Split (1)

train · 25.5k rows

text large_stringlengths 39 13.3M	id large_stringlengths 36 47	repo_tree_path large_stringclasses 20 values	source_dataset large_stringclasses 1 value	lang large_stringclasses 20 values	num_chars uint32 39 13.3M
Extrastriate visual cortex reorganizes despite sequential bilateral occipital stroke: implications for vision recovery Amy Brodtmann 1 , Aina Puce 2 , David Darby 1 and Geoffrey Donnan 1 1 Behavioural Neuroscience, Florey Institute for Neuroscience and Mental Health, University of Melbourne, Melbourne, VIC, Australia, 2 Department of Psychological and Brain Sciences, Indiana University, Bloomington, IN, USA The extent of visual cortex reorganization following injury remains controversial. We report serial functional magnetic resonance imaging (fMRI) data from a patient with sequential posterior circulation strokes occurring 3 weeks apart, compared with data from an age-matched healthy control subject. At 8 days following a left occipital stroke, contralesional visual cortical activation was within expected striate and extrastriate sites, comparable to that seen in controls. Despite a further infarct in the right (previously unaffected hemisphere), there was evolution of visual cortical reorganization progressed. In this patient, there was evidence of utilization of peri-infarct sites (right-sided) and recruitment of new activation sites in extrastriate cortices, including in the lateral middle and inferior temporal lobes. The changes over time corresponded topographically with the patient's lesion site and its connections. Reorganization of the surviving visual cortex was demonstrated 8 days after the ﬁrst stroke. Ongoing reorganization in extant cortex was demonstrated at the 6 month scan. We present a summary of mechanisms of recovery following stroke relevant to the visual system. We conclude that mature primary visual cortex displays considerable plasticity and capacity to reorganize, associated with evolution of visual ﬁeld deﬁcits. We discuss these ﬁndings and their implications for therapy within the context of current concepts in visual compensatory and restorative therapies. Keywords: visual cortex, stroke, reorganization, plasticity, hemianopia, fMRI Introduction Serial functional magnetic resonance imaging (fMRI) has been used to examine cortical remodeling following injury and track functional recovery, particularly after strokes involving the motor and sensory systems (Calautti and Baron, 2003). Activation patterns are often compared to those of healthy age-matched control participants, and assume that pre-stroke activation in the patient population would have been comparable to those of controls. There are few case reports in the fMRI literature where individuals were studied prior to their deﬁcits (Thulborn et al., 1999), and sequential strokes have rarely been studied. In addition, researchers studying the visual system have usually recruited patients months to years following their injury (Goebel et al., 2001; Nelles et al., 2002; Schoenfeld et al., 2002). Here we present qualitative fMRI ﬁndings from a 49 year old man, who participated in a prospective study of visual reorganization Edited by: Ela B. Plow, Cleveland Clinic Foundation, USA Reviewed by: Emmanuel Carrera, Geneva University Hospital, Switzerland Dorothe A. Poggel, Hanse-Wissenschaftskolleg Institute for Advanced Study, Germany Correspondence: Amy Brodtmann, Melbourne Brain Centre, The Florey Institute for Neuroscience and Mental Health, 245 Burgundy Street, Heidelberg, VIC 3081, Australia firstname.lastname@example.org Received: 10 December 2014 Accepted: 08 April 2015 Published: 28 April 2015 Citation: Brodtmann A, Puce A, Darby D and Donnan G (2015) Extrastriate visual cortex reorganizes despite sequential bilateral occipital stroke: implications for vision recovery. Front. Hum. Neurosci. 9:224. doi: 10.3389/fnhum.2015.00224 after stroke. He suﬀered sequential occipital strokes 3 weeks apart aﬀecting ﬁrst the left, then the right visual cortices. We contrast his ﬁrst scan at 8 days following his ﬁrst stroke with that done on review at 6 months, and with those of a healthy control subject selected from a group of people tested for associated projects. We then discuss mechanisms of recovery in the visual cortex following stroke, and present a brief summary of both compensatory and restorative therapies and their implications for rehabilitation. Background Ethics Informed written consent was obtained. The study was approved by the Austin Health Human Research Ethics Committee, which abides by the Declaration of Helsinki. Participants Single case data were taken from a prospective clinical study on the fMRI study of visual recovery after stroke. Patients received standard stroke management, including admission imaging with CT or MRI scans. Patients were studied within 10 days poststroke (Session 1) and at 6 months (Session 2) with fMRI and visual perimetry. Controls had identical testing in two sessions 6 months apart. Inclusion Criteria Stroke patients were recruited if they had a conﬁrmed ﬁrst-ever acute ischemic infarct aﬀecting visual cortex with a corresponding perimetric defect (n = 10, one presented here). Other study criteria have been described in detail (Brodtmann et al., 2003, 2007, 2009a,b). Control participants were included if they were free of neurological disease, and aged in the following decade cohorts: 30–39, 60–69, 70–79, and 80–89 years; total n = 24, 12 women. This formed the basis of a normal cohort for comparison, from whom we have selected one age- and sex-matched subject for this case report (Brodtmann et al., 2003, 2009a). Experimental Design Magnetic Resonance Imaging Activation task A block-design was used with alternating central presentations of grayscale unfamiliar faces (FACE), scrambled faces (SCRF), and a 50% gray ﬁeld with a central black ﬁxation cross (GRAY). Stimulus conditions (A = FACE, B = SCRF, C = GRAY) alternated in a repeated ACBC... sequence—see Figure S1 for schematic. Each single stimulus was presented for 0.5 s with no gap between successive stimuli. The duration of each stimulus block was 20 s, therefore 40 FACE or SCRF stimuli were presented in each block. There were three stimulus cycles (i.e., ABCB-) within an imaging run (3 cycles × 20 s block × 4 blocks/cycle = 240 s). The duration of the imaging run was 254 s as it included an initial 8 s non-stimulation (50% gray—rest task) period allowing for steady-state transverse magnetization and a 6 s nonstimulation period (black screen) at the end of the run to allow the hemodynamic response to return to baseline. After a rest of approximately 2–4 min the imaging run was repeated. We have 2 previously demonstrated robust striate and extrastriate activation in the cortices of participants aged 30–90 years using this paradigm (Brodtmann et al., 2003, 2009b). The subject was placed in the scanner in a supine position with a mirror attached to the head coil centered above his eyes. Through the mirror he was able to see the stimuli projected onto a screen placed at his feet and positioned prior to scanning so that he was able to see the entire image margins. Video images (PAL format size = 768 × 576 resolution) were projected via a mirror through the control room window onto the back of a screen. Once the subject's head was positioned inside the scanner the visual angle of display was approximately 15 ◦ in diameter. Functional imaging All images were acquired on a 3 Tesla GE Horizon LX MRI scanner in a single scanning session (GE Systems, Milwaukee, Wisconsin, USA): 14 coronal T1-weighted slices beginning at primary visual cortex and covering the posterior half of the brain, extending anteriorly through to the thalami. Coronal section was selected as it covered all the visual areas of interest with the least number of slices (compared to axial acquisition, for example). The convoluted nature of the calcarine sulcus means that it is poorly visualized in axial and sagittal slices. Activation on both medial and lateral sides of the fusiform gyrus could also be seen with coronal slices. Fewer slices (i.e., partial brain acquisition) also increased the number of brain volumes per task available for analysis. These images were used as a template for a real-time gradient echo echo-planar imaging sequence (EPI: TR = 2000, TE = 40, FOV = 24 cm, ﬂip angle = 40 ◦ , matrix = 128 × 128, inplane voxel size = 1.85 × 1.85 mm, slice thickness = 4 mm, gap = 1 mm). Two imaging runs were obtained, yielding a maximum number of 60 volumes per condition. A face localizer pre-scan was performed prior to the fMRI scanning run. Behavioral Data Collection A target detection task was introduced in order to monitor maintenance of attention on the visual stimulus display. Subjects were asked to detect a transiently appearing centrally presented white cross (target), and to raise their left thumb on target detection. Targets were presented for 0.5 s each time. They were randomly interspersed throughout the paradigm, were equally distributed in each condition, and acted as an objective means of monitoring attention during functional scanning. A total of 12 targets were presented during the course of each imaging run. Subjects were observed throughout each run for target detection accuracy. Black crosses were not present during the face or scrambled face image presentation displayed without white cross targets. Subjects were requested to keep their eyes directed centrally and remain vigilant for the appearance of the targets. Eye movements were not otherwise monitored during the scanning sessions. The number of hits, misses and falsely identiﬁed targets was noted at the end of each imaging run. Student's t-test was used to evaluate diﬀerence between error rates. Structural Imaging Coronal T1 and magnetic resonance angiography (MRA) sequences and axial 3D SPGR images were also acquired. All structural scans were independently reported by a radiologist blinded to the subject's details so that subtle structural pathology would not be overlooked (e.g., prior silent infarcts, new infarction). fMRI Data Analysis Our choice of partial brain acquisition for the functional images limited the analysis tools available. MEDx 3.3 (Sensor Systems Inc., Sterling, VA, USA) was used for the majority of the analysis. Motion detection and correction was performed using the AIR algorithm as previously described (Brodtmann et al., 2003, 2007, 2009a,b). Within-subject t-test maps were obtained for each comparison of interest i.e., FACE vs. GRAY, and SCRF vs. GRAY. T-test maps were thresholded using an uncorrected p < 0 . 001, based on a prior false-positive analysis (Brodtmann et al., 2003). These thresholded maps were overlaid on MRA images to exclude activation arising from large intracerebral blood vessels and onto the matching extracted T1-coronal slices (Smith, 2002). All subsequent analysis was performed using the functional data overlaid onto the extracted T1-images as an index of individual anatomy. We did not normalize or spatially smooth the fMRI data. Data remained in the subject's native anatomical space to allow for diﬀering infarct sites, variable age-related atrophy, possible acute edema and chronic involution. For each subject, left and right striate and ventral extrastriate cortices were identiﬁed a priori, using T1-weighted anatomical coronal sections as a reference and comparing to coronal sections in a standard published text (Duvernoy et al., 1999). Anatomical ambiguities were also clariﬁed by scrutinizing the 3D SPGR high-resolution T1 axial images in the orthogonal viewer in MED × 3.3. Regions of interest (ROIs) were identiﬁed, combined into groupings of left and right ventral extrastriate, and left and right striate cortical sites. Each extrastriate region included the posterior two-thirds of the fusiform gyrus, ventromedial parts of the inferior temporal gyrus, inferior lingual, and inferior occipital gyri; the "striate" region included cuneus, gyrus descendens, and the parts of the superior lingual and lingual gyri and precuneus adjacent to the calcarine sulcus. The striate areas were deﬁned according to a standard anatomical reference (Duvernoy et al., 1999). Visual Field Testing Visual ﬁelds were assessed using Medmont M600 automated perimetry including ﬁxation loss errors (Medmont, Camberwell, Australia). This computerized program gives a number of options for assessment. The neurological visual ﬁeld option was used as this paradigm has been designed to identify a variety of visual ﬁeld anomalies associated with neurological (as opposed to ophthalmological) disease, including homonymous and bitemporal deﬁcits, scotomas, and cataracts. For the stroke subjects, ﬁelds were graded as normal, partial hemianopia, or complete hemianopia. Comparisons of visual ﬁelds between sessions were descriptive, graded as minimal, partial, and complete recovery. This is a full ﬁeld test. Fixation errors were compared between groups, but for the purposes of this case report only individual ﬁxation errors are reported for perimetry. Case Report A 49-year-old recreational intravenous drug user with known insulin-dependent diabetes mellitus presented with a 48 h history of visual disturbance, confusion, and reduced hearing following a 2 week period of heavier than usual heroin use. Admission renal function was impaired, presumed secondary to dehydration: creatinine 0.17 mmol/l (normal range 0.03–0.11 mmol/l), urea 17.8 mmol/l (2.8–7.7 mmol/l), glucose 16.1 mmol/l (3.3–8.0 mmol/l); BP was 190/90, heart rate 92. He was disoriented and had trouble hearing the examiner. Left ptosis and a right congruous homonymous visual ﬁeld deﬁcit with macular sparing were noted. Admission MRI scanning conﬁrmed the presence of a left inferior occipital infarct and right-midline midbrain infarct (see Figure 1). Blood glucose and renal function normalized rapidly: Day 2 glucose 5.1 mmol/l, creatinine 0.075 mmol/l, creatinine clearance 2.91 ml/s (1.50–2.50 ml/s). Within 2 days his hearing and orientation returned to normal, and his visual deﬁcits rapidly evolved. On day 5, automated perimetry was performed, and revealed incomplete resolution of the right homonymous visual deﬁcit, restricted to the superior quadrant for the left eye and FIGURE 1 \| Stroke sites and corresponding visual ﬁeld deﬁcits on perimetry. Top Row: day 8 T2-weighted MRI scan, axial slices (radiological convention, so images are ﬂipped) through occipital cortex showing left acute occipital lesion and demonstrating midbrain lesion (traced or circled in white). Despite the fact that his midbrain lesion was right-sided, the patient had persistent left ptosis, with left lid artifact present on perimetry (white arrow). T2 images are shown as subacute ischemic lesions are difﬁcult to see on T1 images. His right partial homonymous visual deﬁcit can be seen on his perimetric visual ﬁeld maps (black arrows). Note that perimetric tests were 90 ◦ visual ﬁeld tests. Bottom row: repeat MRI at 6 months, axial T1-weighted slices through occipital lobes, revealed interval infarction in the right occipital pole (traced in white). Lid artifact still present from ptosis (white arrow), but perimetry revealed almost complete resolution of right homonymous deﬁcit despite interval development of partial left inferior quadrantanopia (gray speckled arrow). LE, left eye; RE, right eye. peripheral loss crossing the horizontal meridian in the right eye (Figure 1). Perimetry also demonstrated a patchy symmetrical reduction in peripheral vision in the unaﬀected hemiﬁeld. These deﬁcits have been described previously in the acute post-stroke period, and are believed to be due to associated hypometabolism or diaschisis of the contralesional hemisphere, as they recover over the ensuing weeks after stroke (Bosley et al., 1987). Left ptosis caused signiﬁcant left lid artifact. Transcranial and carotid Doppler studies were normal. Contrast transesophageal echocardiography was positive, consistent with a trivial patent foramen ovale, but no signiﬁcant right to left shunt. Endocarditis was excluded. Stroke etiology was presumed to be thromboembolic secondary to a contaminated intravenous injection. He was discharged home with residual left ptosis. Two weeks later he noted sudden onset of diﬃculty reading and reduced vision in the left visual ﬁeld, not associated with a resumption of drug use. He did not seek medical attention. Repeat MR scanning at 6 months as part of our fMRI research study conﬁrmed the presence of a further right-sided stroke, aﬀecting the superior occipital gyrus and cuneus (Figure 1). After review, the mechanism of this further stroke was thought to be due to non-compliance with stroke prophylaxis with known patent foramen ovale. Results Control Subject We chose one age- and gender-matched control (39 year old man) as an exemplar for qualitative comparison for this report. On both occasions, visual ﬁeld testing was normal, with no ﬁxation errors made on perimetric testing. Patient Results Session 1 Visual ﬁeld testing on Day 5 revealed a resolving partial right homonymous hemianopia. One ﬁxation loss was detected for the left eye and four for the right eye with no false positive responses (graded as excellent ﬁxation by Medmont automation). Day 8 fMRI revealed reduced left-sided ipsilesional ventral extrastriate activation (fusiform and lingual gyri) compared to controls, with no evidence of intra-infarct activation (Figure 2). Periinfarct activation foci were seen medially and laterally. Reduced calcarine activation was seen bilaterally, common in the acute post-stroke period presumed secondary to diaschisis (Brodtmann et al., 2007). Evidence of right superior occipital activation can be seen. Session 2 Visual ﬁeld testing at 6 months revealed an incomplete resolution of the right homonymous hemianopia and a new left inferior quadrantanopia; one ﬁxation loss and one false positive response were made for each eye. fMRI revealed that fusiform activation was unchanged. On the left (ﬁrst stroke side) new left superior parietal and left middle temporal gyral activation was noted, with small nodes of peri-infarct activation also apparent. On the right, occipital activation was shifted superiorly and laterally compared to Session I (Figure 2). FIGURE 2 \| (A) Control subject t-test SCRF maps (individual exemplar) overlaid onto corresponding T1-weighted images, 3 coronal slices through occipital pole and calcarine cortices, demonstrating symmetrical activation in striate (calcarine) and extrastriate regions. Normal visual ﬁeld in seen on perimetry, right of ﬁgure. (B) Patient t-test SCRF maps overlaid onto corresponding T1-weighted images, 3 coronal slices through occipital pole and calcarine cortices (radiological convention), demonstrating reduced extrastriate activation and bilaterally absent calcarine activation, common acutely secondary to diaschisis. Stroke site traced in pink. Corresponding visual deﬁcit again shown, highlighted with pink arrow. Note the white arrows highlighting sites of activation in the middle occipital lobe. (C) Patient t-test SCRF maps overlaid onto corresponding T1-weighted images, 3 coronal slices through occipital pole and calcarine cortices (radiological convention), demonstrating bilateral return of striate (calcarine) activation, despite the presence of a further stroke, stroke site traced in green. Corresponding visual deﬁcit shown, green arrow. Note that the new stroke site has affected an area of activation demonstrated in the initial fMRI, but visual cortical reorganization has continued despite the recurrent lesion. Blue arrows point out regions of activation not present on initial fMRI. Discussion Case Report Findings This case report is unique in documenting fMRI evidence of visual system plasticity between sequential occipital infarcts. Initial fMRI evaluation following his ﬁrst stroke showed abnormal visual cortex activation ipsilesionally and normal patterns contralesionally. 6 months after the initial stroke, left visual cortex reorganization changes were seen along with peri-infarct activation. This report complements one of the few other studies which also document pre-stroke fMRI activation patterns, but which involved a language evaluation rather than visual system paradigm (Thulborn et al., 1999). Whilst there is minimal evidence in the functional MRI literature of patients with recurrent or sequential stroke, we know that functional status declines after ischemic stroke. Recurrent stroke is associated with worse cognition and function (Dhamoon et al., 2012). From this we infer that compensatory remodeling may be limited by recurrent events. Yet the visual system appears capable of functional recovery following repeated infarction (Gray et al., 1989; Goebel et al., 2001; Nelles et al., 2002; Schoenfeld et al., 2002). There are two main ﬁndings. First, contralesional activation was within expected sites and comparable to that seen in controls prior to the second stroke. This ﬁnding is important as the major underlying assumption of lesion-based functional neuroimaging studies is that the patient under study would have had a pattern of cortical activation prior to injury within the spectrum of normal variation. This patient's data demonstrated the expected pattern of activation in the right hemisphere following the initial left occipital stroke. Second, visual cortical reorganization progresses despite sequential infarcts. In this patient, there was evidence of utilization of peri-infarct sites (right-sided) and recruitment of new activation sites, such as the left lateral middle and inferior temporal nodes. The changes over time corresponded topographically with the patient's lesion site and its connections. Study Limitations Case reports are always limited by individual variation. In addition, our choice of partial-brain coronal acquisition and inability to register these images into standard space means that only a modest interpretation of the fMRI activation changes is possible. Whilst the patient's visual ﬁelds were closely studied, no detailed face perception tasks were performed. Attention was monitored during the activation task, but eye movement monitoring was not performed, meaning that eye movement diﬀerences may have contributed to the fMRI changes described. Mechanisms of Recovery Following Ischemic Stroke There are two major phases to recovery of function following stroke. The acute phase incorporates re-perfusion with salvage of extant neurons in ischaemic, but not infarcted, zones, and resolution of edema. In this patient, penumbral salvage was not possible as re-perfusion therapies such as thrombolysis or clot retrieval, which need to be given within hours of stroke, were not feasible due to his late presentation. A later or chronic phase includes re-modeling or re-organization of surviving cortex to resume or approximate impaired function. Recovery predominantly occurs in the ﬁrst few weeks, plateauing at 3 months, but many patients report on-going improvements over years. Recovery over the ﬁrst few days is usually due to resolution of edema which is believed to disrupt axonal pathways and hence corticocortical connectivity, thereby uncovering the extent of the deﬁcit (Calautti and Baron, 2003). Reperfusion of the ischemic penumbra appears important, but it is not yet known to what extent this aﬀects prognosis (Astrup et al., 1981; Donnan and Davis, 2002). Some authors posit that the perfusion deﬁcit has more impact on sub-acute post-stroke function than the infarct core (Shirani et al., 2009; Khurshid et al., 2012). In addition, recovery of damaged or ischemic neural networks within the infarct may also contribute, particularly in areas of misery perfusion or chronic ischemia, but these latter two phenomena remain unproven in human studies ( Cao et al., 1999; Thulborn et al., 1999 ). Cellular level changes, such as cortical reorganization via synaptic sprouting, and the formation of new cortical connections may also contribute to recovery ( Darian-Smith and Gilbert, 1994 ). Patterns of activation after stroke have been reported, characterized by diaschisis, compensation and restitution of function. For example, stroke patients with left motor cortical infarction demonstrate bilateral reductions in motor network activation acutely, presumed secondary to diaschisis. With early recovery, they display increased right motor and supplementary motor activation, which are felt to be compensatory and may relate to more "eﬀortful" tasks. Only with good recovery is there restitution of activation to peri-infarct regions, or even to primary motor cortex in patients with subcortical lesions. In prior studies examining patients with visual cortical stroke, we have demonstrated similar ﬁndings in the visual cortex, with a return of activation to peri-infarct regions with visual recovery. In this patient's ﬁrst scan, we demonstrated a generalized reduction in right and left hemispheric activation, and have shown this in Figure 2. Whilst reduced, there was evidence of a normal pattern of activation in the right visual cortex. The second right-sided stroke aﬀected the superior occipital gyrus and cuneus, causing a new left inferior quadrantanopia. The second stroke aﬀected some regions that had shown activation in the initial scan. Right visual cortical activation patterns were hence altered in the second scan, exhibiting regions of new or increased activation in the right visual network. Relevance to Presented Case The information presented in this case report demonstrates evidence of each of these post-stroke phenomena. There was evidence of diaschisis on initial perimetry, associated with a symmetrical constriction in the unaﬀected hemiﬁeld—see Figure 1. Diaschisis may also have contributed to the overall reduction in bihemispheric activation seen on early scanning (Bosley et al., 1987; Brodtmann et al., 2007)—see Figure 2. We interpret the fMRI activation changes as evidence of cortical remodeling, which may be compensatory or associated with a restitution of function. At 6 months, there was almost complete recovery of his right hemianopia caused by his left occipital stroke, with associated return of peri-calcarine (peristriate) and new extrastriate activation in the left hemisphere. In the right hemisphere, the site of the second stroke, there was increased activation in extrastriate regions, especially within the dorsal extrastriate visual cortex. It is not possible to comment on the recovery of his visual deﬁcit, as perimetry was not performed at the time of the second stroke. We have previously reported utilization of dorsal extrastriate cortices in poststroke recovery (Brodtmann et al., 2007, 2009b). Dorsal regions are association or "secondary" cortical regions, and demonstrate unique characteristics within the visual network. They are less reliant on striate regulation, display greater inherent levels of experience dependent plasticity, and have faster, more abundant extra-geniculostriate connections (Brodtmann et al., 2009b). Mechanisms of Recovery Following Stroke Affecting the Visual System Until recently, the human visual system was thought to have an exquisitely contralateral representation, and was thought to be one of the least plastic parts of the brain (Tootell et al., 1998). However, there is now interest in visual function recovery after stroke (Brodtmann, 2012). Many therapists are taught that visual recovery after stroke is poor and incomplete, but results from natural history studies are at odds with this preconception. Whilst Ali et al. reported that less than 20% of completely hemianopic patients had full recovery of their visual ﬁelds after a month (Ali et al., 2013), more than 70% of those with partial hemianopia recovered their vision fully in the same time frame (Gray et al., 1989). Moreover, Zhang et al. found that spontaneous visual ﬁeld defect recovery occurred in at least 50% of a group of 254 patients within 1 month of injury (Zhang et al., 2006a,b). Cross-Modal Plasticity in the Visual System Evidence for cross-modal plasticity in the visual system has emerged in the last decade, when functional neuroimaging researchers (using PET, TMS, and fMRI) revealed remarkable activation of the primary visual cortex during tactile tasks. Some regions in the visual system display high levels of cross-modality. There appear to be cross-modal interactions of auditory, visual, somatic, and even olfactory inputs, with studies in blind people demonstrating extraordinary levels of activation in occipital regions to auditory and tactile stimuli (Saenz et al., 2008; Collignon et al., 2009; Fiehler and Rosler, 2010; Lewis et al., 2010; Kupers et al., 2011; Wong et al., 2011; Striem-Amit et al., 2012). These ﬁndings represent some of the most exciting advances in cognitive neuroscience, as researchers explore the organizational principles that drive this cross-modal plasticity. Implications for Therapy: Restorative vs. Compensatory Training Over the last few decades, a number of research groups postulated that deﬁcits caused by acquired visual pathway injury in adulthood were potentially reversible through visual training strategies. Researchers demonstrated evidence of visual ﬁeld recovery in people with stable lesions, often with lesions that were many years old (Kasten et al., 1999, 2006, 2007; Poggel et al., 2004, 2006, 2010; Henriksson et al., 2007; Chokron et al., 2008; Mueller et al., 2008; Jobke et al., 2009; Raemaekers et al., 2011). Visual Restoration Therapy (VRT) has been promoted by a number of researchers as a means of "striate system restoration" (Sabel and Kasten, 2000). The training usually consists of target detection during gaze ﬁxation. During training, the subjects are asked to ﬁx their gaze centrally whilst detecting stimuli in the border zone of their impaired visual ﬁeld; i.e., on the edge of their visual ﬁeld deﬁcit. Results from these studies have demonstrated a gradual enlargement of their functional visual ﬁeld, with concomitant reduction in their objective visual ﬁeld deﬁcit (Bergsma and van der Wildt, 2010). It remains unclear whether such therapies are causing actual improvement of visual ﬁeld deﬁcits or whether they are adaptive, causing functional improvement by increased saccades 6 into the aﬀected hemiﬁeld (Reinhard et al., 2005; Glisson and Galetta, 2007). When the early studies were ﬁrst published, many researchers felt that the functional improvements demonstrated by the authors were due to compensation strategies (e.g., better scanning and attention) rather than a true expansion of the visual ﬁeld. However, ﬁeld expansion has subsequently been shown to be independent of eye movements (Kasten et al., 2006). Mueller, Mast, and Sabel performed a large clinical observational study of 302 patients before and after being treated with computer-based VRT for a period of 6 months at eight clinical centers. In around 70% of patients, VRT was associated with a 17% improvement stimuli detection in the blind hemiﬁeld. These detection gains were not signiﬁcantly correlated with eye movements, and were validated by standard perimetry (Mueller et al., 2007). In their comprehensive review of spontaneous recovery and treatment eﬀects following homonymous visual deﬁcits, de Haan et al. identiﬁed important diﬀerences between the outcomes measured by restorative vs. compensatory training (de Haan et al., 2014). By deﬁnition, restorative training primarily focuses on improving the visual ﬁeld, reducing the visual deﬁcit, whilst compensatory training teaches the patient to apply scanning strategies in daily life in order to improve independence and mobility. They also recommended patient participation measures be used more frequently as a rehabilitation outcome, in order to assess whether an intervention or treatment is of beneﬁt for their activities of daily living. These are important considerations for therapists working with patients with acquired visual ﬁeld deﬁcits, as merely expanding a visual ﬁeld is of no beneﬁt unless it translates into functional gains. Involvement of specialist therapists with speciﬁc expertise with clients with blindness or low vision is especially important in their rehabilitation. Concluding Remarks The data support the assumption that stroke patients have activation patterns comparable with healthy controls prior to their strokes, and that abnormal activation sites are a consequence of their pathology. The ﬁndings also demonstrate the degree of resilience and extent of plasticity in the visual system, with utilization of other visually sensitive areas even in the presence of sequential insults. Specialist therapies are available for treatment. Traditionally, these are largely compensatory training strategies, teaching the patient to overcome their deﬁcit via compensatory methods. However, there is renewed interest in restorative training, although these methods are not without controversy. These data challenge the concept of a hard-wired visual system capable of minimal remodeling following injury. As demonstrated in this case report, mature primary visual cortex displays remarkable plasticity and capacity to reorganize following injury. Acknowledgments This work was supported by a National Health and Medical Research Council (Australia) Post-Graduate Scholarship, an Austin Research Council Grant, a Pﬁzer CVL Grant, and assistance with MRI scans from the Brain Research Institute. Supplementary Material The Supplementary Material for this article can be found online at: http://journal.frontiersin.org/article/10.3389/fnhum. 2015.00224/abstract References Ali, M., Hazelton, C., Lyden, P., Pollock, A., and Brady, M. (2013). Recovery from poststroke visual impairment: evidence from a clinical trials resource. Neurorehabil. Neural Repair 27, 133–141. doi: 10.1177/1545968312454683 Astrup, J., Siesjo, B. K., and Symon, L. (1981). Thresholds in cerebral ischemia–the ischemic penumbra. Stroke 12, 723–725. doi: 10.1161/01.STR.12.6.723 Bergsma, D. P., and van der Wildt, G. (2010). Visual training of cerebral blindness patients gradually enlarges the visual ﬁeld. Br. J. Ophthalmol. 94, 88–96. doi: 10.1136/bjo.2008.154336 Bosley, T. M., Dann, R., Silver, F. L., Alavi, A., Kushner, M., Chawluk, J. B., et al. (1987). Recovery of vision after ischemic lesions: positron emission tomography. Ann. Neurol. 21, 444–450. doi: 10.1002/ana.410210505 Brodtmann, A. (2012). "Vision," in Stroke Rehabilitation: Insights from Neuroscience and Imaging, ed L. M. Carey (Oxford: Oxford University Press), 173–185. Brodtmann, A., Puce, A., Darby, D., and Donnan, G. (2007). fMRI demonstrates diaschisis in the extrastriate visual cortex. Stroke 38, 2360–2363. doi: 10.1161/STROKEAHA.106.480574 Brodtmann, A., Puce, A., Darby, D., and Donnan, G. (2009a). Regional fMRI brain activation does correlate with global brain volume. Brain Res. 1259, 17–25. doi: 10.1016/j.brainres.2008.12.044 Brodtmann, A., Puce, A., Darby, D., and Donnan, G. (2009b). Serial functional imaging poststroke reveals visual cortex reorganization. Neurorehabil. Neural Repair 23, 150–159. doi: 10.1177/1545968308321774 Brodtmann, A., Puce, A., Syngeniotis, A., Darby, D., and Donnan, G. (2003). The functional magnetic resonance imaging hemodynamic response to faces remains stable until the ninth decade. Neuroimage 20, 520–528. doi: 10.1016/S1053-8119(03)00237-4 Calautti, C., and Baron, J. C. (2003). Functional neuroimaging studies of motor recovery after stroke in adults: a review. Stroke 34, 1553–1566. doi: 10.1161/01.STR.0000071761.36075.A6 Cao, Y., Vikingstad, B. S., George, K. P., Johnson, A. F., and Welch, K. M. A. (1999). Cortical language activation in stroke patients recovering from aphasia with functional MRI. Stroke 30, 2331–2340. doi: 10.1161/01.STR.30.11.2331 Chokron, S., Perez, C., Obadia, M., Gaudry, I., Laloum, L., and Gout, O. (2008). From blindsight to sight: cognitive rehabilitation of visual ﬁeld defects. Restor. Neurol. Neurosci. 26, 305–320. Collignon, O., Voss, P., Lassonde, M., and Lepore, F. (2009). Cross-modal plasticity for the spatial processing of sounds in visually deprived subjects. Exp. Brain Res. 192, 343–358. doi: 10.1007/s00221-008-1553-z Darian-Smith, C., and Gilbert, C. D. (1994). Axonal sprouting accompanies functional reorganization in adult cat striate cortex. Nature 368, 737–740. doi: 10.1038/368737a0 de Haan, G. A., Heutink, J., Melis-Dankers, B. J., Tucha, O., and Brouwer, W. H. (2014). Spontaneous recovery and treatment eﬀects in patients with homonymous visual ﬁeld defects: a meta-analysis of existing literature in terms of the ICF framework. Surv. Ophthalmol. 59, 77–96. doi: 10.1016/j.survophthal.2013.02.006 Dhamoon, M. S., Moon, Y. P., Paik, M. C., Sacco, R. L., and Elkind, M. S. (2012). Trajectory of functional decline before and after ischemic stroke: the Northern Manhattan study. Stroke 43, 2180–2184. doi: 10.1161/STROKEAHA.112.658922 Donnan, G. A., and Davis, S. M. (2002). Neuroimaging, the ischaemic penumbra, and selection of patients for acute stroke therapy. Lancet Neurol. 1, 417–425. doi: 10.1016/S1474-4422(02)00189-8 Duvernoy, H. M., Bourgouin, P., Cabanis, E. A., and Cattin, F. (1999). The Human Brain: Surface, Three Dimensional Sectional Anatomy with MRI, and Blood Supply, 2nd Edn. New York, NY: Springer Verlag. Figure S1 \| Schematic of activation task. (A) Example of FACE image displaying white cross target, (B) 50% GRAY background with black central ﬁxation cross, (C) Example of scrambled face (SCRF) image without white cross target, (D) 50% GRAY background displaying white cross target, (E) Example of FACE image without white cross target. First 100 s shown but cycle continued for 240 s. Fiehler, K., and Rosler, F. (2010). Plasticity of multisensory dorsal stream functions: evidence from congenitally blind and sighted adults. Restor. Neurol. Neurosci. 28, 193–205. doi: 10.3233/RNN-2010-0500 Glisson, C. C., and Galetta, S. L. (2007). Visual rehabilitation: now you see it; now you don't. Neurology 68, 1881–1882. doi: 10.1212/01.wnl.0000267412.5 4793.38 Goebel, R., Muckli, L., Zanella, F. E., Singer, W., and Stoerig, P. (2001). Sustained extrastriate cortical activation without visual awareness revealed by fMRI studies of hemianopic patients. Vision Res. 41, 1459–1474. doi: 10.1016/S00426989(01)00069-4 Gray, C. S., French, J. M., Bates, D., Cartlidge, N. E., Venables, G. S., and James, O. F. (1989). Recovery of visual ﬁelds in acute stroke: homonymous hemianopia associated with adverse prognosis. Age Ageing 18, 419–421. doi: 10.1093/ageing/18.6.419 Henriksson, L., Raninen, A., Nasanen, R., Hyvarinen, L., and Vanni, S. (2007). Training-induced cortical representation of a hemianopic hemiﬁeld. J. Neurol. Neurosurg. Psychiatr. 78, 74–81. doi: 10.1136/jnnp.2006.099374 Jobke, S., Kasten, E., and Sabel, B. A. (2009). Vision restoration through extrastriate stimulation in patients with visual ﬁeld defects: a double-blind and randomized experimental study. Neurorehabil. Neural Repair 23, 246–255. doi: 10.1177/1545968308324221 Kasten, E., Bunzenthal, U., Muller-Oehring, E. M., Mueller, I., and Sabel, B. A. (2007). Vision restoration therapy does not beneﬁt from costimulation: a pilot study. J. Clin. Exp. Neuropsychol. 29, 569–584. doi: 10.1080/13803390600878919 Kasten, E., Bunzenthal, U., and Sabel, B. A. (2006). Visual ﬁeld recovery after vision restoration therapy (VRT) is independent of eye movements: an eye tracker study. Behav. Brain Res. 175, 18–26. doi: 10.1016/j.bbr.2006.07.024 Kasten, E., Poggel, D. A., Muller-Oehring, E., Gothe, J., Schulte, T., and Sabel, B. A. (1999). Restoration of vision II: residual functions and training-induced visual ﬁeld enlargement in brain-damaged patients. Restor. Neurol. Neurosci. 15, 273–287. Khurshid, S., Trupe, L. A., Newhart, M., Davis, C., Molitoris, J. J., Medina, J., et al. (2012). Reperfusion of speciﬁc cortical areas is associated with improvement in distinct forms of hemispatial neglect. Cortex 48, 530–539. doi: 10.1016/j.cortex.2011.01.003 Kupers, R., Beaulieu-Lefebvre, M., Schneider, F. C., Kassuba, T., Paulson, O. B., Siebner, H. R., et al. (2011). Neural correlates of olfactory processing in congenital blindness. Neuropsychologia 49, 2037–2044. doi: 10.1016/j.neuropsychologia.2011.03.033 Lewis, L. B., Saenz, M., and Fine, I. (2010). Mechanisms of cross-modal plasticity in early-blind subjects. J. Neurophysiol. 104, 2995–3008. doi: 10.1152/jn.00983.2009 Mueller, I., Gall, C., Kasten, E., and Sabel, B. A. (2008). Long-term learning of visual functions in patients after brain damage. Behav. Brain Res. 191, 32–42. doi: 10.1016/j.bbr.2008.03.005 Mueller, I., Mast, H., and Sabel, B. A. (2007). Recovery of visual ﬁeld defects: a large clinical observational study using vision restoration therapy. Restor. Neurol. Neurosci. 25, 563–572. Nelles, G., Widman, G., de Greiﬀ, A., Meistrowitz, A., Dimitrova, A., Weber, J., et al. (2002). Brain representation of hemiﬁeld stimulation in poststroke visual ﬁeld defects. Stroke 33, 1286–1293. doi: 10.1161/01.STR.0000013685.76 973.67 Poggel, D. A., Kasten, E., Muller-Oehring, E. M., Bunzenthal, U., and Sabel, B. A. (2006). Improving residual vision by attentional cueing in patients with brain lesions. Brain Res. 1097, 142–148. doi: 10.1016/j.brainres.2006.04.011 Poggel, D. A., Kasten, E., and Sabel, B. A. (2004). Attentional cueing improves vision restoration therapy in patients with visual ﬁeld defects. Neurology 63, 2069–2076. doi: 10.1212/01.WNL.0000145773.26378.E5 Poggel, D. A., Mueller, I., Kasten, E., Bunzenthal, U., and Sabel, B. A. (2010). Subjective and objective outcome measures of computer-based vision restoration training. Neurorehabilitation 27, 173–187. doi: 10.3233/NRE2010-0594 Raemaekers, M., Bergsma, D. P., van Wezel, R. J., van der Wildt, G. J., and van den Berg, A. V. (2011). Eﬀects of vision restoration training on early visual cortex in patients with cerebral blindness investigated with functional magnetic resonance imaging. J. Neurophysiol. 105, 872–882. doi: 10.1152/jn. 00308.2010 Reinhard, J., Schreiber, A., Schiefer, U., Kasten, E., Sabel, B. A., Kenkel, S., et al. (2005). Does visual restitution training change absolute homonymous visual ﬁeld defects? A fundus controlled study. Br. J. Ophthalmol. 89, 30–35. doi: 10.1136/bjo.2003.040543 Sabel, B. A., and Kasten, E. (2000). Restoration of vision by training of residual functions. Curr. Opin. Ophthalmol. 11, 430–436. doi: 10.1097/00055735200012000-00008 Saenz, M., Lewis, L. B., Huth, A. G., Fine, I., and Koch, C. (2008). Visual motion area MT+/V5 responds to auditory motion in human sight-recovery subjects. J. Neurosci. 28, 5141–5148. doi: 10.1523/JNEUROSCI.0803-08.2008 Schoenfeld, M. A., Noesselt, T., Poggel, D., Tempelmann, C., Hopf, J. M., Woldorﬀ, M. G., et al. (2002). Analysis of pathways mediating preserved vision after striate cortex lesions. Ann. Neurol. 52, 814–824. doi: 10.1002/ana. 10394 Shirani, P., Thorn, J., Davis, C., Heidler-Gary, J., Newhart, M., Gottesman, R. F., et al. (2009). Severity of hypoperfusion in distinct brain regions predicts severity of hemispatial neglect in diﬀerent reference frames. Stroke 40, 3563–3566. doi: 10.1161/STROKEAHA.109.561969 Smith, S. M. (2002). Fast robust automated brain extraction. Hum. Brain Mapp. 17, 143–155. doi: 10.1002/hbm.10062 Striem-Amit, E., Dakwar, O., Reich, L., and Amedi, A. (2012). The large-scale organization of "Visual" streams emerges without visual experience. Cereb. Cortex 22, 1698–1709. doi: 10.1093/cercor/bhr253 Thulborn, K. R., Carpenter, P. A., and Just, M. A. (1999). Plasticity of languagerelated brain function during recovery from stroke. Stroke 30, 749–754. doi: 10.1161/01.STR.30.4.749 Tootell, R. B., Mendola, J. D., Hadjikhani, N. K., Liu, A. K., and Dale, A. M. (1998). The representation of the ipsilateral visual ﬁeld in human cerebral cortex. Proc. Natl. Acad. Sci. U.S.A. 95, 818–824. doi: 10.1073/pnas.95.3.818 Wong, M., Gnanakumaran, V., and Goldreich, D. (2011). Tactile spatial acuity enhancement in blindness: evidence for experience-dependent mechanisms. J. Neurosci. 31, 7028–7037. doi: 10.1523/JNEUROSCI.6461-10.2011 Zhang, X., Kedar, S., Lynn, M. J., Newman, N. J., and Biousse, V. (2006a). Homonymous hemianopias: clinical-anatomic correlations in 904 cases. Neurology 66, 906–910. doi: 10.1212/01.wnl.0000203913.12088.93 Zhang, X., Kedar, S., Lynn, M. J., Newman, N. J., and Biousse, V. (2006b). Natural history of homonymous hemianopia. Neurology 66, 901–905. doi: 10.1212/01.wnl.0000203338.54323.22 Conﬂict of Interest Statement: The authors declare that the research was conducted in the absence of any commercial or ﬁnancial relationships that could be construed as a potential conﬂict of interest. Copyright © 2015 Brodtmann, Puce, Darby and Donnan. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.	<urn:uuid:de26e997-a190-4363-9ad2-8fc95a34ffea>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	45,321
SANTA CLARA COUNTY OFFICE OF EDUCATION CLASS TITLE: ENVIRONMENTAL EDUCATION SPECIALIST BASIC FUNCTION: Prepares and implements lessons and materials for science and environmental education activities; performs a variety of related duties for an effective learning environment for students. DISTINGUISHING CHARACTERISTICS The Environmental Education Specialist provides responsible instructional assistance to assigned teachers/students in implementing the educational and social objectives of assigned program(s). Employees in this classification receive general supervision within a framework of standard policies and procedures. This classification requires a high degree of independent and positive contact with both students and teaching staff. REPRESENTATIVE DUTIES: The following duties are examples of assignments performed by incumbents in this classification. It is not a totally comprehensive list of duties, nor is it restrictive regarding job assignments. ESSENTIAL DUTIES: Prepares and implements lessons and materials for science and environmental education activities in conjunction with well-defined and structured objectives. Coordinates and conducts the instruction of students in outdoor classrooms with a greater degree of independence than would be found in traditional classrooms. Adjusts lesson plans to accommodate students with special needs and/or with limited English. Provides training, support and guidance to cabin leaders; assists in training cabin leaders and in the supervision of living units. Organizes and leads recreational activities such as, but not limited to art, music, campfires, hikes, storytelling, games, and slide shows. Orchestrates and coordinates the activities for students and large and small student groups, which may require driving to a variety of locations. Enforces established rules and standards, supporting students experiencing emotional illness and noting behavioral problems; applies approved disciplinary procedures, working with teachers and contacting parents when necessary. Provides necessary first aid for student illnesses and/or injuries. Attends and participates in meetings, trainings and other staff in-service activities, which may require driving to a variety of locations. Monitors and evaluates student progress in assigned learning areas. Supervises students during instructional, recreational and meal time activities. Assists in maintaining garden and outdoor areas, trails and living area(s); ensures site is kept in a clean and orderly fashion; empties trash, picks up litter, and organizes furniture, including chairs. Provides a variety of clerical support functions such as, but not limited to taking attendance, recording test scores, and filing, in support of program objectives. Operates audio-visual equipment, two-way radio, microphone, stereo, telescope, microscope, and other related equipment. OTHER DUTIES: Perform related duties as assigned. KNOWLEDGE AND ABILITIES: KNOWLEDGE OF: Natural and environmental science. Effective child guidance practices and principles. Student recreational activities involving sports, games, arts, and crafts. Pertinent academic areas and learning situations. Effective record keeping methods and techniques. Student safety and first aid for minor injuries. Proper English usage, grammar, vocabulary, spelling, punctuation and sentence structure. ABILITY TO: Prepare and implement lessons and materials for science and environmental education activities in conjunction with well-defined and structured objectives including fifth and sixth grade science standards. Understand and carry out both oral and written instructions in an independent manner. Understand the needs of students in difficult circumstances and effectively relate to these needs in a learning and/or recreational situation. Communicate effectively with students in small and large group settings. Analyze situations accurately and adopt an effective course of action. Effectively supervise large students groups in a variety of situations. Adjust lesson plans to accommodate students with special needs and/or with limited English. Operate standard office/classroom equipment which may include typewriter, copy machine, tape recorder, projector, two-way radio, stereo, telescope and microscope. Maintain effectiveness in stressful situations. Meet the physical requirements necessary to safely and effectively perform the required duties. Establish and maintain cooperative and effective work relationships with those contacted in the performance of required duties. EDUCATION AND EXPERIENCE: Any combination equivalent to: Education and experience equivalent to four years in the natural sciences, environmental sciences, or a related field. LICENSES AND OTHER REQUIREMENTS: A valid first aid certificate and a cardiopulmonary (CPR) certificate A valid California Driver's License. A driving record that meets the insurance requirements of the County Office of Education. WORKING CONDITIONS: ENVIRONMENT: Outdoor environment. PHYSICAL DEMANDS: Strength, endurance and dexterity to participate in strenuous physical activities, including hiking on mountain trails and clearing chaparral and cutting tree branches. Walking for extended periods of time; hearing and speaking to exchange information. Seeing to read and prepare documents. Sitting or standing for extended periods of time; dexterity of hands and fingers to operate office and assemble outdoor equipment. Kneeling, bending at the waist, and reaching overhead, above the shoulders and horizontally. Pushing, lifting and/or carrying heaving objects weighing up to 25 pounds. 09/25/84; Approved by Personnel Commission: December 12, 1994; Revised: 01/18/85, 01/10/89; Revised Commission Approval: March 1999, August 1999, February 14, 2008, May 10, 2017 Kristin Olson Director-Classified Personnel Services Date: 05/10/2017	<urn:uuid:71e9c97e-c875-48d8-ab52-b2a502c26d03>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	5,946
DODÁVATEĽ: Juraj Franko HORSE DENTIST Jedľová 254/14 Trenčín - Zlatovce 911 05 Slovenská republika IČO: 47803240 DIČ: 1086979828 Okr.súd Bánovce nad Bebravou číslo Živ.registra: 310-8435 FAKTÚRA číslo: 2023/039 Objednávka: Dodací list: ODBERATEĽ: Národný žrebčín 'Topoľčianky' štátny podnik Parková 13 951 93 Topoľčianky \| IČO: \| 31447708 \| \|------\|----------\| \| DiČ: \| 2020412196 \| \| IČ DPH: \| SK2020412196 \| Číslo účtu: SK98 7500 0000 0040 1385 0037 VS: 2023039 SWIFT: CEKOSKBX Spôsob dopravy: Prikaz na úhradu Dodacia adresa: Národný žrebčín 'Topoľčianky' štátny podnik, Parková 13, 951 93 Topoľčianky, Slovenská republika Fakturujeme Vám ošetrenie: \| P.č. \| Číslo položky \| Nazov položky \| Množstvo \| MJ \| Zľava % \| Jednotková cena \| Cena spolu \| \|------\|---------------\|---------------\|----------\|----\|---------\|----------------\|-----------\| \| 1. \| zubné ošetrenia koní \| 1 m.j. \| 0 \| 1 100,00 \| 1 100,00 \| Dodávateľ nie je platiteľ DPH. Celková fakturovaná suma: EUR 1 100,00 Fakturowaná suma: EUR 1 100,00 --- Národný žrebčín Topoľčianky, štátny podnik Dátum: 14. NOV. 2023 Číslo spisu: R.Z.: Prílohy: Vybavuje: --- Vyhotovil: Juraj Franko Vytvorené v programe ALFA plus - jednoduché účtovníctvo a legislatíva bez starosti. © KROS a.s., www.kros.sk/alfaplus	<urn:uuid:43ed95be-71dd-4035-bf12-de55e64ae42a>	HuggingFaceFW/finepdfs/tree/main/data/slk_Latn/train	finepdfs	slk_Latn	1,353
Annual Growth Plan Working Template Areas for Growth Growth Strategies/ Supports (ways of acquiring skills) Follow-up if required Target Dates for Completion Suggested Annual Growth Plan For Next Year Personal Goals Leader Practices • Setting directions • Building relationships and developing people • Developing the organization • Leading the instructional program • Securing accountability • Catholic faith, community, and culture Leader Competencies • Skills • Knowledge • Attitudes Ongoing Professional Development • Learning networks • Mentoring • Coaching • Job-shadowing Performance Plan Goals System Practices and Procedures • School and district improvement • Fostering a culture of professionalism • Leadership development • Administrative structures • Parent and community supports • Succession planning, including recruitment, to build capacity and to retain and sustain effective leaders	<urn:uuid:baebc520-b5eb-4341-818c-12798e9a1001>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	901
Titolo: Il destino Autore: Carolina Purici Editore: Aletti Anno edizione: 2015 EAN: 9788859125372 Il destino.pdf [PDF] • Il destino.epub [ePUB] • Il "Destino" è un racconto autobiografico che unisce due generazioni, due storie, una cerca il destino promettente nelle terre lontane, un'altra subisce il destino poco promettente. Persone che vivono la loro giovinezza come una lotta continua per la sopravvivenza. I migliori anni per forgiare il carattere, la volontà, la determinazione e il lavoro. Epoche diverse attraversate da svariate intemperie sociali con unico filo conduttore che li accomuna, il legame di sangue. Eventi raccontati e vissuti in prima persona, oppure sentiti e risentiti da diventare come personale. Esperienze di profonda rilevanza emotiva, come nascita di un figlio, poi nel momento successivo abbandono, isolamento sociale, impatto con un altro modo di vivere e pensare. Poi riscatto con la società e anche con se stessi. Acquisita la stabilità si fanno sentire le perdite delle persone care, e all' improvviso dalla piccola della casa si fa salto di una generazione e ti ritrovi veramente con il peso di quarant'anni e con la domanda, è stata una decisione giusta di vivere e far vivere in solitudine i tuoi cari? Il funerale del nonno riporta altre memorie e altri diari. Con il termine destino ci si riferisce a un insieme d'inevitabili eventi che accadono secondo una linea temporale soggetta alla necessità e che portano ad una. Le onde del destino (Breaking the Waves) è un film del 1996 diretto dal regista danese Lars von Trier. La pellicola rivelò al grande pubblico il talento del regista. Ore 11:14, Destino fatale di Greg Marcks, con Hilary Swank, Patrick Swayze, Barbara Hershey, è un breve film corale, ambientato nella piccola città di Middleton. Un film di Peter Levin con Thora Birch, Michael Riley, Robert Bockstael, Makyla Smith. "Non possiamo scegliere la cornice del nostro destino, ma ciò che vi mettiamo dentro è nostro". Frasi, citazioni e aforismi sul destino. Saggio breve di storia Il re scelto dal destino: Alessandro Magno di Andrea Betti, classe I^ G, a s 2004/'05 La nascita di Alessandro, come quella di altri In questa sezione potrai procedere con il calcolo del Carolina Purici a.s. 2004/ 05 La nascita di Alessandro, come quella di altri. In questa sezione potrai procedere con il calcolo del Numero del Destino e i Numeri della Personalità (numero dell'Espressione, dell'Apparenza e della Determinazione. Guarda Destino Enemigo. Pornhub è il sito di porno xxx e sesso definitivo. La Numerologia, le cui origini risalgono a Pitagora, è lo studio dei numeri e del modo in cui essi riflettono certe attitudini e tendenze caratteriali, come una. Inter, il destino di Pioli deciso da tempo: si punta su Simeone e Conte. La proprietà cinese ha già deciso da novembre che a giugno si cambierà tecnico. Reserve no Hotel Il Podere Siracusa Grandes preços, sem custos reserva Reserve no Baia Residence Il. Grandes preços, sem custos reserva Il Destino is the coming together of two renowned singers their new and critically acclaimed shows have taken them across the UK and Europe as well as The States. Restaurant Il Destino, Geneva, Switzerland. 126 likes. Pizza Place. Facebook. Email or Phone: Password: Forgot account? Explore local businesses on Facebook. Il Destino are an English classical crossover duo composed of international tenor Jon Christos and Musical theatre performer Adam Lacey. Jon Christos is a ... 04/12/2010 · Встроенное видео · Indietro - Il Destino (Radio Version) DJ RICARDO RANGUET Duration: 3:55. DJRanguet 8,325 views. 3:55. Brothers - Sexy Girl - … 07/01/2015 · Встроенное видео · IL DESTINO ESISTE? QUI LA RISPOSTA DEFINITIVA QUANTOLUX. Loading ... Il DESTINO: è ora di prendere in mano le … De indata ce pasiti pragul restaurantului porniti intr-o calatorie gastronomica in jurul Italiei, unde puteti savura preparate atent selectionate reprezentative ... Destino is the new boutique resort concept by Pacha Group in the island of Ibiza. One place to enjoy the real Mediterranean lifestyle all day and all night long. Встроенное видео · Il Destino: Get the car out of your father's shop! - Il Destino is one of our selected Escape Games. Play Il Destino for Free, and Have Fun! destino_top - 】】】】】】】】】】】】】】】 Con il termine destino ci si riferisce a un insieme d'inevitabili eventi che accadono secondo una linea temporale soggetta alla necessità e che portano ad una ... destino (ant. distino) s. m. [der. di destinare]. – 1. La predeterminazione fatale dell'accadere; il succedersi degli eventi ritenuto come preordinato e ... Chiamatelo destino, sorte o fato, ma credici sempre. Qui trovi una raccolta delle migliori frasi, citazioni e aforismi sul destino. Citazioni sul destino. Citazioni . Abbiamo un destino? Che noia non saperlo! Che noia se lo si sapesse! (Jules Renard) Anche il destino detiene le proprie onorevoli ... Destino: Necessità che sembra determinare gli eventi e che appare esterna e superiore alla volontà dell'uomo SIN lett. fato. Definizione e significato del termine ... Numeri del destino; Cosa sono le sibille; Oroscopo celtico; Oroscopo del giorno; Le origini delle sibille; Come conqustarlo; metafonia; Che cosè la magia; riti ... Frasi sul destino: citazioni e aforismi sul destino dall'archivio di Frasi Celebri .it Aforismi Destino, Aforismi Sul Destino, i Più bei Aforismi Di Destino. AFORISMI DESTINO Celebri, Frasi e Aforismi Del Destino Famosi! Destino è un cortometraggio a cartoni animati, della durata di 6:32 minuti, cominciato da Walt Disney e Salvador Dalì, completato ed infine prodotto nel 2003 dalla ... destino : la traduzione del dizionario Hoepli Italiano-Inglese. Scopri i nostri dizionari di italiano, inglese e l'enciclopedia Zanichelli	<urn:uuid:45295c39-320a-4c3f-8f73-c66731e95073>	HuggingFaceFW/finepdfs/tree/main/data/ita_Latn/train	finepdfs	ita_Latn	5,788
gara 1 Ragazzi, 100m Mista 12 anni e più giovani gara 5 8 GALETTA Dario Ragazzi, 50m Dorso 1:41.00 16 BIGA Alessandro 13 anni e più giovani LUGA NT 13 NUM 13 gara 8 Ragazze, 100m Stile Libero 11 anni e più giovani gara 12 26.11.2023 - 16:35 13 anni e più giovani NT RSR: Meeting de Formation "Futura" - Etape 1 misto, 4 x 50m Stile Libero 13 anni e più giovani Lista d'iscrizioni	<urn:uuid:963825ec-b621-4987-b753-a9932104290e>	HuggingFaceFW/finepdfs/tree/main/data/ita_Latn/train	finepdfs	ita_Latn	401
OMH Wedding Agreement Scheduling Details - +1hr is required for each woman's full face of Make up. - +1hr is required for each woman's styling appointment. - 50% of the total is due day of booking - Deposits are non refundable for cancellations within 30 days of scheduled event. - Bridal-Trial appointment recommended at $65.00 - Final balance is due 30 days prior to event Pricing Details - Updo $100.00 per women - Flower girls (under 10 years old) $25.00 - Down styling $75.00 per women - On site services are available with a $25.00 traveling per stylist, prices may vary depending on on-site location (Ask salon for all inquiries) Make up Details - Airbrush-$100.00 - Standard Make up-$75.00 - Full Face Airbrush (includes false lashes)-$120.00 - False Eyelashes add ons-$20.00 Wedding Date? On site services? – Deposit Form ___________ x $25 = # of Girls (hair) __________ x $25 = # of Girls (make up) *Total Deposit: __________________ (1 payment due in full at time bridal party books appointment to secure the date)	<urn:uuid:71cc567f-4bf5-4a46-9ee8-174926f51b1c>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	1,042
