’s bad. But it’s less and less clear that it is.
Economists or economic thinkers can get things wrong other ways. They can steer utility toward group rights and against individual liberty. They can model human behavior badly, undercutting political outcomes they might prefer. The opportunities for error grow with the things economists claim to know.
So it is with Stiglitz, who seems certain about Bitcoin’s lacking “social utility,” even while people buy and hold enough to make it a top-20 global currency. There may be some over-enthusiasm, of course, but people around the world see hundreds of billions of dollars’ worth of present and potential value in Bitcoin and cryptocurrency. Who are you going to believe, Mr. Stiglitz, “socially useful,” or the actual society around you?
There’s little likelihood that Stiglitz and others in elite positions will absorb these ideas and approach Bitcoin with renewed humility and open-mindedness. Rather, seeing society’s interests as they define them, they will regard Bitcoin as a threat. They will move against it, possibly even trying to outlaw Bitcoin as Stiglitz suggests.
That’s why it’s so important for new holders of Bitcoin take actual control of it.
Many people who have recently purchased Bitcoin leave it with services like Coinbase. That company has shown a laudable willingness to defend its customers, such as from the IRS’ dragnet effort to collect its users’ data. (We participated in that dispute as a friend of the court.) But centralized services like Coinbase are where the government will go if and when the time comes to grab the Bitcoin.
It’s often said in the Bitcoin community that you don’t own your bitcoins if you don’t control your keys. That refers to the private key in the public-private key pairs that make Bitcoin work. You don’t have to be a cryptographer to do that, but it does take a little time and effort.
I don’t recommend large investments in Bitcoin, and one should only invest funds in cryptocurrency that they would be comfortable losing entirely. But if you have any serious quantity of Bitcoin, you should secure it against seizure from a third-party service by taking control of it yourself.
The best way to do that is to use a hardware wallet, such as Trezor or Ledger. These are specially designed devices for storing the private keys to Bitcoin and other cryptocurrencies. A hardware wallet is like a Bitcoin safe because it protects the codes that control your Bitcoin. When your Bitcoin is stored on a hardware wallet, it is truly in your control. Someone trying to seize it has to find you or your wallet and your codes in order to get it. (Likewise, if you lose a hardware wallet and the recovery “seed” used to create the private keys in it, you lose your Bitcoin.)
It’s a fascinating new world of personal responsibility for those who care to live it. It’s not guaranteed that the careless talk of Joseph Stiglitz won’t turn into careless and wrongheaded action by government officials. So it’s a good time to secure yourself from the depredations of economists who’ve lost their way and no longer serve any socially useful function. | {
"pile_set_name": "OpenWebText2"
} |
Dementia is a syndrome that can be caused by a number of progressive disorders that affect memory, thinking, behavior and the ability to perform everyday activities. About 36 million people worldwide are suffering from dementia today. The number of people with dementia is projected to double by 2030, and more than triple to 115.4 million people by 2050. Alzheimer's disease (AD) is the most common type of dementia. Currently, one in nine people age 65 and older (11 percent) and nearly half of those over age 85 have Alzheimer's disease. According to Alzheimer's Disease International, current global costs of caring for these patients exceeds $600 billion annually. These costs are likely to rise even faster than the prevalence of disease, especially in the developing world, as more formal social care systems emerge, and rising incomes lead to higher opportunity costs (B. Winblad and L. Jonsson, World Alzheimer Report 2010).
The brains of AD patients have an abundance of two abnormal structures, amyloid plaques and neurofibrillary tangles. This is especially true in certain regions of the brain that are important in memory. There is also a substantial loss of neurons and synapses in the cerebral cortex and certain subcortical regions. Both neurofibrillary tangles and neuronal loss increase in parallel with the duration and severity of illness (T. Gomez-Isla et al., Ann. Neurol. 1997; 41:17-24) and neurofibrillary load has been shown to correlate with cognitive decline (H. Braak and E. Braak, Neurobiol. Aging 1997 July-August; 18(4):351-7).
Neurofibrillary tangles are intraneuronal lesions that are composed of hyperphosphorylated and insoluble accumulations of the microtubule-associated protein, tau. These accumulations are a histopathological feature of many neurodegenerative diseases, which are collectively known as tauopathies. Tauopathies include, e.g., Alzheimer's disease (AD), Pick's disease (PiD), progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), and frontotemporal lobar degeneration (FTLD). In human tauopathies, pathology progresses from one brain region to another in disease-specific patterns (H. Braak and E. Braak, Neurobiol. Aging 1997 July-August; 18(4):351-7; Raj et al., Neuron. 2012; 73:1204-1215; Seeley et al., Neuron. 2009; 62:42-52; and Zhou et al. Neuron. 2012; 73:1216-1227), the underlying mechanism of which is not yet clear.
Tau pathology is involved in and may be a cause of many tauopathies. In its normal form, tau is a highly soluble microtubule-associated protein (Jeganathan et al., Biochemistry 2008, 47:10526-10539) that binds and promotes the assembly of microtubules (Drechsel et al., Mol. Biol. Cell. 1992, 3:1141-1154). However, in tauopathies, tau becomes hyperphosphorylated, causing detachment from microtubules, and ultimately accumulation as neurofibrillary tangles that are visualized within dystrophic neurites and cell bodies (Mandelkow and Mandelkow, Cold Spring Harbor, Perspect. Med. 2, 2012: a006247). The amount of tau pathology correlates with progressive neuronal dysfunction, synaptic loss, and functional decline in humans and transgenic mouse models (Arriagada et al., Neurology 1992 March; 42(3 Pt 1):631-9; Bancher et al., Neurosci. Lett. 1993, 162:179-182; Polydoro et al., J. Neuroscience 2009, 29:10741-10749; and Small and Duff, Neuron. 2008 Nov. 26; 60(4):534-42). While there have been no tau mutations observed in Alzheimer's disease, mutations in the tau gene appear to cause some forms of frontotemporal dementia (Cairns et al., Am. J. Pathol. 2007, 171:227-40), presenting with tau-positive inclusions and signifying that tau dysfunction is sufficient to cause neurodegeneration. Moreover, pathological tau appears to be an integral part of Aβ-induced neurotoxicity in cell culture and transgenic animal models (M. Rapoport, PNAS 2002, 99:9, 6364-6369; E. D. Roberson et al., Science 2007, 316:750-754; A. M. Nicholson and A. Ferreira, J. Neurosci. 2009, 29:4640-4651; H. Oakley, J. Neurosci. 2006, 26(40):10129-10140).
Passive and active immunizations against tau have been analyzed in mice using several different mouse models, including different phospho-tau peptides for active immunizations and anti-tau antibodies for passive immunotherapy (A. A. Asuni et al., J. Neurosci. 2007, 27(34):9115-9129; E. M. Sigurdsson, Curr. Alzheimer Res. 2009, 6(5):446-450; A. Boutajangout et al., J. Neurosci. 2010, 30(49):16559-16566; H. Rosenmann et al., Arch. Neurol. 2006, 63(10):1459-1467; M. Boimel et al., Exp. Neurol. 2010, 224(2):472-485). In the first report describing immunizations with a 30-amino acid phosphorylated tau peptide, an effect on the ratios of soluble and insoluble tau, reduction of tangle formation in the immunized mice, and functional benefits observed in behavior testing for these mice were shown (A. Boutajangout et al., J. Neuroscience 2010, 30:16559-16566). Passive immunization with well-characterized anti-tau antibodies, which react with phosphorylated Ser396 and Ser404 of the hyperphosphorylated tau protein at an early pathologic conformational epitope on tau, confirmed the results seen in active immunization studies. Mice treated with these antibodies showed marked reductions in tau pathology, which was measured by biochemical methods and histology, as well as a significant delay in loss of motor-function decline that was assessed in behavioral testing (A. Boutajangout et al., J. Neurochem. 2011, 118(4):658-667; X. Chai et al., J. Biol. Chem. 2011, 286(39):34457-34467).
Tau-based therapies have only been analyzed in mouse models to date. But in view of the severity of tauopathies in general, and to the cost to society of Alzheimer's disease specifically, there is an ongoing need for effective means to diagnose, monitor, prevent and treat tauopathies. | {
"pile_set_name": "USPTO Backgrounds"
} |
Mamillisphaeria
Mamillisphaeria is a genus of fungi in the family Melanommataceae; according to the 2007 Outline of Ascomycota, the placement in this family is uncertain.
References
Category:Melanommataceae | {
"pile_set_name": "Wikipedia (en)"
} |
Haddam Island State Park
Haddam Island State Park is an undeveloped island in the lower Connecticut River in the town of Haddam, Connecticut, in the United States. Originally used by the Wangunk tribe, the island was reserved for their use as part of a land sale to English colonists in May 1662. In the 19th century, the island was used for fishing and farming. The early 20th century saw it as a place of public recreation, and the State of Connecticut purchased the island and made it a state park in 1944. The park is only accessible by boat, and recommended activities are boating, fishing, and birdwatching.
History
The English settlers in the Connecticut Colony originally named the island Thirty Mile Island because it was erroneously believed to be north of the Connecticut River's mouth. The original English settlement in the area was called Thirty Mile Island Plantation. In May 1662, an area of of land, including the island, was sold by the Wangunk tribe to the English settlers for 30 coats. However, the natives reserved the right to use the island as part of the sale stipulations. Though little documentation exists today, the Wangunk tribe lived on the island and in the surrounding area before selling it along with the rest of their land. Recorded deeds show that the Wangunk tribe made another land sale in 1672, and the remaining parcels of Wangunk land were sold between 1765 and 1769.
At the close of the 18th century, the island was one of the most important fishing locations on the Connecticut River. By 1819, the island was listed as in area and was expected to increase in size following the construction of a pier 90 rods north of the island, which caused the accumulation of sand at the head of the island. The island is currently listed as in size. In the 19th century, two fishing companies operated from the island and constructed piers, and the island was also used for grazing cattle and farming corn. Records in the late 19th century indicate that the Haddam Island area of the Connecticut River was dredged annually. The island became a popular recreational area with picnics and private events in the beginning of the 20th century. The island was purchased by the State of Connecticut in 1944, and it became a state park. According to legend, Captain Kidd buried some of his treasure on the island, but none has been found.
Activities
Haddam Island State Park is home to a large number of bird species, especially during annual migrations, which make it suitable for birdwatching. Bird-banding and other research activities have taken place on the island. Other recommended activities are boating and fishing. Access via boat is available from the Haddam Meadows State Park boat launch, a half mile south of Haddam Island. The northern side of the island has a beach that is fragile and cannot support heavy visitation, and the island has a significant amount of poison ivy.
References
External links
Haddam Island State Park, Connecticut Department of Energy and Environmental Protection
Photo of the island in 1877 in Haddam, 1870-1930
Category:State parks of Connecticut
Category:Parks in Middlesex County, Connecticut
Category:Protected areas established in 1944
Category:1944 establishments in Connecticut
Category:Connecticut River
Category:River islands of Connecticut
Category:Haddam, Connecticut | {
"pile_set_name": "Wikipedia (en)"
} |
Campsited @ Collision 2015
Tuesday May 5, 2015
(00:13:04)
Video
Episode Tease
While some people may prefer a hotel room and air-conditioning on a vacation, others prefer a view of a stream or forest. For the latter, booking camp sites can be a real pain, especially if you want to do it on your schedule online. A comprehensive list of camp sites with the ability to research, compare and book does not exist.
That is, until now. Campsited is here to make the process of finding and booking a site with your specific amenities, or none at all, possible. Started in Ireland to help solve the founder's personal pain, the company is now looking to expand to help others in Europe find and book these same types of experiences.
The site is available now in Ireland, with other European countries coming soon. | {
"pile_set_name": "Pile-CC"
} |
Witness the beautiful fabric woven by traditional weavers in Toraja, Indonesia, and learn how their collective is working to bring economic independence to the weavers while preserving weaving as part of their cultural heritage. The social enterprise, Torajamelo, transforms the lives of these weavers, offering scholarships for their children and grandchildren and health insurance for themselves and their families so that they can continue making their beautiful creations while still caring for their families and farms. | {
"pile_set_name": "OpenWebText2"
} |
The Genetics of Warfarin Dose-Response Variability in Africans: An Expert Perspective on Past, Present, and Future.
Coumarins such as warfarin are prescribed for prevention and treatment of thromboembolic disorders. Warfarin remains the most widely prescribed and an anticoagulant of choice in Africa. Warfarin use is, however, limited by interindividual variability in pharmacokinetics and a narrow therapeutic index. The difference in patients' pharmacodynamic responses to warfarin has been attributed to genetic variation in warfarin metabolism and molecular targets (e.g., CYP2C9 and VKORC1) and host-environment interactions. This expert review offers a synthesis of human genetics studies in Africans with respect to pharmacogenetics-informed warfarin dosing. We identify areas that need future research attention or could benefit from harnessing existing pharmacogenetics knowledge toward rational and optimal therapeutics with warfarin in African patients. A literature search was conducted until January 2019. A total of 343 articles were retrieved from nine African countries: Botswana, Ethiopia, Egypt, Ghana, Kenya, South Africa, Sudan, Tanzania, and Mozambique. We found 19 studies on genetics of warfarin treatment specifically among Africans. Genes examined included CYP2C9, VKORC1, CYP4F2, APOE, CALU, GGCX, and EPHX1. CYP2C9*2 and *3 alleles were highly frequent among Egyptians, while rare in other African populations. CYP2C9*5, *8, *9, and *11, and VKORC1 Asp36Tyr genetic variants explained warfarin variability in Africans better, compared to CYP2C9*2 and *3. In Africa, there is limited pharmacogenetics data on warfarin. Therefore, future research and funding commitments should be prioritized to ensure safe and effective use of warfarin in Africa. Lessons learned in Africa from the science of pharmacogenetics would inform rational therapeutics in hematology, cardiology, and surgical specialties worldwide. | {
"pile_set_name": "PubMed Abstracts"
} |
1956 Kansas City Athletics season
The 1956 Kansas City Athletics season, the team's 56th in the American League and second in Kansas City, involved the A's finishing 8th in the American League with a record of 52 wins and 102 losses, 45 games behind the World Champion New York Yankees.
Offseason
March 2, 1956: Tommy Lasorda was purchased by the Athletics from the Brooklyn Dodgers.
Regular season
Season standings
Record vs. opponents
Notable transactions
April 16, 1956: Lee Wheat, Tom Saffell and cash were traded by the Athletics to the Brooklyn Dodgers for Tim Thompson.
April 16, 1956: Johnny Groth was purchased by the Athletics from the Washington Senators.
May 1956: Marion Fricano and $60,000 were traded by the Athletics to the Toronto Maple Leafs for Jack Crimian.
June 14, 1956: Moe Burtschy, Bill Renna and cash were traded by the Athletics to the New York Yankees for Lou Skizas and Eddie Robinson.
July 11, 1956: Tommy Lasorda was traded by the Athletics to the New York Yankees for Wally Burnette.
August 17, 1956: Joe Ginsberg was traded by the Athletics to the Baltimore Orioles for Hal Smith.
August 25, 1956: Enos Slaughter was selected off waivers from the Athletics by the New York Yankees.
Roster
Player stats
Batting
Starters by position
Note: Pos = Position; G = Games played; AB = At bats; H = Hits; Avg. = Batting average; HR = Home runs; RBI = Runs batted in
Other batters
Note: G = Games played; AB = At bats; H = Hits; Avg. = Batting average; HR = Home runs; RBI = Runs batted in
Pitching
Starting pitchers
Note: G = Games pitched; IP = Innings pitched; W = Wins; L = Losses; ERA = Earned run average; SO = Strikeouts
Other pitchers
Note: G = Games pitched; IP = Innings pitched; W = Wins; L = Losses; ERA = Earned run average; SO = Strikeouts
Relief pitchers
Note: G = Games pitched; W = Wins; L = Losses; SV = Saves; ERA = Earned run average; SO = Strikeouts
Farm system
LEAGUE CHAMPIONS: Seminole
References
External links
1956 Kansas City Athletics team page at Baseball Reference
1956 Kansas City Athletics team page at www.baseball-almanac.com
Category:Oakland Athletics seasons
Kansas City Athletics season
Category:1956 in sports in Missouri | {
"pile_set_name": "Wikipedia (en)"
} |
The Indian Peaks from the...
The Indian Peaks from the Cooper Peak-Marten Peak saddle. From left to right rises Piaute Peak, Mount Toll, Pawnee Peak, Apache Peak, "Iroqois Peak", "Hopi Peak", and Achonee Peak. "Blackfoot Peak" and Thunderbolt Peak are lower and closer. The lakes are unnamed and perfect. September 2003. Jon Bradford | {
"pile_set_name": "Pile-CC"
} |
<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN" "http://www.w3.org/TR/html4/loose.dtd">
<!-- NewPage -->
<html lang="en">
<head>
<!-- Generated by javadoc (1.8.0) on Thu Jan 05 01:03:22 EST 2017 -->
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8">
<title>StaxServerConfiguration (appsensor-parent 2.3.1 API)</title>
<meta name="date" content="2017-01-05">
<link rel="stylesheet" type="text/css" href="../../../../../../stylesheet.css" title="Style">
<script type="text/javascript" src="../../../../../../script.js"></script>
</head>
<body>
<script type="text/javascript"><!--
try {
if (location.href.indexOf('is-external=true') == -1) {
parent.document.title="StaxServerConfiguration (appsensor-parent 2.3.1 API)";
}
}
catch(err) {
}
//-->
</script>
<noscript>
<div>JavaScript is disabled on your browser.</div>
</noscript>
<!-- ======== START OF CLASS DATA ======== -->
<div class="header">
<div class="subTitle">org.owasp.appsensor.configuration.stax.server</div>
<h2 title="Class StaxServerConfiguration" class="title">Class StaxServerConfiguration</h2>
</div>
<div class="contentContainer">
<ul class="inheritance">
<li><a href="http://docs.oracle.com/javase/7/docs/api/java/lang/Object.html?is-external=true" title="class or interface in java.lang">java.lang.Object</a></li>
<li>
<ul class="inheritance">
<li><a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html" title="class in org.owasp.appsensor.core.configuration.server">org.owasp.appsensor.core.configuration.server.ServerConfiguration</a></li>
<li>
<ul class="inheritance">
<li>org.owasp.appsensor.configuration.stax.server.StaxServerConfiguration</li>
</ul>
</li>
</ul>
</li>
</ul>
<div class="description">
<ul class="blockList">
<li class="blockList">
<hr>
<br>
<pre>@Named
public class <span class="typeNameLabel">StaxServerConfiguration</span>
extends <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html" title="class in org.owasp.appsensor.core.configuration.server">ServerConfiguration</a></pre>
</li>
</ul>
</div>
<div class="summary">
<ul class="blockList">
<li class="blockList">
<!-- ======== CONSTRUCTOR SUMMARY ======== -->
<ul class="blockList">
<li class="blockList"><a name="constructor.summary">
<!-- -->
</a>
<h3>Constructor Summary</h3>
<table class="memberSummary" border="0" cellpadding="3" cellspacing="0" summary="Constructor Summary table, listing constructors, and an explanation">
<caption><span>Constructors</span><span class="tabEnd"> </span></caption>
<tr>
<th class="colOne" scope="col">Constructor and Description</th>
</tr>
<tr class="altColor">
<td class="colOne"><code><span class="memberNameLink"><a href="../../../../../../org/owasp/appsensor/configuration/stax/server/StaxServerConfiguration.html#StaxServerConfiguration--">StaxServerConfiguration</a></span>()</code></td>
</tr>
<tr class="rowColor">
<td class="colOne"><code><span class="memberNameLink"><a href="../../../../../../org/owasp/appsensor/configuration/stax/server/StaxServerConfiguration.html#StaxServerConfiguration-boolean-">StaxServerConfiguration</a></span>(boolean loadConfiguration)</code></td>
</tr>
</table>
</li>
</ul>
<!-- ========== METHOD SUMMARY =========== -->
<ul class="blockList">
<li class="blockList"><a name="method.summary">
<!-- -->
</a>
<h3>Method Summary</h3>
<ul class="blockList">
<li class="blockList"><a name="methods.inherited.from.class.org.owasp.appsensor.core.configuration.server.ServerConfiguration">
<!-- -->
</a>
<h3>Methods inherited from class org.owasp.appsensor.core.configuration.server.<a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html" title="class in org.owasp.appsensor.core.configuration.server">ServerConfiguration</a></h3>
<code><a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#equals-java.lang.Object-">equals</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#findClientApplication-java.lang.String-">findClientApplication</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#findDetectionPoints-org.owasp.appsensor.core.DetectionPoint-">findDetectionPoints</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#findDetectionPoints-org.owasp.appsensor.core.DetectionPoint-java.lang.String-">findDetectionPoints</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#getClientApplicationIdentificationHeaderName--">getClientApplicationIdentificationHeaderName</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#getClientApplications--">getClientApplications</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#getConfigurationFile--">getConfigurationFile</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#getCorrelationSets--">getCorrelationSets</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#getCustomDetectionPoints--">getCustomDetectionPoints</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#getDetectionPoints--">getDetectionPoints</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#getGeolocationDatabasePath--">getGeolocationDatabasePath</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#getRelatedDetectionSystems-org.owasp.appsensor.core.DetectionSystem-">getRelatedDetectionSystems</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#getServerHostName--">getServerHostName</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#getServerPort--">getServerPort</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#getServerSocketTimeout--">getServerSocketTimeout</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#hashCode--">hashCode</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#isGeolocateIpAddresses--">isGeolocateIpAddresses</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#setClientApplicationIdentificationHeaderName-java.lang.String-">setClientApplicationIdentificationHeaderName</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#setClientApplications-java.util.Collection-">setClientApplications</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#setConfigurationFile-java.io.File-">setConfigurationFile</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#setCorrelationSets-java.util.Collection-">setCorrelationSets</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#setCustomDetectionPoints-java.util.HashMap-">setCustomDetectionPoints</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#setDetectionPoints-java.util.Collection-">setDetectionPoints</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#setGeolocateIpAddresses-boolean-">setGeolocateIpAddresses</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#setGeolocationDatabasePath-java.lang.String-">setGeolocationDatabasePath</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#setServerHostName-java.lang.String-">setServerHostName</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#setServerPort-int-">setServerPort</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#setServerSocketTimeout-int-">setServerSocketTimeout</a>, <a href="../../../../../../org/owasp/appsensor/core/configuration/server/ServerConfiguration.html#toString--">toString</a></code></li>
</ul>
<ul class="blockList">
<li class="blockList"><a name="methods.inherited.from.class.java.lang.Object">
<!-- -->
</a>
<h3>Methods inherited from class java.lang.<a href="http://docs.oracle.com/javase/7/docs/api/java/lang/Object.html?is-external=true" title="class or interface in java.lang">Object</a></h3>
<code><a href="http://docs.oracle.com/javase/7/docs/api/java/lang/Object.html?is-external=true#clone--" title="class or interface in java.lang">clone</a>, <a href="http://docs.oracle.com/javase/7/docs/api/java/lang/Object.html?is-external=true#finalize--" title="class or interface in java.lang">finalize</a>, <a href="http://docs.oracle.com/javase/7/docs/api/java/lang/Object.html?is-external=true#getClass--" title="class or interface in java.lang">getClass</a>, <a href="http://docs.oracle.com/javase/7/docs/api/java/lang/Object.html?is-external=true#notify--" title="class or interface in java.lang">notify</a>, <a href="http://docs.oracle.com/javase/7/docs/api/java/lang/Object.html?is-external=true#notifyAll--" title="class or interface in java.lang">notifyAll</a>, <a href="http://docs.oracle.com/javase/7/docs/api/java/lang/Object.html?is-external=true#wait--" title="class or interface in java.lang">wait</a>, <a href="http://docs.oracle.com/javase/7/docs/api/java/lang/Object.html?is-external=true#wait-long-" title="class or interface in java.lang">wait</a>, <a href="http://docs.oracle.com/javase/7/docs/api/java/lang/Object.html?is-external=true#wait-long-int-" title="class or interface in java.lang">wait</a></code></li>
</ul>
</li>
</ul>
</li>
</ul>
</div>
<div class="details">
<ul class="blockList">
<li class="blockList">
<!-- ========= CONSTRUCTOR DETAIL ======== -->
<ul class="blockList">
<li class="blockList"><a name="constructor.detail">
<!-- -->
</a>
<h3>Constructor Detail</h3>
<a name="StaxServerConfiguration--">
<!-- -->
</a>
<ul class="blockList">
<li class="blockList">
<h4>StaxServerConfiguration</h4>
<pre>public StaxServerConfiguration()</pre>
</li>
</ul>
<a name="StaxServerConfiguration-boolean-">
<!-- -->
</a>
<ul class="blockListLast">
<li class="blockList">
<h4>StaxServerConfiguration</h4>
<pre>public StaxServerConfiguration(boolean loadConfiguration)</pre>
</li>
</ul>
</li>
</ul>
</li>
</ul>
</div>
</div>
<!-- ========= END OF CLASS DATA ========= -->
<p class="legalCopy"><small>Copyright © 2017 <a href="http://www.owasp.org">The Open Web Application Security Project (OWASP)</a>. All rights reserved.</small></p>
</body>
</html>
| {
"pile_set_name": "Github"
} |
The effects of prenatal exposure to low-level cadmium, lead and selenium on birth outcomes.
To evaluate the current maternal and fetal exposure to cadmium (Cd), lead (Pb) and selenium (Se), and their potential effect on newborn birth outcomes, a cross-sectional study involving an assessment of the levels of these three metals in maternal blood, urine and umbilical cord blood was conducted in 209 pregnant women living in Eastern China. The maternal blood, urine and cord blood samples were collected and measured with inductively coupled plasma mass spectrometry (ICP-MS). The maternal blood concentrations of Cd, Pb and Se (the geometric means (GMs) were 0.48, 39.50 and 143.53 μg L(-1)) were significantly higher than and correlated with those in the cord blood (GM: 0.09, 31.62 and 124.61 μg L(-1)). In the urine samples, the GMs for Cd, Pb and Se were 0.13, 0.48, and 4.78 μg L(-1), respectively. Passive smoking was found to positively correlate with urine Cd (r=0.16) and negatively correlate with urine Se (r=-0.29). The maternal blood Se level was negatively associated with the cord Cd levels (r=-0.41). The blood Cd concentration in the mother could significantly affect the newborn birth weight (r=-0.22), but it was not correlated with birth height. We identified cord Se as a new factor which significantly correlated with birth weight. In conclusion, maternal Cd, Pb, Se exposure correlated with their umbilical cord concentration, and maternal Cd exposure might affect the newborn birth weight. Increasing the Se intake might reduce the cord blood Cd concentration and promote the fetal growth. | {
"pile_set_name": "PubMed Abstracts"
} |
Pasiphilodes viridescens
Pasiphilodes viridescens is a moth in the family Geometridae. It is found in Malaysia, New Guinea and possibly Borneo.
The wingspan is about . The forewings are green and the hindwings are pale cinereous, with traces of three or four dusky curved fasciae.
Larvae have been recorded feeding on Rhododendron species.
References
Category:Moths described in 1895
Category:Eupitheciini | {
"pile_set_name": "Wikipedia (en)"
} |
Plugin bundle, 35 plugins,.waves restoration bundle. Waves version 9 opens up new dimensions of high performance plugin.the restoration bundle.shop online with dv247.audio clean up plug in bundle.add to cart.waves is the leading developer of audio plugins for mixing, mastering, post production and live sound, with plugins for pro tools, cubase,.prenotazioni online facili e sicure.log in every day for 3 plugin deals selected personally for.waves plug in installer.waves restoration plug in bundle with five intuitive state of the art noise reduction tools, restoration includes everything you need to revive damaged recordings.reference: condition: new product. Waves debreath plugin.find great deals on ebay for waves plugins and usb mixer. Waves platinum plugin bundle, 50.waves dugan automixer plugin.waves restoration bundle included plug ins: x click x crackle. Z noise. Make your audio sound its best with the waves restoration plug in bundle.delivers versatile effects with warmth, depth and fatness of analog. | {
"pile_set_name": "Pile-CC"
} |
Seems we have revolution here in America erupting under our noses and there is not much we can do about it. This revolution pits compassionate children against their uncaring parents. The revolution even has a name, "Vegan America
-- Revolt!"
The revolution was born from incidents surrounding Dave Warwak and his persistent attempts to teach Humane Education at Fox River Grove Middle School. Warwak said, "I can't understand why they are fighting so hard against something so good. The World is behind us and prepared to help. There is every reason in the world for the school to go vegan and not one single reason to do otherwise"
PETA's Vice President, Bruce Friedberg is offering to help Fox River Grove Middle School with its transition to a vegan diet "We'll pay for food for a week, get vegan chefs in to help and consult, whatever". The "Chicago Animal Rights Meetup Group", "Mercy for Animals", and other groups around the world are prepared to step in and help Fox River Grove Middle School become the first vegan public school in America. The "CARMG" is embarking on a campaign to educate the youth of America. The group's president, Shalesh Kumbhat and Warwak are very enthusiastic about the group's new focus. The campaign consists of passing out small business cards to children wherever they may be. Thanks to Kumbhat's efforts and his extensive connections, animal rights groups, vegetarians, vegans, and humane educators all over the world will be passing out business cards to children wherever they may be. Warwak said, "Groups are hitting the streets, during times when children are most likely to be out and about. Groups are already planning on a full force presence on Halloween. Even vegans who stay home will be passing out vegan candies accompanied by a message of love." Warwak, then went on to say, "So far today, I passed out 34 cards!"
The business card's front reads:
Remember the Santa Claus lie?
One lie is so big, some people prefer to keep it hidden.
So hidden, some never find out!
Do you want to live a lie?
The back reads:
Go to your favorite search engine.
Look-up "Factory Farming" Look-up "Vegan"
"Naming a rock, a banana, does not make it food" | {
"pile_set_name": "Pile-CC"
} |
In a semiconductor device manufacturing process, an etching process is performed to various semiconductor layers. As one of such semiconductor layers, a polycrystalline silicon layer may be used. When a polycrystalline silicon layer as an etching target layer is etched, generally, a mask made of silicon oxide is formed on the etching target layer, and an etching process is performed to the etching target layer with the mask. Such an etching method is described in, for example, Patent Document 1.
To be more specific, in the etching method described in Patent Document 1, a silicon oxide layer is formed on the etching target layer which is a polycrystalline silicon layer, and a resist mask is formed on the silicon oxide layer. Then, the silicon oxide layer is etched using the resist mask, and, thus, a mask made of silicon oxide is formed. Then, the resist mask is removed. Thereafter, the etching target layer is etched with plasma of an etchant gas with the mask made of silicon oxide. | {
"pile_set_name": "USPTO Backgrounds"
} |
Irish Times (album)
Irish Times is the third studio album by the Irish folk band Patrick Street, released in 1990 on Green Linnet and Special Delivery Records, a division of Topic Records.
Founding members Andy Irvine, Kevin Burke, Jackie Daly and Arty McGlynn were joined by Bill Whelan (keyboards), James Kelly (fiddle), Declan Masterson (uilleann pipes, low whistle, keyboards) and Gerry O'Beirne (vocals, guitar), who also contributed two songs. The album was produced by Gerry O'Beirne and Patrick Street, and recorded at Windmill Lane Studios, Dublin, Ireland.
Track listing
All tracks Traditional; arranged by Patrick Street; except where indicated
"Music for a Found Harmonium" (Simon Jeffes, Penguin Café Ltd) – 2:38
"Brackagh Hill" (words: Traditional; music: Andy Irvine) – 5:48
"Brian O'Lynn"/"The Woods of Old Limerick" – 3:17
"Strokestown" (G. O'Beirne) – 4:45
"The Newmarket Polkas" – 3:32
"A Forgotten Hero" (Andy Irvine) – 6:02
"Doorus Hill" (J. Daly) / "The Rolling Reel/The Ballygrow Reel/Dennis Murphy's Reel" – 4:40
"In the Land of the Patagarang" (G. O'Beirne) – 4:20
"Boston O'Connor"/"John Gaffy's Fling"/"The Kerryman's Fling" – 3:40
"The Humours of the King of Ballyhooley" – 4:08
Personnel
Andy Irvine - vocals, mandolin, bouzouki, harmonica
Kevin Burke - fiddle
Jackie Daly - accordion
Gerry O'Beirne - vocals, guitar
James Kelly - fiddle
Declan Masterson - uilleann pipes, low whistle, keyboards
Arty McGlynn - guitar
Bill Whelan - keyboards
References
External links
''Irish Times at Allmusic website
Irish Times at MusicBrainz website
Irish Times at Discogs website
Patrick Street at Adastra website
Category:1990 albums
Category:Patrick Street albums | {
"pile_set_name": "Wikipedia (en)"
} |
Is the treatment of the small saphenous veins with foam sclerotherapy at risk of deep vein thrombosis?
To assess the deep vein thrombosis risk of the treatment of the small saphenous veins depending on the anatomical pattern of the veins. A multicenter, prospective and controlled study was carried out in which small saphenous vein trunks were treated with ultrasound-guided foam sclerotherapy. The anatomical pattern (saphenopopliteal junction, perforators) was assessed by Duplex ultrasound before the treatment. All patients were systematically checked by Duplex ultrasound 8 to 30 days after the procedure to identify a potential deep vein thrombosis. Three hundred and thirty-one small saphenous veins were treated in 22 phlebology clinics. No proximal deep vein thrombosis occurred. Two (0.6%) medial gastrocnemius veins thrombosis occurred in symptomatic patients. Five medial gastrocnemius veins thrombosis and four cases of extension of the small saphenous vein sclerosis into the popliteal vein, which all occurred when the small saphenous vein connected directly into the popliteal vein, were identified by systematic Duplex ultrasound examination in asymptomatic patients. Medial gastrocnemius veins thrombosis were more frequent (p = 0.02) in patients with medial gastrocnemius veins perforator. A common outlet or channel between the small saphenous vein and the medial gastrocnemius veins did not increase the risk of deep vein thrombosis. Deep vein thrombosis after foam sclerotherapy of the small saphenous vein are very rare. Only 0.6% medial gastrocnemius veins thrombosis occurred in symptomatic patients. However, the anatomical pattern of the small saphenous vein should be taken into account and patients with medial gastrocnemius veins perforators and the small saphenous vein connected directly into the popliteal vein should be checked by Duplex ultrasound one or two weeks after the procedure. Recommendations based on our everyday practice and the findings of this study are suggested to prevent and treat deep vein thrombosis. | {
"pile_set_name": "PubMed Abstracts"
} |
Marks, who struck out two and gave up one hit over one inning in Sunday's 5-3 Grapefruit League win over the Blue Jays, is making a push for a bullpen spot this spring, Marc Topkin of the Tampa Bay Times reports. | {
"pile_set_name": "Pile-CC"
} |
628 So.2d 773 (1993)
George D. EUBANKS
v.
Jo Ann HALL.
AV92000080.
Court of Civil Appeals of Alabama.
July 23, 1993.
*774 D.E. Brutkiewicz, Jr., of Brutkiewicz Attorneys, Mobile, for appellant.
Samuel N. Crosby and L. Brian Chunn of Stone, Granade, Crosby & Blackburn, P.C., Bay Minette, for appellee.
THIGPEN, Judge.
This is a malicious prosecution case.
Jo Ann Hall filed suit against George D. Eubanks in September 1991, charging him with malicious prosecution and seeking $1 million in damages. She alleged that the complaint resulted from an arrest warrant which Eubanks had sworn against Hall, charging her with criminal charges, and that she sustained damages, including legal expenses, although the criminal proceedings terminated in her favor. Following a jury trial, the jury returned a verdict favoring Hall in the amount of $10,000, and the trial court entered a judgment accordingly. Eubanks appeals.
Eubanks contends on appeal that the trial court erred in allowing certain testimony to be admitted at trial; that the trial court erred in denying his motion for a directed verdict; and that the trial court improperly refused to use his proffered jury instructions regarding punitive damages.
At the outset, we note that jury verdicts are presumed to be correct. Uphaus v. Charter Hospital of Mobile, 582 So.2d 1140 (Ala.Civ.App.1991). Malicious prosecution actions, however, are not favored in law, and face stringent limitations. Uphaus, supra.
The elements of an action for malicious prosecution are: "(1) a judicial proceeding initiated by the defendant; (2) the lack of probable cause; (3) malice on the part of the defendant; (4) termination of the judicial proceeding favorably to the plaintiff; and, (5) damages." Empiregas, Inc., of Elberta v. Feely, 524 So.2d 626, 627 (Ala.1988).
Testimony adduced at trial reveals that Eubanks apparently was tried in an August 1991 criminal proceeding, and, according to Hall, her husband testified against Eubanks. There is testimony that afterwards, Eubanks reportedly threatened to "get" the witnesses who testified against him. Hall testified that approximately one month after Eubanks's trial, she and another woman were cleaning crabs on Hall's property on Tensaw Island when Eubanks's son and his cousin began travelling on the river, yelling obscenities. Hall testified that when she and the other woman got into a boat to bait the crab baskets in the river, Eubanks's son and nephew deliberately maneuvered close to Hall's boat, splashing Hall with water. She testified that Eubanks's son was on a "kneeboard" and was riding in the water behind the boat, and that at that time, they came so close that she believed that their boat would hit them. She stated that he fell from the kneeboard, and that she and the other woman drove the boat over to him and accused him of trying to run over them. They then told the boys that they were going to call the water patrol.
At trial, Eubanks's nephew disputed Hall's version of events. Eubanks's nephew testified that after the alleged incident, he called the police for Eubanks's son, and that Eubanks's son told the police that Hall cursed them, and that there was a paddle and gun involved. The nephew also testified that Eubanks actually signed the complaint at the police's behest, because Eubanks's son and nephew were too young to sign the complaint.
Although Hall was charged with harassment and menacing, the trial court granted Hall's motion for judgment of acquittal in September 1991, and Hall filed suit against Eubanks for malicious prosecution that same month.
Eubanks first contends that the trial court erred in admitting, over his objection, testimony regarding his prior acts. Jerry Crowe, another witness in Eubanks's criminal trial, testified that after that trial, Eubanks harassed him in various ways, including discharging firearms near Crowe's house, making numerous phone calls to him, and by harassing him while driving. A person's character, when offered for the purpose of showing his conduct on a specific occasion, *775 may not be proven by evidence of his specific acts or conduct. Mayfield v. State, 591 So.2d 143 (Ala.Crim.App.1991); C. Gamble, McElroy's Alabama Evidence, § 26.01 (4th ed. 1991). Hall argues that Crowe's testimony was proffered not to show that Eubanks acted in conformity therewith in signing the complaint, but rather to establish Eubanks's malice towards the witnesses who testified against him at his criminal trial.
Malice, for purposes of a malicious prosecution action, may be inferred from want of probable cause or it may be inferred from the circumstances surrounding and attending prosecution. Thompson v. Kinney, 486 So.2d 442 (Ala.Civ.App.1986). "This is because malice is incapable of positive, direct proof and must out of necessity be rested on inferences and deductions from facts which are heard by the trier of fact." Thompson at 445. The element of malice may be inferred from the conduct of the defendant if no other reasonable explanation exists for his actions. Johnson v. Smith, 503 So.2d 868 (Ala.Civ. App.1987). Therefore, Crowe's testimony was admissible for the narrow purpose of establishing Eubanks's malice towards the witnesses.
Eubanks next contends that the trial court erred in refusing to grant his motion for a directed verdict. A directed verdict in favor of a defendant is proper only when there is no evidence to support one or more of the elements in the plaintiff's cause of action. Smith v. Wendy's of the South, Inc., 503 So.2d 843 (Ala.1987). Eubanks argues that Hall had failed to prove he lacked probable cause for instigating the judicial proceedings against Hall.
Probable cause is the state of facts which would lead a person of reasonable prudence to honestly believe that the claims put forth in the prior suit would prevail. Empiregas, supra. The issue of probable cause must go to a jury when the material facts are in dispute, as in this case. Harris v. Harris, 542 So.2d 284 (Ala.Civ.App.1989). The question of probable cause being a jury question, the trial court properly refused Eubanks's motion for a directed verdict.
Eubanks last contends that the trial court erred in refusing to give one of his jury instructions. Specifically, the trial court refused Eubanks's request to charge the jury that in order to award punitive damages, the jury must find by "clear and convincing evidence" that he lacked probable cause to instigate criminal proceedings against Hall.
Eubanks cites Ala.Code 1975, § 12-21-12(a), in support of this contention; however, this section establishes the "substantial evidence" rule for testing the sufficiency of evidence in rulings by the trial court and does not apply to the instant case.
It appears that Eubanks intended to cite Ala.Code 1975, § 6-11-20, as requiring that the absence of probable cause be proven by clear and convincing evidence in awarding punitive damages. We find, however, that this statute requires "clear and convincing evidence" only for awarding punitive damages in cases of oppression, fraud, wantonness, or malice. Ala.Code 1975, § 6-11-20(a). Nowhere does this statute require that the absence of probable cause be proven by the same standard. Moreover, we find that the issue of punitive damages was properly submitted to the jury. See Delchamps, Inc. v. Larry, 613 So.2d 1235 (Ala.1992). A court cannot be reversed for its refusal to give a charge that is not expressed in the exact and appropriate terms of the law. Johnston v. Byrd, 279 Ala. 491, 187 So.2d 246 (1966). The trial court instructed the jury that it must be "reasonably satisf(ied)" that Eubanks had no probable cause to instigate the action against Hall, and this was not reversible error. See also Alabama Pattern Jury Instructions, § 24.05.
Based on the foregoing, we find that the judgment of the trial court is due to be affirmed.
AFFIRMED.
ROBERTSON, P.J., and YATES, J., concur.
| {
"pile_set_name": "FreeLaw"
} |
Check out our new site Makeup Addiction
Observe socially awkward penguin back that fucker up | {
"pile_set_name": "OpenWebText2"
} |
What you see: White film on grapes
What it is: “Bloom” produced by the grape as a natural protection
Eat or toss? Eat! It’s just part of the grape’s natural coating, nothing more.
I admit that there was a tiny part of me that used to eye the white film on grapes with suspicion, assuming it to be some very obvious pesticide residue. Of course, nothing could be further from the truth. The white film, called “bloom,” is something that you see on a number of soft fruits and protects the grape from things like moisture loss and decay. Produced by the grape itself, the bloom is mostly made of a waxy substance called oleanolic acid. Oleanolic acid occurs widely in food and might even have some disease-fighting properties.
SOURCES:
California Table Grape Commission - Grape Terms
Waste Free Kitchen Handbook by Dana Gunders p. 151
Pharmacology of oleanolic acid and ursolic acid
The white stuff on grapes? Why, that's just a little self-preservation. | {
"pile_set_name": "OpenWebText2"
} |
Community-based adolescent health services in Israel: from theory to practice.
Despite their engagement in health-risk behaviors and their health-related concerns, adolescents have the lowest rate of health service utilization of any age group. Time constraints during routine medical encounters generally leave little opportunity for professional screening for health-risk behaviors or for discussing psychosocial problems. In addition, providers express low levels of perceived competency in areas such as sexuality, eating disorders or drug abuse. To address these needs, a walk-in Adolescent Health Service was established by the Sheba Medical Center to provide diagnosis and short-term treatment for individual adolescents, as well as counseling and support for local care providers. A three-way model of cooperation and partnership was developed and implemented. A professional and financial partnership with local authorities were established to help define the particular needs of the community's youth and to improve the ability to reach youth with special health needs. The partnership along with the main medical provider (Kupat Holim Clalit) helped define local health needs, served as a referral source of patients with unmet health needs, and improved the continuity of care. The regional medical center (Sheba Medical Center) provided supervision and consultation for the medical staff of the service, as well as a referral center for patients. It was emphasized that the service staff was intended as a professional source for the primary physician and should not be considered a rival. The core staff included a specialist in adolescent medicine, gynecologist, mental health specialist and social worker. A structured intake procedure was developed for assessing health concerns and problems of adolescents in the context of a community clinic. Findings from the first years of services showed that the first 547 female adolescents demonstrated that a majority of adolescents presented with primary complaints of a somatic nature, while one third were diagnosed with psychosocial problems and one-fifth with a sexuality-related problem. A considerable percentage of those diagnosed with psychosocial or sexuality-related problems had not stated these issues as their "reason for encounter". This additional increment probably represents the contribution of the Health Concern Checklist (HCC), in which the adolescent was asked to mark each item for which she had concerns or would like to receive further information. The HCC can help primary care physicians as well as adolescent medical specialists approach the teenage patient and initiate productive communication. A practical approach to confidential health care for adolescents: The issue of confidentiality has not been sufficiently clarified by Israeli law or by the medical community. The need for confidentiality was strongly felt in the adolescent health service. A policy which provides all adolescents with the opportunity to meet with a physician and receive health guidance or advice at least once, even without parental knowledge or consent, was formulated and implemented. If parental consent was not feasible, the minor was allowed to give informed consent for medical and psychosocial care for himself/herself, with certain limitations. | {
"pile_set_name": "PubMed Abstracts"
} |
About The Author
John Babos
John is a long-time pop culture fan, comics historian, and blogger. He is currently the Editor-in-Chief at Comics Nexus. Prior to being EIC he has produced several column series including DEMYTHIFY, NEAR MINT MEMORIES and the ONE FAN'S TRIALS at the Nexus plus a stint at Bleeding Cool producing the COMICS REALISM column. As BabosScribe, John is active on his twitter account, his facebook page and welcomes any and all feedback. Bring it on!
Loading...
Latest Comments
Bitchard PryorSo a year and a half later, Jodie's first series of Doctor Who pulled in the highest ratings since Tennant and despite attempts to review bomb it on Rotten Tomatoes by Reddit douchebags, all of...
AnimehunterJust to clear things regarding Mary Jane in the issue, what Spider-Man is experiencing is a result of the gas that Kraven's clone released, which is either a hallucination due to his fears of... | {
"pile_set_name": "Pile-CC"
} |
let's just hope the people in charge of the Large Hadron Collider aren't like your bus driver, or else they might cause a black hole while bickering about whether or not they can eat something in the room. XD
In lectures, do you ever imagine monsters or bad people coming into the room while you jump around and save everyone?Sometimes, I daydream like that.It's a lot of fun, but I should pay attention more...
hahah, maybe not saving everyone, if it's to jump and to attack the lecturer and then run away from the class, then I might have.Gosh...I know something is wrong within me.nah, I'm not a big dreamer like i once used to be, but i started to realize there are many insignificant things that could be significant in this life, that's where i got ideas from | {
"pile_set_name": "Pile-CC"
} |
Will it happen at the shops?
Will it be a huge gush of water?
Does it hurt?
These are the questions many first time pregnant mamas ask themselves when thinking about the possibility of their waters breaking.
It’s pretty normal to feel a bit worried about your waters breaking, particularly if you have no idea what to expect and thanks to today’s media, which makes waters breaking seem like The Worst Thing Ever.
Myths About Your Waters Breaking
Here are 9 myths about your waters breaking.
#1: You Have No Warning
Ok we’ve all seen it happen in the movies – pregnant woman is minding her own business at work or shopping and suddenly she’s taken by complete surprise when her waters break.
While you don’t know exactly when your waters may break, it commonly happens during active labour – when you’ve already been having regular contractions for a while. If your waters break before labour has begun, you will usually have some warning signs, like mild cramping that feels a bit like period pain, or even lower backache.
While the medical world would have us believe different, there aren’t any rules to labour and birth. Yes there is a fairly typical chain of events that happen to most women but within that wide range of normal are many variations. You’re unique and might not experience the start of labour like your mother, sister or best friend. Roll with it!
Find out the differences between labour in the movies and real life here.
#2: You Will Feel Your Waters Break
You might feel a pop, you might not. You might feel a rush of fluid, a trickle or simply wonder if you have pee’d yourself. You may feel all of the above or none at all!
It can actually be harder than you think to tell if your waters have broken. Vaginal fluid increase toward the end of pregnancy, and the mucus plug can begin to come away as the cervix starts to ripen. This can be mistaken for amniotic fluid.
If the amniotic sac ruptured higher than the baby’s head, only a trickle will be able to make its way out. Which can cause you to regret not doing more pelvic floor exercises! You might even notice the trickle stops which can really make things confusing as nothing might happen for a few days.
Some women do experience the full gush of waters, and are surprised that more fluid can come out with each contraction. Most of the time, if your waters have broken, moving around or being in an upright position will give you a clue as to what’s going on, as you may feel wetness that you can’t control.
#3: Labour Doesn’t Start Immediately
Just because your waters have broken doesn’t mean labour is going to start immediately. Contractions might start in a few hours, they may take their merry time and keep you waiting for 12 or more hours. About 1 in 10 women experience their waters breaking several hours before labour begins.
How long you have to wait depends on a few factors, such as your baby’s position and what your care provider policy is on waters breaking before labour starts.
Many women want things to get a move on and will try to encourage contractions to begin. Try not to wear yourself out because you will need that energy for later and definitely don’t insert anything in your vagina to limit infection risk.
#4: You Don’t Need To Rush To the Hospital
So your waters have broken – now what? If you were in the movies, you might jump in the nearest taxi or phone your partner to get home NOW and race you into hospital.
But this isn’t the movies and it’s probably 2am (little known fact: waters most often break at night when you are in bed sleeping). You might get up and check what’s going on, feel excited – even wake your partner to say ‘the baby’s coming’ just to have someone to share the news with.
Your care provider may have recommended you contact them when your waters have broken. This is to make sure all is well and to reassure you of what do if things change. Get some rest or snuggle up on the couch and watch a movie. Trying to get things moving can seem like a good idea but that gets tiring pretty quickly.
#5: You Might Get An Infection
The amniotic sac serves a purpose other than holding onto the amniotic fluid. It acts as a barrier to prevent infections which can cause severe complications.
If water is trickling out there is little chance of bacteria swimming against the tide as it were, unless something is inserted into the vagina and close to the cervix. This would allow bacteria to be pushed upwards and potentially be introduced through the cervix.
Policy differs as to how long you can wait after your waters break and contractions begin – usually between 48 and 72 hours. After this time, your care provider may recommend induction of labour as the risk of you acquiring an infection is believed to be increased.
#6: You Might Have A Dry Birth
A dry birth is a bit of an urban myth. The theory goes if a woman’s waters break days or weeks before labour begins, all the fluid is gone and she has a dry birth.
There are several reasons why this just can’t happen. The baby’s head acts like a cork in a bottle, so if the amniotic sac breaks not all the water can escape at once. Usually when a large gush does occur it is because the baby’s head isn’t fully engaged and there is a decent amount of fluid in front of the head. Once the sac ruptures, the baby’s head will descend over the cervix and act as a plug for the water remaining.
Amniotic fluid can also replenish itself. During late pregnancy, the source of most of the fluid is from the baby and the rest from the mother. A healthy baby can replenish the fluid even if the amniotic sac has ruptured.
#7: You Can Make Your Waters Break
You’re full term, over it and ready for this baby to be born. A late night Google session gives you the bright idea to drive down a bumpy road, have sex, bounce on your birth ball, eat lots of pineapple…
Science has only just started to figure out what causes labour to start and it definitely isn’t a spicy curry. Your baby’s lungs reach a certain point of maturity, triggering a complex process that tells your body to go into labour. Read more here about what causes labour to start.
Most of the time when women go into labour after using natural induction methods, it is because they were already in prelabour and their bodies were ready to start getting serious. Being patient pays off but it can be a good story to tell if you don’t mind amniotic fluid on your car seat.
Find out 7 things that failed to induce labour for BellyBelly writer Fiona.
#8: Waters Don’t Break Early
Unfortunately this isn’t true. Around 10% of women will experience what is known as premature rupture of membranes (PROM). This is when the amniotic sac ruptures before your baby is ready to be born (earlier than 37 weeks).
Why this happens has been one of science’s greatest mysteries but recent research has discovered labour is associated with an inflammatory response and there is increased concentrations of bacteria in women who have experienced PROM.
If your waters do break earlier than 37 weeks, contact your care provider right away as there are management and treatment options available depending on how many weeks pregnant you are.
Here’s more information about when your water breaks prematurely.
#9: No Interventions Needed After Waters Break
Sometimes contractions don’t get started or aren’t regular and strong enough to dilate the cervix. An infection might be present or there can be a complication like cord prolapse (when the cord is swept out through the cervix before the baby’s head).
Interventions can be medically necessary and save lives of mothers and babies around the world. They can also be used unnecessarily because of an impatience and desire to avoid any deviation from what is considered ‘normal’ labour by the medical profession.
If an intervention is recommended by your care provider, don’t be afraid to ask for more information, including the risks and benefits of having/not having the intervention. Unless things are urgent you will have time to consider your options and make the best decision for you and your baby.
Recommended Reading: | {
"pile_set_name": "OpenWebText2"
} |
Exterior
Map & Points of Interest
Cranston
Cranston is the third largest city in Rhode Island. It is a vibrant suburban community that boasts rural areas on the city’s western side, and the Narragansett Bay shoreline on the city's eastern side. | {
"pile_set_name": "Pile-CC"
} |
Intrauterine levonorgestrel delivered by a frameless system, combined with systemic estrogen: acceptability and endometrial safety after 3 years of use in peri- and postmenopausal women.
To evaluate the acceptability and endometrial safety of a novel intrauterine drug delivery system, FibroPlant-levonorgestrel (LNG), combined with estrogen therapy (ET) in 150 peri- and postmenopausal women, followed-up for at least 3 years. This was a prospective, non-comparative study in peri- and postmenopausal women. In the majority of women, treatment with the FibroPlant-LNG intrauterine system (IUS), combined with ET, was initiated during the perimenopausal transitional phase to establish a smooth transition to menopause and suppress the endometrium to prevent endometrial proliferation and bleeding. A 3.5-cm long coaxial fibrous delivery system, delivering approximately 14 microg LNG/day, was used. The calculated duration of release of the system is at least 3 years. The majority of women received percutaneous 17beta-estradiol (Oestrogel), 1.5 mg daily on a continuous basis, which provides sufficient blood levels of estrogen in most women to suppress climacteric symptoms and protect against bone loss. To measure acceptability, women were asked, after they had the IUS in place for a minimum of 3 years, if they would like to continue the combined regimen and if they would accept renewal of the IUS. Endometrial safety was evaluated by transvaginal ultrasound examination and endometrial biopsy in a subset of 101 women prior to replacement of the IUS. Ninety-four insertions were done in perimenopausal and 56 in postmenopausal women aged between 33 and 78 years. Of the total group of 150 women, 132 women (88.0%) accepted replacement of the IUS and ten are waiting for replacement. This group includes nine women who will receive a second replacement. The number of women continuing the method is 142 (94.6%). Histological examinations conducted on endometrial biopsies from 101 postmenopausal women prior to replacement, after an average period of use of the regimen of 40 months (range 25-50 months), showed predominantly inactive endometrium characterized by pseudodecidual reaction of the endometrial stroma with endometrial atrophia, which is in keeping with the effects seen with a progestogenic compound. There were no specimens showing signs of proliferation. Results suggest that the frameless FibroPlant-LNG IUS is safe, well tolerated, well accepted and effective in suppressing the endometrium during ET. Intrauterine progestogen administration in postmenopausal women can be regarded as fundamentally advantageous compared with systemically applied progestogens, which may have potentially inherent ill side-effects, especially on the breast and cardiovascular system, as reported in the recent literature. | {
"pile_set_name": "PubMed Abstracts"
} |
// Licensed to the .NET Foundation under one or more agreements.
// The .NET Foundation licenses this file to you under the MIT license.
using Xunit;
namespace System.Runtime.InteropServices.Tests
{
public class TypeLibVarAttributeTests
{
[Theory]
[InlineData((TypeLibVarFlags)(-1))]
[InlineData((TypeLibVarFlags)0)]
[InlineData(TypeLibVarFlags.FBindable)]
public void Ctor_TypeLibVarFlags(TypeLibVarFlags flags)
{
var attribute = new TypeLibVarAttribute(flags);
Assert.Equal(flags, attribute.Value);
}
[Theory]
[InlineData(-1)]
[InlineData(0)]
[InlineData(4)]
public void Ctor_ShortFlags(short flags)
{
var attribute = new TypeLibVarAttribute(flags);
Assert.Equal((TypeLibVarFlags)flags, attribute.Value);
}
}
}
| {
"pile_set_name": "Github"
} |
This Week in HN podcast – our first episode - ThatMightBePaul
https://soundcloud.com/thatmightbepaul/this-week-in-hacker-news
======
jaywunder
You guys really need better quality microphones. I appreciate the idea that
you have, and I think you're generally a funny bunch, but I can't hear what
you're saying if your laughing overcomes that one quiet guy's audio. Other
suggestions would be to introduce yourselves at the start, and keep topicality
more. I enjoyed listening though!
| {
"pile_set_name": "HackerNews"
} |
The Great Escape
:
Wynette, Texas
Publisher's Summary
Instead of saying "I do" to Mr. Irresistible, Lucy Jorik hitches a ride on the back of a beat-up motorcycle with a rough looking, bad-tempered stranger who couldn't be more foreign to her privileged existence. While the world searches for her, Lucy must search for herself, and she quickly realizes that her customary good manners are no defense against a man who's raised rudeness to an art form. Lucy needs to toughen up - and fast. Her great escape takes her to his rambling beach house on a Great Lakes island. Here, she hopes to find a new direction...and to unlock the secrets of this man who knows so much about her but reveals nothing about himself. As the hot summer days unfold amid scented breezes and sudden storms, she'll encounter a passion that could change her life forever. In this dazzling follow-up to her New York Times best seller, Call Me Irresistible, Susan Elizabeth Phillips tells the funny, touching, enchanting story of a young woman searching for her destiny...and of a damaged man who doesn't believe in second chances. Performed by Shannon Cochran
Sorry for the Short Delay
Unfortunately, that depends on our systems, and they're keeping it to themselves. It could take a few minutes, but there's a chance it will be longer. We recommend that you check back with us in a few hours, when your title should be available for download in My Library. We appreciate your patience, and we apologize for the inconvenience.
Please contact customer service if the problem persists.
(888) 283-5051
See More Like This
Customer Reviews
Most Helpful
Better than the last one
I was so disappointed with Call Me Irresistible that I was prepared for disaster with this one. In spite of that, I stayed up until 3am waiting for the Audible download to go live. Diehard SEP fans do that.
THE GOOD: The story was satisfying in the way some of the older books were - good characterization, a couple of side stories, an interesting location, and some interesting bits about various "locale" things that made it easier to visualize the setting.
THE IRRITATING: Like so many successful fiction writers, SEP seems to feel it her duty to jump on social and political issues as part of the storyline. This is not a terrible thing. I suspect that authors employing these devices do make their readers stop and think a bit, but in this book, as in many others I've read in recent years, the preaching is just a little bit too much to the forefront and takes away from the story, rather than adding to it.
THE MEDIOCRE: I came away knowing more about the secondary characters and their motivations than I did the Hero. His story is held back for much of the book. The sexual tension between Lucy and Panda is not quite as hot as I might have wanted, and I''m not talking about explicit sex scenes here, but the ongoing sizzle. SEP is capable of this, as seen in Match Me If You Can and as far back as This Heart of Mine.
I'm hoping her next book will have less social consciousness and more romance.
What did you like best about The Great Escape? What did you like least?
SEP always involves past book characters in her story, and Great Escape was no exception. The secondary romance between Bree and Mike took too long to develop, but was resolved very nicely.
How could the performance have been better?
I think that we all miss Anna Fields who was Phillips' go-to narrator until Fields' tragic death. While Shannon Cochran is a competent narrator, I finally decided why she was ALL WRONG for Great Escape. Her voice is too old for Lucy, and secondly, most importantly, she never conveyed the joy that SEP imbues in all her books. | {
"pile_set_name": "Pile-CC"
} |
506 So.2d 66 (1987)
James L. PERCIVAL, Appellant,
v.
STATE of Florida, Appellee.
Nos. 85-2338 to 85-2345.
District Court of Appeal of Florida, Second District.
April 29, 1987.
James Marion Moorman, Public Defender, and D.P. Chanco, Asst. Public Defender, Bartow, for appellant.
Robert A. Butterworth, Atty. Gen., Tallahassee, and Candance M. Sunderland, Asst. Atty. Gen., Tampa, for appellee.
PER CURIAM.
Appellant, James L. Percival, appeals the judgments and sentences entered in eight cases. We find that the trial court erred by requiring appellant's sentences to be served consecutively to an undetermined sentence to be imposed at an undetermined time in the future by a court in another county. We, accordingly, remand with instructions to strike that requirement from the judgments and sentences, but affirm in all other respects.
Appellant was originally placed on probation for two years in Hillsborough County after pleading nolo contendere to the charge of dealing in stolen property. Less than five months later, the state filed seven informations in Hillsborough County charging appellant with ten counts of robbery and one count of attempted robbery. Appellant pled nolo contendere to these charges in exchange for the trial court's agreement that he would not be sentenced to serve more than fifteen years in prison.
Although the guidelines scoresheet is not contained in the record, the record reveals that the prosecutor advised the trial court at sentencing that appellant's scoresheet reflected a presumptive sentence of twelve to seventeen years. Defense counsel neither disagreed with nor objected to the prosecutor's statement.
The trial court denied the state's request to depart from the presumptive sentence and, pursuant to its agreement with appellant, imposed five years imprisonment for dealing in stolen property and fifteen years imprisonment for each of the other eleven charges. All of the sentences were to be served concurrently. Over defense counsel's *67 objection, however, the trial court granted the state's request to require these sentences to be served consecutively to a sentence to be imposed at a later date on charges pending against appellant in Pinellas County. Appellant filed timely notices of appeal which have been consolidated for purposes of appeal.
We reject appellant's contention that we must remand for resentencing because there is no scoresheet in the record. Appellant's sentences were entered pursuant to an agreement with the trial court. See Lawson v. State, 497 So.2d 288 (Fla. 1st DCA 1986); Rowe v. State, 496 So.2d 857 (Fla. 2d DCA 1986), petition for review granted, No. 69-606 (Fla. March 20, 1987). Additionally, the record reflects that a scoresheet was prepared, that the trial court was informed of appellant's score and presumptive sentence, and that the trial court did not depart from the presumptive sentence. The mere absence of the scoresheet in the record is, therefore, irrelevant. See Davis v. State, 461 So.2d 1361 (Fla. 2d DCA), petition for review denied, 471 So.2d 43 (Fla. 1985).
We agree, however, with appellant's contention that the trial court erred in requiring his sentences to be served consecutively to a sentence which had not yet been imposed on other charges pending against him. The sentence imposed by a trial court must commence on a definite date, Keel v. State, 321 So.2d 86 (Fla. 2d DCA 1975), and may only be required to be served consecutively to an existing sentence. See Richardson v. State, 432 So.2d 750 (Fla. 2d DCA 1983); Teffeteller v. State, 396 So.2d 1171 (Fla. 5th DCA 1981).
In this case, the trial court did not know when, if ever, the Pinellas County sentence would be imposed or what length the sentence would be. Under these circumstances, the trial court erroneously ordered appellant's sentences to be served consecutively to an undetermined sentence to be imposed at an undetermined time in the future. We, accordingly, remand with instructions that the trial court strike that portion of appellant's sentences which requires the sentences to run consecutively to appellant's expected Pinellas County sentence. We affirm the judgments and sentences in all other respects.
Affirmed in part, reversed in part, and remanded.
DANAHY, C.J., and SCHOONOVER and SANDERLIN, JJ., concur.
| {
"pile_set_name": "FreeLaw"
} |
/*
* Broadcom UniMAC MDIO bus controller driver
*
* Copyright (C) 2014-2017 Broadcom
*
* This program is free software; you can redistribute it and/or modify
* it under the terms of the GNU General Public License as published by
* the Free Software Foundation; either version 2 of the License, or
* (at your option) any later version.
*/
#include <linux/kernel.h>
#include <linux/phy.h>
#include <linux/platform_device.h>
#include <linux/sched.h>
#include <linux/module.h>
#include <linux/io.h>
#include <linux/delay.h>
#include <linux/of.h>
#include <linux/of_platform.h>
#include <linux/of_mdio.h>
#include <linux/platform_data/mdio-bcm-unimac.h>
#define MDIO_CMD 0x00
#define MDIO_START_BUSY (1 << 29)
#define MDIO_READ_FAIL (1 << 28)
#define MDIO_RD (2 << 26)
#define MDIO_WR (1 << 26)
#define MDIO_PMD_SHIFT 21
#define MDIO_PMD_MASK 0x1F
#define MDIO_REG_SHIFT 16
#define MDIO_REG_MASK 0x1F
#define MDIO_CFG 0x04
#define MDIO_C22 (1 << 0)
#define MDIO_C45 0
#define MDIO_CLK_DIV_SHIFT 4
#define MDIO_CLK_DIV_MASK 0x3F
#define MDIO_SUPP_PREAMBLE (1 << 12)
struct unimac_mdio_priv {
struct mii_bus *mii_bus;
void __iomem *base;
int (*wait_func) (void *wait_func_data);
void *wait_func_data;
};
static inline u32 unimac_mdio_readl(struct unimac_mdio_priv *priv, u32 offset)
{
/* MIPS chips strapped for BE will automagically configure the
* peripheral registers for CPU-native byte order.
*/
if (IS_ENABLED(CONFIG_MIPS) && IS_ENABLED(CONFIG_CPU_BIG_ENDIAN))
return __raw_readl(priv->base + offset);
else
return readl_relaxed(priv->base + offset);
}
static inline void unimac_mdio_writel(struct unimac_mdio_priv *priv, u32 val,
u32 offset)
{
if (IS_ENABLED(CONFIG_MIPS) && IS_ENABLED(CONFIG_CPU_BIG_ENDIAN))
__raw_writel(val, priv->base + offset);
else
writel_relaxed(val, priv->base + offset);
}
static inline void unimac_mdio_start(struct unimac_mdio_priv *priv)
{
u32 reg;
reg = unimac_mdio_readl(priv, MDIO_CMD);
reg |= MDIO_START_BUSY;
unimac_mdio_writel(priv, reg, MDIO_CMD);
}
static inline unsigned int unimac_mdio_busy(struct unimac_mdio_priv *priv)
{
return unimac_mdio_readl(priv, MDIO_CMD) & MDIO_START_BUSY;
}
static int unimac_mdio_poll(void *wait_func_data)
{
struct unimac_mdio_priv *priv = wait_func_data;
unsigned int timeout = 1000;
do {
if (!unimac_mdio_busy(priv))
return 0;
usleep_range(1000, 2000);
} while (--timeout);
if (!timeout)
return -ETIMEDOUT;
return 0;
}
static int unimac_mdio_read(struct mii_bus *bus, int phy_id, int reg)
{
struct unimac_mdio_priv *priv = bus->priv;
int ret;
u32 cmd;
/* Prepare the read operation */
cmd = MDIO_RD | (phy_id << MDIO_PMD_SHIFT) | (reg << MDIO_REG_SHIFT);
unimac_mdio_writel(priv, cmd, MDIO_CMD);
/* Start MDIO transaction */
unimac_mdio_start(priv);
ret = priv->wait_func(priv->wait_func_data);
if (ret)
return ret;
cmd = unimac_mdio_readl(priv, MDIO_CMD);
/* Some broken devices are known not to release the line during
* turn-around, e.g: Broadcom BCM53125 external switches, so check for
* that condition here and ignore the MDIO controller read failure
* indication.
*/
if (!(bus->phy_ignore_ta_mask & 1 << phy_id) && (cmd & MDIO_READ_FAIL))
return -EIO;
return cmd & 0xffff;
}
static int unimac_mdio_write(struct mii_bus *bus, int phy_id,
int reg, u16 val)
{
struct unimac_mdio_priv *priv = bus->priv;
u32 cmd;
/* Prepare the write operation */
cmd = MDIO_WR | (phy_id << MDIO_PMD_SHIFT) |
(reg << MDIO_REG_SHIFT) | (0xffff & val);
unimac_mdio_writel(priv, cmd, MDIO_CMD);
unimac_mdio_start(priv);
return priv->wait_func(priv->wait_func_data);
}
/* Workaround for integrated BCM7xxx Gigabit PHYs which have a problem with
* their internal MDIO management controller making them fail to successfully
* be read from or written to for the first transaction. We insert a dummy
* BMSR read here to make sure that phy_get_device() and get_phy_id() can
* correctly read the PHY MII_PHYSID1/2 registers and successfully register a
* PHY device for this peripheral.
*
* Once the PHY driver is registered, we can workaround subsequent reads from
* there (e.g: during system-wide power management).
*
* bus->reset is invoked before mdiobus_scan during mdiobus_register and is
* therefore the right location to stick that workaround. Since we do not want
* to read from non-existing PHYs, we either use bus->phy_mask or do a manual
* Device Tree scan to limit the search area.
*/
static int unimac_mdio_reset(struct mii_bus *bus)
{
struct device_node *np = bus->dev.of_node;
struct device_node *child;
u32 read_mask = 0;
int addr;
if (!np) {
read_mask = ~bus->phy_mask;
} else {
for_each_available_child_of_node(np, child) {
addr = of_mdio_parse_addr(&bus->dev, child);
if (addr < 0)
continue;
read_mask |= 1 << addr;
}
}
for (addr = 0; addr < PHY_MAX_ADDR; addr++) {
if (read_mask & 1 << addr) {
dev_dbg(&bus->dev, "Workaround for PHY @ %d\n", addr);
mdiobus_read(bus, addr, MII_BMSR);
}
}
return 0;
}
static int unimac_mdio_probe(struct platform_device *pdev)
{
struct unimac_mdio_pdata *pdata = pdev->dev.platform_data;
struct unimac_mdio_priv *priv;
struct device_node *np;
struct mii_bus *bus;
struct resource *r;
int ret;
np = pdev->dev.of_node;
priv = devm_kzalloc(&pdev->dev, sizeof(*priv), GFP_KERNEL);
if (!priv)
return -ENOMEM;
r = platform_get_resource(pdev, IORESOURCE_MEM, 0);
/* Just ioremap, as this MDIO block is usually integrated into an
* Ethernet MAC controller register range
*/
priv->base = devm_ioremap(&pdev->dev, r->start, resource_size(r));
if (!priv->base) {
dev_err(&pdev->dev, "failed to remap register\n");
return -ENOMEM;
}
priv->mii_bus = mdiobus_alloc();
if (!priv->mii_bus)
return -ENOMEM;
bus = priv->mii_bus;
bus->priv = priv;
if (pdata) {
bus->name = pdata->bus_name;
priv->wait_func = pdata->wait_func;
priv->wait_func_data = pdata->wait_func_data;
bus->phy_mask = ~pdata->phy_mask;
} else {
bus->name = "unimac MII bus";
priv->wait_func_data = priv;
priv->wait_func = unimac_mdio_poll;
}
bus->parent = &pdev->dev;
bus->read = unimac_mdio_read;
bus->write = unimac_mdio_write;
bus->reset = unimac_mdio_reset;
snprintf(bus->id, MII_BUS_ID_SIZE, "%s-%d", pdev->name, pdev->id);
ret = of_mdiobus_register(bus, np);
if (ret) {
dev_err(&pdev->dev, "MDIO bus registration failed\n");
goto out_mdio_free;
}
platform_set_drvdata(pdev, priv);
dev_info(&pdev->dev, "Broadcom UniMAC MDIO bus at 0x%p\n", priv->base);
return 0;
out_mdio_free:
mdiobus_free(bus);
return ret;
}
static int unimac_mdio_remove(struct platform_device *pdev)
{
struct unimac_mdio_priv *priv = platform_get_drvdata(pdev);
mdiobus_unregister(priv->mii_bus);
mdiobus_free(priv->mii_bus);
return 0;
}
static const struct of_device_id unimac_mdio_ids[] = {
{ .compatible = "brcm,genet-mdio-v5", },
{ .compatible = "brcm,genet-mdio-v4", },
{ .compatible = "brcm,genet-mdio-v3", },
{ .compatible = "brcm,genet-mdio-v2", },
{ .compatible = "brcm,genet-mdio-v1", },
{ .compatible = "brcm,unimac-mdio", },
{ /* sentinel */ },
};
MODULE_DEVICE_TABLE(of, unimac_mdio_ids);
static struct platform_driver unimac_mdio_driver = {
.driver = {
.name = UNIMAC_MDIO_DRV_NAME,
.of_match_table = unimac_mdio_ids,
},
.probe = unimac_mdio_probe,
.remove = unimac_mdio_remove,
};
module_platform_driver(unimac_mdio_driver);
MODULE_AUTHOR("Broadcom Corporation");
MODULE_DESCRIPTION("Broadcom UniMAC MDIO bus controller");
MODULE_LICENSE("GPL");
MODULE_ALIAS("platform:" UNIMAC_MDIO_DRV_NAME);
| {
"pile_set_name": "Github"
} |
Q:
Infima and Inequalities
This is a question about "taking the inf" that is done everywhere in analysis. I give one example here to make my question more concrete.