Vládní nařízení ze dne 1. února 1923 o zatímčinm uvedení v platnost prozatímní obchodní dohody mezi republikou Československou a Řeckem. Vláda Československé republiky nařizuje podle § 1 zákona ze dne 25. listopadu 1919, č. 637 Sb. z. a n., toto: § 1. Prozatímní obchodní dohoda mezi Československou republikou a Řeckem, podepsaná v Athénách dne 10. ledna 1923, uvádí se v prozatímní platnost. § 2. Toto nařízení nabývá účinnosti dnem vyhlášení. § 3. Provedení se ukládá ministru věcí zahraničních, ministru obchodu, průmyslu a živností a ministru financí v dohodě s ostatními súčastněnými ministry. Habrmann v. r. Dr. Beneš v. r. Dr. Hodža v. r. Malypetr v. r. Udržal v. r. Dr. Doňanský v. r. Tučný v. r. Stříbrný v. r. Dr. Kállay v. r. Srba v. r. Dr. Markovič v. r. Novák v. r., též za ministra Dra Rašina. (Překlad.) Prozatímní obchodní dohoda československo-řecká. VLÁDA ČESKOSLOVENSKÁ a VLÁDA ŘECKÁ, proniknutý přáním po usnadnění obchodních styků stávajících i všech, které mají být navázány a rozšířeny mezi oběma zeměmi, rozhodly se uzavřít prozatímní obchodní dohodu. K tomu cíli podepsaní, řádně zplnomocnění svými vládami, shodli se na tomto: Článek I. Ježto dovoz některých druhů zboží, výrobků to řeckých, není do Československa dovolen než s povolením vlády československé, zavazuje se tato, že dovolí do Československa dovoz kontingentů vypočtených v příloze A, énumérés dans l'annexe A, qui forme une partie intégrante de la présente convention. Les contingents annuels fixés dans cette liste seront répartis entre les trimestres de l'année pour laquelle ils auront été accordés, étant entendu que, si l'importation d'un trimestre demeure inférieure au quart du contingent, la différence en sera ajoutée au contingent du trimestre suivant. Les produits et marchandises Helléniques énumérés dans l'annexe A jouiront à leur entrée en Tchécoslovaquie de la clause de la nation la plus favorisée, y compris les faveurs accordées ou à accorder postérieurement à des articles similaires d'autres pays et en particulier en ce qui concerne la réduction ou abolition des coefficients existant actuellement. Article II. Par contre le Gouvernement Hellénique s'engage à accorder le traitement de la nation la plus favorisée y comprises toutes les faveurs accordées ou à accorder par le tarif douanier conventionnel aux marchandises Tchécoslovaques énumérées dans l'annexe B faisant partie intégrante de la présente convention. Article III. Le Gouvernement Tchécoslovaque prend acte de l'abolition des restrictions d'importation qui touchaient les produits Tchécoslovaques. D'autre part dans le cas, où le Gouvernement Hellénique établirait à l'avenir une restriction ou prohibition quelconque d'importation d'une ou plusieurs marchandises énumérées dans l'annexe B de la présente convention, il s'engage à entrer en négociations avec le Gouvernement Tchécoslovaque en vue de rendre ces restrictions le moins préjudiciables possible à l'exportation Tchécoslovaque. Article IV. Le Gouvernement Tchécoslovaque s'engage à ce que sa Régie des tabacs en faisant des achats de tabac de cigarettes pour satisfaire à ses besoins, donnera la préférence aux tabacs grecs aux conditions suivantes: 1. aux tabacs provenant de la Vieille Grèce ou des îles (Samos) jusqu'à concurrence de 700.000 kilos par an, 2. aux tabacs provenant de la Nouvelle Grèce (Macédoine) jusqu'à concurrence d'1,300.000 Kilos par an, která tvoří nedílnou část této smlouvy. Roční kontingenty stanovené v tomto seznamu budou rozděleny na čtyrtletí roku, pro který byly poskytnuty, při čemž ovšem, nedosáhne-li dovoz jednoho čtvrtletí čtvrtiny kontingentu, příslušný rozdíl bude započten do kontingentu čtvrtletí následujícího. Výrobky a zboží řecké vyjmenované v příloze A budou požívati při svém vstupu do Československa nejvyšších výhod, v to počítaje výhody již přiznané nebo které budou přiznány později podobným druhům zboží jiných zemí a zvláště pak, pokud jde o snížení nebo zrušení nyní stavajících koeficientů. Článek II. Naproti tomu řecká vláda se zavazuje poskytnouti nakládání dle nejvyšších výhod, včetně všech výhod přiznaných či které budou přiznány celnim smluvním sazebníkem, zboží československému vypočtenému v příloze B, která tvoří nedílnou část této smlouvy. Článek III. Vláda československá bere na vědomí zrušení dovozních omezení, která se týkala československých výrobků. S druhé strany zavazuje se vláda řecká, že jestliže by zavedla v budoucnu jakékoliv dovozní omezení nebo zákaz dovozu jednoho nebo více druhů zboží, vypočtených v příloze B této smlouvy, vstoupí v jednání s vládou československou, aby tato omezení nebo zákazy způsobily co nejméně újmy československému vývozu. Článek IV. Vláda československá se zavazuje, že československá tabáková režie dá při nákupech cigaretového tabáku k hrazení své potřeby přednost tabákům řeckým za následujících podmínek: 1. tabákům pocházejícím ze Starého Řecka nebo z ostrovů (Samos) až do výše 700.000 kg ročně, 2. tabákům pocházejícím z Nového Řecka (Macedonie) až do výše 1,300.000 kg ročně, tout ceci à condition: 1. que ces tabacs lui soient offerts, 2. que cette offre soit faite à des prix et à d'autres conditions qu'elle trouverait satisfaisantes par rapport aux conditions qu'on lui ferait au sujet de tabacs d'autres provenances et dont l'achat pourrait être envisagé par elle pour la fabrication de cigarettes Tchécoslovaques. Par contre le Gouvernement Hellénique déclare expressément: 1. que les maisons Tchécoslovaques sont libres à participer à l'adjudication des commandes de cartes à jouer de luxe et des allumettes dans les mêmes conditions que les autres maisons étrangères, 2. que les marchands de tabacs grecs sont libres d'acheter les papiers à cigarettes en Tchécoslovaquie dans les mêmes conditions que dans les autres pays, 3. que dans le cas où l'importation d'alcool serait permise en Grèce pour un temps limité, les importateurs Tchécoslovaques seront traités sur le même pied que tout autre importateur. Article V. Les deux Parties Contractantes pourront exiger que les produits et marchandises importés sur leur territoire soient accompagnés d'un certificat d'origine, délivré par les Chambres de Commerce au autres autorités compétentes. Article VI. Cet accord sera ratifié et entrera en vigueur quinze jours après l'échange des ratifications qui aura lieu à Athènes. L'accord restera obligatoire pendant six mois à partir du jour de son entrée en vigueur. Après l'expiration de ce délai il sera prolongé par voie de tacite reconduction et à partir du jour de sa dénonciation par une des parties contractantes il restera en vigueur encore trois mois. Fait en double exemplaire à Athènes le vingt huit Décembre 1922 — dix Janvier 1923. A. Alexandri m. p. Charles Mečíř m. p. a to s podmínkou: 1. že tabáky tyto budou jí nabídnuty, 2. že tato nabídka bude učiněna za cen a ostatních podmínek, které shledá vyhovujícími vzhledem k podmínkám, které by jí byly učiněny, pokud jde o tabáky jiného původu a na jichž nákup by pro výrobu československých cigaret mohlo být pomýšleno. Naproti tomu vláda řecká prohlašuje výslovně: 1. že firmy československé mohou se volně účastnit soutěže při objednávkách hracích karet přepychových a zápalík za týchž podmínek jako jiné firmy cizozemské, 2. že obchodníci s řeckým tabákem mohou svobodně kupovat cigaretové papíry v Československu za týchž podmínek jako v jiných zemích, 3. jestliže by byl dovolen do Řecka pro omezenou dobu dovoz alkoholu, že s dovozcí československými bude nakládáno stejně jako s každým jiným dovozcem. Článek V. Obě smluvní strany budou moci žádati, aby výrobky a zboží dovážené do jejich území byly provázeny osvědčením o původu, vydaným obchodními komorami nebo jinými příslušnými úřady. Článek VI. Tato dohoda bude ratifikována a vstoupí v působnost čtrnáct dní po výměně ratifikací, k níž dojde v Athénách. Dohoda bude závaznou po šest měsíců ode dne, kdy nabude působnosti. Po uplynutí této lhůty bude bez dalšího prodloužena a ode dne výpovědi jednou ze smluvních stran zůstane ještě tři měsíce v působnosti. Vyhotoveno dvojmo v Athénách, dne dvacátéhoosmého prosince 1922 — desátého ledna 1923. A. Alexandri v. r. Karel Mečíř v. r. Annexe A. \| Classe du tarif douanier tchécoslovaque \| Genre de produits \| Contingent \| \|----------------------------------------\|------------------\|------------\| \| 9 b \| Figues sèches: \| \| \| 1. En boîtes, caissettes ou petits paniers \| Kilos \| 6,720,000 \| \| 2. En chapelets ou autrement conditionnées \| Kilos \| 2,000,000 \| \| 10 \| Raisins secs en grains et grappes, raisins de Corinthe \| Kilos \| 500,000 \| \| 104 \| Huile d'olive, etc. \| Kilos \| 15,000 \| \| 108 b \| Liqueurs, essences de punch et autres spiritueux distillés, additionnés de sucre ou d'autre substance; eau de vie de France \| Kilos \| 20,000 \| \| 109 \| Vins, vins de fruits, moût de raisins et de fruits, jus de fruits et de baies non condensées; hydromel, en tonneaux \| Hectol. \| 20,000 \| \| 109 a \| Vins doux pharmaceutiques (Medicinal-Weine), vins Muscats (Samos-Weine) blancs ou rouges contenant de sucre plus de 220 gr. par litre alcool 14/2—15° par volume, si possible jusqu'à 17° dont 6 degrés par fermentation, extrait sec reduit minimum 28 grammes par litre. Vins Muscats de raisins Muscats (Samos-Weine) pays d'origine: Samos, Patras, Eubée et Céphalonie. Caractéristiques spéciales: sucre plus de 180 par litre, alcool 15°, goût caractéristique Muscat \| Hectol. \| 15,000 \| \| \| Vermuth \| Hectol. \| 3,000 \| A. A. m. p. Ch. M. m. p. Annexe B. \| No. du tarif \| Aliénés \| Poids ou mesures \| Droit en espèce métallique général/convent. \| \|--------------\|---------\|------------------\|---------------------------------------------\| \| 20 b \| Malt \| 100 oq. 120 \| 100 \| \| 61 a \| Marbres, dalles et pierres brutes, pierres typographiques et lithographiques, silice, borax à l'état naturel, pierres à aiguiser et pierres \| 100 oq. 120 \| 100 \| Příloha A. \| Sazební číslo \| Druh výrobku \| Kontingent \| \|---------------\|--------------\|------------\| \| 9 b \| Fíky sušené: \| \| \| 1. v krabicích, bedničkách nebo v košíčcích \| kilogramů \| 6,720,000 \| \| 2. ve věnčících nebo jinak balené \| kilogramů \| 2,000,000 \| \| 10 \| Vinné bobule a hrozný sušené, korintky \| kilogramů \| 500,000 \| \| 104 \| Olej olivový atd. \| kilogramů \| 15,000 \| \| 108 b \| Likéry, punšové tresti a jiné lihové tekutiny pálené, s přísadou cukru nebo jiných látek, francovka \| kilogramů \| 20,000 \| \| 109 \| Víno, ovocné víno, vinný a ovocný mošt, šťávy z plodů, ovocce a bobulí, nezahustěné; medovi na v sudech \| hektolitrů \| 15,000 \| \| 109 a \| Vína sladká léčivá (vína medicinální), vína muskátová (vína samoská), bílá či červená, obsahující více než 25 g cukru na litr při obsahu 14 1/2 až 15° alkoholu, připadně možno-li až 17° objemových, z nichž 6° vzniklo kvašením, suchého vytážku nejméně 28 g na litr. Vína muskátová z muskátových hroznů (vína samoská) — země původu: Samos, Patras, Euboia, a Kefalonie. Zvláštní znaky: cukru více než 180 na litr, 15° alkoholu, charakteristická chuť muskátová. \| hektolitrů \| 3,000 \| Příloha B. \| Sazební číslo \| Ostatavec \| Zboží \| Váha či míra \| Clo v kovov. peněz. všeob. smluvní \| \|---------------\|-----------\|-------\|--------------\|-----------------------------------\| \| 20 b \| Slad \| 100 oka \| 120 \| 100 \| \| 61 a \| Mramor, dlaždice a kámen nezpracované, kamenný typografické a litografické, křemen, borax v přírodním stavu, kameny na broušení \| 100 oka \| 120 \| 100 \| \| No. du tarif \| Afinés \| Poids ou mesures \| Droit en espèce métallique général \| conven. \| \|-------------\|--------\|-----------------\|----------------------------------\|---------\| \| 80 \| Huiles volatiles (essences) \| l'ocq. \| 5 \| — \| \| 87 \| a Couleurs à l'huile \| 100 ocq. \| 140 \| 70 \| \| \| b Couleurs à l'eau \| 100 \| 35 \| 14 \| \| \| c Vernis à l'alcool, à l'huile, ou à l'essence de térbenthine \| 100 \| 2 \| 105 \| \| 88 \| a Cirage pour cuir, chaussures et parquets \| 100 \| 105 \| 70 \| \| 89 \| a Toutes autres couleurs terreuses ou minérales à l'état solide telles que minium, ceruse, litharge, sulfate de baryum \| 100 \| 14 \| 7 \| \| \| b Couleurs autres, végétales ou animales, non dénommées \| 100 \| 40 \| — \| \| 90 \| Parfumerie à l'alcool ou à l'eau, vinaigres, pom-mades, huiles, savons, poudres, pâtes pour usages divers (tous ces produits aromatiques), plantes et bois de senteur, parfum en sachets de tissus divers, fards, pâte de perles carbonées, poudre et autres articles de toilette sous n'importe quelle forme \| l'ocq. \| 5 \| 250 \| \| 95 \| Colle de poisson ordinaire, celle de peaux, colle d'os et colles autres de toute espèce liquides ou solides \| 100 ocq. \| 40 \| — \| \| 98 \| a Cire à cacheter \| 100 \| 120 \| — \| \| \| b Cire en pains, en plaques ou en masses pour cacheter les bouteilles \| 100 \| 20 \| — \| \| 102 \| a Encre à écrire ou à dessiner, liquide \| 100 \| 70 \| 28 \| \| \| b Encre à écrire ou à dessiner, en poudre ou en tablettes \| 100 \| 140 \| 105 \| \| \| c Encres grasses typographiques ou lithographiques \| 100 \| 56 \| 21 \| \| 103 \| a Carbonate de potasse, carbonate de soude, soude caustique pour la fabrication du savon et du verre, nitrate de potasse (nitre), chlorate de potasse ou de soude pour la fabrication de la poudre, chlorure de potassium, chlorure de chaux, sulfure \| \| Sazební číslo \| Odstavec \| Zboží \| Váha či míra \| Clu v kovov. peněz. všeob. \| smluvně \| \|---------------\|----------\|-------\|--------------\|---------------------------\|---------\| \| 80 \| Oleje prchavé (silice) \| 1 oka \| 5 \| — \| \| 87 \| a Barvy olejové \| 100 \| 140 \| 70 \| \| \| b Barvy vodové \| 100 \| 35 \| 14 \| \| \| c Fermež s lihem nebo s olejem nebo s terpentinem \| 100 \| 210 \| 105 \| \| 88 \| a Leštido na kůži, obuv a parkety \| 100 \| 105 \| 70 \| \| 89 \| a Všechny ostatní barvy zemité a minerální v pevném stavu, jako mium, bělčba zinková a olověná, sírnik barnatý \| 100 \| 14 \| 7 \| \| 89 \| b Barvy jiné, původu rostlinného či zvířecího zvláště nejmenované \| 100 \| 40 \| — \| \| 90 \| Voňavky lihové neb vodové, octy, pomády, oleje, mydla, pudry, krémy k různému užití (všechny tyto výrobky aromatické), voňavé byliny a voňavá dřeva, voňavky v obálkách (sachets) z libovolných tkanin, lišidla, perlový krém, prášky a jiné předměty toletní v jakékoliv formě \| 1 \| 5 \| 250 \| \| 95 \| a Klih rybí obyčejný, klih z kůže, kostí a jiné klihy všeho druhu tektuté nebo pevné \| 100 \| 40 \| — \| \| 98 \| a Pečetní vosk \| 100 \| 120 \| — \| \| 98 \| b Vosk v koulích, deskách nebo kusech, k pečetění lahvi \| 100 \| 20 \| — \| \| 102 \| a Inkoust ku psaní nebo kreslení, tektutý \| 100 \| 70 \| 28 \| \| 102 \| b Inkoust ku psaní nebo kreslení v prášku nebo v tabletách \| 100 \| 140 \| 105 \| \| 102 \| c Mastné barvy typografické nebo litografické \| 100 \| 56 \| 21 \| \| 103 \| a Uhličitan draselný, sodný, žíravé draslo k výrobě mýdla a skla, dusičnan draselný (salyntr), chlorečnan draselný nebo sodný k výrobě střelného prachu, chlorid draselný, chlorové vápno, sirouhlík, olejn, modrá skalice, jakož i chemické \| \| No. du tariff \| Alinéas \| Poids ou mesures \| Droit en espèce métallique général \| convent. \| \|---------------\|---------\|-----------------\|----------------------------------\|----------\| \| 103 \| a \| de carbone, oléine et sulfate de cuivre ainsi que préparations chimiques composées de sulfate de cuivre et d'autres matières destinées à combattre le peronosporae (mildiou) \| 100 oeq. exempts — \| \| \| c \| Acides purs, c'est à dire acide sulfurique, acide chlorhydrique, acide nitrique, acide phénique et autres analogues ainsi que tous produits chimiques non dénommés \| 100 „ 20 10 \| \| \| d \| Acides impurs, dits du commerce \| 100 „ 10 exempts \| \| 106 \| a \| Lait concentré, farine lactée avec ou sans sucre \| 100 „ 100 35 \| \| 115 \| a \| Brodequins et souliers de tout genre en cuir pour hommes \| l'ocque 10 — \| \| 116 \| a \| Chaussures pour femmes et enfants de tout genre en cuir ou tissus \| 20 — \| \| 127 \| — \| Petits articles (bimboleries) en os, en corne, simples, sculptés ou ornés ainsi que ceux en os artificiel, en celluloid, gluten ou caséine \| 10 6 \| \| 130 \| c \| Cadres et baguettes pour cadres non p'âtres: 1. colorés ou vernis 2. dorés ou argentés ou vernis avec poudre métallique \| 100 oeq. 120 100 200 160 \| \| \| \| Plâtrés: 1. colorés, or vernis 2. argentés ou dorés ou vernis avec poudre métallique \| 100 „ 280 200 300 250 \| \| 131 \| — \| Jouets d'enfants en bois l'ocque \| 5 — \| \| 135 \| d \| Chaises en canne naturelle ou en bois rond \| 100 oeq. 150 — \| \| 187 \| a \| Sucre de betteraves, de canne, de raisin et de féculé, de tout genre et de toute densité ainsi que ses sirops \| 100 „ 70 42 \| \| 146 \| Bière: \| a en fûts ou autres récipients b en bouteilles de toute capacité \| 100 „ 110 85 140 110 \| \| Sazební číslo \| Odstavec \| Zboží \| Váha či míra \| Clo v kovov. použ. všeob. smluvní \| \|---------------\|----------\|-------\|--------------\|-----------------------------------\| \| 103 \| a \| preparáty složené z modré skaltice a jiných látek, sloužících k potírání peronosporae \| 100 oka beze cla — \| \| 103 \| c \| Kyseliny čisté, to jest kyselina sírová, kyselina solná, kyselina dusičná, kyselina karbolová a jiné kyseliny analogické, jakož i všechy ostatní chemické výrobky, zvláště nejmenované \| 100 „ 20 10 \| \| 103 \| d \| Kyseliny nečisté, tak zv. obchodní \| 100 „ 10 beze cla \| \| 106 \| a \| Mléko kondensované, v prášku s cukrem nebo bez cukru \| 100 „ 100 35 \| \| 115 \| a \| Polobotky a střevíce všeho druhu, kožené pro muže \| 1 „ 10 — \| \| 116 \| a \| Obuv pro ženy a děti, kožená nebo látková všeho druhu \| 1 „ 20 — \| \| 127 \| — \| Zboží galanterní z kosti, z rohoviny hladké, vyřezávané nebo zdobené, jakož i z kosti umělé, celuloidu, galalitu a kaseinu \| 1 „ 10 6 \| \| 130 \| c \| Rámy a lišty na rámy nezádrované: 1. barvené nebo pokostované 2. zlečené nebo stříbrné, nebo pokostované kovovým práškem \| 100 „ 120 100 200 160 \| \| \| \| Sádrované: 1. barvené nebo pokostované 2. stříbrné nebo zlacené, nebo pokostované kovovým práškem \| 100 „ 260 200 300 250 \| \| 131 \| — \| Dětské dřevěné hračky \| 1 „ 5 — \| \| 135 \| d \| Židle z přírodního rákosu nebo z ohýbaného dřeva \| 100 „ 150 — \| \| 187 \| a \| Cukr řepný, třtinový, hroznový a škrobový všeho druhu a jakékoliv hustoty, jakož i syrupy z nich \| 100 „ 70 42 \| \| 146 \| Pivo: \| a v sudech nebo jiných nádobách b v lahvičkách jakéhokoliv obsahu \| 100 „ 110 85 140 110 \| \| No. du tarif \| Alineas \| Poids ou mesures \| Droit en espèce métallique général/convent. \| Sazební číslo \| Odstavec \| Zboží \| Váha či míra \| Cło v kovov. peněz. všeob. \| cło můra \| \|-------------\|---------\|-----------------\|------------------------------------------\|--------------\|---------\|--------\|-------------\|---------------------------\|----------\| \| 148 \| Note. L'alcool titrant plus de 92° centésimaux destiné à l'éclairage ou au chauffage après dénaturation et importé conformément aux dispositions de la loi relative à la taxe sur l'alcool, est exempt du droit d'importation ainsi que de toute taxe ou de tout impôt de port, municipal ou local. 100 oeq exempts \| \| \| 148 \| \| Poznámka: Denaturovaný líh obsahující více než 92 objemových stupňů, určený po denaturaci ke svícení nebo topení a dovážený dle ustanovení zákona o dani z líhu, jest osvobozen od dovozního cla, jakož i od poplatků a daní přistavních, obecních nebo místních ... 100 oka beze cla \| \| \| \| 149 \| a Liqueurs de toute sorte ... 100 „ 350 175 \| \| \| 149 \| a \| Likéry všeho druhu ... 100 „ 350 175 \| \| \| \| 159 \| a Tissus composés de fils teints, imprimés ou teints à l'huile, non spécialement dénommés ... 100 „ 800 120 \| \| \| 159 \| a \| Tkaniny s příze barevné, potištěné nebo napouštěné olejovou barvou, zvláště nejmenované ... 100 „ 300 120 \| \| \| \| 162 \| a Tissus veloutés (tissus façon velours, peluche), crétonne, satins, piqués l'ocque 3 2 \| \| \| 162 \| a \| Tkaniny sametové (tkaniny po způsobu sametu, plyšů), kreton, satin, piqué ... 1 „ 3 2 \| \| \| \| \| b Jarretières, rubans, franges simples, tissus pour rideaux, mousselines (sankoulia) indiennes, espagnoles, pompadour, indiennes ayant plus de 56 fils, rubans pour ornements de tête (tsemperia), bas etc, coupures de tissus de coton, à l'exception du madapolan ... , 5 2:10 \| \| \| 162 \| b \| Podvazky, stuhy, třásně prosté, záclonové látky, mušeliny (sankulia) indické, španělské, pompadour, perkal (indický) s více než 56 nitmi, stuhy k ozdobě hlavy (tsemperia), punchochy atd., zbytky bavlněných tkanin s výjimkou madapolanu ... 1 „ 5 2:10 \| \| \| \| 210 \| b Chapeaux bas pour hommes et enfants ... la pièce 4 2:50 \| \| \| 210 \| b \| Klobouky pro muže a děti kus 4 2:50 \| \| \| \| 223 \| a Tous articles en terre cuite non vernissés ... 100 oeq. 3 — \| \| \| 223 \| a \| Veškeré zboží z pálené hlíny nepoléváne ... 100 oka 3 — \| \| \| \| \| c Carreaux plats ainsi que carreaux artistiques comprimés pour le revêtement des façades ... le mille 50 — \| \| \| 223 \| c \| Dlaždice ploché, jakož i lisované umělecké dlaždice na fasády ... 1000 kusů 50 — \| \| \| \| \| d Briques en ciment en tout ou en partie, vernissées ou non, colorées ou non et carreaux en terre cuite pour dallage 100 oeq. 6 — \| \| \| 223 \| d \| Cihly částečně nebo úplně cementové, polévané nebo nepoléváne, barvené nebo nebarvené a dlaždice z pálené hlíny ... 100 oka 6 — \| \| \| \| \| e Briques réfractaires ... 100 „ exempts — \| \| \| 223 \| e \| Ohnivzdorné cihly ... 100 „ beze cla — \| \| \| \| 224 \| — Tous objets en terre cuite vernissés ou émaillés d'une seule couleur ... 100 „ 14 5:60 \| \| \| 224 \| — \| Všechny předměty z pálené hlíny polévané nebo emailované, jednobarevné ... 100 „ 14 5:60 \| \| \| \| 225 \| — Les mêmes de différentes couleurs ... 100 „ 21 12:60 \| \| \| 225 \| — \| Tytéž různobarevné ... 100 „ 21 12:60 \| \| \| \| 236 \| Verres à glaces pour devantures ou autres usages polis ou non: \| \| \| 236 \| \| Zrcadlové sklo pro výklady a jiné účely, lesiténé či nelesiténé: \| \| \| \| \| a non biseautés ... 100 „ 80 60 \| \| \| 236 \| a \| nebroušené ... 100 „ 80 60 \| \| \| \| \| b biseautés ... 100 „ 120 100 \| \| \| 236 \| b \| broušené ... 100 „ 120 100 \| \| \| \| No. du tarif \| Alineas \| Poids ou mesures \| Droit en espèce métallique général convenu. \| Sazební číslo \| Odstavec \| Zboží \| Váha či měra \| Cló v kovov. použ. všeho i smluvní \| \|-------------\|---------\|-----------------\|------------------------------------------\|---------------\|---------\|--------\|-------------\|-------------------------------\| \| 244 \| \| \| Tous objets en fer forgé, en tôle ou en fer blanc, pour construction, chemins de fer et autres usages (à l'exception de machines, des instruments agricoles, des appareils scientifiques et des articles servant aux navires et à leur construction), limés ou non, étamés ou non, goudronnés ou non, vernis ou non, que le vernis contienne de la poudre métallique ou non \| 100 oeq. \| 40 \| 25 \| \| \| \| 245 \| \| \| Les mêmes, polis ou brunis, dorés ou galvanisés; clous, vis et pointes de toute sorte, polis ou dorés \| 100 \| 50 \| 50 \| \| \| \| 249 \| \| \| Instruments et outils agricoles \| 100 \| exempts \| exempts \| \| \| \| 252 a \| \| \| Pompes aspirantes ou foulantes, pompes à incendie en métal quelconque, machines agricoles et industrielles et leurs pièces détachées \| 100 \| exempts \| exempts \| \| \| \| 260 a \| \| \| Tous articles en acier non dénommés \| 100 \| 50 \| 50 \| \| \| \| 261 a \| \| \| Articles en acier fin \| 100 \| 200 \| \| \| \| \| 261 b \| \| \| Aiguilles à coudre sans déduction de tare pour les enveloppes et les boîtes \| l'ocque \| 2 \| 2 \| \| \| \| 265 a \| \| \| Jouets d'enfants en plomb \| 5 \| \| \| \| \| \| 298 \| \| \| Papier pour toiture, papier de verre ou d'émeri et papier goudronné \| exempts \| \| \| \| \| \| 300 \| \| \| Papier à imprimer: a glacé ou non \| 100 oeq. \| 60 \| 30 \| \| \| \| \| \| \| b commun non glacé, destiné exclusivement à l'impression des journaux \| 100 \| exempts \| \| \| \| \| 301 \| \| \| Papier à lettres, de tout format, papier parchemin et papier de teinture \| 100 \| 200 \| 100 \| \| \| \| 303 \| \| \| Papier à écrire de toute couleur: a non glacé \| 100 \| 50 \| 30 \| \| \| \| \| \| \| b glacé \| 100 \| 56 \| 30 \| \| \| \| 244 \| \| \| Všechny předměty z kujného železa, z plechu železného nebo bílého, ke stavbě, pro železnice nebo k jinému užití (s výjimkou strojů, hospodářských strojů, přístrojů vědeckých a předmětů pro plavidla a pro zhotovení plavidel), pilované nebo nepilované, činované nebo necinované, natřené dehtem nebo bez nátěru, pokostované nebo nepokostované, ať pokost obsahuje kovový prášek či nikoliv \| 100 oka \| 40 \| 25 \| \| \| \| 245 \| \| \| Tytéž předměty hlazené nebo leštěné, zlacené nebo galvanizované, hřeby, šrouby a hroty všeho druhu, hlazené nebo zlacené \| 100 \| 50 \| 50 \| \| \| \| 249 \| \| \| Nástroje a přístroje zemědělské \| 100 \| beze cla \| beze cla \| \| \| \| 252 a \| \| \| Pumpy nasávající nebo na tlak, požární stříkačky z jakéhokoliv kovu; stroje hospodářské a průmyslové a jich součástky \| 100 \| beze cla \| beze cla \| \| \| \| 260 a \| \| \| Všechny ocelové předměty zvláště nejmennované \| 100 \| 50 \| 50 \| \| \| \| 261 a \| \| \| Předměty z jemné oceli \| 100 \| 200 \| \| \| \| \| 261 b \| \| \| Jehly šicí, bez srážky tary na obálky a krabičky \| 1 \| 2 \| 2 \| \| \| \| 285 \| \| \| Dětské hračky olověné \| 1 \| 5 \| \| \| \| \| 298 \| \| \| Krycí lepenka, papír skelný nebo smirkový a papír dehtovaný \| beze cla \| \| \| \| \| \| 300 \| \| \| Papír pro tisk: a hlazený nebo nehlazený \| 100 \| 60 \| 30 \| \| \| \| \| \| \| b obyčejný nehlazený, určený výhradně k tisku novin \| 100 \| beze cla \| \| \| \| \| 301 \| \| \| Papír dopisní jakéhokoliv formátu, papír pergamenový a papírové čalouny \| 100 \| 200 \| 100 \| \| \| \| 303 \| \| \| Papír na psaní ve všech barvách: a nehlazený \| 100 \| 50 \| 30 \| \| \| \| \| \| \| b hlazený \| 100 \| 56 \| 30 \| \| \| \| No. du tarif \| Alineas \| Poids ou mesures \| Droit en espèce métallique général \| Zboží \| Váha či míra \| \|-------------\|---------\|-----------------\|----------------------------------\|-------\|--------------\| \| 304 \| b \| Papier buvard foncé, papier d'emballage pour fils et autres marchandises gris ou bleu, satiné ou non; papier canevas ainsi que le papier fin pour envelopper les citrons, les oranges, ou autres fruits transparent et poreux, dans lequel on peut constater à l'œil les irrégularités de la masse et les pores, sans filigranes du papier à cigarettes \| 100 oeq. \| 56 80 \| \| 319A (i) \| \| Velocipèdes ordinaires, montés ou non \| pièce \| 21 14 \| \| \| k (ia) \| Motocyclettes montées ou non \| pièce \| 42 31:50 \| \| \| l (iB) \| Parties de velocipèdes dénommées sous l'alinea (i), k (ia) importées séparément \| 100 oeq. \| 105 59:50 \| \| 319B \| \| Voitures automobiles pour voies carrossables: \| \| \| \| \| a \| Camions \| 100 \| 21 10:50 \| \| \| Note \| Le montant de ce droit ne pourra jamais dépasser Drachmes papier 275 par camion. \| \| \| \| \| b \| Remorques pour les camions susmentionnés ad valor \| 20% 10% \| \| \| c \| Autobus \| 100 oeq. \| 21 10:50 \| \| \| d \| Voitures automobiles ordinaires pesant jusqu'à 600 kilogr. \| 100 " \| 56 28 \| \| \| e \| Les mêmes pesant plus de 600 kilogr. \| 100 " \| 70 38:50 \| \| 319 Ce \| \| Chambres à air et parties d'automobiles non dénommées ailleurs \| 100 " \| 250 200 \| \| 322 d \| \| Objets divers en écume de mer \| l' oeq. \| 20 - \| \| 325 c \| \| Pièces, plaques, rubans, barres, tuyaux etc. en caoutchouc et en gutta-percha mélangé ou non d'autres matières et bords de chapeaux en coton gommé \| 100 oeq. \| 196 98 \| \| 329 a \| \| Petits miroirs à l'usage des soldats et des paysans, en bois ordinaire, laiton ou autre métal commun, ou en carton \| 100 " \| 100 - \| \| Sazební číslo \| Odstavec \| Zboží \| Váha či míra \| \|---------------\|----------\|-------\|--------------\| \| 304 \| b \| Ssačí papír tmavý, balící papír k balení příze a jiného zboží, šedý nebo modrý, satinovaný nebo nesatinovaný, papír kanevový, jakož i hedvábný papír k balení citronů, pomerančů a jiného ovoce, průhledný, porovitý, v němž možno pouhým okem zjistit nepravidelnosti papíroviny a pory, bez vodových znaků papíru cigaretového \| 100 oka \| 56 30 \| \| 319A (i) \| \| Velocipedy obyčejné, úplné nebo rozložené \| kus \| 21 14 \| \| \| k (ia) \| Motorová kola úplná nebo rozložená \| kus \| 42 31:50 \| \| \| l (iB) \| Součástky velocipedů vyjmenované v odstavci (i), k (ia) dovážené odděleně \| 100 oka \| 105 59:50 \| \| 319B \| \| Automobily: \| \| \| \| \| a \| nákladní \| 100 " \| 21 10:50 \| \| \| Poznámka: Clo nesmí nikdy převyšovat 275 papírových drachm za jeden nákladní automobil. \| \| \| \| \| b \| Vlečné vozy k nákladním automobilům shora jmenovaným \| ad valor \| 20% 10% \| \| \| c \| Autobusy \| 100 oka \| 21 10:50 \| \| \| d \| Automobily obyčejné až do váhy 600 kg \| 100 " \| 56 28 \| \| \| e \| Tytéž vážící více než 600 kg \| 100 " \| 70 38:50 \| \| 319 Ce \| \| Duše do pneumatik a části automobilů jinde nevyjmenované \| 100 " \| 250 200 \| \| 322 d \| \| Různé předměty z mořské pěny \| 1 " \| 20 - \| \| 325 c \| \| Kusy, desky, stuhy, tyče, roury atd., z kaučuku a gutaperčí čistých nebo ve spojení s jinými látkami a střísky klobouků z klížené bavlny \| 100 " \| 196 98 \| \| 329 a \| \| Zrcádka pro vojáky a venkovany v obyčejném dřevě, mosazi nebo i jiném obyčejném kovu, nebo v lepence \| 100 " \| 100 - \| \| No. du tarif \| Alineas \| Poids ou mesures \| Droit en espèce métallique général \| convention \| \|--------------\|---------\|-----------------\|----------------------------------\|------------\| \| 329 \| b \| Miroirs de toute sorte, autres que ceux dénommés sous l'alinéa a) et sous le No. 330 \| 100 ocaq. 200 \| — \| \| 330 \| — \| Glaces avec ou sans cadre, de 50 c/m carrés et plus \| 100 „ 300 \| — \| \| 332 \| b \| Toile cirée pour planchers \| 100 „ 30 \| — \| \| 333 \| a \| Boutons en ivoire ou en nacre \| l'ocaq. 5 \| — \| \| 333 \| b \| Boutons en os, corne, porcelaine, papier mâché, bois, verre ou de ces matières combinées avec un métal commun \| „ 1 1 \| — \| \| 333 \| c \| Boutons en soie, laine ou calucande \| „ 4 \| — \| \| 333 \| d \| Boutons de toute espèce non dénommés \| „ 2 \| — \| \| 340 \| a \| Douilles \| mille 40 \| — \| \| 340 \| b \| Cartouches de toute sorte, chargées non soumises au droit de consommation sur la poudre \| „ 40 \| — \| \| 354 \| — \| Poupées habillées \| l'ocaq. 10 \| — \| \| 358 \| — \| Jouets autres que ceux en bois ou en papier et jouets en métaux communs autres qu'en plomb \| „ 5 \| — \| A. A. m. p. Ch. M. m. p. \| Sazební číslo \| Odstavec \| Zboží \| Váha či míra \| Cenová smluvní \| \|---------------\|----------\|-------\|--------------\|----------------\| \| 329 \| b \| Zrcadla všeho druhu mimo jmenovaná v odstavci a) a pod položkou 330 \| 100 oka 200 \| — \| \| 330 \| — \| Zrcadla rámovaná nebo nerámovaná o velikosti ½ čtverečního metru a více \| 100 „ 300 \| — \| \| 332 \| b \| Voskované plátno na podlahu \| 100 „ 30 \| — \| \| 333 \| a \| Knoflíky ze slonoviny a perleti \| 1 „ 5 \| — \| \| 333 \| b \| Knoflíky koštěné, rohové, porculánové, z papíroviny, ze dřeva, ze skla nebo z těchto hmot, spojených s obyčejným kovem \| 1 „ 1 1 \| — \| \| 333 \| c \| Knoflíky z hedvábí, vlny nebo lastingu \| 1 „ 4 \| — \| \| 333 \| d \| Knoflíky všech druhů, zvláště nejménované \| 1 „ 2 \| — \| \| 340 \| a \| Nábojové dutinky \| za tisíc 40 \| — \| \| 340 \| b \| Patrony ostré všeho druhu, nepodléhající spotřební daní z prachu \| „ 40 \| — \| \| 354 \| — \| Loutky obléčené \| 1 oka 10 \| — \| \| 358 \| — \| Hračky jiné než dřevěné, nebo papírové a hračky z obyčejných kovů jiných než z olova \| 1 „ 5 \| — \| A. A. v. r. K. M. v. r.	ce9df4bf-152d-4179-8253-4e1b427f206e	HuggingFaceFW/finepdfs/tree/main/data/ces_Latn/train	finepdfs	ces_Latn	35,678
ISTITUTO TECNICO STATALE "CESARE BATTISTI" REGOLAMENTI ASSEMBLEE DI ISTITUTO PREMESSA Le assemblee sono "occasione di partecipazione democratica per l'approfondimento dei problemi della scuola e della società in funzione della formazione culturale e civile degli studenti". Possono essere di classe o di istituto. È consentito lo svolgimento di una assemblea di istituto ed una di classe al mese nel limite, la prima coincidente, al massimo, con le ore di lezione di una giornata scolastica e, la seconda, di due ore. L'assemblea di istituto deve darsi un Regolamento per il proprio funzionamento. Alle assemblee di istituto svolte durante l'orario delle lezioni può essere autorizzata la partecipazione di esperti di problemi sociali, culturali, artistici e scientifici, su proposta degli studenti unitamente agli argomenti da inserire nell'ordine del giorno. Il Dirigente scolastico ha potere di intervento e di interruzione delle assemblee nel caso di violazione del regolamento o in caso di constatata impossibilità di ordinato svolgimento dell'assemblea stessa, nonché di partecipazione di esperti esterni non preventivamente autorizzati. Riferimenti normativi Decreto del Presidente della Repubblica n. 416 del 1974 Decreto legislativo n,. 297/1994, artt. 12, 13, 14 Circolare ministeriale 312/1979, par. I REGOLAMENTO ASSEMBLEE DI ISTITUTO ITS CESARE BATTISTI DI SALO' ART.1 Numero delle assemblee L'assemblea d'Istituto può svolgersi una volta al mese, in orario curricolare e nel limite delle ore di lezione di una giornata scolastica; è tuttavia escluso che si possano tenere assemblee durante il primo o l'ultimo mese dell'anno scolastico. L'assemblea non può essere tenuta sempre nello stesso giorno della settimana durante l'anno scolastico. ART.2 Convocazione L'assemblea d'Istituto è convocata su richiesta della maggioranza del Comitato studentesco o su richiesta del 10% degli studenti (art. 14, comma 2,del D.Lgs. n. 297/94). Il calendario annuale delle assemblee d'Istituto è proposto dal comitato studentesco, per iscritto, al Dirigente Scolastico o ad un suo delegato, ad inizio anno scolastico, possibilmente entro il mese di novembre. La richiesta singola ISTITUTO TECNICO STATALE "CESARE BATTISTI" REGOLAMENTI mensile con la programmazione delle attività, con le indicazioni degli argomenti all'ordine del giorno, della data e dell'orario d'inizio e fine all'assemblea, deve essere presentata dai rappresentanti d'Istituto al Dirigente scolastico o ad un suo delegato almeno quindici giorni prima. Il Dirigente scolastico verificata la rispondenza degli argomenti all'ordine del giorno con le finalità previste dalla normativa, se necessario, concorda una diversa data dell'assemblea studentesca. Il Dirigente informa, della stessa, il personale docente, gli studenti e le famiglie, tramite circolare scolastica. Nel caso in cui l'assemblea si svolga in luoghi esterni all'area dell'Istituto, gli studenti partecipanti devono portare, entro cinque giorni precedenti all'assemblea, l'autorizzazione o la non autorizzazione alla partecipazione, firmata da un genitore o da chi ha la rappresentanza legale o l'affido del minore. Tale autorizzazione sarà firmata dagli alunni maggiorenni e avrà valore informativo per la famiglia. Il docente coordinatore della classe raccoglierà le autorizzazioni e le consegnerà in segreteria studenti almeno quattro giorni prima dell'assemblea. In vista dei rinnovi delle elezioni per il Consiglio d'Istituto e per la Consulta provinciale, l'assemblea d'Istituto immediatamente precedente la data di quelle elezioni dovrà avere all'Ordine del giorno la presentazione delle liste degli studenti che si candidano a svolgere le funzioni di rappresentanti studenteschi in quegli organi: tale assemblea è convocata dal Dirigente scolastico su richiesta degli studenti come sopra. ART.3 Svolgimento L'assemblea è coordinata dai rappresentanti d'Istituto, che ne curano l'organizzazione. I rappresentanti di Istituto nominano un gruppo di studenti con funzione di vigilanza, nonché studenti aventi mansioni diverse in base al programma e all'organizzazione delle singole assemblee. L'assemblea può essere utilizzata per lo svolgimento di attività di ricerca, di seminario o per gruppi di lavoro (art. 13, comma 7, del D.Lgs. n. 297/94); può avere come finalità l'approfondimento dei problemi della scuola e della società in funzione della formazione culturale e civile degli studenti, può attivare anche laboratori artistici, culturali, sportivi, nonché attività con scopi di carattere sociale e ambientale. Lo svolgimento dei lavori deve essere improntato al rispetto reciproco e deve favorire un confronto civile e democratico delle idee. I partecipanti non possono uscire dagli spazi in cui si svolge l'assemblea. Durante la stessa, gli studenti mantengono un comportamento corretto, non chiassoso, né di continuo movimento nel rispetto del programma delle attività dell'assemblea presentato al Dirigente scolastico. Al termine dell'assemblea il gruppo adibito alla vigilanza provvede a controllare che l'aula magna od altro locale comune utilizzato non abbia subito danneggiamenti e che non sia lasciato in condizioni di sporcizia o di degrado, provvedendo all'eventuale riordino. In caso di riscontri negativi informa dell'accaduto il Dirigente scolastico per l'adozione di adeguati provvedimenti. ISTITUTO TECNICO STATALE "CESARE BATTISTI" REGOLAMENTI Nelle assemblee d'Istituto si applica quanto disposto dal comma 8 dell'art. 13 del D.Lgs. n. 297/94, relativo al diritto del Dirigente scolastico, o di un suo delegato, e degli insegnanti che lo desiderino di poter assistere all'assemblea. Il Dirigente scolastico ha potere di intervento d di interruzione dell'assemblea, nel caso di violazione del regolamento o in caso di constatata impossibilità di ordinato svolgimento dell'assemblea stessa (art. 14, comma 5, del D.Lgs. n. 297/94), nonché nel caso di partecipazione di esperti esterni non preventivamente autorizzati. ART.4 Partecipazione di esperti Alle assemblee d'Istituto svolte durante l'orario delle lezioni, può essere richiesta la partecipazione di esperti di problemi sociali, culturali, artistici e scientifici, su proposta degli studenti unitamente agli argomenti da inserire nell'ordine del giorno. Gli studenti dovranno allegare alla richiesta dell'assemblea di Istituto il curriculum vitae dell'esperto. La partecipazione di tutti gli esperti esterni deve essere preventivamente autorizzata dalla Dirigenza. ART.5 Verbale Il verbale redatto dell'assemblea deve essere consegnato, entro cinque giorni, al Dirigente scolastico. Il verbale deve riportare: luogo, data e ora della riunione, l'ordine del giorno, il resoconto dei lavori. Il verbale deve essere completato con i nominativi degli studenti addetti alla vigilanza e con eventuali loro dichiarazioni relative ad atti di vandalismo o di mancato rispetto delle norme di sicurezza o dei regolamenti avvenuti durante l'assemblea. Il verbale è sottoscritto dal presidente dell'assemblea e dal segretario. Una copia del presente Regolamento è allegata al POFT dell'Istituto. Comitato Studentesco del …/…/20… Delibera del Consiglio di Istituto del …/…/20… ALLEGATI: MODULO PER LA RICHIESTA DELLE ASSEMBLEE DI ISTITUTO OGGETTO: RICHIESTA CONVOCAZIONE ASSEMBLEA D' ISTITUTO. I sottoscritti studenti, Rappresentanti di Istituto, ________________________________________________________________________________ ________________________________________________________________________________ CHIEDONO alla S.V. la convocazione di un'assemblea d'istituto avente per oggetto la seguente tematica: ________________________________________________________________________________ SEDE DI SVOLGIMENTO DELL'ASSEMBLEA DI ISTITUTO: ________________________________________________________________________________ DATA E ORARIO DI INIZIO E FINE DELL'ASSEMBLEA DI ISTITUTO:______________________________________________________________________ CLASSI PARTECIPANTI: _________________________________________________________ ESPERTI ESTERNI: ______________________________________________________________ PRESENTAZIONE DELLE ATTIVITA':_____________________________________________________________________ ________________________________________________________________________________ ________________________________________________________________________________ ________________________________________________________________________________ Al termine dell'Assemblea sarà redatto apposito Verbale digitale che dovrà essere inviato al Dirigente Scolastico o ad un suo delegato, entro 5 giorni dalla data dell'assemblea stessa, al seguente indirizzo mail: firstname.lastname@example.org I sottoscritti alunni si impegnano al rispetto del Regolamento delle Assemblee studentesche. Data __________________ ISTITUTO TECNICO STATALE "CESARE BATTISTI" REGOLAMENTI ISTITUTO TECNICO STATALE "CESARE BATTISTI" REGOLAMENTI Firma dei Rappresentanti di Istituto ______________________________________ ______________________________ _____________________________________ _______________________________ Il Dirigente Scolastico Valutata la richiesta del ________________________ presentata dai Rappresentanti di Istituto AUTORIZZA lo svolgimento dell'Assemblea di Istituto del _________________ con le modalità concordate. IL DIRIGENTE SCOLASTICO Prof. Gian Luca Chiodini	<urn:uuid:0aa97f77-5522-412a-ba91-4e05b2a413cc>	HuggingFaceFW/finepdfs/tree/main/data/ita_Latn/train	finepdfs	ita_Latn	9,443
Inducing and modulating anisotropic DNA bends by pseudocomplementary peptide nucleic acids Heiko Kuhn, Dmitry I. Cherny†‡, Vadim V. Demidov, and Maxim D. Frank-Kamenetskii§ Center for Advanced Biotechnology and Department of Biomedical Engineering, Boston University, 36 Cummingston Street, Boston, MA 02215; †Department of Molecular Biology, Max Planck Institute for Biophysical Chemistry, Am Fassberg 11, D-37077 Göttingen, Germany; and §Institute of Molecular Genetics, Russian Academy of Sciences, Kurchatov’s Square, Moscow, 123182 Russia Edited by Alexander Rich, Massachusetts Institute of Technology, Cambridge, MA, and approved April 7, 2004 (received for review December 31, 2003) DNA bending is significant for various DNA functions in the cell. Here, we demonstrate that pseudocomplementary peptide nucleic acids (pcPNAs) represent a class of versatile, sequence-specific DNA-bending agents. The occurrence of anisotropic DNA bends induced by pcPNAs is shown by gel electrophoretic phasing analysis. The magnitude of DNA bending is determined by circular permutation assay and by electron microscopy, with good agreement of calculated mean values between both methods. Binding of a pair of 10-meric pcPNAs to its target DNA sequence results in moderate DNA bending with a mean value of 40–45°, while binding of one self-pc 8-mer PNA to target DNA yields a somewhat larger average value of the induced DNA bend. Both bends are found to be in phase when the pcPNA target sites are separated by distances of half-integer numbers of helical turns of regular duplex DNA, resulting in an enhanced DNA bend with an average value in the range of 80–90°. The occurrence of such a sharp bend within the DNA double helix is confirmed and exploited through efficient formation of 170-bp-long DNA minicircles by means of dimerization of two bent DNA fragments. The pcPNAs offer two main advantages over previously designed classes of nonnatural DNA-bending agents: they have very mild sequence limitations while targeting duplex DNA and they can easily be designed for a chosen target sequence, because their binding obeys the principle of complementarity. We conclude that pcPNAs are promising tools for inducing bends in DNA at virtually any chosen site. Intrinsic or induced DNA bending plays an important role in various biological processes such as transcription, replication, recombination, DNA packaging, and repair (1–6). It has therefore been recognized that biological functions relying on DNA bending may be influenced by nonnatural DNA-bending agents (7–11). So far, two classes of artificial DNA-bending agents have been investigated: tethered triple-helix-forming oligonucleotides (7–9) and six-zinc-finger peptides (10, 11). In both classes, two DNA-binding domains are connected by a linker and targeted to two separated sites in double-stranded DNA (dsDNA), thus inducing bending at the intervening region. Whereas tethered triplex-forming oligonucleotides can easily be designed, they suffer from severe sequence limitations because they require the presence of two ≥15-bp-long homopurine-homopyrimidine (hpyr) tracts, located not far from each other in the target DNA. On the other hand, the design of artificial DNA-binding peptides such as the reported six-zinc-finger peptides is not straightforward and may require a selection process starting with a pool of peptides for any chosen DNA target sequence (12). Thus, a DNA-binding ligand capable of sequence-specific recognition and bending of DNA, which could easily be designed for a chosen DNA target sequence, would be of great interest. Certain types of peptide nucleic acids (PNAs) are known to bind complementary target sites in dsDNA sequence-specifically through invasion of the double helix (13–23). Of those types, however, only hpvrPNAs and pseudocomplementary (pc)PNAs form stable PNA–dsDNA complexes and thus are of practical value as functional tools. Along with ordinary guanines and cytosines, pcPNAs carry 2,6-diaminopurines (D) and 2-thiouracils (U) instead of adenines and thymines, respectively (Fig. 1A). Lohse et al. (17) and Demidov et al. (20) showed that corresponding pairs of pcPNAs recognize their natural A-T or G-C counterpart, but form unstable duplexes with one another due to steric interference (see Fig. 1B). As a result, stable double-duplex invasion complexes (Fig. 1C) are formed when a pair of pcPNAs is added to dsDNA carrying the target sequence (17, 20). For hpvrPNAs as well as pcPNAs, the corresponding invasion complexes with dsDNA show a reduced electrophoretic mobility compared with uncomplexed DNA, which may be caused by directional (anisotropic) or nondirectional (isotropic) deviations from the DNA helix axis. The former is usually referred to as DNA bending, whereas the latter is commonly designated as increased flexibility. Earlier data with hpvrPNAs suggested that triplex invasion complexes do not cause anisotropic DNA bending (24), whereas recent results with pcPNAs have indicated that these ligands induce a directional DNA bend (25). However, a study analyzing the nature and degree of the DNA curvature induced by either type of PNA has been lacking. Because pcPNAs, unlike hpvrPNAs, provide with essentially sequence-unrestricted targeting of dsDNA, we have chosen to investigate DNA bending by this class of PNA. By using gel electrophoretic methods in combination with electron microscopy (EM), we now provide clear evidences that pcPNAs induce bending of the DNA molecule in only one direction. We show that the degree of bending can be significantly increased by targeting two closely located sites of duplex DNA with pcPNAs. We therefore demonstrate that pcPNAs represent a very promising class of DNA-bending ligands. Because pcPNAs produce substantial directional bends in a highly sequence-specific manner and allow DNA targeting with very mild sequence restrictions, they are much superior to previously proposed DNA-bending ligands. Materials and Methods pcPNAs. The following pcPNAs carrying 5′U and D were used: I, H-K$_2$-5′UUGD$^$UCDD-KNH$_3$; II, H-K$_2$-5′UCDDDC$^$UGC-K-NH$_3$; III, H-GCD$^$UG-U$^$U$^$UGD-K-NH$_2$. Like other types of PNAs (15, 22), pcPNAs are tagged by lysine residues (K) at their termini to increase solubility and affinity. PNAs were synthesized, purified, and characterized as described (17). DNA. Plasmids pPA2-pPA24 used in our study are pUC19 derivatives with inserts cloned into the EcoRI/HindIII site of the This paper was submitted directly (Track II) to the PNAS office. Abbreviations: dsDNA, double-stranded DNA; hpvr, homopyrimidine; pc, pseudocomplementary; PNA, peptide nucleic acid; EM, electron microscopy; D, 2,6-diaminopurine; U, 2-thiouracil; CPA, circular permutation assay. †To whom correspondence should be addressed. E-mail: email@example.com. It should be noted that anisotropic DNA bending by increased local flexibility cannot entirely be ruled out. An anisotropic DNA bend can be static (or fixed), dynamic (or flexible), or can include both static and dynamic components. © 2004 by The National Academy of Sciences of the USA Preparation and Purification of DNA Minicircles. DNA monomer duplex, obtained after incubation of a precursor 99-bp DNA duplex with BbsI (see Supporting Text), was bound by pcPNAs, followed by incubation with 20 units of T4 DNA ligase for 6 h at 16°C in a volume of 100 μl containing 1× ligation buffer (Fermentas, Hanover, MD). Samples were then heated for 1 h at 60°C, during which pcPNAs irreversibly dissociate from their targets (see Fig. 7, which is published as supporting information on the PNAS web site), and the DNA was isolated. An aliquot of the obtained product was incubated for 2 h at 37°C with 200 units of exonuclease III in a volume of 100 μl containing 1× reaction buffer (United States Biochemical), and the DNA was isolated. For EM analysis, aliquots of exonuclease-treated samples were subjected to gel filtration chromatography (see Fig. 8, which is published as supporting information on the PNAS web site). EM and Data Analysis. Samples were diluted in a buffer containing 10 mM Na-Hepes (pH 7.5), 50 mM NaCl, and 0.1 mM EDTA to a final DNA concentration of ≈0.5 μg/ml, mounted on EM grids coated with a thin carbon film, and visualized as described (26). Angle measurements and determination of the mean value of the bending angle and its SD were based on described methods (26). Briefly, by using IMAGEJ software, we first measured the exact position of bends of the major part of molecules that had a clearly visible bend, thus verifying that bends were located at the center of the DNA fragments. We then measured the smallest angle, φ, between the tangents to the DNA arms emerging from the center of the fragment from which the bending angle, α, was calculated as $ \alpha = 180^\circ - \varphi $. Analyzing all DNA molecules for each pcPNA–DNA complex, a large number ($ n > 500 $) of bend angles was measured and converted to a cumulative distribution (normalized by $ n $) in steps of 0.18°. Mean bending angle values and standard deviations were obtained by fitting the experimental cumulative distribution to the cumulative distribution of the folded Gaussian probability density function by minimizing the Kolmogorov–Smirnov statistic using MATHEMATICA 4.2 (26). Results and Discussion Phasing Analysis. Phasing analysis is widely used to detect and analyze DNA bending and allows, under certain conditions, discrimination between anisotropic (directional) bending and increase in DNA local flexibility (27–30). We prepared a set of 251-bp-long DNA fragments that varied in the length of regular duplex DNA between two target sites for pcPNAs (Fig. 2A). Because one target site contained a palindromic sequence, only one self-pcPNA (pcPNA I) was sufficient for binding in this case, whereas for the other, nonpalindromic target sequence, a pair of pcPNAs (pcPNAs II/III) was required. If binding of pcPNAs were to induce directional DNA bends at the target sites, the electrophoretic mobility of pcPNA-bound fragments would strongly depend on the spacer length that determines the relative angle between the bends. It would be slowest when the two bends are in the same plane and direction, i.e., in phase (cis orientation), and fastest when the two bends are 180° out of phase (trans orientation). Indeed, when the DNA fragments were complexed with pcPNA I–III and resolved together with the initial free DNA by 5% nondenaturing PAGE, we observed significant sinusoidal variation in gel mobility of the pcPNA-bound DNA fragments as a function of phasing distance (Fig. 2B). The data were analyzed by plotting the relative mobility of pcPNA-bound DNA fragments as a function of spacer length between the target sites and fitting to a cosine function (Fig. 2C). Note that even for very short spacer lengths, the obtained data points lie perfectly on the cosine fit, indicating the occurrence of dsDNA throughout the spacer region. This result could be accredited to a duplex-stabilizing effect of the positively Circular Permutation Assay (CPA). This method, originally developed by Wu and Crothers (32), is based on the principle that the electrophoretic mobility of a bent DNA fragment depends on the location of the bend within the DNA fragment. We prepared a set of DNA fragments differing in the locations of the target sites for pcPNAs (schematics in Fig. 3), and bound pcPNAs to one or both target sites. As expected, the formation of pcPNA–DNA complexes resulted in significant alteration of gel mobility with maximum values at central binding locations (Fig. 3 A–D). Bend angles were then derived from second-order polynomial or cosine fits to the plots of the relative mobility of pcPNA-bound DNA fragments against the bend location (Fig. 3 E–H), by using described algorithms (33, 34). As shown in Table 1, binding of the self-pcPNA I to its DNA target resulted in a bend with a mean value of ≈70°, whereas the pcPNA pair II/III provided with a moderate bend of ≈45° on average when it was bound to the corresponding target sequence on duplex DNA. Binding of pcPNAs to both target sites resulted in an overall mean bend angle of ≈90° when the bends were in phase (16-bp spacer; complex I/II/III cis) and an overall mean bending angle of ≈50° when the bends were out of phase (10-bp spacer; complex I/II/III trans). The quantitation is based on the assumption that the electrophoretic mobilities of probes containing two closely juxtaposed in-phase or out-of-phase bends are comparable with those probes containing single DNA bends with the bend angle being the sum or difference of the two individual bend angles. This assumption has been previously found to be approximately valid for closely spaced bends with long flanking sequences (30). It is also worth mentioning that each pcPNA–DNA complex produced only a single band on polyacrylamide gels indicating the absence of structural isomers with different electrophoretic mobility that have been observed for complexes of duplex DNA with hpyrPNAs (16, 35). The CPA has been found to overestimate bend angles because other factors such as increased DNA flexibility, direct size effects, or fractional occupancy can affect the electrophoretic migration (33, 36–38). Because pcPNAs have a low molecular weight as compared with the target DNA fragment and because pcPNA–DNA complexes are stable under the electrophoretic conditions used here, the latter two factors should not play a role in case of pcPNAs. However, an increase in DNA flexibility in pcPNA–DNA complexes cannot be ruled out. Therefore, we additionally determined bend angles by EM. Determination of Bend Angles by EM. EM allows visualization of specific DNA complexes and measurement of the extent of DNA bending (39–41). In addition, a bending angle distribution is readily obtained providing useful information about the flexibility of a specific complex (42). Visualization and angle measurements of a large number of DNA fragment molecules bound centrally with pcPNA I, pcPNAs II/III, or with all three pcPNAs revealed significant DNA bending in the middle of the fragments, as shown in the histograms and microphotographs in Fig. 4. Mean values for the EM-measured bending angles and their SD, obtained from folded Gaussian fits to the experimental data, are given in Table 1. It can be seen that pcPNA I bends the DNA axis with a mean value of 57°. A lower magnitude of 43° is obtained at binding of pcPNA pair II/III to the DNA target fragment. The complex of all three pcPNAs with both DNA target sites in cis orientation gives rise to an enhanced bend with an average of 77°. The mean bend angle values for pcPNA–DNA complexes I and I/II/III cis are 13–17° smaller in the EM measurements as compared with the values obtained by CPA, while good agreement in the magnitude of DNA bending induced by pcPNAs II/III was obtained by both methods. The tendency to slightly higher bending angle values by gel electrophoresis indicates that most probably a cumulative value was calculated by this method, --- 1Typically, an A-tract reference bend is employed in phasing analysis to determine the absolute orientation of an unknown bend at binding of a ligand to dsDNA. Due to the nature of the duplex invasion complexes, such an approach is not feasible here. consisting of a major contribution of directional DNA bending in pcPNA–DNA complexes and of a minor contribution due to increased flexibility. An increased flexibility of a specific DNA complex can also be deduced from the analysis of SD, $\sigma$, of bending angles. A value for $\sigma$ that significantly exceeds the measured value for free DNA can be explained by a higher flexibility of the complex (42). The mean value of $\sigma$ for each pcPNA–DNA complex was found to be 1–3° higher than the corresponding value for free DNA (data not shown), indicating that the complexes may have a higher flexibility. It should be noted, however, that the possible gain in DNA flexibility at binding of pcPNAs is relatively small. Therefore, it appears that anisotropic DNA bends induced by pcPNAs are predominantly responsible for the kinks seen by EM and for the retarded migration observed in polyacrylamide gels, whereas the contribution of an increased isotropic flexibility is rather small. The fact that we found the bend induced by the double-duplex invasion complex to be highly directional is hardly surprising. Indeed, two bulky DNA–PNA heteroduplexes, which include two negatively charged DNA backbones, two neutral PNA backbones, and positively charged oligolysine “tails,” are situated in a side-by-side manner within the complex (see schematics in Fig. 2A where oligolysines are omitted), and must create a very tight and strained structure. Moreover, as such a complex constitutes a distortion of the DNA duplex at the target sequence, it should be bent. The apparent extreme tightness of the double-duplex complex is emphasized by our data in Fig. 2C, according to which two double-duplex complexes separated by a DNA duplex spacer do not open the spacer up, even when it consists of only 2 bp. These properties of the double-duplex invasion complex contrast to the properties of the triplex-invasion complex formed by hpyPNAs with dsDNA, which has been extensively studied before (14, 16, 22). In fact, two triplex-invasion complexes form an extended open region even if separated by as many as 10 bp (43). Thus, significant flexibility can be expected in a triplex-invasion complex. Data by Kim et al. (24) and D.I.C. (unpublished observations) seem to support this expectation. DNA Minicircles. It is well known that the rate of ligase-mediated cyclization of “straight,” linear DNA fragments into circular products decreases dramatically below 300 bp, reaching essentially zero somewhere between 126 and 200 bp, i.e., in the size --- Table 1. Quantitative estimation of DNA bends in pcPNA–DNA complexes by CPA and EM \| Complexes \| CPA bend angle $\alpha_r$* \| EM bend angle $\alpha_r$† \| $\sigma_r$° \| \|-----------\|-----------------------------\|---------------------------\|------------\| \| I \| 70 \| 74 \| 57 \| 35 \| \| II/III \| 43 \| 46 \| 43 \| 32 \| \| I/II/III trans \| 50 \| 52 \| ND‡ \| ND‡ \| \| I/II/III cis \| 90 \| 93 \| 77 \| 38 \| Values represent means of triplicate determinations using the algorithms of Kerppola and Curran (ref. 33, left column) or of Ferrari et al. (ref. 34, right column). Errors are 1–5°. †Mean values of bending angles, $\alpha_r$ and SD, $\sigma_r$ were obtained from the folded Gaussian fit to the experimental data according to Cherny et al. (26). Numbers of complexes scored: 913 (I), 621 (II/III), and 504 (I/II/III cis). Errors for mean bend angles and SD are 2–4°. ‡ND, not determined. range of the persistence length of duplex DNA (44, 45). Thus, to date only two methods exist where DNA minicircles below 200 bp can be obtained to a significant extent: (i) ligation of fragments containing multiple phased intrinsic bends such as A-tracts and (ii) ligation of fragments associated to a DNA-binding protein that induces strong DNA bending. Hence, the introduction of a strong bend in duplex DNA by small, synthetic ligands such as pcPNAs would present a new method for the ring closure of short duplex DNA fragments, which could be performed sequence-specifically on any DNA fragment. To test this possibility, we designed a DNA fragment of 85-bp monomer length that carries two in-phase bends with an overall average value of 80–90° upon binding of pcPNAs I–III, and could be head-to-tail ligated due to complementary 5′-protruding termini (Fig. 5A). The choice of the fragment size was based on reported ring closure data of DNA duplexes containing phased A-tracts. With DNA fragments of 21-bp monomer length that contain two phased A-tracts a relatively narrow distribution of circle sizes in the range of 105–210 bp has been observed (46–48). Because those monomers have an intrinsic bend of ≈28–36°, the maximum circularization efficiency of such constructs at 147 bp corresponds to an overall bend angle of 200–250°. Therefore, we expected that the ligation reaction with the 85-bp monomer DNA fragment bound to pcPNAs I–III would lead to efficient cyclization of its dimer to 170-bp DNA minicircles, whereas the yield of circles originating from ligation of the monomer or of multimers with three or more subunits should be very limited. The formation of DNA minicircles as major products of ligation with the DNA monomer complexed with pcPNAs was first verified by means of analysis of samples by nondenaturing PAGE before and after exonuclease treatment, as shown in Fig. 5B.* Because sizes of circular DNA cannot be directly established from gel electrophoresis, the assignment of specific bands in electrophoregrams as 170- or 255-bp DNA circles was based on visualization and analysis of samples by EM (Fig. 6). The gel electrophoretic mobility of the major ligation products **Note that pcPNAs remained stably bound to DNA under the conditions employed for ligation, thereby causing different gel retardation effects with each ligamer (data not shown), so that they had to be irreversibly dissociated from their targets before analysis of ligation products could be performed. Fig. 4. Histograms showing frequencies of bending angles measured for DNA fragments 251 bp in length bound centrally by pcPNAs. Shown are results of binding to one target site (A and B) and binding to both target sites (C). Calculated mean values of bending angles and SD are given in Table 1. (Insets) Exemplary EM images of the pcPNA–DNA complexes. (Scale bars, 100 nm.) Fig. 5. Formation of DNA minicircles by means of pcPNA-induced DNA bending. (A) Schematics of the DNA monomer construct and outline of the experimental procedure. Binding sites for pcPNAs (gray areas) are separated by 5 bp. (B) Analysis of ligation products by 6% nondenaturing PAGE. Note that after ligation, the samples were heated to irreversibly dissociate pcPNAs. Black arrows show intact DNA minicircles, whereas gray arrowheads show nicked DNA minicircles. Linear DNA ligamers are assigned in the range of L2 (dimer) to L8 (octamer). a 6% polyacrylamide gel, the major ligation product (60%) of the monomer complex with pcPNAs I–III comigrated with a linear 850-bp DNA fragment, whereas its mobility was reduced to the one of a linear 1,500-bp DNA size marker in a 7% polyacrylamide gel. To prove that this product was comprised of an intact DNA minicircle, we treated it with exonuclease III. As shown in Fig. 5B, it was resistant to cleavage by exonuclease III, whereas all other products with the exception of one minor byproduct (identified by EM as trimer circles) were completely digested by this enzyme (compare lanes 1 and 2). Based on their specific gel electrophoretic mobilities, the cleaved byproducts were identified as linear ligamers L or nicked DNA circles, respectively. The exonuclease-treated sample was then further analyzed by EM. As expected, it consisted almost exclusively (>96%) of covalently closed dimer circles. The minute fraction of larger circles present in this sample was subsequently removed by gel filtration chromatography (Fig. 8A), thus yielding a homogeneous sample of intact 170-bp DNA circles (Fig. 6A). As expected, moderate bending of the DNA monomer induced by binding of pcPNAs II and III led to a wide distribution of DNA minicircles upon ligation with circular dimers and trimers as main products (Fig. 5B, lanes 3 and 4). We were able to separate the mixture of DNA circles in the exonuclease-treated sample by gel filtration chromatography into fractions containing either cyclic multimers (≥4-mers), trimers, or dimers (Fig. 8B), enabling accurate quantitation of yields of the small DNA circles and in detail analysis of ligation products by EM. A representative EM image of the fraction comprised of trimer DNA circles is shown in Fig. 6B. Control ligation reactions, performed in the absence of pcPNAs, led predominantly to linear multimers of the initial duplex (Fig. 5B, lane 5). The small quantity of DNA circles obtained after exonuclease III treatment of this sample contained mostly circles in the range between tri- and pentamers, as identified by EM (data not shown). It should be noted that the formation of DNA minicircles competes with the formation of linear ligamers at the used input concentration of monomer in the ligation reactions (49). Thus, the obtained high yield (60%) of the 170-bp DNA minicircle for the monomer bound to pcPNAs I–III is quite remarkable and confirms the presence of highly bent DNA in this complex. We thank Dr. Peter E. Nielsen (University of Copenhagen, Copenhagen) for providing PNA oligomers. This work was supported by National Institutes of Health Grant GM59173 (to M.D.F.-K.) and by a Boston University Special Program for Research Initiation Grants Award (to V.V.D.). 1. Hagerman, P. J. (1990) Annu. Rev. Biochem. 59, 755–781. 2. Sinden, R. R. (1994) DNA Structure and Function (Academic, San Diego). 3. Perez-Martin, J., Rojo, F. & de Lorenzo, V. (1994) Microbiol. Rev. 58, 268–290. 4. Muller, H. P. & Varmus, H. E. (1994) EMBO J. 13, 4704–4714. 5. Perez-Martin, J. & de Lorenzo, V. (1997) Annu. Rev. Microbiol. 51, 593–628. 6. Ohyama, T. (2001) BioEssays 23, 708–715. 7. Liberles, D. A. & Dervan, P. B. (1996) Proc. Natl. Acad. Sci. USA 93, 9510–9514. 8. Akiyama, T. & Hogan, M. E. (1996) Proc. Natl. Acad. Sci. USA 93, 12122–12127. 9. Akiyama, T. & Hogan, M. E. (1997) Biochemistry 36, 2307–2315. 10. Imanishi, M., Hori, Y., Nagaoka, M. & Sugiura, Y. (2000) Biochemistry 39, 4383–4390. 11. Imanishi, M. & Sugiura, Y. (2002) Biochemistry 41, 1328–1334. 12. Pabo, C. O., Peisach, E. & Grant, R. A. (2001) Annu. Rev. Biochem. 70, 313–340. 13. Nielsen, P. E., Egholm, M., Berg, R. H. & Buchardt, O. (1991) Science 254, 1497–1500. 14. Demidov, V. V., Yavnovich, M. V., Belotskorskiy, B. P., Frank-Kamenetskii, M. D. & Nielsen, P. E. (1995) Proc. Natl. Acad. Sci. USA 92, 2637–2641. 15. Kuhn, H., Demidov, V. V., Frank-Kamenetskii, M. D. & Nielsen, P. E. (1998) Nucleic Acids Res. 26, 582–587. 16. Kuhn, H., Demidov, V. V., Nielsen, P. E. & Frank-Kamenetskii, M. D. (1999) J. Mol. Biol. 286, 1337–1345. 17. Lohse, J., Dahl, O. & Nielsen, P. E. (1999) Proc. Natl. Acad. Sci. USA 96, 11804–11808. 18. Zhang, X., Ishihara, T. & Corey, D. R. (2000) Nucleic Acids Res. 28, 3332–3338. 19. Izvolsky, K. I., Demidov, V. V., Nielsen, P. E. & Frank-Kamenetskii, M. D. (2000) Biochemistry 39, 10908–10913. 20. Demidov, V. V., Protozanova, E., Izvolsky, K. I., Price, C., Nielsen, P. E. & Frank-Kamenetskii, M. D. (2002) Proc. Natl. Acad. Sci. USA 99, 5953–5958. 21. Kaihatsu, K., Braasch, D. A., Cansizoglu, A. & Corey, D. R. (2002) Biochemistry 41, 11118–11125. 22. Nielsen, P. E. (2002) Peptide Nucleic Acids: Methods and Protocols (Humana, Totowa, NJ). 23. Bentin, T. & Nielsen, P. E. (2003) J. Am. Chem. Soc. 125, 6378–6379. 24. Kim, J. H., Kim, K. H., Mollegaard, N. E., Nielsen, P. E. & Koo, H. S. (1999) Nucleic Acids Res. 27, 2842–2847. 25. Protozanova, E., Demidov, V. V., Soldatenkov, V., Chasovskikh, S. & Frank-Kamenetskii, M. D. (2002) EMBO Rep. 3, 956–961. 26. Cherny, D. I., Striker, G., Subramaniam, V., Jett, S. D., Palecek, E. & Jovin, T. M. (1999) J. Mol. Biol. 294, 1015–1026. 27. Salvo, J. J. & Grindley, N. D. (1987) Nucleic Acids Res. 15, 9771–9779. 28. Zinkel, S. S. & Crothers, D. M. (1987) Nature 328, 178–181. 29. Snyder, U. K., Thompson, J. F. & Landy, A. (1989) Nature 341, 255–257. 30. Kerppola, T. K. (1996) Proc. Natl. Acad. Sci. USA 93, 10117–10122. 31. Wang, J. C. (1979) Proc. Natl. Acad. Sci. USA 76, 200–203. 32. Wu, H. M. & Crothers, D. M. (1984) Nature 308, 509–513. 33. Kerppola, T. K. & Curran, T. (1991) Science 254, 1210–1214. 34. Ferrari, S., Harley, V. R., Pontiggia, A., Goodfellow, P. N., Lovell-Badge, R. & Bianchi, M. E. (1992) EMBO J. 11, 4497–4506. 35. Hansen, G. I., Bentin, T., Larsen, H. J. & Nielsen, P. E. (2001) J. Mol. Biol. 307, 67–74. 36. Gartenberg, M. R., Ampe, C., Steitz, T. A. & Crothers, D. M. (1990) Proc. Natl. Acad. Sci. USA 87, 6034–6038. 37. Avitalh, N. & Calame, K. (1994) J. Biol. Chem. 269, 23553–23562. 38. Hagerman, P. J. (1996) Proc. Natl. Acad. Sci. USA 93, 9993–9996. 39. Le Cam, E., Fack, F., Menissier-de Murcia, J., Cognet, J. A., Barbin, A., Sarantoglou, V., Revet, B., Delain, E. & de Murcia, G. (1994) J. Mol. Biol. 235, 1062–1071. 40. Cherny, D. I., Fourcade, A., Svinaichuk, F., Nielsen, P. E., Malvy, C. & Delain, E. (1998) Biophys. J. 74, 1015–1023. 41. Le Cam, E., Culard, F., Larquet, E., Delain, E. & Cognet, J. A. (1999) J. Mol. Biol. 285, 1011–1021. 42. Cognet, J. A., Pakleza, C., Cherny, D., Delain, E. & Le Cam, E. (1999) J. Mol. Biol. 285, 997–1009. 43. Bukanov, N. O., Demidov, V. V., Nielsen, P. E. & Frank-Kamenetskii, M. D. (1998) Proc. Natl. Acad. Sci. USA 95, 5516–5520. 44. Shore, D., Langowski, J. & Baldwin, R. L. (1981) Proc. Natl. Acad. Sci. USA 78, 4833–4837. 45. Vologodskaiia, M. & Vologodskii, A. (2002) J. Mol. Biol. 317, 205–213. 46. Ulanovsky, L., Bodner, M., Trifonov, E. N. & Choder, M. (1986) Proc. Natl. Acad. Sci. USA 83, 862–866. 47. Dlakic, M., Park, K., Griffith, J. D., Harvey, S. C. & Harrington, R. E. (1996) J. Biol. Chem. 271, 17911–17919. 48. Podtelezhnikov, A. A., Mao, C., Seeman, N. C. & Vologodskii, A. (2000) Biophys. J. 79, 2692–2704. 49. Zahn, K. & Blattner, F. R. (1987) Science 236, 416–422.	<urn:uuid:a503ae34-271b-4663-afb3-2c0e3987984d>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	29,833
Messenger ' Cultivating creative ways to care for others, ourselves, and the environment. Keep on Movin'! With the keiki back in school, keeping up with work, or just managing your daily commitments, fitting in exercise can seem like an unrealistic thing to do. But, the good news is, research indicates regular movement throughout the day is what our bodies need to help with weight management and for the prevention/ management of chronic diseases. Short bursts of exercise may be a hard concept to buy into, because exercise has been marketed as needing to be long and sustained, but we encourage you to give it a try! You might be pleasantly surprised with how doable exercise becomes when done in this fashion, as well as pleased with the results. Here are some tips to fit regular movement into your workday. Buddies are the Best! Find an at work walking buddy. Take turns being in charge of getting the other to take the walk. Take a 10 minute walk together during morning, afternoon or lunch breaks. VIPP Spot—Very Important Person Parking— Commit to finding a parking space in your work lot that's further away. Because it's further away it's more likely to always be open. It's a spot reserved especially for YOU! Get off the bus Gus! Create a new bus stop: Get off the bus one stop early. DING! Set a reminder on your magic phone or computer to take a short stretching break. Get Up! When on a phone call, do calf raises or squats. Become the Stair Master! Take the stairs as much as possible. If you have a meeting on floor 14, consider taking the elevator to 11 and walk the rest. Over time get off the elevator sooner and sooner. Do what is realistic; maybe you cannot walk up all 14 flights, but can you take the elevator to 10 and walk up the last 4 flights? Keeping it Blue! Ready, Set, Goal Set For the rest of the month, add in a short burst of a strength training exercise. For example, when you brush your teeth do calf raises. Write out a goal. For example: For one week you will do this at least 10 times, if you meet or exceed this goal reward yourself with a new book, magazine, music download, crafting supply, etc. (make the reward be something that helps to manage stress). Moon Gardens just became a Blue Zones certified company! Blue Zones Hawaii: https://info.bluezonesproject.com/bzphawaii offers many programs, in the community, to support one's health based on principles we at Moon Gardens promote such as: eating real traditional foods, making little burst of movement a part of your day and enjoying the moments of life! Check out our website in regards to a cooking demo we will be offering in injunction with them and visit their website for more activities in your area. "Life is really simple, but we insist on making it complicated." ~ Confucius Food is Medicine Currently in the United States, the supplement industry (vitamins, minerals, herbs, etc.) is not a regulated industry, so we need to play on the side of caution. Studies have been showing that many vitamin and supplement bottles are mislabeled. They have been shown to contain ingredients that are not on the label and/or were missing things that were listed. Choose to get your nutrients from foods instead of supplements. Research demonstrates the body would rather get its nutrients. In addition, some research suggests that high doses of various supplements may pose a risk for kidney stones. Travel Through Taste Greek Lemon Soup Ingredients * 8 cups chicken broth * ½ cup rice of choice (long-grain rice is traditionally used) * 3 eggs * Juice from one lemon (more if you would like) Directions Lunch Outside the Home These days, adults and keiki are having to eat meals outside the home (such as school and work lunches). Here are a few ideas for easy, nutritious packable meals: * Make a musubi: Try an avocado, smoked salmon or tofu one. Enjoy with a side of steamed broccoli and nuts . t * Baked sweet potato and salad topped with sesame dressing ( ht ps:// moongardensorg.f les.wordpress.com/2019/05/ sesame-dressing.pdf ) side of nuts. * Boiled egg, brown rice topped with sautéed onions, side of pineapple. * Avocado, tomato, red onion sandwich, made with whole wheat bread. Side of nuts and dark chocolate chips. * Bring broth to a boil and then add rice to boiling broth. Cook on simmer for 25 minutes. * In a separate bowl beat 3 eggs and mix in the lemon juice. When broth is done simmering, slowly add 1 cup of the broth to the egg and lemon juice mixture while continually mixing. * Next add it all back into the pot and on low heat for approximately 4 minutes or until heated through.	<urn:uuid:a555222f-458f-4e60-97df-2564ce884cd0>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	4,640
126.96.36.199 Quantitative PCR to identify Nucleospora (Enterocytozoon) salmonis DNA within Fish Tissue Appendix 2 A. Reference Protocol targets the N. salmonis small subunit (SSU) of the rDNA complex. Protocol is modified from: Badil, S. B., D. G. Elliott, T. Kurobe, R. P. Hedrick, K. Clemens, M. Blair and M. K. Purcell. 2011. Comparative evaluation of molecular diagnostic tests for Nucleospora salmonis and prevalence in migrating juvenile salmonids from the Snake River, USA. J. Aquatic Animal Health 23: 19-29. B. Primer sets Primer name Sequence (5' – 3') Ns-332-F AGGCGTGATTAAAAGAGCGAAGTG Ns-458-R ACTTTTTAACTGCAGCATCCACCA Ns-360-T 6'Fam-CACCTTCGTGTAACGCAATT-NFQ/MGB C. Quantitative PCR amplification \| PCR Reagents \| Lot No. \| Stock Concentration * \| Final Concentration \| Volume/Reaction (Total Volume = 12 µl \| \|---\|---\|---\|---\|---\| \| Commercial Master Mix** \| \| 2X \| 1X \| 6 µl \| \| Forward Primer \| \| 50 µM \| 0.9 µM \| 0.22 µl \| \| Reverse Primer \| \| 50 µM \| 0.9 µM \| 0.22 µl \| \| Taq Man Probe \| \| 10 µM \| 0.20 µM \| 0.24 µl \| \| Water \| \| \| \| 0.32 µl \| \| DNA \| \| \| 10-100 ng \| 5 µl \| \| Total \| \| \| \| 12 µl \| Change "Stock Concentration" parameters as necessary depending on reagent source. Protocol assumes commercial master mix contains uracil-N-glycosylase (UNG). 1. Add PCR reagents except the template DNA into the "Master Mix" tube. 2. Aliquot 7 µl of Master Mix to the wells. 3. Move to DNA extraction area and add 5 µl of extracted DNA to the wells. Add DNA standards and seal plate. 188.8.131.52 Quantitative PCR to Identify Nucleospora salmonis DNA within Fish Tissue -2 4. Centrifuge plate for 3 minutes at 3000 rpm in the centrifuge to eliminate air bubbles in wells. 5. Program quantitative PCR with the following parameters a. Denaturing at 95°C for 15 seconds. Activation of uracil N-glycosylase: 50°C for 2 min Deactivate uracil N-glycosylase: 95°C incubation for 10 minutes Amplification for 40 cycles: D. Analysis b. Anneal/Extend at 60°C for 60 seconds. Refer to quantitative PCR instrumentation documentation on analyzing run results. * Absolute quantitative standards in the form of a plasmid DNA encoding the target SSU region is available from the Western Fisheries Research Center, 6505 NE 65 th St. Seattle, WA 98115. Attn. Maureen Purcell.	<urn:uuid:b3256b62-b147-472b-b026-d2cf2fc671b6>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	2,313