In the proof that the Lebesgue outer measure of intervals is equal to the length of the interval $[a,b]$, we take any cover of intervals $\{I_n\}$ and show that
$$\sum_{n=1}^\infty |I_n| \geq b-a,$$
as in equations 1-8 here.
Then, we "take the infinum of this set of numbers" and obtain that
$$m^*([a,b]) \geq b-a.$$
Why is it that we can take the infinum and the inequality still holds? Can we always do this? In the first inequality, we had that for any cover the inequality holds. But the infinum is not referring to a specific cover, it is rather the largest lower bound of all these numbers. Why is it not possible that this largest lower bound is less than $b-a$?
How can this be made more explicit? Perhaps by stating that for every $\epsilon >0$, there exists a specific cover $\{I'_n\}$ such that
$$m^*([a,b]) + \epsilon \geq \sum_{n=1}^\infty |I_n'| $$
and hence because the first inequality holds for any cover and we can take $\epsilon$ to be arbitrarily small,
$$m^*([a,b]) \geq b-a.$$
Is that "how infimums work" in this context?
A:
Your question is this: if we have a set $A$ and a number $\alpha$ such that $(\forall a\in A):a\geqslant\alpha$, then $\inf A\geqslant\alpha$. This is true, because we are assuming that $\alpha$ is a lower bound of $A$ and, by definition, $\inf A$ is the greatest lower bound of $A$.
| {
"pile_set_name": "StackExchange"
} |
Turkey - a Place for Destination Weddings
Getting married abroad is becoming more and more popular. The pull of being able to spend your momentous day in a spectacular setting, accompanied by the beautiful weather – and have a much more affordable wedding! – makes it hard to resist.
Turkey is one of the most popular countries for destination weddings, especially the elegant city of Fethiye and the picturesque towns surrounding it – Oludeniz, Gocek, Faralya, and others. The breathtaking scenery here is jaw-dopping even for the most seasoned traveller. Known for its magnificent forest covered mountains, piercing turquoise water and beautiful sandy beaches, Turkey also has a rich history. A unique fusion of the West and the East is evident in its culture, cuisine and architecture. Turkey is a treasure trove for lovers of history. Roman, Byzantine, Ottoman, Greek and other empires have all left their marks on the country, and there are many landmarks and ruins that are worth a visit.
The unique combination of Turkey’s nature, history and culture, alongside its reasonable prices, makes it one of the most tempting and affordable places for getting married, especially compared to Europe or the UK. Did you know the average cost of a wedding in the UK is now £27,000? For a fraction of that you can organise a wedding that would far exceed anything you could have had in the UK – not to mention the opportunity to plan something different to the norm.
Turkish cuisine is famed for its variety and taste. Baklava, the infamous kebabs, pastries, Turkish coffee – the list of gastro-economic delights could go on forever. There are many local delicacies, including wines, cheeses and olives. Restaurants will serve you plate upon plate of meze, fish and meat dishes – all prepared with fresh herbs, spices, organic vegetables and local olive oil. There are a large number of colourful markets, with original handmade goods, boutique clothing, antiques and traditional jewellery.
Turkey is famous for its hospitality. Ingrained in its culture and its businesses, the level of service in hotels and restaurants is unparalleled. Locals are friendly and welcoming, and the low crime rate and respect for foreigners make this a safe and ideal area.
Hosting a wedding in Turkey is an excellent opportunity to save on flight costs and get an all inclusive wedding package with a honeymoon. A large number of direct flights from numerous UK airports are available at reasonable prices. The visa system is simple, it can be bought cheaply online, ahead of time – there is no “application” process as such.
Turkey is surrounded by four different seas and has over 8000km worth of beaches, and therefore it is one of the most popular beach wedding venues. There are many activities you can partake in: paragliding, horse-riding, sailing, trekking, scuba-diving and many others.
We offer a large selection of wedding venues for getting married abroad: on a private beach; a luxury yacht; the terrace of a boutique hotel; in a chic restaurant overlooking the azure sea and mountains – and more.
We will assign a personal wedding planner for you who will take care of every last detail, from selecting a perfect wedding venue and developing the wedding concept and decor, to appointing entertainment shows and picking up cufflinks for the groom, should he has forgotten them – so that you can enjoy every moment of your celebration, and the build up to it. For years to come, perhaps while you are recalling the day to children or grandchildren, we guarantee that the smill will not yet have left your face! | {
"pile_set_name": "Pile-CC"
} |
Low Oil Prices Continue To Decimate Saudi Arabia’s Currency Reserves
The low oil price continues to wreak financial havoc on the largest oil producer in the Middle East. While the Mainstream press has published articles forecasting a rebound in Saudi Arabia’s financial outlook, due to higher oil prices this year, it seems like the Kingdom’s problems are just beginning.
In order to make up for falling oil revenues, Saudi Arabia has been liquidating its foreign currency reserves at a pretty good rate over the past two and a half years. I discussed this in my article, Bankrupting OPEC… One Million Barrels Of Oil At A Time. In that article I published this chart:
Due to the rapid oil price decline, Saudi Arabia liquidated 27% of its foreign currency reserves. At its peak, Saudi Arabia held $797 billion in foreign currency reserves. In just two and a half years, Saudi Arabia’s currency reserves declined $258 billion (U.S. Dollars) to $536 billion currently (Dec 2016).
I also published the following chart showing Saudi Arabia’s foreign currency reserves declined in 2016, even as the oil price recovered from a low of $30.7 in January to a high of $53.3 in December:
Now, what’s even more interesting… is that Saudi Arabia’s foreign currency reserves took another BIG HIT in January, by falling $12.5 billion in just one month:
Saudi Arabia’s foreign currency reserves fell from $536.3 billion in Dec 2016, to $523.8 billion in January. The chart displays the figures in Saudi Arabia Riyal. They were converted to U.S. Dollars. This is a pretty good drop in just one month. Moreover, this occurred even as the oil price increased to $54.6 a barrel in January versus $53.3 in December.
I would imagine some would assume that this fall in exchange reserves may have been due to the recent Saudi oil production cut. While it is true that Saudi Arabia has cut oil production, as well as exports, this only accounts for a small portion of the $12.5 billion decline in foreign currency reserves.
While Saudi Arabia has the ability to store crude — meaning that its exports aren’t perfectly correlated with production — a month-on-month decline in exports would support the country’s assertion it’s cutting back. Exports fell from about 7.16 million barrels a day in January, according to Bloomberg calculations based on industry standard cargo sizes.
Saudi Arabia exported about 7.64 million barrels a day in October, according to figures from the Joint Organisations Data Initiative. Riyadh-based JODI collates data including production and exports directly from countries. Shipments exceeded 8 million barrels a day in both November and December. The deal to cut supply took effect at the beginning of the year.
The article states that Saudi Arabia’s oil exports declined from 8+ million barrels per day in November and December, down to 7.16 million barrels per day in January. If we do some simple math, we have the following:
If we assume that Saudi Arabia was paid spot price of $54.58 for each barrel (they didn’t, they have long-term contracts), then they would have lost $1.7 billion in oil revenue for the 1 million barrel per day cut in exports in January. So, if we subtract the $1.7 billion in lost oil revenues in January from the $12.5 billion in foreign exchange reserve liquidation, there’s a difference of about $10.8 billion.
With the largest budget shortfall among the world’s 20 biggest economies, Saudi Arabia is planning more austerity measures this year. The kingdom will scrap projects worth more than $20 billion as it comes to terms with cheaper oil.
According to the Saudi government’s bond prospectus obtained by Bloomberg, capital expenditure is expected to fall to $20.6 billion (75.8 billion riyals) this year compared with $70.2 billion (263.7 billion riyals) in 2015. Two years ago, the country’s capital spending was $98.6 billion (370 billion riyals).
Saudi Arabia is in serious trouble if it has to cut its capital expenditures by 71% this year. In addition, the Kingdom is placing its hope on the upcoming Saudi Aramco IPO. Saudi Aramco values its assets at $2 trillion and its five percent initial offering could be worth $200 billion. However, Wood Mackenzie believes Saudi Aramco’s assets are worth much less…. 80% less. From the article linked above:
Now, analysts at Wood Mackenzie have conducted their own study of Saudi Aramco, and came up with a completely different (and much lower) figure. WoodMac puts Aramco’s true value closer to $400 billion, eighty percent less than the Saudi estimate, and it arrived at the figure by considering future demand and the anticipated average price of oil (on which profits will depend), as well as Saudi Aramco’s status as a state-run company.
If I had to choose between these two different asset valuations, I would probably side with Wood Mackenzie. I have read several of their reports and trust their figures over the Saudi’s as they are more objective. Regardless, if the oil price continues to decline, Saudi Arabia will likely have to liquidate more of its foreign currency reserves to fill in the gap from insufficient oil export revenues.
According to the data by the EIA – U.S. Energy Information Agency, Saudi Arabia’s oil export revenues fell nearly 50% from $247 billion in 2014 down to $130 billion in 2015. And the figures for 2016 were even worse. The EIA only has data for the first five months of the year, which reports Saudi Arabia’s oil export revenue was a measly $39 billion. Even though the oil price rebounded towards the end of the year, Saudi Arabia’s oil export revenue was probably less than $110 billion in 2016.
Investors need to keep an eye on the U.S. and global oil industries this year. If we do see continued weakness in the oil price, this could spell BIG TROUBLE for an industry that is the backbone of the global economy.
“Looking for other alternatives” was path that always was available. As the Saudi’s suffer from lower revenue, caused by the major competition coming from US fracking and other technological advances, there are dwindling cash reserves to pay to keep its population docile. The alternatives that I expect to be used are lower social payments and more authoritarian suppression of dissent. | {
"pile_set_name": "Pile-CC"
} |
Isotachophoresis for the determination of oxalate in unprocessed urine.
The principle of isotachophoresis has been used to develop a simple, specific and sensitive analytical procedure for the determination of oxalate in unprocessed urine. Analytical conditions were optimized. The accuracy and precision of the method were estimated. The specificity was checked with oxalate decarboxylase. Separation of oxalate from a number of organic acids was achieved. The influence of factors such as storage, calcium concentration, pH or ionic strength was examined. The 24-h urine excretion rates for healthy children, healthy adults and for patients with idiopathic stone formation were established. Lower absolute excretion rates were found in children and females. Urinary oxalate/creatinine ratios were higher in children than in adults. The mean oxalate excretion in 24-h urines of adult healthy individuals was 413 +/- 150 mumol per 24 h per 1.73 m2 (range 195-732). The mean oxalate/creatinine ratio was 0.033 +/- 0.011 (range 0.018-0.065). | {
"pile_set_name": "PubMed Abstracts"
} |
Windows 10 marks the end of 'pay once, use forever' software - aceperry
http://www.theregister.co.uk/2015/07/31/rising_and_ongoing_cost_of_windows/
======
chmike
I have my finger hanging over the mouse button ready to click install Ubuntu.
I'm not a cash cow waiting to be milked.
~~~
Rockdtben
I will be switching to Ubuntu as well. I have encouraged my friends to do the
same.
------
teaneedz
What will Microsoft be doing a year from now in regards to pricing and
services? This really requires some clarity, because so far Win10 is not
looking good from a privacy perspective IMO. It's not easy to recommend an
upgrade right now with so much unanswered questions regarding data usage and
price roadmap. What is their strategy after the first year?
~~~
matthewarkin
Pricing for Windows 10 has been announced, $110 for Home and $199 for Pro. You
have 1 year to upgrade for free, then you have a license for Windows 10
forever for that machine and you'll be supported for the lifetime of that
device (as defined by Microsoft). If you don't upgrade within that year then
you'd have to pay for the upgrade.
| {
"pile_set_name": "HackerNews"
} |
---
abstract: 'We propose a construction of string cohomology spaces for Calabi-Yau hypersurfaces that arise in Batyrev’s mirror symmetry construction. The spaces are defined explicitly in terms of the corresponding reflexive polyhedra in a mirror-symmetric manner. We draw connections with other approaches to the string cohomology, in particular with the work of Chen and Ruan.'
address:
- 'Department of Mathematics, Columbia University, New York, NY 10027, USA'
- 'Max-Planck-Institut für Mathematik, Bonn, D-53111, Germany'
author:
- 'Lev A. Borisov'
- 'Anvar R. Mavlyutov'
title: 'String cohomology of Calabi-Yau hypersurfaces via Mirror Symmetry'
---
Å[[A]{}]{}
\[section\] \[thm\][Lemma]{} \[thm\][Corollary]{} \[thm\][Proposition]{}
\[thm\][Remark]{} \[thm\][Example]{} \[thm\][Definition]{} \[thm\][Conjecture]{} \[thm\][Conjectural Definition]{}
Introduction {#section.intro}
============
The notion of orbifold cohomology has appeared in physics as a result of studying the string theory on orbifold global quotients, (see [@dhvw]). In addition to the usual cohomology of the quotient, this space was supposed to include the so-called twisted sectors, whose existence was predicted by the modular invariance condition on the partition function of the theory. Since then, there have been several attempts to give a rigorous mathematical formulation of this cohomology theory. The first two, due to [@bd] and [@Batyrev.cangor], tried to define the topological invariants of certain algebraic varieties (including orbifold global quotients) that should correspond to the dimensions of the Hodge components of a conjectural string cohomology space. These invariants should have the property arising naturally from physics: they are preserved by partial crepant resolutions; moreover, they coincide with the usual Hodge numbers for smooth varieties. Also, these invariants must be the same as those defined by physicists for orbifold global quotients. In [@Batyrev.cangor; @Batyrev.nai], Batyrev has successfully solved this problem for a large class of singular algebraic varieties. The first mathematical definition of the orbifold cohomology [*space*]{} was given in [@cr] for arbitrary orbifolds. Moreover, this orbifold cohomology possesses a product structure arising as a limit of a natural quantum product. It is still not entirely clear if the dimensions of the Chen-Ruan cohomology coincide with the prescription of Batyrev whenever both are defined, but they do give the same result for reduced global orbifolds.
In this paper, we propose a construction of string cohomology spaces for Calabi-Yau hypersurfaces that arise in the Batyrev mirror symmetry construction (see [@b2]), with the spaces defined rather explicitly in terms of the corresponding reflexive polyhedra. A peculiar feature of our construction is that instead of a single string cohomology space we construct a finite-dimensional family of such spaces, which is consistent with the physicists’ picture (see [@Greene]). We verify that this construction is consistent with the previous definitions in [@bd], [@Batyrev.cangor] and [@cr], in the following sense. The (bigraded) dimension of our space coincides with the definitions of [@bd] and [@Batyrev.cangor]. In the case of hypersurfaces that have only orbifold singularities, we recover Chen-Ruan’s orbifold cohomology as one special element of this family of string cohomology spaces. We also conjecture a partial natural ring structure on our string cohomology space, which is in correspondence with the cohomology ring of crepant resolutions. This may be used as a real test of the Chen-Ruan orbifold cohomology ring. We go further, and conjecture the B-model chiral ring on the string cohomology space. This is again consistent with the description of the B-model chiral ring of smooth Calabi-Yau hypersurfaces in [@m2].
Our construction of the string cohomology space for Calabi-Yau hypersurfaces is motivated by Mirror Symmetry. Namely, the description in [@m3] of the cohomology of semiample hypersurfaces in toric varieties applies to the smooth Calabi-Yau hypersurfaces in [@b2]. Analysis of Mirror Symmetry on this cohomology leads to a natural construction of the string cohomology space for all semiample Calabi-Yau hypersurfaces. As already mentioned, our string cohomology space depends not only on the complex structure (the defining polynomial $f$), but also on some extra parameter we call $\omega$. For special values of this parameter of an orbifold Calabi-Yau hypersurface, we get the orbifold Dolbeault cohomology of [@cr]. However, for non-orbifold Calabi-Yau hypersurfaces, there is no natural special choice of $\omega$, which means that the general definition of the string cohomology space should depend on some mysterious extra parameter. In the situation of Calabi-Yau hypersurfaces, the parameter $\omega$ corresponds to the defining polynomial of the mirror Calabi-Yau hypersurface. In general, we expect that this parameter should be related to the “stringy complexified Kähler class”, which is yet to be defined.
In an attempt to extend our definitions beyond the Calabi-Yau hypersurface case, we give a conjectural definition of string cohomology vector spaces for stratified varieties with $\QQ$-Gorenstein toroidal singularities that satisfy certain restrictions on the types of singular strata. This definition involves intersection cohomology of the closures of strata, and we check that it produces spaces of correct bigraded dimension. It also reproduces orbifold cohomology of a $\QQ$-Gorenstein toric variety as a special case.
Here is an outline of our paper. In Section \[s:sth\], we examine the connection between the original definition of the [*string-theoretic*]{} Hodge numbers in [@bd] and the [*stringy*]{} Hodge numbers in [@Batyrev.cangor]. We point out that these do not always give the same result and argue that the latter definition is the more useful one. In Section \[section.mirr\], we briefly review the mirror symmetry construction of Batyrev, mainly to fix our notations and to describe the properties we will use in the derivation of the string cohomology. Section \[section.anvar\] describes the cohomology of semiample hypersurfaces in toric varieties and explains how mirror symmetry provides a conjectural definition of the string cohomology of Calabi-Yau hypersurfaces. It culminates in Conjecture \[semiampleconj\], where we define the stringy Hodge spaces of semiample Calabi-Yau hypersurfaces in complete toric varieties. We spend most of the remainder of the paper establishing the expected properties of the string cohomology space. Sections \[s:hd\] and \[section.brel\] calculate the dimensions of the building blocks of our cohomology spaces. In Section \[section.brel\], we develop a theory of deformed semigroup rings which may be of independent interest. This allows us to show in Section \[section.bbo\] that Conjecture \[semiampleconj\] is compatible with the definition of the stringy Hodge numbers from [@Batyrev.cangor]. In the non-simplicial case, this requires the use of $G$-polynomials of Eulerian posets, whose relevant properties are collected in the Appendix. Having established that the dimension is correct, we try to extend our construction to the non-hypersurface case. Section \[section.general\] gives another conjectural definition of the string cohomology vector space in a somewhat more general situation. It hints that the intersection cohomology and the perverse sheaves should play a prominent role in future definitions of string cohomology. In Section \[s:vs\], we connect our work with that of Chen-Ruan [@cr] and Poddar [@p]. Finally, in Section \[section.vertex\], we provide yet another description of the string cohomology of Calabi-Yau hypersurfaces, which was inspired by the vertex algebra approach to Mirror Symmetry.
[*Acknowledgments.*]{} We thank Victor Batyrev, Robert Friedman, Mainak Poddar, Yongbin Ruan and Richard Stanley for helpful conversations and useful references. The second author also thanks the Max-Planck Institut für Mathematik in Bonn for its hospitality and support.
String-theoretic and stringy Hodge numbers {#s:sth}
==========================================
The [*string-theoretic*]{} Hodge numbers were first defined in the paper of Batyrev and Dais (see [@bd]) for varieties with Gorenstein toroidal or quotient singularities. In subsequent papers [@Batyrev.cangor; @Batyrev.nai] Batyrev defined [*stringy*]{} Hodge numbers for arbitrary varieties with log-terminal singularities. To our knowledge, the relationship between these two concepts has never been clarified in the literature. The goal of this section is to show that the string-theoretic Hodge numbers coincide with the stringy ones under some conditions on the singular strata.
We begin with the definition of the string-theoretic Hodge numbers.
\[d:bd\] [@bd] Let $X = \bigcup_{i \in I} X_i$ be a stratified algebraic variety over $\CC$ with at most Gorenstein toroidal singularities such that for each $i \in I$ the singularities of $X$ along the stratum $X_i$ of codimension $k_i$ are defined by a $k_i$-dimensional finite rational polyhedral cone $\sigma_i$; i.e., $X$ is locally isomorphic to $${\CC}^{k-k_i} \times U_{\sigma_i}$$ at each point $x \in X_i$, where $U_{\sigma_i}$ is a $k_i$-dimensional affine toric variety which is associated with the cone $\sigma_i$ (see [@d]), and $k=\dim X$. Then the polynomial $$E^{\rm BD}_{\rm
st}(X;u,v) := \sum_{i \in I} E(X_i;u,v) \cdot S(\sigma_i,uv)$$ is called the [*string-theoretic E-polynomial*]{} of $X$. Here, $$S(\sigma_i,t):=(1-t)^{\dim \sigma_i}\sum_{n\in \sigma_i} t^{\deg
n}= (t-1)^{\dim \sigma_i}\sum_{n\in {\rm int} \sigma_i} t^{-\deg
n}$$ where $\deg$ is the linear function on $\sigma_i$ that takes value $1$ on the generators of one-dimensional faces of $\sigma_i$, and ${\rm int}\sigma_i$ is the relative interior of $\sigma_i$. If we write $E_{\rm st}(X; u,v)$ in the form $$E^{\rm
BD}_{\rm st}(X;u,v) = \sum_{p,q} a_{p,q} u^{p}v^{q},$$ then the numbers $h^{p,q{\rm (BD)}}_{\rm st}(X) := (-1)^{p+q}a_{p,q}$ are called the [*string-theoretic Hodge numbers*]{} of $X$.
\[r:epol\] The E-polynomial in the above definition is defined for an arbitrary algebraic variety $X$ as $$E(X;u,v)=\sum_{p,q}e^{p,q}u^p v^q,$$ where $e^{p,q}=\sum_{k\ge0}(-1)^k h^{p,q}(H^k_c(X))$.
Stringy Hodge numbers of $X$ are defined in terms of the resolutions of its singularities. In general, one can only define the $E$-function in this case, which may or not be a polynomial. We refer to [@Kollar] for the definitions of log-terminal singularities and related issues.
\[d:bcangor\][@Batyrev.cangor] Let $X$ be a normal irreducible algebraic variety with at worst log-terminal singularities, $\rho\, : \, Y \rightarrow
X$ a resolution of singularities such that the irreducible components $D_1, \ldots, D_r$ of the exceptional locus is a divisor with simple normal crossings. Let $\alpha_j>-1$ be the discrepancy of $D_j$, see [@Kollar]. Set $I: = \{1, \ldots, r\}$. For any subset $J \subset I$ we consider $$D_J := \left\{ \begin{array}{ll}
\bigcap_{ j \in J} D_j & \mbox{\rm if $J \neq \emptyset$}
\\
Y & \mbox{\rm if $J = \emptyset$} \end{array} \right. \;\;\;\;
\;\;\;\; \,\mbox{\rm and} \;\;\;\; \;\;\;\; D_J^{\circ} := D_J
\setminus \bigcup_{ j \in\, I \setminus J} D_j.$$ We define an algebraic function $E_{\rm st}(X; u,v)$ in two variables $u$ and $v$ as follows: $$E_{\rm st}(X; u,v) := \sum_{J \subset I}
E(D_J^{\circ}; u,v) \prod_{j \in J} \frac{uv-1}{(uv)^{a_j +1} -1}$$ (it is assumed $\prod_{j \in J}$ to be $1$, if $J =
\emptyset$). We call $E_{\rm st}(X; u,v)$ [*the stringy $E$-function of*]{} $X$. If $E_{\rm st}(X; u,v)$ is a polynomial, define the stringy Hodge numbers the same way as Definition \[d:bd\] does.
It is not obvious at all that the above definition is independent of the choice of the resolution. The original proof of Batyrev uses a motivic integration over the spaces of arcs to relate the $E$-functions obtained via different resolutions. Since the work of D. Abramovich, K. Karu, K. Matsuki, J. Włodarsczyk [@AKMW], it is now possible to check the independence from the resolution by looking at the case of a single blowup with a smooth center compatible with the normal crossing condition.
\[strataE\] Let $X$ be a disjoint union of strata $X_i$, which are locally closed in Zariski topology, and let $\rho$ be a resolution as in Definition \[d:bcangor\]. For each $X_i$ consider $$E_{\rm st}(X_i\subseteq X; u,v) := \sum_{J \subset I}
E(D_J^{\circ}\cap \rho^{-1}(X_i); u,v)
\prod_{j \in J}
\frac{uv-1}{(uv)^{a_j +1} -1}.$$ Then this $E$-function is independent of the choice of the resolution $Y$. The $E$-function of $X$ decomposes as $$E_{\rm st}(X;u,v) = \sum_i E_{\rm st}(X_i\subseteq X; u,v).$$
[*Proof.*]{} Each resolution of $X$ induces a resolution of the complement of $\bar{X_i}$. This shows that for each $X_i$ the sum $$\sum_{j,X_j\subseteq \bar{X_i}} E_{\rm st}(X_j\subseteq X; u,v)$$ is independent from the choice of the resolution and is thus well-defined. Then one uses the induction on dimension of $X_i$. The last statement is clear.
It is a delicate question what data are really necessary to calculate $E_{\rm st}(X_i\subseteq X; u,v)$. It is clear that the knowledge of a Zariski open set of $X$ containing $X_i$ is enough. However, it is not clear whether it is enough to know an analytic neighborhood of $X_i$.
We will use the above lemma to show that the string-theoretic Hodge numbers and the stringy Hodge numbers coincide in a wide class of examples.
\[BDvsB\] Let $X=\bigcup_i X_i$ be a stratified algebraic variety with at worst Gorenstein toroidal singularities as in Definition \[d:bd\]. Assume in addition that for each $i$ there is a desingularization $Y$ of $X$ so that its restriction to the preimage of $X_i$ is a locally trivial fibration in Zariski topology. Moreover, for a point $x\in X_i$ the preimage in $Y$ of an analytic neighborhood of $x$ is complex-analytically isomorphic to a preimage of a neighborhood of $\{0\}$ in $U_{\sigma_i}$ under some resolution of singularities of $U_{\sigma_i}$, times a complex disc, so that the isomorphism is compatible with the resolution morphisms. Then $$E_{\rm st}^{\rm BD}(X;u,v) = E_{\rm st}(X;u,v).$$
[*Proof.*]{} Since $E$-polynomials are multiplicative for Zariski locally trivial fibrations (see [@dk]), the above assumptions on the singularities show that $$E_{\rm st}(X_i\subseteq X; u,v) =
E(X_i;u,v)E_{\rm st}(\{0\}\subseteq U_{\sigma_i};u,v).$$ We have also used here the fact that since the fibers are projective, the analytic isomorphism implies the algebraic one, by GAGA. By the second statement of Lemma \[strataE\], it is enough to show that $$E_{\rm st}(\{0\}\subseteq U_{\sigma_i};u,v) = S(\sigma_i,uv).$$ This result follows from the proof of [@Batyrev.cangor], Theorem 4.3 where the products $$\prod_{j \in J}
\frac{uv-1}{(uv)^{a_j +1} -1}$$ are interpreted as a geometric series and then as sums of $t^{\deg(n)}$ over points $n$ of $\sigma_i$.
String-theoretic and stringy Hodge numbers coincide for nondegenerate hypersurfaces (complete intersections) in Gorenstein toric varieties.
Indeed, in this case, the toric desingularizations of the ambient toric variety induce the desingularizations with the required properties.
We will keep this corollary in mind and from now on will silently transfer all the results on string-theoretic Hodge numbers of hypersurfaces and complete intersections in toric varieties in [@bb], [@bd] to their stringy counterparts.
An example of the variety where string-theoretic and stringy Hodge numbers [*differ*]{} is provided by the quotient of $\CC^2\times E$ by the finite group of order six generated by $$r_1:(x,y;z)\mapsto (x\ee^{2\pi\ii/3},y\ee^{-2\pi\ii/3};z),~
r_2:(x,y;z)\mapsto(y,x;z+p)$$ where $(x,y)$ are coordinates on $\CC^2$, $z$ is the uniformizing coordinate on the elliptic curve $E$ and $p$ is a point of order two on $E$. In its natural stratification, the quotient has a stratum of $A_2$ singularities, so that going around a loop in the stratum results in the non-trivial automorphism of the singularity.
We expect that the stringy Hodge numbers of algebraic varieties with abelian quotient singularities coincide with the dimensions of their orbifold cohomology, [@cr]. This is not going to be true for the string-theoretic Hodge numbers. Also, the latter numbers are not preserved by the partial crepant resolutions as required by physics, see the above example. As a result, we believe that the stringy Hodge numbers are the truly interesting invariant, and that the string-theoretic numbers is a now obsolete first attempt to define them.
Mirror symmetry construction of Batyrev {#section.mirr}
=======================================
In this section, we review the mirror symmetry construction from [@b2]. We can describe it starting with a semiample nondegenerate (transversal to the torus orbits) anticanonical hypersurface $X$ in a complete simplicial toric variety ${{{\PP}_{\Sigma}}}$. Such a hypersurface is Calabi-Yau. The semiampleness property produces a contraction map, the unique properties of which are characterized by the following statement.
\[p:sem\] [@m1] Let $\PP_\Sigma$ be a complete toric variety with a big and nef divisor class $[X]\in A_{d-1}({{{\PP}_{\Sigma}}})$. Then, there exists a unique complete toric variety ${{\PP}_{\Sigma_X}}$ with a toric birational map $\pi:{{{\PP}_{\Sigma}}}@>>>{{\PP}_{\Sigma_X}}$, such that $\Sigma$ is a subdivision of $\Sigma_X$, $\pi_*[X]$ is ample and $\pi^*\pi_*[X]=[X]$. Moreover, if $X=\sum_{\rho}a_\rho D_\rho$ is torus-invariant, then $\Sigma_X$ is the normal fan of the associated polytope $$\Delta_X=\{m\in M:\langle m,e_\rho\rangle\geq-a_\rho
\text{ for all } \rho\}\subset M_{\Bbb R}.$$
Our notation is a standard one taken from [@bc; @c2]: $M$ is a lattice of rank $d$; $N=\text{Hom}(M,{\Bbb Z})$ is the dual lattice; $M_{\Bbb R}$ and $N_{\Bbb R}$ are the $\Bbb R$-scalar extensions of $M$ and $N$; $\Sigma$ is a finite rational polyhedral fan in $N_{\Bbb R}$; ${\PP}_{\Sigma}$ is a $d$-dimensional toric variety associated with $\Sigma$; $\Sigma(k)$ is the set of all $k$-dimensional cones in $\Sigma$; $e_\rho$ is the minimal integral generator of the $1$-dimensional cone $\rho\in\Sigma$ corresponding to a torus invariant irreducible divisor $D_\rho$.
Applying Proposition \[p:sem\] to the semiample Calabi-Yau hypersurface, we get that the push-forward $\pi_*[X]$ is anticanonical and ample, whence, by Lemma 3.5.2 in [@ck], the toric variety ${{\PP}_{\Sigma_X}}$ is Fano, associated with the polytope $\Delta\subset M_{\Bbb R}$ of the anticanonical divisor $\sum_{\rho} D_{\rho}$ on ${{{\PP}_{\Sigma}}}$. Then, [@m1 Proposition 2.4] shows that the image $Y:=\pi(X)$ is an ample nondegenerate hypersurface in ${{\PP}_{\Sigma_X}}={{\PP}}_\Delta$. The fact that ${{\PP}}_\Delta$ is Fano means by Proposition 3.5.5 in [@ck] that the polytope $\Delta$ is reflexive, i.e., its dual $$\Delta^*=\{n\in N_{\Bbb R}: \langle m,n\rangle\ge-1\text{ for } m\in\Delta\}$$ has all its vertices at lattice points in $N$, and the only lattice point in the interior of $\Delta^*$ is the origin $0$. Now, consider the toric variety ${{\PP}}_{\Delta^*}$ associated to the polytope $\Delta^*$ (the minimal integral generators of its fan are precisely the vertices of $\Delta$). Theorem 4.1.9 in [@b2] says that an anticanonical nondegenerate hypersurface $Y^*\subset{{\PP}}_{\Delta^*}$ is a Calabi-Yau variety with canonical singularities. The Calabi-Yau hypersurface $Y^*$ is expected to be a mirror of $Y$. In particular, they pass the topological mirror symmetry test for the stringy Hodge numbers: $$h^{p,q}_{\rm st}(Y)=h_{\rm st}^{d-1-p,q}(Y^*), 0\le p,q\le d-1,$$ by [@bb Theorem 4.15]. Moreover, all crepant partial resolutions $X$ of $Y$ have the same stringy Hodge numbers: $$h^{p,q}_{\rm st}(X)=h^{p,q}_{\rm st}(Y).$$ Physicists predict that such resolutions of Calabi-Yau varieties have indistinguishable physical theories. Hence, all crepant partial resolutions of $Y$ may be called the mirrors of crepant partial resolutions of $Y^*$. To connect this to the classical formulation of mirror symmetry, one needs to note that if there exist crepant smooth resolutions $X$ and $X^*$ of $Y$ and $Y^*$, respectively, then $$h^{p,q}(X)=h^{d-1-p,q}(X^*), 0\le p,q\le d-1,$$ since the stringy Hodge numbers coincide with the usual ones for smooth Calabi-Yau varieties. The equality of Hodge numbers is expected to extend to an isomorphism ([*mirror map*]{}) of the corresponding Hodge spaces, which is compatible with the chiral ring products of A and B models (see [@ck] for more details).
String cohomology construction for Calabi-Yau hypersurfaces {#section.anvar}
===========================================================
In this section, we show how the description of cohomology of semiample hypersurfaces in [@m3] leads to a construction of the string cohomology space of Calabi-Yau hypersurfaces. We first review the building blocks participating in the description of the cohomology in [@m3], and then explain how these building blocks should interchange under mirror symmetry for a pair of smooth Calabi-Yau hypersurfaces in Batyrev’s mirror symmetry construction. Mirror symmetry and the fact that the dimension of the string cohomology is the same for all partial crepant resolutions of ample Calabi-Yau hypersurfaces leads us to a conjectural description of string cohomology for all semiample Calabi-Yau hypersurfaces. In the next three sections, we will prove that this space has the dimension prescribed by [@bd].
The cohomology of a semiample nondegenerate hypersurface $X$ in a complete simplicial toric variety ${{{\PP}_{\Sigma}}}$ splits into the [*toric*]{} and [*residue*]{} parts: $$H^*(X)=H^*_{\rm toric}(X)\oplus H^*_{\rm res}(X),$$ where the first part is the image of the cohomology of the ambient space, while the second is the residue map image of the cohomology of the complement to the hypersurface. By [@m2 Theorem 5.1], $$\label{e:ann}
H^*_{\rm toric}(X)\cong H^*({{{\PP}_{\Sigma}}})/Ann(X)$$ where $Ann(X)$ is the annihilator of the class $[X]\in H^2({{{\PP}_{\Sigma}}})$. The cohomology of ${{{\PP}_{\Sigma}}}$ is isomorphic to $${\Bbb C}[D_\rho:\rho\in\Sigma(1)]/(P(\Sigma)+SR(\Sigma)),$$ where $$P(\Sigma)=\biggl\langle \sum_{\rho\in\Sigma(1)}\langle m,e_\rho\rangle D_\rho:
m\in M\biggr\rangle$$ is the ideal of linear relations among the divisors, and $$SR(\Sigma)=\bigl\langle D_{\rho_1}\cdots D_{\rho_k}:\{e_{\rho_1},\dots,e_{\rho_k}\}
\not\subset\sigma
\text{ for all }\sigma\in\Sigma\bigr\rangle$$ is the Stanley-Reisner ideal. Hence, $H^{*}_{\rm toric}(X)$ is isomorphic to the bigraded ring $$T(X)_{*,*}:={\Bbb C}[D_\rho:\rho\in\Sigma(1)]/I,$$ where $I=(P(\Sigma)+SR(\Sigma)):[X]$ is the ideal quotient, and $D_\rho$ have the degree $(1,1)$.