GRAPHIUS Magazine R4 next Bulky: betreed de 4e dimensie Til uw creativiteit naar een hoger niveau. R4 next Bulky, de ideale keuze voor wie op zoek is naar een zeer hoogwaardig en stevig opdikkend papier. Met een natuurlijke touch en de bedrukbaarheid van gestreken papier, voor uitstekende resultaten die de creativiteit van elke afdruk ten volle benadrukken. Ideaal voor boeken, handleidingen en catalogi van hoge kwaliteit. De optimale matheid en de wat hogere opdikking van R4 next Bulky garanderen een levendige weergave van afbeeldingen. R4 next Bulky. Wacht niet langer en betreed de 4e dimensie. Nicolas Bets is een Belgische fotograaf, geroemd om zijn kleurrijke, retro-geïnspireerde stijl die humor en glamour moeiteloos combineert. Geïnspireerd door iconen als Newton en Ritts, volgde hij een opleiding in Parijs en werkte samen met gerenommeerde fotografen voordat hij zijn kenmerkende cinematografische stijl ontwikkelde. Met klanten als Louis Vuitton en Vogue heeft hij een indrukwekkende reputatie opgebouwd. www.nicolasbets.com Colofon: Members of Graphius Group: Graphius Gent, Graphius Brussels, Belprinto, Bietter, Park Communications, PPO Graphius, Mirror Print, Casasocorro Verantwoordelijke uitgever: Denis Geers. Traktaatweg 8, 9044 Gent, België. Redactie: Lies De Potter, Amandine Demal, Fei Lauw, Vaughn Bayley, Ann Dehoucke Vormgeving: studio Park Communications. Fotografie: studio Antigoë De Bie printing, Duffel. Eindredactie: Ann Dehoucke Abonnementen: U kan zich gratis abonnieren via email@example.com Graphius, Traktaatweg 8, 9044 Gent, België. Tel. +32 (0)8 218 08 41. firstname.lastname@example.org. www.graphius.com Gedrukt met vegetale bio-inktten op een Heidelberg XL 106-4-kleurengers met hybride raster 250 lpi. Cover: Prisma Up Silk 2SC 250 g/m² Binnenwerk: R4 Next Bulky 150 g/m² Uitslaander: R4 Next Bulky 170 g/m² 49 Gebinte van een buiging Een ode aan verstilling 53 Aesthetic Nomads In het toevallige schuilt veel schoonheid 67 SAGA Nog steeds een scherpe blik EN VERDER 3 - Bietlot 6 - De details maken het boek 7 - GIPi 13 - Geoff Neal Printworks 22 - Meyers Manx 25 - Boogie Bougie 41 - Kies voor digitaal 44 - Vers van de pers 58 - The Roar of an Angel 62 - Illuxtron 65 - Burocad 73 - Wire-o binding 75 - Graphius Nieuws 70 Gazet van 't Budget absoluut vzw Sinds de drukkerij Bietlot, gevestigd in Gilly, in 1951 werd opgericht door twee broers, heeft ze zichzelf opnieuw kunnen uitvinden om de vele uitdagingen van de grafische sector het hoofd te bieden. De uitdagingen van de printmarkt, die steeds complexer en competitiever is geworden, hebben ertoe geleid dat het bedrijf een nieuwe fase in zijn geschiedenis heeft bereikt. In augustus 2024 sloot Bietlot zich aan bij Graphius Group, wat weer heel wat nieuwe perspectieven opent. Deze integratie is veel meer dan een simpele economische alliantie: het symboliseert de intrede in een nieuw tijdperk voor een bedrijf dat diep geworteld is in zijn geschiedenis, maar ook resoluut gericht is op de toekomst. Familie-erfgoed dat blijft bestaan Het verhaal van drukkerij Bietlot begon in 1951, op een heel bescheiden manier. Jacques en André Bietlot, twee broers met een passie voor drukwerk, besloten hun eigen drukkerij op te richten. Door de jaren heen heeft Bietlot zich ontwikkeld tot een referentie binnen de sector. Het heeft zijn reputatie opgebouwd dankzij de kwaliteit van zijn drukwerk en zijn persoonlijke klantenservice. "Bietlot is in de eerste plaats een familiebedrijf met een lange traditie van uitzmuntendheid", zo legt Éric Guillaume, algemeen directeur van Bietlot, uit. Dit familiare karakter en deze nabijheid tot de klanten hebben ervoor gezorgd dat het bedrijf in al die jaren zijn roots niet uit het oog verloor. Aan het begin van de jaren 2000 stond de grafische industrie echter voor het eerste grote keerpunt. De twee broers Bietlot gaven de fakkel door aan drie van hun directieleden in het kader van een "management buy-out". Deze procedure stelde de verantwoordelijken van het bedrijf in staat om de controle over te nemen zonder de familiale spirit te verliezen. Deze koerswijziging was meteen het begin van een nieuw tijdperk voor de drukkerij, met de uitgesproken wens om te investeren in geavanceerde apparatuur en te diversifiëren. Antwoorden op de uitdagingen van een veranderende markt De jaren 2000 stonden synoniem voor omwentelingen in de printsector. De digitalisering en dematerialisering van de media, de opkomst van het internet en meer recentelijk de Covid-19-crisis hebben het landschap diepgaand veranderd. De hoeveelheden drukwerk zijn afgenomen, en hetzelfde geldt voor de marketingbudgetten van bedrijven. "De afgelopen jaren is de markt steeds complexer geworden. We moesten ons voortdurend aanpassen", benadrukt Éric Guillaume. Een van de grootste uitdagingen voor drukkerij Bietlot was de spectaculaire stijging van de papierprijzen in 2022. "De papierprijs is in negen maanden tijd verdubbeld, wat voor veel van onze klanten een budgettaire onevenwicht heeft veroorzaakt", zo herinnert Éric Guillaume zich. Voor een bedrijf gespecialiseerd in het drukken van brochures en catalogi had deze klap fataal kunnen zijn. Maar Bietlot heeft veerkracht kunnen tonen. De sleutel van deze veerkracht ligt in het vermogen om te innoveren. In 2016 investeerde het bedrijf in een LED-UV-pers, een technologie die het droogproces versnelt en tegelijkertijd het energieverbruik vermindert. "Zo konden we veel sneller reageren op complexere bestellingen", aldus Éric Guillaume. Bovendien past deze keuze binnen een milieuaanpak, omdat deze nieuwe technologie minder energie verbruikt. Dit gaat hand in hand met de ecologisch verantwoorde strategie van het bedrijf. Een bedrijf dat voorop loopt op vlak van ecologie Drukkerij Bietlot kiest al verschillende jaren voor een ambitieus milieubeleid. Gedreven door de voorschriften van zijn belangrijkste klant, het Publicatiebureau van de Europese Unie, heeft Bietlot het "Imprim'vert" label behaald, een bewijs van zijn engagement om de impact van zijn activiteiten op het milieu te verminderen. "Het verkrijgen van dit label was voor ons een echte uitdaging", zegt Éric Guillaume. "Maar intussen is het een echte leidraad geworden voor het hele bedrijf." Dankzij deze certificering heeft Bietlot niet alleen zijn energieverbruik en afvalproductie verminderd, maar ook diverse duurzame praktijken geïmplementeerd, zoals het gebruik van plantaardige inkten en gerecycleerd of FSC- en PEFC-gelabeld papier, voornamelijk afkomstig uit Wallonië. Dit ecologische engagement wordt ook doorgetrokken in het afvalbeheer. "We hebben het sorteren en beheren van ons afval onder de knie", aldus Éric Guillaume. Het bedrijf heeft ook geïnvesteerd in fotovoltaïsche panelen die op al zijn gebouwen zijn geïnstalleerd. Daarnaast heeft men ook de verlichtingssystemen in de werkplaatsen en kantoren vernieuwd om het energieverbruik verder te verminderen. Deze acties zijn verre van anekdotisch, maar hebben Bietlot in staat gesteld om de banden te versterken met een cliënteel dat steeds gevoeliger wordt voor deze kwesties. "Steeds meer van onze klanten besteden aandacht aan onze ecologische waarden", benadrukt Éric Guillaume. Deze milieudimensie is nu een sterk argument om klanten te behouden en aan te trekken, vooral in de B2B-sector, waar Bietlot in Wallonië gepositioneerd is als een belangrijke speler in het drukken van catalogi en brochures. De aansluiting bij Graphius: een strategische keuze voor de toekomst Ondanks de inspanningen op het vlak van innovatie en het milieubeleid begreep Éric Guillaume al snel dat het nodig was om de krachten te bundelen met een sterkere speler om het voortbestaan van de drukkerij te garanderen. Daarom sloot Bietlot zich in augustus 2024 aan bij Graphius Group. “De integratie binnen Graphius Group was onvermijdelijk en betekende een echte kans voor ons”, legt Éric Guillaume uit. “Alleen werd het steeds moeilijker om te blijven innoveren en te voldoen aan de toenemende eisen van onze klanten. Door ons aan te sluiten bij een groep konden we onze productiecapaciteiten maximaliseren en tegelijkertijd onze onafhankelijkheid behouden.” Deze integratie betekent een strategisch keerpunt voor drukkerij Bietlot. Dankzij deze toenadering, kan men nu genieten van de synergieën van Graphius Group, met name op vlak van aankoopkracht en technologieën. “We hebben toegang tot grotere en efficiëntere persen, waardoor we opdrachten kunnen uitvoeren die we voorheen niet konden aankondigen”, aldus Éric Guillaume. Bovendien kan het bedrijf nu kleine series aanbieden dankzij de digitale persen van de groep, wat nieuwe commerciële mogelijkheden opent. De identiteit van Bietlot behouden mét de voordelen van een grote groep Hoewel de integratie in Graphius Group de structuur van de drukkerij heeft gewijzigd, heeft zij op geen enkele wijze haar identiteit veranderd. Bietlot blijft opereren vanuit zijn pand in Gilly, met een team van 17 mensen. Het blijft trouw aan zijn familiegeest en zijn lokale waarden. “We hebben het geluk dat we onze autonomie kunnen behouden en tegelijkertijd kunnen profiteren van de kracht van de groep”, zegt Éric Guillaume. “Dit is een echte meerwaarde voor ons bedrijf, omdat we hierdoor sneller op aanvragen kunnen reageren, onze rentabiliteit kunnen verbeteren en de lokale werkgelegenheid kunnen behouden.” De integratie van het bedrijf Bietlot in Graphius Group heeft niet tot grote wijzigingen in de werking van de drukkerij geleid. “Onze structuur blijft hetzelfde en we blijven onze klanten een persoonlijke service bieden. Er is niets veranderd, behalve dat we sterker staan dankzij de steun van de groep”, benadrukt Éric Guillaume. Deze fusie is dan ook een echte zegen voor drukkerij Bietlot, die haar toekomst met meer rust tegemoet ziet. “Vandaag zijn we beter in staat om aan de behoeften van onze klanten te voldoen. En we kunnen hun een breder productassortiment aanbieden. Het is een winnende formule, zowel voor ons als voor hen”, zo vertrouwt Éric Guillaume toe. Een veelbelovende toekomst voor Bietlot De toekomst van drukkerij Bietlot ziet er goed uit. Door de integratie in Graphius Group heeft het bedrijf niet alleen zijn toekomst veiliggesteld, maar heeft het zichzelf ook uitgerust met de nodige tools om zich te blijven ontwikkelen in een snel veranderende markt. “In de huidige printmarkt is het niet meer mogelijk om er alleen voor te staan. We moeten samenwerken om te kunnen blijven innoveren en kwaliteitsdiensten aan te bieden”, zegt Éric Guillaume. Met zijn knowhow, zijn flexibiliteit en zijn voorbeeldige milieubeleid is Bietlot nu beter dan ooit uitgerust om de uitdagingen van morgen aan te gaan. “Wij geloven rotsvast in de toekomst van papier en zolang onze klanten brochures en catalogi nodig hebben, zullen wij er zijn om aan hun verwachtingen te voldoen”, zo besluit Éric Guillaume. DE DETAILS MAKEN HET BOEK. Een surrealistische reis in druk Voor de tentoonstelling Paul Delvaux en zijn Universum in La Boverie (tot en met 16 maart 2025) creëerden we een catalogus die even adembenemend is als de kunstwerken zelf. Dit 224 pagina’s tellende hardcover boek, van 220 x 270 mm, combineert Magno Plus Silk papier met diepzwarte Sirio schutbladen. De omslag, uitgevoerd in Wilbalin Buckram White met een lichtblauw kapitaaltje, biedt een elegante en tactiele ervaring. De stevige genaaide binding benadrukt de duurzaamheid en kwaliteit. Elke technische keuze, van papier tot afwerking, werd gemaakt om de surrealistische wereld van Paul Delvaux tot leven te brengen. Het resultaat is een catalogus die de bezoeker meeneemt in een visueel en tastbaar avontuur, perfect passend bij de meesterwerken van deze Belgische grootmeester. Met trots dragen we zo bij aan de viering van 100 jaar surrealisme. PAUL DELVAUX EN ZIJN UNIVERSUM • Tempora • Brussel • 220 x 270 mm • Magno Plus Silk 170 g/m² • 224 p • Design by denisdecaluwe.be Een eindeloos avontuur in boekvorm Het boek It Never Ends is veel meer dan een catalogus: het is een multidimensionale ervaring. Voor dit project, verbonden aan de gelijknamige tentoonstelling van John M. Armleder in KANAL – Centre Pompidou, drukten we een indrukwekkend werk dat creativiteit en samenwerking belichaamt. De zachte kaft, gemaakt van 300g/m² sulfaatkarton met een spiegelreffect is een verlenging van het werk van de kunstenaar, die een voorliefde voor spiegelloppervlakken in zijn werk toont. Binnenin vinden we 246 pagina’s Munken Polar Rough papier, dat de artistieke details prachtig tot hun recht laat komen. Het formaat van 21 x 26 cm maakt het boek handzaam en toch royaal. Met bijdragen van meer dan honderd kunstenaars en uitgebreide interviews biedt het boek een duik in een collectief zelfportret. Net als de tentoonstelling zelf is It Never Ends een levendig en hybride kunstwerk, een blijvende herinnering aan Armleders meest ambitieuze project tot nu toe. IT NEVER ENDS • Stichting KANAL • Brussel • 210 x 260 mm • Munken Polar Rough 120 g/m² • 124 p • Design by sunny-side-up.be, beschikbaar bij LENZ, Milano. ‘Het Wereldkunstwerk’ de tour de force van de Gentse tekenaar GIPI Indrukwekkend, dat is het minst dat je kunt zeggen van ‘Het Wereldkunstwerk’ van de Gentse tekenaar GIPI, het alias van Pierre Gillis (77). Gillis maakte van 25 iconen uit de kunstgeschiedenis evenveel potloodtekeningen, met een verbluffend oog voor detail. Tien jaar lang wijdde hij zich als een middeleeuws monnik aan wat je een levenswerk kunt noemen. ‘Het Wereldkunstwerk’ is een legacy van een begenadigd tekenaar en tegelijk een ode aan de kunsten. We ontmoeten GIPI in Gentbrugge. Oktober gooit zijn herfstig juk af en toont zich als een jong lentekind. Het is boven de 20°C, maar we trekken naar binnen, naar de plek waar Pierre Gillis het liefst van al vertoeft: aan de eettafel, waar hij de afgelopen tien jaar potlood na potlood op tekende. Maar liefst 18.000 uur werk kroop er in ‘Het Wereldkunstwerk’, maar GIPI blijft daar redelijk stoïcijns bij. “Het is het enige wat ik echt goed kan. Naast koken”, lacht hij. “Want dat is echt een andere passie. Ik heb hier een paar honderd kookboeken staan. Ik ben trouwens ook officieel een chef-kok, na een avondopleiding aan de kokschool. Het was mijn goede vriend, topchef Guy Vancauteren, die me dat heeft opgedragen. Ik kon dus niet anders (lacht).” Over koken en kookkunst kunnen we het een andere keer hebben. Laten we een blik tekenkunst opentrekken. Jij tekent al heel je leven? “Jazeker! Maar wacht, laat me je eerst een koffie aanbieden. Zelf drink ik geen koffie. Koffie en tekenen, dat gaat niet samen. Alles wat de zenuwen kan prikkelen, zoals cafeïne, maakt het moeilijker om een vaste hand te behouden. Het is bijvoorbeeld bijna onmogelijk om nog een perfecte cirkel te tekenen. En je maakt er onbedoeld je papier mee vuil, vooral wanneer je met een potlood werkt. Dat heb ik al vroeg geleerd van Franquin (Belgisch striptekenaar, bekend van Guust Flater, nvdr.). Hij heeft me laten zien hoe je moet tekenen met je hele hand, zoals een danser die sierlijk beweegt. Het is belangrijk om drie vingers te gebruiken als steunpunt; en het is zaak van je hand te trainen, minstens twee uur per dag. Zelfs nu teken ik nog vijf uur per dag, zonder uitzondering. Vakantie, reizen – ik heb niet veel nodig, enkel een potlood en een vel papier.” Een obsessie noem je het zelf. “Dat is het zeker. Ik ben al heel mijn leven gepassioneerd door potloodtekeningen. Het vreemde daarbij is dat een tekening in de kunstwereld vaak onderschat wordt. Een lijn is definitief, die staat erop voor altijd. Wat er staat, blijft. Toch zijn tekeningen en aquarellen vaak de minst gewaardeerde kunstwerken, terwijl ze juist het meest authentiek zijn. Dat vind ik compleet onbegrijpelijk. Het begint allemaal met één enkele lijn, en die lijn bepaalt alles. Dat is wat ik zo waardeer aan tekenen; het voelt veilig, vertrouwd, en is tegelijkertijd zo puur.” Kind van de tekening “Ik kom eigenlijk uit een zeer eliteaire familie”, vertelt GIPI. “Opgevoed door gouvernantes, totaal afgezonderd van de buitenwereld. Ik ervaarde dat “Het begint allemaal met één enkele lijn, en die lijn bepaalt alles. Dat is wat ik zo waardeer aan tekenen; het voelt veilig, vertrouwd, en is tegelijkertijd zo puur.” als een ongelukkige, eenzame jeugd. Alles in mijn leven werd getekend door die isolatie. En ik vond troost in tekenen. Ik herinner me nog goed dat een van de broeders van het college waar ik school liep tijdens een van de eerste oudervergaderingen zei tegen mijn moeder: “Mevrouw, als ik nu over mocht beslissen, zou ik hem een andere richting opsturen. Hij mist twee dingen: te weinig fantasie, maar wat veel erger is, hij kan absoluut niet tekenen.” Ik denk dat ik zelden zo kwaad ben geweest als toen. Gelukkig had ik later wel een andere leraar Harold Van der Perre, die wel in mij geloofde. Eerst als leraar en nu als mijn grootste fan. Hij heeft me altijd gestimuleerd. Bij de eerste les zei hij tegen me: “Wanneer ga je eindelijk je potlood stevig vasthouden?” Dat was de basis van alles. Maar die verdwijnt helaas, merk ik. Tijdens een paar masterclasses die ik gaf aan leraren en kunstenaars, ontdekte ik dat we de meest elementaire dingen vergeten zijn. Neem bijvoorbeeld de vier perspectieven. De meesten kennen het puntlijnperspectief wel, maar dan heb je het kleurperspectief, dat vaak over het hoofd wordt gezien. Als je bijvoorbeeld een heldere rode kleur vooraan op je schilderij plaatst en hetzelfde rood in de achtergrond gebruikt, maak je je schilderij plat. Het mist diepte en dimensie. Dan is er het scherpteperspectief, wat voor tekenen een grotere uitdaging is. Dit geeft de indruk van afstand en de manier waarop objecten in de ruimte zich tot elkaar verhouden. En ten slotte, het moeilijkste van allemaal: het lichtperspectief. Dit is waar je een echt meesterwerk kunt herkennen aan de manier waarop het licht wordt weergegeven. Als je een goed schilderij bekijkt, kun je de finesse van het lichtperspectief zien. Kijk bijvoorbeeld naar Caravaggio, een van de grootste kunstenaars ooit. Een schurk, dat wel, maar niettemin een titaan!” Bij tekenen draait alles om de observatie, kijken … wie heeft jou leren observeren? “Mijn grootvader, die in Dendermonde aan de Oude Schelde woonde, heeft me echt leren kijken. Hij woonde aan een idyllisch plekje, vlakbij een grote vlakte die onder water kwam te staan als de Schelde te hoog stond. Hij zei altijd tegen me: ‘Pietje, wat zie je?’ Ik antwoordde: ‘Gras, opa. Heel veel gras.’ Maar hij zei: ‘Nee, kijk beter. Wat je ziet, zijn miljoenen grassprietjes, en ze zijn allemaal anders.’ Toen heb ik echt leren observeren en vergelijken. Dat is de basis van tekenen. Helaas is het een kunstvorm die volledig aan het verdwijnen is. Tegenwoordig zijn er steeds minder mensen die potloodtekeningen maken. Het is een uitstervende kunst. Maar je moet er wel wat voor over hebben en opofferen. Sporten? Heb ik nooit gedaan. Het enige wat ik doe, is zwemmen, elke week 1500 meter, plus wat massages en dagelijks tekenen. Het klinkt misschien gek, maar die obsessie is een essentiële voorwaarde om echt goed te worden. Ik vind van mezelf dat ik er te laat mee begonnen ben. Ik ben er nu 77 en heb een tijd geleden een voorstel ontvangen van Stad Gent, omdat Gent tegen tegen 2030 de culturele hoofdstad van Europa kan worden. Ze hebben me gevraagd om de 250 beroemdste kunstschilders uit de kunstgeschiedenis in hun habitat te tekenen. Voor elke tekening krijg ik ongeveer tien dagen. Tot nu toe heb ik bijna honderd van deze kunstschilders getekend, wat betekent dat er nog ongeveer 150 te gaan zijn. Dat is goed voor nog eens drie jaar werk. Tegen die tijd ben ik dik tachtig. Ik vraag me af of ik dat nog zal kunnen, want het vergt veel concentratie. Vroeger had ik daar geen probleem mee; ik kon drie tot vier uur aaneen geconcentreerd werken, zonder enige afleiding. Maar nu moet ik na twee uur tekenen soms even pauzeren.” Het Wereldkunstwerk: adembenemend “Het idee voor ‘Het Wereldkunstwerk’ ontstond op het kabinet van de toenmalige cultuurminister Sven Gatz,” vertelt hij. “Tijdens een vergadering probeerden we te definiëren wat ‘Kunst’ eigenlijk is. We kwamen tot de conclusie dat dit onmogelijk was, maar we stelden wel 24 hoedanigheden vast waaraan een wereldkunstwerk moest voldoen, zoals ‘stilte’. Wanneer je naar zo’n kunstwerk kijkt, moet het je brein tot 3 tot 5 seconden absolute stilte brengen. De uitdaging was om kunstwerken te maken die deze hoedanigheden belichamen.” In het werk zien we 25 grootmeesters, elk in hun eigen habitat. “Ja, ik heb de grootmeesters geportretteerd in hun leefwereld. Een monnikenwerk, elke dag vijf uur lang, tien jaar lang. Het vereiste een immense concentratie en het voelde als een drug. Soms sprak ik wekenlang niet, wat voor mijn vrouw natuurlijk een uitdaging was. Gelukkig steunt ze me al jaren, niet het minst met haar dagelijkse gastronomische gerechten. Intensieve focus en toewijding, dat was het. Aan één stuk plafond heb ik bijvoorbeeld een maand gewerkt. De precisie die voor deze tekeningen nodig is, is enorm. En het mooiste? In tien jaar tijd heb ik geen enkele gom gebruikt. Elke tekening moest perfect zijn, en dat vergt geduld. Beginnen en zeker zijn van je stuk, elke dag opnieuw.” “De precisie die voor deze tekeningen nodig is, is enorm. En het mooiste? In tien jaar tijd heb ik geen enkele gom gebruikt. Elke tekening moest perfect zijn, en dat vergt geduld. Beginnen en zeker zijn van je stuk, elke dag opnieuw.” Vincent van Gogh Vincent van Gogh, de grootmeester van de interpretatie. Toen Vincent stierf, nam zijn schoonzus Johanna – de echtgenote van Theo – de taak op zich om de kunst van Vincent te promoten. Ze ging naar Parijs, naar het depot waar zijn werken opgeslagen lagen. Ze wist niet goed wat ze met de schilderijen moest doen, maar ze begon tentoonstellingen te organiseren. Langzaam maar zeker werd Van Gogh beroemd, en dat was grotendeels te danken aan haar inzet. De tekening toont hoe het Place Lamartine in 1895 eruitzag, met het gele huis van Van Gogh, dat helaas in 1944 door de Duitsers is gebombardeerd en nu niet meer bestaat. Wat bijzonder is, is dat Van Gogh dit huis zes keer schilderde, zeven jaar voordat het werd vernietigd, maar zonder een enkele boom. We onderzoeken nu in Amsterdam waarom dat zo is. Het lijkt ertop dat Van Gogh nooit een plaat aan heeft geschilderd. En dan is er het verhaal over zijn zelfmoord. Van Gogh heeft nooit zelfmoord gepleegd; dat is een misvatting. Van Gogh was in wezen een normale man, maar hij werd in het dorp als een gek gezien. Kinderen pestten hem, gooiden zijn ezel omver en deden hem de duivel aan. Op een gegeven moment kreeg hij een woedeaanval. Hij greep een pistool en volgens de reconstructie moet het per ongeluk zijn afgegaan. Hij raakte zichzelf in de buik. Het pistool dat hij gebruikte werd tachtig jaar later teruggevonden; het is nu een museumstuk. Na het schietincident nam Vincent zijn ezel, zijn doek en al zijn verf mee, en hij liep naar Herberg Ravoux, waar hij logeerde. Toen hij aankwam, zag de gerante dat hij zich niet lekker voelde, maar Van Gogh trok naar zijn kamer. Na anderhalf dag was hij nog steeds niet naar beneden gekomen. Toen ze hem vonden, zat hij in een rieten stoel met een grote plas bloed onder zich. Er was niets meer aan te doen. Michelangelo “Niemand weet precies hoe Michelangelo eruitzag,” zegt hij terwijl hij zijn kunstwerk toont. “Dus heb ik geprobeerd om een beeld van hem te creëren dat zijn geest en zijn tijd weerspiegelt.” “Kijk, hier zie je Michelangelo die naar de Sixtijnse Kapel wijst, de plek waar hij zo veel van zijn talenten heeft ingezet. En daar zijn zijn drie iconische meesterwerken: de David, de Mozes en de Pietà.” “De David is niet zomaar een beeldhouwwerk; het is een symbool van de strijd en de overwinning van de menselijke geest. De Pietà weerspiegelt verdriet en medeleven, en het Laatste Oordeel is een krachtig visueel verhaal dat ons uitnodigt om na te denken over leven en dood.” De vier onafgewerkte slaven, die in de Accademia in Florence staan, zijn een krachtige metafoor voor de worsteling van de kunstenaar. Ze vertegenwoordigen de onafgebroken strijd om perfectie en de relatie tussen de kunstenaar en zijn creatie. Michelangelo laat ons hier zien dat zelfs in onvoltooid werk, er een diepte van betekenis en emotie aanwezig is. Kunst is een venster naar onze ziel, en ik hoop dat mijn werk deze connectie versterkt. Het is een eer om de grootmeesters van de kunstgeschiedenis te eren en hun verhalen door te geven aan de volgende generatie.” Alfred Stevens “Als derde wil ik toch graag Alfred Stevens eens in het daglicht plaatsen, omdat ik het onbegrijpelijk vind dat een kunstenaar van zijn kaliber zo weinig aandacht krijgt. Meer nog: vrijwel iedereen aan wie ik vraag of ze Stevens kennen, blijkt de man niet te kennen of er zelfs nog nooit van gehoord te hebben. Het is nochtans grootmeester, die vooral in de tweede helft van de 19e eeuw bekendheid genoot. Een ietwat brutale Brusselaar die fenomenaal kon schilderen en als eerste onbekende vrouwen van de haute-bourgeoisie afbeeldde, op een heel elegante manier. Hij was ook een van de eerste schilders die het Japonisme in zijn schilderijen introduceerde, en zijn werk wekte de interesse op van mensen als Manet, die een van zijn beste vrienden werd. Stevens verkaste op jonge leeftijd naar Parijs, waar hij een gigantisch huis huurde, met een grote tuin. Hij richtte er een atelier in waar hij uitsluitend dames schilderde, in elegante poses en weelderige japonnen. Onbekende vrouwen, met één uitzondering: Sarah Bernhardt, een gevierde toneeldiva. Dat we Stevens vandaag niet meer kennen, mag als vreemd beschouwd worden. Je zou zelfs kunnen stellen dat het impressionisme dankzij hem een grote push gekregen heeft, nadat hij Manet introduceerde bij Paul Durand-Ruel, een kunsthandelaar die een van de grootste promotoren van het impressionisme werd. Stevens zelf kreeg tijdens zijn leven veel bijval van generatietgenoten – er werd zelfs bij leven een retrospectieve aan hem gewijd, een zeldzaamheid toen – maar keerde na zijn Parijse avonturen berooid terug naar Brussel. Een geniaal kunstenaar, maar onbekend bij het grote publiek.” Jack Bush: Kleurenpionier met een blijvende impact De Canadese kunstenaar Jack Bush begon zijn carrière met rustige landschappen, geïnspireerd door de ongerepte natuur van zijn thuisland. Maar zijn echte kracht ontdekte hij later, toen hij zich stortte op abstracte kunst. Met levendige kleuren en krachtige vormen liet Bush zien dat kunst veel meer kan zijn dan een weergave van de werkelijkheid. Zijn vernieuwende stijl bracht hem internationale roem. Bush was een van de weinige Canadese kunstenaars die al tijdens zijn leven doorbrak buiten de landsgrenzen. Mede dankzij zijn vriendschap met de invloedrijke kunstcriticus Clement Greenberg kwam hij in contact met grote namen uit de New Yorkse kunstwereld, wat zijn carrière een flinke boost gaf. Nu brengt het prachtige Catalogue Raisonné zijn werk opnieuw tot leven. Deze indrukwekkende uitgave is niet alleen een visueel feestje, maar ook een schat aan informatie. Slimme details, zoals pagina’s in kleuren van zijn schilderijen, maken het boek zelf bijna tot een kunstwerk. Dankzij dit naslagwerk wordt Bush’s nalatenschap in volle glorie gevierd, precies op het moment dat abstracte kunst weer helemaal in de spotlight staat. Jack Bush bewijst dat je met kleur, vorm en lef de wereld kunt veroveren. Zijn werk blijft inspireren en geeft kunstliefhebbers een frisse blik op de kracht van abstractie. JACK BUSH • Type A Print • Toronto • 292.1 x 292.1 mm • Matt Coated White 150 g/m² • 540 p Verrassingen op maat met Sabato Sabato, het lifestylemagazine van De Tijd, vertrouwt al jaren op Antilope De Bie voor de creatie van hun exclusieve verrassingsdozen. Elk jaar bedenkt Sabato originele concepten die variëren van luxe parfum en boeken tot een fles drank met bijpassende glazen. Ons team vertaalt deze creatieve ideeën naar technisch haalbare ontwerpen en zet ze om in prachtig afgewerkte dozen. Met oog voor detail drukken we de dozen, monteren ze zorgvuldig en vullen ze met de producten die door Sabato worden aangeleverd. Vervolgens zorgen we ervoor dat ze piekfijn klaarstaan voor verzending. Het resultaat? Een geschenk dat telkens weer indruk maakt, zowel bij de ontvangers als bij onze klant. SABATO • Trustmedia, part of Mediafin • Brussel • 290 x 235 x 105 mm • Heaven 42 150 g/m² My White Cotton: zacht, duurzaam en stijlvol De nieuwe catalogus van My White Cotton legt de nadruk op duurzaam comfort. De T-shirts zijn gemaakt van 100% biologisch katoen, een natuurlijk materiaal dat ademt en zachter aanvoelt dan conventioneel katoen. Dankzij het gebruik van geavanceerde productiemethoden zonder chemische meststoffen of pesticiden, dragen deze shirts bij aan een beter milieu. Het materiaal is gecertificeerd biologisch en respecteert het natuurlijke evenwicht tijdens de productie. Ook het drukwerk van de catalogus ademt deze comfortabele sfeer uit. De hoogwaardige afwerking en de keuze voor natuurlijke kleuren en zachte texturen sluiten perfect aan bij de gloednieuwe branding van het merk. Het geheel straalt eenvoud, zachtheid en kwaliteit uit, net zoals de producten van My White Cotton. Hierdoor wordt niet alleen het verhaal van het merk verteld, maar ook beleefd. MY WHITE COTTON • Waregem • 200 x 350 mm • Arctic Volume White 170 g/m² • 24 p Bakkerij Aernoudt Groot in patisserie en brood Op elke hoek van de straat een bakker? Wie door Vlaanderen rijdt, merkt het dagelijks op: we zijn een volk van échte broodeters. We schuiven aan tafel bij een speler die dat straatbeeld mee bepaalt: Bakkerij Aernoudt. Ooit gestart in Gent, maar ondertussen stevig gegroeid met flink wat vestigingen in zowel Oost- als West-Vlaanderen. We zetten ons samen in één van hun tearooms, krijgen een heerlijke koffiekoek en dampende koffie voorgeschoteld, en starten het gesprek met Eline Van Oostende, marketeer en brood-aficionado. “Ons verhaal is eigenlijk heel eenvoudig: we willen de traditionele bakkersstijl in ere houden en tegelijkertijd de bakkerij zo lokaal en toegankelijk mogelijk maken,” vertelt ze. “Dat betekent dat we altijd open zijn, op elk moment van de dag, en dat we stevast verse producten aanbieden. Bakker zijn is een uitdagend beroep, zeker als je het alleen doet. Onze aanpak zorgt ervoor dat het ambacht blijft bestaan en dat we tegelijkertijd lokaal bakverse producten beschikbaar houden.” Aernoudt is een gevestigde naam in de wereld van bakkerijen, en er komen steeds meer vestigingen bij. Wat is jullie doel? Voor ons is het aantal winkels geen doel op zich. In Oost-Vlaanderen zijn we inmiddels goed bekend. Daar hebben we bijna het maximale aantal winkels bereikt dat we vanuit onze centrale productie in Gentbrugge kunnen bedienen. Het was daarom belangrijk om verder te kijken naar nieuwe mogelijkheden om onze bakkerijen lokaal en vers te houden, zonder afbreuk te doen aan onze kwaliteit en service. We vonden deze uitbreidingskansen in West-Vlaanderen, waar we recent een nieuwe productiesite in Ruddervoorde hebben opgezet. Over brood valt veel te zeggen. Wat maakt Aernoudt anders dan andere bakkerijen? “Kom het gewoon eens proeven!” zou mijn eerste antwoord zijn. Dat klinkt misschien eenvoudig, maar uiteindelijk draait het allemaal om de smaak en de kwaliteit van het product. Wat ons als bakkerij bijzonder maakt, is dat we erin slagen om met een groot en toegewijd team – van onze bakkers en patissiers tot aan de winkelmedewerkers, chauffeurs en ook de schoonmaakploegen – elke dag op zoveel locaties dagverse producten te leveren. Dat varieert van broden en pistolets tot koffiekoeken, taarten en nog veel meer. Het feit dat we dit elke dag voor elkaar krijgen en op zo’n hoog kwaliteitsniveau kunnen blijven werken, vind ik persoonlijk nog steeds iets om trots op te zijn. Het ambacht blijft bij ons centraal staan, en we combineren dat met een efficiënte organisatie die ervoor zorgt dat we op heel veel plekken tegelijkertijd vers kunnen leveren. Het is die combinatie van vakmanschap, passie en logistieke kracht die ons in staat stelt om niet alleen te groeien, maar ook om die constante kwaliteit te garanderen. Geen baksteen, wel een brood in de maag De Vlaming blijft door de week enorm gehecht aan zijn klassieke boterham en aan een heerlijke koffiekoek in het weekend”, zegt Eline. “Brood speelt nog steeds een centrale rol in onze voeding: het is niet alleen lekker, maar ook voedzaam, gezond en makkelijk. Voor veel mensen is het een onmisbaar onderdeel van hun “Brood speelt nog steeds een centrale rol in onze voeding: het is niet alleen lekker, maar ook voedzaam, gezond en makkelijk.” dagelijkse routine. Of het nu gaat om een snelle lunch of een stevig ontbijt, brood is iets waar Vlamingen op kunnen vertrouwen. En hoe zit het met patisserie? Taart is feest, hé (lacht). Op dat vlak zijn we met z’n allen echte Bourgondiërs. Ook binnen onze patisserie hebben we een aantal klassiekers die altijd in de smaak vallen, zoals de éclairs en aardbeientaartjes. Deze traditionele favorieten blijven onverminderd populair, omdat ze bij veel mensen nostalgische gevoelens oproepen en vaak deel uitmaken van feestelijke momenten. Maar dat betekent niet dat we stilzitten. Onze patissiers experimenteren in de ateliers graag met nieuwe smaken en samenstellingen. Zo proberen ze regelmatig andere soorten fruit of vervangen ze een ingrediënt om te zien wat voor verrassende combinaties daaruit voortkomen. Hoewel niet elke nieuwe creatie meteen in onze winkels belandt, zorgt dat creatieve proces er wel voor dat we altijd blijven innoveren en het voor onszelf ook leuk en uitdagend houden. De ingrediënten voor mooi drukwerk “We hechten enorm veel belang aan kwaliteit, en dat geldt niet alleen voor onze producten. Alles wat rond ons merk hangt, moet diezelfde kwaliteit uitstralen,” aldus Eline. “Ons drukwerk is daarbij geen uitzondering. Of het nu gaat om een flyer, een poster, taartdozen of ons eigen Lekker Dichtbij krantje dat je in onze winkels vindt, elk stuk drukwerk moet naadloos aansluiten bij de hoge standaarden die we voor ons merk hanteren. Het is voor ons essentieel dat klanten dezelfde zorg en aandacht voor detail voelen in ons drukwerk als in de producten die ze dagelijks van ons kopen.” Welke uitstraling moet jullie drukwerk hebben? Het is onze kans om onze identiteit en onze waarden over te brengen, dus we willen dat het de juiste uitstraling heeft. We kiezen voor stralende kleuren die onze energie en passie voor bakken weerspiegelen, en een aantrekkelijke textuur die mensen uitnodigt om het drukwerk aan te raken en te ervaren. Dit alles helpt ons niet alleen om de aandacht te trekken, maar ook om een emotionele connectie te maken met onze klanten. Drukwerk moet niet alleen informatief zijn, maar ook inspireren en de kwaliteit van onze producten weerspiegelen. Waarom werken jullie samen met Graphius? We geloven sterk in de kracht van lokale netwerken en de voordelen van samenwerken met gelijkgestemde bedrijven die dezelfde kwaliteit nastreven. Bij Graphius ervaren we niet alleen een gedeelde focus op klantgerichtheid, maar ook een diepgaand begrip van onze behoeften. Deze samenwerking gaat verder dan alleen het afnemen van diensten; het is een partnerschap gebaseerd op vertrouwen en wederzijds respect. Daarnaast waarderen we de snelheid en professionaliteit die Graphius in onze samenwerking brengt. Of het nu gaat om drukwerk, advies of uitvoering, we weten dat we op hen kunnen rekenen om consistent hoge kwaliteit te leveren binnen strakke deadlines. Dit versterkt onze eigen efficiëntie en stelt ons in staat om onze klanten beter van dienst te zijn. BOB SINCLAR EN DE FRENCH TOUCH 30 JAAR MUZIKALE REVOLUTIE GEVIERD IN EEN BOEK Hij kreeg ons allemaal aan het dansen op de dansvloer, maar wie is Bob Sinclar eigenlijk? Wat is deze beweging die hij ten tonele voerde op het wereldpodium en die Frankrijk over de hele wereld op de kaart zette? ‘Bob Sinclar et DJ Yellow: nos 30 ans de French Touch’ is veel meer dan een eenvoudige terugblik. Dit boek beschrijft de 30 jaar van Yellow Productions, het baanbrekende label van de Franse elektronische muziek, en vertelt het verhaal van een muzikale beweging die de internationale scène veranderde. De French Touch is meer dan een muzikale revolutie en belichaamt een moment van ongebreidelde creativiteit dat tot op de dag van vandaag muzikale creaties beïnvloedt. Aan de hand van persoonlijke verhalen, anekdotes en boeiende verhalen duikt dit boek in de geschiedenis, de backstage en de ziel van deze unieke artistieke beweging. Op die manier biedt het een frisse kijk op drie decennia elektronische muziek. ‘Bob Sinclar et DJ Yellow: nos 30 ans de French Touch’ blikt terug op deze cruciale periode, toen het muzikale experiment op zijn hoogtepunt was. Yellow Productions, het door Bob Sinclar en DJ Yellow opgerichte onafhankelijk label, werd een essentiële referentie op dit gebied en bracht artiesten voort die internationale aandacht trokken. De auteur van het werk, Bertrand Richard, is geen beginner op het gebied van Franse culturele producten. Hij is een scherpzinnige waarnemer van de muziekscene en analyseert de opkomst van de French Touch met nauwgezetheid en passie. Daarbij ontleedt hij de wortels, invloeden en technologische innovaties die het mogelijk maakten dat deze muziek zich over de hele wereld deed gelden. Hij legt haarlijn uit hoe de elektronische muziek vanaf de jaren 90 evolueerde, hoe de French Touch de tijdgeest veroverde en hoe het uitgroeide tot een waar fenomeen. Wanneer elektronica en digitaal elkaar ontmoeten... Een van de fascinerende aspecten van de French Touch is de opkomst van nieuwe technologieën die de manier waarop muziek wordt geproduceerd ingrijpend veranderden. In de jaren 90 grepen jonge Franse DJs en producers naar nieuwe instrumenten zoals drummachines, samplers en analoge synthesizers om compleet nieuwe geluiden te creëren. In die tijd vormden deze machines een ware revolutie en stelden ze artiesten in staat de grenzen van de traditionele muziek te verleggen en nieuwe klankgebieden te verkennen. Deze technologische innovaties lopen als een rode draad door het boek. Bertrand Richard geeft een gedetailleerd verslag van hoe deze nieuwe machines de creatie van hypnotiserende tracks mogelijk maakten die niet alleen de Franse, maar ook de internationale dansvloeren veroverden. Deze culttracks zijn het resultaat van een kundige mix van technologische innovatie en een passie voor muziek. Vandaag, in een tijd waarin de muziekindustrie op zijn kop is gezet door digitale technologie, is de French Touch erin geslaagd om zich aan te passen en zichzelf opnieuw uit te vinden. Bob Sinclar is een van de beste voorbeelden van dit vermogen om met zijn tijd mee te gaan. Sinds zijn begindagen stopte hij nooit met het verkennen van nieuwe manieren om zijn muziek te produceren en te delen. Hij liep altijd voorop en begreep al vroeg het belang van digitale platforms en sociale netwerken om in contact te blijven met zijn publiek en een nieuwe generatie fans te bereiken. Tijdens de COVID-19 pandemie, toen nachtclubs en festivals stil kwamen te liggen, greep Bob Sinclar de kans om zijn muziek levend te houden. Zijn online DJ-sets waren meteen een succes en trokken duizenden fans van over de hele wereld aan. Deze optredens bewezen dat de French Touch een ruimte van vrijheid en innovatie blijft, die in staat is om zich aan te passen aan de tijd, met behoud van zijn essentie. Bob Sinclar: een artiest voorbij de draaitafels Een van de grote rijkdommen van dit boek berust bij het exclusieve interview met Bob Sinclar, waarin hij alles over zichzelf onthult. Hij vertelt over zijn carrière, zijn invloeden en zijn successen, maar ook over zijn twijfels en zijn persoonlijke overpeinzingen. Bob Sinclar werd pas écht een artiest toen hij in 2005 met zijn wereldwijde hit Love Generation een nieuwe dimensie bereikte in de muziekindustrie. “Daarvoor, in 1995, wisten mensen niet echt wat een DJ was,” zegt hij. Het was rond deze tijd, toen DJ’s zichtbare figuren werden via hun platen en op de radio, dat de French Touch-generatie zijn stempel begon te drukken. Zijn obsessie was het vinden van ‘de perfecte sample’. Het ging om het creëren van een ‘sonische hypnose’, een magie die, als je die telkens weer herhaalt, luisteraars meevoert. Bob Sinclar beschrijft zichzelf als een ‘sound assembler’, naar het voorbeeld van de klassieke muzikant die noten mixt. Voor hem heeft elk geluid een eigen kleur. In de loop der tijd leerde hij hoe je een track kon laten dansen, zonder dat hij zelf ooit in het middelpunt van de belangstelling hoefde te staan. Zijn doel was altijd breder dan dat: de energie behouden en een muzikale reis creëren. “Een geliefde track genereert feestelijke energie, maar als je alleen maar hits draait, stoppen mensen met dansen”, legt hij uit. Een DJ-set moet volgens hem navigeren tussen verschillende emoties – melancholie, vreugde, verdriet – om terug te keren naar die vrolijke energie. Het is deze subtiële wisselwerking tussen terwedenheid en frustratie die een echte muzikale ervaring teweegbrengt. Ondanks een steeds veranderende wereld blijft Bob Sinclar trouw aan zijn zoektocht naar geluiden en emoties en creëert hij sets die de volledige complexiteit van de menselijke energie weerspiegelen. Rijke en gevarieerde getuigenissen Om deze onderdompeling in de wereld van de French Touch te verrijken, verzamelde Bertrand Richard een schat aan getuigenissen van hoofdrolspelers in deze beweging. Muzikanten, DJ’s, producers, journalisten… ze kijken allemaal terug op een tijd waarin Frankrijk het middelpunt vormde van een ware muzikale revolutie. Onder hen vinden we namen terug als die van Dimitri from Paris, Pedro Winter, DJ Gregory, Karel Balas en vele anderen. Zij delen hun herinneringen en hun visie op wat de French Touch volgens hen vertegenwoordigde in zijn beginlagen. Sommigen vertellen hoe de French Touch ontstond uit de underground, toen feestjes en geïmproviseerde raves de enige manier waren om deze nieuwe muziek gehoord te krijgen. Anderen benadrukken dan weer de culturele en sociale dimensie van deze beweging, die gepaard ging met de diepgaande veranderingen van de Franse samenleving in de jaren 90. Deze stemmen helpen ons te begrijpen waarom de French Touch niet alleen zijn stempel drukte op de muziek, maar op de hele maatschappij en hoe hij uitgroeide tot een symbool van emancipatie en creatieve vrijheid. Een boek-object: een visueel en tactiel kunstwerk ‘Bob Sinclar et DJ Yellow : nos 30 ans de French Touch’ is niet louter een boek over muziekgeschiedenis. Het is ook een collector’s item, bedacht door de twee artistieke leiders van het project, Laurent Bismuth en Jonathan Kluger, en uitgever Brigitte Trichet. Het op vinyl geïnspireerde formaat en het hoogwaardige drukwerk maken het tot een uniek stuk. Met een dikte van 4 centimeter en een gewicht van 2,5 kg is het boek een visueel indrukwekkend werk, dat ontworpen is als eerbetoon aan de platenindustrie die gepaard ging met de opkomst van de French Touch. De met zorg gemaakte illustraties bieden een visuele onderdompeling in de esthetiek van de jaren 90 en 2000. Elke pagina vormt een uitnodiging om het tijdperk te herbeleven waarin muziek, kunst en technologie volop in beweging waren. Nostalgie met het oog op de toekomst Voor degenen die heimwee hebben naar de jaren 90 zal dit boek als een ‘Madeleine de Proust’ zijn. Het biedt een reis terug in de tijd aan, naar een periode waarin de dansvloeren dreunden op het geluid van de eerste hits van Bob Sinclar. Maar dit boek blikt niet alleen terug. Het laat ook zien hoe de French Touch met zijn tijd is meegegaan en hoe hij zich aanpaste aan nieuwe technologieën en nieuwe consumententrends. Vandaag de dag wordt muziek niet langer alleen op dansvloeren gedraaid, maar gebeurt dit ook via streamingplatforms en digitale downloads. Deze transformatie, van vinyl naar digitaal, van fysieke feesten naar gedematerialiseerde consumptie, is een van de belangrijkste ontwikkelingen die het boek onderzoekt, waarbij wordt benadrukt dat de geest van de French Touch intact blijft. ‘Bob Sinclar et DJ Yellow: nos 30 ans de French Touch’ is veel meer dan louter een boek over elektronische muziek. Het neemt een fascinerende duik in de geschiedenis van een beweging die een revolutie teweegbracht in de wereld, terwijl het een intieme kijk biedt op een van de grootste ambassadeurs ervan, Bob Sinclar. Door middel van dit retrospectief ontdekken lezers niet alleen de geschiedenis van de French Touch, maar ook de toekomst, aangezien de muziek blijft vibreren en generaties na ons blijft beïnvloeden. Dit boek werd geproduceerd door de Parijse uitgeverij Hemeria, in opdracht van Yellow Productions. ISBN: 978-2-490952-55-7 59 € INCLUSIEF BTW Publicatiedatum: 18 oktober 2024 --- BOB SINCLAR & DJ YELLOW - Hemeria - Paris - 290 x 290 mm - Gardapat Kiara 1.3 150 g/m² - 332 p ELEKTRISCHE DROMEN EN ZANDDUINEN: 60 JAAR MEYERS MANX DUNE BUGGY Weinig voertuigen vallen zo samen met de geest van het avontuur als de Meyers Manx dune buggy. Geboren uit het innovatieve brein van Bruce Meyers in de jaren 1960, was deze speelse buggy met een carrosserie van glasvezel veel meer dan zomaar een nieuw type auto; het was de vonk die een lifestylebeweging ontstak. De ‘little dune buggy’ veroverde meteen de wildere harten met zijn beheersing van zandduinen en rotspartijen. De belichaming van vrijheid, avontuur en gezandstraalde rebellie. Een man met een plan: Bruce Meyers Als iemand in de autowereld zich een “vrije geest” mag noemen, dan is het Bruce Meyers. Met een energie die bijna mythische proporties aanneemt, combineerde Meyers kunstenaar, ingenieur en dromer in één persoon. Bruce is een Tweede Wereldoorlog-veteraan en een Californische surfer. Auto’s zijn voor hem niet alleen machines, maar magische tapijten. Begin jaren ’60 richtte Meyers zijn aandacht op het bouwen van iets radicaals – iets dat moeiteloos en stijlvol over zandduinen zou kunnen glijden, als een surfplank op de golven. In een garage in Zuid-Californië bouwde hij een voertuig dat al snel de harten van strandgangers, off-road liefhebbers en het soort mensen die hun haar graag door de wind laten verwarren, zou veroveren. Zo ontstond de Meyers Manx, een buggy met een glasvezel carrosserie, gebaseerd op een VW. De auto die de categorie van vervoermiddel overstijgt en als het ware een enkeltje Avontuur is. Het hart van een VW, de bouw van een kat Dat de Meyers Manx een buggy is, is niet de enige verklaring voor het revolutionaire karakter van de auto. Het was revolutionair vanwege de manier waarop het werd gemaakt. De meeste auto’s uit die tijd waren massieve brokken metaal, maar Meyers durfde te dromen in glasvezel, waardoor de Manx een lichtgewicht is, gemakkelijk te produceren en eenvoudig te repareren. Perfect dus voor een voertuig dat wel eens van een duin kan tuimelen. En waarom “Manx”? Wel, net als het beroemde kattentras van het eiland Man, dat bekend staat om zijn gebrek aan een staart en wilde natuur, had de buggy van Meyers een compact, staartloos ontwerp met een flinke dosis attitude. Het ontwerp zelf was pure genialiteit. Meyers creëerde een carrosserie met een hoge bodemvrijheid en een korte, stevige achterkant die het zo wendbaar maakte als een go-kart, maar met een robuuster gevoel van avontuur. De Manx was gebouwd op het chassis van de iconische Volkswagen Kever, maar zag eruit als geen enkele Kever die je ooit had gezien. De ronde spatborden en golvende lijnen leken te smeken om een race, een klim, of op zijn minst een paar donuts in het zand te draaien. Vraag eender wie het geluk heeft rijervaring te hebben in een Manx, en ze zullen je hetzelfde vertellen: de auto lacht met geplaveide wegen, daagt obstakels uit en high-fivet de piloot telkens ze samen een heuvel bedwingen. Van duin naar disco Vanaf het moment dat de Meyers Manx het zand raakte, was het al iets van een beroemdheid. Het voertuig kreeg meteen bekendheid in de jaren ’60 dankzij zijn looks, kracht en ongeëvenaarde vermogen om over duinen te dansen. En net zo snel als het de harten veroverde, ging het mainstream. De Manx reed niet alleen; hij deed mee aan wedstrijden. In 1967 nam Meyers de Manx mee naar de Mexican 1000 (nu Baja 1000), en in een coup tegen traditionele off-road voertuigen, won hij, verbrijzelde alle records en vergrootte hij de faam van de buggy. De Manx van Meyers was niet alleen het coolste ding op het zand; het was het snelste. Na verloop van tijd verschenen er speciale edities. Er waren de glittergekleurde Manxes uit het discottijdperk, die glinsterden als de hoofd-discobal van Studio 54. De Manx verscheen in films, tijdschriften en op talloze ansichtkaarten, gespoten in zonsondergangkleuren die schreeuwden “Californië!”. De buggy stond zelfs samen met beroemdheden op de foto, van Steve McQueen tot Elvis. En met elke cameo, elke race en elke foto groeide de Manx van een auto uit tot een cultureel icoon. De Manx Club Het is dan ook geen wonder dat de auto snel een schare trouwe fans verzamelde. In de jaren ’90 evolueerde die liefde naar de Manx Club, die zich richt op het vieren, bewaren en promoten van de Manx-geest. Opgericht met de zegen van Meyers zelf, is de club sindsdien uitgegroeid tot een internationale gemeenschap die jaarlijkse bijeenkomsten organiseert, onderdelen ruilt en verhalen deelt over hun buggy-avonturen. Dus, een autoclub? Een stel mensen die rondhangen en kletsen over een voertuig? De Manx Club doet veel meer dan dat, door de Manx niet alleen als een auto te beschouwen, maar als een beweging. Leden van de club variëren van gezinnen op zoek naar avontuur tot hardcore monteurs die een echte Manx van een mijl afstand kunnen herkennen. Ze delen één gemeenschappelijk kenmerk: een passie voor de unieke, zorgeloze en rebelse aard van de Meyers Manx. En het is dit netwerk van fans die de Manx door de decennia heen heeft geholpen om door te rollen, lang nadat de oorspronkelijke productie werd gestopt. Op een bepaalde manier heeft de Manx Club de buggy onsterfelijk gemaakt, door zijn status als cultureel symbool en, belangrijker nog, als een levensstijl te behouden. Zoals elke goede icon is de Meyers Manx meer dan alleen wielen en een motor geworden. Het werd een merk, een sfeer, een look. De Manx Club en merchandising maakten van de dune buggy een volwaardige levensstijl. Terwijl kinderen opgroeiden met Hot Wheels Manxes in hun speelgoedkisten en tieners hun muren versierden met posters van strandbuggy’s, verankerde de Manx zichzelf dieper in de popcultuur. De merchandise overstijgt het idee van een simpele gimmick; het is een toegangspoort. Elk product bevat een stukje van de Californische droom: een uitnodiging om off-road te gaan, uit de mal te breken en met een beetje meer opwinding te leven. Na verloop van tijd werd de Manx-merchandise meer dan alleen een knipoog naar de auto; het was een signaal naar andere enthousiastelingen, zoals motorrijders doen wanneer ze elkaar opmerken, een manier om te zeggen: “Ik doe ook mee.” Van klassiek naar elektrisch Vandaag de dag is de Meyers Manx niet zomaar een historisch voertuig, noch is het simpelweg een artefact uit de jaren ’60 duincultuur. Het is een nog altijd levend erfgoed, een verzamelpunt voor avonturiers, nostalgiezoekers en degenen die weten dat rijden meer is dan alleen een manier om van punt A naar punt B te komen. Zestig jaar nadat Bruce Meyers zijn iconische dune buggy op het zand losliet, blijft de Meyers Manx zich verder ontwikkelen. Om deze mijlpaal te vieren, heeft het team achter de Manx eerder dit jaar de gloednieuwe Meyers Manx 2.0 Electric onthuld—een model dat het tijdloze ontwerp van de originele Manx behoudt en het elektrificeert voor een nieuwe generatie. Deze eco-vriendelijke draai bewaart de lichtgewicht glasvezelconstructie en legendarische wendbaarheid van de buggy, terwijl de VW-motor wordt vervangen door een moderne elektrische motor die even krachtig als stil is. De Manx 2.0 behoudt de geest van het origineel met dezelfde openlucht sensatie, maar biedt nu een emissievrije rijervaring, waardoor hij perfect is voor strandavonturen in een tijd van klimaatbewustzijn. Zo zorgt de elektrische Manx ervoor dat Bruce Meyers’ droom van avontuur blijft leven—aangedreven door de toekomst, maar onmiskenbaar een Manx. In de feestelijke sfeer is er een nieuw boek uitgebracht dat de rijke geschiedenis en culturele impact van de buggy vastlegt. En dit boek is niet alleen een leeservaring—het is een stukje memorabilia. Vol zeldzame foto’s, verhalen van de vroege duinveroveringen tot de laatste elektrische wederopstanding, en exclusieve interviews, is het boek ontworpen om zowel te lezen als genietend naar te kijken. Trouw aan de opzet van alle Meyers Manx-merchandise, is dit een boek om te koesteren, een bewijs van de blijvende geest van het merk. Stijlvolle geurkaarsen BOOGIE BOUGIE Black Fig & Neroli green leaf, sweet fig, cedar, liquorice, heart notes of neroli blossoms, jasmine, base notes of oakmoss, musk and amber met een LUXUEUZE twist Nu de winter ons allemaal binnen houdt, en we stilaan uitkijken naar de feestdagen, wordt het hoog tijd om ons interieur te voorzien van een vleugje gezelligheid. Met de winterwende in het vooruitzicht, is kiezen voor kaarsen een logische stap. Wie graag wat buiten de lijntjes ‘geurt’, moet daarvoor beslist eens kijken in het mooie aanbod van het Antwerpse Boogie Bougie, de geurkaarsenbrand van Pieter-Jan Boucquaert en Vincent Dardenne. “Boogie Bougie is ontstaan vanuit onze liefde voor geur en het ritueel van het aansteken van een kaars,” vertelt Pieter-Jan. “Het is een moment dat telkens weer zorgt voor sfeer en warmte aan een ruimte. Een fijne kaars maakt van een huis een echte thuis. Met Boogie Bougie wilden we iets creëren dat niet alleen functioneel was, maar ook visueel aantrekkelijk, zodat het een decoratieve waarde heeft in elk interieur.” Voor het prille begin van Boogie Bougie moeten we terug naar Mexico; toen Vincent en ik daar jaren geleden op reis waren, hadden we al het idee geopperd om iets te doen met geuren, maar het plan kreeg pas echt vorm toen we in Mexico zagen dat mensen er verschillende etherische oliën kochten om thuis zelf zeepjes van te maken, heel artisanaal. De geur die ik met die reis associeer is die van rozen. Niet dat ik iets speciaals heb met de geur van rozen, maar toen was die wel alomtegenwoordig. We hebben toen in een enthousiaste opwelling zelf een tiental staaltjes van die etherische oliën gekocht, maar we hebben er uiteindelijk niets mee gedaan. Niettemin, de kiem was gelegd. En vandaag komt de inspiratie voor de collectie van overal. Of het nu op reis is of als we ergens gaan eten of uitgaan, onze ‘geursensoren’ staan aan. Op die manier hebben we een hele verzameling geuren aangelegd waarmee we onze collectie kunnen aanvullen. Voor ons mogen geuren iets bolds hebben, levendig zijn … iets wat je elke dag wil gebruiken. Over geur kan ik echt wel lyrisch worden, omdat het iets is wat je niet kunt vastgrijpen, maar wat wel een grote impact heeft op je leven en je omgeving. Geuren kunnen je op een fractie van een seconde terug transporteren naar een herinnering of naar een moment in je leven. Ik heb dat zelf vaak als ik terug ga naar de kust, waar ik oorspronkelijk vandaankom. Als daar ben, dan merk ik dat de geuren er anders zijn dan in Antwerpen, waar ik nu woon. Dat zilte, gecombineerd met de aanwezigheid van jodium, geeft toch wel iets speciaals. Voor mij zullen de geuren die ik associeer met de zee altijd iets speciaals blijven. Zand, zonnecrème, het zilte … het roept instant herinneringen op van een dagje strand, en de hele zomerse laidback sfeer errond.” Puur natuur! “Al onze producten zijn handgemaakt in ons atelier in Antwerpen, en we gebruiken daarvoor enkel natuurlijke ingrediënten. We gebruiken 100% duurzame sojawas, die we met de hand gieten, zodat iedere kaars met liefde en vakmanschap tot stand komt. Het is onze manier om een steentje bij te dragen aan de zorg voor de natuur. Door resoluut te kiezen voor natuurlijke materialen, zorgen we voor een blijvende geurervaring en creëren we unieke combinaties die aansluiten bij verschillende stemmingen en seizoenen. Onze geurkaarsen en diffusers zijn een uitdrukking van de seizoenen en herinneringen, zoals boswandelingen en zomerse stranddagen. We stellen onze geurmelanges zelf samen en zoeken altijd naar een verrassende twist. De geuren zijn rijk en vullen de hele ruimte, zodat elke kaars een specifieke geurervaring biedt die je niet snel vergeet. Met Boogie Bougie kiezen we bewust voor lokale en natuurlijke materialen. Het was van in het begin ons doel om producten aan te bieden die niet alleen mooi zijn, maar ook bijdragen aan een gezondere leefomgeving.” Yes, sir I can boogie “Over de naam krijgen we nogal wat vragen, ja (lacht). Speels, met een tikje luxe. Het weerspiegelt alleszins hoe we Boogie Bougie in de wereld willen zetten. Luxe hoeft niet altijd serieus of onbereikbaar te zijn: het kan een dagelijks genot zijn, iets om van te genieten in je eigen huis. Wat de vormgeving van onze verpakkingen betreft, hebben we ervoor gekozen om ook daar de lijn van luxe en speelsheid door te trekken: onze kaarsen zitten in stijlvolle aluminium blikjes die in elk interieur passen. Bovendien kun je de blikjes na gebruik hergebruiken, waardoor onze producten niet alleen mooi zijn, maar ook praktisch en duurzaam. De verpakking zelf mocht een bijzondere uitstraling hebben: aangezien het doosje zelf sober is – tin en aluminium met een zwart label – vonden we dat er iets exuberanter uit de hoek mochten komen met de verpakking zelf, kleurrijk, levendig. Toen we onze vormgever vroegen om iets uit te werken, kwam ze al snel met een aantal heel bruikbare voorstellen. De kleuren van de doosjes weerspiegelen de geur van de kaarsen. Zoals Mimosa Darling & Leather, wat refereert naar de bloem zelf, terwijl het oranje van Black Fig & Neroli een associatie oproept met het warme mediterrane klimaat, met een twist van viji en de sinaasappelbloesem (neroli).” Limited Edition Series aanbieden, die inspeelt op de geuren die typisch zijn voor die tijd van het jaar. Voor de winter hebben we bijvoorbeeld drie limited editions. De Silver Suede & Fireplace Haze is een geurkaars met tonen van cypriol, mirre, suède, lavendel, kaneel, heliotroop, guaiacwood, mos, amber, vanille en tonkaboon. Hier brengen de rokerige cypriol, rijke harsachtige mirre en een zachte touch van suède een intense geuervaring die doet denken aan knusse avonden bij de haard. Lipstick Stains & Cinnamon Sins is dan weer een geurkaars met tonen van appel, kaneel, rabarber, kruidnagel, perzik, roos, bruine suiker, sandelhout en vanille. En tenslotte hebben we een Caramel Leather & Incense Innuendo, met tonen van bergamot, roze peper, karamel, ylang ylang, wierook, leer, oud, sandelhout, vanille en muskus. Het zijn stuk voor stuk geuren die het najaarsgevoel perfect belichamen. Mocht ik ze zelf niet maken, ik zou ze zeker in huis halen.” WIN DE WINTERCOLLECTIE VAN BOOGIE BOUGIE! Heb jij een geur die je meteen doet wegdromen? Een vleugje nostalgie, een favoriete herinnering? Vertel het ons! De eerste vijf lezers die hun favoriete geur of geurenherinnering delen via een mailtje naar email@example.com winnen een set van de drie geurkaarsen uit de exclusieve wintercollectie van Boogie Bougie. De geuren Silver Suede & Fireplace Haze, Lipstick Stains & Cinnamon Sins, en Caramel Leather & Incense Innuendo brengen gegarandeerd warmte in huis! Villa H²O een architectonische parel aan de kust Waar begint kunst en eindigt architectuur? Het is een vraag waar de gemoeiden nog al eens van durven op te laaien. Is het Guggenheim Museum in New York een kunstwerk of gewoon een bijzonder gebouw? We gaan de discussie hier niet voeren, maar we willen wel een gebouw introduceren dat de grenzen tussen kunst en architectuur opnieuw defineert: het aan Stéphane Beels brein ontsproten Villa H²O, een architectonisch meesterwerk in Oostduinkerke. Ontworpen door Stéphane Beel – met als bouwheer de familie Haverals, via Martha Atelier – benadrukt Villa H²O niet enkel de schoonheid van het landschap, maar creëert het evenzeer een harmonieuze verbinding met de natuur. Tel daarbij de kunstige interventies van gerenommeerde porseleinkunstenaar Piet Stockmans en het elegante tuinontwerp van Wirtz International en je eindigt bij een viering van de elementen water en lucht, harmonieus verweven in het ontwerp van twee luxe villa’s, op een unieke locatie in de duinen. H. Haverals: “Elke villa biedt ongeveer 450 vierkante meter aan zorgvuldig ontworpen woonruimte, met een focus op comfort en esthetiek. De ruime slaapkamers, moderne badkamers en open woonruimtes gaan naadloos over in terrassen met een adembenemend uitzicht op de zee. Functioneel, zeker, maar de villa’s stralen ook een tijdloze elegantie uit, waarbij elke lijn en elk detail met de grootste precisie is uitgevoerd. De integratie van een zwembad en slimme ruimtes versterkt de luxe van het leven aan de kust. Wat Villa H²O echt bijzonder maakt, is de nauwe samenwerking tussen architectuur en landschap. Het project weerspiegelt de filosofie dat architectuur niet alleen een visuele ervaring is, maar een emotionele connectie met de plek zelf. Villa H²O is een unieke kans voor liefhebbers van architectuur om een stukje van de Belgische kust te bezitten dat zowel esthetisch als ecologisch verantwoord is. De villa’s zijn niet alleen een thuis, maar ook een inspiratiebron voor iedereen die de schoonheid van moderne architectuur waardeert. Het idee achter de architectuur is om als een ‘beacon of peace’ te functioneren, waardoor het een serene plek vormt te midden van de duinen.” Eén villa, drie namen In de realisatie van Villa H²O speelde Martha Atelier – speciaal in het leven geroepen om dit project te realiseren – een cruciale rol. “Het resultaat is een architectuur die niet alleen visueel aantrekkelijk is, maar ook bijdraagt aan een hogere kwaliteit van leven in deze regio. En we durven daarin nu en dan eens stoutmoedige keuzes te maken. Voor Villa H²O lieten we keramiekkunstenaar Piet Stockmans de gevel bekleden met porselein. Innovatief, jazeker. Een wereldprimeur, zonder meer. Het geeft het project alvast een unieke uitstraling.” “Het project weerspiegelt de filosofie dat architectuur niet alleen een visuele ervaring is, maar een emotionele connectie met de plek zelf.” Voor H. Haverals maakt Villa H²O de cirkel mooi rond. “Ik heb tot mijn zestende op de plaats van Villa H²O mijn vakanties doorgebracht. Villa H²O ligt aan een doodlopende straat, op een berg waarvan ik als kind wist dat het de hoogste duin was die ik ooit gezien had. Voor mij voelt Villa H²O als een eerbetoon aan mijn grootouders, een soort van laatste groet. Het enige doel dat we hadden met Villa H²O was om op die berg schoonheid te creëren, als een soort standbeeld dat er altijd zal staan. Het feit dat het ontwerp afkomstig is van Stéphane Beel, samen met Wirtz International en Stockmans, voelt perfect aan. Voor mij zit er een grote symboliek achter. Stockmans komt uit Limburg, Beel uit Oost-Vlaanderen en Wirtz uit Antwerpen. Villa H²O verbindt dus het beste van Vlaanderen, er is een bijzondere liaison, iets wat mijn grootvader, ooit een generaal, ook altijd hoog in het vaandel droeg. Met Wirtz heb ik zelf een bijzondere connectie, via mijn moeder. Thuis zijn we opgegroeid met de creaties van Wirtz, zijn werk was als een tweede natuur voor ons. We gingen vaak naar het Louvre, en de tuinen daar zijn ontworpen door Wirtz. In Villa H²O smelt alles mooi samen.” Het aandeel van Beel “Waarom Beel? Ik heb er een grote bewondering voor”, vertelt H. Haverals. “Toen ik nog in Antwerpen aan de Singel van Léon Stynen woonde, passeerde ik elke dag langs Beels architectuur. Zo is hij in mijn leven gekomen. En aangezien we een aantal gemeenschappelijke kennissen delen, had ik makkelijk toegang. Toen ik voor het eerst langs zijn werk reed, raakte het me niet. Ik begreep het niet, maar op een dag viel het kwartje. Dat was een bijzonder moment. Ik heb hem op een avond gebeld, vrij impulsief, omdat ik een grotere naam aan het project wilde verbinden. Ik vond Stéphane Beel de meest geschikte architect, iemand met aanzien en een naam, en een renomme zoals Horta. Ik wilde dat de naam iets zou toevoegen aan het project en vond het alvast een hele eer dat hij toestemde. En laten we eerlijk zijn, er zit ook een stukje marketing in (lacht). Wat het gebouw, de villa, voor mij moest uitstralen? Mijn enige doel was om schoonheid te creëren door eenvoud. Ik wilde werken met meesters in hun vak. Beel is voor mij een kunstenaar, jazeker. Ik vind de manier waarop hij werkt fascinerend. Ik heb bij niemand zo’n arbeidsethos gezien als bij Beel. Hij is enorm gedreven, bijna pathologisch zelfs, maar het is prachtig om hem aan het werk te zien. Een artiest onder de artiesten. Hij is absoluut een kunstenaar. Hem aan het werk mogen ervaren, is bijzonder straf. Ik vrees dat Beels authenticiteit erg zeldzaam is binnen zijn vakgebied.” ■ VILLA H²O • Handlangers • Gent • 420 x 260 mm • Munken Kristall 1.13 240 g/m² • 56 p De Brits-Caribische kunstenaar en dichter John Lyons heeft meer dan zestig jaar bijgedragen aan de Britse creatieve scène, maar kreeg nooit de juiste erkenning. Tot nu, in 2024. Het Whitworth in Manchester pakte uit met zijn eerste grote retrospectief: John Lyons, Carnivalesque. De tentoonstellingscatalogus, Lyons’ eerste monografie, bevat essays over de kunstenaar, verschillende gedichten van zijn hand en afbeeldingen van meer dan zestig van zijn schilderijen, in tierige kleuren dankzij de geavanceerde druktechniek. We spraken met de curator van de tentoonstelling en mederedacteur van de catalogus, Olivia Heron. Hoe werd de tentoonstelling ontvangen? “Geweldig! Veel bezoekers merkten op hoe mooi en krachtig de schilderijen, tekeningen en prenten zijn. John heeft een ongelooflijke bijdrage geleverd aan de Britse kunst en literatuur, met een bijzonder sterke aanwezigheid in Manchester, waar hij dertig jaar heeft gewoond en gewerkt. We bouwden ook een geweldig programma op rondom de tentoonstelling, waaronder nieuwe poëzie-opdrachten door dichters uit de streek. De tentoonstelling gaat nu op tour en opent in februari 2025 in The Box in Plymouth.” Waarom hebben jullie besloten om een tentoonstelling aan zijn werk te wijden? “Het idee voor een John Lyons retrospectief kwam van Alnoor Mitha, kunstenaar en curator en een oude vriend van John. Hij wees erop dat John al lang een grote tentoonstelling verdiende en dat het Whitworth de perfecte plek zou zijn vanwege Johns lange verbondenheid met Manchester. John Lyons werd geboren en groeide op in Trinidad en Tobago. In 1959, op 25-jarige leeftijd, kwam hij naar het Verenigd Koninkrijk om aan de kunstacademie Goldsmith’s College in Londen te studeren. Daarna volgde hij een lerarenopleiding in Newcastle, voordat hij zich in 1967 in Manchester vestigde. Naast lesgeven aan lokale scholen en hogescholen, ontwikkelde hij zijn atelier als kunstenaar en dichter. Hij exposeerde regelmatig en speelde een vitale rol in de kunstwereld, in Manchester en in het hele land. Met de tentoonstelling en de catalogus hopen we zijn creatieve impact te erkennen en te vieren, en zijn werk aan een nieuwe generatie voor te stellen.” Wat willen jullie bereiken met het boek? “Tijdens het onderzoek voor de tentoonstelling viel het me op dat John Lyons weliswaar vaak werd genoemd in artikelen en boeken naast andere kunstenaars, maar dat er heel weinig interpretatie, analyse of zelfs beschrijving van zijn werk was. Er zijn geen boeken over hem. We vonden het belangrijk dat er iets zou zijn waar mensen naar kunnen verwijzen, iets dat toelaat om meer te weten te komen over zijn werk en artistieke intenties. Met het boek willen we een startpunt markeren, het punt waar kritische verslagen over John aanvangen. Onlangs kreeg hij groen licht voor de financiering van professionele fotografie van zijn oeuvre. Sommige werken werden voor het eerst, of althans voor het eerst in kleur, gefotografeerd. Dit viel samen met de voorbereidingen voor de tentoonstelling. We hebben dus prachtige, nooit eerder gezien afbeeldingen van Johns werk in de catalogus.” “Wat betreft de essays; er is weinig interpretatieve informatie over veel van zijn werk. Het tentoonstellingsverhaal is ontwikkeld in nauwe dialoog met John. Ik leerde de ziel van zijn werk en de verhalen achter de werken kennen door middel van gesprekken. Het was voor ons belangrijk dat het onderzoek en de betekenis die naar voren kwamen niet weer in het niets verdwenen na de tentoonstelling. We wilden een basis creëren voor iedereen, van kunststudenten tot academici, om John Lyons’ werk te ontdekken, ervan te genieten, onderzoek te doen en meer te schrijven over zijn praktijk en kunsthistorische betekenis. Dat is tenslotte zijn nalatenschap.” We hebben het vaak over de omslagen van boeken, maar deze trekt écht wel de aandacht. Hoe zijn jullie tot deze keuze gekomen? “Dat werk is gewoon geweldig! Het is een mooi, dynamisch beeld en het vat ook samen wie John is als kunstenaar. Het heet Zelfportret met Jumbie Bird en Alter Ego (1990) en bevat belangrijke symbolen uit zijn oeuvre. Het werk bevindt zich in de collectie van de Huddersfield Art Gallery, die zo vriendelijk waren om het uit te lenen voor de tentoonstelling. De uil, of jumbie bird zoals hij bekend is in Trinidad en Tobago, is een belangrijk symbool voor John. Het is op een bepaalde manier zijn gids, creatief en spiritueel. Er is ook de jab-jab, een personage uit het carnaval van Trinidad dat lijkt op een nar, die John ziet als zijn alter ego. Jab-jabs zijn strijdlustig, slaan met gevlochten zwepen en zingen luidkeels, waarbij ze de waarheid niet schuwen. Johns persoonlijke versie lijkt speels en vermakelijk, maar is toch gevat, listig en wijs. Hier balanceert de jab-jab op een koord, terwijl John op één been staat en een penseel op het puntje van zijn vinger balanceert. Dit beeld vat samen hoe John het leven als kunstenaar en schilder ziet: risicovol en avontuurlijk. Je moet erin duiken en vertrouwen hebben in je eigen creatieve visie. Als coverbeeld komt het dus op meerdere niveaus samen.” Hoe voelde John zich over het feit dat hij zo lang over het hoofd was gezien, en nu ineens alles tegelijk gebeurt? “John is een zeer optimistisch persoon, dus ik denk dat hij echt blij was dat het eindelijk zo ver was. Het is jammer dat het zo lang geduurd heeft, hij is nu immers 91. In de jaren 80 en 90 maakte hij wel degelijk deel uit van de scène en werd getoond door veel kleinere galerieën en organisaties, waarvan sommigen zijn werk hebben verzameld of in opdracht hebben laten maken, maar veel grote spelers hebben hem niet de nodige aandacht gegeven. Dit heeft een domino-effect op hoe bekend zijn werk is bij latere generaties curatoren, kunstenaars en academici. Maar hij heeft onderweg wel zijn trouwe supporters gehad en krijgt nu eindelijk de bredere erkenning die hij verdient, wat geweldig is.” Was het moeilijk om zo’n lange periode—zestig jaar—toe behandelen? “Voor de vroegere werken was dat inderdaad een uitdaging. John maakt al kunst sinds zijn jeugd. In Trinidad was hij betrokken bij de Trinidad Art Society, waar hij aquarellandschappen en portretten exposeerde. In 1959 verhuisde hij naar Londen om kunst te studeren aan Goldsmiths College. Er is niets bewaard gebleven uit die tijd; hij verhuisde naar het buitenland, en er gaat al eens iets verloren als je in Londen bent met een krap budget en steeds van flat naar flat verhuist. Het zou opvallend zijn als hij dat materiaal meer dan zestig jaar later nog zou hebben! De tentoonstelling begint met werken uit 1964, nadat Johns begon aan de kunstacademie in Londen. Het is een keerpunt voor hem en het markeert zijn overgang van representatiekunst naar abstractie en expressie. De tentoonstelling focust op de kernthema’s van Lyons’ werk: carnaval, en de folklore en legendes van Trinidad en Tobago. De werken in deze zalen dateren van 1985 tot het heden. Een andere zaal volgt de ontwikkeling van zijn artistieke stijl en symboliek van de jaren 60 tot de jaren 2000. Het was moeilijk om de uiteindelijke selectie te maken, omdat John door de jaren heen zoveel geweldig werk heeft gemaakt. Wat we moesten schrappen, was in functie van de ruimte. Er zijn nog steeds meer dan tachtig werken te zien. Over het algemeen voel ik dat het een redelijk compleet verhaal van zijn werk vertelt.” Zijn er kunstwerken waarvan de betekenis in de loop der tijd is veranderd? “Als ik door zijn werk ging, zei ik weleens: ‘Dit doet me denken aan X of ik zie deze vorm erin.’ En hij zou zeggen: ‘Weet je, daar had ik nog niet aan gedacht, maar nu je het zegt…’ Een echt interessant deel van het project was de dialoog met John en zijn idee van creatieve continuitéit, waarbij hij de betekenis van zijn werk voortdurend ziet evolueren, zowel voor zichzelf als voor anderen. Het heeft te maken met zijn intuïtieve benadering van schilderen, waarbij hij zijn onderbewustzijn aanbort. Hij laat aanwijzingen achter voor de kijker, zodat zij manieren kunnen vinden om erin te duiken. Hoe mensen reageren hangt af van hun persoonlijke ervaringen. In veel van Lyons’ werk duikt hij in zijn psyche, dromen en herinneringen, persoonlijke en collectieve culturele ervaringen en verhalen. De beeldtaal die hij gebruikt kan vrij dubbelzinnig zijn. Soms moet je in jezelf zoeken om betekenis te vinden of te interpreteren. Het biedt altijd meerdere mogelijkheden.” Genoot John Lyons ervan om deze stukken uit het verleden opnieuw te bekijken? “Ik denk dat hij het erg nuttig vond om werken terug te zien na twintig of dertig jaar. Hij herontdekt elementen die hij was vergeten en ziet nieuwe dingen in oud werk. Het geeft hem frisse ideeën en nieuwe energie voor wat hij later wil maken. Hij is creatief onstopbaar. Zo schreef hij voor de tentoonstelling drie nieuwe gedichten. We hebben dat niet gevraagd. Hij zei gewoon: ‘Ik ga hier een gedicht over schrijven.’ We hebben ze in de tentoonstelling opgenomen. En ook in het boek.” Graphius gebruikte een speciale zevengangen druktechniek die de vier standaard CMYK-kleuren combineert met oranje, groen en blauw. Welke indruk heb je hiervan? “De kleuren zijn verblijfend. We hebben een volledige oplage laten maken in zevengangen en één in viergangen als vergelijking. Poppy en ik hebben ze allemaal bekeken. In bijna elk geval kozen we voor de zevengangen druk, omdat de kleuren er zo levendig en waarheidsgetrouw uitzagen ten opzichte van de schilderijen. Ze zijn prachtig intens. In sommige gevallen kozen we voor de viergangen druk. De zevengangen versterkt het uiterlijk van het beeld op de pagina, wat perfect is voor John’s levendige kleurenpalet. Maar voor enkele oudere, monochrome werken op papier versterkte het de vergeling van het papier. Dat was fascinerend, maar duidelijk niet wat we wilden! We zouden zeker weer de zevengangen gebruiken. Het resultaat is een prachtig boek dat John en zijn kunstwerken alle eer aan doet.” ■ John Lyons: Carnivalesque was te zien in de Whitworth, The University of Manchester van 10 mei tot 25 augustus 2024. De tentoonstelling reist door naar The Box, Plymouth van 8 februari tot 5 mei 2025. --- JOHN LYONS: CARNIVALESQUE - Alan Ward - London - 245 x 280 mm - 144 p. - Magno Mat 170 g/m² 36 GRAPHUS 37 GRAPHIUS The painting above depicts a scene with three figures: a child, a red demon-like figure, and a green demon-like figure. The child appears to be reaching out towards the red demon, while the green demon stands behind them. The background is filled with vibrant colors and abstract shapes. The painting below features a surreal landscape with a large, glowing moon in the sky. There are several figures in the scene, including a ghostly figure and a creature with a long neck. The overall atmosphere is dreamlike and otherworldly. 39 GRAPHIUS Breid je kleurhorizonten uit met Multicolor drukwerk Bij het drukken van hoogwaardige boeken en tijdschriften is het vastleggen van levendige, levensechte kleuren essentieel om beelden tot leven te brengen. Multicolor drukwerk biedt een doorbraak in kleureproductie door verder te gaan dan de beperkingen van CMYK en extra inktten in oranje, groen en violet toe te voegen. Dit geavanceerde zevengangen proces breidt het kleurbereik drastisch uit, waardoor tot 95% van de Pantone-kleuren kan worden gereproduceerd, die traditionele CMYK-druk niet kan bereiken. Of je nu kunstboeken, fotocollecties of tijdschriften met opvallende visuals produceert, Multicolor drukwerk zorgt ervoor dat elk beeld wordt weergegeven met ongeëvenaarde helderheid en diepte. Het resultaat is een levendigere en nauwkeurigere weergave van het oorspronkelijke kunstwerk of de foto, met verbeterde toonbereiken en soepelere overgangen. Bij Graphius passen we deze geavanceerde technologie toe om foutloze resultaten te leveren in verschillende drukformaten. Onze experts beheren het hele proces intern, van kleurenscheiding tot drukwerk, om consistente kwaliteit en precisie te waarborgen. Voor meer informatie over hoe Multicolor jouw volgende boek- of tijdschriftproject kan verbeteren, neem contact op met uw Graphius-vertegenwoordiger. Graphius Group staat bekend als een van de toonaangevende drukkerijen in Europa, met een sterke focus op innovatie en klantgerichtheid. In een snel veranderende wereld, waar digitale tools en efficiëntie steeds belangrijker worden, zet Graphius in op oplossingen die niet alleen inspelen op de noden van vandaag, maar ook de toekomst in gedachten houden. Dankzij twee krachtige online platforms – iQuest en Belprinto – biedt Graphius zijn klanten een gebruiksvriendelijke en flexibele manier om drukwerk te bestellen en beheren. We spraken met Lauren Cockhuyt, verantwoordelijke voor beide platforms, over de unieke voordelen en mogelijkheden die deze tools bieden. Innovatie bij Graphius Group Lauren steekt meteen van wal: “Wat Graphius zo innovatief maakt, is dat we continu ons machinepark vernieuwen met de nieuwste technologieën. Automatisatie is daarbij cruciaal, en we zetten sterk in op AI om processen verder te optimaliseren. Onze online tools spelen hierin een sleutelrol.” De drang naar innovatie blijkt uit elk aspect van de organisatie, van de productievloer tot de online klantenservice. “We luisteren constant naar onze klanten, hun feedback is onmisbaar om onze tools te verbeteren en te laten aansluiten bij hun verwachtingen. Dankzij automatische mails na elke bestelling en regelmatige nieuwsbrieven vragen we actief om feedback. Zo blijven we scherp op de wensen van de klant.” iQuest: Maatwerk voor de klant Het iQuest platform is volgens Lauren een perfecte illustratie van hoe Graphius innovatie toepast om de klantenervaring te verbeteren. “iQuest is een portaal dat volledig op maat van de klant gemaakt wordt,” legt ze uit. “Het platform maakt het mogelijk voor bedrijven om al hun marketingmateriaal op één plek te beheren en te bestellen. Of het nu gaat om visitekaartjes, brochures of posters – alles is ontworpen om snel en efficiënt te werken.” Wat iQuest uniek maakt, is de mate van personalisatie die het biedt. “Een goed voorbeeld is hoe we voor sommige klanten visitekaartjes aanbieden in een vast template. De klant voert simpelweg de benodigde informatie in, zoals naam en e-mailadres, en ziet direct een preview van het kaartje in de huisstijl van het bedrijf. Geen gedoe meer met grafisch ontwerpers voor elke kleine aanpassing.” Dit bespaart tijd en moeite voor de klant, en het resultaat is een consistentere merkbeleving. Lauren voegt toe dat het systeem ook geschikt is voor bedrijven die grotere oplages bestellen. “Veel bedrijven willen bijvoorbeeld brochures in bulk laten drukken en in afroep laten leveren. Dat kan via iQuest allemaal automatisch geregeld worden. Het systeem zorgt ervoor dat alles vlekkeloos wordt geleverd, precies zoals de klant het wil.” De kracht van iQuest ligt niet alleen in de efficiëntie, maar ook in de nauwkeurige afstemming op de behoeften van elke klant. “Voor elk iQuest-platform zitten we met de klant samen om te begrijpen wat hun specifieke noden zijn. We passen het platform aan zodat het voor hen zo eenvoudig mogelijk is om hun drukwerk te beheren en bestellen.” Belprinto: Gebruiksvriendelijke webshop Waar iQuest maatwerk biedt voor grotere bedrijven, richt Belprinto zich op een breder publiek. "Belprinto is een online platform dat zowel B2B- als B2C-klanten de mogelijkheid biedt om zelfstandig drukwerk te bestellen," vertelt Lauren. "Het grote verschil met iQuest is dat Belprinto geen maatwerk vereist. Het is een intuïtieve webshop waar klanten hun producten kunnen configureren en bestellen wanneer het hen uitkomt." De klantreis bij Belprinto is eenvoudig en transparant. "Klanten kiezen hun product, zoals flyers, affiches of zelfs hardcover boeken, en uploaden hun druk klaar bestand. Vervolgens kunnen ze de levertijd en eventuele afwerkingen selecteren. Het hele proces is ertop gericht om de klant zoveel mogelijk controle te geven." Lauren benadrukt dat Belprinto vooral aantrekkelijk is voor kleinere ondernemers en particulieren die snel kwalitatief drukwerk nodig hebben. "Omdat alles geautomatiseerd is, kunnen we scherpe prijzen en snelle levertijden aanbieden, zonder in te boeten op kwaliteit. Het platform is zo ontworpen dat zelfs mensen zonder ervaring met drukwerk gemakkelijk hun bestelling kunnen plaatsen." Een ander belangrijk voordeel van de online platforms is de automatisering van het bestelproces. "Bij Belprinto hoeft de klant niet te wachten op offertes of bevestigingen," legt Lauren uit. "Alles gebeurt in real-time: van het kiezen van specificaties tot het ontvangen van een track en trace voor de levering. Dit zorgt ervoor dat de klant altijd precies weet wanneer hun bestelling aankomt." Belprinto biedt klanten eveneens veel mogelijkheden voor maatwerk. "We hebben onlangs de optie toegevoegd om drukwerk op maat te snijden, zodat klanten niet langer beperkt zijn tot standaardformaten. In de toekomst willen we nog meer opties toevoegen, zoals spoedleveringen en een gepersonaliseerd portaal voor terugkerende klanten." Digitale Drukwerkoplossingen voor iedereen In een wereld waar snelheid en efficiëntie steeds belangrijker worden, biedt Graphius met iQuest en Belprinto precies wat moderne bedrijven nodig hebben: slimme, digitale oplossingen die het bestelproces van drukwerk vereenvoudigen. Met iQuest krijgen bedrijven een op maat gemaakt platform, waardoor het beheren van hun drukwerk niet alleen efficiënter, maar ook consistentier wordt. Voor wie op zoek is naar gebruiksgemak zonder maatwerk, biedt Belprinto een eenvoudige webshop waar alles – van configuratie tot bestelling – volledig geautomatiseerd verloopt. Of je nu een groot bedrijf bent of een zelfstandige ondernemer, met deze platforms hoef je niet te wachten op offertes of bevestigingen. Alles is gericht op snelheid en eenvoud, zodat je altijd het drukwerk krijgt dat je nodig hebt, precies wanneer je het nodig hebt. Graphius Group versterkt zijn aanwezigheid in het VK met een tweede overname De kogel is door de kerk: Park Communications, onderdeel van de Graphius Group, heeft de Londense drukkerij Geoff Neal Litho overgenomen. Deze strategische zet versterkt onze aanwezigheid in het Verenigd Koninkrijk, onze derde grootste markt. “Een perfecte match” Geoff Neal Litho, opgericht in 1976 en gevestigd in Feltham nabij Heathrow, is een gevestigde naam in de Britse drukkerijsector. Het bedrijf heeft onder leiding van Sam Neal een sterke reputatie opgebouwd voor hoogwaardig drukwerk en direct mail-diensten. Met een jaarlijkse omzet van £11 miljoen en een team van 45 medewerkers zal Geoff Neal Litho zelfstandig blijven opereren, ondersteund door het ervaren managementteam. Heath Mason, CEO van Park Communications, is enthousiast: “Geoff Neal Litho heeft een sterke reputatie voor kwaliteit en betrouwbaarheid, en is een perfecte match voor Park Communications. We zijn verheugd om de krachten te bundelen met het team rond Sam Neal en zo samen de toekomst van het bedrijf vorm te geven.” Sam Neal, CEO van Geoff Neal Litho, deelt dit sentiment: “De gedeelde cultuur tussen Graphius, Park en Geoff Neal is gebouwd op oprechte zorg voor de belanghebbenden. Dat geeft me veel vertrouwen in wat er voor ons ligt. Ik ben enthousiast om Geoff Neal verder te laten groeien binnen de Graphius-familie.” Nieuwe kansen ontsluiten Deze overname versterkt niet alleen de positie van Graphius in het VK, maar opent ook spannende mogelijkheden voor synergie. Door de expertise van Geoff Neal Litho te combineren met de ultramoderne productievoorzieningen van Park Communications in Beckton, Londen, kunnen we onze klanten een nog breder dienstenaanbod en grotere efficiëntie bieden. Zoals altijd blijven we ons inzetten voor de uitmuntendheid die u van Graphius gewend bent. En met Geoff Neal Litho als onderdeel van de familie, ziet de toekomst er absoluut hires uit! Heath Mason, Sam Neal en Alison Branch EEN BOEK ALS WELKOMSTGESCHENK Zeg het met een bloemetje. Of neen, zeg het met een boek. Als Stad Antwerpen nieuwe investeerders, belangrijke buitenlandse gasten of genodigden verwelkomt, gebeurt dat niet enkel met een doosje Antwerpse handjes of een boeketje bloemen. Gasten krijgen er het mooie vormgegeven welkomboek ‘A Warm Welcome’, waarin alle troeven van de stad aandacht krijgen. Tekent verantwoordelijk voor dit bijzondere boekenproject: Sofie Hennen, communicatiespecialist B2B, en haar collega’s. In haar functie ondersteunt Sofie Hennen haar Business en Innovatie-collega’s bij het uitdenken van communicatieplannen om investeerders en ondernemers aan te trekken. “Het aantrekken van investeringen draait niet alleen om cijfers”, zegt ze. “Het gaat ook om het creëren van een aantrekkelijke en overtuigende boodschap over wat Antwerpen te bieden heeft. Het zijn mijn collega’s bij de afdeling Business & Innovatie die verantwoordelijk zijn voor het directe contact met potentiële investeerders, meestal internationaal opererende bedrijven. Als internationale/nationale bedrijven of ondernemers voor de keuze staan om zich ergens te vestigen, is het onze taak om ze te overtuigen om naar Antwerpen te komen in plaats van naar een andere stad. Daarom werken mijn collega’s bij Business en Innovatie aan dossiers waarin de sterke punten van de stad worden gepresenteerd, ondersteund door relevante statistieken en gegevens. Dat gaat bijvoorbeeld over het benadrukken van de belangrijkste troeven van Antwerpen: na Houston de tweede grootste chemische cluster wereldwijd en de grootste in Europa, de Port of Antwerp-Brugge, die de op één na grootste van Europa is, de diamant-, gezondheids- en modesector etc.” De talloze troeven van de stad “We gebruiken heel diverse communicatiekanalen om Antwerpen te positioneren en ondernemers te informeren”, vertelt ze verder. “Linkedin, de Engelstalige website Business in Antwerp en ons Instagram (#ondernemeninantwerpen) en Facebookkanaal (OndernemeninAntwerpen) spelen een centrale rol in onze strategie. Het zijn de platforms bij uitstek waarmee we de stad kunnen positioneren als een aantrekkelijke plek voor zakelijke investeringen. Daarnaast kunnen we een beroep doen op de informatieve website, Ondernemen in Antwerpen, waar we ondernemers kunnen informeren over onder andere subsidies en financiële steunmaatregelen. Ik vind het een leuke uitdaging om de stad te ‘verkopen’ op basis van de unieke kwaliteiten die Antwerpen te bieden heeft. En ik krijg veel voldoening van de samenwerking met interne ‘klanten’.” Welkom in Antwerpen “Wij beschouwen het Welkomboek als onze corporate brochure, die bedoeld is als een eerste kennismaking met de stad,” zegt Sofie. “We vertelden vroeger te veel vanuit de stad zelf, nu zijn we ervan overtuigd dat het sterker is om ons verhaal door derden te laten vertellen. Dat zijn echt de ambassadeurs voor onze stad. Het zijn daarom de ondernemers die aan het woord zijn over de reden waarom ze hier investeren of ondernemen. Waarom blijven ze hier, wat maakt het hier interessant? Om deze vragen te beantwoorden, hebben we in het begin van de brochure expats aan het woord gelaten die de lezer welkom heten, en vertellen waarom ze hier wonen en werken. Anderzijds laten we per hoofdstuk een ondernemer aan het woord die zijn visie deelt over “In Antwerpen heb je niet enkel een sterke economie, maar ook een mooie cultuursector, lekker eten, een bruisende winkelstad en fashion die het internationaal goed doet … Het is een kleine stad, maar je hebt hier alles.” ondernemen in Antwerpen en waarom hij of zij precies onze stad gekozen heeft. Voor het hoofdstuk ‘Haven’ is dit bijvoorbeeld Jacques Vandermeiren, voor het hoofdstuk ‘Food & Culture’ Sofie Van de Velde van galerij Sofie Van de Velde... Deze persoonlijke inzichten en adviezen, die in de verhalen naar voren komen, bieden een praktische en inspirerende blik op het leven en ondernemen hier. Zo krijgt de lezer ook een idee van de quality of life die je hier vindt. In Antwerpen heb je niet enkel een sterke economie, maar ook een mooie cultuursector, lekker eten, een bruisende winkelstad en fashion die het internationaal goed doet ... Het is een kleine stad, maar je hebt hier alles. ‘A Warm welcome’ is een veelzijdig pakket, waarin we Antwerpen beschrijven als een “pocket-sized metropolis.” Soft- en hardcover Het Welkomboek bestaat in twee versies, met een soft- en een hardcover. “Dat gebeurde op verzoek van Externe Relaties”, aldus Sofie. “Zij ontvangen regelmatig officiële gasten, zoals ambassadeurs, en geven dan een attentie. ‘A Warm welcome’ is bedoeld als eerste kennismaking met onze stad. Als er bijvoorbeeld een belangrijke spreker is, dan geven we ook een hardcover. Het is een chique uitgave, waarvan we er maar honderd hebben laten drukken. We moeten er dus wel zorgvuldig mee omgaan. Voor het boek hebben we samengewerkt met het contentbureau Propaganda. We zijn uitgegaan van het ‘Antwerpen heet je welkom’-idee. Iedereen heeft een verhaal te vertellen, ook ondernemers, organisaties etc. Het geeft de mens achter de functie en de organisatie een gezicht. En aangezien verhalen een gevoel kunnen oproepen bij de lezer, of iets kunnen losmaken, was de keuze vrij snel gemaakt. Het moest menselijk zijn. En dat zie je ook weerspiegeld in de fotografie: minder foto’s van de stad, en meer van de mensen zelf, in hun werkomgeving of de stad zelf. Het idee om de hardcover in ons stadsrood te maken met een diepdruk kwam ook van hen. Voor de softcover hebben we een driehoekje aan de achterkant toegevoegd, zodat we daar iets extra’s kunnen insteken. De reacties? “Buitengewoon positief,” zegt Sofie enthousiast. “We merken dat het boek veelvuldig wordt gebruikt, wat ons heeft doen kiezen voor een herdruk. Het is geweldig om te zien dat onze collega’s het boek actief gebruiken en graag weggeven. De reacties van buitenstaanders, zoals bezoekers en andere belanghebbenden, zijn erg goed. Voor ons is dat ontzettend waardevol, want het bevestigt dat al het werk dat we in dit project hebben gestoken zijn vruchten afwerpt.” Wat betreft de keuze voor Antilope De Bie: dat is een samenwerking die al jarenlang bestaat. Een waar we heel blij mee zijn én die werkt, want niet iedereen kan de technische kwaliteit leveren die wij nodig hebben. Het drukproces is immers complex en vereist speciale afwerkingen, zoals de specifieke binding die we voor dit boek hebben gebruikt. Antilope De Bie heeft dat uitstekend gedaan; het hele proces verliep bijzonder soepel.” In een wereld die elke dag sneller lijkt te gaan, is een bezoek aan Piet De Moors Gentse stek een welkome halte. De Moor bracht onlangs via Skribis het mooie reisverslag met tekeningen ‘Gebinte van een buiging’ uit, ontstaan na een vijf weken durende reis naar Japan. Bijzonder aan die reis was dat De Moor zich vijf weken quasi afsloot van de wereld. Hij nam geen telefoon mee, koppelde zich los van het online leven en had enkel een reiswekker op zak. De Moor is wat je noemt ‘onthecht’. In een wereld die geregeerd wordt door technologische vooruitgang en digitalisering, kiest hij ervoor om enkel te leven met wat hij echt nodig heeft. In zijn Gentse onderkomen geen overdaad aan luxe, wel veel boeken. Een auto, fiets, wasmachine, droogkast, tv, vaatwasmachine, koelkast … heeft hij niet. En een paar jaar geleden deed hij ook zijn bed van de hand. “Even wennen, maar ik slaap nu beter dan ooit, en heb minder last van mijn rug,” zegt hij. “Het klinkt voor een buitenstaander vreemd dat hier geen bed of een koelkast staat. Ik woon in centrum-Gent. Op amper vijf minuten vind ik gekoelde producten in talloze winkels. Voor mij werkt het prima zo.” Toen ik hier binnenkwam, was het eerste wat opviel de hele rij met – naar ik vermoed – reisdagboeken. ‘Gebinte van een buiging’ krijgt wellicht nog opploping. “Ja, je zou het ‘Gebinte van een buiging’ kunnen beschouwen als een prelude op een groter werk. Het is mijn bedoeling om aan de slag te gaan met alle verhalen en schetsen die ik doorheen de tijd verzameld heb. En dat zijn er nogal wat. Het is nog even wachten tot mijn pensioen, en dan kan ik eraan beginnen. Ik ben al sinds mijn achttiende aan het tekenen, schrijven en observeren. En daarin is verwondering de rode draad. Als ik om me heen kijk, begrijp ik de wereld niet altijd. Wat is dit allemaal? Wat doe ik hier? Door te schrijven krijg ik misschien iets meer grip op die vragen, al blijven ze natuurlijk altijd hangen. Maar dat is juist het boeiende: die constante zoektocht.” Op zoek in een digitale wereld Zijn werk als docent aan de kunsthumaniora Sint-Lucas in Gent voedt zijn creativiteit nog verder. “Wat ik zelf leer en ervaar, geef ik door aan mijn studenten. En het mooie is dat zij, net als ik, op zoek zijn. Ze willen verzamelen, uitwerken, hun eigen ervaringen vastleggen. We zijn samen bezig met hetzelfde proces van ontdekken en creëren. Ik vind die wisselwerking onzettend waardevol. Het mooie is dat mijn studenten niet zomaar iets willen maken, maar echt vanuit hun eigen ervaring willen werken. Ze willen proeven van het leven, van kunst, van wat het betekent om iets tastbaars te creëren. En dat raakt me, want dat is ook wat mij drijft. Het proces van observeren, leren, uitwisselen en groeien houdt ons allemaal scherp.” Als ‘Gebinte van een buiging’ iets doet, dan is het wel de lezer verplichten tot vertragen. “Het mag allemaal wat minder, minder luid en vooral minder snel. ‘Gebinte van een buiging’ begon als een maand lange reis naar Japan, maar het werd uiteindelijk veel meer dan dat. Zoals ik voor elke reis doe, had ik nu ook mijn schetsboek bij, waarin ik elke dag tekende en schreef. Zonder het echt te beseffen, creëerde ik een soort visueel dagboek. Na een maand keek ik terug en dacht ik: wauw, dit is wat je kunt vastleggen als je jezelf de tijd en ruimte geeft om echt te observeren en te creëren. Ik realiseerde me dat ik al 40 jaar aan het kijken, schrijven en schetsen was. Zonder er ooit bewust mee te stoppen, is het altijd al een deel van mijn leven geweest. Wat mij vooral fascineert, is hoe we telkens proberen het voorbijgaan van de tijd te vangen, vast te houden. In principe doe ik dat door te schrijven en te schetsen ook: het moment grijpen, het vastleggen in een vorm die blijft, zelfs wanneer herinneringen vervagen of vervormen. Als ik terugkijk op wat ik twintig of dertig jaar geleden heb geschreven, dan verbaast me dat soms, en word ik een vreemde voor mezelf. Je bent niet meer de persoon die je toen was, en toch sluiert van die oude ik nog heel wat door in het heden. Ik vind dat een boeiend proces. De snelheid waarmee we leven – altijd onderweg, altijd gehaast – doet ons vergeten hoe waardevol het is om even stil te staan. In plaats van met de fiets te racen, zouden we meer moeten wandelen. En in plaats van constant te sms’en, zouden we echt met mensen moeten praten. Dat is wat ik wil laten zien met dit boek. Niet omdat ik iets wil bewijzen, maar omdat ik het gevoel heb dat het nu de juiste tijd is om de inzichten die ik onderweg heb opgedaan te delen.” Je reisde door Japan zonder smartphone, computer of wat dan ook. In een hoogtechnologische samenleving als die van Japan moet je wel opgevallen zijn. “Ik had er enkel een wekker met batterijen om op tijd de trein te halen (lacht). En als ik ergens een probleem had, vond ik altijd wel iemand die me hielp. In een technologisch geavanceerd land als Japan voelde het bevrijdend om het zonder al die hulpmiddelen te doen. Ik werd er echt blij van, ook omdat ik altijd een aversie gehad heb tegen die niet te stuiten technologische evolutie. Ik had nooit gedacht dat die zo’n impact zou hebben op ons dagelijks leven. Op reis kon ik daar bewust van wegstappen en vertrouwen op de mensen om me heen. Dat leerde ik ook in Japan: als iemand iets tegen je zegt, vertrouw erop. Natuurlijk had ik ook mijn twijfels en momenten waarop ik dacht het beter te weten, maar uiteindelijk ervaar je een diep vertrouwen in de ander. Het voelt alsof je eindelijk loskomt van je westerse manier van denken. Na drie weken reizen voelde ik me los van mijn roots. De laatste twee weken waren echt een juweel; ik voelde me heel vrij. Die hele periode zit in mij gegrift, als iets kostbaars dat niemand me ooit nog kan afnemen. Meer nog: ook al sprak ik de taal niet, toch ontwikkelde ik een soort gelukservaring. Een diep vertrouwen in het leven en de mensen om me heen. We zijn allemaal bezig met dezelfde vragen: wie ben ik, waar kom ik vandaan, waar ga ik naartoe? En Japan heeft me laten zien dat, zelfs met de constante dreiging van natuurrampen zoals aardbevingen en tsunami’s, mensen daar niet panikeren. Ze zijn voorbereid en accepteren dat het leven doorgaat, zelfs als alles kapot gaat. Dat is een heel groot contrast met hoe wij tegenover het leven staan. In het Westen gedragen we ons soms als drama queens. We maken overal een groot probleem van, terwijl de Japanners tegenslag of calamiteiten meer zien als een deel van het leven. Ze beginnen gewoon opnieuw, zonder gedoe. De schoonheid van de natuur en cultuur in Japan heeft me diep geraakt. De geduldige omgang met de tienduizend dingen, samen met de geschiedenis van het land, met de impact van de atoombommen op Hiroshima en Nagasaki; het heeft me allemaal een ander perspectief gegeven op oorlog en menselijke interactie. Mijn ervaringen hebben me doen beseffen dat echte rijkdom niet in materieel bezit zit, maar in de verbinding met mezelf en anderen.” Misschien een voor de hand liggende vraag: waarom Japan? “Ik reis al twintig jaar. Na mijn scheiding ontdekte ik de waarde van reizen. Eerst waren het kortere trips, naar Polen, Roemenië, Bulgarije… Later werden het langere reizen, naar Peru, Nepal, India. En toen kwam Japan. Ik lees al jaren Japanse literatuur, en de kunst fascineert me al lang. Het is een cultuur die zo ongelooflijk rijk is, zo diep geworteld in tradities en natuurlijke subtiliteiten. De groene eilandarchipel, het heldere water van de oceaan eromheen… Het klimaat, die fijne, zachte regen die de planten laat glanzen. Het leek bijna onwerkelijk. En dan dat maniakale perfectionisme van de Japanners, dat geduld en die beheersing. Ongelooflijk. Maar er is ook een andere kant. Het werkethos, bijvoorbeeld. Het idee dat je niet naar huis gaat voordat je baas vertrekt – dat zou hier nooit werken. Je ziet dat ook in kleine dingen, zoals een vrouw die de hele dag meticuleus dezelfde rubberband van een roltrap stond te poetsen. Trots rechtop. Indrukwekkend, maar ook extreem.” Je vertelde het net: Japan was niet je eerste solo-reis. Waarom kies je ervoor om alleen te reizen? “Omdat ik het zo graag doe (lacht). Neen, alle gekheid: alleen reizen heeft me als mens veranderd. Wanneer je met iemand anders reist, is de dynamiek anders. Wat ik in Japan ontdekte, was dat eenzaamheid uitnodigt tot zelfreflectie. Als ik met iemand anders was geweest, zou ik deze verbinding met mezelf misschien niet hebben kunnen ervaren. Ik zou het iedereen aanraden, zeker jongeren. Hoe mooi zou het niet zijn om elke jongere voor hij aan zijn studies begint te verplichten om minstens één week alleen op reis te gaan? Of een jaar? Ik ben ervan overtuigd dat dit veel zou verhelpen aan de angst en het wantrouwen in onze samenleving. En dat het verkennen van andere culturen ons helpt om beter te begrijpen wie we zijn.” Wil je Piet De Moor zien optreden, voorlezen en op de piano improviseren? Neem dan een kijkje op de kalender op www.pietdemoor.be “Als ik om me heen kijk, begrijp ik de wereld niet altijd. Wat is dit allemaal? Wat doe ik hier? Door te schrijven krijg ik misschien iets meer grip op die vragen, al blijven ze natuurlijk altijd hangen. Maar dat is juist het boeiende: die constante zoektocht.” SKRIBIS Uitgeefbegeleider Rafaël Adriaen: “Je kunt SKRIBIS situeren tussen een klassieke en een online uitgeverij in. Bij een klassieke uitgeverij is het doorgaans niet de auteur die de investering maakt, maar de uitgeverij zelf. Al dragen de laatste jaren niet alle klassieke uitgeverijen nog alle kosten alleen. Het grote verschil met SKRIBIS is dat dat de rechten en beslissingen bij ons volledig bij de auteur liggen. Auteurs staan dus wel in voor de initiële investering, maar dat geeft hen meer vrijheid. Mensen die bij ons aankloppen, willen hun werk in eigen beheer uitgeven, maar met de begeleiding die je bij een klassieke uitgeverij verwacht. Samenwerken met SKRIBIS houdt in dat de auteur alle rechten behoudt en – in principe – alle inkomsten bij de verkoop. Bovendien geven ze hun publicatie niet uit handen, maar worden ze bij elke keuze betrokken; wij gaan enkel verder als we het akkoord krijgen van de auteur.” Wij ontzorgen, van het eerste contact tot het moment dat de boeken aan de deur geleverd worden. Dat is de basisservice. Heeft de auteur nood aan een schrijfcoach, eindredactie of een vormgever van het binnenwerk en de cover, dan bieden wij die diensten ook aan, in samenwerking met professionele freelancers. SKRIBIS is er voor iedereen. Het spreekt dat we aan kwaliteitsbewaking doen – manuscripten moeten vlot leesbaar zijn en mogen niet aanzetten tot discriminatie, haat, etc. – maar we zijn minder streng dan een klassieke uitgeverij. SKRIBIS is een uitgeverij die mensen professioneel én persoonlijk wil begeleiden. En die beginnen bij het indienen van het manuscript en eindigen bij het leveren van de boeken bij de deur en verkoop via de webshop, met daartussen talloze opties.” ‘Birth, school, work, death’ is niet de titel van een obscuur boek dat we bij Graphius lieten drukken, maar wel van een song van de alt-rockband The Godfathers. Een ironische knipoog naar hoe ons leven opgebouwd is uit vier grote momenten. Is dat zo? Uiteraard niet, maar soms lijken we ons leven wel te leiden van groot moment naar groot moment. Van werken naar een welverdiend pensioen. En dan: stop machine. Dat het leven gerust uit meer mag bestaan dan een aaneenrijging van ‘grote momenten’ tonen Hans Pauwels en Reinhilde Gielen in hun bijzondere en indrukwekkende foto/verhalenboek Aesthetic Nomads. “Elk jaar laten we België achter ons om een paar maanden als nomaden in het buitenland te leven en te werken,” vertelt Hans. “We duiken diep in de verhalen achter het alledaagse en geven onszelf de tijd om op ontdekking te gaan, te fotograferen en te schrijven. Het voelt alsof we telkens opnieuw een verborgen wereld ontsluiten. En telkens opnieuw brengen onze reizen ons naar authentieke plekken waar het leven nog écht geleefd wordt, en ontmoeten we er bijzondere mensen die ons inspireren. Dit alles hebben we vastgelegd in Aesthetic Nomads, een kroniek van 20 jaar aan unieke ervaringen.” “Wat mij altijd heeft gefascineerd, is hoe licht door het accentueren van een detail van iets heel gewoons iets prachtigs kan maken,” zegt Reinhilde. “Waar mij zit schoonheid in de manier waarop licht een bepaalde vorm, een kleur of een materiaal tot leven kan wekken. Ik beschouw licht als de eerste prikkel die schoonheid tot leven brengt. Ik heb vanuit mijn werk in de modewereld – waar ik altijd op zoek moest naar nieuwe vormen en details – geleerd om schoonheid te zien of te proberen te ontdekken in het onverwachte. Ik kan echt lyrisch worden over licht (lacht). Als we ergens ter plekke zijn, streef ik er steeds naar om ons niet te veel te laten leiden door de directe route naar deze of gene bestemming. Ik wil me door het licht laten leiden. En dan gebeurt het dat we op een heel andere plek belanden dan wat we eerst in gedachten hadden. Maar het brengt ons altijd verrassende, mooie ontdekkingen.” Hans: “Een heel mooi voorbeeld van zo’n plek is het Schotse Isle of Bute. Een prachtig eiland met een heel bijzondere dramatische sfeer, zeker bij donker weer. Dan zie je hoe de wolken het landschap veranderen en in een heel aparte romantische gloed onderdompelen. Het zijn net die wisselende luchten die het landschap zoveel interessanter maken dan gewoon zonlicht. Voor ons zijn dat soort momenten, waar het licht en de omgeving samenkomen om iets speciaals te creëren, de essentie van schoonheid.” Reinhilde: “Het geeft zo’n enorme energie wanneer het licht wel klopt, en wanneer je het moment weet te vangen. Dat gevoel wilden we met dit boek delen, zonder dat het ooit de bedoeling was om commercieel of perfect te zijn. Het is gewoon een weerspiegeling van onze manier van kijken naar de wereld.” Wie kijkt, ziet schoonheid “Het is altijd een uitdaging om het beeld dat je in hoofd zitten hebt zo goed mogelijk vast te leggen in een foto,” gaat Reinhilde verder. “De realiteit laat zich niet altijd makkelijk registreren. Een foto is altijd een benadering van … En het licht van de computer en de druktechnieken maken dat de realiteit soms veraf ligt van wat ik heb ervaren. Er zijn zoveel stappen in het proces – van de opname tot het drukken – die allemaal hun eigen impact hebben.” Terwijl je zou denken dat je met de techniek die vandaag voorhanden is de realiteit net wel zou moeten kunnen vatten. Hans: “Ik vind dat we in deze tijd met hypergeperfectioneerde camera’s soms de ‘ziel’ van de foto’s verliezen. De technische vooruitgang heeft talloze voordelen, maar het lijkt alsof het de emotie en de poëzie uit het beeld haalt. Bij sommige van die oudere beelden, genomen met minder geavanceerde apparatuur, voel je wel nog de poëzie en de diepgang. Ik mis dat nu vaak.” Reinhilde: “Wat ik mis, is de vertraging die inherent met het medium fotografie verbonden is. Je moet tijd nemen om te kijken. De moderne kijker is anders. Met de vluchtigheid van beelden op sociale media – waar mensen letterlijk met een swipe door hun feed gaan – is het moeilijk om een gevoel van poëzie en betekenis over te brengen. Een goed beeld heeft tijd nodig om te worden begrepen en gewaardeerd, zowel in de creatie als in het ontvangen.” Zou je ‘Aesthetic Nomads’ – zowel het project als het boek – kunnen beschouwen als een ‘oefening in vertragen’? Reinhilde: “Ik denk het wel. Ik heb de indruk dat we vandaag veel te snel gaan. We consumeren meer, maar genieten minder. Het nu-nu-nu dicteert de orde van de dag. Terwijl de traagheid zo mooi kan zijn. Tijd nemen, kijken, waarderen wat je ziet … Ik denk dat vertraging ons creatieve proces ten goede komt. En dat het ons in staat stelt om een dieper begrip van de wereld om ons heen te ontwikkelen.” Laten we het even hebben over jullie jaarlijkse ‘nomaderie’. Jullie verlaten België elk jaar voor een paar maanden, en zoeken overal ter wereld naar bijzondere huizen waar jullie een tijdje kunnen wonen. Reinhilde: “Dat klopt, en in die zoektocht is het voor ons belangrijk dat het niet alleen maar een vakantiewoning is. We willen een echt huis waar we ons thuis kunnen voelen. Toen we bijvoorbeeld naar Buenos Aires gingen voor een langere periode, zochten we niet alleen naar een plek om te slapen, maar naar een omgeving waarin we ons helemaal konden inleven. Het idee is om tussen de lokale bevolking te leven, om ons deel van de gemeenschap te voelen. Dat maakt de ervaring zoveel authentieker.” “Een heel mooi voorbeeld van zo’n plek is het Schotse Isle of Bute. Een prachtig eiland met een heel bijzondere dramatische sfeer, zeker bij donker weer. Dan zie je hoe de wolken het landschap veranderen en in een heel aparte romantische gloed onderdompelen. Het zijn net die wisselende luchten die het landschap zoveel interessanter maken dan gewoon zonlicht.” Hans: “Precies! We willen dat gevoel van integratie echt voelen. Het is niet zo dat we er alleen maar zijn om te ontspannen en te genieten. We werken ook tijdens ons verblijf. Daarom is het cruciaal dat de plek comfortabel is en uitnodigend aanvoelt. Het begint altijd met het vinden van dat ene huis waar we ons voor een langere tijd kunnen settelen. Als die basis er niet is, wordt het moeilijk om de omgeving echt te ontdekken.” Reinhilde: “Bijvoorbeeld Mérida, Mexico. Toen we daar aankwamen, was de eerste indruk niet bepaald positief. De stad leek in eerste instantie niet aantrekkelijk. Maar na een paar dagen begonnen we de charme van de plek te zien. We ontdekten verborgen juweeltjes en unieke plekken. Dat soort ervaringen maakt het reizen zo bijzonder.” Hans: “Vooral in de Verenigde Staten is het een uitdaging om iets te vinden dat karakter heeft. Het gebeurt vaak dat je er een huis binnenkomt en denkt: dit is geen huis, maar een showroom. Er is gewoon niets persoonlijks aan. We streven er steeds naar om te wonen in een ruimte die ons iets vertelt, een plek met karakter. We willen niet zomaar in een onpersoonlijk appartement verblijven, maar een plek met een verhaal, waar we iets van de lokale cultuur kunnen opsnuiven. Het is die verbinding met de omgeving die onze reizen echt betekenisvol maakt. Het verlangen naar authenticiteit drijft ons. Dat is de uitdaging en de vreugde van reizen. Een van de mooiste plekken waar we ooit geweest zijn, was in Cape Cod. Dat was echt uniek. We verbonden er in een soort beach shack. Er was geen verwarming, en volledig gemaakt van hout, maar op een zeer moderne en sfeervolle manier.” Reinhilde: “Heel modernistisch. Basic, maar perfect voor wat het moest zijn. We hebben daar echt genoten en het was gewoon uniek. Het voelde goed en dat is wat we zoeken.” Hans: “Leuk is ook dat plekken zich pas openbaren door er echt te zijn. Neem nu de East Coast van Amerika. Hoewel we er niet veel reden hadden om terug te komen, hebben we wel interessante dingen gezien, zoals ons huis in Lakeland. Een pareltje uit 1956 met een volledig originele keuken. Heel modernistisch, maar met die oude charme. Zeer interessante omgeving, omdat ze vlakbij de school van Frank Lloyd Wright lag.” Jullie ademen levensvreugde. Het lijkt wel jullie missie om schoonheid te verzamelen, of om ze enigszins trachten te vrijwaren van vervall. De plek waar jullie wonen is bijvoorbeeld het huis van een ex-kunstschilder. Ook hier valt het licht heel mooi binnen. Reinhilde: “Dat is exact de reden waarom we dit pand ooit gekocht hebben. Nu ja, over architectuur kunnen we eindeloos praten, en dan vooral over hoe we hier omgaan met architecturaal erfgoed. Het is vaak catastrofaal wat er tegenwoordig gebeurt. Vandaag zien we dat heel wat mensen enkel nog willen kiezen voor open ruimtes, volledig wit, met rechte lijnen en zonder karakter. Ik vind dat erg jammer. Omdat ook hier de ziel verdwijnt. Het is heel triest dat we zoveel authentieke architectuur verliezen. Het zou geweldig zijn als we een manier konden vinden om de unieke elementen van een huis te behouden én te combineren met moderniteit en duurzaamheid. Maar wat gebeurt nu? Nieuwe eigenaars van oude huizen laten de façade staan, halen alles eruit en bouwen iets nieuws. Weg Ziel, weg gevoel.” Dag tekst, ik ben beeld Wat meteen opvalt in ‘Aesthetic Nomads’ is dat de teksten en de beelden los van elkaar lijken te staan. Teksten zijn niet descriptief, maar geven wel verdieping aan het beeld. Hans: “Ik noem het vignettes, in een soort feuilleton-stijl. Het zijn anekdotes, tranches de vie. Gesprekken die ik opving, gedachten bij een plek. Met hier en daar een vleug humor en wat absurditeit. Licht verteerbaar, ook. Een tekstuele soundtrack bij het beeld dat Reinhilde maakte.” Reinhilde: “Hans’ teksten geven een verdieping bij de beelden of geven ze een ander cachet. Heel welkom ook, omdat ik absoluut niet denk in woorden. Ik componeer het verhaal met de beelden in mijn hoofd. Ik laat me leiden door een intuïtief aanvoelen. Als ik met de fotoselectie in de weer ben of een collage van beelden wil maken, geef ik de beelden zelf de vrijheid: ik merk “Wat mij altijd heeft gefascineerd, is hoe licht door het accentueren van een detail van iets heel gewoons iets prachtigs kan maken.” dat het ene beeld om het andere vraagt, waarbij kleuren en vormen elkaar versterken.” Als je een plek mag kiezen waar je meteen naar terug kan, wat wordt het dan? Reinhilde: “Voor mij is mijn keuze vaak beïnvloed door het weer. Kijk nu, het regent en dat doet me denken aan de stijl en schoonheid van Engeland.” Hans: “Soms denk ik ook aan Uruguay. Het voelde nooit nostalgie voor mij, maar meer als het ideaal van een relaxed leven, omgeven door de natuur. De mensen hechten er bijvoorbeeld nog veel waarde aan familie en gemeenschap. En op het strand zag je kinderen spelen zonder dat ze vastgekleefd zaten aan hun telefoons. Ze maakten kampjes, speelden met elkaar en waren gewoon echt kind. Dat soort authentieke ervaringen zijn voor mij van onschatbare waarde. En dan heb je nog die adembenemende oceaan.” Hans: “Als je me nu vraagt waar ik naartoe zou willen, dan zou het heel waarschijnlijk Manhattan zijn. Het is een plek waar altijd iets te doen is. En je kunt van daaruit makkelijk naar de zee. Long Island is vlakbij. Maar het idee om alles op te pakken en naar New York te verhuizen, voelt nu een beetje surrealistisch aan. De kosten van levensonderhoud daar, vooral de gezondheidszorg, zijn gewoon onbetaalbaar. Waren we jonger geweest, dan zouden we dat zonder aarzeling hebben gedaan.” Reinhilde: “Ja, dat is het mooie van reizen en ontdekken. Het brengt ons terug naar de essentie van wie we zijn. Het is echt de wereld in een notendop, en wat we daaruit halen is onvervangbaar.” ■ AESTHETIC NOMADS • Beta-Plus • London • 255 x 297 mm • Gardapat Bianca 135 g/m² • 528 p Draait het in dit boek integraal rond de geschiedenis en ontwikkeling van één enkele auto? Of is het een verhaal over passie, toewijding en misschien zelfs obsessie? Graphius Magazine sprak met Adam Waddell over het maken van het boek van een iconische auto, LFA: Roar of an Angel, de Lexus LFA en hoe je verschillende nichedoelgroepen kunt bereiken. *Hoe raakte je betrokken bij LFA: Roar of an Angel?* Ik ben nogal verankerd in de print- en autowereld. Mijn carrière begon met het uitgeven van tijdschriften; meteen na de universiteit ging ik aan de slag bij Haymarket magazines, waar ik werkte aan het iconische Autosport. Ik maakte deel uit van het lanceringsteam van Top Gear-magazine voor BBC in 1993. Ik heb dat tijdschrift verschillende jaren gepubliceerd. Nu geef ik vooral advies over The Road Rat, een luxe verzamel-tijdschrift over auto's. LFA: Roar of an Angel is geen boek van Road Rat; de uitgevers zitten in Japan en het kwam bij ons terecht via een wederzijdse kennis. Onze rol beperkt zich tot de productie en distributie. Maar door mijn achtergrond ben ik perfect geplaatst om het boek, de doelgroep en de LFA in te schatten. Misschien beginnen we best bij waarom het de moeite waard is om een heel boek te wijden aan het verhaal van de Lexus LFA. Het verhaal van de Lexus LFA gaat als volgt: de ontwikkeling duurde negen jaar en werd gedreven door de wens om een bij benadering perfecte auto te maken. Veel ontwikkelingsprojecten in de auto industrie worden tegenwoordig gedicteerd door marge en planning. Maar zoals de lezers van het boek zullen ontdekken, waren dat hier niet de belangrijkste factoren. In plaats daarvan – en dat komt heel sterk naar voren in het boek – werden de ontwerpers gedreven door passie. Ja zelfs, bijna een obsessie. Ik ga niet beweren dat ze de perfecte auto hebben gemaakt, maar toen de LFA in 2012 eindelijk op de markt kwam, reed Jeremy Clarkson van Top Gear ermee. Hij zei toen: “Het is de beste auto waar ik ooit in heb gereden.” Qua loftbetuiging kan dat tellen. Het boek is geschreven door Tanahashi Haruhiko, hoofdingenieur. De expert die de auto heeft gemaakt en de meesterwerken heeft gecreeëerd, vertelt nu zijn verhaal. Er zal bijgevolg nooit een ander boek over deze auto zijn dat zo gedetailleerd of zo authentiek is. En als je het boek leest, is het duidelijk dat de LFA voor hem een passieproject was. De auto was nooit bedoeld om Lexus veel geld op te leveren. Ik denk zelfs dat elke auto effectief met verlies werd verkocht. Maar er was altijd dat obsessieve verlangen om de ultieme auto te maken. Waarom werd er besloten om een boek te maken? Ik denk dat de uitgevers in Japan vonden dat het boek er moest zijn. Ze wilden dat het een verslag werd van wat Tanahashi-san had bereikt en hoe hij dat had gedaan. Dit boek is zo bepalend, zo gedetailleerd en zo authentiek in zijn verhaal, dat het eigenlijk bedoeld is voor een heel specifieke groep mensen. Het is niet bestemd voor de bestsellerlijsten. Niemand verwacht echt dat er honderdduizenden exemplaren van verkocht zullen worden. Het is interessant, want het boek komt oorspronkelijk uit Japan en is in het Japans geschreven. Maar het werd vertaald naar het Engels en ik vermoed dat hun wens om het in het Engels te drukken en vanuit Europa te distribueren deels was om een wereldwijde fanbase tevreden te stellen. Ik zeg wel wereldwijd, maar we hebben het nog steeds over een erg niche publiek. Binnen die niche zijn er ook subsegmenten. Als je een Lexus LFA hebt – en er zijn maar 500 LFAs in de wereld – wil je minstens één exemplaar van het boek. Voor een andere subgroep van autoliefhebbers met een bijzondere passie voor Japanse auto’s – dit is de ultieme Japanse auto – is het een must. En dan heb je nog de bredere autoliefhebbers. Dit boek telt 272 pagina’s met zeer, zeer gedetailleerde auto-informatie. Hoe konden ze nee zeggen? Hoe heb je laten beïnvloeden door de doelen en diverse doelgroepen wanneer je het boek publiceerde? We hadden gemakkelijk een boek ter waarde van £200 kunnen maken. Als je een superauto van een miljoen dollar bezit, betaal je eender wat voor het Er valt veel te zeggen over de titel. ‘LFA: Roar of an Angel’ … Dat spreekt tot de verbeelding en vertelt je veel over de auto en wat je voelt als je erin rijdt. boek. We hadden waarschijnlijk ook stoffen hoesjes en dergelijke kunnen kopen. Maar dat is niet de kern van het boek. Ik denk dat Tanahashi-san dit verhaal graag wilde delen. En ik denk dat de uitgevers in Japan er erg op gebrand waren dat het niet exclusief of beperkt was, maar dat het een verhaal was waar mensen – iedereen – toegang toe hadden en van konden genieten. Daarom hielden we de prijs op £50. En dat was de leidraad voor het productieproces. We wisten dat Park Communications UK, onderdeel van Graphius Group, een bedrijf is met veel aandacht voor detail. Het was geen kwestie van bestanden aanleveren en een paar weken wachten tot er een exemplaar op de deurmat lag. Het was veel, veel meer dan dat. Peter Appleton van Park was zeer attent. Niets was hem te veel. Tijdens het productieproces belde en e-mailde hij constant. Dat gaf op zich al veel vertrouwen. Als je een boek produceert, vooral voor een derde partij, wil je weten of het perfect wordt en ik had er het volste vertrouwen in. Geheel terecht, zo blijkt. We wisten dat het een mooi boek moest worden om de auto en het verhaal erachter eer aan te doen. Zo wilden we een groot formaat, zodat de afbeeldingen van de auto goed tot hun recht zouden komen. We hebben niet beknibbeld op de papierkwaliteit, we hebben bijpassende kop- en staartbanden gebruikt enzovoort. We hebben geen nieuwe verpakkingstechnieken gebruikt, maar gekozen voor de basisprincipes die het een prachtig verzamelboek maken. Hier was Peter echt briljant in; hij kwam op de proppen met de details die er een prachtig boek van maken. Ideeën voor afwerkingen, voor verpakkingen enzovoort. Een heel mooi voorbeeld van iets waar ik in geen miljoen jaar zou aan denken, is de anti-scuff afwerking van de stofomslag. De achterkant van de stofomslag is namelijk bijna helemaal zwart, wat betekent dat er heel gemakkelijk vlekken ontstaan als je het boek in een boekenkast schuift. De anti-scuff afwerking kostte niet veel geld, maar het is een van die details waar je het meteen over eens bent. Als mensen £50 plus verzendkosten betalen voor een boek, dan wil je dat het van zo’n hoog mogelijke kwaliteit is. Hoe plaats je het boek in de markt? Een nichepubliek met veel subgroepen, verspreid over de hele wereld, bereik je het best via sociale media. Het kost niet veel moeite om erachter te komen dat er speciale Facebook-groepen zijn. Ze zijn niet groot, maar je maakt contact met hen, vervolgens maken zij contact met de andere mensen in hun groep en dan ben je vertrokken. Het nieuws verspreidt zich heel snel zonder dat je echt actief hooft te proberen om het op de markt te brengen. In die gemeenschappen op sociale media is er maar één persoon nodig die zegt: “Wow, iemand heeft een geweldig boek over onze auto gemaakt!” (Zo denken zij er ook over: “Onze auto!”) Als je ergens gepassioneerd over bent, voel je een connectie. En door die passie, die connectie, verspreidt het nieuws zich uiteraard snel. We zien dat de verkoop momenteel in diverse landen plaatsvindt, van Europa tot Japan en de VS. Het is een auto die geleidelijk aan verzamelbaar is geworden en een iconische status heeft gekregen - zijn mythologie - en daarom willen mensen er meer over lezen. De LFA wordt sinds 2012 niet meer gemaakt. Waarom dan toch een boek ervoor uitbrengen? Het duurt even voordat auto’s echt iconisch worden. Vooral als ze niet meer in productie zijn. In de kranten lees je over auto’s die vijf jaar geleden nog niets waard waren, maar die plotseling iconisch zijn geworden en in waarde zijn gestegen. Deze auto is natuurlijk altijd wel wat waard geweest. Ik geloof dat hij nieuw ongeveer £340.000 waard was. Op dit moment staan er niet zoveel te koop, maar ze zijn allemaal tussen de 750.000 en 1.000.000 pond. Het is een auto die geleidelijk aan verzamelbaar is geworden en een iconische status heeft gekregen – zijn mythologie – en daarom willen mensen er meer over lezen. Ze willen de details en het verhaal achter de auto weten. Wat bekoort jou het meest aan het boek? Er valt veel te zeggen over de titel, ‘LFA: Roar of an Angel’ … Dat spreekt tot de verbeelding en vertelt je veel over de auto en wat je voelt als je erin rijdt. Mijn favoriete deel van het boek is een sectie achterin, waar ze voor elk van de 500 LFA’s een overzicht geven van de kleur, specificaties, registratiedatum en exportland. Het is een briljante opname. Er zijn ook prachtige foto’s van de auto, op snelheid, mooi en scherp in beeld gebracht op dubbele pagina’s, gedrukt op glanzend kwaliteitspapier. Dat zal altijd een grote impact hebben. Tegelijkertijd zijn er ook een paar beelden die eruitzien alsof ze met een mobiele telefoon zijn gemaakt. In dit soort reportages passen zo’n beelden wel en het is veelzeggend dat het team dit besefte toen ze het boek maakten. Het is heel authentiek. Het legt een moment vast, of dat nu in de fabriek is, in de ontwerpstudio of in de pits van een racecircuit. De wetenschap dat het een snelle momentopname is, in plaats van een bewust opgezette shoot met een professionele fotograaf, maakt het net krachtig en charmant. Eenvoud siert de prachtige coverfoto. Er is geen ruis, alleen een stuk asfalt en een mooie heldere achtergrond van bomen. De auto ziet er geweldig uit vanaf de achterste driekwart met de vleugel omhoog. Het is een heel puur, helder beeld dat duidelijk maakt waar de auto voor staat. Als je daar naar kijkt, weet je wat de LFA is. ■ LFA: ROAR OF AN ANGEL • Tanahashi Haruhiko • London • 328 x 249 x 25 mm • 272 p • Magno Art Gloss 150 g/m² Het thuis knus en gezellig maken? Dat begint bij de keuze van de juiste verlichting. Sfeerlampje hier, warm licht daar en feestelijk licht in de tuin. Er zijn in Europa verschillende fabrikanten van verlichting, maar er is maar één Illuxtron. Het Nederlandse bedrijf heeft zich – sinds de oprichting in 2009 – door de jaren heen opgewerkt als één van de vooraanstaande internationale fabrikanten van verlichting, met een sterke verkoopbasis door heel Europa. "We zijn begonnen met een duidelijke visie om innovatieve verlichtingsoplossingen te bieden die aansluiten bij de behoeften van professionele verlichtingsadviseurs en groothandels. Het was ons doel om snel in te spelen op de technologische ontwikkelingen in de LED-markt", zegt Quinten van de Vrie, general manager. "Voor het prille begin van Illuxtron, moeten we even 50 jaar terug in de tijd", vertelt Quinten. Het is daar dat de klem voor de passie onstaan is, als familiebedrijf. Anno 2024 zijn we uitgegroeid tot een vooraanstaande leverancier van hoogwaardige LED-verlichting. Dankzij onze in-house R&D-afdeling kennen we onze producten door en door en dagen we onszelf voortdurend uit om ze te verbeteren. Maar daar stopt het niet. Vinden klanten hun gading niet in onze collectie, dan gaan we samen op zoek naar maatwerkoplossingen. Of het nu gaat om subtiële aanpassingen of het creëren van geheel nieuwe LED-armaturen, hier kunnen klanten voor alles terecht." Het lichtend pad naar innovatie In de afgelopen decennia heeft de verlichtingsindustrie een ware transformatie ondergaan, van traditionele verlichting naar halogene en vervolgens naar LED. "De veranderingen in de verlichtingswereld zijn inderdaad ongekend", bevestigt Quinten. "En wij hebben als toonaangevend bedrijf de verantwoordelijkheid om deze evolutie te volgen en om te zetten in innovatieve producten. Daarvoor werken we nauw samen met een netwerk van fabrikanten die voorop lopen in technologie. Onze betrokkenheid bij internationale beurzen en ons nauwe contact met klanten stellen ons in staat om continu te leren en ons aanbod te verbeteren." We staan vaak niet stil in hoeverre licht een rol speelt in ons dagelijks leven. En toch is het er altijd, maar merken we het pas op als het defect is. Of als een stad een heus lichtfestival op poten zet, waar kunstenaars het publiek verbluffen met bijzonder lichtsculpturen. Ook dat is licht." Dat klopt", zegt Quinten. "En hoewel licht een cruciale rol speelt in ons leven, is er vaak onvoldoende kennis over de verschillende lichtsoorten en hun impact op de..." gezondheid. Zelfs bij onze dealers is er vaak gebrek aan bewustzijn over deze aspecten. Wij zien het als onze taak om deze kennis te verspreiden. Via onze verkoopafdeling en nieuwsbrieven blijven we onze klanten informeren. Het is een essentiële tak van onze bedrijfsvoering, vooral in een tijd waarin de keuze voor de juiste verlichting niet alleen functioneel, maar ook levensveranderend kan zijn.” Het licht zien Een van de meest opwindende projecten waar Illuxtron aan werkt, is een nieuw type inbouwspot. “We zijn bezig met het assembleren van onze producten met behulp van robots. Dit stelt ons in staat om concurrerend te blijven in de lagere prijsklasse, vooral tegenover de Chinese markt,” legt Quinten uit. “We omarmen innovatie, maar het mag niet te koste gaan van kwaliteit. We zijn daarin heel stellig: we willen kwaliteit te leveren tegen een betaalbare prijs. Het spreekt voor zich dat we in deze concurrentiële markt zichtbaar willen zijn. No pun intended (lacht). Daarom schenken we veel aandacht aan ons drukwerk. Dat moet af zijn, een professionele en toegankelijke uitstraling hebben. Zoals onze catalogus; als je die op tafel legt, maak je direct een statement. Het weerspiegelt onze inzet voor kwaliteit en aandacht voor detail. De keuze voor een volledig zwarte afwerking met kleur op snee is een bewuste beslissing. De foliedruk en het zwarte ontwerp vertegenwoordigen niet alleen onze kwaliteit, maar zijn ook een cruciaal onderdeel van onze merkidentiteit.” De focus op kwaliteit en garantie “Zeven jaar garantie, dat krijgen klanten. Dat is niet niks, en het is zeker geen marketingtruc, maar wel een belofte aan onze klanten dat we vertrouwen hebben in de kwaliteit van wat we leveren. Samen met een betaalbare prijs is kwaliteit de hoeksteen van ons productaanbod. Die insteek benadrukt niet alleen de waarde die Illuxtron hecht aan klanttevredenheid, maar ook onze toewijding aan het leveren van betrouwbare en duurzame verlichtingsoplossingen.” ■ ILLUXTRON • Illuxtron International • Vlissingen • 220 x 340mm • Condat Mat 150 g/m² • 192 p “Samen met een betaalbare prijs is kwaliteit de hoeksteen van ons productaanbod.” Antilope De Bie, een gevestigde naam in de grafische sector en partner van de Graphius Group, kondigt met trots haar samenwerking aan met Burocad, specialist in digitaal en grootformaat drukwerk. Als onderdeel van deze samenwerking heeft Antilope De Bie een minderheidsbelang in Burocad verworven, waardoor beide bedrijven nog beter in staat zijn om klanten te bedienen met een uitgebreidere set aan diensten. Burocad, opgericht in 1997, heeft zich ontwikkeld tot een expert op het gebied van digitaal printen en biedt een breed assortiment aan printproducten, zoals beursstands, POS-displays, interieurdecoratie en grootformaat prints. Dankzij deze nieuwe samenwerking wordt Burocad het expertisecentrum voor grootformaat printen binnen Graphius Group, wat klanten toegang geeft tot nog meer knowhow en hoogwaardige oplossingen voor grootformaat drukwerk. Mieke Neven, die Burocad blijft leiden, legt uit: “Bij ons staat de klant altijd centraal. Ons team van ontwerpers en printprofessionals maakt de ideeën van onze klanten tastbaar, van concept tot eindproduct. Ons motto is niet voor niets: ‘imagine it. print it.’” Volgens Neven brengt de samenwerking vooral voordelen voor de klanten: “Door onze krachten te bundelen met Antilope De Bie en Graphius Group, kunnen we een breder aanbod aan printmogelijkheden aanbieden. Dit maakt ons sterker, niet alleen in Limburg, maar in heel België.” Burocad blijft zelfstandig opereren vanuit Peer, met een team van 30 medewerkers. Ondertussen kan Antilope De Bie, opgericht in 1922 en gespecialiseerd in hoogwaardig maatwerk, nu voor het eerst grootformaat printwerk zoals banners en POS-materialen in eigen beheer produceren. Dit betekent dat hun klanten en die van Graphius Group voortaan alles op één plek kunnen regelen, van offset tot grootformaat printwerk. Ook qua service is dit een grote stap vooruit: klanten uit Limburg krijgen nu een lokaal aanspreekpunt, wat de communicatie en dienstverlening nog vlotter maakt. Met deze samenwerking zetten Antilope De Bie, Graphius Group en Burocad een belangrijke stap om hun klanten beter te bedienen met een breder dienstenpakket en meer gespecialiseerde expertise. Samen bieden ze alles wat nodig is om creatieve ideeën om te zetten in prachtig drukwerk. “Bij ons staat de klant altijd centraal. Ons team van ontwerpers en printprofessionals maakt de ideeën van onze klanten tastbaar, van concept tot eindproduct. Ons motto is niet voor niets: ‘imagine it. print it.’” Nog steeds een scherpe blik Afgelopen juli is ‘SAGA. A Photographic Journey from Lewis Baltz to Tarrah Krajnak’ verschenen. Met niet minder dan 1.800 beelden, van meer dan 100 fotografen, neemt dit indrukwekkende werk de lezer mee op een fascinerende reis door zelfreflexieve en conceptuele documentaire fotografie van de 20ste eeuw. Maar het biedt vooral ook een uitstekende kennismaking met de fotocollectie die Astrid Ullens De Schooten Whettnall je wil laten ontdekken tijdens verschillende tentoonstellingen in de A Stichting (Fondation A) in Vorst. Ze noemt zichzelf daarbij meer een doorgave dan een verzamelaar. Voor ons vertelt ze uitgebreid over de ontstaansgeschiedenis van deze collectie en de bestaansreden van de stichting... Astrid Ullens, intussen 86 jaar oud en afkomstig uit een aristocratische familie, zou je zeker gek verklaard hebben als je haar zo'n zestig jaar geleden had verteld dat ze later een van de meest gerespecteerde figuren uit de wereld van de fotografie zou worden. Zij die nooit enige cursus fotografie had gevolgd... "Dat komt omdat ik een scherpe blik heb!", zo verklaart deze kunstliefhebster, voordat ze ons uitlegt hoe het allemaal begon. Van hedendaagse kunst tot fotografie "Eigenlijk werd ik in 1976, op het Salon van Keulen, letterlijk gegrepen door de hedendaagse kunst. Omdat ik alles waardeerde wat vragen oproept, besloot ik lessen te volgen om het onderwerp dieper te verkennen. Toch was het pas aan het begin van de jaren '80 dat ik mijn eerste hedendaagse kunstwerken begon te verwerven. Maar ik was meer geïnteresseerd in de intellectuele benadering dan in het financiële aspect. En zo werd ik deze kunstvorm een beetje beu. Er veranderde iets toen ik 30 jaar geleden op het Kunstsalon van Bazel een foto zag, gemaakt door de Roemeense fotograaf Brancusi. Ik begaf me plots op een terrein waar ik niets vanaf wist, ook al is het vrij gemakkelijk om van minimale en conceptuele kunst naar fotografie over te gaan. Tussen de verschillende fotografische trends ben ik bezweken voor de charmes van de documentaire fotografie. Deze vorm brengt bijna altijd een enigszins filosofische boodschap over, die doorgaans draait om belangrijke onderwerpen zoals 'welk erfgoed gaan we later aan onze kinderen nalaten?'. Door middel van fotografie wilde ik ook sporen bewaren van dingen die niet voor altijd zullen bestaan." Een unieke collectie "Al snel leidden die eerste foto's tot meer... In de loop van al die jaren heb ik een verzameling van ruim 5.500 foto's opgebouwd, van een honderdtal hedendaagse fotografen, zoals Lewis Baltz, Walker Evans, Robert Adams, en vele andere grootheden uit de Amerikaanse fotografie. Deze zijn te bewonderen in de A (van Astrid) Stichting of tijdens de verschillende tentoonstellingen waar ik over de hele wereld aan deelneem, zoals de beroemde Rencontres d'Arles." Astrid schrijft deze bekendheid vooral toe aan het unieke karakter van haar collectie. "Mijn collectie valt op door het feit dat deze uit sets bestaat. Ik ben eigenlijk de enige verzamelaar die zulke grote sets foto's, tientallen of zelfs honderden, van dezelfde kunstenaar heeft gekocht. Zoals die van Lewis Baltz bijvoorbeeld. Vroeger was dat financieel nog haalbaar, maar tegenwoordig is het helaas niet meer mogelijk omdat de prijzen zijn geëvolueerd. Ik deed het echter niet bewust, het was echt op basis van intuïtie en smaak. Om het werk van een kunstenaar te laten begrijpen en hem te verdedigen." “In musea maken ze foto’s van wat ze zien, maar ze ‘zien’ niet. Ze maken selfies, en dan gaan ze verder. En achteraf kijken ze zelden naar hun foto’s. De kleine formaten dwingen je om dichter bij de foto’s te komen en er naar te kijken.” De mensen kijken niet meer… Naast deze grote sets valt de collectie van Astrid ook op door de voorliefde voor kleine formaten. “We leven eigenlijk in een tijd waarin mensen niet meer kijken. In musea maken ze foto’s van wat ze zien, maar ze ‘zien’ niet. Ze maken selfies, en dan gaan ze verder. En achteraf kijken ze zelden naar hun foto’s. De kleine formaten dwingen je om dichter bij de foto’s te komen en er naar te kijken. Dit geldt nog meer voor zwart-witfoto’s, omdat een kleurenfoto volgens mij al een beetje van de intensiteit van het werk van de kunstenaar verliest.” De strijd tegen obscurantisme Omdat Astrid altruïstisch en welwillend is, wilde ze anderen laten meegenieten van haar unieke collectie. Daarom richtte ze in oktober 2012 de A Stichting op. “Begin jaren ’70 was ik in Afghanistan voor een privéreis, en daar werd ik me bewust van het obscurantisme, de onwetendheid en het onrecht waarin bepaalde bevolkingsgroepen leven. Om mijn steentje bij te dragen in de strijd tegen deze plagen, heb ik deze stichting opgericht. De doelstelling ervan is om de creatie, de kennis en de instandhouding van het fotografische beeld te ondersteunen.” De blik van de jongeren opleiden De A Stichting is gelegen in het laagste deel van Vorst, een gebied dat vroeger gekenmerkt werd door de industrie en geleidelijk is getransformeerd naar een woonwijk met heel wat plaatsen gewijd aan artistieke creatie. Het was de bedoeling om als culturele speler deel te nemen aan het leven in deze buurt, en om er vooral ook jongeren bij te betrekken. “Naast het tonen van kwaliteitsvolle stukken en het populariseren van de fotografiekunst, wilde ik vooral de horizon van jonge mensen openen. Ik wilde hun blik opleiden en hen ‘dwingen te kijken’, om hun verbeeldingskracht de vrije loop te laten en zich uit te drukken. Dit is een mooie manier om hen te leren zich de werkelijkheid toe te eigenen en deze in twijfel te trekken, en ongelijkheid aan de kaak stellen. Om hen een andere openheid voor de wereld bij te brengen.” Talent valoriseren De A Stichting gebruikt deze geest van openheid ook om jonge, beginnende fotografen een kans te geven door hen zichtbaarheid te bieden, hen te helpen hun eerste tentoonstellingen op te zetten en deuren te openen om hun talenten te valoriseren. “En dat werkt! Scholen komen onze tentoonstellingen bezoeken. In het kader van de recente tentoonstelling ‘Contacts’ bijvoorbeeld bezochten de kinderen van één school de tentoonstelling op een nogal amorfe en verklarende manier. Totdat de curator van deze tentoonstelling – Anne Lacoste die het Instituut voor Fotografie in Lille leidt – met hen sprak over de opvolging van jongeren op het Instituut. Toen zag ik de gezichten van deze jongeren beginnen stralen. Dat is dus de richting die we uit willen gaan: jongeren vergezellen en helpen om hun talent tot uiting te laten komen zodat ze er, wie weet, ooit van kunnen leven…”, zo besluit Astrid Ullens. ■ SAGA - Ludion - Brussel - 240 x 300 mm - Magno Volume 150 g/m² - 576 p In Vlaanderen zijn er honderden verenigingen die zich als doel gesteld hebben om van de wereld een betere plek te maken. De ene doet aan voedselinzameling, de andere helpt om versleten huishoudtoestellen nieuw leven in de blazen. En nog andere organisaties doen er alles aan om mensen met een handicap makkelijker toegang te geven tot de maatschappij en de arbeidsmarkt. Tot die laatste categorie behoort absoluut vzv, dat als bijstandsorganisatie de budgethouder ondersteunt die een Persoonsvolgend Budget (PVB) krijgt van het Vlaams Agentschap voor Personen met een Handicap (VAPH). Wij spraken even met Catharina Larsen, communicatiemedewerker. “Absoluut vzw geeft mensen handige info en advies over de zorg- en ondersteuningsmogelijkheden, hoe je het budget mag besteden en hoe je alles netjes verantwoordt,” legt Catharina Larsen uit. “Mensen met een handicap kunnen bij het Vlaams Agentschap voor Personen met een Handicap (VAPH) een budget aanvragen om hun zorg en ondersteuning te regelen. Voor volwassenen heet dit een Persoonsvolgend Budget (PVB). Daarmee kun je bijvoorbeeld een vervoersdienst inschakelen, hulp in het huishouden krijgen, of een persoonlijke assistent betalen die helpt met dingen zoals aankleden, boodschappen doen, of koken. Samen met hun netwerk (ouders, broers, zussen, enzovoort) bekijken mensen met een handicap welke ondersteuning hun dagelijks leven makkelijker maakt en hun draagkracht vergroot. Voor kinderen met een handicap bestaat een vergelijkbaar systeem, het Persoonlijk-Assistentiebudget (PAB). Daarbij wordt ook gekeken naar de specifieke steun die binnen het gezin nodig is. Als bijstandsorganisatie willen we dat onze leden goed geïnformeerd zijn en eigen keuzes maken. Concreet betekent dit dat we ze informeren over de mogelijkheden en richtlijnen van het budget. We ondersteunen hen in het maken van keuzes rond zorg en ondersteuning en helpen bij de praktische kant, zoals het administratieve luik van het budget. Verder zetten we ons in om de belangen van mensen met een handicap bij beleidsmakers te vertegenwoordigen. Door ons in te zetten voor verbeteringen in het systeem van persoonsvolgende financiering en het bevorderen van inclusie, proberen we bij te dragen aan een samenleving waarin iedereen volwaardig kan meedoen.” Over het gebrek aan middelen in de zorg is de laatste jaren veel te doen. Kunnen jullie dat als vzw allemaal bolwerken? ‘Onze organisatie is erkend door het VAPH en we krijgen dan ook subsidies voor onze dienstverlening. Onze diensten zijn ook deels betalend; mensen betalen ons met hun PAB of PVB. Maar het klopt dat er nog veel noden zijn in de zorg. Dit zien we onder andere terug in de lange wachttijden voor zo’n budget. Mensen met een handicap krijgen weliswaar de bevestiging dat ze recht hebben op een budget, of op extra budget, maar eindigen vaak op een wachtlijst door de beperkte middelen. Helaas wachten sommige mensen al meer dan 20 jaar op hun budget, terwijl ze zonder die (extra) ondersteuning niet verder kunnen met hun leven. Zo zijn er mensen met een handicap die graag alleen willen gaan wonen, maar ondersteuning nodig hebben. Zonder budget kunnen ze dat niet betalen, dus blijven ze thuis bij de ouders wonen. Daarnaast geeft het hebben van een budget geen garantie op het vinden van ondersteuning. Zeker voor mensen met heel specifieke of meervoudige noden, is het soms lang zoeken naar een geschikte plek of assistent. “Als bijstandsorganisatie willen we dat onze leden goed geïnformeerd zijn en eigen keuzes maken.” Bij absolut vzw zijn we actief bezig met beleidswerk, omdat we geloven dat iedereen recht heeft op een volwaardig leven.” Hoe past de Gazet van ‘t Budget in jullie werking? “De Gazet van ‘t Budget is ons ledenmagazine, waarmee we leden willen inspireren en informeren. We delen verhalen van andere leden en informatieve artikels over het PAB/PVB. Een deel van onze leden krijgt coaching van mijn collega’s. Dit betekent dat ze op regelmatige basis een afspraak hebben met een van mijn collega’s en samen hun huidige ondersteuning bekijken en evalueren, en samen de administratie van het budget overlopen. Maar we hebben ook veel leden die hun administratie zelf doen, en dus geen coaching krijgen. Ook die leden willen we voldoende informeren, onder andere via de Gazet van ‘t Budget, maar ook met onze website, flyers, brochures en webinars. Ze kunnen ook bellen naar onze infolijn. Zo hopen we een antwoord te bieden op de vragen van al onze leden.” Welke thema’s komen er zoal aan bod? “Voor elke editie kiezen we een relevant thema. De meest recente editie, die in november verscheen, staat bijvoorbeeld in het teken van het belang van goed lokaal beleid. In elk magazine hebben we vaste artikels, die dan ingevuld worden naargelang het grote thema. In de laatste editie hadden we een interview met een vader die samen met de gemeente een woonhuis voor mensen met een handicap heeft opgericht, en een interview met een van onze leden die is verkozen tijdens de laatste lokale verkiezingen. Verder is er telkens een artikel waar onze inhoudelijk coordinator, die veel beleidswerk doet, een inkijk geeft in wat er op beleidsvlak gebeurt, en een artikel waarin we een van de richtlijnen van het VAPH extra uitleggen. Tot slot delen we nieuwtjes en beantwoorden we een veelgestelde vraag.” Wat is jouw taak binnen de vzw? “As communicatiemedewerker verzorg ik de communicatie naar onze leden. Ik zorg ervoor dat onze website en sociale media altijd up-to-date zijn en werk mee aan de ontwikkeling van brochures en flyers. Daarnaast schrijf ik de ledenbrieven en ondersteun ik bij de voorbereidingen van webinars en infosessies. En natuurlijk besteed ik veel tijd en aandacht aan onze Gazet van ‘t Budget. Van het interviewen van leden en het schrijven van artikels tot het contact onderhouden met de fotograaf en vormgever. Hoewel ik de enige communicatiemedewerker ben bij absolut vzw, werk ik veel samen met mijn collega’s. Dat maakt mijn job heel fijn!” ■ GAZET VAN ‘T BUDGET • absolut vzw • Antwerpen • 210 x 280 mm • Condat Matt Perigord 115 g/m² • 20 p Antilope De Bie en Stockmans Kalenders, beide onderdeel van de Graphius Group, staan bekend om hun hoogwaardige afwerking en innovatieve oplossingen. Een van de meest veelzijdige en praktische bindtechnieken die zij aanbieden, is Wire-O binding. Deze methode is ideaal voor projecten die een duurzame en functionele afwerking vereisen, en dankzij hun geavanceerde technologie kunnen ze het volledige productieproces in eigen huis verzorgen – van druk tot afwerking. Wat is Wire-O binding? Wire-O binding is een bindtechniek waarbij dubbele metalen ringen door gaatjes in de pagina's worden gevoerd. Deze techniek biedt diverse voordelen, zoals het soepel kunnen omslaan van pagina's en de mogelijkheid om het document volledig plat te laten liggen of zelfs 360 graden te draaien. Dit maakt Wire-O binding bijzonder gebruiksvriendelijk en geschikt voor een breed scala aan toepassingen. Waarom kiezen voor Wire-O binding? 1. Productie volledig in eigen huis Antilope De Bie en Stockmans Kalenders houden het volledige productieproces onder één dak, van het drukken tot het binden. Deze aanpak geeft hen volledige controle over elke stap van het proces en garandeert een constante, hoge kwaliteit. Bovendien kunnen ze flexibel inspelen op specifieke wensen en strakke deadlines van klanten. 2. Professionele uitstraling Wire-O binding geeft documenten een strakke en verzorgde look, ideaal voor zakelijke toepassingen zoals presentaties, rapporten en kalenders. De metalen ringen zijn verkrijgbaar in diverse kleuren en maten, zodat elk project perfect afgestemd kan worden op de gewenste uitstraling. 3. Flexibiliteit en maatwerk Of het nu gaat om kleine oplages of grote zakelijke bestellingen, Antilope De Bie kan elke opdracht aan. Hun gespecialiseerde kalenderafdeling bij Stockmans, met meer dan 150 jaar ervaring, maakt hen tot de ideale partner voor op maat gemaakte Wire-O kalenders en andere projecten. Ze bieden flexibele oplossingen die afgestemd zijn op de specifieke eisen van elke klant. 4. Duurzaam en betrouwbaar Wire-O binding is een uiterst duurzame bindmethode, ideaal voor documenten die intensief worden gebruikt, zoals handleidingen, kalenders en agenda’s. De metalen ringen zijn slijtvast en bieden een lange levensduur, zelfs bij dagelijks gebruik. 5. Efficiëntie en kostenbesparing Door het volledige productieproces in eigen beheer te houden, kunnen Antilope De Bie en Stockmans Kalenders efficiënt werken en kosteneffectieve oplossingen bieden zonder concessies te doen aan de kwaliteit. Dit leidt tot kortere doorlooptijden en een hogere mate van flexibiliteit. Een betrouwbare partner voor Wire-O projecten Antilope De Bie en Stockmans Kalenders onderscheiden zich door hun uitgebreide ervaring en geavanceerde technologie. Ze bieden een complete oplossing voor Wire-O binding, of het nu gaat om kleine maatwerkopdrachten of grote B2B-projecten. Hun expertise en technologische knowhow, ondersteund door de Graphius Group, maken hen tot een van de weinige drukkerijen in België die Wire-O binding op deze schaal volledig in eigen huis kunnen verzorgen. Voor bedrijven die op zoek zijn naar hoogwaardige, duurzame en efficiënte oplossingen, biedt Wire-O binding de perfecte mix van functionaliteit en esthetiek. Nieuwe machines bij Park verhogen productiviteit en duurzaamheid Bij Park Communications, onderdeel van Graphius Group, investeren we voortdurend in nieuwe technologieën om onze groei te ondersteunen. Onlangs hebben we de nieuwste generatie Heidelberg Speedmaster XL 10-kleurenpers aangeschaft, samen met twee nieuwe Stahl-vouwmachines (TP-82P en Ti-52) en een Primera E140 hechtlijn met zes stations en een cover feeder. Deze aankopen verbeteren niet alleen de productiviteit en kwaliteit, maar zorgen ook voor een energiebesparing van ongeveer 50% bij dezelfde output. Deze verduurzaming is een belangrijke stap in onze missie om steeds milieubewuster te werken. Dankzij kortere insteltijden en hogere snelheden kunnen we op een rendabele manier ook kleine oplages opleveren. Bovendien brengt de nieuwe pers geavanceerde kleurprecisie met zich mee, dankzij AI-technologie en complexe algoritmen die handmatige aanpassingen minimaliseren. Dit helpt ons om onze klanten een nog hoger kwaliteitsniveau te bieden voor producten zoals kunstbrochures, jaarverslagen, magazines en catalogi. Nieuwe plastificeermachine Autobond FL106 in Gent Bij Graphius Gent hebben we recent de Autobond FL106 in gebruik genomen, een geavanceerde plastificeermachine die al zijn waarde heeft bewezen bij PPO Graphius in Parijs. Deze machine levert niet alleen een hogere snelheid, maar ook een betere kwaliteit dan onze vorige modellen. Zo verhogen we onze efficiëntie en tillen we de kwaliteit van ons drukwerk naar een hoger niveau. Don Bosco St-Denijs-stagiairs aan de slag We hebben met veel enthousiasme de stagiairs van Don Bosco St-Denijs verwelkomd bij Graphius! Tijdens hun eerste dagen kregen ze een uitgebreide rondleiding door onze afdelingen en maakten ze kennis met de machines en hun mentoren. Nu duiken ze volledig in de productie: van praktijkervaring met onze machines tot werken aan echte opdrachten onder begeleiding. We kijken ernaar uit om hun groei en ontwikkeling in de grafische sector mee te begeleiden. Verzending met papieren wraps: een duurzame oplossing Graphius biedt sinds kort de mogelijkheid om magazines met een papieren wrap te verzenden. In sommige regio's is plastic folie verboden, en niet alle ecologische alternatieven zijn haalbaar. Daarom introduceren wij deze duurzame en stijlvolle oplossing. Met een papieren wrap worden jouw magazines milieuvriendelijk verpakt en voldoen ze aan de strengste regelgeving. Neem contact op met je accountmanager voor meer informatie over deze nieuwe optie. ECO3, met hoofdkantoor in België, is een toonaangevende wereldwijde leverancier van prepress-systemen voor de grafische industrie. Commerciële, kranten- en verpakkingsdrukkerijen vertrouwen op ons voor het meest volledige aanbod van geïntegreerde oplossingen, van drukplaten en computer-to-plate-systemen, software voor workflow-en printmanagement tot drukkerijchemicaliën. Onze oplossingen worden speciaal bedacht met het oog op een hogere productiviteit, lagere kosten en groenere resultaten in elke fase van het drukproces. www.ECO3.com YOU PRINT. WE CARE. De wereld van drukwerk, binnen handbereik... Bestel je drukwerk online www.belprinto.be	a2fc44e2-fa9e-4202-b946-5ed6b753dc2a	HuggingFaceFW/finepdfs/tree/main/data/nld_Latn/train	finepdfs	nld_Latn	151,304
Mental Health: A Perspective from Uganda By Namuyanja Hajara 2 February 2019\|Mental Health in Africa Mental health challenges maybe unseen, but it is real, present and dangerous if unaddressed. By Namuyanja Hajara, Changemaker, OurCause, Uganda. According to World Health Organization, mental health refers to a state of wellbeing in which every individual realizes his or her own potential, can cope with normal stress of life, work productively, fruitfully and is able to make a contribution to his or her community. Basing on the definition mental health challenges encompass the emotional, physical, social and the psychological feeling/understanding. There are various mental health problems such as:- (a) Depression: referring to constant sadness. (b) Bi-polar disorder: referring to the extreme and depressive phases more so characterized by sadness. (c) Anxiety: referring to intense attacks of fear, questioning involving a variety of feelings that can be either bad or good. These various forms of mental health problems not only change the person but rather affect how a person thinks, feels, relates, views and reacts to different occurrences in everyday life. In addition it controls and determines how individuals make choices in their lives. It should be noted, the reaction of an individual bases on the intensity, the time it lasted, stage it reached, reactions of those around and their response in trying to help the patient (the person with the mental health challenge). We cannot attribute mental health problems to one cause because there are quite a number such as abuse, loss of a loved one, joblessness, brain factors, family history, drug use among others depending on the circumstances. Largely the usage of drugs such as marijuana, cocaine among others seems to be the most leading cause of mental health problems among the Ugandan youth. For instance according to New vision newspaper dated 7th/03/201, 45% of the youth in Uganda abuse drugs resulting into mental health challenges. Here in Uganda there is very less awareness surrounding mental health that is in form of speaking, doing sensitization drives, breaking the stigma or encouraging people to come forward. However a small number that understands the gravity of mental health challenges tries to speak out. Honestly mental health challenges are spoken about to the general public incasetwo or more cases are committed by culprits who have are believed to be mentally challenged which also doesn't last long. The most challenging issue is the mentality among Ugandans who consider every person who comes forward as having mental challenges as an INSANE or MAD individual. The way the families, friends and communities view mental health challenges differs and they are as follows:- Families This depends on what family though some parents are usually supportive and engage in getting educated about it whenever they take their affected relatives for counselling and medication. Some families consider and look at mental health centers as hiding places for their mentally challenged children, relatives among others. This widens the gap of them not knowing or understanding the problem as they should since everything is left up to counsellors. Other families lock them up inside their houses in order to avoid disturbance or shame from the community. In most families the mentally challenged people are usually undermined, misunderstood, and distanced from, hidden, unaccepted and seen as bad omens. Friends With friends, less of them understand or try to understand. The over generalization basing on what they heard or saw on their mentally challenged friends. Always feeling the extreme need to question or be proved by the mentally challenged people, their questions are usually not to understand or know the real issue but to check the credibility of the mentally affected people such as if they can get a job, do this or that. Community The community is very judgmental, highly opinionated about something they don't know or understand but only under the umbrella of referring to someone as Insane or mad. The community largely mistakes and has continually failed to distinguish mental health challenges from witchcraft practices. There is always attachment from their judgment that mental health challenges are either from witchcraft practices that a family may have done wrongly or didn't do and thus it is why they have mentally sick or unstable individuals in their families. The over criticism and judgment from people is uncalled for yet sadly it is part and parcel of everyday live with in our community. Personally I believe they aren't words that can explain the pain, shame and over demanding pressure on mentally challenged people having to prove themselves to their families, friends and communities. However there is persistent need to engage the whole community in activities that bring awareness about mental health such as - Engaging and involving people - Mental health workshops - Interactions - Awareness drives - Breaking of the stigma among people through interactions - More sensitization so as people distinguish between witchcraft and mental health. - Personal and outreach programs in various communities.	<urn:uuid:5068e3fd-4b0a-4614-b5a9-8d65cc14c19a>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	5,255
Inferring vertex properties from topology in large networks Janne Aukia\textsuperscript{a}, Samuel Kaski\textsuperscript{b}, and Janne Sinkkonen\textsuperscript{a} \textsuperscript{a}Xtract Ltd, Helsinki, Finland \textsuperscript{b}Laboratory of Computer and Information Science, Helsinki University of Technology, Finland Data collections representable as networks appear now frequently in many fields, and inferring properties of the vertices from the relations has become a common data mining problem. We introduce a model for the case where no \textit{a priori} defined characteristics for the vertices are available, and the task is to infer latent vertex or edge properties from the topology. Depending on the hyperparameters, the properties are either latent blocks (“communities” in social networks) or more graded, hidden-variable like structures. As a demonstration, musical tastes of people are induced from the friendship network of the online music service Last.fm (\url{www.last.fm}), with over $10^5$ vertices and edges. The model generates \textit{edges}, and is fitted with collapsed Gibbs sampling. Mixture components have a Dirichlet process prior. The model structure allows a sparse implementation, with which analysis of millions of vertices with models including thousands of latent components come feasible. The generative process out of which the network is supposed to arise is the following; it is parameterized by $(\alpha, \beta)$: (1.1) Initialize by generating a multinomial distribution $\theta_z$ over an infinite number of \textit{latent components} $z$, generated by the Dirichlet process DP$(Z\|\alpha)$; (1.2) to each $z$, assign a multinomial distribution over the $M$ vertices $i$ by sampling the multinomial parameters $m_{zi}$ from the Dirichlet distribution Dir$(\beta)$—the prior is constant over the vertices. (To clarify, we have $\sum_i m_{zi} = 1$ for each $z$, and $\sum_z \theta_z = 1$.); (2) Then, repeat for each edge $l$: (2.1) draw a latent component $z$ from the multinomial $\theta_z$; (2.2) generate two vertices, $i$ and $j$, independently of each other, with probabilities $m_z$; set up a non-directed edge between $i$ and $j$. Note that within components edges are generated independently of each other and “randomly”; the non-random structure of the network emerges from the tendency of components to prefer certain vertices (that is, $m_z$). There is no explicit hierarchy level for vertices, but because vertices typically have several edges, they are implicitly treated as mixtures over the latent components. Finally, the model, in its current form, is parameterized to generate self-links and multi-edges although they are not present in typical data sets. This allows sparse implementations that would be impossible for an equivalent Bernoulli model. Although the number of potentially generated components is infinite, the Dirichlet process gives a very uneven distribution over them. With a suitably small value of $\alpha$, we observe much fewer components there is edges, and the model is useful. On the other hand, $\beta$ describes the unevenness of the degree distribution of the vertices \textit{within components}: a high $\beta$ tends to distribute edges evenly over the vertices, and therefore give components spanning over all vertices, while a small $\beta$ prefers mutually exclusive, community-like components. In the collapsed Gibbs sampling algorithm, the unknown model parameters $m_{zi}$ and $\theta_z$ are marginalized away, and only the latent classes of the edges, $z_l$, are sampled one at a time. Given the simplicity of the sampling scheme, it is easy to make it highly efficient. For example, the degree of a vertex poses an upper limit for its component heterogeneity, so that in most real-life networks only few of the counts $k_{zi}$ are simultaneously non-zero, allowing sparse implementation and a high number of components. (We have experimented with $10^6$ vertices and $10^4$ components.) Edges can be sampled in parallel by locking vertices in the count table $k_{zi}$. For $M$ vertices, $L$ edges, $C$ components, and $I$ iteration rounds, memory consumption scales as $O(MC + L + C)$, but with hash tables this can be reduced to $O(Md + L + C)$ where $d$ is the average degree. Because $d = L/M$, memory consumption scales as $O(L + C)$. After optimizing the sampling with trees, running time can be lowered down to $O(ILd \log C)$. That is, running time scales linearly in the number of edges and logarithmically in the number of components—excluding the required number of iterations $I$. In the figure, the component structure reflecting musical tastes resulted from a run with 147,610 (anonymous) Last.fm users claiming to be from US, and their 352,987 self-announced mutual friendships. The parameters of the model ($\alpha=0.2$, $\beta=0.2$) were chosen to prefer a small number of diffuse components. As a result (10,000 iterations in just under four hours), each user gets a probabilistic profile over eight latent components. The components were afterwards correlated with user’s listening habits; in the figure songs are aggregated by tags given to them. Users have mixed tastes, while tags are intuitively grouped into components. The tastes emerge from the friendships, which makes the approach usable in customer relationship management and personalization tools.	<urn:uuid:2f7a8725-e163-4dbd-ad2d-0c4308e976c5>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	5,387
Mathematical Induction Problems With Solutions When people should go to the ebook stores, search launch by shop, shelf by shelf, it is in point of fact problematic. This is why we offer the book compilations in this website. It will utterly ease you to look guide mathematical induction problems with solutions as you such as. By searching the title, publisher, or authors of guide you in reality want, you can discover them rapidly. In the house, workplace, or perhaps in your method can be every best place within net connections. If you try to download and install the mathematical induction problems with solutions, it is utterly easy then, previously currently we extend the join to purchase and create bargains to download and install mathematical induction problems with solutions correspondingly simple! Mathematical Induction Practice Problems Mathematical Induction Examples Proof by Mathematical Induction - How to do a Mathematical Induction Proof ( Example 1 ) MATHEMATICS Challenging Proof by Induction Problem Proof by Induction - Example 1Induction Divisibility Discrete Math 5.1.1 Mathematical Induction Summation Formulae and Inequalities MATHEMATICAL INDUCTION - DISCRETE Mathematical Induction Induction Inequality Proof Example 1: Σ(k = 1 to n) 1/k² ≤ 2 - 1/n Inequality Mathematical Induction Proof: 2^n greater than n^2Mathematical Induction with Divisibility: 3^(2n + 1) + 2^(n + 2) is Divisible by 7 Proving Divisibility Statement using Mathematical Induction (1) Induction with inequalities Proof by Mathematical Induction First Example Prove n! is greater than 2^n using Mathematical Induction Inequality Proof Euclidean Algorithm (Proof) Learn how to use mathematical induction to prove a formula Induction Inequality Proof Example 3: 5^n + 9 less than 6^n Proof by Induction Example (Inequalities) Maths Skills: Mathematical Induction Principle of Mathematical Induction Inequality Proof Video[Discrete Mathematics] Mathematical Induction Examples Mathematical Induction Examples \| Solutions Induction: Inequality Proofs Mathematical Induction - Divisibility Tests (1) \| ExamSolutions Intro to Mathematical Induction Mathematical Induction: (problem example) principle of mathematical induction example 2 (class 11) ncert math Discrete Math - 5.1.3 Proof Using Mathematical Induction - Divisibility Mathematical Induction - Problems With Solutions Step 1: We first establish that the proposition P (n) is true for the lowest possible value of the positive integer n. Step 2: We assume that P (k) is true and establish that P (k+1) is also true Mathematical Induction Problems With Solutions Mathematical Induction - Problems With Solutions Mathematical Induction Problems With Solutions. Question 1 : By the principle of mathematical induction, prove that, for n ≥ 1. 1 3 + 2 3 + 3 3 + · · · + n 3 = [n(n + 1)/2] 2. Solution : Let p(n) = 1 3 + 2 3 + 3 3 + · · · + n 3 = [n(n + 1)/2] 2. Step 1 : put n = 1. p(1) = 1 3 + 2 3 + 3 3 + · · · + 1 3 = [1(1 + 1)/2] 2 1 = 1. Hence p(1) is true. Mathematical Induction Problems With Solutions In mathematics, the principle of mathematical induction is used to prove a statement, a formula or a theorem for some positive integer range. The method involves mainly two steps. Induction: Problems with Solutions Greg Gamble 1. Prove that for any natural number n 2, 1 2 2 + 1 3 + + 1 n <1: Hint: First prove 1 1:2 + 1 2:3 + + 1 (n−1)n = n−1 n: Solution. Observe that for k>0 1 k − 1 k+1 = k+1−k k(k+1) = 1 k(k+1): Hence 1 1:2 + 1 2:3 + + 1 (n−1)n = 1 1 − 1 2 + 1 2 − 1 3 + + 1 n−1 − 1 n =1− 1 n = n−1 n: Now, for all k>2 1 k2 < 1 Induction: Problems with Solutions MATHEMATICAL INDUCTION WORKSHEET WITH ANSWERS. 1 3 + 2 3 + 3 3 + · · · + n 3 = [n (n + 1)/2] 2. (3) Prove that the sum of the first n non-zero even numbers is n2 + n. Solution. (1 − 1/2 2) (1 − 1/3 2 ) (1 − 1/4 2) ............... (1 − 1/n 2 ) = (n + 1)/2n. Mathematical Induction Worksheet With Answers The solution in mathematical induction consists of the following steps: Write the statement to be proved as P(n) where n is the variable in the statement, and P is the statement itself. Example, if we are to prove that 1+2+3+4+. . . .+n=n(n+1)/2, we say let P(n) be 1+2+3+4+. . .+n=n(n+1)/2. The Principle of Mathematical Induction with Examples and ... MATHEMATICAL INDUCTION, INTERMEDIATE FIRST YEAR PROBLEMS WITH SOLUTIONS 1 . Locus 2. Transformation of axes 3. The straight lines vs Straight lines sa Straight lines la 4. Pair of straight lines 5. Three dimensional coordinates 6. Direction cosines and direction ratios 7. The plane 8. Limits and ... MATHEMATICAL INDUCTION, Intermediate 1st year problems ... Induction problems can be hard to ﬁnd. Most texts only have a small number, not enough to give a student good practice at the method. Here are a collection of statements which can be proved by induction. Some are easy. A few are quite diﬃcult. The diﬃcult ones are marked with an asterisk. I would not ask you to do a problem this hard in a ... Induction problems - Department of Mathematics: University ... Solution. For any n 1, let Pn be the statement that xn < 4. Base Case. The statement P1 says that x1 = 1 < 4, which is true. Inductive Step. Fix k 1, and suppose that Pk holds, that is, xk < 4. It remains to show that Pk+1 holds, that is, that xk+1 < 4. xk+1 = p 1+2xk < √ 1+2(4) = p 9 = 3 < 4: Therefore Pk+1 holds. Thus by the principle of mathematical induction, for all n 1, Pn holds. Question 1. Prove using mathematical induction that for ... Mathematical induction seems like a slippery trick, because for some time during the proof we assume something, build a supposition on that assumption, and then say that the supposition and assumption are both true. So let's use our problem with real numbers, just to test it out. Remember our property: n3 + 2n n 3 + 2 n is divisible by 3 3. Mathematical Induction: Proof by Induction (Examples & Steps) Page 2/5 Induction Problem Set Solutions These problems flow on from the larger theoretical work titled "Mathematical induction - a miscellany of theory, history and technique - Theory and applications for advanced secondary students and first year undergraduates" Induction Problem Set Solutions - gotohaggstrom.com Principle of Mathematical Induction is one of the most complex chapters of Class 11 Mathematics syllabus. Hence, students must avail the solutions from the right platform that caters to well-researched NCERT Solutions. NCERT Solutions for Class 11 Maths Chapter 4 Principle of ... Mathematical Induction Tom Davis 1 Knocking Down Dominoes The natural numbers, N, is the set of all non-negative integers: ... 4 Make Up Your Own Induction Problems In most introductory algebra books there are a whole bunch of problems that look like problem 1 in the next section. They add up a bunch of similar polynomial terms on one side, and ... Mathematical Induction - Math - The University of Utah southern europe through the middle east and east up to india''mathematical induction problems with solutions may 11th, 2018 - the principle of mathematical induction is used to prove that a given proposition formula equality inequality… is true for all positive integer numbers greater than or equal to some integer n' 2 / 5 Mathematical Induction Problems And Solutions Mathematical Induction Divisibility can be used to prove divisibility, such as divisible by 3, 5 etc. Same as Mathematical Induction Fundamentals, hypothesis/assumption is also made at step 2. Basic Mathematical Induction Divisibility Prove 6 n + 4 is divisible by 5 by mathematical induction, for n ≥ 0. Best Examples of Mathematical Induction Divisibility – iitutor JEE Main Important Questions of Mathematical Induction Mathematics is such a subject which needs conceptual understanding. To do that, you have to practice a lot to remember all the formulae because these are very important to solve any problem. And, when it comes to the IIT JEE exam, Maths holds sheer importance. JEE Main Mathematical Induction Important Questions Principle of mathematical induction for predicates Let P(x) be a sentence whose domain is the positive integers. Suppose that: (i) P(1) is true, and (ii) For all n2Z+, P(n) is true =)P(n+ 1) is true. Then P(n) is true for all positive integers n. LECTURE NOTES ON MATHEMATICAL INDUCTION Contents Mathematical Induction Problems And Solutions AwesomeMath – making x y z as easy as a b c. Mathematics Georgia Standards of Excellence GSE 9 12. INTRODUCTION TO THE SPECIAL FUNCTIONS OF MATHEMATICAL. Mathematics and Plausible Reasoning Vol II Patterns of. Mathematical Analysis amp Calculus Free Books at EBD. Acces PDF Mathematical Induction Problems With Solutions mathematical induction. This comprehensive book covers the theory, the structure of the written proof, all standard exercises, and hundreds of application examples from nearly every area of mathematics. In the first part of the book, the author discusses different inductive techniques, including well-ordered sets, basic mathematical induction, strong induction, double induction, infinite descent, downward induction, and several variants. He then introduces ordinals and cardinals, transfinite induction, the axiom of choice, Zorn's lemma, empirical induction, and fallacies and induction. He also explains how to write inductive proofs. The next part contains more than 750 exercises that highlight the levels of difficulty of an inductive proof, the variety of inductive techniques available, and the scope of results provable by mathematical induction. Each self-contained chapter in this section includes the necessary definitions, theory, and notation and covers a range of theorems and problems, from fundamental to very specialized. The final part presents either solutions or hints to the exercises. Slightly longer than what is found in most texts, these solutions provide complete details for every step of the problem-solving process. Susanna Epp's DISCRETE MATHEMATICS: AN INTRODUCTION TO MATHEMATICAL REASONING, provides the same clear introduction to discrete mathematics and mathematical reasoning as her highly acclaimed DISCRETE MATHEMATICS WITH APPLICATIONS, but in a compact form that focuses on core topics and omits certain applications usually taught in other courses. The book is appropriate for use in a discrete mathematics course that emphasizes essential topics or in a mathematics major or minor course that serves as a transition to abstract mathematical thinking. The ideas of discrete mathematics underlie and are essential to the science and technology of the computer age. This book offers a synergistic union of the major themes of discrete mathematics together with the reasoning that underlies mathematical thought. Renowned for her lucid, accessible prose, Epp explains complex, abstract concepts with clarity and precision, helping students develop the ability to think abstractly as they study each topic. In doing so, the book provides students with a strong foundation both for computer science and for other upper-level mathematics courses. Important Notice: Media content referenced within the product description or the product text may not be available in the ebook version. A Spiral Workbook for Discrete Mathematics covers the standard topics in a sophomore-level course in discrete mathematics: logic, sets, proof techniques, basic number theory, functions,relations, and elementary combinatorics, with an emphasis on motivation. The text explains and claries the unwritten conventions in mathematics, and guides the students through a detailed discussion on how a proof is revised from its draft to a nal polished form. Hands-on exercises help students understand a concept soon after learning it. The text adopts a spiral approach: many topics are revisited multiple times, sometimes from a dierent perspective or at a higher level of complexity, in order to slowly develop the student's problem-solving and writing skills. 1.Sets, 2 .Relations and Functions, 3 .Trigonometric Functions, 4. Principle of Mathematical Induction , 5. Complex Numbers and Quadratic Equations , 6 .Linear Inequalities, 7. Permutations and Combinations, 8 .Binomial Theorem , 9. Sequences and Series, 10. Straight Lines, 11. Conic Sections, 12. Introduction to Three-Dimensional Geometry, 13. Limits and Derivatives , 14. Mathematical Reasoning , 15. Statistics , 16. Probability. In China, lots of excellent maths students takes an active part in various maths contests and the best six senior high school students will be selected to form the IMO National Team to compete in the International Mathematical Olympiad. In the past ten years, China's IMO Team has achieved outstanding results — they have won the first place almost every year.The author is one of the senior coaches of China's IMO National Team, he is the headmaster of Shanghai senior high school which is one of the best high schools of China. In the past decade, the students of this school have won the IMO gold medals almost every year.The author attempts to use some common characteristics of sequence and Page 4/5 Copyright : rocklandmariner.com Acces PDF Mathematical Induction Problems With Solutions mathematical induction to fundamentally connect Math Olympiad problems to particular branches of mathematics. In doing so, the author hopes to reveal the beauty and joy involved with math exploration and at the same time, attempts to arouse readers' interest of learning math and invigorate their courage to challenge themselves with difficult problems. 1. Sets, 2. Relations and Functions, 3. Trigonometric Functions, 4. Principle of Mathematical Induction, 5. Complex Numbers and Quadratic Equations, 6. Linear Inequalities, 7. Permutations and Combinations, 8. Binomial Theorem, 9. Sequences and Series, 10. Straight Lines, 11. Conic Sections, 12. Introduction to Three-Dimensional Geometry, 13. Limits and Derivatives, 14. Mathematical Reasoning, 15. Statistics, 16. Probability. Mathematical Reasoning: Writing and Proof is a text for the ?rst college mathematics course that introduces students to the processes of constructing and writing proofs and focuses on the formal development of mathematics. The primary goals of the text are to help students: Develop logical thinking skills and to develop the ability to think more abstractly in a proof oriented setting; develop the ability to construct and write mathematical proofs using standard methods of mathematical proof including direct proofs, proof by contradiction, mathematical induction, case analysis, and counterexamples; develop the ability to read and understand written mathematical proofs; develop talents for creative thinking and problem solving; improve their quality of communication in mathematics. This includes improving writing techniques, reading comprehension, and oral communication in mathematics; better understand the nature of mathematics and its language. Another important goal of this text is to provide students with material that will be needed for their further study of mathematics. Important features of the book include: Emphasis on writing in mathematics; instruction in the process of constructing proofs; emphasis on active learning.There are no changes in content between Version 2.0 and previous versions of the book. The only change is that the appendix with answers and hints for selected exercises now contains solutions and hints for more exercises. Handbook of Mathematical Induction: Theory and Applications shows how to find and write proofs via mathematical induction. This comprehensive book covers the theory, the structure of the written proof, all standard exercises, and hundreds of application examples from nearly every area of mathematics.In the first part of the book, the author discuss This comprehensive study guide covers the complete HSC Maths Extensio n 1 course and has been specifically created to maximise exam success. T his guide has been designed to meet all study needs, providing up-to-dat e information in an easy-to-use format. Excel HSC Maths Extensi on 1 includes: free HSC study cards for revision on th e go or at home comprehensive topic-by-topic summaries of the c ourse preliminary course topics covered in detail illu strated examples of each type of question selftesting question s to reinforce what you have just learned fully worked solution s for every problem chapter summaries for pre-exam revision icons and boxes to highlight key ideas and words four com plete trial HSC exam papers with worked solutions extra questio ns with answers Page 5/5	<urn:uuid:a952707a-24e6-4246-86c2-5b5df2dc7e28>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	16,642
PROGRAMA TELCO II TRABAJOS EN ALTURA Objetivos El Módulo de Trabajos en Altura TELCO II tiene como objetivo conocer los riesgos y las medidas preventivas de los trabajos en altura, así como los procedimientos de trabajo y el uso de los EPI's. Formación impartida bajo el estándar TELCO y veriﬁcada por la entidad certiﬁcada AUDELCO. Destinatarios Acción formativa dirigida al personal del sector de telecomunicaciones que desarrolle trabajos en altura en torres de antena (celosía y tubulares), mástiles y cubiertas sin protección. Especiﬁcaciones Carga horaria: 16 horas teórico-prácticas. Ratio formador/alumno: 1:6. Validez: 36 meses. Programa Contenidos teóricos (4 horas): 1. Normativa y legislación. 2. Física de la caída. 3. Equipos de protección individual. 4. Sistema protección de caídas. 5. Dispositivos de anclaje. 6. Izado manual de cargas. 7. Actuación ante un accidente. 8. Identiﬁcación de Riesgos. Contenidos prácticos (12 horas): 1. Equipos de protección individual. 2. Sistemas de protección de caídas. 3. Dispositivos de anclaje. 4. Izado manual de cargas. www.previnsa.com ı	<urn:uuid:3f0864aa-89ae-4a31-9672-7c2d31b33ac7>	HuggingFaceFW/finepdfs/tree/main/data/spa_Latn/train	finepdfs	spa_Latn	1,112
Aquariumvereniging Ons Genoegen Tilburg SINCE DECEMBER 1950 \| mei 2024 De terugkeer van de go(o)den door Ronny Vannerom Tijdens de komende ledenavond van 16 mei zal ik jullie uitgebreid informeren over de Goodeiden. De meeste vissen in Mexico behoren tot de familie van de levendbarende Poeciliidae en Goodeidae. Deze beide genussen bezitten samen 130 soorten wat overeenkomt met 32% van alle zoetwater vissen in Mexico. Mexico heeft het de laatste decennia zwaar te verduren gehad met opwarming van de aarde, invasie van exoten en de lakse wetten van de Mexicaanse regering. Hierdoor is 39% van de zoetwatervissen bedreigd met uitsterven en dat geldt ook voor de goodeiden. Het land heeft ook een groot aantal natuurlijke prachtige biotopen. Zo kan men enkele terugvinden in de staat Michoacan. Waaronder La Mintzita waar actueel 13 inheemse vissoorten nog aanwezig zijn. Een plaats ook waar men uit de familie van Goodeiden het zeer bedreigde genus Allotoca kan terugvinden. Maar op veel plaatsen zijn de Goodeiden bedreigd, verdwenen of verdreven door exoten. Gelukkig zijn er ook voorbeelden van succesvolle herintroducties. Ik breng jullie een verhaal dat zal gaan over de moeilijke overlevingskansen van de Goodeiden maar daarnaast ook een beetje een aanzet om sommige soorten toch in het aquarium eens te houden. Colofon Aquariumvereniging Ons Genoegen St. Maartensloop 42, 5032 CW Tilburg Website: www.av-onsgenoegen.nl E-Mail: email@example.com ING Bank, IBAN: NL51 INGB 0002 4012 10 BIC: INGBNL2A Inschrijving KvK Tilburg: 40258362 CONTRIBUTIE m.i.v. 2024 \| Lidmaatschap AV Ons Genoegen \| € 37,40 \| \|-------------------------------\|---------\| \| Lidmaatschap + NBAT \| € 53,40 \| \| Lidmaatschap + NBAT + Het Aquarium \| € 78,40 \| \| Donateur (incl. verenigingsblad) \| € 37,40 \| Onze vereniging is aangesloten bij de Meedoenregeling van de gemeente Tilburg, wil je hiervan gebruik maken geef je dan op bij de penningmeester via e-mail. Alle bedragen gaan uit van automatische incasso. Jaarlijks wordt de contributie vastgesteld naar index CBS, Zie toelichting op website. Lidmaatschap beëindigen kan schriftelijk voor 1 december. LEDENBIJEENKOMSTEN Ledenbijeenkomsten, 3e donderdag van de maand bij Dierenpark De Oliemeulen, Reitsehoevenstraat 30 5042 EH Tilburg, Tel: 013-4630026 Aanvang 19.30u meerdere uitstapjes gedurende het jaar. Let op in Juli en augustus kan het zijn dat er geen bijeenkomsten zijn i.v.m. de vakantieperiode. © Niets uit deze uitgave mag worden verveelvoudigd en/of openbaar gemaakt worden door druk, fotokopie of op welke andere wijze dan ook, zonder toestemming van de eindredactie. Bestuur Voorzitter Secretaris Michel Ruts firstname.lastname@example.org 06 - 196 101 54 Penningmeester Kees Koons email@example.com 06 - 219 417 41 Redactie Michel Ruts firstname.lastname@example.org 06 - 196 101 54 overige bestuur Koen Wolters Vormgeving en fotografie Ezra Szigetti email@example.com 06 - 122 392 84 NBAT ZAKEN firstname.lastname@example.org \| Inhoudsopgave \| Pagina \| \|-------------------------------------\|--------\| \| Uit de bestuurskamer \| 5 \| \| Voorwoord van de voorzitter \| 6 \| \| Youtube aanraders van deze maand \| 9 \| \| Vis in de spotlight \| 20 \| \| Agenda \| 26 \| BIBLIOTHEEK Op de website staat een lijst met hierop de aanwezige boeken, cd’s, dvd’s en videobanden. Liefhebbers voor een papieren versie kunnen deze opvragen via het secretariaat. Alle media zijn één maand gratis te lenen. Wordt iets na één maand niet geretourneerd, dan zal er per te late maand € 1,00 in rekening worden gebracht. LEDEN VOOR LEDEN Leden voor leden is in het leven geroepen om leden die problemen met hun aquarium/terrarium hebben met raad en daad te ondersteunen. Hebt u problemen en komt u er zelf niet uit, schroom dan niet om contact op te nemen met het secretariaat. BAKKENSCHOUW Heeft u een mooi aquarium, of andere bezienswaardigheden over onze hobby? Geef u dan op voor een bakkenschouw. REDACTIE Kopij, aangeboden/gevraagden mededelingen dienen uiterlijk de laatste vrijdag van de maand bij de redactie binnen te zijn om nog in het eerstvolgende maandblad geplaatst te kunnen worden. Aanlevering kan via: email@example.com Of per post: AV-Ons Genoegen St. Maartensloop 42 5032 CW Tilburg MEEUWSSEN aquaria - hengelsport adviseurs voor uw aquarium haagdijk 145 breda tel. 076-5146759 firstname.lastname@example.org kijk ook eens op onze facebook-pagina Voorwoord van het bestuur Nu de maand mei is aangebroken lijkt eindelijk het betere weer zijn begonnen. Voor mij gevoel hebben we een hele lange herfst gehad door de vele regenbuien waar geen eind aan leek te komen. Toch klaag ik niet, de natuur heeft er enorm van geprofiteerd na vele jaren van droogte zie ik deze nu enorm groeien en bloeien onder deze ideale omstandigheden. Het is dus nu enorm genieten wanneer je eropuitgaat. Ook deze maand hadden we een uitje op de planning staan. Met een klein gezelschap hebben we op 11 mei Yerseke in Zeeland bezocht. zie verslag verderop in het blad. Op de ledenavond van 16 mei zal Ronny Vannerom ons iets meer vertellen over de terugkeer van de golfofen in Mexico. Ronny heeft al meerdere uitzonderlijke lezingen bij ons gegeven dus mis deze niet! Voor de maand erop hebben we de BBQ op de planning staan. Mocht je jezelf (en eventueel partner en kinders) nog niet opgegeven hebben meldt je dan nog vlug aan! Tenslotte hadden we voor volgende maand een uitje naar dierentuin Zoo Antwerpen staan (incl. Kijkje achter de schermen bij de aquaria). Helaas hebben we door tijdgebrek dit niet op tijd kunnen regelen waardoor we dit uitje schrappen van de planning van dit jaar. Wees niet getreurd we hebben voor dit jaar nog een hoop leuke uitjes op de planning en bewaren dit uitje voor volgend jaar. Michel Bakkenschouw Op vrijdag 26 april hadden we weer eens een ouderwetse bakkenschouw. 6 leden waren aanwezig en daaronder waren geen zee-aquarianen. Waarschijnlijk kennen ze de bak van Wilco al, want ik weet dat er regelmatig contacten zijn. De bak van Wilco staat in de garage van zijn huis met uitzicht op de tuin. Natuurlijk geen ideale plaats maar aan het aquarium zelf kon je daar niets van zien. De bak zag er prima uit en we zaten vol bewondering te kijken naar zijn bak. Toch altijd weer mooi om te zien hoe de verschillende kleurrijke koralen en zeevissen zo’n aquarium tot een aantrekkelijk plaatje maken. Je gaat bijna vanzelf denken om te switchen van zoet naar zee. Een gedachte die dikwijls al snel opzij wordt geschoven als je enig inzicht in de kosten krijgt. Hij bestrijdt dit overigens. Hij is ook begonnen met een gewone bak met een potfilter en dat is best te doen. Kies voor softkoralen en je kunt probleemloos een zeeaquarium houden. Wilco heeft dat traject natuurlijk al lang achter zich gelaten. De verlichting is professioneel, hetzelfde geldt voor de sump met een filter en automatisch toewoeging van osmosewater. Ook de stoffen voor het water worden via een automatisch doseersysteem toegevoegd. Hij zette aan het eind van de avond ook nog even de UV-verlichting aan. Hierdoor ging het aquarium nog mooier kleuren. We hebben ervan genoten, zelfs zo erg dat we vergaten naar zijn vijver te kijken (Matth heeft wel gekeken). Wilco, bedankt voor de gastvrijheid, het was de moeite waard. Afgesproken: Gegarandeerd altijd de laagste prijs! Hombach Tilburg Hestiastraat 1 Vossenberg oost nr.1227 Tel.:013-57805-75 HORN BACH Er is altijd iets te doen. hornbach.nl Op onze uitgebreide dierenafdeling vind je zoetwatervissen, waterplanten en alle bekende merken op gebied van aanschaf, inrichting en onderhoud aan aquaria! Wij bieden: - deskundig advies - gezonde vissen - kwalitatieve sterke planten - gratis watertest - merkproducten -levering aan huis Afgesproken: Gegarandeerd altijd de laagste prijs! Er is altijd iets te doen. Bunocephalus coracoideus Bunocephalus coracoideus is een vreedzame soort die een voorkeur heeft voor een donkere bodem van fijn zand en een niet al te dichte beplanting. Een goede filtering is aanbevolen. Aan temperatuur en watersamenstelling worden geen grote eisen gesteld. Planten moeten stevig verankerd worden aangezien deze soort graag woelt, vooral in de paartijd. Deze soort is in 1874 officieel beschreven door Cope. Synoniemen: Dysichthys coracoideus, Bunocephalus bicolor, Dysichthys bicolor, Bunocephalus haggini. Dieet Als voer moet fors levend voer worden gegeven. Kweek van de Bunocephalus coracoideus De kweek van de Bunocephalus coracoideus vindt plaats in groepen. Tot 5.000 eieren worden op de zandbodem afgezet. De jongen kunnen worden grootgebracht met het fijnste levend voer. Vanaf 12 mm wordt gehakte Tubifex gegeten. \| Familie \| Aspredinidae \| \|-----------------\|--------------\| \| Geslacht \| Bunocephalus \| \| Soortnaam \| coracoideus \| \| Synoniemen \| Bunocephalus bicolor, Bunocephalus haggini, Dysichthys bicolor, Dysichthys coracoideus \| \| Eerstbeschrijving\| Edward Drinker Cope \| \| Karakter \| Vredelievend \| \| Broedgedrag \| Substraatbroeder \| \| Dieet \| Carnivoor \| \| Zone \| Bodem \| \| Herkomst \| Zuid-Amerika \| \| Landen \| Bolivia, Brazilië, Peru, Uruguay \| \| Amazone \| Lengte Minimaal \| \|------------------\|-----------------\| \| \| 12 \| \| \| Lengte Maximaal \| \| \| 15 \| \| Temperatuur minimaal \| 20 \| \| Temperatuur maximaal \| 27 \| \| pH minimum \| 7.0 \| \| pH maximum \| 7.5 \| \| GH minimum \| 12 \| \| GH maximum \| 16 \| \| Auteur \| Jan Bukkems – Aquavisie \| \| Copyright foto’s \| Michael Negrini – Pisciculture d’Estalens Franz Steindachner (Tekening) \| Barbecue Voorheen was juni altijd de maand van het jaarlijks uitstapje gecombineerd met een barbecue aan het eind van de dag. Deze koppeling is losgelaten, we hebben immers een uitgebreid ErOpUit-programma. Hierdoor zijn er gedurende het jaar veel meer uitjes. In het kader van het ErOpUit-programma hadden we wel een uitje gepland naar de Zoo in Antwerpen. We vonden eigenlijk de entreeprijs (€ 30,50) veel te hoog en hebben tot nu toe een “kijkje achter de schermen” nog niet kunnen regelen. Daarom hebben we dit uitje gecanceld, misschien is het meer iets voor een jubileumjaar. Daarom resteert in de maand juni alleen nog maar een barbecue. Deze is gepland op donderdagavond (ledenavond) 20 juni. Zoals altijd zijn er voor deelname geen kosten verbonden, alleen de drank is voor eigen rekening. Tevens is het zo dat je als lid zijnde ook je partner mee mag nemen. De barbecue is gepland van 19.00 uur tot 22.00 uur. Wil je komen, meld je dan aan tijdens een van onze ledenvonden of via e-mail (email@example.com) Aquarium Coenen Iedere eerste zondag van de maand geopend van 12.00 tot 17.00 uur. Zeewater - Zoetwater - Aquariumbouw Aquarium Coenen B.V. - Koningin Julianaweg 21 5684 VA Best - Tel.: 0499 395000 firstname.lastname@example.org - www.aquariumcoenen.nl AQUAFIZZ AQUARIUMSPECIALZAAK Voor al uw planten, vissen, garnalen en toebehoren De grootste aquarium speciaalzaak van Zuid Holland, met meer dan 300 aquariums, 20000 vissen en 5000 garnalen. Aquafizz Willem Ruysplein 2-4 3333 BX Zwijndrecht 078-612 24 25 (Richard) Openingstijden: Maandag t/m Zaterdag Website: www.Aquafizz.nl Email: email@example.com Facebook: Aquafizz 9.30 tot 17.00 uur Bij ons in het tuincentrum is er een prachtige aquariumafdeling met een ruim en compleet assortiment. Heistraat 47 - 4909 BD Oosteind - 0162-312913 - firstname.lastname@example.org www.avri-tuincentrum.nl Grootste en goedkoopste vogel en dierenspeciaalzaak uit de regio Alles op het gebied van: Hond, Kat, Vogel, Vis, Knaagdier, Paard en Duif Vanaf 1 oktober bezorgservice* Duizenden dieren op voorraad Vogels - Knaagdieren - Vissen * informeer naar de voorwaarden Vogel & Dierenspeciaalzaak Geldof Prof. Keesomweg 10a Waalwijk Telefoon 0416 - 34 46 41 - www.vogelhandelgeldof.nl Let op nieuwe Website !! Vissen 2 betalen 3 halen !! http://www.vogelendierenspeciaalzaakgeldof.com L. KLERKS TUINCENTRUM Gespecialiseerd in keukenkruiden, groenteplanten en vaste planten. Ook voor al uw moeras- en oeverplanten. Op vertoon van uw lidmaatschap van vereniging "Ons Genoegen" krijgt u van ons 10% korting! www.tuincentrumklerks.nl BUBBELS Voor de Aquarium en vijver liefhebber Bubbels, Voltweg 25, 4631SR Hoogerheide, Tel: 0031 (0)164-612810, Webshop: www.bubbelsbv.nl Wij beschikken over een ruime eigen parkeerplaats Youtube aanrader van deze maand! In deze rubriek wordt er aandacht gevestigd op leerzame en interessante youtube kanalen, iedere maand zetten we hier nieuwe links neer waar we allemaal iets aan hebben in de aquarium hobby. Heb je zelf een favoriet? Laat het ons weten. En omdat dit een digitaal medium is, is het uiteraard alleen te bekijken via de link in de online pdf versie van dit maandblad. The Budget Aquarium Setup You Cannot Miss! https://youtu.be/U2qTZy-696c0?si=V2n5BDhnMCAM94yz Juwelen van de zee Germain LeysVerslag van de ledenavond Best gevaarlijk om een hele ledenavond aan een soort vis te besteden. Achteraf blijkt dat dat helemaal niet zo is. De familie (Labridae) van de lipvissen bestaat uit 70 genera 557 soorten. Best groot en voldoende om daar een avond mee te vullen. Ook niet saai want ze zijn niet alleen mooi maar ook verschillend van kleur en patroon. Ze zijn de kleurrijkste vissen op aarde en veranderen tijdens hun levensfase zelfs van kleur. Van deze 70 genera zijn er maar 10 geschikt voor een aquarium. Als je overigens wilt zoeken op het internet naar lipvissen ben je het meest succesvol als je de naam “wrasses” intypt. Enkele wetenswaardigheden over lipvissen: Verschijning: Alle lipvissen kennen vier verschillende levensstadia te weten juvenile – vrouwelijk – mannelijk – terminaal. Tijdens elk stadium zijn ze verschillend van kleur en patroon. Grootte: Lipvissen kunnen zeer groot worden, sommige zelfs 30 à 40 cm. Er zijn echter ook lipvissen die qua grootte onder de 10 cm blijven zoals het genus Cirrhilabrus. Milieu: Ze overleven niet als je te veel nitraat in je aquarium hebt. Om lipvissen te houden heb je een dikke zandbodem nodig van minimaal 10 cm dik. Het hebben van een groot aquarium is voorwaarde tot het houden van lipvissen. Hoewel de grootte varieert van 10 tot wel 40 cm of meer is een minimum lengte van 1,5 – 2 meter wel voorwaarde voor het houden van deze vissen. Voeding: Ze eten kleine crustaceeën, borstelwormen, slangsterretjes, kreeftachtigen, slakje, vlokvoer, artemia, mysis en krill. De meeste lipvissen eten ook planaria, maar niet genoeg om ze een plaag uit je aquarium te laten verwijderen. Gedrag: Lipvissen zijn springers en daarom is het raadzaam het aquarium af te dekken om te voorkomen dat je ze de volgende morgen op de vloer buiten het aquarium vindt. Lipvissen zwemmen gewoonlijk voor het rif en zullen dus vaak zichtbaar zijn. Ze gaan vaak op het levend steen op zoek naar iets eetbaars. Sommige lipvissen draaien de stenen om op zoek naar prooi. Dit geldt met name voor het genus Coris. Sommige lipvissen kunnen in schooltjes gehouden worden zoals het genus Halichoeres en/of de Bipartitus. Eentje zal zich tot mannetje ontwikkelen. Als je zoveel verschillende lipvissen ziet van zoveel verschillende soorten, kleuren, verschijningsvormen en grootte is het verstandig om je eerst goed te informeren voordat je daadwerkelijk tot koop overgaat. Laat je niet verleiden door de kleurpracht. Dit voorkomt teleurstellingen zowel voor jou als voor de dieren. Om een goed beeld te krijgen van het aanbod, zie je hierna een overzicht van de 10 genera met steeds één voorbeeld. LIMBEURS Zondag 7 juli 2024 VAN 10.00U TOT 16.00U De beurs voor aquarium, terrarium en tuinvijver m.m.v. fabrikanten, handelaars, kwekers en liefhebbers Organisatie B.B.A.T. Limburg SPORTCENTRUM KARTERIA Kluisbergstraat 21 - 3290 Diest Toegang: volwassenen € 5,00 Kinderen tot 12 jaar gratis - € 1,00 korting op vertoon van uw BBAT-lidkaart Info: +32 (0) 479 21 94 03 +32 (0) 489 68 25 15 www.limbeurs.be email@example.com Kortingen niet cumuleerbaar Aquariums are not just about fish; they are also about creating a beautiful and balanced ecosystem. The right combination of plants, rocks, and decorations can make your aquarium look stunning. Here are some tips to help you create a beautiful aquarium: 1. Choose the right plants: Plants are essential for creating a natural environment in your aquarium. They provide oxygen, help maintain water quality, and add color and texture to your tank. 2. Use a variety of rocks: Rocks can add visual interest to your aquarium and provide hiding spots for your fish. Make sure to choose rocks that are stable and won't break easily. 3. Add decorations: Decorations can help create a sense of depth and dimension in your aquarium. You can use driftwood, coral, or even small statues to add interest to your tank. 4. Keep it clean: Regularly cleaning your aquarium will help keep it healthy and looking its best. Make sure to remove any dead plants or fish waste to prevent algae growth. 5. Choose the right lighting: Lighting is important for plant growth and can also affect the mood of your aquarium. Choose lights that are appropriate for the type of plants you have in your tank. By following these tips, you can create a beautiful and thriving aquarium that will bring joy to you and your loved ones. AGENDA Programma 2024 Hieronder een overzicht van de activiteiten die inmiddels vastliggen. Ledenavonden: 20 juni: BBQ 19 september: Natuurproducten in het aquarium door Kenny Martens 12 december: Uitslag verenigingskeuring Uitjes 26 april: Bakkenschouw bij Wilco Bongers 11 mei: Aquariumplantenshop Heikenszand en excursie mosselkwekerij Yrseke Zie extra uitstapje Geef je idee of wens op bij firstname.lastname@example.org Externe agenda zie website. \| Datum \| 17 april 2024 \| \|---------------------\|---------------\| \| Onderwerp \| Juwelen van de zee \| \| Spreker \| Germain Leys \| \| Aanwezig leden \| 8 \| \| Ingeleverde enquêtes\| 7 \| \| Beoordeling lezing \| Opmerkingen lezing \| \| Zeer goed \| 2 \| \| Goed \| 5 \| \| Matig \| 0 \| \| Slecht \| 0 \| \| Geen mening \| 0 \| - Erg specifiek op 1 vissoort, daar wel veel over verteld maar weinig over het algemeen houden van lipvissen en hun toegevoegde waarde voor de bak. - Zeer interessant voor mij. Het is geen saaie opsomming. - Kleurrijke presentatie Aquariumvereniging Ons Genoegen St. Maartensloop 42 5032 CW Tilburg Website: www.av-onsgenoegen.nl E-Mail: email@example.com LEDENBIJEENKOMSTEN Ledenbijeenkomsten, 3e donderdag van de maand bij Dierenpark De Oliemeulen, Reitsehoevenstraat 30 5042 EH Tilburg, Tel: 013-4630026 Aanvang 19.30u	e631bb2c-daa5-4ae1-a460-bd8bd8c1a3a1	HuggingFaceFW/finepdfs/tree/main/data/nld_Latn/train	finepdfs	nld_Latn	19,137
ΕΘΝΙΚΟ ΣΧΕΔΙΟ ΕΦΑΡΜΟΓΗΣ ΓΙΑ ΤΗΝ ΠΡΟΣΒΑΣΙΜΟΤΗΤΑ ΤΟΥ ΕΛΛΗΝΙΚΟΥ ΣΙΔΗΡΟΔΡΟΜΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ ΓΙΑ ΤΑ ΑΤΟΜΑ ΜΕ ΑΝΑΠΗΡΙΑ ΚΑΙ ΑΤΟΜΑ ΜΕ ΜΕΙΩΜΕΝΗ ΚΙΝΗΤΙΚΟΤΗΤΑ 1 Ι. ΕΙΣΑΓΩΓΗ Σύμφωνα με τα προβλεπόμενα στον Κανονισμό (ΕΕ) 1300/2014 της Επιτροπής της 18ης Νοεμβρίου 2014 σχετικά με τις τεχνικές προδιαγραφές διαλειτουργικότητας για την προσβασιμότητα του σιδηροδρομικού συστήματος της Ευρωπαϊκής Ένωσης για άτομα με αναπηρία (ΑμεΑ) και άτομα με μειωμένη κινητικότητα (ΑΜΚ), τα Κράτη-Μέλη κοινοποιούν στην Ευρωπαϊκή Επιτροπή, εγκεκριμένα Εθνικά Σχέδια Εφαρμογής (ΕΣΕ) της εν θέματι Τεχνικής Προδιαγραφής Διαλειτουργικότητας (ΤΠΔ) με σκοπό την προοδευτική κατάργηση όλων των εντοπιζόμενων εμποδίων προσβασιμότητας. Το παρόν τεύχος συντάσσεται στο πλαίσιο της ως άνω περιγραφόμενης υποχρέωσης της χώρας μας. Για την κατάρτιση του ΕΣΕ λήφθηκε υπόψη το εξής νομοθετικό πλαίσιο: * Κανονισμός (ΕΚ) 1371/2007 σχετικά με τα δικαιώματα και τις υποχρεώσεις των επιβατών σιδηροδρομικών γραμμών * Νέος Οικοδομικός Κανονισμός (ΝΟΚ) Ν.4067/2012 (ΦΕΚ Α-79/09-04-2012) / Άρθρο 26 – Ειδικές Ρυθμίσεις για την Εξυπηρέτηση Ατόμων με Αναπηρία ή Εμποδιζόμενων Ατόμων * Απόφαση 52907/2009 (ΦΕΚ Β-2621/31-12-2009) * Απόφαση 52487/2002(ΦΕΚ 18Β/15-01-2002) * Οδηγίες Σχεδιασμού του Υπουργείου Περιβάλλοντος, Ενέργειας και Κλιματικής Αλλαγής «Σχεδιάζοντας για Όλους», όπως αυτές τροποποιούνται και ισχύουν κάθε φορά (άρθρο 26 ΝΟΚ) * Κύρωση της Σύμβασης για τα δικαιώματα των ατόμων με αναπηρίες και του Προαιρετικού Πρωτοκόλλου στη Σύμβαση για τα δικαιώματα των ατόμων με αναπηρίες, Ν.4074/2012 (ΦΕΚ Α-88/11-04-2012) * Συνταξιοδοτικές ρυθμίσεις Δημοσίου και λοιπές ασφαλιστικές διατάξεις, ενίσχυση της προστασίας των εργαζομένων, δικαιώματα ατόμων με αναπηρίες και άλλες διατάξεις, Ν.4488/2017 (ΦΕΚ Α-137/13-09-2017), ΜΕΡΟΣ Δ' ΚΑΤΕΥΘΥΝΤΗΡΙΕΣΟΡΓΑΝΩΤΙΚΕΣ ΔΙΑΤΑΞΕΙΣ ΥΛΟΠΟΙΗΣΗΣ ΤΗΣ ΣΥΜΒΑΣΗΣ ΤΩΝ ΗΝΩΜΕΝΩΝ ΕΘΝΩΝ ΓΙΑ ΤΑ ΔΙΚΑΙΩΜΑΤΑ ΤΩΝ ΑΤΟΜΩΝ ΜΕ ΑΝΑΠΗΡΙΕΣ, ΚΕΦΑΛΑΙΑ Α'-Δ' Οι οργανισμοί που συνέβαλαν/γνωμοδότησαν επί του ΕΣΕ είναι οι κάτωθι: 1. Ρυθμιστική Αρχή Σιδηροδρόμων (ΡΑΣ), ασκεί τα καθήκοντα της Εθνικής Αρχής Ασφάλειας 2. Οργανισμός Σιδηροδρόμων Ελλάδας (ΟΣΕ Α.Ε), ασκεί τα καθήκοντα του Διαχειριστή Υποδομής 3. ΕΡΓΑ ΟΣΕ (ΕΡΓΟΣΕ Α.Ε.), αποτελεί θυγατρική Εταιρεία του ΟΣΕ για τη Διαχείριση των Έργων του ΟΣΕ 4. ΤΡΑΙΝΟΣΕ Μεταφορές - Μεταφορικές Υπηρεσίες Επιβατών και Φορτιού Ανώνυμη Σιδηροδρομική Εταιρεία (ΤΡΑΙΝΟΣΕ Α.Ε.), αποτελεί εταιρεία παροχής Σιδηροδρομικών Μεταφορών 5. Σταθερές Συγκοινωνίες (ΣΤΑΣΥ ΑΕ), αποτελεί εταιρεία παροχής Σιδηροδρομικών Μεταφορών 6. Εταιρεία Διαχείρισης Σιδηροδρομικής Περιουσίας (ΓΑΙΑΟΣΕ Α.Ε), υπεύθυνη για την διαχείριση του τροχαίου υλικού 7. Ε.Σ.Α.μεΑ.: Εθνική Συνομοσπονδία Ατόμων με Αναπηρία. Η κατάρτιση ΕΣΕ για το σιδηροδρομικό σύστημα της χώρας μας αποτελεί αναγκαιότητα και υποχρέωση όλων των εμπλεκόμενων φορέων σε σχέση με τους συμπολίτες μας οι οποίοι αντιμετωπίζουν προβλήματα μετακίνησης και επί του παρόντος δεν ικανοποιούνται πλήρως από τις υπάρχουσες υποδομές. Η ΤΡΑΙΝΟΣΕ, ως βασικός πάροχος σιδηροδρομικής μεταφοράς επιβατών στην Ελλάδα, θέσπισε εγκύκλιο αναφορικά με τη διαδικασία μεταφοράς ΑμεΑ/ΑΜΚ με σιδηρόδρομο στην Ελλάδα, μέχρι τη γενικότερη επίλυση των προβλημάτων που συνδέονται με τη σιδηροδρομική μεταφορά ΑμεΑ/ΑΜΚ με σιδηρόδρομο. Η εγκύκλιος αυτή είναι διαθέσιμη στην ιστοσελίδα της ΤΡΑΙΝΟΣΕ στη διαδρομή Αρχική \ Επιβατικό Έργο \ Υπηρεσίες για τον επιβάτη \ Μεταφορά ατόμων ΑμεΑ/ΑΜΚ όπου φαίνονται η επικαιροποιημένη διαδικασία μεταφοράς ΑμεΑ/ΑΜΚ καθώς και η φόρμα μεταφοράς ΑμεΑ/ΑΜΚ (Παράρτημα Ι). Επισημαίνεται ότι η ιστοσελίδα πρόκειται να καταστεί προσβάσιμη στα άτομα με αναπηρία σύμφωνα με τα οριζόμενα στην υπ. αριθμ. ΥΑΠ/Φ.40.4/1/989 (Β' 1301/12.04.2012) Απόφαση «Κύρωση Πλαισίου Παροχής Υπηρεσιών Ηλεκτρονικής Διακυβέρνησης», έως τον Ιούλιο του 2018. Επίσης η ΤΡΑΙΝΟΣΕ, στο πλαίσιο των αρμοδιοτήτων της, προχώρησε σε έρευνα αγοράς μηχανικών βοηθημάτων για τη μεταφορά αναπηρικών αμαξιδίων από το επίπεδο της αποβάθρας έως το επίπεδο του συρμού. Σε συνεννόηση με την κατασκευάστρια εταιρία και με την παρουσία εκπροσώπου της, πραγματοποιήθηκαν με επιτυχία προκαταρκτικές δοκιμές δύο μηχανικών βοηθημάτων επιβίβασης με ικανοποιητικά αποτελέσματα και το αρμόδιο προσωπικό της ΤΡΑΙΝΟΣΕ στους σταθμούς της Αθήνας και της Θεσσαλονίκης έχει ήδη εκπαιδευτεί στη χρήση τους. Ο ΟΣΕ έχει ξεκινήσει τις διαδικασίες για την προμήθεια σε πρώτη φάση έξι (6) μηχανικών βοηθημάτων, τα οποία θα καλύψουν τις ανάγκες αρχικά των τριών σταθμών με την μεγαλύτερη επιβατική κίνηση Αθηνών – Λάρισας – Θεσσαλονίκης. Εκτός των ανωτέρω η ΤΡΑΙΝΟΣΕ έχει προχωρήσει στην προμήθεια ειδικών εύχρηστων κινητών ραμπών επιβίβασης επιβατών ΑμεΑ στις ηλεκτροκίνητες αμαξοστοιχίες (electric Desiro), διευκολύνοντας τη διέλευση τόσο των χειροκίνητων, όσο και των ηλεκτροκίνητων αμαξιδίων των ατόμων με κινητικά προβλήματα εξυπηρετώντας την κάλυψη του οριζόντιου κενού μεταξύ του ηλεκτρικού συρμού και της αποβάθρας. Οι αμαξοστοιχίες electric Desiro εκτελούν δρομολόγια στις γραμμές: * Αεροδρομίου - Πειραιά – Χαλκίδας (πρόκειται για 27 ζεύγη ραμπών, τα οποία θα τοποθετηθούν ανά δύο στους αντίστοιχους ενεργούς σταθμούς της διαδρομής). Ήδη υπάρχουν στο τμήμα του προαστιακού Κιάτο -Αεροδρόμιο -Πειραιάς και θα συμπληρωθεί η γραμμή της Χαλκίδας και ότι έχει καταστραφεί στα υπόλοιπα τμήματα του Προαστιακού δικτύου της Αθήνας – Αεροδρομίου – Κιάτου. * Προαστιακός Πάτρας - Σταθμοί: Πάτρα και Ρίο (είναι σε εξέλιξη) * Θεσσαλονίκης - Λάρισας (πρόκειται για ζεύγη ραμπών, τα οποία τοποθετήθηκαν ανά δύο στους σταθμούς Λάρισας, Νέων Πόρων, Λεπτοκαρυάς, Λιτοχωρίου, Ραψάνης, Κατερίνης, Πλατέος, Αδένδρου και Θεσσαλονίκης) και κρατήθηκαν και εφεδρικά. Τέλος, ο ΟΣΕ ως Διαχειριστής Υποδομής, θα προβεί σε όλες τις απαραίτητες ενέργειες– συνεννοήσεις με όλους τους εμπλεκόμενους φορείς για την από κοινού συνεργασία, για την εξασφάλιση απαιτούμενων χώρων στάθμευσης ατόμων με αναπηρία ή μειωμένης κινητικότητας καθώς και την κάλυψη των απαιτήσεων για την εξασφάλιση της διαδρομής χωρίς εμπόδια από σημείο στάσης άλλων μέσων μεταφοράς εντός των ορίων των σταθμών. ΙΙ. ΥΠΟΔΟΜΗ - ΥΦΙΣΤΑΜΕΝΗ ΚΑΤΑΣΤΑΣΗ, ΣΤΡΑΤΗΓΙΚΗ ΚΑΙ ΣΧΕΔΙΑΣΜΟΣ Η ανακαίνιση/αναβάθμιση των περισσότερων σιδηροδρομικών σταθμών/στάσεων του σιδ/κου δικτύου ΠΑΘΕ, του Προαστιακού Αθήνας και άλλων αξόνων του σιδ/κου δικτυού, όπως εμφανίζονται στον συνημμένο χάρτη (Παράρτημα ΙΙ), έχει ολοκληρωθεί πριν την εφαρμογή του Κανονισμού (ΕΕ) 1300/2014, αλλά στους περισσότερους σταθμούς σε μεγάλο βαθμό καλύπτονται οι απαιτήσεις της Κανονισμού. Επιπλέον βρίσκονται υπό κατασκευή από την ΕΡΓΟΣΕ νέοι σιδηροδρομικοί σταθμοί, οι οποίοι θα παραδοθούν στον Διαχειριστή Υποδομής το διάστημα 2018 – 2023 και οι οποίοι θα πληρούν τις απαιτήσεις του Κανονισμού. Ο ευρύτερος σχεδιασμός του ΟΣΕ, ως Διαχειριστής Υποδομής, είναι την επόμενη δεκαετία να μεριμνήσει για την εκτέλεση μελετών και έργων, ώστε να υπάρχει πλήρης συμμόρφωση προς τις τεχνικές προδιαγραφές της παραγράφου 4.2.1 του Κανονισμού (ΕΕ) 1300/2014, που αφορούν το υποσύστημα «υποδομή». Ο σχεδιασμός στοχεύει στην εξασφάλιση της απαίτησης για τήρηση της ανεμπόδιστης προσβασιμότητας σε σταθμούς με μέγιστη ημερήσια ροή διακίνησης επιβατών σε 12μηνη βάση (αφίξεις και αναχωρήσεις), 1.000 επιβάτες και την εξασφάλιση ενός προσβάσιμου σταθμού, που πληροί τις απαιτήσεις του Κανονισμού ΕΕ 1300/2014, ανά 50 km σε όλο το μήκος του σιδ/κου δικτύου κανονικού εύρους της χώρας, όπως αυτό αποτυπώνεται στο συνημμένο σιδ/κο χάρτη (Παράρτημα ΙΙ) με χρονοδιάγραμμα ολοκλήρωσης των παρακάτω σταθμών. Ο σχεδιασμός του ΟΣΕ έλαβε υπόψη επιπλέον των παραπάνω απαιτήσεων του Κανονισμού και άλλα κριτήρια όπως, την εξυπηρέτηση των μεγάλων αστικών κέντρων, πληθυσμιακά, κοινωνικά αλλά και τουριστικά και χωροταξικά κριτήρια. Για την κατάρτιση του ΕΣΕ προσδιορίστηκε ο χρονικός ορίζοντας για την επόμενη δεκαετία 2018 – 2028, των έργων που θα κατασκευάσει ο ΟΣΕ και η ΕΡΓΟΣΕ ώστε να λειτουργούν στην σιδηροδρομική υποδομή σταθμοί με προβλεπόμενο επίπεδο εξυπηρέτησης ΑΜΕΑ/ΑμΚ ή πλήρως συμμορφωμένοι με τον Κανονισμό (ΕΕ) 1300/2014. Στους παρακάτω Πίνακες παρουσιάζεται το σιδηροδρομικό δίκτυο του ΟΣΕ σε τμήματα γραμμής και παρατίθενται οι εξής πληροφορίες: (1) Περιγραφή Δικτύου (2) Σιδηροδρομικοί Σταθμοί 5 (3) Απόσταση μεταξύ των σταθμών (4) Βαθμός Συμμόρφωσης σήμερα, με την παρακάτω κλίμακα κατηγοριοποίησης: Προς Δημοπράτηση (ΠΔ) Υπό Κατασκευή (ΥΚ) Καλύπτει (Κ) (Η αναφορά προσδιορίζει σταθμούς που έχουν τεθεί σε λειτουργία τα τελευταία χρόνια, καλύπτουν τις απαιτήσεις του Κανονισμού σε μεγάλο βαθμό αλλά απαιτούνται προσαρμογές/επεμβάσεις πολύ μικρής κλίμακας για την πλήρη συμμόρφωση). Λίγες Ελλείψεις (ΛΕ) Πολλές Ελλείψεις (ΠΕ) (5) Χρόνος συμμόρφωσης \| \| Α. ΤΜΗΜΑ ΠΑΤΡΑ - ΚΟΡΙΝΘΟΣ – ΣΚΑ - ΑΘΗΝΑ (CORE NETWORK) \| \| \| \| \|---\|---\|---\|---\|---\| \| ΠΕΡΙΓΡΑΦΗ ΔΙΚΤΥΟΥ \| \| ΣΙΔΗΡΟΔΡΟΜΙΚΟΣ ΣΤΑΘΜΟΣ \| ΑΠΟΣΤΑΣΗ ΜΕΤΑΞΥ ΔΙΑΔΟΧΙΚΩΝ ΣΤΑΘΜΩΝ (km) \| ΒΑΘΜΟΣ ΣΥΜΜΟΡΦΩΣΗΣ ΣΗΜΕΡΑ \| \| \| \| ΣΣ Πάτρας \| ΑΦΕΤΗΡΙΑ \| ΠΔ \| \| \| \| ΣΣ Αιγίου \| 32 \| ΥΚ \| \| \| \| ΣΣ Διακοφτού \| 16 \| ΥΚ \| \| \| \| ΣΣ Ξυλοκάστρου \| 41 \| ΥΚ \| \| \| \| ΣΣ Κιάτου \| 10 \| Κ \| \| \| \| ΣΣ Κορίνθου \| 25 \| Κ \| \| \| \| ΣΣ Μεγάρων \| 40 \| Κ \| \| \| \| ΣΚΑ \| 32 \| ΛΕ \| Β. ΠΡΟΑΣΤΙΑΚΟΣ ΣΚΑ – ΑΕΡΟΔΡΟΜΙΟ \| ΠΕΡΙΓΡΑΦΗ ΔΙΚΤΥΟΥ \| ΣΙΔΗΡΟΔΡΟΜΙΚΟΣ ΣΤΑΘΜΟΣ \| ΑΠΟΣΤΑΣΗ ΜΕΤΑΞΥ ΔΙΑΔΟΧΙΚΩΝ ΣΤΑΘΜΩΝ (km) \| ΒΑΘΜΟΣ ΣΥΜΜΟΡΦΩΣΗΣ ΣΗΜΕΡΑ \| ΧΡΟΝΟΣ ΣΥΜΜΟΡΦΩΣ ΗΣ \| \|---\|---\|---\|---\|---\| \| ΔΙΠΛΗ ΣΙΔΗΡΟΔΡΟΜΙΚΗ ΓΡΑΜΜΗ ΜΕ ΣΗΜΑΤΟΔΟΤΗΣΗ ΚΑΙ ΗΛΕΚΤΡΟΚΙΝΗΣΗ \| ΣΚΑ \| ΑΦΕΤΗΡΙΑ \| ΛΕ \| 2019 \| \| \| ΣΣ Μεταμόρφωσης \| 1,3 \| Κ \| 2019 \| \| \| ΣΣ Ηρακλείου \| 1,5 \| Κ \| 2019 \| \| \| ΣΣ Νερατζιώτισσας \| 2 \| Κ \| 2019 \| \| \| ΣΣ Κηφισίας \| 1,2 \| Κ \| 2019 \| \| \| ΣΣ Πεντέλης \| 2 \| Κ \| 2019 \| \| \| ΣΣ Δουκίσης Πλακεντίας \| 1,2 \| Κ \| 2019 \| \| \| ΣΣ Παλλήνης \| 4,5 \| Κ \| 2019 \| \| \| ΣΣ Κάντζας \| 2,5 \| Κ \| 2019 \| \| \| Κορωπίου \| 8,5 \| Κ \| 2019 \| \| \| Γ. ΤΜΗΜΑ ΟΙΝΟΗ - ΧΑΛΚΙΔΑ \| \| \| \| \|---\|---\|---\|---\|---\| \| ΠΕΡΙΓΡΑΦΗ ΔΙΚΤΥΟΥ \| \| ΣΙΔΗΡΟΔΡΟΜΙΚΟΣ ΣΤΑΘΜΟΣ \| ΑΠΟΣΤΑΣΗ ΜΕΤΑΞΥ ΔΙΑΔΟΧΙΚΩΝ ΣΤΑΘΜΩΝ (km) \| ΒΑΘΜΟΣ ΣΥΜΜΟΡΦΩΣΗΣ ΣΗΜΕΡΑ \| \| ΜΟΝΗ ΣΙΔΗΡΟΔΡΟΜΙΚΗ ΓΡΑΜΜΗ ΜΕ ΣΗΜΑΤΟΔΟΤΗΣΗ ΚΑΙ ΗΛΕΚΤΡΟΚΙΝΗΣΗ \| \| ΣΣ Οινόης \| ΑΦΕΤΗΡΙΑ \| ΠΕ \| \| \| \| ΣΣ Χαλκίδας \| 22 \| ΛΕ \| Δ. ΤΜΗΜΑ ΠΕΙΡΑΙΑΣ – ΑΘΗΝΑ – ΘΕΣΣΑΛΟΝΙΚΗ (CORE NETWORK) \| ΠΕΡΙΓΡΑΦΗ ΔΙΚΤΥΟΥ \| ΣΙΔΗΡΟΔΡΟΜΙΚΟΣ ΣΤΑΘΜΟΣ \| ΑΠΟΣΤΑΣΗ ΜΕΤΑΞΥ ΔΙΑΔΟΧΙΚΩΝ ΣΤΑΘΜΩΝ (km) \| ΒΑΘΜΟΣ ΣΥΜΜΟΡΦΩΣΗΣ ΣΗΜΕΡΑ \| \|---\|---\|---\|---\| \| ΔΙΠΛΗ ΣΙΔΗΡΟΔΡΟΜΙΚΗ ΓΡΑΜΜΗ ΜΕ ΣΗΜΑΤΟΔΟΤΗΣΗ ΚΑΙ ΗΛΕΚΤΡΟΚΙΝΗΣΗ \| ΣΣ Πειραιά \| ΑΦΕΤΗΡΙΑ \| Κ \| \| \| ΣΣ Αθηνών \| 10 \| ΥΚ \| \| \| ΣΚΑ \| 30 \| ΛΕ \| \| \| ΣΣ Οινόης \| 31 \| ΛΕ \| \| \| ΣΣ Θήβας \| 29 \| ΛΕ \| \| \| ΣΣ Λειβαδιάς \| 41 \| ΛΕ \| \| \| ΣΣ Τιθορέας \| 25 \| ΥΚ \| \| \| ΣΣ Μώλου \| 26 \| ΥΚ \| \| \| ΣΣ Λιανοκλαδίου \| 28 \| ΥΚ \| \| \| ΣΣ Αγίου Στεφάνου Ξυνιάδας \| 26 \| ΥΚ \| \| \| ΣΣ Δομοκού \| 25 \| ΥΚ \| \| \| ΣΣ Παλαιοφαρσάλου \| 15 \| ΛΕ \| \| \| ΣΣ Λάρισας \| 45 \| ΠΕ \| \| \| ΣΣ Νέων Πόρων \| 50 \| ΛΕ \| \| \| ΣΣ Κατερίνης \| 30 \| ΛΕ \| \| \| ΣΣ Πλατέως \| 47 \| ΠΕ \| \| \| ΣΣ Θεσσαλονίκης \| 30 \| ΛΕ \| Ε. ΤΜΗΜΑ ΠΑΛΙΟΦΑΡΣΑΛΟΣ - ΚΑΛΑΜΠΑΚΑ \| ΠΕΡΙΓΡΑΦΗ ΔΙΚΤΥΟΥ \| ΣΙΔΗΡΟΔΡΟΜΙΚΟΣ ΣΤΑΘΜΟΣ \| ΑΠΟΣΤΑΣΗ ΜΕΤΑΞΥ ΔΙΑΔΟΧΙΚΩΝ ΣΤΑΘΜΩΝ (km) \| ΒΑΘΜΟΣ ΣΥΜΜΟΡΦΩΣΗΣ ΣΗΜΕΡΑ \| \|---\|---\|---\|---\| \| ΜΟΝΗ ΣΙΔΗΡΟΔΡΟΜΙΚΗ ΓΡΑΜΜΗ ΜΕ ΣΗΜΑΤΟΔΟΤΗΣΗ ΚΑΙ ΗΛΕΚΤΡΟΚΙΝΗΣΗ \| ΣΣ Παλαιοφαρσάλου \| ΑΦΕΤΗΡΙΑ \| ΛΕ \| \| \| ΣΣ Καρδίτσας \| 30 \| ΛΕ \| \| \| ΣΣ Τρικάλων \| 30 \| ΛΕ \| \| \| ΣΣ Καλαμπάκας \| 21 \| ΛΕ \| \| \| ΣΤ. ΤΜΗΜΑ ΛΑΡΙΣΑ - ΒΟΛΟΣ \| \| \| \| \|---\|---\|---\|---\|---\| \| ΠΕΡΙΓΡΑΦΗ ΔΙΚΤΥΟΥ \| \| ΣΙΔΗΡΟΔΡΟΜΙΚΟΣ ΣΤΑΘΜΟΣ \| ΑΠΟΣΤΑΣΗ ΜΕΤΑΞΥ ΔΙΑΔΟΧΙΚΩΝ ΣΤΑΘΜΩΝ (km) \| ΒΑΘΜΟΣ ΣΥΜΜΟΡΦΩΣΗΣ ΣΗΜΕΡΑ \| \| ΜΟΝΗ ΣΙΔΗΡΟΔΡΟΜΙΚΗ ΓΡΑΜΜΗ ΜΕ ΣΗΜΑΤΟΔΟΤΗΣΗ ΚΑΙ ΗΛΕΚΤΡΟΚΙΝΗΣΗ \| \| ΣΣ Λάρισας \| ΑΦΕΤΗΡΙΑ \| ΠΕ \| \| \| \| ΣΣ Βελεστίνου \| 41 \| ΠΕ \| \| \| \| ΣΣ Βόλου \| 20 \| ΠΕ \| \| \| Ζ. ΤΜΗΜΑ ΘΕΣΣΑΛΟΝΙΚΗ –ΣΤΡΥΜΩΝΑ – ΠΡΟΜΑΧΩΝΑ (CORE NETWORK) \| \| \| \| \|---\|---\|---\|---\|---\| \| ΠΕΡΙΓΡΑΦΗ ΔΙΚΤΥΟΥ \| \| ΣΙΔΗΡΟΔΡΟΜΙΚΟΣ ΣΤΑΘΜΟΣ \| ΑΠΟΣΤΑΣΗ ΜΕΤΑΞΥ ΔΙΑΔΟΧΙΚΩΝ ΣΤΑΘΜΩΝ (km) \| ΒΑΘΜΟΣ ΣΥΜΜΟΡΦΩΣΗΣ ΣΗΜΕΡΑ \| \| ΜΟΝΗ ΣΙΔΗΡΟΔΡΟΜΙΚΗ ΓΡΑΜΜΗ ΜΕ ΣΗΜΑΤΟΔΟΤΗΣΗ ΚΑΙ ΗΛΕΚΤΡΟΚΙΝΗΣΗ \| \| ΣΣ Θεσσαλονίκης \| ΑΦΕΤΗΡΙΑ \| ΛΕ \| \| \| \| ΣΣ Κιλκίς \| 41 \| ΠΕ \| \| \| \| ΣΣ Ροδόπολης \| 21 \| ΠΕ \| \| \| \| ΣΣ Στρυμόνα \| 37 \| ΠΕ \| \| \| \| ΣΣ Προμαχώνα \| 13 \| ΠΕ \| Η. ΤΜΗΜΑ ΘΕΣΣΑΛΟΝΙΚΗ – ΕΙΔΟΜΕΝΗ (CORE NETWORK) \| ΠΕΡΙΓΡΑΦΗ ΔΙΚΤΥΟΥ \| ΣΙΔΗΡΟΔΡΟΜΙΚΟΣ ΣΤΑΘΜΟΣ \| ΑΠΟΣΤΑΣΗ ΜΕΤΑΞΥ ΔΙΑΔΟΧΙΚΩΝ ΣΤΑΘΜΩΝ (km) \| ΒΑΘΜΟΣ ΣΥΜΜΟΡΦΩΣΗΣ ΣΗΜΕΡΑ \| \|---\|---\|---\|---\| \| ΜΟΝΗ ΣΙΔΗΡΟΔΡΟΜΙΚΗ ΓΡΑΜΜΗ ΜΕ ΣΗΜΑΤΟΔΟΤΗΣΗ ΚΑΙ ΗΛΕΚΤΡΟΚΙΝΗΣΗ \| ΣΣ Θεσσαλονίκης \| ΑΦΕΤΗΡΙΑ \| ΛΕ \| \| \| ΣΣ Γέφυρας \| 22 \| ΠΕ \| \| \| ΣΣ Πολυκάστρου \| 34 \| ΥΚ \| \| \| ΣΣ Ειδομένης \| 22 \| ΥΚ \| \| \| Θ. ΤΜΗΜΑ ΠΛΑΤΥ - ΦΛΩΡΙΝΑ \| \| \| \| \|---\|---\|---\|---\|---\| \| ΠΕΡΙΓΡΑΦΗ ΔΙΚΥΟΥ \| \| ΣΙΔΗΡΟΔΡΟΜΙΚΟΣ ΣΤΑΘΜΟΣ \| ΑΠΟΣΤΑΣΗ ΜΕΤΑΞΥ ΔΙΑΔΟΧΙΚΩΝ ΣΤΑΘΜΩΝ (km) \| ΒΑΘΜΟΣ ΣΥΜΜΟΡΦΩΣΗΣ ΣΗΜΕΡΑ \| \| ΜΟΝΗ ΣΙΔΗΡΟΔΡΟΜΙΚΗ ΓΡΑΜΜΗ ΜΕ ΣΗΜΑΤΟΔΟΤΗΣΗ ΚΑΙ ΗΛΕΚΤΡΟΚΙΝΗΣΗ \| \| ΣΣ Πλατέως \| ΑΦΕΤΗΡΙΑ \| ΛΕ \| \| \| \| ΣΣ Βέροιας \| 31 \| ΠΕ \| \| \| \| ΣΣ Νάουσας \| 12 \| ΠΕ \| \| \| \| ΣΣ Έδεσσας \| 32 \| ΠΕ \| \| \| \| ΣΣ Αμυνταίου \| 50 \| ΠΕ \| \| \| \| ΣΣ Φλώρινας \| 28 \| ΠΕ \| \| ΠΕΡΙΓΡΑΦΗ ΔΙΚΤΥΟΥ \| ΣΙΔΗΡΟΔΡΟΜΙΚΟΣ ΣΤΑΘΜΟΣ \| ΑΠΟΣΤΑΣΗ ΜΕΤΑΞΥ ΔΙΑΔΟΧΙΚΩΝ ΣΤΑΘΜΩΝ (km) \| ΒΑΘΜΟΣ ΣΥΜΜΟΡΦΩΣΗΣ ΣΗΜΕΡΑ \| ΧΡΟΝΟΣ ΣΥΜΜΟΡΦΩΣΗΣ \| \|---\|---\|---\|---\|---\| \| ΜΟΝΗ ΣΙΔΗΡΟΔΡΟΜΙΚΗ ΓΡΑΜΜΗ ΧΩΡΙΣ ΣΗΜΑΤΟΔΟΤΗΣΗ ΚΑΙ ΗΛΕΚΤΡΟΚΙΝΗΣΗ \| ΣΣ Στρυμόνα \| ΑΦΕΤΗΡΙΑ \| ΠΕ \| 2020 \| \| \| ΣΣ Σερρών \| 32 \| ΠΕ \| 2025 \| \| \| ΣΣ Νέας Ζίχνης \| 33 \| ΠΕ \| 2025 \| \| \| ΣΣ Δράμας \| 38 \| ΠΕ \| 2025 \| \| \| ΣΣ Παρανεστίου \| 37 \| ΠΕ \| 2025 \| \| \| ΣΣ Ξάνθης \| 50 \| ΠΕ \| 2025 \| \| \| ΣΣ Κομοτηνής \| 47 \| ΠΕ \| 2025 \| \| \| ΣΣ Μέστης \| 30 \| ΠΕ \| 2025 \| \| \| ΣΣ Αλεξανδρούπολης \| 38 \| ΠΕ \| 2025 \| \| \| Κ. ΤΜΗΜΑ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗ - ΟΡΜΕΝΙΟ \| \| \| \| \|---\|---\|---\|---\|---\| \| ΠΕΡΙΓΡΑΦΗ ΔΙΚΤΥΟΥ \| \| ΣΙΔΗΡΟΔΡΟΜΙΚΟΣ ΣΤΑΘΜΟΣ \| ΑΠΟΣΤΑΣΗ ΜΕΤΑΞΥ ΔΙΑΔΟΧΙΚΩΝ ΣΤΑΘΜΩΝ (km) \| ΒΑΘΜΟΣ ΣΥΜΜΟΡΦΩΣΗΣ ΣΗΜΕΡΑ \| \| ΜΟΝΗ ΣΙΔΗΡΟΔΡΟΜΙΚΗ ΓΡΑΜΜΗ ΧΩΡΙΣ ΣΗΜΑΤΟΔΟΤΗΣΗ ΚΑΙ ΗΛΕΚΤΡΟΚΙΝΗΣΗ \| \| ΣΣ Αλεξανδρούπολης \| ΑΦΕΤΗΡΙΑ \| ΠΕ \| \| \| \| ΣΣ Φερών \| 29 \| ΠΕ \| \| \| \| ΣΣ Σουφλίου \| 40 \| ΠΕ \| \| \| \| ΣΣ Διδυμότειχου \| 23 \| ΠΕ \| \| \| \| ΣΣ Πυθίου \| 20 \| ΠΕ \| \| \| \| ΣΣ Ορεστιάδας \| 45 \| ΠΕ \| Οι σταθμοί που έχουν επιλεγεί να προσαρμοστούν κατά προτεραιότητα πλήρως στις διατάξεις του Κανονισμού είναι οι εξής: ΣΣ Κορίνθου, ΣΣ Πειραιά, ΣΣ Αθηνών, ΣΣ Τιθορέας, ΣΣ Μώλου, ΣΣ Λιανοκλαδίου, ΣΣ Αγίου Στεφάνου Ξυνιάδας, ΣΣ Δομοκού, ΣΣ Παλαιοφαρσάλου και ΣΣ Κατερίνης. ΙΙΙ. ΤΡΟΧΑΙΟ ΥΛΙΚΟ - ΥΦΙΣΤΑΜΕΝΗ ΚΑΤΑΣΤΑΣΗ, ΣΤΡΑΤΗΓΙΚΗ ΚΑΙ ΣΧΕΔΙΑΣΜΟΣ ΙΙΙ.1 Τροχαίο Υλικό αρμοδιότητας ΓΑΙΑΟΣΕ Σύμφωνα με τις αυτοψίες που διενεργήθηκαν στους τύπους του Τροχαίου Υλικού που έχουν κάποιες υποδομές για την εξυπηρέτηση ατόμων μειωμένης κινητικότητας, προέκυψε ο προσδιορισμός της υφιστάμενης κατάστασης, η ενδεικτική αξιολόγηση του βαθμού συμμόρφωσης με τον κανονισμό και ο ενδεικτικός προσδιορισμός βασικών παρεμβάσεων που μπορούν να γίνουν οι οποίες χαρακτηρίζονται ως εκτεταμένες ή μη εκτεταμένες. Ακολουθεί πίνακας στο οποίο καταγράφεται το Τροχαίο Υλικό ανάλογα με το αν ικανοποιεί σε κάποιο βαθμό την οδηγία ή δεν ικανοποιεί καθόλου. Το Τροχαίο Υλικό το οποίο καταγράφεται στην αρχή του πίνακα και αφορά: * Επιβατάμαξες (Ε/Α) τύπου ADmz Α' Θέσης * Ηλεκτροκίνητες Αυτοκινητάμαξες (ΗΑ/A-EMU) τύπου Siemens Desiro (προαστιακός) * Αυτοκινητάμαξες (Α/Α) τύπου AEG/LEW (τετράδυμοι συρμοί) * Αυτοκινητάμαξες (Α/Α) τύπου MAN2000 είναι εκείνο το οποίο έχει προβλέψεις που αφορούν τον κανονισμό, σε αυτό θα δοθεί μεγαλύτερη βαρύτητα και περιλαμβάνει τα οχήματα στα οποία θα γίνουν οι αρχικές παρεμβάσεις. Υπολογίζεται ότι οι εργασίες, των αρχικών παρεμβάσεων, θα ολοκληρωθούν σε 18 μήνες από την προκήρυξη του διαγωνισμού ο οποίος χρονικά μπορεί να προσδιορισθεί μέχρι το τέλος του 2022, υπό την προϋπόθεση να βρεθεί έγκαιρα χρηματοδότηση. Το κόστος των παρεμβάσεων που απαιτούνται υπολογίζεται περίπου στα 4.500.000 Ευρώ, χωρίς να έχει γίνει ακόμη λεπτομερής καταγραφή και υπολογισμός. Στο δεύτερο μέρος του πίνακα καταγράφεται το Τροχαίο Υλικό το οποίο δεν ικανοποιεί τον κανονισμό. Για αυτό θα γίνουν καταγραφές και θα εξετασθεί το κατά πόσο μπορούν να γίνουν παρεμβάσεις οι οποίες θα το βελτιώσουν σε σχέση με τον κανονισμό. Για όλο το Τροχαίο Υλικό η ιεράρχηση για τις παρεμβάσεις και την ακόλουθη συμμόρφωση με την οδηγία θα γίνουν με τα ακόλουθα κριτήρια: * Εντοπισμός χώρων για να δημιουργηθούν χώροι για αμαξίδια * Καθορισμός θέσεων προτεραιότητας και περιγραφή παρεμβάσεων ώστε να προσαρμοστούν στον κανονισμό. * Διευκολύνσεις κατά την πρόσβαση στο αντίστοιχο Τροχαίο Υλικό και την μετακίνηση μέσα σε αυτό (το θέμα αυτό θα πρέπει να εξετασθεί σε συνδυασμό με την υποδομή και τα νέα μηχανικά βοηθήματα επιβίβασης στις αμαξοστοιχίες) * Βελτιώσεις στη σήμανση και πληροφόρηση * Εξέταση στις τουαλέτες για το κατά πόσο κάποιες μπορούν να μετατραπούν σε καθολικές τουαλέτες. \| \| ΤΥΠΟΣ ΤΡΟΧΑΙΟΥ \| ΕΤΟΣ \| ΠΟΣ/ΤΑ \| ΠΑΡΑΤΗΡΗΣΕΙΣ \| \| \| \|---\|---\|---\|---\|---\|---\|---\| \| \| ΥΛΙΚΟΥ \| \| \| \| \| ΕΚΤΕΤΑΜΕΝΕΣ \| \| Επιβατάμαξες (Ε/Α) τύπου ADmz Α’ Θέσης \| \| 2004 \| 36 \| Οι προδιαγραφές του Κανονισμού καλύπτονται σε μεγάλο βαθμός με κύρια χαρακτηριστικά: • Επαρκής χώρος για δύο αμαξίδια και τρεις συνοδούς. • Εύκολη πρόσβαση στην τουαλέτα • Τουαλέτα και χώρος αμαξιδίων βρίσκονται σε μικρή απόσταση μεταξύ τους και πολύ κοντά στις εξωτερικές θύρες. • Αναμένεται προμήθεια μηχανικών βοηθημάτων επιβίβασης στις αμαξοστοιχίες \| ΔΕΝ ΑΠΑΙΤΟΥΝΤΑΙ \| \| \| Ηλεκτροκίνητες Αυτοκινητάμαξες (ΗΑ/A-EMU) τύπου Siemens Desiro (προαστιακός) \| \| 2004 \| 20 \| • Οι προδιαγραφές του Κανονισμού καλύπτονται σε σχέση με την τουαλέτα και την δυνατότητα πρόσβασης ΑΜΚ λόγω χαμηλού δαπέδου. • Υπάρχει χώρος για δημιουργία χώρων αναπηρικών αμαξιδίων. \| ΔΕΝ ΑΠΑΙΤΟΥΝΤΑΙ \| \| \| Αυτοκινητάμαξες (Α/Α) τύπου AEG/LEW (τετράδυμοι συρμοί) \| \| 1989 \| 4 \| • Διαθέτουν διαμέρισμα με τρεις χώρους για αμαξίδια και τρεις θέσεις για συνοδούς οι οποίοι ικανοποιούν σε μεγάλο βαθμό τον κανονισμό. • Δεν διαθέτουν τουαλέτα καθολικής χρήσης • Δυσκολία στην πρόσβαση \| ΑΠΑΙΤΟΥΝΤΑΙ: Δομικές παρεμβάσεις στις τουαλέτες Μηχανικά βοηθήματα επιβίβασης στις αμαξ/χίες \| \| \| Αυτοκινητάμαξες (Α/Α) τύπου MAN2000 \| \| 2006 \| 15 \| Υπάρχουν μόνο χώροι προς διαμόρφωση για αναπηρικά αμαξίδια. \| Όλες οι απαιτούμενες από τον κανονισμό \| \| \| \| ΤΥΠΟΣ ΤΡΟΧΑΙΟΥ \| ΕΤΟΣ \| ΠΟΣ/ΤΑ \| ΠΑΡΑΤΗΡΗΣΕΙΣ \| ΕΙΔΟΣ ΠΑΡΕΜΒΑΣΕΩΝ \| \| \|---\|---\|---\|---\|---\|---\|---\| \| \| ΥΛΙΚΟΥ \| \| \| \| ΕΚΤΕΤΑΜΕΝΕΣ \| ΜΗ ΕΚΤΕΤΑΜΕΝΕΣ \| \| \| ΤΡΟΧΑΙΟ ΥΛΙΚΟ ΣΤΟ ΟΠΟΙΟ ΔΕΝ ΕΧΟΥΝ ΓΙΝΕΙ ΑΥΤΟΨΙΕΣ ΚΑΙ ΔΕΝ ΙΚΑΝΟΠΟΙΕΙ ΤΗΝ ΟΔΗΓΙΑ Η΄ΤΗΝ ΙΚΑΝΟΠΟΙΕΙ ΕΛΑΧΙΣΤΑ ΤΑ ΟΠΟΙΑ ΘΑ ΠΡΕΠΕΙ ΝΑ ΕΞΕΤΑΣΘΟΥΝ ΩΣ ΠΡΟΣ \| \| \| \| \| \| \| \| ΤΗ ΔΥΝΑΤΟΤΗΤΑ ΠΑΡΕΜΒΑΣΕΩΝ \| \| \| \| \| \| \| Αυτοκινητάμαξες (Α/Α) τύπου AEG σειράς 520ii κανονικής γραμμής (πεντάδυμοι συρμοί) \| \| 1994/ 1995 \| 8 \| Δεν διαθέτουν κανενός είδους εξοπλισμό για την εξυπηρέτηση ΑΜΕΑ. Αφορά 40 μονάδες Τροχαίου Υλικού δηλαδή 8 πεντάδυμους συρμούς με έτος κατασκευής το 1994 ή το 1995. \| \| \| \| Αυτοκινητάμαξες (Α/Α) τύπου STADLER Railbus Κανονικής Γραμμής σειράς 560 \| \| 2003/ 2004 \| 17 \| Υπάρχει η δυνατότητα πρόσβασης ΑΜΕΑ λόγω χαμηλού δαπέδου και χώρου παραμονής κατά τη διάρκεια του ταξιδιού, αλλά δεν υπάρχουν ζώνες πρόσδεσης. Το WC, σε όσους συρμούς υπάρχει, δεν μπορεί να εξυπηρετήσει πλήρως ΑΜΕΑ. Αφορά 51 μονάδες Τροχαίου Υλικού, δηλαδή 17 τρίδυμα με έτος κατασκευής το 2003 ή το 2004. \| \| \| \| Αυτοκινητάμαξες (Α/Α) τύπου STADLER Railbus Μετρικής Γραμμής σειράς 4500 \| \| 2003/ 2004 \| 12 \| Υπάρχει η δυνατότητα πρόσβασης ΑΜΕΑ λόγω χαμηλού δαπέδου και χώρου παραμονής κατά τη διάρκεια του ταξιδιού, αλλά δεν υπάρχουν ζώνες πρόσδεσης και WC. Αφορά 36 μονάδες Τροχαίου Υλικού, δηλαδή 12 τρίδυμα με έτος κατασκευής το 2003 ή το 2004. \| \| \| \| Αυτοκινητάμαξες (Α/Α) τύπου STADLER Γραμμής Δ-Κ (οδοντωτού) σειράς 3507-3510 (αυτός ο τύπος δεν είναι στη διαχείριση της ΓΑΙΑΟΣΕ και έχει παραμείνει στον ΟΣΕ) \| \| \| \| Υπάρχει η δυνατότητα πρόσβασης και παραμονής ΑΜΕΑ, αλλά δεν υπάρχουν ζώνες πρόσδεσης και WC. \| \| \| \| \| ΤΥΠΟΣ ΤΡΟΧΑΙΟΥ \| ΕΤΟΣ \| \| ΠΟΣ/ΤΑ \| ΠΑΡΑΤΗΡΗΣΕΙΣ \| \| ΕΙΔΟΣ ΠΑΡΕΜΒΑΣΕΩΝ \| \| \|---\|---\|---\|---\|---\|---\|---\|---\|---\| \| \| ΥΛΙΚΟΥ \| \| \| \| \| \| ΕΚΤΕΤΑΜΕΝΕΣ \| ΜΗ ΕΚΤΕΤΑΜΕΝΕΣ \| \| \| ΤΡΟΧΑΙΟ ΥΛΙΚΟ ΣΤΟ ΟΠΟΙΟ ΔΕΝ ΕΧΟΥΝ ΓΙΝΕΙ ΑΥΤΟΨΙΕΣ ΚΑΙ ΔΕΝ ΙΚΑΝΟΠΟΙΕΙ ΤΗΝ ΟΔΗΓΙΑ Η΄ΤΗΝ ΙΚΑΝΟΠΟΙΕΙ ΕΛΑΧΙΣΤΑ ΤΑ ΟΠΟΙΑ ΘΑ ΠΡΕΠΕΙ ΝΑ ΕΞΕΤΑΣΘΟΥΝ ΩΣ ΠΡΟΣ \| \| \| \| \| \| \| \| \| \| ΤΗ ΔΥΝΑΤΟΤΗΤΑ ΠΑΡΕΜΒΑΣΕΩΝ \| \| \| \| \| \| \| \| \| \| ΜΑΝ Κατ.1 \| 1990/1991 \| \| 10 \| \| Ενδεχομένως σε κάποια που είναι σε καλύτερη κατάσταση να υπάρχει \| \| \| \| \| (Μετρικής γραμμής) \| \| \| \| \| ενδιαφέρον, από τη στιγμή που θα υπάρξει ενδιαφέρον να χρησιμοποιηθούν \| \| \| \| \| 2δυμα \| \| \| \| \| στο μέλλον. \| \| \| \| ΜΑΝ Κατ.2 2δυμα (κανονικής γραμμής) \| ΜΑΝ Κατ.2 2δυμα \| 1990 \| \| 10 \| \| Ενδεχομένως σε κάποια που είναι σε καλύτερη κατάσταση να υπάρχει \| \| \| \| \| (κανονικής γραμμής) \| \| \| \| \| ενδιαφέρον, από τη στιγμή που θα υπάρξει ενδιαφέρον να χρησιμοποιηθούν \| \| \| \| \| \| \| \| \| \| στο μέλλον. \| \| \| \| Bmhe Β' Θέσης \| \| 1993 \| \| 14 \| ΠΡΟΣ ΕΞΕΤΑΣΗ/ΕΠΙΒΑΤΑΜΑΞΕΣ \| \| \| \| \| WLABmh Κλινάμαξες \| \| Α \| 1958/60 \| 7 \| ΠΡΟΣ ΕΞΕΤΑΣΗ/ΕΠΙΒΑΤΑΜΑΞΑ ΜΕ ΚΟΥΚΕΤΕΣ-ΟΧΗΜΑΤΑ ΜΕ ΚΛΙΝΕΣ \| \| \| \| \| \| \| \| ΜΕ \| \| \| \| \| \| \| \| \| \| ΝΑΚΑΤΑΣΚΕΥΗ \| \| \| \| \| \| \| \| \| \| 2004/05 \| \| \| \| \| \| \| Wrmy WR-Bar Κ.