The following modules over the ring $T(X)$ have appeared in the description of cohomology of semiample hypersurfaces:
Given a big and nef class $[X]\in A_{d-1}({{{\PP}_{\Sigma}}})$ and $\sigma\in\Sigma_X$, let $$U^\sigma(X)=\biggl\langle \prod_{\rho\subset\gamma\in\Sigma}D_\rho:
{{\rm int}}\gamma\subset{{\rm int}}\sigma\biggr\rangle$$ be the bigraded ideal in ${\Bbb C}[D_\rho:\rho\in\Sigma(1)]$, where $D_\rho$ have the degree (1,1). Define the bigraded space $$T^\sigma(X)_{*,*}=U^\sigma(X)_{*,*}/I^\sigma,$$ where $$I^\sigma=\{u\in U^\sigma(X)_{*,*}:\,uvX^{d-\dim\sigma}
\in(P(\Sigma)+SR(\Sigma))\text{ for }v\in U^\sigma(X)_{\dim\sigma-*,\dim\sigma-*}\}.$$
Next, recall from [@c] that [*any*]{} toric variety ${{{\PP}_{\Sigma}}}$ has a homogeneous coordinate ring $$S({{{\PP}_{\Sigma}}})={\Bbb C}[x_\rho:\rho\in\Sigma(1)]$$ with variables $x_\rho$ corresponding to the irreducible torus invariant divisors $D_\rho$. This ring is graded by the Chow group $A_{d-1}({{{\PP}_{\Sigma}}})$, assigning $[\sum_{\rho} a_\rho D_\rho]$ to $\deg(\prod_{\rho} x_\rho^{a_\rho})$. For a Weil divisor $D$ on ${{{\PP}_{\Sigma}}}$, there is an isomorphism $H^0({{{\PP}_{\Sigma}}}, O_{{{\PP}_{\Sigma}}}(D))\cong S({{{\PP}_{\Sigma}}})_\alpha$, where $\alpha=[D]\in A_{d-1}({{{\PP}_{\Sigma}}})$. If $D$ is torus invariant, the monomials in $S({{{\PP}_{\Sigma}}})_\alpha$ correspond to the lattice points of the associated polyhedron $\Delta_D$.
In [@bc], the following rings have been used to describe the residue part of cohomology of ample hypersurfaces in complete simplicial toric varieties:
\[d:r1\] [@bc] Given $f\in S({{{\PP}_{\Sigma}}})_\beta$, set $J_0(f):=\langle x_\rho\partial f/\partial x_\rho:\rho\in\Sigma(1)\rangle$ and $J_1(f):=J_0(f):x_1\cdots x_n$. Then define the rings $R_0(f)=S({{{\PP}_{\Sigma}}})/J_0(f)$ and $R_1(f)=S({{{\PP}_{\Sigma}}})/J_1(f)$, which are graded by the Chow group $A_{d-1}({{{\PP}_{\Sigma}}})$.
In [@m3 Definition 6.5], similar rings were introduced to describe the residue part of cohomology of semiample hypersurfaces:
\[d:rs1\] [@m3] Given $f\in S({{{\PP}_{\Sigma}}})_\beta$ of big and nef degree $\beta=[D]\in A_{d-1}({{{\PP}_{\Sigma}}})$ and $\sigma\in\Sigma_D$, let $J^\sigma_0(f)$ be the ideal in $S({{{\PP}_{\Sigma}}})$ generated by $x_\rho\partial f/\partial x_\rho$, $\rho\in\Sigma(1)$ and all $x_{\rho'}$ such that $\rho'\subset\sigma$, and let $J^\sigma_1(f)$ be the ideal quotient $J^\sigma_0(f):(\prod_{\rho\not\subset\sigma}x_\rho)$. Then we get the quotient rings $R_0^\sigma(f)=S({{{\PP}_{\Sigma}}})/J_0^\sigma(f)$ and $R_1^\sigma(f)=S({{{\PP}_{\Sigma}}})/J_1^\sigma(f)$ graded by the Chow group $A_{d-1}({{{\PP}_{\Sigma}}})$.
As a special case of [@m3 Theorem 2.11], we have:
\[t:main\] Let $X$ be an anticanonical semiample nondegenerate hypersurface defined by $f\in S_\beta$ in a complete simplicial toric variety ${{{\PP}_{\Sigma}}}$. Then there is a natural isomorphism $$\bigoplus_{p,q}H^{p,q}(X)\cong\bigoplus_{p,q} T(X)_{p,q}\oplus\biggl(\bigoplus_{\sigma\in\Sigma_X}
T^\sigma(X)_{s,s}
\otimes R^\sigma_1(f)_{(q-s)\beta+\beta_1^\sigma}\biggr),$$ where $s=(p+q-d+\dim\sigma+1)/2$ and $\beta_1^\sigma=
\deg(\prod_{\rho_k\subset\sigma}x_k)$.
By the next statement, we can immediately see that all the building blocks $R^\sigma_1(f)_{(q-s)\beta+\beta_1^\sigma}$ of the cohomology of partial resolutions in Theorem \[t:main\] are independent of the resolution and intrinsic to an ample Calabi-Yau hypersurface:
\[p:iso\] [@m3] Let $X$ be a big and nef nondegenerate hypersurface defined by $f\in S_\beta$ in a complete toric variety ${{{\PP}_{\Sigma}}}$ with the associated contraction map $\pi:{{{\PP}_{\Sigma}}}@>>>{{\PP}_{\Sigma_X}}$. If $f_\sigma\in S(V(\sigma))_{\beta^\sigma}$ denotes the polynomial defining the hypersurface $\pi(X)\cap V(\sigma)$ in the toric variety $V(\sigma)\subset{{\PP}_{\Sigma_X}}$ corresponding to $\sigma\in\Sigma_X$, then, there is a natural isomorphism induced by the pull-back: $$H^{d(\sigma)-*,*-1}H^{d(\sigma)-1}(\pi(X)\cap{{\TT}_\sigma})\cong
R_1(f_{\sigma})_{*\beta^{\sigma}-\beta_0^{\sigma}}{\cong}
R^\sigma_1(f)_{*\beta-\beta_0+\beta_1^\sigma},$$ where $d(\sigma)=d-\dim\sigma$, ${{\TT}_\sigma}\subset V(\sigma)$ is the maximal torus, and $\beta_0$ and $\beta_0^{\sigma}$ denote the anticanonical degrees on ${{{\PP}_{\Sigma}}}$ and $V(\sigma)$, respectively.
Given a mirror pair $(X,X^*)$ of smooth Calabi-Yau hypersurfaces in Batyrev’s construction, we expect that, for a pair of cones $\sigma$ and $\sigma^*$ over the dual faces of the reflexive polytopes $\Delta^*$ and $\Delta$, $T^{\sigma}(X)_{s,s}$ with $s=(p+q-d+\dim\sigma+1)/2$, in $H^{p,q}(X)$ interchanges, by the mirror map (the isomorphism which maps the quantum cohomology of one Calabi-Yau hypersurface to the B-model chiral ring of the other one), with $R^{\sigma^*}_1(g)_{(p+q-\dim\sigma^*)\beta^*/2+\beta_1^{\sigma^*}}$ in $H^{d-1-p,q}(X^*)$ (note that $\dim\sigma^*=d-\dim\sigma+1$), where $g\in S({{\PP}}_{\Sigma^*})_{\beta^*}$ determines $X^*$. For the 0-dimensional cones $\sigma$ and $\sigma^*$, the interchange goes between the [*polynomial part*]{} $R_1(g)_{*\beta^*}$ of one smooth Calabi-Yau hypersurface and the toric part of the cohomology of the other one. This correspondence was already confirmed by the construction of the generalized monomial-divisor mirror map in [@m3]. On the other hand, one can deduce that the dimensions of these spaces coincide for the pair of 3-dimensional smooth Calabi-Yau hypersurfaces, by using Remark 5.3 in [@m1]. The correspondence between the toric and polynomial parts was discussed in [@ck].
Now, let us turn our attention to a mirror pair of semiample singular Calabi-Yau hypersurfaces $Y$ and $Y^*$. We know that their string cohomology should have the same dimension as the usual cohomology of possible crepant smooth resolutions $X$ and $X^*$, respectively. Moreover, the A-model and B-model chiral rings on the string cohomology should be isomorphic for $X$ and $X^*$, respectively. We also know that the polynomial $g$ represents the complex structure of the hypersurface $Y^*$ and its resolution $X^*$, and, by mirror symmetry, $g$ should correspond to the complexified Kähler class of the mirror Calabi-Yau hypersurface. Therefore, based on the mirror correspondence of smooth Calabi-Yau hypersurfaces, we make the following prediction for the small quantum ring presentation on the string cohomology space: $$\label{e:conj}
QH_{\rm st}^{p,q}(Y)\cong
\hspace{-0.05in}
\bigoplus_{(\sigma,\sigma^*)}
R_1(\omega_{\sigma^*})_{(p+q-\dim\sigma^*+2)\beta^{\sigma^*}/2-\beta_0^{\sigma^*}}\otimes
R_1(f_{\sigma})_{(q-p+d-\dim\sigma+1)\beta^\sigma/2-\beta_0^{\sigma}},$$ where the sum is by all pairs of the cones $\sigma$ and $\sigma^*$ (including 0-dimensional cones) over the dual faces of the reflexive polytopes, and where $\omega_{\sigma^*}\in S(V(\sigma^*))_{\beta^{\sigma^*}}$ is a formal restriction of $\omega\in S({{\PP}}_{\Delta^*})_{\beta^*}$, which should be related to the complexified Kähler class of the mirror (we will discuss this in Section \[s:vs\]). This construction can be rewritten in simpler terms, which will help us to give a conjectural description of the usual string cohomology space for all semiample Calabi-Yau hypersurfaces.
First, recall Batyrev’s presentation of the toric variety ${{\PP}}_\Delta$ for an [*arbitrary*]{} polytope $\Delta$ in $M$ (see [@b1], [@c2]). Consider the [*Gorenstein*]{} cone $K$ over $\Delta\times\{1\}\subset M\oplus{\Bbb Z}$. Let $S_\Delta$ be the subring of ${\Bbb C}[t_0,t_1^{\pm1},\dots,t_d^{\pm1}]$ spanned over $\Bbb C$ by all monomials of the form $t_0^k t^m=t_0^kt_1^{m_1}\cdots t_d^{m_d}$ where $k\ge0$ and $m\in k\Delta$. This ring is graded by the assignment $\deg(t_0^k t^m)=k$. Since the vector $(m,k)\in K$ if and only if $m\in k\Delta$, the ring $S_\Delta$ is isomorphic to the semigroup algebra ${\Bbb C}[K]$. The toric variety ${{\PP}}_\Delta$ can be represented as $${\rm Proj}(S_\Delta)={\rm Proj}({\Bbb C}[K]).$$ The ring $S_\Delta$ has a nice connection to the homogeneous coordinate ring $S({{\PP}}_\Delta)={\Bbb C}[x_\rho:\rho\in\Sigma_\Delta(1)]$ of the toric variety ${{\PP}}_\Delta$, corresponding to a fan $\Sigma_\Delta$. If $\beta\in A_{d-1}({{\PP}}_\Delta)$ is the class of the ample divisor $\sum_{\rho\in\Sigma_\Delta(1)} b_\rho D_\rho$ giving rise to the polytope $\Delta$, then there is a natural isomorphism of graded rings $$\label{e:isom}
{\Bbb C}[K]\cong S_\Delta\cong\bigoplus_{k=0}^\infty S({{\PP}}_\Delta)_{k\beta},$$ sending $(m,k)\in\CC[K]_k$ to $t_0^k t^m$ and $\prod_\rho x_\rho^{k b_\rho+\langle m,e_\rho\rangle}$, where $e_\rho$ is the minimal integral generator of the ray $\rho$. Now, given $f\in S({{\PP}}_\Delta)_{\beta}$, we get the ring $R_1(f)$. The polynomial $f=\sum_{m\in\Delta}f(m)
x_\rho^{b_\rho+\langle m,e_\rho\rangle}$, where $f(m)$ are the coefficients, corresponds by the isomorphisms (\[e:isom\]) to $\sum_{m\in\Delta}f(m)t_0t^m\in (S_\Delta)_1$ and $\sum_{m\in\Delta}f(m)[m,1]\in{\Bbb C}[K]_1$ (the brackets \[[ ]{}\] are used to distinguish the lattice points from the vectors over $\CC$), which we also denote by $f$. By the proof of [@bc Theorem 11.5], we have that $$(S({{\PP}}_\Delta)/J_0(f))_{k\beta}\cong
(S_\Delta/\langle t_i\partial f/\partial t_i:\, i=0,\dots,d\rangle)_k
\cong R_0(f,K)_k,$$ where $R_0(f,K)$ is the quotient of ${\Bbb C}[K]$ by the ideal generated by all “logarithmic derivatives” of $f$: $$\sum_{m\in\Delta}((m,1)\cdot n) f(m)[m,1]$$ for $n\in N\oplus{\Bbb Z}$. The isomorphisms (\[e:isom\]) induce the bijections $$S({{\PP}}_\Delta)_{k\beta-\beta_0}@>\prod_\rho x_\rho>>\langle
\prod_\rho x_\rho \rangle_{k\beta}\cong
(I_\Delta^{(1)})_k \cong {\Bbb C}[K^\circ]_k$$ ($\beta_0=\deg(\prod_\rho x_\rho)$), where $I_\Delta^{(1)}\subset S_\Delta$ is the ideal spanned by all monomials $t_0^k t^m$ such that $m$ is in the interior of $k\Delta$, and ${\Bbb C}[K^\circ]\subset{\Bbb C}[K]$ is the ideal spanned by all lattice points in the relative interior of $K$. Since the space $R_1(f)_{k\beta-\beta_0}$ is isomorphic to the image of $\langle\prod_\rho x_\rho \rangle_{k\beta}$ in $(S({{\PP}}_\Delta)/J_0(f))_{k\beta}$, $$R_1(f)_{k\beta-\beta_0}\cong R_1(f,K)_k,$$ where $R_1(f,K)$ is the image of ${\Bbb C}[K^\circ]$ in the graded ring $R_0(f,K)$.
The above discussion applies well to all faces $\Gamma$ in $\Delta$. In particular, if the toric variety $V(\sigma)\subset{{\PP}}_\Delta$ corresponds to $\Gamma$, and $\beta^\sigma\in A_{d-\dim\sigma-1}(V(\sigma))$ is the restriction of the ample class $\beta$, then $$S(V(\sigma))_{*\beta^\sigma}\cong {\Bbb C}[C],$$ where $C$ is the Gorenstein cone over the polytope $\Gamma\times\{1\}$. This induces an isomorphism $$R_1(f_\sigma)_{*\beta^\sigma-\beta_0^\sigma}\cong R_1(f_C,C),$$ where $f_C=\sum_{m\in\Gamma} f(m)[m,1]$ in ${\Bbb C}[C]_1$ is the projection of $f$ to the cone $C$.
Now, we can restate our conjecture (\[e:conj\]) in terms of Gorenstein cones: $$\bigoplus_{p,q}QH_{\rm st}^{p,q}(Y)\cong\bigoplus_{\begin{Sb}
p,q\\
(C,C^*)\end{Sb}}
R_1(\omega_{C^*},C^*)_{(p+q-d+\dim C^*+1)/2}\otimes
R_1(f_{C},C)_{(q-p+\dim C)/2},$$ where the sum is by all dual faces of the reflexive Gorenstein cones $K$ and $K^*$. This formula is already supported by Theorem 8.2 in [@bd], which for ample Calabi-Yau hypersurfaces in weighted projective spaces gives a corresponding decomposition of the stringy Hodge numbers (see Remark \[r:corrw\] in the next section). A generalization of [@bd Theorem 8.2] will be proved in Section \[section.bbo\], justifying the above conjecture in the case of ample Calabi-Yau hypersurfaces in Fano toric varieties.
It is known that the string cohomology, which should be the limit of the quantum cohomology ring, of smooth Calabi-Yau hypersurfaces should be the same as the usual cohomology. We also know the property that the quantum cohomology spaces should be isomorphic for the ample Calabi-Yau hypersurface $Y$ and its crepant resolution $X$. Therefore, it makes sense to compare the above description of $QH_{\rm st}^{p,q}(Y)$ with the description of the cohomology of semiample Calabi-Yau hypersurfaces $X$ in Theorem \[t:main\]. We can see that the right components in the tensor products coincide, by Proposition \[p:iso\] and the definition of $R_1(f_{C},C)$. On the other hand, the left components in $QH_{\rm st}^{p,q}(Y)$ for the ample Calabi-Yau hypersurface $Y$ do not depend on a resolution, while the left components $T^\sigma(X)$ in $H^{p,q}(X)$ for the resolution $X$ depend on the Stanley-Reisner ideal $SR(\Sigma)$. This hints us to the following definitions:
\[d:rings\] Let $C$ be a Gorenstein cone in a lattice $L$, subdivided by a fan $\Sigma$, and let ${\Bbb C}[C]$ and ${\Bbb C}[C^\circ]$, where $C^\circ$ is the relative interior of $C$, be the semigroup rings. Define “deformed” ring structures $\CC[C]^\Sigma$ and $\CC[C]^\Sigma$ on ${\Bbb C}[C]$ and ${\Bbb C}[C^\circ]$, respectively, by the rule: $[m_1][m_2]=[m_1+m_2]$ if $m_1,m_2\subset\sigma\in\Sigma$, and $[m_1][m_2]=0$, otherwise.
Given $g=\sum_{m\in C,\deg m=1} g(m)[m]$, where $g(m)$ are the coefficients, let $$R_0(g,C)^\Sigma=\CC[C]^\Sigma/Z\cdot\CC[C]^\Sigma$$ be the graded ring over the graded module $$R_0(g,C^\circ)^\Sigma=\CC[C^\circ]^\Sigma/Z\cdot\CC[C^\circ]^\Sigma,$$ where $Z=\{\sum_{m\in C,\deg m=1} (m\cdot n)
g(m)[m]:\,n\in {\rm Hom}(L,{\Bbb Z})\}$. Then define $R_1(g,C)^\Sigma$ as the image of the natural homomorphism $R_0(g,C^\circ)^\Sigma@>>>R_0(g,C)^\Sigma$.
In the above definition, note that if $\Sigma$ is a trivial subdivision, we recover the spaces $R_0(g,C)$ and $R_1(g,C)$ introduced earlier. Also, we should mention that the Stanley-Reisner ring of the fan $\Sigma$ can be naturally embedded into the “deformed” ring $\CC[C]^\Sigma$, and this map is an isomorphism when the fan $\Sigma$ is smooth.
Here is our conjecture about the string cohomology space of semiample Calabi-Yau hypersurfaces in a complete toric variety.
\[semiampleconj\] Let $X\subset{{{\PP}_{\Sigma}}}$ be a semiample anticanonical nondegenerate hypersurface defined by $f\in H^0({{{\PP}_{\Sigma}}},{\cal O}_{{{\PP}_{\Sigma}}}(X))\cong\CC[K]_1$, and let $\omega$ be a generic element in $\CC[K^*]_1$, where $K^*$ is the reflexive Gorenstein cone dual to the cone $K$ over the reflexive polytope $\Delta$ associated to $X$. Then there is a natural isomorphism: $$H^{p,q}_{\st}(X)\cong
\bigoplus_{C\subseteq K} R_1(\omega_{C^*},C^*)^\Sigma_{(p+q-d+\dim C^*+1)/2}
\otimes R_1(f_C,C)_{(q-p+\dim C)/2},$$ where $C^*\subseteq K^*$ is a face dual to $C$, and where $f_C$, $\omega_{C^*}$ denote the projections of $f$ and $\omega$ to the respective cones $C$ and $C^*$. (Here, the superscript $\Sigma$ denotes the subdivision of $K^*$ induced by the fan $\Sigma$.)
Since the dimension of the string cohomology for all crepant partial resolutions should remain the same and should coincide with the dimension of the quantum string cohomology space, we expect that $$\label{e:expe}
{\dim}R_1(\omega_{C^*},C^*)_{\_}^\Sigma=
{\dim}R_1(\omega_{C^*},C^*)_{\_},$$ which will be shown in Section \[section.brel\] for a projective subdivision $\Sigma$. Conjecture \[semiampleconj\] will be confirmed by the corresponding decomposition of the stringy Hodge numbers in Section \[section.bbo\]. Moreover, in Section \[s:vs\], we will derive the Chen-Ruan orbifold cohomology as a special case of Conjecture \[semiampleconj\] for ample Calabi-Yau hypersurfaces in complete simplicial toric varieties.
Hodge-Deligne numbers of affine hypersurfaces {#s:hd}
=============================================
Here, we compute the dimensions of the spaces $R_1(g,C)_{\_}$ from the previous section. It follows from Proposition \[p:iso\] that these dimensions are exactly the Hodge-Deligne numbers of the minimal weight space on the middle cohomology of a hypersurface in a torus. An explicit formula in [@dk] and [@bd] for the $E$-polynomial of a nondegenerate affine hypersurface whose Newton polyhedra is a simplex leads us to the answer for the graded dimension of $R_1(g,C)$ when $C$ is a simplicial Gorenstein cone. However, it was very difficult to compute the Hodge-Deligne numbers of an arbitrary nondegenerate affine hypersurface. This was a major technical problem in the proof of mirror symmetry of the stringy Hodge numbers for Calabi-Yau complete intersections in [@bb]. Here, we will present a simple formula for the Hodge-Deligne numbers of a nondegenerate affine hypersurface.
Before we start computing ${\rm gr.dim.}R_1(g,C)$, let us note that for a nondegenerate $g\in\CC[C]_1$ (i.e., the corresponding hypersurface in ${\rm Proj}(\CC[C])$ is nondegenerate): $${\rm gr.dim.}R_0(g,C)=S(C,t),$$ where the polynomial $S$ is the same as in Definition \[d:bd\] of the stringy Hodge numbers. This was shown in [@b1 Theorem 4.8 and 2.11] (see also [@Bor.locstring]).
When the cone $C$ is simplicial, we already know the formula for the graded dimension of $R_1(g,C)$:
\[p:simp\] Let $C$ be a simplicial Gorenstein cone, and let $g\in\CC[C]_1$ be nondegenerate. Then $${\rm gr.dim.}R_1(g,C)=\tilde S(C,t)$$ where $\tilde S(C,t)=\sum_{C_1\subseteq C} S(C_1,t)
(-1)^{\dim C-\dim C_1}$.
The polynomial $\tilde S(C,t)$ was introduced with a slightly different notation in [@bd Definition 8.1] for a lattice simplex. One can check that $\tilde S(C,t)$ in this proposition is equivalent to the one in [@bd Corollary 6.6]. [From]{} the previous section and [@b1 Proposition 9.2], we know that $$R_1(g,C)\cong{{\rm Gr}}_F W_{\dim Z_g}H^{\dim Z_g}(Z_g),$$ where $Z_g$ is the nondegenerate affine hypersurface determined by $g$ in the maximal torus of ${\rm Proj}(\CC[C])$. By [@bd Proposition 8.3], $$E(Z_g;u,v)
=\frac{(uv-1)^{\dim C-1}+(-1)^{\dim C}}{uv}+(-1)^{\dim C}
\sum_{\begin{Sb}
C_1\subseteq C\\
\dim C_1>1\end{Sb}}\frac{u^{\dim C_1}}{uv}\tilde S(C_1,u^{-1}v).$$ Now, note that the coefficients $e^{p,q}(Z_g)$ at the monomials $u^p v^q$ with $p+q=\dim Z_g$ are related to the Hodge-Deligne numbers by the calculations in [@dk]: $$e^{p,q}(Z_g)=(-1)^{\dim C}h^{p,q}(H^{\dim Z_g}(Z_g))+(-1)^{p}\delta_{pq}
C_{\dim C-1}^p,$$ where $\delta_{pq}$ is the Kronecker symbol and $C_{\dim C-1}^p$ is the binomial coefficient. Comparing this with the above formula for $E(Z_g;u,v)$, we deduce the result.
\[r:corrw\] By the above proposition, we can see that [@bd Theorem 8.2] gives a decomposition of the stringy Hodge numbers of ample Calabi-Yau hypersurfaces in weighted projective spaces in correspondence with Conjecture \[semiampleconj\].
Next, we generalize the polynomials $\tilde S(C,t)$ from Proposition \[p:simp\] to nonsimplicial Gorenstein cones in such a way that they would count the graded dimension of $R_1(g,C)$.
\[d:spol\]
Let $C$ be a Gorenstein cone in a lattice $L$. Then set $$\tilde
S(C,t) := \sum_{C_1\subseteq C} S(C_1,t) (-1)^{\dim C-\dim C_1}
G([C_1,C],t),$$ where $G$ is a polynomial (from Definition \[Gpoly\] in the Appendix) for the partially ordered set $[C_1,C]$ of the faces of $C$ that contain $C_1$.
\[tildepoincare\] It is not hard to show that the polynomial $\tilde S(C,t)$ satisfies the duality $$\tilde S(C,t) = t^{\dim C} \tilde S(C,t^{-1})$$ based on the duality properties of $S$ and the definition of $G$-polynomials. However, the next result and Proposition \[p:iso\] imply this fact.
\[p:nonsimp\] Let $C$ be a Gorenstein cone, and let $g\in\CC[C]_1$ be nondegenerate. Then $${\rm gr.dim.}R_1(g,C)=\tilde S(C,t).$$
As in the proof of Proposition \[p:simp\], we consider a nondegenerate affine hypersurface $Z_g$ determined by $g$ in the maximal torus of ${\rm Proj}(\CC[C])$. Then [@bb Theorem 3.18] together with the definition of $S$ gives $$E(Z_g;u,v)
= \frac{(uv-1)^{\dim C-1}}{uv} + \frac{(-1)^{\dim C}}{uv}
\sum_{C_2\subseteq C}
B([C_2,C]^*; u,v)S(C_2,vu^{-1})u^{\dim C_2},$$ where the polynomials $B$ are from Definition \[Q\]. We use Lemma \[BfromG\] and Definition \[d:spol\] to rewrite this as $$\begin{gathered}
E(Z_g;u,v)
= \frac{(uv-1)^{\dim C-1}}{uv}
+\frac{(-1)^{\dim C}}{uv}\times
\\
\times
\sum_{C_2\subseteq C_1\subseteq C} u^{\dim C_2}
S(C_2,u^{-1}v)
G([C_2,C_1],u^{-1}v)(-u)^{\dim C_1-\dim C_2}
G([C_1,C]^*,uv)
\\
=\frac{(uv-1)^{\dim C-1}}{uv}+\frac{(-1)^{\dim C}}{uv}
\sum_{C_1\subseteq C}u^{\dim C_1}
\tilde S(C_1,u^{-1}v)
G([C_1,C]^*,uv).\end{gathered}$$
The definition of $G$-polynomials assures that the degree of $u^{\dim C_1}G([C_1,C]^*,uv)$ is at most $\dim C$ with the equality only when $C_1=C$. Therefore, the graded dimension of $R_1(g,C)$ can be read off the same way as in the proof of Proposition \[p:simp\] from the coefficients at total degree $\dim C-2$ in the above sum.
“Deformed” rings and modules {#section.brel}
============================
While this section may serve as an invitation to a new theory of “deformed” rings and modules, the goal here is to prove the equality (\[e:expe\]), by showing that the graded dimension formula of Proposition \[p:nonsimp\] holds for the spaces $R_1(g,C)^\Sigma$ from Definition \[d:rings\]. To prove the formula we use the recent work of Bressler and Lunts (see [@bl], and also [@bbfk]). This requires us to first study Cohen-Macaulay modules over the deformed semigroup rings $\CC[C]^\Sigma$.
First, we want to generalize the nondegeneracy notion:
\[d:nond\] Let $C$ be a Gorenstein cone in a lattice $L$, subdivided by a fan $\Sigma$. Given $g=\sum_{m\in C,\deg m=1} g(m)[m]$, get $$g_j = \sum_{m\in C,\deg m=1}(m\cdot n_j) g(m)[m],\quad\text{ for }
j=1,\dots,\dim C$$ where $\{n_1,\dots,n_{\dim C}\}\subset{\rm Hom}(L,{\Bbb Z})$ descends to a basis of ${\rm Hom}(L,{\Bbb Z})/C^\perp$. The element $g$ is called [*$\Sigma$-regular (nondegenerate)*]{} if $\{g_1,\ldots,g_{\dim C}\}$ forms a regular sequence in the deformed semigroup ring $\CC[C]^\Sigma$.
\[r:nond\] When $\Sigma$ is a trivial subdivision, [@b1 Theorem 4.8] shows that the above definition is consistent with the previous notion of nondegeneracy corresponding to the transversality of a hypersurface to torus orbits.
\[t:cm\] [(i)]{} The ring $\CC[C]^\Sigma$ and its module $\CC[C^\circ]^\Sigma$ are Cohen-Macaulay.\
[(ii)]{} A generic element $g\in\CC[C]_1$ is $\Sigma$-regular. Moreover, for a generic $g$ the sequence $\{g_1,\ldots,g_{\dim C}\}$ from Definition \[d:nond\] is $\CC[C^\circ]^\Sigma$-regular.\
[(iii)]{} If $g\in\CC[C]_1$ is $\Sigma$-regular, then the sequence $\{g_1,\ldots,g_{\dim C}\}$ is $\CC[C^\circ]^\Sigma$-regular.
Part [(ii)]{} follows from the proofs of Propositions 3.1 and 3.2 in [@Bor.locstring]. The reader should notice that the proofs use degenerations defined by projective simplicial subdivisions, and any fan admits such a subdivision.
Then, part [(ii)]{} implies [(i)]{}, by the definition of Cohen-Macaulay, while part [(iii)]{} follows from [(i)]{} and Proposition 21.9 in [@e].
As a corollary of Theorem \[t:cm\], we get the following simple description of $\Sigma$-regular elements:
\[l:iff\] An element $g\in\CC[C]_1$ is $\Sigma$-regular, if and only if its restriction to all maximum-dimensional cones $C'\in\Sigma(\dim C)$ is nondegenerate in $\CC[C']$.
Since $\CC[C]^\Sigma$ is Cohen-Macaulay, the regularity of a sequence is equivalent to the quotient by the sequence having a finite dimension, by [@ma Theorem 17.4].
One can check that $\CC[C]^\Sigma$ is filtered by the modules $R_k$ defined as the span of $[m]$ such that the minimum cone that contains $m$ has dimension at least $k$. The $k$-th graded quotient of this filtration is the direct sum of $\CC[C_1^\circ]$ by all $k$-dimensional cones $C_1$ of $\Sigma$. If $g$ is nondegenerate for every cone of maximum dimension, then its projection to any cone $C_1$ is nondegenerate, and Theorem \[t:cm\] shows that it is nondegenerate for each $\CC[C_1^\circ]$. Then by decreasing induction on $k$ one shows that $R_k/\{g_1,\ldots,g_{\dim C}\}R_k$ is finite-dimensional.
In the other direction, it is easy to see that for every $C'\in \Sigma$ the $\CC[C]^\Sigma$-module $\CC[C']$ is a quotient of $\CC[C]^\Sigma$, which gives a surjection $$\CC[C]^\Sigma/\{g_1,\ldots,g_{\dim C}\}\CC[C]^\Sigma
@>>>\CC[C']/\{g_1|_{C'},\dots,g_{\dim C}|_{C'}\}\CC[C']@>>>0.$$
The above lemma implies that the property of $\Sigma$-regularity is preserved by the restrictions:
Let $C$ be a Gorenstein cone in a lattice $L$, subdivided by a fan $\Sigma$. If $g\in\CC[C]_1$ is $\Sigma$-regular, then $g\in\CC[C_1]_1$ is $\Sigma$-regular for all faces $C_1\subseteq C$.
Let $g\in\CC[C]_1$ be $\Sigma$-regular. By Lemma \[l:iff\], the restriction $g_{C'}$ is nondegenerate in $\CC[C']$ for all $C'\in\Sigma(\dim C)$. Since the property of nondegeneracy associated with a hypersurface is preserved by the restrictions, $g_{C_1'}$ is nondegenerate in $\CC[C_1']$ for all $C_1'\in\Sigma(\dim C_1)$ contained in $C_1$. Applying Lemma \[l:iff\] again, we deduce the result.
The next result generalizes [@b1 Proposition 9.4] and [@Bor.locstring Proposition 3.6].
\[Zreg\] Let $g\in\CC[C]_1$ be $\Sigma$-regular, then $R_0(g,C)^\Sigma$ and $R_0(g,C^\circ)^\Sigma$ have graded dimensions $S(C,t)$ and $t^kS(C,t^{-1})$, respectively, and there exists a nondegenerate pairing $$\langle\_,\_\rangle:
R_0(g,C)_k^\Sigma\times R_0(g,C^\circ)_{\dim C-k}^\Sigma\to R_0(g,C^\circ)_{\dim C}^\Sigma\cong\CC,$$ induced by the multiplicative $R_0(g,C)^\Sigma$-module structure.
It is easy to see that the above statement is equivalent to saying that $\CC[C^\circ]^\Sigma$ is the canonical module for $\CC[C]^\Sigma$. When $\Sigma$ consists of the faces of $C$ only, this is well-known (cf. [@d]). To deal with the general case, we will heavily use the results of [@e], Chapter 21.
We denote $A=\CC[C]^\Sigma$. For every cone $C_1$ of $\Sigma$ the vector spaces $\CC[C_1]$ and $\CC[C_1^\circ]$ are equipped with the natural $A$-module structures. By Proposition 21.10 of [@e], modified for the graded case, we get $$\Ext^i_A(\CC[C_1],w_A) \iso \Bigl\{
\begin{array}{ll}
\CC[C_1^\circ],&i=\codim(C_1)\\
0,&i\neq\codim(C_1)
\end{array}
\Bigr.$$ where $w_A$ is the canonical module of $A$.
Consider now the complex $\cal F$ of $A$-modules $$0@>>>F^0@>>>F^1@>>>\cdots @>>>F^d@>>>0$$ where $$F^n =
\bigoplus_{C_1\in\Sigma,\codim(C_1)=n} \CC[C_1]$$ and the differential is a sum of the restriction maps with signs according to the orientations. The nontrivial cohomology of $\cal F$ is located at $F^0$ and equals $\CC[C^\circ]^\Sigma$. Indeed, by looking at each graded piece separately, we see that the cohomology occurs only at $F^0$, and then the kernel of the map to $F^1$ is easy to describe. We can now use the complex $\cal F$ and the description of $\Ext^i_A(\CC[C_1],w_A)$ to try to calculate $\Hom_A(\CC[C^\circ]^\Sigma,w_A)$. The resulting spectral sequence degenerates immediately, and we conclude that $\Hom_A(\CC[C^\circ]^\Sigma,w_A)$ has a filtration such that the associated graded module is naturally isomorphic to $$\bigoplus_{C_1\in \Sigma} \CC[C_1^\circ].$$
By duality of maximal Cohen-Macaulay modules (see [@e]), it suffices to show that $\Hom_A(\CC[C^\circ]^\Sigma,w_A)\iso A$, but the above filtration only establishes that it has the correct graded pieces, so extra arguments are required. Let $C^\prime$ be a cone of $\Sigma$ of maximum dimension. We observe that $\cal F$ contains a subcomplex ${\cal F}^\prime$ such that $$F^{\prime n}=
\bigoplus_{C_1\subseteq C^\prime} \CC[C_1].$$ Similar to the case of $\cal F$, the cohomology of ${\cal F}^\prime$ occurs only at $F^{\prime 0}$ and equals $\CC[C^{\prime\circ}]$. By snake lemma, the cohomology of ${\cal F}/{\cal F}^\prime$ also occurs at the zeroth spot and equals $\CC[C^\circ]^\Sigma/\CC[C^{\prime\circ}]$. By looking at the spectral sequences again, we see that $$\Ext^{>0}(\CC[C^\circ]^\Sigma/\CC[C^{\prime\circ}],w_A)=0$$ and we have a grading preserving surjection $$\Hom_A(\CC[C^\circ]^\Sigma,w_A)
@>>>\Hom_A(\CC[C^{\prime\circ}],w_A)@>>>0.$$ Since $\Hom_A(\CC[C^\prime],w_A)\iso \CC[C^{\prime\circ}]$, duality of maximal Cohen-Macaulay modules over $A$ shows that $$\Hom_A(\CC[C^{\prime\circ}],w_A)\iso \CC[C^{\prime}]$$ so for every $m\in C^\prime$ the element $[m]$ of $A$ does not annihilate the degree zero element of $\Hom_A(\CC[C^\circ]^\Sigma,w_A)$. By looking at all $C^\prime$ together, this shows that $$\Hom_A(\CC[C^\circ]^\Sigma,w_A)\iso A$$ which finishes the proof.
\[p:nons\] Let $g\in\CC[C]_1$ be $\Sigma$-regular, then the pairing $\langle\_\,,\_\rangle$ induces a symmetric nondegenerate pairing $\{\_\,,\_\}$ on $R_1(g,C)^\Sigma$, defined by $$\{ x,y\} = \langle x,y'\rangle$$ where $y'$ is an element of $R_0(g,C^\circ)^\Sigma$ that maps to $y$.