Γ \| \| Α \| 1973 \| 3 \| ΠΡΟΣ ΕΞΕΤΑΣΗ/ΟΧΗΜΑΤΑ ΕΣΤΙΑΤΟΡΙΟΥ \| \| \| \| \| \| \| \| ΜΕ \| \| \| \| \| \| \| \| \| \| ΝΑΚΑΤΑΣΚΕΥΗ \| \| \| \| \| \| \| \| \| \| 2002/04 \| \| \| \| \| \| \| Amz Α΄Θέσης \| \| 2004/05 \| \| 26 \| ΠΡΟΣ ΕΞΕΤΑΣΗ/ΕΠΙΒΑΤΑΜΑΞΕΣ \| \| \| \| \| Bmpz \| \| 2004 \| \| 79 \| ΠΡΟΣ ΕΞΕΤΑΣΗ/ΕΠΙΒΑΤΑΜΑΞΕΣ \| \| \| \| \| Bmz B΄Θέσης \| \| 2004 \| \| 28 \| ΠΡΟΣ ΕΞΕΤΑΣΗ/ΕΠΙΒΑΤΑΜΑΞΕΣ \| \| \| \| \| WRmz Εστιατόρια \| \| 2004 \| \| 24 \| ΠΡΟΣ ΕΞΕΤΑΣΗ/ΟΧΗΜΑΤΑ ΕΣΤΙΑΤΟΡΙΟΥ \| \| \| \| ΙΙΙ.2 Τροχαίο Υλικό τύπου μετρό κατάλληλα εξοπλισμένου ώστε να κυκλοφορεί στο σιδηροδρομικό δίκτυο Η ΣΤΑΣΥ ΑΕ εκτελεί το συγκοινωνιακό της έργο στο τμήμα «ΔΟΥΚΙΣΣΗΣ ΠΛΑΚΕΝΤΙΑΣ - ΑΕΡΟΔΡΟΜΙΟ» της εθνικής σιδηροδρομικής υποδομής, με επτά (7) ειδικούς δι-ρευματικούς συρμούς μετρό της σειράς ΙΙ, οι οποίοι κατασκευάστηκαν την περίοδο 2002-2004, δηλαδή πριν από τη θέση σε ισχύ του Κανονισμού (ΕΕ) 1300/2014. Κατόπιν της πλήρους αποδελτίωσης του Κανονισμού (ΕΕ) 1300/2014, με σκοπό τον πλήρη έλεγχο συμμόρφωσης ως προς τις απαιτήσεις, διαπιστώνεται ότι: * 53% των απαιτήσεων ικανοποιούνται από τον υφιστάμενο σχεδιασμό (ΣΥΜΜΟΡΦΩΣΗ) * 42% των απαιτήσεων δεν έχουν εφαρμογή, καθώς οι συρμοί της ΣΤΑΣΥ προορίζονται κυρίως για παροχή συγκοινωνιακού έργου στο αστικό τμήμα του δικτύου (π.χ. εσωτερικές θύρες, τουαλέτες) (ΜΗ ΕΦΑΡΜΟΣΙΜΟ) * 5% των απαιτήσεων δεν ικανοποιούνται από τον υφιστάμενο σχεδιασμό (ΜΗ ΣΥΜΜΟΡΦΩΣΗ) Στον ακόλουθο πίνακα αναλύεται η κάθε απαίτηση με την οποία δεν υπάρχει συμμόρφωση, οι διορθωτικές ενέργειες που δύναται να εκτελεστούν και εκτιμάται ο χρόνος υλοποίησής τους. Συνοπτικά αναφέρεται ότι, οι επεμβάσεις μικρής κλίμακας θα υλοποιηθούν, οι επεμβάσεις μεγάλης κλίμακας απαιτούν την έγκριση από την ΑΤΤΙΚΟ ΜΕΤΡΟ Α.Ε., η οποία είναι ο ιδιοκτήτης των οχημάτων, ενώ σε ορισμένες περιπτώσεις προτείνεται απόκλιση από τον Κανονισμό (ΕΕ) 1300/2014. Όσον αφορά στο κενό μεταξύ συρμού και αποβάθρας, για την επιλογή της βέλτιστης λύσης θα απαιτηθεί η συνεργασία με το διαχειριστή της υποδομής. Σημειώνεται ότι μη συμμόρφωση του τροχαίου υλικού ισχύει μόνο για τους τρεις (3) ενδιάμεσους σταθμούς της διαδρομής από και προς το αεροδρόμιο. \| ΑΝΑΦΟΡΑ § \| ΠΕΡΙΓΡΑΦΗ ΑΠΑΙΤΗΣΗΣ ΒΑΣΕΙ ΤΟΥ ΚΑΝΟΝΙΣΜΟΥ ΕΕ1300/2014 \| ΣΧΟΛΙΑ ΜΗ ΣΥΜΜΟΡΦΩΣΗΣ \| ΔΙΟΡΘΩΤΙΚΕΣ ΕΝΕΡΓΕΙΕΣ ΜΗ ΣΥΜΜΟΡΦΩΣΗΣ \| \|---\|---\|---\|---\| \| 220.127.116.11. \| \| \| \| \| -2 \| Για λόγους ευστάθειας, οι χώροι αναπηρικών αμαξιδίων σχεδιάζονται κατά τρόπο ώστε το αμαξίδιο να τοποθετείται είτε μετωπικά προς την κατεύθυνση κίνησης της αμαξοστοιχίας είτε αντίθετα προς την κατεύθυνση κίνησης. \| Ο σχεδιασμός του Τ.Y. προβλέπει τη τοποθέτηση των αναπηρικών αμαξιδίων κάθετα προς τη κίνηση. Η απαίτηση για την ευστάθεια επιτυγχάνεται με μηχανική συγκράτηση μέσω της υπάρχουσας ζώνης ασφαλείας. Προτείνεται απόκλιση από τις απαιτήσεις της ΤΠΔ. \| Καμία \| \| 18.104.22.168.2. \| \| \| \| \| -3 \| Όλες οι εξωτερικές θύρες πρόσβασης επιβατών επισημαίνονται στην εξωτερική πλευρά του οχήματος κατά τρόπο ώστε να δημιουργείται αντίθεση με το αμάξωμα του οχήματος που τις περιβάλλει. \| Ο σχεδιασμός του T.Y. δεν προβλέπει ειδική σήμανση για τη θέση των εξωτερικών θυρών από την εσωτερική και εξωτερική πλευρά του οχήματος, με χρωματική αντίθεση ως προς το παρακείμενο δάπεδο. Επίσης, δεν προβλέπεται η οπτική σήμανση ανοίγματος και κλεισίματος θυρών. \| Απαιτείται μεγάλης έκτασης τροποποίηση. Θα διερευνηθεί τεχνική λύση με τον ιδιοκτήτη των οχημάτων (ΑΤΤΙΚΟ ΜΕΤΡΟ Α.Ε.). \| \| -6 \| Από την εσωτερική πλευρά του οχήματος η θέση των εξωτερικών θυρών επισημαίνεται ευδιάκριτα με σήμα με χρωματική αντίθεση ως προς το παρακείμενο δάπεδο. \| \| \| \| -11 \| Το ορατό σήμα είναι ορατό από το εσωτερικό και το εξωτερικό της αμαξοστοιχίας και τοποθετείται έτσι ώστε να ελαχιστοποιείται η δυνατότητα επισκίασής του από επιβάτες ευρισκόμενους στον προθάλαμο της αμαξοστοιχίας. \| \| \| \| ΑΝΑΦΟΡΑ § \| ΠΕΡΙΓΡΑΦΗ ΑΠΑΙΤΗΣΗΣ ΒΑΣΕΙ ΤΟΥ ΚΑΝΟΝΙΣΜΟΥ ΕΕ1300/2014 \| ΣΧΟΛΙΑ ΜΗ ΣΥΜΜΟΡΦΩΣΗΣ \| ΔΙΟΡΘΩΤΙΚΕΣ ΕΝΕΡΓΕΙΕΣ ΜΗ ΣΥΜΜΟΡΦΩΣΗΣ \| \|---\|---\|---\|---\| \| 22.214.171.124.3 \| \| \| \| \| -7 \| Η πληροφορία για την προσεχή στάση επιτρέπεται να εμφανίζεται στην ίδια οθόνη στην οποία αναγράφεται ο τελικός προορισμός. Μόλις όμως η αμαξοστοιχία σταθμεύσει, επανέρχεται η ένδειξη του τελικού προορισμού. \| Ο συρμός μέσω του Συστήματος Πληροφοριών αναφέρει μόνο την επόμενη στάση. \| Θα γίνει η κατάλληλη παραμετροποίηση του συστήματος οπτικής πληροφόρησης. \| \| 126.96.36.199 \| \| \| \| \| 188.8.131.52.1. \| Γενικές απαιτήσεις \| \| \| \| \| Σύμφωνα με το σχέδιο της ΤΠΔ \| Η μη συμμόρφωση αφορά συγκεκριμένα τους τρεις ενδιάμεσους σταθμούς (Παλλήνη, Παιανία- Κάντζα, Κορωπί), όπου το κενό μεταξύ συρμού και αποβάθρας κυμαίνεται από 21 έως 28,5cm. \| Απαιτείται μεγάλης έκτασης τροποποίηση. Θα διερευνηθεί τεχνική λύση με τον διαχειριστή της υποδομής. \| \| 184.108.40.206. \| Διεπαφή της συσκευής κλήσης \| \| \| \| -1 \| επισημαίνεται με σήμα με πράσινο ή κίτρινο φόντο (σύμφωνα με τις προδιαγραφές που αναφέρονται στον δείκτη 10 του προσαρτήματος Α) και λευκό σύμβολο που απεικονίζει κουδούνι ή τηλέφωνο· το σήμα μπορεί να βρίσκεται επάνω σε κομβίο ή στεφάνη ή σε χωριστό εικονόγραμμα \| Ο σχεδιασμός του Τ.Y. προβλέπει τη σήμανση με διαφορετικό φόντο (μπλε, κόκκινο) και δε περιλαμβάνει απτικά σύμβολα \| Θα γίνει η τροποποίηση των σημάνσεων, σύμφωνα με τις απαιτήσεις της ΤΠΔ. \| \| -2 \| περιλαμβάνει απτικά σύμβολα \| \| \| IV. ΧΡΗΜΑΤΟΔΟΤΗΣΗ ΥΠΟΔΟΜΗΣ & ΤΡΟΧΑΙΟΥ ΥΛΙΚΟΥ Για την υλοποίηση του παραπάνω Σχεδίου, όσον αφορά την υποδομή, ο ΟΣΕ θα συντάξει τις σχετικές μελέτες και θα προσπαθήσει να εντάξει τα έργα εκτιμώμενου αρχικού προϋπολογισμού 5.000.000 ευρώ σε προγράμματα συγχρηματοδότησης της Ευρωπαϊκής Ένωσης. Σε αντίθετη περίπτωση θα απαιτηθούν κονδύλια από το Πρόγραμμα Δημοσίων Επενδύσεων προκειμένου τα έργα, τα οποία δεν θα τύχουν συγχρηματοδότησης, να κατασκευαστούν εντός του προβλεπόμενου χρονοδιαγράμματος. Η ΓΑΙΑΟΣΕ εξετάζει την αγορά νέου Τροχαίου Υλικού, με σκοπό την αναβάθμιση του διαθέσιμου στόλου. Στα πλαίσια της έρευνας η οποία πραγματοποιείται για την εύρεση του κατάλληλου Τροχαίου Υλικού εξετάζονται και οι διευκολύνσεις οι οποίες παρέχει σε άτομα με αναπηρία ή μειωμένης κινητικότητας. Κάθε αγορά Τροχαίου Υλικού η οποία θα πραγματοποιηθεί στο μέλλον θα είναι σύμφωνη με τον κανονισμό. Για την αναβάθμιση του υπάρχοντος Τροχαίου Υλικού που διαχειρίζεται η ΓΑΙΑΟΣΕ, υπάρχει η πρόθεση να πραγματοποιηθούν παρεμβάσεις έτσι ώστε να ικανοποιούνται οι ανάγκες του Κανονισμού 1300/2014. Υπολογίζεται ότι ο χρόνος εργασιών θα ολοκληρωθεί σε χρονικό διάστημα 18 μηνών περίπου από την έναρξη τους. Για τις ανάγκες των ως άνω παρεμβάσεων θα επιδιωχθεί η ένταξη σε κάποιο πρόγραμμα χρηματοδότησης της Ευρωπαϊκής Ένωσης, ενδεχομένως σε συνεργασία με άλλον ή άλλους φορείς (όπως η ΕΕΣΣΤΥ). Για την επιδίωξη χρηματοδότησης είναι απαραίτητο ένα ακόμη στάδιο αυτοψιών το οποίο θα καταγράφει με κάθε λεπτομέρεια τις ελλείψεις σχετικά με τον κανονισμό όχι μόνο ανά τύπο Τροχαίου Υλικού, αλλά και ενδεχόμενες διαφοροποιήσεις ανά μονάδα Τροχαίου Υλικού. Κατόπιν θα καθοριστούν όλες οι λεπτομέρειες και το σύνολο των απαραίτητων παρεμβάσεων, λαμβάνοντας υπόψη την προτεραιότητα που θα πρέπει να ακολουθηθεί και την αξιολόγηση για το ποιες είναι εφικτές και ποιες όχι και θα συνταχθεί η αντίστοιχη μελέτη. Με την ολοκλήρωση αυτών των διαδικασιών θα είναι έτοιμο το αντικείμενο για την επιδίωξη τις χρηματοδότησης. Επίσης θα πρέπει να ληφθούν υπόψη οι ανάγκες της ΤΡΑΙΝΟΣΕ για δρομολόγια και ο μελλοντικός της προγραμματισμός ώστε να δοθεί προτεραιότητα σε Τροχαίο Υλικό το όποιο θα εξυπηρετεί περισσότερους επιβάτες. Για το χρονοδιάγραμμα υλοποίησης των ενεργειών συμμόρφωσης που αφορούν το τροχαίο υλικό που διαχειρίζεται η ΣΤΑΣΥ ΑΕ, θα πρέπει προηγουμένως να εκπονηθούν μελέτες και προδιαγραφές, να γίνει η κοστολόγηση και να βρεθούν πηγές χρηματοδότησης. V. ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΤΟΥ Ε.Σ.Ε. Η τακτική επικαιροποίηση του Ε.Σ.Ε θα διενεργηθεί το αργότερο εντός πενταετίας από την έγκρισή του. Το Υπουργείο Υποδομών και Μεταφορών προτίθεται να συμβάλλει στην άρση των εμποδίων που δυσχεραίνουν την πλήρη και ισότιμη συμμετοχή των ΑμεΑ/ΑΜΚ στις σιδηροδρομικές υποδομές της χώρας, στο πλαίσιο του γενικού πλαισίου ρυθμίσεων του Μέρους Δ του ν.4448/2017 (Α' 137). Παράρτημα Ι Διαδικασία μεταφοράς ΑΜΕΑ/ΑΜΚ στο σιδηρόδρομο Η ΤΡΑΙΝΟΣΕ Α.Ε. παρέχει στα άτομα με αναπηρία (ανάπηροι σε ποσοστό άνω του 67%, έκπτωση 50% στις συνολικές τιμές των εισιτηρίων, με την επίδειξη Δελτίου Αναπηρικής Ταυτότητας που εκδίδεται από την αρμόδια κατά περίπτωση Δημόσια Αρχή. Ομοίως, έκπτωση 50% στις συνολικές τιμές των εισιτηρίων χορηγείται στους συνοδούς ατόμων με αναπηρία ή μειωμένη κινητικότητα (όπου απαιτείται), με την επίδειξη του ανάλογου ειδικού Δελτίου Ταυτότητας που εκδίδεται από την αρμόδια Δημόσια Αρχή. H μεταφορά ατόμων με κινητική αναπηρία, τα οποία μεταφέρονται με αναπηρικό αμαξίδιο, είναι δυνατή στις αμαξοστοιχίες, στη σύνθεση των οποίων κυκλοφορούν τα οχήματα με ειδική διαρρύθμιση χώρου ΑμεΑ. Επισημαίνεται, ότι το συνολικό πλάτος των αμαξιδίων δεν πρέπει να υπερβαίνει τα 70 εκατοστά και το συνολικό μήκος το 1 μέτρο και 30 εκατοστά. Για τη διευκόλυνση των μετακινήσεων ΑμεΑ, είτε στην Προαστιακή Γραμμή (Πειραιάς – Αθήνα – Άνω Λιόσια – Κιάτο – Αεροδρόμιο), είτε στο υπόλοιπο σιδηροδρομικό Δίκτυο, συνιστάται ο σχεδιασμός της μετακίνησής τους 48 ώρες (τουλάχιστον) πριν από το ταξίδι τους. Στην περίπτωση αυτή, τα άτομα με αναπηρία θα πρέπει να επικοινωνούν με το Τμήμα Εξυπηρέτησης Πελατών της ΤΡΑΙΝΟΣΕ Α.Ε. (ωράριο λειτουργίας 08.00 – 13.00, ημέρες Δευτέρα έως Παρασκευή), * είτε στο τηλέφωνο 2130 121 121, * είτε συμπληρώνοντας την παρακάτω φόρμα. Στη διάρκεια του Σαββατοκύριακου, ή αργιών, οι ενδιαφερόμενοι επιβάτες θα μπορούν να επικοινωνούν με το Κέντρο Τηλεφωνικής Εξυπηρέτησης Πελατών στον τηλεφωνικό αριθμό 14511 (τηλέφωνο με χρέωση από Ελλάδα, σταθερό: 0,646€/λεπτό, κινητό: 0,984€/λεπτό με επιπλέον τέλος κινητής τηλεφωνίας 12%-20%, ανάλογα με το μηνιαίο λογαριασμό, προ ΦΠΑ) Η μη προγραμματισμένη μετακίνηση επιβάτη ΑμεΑ με την ΤΡΑΙΝΟΣΕ Α.Ε. είναι δυνατή στον Προαστιακό Αθηνών (τμήματα Κιάτο – Πειραιάς- ΣΚΑ- Αεροδρόμιο) και στον Προαστιακό Θεσσαλονίκης (Θεσσαλονίκη-Λάρισα) από τους σταθμούς που λειτουργούν εκδοτήρια και κατά το ωράριο λειτουργίας τους. Οι σταθμοί και συρμοί της Προαστιακής Γραμμής Αθηνών (Κιάτο-Πειραιάς – ΣΚΑ – Αεροδρόμιο) έχουν τον ακόλουθο εξοπλισμό: 1. Χρήση ειδικής ράμπας για την επιβίβαση και αποβίβαση επιβατών με μειωμένη κινητικότητα στους συρμούς. 2. Δυνατότητα οπτικής ενημέρωσης μέσω οθονών για πληροφορίες επιβατών και ενημέρωση για τον επόμενο σταθμό, στην πλειονότητα των συρμών. 3. Ηχητικές αναγγελίες για πληροφορίες επιβατών και ανακοίνωση για τον επόμενο σταθμό (σε όλους τους συρμούς). 4. Εκδοτήρια εισιτηρίων (επανδρωμένα) χαμηλού ύψους στους Σταθμούς Μεταμόρφωση – Αεροδρόμιο και στο Σταθμό Άγιοι Ανάργυροι. 5. Ακυρωτικά μηχανήματα χαμηλού ύψους σε όλους τους σταθμούς. Οι σταθμοί και συρμοί της Γραμμής Θεσσαλονίκης-Λάρισας έχουν τον ακόλουθο εξοπλισμό: 6. Χρήση ειδικής ράμπας για την επιβίβαση και αποβίβαση επιβατών με μειωμένη κινητικότητα στους συρμούς/σταθμό, στην πλειονότητα των συρμών. 7. Δυνατότητα οπτικής ενημέρωσης μέσω οθονών για πληροφορίες επιβατών και ενημέρωση για τον επόμενο σταθμό, στην πλειονότητα των συρμών . 8. Ηχητικές αναγγελίες για πληροφορίες επιβατών και ανακοίνωση για τον επόμενο σταθμό σε όλους τους συρμούς. Στις νέες αποβάθρες του Σιδηροδρομικού Σταθμού Αθηνών η πρόσβαση ατόμων ΑμεΑ γίνεται μέσω δύο διαδρόμων που συνδέουν το κτήριο του σταθμού με τις αποβάθρες. Μη προγραμματισμένη μετακίνηση επιβάτη ΑμεΑ/ΑΜΚ στο υπόλοιπο δίκτυο της ΤΡΑΙΝΟΣΕ γενικά δεν είναι εφικτή. Σε περιπτώσεις που ο επιβάτης προσέλθει σε εκδοτήριο του δικτύου και δηλώσει την επιθυμία του για άμεση μετακίνηση, το αίτημά του εξετάζεται επί τόπου και ο ίδιος ενημερώνεται εάν είναι δυνατή η μετακίνηση που επιθυμεί ή ποιες είναι οι εναλλακτικές δυνατότητες μετακίνησης (πλησιέστερος σταθμός επιβίβασης, πλησιέστερος σταθμός αποβίβασης κλπ). Παράρτημα ΙI P	<urn:uuid:16d47b86-1de1-4943-9816-7864b2b84479>	HuggingFaceFW/finepdfs/tree/main/data/ell_Grek/train	finepdfs	ell_Grek	32,799
Contents lists available atScienceDirect Applied Nursing Research journal homepage: www.elsevier.com/locate/apnr Cultural humility: Essential foundation for clinical researchers Katherine A. Yeager, PhD, RN a , ⁎, Susan Bauer-Wu, PhD, RN, FAAN b a Nell Hodgson Woodruff School of Nursing, Emory University, Atlanta, GA 30322, USA b Tussi and John Kluge Professor in Contemplative End-of-Life Care, University of Virginia School of Nursing, Charlottesville, VA 22908-0826, USA Article history: Received 7 March 2013 Revised 28 June 2013 Accepted 30 June 2013 Keywords: Nursing Research Culture Cultural humility is a process of self-reﬂection and discovery in order to build honest and trustworthy relationships. It offers promise for researchers to understand and eliminate health disparities, a continual and disturbing problem necessitating attention and action on many levels. This paper presents a discussion of the process of cultural humility and its important role in research to better understand the perspectives and context of the researcher and the research participant. We discern cultural humility from similar concepts, speciﬁcally cultural competence and reﬂexivity. We will also explore ways to cultivate cultural humility in the context of human subjects research. Mindfulness is one approach that can be helpful in enhancing awareness of self and others in this process. With a foundation in cultural humility, nurse researchers and other investigators can implement meaningful and ethical projects to better address health disparities. © 2013 Elsevier Inc. All rights reserved. 1. Introduction Understanding and eliminating health disparities requires a close examination of our past work and future focus in health care research across settings. How we approach the many factors that contribute to health disparities and social inequities requires an examination of the environment, context, and culture of those experiencing these disparities. Attention has been given to role of culture in the health care ﬁeld recently. As the different parts of the world become increasingly diverse and multicultural, health care providers have been encouraged to become aware of cultural differences and their impact on health. Much focus has been given to be preparing health care providers, such as nurses and physicians, to give culturally competent care at the bedside (Waite & Calamaro, 2010). However, minimal attention has been on researchers to conduct culturally competent research. Nurse researchers are trained to view health and illness from a holistic approach and therefore should lead the way in this area to address the role of culture in the conduct of research. Papadopoulos and Lees (2002) acknowledge the need for culturally Conﬂict of interest statement: No conﬂict of interest has been declared by the authors. Funding statement: Dr. Yeager was a recipient of the Doctoral Scholarship in Cancer Nursing from the American Cancer Society and also supported by training award, F31NR011383, from the National Institute of Nursing Research during the time that this work developed. The content of this manuscript is solely the responsibility of the authors and does not necessarily represent the ofﬁcial views of the National Institute of Nursing Research or the National Institute of Health. Dr. Bauer-Wu was a Georgia Cancer Coalition Distinguished Cancer Scholar during the period of development of this manuscript. ⁎ Corresponding author. Nell Hodgson Woodruff School of Nursing, Emory University, NE Atlanta, GA 30322 USA. Tel.: +1 404 727 8627 (Ofﬁce), +1 404 875 1490 (Home); fax: +1 404 727 9382. E-mail addresses: email@example.com (K.A. Yeager), firstname.lastname@example.org (S. Bauer-Wu). 0897-1897/$–see front matter © 2013 Elsevier Inc. All rights reserved. competent researchers in order to produce valid research and improve practice; they also note that for too long, research has been unicultural although generalized to a multicultural world. Initially discussed in the context of clinical practice, cultural humility is a process of self-reﬂection and discovery to understand oneself and then others in order to build honest and trustworthy relationships (Tervalon & Murray-Garcia, 1998). It is a promising approach with utility for researchers as well and can play a role in addressing health disparities in research. The purpose of this article is to provide a thoughtful examination of cultural humility with practical relevance for investigators involved in human subjects research. The concepts discussed are applicable to any clinical researcher who is studying someone different from her/himself— different in race, ethnicity, gender, religion, sexual preference, socioeconomic status, and geographic location—in any cultural context and in any part of the world. 2. Cultural humility - what it is and what it's not As we learn to appreciate the value of cultural humility in research, it's important to explore the foundations of this concept and to clearly describe it. There are also related concepts (i.e., cultural competence and reﬂexivity) that may be inappropriately used interchangeably, so it's important to understand the subtle differences among them. 3. What it is Cultural humility, originally described as a tool to educate physicians to work with the increasing cultural, racial and ethnic diversity in the United States, is useful for all researchers involved in human subjects research. Cultural humility is a lifelong process of selfreﬂection and self-critique whereby the individual not only learns Table 1 Difference between cultural competence and cultural humility. about another's culture, but one starts with an examination of her/his own beliefs and cultural identities (Tervalon & Murray-Garcia, 1998). This critical consciousness is more than just self-awareness, but requires one to step back to understand one's own assumptions, biases and values (Kumagai & Lypson, 2009). Individuals must look at one's own background and social environment and how it has shaped experience. Cultural humility cannot be collapsed into a class or education offering; rather it's viewed as an ongoing process. Tervalon and Murray-Garcia (1998) state that cultural humility is "best deﬁned not as a discrete end point but as a commitment and active engagement in a lifelong process that individuals enter into on an ongoing basis with patients, communities, colleagues, and with themselves" (p. 118). This process recognizes the dynamic nature of culture since cultural inﬂuences change over time and vary depending on location. Throughout the day, many of us move between several cultures, often without thinking about it. For example, our home/ family culture often differs from our workplace culture, school culture, social group culture, or religious organization culture. The overall purpose of the process is to be aware of our own values and beliefs that come from a combination of cultures in order to increase understanding of others. One cannot understand the makeup and context of others' lives without being aware and reﬂective of his/her own background and situation. 4. What it's not—related concepts 4.1. Cultural competence In cultural competence training programs, the focus is to learn and examine the patient or research participant's belief system. Many institutions have made cultural competency training required for clinicians to sensitize them to the special needs and vulnerabilities of different populations. The programs often focus on caring for racial and ethnic minorities and on traits and practices of these groups, with the goal to break down cultural barriers to quality health care. Unfortunately the traditional approaches of cultural cross-training have been criticized for potentially promoting stereotyping (Kumagai & Lypson, 2009). Also despite the emphasis on cultural competence in health care, a national survey of over 3,000 physicians found that one in ﬁve felt unprepared to deal with socio-cultural issues—such as patients with religious beliefs that impact treatment decisions, patients that mistrust the health care system, new immigrants, and patients with health beliefs at odds with conventional medicine (Weissman et al., 2005). Despite many resources devoted to cultural competence education, shortcomings have been identiﬁed. Kumas-Tan, Beagan, Loppie, MacLeod, and Frank (2007) systematically reviewed the most frequently used cultural competence measures and identiﬁed assumptions embedded in these measures: culture is usually equivalent to ethnicity and race, and little attention is given to other components of culture such as gender, class, geographic location, country of origin, or sexual preference. These instruments assume that culture is possessed by the patient or client or the ' other ' . In many of the measures, for example, whiteness is understood and represented as the norm. Cultural incompetence is due to a lack of knowledge about the ' other ' and maybe related to the provider ' s discriminatory attitudes toward the ' other ' . Education about the ' other ' is the key to developing cultural competence. Therefore, cultural competence does not incorporate self-awareness since the goal is to learn about the other person ' s culture rather than re ﬂ ection on the provider ' s background. Finally cultural competence is about the provider being con ﬁ dent and comfortable when interacting with the ' other ' . The authors conclude that the assumptions taken together create a worldview that culture is a confounding variable that white providers must control when they care for people of different races than themselves ( Kumas-Tan et al., 2007 ). The goal of cultural competence is to produce con ﬁ dent, competent health care providers with a specialized knowledge and skills that can then serve the communities of ethnic or racial minority groups. Other terms such as cultural awareness, cultural knowledge, and cultural sensitivity often are supported by these same assumptions of cultural competence ( Table 1 ). 4.2. Reﬂexivity Reﬂexivity, a technique used in qualitative research, calls on the researcher to explore personal beliefs in order to be more aware of potential judgments that can occur during data collection and analysis (Jootun, McGhee, & Marland, 2009). Being reﬂexive often requires an awareness and reﬂection of what is happening while being present to one's perceptions and internal experience in the moment. Reﬂexivity by the researcher is done by placing her/himself within the experience and meaning of the study participant and then examining the participant-researcher relationship (Hofman, 2004). In the absence of such contextual information, researchers and study participants are engaged in an impersonal and, often, hierarchical relationships. Reﬂexivity is often used with qualitative studies where sample sizes are small and the researcher and the research participant interaction is often somewhat intimate, however this process can be beneﬁcial in all types of studies, including large quantitative trials, whenever researchers study groups different from themselves. 5. Cultivating cultural humility in research Cultural humility is a process of reﬂection to gain a deeper understanding of cultural differences in order to improve the way vulnerable groups are treated and researched. Cultural humility does not focus on competence or conﬁdence and recognizes that the more you are exposed to cultures different from your own, you often realize how much you don't know about others. That is where humility comes in. Ideas of ethnocentrism and racism, where the underlying idea implies that the problem is due to the difference, are abandoned. Humility requires courage and ﬂexibility. Strengths and challenges of individuals and groups are explored as well as the advantages and privileges of certain group membership. When used by the researcher, this process of reﬂection includes the unpeeling of the layers that make up a person and incorporates an examination of personal, professional, and research values that may guide the researcher's actions. In order to continue the process of cultural humility, this personal review is followed by an inspection of the research participant's perspective. 6. Inventory of values 6.1. Reﬂection of person In the process of cultural humility, personal values, beliefs, and biases that are derived from your own culture must be examined. Beliefs about race, ethnicity, class, religion, immigration status, gender roles, age, linguistic capability, and sexual orientation are explored. Family experiences and values, peer inﬂuences, relationships with different types of people are also reviewed. Where you live or grew up matters (i.e., rural, urban, suburban, afﬂuent, or impoverished) and shapes your views of others. What neighborhood you live and work in inﬂuences who you deal with on a day-to-day basis and how you deﬁne community. Everyday activities such as where you shop, how you travel to work, and what you eat tell something about your values. Political views and the way you express them are important. All of these attributes and the value given to them are important to examine. Examining and deﬁning one's culture is a complex process especially since today most individuals in the United States and other countries are a combination of more than one culture with many different variations and mixtures. Group identities often deﬁne our cultural perspective but these groups, whether based on religion, race, or ethnic classiﬁcation, are broad categories. Minority groups such as American Indians, Alaska Natives, African Americans, Hispanics, Asians, or Paciﬁc Islanders are often given certain cultural characteristics, but those descriptions can miss the mark. Within each group, many subpopulations exist with very different cultures, historical experiences, and views on health and illness. An individual's culture is not a single identity; rather it's a rich mixture of many inﬂuences and values. Thus understanding oneself and others is a complex and lifelong process. 6.2. Reﬂection of profession Professional identity of the clinical researcher is also an important area to reﬂect on. Speciﬁcally nurse researchers ﬁrst must identify that their own values, perspectives, and biases are derived not only from their own cultural origin, but also from the biomedical world view of their professional training. Health care itself is a cultural system with its own speciﬁc language, values, and practices that must be translated, interpreted, and negotiated with patients and family members. Training in Western medicine using a bio-medical framework often inﬂuences how one sees the world. This perspective often deﬁnes 'normal' as the modern Western culture. In the stereotypical perspective, difference is generally deﬁned as anyone who is non-white, non-Western, non-heterosexual, non-English speaking, and non-Judeo-Christian. Often the values of medical training, and to some degree nursing training, reﬂect a strong inclination toward medications, procedures, and cure, and less focus on psychosocial and spiritual inﬂuences. In addition, health care providers and clinical researchers must consider the privilege and power of their profession and its effect on practice and research. 6.3. Reﬂections of researcher An additional set of values worthy of examination are the values embedded in research often guided by ethical principles. Autonomy, bene ﬁ cence, and justice are the basic ethical principles that should underlie the conduct of biomedical and behavioral research ( The National Commission for the Protection of Human Subjects of Biomedical and Behavioral Research, 1979 ). Every clinical researcher must have at least basic training in these values and Institutional Review Boards (IRBs) ensure that researchers incorporate these values in their studies. Researchers need to keep these principles in mind when they select participants, obtain consent, and conduct research. How researchers deﬁne and operationalize these ethical principles in their research is important since research values may be conceptualized differently from person to person. At each step of the research process, thoughtful consideration of these values and principles is needed. For example, during informed consent, how does a researcher proceed when a patient is capable of making decisions for her/himself yet instead prefers that the family decides? For some, value is given to family-centered decision making instead of individual autonomy. In addition, the very deﬁnition of family is variable and evolving, sometimes including self-selected family members rather than the traditional family. The standard consent form that an individual reads and signs is only one part of the process and should take decision-making into account, which varies between cultures. The timing and ﬂow of the research process may need to be adapted to allow for discussions of the risks and beneﬁts based on a study participant's personal values. The scientiﬁc values that the researcher brings to the potential participant may not be appreciated by others whose values are grounded in other areas such as religious teachings. Research procedures involving informed consent, conﬁdentiality, and patient safety may look differently when dealing with different groups. A researcher must consider how a participant's cultural values align with the values of research and to be wary not to make assumptions about the values of others. In health research, cultural stereotypes and assumptions derived from notions of difference ﬁnd their way into explanations of study ﬁndings (Hunt, 2005). Researchers often explain their ﬁndings and base their conclusions by making assumptions about cultural groups. It is problematic when researchers use cultural and racial stereotypes based on someone's ethnic identity or national origin to explain study ﬁndings. For example, researchers have explained their study ﬁndings by saying that the reason foreign-born Mexican Americans had less mental illness compared to U.S. born Mexican Americans was due to (the researcher's belief that) Mexican families being close knit; no measure of family structure or quality was included in the study measures (Grant et al., 2004; Hunt, 2005). Using cultural stereotypes in this way disregards the heterogeneity of groups and wrongly assumes that cultural beliefs and behaviors always go along with ethnic identity. In another example, a study about amniocentesis decision-making, clinicians described Latinos as part of large extended families, being especially family-oriented, and highly inﬂuenced by opinions of family members (Hunt & de Voogd, 2005). In contrast, the sample of Latino women in this study did not behave as expected. The women made independent decisions about the testing and the clinicians seemed to steer the patients in certain direction due to the assumptions made about the patients' cultural values. Therefore, when research results are reported, the bias of the researcher must be acknowledged. Research values also come from the larger research community, which has traditionally taken a paternalistic approach and sometimes denied participants the opportunity to evaluate the cost and beneﬁts of research participation in light of their own goals and values. Also, unfortunately researchable questions go unanswered because researchers shy away from doing research with vulnerable groups because of bureaucratic complexities, such as IRB policies created to protect vulnerable individuals. Regrettably, such well-intentioned protections may have compounded the issue. After some groups had experienced coercion, deception and disrespect, policy makers found it was easier to exclude or limit research participation of entire groups in order to prevent any further violations against them (List, 2005). These policies can be problematic because they exclude groups from participating in research and therefore also exclude groups from reaping the beneﬁts of research. For example, many have voiced concern about conducting research with individuals at the end of life (Gysels, Shipman, & Higginson, 2008). Despite these concerns, a study of patients at the end of life showed that the majority reported no burden associated with participation in research and noted beneﬁts of participating including social interaction, sense of contributing to society, and opportunity to discuss their experiences (Pessin et al., 2008). End-of-life research certainly has some limitations and necessary precautions, yet it is a high priority topic (National Institute of Nursing Research, 2011), particularly with our current aging population. These examples highlight the importance of examining the values of the larger research community. 7. Mindfulness as a tool to enhance awareness and insight Mindfulness is both a mental practice and a trait that involves paying attention to present-moment experience with an attitude of receptivity and acceptance (Bauer-Wu, 2011; Kabat-Zinn, 1990). Shapiro and Carlson (2009) deﬁne it as "the awareness that arises through intentionally attending in an open, caring, and nonjudgmental way" (p. 4). Through mindfulness practices one can cultivate selfawareness through noticing bodily cues, thoughts, and emotions, and awareness and sensitivity to others, to context and circumstances, and to the environment. Mindfulness is essentially seeing and experiencing things more accurately (as they are)—without mental ﬁlters, selfnarratives and judgments—in order to see clearly and respond thoughtfully. In this process, such mental processes are not pushed away or ignored. Rather, they are recognized as opportunities to learn about oneself and one's biases. It is in this way that mindfulness has a role with developing cultural humility. Typically, busy researchers and clinicians go about their days on autopilot, going from one task to another, with little if any acknowledgement of their attitudes, assumptions, and biases or how their words and actions are affecting others. More often than not, these individuals are overextended and running short on time, so they may quickly proceed with their activities with little awareness of what they are doing or considering another's perspective and how their actions (or lack of) have consequences on others. Mindfulness interrupts "automatic pilot" and allows for more thoughtful consideration leading to wise action (Bauer-Wu, 2011; Kabat-Zinn, 1990). Evidence is burgeoning on the effects of mindfulness training in areas such as: * brain function, including perceptual acuity (MacLean, Ferrer, Aichele, Bridwell, & Saron, 2010), working memory and attention (Jha, Krompinger, & Baime, 2007; Lutz et al., 2009; * self-regulation of emotions (Wadlinger & Isaacowitz, 2011); * interpersonal attributes of empathy (Krasner et al., 2009); * recognizing others' emotions (Kemeny et al., 2012). It has been shown to be helpful to clinicians and can lead to being more mindful in the clinical setting and other aspects of everyday life (Krasner et al., 2009; Galantino, Baime, Maguire, Szapary, & Farrar, 2005. While no studies have speciﬁcally explored if clinical researchers can beneﬁt from mindfulness practices, one can extrapolate such a role based on the evidence to date coupled with the theoretical underpinnings (Brown, Ryan, & Creswell, 2007) (Fig. 1). 8. Building relationships with research participants After the researcher has an opportunity to explore his/her own issues related to culture, she/he next considers the culture of the research participant. Who is the person, who has a life and story of her own, on the other side of the consent form or the survey or lab specimen? Consider the dynamics at play during a dialogue between a person of privilege (i.e., an educated, middle class, healthy clinical researcher) and the vulnerable research participant who may be living in poverty with advanced disease and multiple co-morbidities. The power imbalance between the researcher and participant must be recognized and minimized in the research process ( Kvale & Brinkmann, 2009 ). Cultural humility calls on individuals to be ﬂ exible and humble enough to let go of the false sense of security that stereotyping brings and to explore the cultural dimensions of the experiences of each person. Humility is needed to check the power imbalances that exist in the dynamics of researcher-participant communication. In order to build productive relationships with the participant, the researcher must explore the values, beliefs, and biases of the research participant speci ﬁ c to health care and research participation. 9. Understanding the past and present In order to understand how research participants may view research, one must be aware of history. Historically some groups have already been deprived of quality health care and have a long history of not being treated fairly and equitably (Smedley, Stith, & Nelson, 2003), and have experienced abuse and disrespect, as is the case with African Americans (Baker, Brawley, & Marks, 2005). The Public Health Service's Syphilis Experiment at Tuskegee is an unfortunate landmark example that illustrates the worst of research with vulnerable groups. For forty years, the U.S. Public Health Service conducted an experiment on black men in the late stages of syphilis who were never told what disease they were suffering from or of its seriousness (Jones, 1993). This history of mistrust by vulnerable populations has led to skepticism about the purpose and outcomes of research thereby necessitating conscientious effort to build trust (Douglas et al., 2009). In order to build trust, the reasons for mistrust must be uncovered. Some point out that the focus should not be on the participants' mistrust, rather the focus should be on the trustworthiness of the system (Corbie-Smith & Ford, 2006). The lack of trustworthiness in the system is rooted in history as well as the current state of health disparities. The history of slavery, racism, and segregation, and the continuing shortage of minority providers and researchers contribute to mistrust. In addition, poor patient-provider communication and a lack of true cultural understanding by health care providers and researchers inﬂuence level of trust (List, 2005). Health disparities and lack of access to quality health care can add to mistrust. How do you answer a potential study participant when he says, "you want me to help you with this research study but I cannot get health care coverage that I can afford." Equally important to the recognition of historical inﬂuences is the need to understand the heterogeneity of groups. All racial and ethnic groups are heterogeneous and may have different histories and follow different lifestyles. Education, religion, sociocultural factors, geographic location, gender, sexual orientation, and age affect attitudes toward research as much as historical events. Also values, beliefs and attitudes may differ based on age and generational factors, need to also be considered (van Ryn & Burke, 2000). 10. Breaking down stereotypes Relationships between the study team and study participants must be thoughtfully and courageously examined along with barriers imposed by the use of stereotypes to classify individuals. For example, many stereotypes exist about the poor and are often communicated with little hesitancy or shame (Lott, 2002). Common descriptors used to describe the poor include: uneducated, lazy, dirty, Scenario: You, a nurse researcher, are planning to conduct a study with low-income immigrants from a different racial and ethnic background than yourself. You are quickly working on the details of the study procedures to meet an impending grant deadline. You take a few minutes to incorporate mindfulness techniques. Mindfulness tools you can use (sequentially): 1) Intentionally pause from what you are doing. 2) Take a few slow deep breaths, bringing awareness to the experience and sensations of breathing in and breathing out. 3) Reflect on what it might be like to be one of the immigrants participating in the proposed complex clinical trial. Consider how your life is different from these people. Reflect on how difficult their lives are and how participation in this study will be a burden to their already stressful lives. 4) Tune in and notice: how your body feels (i.e., sense if your heart is beating fast or if your shoulder muscles are tense), thoughts coming to mind (i.e., is the study sensitive to the nuances of these individuals or is it asking too much of them?), and emotions arising (i.e., anxiety or worry). 5) Take a few more slow breaths with awareness. 6) Further reflect on the specific issues and circumstances that the immigrants face and consider aspects of their living and working environments. 7) Again, take a few more mindful breaths. 8) Proceed with writing the study protocol with a greater sense of clarity and kindness toward the marginalized study population whom you're studying. Fig. 1. Example of mindfulness as a tool for cultural humility in clinical research. stupid, immoral, criminal, abusive, and violent (Cozzarelli, Wilkinson, & Tagler, 2001, Kemeny et al., 2012). Health care providers may also hold these stereotypes. For example they may perceive patients with lower socioeconomic status as having more negative personality characteristics, lower level of intelligence, less likely to be adherent, and less likely to want active lifestyle even when controlling for other demographic factors (van Ryn & Burke, 2000). Clinical researchers must be cautious to avoid stereotyping groups and must consider the individual who may be distinctly different than others in a similar group. Beyond being a study " subject " , the research participant is a partner who is an expert in her/his own experience. Paternalistic behaviors and gate keeping activities speci ﬁ cally in research recruitment need to be replaced with honest communication and respect. 11. Conclusion and recommendations Cultural humility, a process of reﬂection and lifelong inquiry, involves self-awareness of personal and cultural biases as well as awareness and sensitivity to signiﬁcant cultural issues of others. Core to the process of cultural humility is the researcher's deliberate reﬂection of her/his values and biases. Looking toward the future, cultural humility and practices that cultivate it, like mindfulness, ought to be an essential component of the training of clinical researchers. Given that nursing naturally espouses a holistic perspective, it is logical that nurse researchers take a lead in this area. With a foundation in cultural humility, nurse researchers and other investigators can implement meaningful and ethical projects to better address and minimize health disparities. References Baker, S. M., Brawley, O. W., & Marks, L. S. (2005). Effects of untreated syphilis in the negro male, 1932 to 1972: A closure comes to the Tuskegee study, 2004. Urology, 65(6), 1259–1262, http://dx.doi.org/10.1016/j.urology.2004.10.023. Bauer-Wu, S. (2011). Leaves falling gently: Living fully with serious & life-limiting illness through mindfulness, compassion, and connectedness. Oakland, CA: New Harbinger. Brown,K.W.,Ryan,R. M.,&Creswell,J.D. (2007).Mindfulness:Theoreticalfoundationsand evidence for its salutary effects. Psychological Inquiry, 18, 211–237, http://dx.doi.org/ 10.1080/10478400701598298. Corbie-Smith, G., & Ford, C. L. (2006). Distrust and poor self-reported health - Canaries in the coal mine? Journal of General Internal Medicine, 21(4), 395–397, http: //dx.doi.org/10.1007/s11606-006-0138-4. Cozzarelli, C., Wilkinson, A. V., & Tagler, M. J. (2001). Attitudes toward the poor and attributions for poverty. Journal of Social Issues, 57(2), 207–227, http://dx.doi.org/ 10.1111/0022-4537.00209. Douglas, M. K., Pierce, J. U., Rosenkoetter, M., Callister, L. C., Hattar-Pollara, M., Lauderdale, J., & Pacquiao, D. (2009). Standards of practice for culturally competent nursing care: A request for comments. Journal of Transcultural Nursing, 20(3), 257–269. Galantino, M. L., Baime, M., Maguire, M., Szapary, P. O., & Farrar, J. T. (2005). Association of psychological and physiological measures of stress in health-care professionals during an 8-week mindfulness meditation program: Mindfulness in practice. Stress and Health: Journal of the International Society for the Investigation of Stress, 21(4), 255–261, http://dx.doi.org/10.1002/smi.1062. Grant, B. F., Stinson, F. S., Hasin, D. S., Dawson, D. A., Chou, S. P., & Anderson, K. (2004). Immigration and lifetime prevalence of DSM-IV psychiatric disorders among Mexican Americans and non-Hispanic whites in the United States: Results from the National Epidemiologic Survey on Alcohol and Related Conditions. Archives of General Psychiatry, 61(12), 1226–1233, http://dx.doi.org/10.1001/archpsyc.61.12.1226. Gysels, M., Shipman, C., & Higginson, I. J. (2008). I will do it if it will help others: Motivations among patients taking part in qualitative studies in palliative care. Journal of Pain and Symptom Management, 35(4), 347–355, http://dx.doi.org/ 10.1016/j.jpainsymman.2007.05.012. Hofman, N. G. (2004). Toward critical research ethics: Transforming ethical conduct in qualitative health care research. Health Care for Women International, 25(7), 647–662, http://dx.doi.org/10.1080/07399330490458088. Hunt, L. M. (2005). Health research: What's culture got to do with it? The Lancet, 366(9486), 617–618, http://dx.doi.org/10.1016/S0140-6736(05)67118-8. Hunt, L. M., & de Voogd, K. B. (2005). Clinical myths of the cultural "other": Implications for Latino patient care. Academic Medicine, 80(10), 918–924, http://dx.doi.org/ 10.1097/00001888-200510000-00011. Jha, A., Krompinger, J., & Baime, M. J. (2007). Mindfulness training modiﬁes subsystems of attention. Cognitive, Affective, & Behavioral Neuroscience, 7, 109–119, http: //dx.doi.org/10.3758/CABN.7.2.109. Jones, J. (1993). Bad blood: The Tuskegee syphilis experiment. New York: The Free Press. Jootun, D., McGhee, G., & Marland, G. R. (2009). Reﬂexivity: Promoting rigour in qualitative research. Nursing Standard, 23(23), 42–46. Kabat-Zinn, J. (1990). Full catastrophe living: Using the wisdom of your body and mind to face stress, pain andiIllness. New York: Delta. Kemeny, M. E., Foltz, C., Cavanagh, J. F., Cullen, M., Giese-Davis, J., Jennings, P., & Ekman, P. (2012). Contemplative/emotion training reduces negative emotional behavior and promotes prosocial responses. Emotion, 12, 338–350, http://dx.doi.org/10.1037/a0026118. Krasner, M. S., Epstein, R. M., Beckman, H., Suchman, A. L., Chapman, B., Mooney, C. J., & Quill, T. E. (2009). Association of an educational program in mindful communication with burnout, empathy, and attitudes among primary care physicians. Journal of the American Medical Association, 302(12), 1284–1293, http://dx.doi.org/ 10.1001/jama.2009.1384. Kumagai, A. K., & Lypson, M. L. (2009). Beyond cultural competence: Critical consciousness, social justice, and multicultural education. Academic Medicine, 84(6), 782–787, http://dx.doi.org/10.1097/ACM.0b013e3181a42398. Kumas-Tan, Z., Beagan, B., Loppie, C., MacLeod, A., & Frank, B. (2007). Measures of cultural competence: Examining hidden assumptions. Academic Medicine, 82(6), 548–557, http://dx.doi.org/10.1097/ACM.0b013e3180555a2d. Kvale, S., & Brinkmann, S. (2009). Interviews: Learning the craft of qualitative research interviewing (2nd ed.)Los Angeles: Sage Publications. List, J. M. (2005). Histories of mistrust and protectionism: Disadvantaged minority groups and human-subject research policies. The American Journal of Bioethics, 5(1), 53–56, http://dx.doi.org/10.1080/15265160590927741. Lott, B. (2002). Cognitive and behavioral distancing from the poor. The American Psychologist, 57(2), 100–110, http://dx.doi.org/10.1037//0003-066X.57.2.100. Lutz, A., Slagter, H. A., Rawlings, N. B., Francis, A. D., Greischar, L. L., & Davidson, R. J. (2009). Mental training enhances attentional stability: Neural and behavioral evidence. The Journal of Neuroscience, 29, 13418–13427, http://dx.doi.org/10.1523/ JNEUROSCI.1614-09.2009. MacLean, K. A., Ferrer, E., Aichele, S., Bridwell, D. A., & Saron, C. D. (2010). Intensive meditation training leads to improvements in perceptual discrimination and sustained attention. Psychological Science, 21, 829–839. National Institute of Nursing Research. (2011). NINR Strategic Plan. (11–7783). Bethesda: National Institutes of Health. The National Commission for the Protection of Human Subjects of Biomedical and Behavioral Research. (1979). The Belmont Report. (45 CFR 46). Retrieved from. http://www.hhs.gov/ohrp/humansubjects/guidance/belmont.html. Papadopoulos, I., & Lees, S. (2002). Developing culturally competent researchers. Journal of Advanced Nursing, 37(3), 258–264, http://dx.doi.org/10.1046/j.13652648.2002.02092.x. Pessin, H., Galietta, M., Nelson, C. J., Brescia, R., Rosenfeld, B., & Breitbart, W. (2008). Burden and beneﬁt of psychosocial research at the end of life. Journal of Palliative Medicine, 11(4), 627–632, http://dx.doi.org/10.1089/jpm.2007.9923. Smedley, B. D., Stith, A. Y., & Nelson, A. R. (Eds.). (2003). Unequal Treatment: Confronting Racial and Ethnic Disparties in Health Care. Washington: National Academies Press. Tervalon, M., & Murray-Garcia, J. (1998). Cultural humility versus cultural competence: A critical distinction in deﬁning physician training outcomes in multicultural education. Journal of Health Care for the Poor and Underserved, 9(2), 117–125, http: //dx.doi.org/10.1353/hpu.2010.0233. van Ryn, M., & Burke, J. (2000). The effect of patient race and socio-economic status on physicians' perceptions of patients. Social Science & Medicine, 50(6), 813–828, http: //dx.doi.org/10.1016/S0277-9536(99)00338-X. Shapiro, S., & Carlson, L. (2009). The art and science of mindfulness. Washington, D.C.: American Psychological Association. Wadlinger, H. A., & Isaacowitz, D. M. (2011). Fixing our focus: Training attention to regulate emotion. Personality and Social Psychology Review, 15, 75–102, http: //dx.doi.org/10.1177/1088868310365565. Waite, R., & Calamaro, C. J. (2010). Cultural competence: A systemic challenge to nursing education, knowledge exchange, and the knowledge development process. Perspectives in Psychiatric Care, 46(1), 74–80, http://dx.doi.org/10.1111/j.1744-6163. 2009.00240.x. Weissman, J. S., Betancourt, J., Campbell, E. G., Park, E. R., Kim, M., Clarridge, B., & Maina, A. W. (2005). Resident physicians' preparedness to provide cross-cultural care. Journal of the American Medical Association, 294(9), 1058–1067, http://dx.doi.org/ 10.1001/jama.294.9.1058.	<urn:uuid:64bca9d3-2c03-4edc-9d78-56fe13b0bb29>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	38,915
Collectieve inkoop isolatiemaatregelen: subsidie, financiering en de selectie van de leveranciers Houten, 5 oktober 2022 Geurt Breukink Isoleren v003 zonder Financiële overwegingen ⮚ Nu de mogelijkheid om subsidie te krijgen, de overheid betaalt mee aan de verduurzaming van de woning. ⮚ Voorkomen van uitgaven aan onderhoud en reparaties. ⮚ Oplopende prijzen en wachttijden in de installatiebranche. ⮚ Direct verlagen van de (oplopende) energielasten en verhoging van het comfort. Subsidie Energiebesparing Eigen Huis ⮚ Particuliere woningeigenaren en VVE's ⮚ Verschillend maar ongeveer 20 tot 30% van de kosten (zijn dit jaar verhoogd) Voorwaarden: - Vloer, dak, spouw/gevel, glas - min. 2 isolatiemaatregelen - of 1 maatregel icm bijvoorbeeld warmtepomp - binnen 12 maand aanvragen - HR++: U <1,2 , min. 8 m² max. 45 m² financieringswijzer/isde/woningeigenaren/voorwaarden- ⮚ www.rvo.nl/subsidie-enwoningeigenaren/isolatiemaatregelen InvesteringsSubsidie Duurzame Energie ⮚ Bijdrage voor aanschaf: zonneboiler warmtepomp aansluiting warmtenet ⮚ www.rvo.nl/subsidie-en- financieringswijzer/isde/woningeigenaren Energiebespaarlening ⮚ Nationaal Warmtefonds ⮚ € 2.500 - € 65.000 lenen ⮚ Aantrekkelijke lage rente vanaf 1,51 % ⮚ Maand annuïteitenlening ⮚ Geen afsluitkosten ⮚ Boetevrij aflossen ⮚ www.energiebespaarlening.nl/particulieren/ Handige links ⮚ www.energiebespaarlening.nl ⮚ www.energiesubsidiewijzer.nl ⮚ www.milieucentraal.nl Aandachtspunten ⮚ Glas ⮚ Vloerisolatie ⮚ Spouwisolatie ⮚ Zonwering Glasisolatie Ug-waarde W/m2K Vloerisolatie Algemene richtlijn: ⮚ Beton vloeren vóór 1995 beter om wel te doen zeker wanneer vloerverwarming wordt gewenst ⮚ Houten vloeren direct doen (oude Dorp) ⮚ Woningen in Houten Zuid zijn voldoende geïsoleerd maar wellicht beter om bodemfolie aan te brengen omdat er vocht in de kruipruimte kan staan. Dat levert kou en waterdamp op dat tegen de onderkant van de isolatie condenseert. Spouwmuurisolatie ⮚ Na 1975 is vulling van spouwmuur toegepast ⮚ Wanneer er te weinig ruimte is dan geen na-isolatie ⮚ Oud isolatiemateriaal is te dun, verzakt, of deels vergaan. De isolatie kan 'lek' zijn, met mogelijk vocht + schimmel tot gevolg. ⮚ Onderzoek is nodig voordat besloten wordt!! ⮚ Keuzehulp spouwmuurisolatie: https://energierijkhouten.nl/wpcontent/uploads/2019/12/Keuzehulp-isolatiemaatregelen-inHouten-december-2019-1.pdf Zonwering ⮚ Zonwering is niet direct isolatie tegen koude maar vooral tegen warmte in de zomer ⮚ Screens: 85 % minder warmte en wel lichtdoorlatend ⮚ Rolluiken: verduisterend, behalve in de zomerook isolerend in de winter ⮚ Overige zonwering zoals uitval zonneschermen Criteria keuze aanbieders Combinatie van: - Certificering - Gevestigd in de regio - Bewezen kwaliteit - Goede referenties (evaluatie vorig jaar) - Prijs Vloerisolatie Rento Hermans Taha Appak Uitgangspunten voor Vloerisolatie ⮚ Bij een bezoek ter plekke zal er advies worden gegeven wat de beste optie is. ⮚ Bij meerdere adressen in de straat korting van toepassing ⮚ Prijzen staan op een handout welke beschikbaar is op de site van ERH. www.energierijkhouten.nl/heelhoutenisoleert/vloer/ ⮚ De prijs wordt lager bij grotere vloeroppervlakte ⮚ Maatwerk is mogelijk bijvoorbeeld isolatie van leidingen en convectorputten Glasisolatie * Geen leverancier geselecteerd * Wel diverse leveranciers in de buurt. Lange wachttijden, steeds duurder wordend glas. Uitgangspunten Glasisolatie ⮚ ⮚ Incl BTW prijzen, per m² Prijzen staan op een handout op onze site: www.energierijkhouten.nl/heelhoutenisoleert/glas/ ⮚ Offerte na bezoek ter plaatse ⮚ HR++ U1,1-1,2 (standaard 4-5) genoemde prijs incl standaard BGG lattenwerk ⮚ Toeslag 1 e etage 10% Toeslag 2 e etage 15% ⮚ "Warm edge" zwart/wit of lichtgrijze spouw iets duurder maar nog betere isolatie ⮚ Toeslag standaard triple glas U waarde 0,6-0,8 is mogelijk maar let op noodzaak van uitfrezen van kozijn of nieuwe kozijnen voor verkrijging subsidie. ⮚ Krypton gasvulling behoort ook tot de mogelijkheden met toeslag ⮚ Let ook op aanschaf van ventilatierooster ducoton 10 Spouwmuurisolatie Erik Ranschaert Uitgangspunten spouwmuurisolatie Woningen van na 1986 hebben vanuit de bouw al betere isolatie van de spouwmuren. Ervaring leert dat navullen van de spouw daar niet altijd mogelijk is met parels of wol. Handout beschikbaar op de site: https://energierijkhouten.nl/heelhoutenisoleert/spouwmuur/ ⮚ ⮚ Het aantal m² van de gevels is maatgevend. Prijzen incl BTW. ⮚ De prijzen zijn indicatief. Na een vooronderzoek wordt een definitieve offerte gemaakt. De opname van de woning wordt in overleg gedaan. Zonwering ⮚ Rietveld Zonwering ⮚ 3439 LD Nieuwegein ⮚ Ravenswade 1K ⮚ T (030) 288 29 18 ⮚ www.rietveldzonwering ⮚ E email@example.com ⮚ 5 % korting voor deelnemers via ERH ⮚ CBW gecertificeerd. ⮚ Garantie 7 jaar op Suncircle producten EnergieRijk Houten ⮚ Doel: Onafhankelijk & belangeloos opereren ⮚ Vóór en dóór bewoners van Houten ⮚ Feedback welkom! firstname.lastname@example.org www.energierijkhouten.nl Collectieve Inkoopactie ⮚ Aanmelden via www.energierijkhouten.nl ⮚ Of via www.jouwhuisslimmer.nl (het regionale energieloket van 16 samenwerkende gemeenten)	<urn:uuid:82678c02-8504-4051-90c1-d43630348756>	HuggingFaceFW/finepdfs/tree/main/data/nld_Latn/train	finepdfs	nld_Latn	5,209
Updated August 03 2002 LDP's Editors Choice Short Bibliography History Books all Newcomers and Beginners in AA history should Read and Own. These are Indispensable. Most are commonly available at both small and large bookstores (new and used) and many should be available at your local library. You can always purchase these books new- read them and donate them to your local library for others to read. I Recommend All the Books by AA Historian Dick B http://www.dickb.com of Hawaii especially : Turning Point-A Comprehensive History-Highest Recommendation!! The Oxford Group and Alcoholics Anonymous-Highest Recommendation!! Akron Genesis of AA-Highest Recommendation!! New Light on Alcoholism - Book on Shoemaker -Highest Recommendation!! and the following books: Not God By Ernest Kurtz - -Highest Recommendation!! was The history of AA by Ernie K Bill W by Robert Thomsen c.1975, Published by Harper & Row Bill W. (by Francis Hartigan) AA comes of Age A.A. World Services Slaying the Dragon- The History of Addiction Treatment & Recovery (Bill White) Dr Bob and the Good Old Timers A.A. World Services Language of the Heart A.A. World Services My Search for Bill W. (by Mel B.) 2000 Hazelden New Wine (by Mel B.) 1991 Hazelden Ebby The Man who Sponsored Bill Wilson(by Mel B.) 1998 Hazelden Bill W. and Mr. Wilson (by Matthew J. Raphael a pseudonym) Bill W., My First 40 Years, an Autobiography Bill Pittman Hazleden Publisher The Roots of AA (Bill Pittman Hazelden )- was OOP called AA Way It Began Twelve Step Sponsorship : How It Works by Hamilton B. (Hazelden) The Soul of Sponsorship : The Friendship of Fr. Ed Dowling -Bill Wilson by Robert Fitzgerald The Steps We Took : A Shares His Experience, Strength, and Hope by Joe McQ The Spirituality of Imperfection by Ernest Kurtz, Katherine Ketcham A Simple Program by J Big Book rewritten to Modern Language Courage To Change -Shoemaker (Bill Pittman and Dick B) Hazelden) Sister Ignatia: Angel of Alcoholics Anonymous (Mary Darrah Loyola Univ Press) Mrs. Marty Mann : The First Lady of AA (Sally Brown Hazelden) Women Pioneers in 12 Step Recovery by Charlotte Hunter The Natural History of Alcoholism (Geo E Valiant) Changed Lives : The Story of Alcoholics Anonymous Dennis C. Morreim / 1992 But, for the Grace of God … ,by Wally P.. Bishop of Books Children of the Healer, the Story of Dr. Bob's Kids, Hazelden Getting Better Inside Alcoholics Anonymous, by Nan Robertson, William Morrow How It Worked, the Story of Clarence H. Snyder, by Mitchell K., privately published. Read on Web Getting Better Inside AA (Nan Robertson 1988) Thomas Congan Books Physician, Heal Thyself!, by Dr. Earle M., CompCare Publishers That Amazing Grace, by Dick B., Paradise Research Publications There's More to Quitting Drinking than Quitting Drinking, by Dr. Paul O., Sabrina Pub. Anne Smith's Journal (by Dick B) Grateful to Have Been There by Nell Wing Lois Remembers A.A. World Services Motorcycle Hobos (Lois Wilson) Gratitude Press Children of the Healer (Story- Dr. Bob's Kids) Sue Smith Windows Pass It On - Bill Wilson and the A.A. Message, A.A. World Services Dr. Bob and the Good Old Timers A.A. World Services To Be Continued-AA World Bibliography (Charles Bishop Bill Pittman)Bishop Books The Collected Ernie Kurtz (Kurtz-Bishop of Books) Editors Note: If you like this material from Dick B and all the AA history info contained in these pages You Could Become More Active in Your Own AA Club By Starting a History/Reading Study Group to meet at some time other than your groups regular meetings. Don't Mistakenly get involved in the "Not AA Approved" Or "Not Conference Approved" BS about what books you can and cannot read at your AA Club. http://www.dickb.com/archives/aa_groups.shtml Just start a History/Book Reading Meeting Soon and Share this info with your many AA Friends!! AA HISTORY WEBSITE LEARN ABOUT: The Spiritual Roots and True Background of AA The Oxford Group The Absolutes/Standards Frank N.D. Buchman Early history of Bill Wilson Ebby Thatcher Rowland Hazard Hundreds of Other Topics of Historical Interest Regarding Alcoholics Anonymous Including the many many books Bill Wilson and Dr. Bob studied during their Oxford Group Days and the early Development of AA and Many of the Old AA Pamphlets from the 1940's prior to the Big Book. 100 PDF Printable Documents about AA history. http://www.aabibliography.com firstname.lastname@example.org I also recommend http://www.dickb.com Help us promote this site by passing this flyer to your AA friends AA HISTORY WEBSITE LEARN ABOUT: The Spiritual Roots and True Background of AA The Oxford Group The Absolutes/Standards Frank N.D. Buchman Early history of Bill Wilson Ebby Thatcher Rowland Hazard Hundreds of Other Topics of Historical Interest Regarding Alcoholics Anonymous Including the many many books Bill Wilson and Dr. Bob studied during their Oxford Group Days and the early Development of AA and Many of the Old AA Pamphlets from the 1940's prior to the Big Book. 100 PDF Printable Documents about AA history. http://www.aabibliography.com email@example.com I also recommend http://www.dickb.com Help us promote this site by passing this flyer to your AA friends	<urn:uuid:0303107b-59b3-434d-b261-4924eba8abcd>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	5,267
RENONCIATION A UN NUMERO D'IMMATRICULATION Vérification: Validation: Par la présente je soussigné Nom: Prénom: Adresse: Date de naissance: N° tél.: N° fax.: E-mail: Matricule: □□□□ □□ □□ □□□□□ déclare renoncer au numéro d'immatriculation □ qui était réservé à mon nom □ qui était attribué à mon véhicule Marque: Type: N° châssis: Signature Veuillez renvoyer ou remettre la présente, avec une copie lisible d'un document d'identité, à: SNCT bp 23 L-5201 Sandweiler E-IMM-02.1 Version 1.0 03.06.2014 Page 1 / 1	<urn:uuid:18a2989d-352e-4216-9090-e0522d29494f>	HuggingFaceFW/finepdfs/tree/main/data/fra_Latn/train	finepdfs	fra_Latn	539