The nondegeneracy of the pairing $\{\_\,,\_\}$ follows from that of $\langle\_\,,\_\rangle$. The pairing is symmetric, because it comes from the commutative product on $\CC[C^\circ]^\Sigma$.
\[dimtilde\] Let $C$ be a Gorenstein cone subdivided by a projective fan $\Sigma$. If $g\in\CC[C]_1$ is $\Sigma$-regular, then the graded dimension of $R_1(g,C)^\Sigma$ is $\tilde S(C,t)$.
We will use the description of Bressler and Lunts [@bl] of locally free flabby sheaves on the finite ringed topological space associated to the cone $C$. We recall here the basic definitions. Consider the set $P$ of all faces of the cone $C$. It is equipped with the topology in which open sets are subfans, i.e. the sets of faces closed under the operation of taking a face. Bressler and Lunts define a sheaf $\cal A$ of graded commutative rings on $P$ whose sections over each open set is the ring of continuous piecewise polynomial functions on the union of all strata of this set. The grading of linear functions will be set to $1$, contrary to the convention of [@bl].
They further restrict their attention to the sheaves $\cal F$ of $\cal A$-modules on $P$ that satisfy the following conditions.
$\bullet$ For every face $C_1$ of $C$, sections of $\cal F$ over the open set that corresponds to the union of all faces of $C_1$ is a free module over the ring of polynomial functions on $C_1$.
$\bullet$ ${\cal F}$ is flabby, i.e. all restriction maps are surjective.
We will use the following crucial result.
[@bl] Every sheaf $\cal F$ that satisfies the above two properties is isomorphic to a direct sum of indecomposable graded sheaves ${\cal
L}_{C_1}t^i$, where $C_1$ is a face of $C$ and $t^i$ indicates a shift in grading. For each indecomposable sheaf $L_{C_1}$ the space of global sections $\Gamma(P,{\cal L}_{C_1})$ is a module over the polynomial functions on $C$ of the graded rank $G([C_1,C]^*,t)$ where $[C_1,C]$ denotes the Eulerian subposet of $P$ that consists of all faces of $C$ that contain $C_1$.
Now let us define a sheaf ${\cal B}(g)$ on $P$ whose sections over the open subset $I\in P$ are $\CC[\cap_{i\in I}C_i]^\Sigma$. It is clearly a flabby sheaf, which can be given a grading by $\deg(\_)$. Moreover, ${\cal B}(g)$ can be given a structure of a sheaf of $\cal A$ modules as follows. Every linear function $\varphi$ on a face $C_1$ defines a logarithmic derivative $$\partial_\varphi g:=\sum_{m\in C_1,\deg m =1} \phi(m)g(m)[m]$$ of $g$, which is an element of the degree $1$ in $\CC[C_1]^\Sigma$. Then the action of $\varphi$ is given by the multiplication by $\partial_\varphi g$, and this action is extended to all polynomial functions on the cone $C_1$. Similar construction clearly applies to continuous piecewise polynomial functions for any open set of $P$.
Proposition \[Zreg\] assures that ${\cal B}(g)$ satisfies the second condition of Bressler and Lunts, and can therefore be decomposed into a direct sum of $L_{C_1}t^i$ for various $C_1$ and $i$. The definition of $R_1(g,C)^\Sigma$ implies that its graded dimension is equal to the graded rank of the stalk of ${\cal B}(g)$ at the point $C\in P$. Since the graded rank of $\cal B$ is $S(C,t)$, we conclude that $$S(C,t) = \sum_{C_1\subseteq C} {\rm gr.dim.}R_1(g_{C_1},C_1)^\Sigma G([C_1,C]^*,t).$$ To finish the proof of Theorem \[dimtilde\], it remains to apply Lemma \[Ginverse\].
Decomposition of stringy Hodge numbers for hypersurfaces {#section.bbo}
========================================================
In this section, we prove a generalization of [@bd Theorem 8.2] for all Calabi-Yau hypersurfaces, which gives a decomposition of the stringy Hodge numbers of the hypersurfaces. First, we recall a formula for the stringy Hodge numbers of Calabi-Yau hypersurfaces obtained in [@bb]. Then using a bit of combinatorics, we rewrite this formula precisely to the form of [@bd Theorem 8.2] with $\tilde S$ defined in the previous section.
The stringy Hodge numbers of a Calabi-Yau complete intersection have been calculated in [@bb] in terms of the numbers of integer points inside multiples of various faces of the reflexive polytopes $\Delta$ and $\Delta^*$ as well as some polynomial invariants of partially ordered sets. A special case of the main result in [@bb] is the following description of the stringy $E$-polynomials of Calabi-Yau hypersurfaces.
\[st.formula\] [@bb] Let $K\subset M\oplus{\Bbb Z}$ be the Gorenstein cone over a reflexive polytope $\Delta\subset M$. For every $(m,n)\in (K,K^*)$ with $m\cdot n =0$ denote by $x(m)$ the minimum face of $K$ that contains $m$ and by $x^*(n)$ the dual of the minimum face of $K^*$ that contains $n$. Also, set $A_{(m,n)}(u,v)$ be $$\frac{(-1)^{\dim(x^*(n))}}{uv}
(v-u)^{\dim(x(m))}(uv -1)^{d+1-\dim(x^*(n))}B([x(m),x^*(n)]^*;u,v)$$ where the function $B$ is defined in Definition \[Q\] in the Appendix. Then $$E_{\rm st}(Y; u,v)=
\sum_{(m,n) \in (K,K^*),m\cdot n =0}
\left(\frac{u}{v}\right)^{{\rm deg}\,m} A_{(m,n)}(u,v)
\left(\frac{1}{uv}\right)^{{\rm deg}\,n}$$ for an ample nondegenerate Calabi-Yau hypersurface $Y$ in $\PP_\Delta={\rm Proj}(\CC[K])$.
The mirror duality $E_{\st}(Y;u,v) = (-u)^{d-1}E_\st(Y^*;u^{-1},v)$ was proved in [@bb] as the immediate corollary of the above formula and the duality property $B(P; u,v) = (-u)^{\rk P} B(P^*;u^{-1},v)$. It was not noticed there that Lemma \[Ginverse\] allows one to rewrite the $B$-polynomials in terms of $G$-polynomials, which we will now use to give a formula for the $E_\st(Y;u,v)$, explicitly obeying the mirror duality. The next result is a generalization of Theorem 8.2 in [@bd] with $\tilde S$ from Definition \[d:spol\].
\[estfromtilde\] Let $Y$ be an ample nondegenerate Calabi-Yau hypersurface in $\PP_\Delta={\rm Proj}(\CC[K])$. Then $$E_\st(Y;u,v) = \sum_{C\subseteq K}
(uv)^{-1}(-u)^{\dim C}\tilde S(C,u^{-1}v)
\tilde S(C^*,uv).$$
[*Proof.*]{} First, observe that the formula for $E_{\rm st}(Y; u,v)$ from Theorem \[st.formula\] can be written as $$\sum_{m,n,C_1,C_2} \frac{(-1)^{\dim C_2^*}}{uv}
(v-u)^{\dim(C_1)}B([C_2,C_1^*];u,v)(uv -1)^{\dim C_2}
\left(\frac{u}{v}\right)^{{\rm deg} m}
\left(\frac{1}{uv}\right)^{{\rm deg}n}$$ where the sum is taken over all pairs of cones $C_1\subseteq K, C_2\subseteq K^*$ that satisfy $C_1\cdot C_2 = 0$ and all $m$ and $n$ in the relative interiors of $C_1$ and $C_2$, respectively. We use the standard duality result (see Definition \[d:bd\]) $$\sum_{n\in {\rm int}(C)}
t^{-\deg(n)}= (t-1)^{-\dim C}S(C,t)$$ to rewrite the above formula as $$\frac 1{uv}\sum_{C_1\cdot C_2=0} (-1)^{\dim(C_2^*)}u^{\dim
C_1} B([C_2,C_1^*];u,v)S(C_1,u^{-1}v)S(C_2,uv).$$ Then apply Lemma \[BfromG\] to get $$E_\st(Y;u,v) = \frac 1{uv} \sum_{C\in
K} \sum_{C_1\subseteq C,C_2\subseteq C^*}
(-1)^{\dim(C_2^*)}u^{\dim C_1} ~\times$$ $$\times~
G([C_1,C],u^{-1}v) (-u)^{\dim C_1^* -\dim C^*} G([C_2,C^*],uv)
S(C_1,u^{-1}v)S(C_2,uv).$$ It remains to use Definition \[d:spol\].
String cohomology construction via intersection cohomology {#section.general}
==========================================================
Here, we construct the string cohomology space for $\QQ$-Gorenstein toroidal varieties, satisfying the assumption of Proposition \[BDvsB\]. The motivation for this construction comes from the conjectural description of the string cohomology space for ample Calabi-Yau hypersurfaces and a look at the formula in [@bd Theorem 6.10] for the stringy $E$-polynomial of a Gorenstein variety with abelian quotient singularities. This immediately leads to a decomposition of the string cohomology space as a direct sum of tensor products of the usual cohomology of a closure of a strata with the spaces $R_1(g,C)$ from Proposition \[p:simp\]. Then the property that the intersection cohomology of an orbifold is naturally isomorphic to the usual cohomology leads us to the construction of the string cohomology space for $\QQ$-Gorenstein toroidal varieties. We show that this space has the dimension prescribed by Definition \[d:bd\] for Gorenstein complete toric varieties and the nondegenerate complete intersections in them.
\[d:orbdef\] Let $X=\bigcup_{i \in I} X_i$ be a Gorenstein complete variety with quotient abelian singularities, satisfying the assumption of Proposition \[BDvsB\]. The stringy Hodge spaces of $X$ are naturally isomorphic to $$H_{\rm st}^{p,q}(X)\cong\bigoplus_{\begin{Sb}i \in I\\
k\ge0 \end{Sb}}H^{p-k,q-k}(\overline{X}_i)\otimes
R_1(\omega_{\sigma_i},\sigma_i)_k,$$ where $\sigma_i$ is the Gorenstein simplicial cone of the singularity along the strata $X_i$, and $\omega_{\sigma_i}\in\CC[\sigma_i]_1$ are nondegenerate such that, for $\sigma_j\subset \sigma_i$, $\omega_{\sigma_i}$ maps to $\omega_{\sigma_j}$ by the natural projection $\CC[\sigma_i]@>>>\CC[\sigma_j]$.
Since $\overline{X}_i$ is a compact orbifold, the coefficient $e^{p,q}(\overline{X}_i)$ at the monomial $u^p v^q$ in the polynomial $E(\overline{X}_i;u,v)$ is equal to $(-1)^{p+q}h^{p,q}(\overline{X}_i)$, by Remark \[r:epol\]. Therefore, Proposition \[p:simp\] shows that the above decomposition of $H_{\rm st}^{p,q}(X)$ is in correspondence with [@bd Theorem 6.10], and the dimensions $h_{\rm st}^{p,q}(X)$ coincide with those from Definition \[d:bcangor\].
Since we expect that the usual cohomology must be replaced in Definition \[d:orbdef\] by the intersection cohomology for Gorenstein toroidal varieties, the next result is a natural generalization of Theorem 6.10 in [@bd].
\[8.3\] Let $X=\bigcup_{i \in I} X_i$ be a Gorenstein complete toric variety or a nondegenerate complete intersection of Cartier hypersurfaces in the toric variety, where the stratification is induced by the torus orbits. Then $$E_{\rm st}(X;u,v)= \sum_{i \in I} E_{\rm int}(\overline X_i;u,v)
\cdot \tilde S(\sigma_i,uv),$$ where $\sigma_i$ is the Gorenstein cone of the singularity along the strata $X_i$.
Similarly to Corollary 3.17 in [@bb], we have $$E_{\rm
int}(\overline X_i;u,v)=\sum_{X_j\subseteq \overline
X_i}E(X_i;u,v)\cdot G([\sigma_i\subseteq \sigma_j]^*,uv).$$ Hence, we get $$\sum_{i \in I} E_{\rm
int}(\overline X_i;u,v) \cdot \tilde S(\sigma_i,uv) = \sum_{i\in
I}\sum_{X_j\subseteq \overline X_i} E(X_j;u,v)
G([\sigma_i\subseteq \sigma_j]^*,uv)\tilde S(\sigma_i,uv)$$ $$=\sum_{j\in I} E(X_j;u,v) \Bigl(\sum_{\sigma_i\subseteq \sigma_j}
G([\sigma_i\subseteq \sigma_j]^*,uv)\tilde S(\sigma_i,uv) \Bigr) =
\sum_{j\in I} E(X_j;u,v) S(\sigma_j,uv),$$ where at the last step we have used the formula for $\tilde S$ and Lemma \[Ginverse\].
Based on the above theorem, we propose the following conjectural description of the stringy Hodge spaces for $\QQ$-Gorenstein toroidal varieties.
\[d:tordef\] Let $X=\bigcup_{i \in I} X_i$ be a $\QQ$-Gorenstein $d$-dimensional complete toroidal variety, satisfying the assumption of Proposition \[BDvsB\]. The stringy Hodge spaces of $X$ are defined by: $$H_{\rm st}^{p,q}(X):=\bigoplus_{\begin{Sb}i \in I\\
k\ge0 \end{Sb}}H_{\rm int}^{p-k,q-k}(\overline{X}_i)\otimes
R_1(\omega_{\sigma_i},\sigma_i)_k,$$ where $\sigma_i$ is the Gorenstein cone of the singularity along the strata $X_i$, and $\omega_{\sigma_i}\in\CC[\sigma_i]_1$ are nondegenerate such that, for $\sigma_j\subset \sigma_i$, $\omega_{\sigma_i}$ maps to $\omega_{\sigma_j}$ by the natural projection $\CC[\sigma_i]@>>>\CC[\sigma_j]$. Here, $p,q$ are rational numbers from $[0,d]$, and we assume that $H_{\rm int}^{p-k,q-k}(\overline{X}_i)=0$ if $p-k$ or $q-k$ is not a non-negative integer.
Toric varieties and nondegenerate complete intersections of Cartier hypersurfaces have the stratification induced by the torus orbits which satisfies the assumptions in the above definition.
String cohomology vs. Chen-Ruan orbifold cohomology {#s:vs}
===================================================
Our next goal is to compare the two descriptions of string cohomology for Calabi-Yau hypersurfaces to the Chen-Ruan orbifold cohomology. Using the work of [@p], we will show that in the case of ample orbifold Calabi-Yau hypersurfaces the three descriptions coincide. We refer the reader to [@cr] for the orbifold cohomology theory and only use [@p] in order to describe the orbifold cohomology for complete simplicial toric varieties and Calabi-Yau hypersurfaces in Fano simplicial toric varieties.
From Theorem 1 in [@p Section 4] and the definition of the orbifold Dolbeault cohomology space we deduce:
Let ${{{\PP}_{\Sigma}}}$ be a $d$-dimensional complete simplicial toric variety. Then the orbifold Dolbeault cohomology space of ${{{\PP}_{\Sigma}}}$ is $$H^{p,q}_{orb}({{{\PP}_{\Sigma}}};\CC)\cong\bigoplus_{\begin{Sb}\sigma\in\Sigma\\l\in\QQ\end{Sb}}
H^{p-l,q-l}(V(\sigma))\otimes \bigoplus_{t\in T(\sigma)_l}\CC t,$$ where $T(\sigma)_l=\{\sum_{\rho\subset\sigma}a_\rho [e_\rho]\in
N:a_\rho\in(0,1), \sum_{\rho\subset\sigma}a_\rho=l\}$ (when $\sigma=0$, set $l=0$ and $T(\sigma)_l=\CC$), and $V(\sigma)$ is the closure of the torus orbit corresponding to $\sigma\in\Sigma$. Here, $p$ and $q$ are rational numbers in $[0,d]$, and $H^{p-l,q-l}(V(\sigma))=0$ if $p-l$ or $q-l$ is not integral. (The elements of $\oplus_{0\ne\sigma\in\Sigma,l}T(\sigma)_l$ correspond to the twisted sectors.)
In order to compare this result to the description in Definition \[d:tordef\], we need to specify the $\omega_{\sigma_i}$ for the toric variety ${{{\PP}_{\Sigma}}}$. The stratification of ${{{\PP}_{\Sigma}}}$ is given by the torus orbits: ${{{\PP}_{\Sigma}}}=\cup_{\sigma\in\Sigma}\TT_\sigma$. The singularity of the variety ${{{\PP}_{\Sigma}}}$ along the strata $\TT_\sigma$ is given by the cone $\sigma$, so we need to specify a nondegenerate $\omega_\sigma\in\CC[\sigma]_1$ for each $\sigma\in\Sigma$. If $\omega_\sigma=\sum_{\rho\subset\sigma}\omega_\rho [e_\rho]$ with $\omega_\rho\ne0$, then one can deduce that $\omega_\sigma$ is nondegenerate using Remark \[r:nond\] and the fact that the nondegeneracy of a hypersurface in a complete simplicial toric variety (in this case, it corresponds to a simplex) is equivalent to the nonvanishing of the logarithmic derivatives simultaneously. So, picking any nonzero coefficients $\omega_\rho$ for each $\rho\in\Sigma(1)$ gives a nondegenerate $\omega_\sigma\in\CC[\sigma]_1$ satisfying the condition of Definition \[d:tordef\]. For such $\omega_\sigma$, note that the set $Z=\{\sum_{\rho\subset\sigma} (e_\rho\cdot m) \omega_\rho
e_\rho:\,m\in {\rm Hom}(N,{\Bbb Z})\}$ is a linear span of $e_\rho$ for $\rho\subset\sigma$. Hence, $$R_0(\omega_\sigma,\sigma)_l=(\CC[\sigma]/Z\cdot\CC[\sigma])_l\cong
\bigoplus_{t\in \tilde{T}(\sigma)_l}\CC t,$$ where $\tilde
T(\sigma)_l=\{\sum_{\rho\subset\sigma}a_\rho e_\rho\in
N:a_\rho\in[0,1), \sum_{\rho\subset\sigma}a_\rho=l\}$, and $$R_1(\omega_\sigma,\sigma)_l\cong
\bigoplus_{t\in{T}(\sigma)_l}\CC t.$$ This shows that the orbifold Dolbeault cohomology for complete simplicial toric varieties can be obtained as a special case of the description of string cohomology in Definition \[d:tordef\].
We will now explain how the parameter $\omega$ should be related to the complexified Kähler class. We do not have the definition of the “orbifold” Kähler cone even for simplicial toric varieties. However, we know the Kähler classes in $H^2({{{\PP}_{\Sigma}}},\RR)$.
Let ${{{\PP}_{\Sigma}}}$ be a projective simplicial toric variety, then $H^2({{{\PP}_{\Sigma}}},\RR)\cong PL(\Sigma)/M_\RR$, where $PL(\Sigma)$ is the set of $\Sigma$-piecewise linear functions $\varphi:N_\RR@>>>\RR$, which are linear on each $\sigma\in\Sigma$. The Kähler cone $K(\Sigma)\subset H^2({{{\PP}_{\Sigma}}},\RR)$ of ${{{\PP}_{\Sigma}}}$ consists of the classes of the upper strictly convex $\Sigma$-piecewise linear functions.
One may call $K(\Sigma)$ the “untwisted” part of the orbifold Kähler cone. So, we can introduce the [*untwisted complexified Kähler space*]{} of the complete simplicial toric variety: $$K^{\rm untwist}_\CC({{{\PP}_{\Sigma}}})= \{\omega\in
H^2({{{\PP}_{\Sigma}}},\CC):Im(\omega)\in K(\Sigma)\}/{\rm im}H^2({{{\PP}_{\Sigma}}},\ZZ).$$ Its elements may be called the [*untwisted complexified Kähler classes*]{}. We can find a generic enough $\omega\in K^{\rm
untwist}_\CC({{{\PP}_{\Sigma}}})$ represented by a complex valued $\Sigma$-piecewise linear function $\varphi_\omega:N_\CC@>>>\CC$ such that $\varphi_\omega(e_\rho)\ne0$ for $\rho\in\Sigma(1)$. Setting $\omega_\rho=\exp(\varphi_\omega(e_\rho))$ produces our previous parameters $\omega_\sigma$ for $\sigma\in\Sigma$. This is how we believe $\omega_\sigma$ should relate to the complexified Kähler classes, up to perhaps some instanton corrections.
We next turn our attention to the case of an ample Calabi-Yau hypersurface $Y$ in a complete simplicial toric variety ${{{\PP}_{\Sigma}}}$. Section 4.2 in [@p] works with a generic nondegenerate anticanonical hypersurface. However, one can avoid the use of Bertini’s theorem and state the result without “generic”. It is shown that the nondegenerate anticanonical hypersurface $X$ is a suborbifold of ${{{\PP}_{\Sigma}}}$, the twisted sectors of $Y$ are obtained by intersecting with the closures of the torus orbits and the degree shifting numbers are the same as for the toric variety ${{{\PP}_{\Sigma}}}$. Therefore, we conclude:
\[p:des\] Let $Y\subset{{{\PP}_{\Sigma}}}$ be an ample Calabi-Yau hypersurface in a complete simplicial toric variety. Then $$H^{p,q}_{orb}(Y;\CC)\cong\bigoplus_{\begin{Sb}\sigma\in\Sigma\\l\in\ZZ\end{Sb}}
H^{p-l,q-l}(Y\cap V(\sigma))\otimes
\bigoplus_{t\in T(\sigma)_l}\CC t,$$ where $T(\sigma)_l=\{\sum_{\rho\subset\sigma}a_\rho [e_\rho]\in N:a_\rho\in(0,1),
\sum_{\rho\subset\sigma}a_\rho=l\}$ (when $\sigma=0$, set $l=0$ and $T(\sigma)_l=\CC$).
As in the case of the toric variety, we pick $\omega_\sigma=\sum_{\rho\subset\sigma}\omega_\rho e_\rho$ with $\omega_\rho\ne0$. Then, by the above proposition, $$H_{\rm st}^{p,q}(Y)\cong H^{p,q}_{orb}(Y;\CC).$$
We now want to show that the description in Proposition \[p:des\] is equivalent to the one in Conjecture \[semiampleconj\]. First, note that the proper faces $C^*$ of the Gorenstein cone $K^*$ in Conjecture \[semiampleconj\] one to one correspond to the cones $\sigma\in\Sigma$. Moreover, the rings $\CC[C^*]\cong\CC[\sigma]$ are isomorphic in this correspondence. If we take $\omega\in\CC[K^*]^\Sigma_1$ to be $[0,1]+\sum_{\rho\in\Sigma(1)}\omega_\rho[e_\rho,1]$, then $\omega$ is $\Sigma$-regular and $$R_1(C^*,\omega_{C^*})_l\cong R_1(\omega_\sigma,\sigma)_l\cong
\oplus_{t\in{T}(\sigma)_l}\CC t.$$ On the other hand, the Hodge component $H^{p-l,q-l}(Y\cap V(\sigma))$ decomposes into the direct sum $$H^{p-l,q-l}_{\rm toric}(Y\cap V(\sigma))\oplus H^{p-l,q-l}_{\rm res}(Y\cap V(\sigma))$$ of the toric and residue parts. Since $Y\cap V(\sigma)$ is an ample hypersurface, from [@bc Theorem 11.8] and Section \[section.anvar\] it follows that $$H^{p-l,q-l}_{\rm res}(Y\cap V(\sigma))\cong R_1(f_C,C)_{q-l+1},$$ where $C\subset K$ is the face dual to $C^*$ which corresponds to $\sigma$, $p+q-2l=\dim Y\cap V(\sigma)=d-\dim\sigma-1=d-\dim C^*-1$. If $p+q-2l\ne d-\dim C^*-1$, then $H^{p-l,q-l}_{\rm res}(Y\cap V(\sigma))=0$. Hence, we get $$\bigoplus_{\begin{Sb}\sigma\in\Sigma\\l\in\ZZ\end{Sb}}
H_{\rm res}^{p-l,q-l}(Y\cap V(\sigma))\otimes
\bigoplus_{t\in T(\sigma)_l}\CC t
\cong \bigoplus_{0\ne C\subseteq K} R_1(\omega_{C^*},C^*)^\Sigma_{a}
\otimes R_1(f_C,C)_{b},$$ where $a=(p+q-d+\dim C^*+1)/2$ and $b=(q-p+\dim C)/2$. We are left to show that $$\label{e:lef}
\bigoplus_{\begin{Sb}\sigma\in\Sigma\\l\in\ZZ\end{Sb}}
H_{\rm toric}^{p-l,p-l}(Y\cap V(\sigma))\otimes
\bigoplus_{t\in T(\sigma)_l}\CC t
\cong R_1(\omega,K^*)^\Sigma_{p+1}.$$ Notice that the dimensions of the spaces on both sides coincide, so it suffices to construct a surjective map between them. This will follow from the following proposition.
\[p:sttor\] Let ${{{\PP}_{\Sigma}}}={\rm Proj}(\CC[K])$ be the Gorenstein Fano simplicial toric variety, where $K$ as above. Then there is a natural isomorphism: $$H^{p,p}_{\rm st}({{{\PP}_{\Sigma}}})\cong\bigoplus_{\begin{Sb}\sigma\in\Sigma\\l\in\ZZ\end{Sb}}
H^{p-l,p-l}(V(\sigma))\otimes \bigoplus_{t\in T(\sigma)_l}\CC t\cong
R_0(\omega,K^*)_p^\Sigma,$$ where $\omega=[0,1]+\sum_{\rho\in\Sigma(1)}\omega_\rho[e_\rho,1]$ with $\omega_\rho\ne0$.
First, observe that the dimensions of the spaces in the isomorphisms coincide by our definition of string cohomology, Proposition \[Zreg\] and [@bd Theorem 7.2]. So, it suffices to construct a surjective map between them.
We know the cohomology ring of the toric variety: $$H^{*}(V(\sigma))\cong
\CC[D_\rho:\rho\in\Sigma(1),\rho+\sigma\in\Sigma(\dim\sigma+1)]/
(P(V(\sigma))+SR(V(\sigma))),$$ where $$SR(V(\sigma))=\bigl\langle
D_{\rho_1}\cdots D_{\rho_k}:\{e_{\rho_1},\dots,e_{\rho_k}\}
\not\subset\tau \text{ for all
}\sigma\subset\tau\in\Sigma(\dim\sigma+1)\bigr\rangle$$ is the Stanley-Reisner ideal, and $$P(V(\sigma))=\biggl\langle
\sum_{\rho\in\Sigma(1),\rho+\sigma\in\Sigma(\dim\sigma+1)} \langle
m,e_\rho\rangle D_\rho: m\in M\cap\sigma^\perp\biggr\rangle.$$
Define the maps from $H^{p-l,p-l}(V(\sigma))\otimes \bigoplus_{t\in T(\sigma)_l}\CC t$ to $R_0(\omega,K^*)^\Sigma$ by sending $D_{\rho_1}\cdots D_{\rho_{p-l}}\otimes t$ to $\omega_{\rho_1}[e_{\rho_1}]\cdots \omega_{\rho_{p-l}} [e_{\rho_{p-l}}]\cdot t\in\CC[N]^\Sigma$. One can easily see that these maps are well defined. To finish the proof we need to show that the images cover $R_0(\omega,K^*)^\Sigma$. Every lattice point $[n]$ in the boundary of $K^*$ lies in the relative interior of a face $C\subset K^*$, and can be written as a linear combination of the minimal integral generators of $C$: $$[n]=\sum_{[e_\rho,1]\in C}(a_\rho+b_\rho)[e_\rho,1],$$ where $a_\rho\in(0,1)$ and $b_\rho$ are nonnegative integers. Let $C'\subseteq C$ be the cone spanned by those $[e_\rho,1]$ for which $a_\rho\ne0$. The lattice point $\sum_{[e_\rho,1]\in C'}(a_\rho)[e_\rho,1]$ projects to one of the elements $t$ from $T(\sigma)_l$ for some $l$ and $\sigma$ corresponding to $C'$. Using the relations $\sum_{\rho\in\Sigma(1)}\omega_\rho\langle m,e_\rho\rangle [e_\rho,1]$ in the ring $R_0(\omega,K^*)^\Sigma$, we get that $$[n]=\sum_{[e_\rho,1]\in C'}(a_\rho)[e_\rho,1]+
\sum_{\rho+\sigma\in\Sigma(\dim\sigma+1)}b'_\rho[e_\rho,1],$$ which comes from $H^{p-l,p-l}(V(\sigma))\otimes \CC t$ for an appropriate $p$. The surjectivity now follows from the fact that the boundary points of $K^*$ generate the ring $C[K^*]^\Sigma/\langle \omega\rangle$.
The isomorphism (\[e:lef\]) follows from the above proposition and the presentation: $$H_{\rm toric}^{*}(Y\cap V(\sigma))\cong H^*(V(\sigma))/{\rm Ann}([Y\cap V(\sigma)])$$ (see (\[e:ann\])). Indeed, the map constructed in the proof of Proposition \[p:sttor\] produces a well defined map between the right hand side in (\[e:lef\]) and $R_0(\omega,K^*)^\Sigma/Ann([0,1])$ because the annihilator of $[Y\cap V(\sigma)]$ maps to the annihilator of $[0,1]$. On the other hand, $$(R_0(\omega,K^*)^\Sigma/Ann([0,1]))_p\cong R_1(\omega,K^*)^\Sigma_{p+1},$$ which is induced by the multiplication by $[0,1]$ in $R_0(\omega,K^*)^\Sigma$.
We expect that the product structure on $H^{*}_{\rm st}({{{\PP}_{\Sigma}}})$ is given by the ring structure $R_0(\omega,K^*)^\Sigma$. Also, the ring structure on $R_1(\omega,K^*)^\Sigma_{*+1}$ induced from $R_0(\omega,K^*)^\Sigma/Ann([0,1])$ should give a subring of $H^{*}_{\rm st}(Y)$ for a generic $\omega$ in Conjecture \[semiampleconj\]. Moreover, $$\bigoplus_{p,q} R_1(\omega_{C^*},C^*)^\Sigma_{(p+q-d+\dim C^*+1)/2}
\otimes R_1(f_C,C)_{(q-p+\dim C)/2},$$ should be the module over the ring $R_0(\omega,K^*)^\Sigma/Ann([0,1])$: $$a\cdot(b\otimes c)=\bar{a}b\otimes c,$$ for $a\in R_0(\omega,K^*)^\Sigma/Ann([0,1])$ and $(b\otimes c)$ from a component of the above direct sum, where $\bar{a}$ is the image of $a$ induced by the projection $R_0(\omega,K^*)^\Sigma@>>>R_0(\omega_{C^*},C^*)^\Sigma$.
We can also say about the product structure on the B-model chiral ring. The space $R_1(f,K)\cong R_0(f,K)/Ann([0,1])$ in Conjecture \[semiampleconj\], which lies in the middle cohomology $\oplus_{p+q=d-1}H^{p,q}_{\rm st}(Y)$, should be a subring of the B-model chiral ring, and $$\bigoplus_{p,q} R_1(\omega_{C^*},C^*)^\Sigma_{(p+q-d+\dim C^*+1)/2}
\otimes R_1(f_C,C)_{(q-p+\dim C)/2},$$ should be the module over the ring $R_1(f,K)$, similarly to the above description in the previous paragraph.
These ring structures are consistent with the products on the usual cohomology and the B-model chiral ring $H^*(X,\bigwedge^*T_X)$ of the smooth semiample Calabi-Yau hypersurfaces $X$ in [@m3 Theorem 2.11(a,b)] and [@m2 Theorem 7.3(i,ii)].
Description of string cohomology inspired by vertex algebras {#section.vertex}
============================================================
Here we will give yet another description of the string cohomology spaces of Calabi-Yau hypersurfaces. It will appear as cohomology of a certain complex, which was inspired by the vertex algebra approach to Mirror Symmetry.
We will state the result first in the non-deformed case, and it will be clear what needs to be done in general. Let $K$ and $K^*$ be dual reflexive cones of dimension $d+1$ in the lattices $M$ and $N$ respectively. We consider the subspace $\CC[L]$ of $\CC[K]\otimes \CC[K^*]$ as the span of the monomials $[m,n]$ with $m\cdot n =0$. We also pick non-degenerate elements of degree one $f=\sum_m f_m [m]$ and $g=\sum_n g_n [n]$ in $\CC[K]$ and $\CC[K^*]$ respectively.
Consider the space $$V = \Lambda^*(N_\CC)\otimes \CC[L].$$
The space $V$ is equipped with a differential $D$ given by $$D:= \sum_{m} f_m \contr m \otimes(\pi_L\circ[m]) +
\sum_{n} g_n (\wedge n) \otimes(\pi_L\circ[n])$$ where $[m]$ and $[n]$ means multiplication by the corresponding monomials in $\CC[K]\otimes\CC[K^*]$ and $\pi_L$ denotes the natural projection to $\CC[L]$.
It is straightforward to check that $D^2=0$.
\[Dcoh\] Cohomology $H$ of $V$ with respect to $D$ is naturally isomorphic to $$\bigoplus_{C\subseteq K} \Lambda^{\dim C^*}C^*_\CC
\otimes R_1(f,C)\otimes R_1(g,C^*)$$ where $C^*_\CC$ denotes the vector subspace of $N_\CC$ generated by $C^*$.
First observe that $V$ contains a subspace $$\bigoplus_{C\subseteq K} \Lambda^* N_\CC \otimes (\CC[C^\circ]\otimes
\CC[C^{*\circ}])$$ which is invariant under $D$. It is easy to calculate the cohomology of this subspace under $D$, because the action commutes with the decomposition $\oplus_C$. For each $C$, the cohomology of $D$ on $\Lambda^* N_\CC \otimes (\CC[C^\circ]\otimes
\CC[C^{*\circ}])$ is naturally isomorphic to $$\Lambda^{\dim C^*}C^*_\CC
\otimes R_0(f,C^\circ)\otimes R_0(g,C^{*\circ}),$$ because $\Lambda^* N_\CC \otimes (\CC[C^\circ]\otimes\CC[C^{*\circ}])$ is a tensor product of the Koszul complex for $\CC[C^\circ]$ and the dual of the Koszul complex for $\CC[C^{*\circ}]$. As a result, we have a map $$\alpha:H_1\to H,~H_1:=\bigoplus_{C\subseteq K}\Lambda^{\dim C^*}C^
*_\CC
\otimes R_0(f,C^\circ)\otimes R_0(g,C^{*\circ}).$$
Next, we observe that $V$ embeds naturally into the space $$\bigoplus_{C\subseteq K} \Lambda^* N_\CC \otimes (\CC[C]\otimes
\CC[C^{*}])$$ as the subspace of the elements compatible with the restriction maps. This defines a map $$\beta:H\to\bigoplus_{C\subseteq K}\Lambda^{\dim C^*}C^
*_\CC
\otimes R_0(f,C)\otimes R_0(g,C^{*})=:H_2.$$
We observe that the composition $\beta\circ\alpha$ is precisely the map induced by embeddings $C^\circ\subseteq C$ and $C^{*\circ}\subseteq C^*$, so its image in $H_2$ is $$\bigoplus_{C\subseteq K}\Lambda^{\dim C^*}C^
*_\CC \otimes R_1(f,C)\otimes R_1(g,C^{*}).$$ As a result, what we need to show is that $\alpha$ is surjective and $\beta$ is injective. We can not do this directly, instead, we will use spectral sequences associated to two natural filtrations on $V$.