REAL ESTATE BROKERAGE REALTORS® 'Let us show you… Texas' 1/6 INTEREST IN ACREAGE ON BOTH SIDES OF THE SABINAL RIVER IDEAL ELEVATED BUILDING SITES BEAUTIFUL HEALTHY HARDWOODS EXQUISITE VIEWS PRIVATE EXCELLENT HUNTING, FISHING, HIKING AND SWIMMING Bownds & Associates, Inc. © 2016 Information is believed reliable, but is not guaranteed by REALTOR®. Property is subject to prior sale, correction or withdrawal without notice. BRANDON BOWNDS BROKER 1223 Main Street P.O. Box 617 Utopia, Texas 78884 (830)966-6111 EMAIL email@example.com WEB www.bowndsrealtors.com ACREAGE 66.84±ac Unimproved Acres with 1/6 interest in 2.59± acres on BOTH sides of the Strong Flowing Crystal Clear Sabinal River. LOCATION Vanderpool, Texas • Bandera County ACCESS Access to Ranch off Paved FM 187 and All Weather Foster Ranch Road WATER 1/6 Ownership in 2.59± acres featuring BOTH sides of some of the strongest ﬂowing frontage of the Crystal Clear Sabinal River in the area. Ranch provides for an ideal Lake Site. TOPOGRAPHY A great combination of good usable bottomland with fertile soil, well established native grasses. Gradual incline to steep and rugged hillside. Heavily wooded with massive Oaks and an abundant variety of other trees native to the Hill Country creating privacy for excellent building site overlooking the vast panoramic views across the Sabinal Canyon. VEGETATION Cypress-Lined and Sycamore studded Riverbanks, Live Oak, Spanish Oak, Blue Oak, Cedar Elm, Mountain Laurel, scattered Heart Cedar. Abundant variety of beautiful hardwoods, proliﬁc plant community and sure to please with a vast array of color showcasing the Springtime Wildﬂowers and lush green grasses or the bright shades of the leaves during Fall Foliage. WILDLIFE Including but not limited to : Whitetail, Axis, Turkey, Hog, Coyote, Ringtail, Fox, Raccoon, Cottontail, Jackrabbit, Squirrel, Dove, Roadrunner and many other free roaming wildlife. A diverse array of birds: Red Bird, Blue Bird, Hawk, Crane... Bass, Perch, Catﬁsh. IMPROVEMENTS & HIGHLIGHTS Premium Quality Gated Entry to Sabinal River Exceptional Sabinal River Frontage along 2.59± Acres with Quality Pipe Gated Entrance Superb Live Water perfect for Swimming and Fishing. Deep Pools and Shallow Pockets, Solid Rock Bottom Bownds & Associates, Inc. © 2016 Information is believed reliable, but is not guaranteed by REALTOR®. Property is subject to prior sale, correction or withdrawal without notice. BRANDON BOWNDS BROKER 1223 Main Street P.O. Box 617 Utopia, Texas 78884 (830)966-6111 EMAIL firstname.lastname@example.org WEB www.bowndsrealtors.com Serene Riverbanks. Prime Picnic and Hang Out. A veritable parade for lawn chairs, swimsuits, cold drinks, weekends and long summer stays Great Pasture Land perfect for Grazing for Horses or Cattle Exceptional Elevated Building Sites for Full-Time, Retirement or Recreational Home with Breathtaking views and Beautiful Sunsets Tall, Towering, Shade Casting Hardwoods Stock Tank Hunt, Skeet Shoot, Target Practice Established trails ideal for ATVs and UTVs Showcasing Spectacular Views and Clear Night Skies with an Exquisite Whether it's standing under the shades of the towering Cypress or exploring the trails through the hills, you can have it all! Build your Dream House! Hike the established trails or go off road and create your own. Climb to the top of the Hills and see the sights. Amazing views across the Sabinal Canyon. A great place to Hunt or just check out the abundant variety of free roaming wildlife. Private Park-like setting along the River bank serves as a Prime Picnic Spot and great hang out. Beat the Summer Heat, Go Swimming! Start out with a good ole fashioned cannonball, accidental belly ﬂop or relax on the inner tube. This is deﬁnitely a place to make a splash! Enjoy the sounds of the laughter of friends and family and most desired peace and quiet! PRICE $461,196 TERMS Cash to Seller Third Party Finance CONTACT Brandon Bownds, Broker Ofﬁce (830)966-6111 Mobile (210)288-4325 BRANDON BOWNDS BROKER 1223 Main Street P.O. Box 617 Utopia, Texas 78884 (830)966-6111 EMAIL email@example.com WEB www.bowndsrealtors.com	<urn:uuid:609b1677-5639-4dbd-a89d-4f5dc6a87ce0>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	4,204
Leidraad 8 TIJDSBLOK 18.30 aanvang, gebed en beginnen met de maaltijd 19.30 terugblik op thema 6, Time-Out 20.30 aanvangen met thema 7, Omzien 21.45 kringgebed en mededelingen 22.00 einde 1 2 3 MAALTIJD Laat degene die de maaltijd heeft verzorgd, ook bidden voor de maaltijd en voor de avond. Waar gaat Gods hart naar uit? Lees bij het eten het volgende vanuit de bijbel: Jakobus 1 vers 27 "Voor God, de Vader, is alleen dit reine, zuivere godsdienst: weduwen en wezen bijstaan in hun nood, en je in acht nemen voor de wereld en onberispelijk blijven". 1 Lees ook Psalm 68 vers 5: "Hij is de vader der wezen en de rechter der weduwen, God in zijn heilige woning". TERUGBLIK THEMA 6 \| TIME-OUT Stel open vragen om de kern van het gesprek van de vorige keer aan te halen om te kijken welke punten zijn blijven hangen. Is er iemand die iets meegemaakt heeft in afgelopen twee weken en wil delen? Vragen die kunt stellen om het gesprek over het thema op gang te brengen: # Laat jij je beïnvloeden door meningen van anderen? Zo ja, in hoe verre? # In hoeverre lukt het om de 'trein' tijdelijk stil te zetten en na te denken of je nog op de juiste weg zit? # En zo ja, hoe doe jij dat? Zo nee, wat heb jij nodig om het wel te kunnen? # Heb jij iemand waar jij jezelf kunt zijn en hem kunt vertrouwen om je hele hebben en houden kunt neerleggen? Thuisopdracht Voor welke optie heb jij gekozen? Optie1: Bestudeer 1 Timotheüs 4 vers 7 en 8. Vrij vertaald: "Besteed je tijd en energie aan het trainen van jezelf om geestelijk fit te zijn". Wat heb jij nodig om dit toe te passen? En lukt het om dit toe te passen? Optie 2: Heb je kunnen nadenken over de vragen en heb je dit samen met je vrouw kunnen doen? Wat is je/jullie conclusie? Wat is de balans? Of weet je wel dat het anders moet, maar weet je niet hoe of waar te beginnen? 2 THEMA 7 \| OMZIEN We zijn gekomen bij de laatst thema 7, het 'omzien'. 3 Betekenis van 'omzien' uit Van Dale is 'omkijken' en belangstellende zorg voor een ander. Maar goed, als jij zelf en daarbij je gezin nog niet goed in evenwicht bent, hoe kun je er dan 'zijn' voor de ander? Hieronder 3 opties: de vraag is dan ook: Waar sta jij? 1. Jouw dagelijkse leven heb je goed op orde, uit de time-out is gebleken dat je in balans bent. Zou je willen nadenken of je tijd kunt vrij maken om te zien naar je broeder van je mandaat-groep die een ander nodig heeft? 2. Bleek uit het vorige thema dat jouw leven niet in balans is, misschien ben je wel veel te goed in het uitdelen, maar kom jijzelf of je gezin daardoor tekort, dan is het beter om hier meer aandacht aan te besteden, dan is omzien naar jouw dierbaren op dit moment de belangrijkste vorm van omzien. 3. Een derde mogelijkheid is dat jouw leven mooi in balans is als het gaat om aandacht voor je gezin en jouw activiteiten voor de ander. Maar hoe zit het met jezelf? Heb jij mensen, mannen, waarmee jij het leven kunt delen? Mannen die jou een spiegel voor (durven) houden? En visa versa? Heb je wel eens gedacht aan een of meerdere mannen waar je regelmatig mee bij elkaar komt om het leven te delen? Samen te bidden? Er zal een wereld voor je open gaan….. Waar sta jij en welk actie hoort daarbij? Vragen die jullie verder kunnen helpen: -wie heeft behoefte om met iemand op te trekken? Spreek het uit. -wie zou het mooi vinden om geregeld bij elkaar te komen om te bidden voor elkaar en onze gezinnen? -wat raakt jou hart als het gaat om 'naastenliefde'? Groepsopdracht Deel pennen en een strookjes papier uit en laat een ieder nadenken over zijn buurman rechts van hem. Omschrijf wat je zo mooi aan hem vindt en wat waardeer je in hem. Vervolgens laat je de mannen hun eigen valkuil opschrijven op een ander strookje en laat een ieder zelf kort daarover vertellen. Laat daarna een ieder vertellen welke mooie dingen hij opgeschreven heeft over zijn rechter buurman. Laat het een mooi bemoedigingsronde zijn en dat Afsluiten Sluit af met kringgebed. Bid dat jullie het verschil mogen maken in je eigen leven, maar ook in levens van je 'naasten'. Dat jullie mogen omzien door er te 'zijn'. Mededelingen: Eten: BBQ! Gezamenlijk inbreng. Wie verzorgd wat? Statement: Zie de uitleg hieronder beschreven Eventuele eigen mededelingen: VOORBEREIDING AFSLUITAVOND Zie ook de handleiding voorin onder 'voorbereiding voor de laatste avond' Neem het onderstaand met de mannen door: Indeling van de laatste avond: 18.30 uur: Aanvang, eten en drinken verzamelen, bbq is reeds ontstoken: 18.45 uur Statement maken en elkaar zegenen; 19.15 uur Starten met bbq 22.00 uur Officieel eind Eten: Regel onderling wie wat meeneemt. Bijvoorbeeld de ene neemt briketten mee, de ander een pak karbonades en de ander bijvoorbeeld een fles wijn. Zo stel je simpel een bbq-maaltijd samen. Statement: Op de afsluitavond willen wij een statement maken, of te wel een uitspraak waar wij als Mandaat7 voor staan. Er zijn twee verschillende statements waar een ieder zelf voor kan kiezen. Ook is het mogelijk om zelf tekst aan te dragen die het beste bij je past. Laat de twee voorbeelden zien en noteer hun keuze. Het statement gaan we op de afsluitavond ondertekenen en elkaar zegenen. Vervolgens gaan we het feestelijk met elkaar afsluiten. Het ondertekenen van het statement is niet verplicht, maar wel een mooi gebaar naar elkaar toe. De keuze om mandaat te (blijven) doen, doe je immers niet vanuit het moeten, maar vanuit je hart. Laat de mannen het ook gewoon eens even lezen die daar behoefde aan hebben wat zij gaan ondertekenen. Vervolgens zullen we na het ondertekenen, elkaar gaan zegenen.	<urn:uuid:456c0b24-d333-49b0-9fc6-1bbc3a9db034>	HuggingFaceFW/finepdfs/tree/main/data/nld_Latn/train	finepdfs	nld_Latn	5,624
Urbanisme RÈGLEMENT NO 2016-341 — ZONAGE CHAPITRE IX : LES CLÔTURES, MURETS ET HAIES 136. CHAMP D'APPLICATION POUR LES CLÔTURES, MURETS ET HAIES Les normes prescrites au présent chapitre s'appliquent à toutes les zones, mais ne visent pas un immeuble affecté à des fins publiques. 137. IMPLANTATION DES CLÔTURES, MURETS ET HAIES Une clôture, un muret ou une haie ne doit pas être implanté à moins de 60 centimètres de la limite du trottoir ou de la bordure ou de la ligne de rue s'il n'y a pas de bordure ou de trottoir et à moins de 1,5 mètre d'une borne-fontaine. Les clôtures, murets et haies implantés sur la propriété publique sont tolérés aux risques du propriétaire, et tout déplacement nécessité par des travaux pour fins de voirie ou d'utilités publiques doit, après avis sauf en cas d'urgence, être exécuté par le propriétaire à ses frais. Si celui-ci refuse ou néglige de faire les travaux de déplacements requis, ces travaux peuvent être exécutés par la Ville aux frais du propriétaire. La Ville ne peut, ni directement ni indirectement, être tenue responsable des dommages que peut subir toute clôture, muret et haie implantés sur la propriété publique, ni être tenue responsable des dommages ou blessures que pourraient s'y infliger des personnes. 138. HAUTEUR DES CLÔTURES, MURETS ET HAIES DANS LA COUR OU DANS LA MARGE DE RECUL AVANT Dans la cour ou dans la marge de recul avant, la hauteur d'une clôture, d'un muret ou d'une haie, mesurée à partir du niveau du sol adjacent, ne doit pas excéder les hauteurs suivantes : 1° pour un usage résidentiel sur un terrain intérieur : 1 mètre 2° pour un usage résidentiel sur un terrain d'angle : 1.0 m dans la cour avant comprise entre la ligne de rue et la limite de la marge avant et 1.5 m de hauteur entre la façade de la maison et la limite de la marge de recul avant. 3° pour les usages autres que résidentiels seulement derrière la marge avant, d'une hauteur maximale 2 mètres, jusqu'à la façade du bâtiment principal. Malgré ce qui précède, dans les zones où le groupe d'usage exploitation primaire est autorisé, la hauteur des haies est illimitée. 540, boulevard Renault Beauceville (Québec) G5X 1N1 Téléphone : 418-774-9137 —http://ville.beauceville.qc.ca/ Urbanisme 139. HAUTEUR DES CLÔTURES, MURETS ET HAIES DANS UNE COUR LATÉRALE OU ARRIÈRE Dans la cour latérale ou arrière, la hauteur d'une clôture ou d'un muret, mesurée à partir du niveau du sol adjacent, ne doit pas excéder les hauteurs suivantes : 1° pour les usages résidentiels : 2 mètres; 2° pour les usages autres que résidentiels : 3° mètres. Aucune hauteur maximale ne s'applique pour une haie. 140. HAUTEUR DES CLÔTURES ET MURETS AU SOMMET D'UN MUR DE SOUTÈNEMENT Malgré les dispositions des deux articles précédents, la hauteur d'une clôture, d'un muret ou d'une palissade implantée à une distance moindre que 1 mètre du sommet d'un mur de soutènement ne doit pas être supérieure à 1,2 mètre. 141. LES MATÉRIAUX D'UNE CLÔTURE OU D'UN MURET ET LA FAÇON DE LES ASSEMBLER 1° Sauf dans le cas d'une clôture de perches, une clôture de bois doit être faite avec des matériaux planés, peints ou traités contre les intempéries. Les contreplaqués, les panneaux gaufrés et les panneaux particules sont prohibés. 2° Une clôture de métal doit être exempte de rouille. À l'exception des cours d'école, des usages industriels et para-industriels, des infrastructures de services publics et des activités d'élevage où le groupe d'usage exploitation primaire est autorisé, toute clôture en maille de métal non recouverte d'un enduit de couleur, donnant sur une rue doit être cachée par une plantation d'arbustes conifères d'une hauteur équivalente à celle de la clôture. 3° Une clôture doit être solidement fixée au sol et elle doit être d'une conception propre à éviter toute blessure. 4° Un muret doit être constitué de pierres naturelles taillées ou non, de briques, de blocs de béton architectural ou de béton à agrégats exposés ou rainuré. 5° Un muret doit être stable et ne représenter aucun risque d'effondrement. 6° Une clôture ou un muret doit présenter un agencement uniforme des matériaux. 7° Une clôture, un muret ou une haie doit être bien entretenu. 142. FIL DE FER BARBELÉ Malgré l'article précédent, l'utilisation de fil barbelé (broche piquante) est autorisée pour les usages des groupes industrie, para-industrie, transport et infrastructure de services publics où le groupe d'usage exploitation primaire est autorisé aux conditions suivantes : 1° le fil de fer barbelé doit être installé à une hauteur supérieure à 2 mètres; 2° le fil de fer barbelé doit être installé sur un pan incliné vers l'intérieur du terrain; 540, boulevard Renault Beauceville (Québec) G5X 1N1 Téléphone : 418-774-9137 —http://ville.beauceville.qc.ca/ Urbanisme 3° dans le cas des usages où le groupe d'usage exploitation primaire est autorisé, le fil de fer barbelé peut être installé sans tenir compte des paragraphes 1et 2, mais ne doit jamais être utilisé pour barrer un chemin, sans être couvert d'un recouvrement très visible qui indique sa présence, suffisamment tôt pour permettre aux conducteurs de tout type de véhicules, susceptible d'emprunter la route à bonne vitesse (± 15 km/h) de freiner avant de franchir sa limite. TERMINOLOGIE Chemin forestier : Chemin aménagé sur un terrain pour transporter le bois du lieu d'abattage jusqu'au chemin public. Chemin privé : Chemin aménagé sur une propriété privée et destiné à l'usage exclusif du propriétaire et de ceux ayant reçu son autorisation explicite. Façade avant d'un bâtiment : Mur extérieur du bâtiment donnant sur une rue, implanté selon un angle inférieur à 45 degrés par rapport à celle-ci. Façade arrière d'un bâtiment : Mur extérieur situé à l'opposé de la façade avant d'un bâtiment. Façade avant principale ou secondaire (distinction) : Dans le cas d'un lot d'angle, la façade avant principale constitue la façade pour laquelle un numéro civique a été émis par la Ville. La façade avant secondaire constitue l'autre façade pour laquelle aucun numéro civique n'apparait. Façade latérale d'un bâtiment : Mur extérieur situé entre la façade avant et la façade arrière d'un bâtiment. Haie: Alignement de végétaux n'excédant pas une largeur de 0,5 mètre à la plantation. Marge de recul : Distance minimale calculée perpendiculairement en tout point des limites d'un lot et en deçà de laquelle il est interdit d'implanter un bâtiment principal. Marge de recul arrière : Prescription de la réglementation établissant la marge de recul à partir de la ligne arrière du lot. Marge de recul avant : Prescription de la réglementation établissant la marge de recul à partir de la ligne avant du lot. Marge de recul latérale : Prescription de la réglementation établissant la marge de recul à partir de la ligne latérale du lot. 540, boulevard Renault Beauceville (Québec) G5X 1N1 Téléphone : 418-774-9137 —http://ville.beauceville.qc.ca/	<urn:uuid:cf3ed7ae-e187-4e8d-832f-09018b6abf24>	HuggingFaceFW/finepdfs/tree/main/data/fra_Latn/train	finepdfs	fra_Latn	6,956
1. Introducción. En el presente trabajo, efectuaremos una esquematización del Monotributo (Régimen Simplificado para Pequeños Contribuyentes), indicando someramente su caracterización, lo que en nuestro ordenamiento se entiende por Pymes, así como también haremos mención a la última reforma del impuesto a las ganancias que incorpora una alícuota progresiva para la renta de sociedades. Ello, más allá de que tal concepto no es unívoco, para los distintos regímenes tributarios de los Estados, y ni siquiera para los sistemas legales de nuestro país. Por otro lado, mencionaremos los controles que realiza la AT sobre el RS, analizando los guarismos de recaudación e inclusión que exhibe dicho régimen. Entendemos que con ello, quedará explícito un diagnóstico crítico desde lo previo (enanismo fiscal$^1$, escasa recaudación, altos costos de control, etc.), para lo cual pensaremos algunas soluciones. Para finalizar, ensayaremos algunas propuestas superadoras respecto del régimen en sí, como también con relación a las estrategias de control que podrían implementarse, y especialmente plantearemos la necesidad de diseñar un régimen intermedio para pymes. Antes de comenzar, debemos destacar que en la República Argentina existe una brecha cambiaria, entre el dólar oficial y el de mercado, superior al 50% al momento de escribir estas líneas, que tiene su origen en una serie de restricciones impuestas por las autoridades que limitan el libre acceso al mercado de cambios, a efectos de no complejizar el presente trabajo, en adelante cuando se conviertan valores en pesos a dólares se utilizará el tipo de cambio vendedor oficial del Banco de la Nación Argentina, el lector deberá tener presente que se debe aplicar a los valores el factor de corrección antes mencionado. 2. Normas de aplicación. La ley 24.977 de 1998 estableció un Régimen Simplificado para Pequeños Contribuyentes (en adelante RS), que se conoce como Monotributo, y ha sufrido numerosas modificaciones a lo largo de más de dos décadas de vigencia, siendo que su última modificación se debe a la ley 27.618 del 21/04/2021. El Régimen (RS) abarca la cobertura de dos impuestos federales: el Impuesto al Valor Agregado (IVA), y el Impuesto a las Ganancias (IG) -es decir, un impuesto al consumo y otro a la renta-. Asimismo, integra en el pago de una única cuota mensual, el pago de un aporte de seguridad social, con cobertura jubilatoria y de obra social. --- $^1$ Se entiende por tal expresión, la situación en que los contribuyentes revelan una capacidad contributiva inferior a la real. La cuota tributaria mensual está dada por distintos niveles de indicadores que definen la Categoría: ingresos brutos, tipo de actividad, consumo de electricidad, superficie ocupada, alquileres devengados, personal ocupado y precio unitario máximo (en la venta de cosas muebles). Se prevé una recategorización semestral por parte de los contribuyentes, cuando se produzcan modificaciones en dichos indicadores. Entre las facultades de administración y control se delegó en la AFIP la facultad de recategorizar de oficio a aquellos sujetos que habiendo superado los límites de la categoría en la que tributan, no lo hayan hecho; o directamente excluirlos del RS, cuando superen los máximos de alguno de los parámetros previstos para el régimen, o se verifiquen situaciones que prevean tal temperamento (actividades no abarcadas: financieras, inmobiliarias, importadores, etc.). La última modificación normativa puede resumirse en tres pilares: i. Actualización automática de los parámetros de cada categoría: Consiste en un alivio para los contribuyentes, en contextos de alta inflación. ii. Cambios en la forma de facturar a monotributistas: Cuando un sujeto inscripto en el IVA realice operaciones gravadas con Monotributistas deberá discriminar en la factura el gravamen que recae sobre la operación. Esta modificación intenta atenuar el shock que sufriría el contribuyente en caso de ser excluido del régimen simplificado, a fin de poder computar o netear el crédito fiscal incluido en sus compras. iii. Puentes para morigerar el impacto del pase de un RS al Régimen General, mediante mecanismos transitorios y permanentes; otorgando beneficios a quienes pasen voluntariamente a ser responsables inscriptos. En ese sentido, se establece para aquellos que superen los techos del RS, que pasen voluntariamente al RG, y no superen el 50% de ingresos brutos de las micro-empresas, una forma simplificada de determinar el IVA, por un período máximo de 3 años, así como algunas deducciones adicionales en el Impuesto a las Ganancias. 3. Colectivo de contribuyentes sobre los que recae. El RS está dirigido a personas humanas que realicen tanto prestación de servicios (PS) como la venta de cosas muebles (VC), o integren cooperativas de trabajo, y las sucesiones indivisas -sujeto tributario que reemplaza al difunto en su relación con el fisco, y antes de la partición hereditaria-. Si bien el régimen prevé una serie de indicadores a considerar a fin de categorizar al pequeño contribuyente, nos centraremos en aquel referido a sus ingresos brutos anuales, por ser aquel dato con el que más se realizan comparaciones con otros países. El límite de la primera categoría -que abarca servicios y venta de cosas - es de poco más de $200.000.- (unos 2.100 dólares). Por el otro extremo, los sujetos que realicen prestaciones de servicios podrán tributar por el RS, si sus ingresos anuales no superan $1.740.000.- (unos 17.575. dólares). En cambio, aquellos que realicen ventas de cosas muebles, podrán mantenerse dentro del régimen con ventas de hasta -algo más de- $2.609.000.- (o sea, unos 27.170 dólares). En resumidas cuentas, el descrito, es el régimen para trabajadores independientes o asociados a una cooperativa de trabajo, al que podríamos referir como Monotributo genérico. Pero también existen otros 4 tipos de monotributo: el relacionado al trabajo independiente promovido, el monotributo social, el especial (agrícola) y el unificado. El primero de estos, en el que se tributa un 5% del monto facturado, se encuentra fuertemente limitado: que tenga una sola actividad, sin local, en servicios no facture más de 6 veces en el año y por un monto bajo ($4.000) a un mismo sujeto, no ser empleador ni contribuyente del Impuesto sobre Bienes Personales, no superar los ingresos de la categoría A, ni tener más de 2 años de graduados -los profesionales-. Por el lado del monotributo social, pueden adherirse aquellos inscriptos en el Registro Nacional de Efectores de Desarrollo Local y Economía Social, personas en condición de vulnerabilidad social, fuera del mercado laboral, tributando por todo concepto $520,61 mensuales. En cambio, el monotributo especial, está dirigido a agricultores de caña de azúcar, tabaco, yerba mate, té y otras hierbas para infusión, debiendo tributar el 50% del componente previsional, al tiempo que se los exime de la parte impositiva. Finalmente, el monotributo unificado, es aquel al que pueden adherir los contribuyentes de algunas provincias, en las que al componente impositivo de los impuestos federales y al previsional (Monotributo genérico o integrado), se le agrega un componente de impuesto subnacional (que viene a cubrir el impuesto sobre los ingresos brutos provincial que percute sobre el contribuyente en cuestión). 4.- Definición de Pyme, según la norma que resulta de aplicación. Una PyME es una micro, pequeña o mediana empresa que realiza sus actividades en el país, en alguno de estos sectores: comercial, servicios, comercio, industria o minería o agropecuario. Puede estar integrada por varias personas según la actividad y sus ventas totales anuales en pesos no pueden superar los montos establecidos según su categoría. De acuerdo a la Resolución 19/2021 SEPYME publicada en el boletín oficial el 31/3/2021 con vigencia a partir del 1/4/2021 podrán ser consideradas micro, pequeñas y medianas, las empresas que tengan ingresos hasta los siguientes parámetros, y teniendo en cuenta alguna de las cinco actividades previstas en la normativa: \| Categoría \| Construcción \| Servicios \| Comercio \| Industria y Minería \| Agropecuario \| \|-----------\|--------------\|-----------\|----------\|---------------------\|--------------\| \| Micro \| 24.990.000 \| 13.190.000\| 57.000.000\| 45.540.000 \| 30.770.000 \| \| Pequeña \| 148.2 \| 79.54 \| 352.42 \| 326.660.00 \| 116.300 \| 60.000 0.000 0.000 0 0.000 Para una mejor comparación con otros sistemas tributarios, hemos calculado los parámetros en dólares estadounidenses: \| Categoría \| Construcción \| Servicios \| Comercio \| Industria y Minería \| Agropecuario \| \|-----------------\|--------------\|-----------\|------------\|---------------------\|--------------\| \| Micro \| 251.156 \| 132.563 \| 572.864 \| 457.688 \| 309.246 \| \| Pequeña \| 1.490.050 \| 799.397 \| 3.541.910 \| 3.283.015 \| 1.168.844 \| \| Mediana - Tramo 1 \| 8.313.668 \| 6.616.583 \| 26.017.789 \| 25.431.859 \| 6.964.020 \| \| Mediana - Tramo 2 \| 12.469.146 \| 9.449.447 \| 37.168.543 \| 39.750.754 \| 11.045.427 \| Por lo pronto, podríamos decir que las empresas de menor envergadura según esta clasificación (Micro), se ubican en esa conceptualización con ingresos de hasta 7.5 veces más que los que les permitiría empadronarse en el RS para servicios, y de hasta 22 veces el tope para ventas, a contribuyentes individuales. De esta forma, habrá Micro emprendimientos que no podrán adherir al RS, por superar su límite de ingresos, aun siendo conceptualmente, para otras normas, Micro. De aquí, se desprende que ni las Pequeñas ni las Medianas, con volúmenes de operaciones por encima de las clasificadas como Micro podrán tributar por el RS. Esto, no hace más que reforzar que el Monotributo, como su nombre originario lo indicaba, es un régimen para pequeños contribuyentes. La principal conclusión, es que el Monotributo es un sistema que -según las normas- no alcanza a las Pymes, sino exclusivamente a pequeños contribuyentes que se encuentran por debajo del volumen de las micro empresas. 5. Tributación de los pequeños contribuyentes y las Pymes. Modo de estimación de rentas, cuantía de la tributación. Como lo expresamos más arriba, las Pymes -según su definición legal- no son abarcadas por el RS. Por ello, nos centraremos en la relación entre estimación de rentas y cuantía de la estimación para los contribuyentes del RS, dado que las Pymes -como se advierte- tributan por el régimen general (RG). El total anual que abona un contribuyente monotributista, considerando las cuotas mensuales integradas, va desde $23.468,16 (Categoría A) hasta $176.596,92 (Categoría K) para venta de cosas muebles; o bien hasta $113.423,16 (Categoría H) para locaciones y/o prestaciones de servicios. Considerando estas cuotas integradas respecto de los volúmenes de venta límite de cada categoría, observamos que aquellas representan un 8.31% del techo de ingresos para Cat. A, 4.82% para la Cat. H y 5% para la K. Adicionalmente, digamos que es posible que contribuyentes que ya cotizan por otro régimen a la seguridad social -por ejemplo, empleados en relación de dependencia- tributen exclusivamente el componente impositivo del monotributo, si desarrollan otra actividad de prestación de servicios, siendo que el monto anual ascenderá a 2.027,64 (para la categoría A) y 83.495,52 (categoría H). Asimismo, es posible que aquellos monotributistas que posean personas a su cargo (grupo familiar) efectúen el aporte de obra social para dar cobertura a dichas personas. 6. Niveles de recaudación, basados en datos oficiales publicados. Si bien analizamos un lapso de tiempo que abarca 11 períodos fiscales entre los años 2010 y 2020, concentramos el análisis en el año 2018, toda vez que es el periodo donde observamos mejor performance del RS. En el gráfico siguiente -aunque apenas se aprecia por muy bajo nivel- se muestra que esta tendencia se mantuvo estable a lo largo de los últimos 10 años, oscilando entre un mínimo de 0.92% y 1.25%: Similar situación se observa si se compara la performance del RS contra los dos tributos más importantes del régimen impositivo federal argentino, como lo son el Impuesto al Valor Agregado y el Impuesto a las Ganancias. La recaudación federal en el año 2018 se situó en 15.7 puntos del PBI, mientras que el total de las cuotas pagadas por los monotributistas, por todo concepto, solamente alcanzaron en este periodo: 0.0008 puntos del PBI. Esta es la mejor performance lograda por el régimen en los 11 años analizados, en los que osciló entre 0.00059 y 0.0008, incrementándose entre los años 2010 a 2018 para posteriormente descender, En marzo de 2021 los monotributistas inscriptos por categoría totalizaron poco más de 4 millones de personas, siendo que las primeras dos categorías (A y B) junto a los monotributistas de actividad primaria, asociados a cooperativas y trabajadores promovidos acaparan más del 60% de los inscriptos en el régimen (por encima de los 2.470.000), en el siguiente gráfico podemos observar la distribución: Del gráfico anterior, se observa la marcada relevancia de los monotributistas Cat. A, seguidos de los sociales, y los Cat. B; en suma, los 3 tipos y categorías de menor tributación. Podemos inferir una relación inversamente proporcional entre cantidad de contribuyentes y volumen de la recaudación, mientras que en la parte más alta de la pirámide nos encontramos con un escaso número de grandes contribuyentes y contribuyentes del régimen general que generan el grueso de la recaudación en la base nos encontramos con un elevado número de pequeños contribuyentes que realizan un aporte marginal a la recaudación federal, como observamos en el siguiente gráfico: 7. Algunas propuestas para el RS, tendientes a hacerlo más eficiente en el logro de sus objetivos. El espíritu de la última modificación del RS, si bien tiene la buena intención de implementar un régimen de transición entre aquel y el RG, lamentablemente aún no se encuentra operativo. La reforma no tuvo en cuenta una simplificación respecto de las obligaciones formales en aquel período de transición en que se pasa del RS al RG (por ejemplo: utilización de un único libro de movimientos, eximición de otros regímenes de información, etc.). Por otro lado, el régimen no prevé límites respecto de la posibilidad de “distribuir” la actividad dentro del grupo familiar -una modalidad empleada en todos los regímenes de este tipo que no restringen tal “uso”-, lo que permite frecuentes ocultamientos. Al respecto, creemos que una modificación normativa que establezca prevenciones en ese sentido, colaboraría mucho a morigerar ese tipo de elusión: por ejemplo, que la facturación efectuada por monotributistas del mismo grupo familiar, hasta cierto grado de consanguinidad o convivientes, para idéntico periodo mensual, se presumirá -salvo prueba en contrario- efectuada por uno sólo de ellos, conforme lo determine la Administración, e incluso que le sea asignado de oficio legalmente a aquel monotributista que se encuentra en la categoría más alta dentro del grupo familiar. Finalmente, aunque esto requeriría de un desarrollo que excedería el pensado para el presente, advertimos que las actuales escalas de este régimen incluyen a sujetos que debieran estar fuera de la tributación, por sus escasos ingresos brutos, con lo que se estaría tergiversando el objetivo que moldeó esta iniciativa, con un fin predominantemente de inclusión y formalización. 8. Medidas de control, auditoría o fiscalización actuales, con relación al régimen simplificado. La AFIP implementa distintas acciones para controlar el universo de Monotributistas. Cuenta con inducciones, cruces centralizados y órdenes de inspección con distinto tipo de alcance, según el interés que revista la inconsistencia detectada. A través de herramientas informáticas que permiten generar masivamente hipótesis para la detección y depuración del universo a controlar. En general y a modo de síntesis, se coteja el límite máximo de la categoría del RS versus distintos indicadores de actividad económica y/o financiera). Como resultado de las fiscalizaciones efectuadas sobre sujetos del RS que se encuentran mal categorizados, o directamente fuera del régimen, se inicia un procedimiento mediante el cual se buscará recategorizar o excluir al contribuyente en irregularidad. Como resulta obvio, no podemos avanzar en el comentario de estas herramientas, más allá de estos cruces que resultan del cotejo de información brindada a la AT por distintos sujetos obligados, que puede ser de utilidad para detectar y focalizar casos o estamentos de dispersión evidente de los parámetros permitidos en el RS con los datos surgidos de las bases de datos del Organismo. 9. Medidas que podrían mejorar la estrategia de control respecto del RS. Una medida que debería llevarse a todo el territorio, es el Monotributo unificado con el Impuesto sobre los Ingresos Brutos, que a la fecha sólo está vigente en pocas jurisdicciones provinciales (Córdoba, San Juan, Mendoza, Entre Ríos, Río Negro y Jujuy). Esta medida facilita el cumplimiento a los contribuyentes, a la vez que amplía el número de sujetos empadronados en los fiscos nacional y provinciales. Por otra parte, la incorporación de un “chatbot” como el de Perú (Sofia) para las consultas sencillas de los pequeños contribuyentes, podría acercar a la Administración Tributaria, resolviendo cuestiones que puedan parametrizarse. En este sentido, la Provincia de Buenos Aires y su agencia tributaria provincial (ARBA) posee una herramienta de este tipo en su página web, y parece ser de gran utilidad. Analizando la distribución de los contribuyentes en las categorías previstas, hay muchas personas en la primera categoría (categ. A superior a 1.3 millones de contribuyentes, que representan el 32.48% del total de contribuyentes monotributistas a marzo 2021); considerando que -por ejemplo- en la última categoría para la prestación de servicios o locaciones de obra (la K) solo hay algo más de 5.700 contribuyentes (0,0014%). Esto pareciera mostrar la concreción del riesgo que encierra todo régimen simplificado para pequeños contribuyentes: el enanismo fiscal; ello, incluso dentro del propio RS. Es decir, a los eventuales contribuyentes del régimen general que intentan “refugiarse” dentro del RS, se suman los del propio RS que se subcategorizan, o no actualizan su categorización, conforme la evolución de sus indicadores. Dado el enorme universo de contribuyentes del RS, lo que lo hace difícil de administrar en función del riesgo, y considerando los escasos recursos y tiempos de fiscalización y procedimientos de exclusión, pensamos que debería estar previsto un régimen mediante el cual -detectados indicadores objetivos que excluirían al contribuyente del RS-, se le aplique una marca en el padrón al mismo, a fin que, a partir de allí, sea sujeto de retenciones y percepciones en sus compras y ventas por parte de los contribuyentes del RG, y hasta tanto se fiscalice y determine desde cuándo y las eventuales obligaciones tributarias incumplidas. La problemática de que contribuyentes con una mayor capacidad contributiva a la prevista en este tipo de Regímenes Simplificados se oculten en el mismo, lo que comúnmente denominamos enanismo fiscal, se puede ver agravada cuando la alternativa es tener que tributar dentro de un sistema de alta complejidad para el contribuyente. Y puntualmente, en nuestro país, fuera del RS, tanto una micro empresa como las empresas más grandes -nacionales o filiales de otras multinacionales- cumplirán sus obligaciones tributarias a través del Régimen General. El principal inconveniente que enfrentan los contribuyentes que quedan excluidos del RS, ya sea porque superaron al menos uno de los parámetros establecidos para la categoría más alta o porque fueron excluidos por alguna falta formal, no es tanto el mayor costo impositivo que deben asumir, sino los costos administrativos que deben enfrentar y las complejidades que deben afrontar, que equiparan el régimen para una micro, una pyme y para una multinacional. Fácil resulta entender que los recursos que disponen una con respecto a la otra son muy distintos. Recordemos que los impuestos deben tratar con igualdad a los contribuyentes, y para que este principio se cumpla cuando nos referimos al sistema impositivo, debería preverse un tratamiento igual para los contribuyentes de similares condiciones. En forma opuesta, incluir a todos los contribuyentes -a excepción de los pequeños individuales- en un Régimen General, no parece respetar las diferencias de los contribuyentes que no se encuentran en las mismas condiciones. Y esta falta de tratamiento igualitario, obviamente, beneficiará al más poderoso -económicamente-, en un sentido que resultaría contrario a los objetivos siempre declamados respecto al apoyo a las Pymes. Como se adivina, la falta de una simplificación del sistema para aquellos contribuyentes que no poseen una estructura administrativa y económica de importancia, contrasta con la necesidad que el sistema prevea todas las posibilidades y complejidades que pueden presentarse en los contribuyentes de mayor capacidad. La tensión entre esas dos cuestiones, se ha resuelto por la vía más sencilla -aunque no más justa- de englobar a todos (los que no son monotributistas) en el RG. 10. Ideas que podrían re-encauzar el RS. De hecho, hemos observado que el siempre latente “enanismo fiscal” que puede prohijar este tipo de regímenes, se estaría produciendo incluso dentro del mismo -donde los contribuyentes se concentran en las categorías más bajas-. Tal vez, una de las razones que podrían explicar esta situación podría ser la gran cantidad de categorías que posee actualmente el RS, con lo cual se ha intentado abarcar dentro del mismo a contribuyentes de ingresos “no tan pequeños”. En este sentido, una simplificación del RS, tendiente a limitar la cantidad de categorías que comprenden el mismo -como en otros países de la región, de unos 3 ó 4 niveles- podría redundar en la facilitación de las tareas de fiscalización y de administración en general del régimen. Incluso, la cantidad de variables a tener en cuenta en el monotributo, va mucho más allá de las que se consideran en otros RS en países vecinos, en que principalmente se utiliza, la variable “ingreso bruto”. El mayor problema de excluir del régimen a las categorías más altas, es que las mismas pasarían a tributar en el RG, siendo que ello implica no sólo una mayor carga tributaria, sino una carga administrativa desproporcionadamente superior -con su costo asociado-. No obstante, como lo dejamos entrever en el apartado anterior, las categorías inferiores -al menos las 2 primeras, según las variables que hoy prevén- no debieran encontrarse en un RS que impone la tributación mensual de cotizaciones; siendo en su lugar más recomendable un mecanismo del tipo del monotributo social. 11. La modificación en el Impuesto a las Ganancias empresariales. Paralelamente a la modificación que se efectuó respecto del monotributo, en el presente año la reforma del Impuesto a las Ganancias empresariales sancionada por el Congreso, aprobó la aplicación de un esquema impositivo progresivo sobre los beneficios empresariales. La escala comienza en un primer escalón que va de 0 a $5 millones (de ganancia neta sujeta a impuesto), otra que va hasta los $50 millones, y una tercera para aquellas de más de $50 millones, con una alícuota fija incremental parte del 25%, pasando al 30% en el segundo escalón, y 35% en el tercero; estableciéndose un monto fijo respecto de los dos últimos, y la alícuota mencionada sobre el exceso de esos montos respectivamente. Asimismo, se mantiene el 7% sobre la distribución de resultados para todos los casos. En este punto, debemos hacer notar que en el mundo existen pocos países que apliquen un esquema progresivo sobre el impuesto a la renta empresarial -al menos de aquellos occidentales con difusión de sus esquemas tributarios-; más aún, lo que se está discutiendo a nivel de los principales países del mundo, es una alícuota plana universal que evite distintas maniobras de deslocalización y erosión de las bases imponibles. En este sentido, un diseño de los impuestos que permita minimizar la interferencia del Estado en las actividades privadas, dará señales e información hacia los mercados para evitar asignaciones sub-óptimas que reduzcan el bienestar social, en lo que se conoce como requisito de neutralidad. 12. Necesidad de un Régimen Intermedio para Pymes A lo largo del presente, hemos analizado el Monotributo, pensado -como su propio nombre lo indicaba- para pequeños contribuyentes individuales. Las modificaciones que ha ido sufriendo el régimen a lo largo de su ya dilatada historia, parecen mostrar que el mismo no ha conseguido cumplir -o lo ha hecho en una pobre medida- con su cometido más importante: la inclusión y formalización de sectores económicos marginales. De hecho, podríamos decir que la presión, de los interesados por mantener -y en lo posible ampliar- el RS, fue llevando al Régimen Simplificado para Pequeños Contribuyentes, a un régimen con una gran cantidad de variables a considerar para la categorización, y otro importante número de categorías a las que sumarse para “escapar” del RG. Desde distintas iniciativas, impulsadas por unas y otras ideas políticas -y en todos los gobiernos-, se ha intentado acompañar o ayudar a las pymes, reconociéndolas como el motor de la economía interna, y especialmente, como las mayores generadoras de empleo. Sin embargo, no se ha pensado en un régimen tributario especial para estas “vedettes” de los anuncios políticos. En tiempos en que las TICs (tecnología de la información y la comunicación) no cesan de sorprendernos con sus avances, la factura electrónica es una obligatoriedad en la amplia mayoría de las operaciones, y con ello, los libros de movimientos (o de compras y ventas, se acercan a la realidad diaria). Si a esto le sumamos el avance de los medios de pago electrónicos -empujados por los cierres de la movilidad en la pandemia, aún en nuestro país, donde existe un importante uso de dinero en efectivo-, observaremos que buena parte de la operatoria económica puede efectuarse, pagarse, registrarse y declararlas al fisco en forma digital. En este sentido, consideramos que sería interesante y beneficioso ofrecer a las micro-pymes que opten por este régimen, el acceso a un sistema “ERP” (Enterprise Resource Planning – Planificación de Recursos Empresariales) que opere en el entorno de los servidores de la AFIP, tal como lo hace actualmente el sistema de facturación electrónica. Este tipo de instrumentos (ERP), ha sido desarrollado como un conjunto de sistemas de información que permite la integración de ciertas operaciones de una empresa, especialmente las que tienen que ver con la producción, la logística, el inventario, los envíos, administración de recursos humanos y la contabilidad. Por ello, entendemos que una herramienta de estas características, podría emplearse para integrar la relación de determinados sujetos (Pymes) con la AT, desde la facturación, registración y liquidación de las obligaciones tributarias, sería una forma de efficientizar desde ambas partes el vínculo obligacional. Fuera de ello, la utilización de una herramienta de tipo ERP por parte de las micro y pymes, podría redundar en su uso directo empresarial -más allá de la cuestión tributaria-, lo que potenciaría su crecimiento, pudiendo volverlas más eficientes y reducir significativamente los costos de administración. En este contexto, no parece muy complicado que las micro, pequeñas y medianas empresas, pudieran incorporarse a un -llamémosle- Régimen Intermedio (RI), en el que rigiera la obligatoriedad de utilizar esos medios electrónicos. Esto es, el atractivo de un beneficio de ingresar y permanecer en un régimen especial con dos beneficios y una obligación como contrapartida. Los beneficios serían que el Régimen Intermedio asegure cierta simplicidad en su trato con la Administración Tributaria, a la vez que la tributación del mismo se ubique en la más baja de lo que hoy es el RG para sociedades: 25%. La obligación en contraprestación a estos beneficios, sería que el contribuyente acepte la utilización exclusiva de facturación electrónica para sus operaciones de compra y venta, la implementación de un libro digital de las mismas, así como el acogimiento a un sistema de declaraciones de impuestos pro-forma, que debiera implementarse para efectuar este tipo de liquidaciones, y la conformidad de manejar todas las notificaciones también por vía digital. De esta forma, se podría incluir en ese régimen, que tendría mucho de pre-establecido o mejor dicho de autodefinido en forma digital, a una buena parte de los contribuyentes de sectores medios que tienen una conducta mayormente de cumplimiento de las obligaciones tributarias, facilitando su interacción con el fisco, beneficiándose con dicha simplicidad, y con la aplicación de una alícuota constante y relativamente baja. Ello también traería aparejado la liberación de recursos de la AT para efectuar mejores controles respecto de los sujetos del RG. Con lo mencionado, debe quedar claro que el Régimen Intermedio (RI) que se plantea, sería en todos los casos uno de acceso facultativo para el contribuyente, aunque sí debiera tener un límite para los sujetos de mayor peso contributivo y complejidad; por ejemplo, restringiendo su acceso a holdings, sucursales de empresas extranjeras, aquellas con un patrimonio superior a determinado monto, o ingresos también superiores a ciertos guarismos. Así, los contribuyentes de capacidad contributiva media podrían elegir entre tributar en el RG, o hacerlo con los beneficios mencionados y con la obligación descripta, en uno nuevo que permitiría simplificar costos de cumplimiento fiscal, a través de una plataforma que pre-liquidaría las obligaciones con base en la información electrónica que poseería la AT, desde la utilización de facturación electrónica. Obviamente, aquellos que no deseen suscribir a ese RI, tendrían su interfaz con el fisco a través del RG. 13. Conclusiones. A lo largo del presente hemos repasado las características del Régimen Simplificado tributario implementado hace más de 20 años en nuestro país, conocido con el nombre de Monotributo. Respecto al mismo, expusimos su importancia relativa en mérito a su peso en la masa de recursos tributarios, así como con relación a la cantidad de contribuyentes que aglutina. A partir de allí, pudimos observar que una muy abultada participación de contribuyentes en este RS, concentrados en las categorías de más baja cotización, que impactan de una manera casi insignificante en las cuentas recaudatorias. Esto último no sería algo que debiera traer preocupación a quienes diseñan la política fiscal, por cuanto este tipo de regímenes tienen otros objetivos primordiales en miras, como la inclusión y formalización de sujetos y actividades frecuentemente marginales. Sin embargo, no podríamos decir lo mismo de la cantidad de sujetos comprendidos en el RS, descontando que en nuestro país hay un número aún superior de personas que siguen en la informalidad -o directamente dependen del Estado para subsistir-, e incluso que en el monotributo -con sus escalas actuales- se mantienen como sujetos tributarios algunos -los más- cuya capacidad contributiva es cuanto menos discutible. A esta realidad, se contrapone un notorio rechazo por parte de los monotributistas a “salir del régimen”, fuera de la ya referida concentración en los niveles más bajos. Mencionamos los controles que se efectúan sobre el régimen, así como alguna sugerencia para eficientizar su fiscalización, así como algunas otras ideas tendientes a reducir o “simplificar el RS”, dado que la última modificación del mismo, aunque prevé un régimen de transición para aquellos que queden fuera del monotributo, que no representa simplificación alguna, sino un temporal mantenimiento en el régimen -bajo ciertas condiciones-. Por otro lado, abordamos la última reforma al Impuesto a las Ganancias, que con relación a aquellas rentas empresariales, estableció una alícuota gradual o progresiva, respecto de 3 escalas de ganancias, indicando que este tipo de estructura no es frecuente en otros países, para no decir que se trata de una “rara avis”. Finalmente, todo lo anterior llevó a plantear la necesidad de diseñar y establecer un Régimen Intermedio de Tributación para las micro, pequeñas y medianas empresas. Ello, considerando que el régimen general debe prever todas las alternativas y complejidades que puede presentar la más grande de las empresas contribuyentes. En este sentido, pensamos en un RI que pudiera funcionar como régimen de adhesión por parte de una gran cantidad de contribuyentes del estrato medio. El mismo, utilizaría un sistema de tipo ERP (Planificación de Recursos Empresariales), a fin de facilitar la relación con el fisco, a partir de la utilización de documentación electrónica, registros virtuales y liquidaciones pre-establecidas; a la vez que beneficiaría a sus adherentes con la aplicación del mínimo de la alícuota tributaria prevista en las 3 escalas vigentes. Adicionalmente, este tipo de instrumentos -a partir de su familiarización por parte de los contribuyentes- podrían ser también utilizados en forma privada para mejorar sus procesos internos, y optimizar sus recursos, eficientizando su actuación. De cualquier forma, somos conscientes que en el presente hemos sugerido algunas ideas que pueden ser profundizadas y enriquecidas, a fin de paliar los problemas que advertimos en la situación tanto de pequeños contribuyentes, como de Pymes, respecto de los cuales, lo único que no podría hacerse es sencillamente: no hacer nada. Ello, en un momento crucial -y hasta para algunos terminal- de la vida de muchas Pymes, al punto que hasta se hable de evitar un Pymecidio$^2$. 13. Bibliografía - [https://pymes.afip.gob.ar/estiloAFIP/pymes/ayuda/default.asp](https://pymes.afip.gob.ar/estiloAFIP/pymes/ayuda/default.asp) - [https://afip.gob.ar/monotributo](https://afip.gob.ar/monotributo) - [https://www.afip.gob.ar/institucional/estudios/](https://www.afip.gob.ar/institucional/estudios/) - [https://www.iprofesional.com/impuestos/332117-que-provincia-se-incorpora-al-monotributo-unificado](https://www.iprofesional.com/impuestos/332117-que-provincia-se-incorpora-al-monotributo-unificado) - Leyes 24.447, 26.565 y 27.618 ([www.infoleg.gob.ar](http://www.infoleg.gob.ar)) - Resolución 19/2021 SEPYME publicada en el boletín oficial el 31/3/2021 con vigencia a partir del 1/4/2021 - Resolución General (AFIP) 4309/2018 --- $^2$ Conferencia en la UCEMA: [https://www.linkedin.com/feed/update/urn:li:activity:6811649051499487232/](https://www.linkedin.com/feed/update/urn:li:activity:6811649051499487232/), de Ariel Corenberg.	24433c3f-12d4-41ef-870d-e1c97938334f	HuggingFaceFW/finepdfs/tree/main/data/spa_Latn/train	finepdfs	spa_Latn	35,074
DBC Data Protection Policy 20 th September 2017 We, the deacons of Dumfries Baptist Church ('the church') wish to document that we take Data Protection seriously and wish to conduct the official affairs of the church concerning membership, church events and the use of the church building in accordance with: (i) best practice; (ii) the Data Protection Act 1998; and (iii) looking forward, with the new guidelines of the General Data Protection Regulations which are due to be enforced as from 25 May 2018. Therefore: 1. We appreciate that an individual person's name and contact details (including telephone number(s), postal address(es); and email address(es)) comprise sensitive personal information. 2. If we as a church hold such personal information for an individual on an official basis in connection with membership, church events or hall use, we will seek to ensure the following: - that the individual concerned knows the nature and detail of their personal data which we hold; - that they know and agree to why we hold it; - that with their help, we will endeavour in so far as possible to keep their data up-todate; - that they can ask at any time for their data to be amended or deleted altogether; - that they know and agree to the length of time for which it is intended we hold their data. Registered office: 123 Irish Street, Dumfries DG1 2PE 3. Personal data held electronically will, in so far as is possible, be held on an encrypted device, or if the electronic device used is not encrypted, the device will be password protected and stored as carefully and as safely as possible. 4. Personal data held in paper form will be stored in a locked cabinet. 5. We will not pass an individual’s personal information on to any other party without the consent of the individual concerned. Should you have any queries about this policy, please contact the church office Signed……………………………………………………………………………………………… ……………………………………………………………… on behalf of the Deacons of Dumfries Baptist Church Dumfries Baptist Church Centre, Gillbrae Road, Dumfries, DG1 4EJ Tel: 01387 268926 email@example.com www.dbcc.co.uk	<urn:uuid:61f44d36-295e-4293-8962-34c6d84f01a9>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	2,181
FORMULARZ ZGŁOSZENIOWY do udziału w pracach Komisji Konkursowej opiniującej oferty w otwartym konkursie ofert na realizację zadania publicznego w zakresie prowadzenia punktów nieodpłatnej pomocy prawnej, świadczenia nieodpłatnego poradnictwa obywatelskiego oraz edukacji prawnej na terenie powiatu czarnkowsko-trzcianeckiego w 2019 roku. Imię i nazwisko kandydata………………………………………………………………………………………… Adres do korespondencji………………………………………………………………………………………….. ……………………………………………………………………………………………………………………… Data urodzenia…………………………………………………………………………………………………….. Telefon kontaktowy……………………………………………………………………………………………….. Nazwa organizacji pozarządowej lub podmiotu………………………………………………………………… ………………………………………………………………………………………………………………………. Oświadczam, że: * wyrażam zgodę na zgłoszenie mojej osoby do Komisji Konkursowej do opiniowania złożonych ofert w otwartym konkursie ofert na realizację zadania publicznego w zakresie prowadzenia punktów nieodpłatnej pomocy prawnej, świadczenia nieodpłatnego poradnictwa obywatelskiego oraz edukacji prawnej na terenie powiatu czarnkowsko-trzcianeckiego w 2019 roku * posiadam obywatelstwo polskie i korzystam w pełni z praw publicznych, * nie reprezentuję organizacji/podmiotów biorących udział w konkursie, * wyrażam zgodę na gromadzenie i przetwarzanie moich danych osobowych dla celów związanych z realizacja procedury konkursowej dotyczącej rozpatrywania ofert organizacji pozarządowych na realizację zadania publicznego, wyłącznie dla celów konkursu, zgodnie z ustawą z dnia 29 sierpnia 1997 r. o ochronie danych osobowych (t.j. Dz. U. z 2016 r. poz. 922 oraz z 2018 r. poz. 138, 723 i 1000). ……………………………………………….. czytelny podpis kandydata na członka komisji ………………………… (data) ………………………………………………………. (podpis osoby/osób wskazującej/wskazujących upoważnionych do reprezentowania organizacji)	<urn:uuid:fd3d25f8-eded-48fb-bcf5-66d5e9a81f81>	HuggingFaceFW/finepdfs/tree/main/data/pol_Latn/train	finepdfs	pol_Latn	1,847
Näs, by, Kolbäcks socken, Smedinge härad, Västmanland. Petrus in Nasey 9-149 1331, SD 4, s. 232. avskr. L.Sparre	<urn:uuid:195aa599-4741-46a3-9a36-ed5b3c4bc7a1>	HuggingFaceFW/finepdfs/tree/main/data/swe_Latn/train	finepdfs	swe_Latn	113
INSTALLATION INSTRUCTION CAL-ROYAL FOR MR9800 SERIES MORTISE EXIT DEVICE BEFORE INSTALLING DEVICE, PLEASE CHECK: 1. IF DOOR FITTED AND HUNG. 2. SIZE OF EXIT DEVICE, FUNCTION AND DESIGN... 2.1. 36" DOORS CAN BE CUT TO FIT DOORS DOWN TO 30" WIDE. 2.2. 48" DOORS CAN BE CUT TO FIT DOORS DOWN TO 36" WIDE. 2.3. HAND OF DEVICE AGAINST APPLICATION. 3. APPLY EXTERIOR TRIMS If ESC lever trim is used, attach outside trim and cylinder. 4. APPLY RAIL ASSEMBLY 1. CHECK THE SIZE OF DEVICE, IF CUTTING TO LENGTH IS REQUIRED. 2. DETERMINE CUT OFF LENGTH "X" BY SUBTRACTING 1-3/4" (44.5mm) FROM "Y". MARK CUT OFF POINT ON MOUNTING RAIL. 3. DREPRESS ARM INTO RAIL OPENING AND SLIDE RAIL ONTO CHASSIS. LEVEL RAIL AND FASTEN CHASSIS AND MOUNTING PLATE. 5. APPLY COVER AND STRIKES ATTACH COVER TO CHASSIS WITH (4) #8 TRUSS HEAD MACHINE SCREW. ATTACH END CAP TO MOUNTING PLATE WITH (2) COVER SCREWS. ATTACH STRIKE TO DOOR STOP WITH (2), STRIKE SCREW AND LOCK WASHER. ATTACH STRIKE TO DOOR STOP WITH (2), STRIKE SCREW AND LOCK WASHER.	<urn:uuid:6bd03ce7-7514-4eac-97b9-be4bd1f732a9>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	1,028
Mixed Ligand Complexes of Diamino Pyrimidine Azo Dyes with some Transition Metals and Glycine, DL- Alanine or Gulatamic Acids Nadia Ahmed Abdalla * , Mohamed Tawfek El-Haty, Farok Abd-Elkarim Adam, Fatma Wafdy Hassan Chemistry Department, Aswan Faculty of Science, Aswan University, Egypt Abstract The overall formation constants of ternary complexes of Cu(II), Co(II), Ni(II) with Glycine (Gly) ,DL- Alanine (Ala) and Gulatamic Acids(Glu) as primary and 5-(arylazo)2,6diamino-4- pyrimidinol as secondary ligands as well as those of the binary systems have been investigated potentiometrically in 40 ٪ (v/v) EtOH-H2O at 25 o C and I=0.15 M NaClO4 . The stability of the ternary complexes is quantitatively compared with that of the corresponding binary complexes.The data were interpreted on the basis of statistical considerations and the nature of complexes. The concentration distribution of various species formed in solution was evaluated. Keywords: Mixed ligand , Diamino Pyrimidine, Azo Dyes, Amino Acids. The Cu(II), Co(II) and Ni(II) complexes have been synthesized and the coordination sites of the ligands were characterized by means of IR and 1 HNMR spectroscopy. Correspondence Nadia Ahmed Abdalla, Email: firstname.lastname@example.org Introduction It is suggested that the ternary complexes have been implicated in storage and transport of active substances through biological membranes. Also, the use of arylazo heterocyclic N donor ligands to stabilize low oxidation states like Cu(II) and Co(II) is widely studied in coordination chemistry[1-4]. These phenomena were dependent upon the chelate stability and the nature of involved metal ion [5-7].Mixed complexes of transition metals containing an pyrimidines group as ligands are commonly found in biological media and have important roles in processes as catalysis of drugs interaction with biomolecules[8-12].These types of compounds have been shown to be versatile ligands for preparation of polymolecular complexes which coordinates in a bi-, tri- and tetradentate fashion [13,14]. Further interest in these families of compounds arises from their existence in aqueous media as protonated, neutral and deprotonated species. Each of these prototropic species can act differently with metal ion yield neutral complexes with different composition stability and photo-redox properties [15-16]. We report, here, the results of pH-metric studies of Cu(II), Co(II) and Ni(II) complexes containing glycine (Gly), Dl-alanin (Ala) and glutamic acid (Glu) as primary ligands and 5-(4-N,N-diethyl-1-phenylazo)-2,6 diamino- 4pyrimidinol (L1); 5-(1-naphylazo)2,6 diamino- 4-pyrimidinol (L2); 5-(4,N,N-nitro-1-phenylazo)- 2,6 diamino- 4pyrimidinol (L3);and (4-N,N-1-phenylazo)- 2,6 diamino- 4-pyrimidinol (L4) as secondary ligands. The work aims to establish the various equilibria existing and the stability constant of binary and ternary complexes in 40 % (v/v) EtOH-H2O at 25C and I = 0.15 M NaClO4. Experimental Materials and Reagents All the chemicals used in the preparation of the azo dyes were A.R. products from BDH and Merck.The azo compounds 5-(4-N,N-diethyl-1-phenylazo)-2,6 diamino- 4-pyrimidinol (L1); 5-(1-naphylazo)2,6 diamino- 4pyrimidinol (L2); 5-(4,N,N-nitro-1-phenylazo)- 2,6 diamino- 4-pyrimidinol (L3);and (4-N,N-1-phenylazo)- 2,6 diamino- 4-pyrimidinol (L4) were synthesized by the procedure as described by Vogel [17].Ligand stock solutions were prepared by dissolving the calculated amount in in 40% (v/v) ) EtOH-H2O mixture and were standardized by pH- titration with standard HClO4 .Solutions of the metal ions Cu(II), Co(II) and Ni(II) were prepared in doubly – distilled water and metal content was determined by complexemetric EDTA titration[18]. pH measurements were carried out on a MV 87 digital pH –messgerate accurate to ±0.005 unit equipped with a glass electrode and saturated calomel electrode. The following mixtures (total volume of 50 ml) were titrated against CO2 –free 0.1 M NaOH ,HClO4 (a);a + amine (b) ;b + metal ion (c);a + azody (d); d + metal ion (e), and a + amine + azodye + metal ion (f).The ionic strength was adjusted to 0.15 mol dm -3 by addition of NaClO4 as supporting electrolyte . The pH meter reading (β) recorded in40% (v/v) ) EtOH-H2O solutions were converted to [H + ] by means of relation of Van Uitert and Hass [19]. The absorption spectra in the UV and visible were recorded on a Shimadzu UV-1650 PC , UV-Visible Recording Spectrophotometer using 1 cm matched silica cell. The IR spectra have been recorded with a perkin-Elmer 983B IR recording spectrophotometer. The 1 H NMR spectra were recorded with a varian Em-390 spectrometer at 90 MHZ in DMSO. TMS were used as internal reference. Results and Discussion Proton-Ligand Systems The proton binding and metal binding constants of the different species are detected from the potentiometric, pH titrations of the free and complexed ligands over the pH range 2.0-12.0. The obtained curves are represented graphically in Figs (1-3). 