First, consider the filtration $$V=V^0\supset V^1\supset \ldots \supset V^{d+1}\supset V^{d+2}=0$$ where $V^p$ is defined as $\Lambda^*N_\CC$ tensored with the span of all monomials $[m,n]$ for which the smallest face of $K$ that contains $m$ has dimension at least $p$. It is easy to see that the spectral sequence of this filtration starts with $$H_3:=\bigoplus_{C\subseteq K}\Lambda^{\dim C^*}C^
*_\CC \otimes R_0(f,C^\circ)\otimes R_0(g,C^{*}).$$ Analogously, we have a spectral sequence from $$H_4:=\bigoplus_{C\subseteq K}\Lambda^{\dim C^{*}}C^
*_\CC \otimes R_0(f,C)\otimes R_0(g,C^{*\circ})$$ to $H$, which gives us the following diagram. $$\begin{array}{ccccc}
& & H_3 & & \\
& \nearrow & \Downarrow& \searrow & \\
H_1& \rightarrow & H & \rightarrow &H_2 \\
& \searrow & \Uparrow & \nearrow & \\
& & H_4 & &
\end{array}$$
We remark that the spectral sequences mean that $H$ is a subquotient of both $H_3$ and $H_4$, i.e. there are subspaces $I_3^+$ and $I_3^-$ of $H_3$ such that $H\simeq I_3^+/I_3^-$, and similarly for $H_4$. Moreover, the above diagram induces commutative diagrams $$\begin{array}{ccccccccccc}
& & 0 & & &\hspace{20pt} &
& & 0 & & \\
& & \downarrow& & &\hspace{20pt} &
& & \uparrow & & \\
& & I_3^- & & &\hspace{20pt} &
H_1& \rightarrow & H & \rightarrow &H_2 \\
& & \downarrow& & &\hspace{20pt} &
& \searrow & \uparrow & \nearrow & \\
& & I_3^+ & & &\hspace{20pt} &
& & I_4^+ & & \\
& \nearrow & \downarrow& \searrow & &\hspace{20pt} &
& & \uparrow & & \\
H_1& \rightarrow & H & \rightarrow &H_2&\hspace{20pt} &
& & I_4^- & & \\
& & \downarrow& & &\hspace{20pt} &
& & \uparrow & & \\
& & 0 & & &\hspace{20pt} &
& & 0 & & \\
\end{array}$$ with exact vertical lines. Indeed, the filtration $V^*$ induces a filtration on the subspace of $V$ $$\bigoplus_{C\subseteq K} \Lambda^*\otimes\CC[C^\circ]\otimes
\CC[C^{*\circ}].$$ The resulting spectral sequence degenerates immediately, and the functoriality of spectral sequences assures that there are maps from $H_1$ as above. Similarly, the space $$\bigoplus_{C\subseteq K} \Lambda^*\otimes\CC[C]\otimes
\CC[C^{*}]$$ has a natural filtration by the dimension of $C$ that induces the filtration on $V$. Functoriality then gives the maps to $H_4$.
We immediately get $$Im(\beta) \subseteq Im(H_3\to H_2) \cap Im(H_4\to H_2)$$ which implies that $$Im(\beta) = Im(\beta\circ\alpha)=
\bigoplus_{C\subseteq K}\Lambda^{\dim C^*}
C^*_\CC \otimes R_1(f,C)\otimes R_1(g,C^{*}).$$ Analogously, $Ker(\alpha)=Ker(\beta\circ\alpha)$, which shows that $$\bigoplus_{C\subseteq K}\Lambda^{\dim C^*}
C^*_\CC \otimes R_1(f,C)\otimes R_1(g,C^{*})$$ is a direct summand of $H$.
The fact that $$Ker(\alpha)\supseteq Ker(H_1\to H_4)$$ $$=
\bigoplus_{C\subseteq K}\Lambda^{\dim C^*}C^*_\CC
\otimes Ker(R_0(f,C^\circ)\to R_0(f,C))\otimes R_0(g,C^{*\circ})$$ implies that $I_3^-$ contains the image of this space under $H_1\to H_3$, which is equal to $$\bigoplus_{C\subseteq K}\Lambda^{\dim C^*}C^*_\CC
\otimes Ker(R_0(f,C^\circ)\to R_0(f,C))\otimes R_1(g,C^{*}).$$ Similarly, $I_3^+$ is contained in the preimage of $$\bigoplus_{C\subseteq K}\Lambda^{\dim C^*}C^*_\CC
\otimes R_1(f,C)\otimes R_1(g,C^{*})$$ under $H_3\to H_2$, which is $$\bigoplus_{C\subseteq K}\Lambda^{\dim C^*}C^*_\CC
\otimes R_0(f,C^\circ)\otimes R_1(g,C^{*}).$$ As a result, $$H=\bigoplus_{C\subseteq K}\Lambda^{\dim C^*}
C^*_\CC \otimes R_1(f,C)\otimes R_1(g,C^{*}).$$
If one replaces $\CC[K^*]$ by $\CC[K^*]^\Sigma$ in the definition of $\CC[L]$, then the statement and the proof of Theorem \[Dcoh\] remain intact. In addition, one can make a similar statement after replacing $\Lambda^*N_\CC$ by $\Lambda^*M_\CC$ and switching contraction and exterior multiplication in the definition of $D$. It is easy to see that the resulting complex is basically identical, though various gradings are switched. This should correspond to a switch between $A$ and $B$ models.
We will now briefly outline the connection between Theorem \[Dcoh\] and the vertex algebra approach to mirror symmetry, developed in [@Bvertex] and further explored in [@MS]. The vertex algebra that corresponds to the N=2 superconformal field theory is expected to be the cohomology of a lattice vertex algebra ${\rm Fock}_{M\oplus N}$, built out of $M\oplus N$, by a certain differential $D_{f,g}$ that depends on the defining equations $f$ and $g$ of a mirror pair. The space $\Lambda^*(N_\CC)\otimes \CC[L]$ corresponds to a certain subspace of ${\rm Fock}_{M\oplus N}$ such that the restriction of $D_{f,g}$ to this subspace coincides with the differential $D$ of Theorem \[Dcoh\]. We can not yet show that this is precisely the chiral ring of the vertex algebra, so the connection to vertex algebras needs to be explored further.
Appendix. G-polynomials
=======================
A finite graded partially ordered set is called Eulerian if every its nontrivial interval contains equal numbers of elements of even and odd rank. We often consider the poset of faces of the Gorenstein cone $K$ over a reflexive polytope $\Delta$ with respect to inclusions. This is an Eulerian poset with the grading given by the dimension of the face. The minimum and maximum elements of a poset are commonly denoted by $\hat 0$ and $\hat 1$.
[@stanley1] [Let $P = \lbrack \hat{0}, \hat{1} \rbrack$ be an Eulerian poset of rank $d$. Define two polynomials $G(P,t)$, $H(P,t) \in {\ZZ} [t]$ by the following recursive rules: $$G(P,t) = H(P,t) = 1\;\; \mbox{\rm if $d =0$};$$ $$H(P,t) = \sum_{ \hat{0} < x \leq \hat{1}} (t-1)^{\rho(x)-1}
G(\lbrack x,\hat{1}\rbrack, t)\;\; (d>0),$$ $$G(P,t) =
\tau_{ < d/2 } \left(
(1-t)H(P,t) \right) \;\;( d>0),$$ where $\tau_{ < r }$ denotes the truncation operator ${\ZZ}\lbrack t \rbrack \rightarrow
{\ZZ}\lbrack t \rbrack$ which is defined by $$\tau_{< r} \left( \sum_i a_it^i \right) = \sum_{i < r}
a_it^i.$$]{} \[Gpoly\]
The following lemma will be extremely useful.
For every Eulerian poset $P=[\hat 0,\hat 1]$ of positive rank there holds $$\sum_{\hat 0\leq x\leq \hat 1}(-1)^{\rk[\hat 0,x]} G([\hat 0,x]^*,t)
G([x,\hat 1],t)
=\sum_{\hat 0\leq x\leq \hat 1}
G([\hat 0,x],t)G([x,\hat 1]^*,t)(-1)^{\rk[x,\hat 1]}
=0$$ where $()^*$ denotes the dual poset. In other words, $G(\_,t)$ and $(-1)^{\rk}
G(\_^*,t)$ are inverses of each other in the algebra of functions on the posets with the convolution product. \[Ginverse\]
[*Proof.*]{} See Corollary 8.3 of [@stanley].
The following polynomial invariants of Eulerian posets have been introduced in [@bb].
\[Q\] Let $P$ be an Eulerian poset of rank $d$. Define the polynomial $B(P; u,v) \in {\ZZ}[ u,v]$ by the following recursive rules: $$B(P; u,v) = 1\;\; \mbox{\rm if $d =0$},$$ $$\sum_{\hat{0} \leq x \leq \hat{1}}
B(\lbrack \hat{0}, x \rbrack; u,v) u^{d - \rho(x)}
G(\lbrack x , \hat{1}\rbrack, u^{-1}v) = G(P ,uv).$$
\[BfromG\] Let $P=[\hat 0,\hat 1]$ be an Eulerian poset. Then $$B(P;u,v) = \sum_{\hat 0\leq x \leq \hat 1} G([x,\hat 1]^*,u^{-1}v)
(-u)^{\rk \hat 1 -\rk x}
G([\hat 0,x],uv).$$
Indeed, one can sum the recursive formulas for $B([\hat 0, y])$ for all $\hat 0\leq y\leq\hat 1$ multiplied by $G([y,\hat
1]^*,u^{-1}v) (-u)^{\rk \hat 1 -\rk y}$ and use Lemma \[Ginverse\].
[BaBrFK]{}
\[AKaMW\][AKMW]{} D. Abramovich, K. Karu, K. Matsuki, J. Włodarsczyk, [*Torification and Factorization of Birational Maps*]{}, preprint math.AG/9904135.
\[BaBrFK\][bbfk]{} G. Barthel, J.-P. Brasselet, K.-H. Fieseler, L. Kaup, [*Combinatorial Intersection Cohomology for Fans*]{}, preprint math.AG/0002181.
\[B1\][b1]{} V. V. Batyrev, [*Variations of the mixed Hodge structure of affine hypersurfaces in algebraic tori*]{}, Duke Math. J., [**69**]{} (1993), 349–409.
\[B2\][b2]{} , [*Dual polyhedra and mirror symmetry for Calabi-Yau hypersurfaces in toric varieties*]{}, J. Algebraic Geometry [**6**]{} (1994), 493–535.
\[B3\][Batyrev.cangor]{} , [*Stringy Hodge numbers of varieties with Gorenstein canonical singularities*]{}, Integrable systems and algebraic geometry (Kobe/Kyoto, 1997), 1–32, World Sci. Publishing, River Edge, NJ, 1998.
\[B4\][Batyrev.nai]{} , [*Non-Archimedean integrals and stringy Euler numbers of log-terminal pairs*]{}, J. Eur. Math. Soc. (JEMS) [**1**]{} (1999), no. 1, 5–33.
\[BBo\][bb]{} V. V. Batyrev, L. A. Borisov, [*Mirror duality and string-theoretic Hodge numbers*]{} Invent. math. [**126**]{} (1996), 183–203.
\[BC\][bc]{} V. V. Batyrev, D. A. Cox, [*On the Hodge structure of projective hypersurfaces in toric varieties*]{}, Duke Math. J. [**75**]{} (1994), 293–338.
\[BDa\][bd]{} V. V. Batyrev, D. Dais, [*Strong McKay correspondence, string-theoretic Hodge numbers and mirror symmetry*]{}, Topology [**35**]{} (1996), 901–929.
\[Bo1\][Bor.locstring]{} L. A. Borisov, [*String cohomology of a toroidal singularity*]{}, J. Algebraic Geom. [**9**]{} (2000), no. 2, 289–300.
\[Bo2\][Bvertex]{} , [*Vertex Algebras and Mirror Symmetry*]{}, Comm. Math. Phys. [**215**]{} (2001), no. 3, 517–557.
\[BreL\][bl]{} P. Bressler, V. Lunts, [*Intersection cohomology on nonrational polytopes*]{}, preprint math.AG/0002006.
\[C1\][c]{} D. A. Cox, [*The homogeneous coordinate ring of a toric variety*]{}, J. Algebraic Geom. [**4**]{} (1995), 17–50.
\[C2\][c2]{} , [*Recent developments in toric geometry*]{}, in Algebraic Geometry (Santa Cruz, 1995), Proceedings of Symposia in Pure Mathematics, [bf 62]{}, Part 2, Amer. Math. Soc., Providence, 1997, 389–436.
\[CKat\][ck]{} D. A. Cox, S. Katz, [*Algebraic Geometry and Mirror Symmetry*]{}, Math. Surveys Monogr. [**68**]{}, Amer. Math. Soc., Providence, 1999.
\[ChR\][cr]{} W. Chen, Y. Ruan, [*A new cohomology theory for orbifold*]{}, preprint math.AG/0004129
\[D\][d]{} V. I. Danilov, [*The geometry of toric varieties*]{}, Russian Math. Surveys [**33**]{} (1978), 97–154.
\[DiHVW\][dhvw]{} L. Dixon, J. Harvey, C. Vafa, E. Witten, [*Strings on orbifolds I, II*]{}, Nucl. Physics, [**B261**]{} (1985), [**B274**]{} (1986).
\[DKh\][dk]{} V. Danilov, A. Khovanskii, [*Newton polyhedra and an algorithm for computing Hodge-Deligne numbers*]{}, Math. USSR-Izv. [**29**]{} (1987), 279–298.
\[E\][e]{} D. Eisenbud, [*Commutative algebra with a view toward algebraic geometry*]{}, Graduate Texts in Mathematics [**150**]{}, Springer-Verlag, New York, 1995.
\[F\][f]{} W. Fulton, [*Introduction to toric varieties*]{}, Princeton Univ. Press, Princeton, NJ, 1993.
\[G\][Greene]{}B. R. Greene, [*String theory on Calabi-Yau manifolds*]{}, Fields, strings and duality (Boulder, CO, 1996), 543–726, World Sci. Publishing, River Edge, NJ, 1997.
\[KoMo\][Kollar]{} J. Kollár, S. Mori, [*Birational geometry of algebraic varieties*]{}, With the collaboration of C. H. Clemens and A. Corti. Cambridge Tracts in Mathematics [**134**]{}. Cambridge University Press, Cambridge, 1998.
\[MaS\][MS]{} F. Malikov, V. Schechtman, [*Deformations of chiral algebras and quantum cohomology of toric varieties*]{}, preprint math.AG/0003170.
\[Mat\][ma]{} Matsumura, [*Commutative ring theory.*]{} Translated from Japanese by M. Reid. Second edition. Cambridge Studies in Advanced Mathematics, 8. Cambridge University Press, Cambridge, 1989.
\[M1\][m1]{} A. R. Mavlyutov, [*Semiample hypersurfaces in toric varieties*]{}, Duke Math. J. [**101**]{} (2000), 85–116.
\[M2\][m2]{} , [*On the chiral ring of Calabi-Yau hypersurfaces in toric varieties*]{}, preprint math.AG/0010318.
\[M3\][m3]{} , [*The Hodge structure of semiample hypersurfaces and a generalization of the monomial-divisor mirror map*]{}, in Advances in Algebraic Geometry Motivated by Physics (ed. E. Previato), Contemporary Mathematics, [**276**]{}, 199–227.
\[P\][p]{} M. Poddar, [*Orbifold Hodge numbers of Calabi-Yau hypersurfaces*]{}, preprint math.AG /0107152.
\[S1\][stanley1]{} R. Stanley, [*Generalized $H$-vectors, Intersection Cohomology of Toric Varieties, and Related Results*]{}, Adv. Stud. in Pure Math. [**11**]{} (1987), 187–213.
\[S2\][stanley]{} , [*Subdivisions and local h-vectors*]{}, JAMS [**5**]{} (1992), 805–851.
| {
"pile_set_name": "ArXiv"
} |
Q:
Python df.loc not working for variables
I am fairly new to Python, especially pandas. I have a dataframe called KeyRow which is from a bigger df:
KeyRow=df.loc[df['Order'] == UniqueOrderName[i]]
Then I make a nested loop
for i in range (0,len(PersonNum)):
print(KeyRow.loc[KeyRow['Aisle'] == '6', 'FixedPill'])
So it appears to only work when a constant is placed, whereas if I use PersonNum[0] instead of '6',even though both values are equivalent, it appears not to work. When I use PersonNum[i] this is the output I am getting:
Series([], Name: FixedPill, dtype: object)
Whereas if I use 'x' I get a desired result:
15 5
Name: FixedPill, dtype: object
Thanks for all the help in advance.
A:
It's a little unclear what your are trying to accomplish with this questions. If you are looking to filter a DataFrame, then I would suggest to never do this in an iterative manner. You should take full advantage of the slicing capabilities of .loc. Consider the example:
df = pd.DataFrame([[1,2,3], [4,5,6],
[1,2,3], [2,5,6],
[1,2,3], [4,5,6],
[1,2,3], [4,5,6]],
columns=["A", "B", "C"])
df.head()
A B C
0 1 2 3
1 4 5 6
2 1 2 3
3 2 5 6
4 1 2 3
Suppose you have a list of PersonNum that you want to use to locate the a particular field where your list is PersonNum = [1, 2]. You can slice the DataFrame in one step by performing:
df.loc[df["A"].isin(PersonNum), "B"]
Which will return a pandas Series and
df.loc[df["A"].isin(PersonNum), "B"].to_frame()
which returns a new DataFrame. Utilizing the .loc is significantly faster than an iterative approach.
| {
"pile_set_name": "StackExchange"
} |
Norin-10-based semidwarfism.
Many short-strawed wheats, including the Norin-10-based semidwarfs now grown in many countries, are characterized by their relative "insensitivity" to gibberellic acid. The nature of this insensitivity, its genetic control, and the relationships between the Gai genes and the Rht genes, which control height reductiion in Norin-10 and Tom Thumb wheats, are described. The role and potential of these genes in agriculture and their relationship to other genes affecting yield, height, and other agronomic features are considered. | {
"pile_set_name": "PubMed Abstracts"
} |
%YAML 1.1
%TAG !u! tag:unity3d.com,2011:
--- !u!21 &2100000
Material:
serializedVersion: 6
m_ObjectHideFlags: 0
m_CorrespondingSourceObject: {fileID: 0}
m_PrefabInstance: {fileID: 0}
m_PrefabAsset: {fileID: 0}
m_Name: Floor
m_Shader: {fileID: 4800000, guid: 933532a4fcc9baf4fa0491de14d08ed7, type: 3}
m_ShaderKeywords:
m_LightmapFlags: 4
m_EnableInstancingVariants: 0
m_DoubleSidedGI: 0
m_CustomRenderQueue: 2050
stringTagMap:
RenderType: Opaque
disabledShaderPasses: []
m_SavedProperties:
serializedVersion: 3
m_TexEnvs:
- _BaseMap:
m_Texture: {fileID: 2800000, guid: 7583d2822d7d74246ba5be4bfb4bfb77, type: 3}
m_Scale: {x: 1, y: 1}
m_Offset: {x: 0, y: 0}
- _BumpMap:
m_Texture: {fileID: 0}
m_Scale: {x: 1, y: 1}
m_Offset: {x: 0, y: 0}
- _DetailAlbedoMap:
m_Texture: {fileID: 0}
m_Scale: {x: 1, y: 1}
m_Offset: {x: 0, y: 0}
- _DetailMask:
m_Texture: {fileID: 0}
m_Scale: {x: 1, y: 1}
m_Offset: {x: 0, y: 0}
- _DetailNormalMap:
m_Texture: {fileID: 0}
m_Scale: {x: 1, y: 1}
m_Offset: {x: 0, y: 0}
- _EmissionMap:
m_Texture: {fileID: 0}
m_Scale: {x: 1, y: 1}
m_Offset: {x: 0, y: 0}
- _MainTex:
m_Texture: {fileID: 2800000, guid: 7583d2822d7d74246ba5be4bfb4bfb77, type: 3}
m_Scale: {x: 1, y: 1}
m_Offset: {x: 0, y: 0}
- _MetallicGlossMap:
m_Texture: {fileID: 0}
m_Scale: {x: 1, y: 1}
m_Offset: {x: 0, y: 0}
- _OcclusionMap:
m_Texture: {fileID: 0}
m_Scale: {x: 1, y: 1}
m_Offset: {x: 0, y: 0}
- _ParallaxMap:
m_Texture: {fileID: 0}
m_Scale: {x: 1, y: 1}
m_Offset: {x: 0, y: 0}
- _SpecGlossMap:
m_Texture: {fileID: 0}
m_Scale: {x: 1, y: 1}
m_Offset: {x: 0, y: 0}
m_Floats:
- _AlphaClip: 0
- _Blend: 0
- _BumpScale: 1
- _Cull: 2
- _Cutoff: 0.5
- _DetailNormalMapScale: 1
- _DstBlend: 0
- _EnvironmentReflections: 1
- _GlossMapScale: 1
- _Glossiness: 0.15
- _GlossyReflections: 1
- _Metallic: 0
- _OcclusionStrength: 1
- _Parallax: 0.02
- _QueueOffset: 0
- _ReceiveShadows: 1
- _Smoothness: 0.15
- _SmoothnessTextureChannel: 0
- _SpecularHighlights: 1
- _SrcBlend: 1
- _Surface: 0
- _UVSec: 0
- _WorkflowMode: 1
- _ZWrite: 1
m_Colors:
- _BaseColor: {r: 1, g: 1, b: 1, a: 1}
- _Color: {r: 1, g: 1, b: 1, a: 1}
- _EmissionColor: {r: 0, g: 0, b: 0, a: 1}
- _SpecColor: {r: 0.19999996, g: 0.19999996, b: 0.19999996, a: 1}
--- !u!114 &3801298144813794507
MonoBehaviour:
m_ObjectHideFlags: 11
m_CorrespondingSourceObject: {fileID: 0}
m_PrefabInstance: {fileID: 0}
m_PrefabAsset: {fileID: 0}
m_GameObject: {fileID: 0}
m_Enabled: 1
m_EditorHideFlags: 0
m_Script: {fileID: 11500000, guid: d0353a89b1f911e48b9e16bdc9f2e058, type: 3}
m_Name:
m_EditorClassIdentifier:
version: 1
| {
"pile_set_name": "Github"
} |
C-type natriuretic peptide (CNP), the third discovered member of the natriuretic peptide (NP) family, received its name because it shares a common amino acid core structure with the previously isolated cardiac hormones atrial and B-type NPs (ANP and BNP) (reviewed in ([@CIT0001])). However, human and murine genetic studies later revealed that CNP's major physiological function is not the regulation of renal natriuresis. Instead, CNP is a critical regulatory hormone in the bone, where it stimulates physiological endochondral bone growth by auto/paracrine activation of its specific cyclic GMP-forming natriuretic peptide receptor-B (NPR-B, also named guanylyl cyclase-B) in chondrocytes ([@CIT0001]). In addition, local CNP/NPR-B signalling participates in oocyte maturation, sensory axon bifurcation, and moderation of arterial blood pressure ([@CIT0001], [@CIT0004], [@CIT0005]).
NPR-B presents as a homodimer, and each subunit contains an extracellular CNP-binding domain, a short transmembrane region and an intracellular region with a short submembrane segment followed by a kinase homology regulatory domain, a coiled-coil dimerization region and a C-terminal guanylyl cyclase domain ([@CIT0001], [@CIT0006]). After extracellular binding of CNP, the intracellular guanylyl cyclase domain catalyses the conversion of guanosine triphosphate to cyclic guanosine monophosphate (cGMP) as a second messenger. In chondrocytes, this fosters hypertrophy, differentiation, and extracellular matrix deposition necessary for longitudinal bone growth ([@CIT0002], [@CIT0003]). The kinase-like domain does not exert kinase activity; however, phosphorylation of specific residues within this region is necessary for CNP-dependent stimulation of cGMP synthesis ([@CIT0006]).
The essential role of the chondrocyte CNP/NPR-B/cGMP signalling pathway during long bone growth has been demonstrated in many functional and genetic studies. In mice, global or chondrocyte-restricted CNP (gene name *Nppc*) or NPR-B (*Npr2*) deletions provoke severe dwarfism ([@CIT0003], [@CIT0007]). In human, homozygous or compound heterozygous loss-of-function variants of NPR-B (MIM \#108961) lead to extreme short stature, with shortening of the limbs, severe brachydactyly of the hands and feet, and skeletal dysplasia, a condition named acromesomelic dysplasia, type Maroteaux (AMDM, MIM \#602875) ([@CIT0008]). Consistently, heterozygous loss-of-function NPR-B variants are associated with mildly reduced stature (MIM \#616255) ([@CIT0009], [@CIT0010]). Conversely, gain-of-function NPR-B variants lead to tall stature, sometimes associated with a Marfanoid habitus, arachnodactyly, and scoliosis, a condition named epiphyseal chondrodysplasia, Miura type (MIM \#615923) ([@CIT0011]). Three such intracellular activating variants of NPR-B have been identified in humans: the Val883Met variant is located in the cyclase domain ([@CIT0011]); the Ala488Pro and Arg655Cys variants affect the submembrane and kinase-homology domains, respectively ([@CIT0012], [@CIT0013]). Because such variants enhanced both the basal and CNP-stimulated cGMP-synthesis of NPR-B, it was suggested that they provoke a conformational change which is similar to that adopted by NPR-B in response to CNP binding ([@CIT0014]).
In this report, we describe a novel heterozygous gain-of-function variant c.1444_1449delATGCTG in exon 8 of *NPR2*, predicted to result in the deletion of 2 amino acids Met482-Leu483 in the cytosolic submembrane region of NPR-B. Similarly to the previously identified Ala488Pro variant in this region ([@CIT0012]), this novel variant is associated with tall stature and macrodactyly of the great toes (epiphyseal chondrodysplasia, Miura type).
Research Design and Methods {#s1}
===========================
Patients {#s2}
--------
We studied a family of Dutch origin, including a mother and her 2 daughters. Informed consent and assent were obtained from the 3 probands. Blood samples were obtained from the mother and saliva was obtained from her daughters for genotyping. Fibroblasts from a skin biopsy were obtained from the mother for ex vivo studies of NPR-B activity. We compared fibroblast NPR-B expression and activity with fibroblasts from a wild-type (WT) NPR-B healthy volunteer and with the previously described proband with the activating Arg655Cys NPR-B variant ([@CIT0013]).
Sanger sequencing and analysis {#s3}
------------------------------
DNA was isolated from blood samples using the chemagic Prime instrument (PerkinElmer, Waltham, MA, USA). DNA from saliva was isolated using the prepIT-L2P kit (DNA Genotek, Kanata, Ontario, Canada). Primer design for *NPR2* was based on a template sequence available on Ensembl transcript ENST00000342694.6 and ENST00000265074.13, respectively. Primers were designed for all coding exons and the corresponding intron/exon boundaries using Primer3, version 4.1.0 (sequences available upon request). Amplification of the selected gene regions was performed using GoTaq G2 DNA polymerase-mediated PCR (Promega Corporation, Madison, WI, USA) and was verified by agarose gel electrophoresis. Primer sequences and PCR conditions are available on request. After amplification by PCR, primers, and unincorporated dNTPs (Promega Corporation) were removed using exonuclease I (New England Biolabs, Inc, Ipswich, MA, USA) and calf intestine alkaline phosphatase (CIAP, Roche Applied Science, Hoffmann--La Roche AG, Basel, Switzerland). Sequencing was carried out directly on purified fragments with the ABI 310 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA), using an ABI Prism BigDye terminator cycle sequencing ready reaction kit, version 1.1 (Applied Biosystems). The BigDye XTerminator purification kit was used as purification method for DNA sequencing with the purpose of removing unincorporated BigDye terminators. The presence of the *NPR2* variant in both affected daughters was also confirmed using Sanger sequencing.
Isolation and culture of skin fibroblasts and cGMP determinations {#s4}
-----------------------------------------------------------------
Skin biopsies were taken from the proband and a healthy 37-year-old female (height 171 cm, +0.07 standard deviation score \[SDS\]), and fibroblast cultures were established as previously described ([@CIT0013]). Fibroblasts of the previously described proband (not related to the currently investigated family) with the activating Arg655Cys NPR-B variant were included for comparison ([@CIT0013]). Experiments were performed in mitogen-free, serum-reduced DMEM (0.5% fetal calf serum 4 hours before experimentation). Cells were pretreated with 0.1 mM of the phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine (IBMX; Sigma) for 15 minutes, and then stimulated with CNP (0.1-100 nM; Bachem) for another 10 minutes. Intracellular cGMP contents were extracted with 70% (v/v) ice-cold ethanol and determined by radioimmunoassay ([@CIT0005], [@CIT0013]).
Site-directed mutagenesis and cGMP responses of transfected HEK-293 cells to CNP {#s5}
--------------------------------------------------------------------------------
To generate the construct encoding the mutant protein NPR-B Met482-Leu483del, a PCR fragment was amplified from a *pFLAG-CMV1* vector containing the WT *NPR2* cDNA (Swiss-Prot entry Q6VVW5 ([@CIT0013])). The reverse primer: 5- CCATAGCATGCTAGCCAGCTCCTTCTCCAGCTTCCGGAAAATTAGGAAACTG-3, spanning the novel c.1444_1449delATGCTG deletion, and the forward primer: 5-GGGCACTTCAATTGGACAGCTCG-3 were used for the PCR amplification. The PCR fragment containing the variant was digested with the MfeI and NheI restriction enzymes, and subcloned into the *pFLAG-CMV1-NPR2* vector restricted with the same enzymes. The desired variant and the absence of unwanted variants were verified by sequencing.
To compare the expression and activity levels of the WT and mutant NPR-B proteins, HEK-293 cells were transiently transfected with 10 μg of the respective plasmids in 10-cm dishes using the *X-tremeGene HP* DNA transfection reagent (Roche). For immunoblotting, membrane proteins were isolated 48 hours posttransfection. To assess intracellular cGMP responses, the HEK-293 cells were transferred into 24-well plates (100 000 cells per well) 1 day after transfection ([@CIT0013]). After 20 hours, the cells were serum starved for 4 hours, pretreated with 0.1 mM IBMX for 15 minutes, and then incubated with various concentrations of CNP for another 10 minutes. Intracellular cGMP contents were determined as stated previously ([@CIT0005], [@CIT0013]).
Guanylyl cyclase activity assays {#s6}
--------------------------------
Guanylyl cyclase activity of crude membranes prepared from transfected HEK-293 cells was assessed as described before ([@CIT0013]). Assays were performed in a 50 mM HEPES buffer, pH 7.4, containing 50 mM NaCl, 5% glycerol, 0.05% BSA, 1 mM IBMX, 2 mM guanosine triphosphate, 30 mM creatine phosphate, 1.5 U/mL creatine phosphokinase, and 2 mM ATP. Membranes (20 μg protein) were incubated with CNP (to assess ligand-dependent activity), or with 1% (v/v) Triton X-100 (for detergent stimulated, maximal activity) during 10 minutes ([@CIT0013]). cGMP formation was measured by radioimmunoassay ([@CIT0005], [@CIT0013]). Basal and CNP-stimulated cGMP responses were calculated as percentage of maximal Triton-stimulated activity.
Cell membrane fractionations and western blotting {#s7}
-------------------------------------------------
Membrane protein fractions were obtained from cultured skin fibroblasts and HEK-293 cells using a Protein Fractionation Kit (Thermo Fisher Scientific). For Western blot analyses, 25 μg protein was resolved by sodium dodecyl sulfate-PAGE ([@CIT0013]). The primary antibodies were against NPR-B (1:5000 ([@CIT0005]);) and Na^+^/K^+^-ATPase (1:5000; Abcam).
In silico modelling {#s8}
-------------------
To elucidate the possible impact of the reported Met482-Leu483 deletion within the intracellular membrane near region of NPR-B (UniProt code P20594) a theoretical 3-dimensional (3D) model was built for the region spanning Thr451 to Arg495. First, the location of the transmembrane helix of NPR-B was predicted using the software tool TMHMM 2. 0 (<http://www.cbs.dtu.dk/>). Subsequently, secondary structure prediction was performed for the region comprising residues Leu456 to Trp492 using the software JPRED4 (<http://www.compbio.dundee.ac.uk>). A 3D model was then built using the software package Quanta2008 (BIOVIA, San Diego, CA, USA) and the tool ProteinDesign. A 3D model for the deletion variant was similarly obtained by the building routine using Quanta2008/ProteinDesign removing residues Met482 and Leu483.
Statistical analyses {#s9}
--------------------
Data are presented as mean ± SEM. The 2-tailed unpaired Student *t-*test was used to analyze significant differences between 2 groups. *P* \< 0.01 was considered significant.
Results {#s10}
=======
Clinical characteristics and investigations {#s11}
-------------------------------------------
The proband is a currently 37-year-old female. She was born at term to nonconsanguineous parents after a normal pregnancy with a birth weight of 3400 g (-0.39 SDS) and a birth length of 49 cm (-0.92 SDS). She reached developmental milestones at appropriate ages. At the age of 8 years, she was treated for the first time for markedly long great toes by bilateral percutaneous epiphysiodesis. Throughout adolescence, the proband exhibited tall stature and low weight for height. At 14 years of age, her height was 181 cm, bone age was 13 years according to Greulich and Pyle, and predicted adult height was 186.8 cm based on the Bayley-Pinneau tables. Physical examination at that time showed macrodactyly of the great toes, long thumbs, an arm span to height ratio of 0.9, and a positive "thumb sign" (a sign of arachnodactyly; positive if the distal phalanx of the thumb reaches beyond the ulnar border of the palm, after wrapping the fingers around the thumb in adduction) without other signs of Marfan syndrome. Family history was unremarkable except for osteoporosis in the proband's mother and grandmother. The proband's parents and brother are of normal height. From age 14 years, she was treated with supraphysiological doses of estrogens (200 mcg of ethinylestradiol per day) in combination with progesterone (5 mg of hydroxyprogesterone during the first 10 days of each month) for adult height reduction. Menarche occurred 3 months after start of treatment. Treatment had little effect on her growth and was discontinued at the age of 16 years. The proband has been experiencing irregular menses since menarche (menses every 25-60 days). She has had 2 spontaneous pregnancies and possibly 1 miscarriage.
The proband is presently diagnosed with fibromyalgia and monitored by a rheumatologist. Her current anthropometric data are shown in [Table 1](#T1){ref-type="table"}. She has a minor ankle valgus, no scoliosis, and no joint hypermobility. She reports nearsightedness, with a correction of -5 diopters. Arterial blood pressure is normal.
######
Anthropometric Data
H (HSDS) SHHR (SDS) AHR
------------ ----------------- ------------- ------
Proband 188.1 cm (+2.8) 0.50 (-1.7) 0.90
Daughter 1 136.8 cm (+2.0) 0.53 (-0.5) 0.94
Daughter 2 110.2 cm (+1.3) 0.54 (-0.7) 0.94
Daughter 1: eldest daughter (age 7.1 years), daughter 2: youngest daughter (age 4.0 years). Abbreviations: AHR, arm span to height ratio; H, height; SDS, standard deviation scores; SHHR, sitting height to height ratio.
The proband and her nonconsanguineous spouse gave birth to 2 daughters. The girls were born at term following uneventful pregnancies. Birth weight of the eldest daughter at 38 + 1 weeks gestation was 2740 g (-1.13 SDS); length at 1 month was 53.5 cm (-0.13 SDS). She reached developmental milestones at an appropriate age, except for idiopathic toe walking until the age of 3 years. She has pes planovalgus. She underwent epiphysiodesis of both great toes when she was 5 years old. She wears glasses (+3.75/+3.5). The youngest daughter was born at 37 + 2 weeks gestation with a birth weight of 2740 g (-0.66 SDS); length at the age of 5 weeks was 54 cm (-0.43 SDS). She has a history of minor gross motor developmental delay and receives speech therapy. They were referred for clinical genetic evaluation at the age of 6 and 4 years, respectively, because of progressive macrodactyly of the great toes. At physical examination, the girls had markedly long great toes ([Fig. 1](#F1){ref-type="fig"}), ankle valgus, and long thumbs with a positive thumb sign. Skeletal surveys of the girls demonstrate pseudo-epiphyses of mid- and proximal phalanges in hands and feet, but not in other long bones ([Fig. 1](#F1){ref-type="fig"}). Beighton score (joint hypermobility score in which a maximum of 9 points can be allocated for specific maneuvers; ≥ 4 points indicates generalized hypermobility) was 0 in both girls. No specific facial dysmorphic features were noted. At anthropometric evaluation, the girls had a diminished span to height ratio resulting from shortened forearms (mesomelia). For current anthropometric data, see [Table 1](#T1){ref-type="table"} and [Fig. 1](#F1){ref-type="fig"}. The father of the girls is 178 cm (-0.58 SDS), which results in a target height of 175 cm (+0.68 SDS) with a range of 165 to 185 cm. Skeletal surveys of the girls showed pseudo-epiphyses of the mid- and proximal phalanges of all fingers and both great toes ([Fig. 1](#F1){ref-type="fig"}). The growth curve of the eldest daughter shows progressive growth acceleration until the age of 4.5 years up to a height of +2 SDS ([Fig. 2A](#F2){ref-type="fig"}); the curve of the youngest daughter seems to follow this pattern ([Fig. 2B](#F2){ref-type="fig"}). Bone age was according to calendar age in both girls. No other skeletal abnormalities were observed.
{#F1}
{#F2}
Identification of a heterozygous variant in the *NPR2* gene {#s12}
-----------------------------------------------------------
Because of the similarities with the phenotypes of the patients published by Miura et al. ([@CIT0011], [@CIT0012]), we selected *NPR2* as a candidate gene for further investigations. Sanger sequencing identified a heterozygous c.1444_1449delATGCTG deletion in exon 8 of *NPR2* (NM_003995.3), which is predicted to lead to an in-frame deletion of 2 highly conserved amino acids, methionine 482 and leucine 483, within the intracellular membrane near region of NPR-B ([Fig. 3](#F3){ref-type="fig"}). The same heterozygous *NPR2* variant was sequenced in DNA of the daughters. Other family members were not studied. [Fig. 3](#F3){ref-type="fig"} illustrates that the amino acid sequence of this region of NPR-B is very conserved across species.
![Alignments of the amino acids 459--519 of NPR-B comparing the sequences of wild-type NPR-B across species, human NPR1 and mutant NPR-B. TMD represents the transmembrane domain and PKD the start of the protein kinase-homology domain. The black arrows label the 2 amino acids (Met482-Leu483) that are deleted in the cytosolic sub-membrane region of NPR-B in the proband (last line). For comparison, the sequence of the human natriuretic peptide receptor type A (NPR-A, also named guanylyl cyclase-A \[GC-A\]) is also included. Please note the high sequence conservation of the trans- and submembrane regions of NPR-B among species and between NPR-B and NPR-A, which suggests that the here studied deletion variant affects a functionally critical region. NPR, natriuretic peptide receptor.](dgaa190f0003){#F3}
Fibroblasts from the proband with the Met482-Leu483del NPR-B variant have enhanced basal cGMP levels and augmented cGMP responses to CNP {#s13}
----------------------------------------------------------------------------------------------------------------------------------------
To study the impact of the variant on the expression and activity of native NPR-B, we cultured fibroblasts from skin biopsies of the forearms of the proband and an age-/gender-matched control donor. Western blot analyses of fractionated membrane proteins revealed that membrane NPR-B expression levels were lower in the proband´s fibroblasts as compared to control ([Fig. 4A](#F4){ref-type="fig"}). Despite this attenuated expression, the basal cGMP contents of such fibroblasts were significantly increased ([Fig. 4B](#F4){ref-type="fig"}). Moreover, the cGMP responses to low, physiological CNP concentrations (0.1 and 1 nM) were significantly augmented ([Fig. 4C](#F4){ref-type="fig"}). The effects of higher, supraphysiological CNP concentrations (10 and 100 nM) were also greater in fibroblasts from the proband; however, the difference to controls did not reach statistical significance ([Fig. 4C](#F4){ref-type="fig"}). Although we could only study fibroblasts from 1 control donor, the results suggest increased baseline and ligand-evoked activity of the mutant NPR-B naturally expressed in fibroblasts.
{#F4}
Site-directed mutagenesis demonstrates enhanced baseline and CNP-stimulated guanylyl cyclase activity of the mutant NPR-B {#s14}
-------------------------------------------------------------------------------------------------------------------------
Receptor-independent alterations may influence NPR-B activity in native cells. Therefore, we replicated the variant by site-directed mutagenesis for studies in a heterologous expression system. Transfection of HEK-293 cells with cDNA encoding Met482-Leu483del NPR-B produced slightly less amounts of membrane-bound immunoreactive protein compared with WT NPR-B in 3 separate experiments ([Fig. 5A](#F5){ref-type="fig"}). Together with the experiments with cultured fibroblasts this suggests diminished synthesis and/or membrane localization of the mutant. Despite, basal intracellular cGMP levels of HEK-293 cells expressing the mutant were \~9.9-fold higher in comparison with cells expressing WT NPR-B ([Fig. 5B](#F5){ref-type="fig"}). CNP evoked concentration-dependent increases of intracellular cGMP levels. The responses to low CNP concentrations (0.01-1 nM CNP) were significantly greater in cells expressing the mutant, whereas the responses to a high CNP concentration (10 nM) were similar between cells expressing the WT or the mutant receptor ([Fig. 5B](#F5){ref-type="fig"}).
{#F5}
Guanylyl cyclase activity assays were performed with crude membranes from transfected HEK-293 cells in the presence of 2 mM ATP to mimic cytoplasmic ATP levels. Such assays harbor the advantage that the response to CNP can be normalized to the maximal, detergent (Triton)-induced NPR-B activity. This facilitates the comparison of WT and mutant receptor activities when their membrane expression levels are unequal. [Fig. 5C](#F5){ref-type="fig"} corroborates the previous experiments showing that baseline, ligand-independent activity of Met482-Leu483del NPR-B as well as the responses to low CNP concentrations (0.01-1 nM CNP) were significantly augmented. The responses to the highest CNP concentration (10 nM) were similar to the WT receptor ([Fig. 5C](#F5){ref-type="fig"}). In concordance with the reduced protein expression levels, the maximal, Triton-stimulated activity of the mutant NPR-B was slightly reduced ([Fig. 5C](#F5){ref-type="fig"}). To account for the differences in membrane receptor expression levels, within each experiment the CNP stimulated activity data were normalized to the respective maximal, Triton-stimulated NPR-B activity (considered as 100%) ([Fig. 5D](#F5){ref-type="fig"}). This normalization demonstrated the mutant NPR-B exhibits augmented catalytic activity at baseline and in response to all tested CNP concentrations. In other words, the previous observations that the effects of high CNP concentrations (10-100 nM) on intracellular cGMP levels of fibroblasts ([Fig. 4C](#F4){ref-type="fig"}) or HEK-293 cells ([Fig. 5B](#F5){ref-type="fig"}) were similar between cells expressing WT or mutant NPR-B, is probably linked to the attenuated membrane expression of the mutant.
The Met482-Leu483del NPR-B variant has lower baseline and CNP-stimulated guanylyl cyclase activities than the Arg655Cys NPR-B variant {#s15}
-------------------------------------------------------------------------------------------------------------------------------------
Last, we compared in fibroblasts and transfected HEK-293 cells the CNP responsiveness of the novel deletion variant with the previously published variant Arg655Cys ([@CIT0013]). This point mutation variant, which we found in an extremely tall proband ([@CIT0013]), affects the KHD of NPR-B. [Fig. 6A](#F6){ref-type="fig"} illustrates that membrane NPR-B expression levels in fibroblasts cultured from both probands were lower, as in fibroblasts from the control donor. The cGMP-responses to a physiological CNP concentration (0.1 nM) were greatest in fibroblasts from the previously published proband with the Asp655Cys NPR-B variant ([Fig. 6B](#F6){ref-type="fig"}).
{#F6}
HEK-293 cells were transfected with the cDNAs encoding each mutant. Western blot analysis showed that the expression of the Met482-Leu483del NPR-B mutant was slightly lower than the expression of Arg655Cys NPR-B ([Fig. 6C](#F6){ref-type="fig"}). Guanylyl cyclase activity assays using crude membranes from transfected HEK-293 cells revealed that Met482-Leu483del NPR-B has significantly lower baseline (ligand-independent) activity and lower responses to CNP compared with Arg655Cys NPR-B ([Fig. 6D](#F6){ref-type="fig"}). As also shown, in concordance with the reduced protein expression levels, the maximal, Triton-stimulated activity of the Met482-Leu483del NPR-B mutant was also slightly lower. To account for such differences in membrane expression levels, the CNP-stimulated activity data were again normalized to the respective maximal, Triton-stimulated NPR-B activity. These evaluations confirmed that the Met482-Leu483del NPR-B mutant exhibits lower responsiveness to CNP as compared to the Arg655Cys NPR-B mutant ([Fig. 6E](#F6){ref-type="fig"}).
Molecular modelling suggests that the Met482-Leu483 deletion changes the 3D structure of the submembrane region of NPR-B {#s16}
------------------------------------------------------------------------------------------------------------------------
Crystal structure analyses of the extracellular domain (ECD) of natriuretic peptide receptor-A (NPR-A), shared by ANP and BNP, provided insights into the molecular mechanisms of ligand recognition and a model of ligand-induced allosteric NPR-A activation ([@CIT0015], [@CIT0016]). These experimental studies revealed that ANP binding induces a rotation of the ECDs of the 2 monomer subunits of the receptor dimer with respect to each other. It was postulated that this movement transduces across the membrane being an allosteric trigger for activation of the intracellular guanylyl cyclase domain to cGMP synthesis ([@CIT0015]). Unfortunately, no experimentally validated structure is currently available for the transmembrane and intracellular regions of NPR-B or a homologous protein. To generate a working hypothesis about how the deletion of residues Met482-Leu483 could impact NPR-B activity, a theoretical 3D model of the transmembrane domain and the submembrane segment containing residues Met482-Leu483 was built using bioinformatic tools. Sequence-based tools to predict location and secondary structure indicated that the residues Leu456 to Phe478 form a single transmembrane helix, as expected for a type I transmembrane receptor ([Fig. 3](#F3){ref-type="fig"}). This is consistent with the notion of basic positively charged amino acids at the C-terminal end of transmembrane helices (here, as residues Arg479 and Lys480), which are important to vertically fix such helices in the lipid bilayer ([@CIT0017]). Subsequently secondary structure modelling was performed for this transmembrane sequence and flanking extra- and intracellular protein segments. This predicted that the transmembrane and intracellular membrane near regions very likely form a continuous α-helical structure running from Leu456 to Trp492 ([Fig. 7A](#F7){ref-type="fig"}). The 3D models were built to estimate how the deletion of residues Met482 and Leu483 would change these single helices. Because an α-helix has 3.6 residues per full turn, a 2-residue deletion would result in a reorientation of the helix surface ahead and past the deletion site by 120° ([Fig. 7A](#F7){ref-type="fig"}, right panel; and [Fig. 7B](#F7){ref-type="fig"}, left panel). The amphipathic signature of the helix markedly changes as a result of that. The 3D model of WT NPR-B indicated that this segment does not form a continuous hydrophobic patch, whereas in the Met482-Leu483 deletion variant, a continuous hydrophobic patch is predicted to run along the transmembrane region into the submembrane region ([Fig. 7B](#F7){ref-type="fig"}, middle panel). Such change in the surface chemistry of this intracellular membrane-near segment of the here described mutant NPR-B might can affect dimer stability or conformation thereby leading to a preactivated state already in the absence of CNP or a hyperactivated state by stabilizing the CNP-induced active receptor conformation.
![A theoretical 3D model of the trans- and cytosolic submembrane segments of WT and mutant NPR-B. Bioinformatic modelling predicted that Leu456 is the N-terminal start and Phe478 the end of the transmembrane region, which is consistent with the notion that basic residues at the C-term of transmembrane helices (here, residues Arg479 and Lys480) are important to vertically fix such helices in the lipid bilayer ([@CIT0017]). Secondary structure prediction indicated an uninterrupted α-helical element comprising residues Leu456 to Trp492. (A) A theoretical 3D model of this helix was built for WT NPR-B (A, left helix) and mutant NPR-B (A, right helix; the deleted residues are marked with C-atoms colored in magenta). The deletion Met482-Leu483 results in a rotational rearrangement of the helix past the deletion site (in panel A, the right panel compares the WT and mutant helix, the rotation is marked). This in silico model suggests that in the mutant NPR-B the residues Glu484 to Trp492 are rotated by 120° clockwise and that the amphipathic structure of the helix is markedly changed. (B) Left panel: 3D model of the helix covering the transmembrane and cytoplasmic submembrane regions is shown for WT and Met482-Leu483del NPR-B (residues Thr451 to Arg495). Color coding was done according to amino acid polarity, with hydrophobic amino acid residues colored in gray, positively charged residues colored in blue, negatively charged residues marked in red, and polar but uncharged amino acids indicated in green. Middle panel: The model is depicted with a semitransparent surface representation showing a continuous hydrophobic patch for Met482-Leu483del past the transmembrane segment. WT NPR-B does not show such a hydrophobic surface patch. Right panel: The model is rotated clockwise by 90° around the y-axis. 3D, 3-dimensional; NPR, natriuretic peptide receptor; WT, wild-type.](dgaa190f0007){#F7}
Discussion {#s17}
==========
Loss-of-function sequence variants in NPR-B (encoded by the *NPR2* gene) cause short stature ([@CIT0008]), whereas gain-of-function variants lead to tall stature ([@CIT0011]). Here, we describe a mother and 2 daughters with tall stature and macrodactyly of the great toes (epiphyseal chondrodysplasia, Miura type) associated with an in-frame deletion in *NPR2* resulting in the deletion of the amino acids Met482-Leu483 in the intracellular membrane-near region of NPR-B. Assays with cultured native fibroblasts and transfected HEK-293 cells demonstrated that Met482-Leu483del NPR-B responds to CNP with markedly enhanced cGMP production. Also, the ligand-independent (baseline) cGMP-synthesis activity of this mutant receptor is markedly increased. Because the CNP/NPR-B/cGMP signalling pathway is critically involved in bone development by stimulating growth plate chondrocyte differentiation and proliferation ([@CIT0001]), we conclude that the Met482-Leu483del variant is responsible for the observed skeletal overgrowth of the proband. The current growth of the 2 daughters is not as pronounced compared with the proband. This can be explained by their father's height, which is slightly below average. Because height is a highly polygenic trait, this observation is congruent with the notion that monogenic growth disorders may present with a height within normal ranges.
This report adds to the three earlier reports of gain-of-function NPR-B variants: 2 families with variants in the GCD or submembrane domains exhibited tall stature including macrodactyly of the great toes, scoliosis, coxa valga, and slipped capital femoral epiphysis ([@CIT0011], [@CIT0012]); and 1 man with a variant in the KHD had isolated extreme tall stature ([@CIT0013]). Elegant biochemical studies in a heterologous expression system showed that these variants have distinct effects on NPR-B-mediated cGMP production, NPR-B dephosphorylation/desensitization or the allosteric modulation of the GCD by ATP ([@CIT0014], [@CIT0018]). Our comparative studies of the Met482-Leu483del and Arg655Cys NPR-B mutants indicate that the extent of cGMP-overproduction correlates with height (present study and ([@CIT0013])). Ultimately it remains unclear why different activating NPR-B variants are associated with distinct overgrowth phenotypes.
Pronounced macrodactyly of the great toes is a striking feature shared by almost all known gain-of-function NPR-B variants (([@CIT0011], [@CIT0012]); see [Fig. 1](#F1){ref-type="fig"} of the present study). In general, 3 cGMP-regulated proteins participate in chondrogenesis and chondrocyte proliferation during long bone growth: cGMP-dependent protein kinases type I and II; and phosphodiesterase (PDE) 3A, a cGMP-inhibited cAMP-hydrolyzing enzyme ([@CIT0001]). Notably, during development PDE3A is highly expressed in domains involved in digit formation. PDE3A gain-of-function variants, with increased cAMP-hydrolytic activity, are associated with severe brachydactyly ([@CIT0019]). We suggest that augmented CNP/NPR-B/cGMP-dependent inhibition of PDE3A (diminishing cAMP-hydrolytic activity and thereby enhancing chondrocyte cAMP levels) may contribute to macrodactyly in gain-of-function NPR-B variants. However, why overactivation of CNP/NPR-B/cGMP signalling preferentially affects the growth of the big toes is presently unknown.
The proband has a history of delayed puberty, which also occurred in our previous proband ([@CIT0013]). This increases final height by allowing for prolonged growth before epiphyseal closure. We assume that in the proband, pubertal delay could have been a result of her low body weight, leading to hypothalamic dysfunction. Another novel clinical feature in this NPR-B gain-of-function phenotype is mesomelia. Until now, this was only reported in loss-of-function NPR-B variants. Unfortunately, segregation analysis of the *NPR2* in-frame deletion with mesomelia or delayed puberty could not be established in other family members. Therefore, it remains unclear if these features are part of the phenotypic spectrum of activating NPR-B variants, and this needs to be explored in future diagnosed families with NPR-B gain-of-function variants.
The presence of pseudo-epiphyses ([Fig. 1](#F1){ref-type="fig"}) has been reported before by Boudin et al. ([@CIT0020]), who reviewed X-rays of previously published cases with activating NPR-B variants after they found that biallelic loss-of-function variants in natriuretic peptide receptor-C (NPR-C; also named NPR3) are associated with tall stature, macrodactyly of the great toes, and pseudo-epiphyses ([@CIT0019]). NPR-C binds and internalizes all 3 natriuretic peptides (ANP, BNP, CNP) with similar affinities, thereby acting as a "clearance" receptor ([@CIT0001]). It was suggested that loss-of-function variants in NPR-C result in reduced clearance of CNP, thereby increasing local CNP levels in the bone and CNP/NPR-B signalling ([@CIT0001], [@CIT0020]).
The reported NPR-B deletion variant Met482-Leu483 as well as the previously reported substitution Ala488Pro ([@CIT0012]) affect a topological domain between the transmembrane region and the kinase-homology domain of NPR-B. As shown in [Fig. 3](#F3){ref-type="fig"}, the amino acid sequence of this region is highly conserved in NPR-B across species and among natriuretic peptide receptors. Notably, both variants resulted in augmented baseline as well as ligand-dependent NPR-B/cGMP activities. Moreover, they were associated with very similar clinical phenotypes, with pronounced macrodactyly of the great toes. Interestingly, a recently published novel NPR-B variant Arg495Cys, affecting the same protein region, was associated with diminished CNP-simulated NPR-B catalytic activity and idiopathic short stature ([@CIT0021]). The marked impact of these 3 variants on baseline and CNP-stimulated NPR-B function (([@CIT0012], [@CIT0021]) and present study) indicates that this submembrane region has a critical role, although the precise function is unknown.
Different NPRs can bind the same ligand (e.g., both NPR-A and NPR-C bind ANP and BNP, both NPR-B and NPR-C bind CNP), indicating that the ECD of all NPRs have similar ligand recognition and activation mechanisms ([@CIT0001]). By sedimentation equilibrium analyses, it was found that the crystalized ECD of NPR-A undergoes spontaneous dimerization with a dissociation constant *K*~*d*~ of \~500 nM, suggesting that most NPR-As preexist in the cell's membrane as homodimers ([@CIT0016], [@CIT0022]). Furthermore, crystal structure analyses of the ECDs of NPR-A and NPR-C revealed that a single ANP (in NPR-A) or either ANP or CNP molecule (in NPR-C) binds within the interface of a receptor homodimer and induces a rotation of the ECDs of the 2 dimer subunits with respect to each other ([@CIT0015], [@CIT0023]). It is postulated that this movement transduces across the membrane being an allosteric trigger for intracellular signalling by natriuretic peptides ([@CIT0015], [@CIT0023]). Such experimental studies have not been performed for NPR-B. However, because of the high amino acid homologies to NPR-A (in the intracellular domains) and NPR-C (in the extracellular domain), it is likely that this allosteric activation mechanism is valid also for NPR-B. To provide a potential molecular explanation for the effect of the described Met482-Leu483 deletion here, we performed in silico modelling of this receptor region. Our 3D model predicted a single uninterrupted α-helical element comprising the transmembrane (Leu456-Phe478) and submembrane regions of NPR-B (until residue Trp492). Because of the architecture of α-helices, the deletion reported here Met482-Leu483 would result in a rotational rearrangement of the helix past the deletion site (clockwise by 120°) and thereby markedly change its amphipathic surface. Based on the results of our functional studies, we assume that this change in amphilicity could stabilize the active conformation of the NPR-B dimer and further facilitate its CNP-induced allosteric activation. This could lead to a hyperactivated state of NPR-B at baseline and upon ligand-binding. However, the exact molecular mechanism is unknown.
Because the probands are heterozygous carriers of the variant, they will possibly express WT/WT (\~25%), WT/mut (\~50%), and mut/mut (\~25%) NPR-B dimers. Our present study and also the previously published studies ([@CIT0011]) cannot distinguish whether the resulting gain of function of the CNP/NPR-B system is caused by the small population of mut/mut dimers or linked to the prevalent WT/mut dimers.
In summary, with this report of a family with tall stature and macrodactyly of the great toes because of a gain-of-function in-frame deletion within the submembrane region of NPR-B, the genotypical and phenotypical spectrum of NPR-B-related tall stature is expanded. Our observations emphasize the important role of this domain in the regulation of cyclic GMP production and bone growth in response to CNP/NPR-B signaling.
The authors are grateful for the participation of the proband and her family.
***Financial Support:*** The studies of CNP/NPR-B signalling by M.K.'s group are funded by the Deutsche Forschungsgemeinschaft (DFG KU 1037/7-1 and DFG KU 1037/8-1) and the Bundesministerium für Forschung und Technik (BMBF 01EO1004). The work of E.B. was supported by grants of the 'Fonds voor Wetenschappelijk Onderzoek Vlaanderen' (12A3814N and 1507317N) and the 'Bijzonder Onderzoeksfonds' (BOF) of the University of Antwerp (BOF KP: 34417).
***Author Contributions:*** P.L., D.v.d.K., M.K., and H.v.D. planned the studies and wrote the manuscript. P.L., A.v.H., and D.v.d.K. gathered clinical data on the proband and her family. Functional assays were performed by E.M.L., E.B., F.W., H.S., and M..K. T.M. performed in silico modellings. All authors critically reviewed manuscript drafts and approved the final manuscripts as submitted.
3D
: 3-dimensional
cGMP
: cyclic guanosine monophosphate
CNP
: C-type natriuretic peptide
ECD
: extracellular domain
IBMX
: 3-isobutyl-1-methylxanthine
NP
: natriuretic peptide
NPR
: natriuretic peptide receptor
PDE
: phosphodiesterase
SDS
: standard deviation score
WT
: wild-type.
Additional Information {#s0105}
======================
***Disclosure Summary:*** The authors have no conflicts of interests to state. The authors have no ethical conflicts to disclose. This study was approved by the Medical Ethical Committee of Leiden University Medical Center. The proband and her family agreed to participate and signed informed consent.
***Data Availability:*** The datasets generated during and/or analyzed during the current study are not publicly available but are available from the corresponding author on reasonable request.
[^1]: P.L. and E.M.-L. contributed equally; M.K. and D.C.M.vd.K. contributed equally.
| {
"pile_set_name": "PubMed Central"
} |
Q:
Describe or link to a simple method of solving set theory questions
I have a series of set theory questions to answer and the method I have is to draw out venn diagrams one by one and work them out visually. I have been unsuccessful in my search for 3 set arithmetic questions. Is there a simpler general method or a link to a simpler general method of solving them? Example below:
$A \cap C \cap B^\prime \cup A \cap B \cap C^\prime \subseteq (A \cup B \cup C)^\prime$
$(A \cup B)^\prime \cup C \cap B^\prime \subseteq C \cup A^\prime \cup B^\prime$
Please describe, or link to, a general method able to quickly decide if expressions such as these are true.
A:
First, you need to be much more careful with your parentheses, and add them when needed to avoid ambiguities.
For example, your Venn diagrams should tell you that $A \cap (B \cup C)$ is not the same thing as $(A \cap B) \cup C$
Indeed, if we look at left hand side of your second expression ... is it $((A \cup B)' \cup C) \cap B'$, or is that $(A \cup B)' \cup (C \cap B')$?
Anyway, once you have used parentheses to disambiguate, you can use some algebraic methods, which you can find online (look for 'Boolean algebra' or 'algebra of sets')
To give an example, if we interpret the abov expression as the latter, we ca do the following:
$(A \cup B)' \cup (C \cap B') =$ (DeMorgan)
$(A' \cap B') \cup (C \cap B') =$ (Distribution)
$(A' \cup C) \cap B' = $ (Commutation)
$(C \cup A') \cap B'$
And since in general $A \cap B \subseteq A \cup B$, we can now say that:
$(C \cup A') \cap B' \subseteq C \cup A' \cup B'$
| {
"pile_set_name": "StackExchange"
} |
Detecting esophageal disease with second-generation capsule endoscopy: initial evaluation of the PillCam ESO 2.
Esophageal capsule endoscopy (ECE) provides an alternative, minimally invasive modality for evaluating the esophagus. This study evaluates the performance and test characteristics of a second-generation esophageal capsule endoscope, the PillCam ESO 2. Adults with known or suspected esophageal disease were included. Using the simplified ingestion procedure, each patient underwent capsule endoscopy with the PillCam ESO 2. Following ECE, esophagogastroduodenoscopy (EGD) was performed on the same day by an investigator who was blinded to the results of the ECE. In random order, capsule endoscopy videos were read and interpreted by the study investigator blinded to EGD results. 28 patients (19 men, 9 women; mean age 53.3 years) were included. In 82 % of the patients, at least 75 % of the Z line was visualized by the PillCam ESO 2. A per-lesion analysis demonstrated that the PillCam ESO 2 had definitive results in 30/43 lesions (69.8 %) and EGD in 29/43 (67.4 %), P value = 0.41. Compared with EGD for detecting suspected Barrett's esophagus and esophagitis, the PillCam ESO 2 had a sensitivity of 100 % and a specificity of 74 %, and a sensitivity of 80 % and a specificity of 87 %, respectively. The PillCam ESO 2 demonstrated 86 % agreement with EGD in describing the Z line (kappa statistic 0.68). The modified ingestion protocol provided excellent cleansing, with bubbles/saliva having no or only a minor effect on Z line images in 86 % of cases. The PillCam ESO 2 demonstrated excellent visualization of the Z line. Compared with standard EGD, the PillCam ESO 2 had good test characteristics with high rates of detection of suspected Barrett's esophagus and esophagitis. This study provides indirect validation of the simplified ingestion procedure. The PillCam ESO 2 acquires high quality esophageal images, performs safely, and should be able to replace the current PillCam ESO. | {
"pile_set_name": "PubMed Abstracts"
} |
Q:
Finding kernel and image of a linear transformation, given eigenvalues and eigenvectors?
Problem: Consider the linear transformation $T : \mathbb{R}^3 \rightarrow \mathbb{R}^3$ with eigenvalues $-1, 0$ and $1$ and the corresponding eigenvectors $v_1, v_2, v_3$. Determine $\text{ker}(T)$ and $\text{Im}(T)$.
Attempt at solution: In general we have $D = P^{-1} A P$, where $D$ is a diagonal matrix with the eigenvalues, $P$ is the matrix with columns the corresponding eigenvectors, and $A$ is the matrixrepresentation of $T$ with respect to some basis. Hence $A = PDP^{-1}$. Now the kernel of $T$ is the nullspace of the matrix $A$, while the image of $T$ is the columnspace of $A$. I'm not sure how to solve this problem, because we are not given any specific eigenvectors. So how could we ever find $P^{-1}$? Since $0$ is an eigenvalue of $T$, $A$ is singular. But what does that say about the nullspace and columnspace of $A$?
Any help would be appreciated.
A:
Here's a possible strategy:
Note that the dimension of $\operatorname{im}(T)$ equals the rank of $A$ and hence the rank of $D$ since conjugate matices have same rank. What is the rank of $D$? Hence, what is the dimension of $\operatorname{im}(T)$? Given the eigenvectors corresponding to the distinct non-zero eigenvalues, what are obvious independent elements of $\operatorname{im}(T)$?
Further, how are the dimensions of $\operatorname{im}(T)$ and $\operatorname{ker}(T)$ related? Hence, given that $0$ is an eigenvalue, what is $\operatorname{ker}(T)$?
| {
"pile_set_name": "StackExchange"
} |
/*
* This program is free software; you can redistribute it and/or modify it
* under the terms of the GNU Lesser General Public License as published by
* the Free Software Foundation.
*
* This program is distributed in the hope that it will be useful, but
* WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY
* or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License
* for more details.
*
* You should have received a copy of the GNU Lesser General Public License
* along with this program; if not, see <http://www.gnu.org/licenses/>.
*
* Copyright (C) 1999-2008 Novell, Inc. (www.novell.com)
*/
#include "evolution-config.h"
#include "e-composer-spell-header.h"
G_DEFINE_TYPE (
EComposerSpellHeader,
e_composer_spell_header,
E_TYPE_COMPOSER_TEXT_HEADER)
static void
e_composer_spell_header_class_init (EComposerSpellHeaderClass *class)
{
EComposerTextHeaderClass *composer_text_header_class;
composer_text_header_class = E_COMPOSER_TEXT_HEADER_CLASS (class);
composer_text_header_class->entry_type = E_TYPE_SPELL_ENTRY;
}
static void
e_composer_spell_header_init (EComposerSpellHeader *header)
{
}
EComposerHeader *
e_composer_spell_header_new_label (ESourceRegistry *registry,
const gchar *label)
{
g_return_val_if_fail (E_IS_SOURCE_REGISTRY (registry), NULL);
return g_object_new (
E_TYPE_COMPOSER_SPELL_HEADER,
"label", label, "button", FALSE,
"registry", registry, NULL);
}
EComposerHeader *
e_composer_spell_header_new_button (ESourceRegistry *registry,
const gchar *label)
{
g_return_val_if_fail (E_IS_SOURCE_REGISTRY (registry), NULL);
return g_object_new (
E_TYPE_COMPOSER_SPELL_HEADER,
"label", label, "button", TRUE,
"registry", registry, NULL);
}
| {
"pile_set_name": "Github"
} |
def euclideanDistance(p: List[Int], q: List[Int]): Int =
math.sqrt(p.zip(q).map { case (u, v) => math.pow(u-v, 2) }.sum) | {
"pile_set_name": "Github"
} |
--- a/sockd/sockd_io.c.old 2017-05-10 19:57:20.672000000 +0000
+++ b/sockd/sockd_io.c 2017-05-10 20:00:34.548000000 +0000
@@ -2912,7 +2912,7 @@ siginfo(sig, si, sc)
int src_so_rcvbuf, dst_so_rcvbuf;
#endif /* HAVE_RECVBUF_IOCTL */
-#if HAVE_SENDBUF_IOCTL
+#ifdef HAVE_SENDBUF_IOCTL
int src_so_sndbuf, dst_so_sndbuf;
#endif /* HAVE_SENDBUF_IOCTL */
@@ -2960,7 +2960,7 @@ siginfo(sig, si, sc)
*src_bufferinfo = NUL;
*dst_bufferinfo = NUL;
-#if HAVE_RECVBUF_IOCTL || HAVE_SENDBUF_IOCTL
+#if defined(HAVE_RECVBUF_IOCTL) || defined(HAVE_SENDBUF_IOCTL)
havesocketinfo = 1;
@@ -2987,7 +2987,7 @@ siginfo(sig, si, sc)
}
#endif /* HAVE_RECVBUF_IOCTL */
-#if HAVE_SENDBUF_IOCTL
+#ifdef HAVE_SENDBUF_IOCTL
if (havesocketinfo) {
if (ioctl(src->s, SENDBUF_IOCTLVAL, &src_so_sndbuf) != 0) {
swarn("%s: sendbuf size ioctl() on src-fd %d failed",
@@ -3005,7 +3005,7 @@ siginfo(sig, si, sc)
}
#endif /* HAVE_SENDBUF_IOCTL */
-#if HAVE_SENDBUF_IOCTL && HAVE_RECVBUF_IOCTL
+#ifdef HAVE_SENDBUF_IOCTL && HAVE_RECVBUF_IOCTL
if (havesocketinfo) {
snprintf(src_bufferinfo, sizeof(src_bufferinfo),
"%lu buffered (%lu + %lu + %lu)",
| {
"pile_set_name": "Github"
} |
Antonio Armijo
Antonio Mariano Armijo (1804–1850) was a Spanish explorer and merchant who is famous for leading the first commercial caravan party between Abiquiú, Nuevo México and San Gabriel Mission, Alta California in 1829–1830. His route, the southernmost and most direct, is known as the Armijo Route of the Old Spanish Trail.
Abiquiú was the starting point and eastern terminus of the original route of the Old Spanish Trail. Though segments of an overland route between the Spanish colonies of Nuevo México and Alta California had been blazed decades earlier, Armijo was the first to pioneer a complete route that traveled the entire length. Armijo traveled with sixty mounted men and a caravan of pack animals carrying blankets and other trade goods to barter for mules in California. The caravan left Abiquiú on 7 November 1829 and made the journey to the San Gabriel Mission in what is now San Gabriel, California in eighty-six days, arriving on 31 January 1830. He returned by the same route in 56 days, leaving 1 March and arriving on 25 April 1830. Unlike the other routes of the Old Spanish Trail, Armijo's route was documented day by day, although in a very brief report listing dates and stopping places, with few other details and no distances recorded. The report was submitted to the governor of Nuevo México, José Antonio Cháves, and published by the Mexican government on 19 June 1830.
References
External links
PHOTO #: WY0002a, CAPTION: Antonio Mariano Armijo on horse Fuego (Smokey) 1851. This pencil sketch by J. Lundquist. Antonio Mariano is oldest son of Jose Francisco Armijo and; Jesus Maria Armijo. See also: Rulofson Coll. No. RR-244L Year: 1851 from solanohistory.org accessed 30 October 2015.
Category:1804 births
Category:1850 deaths
Category:Mexican people of Spanish descent
Category:History of California
Category:History of Mexico
Category:1829 in Mexico
Category:1830 in Mexico
Category:History of New Mexico
Category:History of Nevada
Category:History of Utah
Category:History of Clark County, Nevada
Category:People from Santa Fe, New Mexico
Category:Spanish explorers of North America
Category:Explorers of the colonial Southwest of the present United States | {
"pile_set_name": "Wikipedia (en)"
} |
Q:
ERROR: Error installing jekyll: ERROR: Failed to build gem native extension
My system has:
ruby 2.0.0p451 (2014-02-24) [x64-mingw32]
gem -version 2.2.2
devKit : DevKit-mingw64-64-4.7.2-20130224-1432-sfx.exe
When I try to run gem install jekyll, I get this error:
D:\devKit>gem install jekyll
Temporarily enhancing PATH to include DevKit...
Building native extensions. This could take a while...
ERROR: Error installing jekyll:
ERROR: Failed to build gem native extension.
"D:/Program Files (x86)/Ruby200-x64/bin/ruby.exe" extconf.rb
D:/Program Files (x86)/Ruby200-x64/bin/ruby.exe: invalid switch in RUBYOPT: -F (
RuntimeError)
extconf failed, exit code 1
Gem files will remain installed in D:/Program Files (x86)/Ruby200-x64/lib/ruby/g
ems/2.0.0/gems/fast-stemmer-1.0.2 for inspection.
Results logged to D:/Program Files (x86)/Ruby200-x64/lib/ruby/gems/2.0.0/extensi
ons/x64-mingw32/2.0.0/fast-stemmer-1.0.2/gem_make.out
A:
I got this error while installing Jekyll on Linux (Mint 17, which is based on Ubuntu 14.04).
I eventually found the solution here. I needed both the ruby-dev package and nodejs (the latter due to a bug in Jekyll).
sudo apt-get install ruby ruby-dev make
sudo gem install jekyll --no-rdoc --no-ri
sudo apt-get install nodejs
A:
I ran into this problem too. Running the following installed Jekyll for me:
$ \curl -L https://get.rvm.io | bash -s stable --rails --autolibs=enabled
$ sudo gem install jekyll
This installs RVM, updates Rails and installs Jekyll.
BTW - Most of the posts I've found indicate it's a problem with Xcode not having the developer tools installed. I have a newer MacBook Pro on which this stuff was installed by default, so attempting to install the Xcode dev tools did nothing for me (unlike the above, which did everything I needed).
| {
"pile_set_name": "StackExchange"
} |
Q:
Join table on Count
I have two tables in Access, one containing IDs (not unique) and some Name and one containing IDs (not unique) and Location. I would like to return a third table that contains only the IDs of the elements that appear more than 1 time in either Names or Location.
Table 1
ID Name
1 Max
1 Bob
2 Jack
Table 2
ID Location
1 A
2 B
Basically in this setup it should return only ID 1 because 1 appears twice in Table 1 :
ID
1
I have tried to do a JOIN on the tables and then apply a COUNT but nothing came out.
Thanks in advance!
A:
Here is one method that I think will work in MS Access:
(select id
from table1
group by id
having count(*) > 1
) union -- note: NOT union all
(select id
from table2
group by id
having count(*) > 1
);
MS Access does not allow union/union all in the from clause. Nor does it support full outer join. Note that the union will remove duplicates.
| {
"pile_set_name": "StackExchange"
} |
Video-lecture with most views in microeconomics
In the lecture videos, Professor Jonathan Gruber covers the principles of microeconomics conceptually, mathematically, and graphically, giving students a holistic understanding of the subject matter. Lecture 19 of 38.
In the lecture videos, Professor Jonathan Gruber covers the principles of microeconomics conceptually, mathematically, and graphically, giving students a holistic understanding of the subject matter. Lecture 21 of 38.
In the lecture videos, Professor Jonathan Gruber covers the principles of microeconomics conceptually, mathematically, and graphically, giving students a holistic understanding of the subject matter. Lecture 1 of 38.
In the lecture videos, Professor Jonathan Gruber covers the principles of microeconomics conceptually, mathematically, and graphically, giving students a holistic understanding of the subject matter. Lecture 13 of 38. | {
"pile_set_name": "Pile-CC"
} |
Might I just say that after finding Funny bottle chair | Interesting and Beautiful pictures on Pluck, what
a comfort to come across somebody who finally understands what they’re writing about on the web. You truly realize how to bring a problem to light and make it crucial. Many more people should really have a look at this and have an understanding of this side of the story. It’s surprising you’re not more prevalent, as you most really possess the gift.
It is much easier to deal with the status quo than to push
forward beyond the fear. He forwarded the email to her and she just broke down.
However, there’s at least 41 other drivers who will try to beat them to the checkered flag first.
Can I just say what a comfort to uncover an individual who actually knows what they’re discussing over the internet. You certainly realize how to bring a problem to light and make it important. More people really need to look at this and understand this side of the story. I was surprised that you are not more popular given that you definitely possess the gift.
I don’t even know the way I stopped up right here, however I thought this post was once good. I don’t recognize who you’re however certainly you are going to a well-known blogger if you aren’t
already. Cheers! | {
"pile_set_name": "Pile-CC"
} |
Q:
ggplot : Multi variable (multiple continuous variable) plotting
A data that is deduced from a larger data using dplyr, shows me information regarding the total sales of the four quarters for the years 2013 and 2014.
Quarter X2013 X2014 Total.Result
1 Qtr 1 77282.13 66421.10 143703.2
2 Qtr 2 69174.64 76480.13 145654.8
3 Qtr 3 65238.47 79081.74 144320.2
4 Qtr 4 65429.73 109738.82 175168.5
I wish to plot a bargraph for the following using ggplot by comparing the two years on the bars and for such bar-groups for the each of the quarters like shown below. (output from MS Excel)
The ggplot statement that I used is as shown below (I may be wrong)
ggplot(qtr2, aes(x=as.factor(Quarter),fill=c(X2013,X2014))) +
geom_bar(position="dodge")
and I get an error
Error: Aesthetics must either be length one, or the same length as the dataProblems:as.factor(Quarter)
A:
You need to bring your data into the long format for ggplot:
require(ggplot2)
require(reshape2)
df <- read.table(header = TRUE, text = 'R Quarter X2013 X2014 Total.Result
1 Qtr 1 77282.13 66421.10 143703.2
2 Qtr 2 69174.64 76480.13 145654.8
3 Qtr 3 65238.47 79081.74 144320.2
4 Qtr 4 65429.73 109738.82 175168.5')
df$R <- NULL
head(df)
# bring to long data (1)
dfm <- melt(df, id.vars = c('Quarter', 'Total.Result'))
dfm
ggplot(dfm, aes(x = factor(Quarter), y = value, fill = variable) ) +
geom_bar(stat="identity", position = 'dodge')
Regarding the Total Result column / bars: I don't know where this data should come from (missing?) - There is only one column, but two bars? And the values do not fit. If you tell me how to generate these, it should be no problem to plot.
| {
"pile_set_name": "StackExchange"
} |
TRENDING:
Division III
Women's Volleyball
In Case You Missed It
In Case You Missed It
Don't miss it
NCAA.com | November 8, 2013
No. 4 St. Thomas earns trip to title game
Share
MINNEAPOLIS -- St. Benedict (Minn.) came out very strong against No. 13 Augsburg. After Augsburg gave the CSB its first loss of the season by a 3-0 score in September, the Blazers pushed through to take a 3-1 win on the Auggies home court in the rematch Thursday.
In the first set, the score stayed close all the way through starting with a 5-5 tie and staying within two points until the Auggies took a 21-18 lead. From there, the Auggies finished strong and took a 25-19 win. The second set started the same way and the Blazers held a slim 17-15 lead. The Blazers then powered through the end of the set to take a 25-19 win.
The Blazers continued to further their lead in the third set and finished with a 25-16 win.
The fourth and final set once again started out with a close score as the Blazers held a 7-6 lead. After a 5-to-2 run, the Blazers kept a steady lead for the rest of the game finishing the night with a 25-21 win. CSB never trailed in the third and fourth sets.
St. Thomas (Minn.) 3, St. Mary's 1
ST. PAUL, Minn. -- Kelly Foley had a season-high 21 kills and Jill Greenfield had 15 kills and 15 digs as No. 4 St. Thomas (Minn.) (27-2) scored a 3-1 comeback win against St. Mary's (24-9).
Alex Peterson had 23 kills and hit .340 for the Cardinals. St. Thomas will host the third-seed St. Benedict (26-2) on Saturday in the playoff championship match. The Blazers scored a 3-1 road win against Augsburg.
No. 3 Cal Lutheran 3, Chapman 0
Cal Lutheran (29-1) came out fired up in front of a loud and rowdy crowd, breaking a 10-10 tie and stealing the momentum in the opening set. The Regals led by as many as eight and use a mix of solid offense and defense to earn the first set win.
With a lot of great rallies in the second set, CLU and CU each had their swings of controlling the pace. A pair of Allie Eason service aces followed by a block gave the Violet and Gold an 8-6 lead, but the Panthers came back with a block of their own to knot the teams at 9-9. Once the Regals went up 11-10 they never looked back, opening an advantage of eight at 23-15, ultimately winning by nine.
During the third and decisive game, Nicki Tetherow came up with a pancake dig and Eason killed it on a set from Jackie Russell giving CLU a 15-9 lead, forcing CU head coach Mary Cahill to use a timeout. While the Panthers broke the huddle to score the next two points, the Regals resumed the momentum with a Caitlin Fransen and Hayley Tamagni roof block that forced another Panthers timeout at 21-12. CLU cruised to the 25-13 final, locking up a spot in the title match, while Chapman’s season came to a close. | {
"pile_set_name": "Pile-CC"
} |
Can the Hooked app find the next 'Harry Potter' for Hollywood?
By Ryan Faughnder
Jun 21, 2016 | 3:00 AM
Prerna Gupta, right, and her husband Parag Chordia at their home office just south of San Francisco. The two have launched an app called Hooked, which publishes short stories in the form of text message conversations. (David Butow / Special to The Times)
Serial entrepreneurs Prerna Gupta and husband Parag Chordia launched their mobile reading app Hooked in September as a way to publish fiction for the social media generation.
But during the last year, the Silicon Valley upstarts have been making a bold pitch to Hollywood -- use data to find the next “Harry Potter.”
Hooked, which publishes experimental short stories in the form of text message conversations, has won investments from entertainment business heavyweights at companies like Warner Bros. and talent agency WME.
Why would studio executives care about a fiction app for the Snapchat-addicted? Some think the San Francisco start-up might have a diamond in the rough – the data it uses to figure out which stories are working for its readers and which aren’t. Hooked is one of several tech companies that are trying to bring better analytics to Hollywood, which is trying to find new ways to target younger audiences who aren’t going to movies as frequently as their parents.
Screenshot from the Hooked app. (Hooked)
Backers of Hooked, including Warner Bros. production head Greg Silverman and former WME agent-turned entrepreneur Charles King, think Hooked could identify new material and writing talent, and test scripts and story ideas before they become movies and shows – taking some of the guesswork out of the inherently risky business.
The film industry has always made decisions based largely on instinct and experience, and that breeds uncertainty as companies spend hundreds of millions of dollars bef
ore they find out if they have a hit like “Zootopia” or a flop like “Gods of Egypt.”
“For Hollywood, most films require a huge capital investment, so the more data that's available, the easier it is to get them made,” said Molly Schmidt, an investor at WME Ventures. “Hooked could provide granular data that could be very valuable for a studio, financier or any other stakeholder.”
And while Hooked is sure to meet with skepticism, it’s a logical extension of the entertainment business’ push to use numbers and technology more skillfully.
On the marketing side, studios and cinema chains are teaming up with third-party tech companies to target their advertising campaigns to certain segments of the audience, a more tailored approach than traditional TV commercials and billboards.
New Zealand-based company Movio is using data analysis to help cinema chains and studios do a better job of finding the audiences for their films. The company’s new service Movio Media pools audience data from theater loyalty programs to help studios target moviegoers who are interested in certain types of films.
Screenshot from the Hooked app. (Hooked)
Through its database of 15 million moviegoers, Movio, owned by publicly traded company Vista Group, can analyze demographic data including age, gender and location and market to consumers based on that information.
“The cinemas are sitting on a huge amount of data,” said Will Palmer, co-founder and chief executive of Movio. “There's already a massive move toward media that is measurable and targeted.”
The company says it has worked with all the major studios, and Sony Pictures has signed a deal to use Movio’s services for its movie slate. The studio has also forged a partnership with ad agency UM and cinema advertising company National CineMedia to better target ad campaigns with data, starting with the July 15 “Ghostbusters” reboot.
“We have made huge advancements in the use of data to reach moviegoers,” said Elias Plishner, head of worldwide digital marketing for Sony Pictures’ film division.
There are still major limits to what data studios can access. Theater chains are reluctant to share customer information with studios, preferring to use it for their own marketing efforts.
“The more data they can get the better,” said Eric Wold, a media analyst for B. Riley who follows cinema companies and movie studios. “But I'm doubtful how granular they can get.”
Although Hollywood is making progress in using metrics for marketing purposes, the creative end of the business remains a mystery. Enter Hooked, which has yet to test its Hollywood ambitions or develop scripts, and its founders are still trying to figure out how their platform could benefit studio players.
For now, Hooked is experimenting with a new form of writing that it thinks will prove attractive to millennials. Its stories don’t read like traditional fiction. Rather, the pieces – which span genres including mystery, romance and horror -- take the form of a text message conversation. For example, one thriller published on the app follows a person stuck in the trunk of a car, texting a friend for help.
Once users start reading a story, they must push a button on the app to see the next line of dialog. If they don’t continue, Hooked can then tell exactly when readers have lost interest. Users can also “like” stories and leave comments, giving the app feedback about what parts of the story work and what do not.
Screenshot from the Hooked app. (Hooked)
The company recruits graduates from creative writing programs to build its library of pieces, most of which take only five minutes to read. About 450,000 people have downloaded the freeapp and 9,000 stories have been published on the platform.
Gupta and investors say the app could be used to find new writing talent and original stories to adapt into movies, shows and online videos (in an early example, a story called “Past Perfect” was converted into a three-minute short film using Snapchat videos). It could convert existing scripts into episodic Hooked stories and see how readers react, piece by piece.
That may seem like a stretch, and some are skeptical of the idea, including “Foxcatcher” movie producer Anthony Bregman. “It’s interesting conceptually, but who reads movie scripts?” he said. “How accurate is the judgment of a bunch of people who read scripts on iPhones?”
Hooked’s main goal is to reach a big enough audience so it can start making money, either through advertising or a premium subscription model. Hooked so far has raised$3.1 million in capital from investors.
“We thought Hollywood would just laugh in our faces and dismiss us as being completely ignorant, but it has been the opposite,” Gupta said.
She and Chordia previously founded music app maker Khush, which they sold to rival tech company Smule in 2011.
Anjula Acharia-Bath, a talent manager and investor who represents “Quantico” actress Priyanka Chopra, said data mining could help fix Hollywood’s diversity problem. Having more data could make it easier to get unusual concepts and more diverse casts approved by providing hard evidence that audiences gravitate to inclusive entertainment.
“I think it can push the boundaries for Hollywood in experimenting with new storylines and diverse characters,” she said. “If you can test stories and get data to test out stories, you could take out some of the guesswork.” | {
"pile_set_name": "Pile-CC"
} |
5 Simple Statements About homework help online Explained
Menu
5 Simple Statements About homework help online Explained
You are able to constantly be assured that you will Get the assignment within just your specified time-body. Assembly the deadlines is our priority and we often acquire strict actions to fulfil our guarantee.
We have significant knowledge in the sphere of homework online help; that’s why we think We all know what sort of help a student requirements. Just invest in College assignments online and enjoy.
Project Online is a flexible online solution for project portfolio administration (PPM) and each day get the job done. It enables corporations to get started swiftly with potent project management capabilities to strategy, prioritize, and control project and portfolio investments from Virtually anyplace.
Modifications during the content material are carried out if necessary to satisfy The subject desire. This follows referencing of the paper in the needed referencing design in addition to formatting the paper According to the university norms building the assignment ready for submission. location your order
Of course, we'd like help on documenation... We've had a handful of folks step up and produce every one of the documentation up to now. We actually are requesting community assistance listed here. There are actually more than a hundred,000 downloads and a great deal of seasoned gurus. It is just a superior priority receiving the assistance!
Wide selection of services. We propose producing operate of any subject, done by high skilled experts. We provide perform of various ranges – for high school, school or College pupils concerning to distinct topics.
Enable’s say you pay for greater than 10 orders for your duration of a training course. We’ll Provide you with 15% off on all the other papers you order. It can find this be that easy. Absolutely free revisions
They don't just ensure that the scholar has grasped the topic completely but in addition will allow the students to Consider beyond the circumference of the subject. It widens the horizon of the students and can make him mindful of even more than simply what is the part of the book. Nowadays creating a project on 1's very own is completely challenging. It is difficult as the academic projects consist of a wider reach with the subject areas and All people wishes to make the top projects.
Be suggested this support is totally legal and read review isn't going to infringe any college/university law. The paper obtained from our firm may very well be used like a supply for any deeper comprehension on the topic, or as a source for your very own educational exploration.
Decades of encounter. Our Internet site supply these kinds of provider for many years. We have now a good deal of consumers and positive feedbacks. We now have helped A large number of learners and we are able to help you far too.
What an incredible bit of do the job! I'm just spellbound. I don't understand how many of the tutorial Remedy providers can present these types of good dissertation paper at these kinds of low cost fees as it's rather unbelievable. Unquestionably, the most effective in the market. Hugely recommended.
How, you inquire? Begin by examining our listing of the commonest thoughts and responses for those who seek out help with homework online! Our essay producing company is right here to help.
Loyalty Savings We reward return shoppers with discounts. And not just any discounts – we increase the rate cuts dependant upon the amount of you expend eventually.
You inform us which part with the paper to customise, and we customise only that. Formatting and referencing of paper is done In keeping with College norms. Thus, our online assignment help company have gurus who follow Every and every steps of the presented instruction and Be certain that there's no scope for faults. Leading excellent analysis
Protected Payments and published here Confidentiality We cooperate with PayPal, where you pays both with all your equilibrium and credit/debit card. PayPal is usually a visit their website secure payment strategy that we function solely with to prevent any attainable fraud.. | {
"pile_set_name": "Pile-CC"
} |
Q:
JS url encoding
when trying to encode the URL
http://www.example.com/events/tours/example-tour/?utm_source=example&utm_medium=banner
it gives me back the following:
http%3A%2F%2Fwww.example.com%2Fevents%2Ftours%2Fexample-tour%2F%3Futm_source%3Dexample%26utm_medium%3Dbanner%20
which does not represent a valid url, since it can not be called in browsers and leads to a google search (Chrome, you know?)
How can I encode the URL probably using JS only?
A:
the right way in javascript to encode a url properly is
encodeURIComponent();
which gives you
http%3A%2F%2Fwww.example.com%2Fevents%2Ftours%2Fexample-tour%2F%3Futm_source%3Dexample%26utm_medium%3Dbanner
then
decodeURIComponent();
at the other side to decode the url again to make it valid.
encodeURIComponent is not a valid url because you encodeit to pass is as a GET variable.
like
http://www.site.com/index.php?url=http%3A%2F%2Fwww.example.com%2Fevents%2Ftours%2Fexample-tour%2F%3Futm_source%3Dexample%26utm_medium%3Dbanner
| {
"pile_set_name": "StackExchange"
} |
Despite the U.S. Congress providing incentives to drug manufacturers to encourage the study of medications in children, few approved drugs include safe dosing information for obese kids.
A study conducted at Children's National Health System in conjunction with the Food and Drug Administration's (FDA) Center for Drug Evaluation and Research surveyed pediatric medical and clinical pharmacology reviews under the FDA Amendments Act of 2007 and the FDA Safety and Innovation Act of 2012. The study used search terms related to weight and size to determine the current incorporation of obesity as a covariate in pediatric drug development.
Of the 89 product labels identified, none provided dosing information related to obesity. The effect of body mass index on drug pharmacokinetics was mentioned in only four labels, according to the study "Obesity and Pediatric Drug Development," published online Jan. 19, 2018, in The Journal of Clinical Pharmacology.
Data from the Centers for Disease Control and Prevention indicate that one in six children and adolescents in the U.S. is obese. Obesity increases the percentage of fat tissue more than it boosts the percentage of lean body mass and enlarges kidney size, factors that impact how the body takes up medicine, where it retains it and how quickly it is excreted.
"We are making progress in expanding the number of medicines with pediatric labeling, but we need to do more concerning providing dosing guidelines for children with obesity," says Janelle D. Vaughns, M.D., director of bariatric anesthesia at Children's National and the lead study author. "Moving forward, regulators, clinicians and the pharmaceutical industry should consider enrolling more obese patients in pediatric clinical trials to facilitate the safe and effective use of the next generation of medicines by obese children and adolescents." | {
"pile_set_name": "OpenWebText2"
} |
Q:
Why is Android Studio generating duplicate gradle dependency automatically?
I am using Android Studio 2.3.3 on Windows 10. I already have these in my dependencies:
compile 'com.android.support:recyclerview-v7:25.4.0'
compile 'com.android.support:cardview-v7:25.4.0'
compile 'com.android.support:customtabs:25.4.0'
compile 'com.android.support:appcompat-v7:25.4.0'
compile 'com.android.support:design:25.4.0'
compile 'com.android.support:multidex:1.0.1'
compile 'com.android.support:support-v4:25.4.0'
compile 'com.android.support.constraint:constraint-layout:1.0.2'
But these lines are always auto generated in gradle file:
dependencies {
compile 'com.android.support:support-v4:25.+'
}
dependencies {
compile 'com.android.support.constraint:constraint-layout:+'
}
dependencies {
compile 'com.android.support.constraint:constraint-layout:+'
}
Gradle Version: 3.3
Android Plugin Version: 2.3.3
How do it stop Android Studio from generating these unnecessary dependencies and why is it doing so?
A:
For those who are also facing this.
I have found out that whenever we create an Activity using the Activity creation wizard with
New -> Activity
this line:
dependencies {
compile 'com.android.support.constraint:constraint-layout:+'
}
is added automatically to build.gradle file.
And
dependencies {
compile 'com.android.support:support-v4:25.+'
}
is added automatically whenever we create a Fragment using
New -> Fragment
Even if dependencies are already added.
I have not found any solution to prevent it so for now I am removing those manually after the Activity/Fragment are created.
| {
"pile_set_name": "StackExchange"
} |
Q:
Sorting out 2 UIalertview's button clicks
I have 2 alerts on the same page. Problem is that the clickedButtonAtIndex is answering both alerts and not just the second one. How do I separate them?
UIAlertView *passwordAlert = [[UIAlertView alloc] initWithTitle:@"Phone Number" message:@"\n\n\n"
delegate:self cancelButtonTitle:nil otherButtonTitles:NSLocalizedString(@"OK",nil), nil];
UIAlertView *alert=[[UIAlertView alloc]initWithTitle:@"Warning" message:@"Please Enter correct phone no." delegate:self cancelButtonTitle:nil otherButtonTitles:@"Try Again", nil];
- (void)alertView:(UIAlertView *)alert clickedButtonAtIndex:(NSInteger)buttonIndex {
On the first one you enter a phone number and hit ok. If it validates, great. However if it does not the second alert shows. Now when they hit "Try Again" the clickedButtonAtIndex runs on the first and second alert. I need it to only run on the second.
A:
What you have to do is give different tag to both alert view and then access by tags as:-
UIAlertView *passwordAlert = [[UIAlertView alloc] initWithTitle:@"Phone Number" message:@"\n\n\n"
delegate:self cancelButtonTitle:nil otherButtonTitles:NSLocalizedString(@"OK",nil), nil];
passwordAlert.tag=1;
UIAlertView *alert=[[UIAlertView alloc]initWithTitle:@"Warning" message:@"Please Enter correct phone no." delegate:self cancelButtonTitle:nil otherButtonTitles:@"Try Again", nil];
alert.tag=2;
- (void)alertView:(UIAlertView *)alert didDismissWithButtonIndex:(NSInteger)buttonIndex
{
if(alert.tag==1)
{
if (buttonIndex==0) {
}
else if (buttonIndex==1) {
}
}
if(alert.tag==2)
{
if (buttonIndex==0) {
}
else if (buttonIndex==1) {
}
}
| {
"pile_set_name": "StackExchange"
} |
Variations in the frequencies of torque teno virus subpopulations during HAART treatment in HIV-1-coinfected patients.
Sera from 15 patients coinfected with TTV and HIV-1, collected before and at two times after introduction of highly active anti-retroviral therapy (HAART), were tested for TTV load and the presence of the five highly divergent TTV phylogenetic groups. Seven patients showed a 1-5 log TTV load decrease during HAART, while the others did not show significant variations. A decrease in the number of coinfecting TTV genogroups was detected in 12 of 15 patients, with the mean number of TTV genogroups/patient decreasing from 2.33 before HAART to 1.47 at the last collect. All five genogroups were less frequently found after introduction of HAART. Three hundred sixty-seven TTV clones from four different genogroups, derived from two patients, were sequenced. Noticeable fluctuations in TTV subpopulation frequencies were observed in both patients analyzed. In conclusion, HAART tends to reduce the number of TTV genotypes/genogroups and may affect the balance between different TTV isolates coinfecting single individuals. | {
"pile_set_name": "PubMed Abstracts"
} |
/* Copyright 2006-2015 Joaquin M Lopez Munoz.
* Distributed under the Boost Software License, Version 1.0.
* (See accompanying file LICENSE_1_0.txt or copy at
* http://www.boost.org/LICENSE_1_0.txt)
*
* See http://www.boost.org/libs/flyweight for library home page.
*/
#ifndef BOOST_FLYWEIGHT_SERIALIZE_HPP
#define BOOST_FLYWEIGHT_SERIALIZE_HPP
#if defined(_MSC_VER)&&(_MSC_VER>=1200)
#pragma once
#endif
#include <boost/config.hpp> /* keep it first to prevent nasty warns in MSVC */
#include <boost/flyweight/flyweight_fwd.hpp>
#include <boost/flyweight/detail/archive_constructed.hpp>
#include <boost/flyweight/detail/serialization_helper.hpp>
#include <boost/serialization/nvp.hpp>
#include <boost/serialization/split_free.hpp>
#include <boost/throw_exception.hpp>
#include <memory>
/* Serialization routines for flyweight<T>.
*/
namespace boost{
namespace serialization{
template<
class Archive,
typename T,typename Arg1,typename Arg2,typename Arg3
>
inline void serialize(
Archive& ar,::boost::flyweights::flyweight<T,Arg1,Arg2,Arg3>& f,
const unsigned int version)
{
split_free(ar,f,version);
}
template<
class Archive,
typename T,typename Arg1,typename Arg2,typename Arg3
>
void save(
Archive& ar,const ::boost::flyweights::flyweight<T,Arg1,Arg2,Arg3>& f,
const unsigned int /*version*/)
{
typedef ::boost::flyweights::flyweight<T,Arg1,Arg2,Arg3> flyweight;
typedef ::boost::flyweights::detail::save_helper<flyweight> helper;
typedef typename helper::size_type size_type;
helper& hlp=ar.template get_helper<helper>();
size_type n=hlp.find(f);
ar<<make_nvp("item",n);
if(n==hlp.size()){
ar<<make_nvp("key",f.get_key());
hlp.push_back(f);
}
}
template<
class Archive,
typename T,typename Arg1,typename Arg2,typename Arg3
>
void load(
Archive& ar,::boost::flyweights::flyweight<T,Arg1,Arg2,Arg3>& f,
const unsigned int version)
{
typedef ::boost::flyweights::flyweight<T,Arg1,Arg2,Arg3> flyweight;
typedef typename flyweight::key_type key_type;
typedef ::boost::flyweights::detail::load_helper<flyweight> helper;
typedef typename helper::size_type size_type;
helper& hlp=ar.template get_helper<helper>();
size_type n=0;
ar>>make_nvp("item",n);
if(n>hlp.size()){
throw_exception(
archive::archive_exception(archive::archive_exception::other_exception));
}
else if(n==hlp.size()){
::boost::flyweights::detail::archive_constructed<key_type> k(
"key",ar,version);
hlp.push_back(flyweight(k.get()));
}
f=hlp[n];
}
} /* namespace serialization */
} /* namespace boost */
#endif
| {
"pile_set_name": "Github"
} |
Review: Pigeons by Suhayla El-Bushra at the Royal Court Theatre – Downstairs
Parental guidance: this review contains strong language (and some sexual themes). Much like the play.
Pigeons get a bad press. As a character in the new play by Suhayla El-Bushra says, they excrete all over the place and don’t get out of the way when you approach. As it turns out, he is not talking about the birds and he is a bit of a shit himself. Be careful before you agree with him.
The story plays out in playgrounds, backstreets and semi detached houses in inner city neighbourhoods. A bit grim and a bit normal. The characters – most of them young people – are disaffected and bewildered in equal measure. They clash with parents who are present, or long to argue with parents who are not. They perform fellatio in sheds and split drugs in bus stops. Their disaffection mixes with sexual frustration. They turn on each other, and know where to strike in order to inflict the most damage. Some times literally.
Pigeons – cast list
The story is unsurprising but the minutiae is startling in it sharpness: intimate interactions, unfinished sentences, tiny gestures shine with truth and tenderness. Some interesting work with the structure of the play allows the audience to work out cause and effect in an unconventional way.
Carrie Cracknell takes advantage of a talented cast to give the production energy and tension without neglecting intimacy and detail. This is a teenage world: it bristles with potential that burns and crashes with the beauty of a supernova.Ryan Sampson as Ashley is unafraid of the rough unpleasant aspects of the character, but layers him with a unashamed hunger for affection that makes him irresistible. Farzana Dua Elahe as Ameena and Nav Sidhu as Amir skillfully reveal the confusion and exhilaration of being caught between two cultures. Paul Bhattacharjee’s Hassan has the faint air of disappointment of a world lost. Angela Terence as Leah projects a touching capacity for love, often unfulfilled or misplaced.
A promising play by Suhayla El-Bushra, and an engaging revealing production. | {
"pile_set_name": "Pile-CC"
} |
The cerebellum and neuropsychological functioning: a critical review.
The cerebellum, while once considered a brain region principally involved in motor control and coordination, is increasingly becoming associated with a range of neuropsychological and neuropsychiatric presentations. This paper reviews the dominant neuropsychological domains and neuropsychiatric conditions for which cerebellar involvement has been demonstrated, including visuospatial functioning, learning and memory, language, executive functioning, attention-deficit/hyperactivity disorder, autism spectrum disorders, and schizophrenia. The paper concludes with a discussion of a potential neuropsychological localization model within the cerebellum and a discussion of prognosis and rates of recovery that can be expected, following localized cerebellar lesions. | {
"pile_set_name": "PubMed Abstracts"
} |
Q:
Any way to check for un-handled errors in a Go program?
Consider the following:
package main
import (
"errors"
"fmt"
)
func foo() error {
return errors.New("Danger!")
}
func main() {
foo();
fmt.Println("I don't have a care in the world!")
}
It would be nice if there was an easy way to see that possible errors from foo() are not being handled. Does Go have a built-in way to check programs/source files for errors that nothing has been done with?
A:
Go does not have a built-in way to do that, but there's a third-party tool by Kamil Kisiel that does. Just go get github.com/kisielk/errcheck then run bin/errcheck your/import/path from your $GOPATH and it will spit out a list of calls with ignored errors. (I just tried it on a project and, hrm, perhaps I'm not as 100% reliable about it as I thought.)
If you like it, you might also like go vet's checks, and the lint package used within Google for style checks.
A:
You can use errcheck:
$ errcheck github.com/your/package
It will let you know when you are ignoring returned errors. I would argue that this should mostly be rare if you are using a decent editor (that shows you function signatures).
| {
"pile_set_name": "StackExchange"
} |
Oh, so you believe in science? Doesn't that make you a scientologist?
2,307 shares | {
"pile_set_name": "OpenWebText2"
} |
There is not any query social media has reworked the best way individuals talk, collect data, and in addition how customers make choices about purchases. With that in thoughts, it’s a must to get your data on the market the place they are going to see it. Not alone the place they will discover it, all the same in a format they are going to reply positively to. That is the place SMO companies come into the image.
It is essential to grasp this isn’t the identical as SEO. While you’ll be able to rent the identical provider to deal with the duties, you must have distinctive details about the SMO companies they’re offering for you. The two must be half-tracked severally so yow will discover what could should be improved to get a greater response out of your target market.
The largest distinction is SEO is intermeshed in direction of acquiring customers to try your webpages. To do that, it normally focuses on enhancing your placement on the search engine outcomes after customers sort in a key phrase or phrase. With SMO companies, the main focus is on rising your on-line presence and popularity with using varied branches of social media.
Common Outlets
The branches on the SMO companies tree proceed to develop and develop on a regular basis. Social media isn’t a passing pattern, it’s right here to remain and it’s the to the worst degree bit multiplication going to have change and enhancements aboard the best way. Some of the frequent retailers that can help you attain your area of interest advertising embrace Facebook, Twitter, and YouTube. There are many others all the same these are the highest ones.
While some customers have all three of these rather accounts they entry day by day, others alone have one or two of them. It is a private choice as is the period of time individuals spend of their information feeds. Some individuals can spend hours per day on social media websites and others barely coup d’oeil at them. The objective is to get your small business to be familiar to them in addition to fascinating.
Branding
It takes a substantial amount of time for any enterprise to efficiently model themselves in a given area of interest. It is an current work in progress that entails each SEO and SMO companies to tumble established and to maintain it going sturdy for the extended haul. At the identical time, such companies may help to generate extra sensible leads. Often, these leads flip into gross revenue so it boosts your total conversion charge.
Word of Mouth
No type of advertising on the market, regardless of how a deal you invite it, will ever be as precious as phrase of cash. When potential customers hear about your services or products from mortal they’re familiar vial social media, it’s gold of their eyes. That is an actual particular somebody they’ve a connection to, not just few random evaluate they stumbled upon on the web.
Effective SMO companies enable that phrase of mouth to proceed to develop and flow into. People are curious after they see others speaking few explicit enterprise or objects they provide. They wish to discover out for themselves whthe to the worst degree bit the excitement is about and the way they will profit from it too. They don’t wish to be left and ne’er have that services or products that so many are spirited about.
Provider Services
To actually acquire with SMO, you want knowledgeable to work with. You want rather more than simply optimisation and hyperlinks. You want a sensible proficiency your small business can develop from and customers power be excited to discover additive in addition to excited to inform others about. Posting content material and hospitable them to have a look at what you supply is a big piece of constructing that occur. | {
"pile_set_name": "OpenWebText2"
} |
Posterior atlantoaxial fusion. A new internal fixation device.
Biomechanical and clinical testing of an atlantoaxial posterior fixation device. The authors tested an internal fixation device to maintain the atlas and axis in an anatomic relationship while fusion occurs. The device should also facilitate intraoperative reduction of any residual anterior atlantoaxial subluxation. The device should allow the use of cancellous rather than cortical bone graft. Previous techniques of atlantoaxial fusion were not universally successful, and the quality of reduction was assessed infrequently. Biomechanical testing of the fixator and clinical use in two "problem" patients requiring atlantoaxial fusion. Biomechanical testing indicated the device should be successful. Clinical testing was successful. The new fixator facilitates posterior atlantoaxial fusion in an anatomical position. | {
"pile_set_name": "PubMed Abstracts"
} |
The Bank of England has set up a research division looking at how it can get involved with digital currencies such as bitcoin and the technology behind them.
It is exploring the possibility of launching its own digital currency linked to the rate of sterling, which reports suggest could get the go ahead this year.
Britcoin: The Bank of England has set up a research division looking at how it can get involved with digital currencies like Bitcoin and the technology behind it
If given the green light, a digital currency approved and regulated by the Bank of England would give security to people who want to keep their money in a digital format, which could see them complete big payments faster and without the need to go through a High Street bank.
Investors in the unregulated cryptocurrency bitcoin rode a rollercoaster of volatility toward the end of last year as it yo-yoed between $12,000 and $20,000 – having started the year at around $1,000.
Critics have warned against betting on the rogue currency and called for central banks to get involved. | {
"pile_set_name": "OpenWebText2"
} |
Buy ePub
Robert Ludlum is the acknowledged master of suspense and international intrigue. For over thirty years, in over twenty international bestsellers, he has a set a standard that has never been equaled. Now, with the Prometheus Deception, he proves that he is at the very pinnacle of his craft. Nicholas Bryson spent years as a deep cover operative for the American secret intelligence group, the Directorate. After critical undercover mission went horribly wrong, Bryson was retired to a new identity. Years later, his closely held cover is cracked and Bryson learns that the Directorate was not what it claimed - that he was a pawn in a complex scheme against his own country's interests. Now, it has become increasingly clear that the shadowy Directorate is headed for some dangerous endgame - but no one knows precisely who they are and what they are planning. With Bryson their only possible asset, the director of the CIA recruits Bryson to find, reinfiltrate, and stop the Directorate. But after years on the sidelines, Bryson's field skills are rusty, his contacts unreliable, and his instincts suspect. With everything he thought he knew about his own life in question, Bryson is all alone in a wilderness of mirrors - unsure what is and isn't true and who, if anyone, he can trust - with the future of millions in the balance. | {
"pile_set_name": "Pile-CC"
} |
[Carcinogenesis in familial polyposis coli].
The inherited cancer disease familial polyposis coli (FPC) provides an excellent model not only for studying tumor progression in colorectal cancer but also for elucidating molecular mechanism of carcinogenesis in general. This paper reviews recent remarkable progress in the molecular mechanism of tumorigenesis in FPC. Included in this review is information on the localization of the FPC major gene and several types of genetic alterations during the development of tumors. One of these genetic alterations is activation of oncogenes such as mutated ras genes and another is inactivation of tumor suppression genes such as loss of heterozygosity. The mutated FPC gene on chromosome 5 q would be expected to be an early event to initiate the requisite hyperproliferation for adenoma formation. Adenomas will have undergone several gene or chromosome mutations before reaching the fully malignant state. | {
"pile_set_name": "PubMed Abstracts"
} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.