2014, 3(11), 563-578 Article CS03204507 564 Similar titration features are obtained with other systems. The prototropic behaviour of the free ligands under investigations can be ascribed from the examination of the curves (d), which show two illdefined inflections at (m) values of 1.0 and 2.0 before and after the perchloric acid titration curve (a) respectively (where m denotes the number of equivalents of OH- ions added per mole of ligand present in solution mixture). The first inflection point located in the pH range 3.1-3.96 corresponding to the protonation of NH2 or hetero nitrogen atoms of the pyrimidine ring. The second inflection appears after the acid curve (a) at pH range 4.2-11.3 is suggested to be due to the dissociation of the enolic hydroxy group of the pyrimidine moiety. This is supported by the fact that the azoaminopyrimidine can be tautomerised to produce amino-ketone and imino-enol forms [20]. The average number of protons bound to the ligand ( A n ) at various pH values are calculated using the curves (a) and (b), and then the dissociation constants (pK H) are determined from the plot of A n vs. pH, using the computer program based on the Irving-Rossotti equations [21]. The dissociation constants of glycine, Dl-alanin and glutamic acid are also redetermined under the same of our experimental conditions. It is worth mentioning that the first dissociation constant (pKH) values for the amino acids studied are very low values (2.3)[22] and exist only in strongly acidic solutions and accordingly these values are not used in calculations. As expected, the amino nitrogen of DL-alanin is a little more basic than with glycine as a result of the inductive effect of methyl group. The pK values obtained through the refinement of several sets of potentiometric data are quoted in Table (1). Table 1 Ionisation Constants of The Free Ligands and Stability Constants of binary systems at 25ºC, = 0.075 M (NaClO4), (error limit = 0.02-0.06) in log units Metal-Ligand Binary Systems Analysis of the complexed ligands (c) and(d) Figs (1-3) indicates that the addition of metal ion to the free ligand solutions shifts the buffer region of the ligand to lower pH values. Thus shows that complexation reaction proceeds by releasing protons from such ligands.It is observed that MA titration curve (c) diverges from the free ligand curve in the lower pH (3.5) than ML complex (e) which begins to form at pH 4.2. In the formed species, there is no precipitation during the titration up to pH 9.8 ruling out the possibility of hydrolysis of the complexes. The complexes are quite stable up at high pH values.The present study shows two weak inflections below the amino acid curve in case of MA species and a single step inflection during the formation of ML species after addition of two moles of NaOH solution per mole of ligand. This indicates the formation of 1:1 and 1:2 complex species through the liberation of two protons from the free ligand in stepwise manner (A) or simultaneously (L). The probable stepwise complexation equilibria involved in the formation of binary system can be represented by the below equations, (charges are omitted for the sake of clarity). Similarly, for the azo ligands (L) complexes, The overall stability constant can be represented as follows Log 2 MA values are initially determined from the titration curves as described earlier [20]. The average number of ligand molecules is attached per metal ion n and the free ligand exponent pL using the curves of the ligand in absence and in presence of metal ion. The maximum n values obtained are in the range 0.2-1.7 confirming the formation of 1:1 and 1:2 species. The formation curves of the metal complexation equilibria are obtained from the n vs. pL plots Figure (4, 5). From these plots, the values of overall stability constants log MA and log 2 MA are determined using half integral method. The obtained values agree well with those obtained from the linear plots of log n /1- n vs. pL, where log MA = log [L] = pL at log n /1- n = 0. The stability constant of log values for the formed complexes is in accordance with Irving [21] listed in Table (2 ), which indicates that the formation of 1:1 and 1:2 complex species .The present results show the stability of binary chelates increase in the order : This is in agreement with the general order of stability of Transition metal[21] and can be explained similarly . In terms of the nature of ligand ,the stability order of binary system (ML) decrease in the order: According to that agreements, the more basic ligand can form, the more stable complex is found [23,24]. With respect to the amino acid complexes (MA), the order of stabilities has been found to be Gly > Ala > Glu. This behaviour is in line with the previous reported order [25,26], which does not follow the basicity order of studied amino acids probably due to the similarity in the dissociation constant values of these acids. Therefore, the revisal in the relative order of the stabilities of Gly and Ala complexes can be explained based on the size of substituent, considering that the studied amino acids are derivatives of glycine [27].Thus, the observed higher stabilities Gly complexes compared to those of Ala complexes may be due to the stric hindrance results from substituent of bulky methyl group on carbon atom bearing NH2 group. It is suggested that lengthening of alkyl chain in Glu is responsible to lower stability of its complex. Moreover, a comparison of stabilities in terms of the nature of ligand reveals that MA complexes are more stable than the corresponding ML chelates. This behaviour may be explained on the basis that in binary MA complexes, the amino acid acts as monobasic bidentate ligands through the NH2 nitrogen and COOH oxygen atoms, forming stable five-membered ring. In binary ML complexes, the azopyrimidine ligands coordinate in a mono deprotonated bidentate fashion, through the N=N group of nitrogen and either exocyclic N (6) and O (4) atoms of the pyrimidine moiety forming six membered chelate ring. Therefore, in the transition of metal complexes , the higher stability of MA than ML complexes can be explained based on the fact that the fivemembered chelates are more stable than those of six-membered one[28]. Metal-Ligand Ternary Systems Mixed ligand titration curve of Cu(II)-A-L obtained according the sequence described in experimental section and the Similar titration curves were obtained for Co(II) and Ni(II) is given in Fig (1-3). The shape of the titration curves suggested that the amino acids (A) act as primary ligands during the formation of MAL systems as binary MA (curve, c) is found at lower pH values than those of ML system (curve, e). Examination of the obtained titration curves shows that the curve of ternary systems (curve, f) are located above individual curves of binary MA and ML systems, at low pH values and then superimposed with ML curves and consequently moved below ML curve at pH range 5.2-7.5 which confirms the formation of ternary complex species in solution. Further evidence for the formation of mixed ligand MAL chelates is provide by the presence of an inflection point at m = 2, followed by a buffer region in the range of experimental pH values between m = 2 and m = 3 (m = number of alkali moles added per mole of metal ion). At pH 7.5, the solution mixture of ternary complexes is quite stable and remains clear. This may be due to the redistribution of the electron density of metal-ligand bond in MAL chelates in such a way that these chelates are more polarity than binary chelates and hence, are not hydrolyzed up to pH 7.5, precipitation is observed in some systems due to the hydrolysis of metal ion according to the following reaction: The interfering effects of hydroxo species are negligible in the range of experimental pH values. Thus, the secondary ligand must be combined with binary chelates solution in similar manner of its interaction with equated metal ion [M(H2O)6] 2+ solutions. Further, the observed overlapping of MAL curve (f) at low pH values then runs below MA curves to reveal that the secondary ligand (L) does not participate in ternary complex formation below pH 5.2. This indicates that the formation of MAL species starts after the formation of MA species. The overall stability constants are calculated, considering that the ternary chelates may be formed simultaneous or in step wise manner according to the following complexation equilibria, Since, log [M] + log [A] = log [MA] - log M MA K (Equation 2) Similarly, The overall stability constant of ternary chelates is determined from the following relations; The horizontal distance between the MA curves (c) and MAL ones (f) are used for calculation of the average number of secondary ligand moles associated with one mole of binary complex, mix n and free secondary ligand exponent, pLmix using method described earlier [29].Then, the initial formation constants of ternary systems are evaluated from the mix n vs. pLmix curves as represented in Figure (6). Table 2 Stability Constants of M 2+ -Amino acid-Azo Dye Ternary Systems at 25ºC 2014, 3(11), 563-578 Article CS03204507 570 M The obtained high values of log MAL confirm the assumption that the amino acids used act as primary ligands and the formation of ternary complexes is favored by equilibrium (equation 12). In the present study, the behaviour of amino acids is similar to those observed previously [30]. However, in contradiction to those reported by other authors [31],the results show that the stability of ternary chelates follows the same order of the ionic potential of metal as shown in binary systems. It is clear that the stability of ternary systems is always greater than the corresponding binary systems. This data can be interpreted by assuming the -donor tendency of amino acid and -interaction. Hence, due to the accepting character of the pyrimidine moiety, the back donation of -electrons of d-orbital of metal to antibonding orbital of pyrimidine ring will result in an increase in the positive charge and the electrophilic character of the metal in ternary systems. This leads to a slight increase in ML -bonding of the azo ligand compared to ML -bond of binary systems [32]. The relative stability constants of ternary complexes are conveniently characterized by comparing the difference instabilities of binary and ternary systems, log K [33,34].These values are calculated from the reaction of secondary ligand (L) either with MA (equation10) or with the free metal ion (equation 5) and hence, log K = log K MA MAL - log K M ML . The overall equilibrium can be represented from the following equation, It is found that, in case of binary chelates the log K = (log K ML 2 - log K M ML ) values are generally negative as expected, since K M ML > K ML 2 . This indicates the formation of less stable 1:2 species, which may be due to the coulombic repulsion between the two similar ligands bound to the same metal ion. The log KM for the ternary complexes should also be negative, generally in -0.5 to 2.0 range depending on the geometry of the complexes [35].The negative log KM values will result from the presence of a fewer number of binding sites on MA complex than on aquatic metal ion. Thus, it is expected that the secondary ligand bind the MA with small stability. However, the obtained log KM for all ternary systems is less negative values shown in Table 2 which are in contrary to the statistical expectation [32].This behaviour shows higher stability for ternary chelates (equation 14) compared to binary ones. Based on the suggestion that the log KM values depend on the coordination number of the metal ion and the nature of the ligand[36], the change in log KM values obtained may be attributed to the change in the geometry of the formed chelates. The less negative values of log KM may also be due to the absence of coulombic repulsion between the two dissimilar ligands in the ternary complexes. The data show that log KM values of M-Gly-L3 are more positive than the values obtained for M-Ala-L2. The marked stability of M-Gly-L3may be due to the interligand stacking interaction possibly H-bond formation between the two types of ligands[37] , whereas the Dl-alanin can not take part in interligand staking [38].However, the difference between log KM values are small indicating that ternary complexes may exist in staked-open intramolecular equilibrium in solution as postulated by Sigel and coworkers [39]. Another parameter generally used to indicate the quantitative stability of ternary complexes compared to the binary one, is based on the disproportionate constants, X, which calculated from the reaction [39,40]. The values of log X expected on statistical grounds is +0.6 [40] for all geometry. More positive values than those were expected to indicate marked stability of ternary complexes formed through equation (15). On the other hand, meanwhile the log X values can indicate the tendency of secondary ligand (L) to coordinate with MA complex, it fail to discuss the effect of ternary complex formation in weakening or strengthen M-A bond. Thus, other stabilization constant (log X`) is considered based on the following equation, The observed slight variation in values of each parameter suggested similar mode of binding of the ligands in their complexes. The values of log X are found to be in the range of the statistical value or more, show that the binary MA2 complex is less stable than the corresponding tendency complexes. The data, also, shows that the log X` values are higher than the order expected on statistical ground (0.2), indicating that the MA and ML bonds in ternary complexes are stronger than those in the binary complexes. This may be explained based on the back donation of metal ion -electrons to the -electrons cloud of the secondary azo ligand (L), resulting in strengthening the M L bond and weakening the M A one. Further, it is found that the stabilization of MA bond in ternary system increased as the size of amino acids and metal ion decreased. This indicates that the magnitude of log X` is marked influenced by steric difference in both ligands and metal ions used. The overall stabilities can be calculated on the basis of statistical ground [41-43] from the following equation, The results reported in Table (2) show that the difference between stabilities measured experimentally, log MAL and calculated by statistical method log stat are small positive values, confirming that MAL complexes are more stable than both MA2 and ML2 complexes. The high stability of ternary chelates is related to the redistribution of charges over the complexes, which are originated from transfer electrons from ligand orbital (L - ) to the positive MA + species leading to the formation of neutral MAL. Thus, the M L -covalent bond is increased. Distribution Diagrams The distribution profiles of the various azopyrimidine (L) species and free amino acids (A), formed through the change of the pH values of their solutions, are obtained from the plots of pH values of the ligand solution as function of the calculated concentration percentage ( %) of each ligand species using the Pk a values of these ligands. Typical species-distribution graphs are represented in Figure (7, 8). As shown from these curves, almost of the free ligand species are present as dissociated species H2L + ( L H 2 99.8 %) at pH 2.5. On increasing the pH of the medium, H2L + species tends to decrease in its concentration, while that [HL] begins to develop. In the pH range 6.0-7.2, the [HL] species reaches maximum concentration of HL 90 %, while that of [L - ] tends to appear. At pH 5.2 (L1, L3) and pH = 5.8, equal concentration of H2L + and HL species are observed ( L H 2 = HL = 49.3 %). Increasing the pH above 6.0 the HL decrease and [L - ] species begin to appear. At pH 8.8, the HL and L- species are present in equilibrium. The [L - ] species reaches a maximum concentration ( L 97.5 %) in the pH range 8.8-12.0. At this range the [HL] species almost disappear ( HL 3.2 %). For binary systems graphs shown in Fig. (9), the obtained curves are generally showing that, in presence of low concentration of the ligand, [L], all the metal ions will be present as free ions (M 98.7 %). On increasing [L], the metal ion concentration [M] will begin to decrease while that of [ML] species tends to increase. When the [L] = 1/KML value, the M and ML will become equal. On increasing [L] above 1/KML value, the [ML] will exceed that of [M] because the reaction will shift toward [ML] formation. However the values of KML and K 2 ML are so little different that there will be a small value of [ML2] presence even in solution of [L] equal 1/KML value. On further increasing [L] above 1/KML value, the [ML2] species as well as [ML] species, increase. The [ML] and [ML2] species have the same % value at [L] = 1/K 2 ML . Increasing [L] than 1/K 2 ML value, the solution contains more [ML 2 ] than [ML] species. At high concentration of the ligand, the metal ions is completely disappeared ( 0.01%) and [ML] has low value ( ML 7.8 %), while the [ML 2 ] species 0.02 predominate ( 2 ML 92.2 %) . Species-distribution diagrams of (a) Cu-Gly-L 1 and (b) Cu-Ala-L 4 ternary systems are shown in Figs (9) as representative. Similar feature is observed for other ternary systems. The profiles showed that the total concentration of Cu(II) ions in the form of ternary complex species exist in higher concentration than that Ni(II) and Co(II) ions in there corresponding ternary systems, but Cu(II) never exceed 50 % as expected from statistical consideration [34].It is worth mentioning that the obtained graphs are not independent from the initial concentrations of the ligands, since increasing the concentration of one ligand with respect to another may enhance the formation of some species which are not present under different concentration conditions. The best computer models showed the presence of two ternary species of type MAL and MAL2, in addition to the various binary species which may result from the reaction, 2MAL MA2+ML2. Generally, the represented plots indicate that in the presence of lower concentration of [L]than the reciprocal of the formation constants of MA (1/KMAL), nearly all Cu(II) ions present as MA complexes (MA 83.5 %, MA 88.3 % for Cu-Gly-L1 and Cu-Ala-L4 respectively). On increasing, the [L], the [MA] decreases while the [MAL] species increase, and these two concentrations have the same value at [L] 1/KMAL. On a further increase in [L], the [MAL] will exceed that of [MA], in addition to presence of small concentration of ML2 chelate ((a) 5.2 %, (b) 6.5 %). At high concentration of [L], the [MAL] reaches maximum ((a) 74.0 %, (b) 59.5 %) and 2 ML = 7.1 %, while [MA] almost disappeared (MA 1%). In these concentrations, [MAL2] begin to increase ( 2 ML 18.6 %). At [L] more than 1/ MAL value, the [MAL2] tends to increase at the expense of [MAL] species. When the pL (-log [L]) value equal 9.5, the [MAL] nearly vanishes ((a) 2.6 %, (b) 2.3 %), while in case of MAL2 precipitation starts to appear which may be due to steric hindrance offered by the tendency of azopyrimidine ligand to form polymer as well as its ability to form different types of chelate rings [41].Thus, the coordination of the second ligand [L] to MAL ternary complexes may lead to an increase in the size of the chelate ring and change in the geometry of MAL2 complexes compared to MAL ones. Structure of Complexes The electronic spectra of the solid complexes in DMF solution Fig (10) show broad band in the 29000-24000 Cm -1 region. The spectra of all complexes are characterized by one or more broad band in the 29000-24000 cm -1 region corresponding to an intermolecular CT transition from the antibonding level of the ligand to the vacant orbital of metal ion (LM CT). The broad shape of this band influenced by the nature of both metal ion and, substituent is in line with its assignment. Moreover, the electronic structure of the d-metal complexes can be explained on the basis of the electronic configuration of Co (3d 7 ), Ni (3d 8 ), and Cu (3d 9 ) electrons in the d-orbitals [44]. The Ni(II) has two unpaired electrons (even number) in the 3d 8 level, while Co(II) and Cu(II) have one (odd number) unpaired electrons. The pairing effect of the unpaired electrons can occur for Co(II) and Ni(II), while Cu(II) electrons can't pair where no empty inner (d) orbital will be available to form 3d, 4s 2 , sp 2 hypride for square planar structure, and, thus, Cu(II) is expected to be either tetrahedral structure with 4s, 4p 3 hyperdization, or distorted square pyramidal (4s, 4p 3 , 4d 2 ) structure. On the other hand, Co(II) and Ni(II) may be formed square planar (d, s, p 2 ) structure due to the d x 2 -y 2 orbital will be empty. The weak shoulder observed at lower energy side is ascribed to d-d transition within the high-spin octahedral geometry. This leads to splitting the ground state 4 T1g(F) of Co(II) under the influence of the octahedral field to three fold-degeneracy which may be assigned as 1 ( 4 T1g (F) 4 T2g (F)),2 ( 4 T1g (F) 4 A1g (F)) and 3 ( 4 T1g (F) 4 T1g (P)) [45]. The Ni(II) complexes are expected to be diamagnetic, and, thus, may exhibit square-planar geometry. Diamagnetism is resulted from the pairing of the d 8 electrons in four lower lying d-orbitals. These lower orbitals are so close together in energy that individual transition from each orbital to upper (d) level can be distinguished, and, hence, they may appear as a single band. Thus, the observed shoulders may be due to spin-orbital coupling which mixes the very close 3 T1g (F) and 1 Eg starts, expected for square planar or distorted octahedral geometry according to 3A1g (F)3T1g (F). IR Spectra The vibration spectra of the prepared free ligands exhibit a very broad band at around 3450 cm -1 due to the OH and two week bands in the region 3290-3035 cm -1 assigned to the 2 NH stretching vibration of C(2) , C(4)-NH2 of the pyrimidine ring. The broad shape of these bands can be attributed to the possible formation of intramolecular H-bond between the pyrimidine OH or NH2 groups and the azo group [46]. On complexation with Cu(II), Ni(II) and Co(II) ions , the above mentioned bands are affected to different degrees. The OH band shows change in the shape and position which appeared as a medium or strong feature. One of the vibration modes of NH2 is absent, while the other one is blue shifted in Cu(II) complexed or still remained in the same position in case of Ni(II) and Co(II) complexes. These data indicate that both nitrogen (amino) and oxygen (OH) atoms are active sites for complexation. Previous studies on similar compounds have revealed that the coordination through the exocyclic oxygen is preferable than the NH2 group[47,48].On the other hand, the strong and broad bands observed in complexes around 3300 cm -1 weak with shoulder at 3750 which have significantly different characteristics from the H-bonded N-OH vibrations. These bands are attributed to the presence of water molecules in the complexes prepared. Since, it was known that the free water is absorbed at 3520 cm -1 [49].The weak and medium bands at 3150 and 2840 cm -1 region can be assigned to the NH stretching modes. The presence of these band suggests that the pyrimidine hetero-N atom at N(1) and N(3) may be protonated or due to the H-bonded NH of amino groups. This is based on the possible migration of proton from OH and NH2 groups to the adjacent hetero nitrogen atom. This behaviour suggests that the studied compound can exist in keto-enol tautomeric equilibrium [50].The two weak and broad bands located at around 1610 and 1550 cm -1 can be attributed to the heterocyclic ring C=N stretching vibrations. The band at around 1270 cm -1 is assigned to C-N (of NH2) in agreement with earlier publications [51,52].On complexation the C=N and C-N stretching vibrations show lower shift which supports the involvement of NH2 in chelate ring. The observed blue shift in these band may be due to the decrease of the bond order of carbon to the nitrogen link following the coordination of the imine nitrogen atom to metal ions.The studied free ligands show two strong IR bands in the region 1500-1455 cm -1 and around 1385 cm -1 are due to the N=N mode [51].In Cu(II) and Ni(II) complexes, these two bands are absent or shifted from their positions to lower wave numbers by 50 cm -1 relative to the uncoordinated ligands and appeared as weak band in Co(II) complexes, so the nitrogen atom of N=Ngroup is involved in structural configuration. The spectra of the reagents with transition elements under study can act in a N, N or N, O bidentate manner through the N-(or OH) atom of NH2 or OH and N-atom of N=N group in the region 1500-1455 cm -1 and around 1385 cm -1 . In Co(II) (M:L) complexes and in 2M:L these ligands can act as tridentate through the two nitrogen of NH2 1622 cm -1 and the hetero nitrogen of the pyrimidine ring. 1H- NMR Spectra The 1 H NMR spectra of the free ligands signals are appearing at 10.03-11.08 ppm which is attributed to the NH proton associated to the pyrimidine ring N(1), N(3) and hydrazone NH proton [53-55]. The signal at 8.48-9.01 ppm range is in position observed for the hydrogen bonded OH proton of pyrimidine C(6) ring. The presence of the above two signals suggested that the ligands under study do not exclusively exist in hydroxy azo structure, but they contain some amount of azoquinone hydrazone tautomers. The two forms are resulted from the mobility of OH or NH 2 protons which lead to form extensively hydrogen bonded. These ligands can form an intramolecular H-bond between the C(4) NH2 hydrogen or the pyrimidine C(6) OH hydrogen and N=N group, as well as, an intermolecular H-bond involves NH2 or OH hydrogen and the adjacent herterocylic N(1) or N(3) atom. It is found that the migration of the labile proton to the nitrogen atom depends on the relative basicities of the OH, NH2, N=N groups and N(1), N(3) nitrogen. The NH2 protons of the free ligands appear as split signals between 4.42 [C(2)-NH2] and 5.89 [C(6)-NH2] ppm. The non equivalence of the hydrogen atoms of the NH2 groups could be attributed to the NH---N hydrogen banding formation. Owing to this bond, the resonances of the two NH2 groups of the pyrimidine ring occur in different chemical shifts. Moreover, the higher field NH2 group is assigned to the C(6) NH2 protons because its nearby the azo group has a deshielding effect. This indicates that the ligands under study contain some amount of azoquinone hydro tautomers. These signals are absent in complexes indicated its involvement in coordination.The proton of arylazo system appears as broad multi signal at 6.50 to 7.77 ppm . The multiplet nature of this signals can be attributed to the shielding effect of N=N group which shields the para-hydrogen more strongly than the orthohydrogen as a result of a measomeric effect, while the meta-hydrogen is the least shielded. Therefore, the aromatic ring signals appear as multiplet which the para proton resonates upfield relative to that of meta ones. The combination of the IR and 1 HNMR results reveals that ligands can exist in the keto-enol form. Conclusion The overall formation constants of 1:1:1 ternary complexes of Cu(II), Co(II), Ni(II) with Glycine (Gly) ,DL- Alanine (Ala) and Gulatamic Acids(Glu) as primary and 5-(arylazo)2,6- diamino-4- pyrimidinol as secondary ligands as well as those of the binary systems have been investigated potentiometrically in 40 ٪ (v/v) EtOH-H2O at 25 o C and I=0.15 M NaClO4 . The Cu(II), Co(II) and Ni(II) complexes have been synthesized and the coordination sites of the ligands were characterized by IR and 1 HNMR. The stability order of binary system decreases in the order Gly > Ala > Glu. The concentration distribution of various species formed in solution was evaluated spectroscopy. References [1] Zrenner R, Stitt M ,Sonnewald M, Boldt R, Annu Rev Pant Boil ,2006, 57, p805-36. [2] Ray U S, Banerjeed D and C Sinha C , Proc. Indian Acad Sci (Chem. Sci.), 2003,115, 3, p169–174. [3] Mallick T K , Das P K, Sinha S, Ghosh B K , Polyhedron ,1994, 13(12), p817-1823. [4] Santra B K and Lahiri G K ,J Chem Soc , Dalton Trans,1997,29, p1883-1888 . [5] Dusan Z M, Gordana S U, Nataša V V, Aleksandar D M, Hem Ind ,2011,65 (5),p 517–532 . [6] Masoud M S,A .K Ghonaim A K , Ahmed R H , Mahmoud A A, Ali A E , Z Phys Chem, 2001, 215(4), p531542. [7] Williams D R, The Metal of Life , Van-nostrand-Reinhold, London John. Wiley and Sons, 1971, p188-189. [8] Ward B and Dabrowiak J C, J Am Chem Soc , 1987, 109,p 3810-3811. [9] Bhasin C P , Goswami K V and Gongiwala M J , J Ind Council Chem,2009,26, 1, p12-22. [10] Frausto Dasilva J J, Williams R J, Nature, 1976,263, p 237-239. [11] Sigel H, Martin A E,Chem Rev, 1982,82,p 385-426. [12] Kirschner S, Wei Y K, Francis D, Bergam J G, J Med Chem, 1982,9, p 396-411. [13] Stana A, Tiperciuc B, Duma M, Pirnau A, Verite P and Oniga O, J Serb Chem Soc,2014, 79 (2),p 115–123. [14] Santra P K, Das D , Misra T K, Roy R, Sinha C ,Peng, S M , Polyhedron, 1999,18(14),p 1909-1915. [15] Das D, Misra T K, Sinha C, Trans Met Chem., 1998, 23,p 73-75. [16] Misra T K , Das D and Sinha C, Polyhedron, 1997, 16, p 4163-4170. [17] Vogel A I, 3 rd (Ed.),AText Book of Practical Organic Chemistry , Longmans,London, 1961,p 376-396. [18] Amrallah A H, Abdalla N A ,EL-Haty E Y ,J Chin Chem Soc Taip, 2006,53(3),p697-706. [19] Van Uitert L G , Hass C G,J Am Chem Soc , 1953,75, p 451-455. [20] Ruiz J, Calacio E, López-González J D , Sundberg M, Kivekäs R, J Chem Soc , (Dalton Trans ) 1990, 9, p 2747 -2752. [21] Irving H M, Rossotti H S, J Chem Soc,1954, 3397,p 2904-2910 . [22] Hodgman C D ,Weast R C ,Shankland S R ,Hand Book of Chemistry and Physics , Chemical Rubber publishers, 1963,p 3557. [23] Perrin D D, 1 st (Ed.), Stability Constants of Metal Ions Complexes, Part B, Pergamon , press, Oxford , 1979, 22,p13. [24] Perrin D D, 1 st (Ed.), Dissociation constants of organic bases in aqueous solution, London Butterworths Publisher, 1972, p12. 2014, 3(11), 563-578 Article CS03204507 577 [25] Saxena A K , J Chem Soc Pak , 19738,4,2, p77-80. [26] Koeber K, Köttelwesch H, Schneider D, Demmer H, Schleitzer-Rust E, 8 th (Ed.), Gmelin Handbook of Inorganic and Organometallic Chemistry , Springer Berlin Heidelberg 1987,5, p 231-277. [27] Rao P Y, Sawamy S J , Lingaiah P, Ind J Chem., 1985,24 A, p887-889 . [28] Ramanujam V V, Selvarajam V M, Ind J Chem, 1981, 20,p 633-635 . [29] Chidambaram M V, Bhattacharge P K, J Inorg Chem, 1970, 32, p3271-3278. [30] Santra PK , Roy R; Sinha C , P I A S-Ch, 2000,112(5), p 523-534. [31] Fazary E,Hernowo E,Ismadji S,Ju Y,J Solution Chem ,2012, 41,p1156–1164. [32] Joshi J D , Panchal B R , Bhottacharya P K , J Inorg Nucl Chem , 1973, 35, p1685-1688 . [33] Yoshiaiz D, Moya H, Bonqacio R and Coichev N, Spectroscopy Letters,1998, 31(7),p 1495-1512. [34] Sigel H, (Ed.), Coordination Chemistry, Pergamon Press, Oxford publishers,1980, 20, 30,p 27–45. [35] Fischer B E , Sigel H, J Inorg Chem , 1979, 18(2), p 425-435. [36] Klas J, Anal Chim Acta, 1975,74, 1,p220-222 . [37] Amrallah A H, Abdalla N A ,EL-Haty E Y ,Monatsh Chem ,1997,128,p1073-1084 . [38] Scheraga H A, Acc Chem Res, 1979, 12,p 7 -14 . [39] Sigel H, Fischer B E, Farkas E , J Inorg Chem , 1983,22,p 925-943 . [40] Dewitt R, Watters J I, J Am Chem Soc, 1954, 76, p 3810-3814. [41] Arena G, Bonomo R , Musumeci S, Purrello R, Rizzarelli E and Sammartano S, J Chem Soc , Dalton Trans., 1983, p1279-1283. [42] Arena G,, Cali R, Rizzarelli E, Sammartano S, Barbucci R and Campbell M ,J Chem Soc , Dalton Trans., 1978,p1090-1094. [43] Sigel H, (Ed.) , Metal Ions Biological Systems, Marcel Dekker ,New York, 1991,24, p123-163 . [44] Cotton F A and Wilkinson G, 5 th (Ed.), Advanced Inorganic Chemistry, John-Willey. Sons, New York, 1988, p811-818. [45] Hathaway B J, Chem Soc (A) ,1972, p1196-1199. [46] Masoud M S , Khalil E A , Youssef A R , Synth React Inorg Met Org Chem , 1990 ,20(6),p 793-807 . [47] Arriortua M I, Pizarro J L , Ruiz J , Moreno J M and Colacio E , Inorg Chim Acta, 1995 , 231(1-2) ,p103107. [48] Colacio E, Domingues-Vera J M , Escuer A , Kivekas R , Romersa A M, Inorg Chem , 1994, 33, p 39143924. [49] Theriot L G, Carliste G O and Hu H J, J Inorg Nucl Chem , 1969,p 2841-2844 . [50] Abdalla N A, EL-Haty M T, Adam F A and Hasan F W , Eur J Chem ,2014,5(1), p41-52. [51] Masoud M S, Elhamid O H, Zaki Z M, Trans Met Chem, 1994, 19,p 21-24 . [52] Masoud M S, Salem T M and Issa. R M, Egypt J Chem,1974, 17,p 415-423. [53] Beaton H G, Willey G R and Drew M G , J Chem Soc Perkin Trans , 1987,2, p469-472. [54] Drew M G, J Chem Soc, Perkin Trans. II, 1982, p1297-1304. [55] Kaberia F, Vickery B, Willey G R and Drew M G , J Chem Soc , Perkin Trans. II, 1980, p1622-1626. © 2014, by the Authors. The articles published from this journal are distributed to the public under "Creative Commons Attribution License " (http://creativecommons.org/licenses/by/3.0/). Therefore, upon proper citation of the original work, all the articles can be used without any restriction or can be distributed in any medium in any form. Publication History Received 03 rd July 2014 Revised 20 th July 2014 Accepted 14 th Aug 2014 Online 30 th Aug 2014	<urn:uuid:ed7607fc-4c89-41ff-bd8a-7cbc237e300f>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	38,962
DICHIAРАZIONE DI CONFORMITÀ DECLARATION OF CONFORMITY La Ditta / The Company: BONFIGLIOLI RIDUTTORI S.p.A. dichiara sotto la propria responsabilità che i motori elettrici asincroni monofase/ declares under its own responsibility that the single-phase asynchronous electrical motors serie / series: BS, MS soddisfano i requisiti delle Direttive: are in conformity with the requirements of the Directives: Directive 2006/95/EC Directive 2004/108/EC La conformità ai requisiti delle Direttive è comprovato dal rispetto delle seguenti serie di Norme: The conformity with the of Directives requirements is proved by compliance with the following Standard series: EN 60034 I motori sono destinati ad essere montati nelle macchine. La messa in servizio è vietata finché non sia stato verificato che l'installazione finale non soddisfa i requisiti della Direttiva Macchine 2006/42/CE. The motors are intended for installation in machines. Commissioning is prohibited until such time as the end product complies with the provisions of the Machine Directive 2006/42/EC. Dovranno essere osservate le istruzioni di sicurezza riportate nella documentazione di prodotto e le prescrizioni della Norma EN 60204-1: 2006. The safety instructions of the product documentation and EN 60204-1:2006 requirements must be met. 1ª edizione / 1st edition: 14.07.2004 Lippo di Calderara di Reno, 16.05.2012 Firma/Signature Paolo Cominetti R&D Manager	<urn:uuid:51dddf31-3964-4e9d-8cca-d1210f5c29fb>	HuggingFaceFW/finepdfs/tree/main/data/ita_Latn/train	finepdfs	ita_Latn	1,436
Big data UOIT-led Artemis Project wins Ingenious Award TORONTO – University of Ontario Institute of Technology (UOIT)-led research aimed at reducing mortality rates in premature babies has been named a 2013 Ingenious Award winner by the Information Technology Association of Canada (ITAC). The award was presented to the Artemis Project (Using Big Data for Advanced Clinical Decision Support) research team headed by Dr. Carolyn McGregor (pictured), UOIT's Canada Research Chair in Health Informatics, during a ceremony at the Allstream Centre at Exhibition Place in Toronto. Artemis is a first-of-its-kind neonatal health informatics research project involving UOIT in Oshawa, Ontario; The Hospital for Sick Children (SickKids) in Toronto; IBM; and other research partners around the globe. Artemis applies a 'big data' approach to collecting, distributing and processing real-time physiological data at high speed and combines that with other clinical information to provide important clinical context. Dr. McGregor's diverse research team of neonatologists, emergency physicians, nursing staff, computer scientists and engineers has created a cloud-based platform capable of processing more than 1,200 physiological readings a second, per patient, across multiple patients in multiple locations. Artemis was one of 64 nominees chosen by ITAC nationwide across five categories. It won the Ingenious Award in the Not-for-Profit Sector. "Artemis research is helping make sense of the constant stream of data collected from critically ill premature babies so doctors in the future will be able to better recognize subtle changes in a patient's condition," said Dr. McGregor. "The national recognition offered through the Ingenious Award is a testament of the hard work and dedication of our entire research team as we work to create innovative solutions for healthcare." "The 64 entries the Ingenious judges reviewed included some exceptional examples of how excellence and innovation in ICT can make significant changes in the way people work, access services, and communicate," said ITAC President and CEO Karna Gupta. "The winners of the Ingenious Awards represent the best of what our sector is doing to improve business and life in Canada, and help build a leading digital economy." Premature birth is the leading cause of newborn death. Of the 15 million premature babies born around the world every year, almost 1.1 million will die (*) from relatively common ailments such as infection. Many of the infants who survive will end up permanently disabled. Although neonatal intensive care units have state-of-the art-equipment to monitor a baby's vital signs, the interpretation of all the data in a timely and meaningful fashion remains an ongoing challenge. "As Artemis moves towards the clinical phase, Dr. McGregor's research will have farreaching implications for neonatal intensive care units around the world," said Dr. Michael Owen, UOIT Vice-President, Research, Innovation and International. "Her innovative research is exploring vital new ground in health care by combining big data with information and communications technology. We are very proud of her ongoing success with Artemis and her compelling work, which is drawing substantial international attention." Dr. McGregor believes Artemis holds the potential to be "the most positively disruptive influence on healthcare" since genome research was initiated a quarter century ago. "The standard procedure today for monitoring premature babies is for a nurse to go around every hour, record a baby's temperature and heartbeat, chart the data and then analyze it for any changes," said Dr. McGregor. "With the development of Artemis, neonatal intensive care staff will have a new-found ability to remotely monitor complex physiological signals in real-time and to respond earlier to more subtle changes in a baby's vital signs." To date, Artemis has been used as part of new clinical research involving more than 1,000 premature patients at two North American hospitals and another in China. With its ongoing monitoring and measuring of multiple physiological streams, the system has demonstrated new earlier onset detection approaches to the common and highly dangerous infection known as Late Onset Neonatal Sepsis (LONS). It has also demonstrated the ability to detect and eliminate false positives in the onset of LONS typically caused by narcotics or surgery. Two Artemis neonatologists have also presented new work on the analysis of the impact of blood transfusions in premature infants, based on the analysis of physiological data at the American Medical Informatics Association conference. Further details are to be published in a medical journal article in the coming months. ITAC's Ingenious Awards program celebrates enterprises that demonstrate measurable evidence of productivity improvement, efficiency gains, revenue growth, overall business transformation or other organizational outcomes through the use of technology. Nominations come from across Canada and represent a broad cross-section of organizations in the private, public and not-for-profit sectors.	<urn:uuid:5c12bac3-e772-40fa-ab24-4113d08021b5>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	5,158
Utvorenie volebných okrskov a určenie volebných miestností v obci Branovo počas konania volieb do Európskeho parlamentu konaných dňa 25.05.2019 V súlade s § 8 ods. 1 zákona č. 180/2014 Z. z. o podmienkach výkonu volebného práva a o zmene a doplnení niektorých zákonov Obec Branovo oznamuje, že pre voľby do Európskeho parlamentu, ktoré sa konajú 25. mája 2019 v čase od 7.00 hodiny do 22.00 hodiny, sú vytvorené nasledovné volebné okrsky: Volebný okrsok č. 1: Volebná miestnosť na Obecnom úrade v sále Kultúrneho domu, Branovo č. 46	<urn:uuid:8be49657-f6cb-4972-ae05-525ccd953046>	HuggingFaceFW/finepdfs/tree/main/data/slk_Latn/train	finepdfs	slk_Latn	537
NOUVELLE BIOGRAPHIE NATIONALE 13 ROULEAU, Edgar, Marie, Raymond, homme de théâtre et de cinéma, né à Bruxelles le 4 juin 1904, décédé à Paris (France) le 11 décembre 1981. Adolescent, il s'essaie à la poésie, tâte des arts visuels et organise des spectacles entre amis. Grâce au soutien d'un « homme de bien », Charles Fonck, Raymond, qui déteste l'école, entre avec dérogation au Conservatoire royal de Bruxelles dès l'âge de quinze ans. Il y côtoie Fernand Piette et Tania Balachova, qu'il épousera, interprétant à leurs côtés Les Précieuses ridicules et Les Plaideurs (Théâtre du Peuple, 1922). En juillet 1923, il quitte l'ins titution muni d'un « diplôme de capacité avec la plus grande distinction », mais doté surtout d'expérience du fait des petits boulots exercés : pianiste de cinéma muet, souffleur, publiciste, figurant, projectionniste, régisseur... Engagé en 1923 au Théâtre du Marais (1921-1926) que dirige Jules Delacre, il y interprète vingt rôles et y signe en décembre 1925 sa première mise en scène : Un bout de fil coupé en deux de Steve Passeur. Sa mère, Camille-Henriette Decaster, née à Liège en 1877, fut cantatrice. Inscrit dans les registres nationaux sous le nom de sa mère, l'enfant est légitimé en 1913 suite au mariage de celle-ci avec Livin-Antoine Rouleau, à Saint-Josse-ten-Noode, où mère et fils habitent depuis 1906. Avec l'accord de Delacre et l'appui de Ta nia, il cofonde avec le poète Norge, en avril 1925, le Groupe libre, théâtre d'inspiration sur réaliste où il monte notamment R.U.R. de Karel Czapek, Foi d'Herwarth Walden et Rien qu'un homme de Max Deauville. Si René Magritte signe les décors de Foi ainsi que les décors, accessoires et costumes de Rien qu'un homme, des divergences esthétiques les séparent. Avec, pour conséquences, du grabuge émaillant Tam-Tam, « poème scénique à cinq voix » de Géo Norge ainsi que, fin 1926, une « bagarre surréaliste » qui oppose, lors de la lecture des Mariés de la tour Eiffel de Jean Cocteau, sym pathisants du Groupe et surréalistes bruxellois (Paul Nougé, Mesens, Magritte…). Steve Passeur et Marcel Achard, auteurs et amis, l'introduisent à l'Atelier Charles Dullin où il reprend le rôle du jeune premier dans La Comédie du bonheur d'Evreïnoff. De septembre 1927 à juin 1930, il y interprète quelque douze rôles. Toujours à Paris, outre Rosencrantz dans Hamlet par Georges Pitoëff, il joue sous la direction d'Antonin Artaud dans Les Mystères de l'amour de Roger Vitrac et Le Songe d'August Strindberg. D'Artaud, il dira qu'il « n'a jamais été aussi bien mis en scène » (Flamand, p. 168). Désargenté, il partage dans la Ville Lumière un minuscule garni avec Henri Guisol. Mais un ambitieux triplé lui lais sera un goût amer : aux côtés de Balachova, il joue Jean dans L'Admirable Visite d'Olaf Boot, pseudonyme derrière lequel se cache aussi le metteur en scène… Donnée à Bruxelles (sep tembre 1928), la pièce est publiée et reçoit le prix Marcel Loumaye, mais la reprise qu'en donne Dullin à Paris tourne au désastre. L'ac teur rentre à Bruxelles, déterminé à ne plus écrire. Jeune étoile du cinéma — dans L'Argent de Marcel L'Herbier (1928) et Une Idylle à la plage d'Henri Storck (1931) —, Rouleau fonde à Bruxelles, avec Aymé Declercq, le Nouveau Théâtre du Marais (1930-1932) où il réalise sept mises en scène. Vient ensuite Le Mal de la jeunesse de l'Autrichien Ferdinand Bruckner, créé en langue française au Théâtre des Galeries le 20 avril 1931, avec le couple Rouleau-Balachova. Séduits par l'ardeur de toute la troupe, Paulette Pax et Lucien Beer la programment à Paris pour deux semaines. Une centaine de coupures de presse rendront compte des quelque deux cents représenta tions au Théâtre de l'Œuvre puis au Studio des Champs-Élysées ! Rouleau signe la mise en scène, conçoit les décors et interprète — crâne à moitié rasé — le jeune lieutenant allemand. Des acteurs avec l'âge du rôle, un jeu vif et réaliste, des décors dépouillés, tout Paris fris sonne face à cette Allemagne effrayante. En tournage à Berlin, Rouleau découvre l'horreur du nazisme. Il monte alors toujours à l'Œuvre, en mars 1934, Les Races d'un Bruckner mis à Il tiendra parole, si ce n'est, à la fin de sa vie, l'écriture d'Or… demeuré inédit. Adapter le passionne davantage. Ce sera Les Jours de notre vie d'Andreïev (1941), Anna Karénine d'après Tolstoï (Les Œuvres libres, 1952), La Descente d'Orphée de Williams (L'Avantscène, 1959), La plus forte de Strindberg (1978), La Fraîcheur de l'aube de Gardner (L'Avant-scène, 1980), Thérèse Raquin d'après Zola (L'Avant-scène, 1982). l'index et exilé. Juif également menacé, Adrien Meyer accueille ce spectacle « impartial » au Théâtre du Parc. L'attrait pour les femmes qu'attestaient ses poésies de jeunesse s'exacerbe de ses rôles de séducteur un brin démoniaque. Tôt marié à Tania Balachova, il papillonne, se lie à Made leine Ozeray — d'où l'éloignement où le tien dra Louis Jouvet — puis connaît deux liaisons durables : Yolande Laffon (1932-1937) et Re née Saint-Cyr (1936-1939). Cette dernière l'a peint sous les traits de Pierre, amant possessif, cruel et mythomane dans Autopsie d'une pas sion, mais elle louera sa force de travail. Fuit-il la passion qu'il épouse en 1940 Françoise Lu gagne, comédienne dont il aura deux enfants, Philippe (1940-2009) et Fabrice (1947-2001). Le couple se sépare en 1966, divorce en 1970, avec deux « rôles-cadeau » pour elle, dans Noces de sang au théâtre et dans Les Papiers d'Aspern à la télévision. Lors d'actions pour soutenir les grévistes de l'ORTF (Office de radiodiffusion-télévision française) en 1968, il rencontre la jeune Françoise Crémieux, chan teuse de jazz. Elle l'aide dans son militantisme, ils se marient et la voilà assistante, parfois aus si comédienne. Donatrice du « fonds Raymond Rouleau » aux Archives & Musée de la Littéra ture, elle accompagnera son mari dans son dur combat contre le cancer. Parmi les nombreux rôles et mises en scène qui suivront, notons un Britannicus (1939) où Rouleau interprète Néron en habits stylisés et sans emphase, ainsi qu'en 1944, la création de Huis clos de Sartre au Vieux-Colombier. Quant au cinéma, on recense entre 1930 et 1949 trois réalisations : Rose (1935), Trois, six, neuf (1936) et Le Messager (1937) ; deux coréalisa tions avec interprétation : Suzanne (1932), Une Vie perdue (1933) ; ainsi que vingt-six rôles. Jacques Becker — il joue dans son premier long-métrage et interprète Philippe Clarence dans Falbalas — ainsi que Georg Wilhelm Pabst, dont il fut l'assistant, l'impressionnent tout particulièrement. Notre « Cary Grant » résume : « Théâtre, cinéma / cinéma, théâtre… Acteur, metteur en scène / metteur en scène, acteur… Puis-je n'avoir jamais à choisir entre les deux branches de mon métier ! » (Ciné monde, juin 1938). La Seconde Guerre mondiale sonne comme l'heure de l'engagement. Durant la guerre d'Espagne, Raymond Rouleau avait équipé et mené chez les Républicains des camions, sau vant par occasion des enfants. En mai 1940, engagé volontaire aux Sections sanitaires du front, il reçoit la Croix de guerre. Quant à son rôle dans la Résistance, il restera discret, évo quant de simples ports de lettres. Si Rouleau abandonne l'écriture — par manque de talent —, s'il vend ses parts du Théâtre de l'Œuvre suite au désastre financier d' Anna Karénine, s'il s'éloigne du cinéma (qua torze rôles dans les années cinquante ; deux en 1963 et 1964), c'est que la direction d'acteur le passionne encore et toujours. De Simone Signoret qui joue une Élizabeth Proctor « puri taine exemplaire qui s'interdit de laisser filtrer la moindre lueur de la passion et de la ten dresse qui la brûlent intérieurement », Rouleau déclare : « Elle est comme ces desserts enrobés de glace blanche à l'intérieur desquels il y a une crème au chocolat bouillante » (Signoret, p. 132). Gérard Oury écrira : « La main dans la main avec Rouleau, le comédien va explorer son personnage, découvrir où, comment, pour quoi avant que la pièce commence, il a aimé, tué, détruit, rêvé » (Oury, p. 156-157). Au sortir du conflit, Rouleau lorgne la direction d'un théâtre. Après l'éphémère codi rection du Théâtre Daunou (octobre 1934-jan vier 1935) et l'échec du Théâtre de Minuit (inauguré par Virage dangereux en 1938), il codirige le Théâtre de l'Œuvre de 1944 à 1951. Deux de ses mises en scène seront présentées au Théâtre du Parc : Le Sourire de la Joconde d'Huxley et Le Voleur d'enfants de Super vielle. En 1949, il monte Le Corsaire de Mar cel Achard au Théâtre national de Belgique, y interprétant le double rôle principal. L'année où il fonde le « Nouveau Cartel » avec André Barsacq, Jean Mercure et Jean-Louis Barrault, en 1958, il dirige encore durant quelques mois le Théâtre Édouard VII. Peu après, Rashomon (1959-1961) illumine cette Belgique dont il a gardé la nationalité. D'où, également, des initiatives en faveur des jeunes. Pour répondre aux demandes de plus en plus pressantes, il fonde avec Julien Ber theau une « école de comédiens » qui, gratuite d'abord, fonctionnera de 1936 à 1938, puis de 1940 à 1944 en trio avec Jean-Louis Barrault. Directeur du Théâtre de l'Œuvre, il mettra sa salle à la disposition des jeunes acteurs, décora teurs ou metteurs en scène à partir de 1948. Rue Mouffetard, il fonde et anime de 1961 à 1968 la Communauté théâtrale, d'abord dans l'anony mat, puis avec des noms mais sans vedette. Des centaines de compagnons auront été côtoyés, avec éclipses et retours, durant une si vaste carrière, tant dans les théâtres parisiens, avec tournées en France et en Belgique, qu'à l'étranger. Bien que peu nombreux, ses opé ras marquent, comme Carmen à l'Opéra de Paris en novembre 1959. La réalisation filmée de son unique ballet, Les Amants de Téruel (1959), obtient le grand prix de la Commission supérieure technique du cinéma au Festival de Cannes en 1962. À ces spectacles hauts en cou leur qui mêlent détails « vrais » et sentiments paroxystiques, s'oppose un théâtre où l'intimi té de l'homme-acteur se confesse. Rouleau est Stanton dans Virage dangereux de Priestley (entre 1938 et 1958), le comédien Frank dans Pour le meilleur et pour le pire d'Odets (19551957) ou encore Harry Jarvis dans Les Papiers d'Aspern de James (1961), toutes pièces qu'il met en scène. Il donne ainsi sa chance à Bernard Blier dans Trois, six, neuf (1936) puis, au Théâtre de l'Étoile, dans Altitude 3200 (1937). Dans ce spectacle écrit par le grand-père de Corinne Luchaire, outre celle-ci, brillent Gaby Sylvia et Jean Mercanton. Autres révélations : Serge Reggiani dans Le Loup-Garou (1940), Su zanne Flon dans Le Survivant (1943), Louis de Funès dans Un Tramway nommé Désir (1949), Audrey Hepburn dans Gigi (1951-1953), Mar lène Jobert dans Des Clowns par milliers (1963) et Isabelle Adjani dans Ondine (1974). Ce désir de jeunesse le rend aussi proche d'au teurs vivants : Marcel Achard, Henri Troyat, Georges Simenon… Ainsi que du théâtre américain dont il monte Tennessee Williams, Arthur Miller, Henry James, Herb Gardner, Clifford Odets, Paul Osborn, Thornton Wilder et Saul Levitt. Rouleau reçut deux fois le grand prix Do minique de la mise en scène : en 1954 pour Cy rano de Bergerac et Les Sorcières de Salem; en 1971 pour Hadrien VII (Théâtre de Paris) et Le Songe (Comédie française). Ce Songe obtint aussi le prix du Syndicat de la critique et son décorateur, Hubert Monloup, le trophée Dus sane. Il importe de souligner la part qu'eurent les décorateurs dans ces réussites. Monloup signe les décors d' Hadrien VII et du Songe . Lila de Nobili conçoit costumes et décors du Cyrano et des Sorcières ; elle se surpassa, avec tulles pour effets d'ombre et de transparence. Ils collaborèrent vingt-quatre fois, de 1947 à 1967, tant au théâtre qu'à l'opéra ou pour des « dramatiques ». Régulières sont désormais les captations de ses mises en scène. Parfois, seule la télévision le requiert, comme pour L'École des femmes (1972) avec Isabelle Adjani, Vogue la galère (1973) de Marcel Aymé avec Robert Hossein ou encore Bérénice (1975) qui réunit Danièle Lebrun et Laurent Terzieff. À son actif, men tionnons aussi des adaptations et/ou réalisa tions pour la radio... Mais, sur le tard, c'est l'enfance — ses joies et ses peurs — qui le bou leverse. L'enfant est roi dans Le Tour d'écrou (1974), Tim (1976) et L'Eau sale (1976), une fic tion-documentaire née d'une profonde révolte contre l'argent pollueur. Dernier rôle, Rouleau interprète Ziffel dans Dialogues d'exilés de Brecht mis en scène par Tania Balachova (1968). Il a besoin d'argent depuis sa mise à l'écart suite à Mai 68. D'où, également, le tournage en Belgique de Joël Brand. Histoire d'une affaire d'après Kip phardt (1969), film produit par la Radio-Télé vision belge (RTB). Il lui reste alors quelque douze ans à vivre et c'est la gloire avec, à la Comédie française, Ruy Blas (1960), Le Songe (1970), Henri IV (1973), Ondine (1974) et Le Verre d'eau (1976). Raymond Rouleau travaille jusqu'à ses der nières semaines, se reposant dans sa maison de Courcemont. La première de Thérèse Raquin a lieu sans lui... mais pas sans son exigence. Ne disait-il pas : « Je leur demande sans le moindre remords de laisser leur rôle dominer toute leur vie : l'heure, l'amour, le sommeil, l'appétit. Pour que le spectacle soit bon, il faut qu'ils se 'donnent' entièrement » (Flamand, p. 212). Décédé à Paris le 11 décembre 1981, il est enterré à Wy-Dit-Joli-Village. Archives & Musée de la Littérature, à Bruxelles, Archives et interviews. — J. Flamand, Raymond Rouleau, s.l.s.d., texte non publié. M. Ozeray, À toujours, Monsieur Jouvet, Paris, 1966. — R. Saint-Cyr, Autopsie d'une passion, Paris, 1972. — S. Signoret, La nostalgie n'est plus ce qu'elle était, Paris, 1975. — A. et O. Virmaux, Artaud vivant, Paris, 1980. — G. Oury, Mémoires d'éléphant, Paris, 1988. Vincent Radermecker ______________________________________ Illustration : Planche XV, face à la page 288. Raymond Rouleau, 1944. ______________________________________ RUELLE, Pierre, Paul, Jules, philologue mé diéviste, dialectologue et linguiste, membre de l'Académie royale de langue et de littérature françaises de Belgique, né à Pâturages le 10 avril 1911, décédé à Mons le 14 janvier 1993. Diplômé de l'École normale de Mons en 1930, il est instituteur dans une école de Pâturages de 1930 à 1940, où sa fonction consiste surtout à enseigner le français à de petits patoisants et où naitra une passion pour la langue française dont il ne se dépar tira plus. Régent littéraire à l'École normale moyenne de Nivelles en 1937, il est institu teur à l'École d'application de Mons lorsque la guerre éclate. Mobilisé, prisonnier pendant quelques mois, il passe dans la Résistance tout en poursuivant ses tâches d'instituteur à l'École d'application de Mons jusqu'en 1943, puis celles de maitre d'études à l'École nor male primaire de Mons de 1943 à 1945. La guerre finie, il poursuit son parcours d'ensei gnant et est professeur de français à l'École normale primaire de Mons (de 1945 à 1947), puis à l'École normale moyenne de Mons (de 1947 à 1958) et enfin chargé de cours de philo sophie à l'Institut supérieur de commerce de Warocqué (de 1956 à 1958). Simultanément il poursuit ses études et entre à l'Université libre de Bruxelles (ULB), où il obtient une licence en philologie romane en 1948 et un doctorat en philosophie et lettres en 1957. En 1958, il devient professeur de la même université, qu'il ne quittera plus jusqu'à son départ à la retraite en 1981. Ses cours s'y centreront sur Pierre Ruelle passe sa jeunesse dans un coron de houilleurs, au milieu de gens simples, dont il conservera jusqu'à la fin de ses jours la rudesse, la droiture et l'humilité. la grammaire historique du français et la phi lologie, ainsi que sur les textes français et pro vençaux du Moyen Âge. Le premier axe se manifeste dès son mé moire de licence, une étude dialectologique sur Le vocabulaire professionnel du houilleur bo rain (1953), qui marque le début d'une longue série de livres et d'articles que Pierre Ruelle consacrera à son dialecte, auquel il demeurera très attaché, revendiquant avec fierté son statut de patoisant (Introspection d'un intellectuel patoisant, en 1985) et transmettant sa passion pour le Borinage de son enfance à travers des témoignages émouvants (Une enfance boraine vers 1920 en 1977, Le Borinage de 1925 à 1933, Un paysage intellectuel oublié en 1984). Ses contributions sur le borain, publiées dans de nombreuses revues de dialectologie, portent aussi bien sur la syntaxe que sur le lexique ou les proverbes — les plus significatives ont été réunies en 2005 dans le volume Pierre Ruelle et le Borinage. Attaché viscéralement au Bori nage où il est né, Pierre Ruelle est également très attaché à la Wallonie, dont il prend souvent la défense ; il est depuis toujours conscient d'appartenir à la France, un attachement que l'on retrouve notamment dans son ouvrage Un certain amour de la France (1987), ainsi que dans son adhésion au mouvement Retour à la France. Ses travaux universitaires s'inscrivent es sentiellement dans deux grands axes, témoins de deux passions : la dialectologie et la philo logie médiévale. Son second axe de recherche se manifeste dans sa thèse de doctorat, une édition critique de la chanson de geste Huon de Bordeaux (1960), qui marque elle aussi le début d'une longue série d'éditions critiques. Certaines se démarqueront de cette première en ce qu'elles ne porteront plus sur des textes littéraires — Pierre Ruelle estimant que les textes répu tés sans valeur littéraire peuvent donner des informations aussi précieuses sur la langue et la pensée de leurs auteurs que les grands textes littéraires —, mais qui auront toutes en commun de mettre au jour des textes diffi ciles, dans des éditions assorties de commen taires philologiques et linguistiques d'une rare finesse, qui sont aujourd'hui encore citées en exemple. Des éditions de textes d'archives — Actes d'intérêt privé conservés aux Archives	<urn:uuid:987a0ff6-ec8e-44f3-a30b-c2cc71c40deb>	HuggingFaceFW/finepdfs/tree/main/data/fra_Latn/train	finepdfs	fra_Latn	18,061
RUSSMANN ... sorgt für Sauberkeit & Hygiene Hygiene-Spendersystem COSMOS Passend für jede Umgebung! COSMOS-Spendersystem Rollenhandtuchspender COSMOS Autocut Spender - abschließbar - für Handtuchrollen bis 290 m geeignet - automatische Restrollenfunktion - Push-Hebel mir Rutschkuppelung - abnehmbare Wandhalterung - Farbe: schwarz/weiß andere Farben auf Anfrage Toilettenpapierspender COSMOS - abnehmbare Wandhalterung - abschließbar - für 2 x 990 Blatt, kernloses Toilettenpapier, 2-lagig oder für 2 x 600 Blatt, 3-lagig - mit Bremsfunktion - Farbe: schwarz/weiß andere Farben auf Anfrage Schaumseifenspender COSMOS - abnehmbare Wandhalterung - abschließbar - für 1.000 ml Seifenschaumkartuschen - mit Bremsfunktion - Farbe: schwarz/weiß andere Farben auf Anfrage Ob in Schulen, Industrie, Waschräumen, Restaurants oder Hotels: Die Dekorvielfalt und qualitative Verarbeitung aller drei Spender der COSMOS-Reihe sorgt für universelle Einsetzbarkeit. Die Verwendung von Materialien wie robustem Kunststoff stellt dabei zudem eine lange Lebensdauer sicher. Jedes Produkt der Serie harmoniert in Sachen Erscheinungsbild und Funktionalität mit dem anderen. So erhalten Sie Spender und Befüllung aus einer Hand. COSMOS-Spendersystem-Zubehör Handtuchrollen für COSMOS Autocut Spender 1-lagig, 100% Zellstoff, 200 m Toilettenpapier für COSMOS Toilettenpapierspender 2-lagig, 100% Zellstoff, 1060 Blatt/Rolle Nachfüllkartuschen für COSMOS Schaumseifenspender 1.000 ml	<urn:uuid:075d0a71-7ec0-4050-afb5-7f512f54d588>	HuggingFaceFW/finepdfs/tree/main/data/deu_Latn/train	finepdfs	deu_Latn	1,480
COMUNE DI TRINO (Provincia di Vercelli) SETTORE SCOLASTICO - CULTURALE SERVIZIO EXTRASCOLASTICO DETERMINAZIONE DEL RESPONSABILE DEL SETTORE N. 721/16 DEL 10.8.2016 Oggetto: LIQUIDAZIONE REGOLAZIONE POLIZZA INFORTUNI CUMULATIVA ASILO NIDO, CENTRO ESTIVO E PEDIBUS “UNIPOLSAI” - OBBLIGHI DI LEGGE. CIG: ZC51AD9187. PREMESSO che necessita provvedere alla regolazione della polizza infortuni cumulativa “UnipolSai” del Gruppo Assiteca di Torino per gli utenti dell’Asilo Nido, Centro Estivo e Pedibus per un ammontare di € 693,00; VISTA la comunicazione della suddetta Società’ del 01/08/2016, prot. n. 10937 del 01/08/2016; VISTO che, con la medesima comunicazione, in funzione del suddetto pagamento, ha provveduto il Responsabile del Settore Finanziario ed Economico all’assunzione di opportuno impegno di spesa; ACQUISITO dal Sito Ministeriale il cod. CIG: ZC51AD9187; RITENUTO di dover provvedere per la conseguente liquidazione di € 693,00; VISTA, al riguardo, la deliberazione di C.C. n. 19 del 19/05/2016: “Bilancio di previsione 2016-2018. Esame ed approvazione”; VISTA la deliberazione di G.C. n. 111 del 23/06/2016, esecutiva ai sensi di legge, con la quale è stato approvato il P.E.G. 2016/2018; ATTESO, quindi, di dover provvedere in merito secondo il contenuto recato dal sottostante Dispositivo. VISTO il provvedimento di nomina a Responsabile del Settore Scolastico-Culturale emanato dal Sindaco in data 17/12/2015 e repertoriato al n. 23; - VISTO il T.U. Enti Locali, approvato con D.lgs 18.08.2000, n. 267. DETERMINA - di approvare quanto dedotto in narrativa quale parte integrante e sostanziale della presente determinazione; - di liquidare, per i motivi di cui in premessa, in favore della ASSITECA B.A. SPA - Torino per la quota parte della Polizza Infortuni Cumulativa la somma di € 693,00 codice CIG n. ZC51AD9187; - di imputare la spesa sull’intervento del cod. 1040503 (cap. 230) del bilancio esercizio 2016, che presenta la necessaria disponibilità; - di dare atto che al pagamento dell’importo come sopra liquidato provvederà, con apposito mandato di pagamento, il Responsabile del Settore Finanziario ed Economico, al quale sarà trasmessa, per i relativi adempimenti, copia della presente determinazione. La presente determinazione, anche ai fini della pubblicità degli atti e della trasparenza amministrativa, sarà pubblicata all’albo pretorio comunale per 15 giorni consecutivi. Trino, 10.8.2016 Il Responsabile del Settore Scolastico-Culturale (Dott. Domenico Traversa) F.to IN ORIGINALE COPIA CONFORME ALL'ORIGINALE in carta libera ad uso amministrativo Trino, 10. 8. 2016 IL RESPONSABILE DEL SETTORE N 1762/2016 del Registro delle PUBBLICAZIONI ALL'ALBO PRETORIO Su attestazione del Messo si certifica che la presente determinazione, ai fini della pubblicità degli atti e della trasparenza dell'azione amministrativa, viene pubblicata all'Albo Pretorio dell'Ente per quindici giorni consecutivi, dal 10. 8. 2016. Trino, 10. 8. 2016 IL SEGRETARIO COMUNALE (Farana dr. Bartolomeo) IL MESSO COMUNALE	<urn:uuid:5d6f26dd-a479-454c-979f-f87a96681ec4>	HuggingFaceFW/finepdfs/tree/main/data/ita_Latn/train	finepdfs	ita_Latn	3,057
Mütter- und Väterberatung mit Übersetzung in Tigrinya Daten 2018 für Eltern mit Kindern ab 1 Jahr bis 4 Jahre Adresse: Ennetbühlerstr. 5, 8750 Glarus Dienstagnachmittag von 14.00 – 16.00 14. August 4. September 2. Oktober 6. November 4. Dezember Kontakt: Helen Woldehawariat. 076 334 50 53 www.muevaeberatung.ch	<urn:uuid:eae2dc6f-87a0-4449-931b-22297e9b445b>	HuggingFaceFW/finepdfs/tree/main/data/deu_Latn/train	finepdfs	deu_Latn	318
May 20, 2024 The Honorable Amit Bose, Administrator Federal Railroad Administration 1200 New Jersey Avenue, SE Washington, DC 20590 Re: Watco's 2023/2024 CRISI Grant Program Application: "Strategic Bridge Improvement and Sustainability Project" Dear Administrator Bose; On behalf of Schumitsch Companies, I want to extend my full support for Watco's 2023/2024 CRISI Grant Application - Strategic Bridge Improvement and Sustainability Project. This project proposes to complete at least 30% preliminary engineering and design work, including all environmental work, for 116 strategic railroad bridges that traverse waterways across the entire Watco network. These bridges are critical to safe and efficient railroad service to our facility. We are a Wisconsin based small family owned business that relies on the Watco rail network to bring in raw commodities for processing such as oats and barley. We have been asking Watco why we cannot bring in full sized railcar shipments for a bit now and are told it is due to the condition of their bridges which they have been trying to find a solution to. Further weight restrictions and/or rail service disruptions due to the condition of the bridges that serve our facility would severely impact the economics of our business model and would result in more truck traffic navigating local roads through business, commercial and residential areas to reach our plant. I understand Watco is applying for a federal CRISI grant of $15.2M and will be providing a local match of $3.8M if awarded. I applaud Watco for taking this big step forward in trying to address its' infrastructure challenges today and in the future. 420 Wausau Road Antigo, WI 54409 P: 715-623-3351 www.sch-companies.com Schumitsch Companies supports modern infrastructure that helps our economy grow and enhances the safety of the communities we call home, and certainly supports this CRISI grant application. Respectfully, Jay Schumitsch Vice President Schumitsch Companies	<urn:uuid:5a53dbc5-fce8-45f6-8ca0-9dc60d55f3e9>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	2,002
Vom Himmel hoch Weihnachtsfantasie für gemischten Chor und Blechbläserquintett (auch in der Fassung für Männerchor erhältlich) unter Verwendung von: Pastorale (A.Corelli) / Vom Himmel hoch... / Kommet ihr Hirten / Leise rieselt der Schnee / Stille Nach Ernst-Thilo Kalke (* 1924) Andante $ J = 40 $ Sopran Alt Tenor Bass 1.Trpt. 2.Trpt. Horn Posaune Tuba Copyright 1996 by Edition Walhall, Magdeburg. All rights reserved. Printed in Germany. Himmel hoch, da komm ich her ich bring euch gute neue der guten Mär bring ich so viel: Da von ich sing en und sa gen will. Aah Kommet ihr Hirten ihr Männer und Frau'n Kommet das lieb liche Kindlein zu Christus der Herr ist heu te ge bo ren, den Gott zum Hei land euch hat er ko ren Fürch tet euch nicht. schau'n Aah Aah Fürch tet euch nicht. ist ein Ros entsprungen aus einer Wurzel zart. Wie uns die Alten sungen: von Jesse Kam die Art. Und hat ein Blümlein bracht mitten im kalten Winter wohl zu der halben Nacht a tempo J.=30 Leise rieselt der Schnee, still und starr ruht der See. Weihnachtlich glänzet der Wald. Freue dich: Christkind kommt bald. Stille Nacht, heilige Nacht, alles schläft, einsam wacht Stille Nacht, Stille, alles schläft einsam wacht Stille Nacht, Stille, alles schläft einsam wacht nur das trau-te hoch heili-ge Paar, hol-der Kna-be im lock-i-gen Haar, schlaf in himm-li-scher nur das trau-te hoch heili-ge Paar, hol-der Kna-be im lock-i-gen Haar, schlaf in himm-li-scher nur das trau-te hoch heili... heili-ge hol-der Kna-be im lo loc-ki-gen schlaf in himm-li-scher Ruh schla-f in himm-li-scher Ruh Ruh schla-f in himm-li-scher Ruh Ruh schla-f in himm-li-scher Ruh Tempo I Vom Him-mel hoch da kom-m ich her. Ich Vom Him-mel hoch da kom-m ich her. Ich Vom Him-mel hoch da kom-m ich her. Ich bring euch gute neue Mär. Der guten Mär bring ich so viel, davon ich singen und sagen will. Aah	69544853-ab08-415f-a13a-2bc9b4f1c99c	HuggingFaceFW/finepdfs/tree/main/data/deu_Latn/train	finepdfs	deu_Latn	1,887
Luxtronik Ares (WLB) 100w‐200w Spec Sheet Version 1.0 April 20, 2017 Luxtronik Technical Department Ares Low Bay is a tough, durable linear luminaire, perfectly suited to locations that require a high level of ingress protection. With a variety of optics available, Ares can deliver perfect light in open area or aisle racking environments. Features & Benefits ‐ 0‐10V or DALI Dimming options and compatible with all leading sensor brands ‐ Up to 120lm/w system efficacy ‐ Premium grade aluminum die cast housing and stainless steel hardware ‐ Durable powder painting ‐ High performance thermal management design ensures low LED junction temperature and high lumen maintenance ‐ Simple installation and maintenance ‐ Optional lens for narrow and wide beam patterns ‐ 0‐10V or DALI Dimming options and compatible with all leading sensor brand Applications ‐ Cold Storage facilities ‐ Wet Location areas ‐ Warehouses Technical Specification Description Recommended Product Location Model LED Max Power (W) Typical System Power (W) Typical Luminous Flux (lm) Dimensions (mm) Weight (kg) Light Source Correlated Colour Temperature Colour Rendering Index System Efficacy LED Junction Temp. Light Distribution options Driver Input Voltage Range Power Factor Electrical Class Dimming Control (optional) Ambient Operating Temperature Ambient Storage Temperature Material Optical Cover Finish Ingress Protection (IP) Batch Coded Sensor compatible Certification ‐ Logistic centers ‐ Production workshops Ares LED Waterproof Lowbay (WLB) Cold storage wet location lighting applications Lumileds / Osram mid‐power LED 4000K, 5000K, 6500K >70 (or >80 available) 120 lm/w ≤75ºC (@ Ta=25ºC ) Meanwell 100‐305VAC 50/60Hz > 0.90 Class I 0‐10V, DALI ‐40ºC to +45ºC ‐25ºC to +80ºC Aluminium Tempered Glass White powder coated (customized RAL colour available upon request) IP65 (for indoor use) Yes All leading motion or daylight sensors CE, CB, SAA 15°x110°, 30°x110°, 40°x110°, 110°x110°, Accessories Sensor com mpatible Bracket de (ordered se esign can be cus parately) stom made fordifferent senso ors Dimen nsions LUX‐WLB B‐100 / 150 / 2 200 Photo ometrics Order ring Infor rmation (Optional) Note: Actual p Specifications performance may diffe subject to change w er as a result of end-u ithout notice. user environment and d application. All valu ues are typical values s, measured under laboratory conditions a at 25 °C.	<urn:uuid:a0b7bb1d-8f5e-4115-adf1-ee739a57efef>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	2,479
Σχέδιο Δράσης ΣΒΑΚ Δήμου Κοζάνης Ο Δήμος Κοζάνης υπακούοντας στις διατάξεις του Νόμου 4784, απέστειλε με το υπ. Αρίθμ. Πρωτοκόλλου 34545-19/11/2021 αίτημα το Σχέδιο Δράσης, όπως και το Σχέδιο Παρακολούθησης και Αξιολόγησης στους παρακάτω φορείς: * στις υπηρεσίες και φορείς που ορίζονται στα άρθρα 52 και 52Α του ν. 2696/1999 (Κώδικας Οδικής Κυκλοφορίας, Α΄ 57), για τα μέτρα ρύθμισης της οδικής κυκλοφορίας και για τα μέτρα που αφορούν σε χερσαίους χώρους λιμένων αντιστοίχως, δηλαδή στο αρμόδιο Τμήμα Τροχαίας της Περιοχής σας * στο Τμήμα Προγραμματισμού, Συντονισμού και Κανόνων Οδικής Κυκλοφορίας της Διεύθυνσης Οδικής Κυκλοφορίας και Ασφάλειας του Υπουργείου Υποδομών και Μεταφορών για την εξέταση της συνάφειας των μέτρων που προάγουν την οδική ασφάλεια με το Στρατηγικό Σχέδιο Οδικής Ασφάλειας, * στις καθ' ύλην αρμόδιες υπηρεσίες ή φορείς, όπως αυτές προσδιορίζονται στο σχέδιο δράσης, οι οποίες θα κληθούν μεταγενέστερα είτε να εγκρίνουν είτε να υλοποιήσουν μέτρα που προτείνονται από το Σ.Β.Α.Κ.: o Αποκεντρωμένη Διοίκηση: Δ/νση Περιβάλλοντος και Χωρικού Σχεδιασμού o Περιφέρεια Δυτικής Μακεδονίας: Δ/νση Περιβάλλοντος και Χωρικού Σχεδιασμού o Διεύθυνση Πρωτοβάθμιας Εκπαίδευσης o Διεύθυνση Δευτεροβάθμιας Εκπαίδευσης o Σύλλογος ΑμεΑ Περιφερειακής Ενότητας Κοζάνης o Πυροσβεστική Υπηρεσίας Κοζάνης o ΤΕΕ Δυτικής Μακεδονίας o Αστικό ΚΤΕΛ Κοζάνης o Υπεραστικό ΚΤΕΛ Νομού Κοζάνης o Εμπορικός Σύλλογος Κοζάνης Οι παραπάνω φορείς ήταν υποχρεωμένοι να διατυπώνουν γνώμη επί των επιλεγέντων μέτρων του σχεδίου δράσης, εντός αποκλειστικής προθεσμίας δύο (2) μηνών από την παραλαβή αυτού.	<urn:uuid:34a673f7-70fd-4ab1-ba0c-e46c9c146768>	HuggingFaceFW/finepdfs/tree/main/data/ell_Grek/train	finepdfs	ell_Grek	1,593
PROBLEMAS Y CUESTIONES PAU. CAMPO GRAVITATORIO. IES El Clot Curso 2014-15 1) (P Jun94) Se lanza verticalmente un satélite de masa $ m = 2000 \text{ kg} $ desde la superficie de la Tierra, y se pide: a) Energía total necesaria para situarlo en una órbita (supuesta circular) de radio $ R_1 = 2R_T $, donde $ R_T $ es el radio de la Tierra. b) Energía mínima necesaria para trasladarlo hasta la Luna. \[ G = 6,67 \cdot 10^{-11} \text{ S.I.}; \quad \text{Distancia Tierra - Luna} = 60 \ R_T; \ Masa \ de \ la \ Tierra = 5,96 \cdot 10^{24} \text{ kg}; \ Radio \ de \ la \ Tierra = 6,37 \cdot 10^6 \text{ m}; \ Masa \ de \ la \ Luna = 7,3 \cdot 10^{22} \text{ kg}; \ Radio \ de \ la \ Luna = 1,74 \cdot 10^6 \text{ m} \] Sol: a) $ v = 5586 \text{ m/s}; \ E_C = 9,36 \cdot 10^{10} \text{ J}. $ b) $ E_C = 1,17 \cdot 10^{11} \text{ J} $ 2) (C Jun94) Un planeta se mueve alrededor del Sol en una órbita circular con velocidad de 50 km/s, respecto a un sistema de referencia heliocéntrico. Hallar el periodo de este planeta alrededor del Sol. \[ G = 6,67 \cdot 10^{-11} \text{ S.I.} \quad M_{\text{sol}} = 1,97 \cdot 10^{30} \text{ kg}. \] Sol: $ T = 76,4 \text{ días} $ 3) (P Sept94) El periodo de rotación de Venus alrededor del Sol es 0,6 veces el período correspondiente a la Tierra. Considerando circulares las órbitas de ambos planetas, determinar: a) Distancia desde Venus hasta el Sol. b) Velocidad y aceleración de Venus respecto al sistema de referencia heliocéntrico. Datos: $ G = 6,67 \cdot 10^{-11} \text{ N-m}^2/\text{kg}^2; \ Masa \ del \ Sol = 1,97 \cdot 10^{30} \text{ kg}, \ Distancia \ de \ la \ Tierra \ al \ Sol = 149,5 \cdot 10^9 \text{ m} $. Sol: a) $ r = 1,06 \cdot 10^{11} \text{ m/s}; $ b) $ v = 35150 \text{ m/s}; \ a_N = 0,012 \text{ m/s}^2 $ 4) (P Jun95) Calcular la altura, $ h $, medida desde la superficie de la Tierra a la que habría que situar un satélite para que fuese geostacionario, es decir, que mantuviese la misma posición relativa respecto de la Tierra. Datos: $ G = 6,67 \cdot 10^{-11} \text{ S.I.}; \ Masa \ Tierra = 5,98 \cdot 10^{24} \text{ Kg}; \ Radio \ Tierra 6,37 \times 10^6 \text{ m} $ Sol: $ h = 3,59 \cdot 10^7 \text{ m} $ 5) (C Jun95) Explicar el fenómeno de las mareas en base a la ley de gravitación newtoniana. 6) (C Jun95) Si sobre una partícula material actúa una fuerza conservativa aumentando su energía cinética en 100J: a) ¿Cuál es la variación de la energía total de la partícula? b) ¿Cuál es la variación de la energía potencial de la partícula? Razonar las respuestas. S.: a) $ \Delta E_T = 0; $ b) $ \Delta E_P = -100 \text{ J} $ 7) (C Sept95) Concepto de velocidad de escape en el campo gravitatorio terrestre. 8) (P Sept95) La distancia entre los centros $ O_1 $ y $ O_2 $ de dos masas esféricas homogéneas de radios $ R_1 $ y $ R_2 $, respectivamente, es de 30$ R_2 $. Determinar la relación entre las densidades de ambas esferas si se sabe que el punto sobre el que ejercen la misma fuerza gravitatoria sobre la recta $ O_1O_2 $ se encuentra a 20$ R_2 $ de $ O_1 $. Dato: $ R_1 = 10R_2 $ Sol: $ d_1 = 250d_2 $ 9) (P Jun96) Suponiendo a la Tierra como una esfera homogénea de radio $ R $ y despreciando efectos que sobre la fuerza de atracción entre masas ejerce la rotación de la Tierra alrededor de su eje, determinar la altura $ h $ a la que hay que elevar sobre la superficie terrestre una masa de 1 $ Kg $ para que su peso se reduzca a la mitad. Discutir los resultados. Sol: $ h = (\sqrt{2} - 1)R = 0,41R $ 10) (C Jun96) Variación de la aceleración del campo gravitatorio sobre la superficie terrestre en función de su latitud. Dibujar un esquema en el que se pueda apreciar esta variación en el polo y el ecuador, representando las fuerzas que actúan sobre la masa puntual de prueba en cada caso. 11) (C Sept96) Variaciones de “g” (aceleración de la gravedad en el campo gravitatorio terrestre), con la altura. 12) (P Sept96) El planeta Marte tiene un satélite situado en una órbita que se encuentra a una distancia de 9,4x10^6 m del centro de Marte. El periodo de rotación de dicho satélite es de 460 minutos. Calcular la masa de Marte. Datos: $ G = 6,67 \times 10^{-11} \text{ S.I.} $ Sol: $ M_M = 6,45 \cdot 10^{23} \text{ kg} $ 13) (P Jun97) Un satélite artificial de 2 t de masa describe una órbita circular a 400 Km de la superficie terrestre. Se pide: 1. Velocidad orbital del satélite. 2. Si se lanza desde la superficie terrestre, calcular la energía necesaria para situar el satélite en órbita. Datos: $ G = 6,67 \cdot 10^{-11} \text{ S.I.} \quad M_{\text{Tierra}} = 5,98 \cdot 10^{24} \text{ kg}; \ R_{\text{Tierra}} = 6370 \text{ Km}. $ Sol: a) $ v = 7675,7 \text{ m/s}. $ b) $ E_C = 6,6 \cdot 10^{10} \text{ J} $ 14) (P Jun97) Existe un punto sobre la línea que une el centro de la Tierra con el centro de la Luna en el que se cancelan las dos fuerzas gravitacionales. Calcular la distancia de este punto al centro de la tierra, sabiendo que la distancia entre los centros de la Tierra y la Luna es $ D = 3,8 \times 10^5 \text{ Km} $ y que $ M_{\text{Tierra}} = 81M_{\text{Luna}} $ Sol: $ r = 9/10D $ 15) (C Jun97) La Tierra en su órbita elíptica alrededor del Sol presenta dos puntos, el afelio y el perihelio, en los que su velocidad es perpendicular a su vector de posición respecto del Sol. Si en el afelio la velocidad de la Tierra es 30 Km/s y la distancia entre los centros de la Tierra y el Sol es 152x10^8 Km, calcular la velocidad de la Tierra en el perihelio sabiendo que en este punto la distancia entre los centros de la Tierra y del Sol es 147x10^8 Km. Sol: $ v = 31 \text{ km/s} $ 16) (C Sept97) Calcular a qué distancia sobre la superficie terrestre se debe situar un satélite artificial para que describa órbitas circulares con un periodo de 24 horas. Datos: $ G = 6,67 \cdot 10^{-11} \text{ S.I.} \quad M_{\text{Tierra}} = 5,98 \cdot 10^{24} \text{ kg}; \ R_{\text{Tierra}} = 6370 \text{ Km}. $ $ h = 3,59 \cdot 10^7 \text{ m} $ 17) (P Jun98) La distancia entre el Sol y Mercurio es de $57,9 \times 10^6$ Km y entre el Sol y la Tierra es de $149,6 \times 10^6$ Km. Suponiendo que las órbitas de ambos planetas son circulares, calcular su velocidad de rotación alrededor del Sol. Sol: $T_M = 87,9$ días; $v_M = 47878$ m/s; $v_T = 29786$ m/s 18) (C Jun98) Determinar el campo gravitatorio (módulo, dirección y sentido) resultante de los campos gravitatorios individuales de la Tierra y del Sol, en un punto situado en la recta que une la Tierra y el Sol, ya una distancia de $4 \times 10^5$ Km del centro de la Tierra. Datos: $G = 6,67 \times 10^{-11}$ Nm$^2$/Kg$^2$; $M_{Tierra} = 5,98 \times 10^{24}$ Kg; $M_{Sol} = 1,99 \times 10^{30}$ Kg; $D_{Tierra-Sol} = 15 \times 10^7$ Km Sol: $g = 0,0034$ m/s$^2$ hacia el sol 19) (C Sept98) Calcular a qué altura sobre la superficie terrestre la intensidad del campo gravitatorio se reduce a la cuarta parte de su valor sobre dicha superficie. Dato: $R_{Tierra} = 6370$ Km Sol: $h = R_T$ 20) (C Sep98) Si la distancia entre la Tierra y la Luna es $D = 3,8 \times 10^5$ Km, se pide calcular el tiempo que tarda la Luna en dar una vuelta completa a la Tierra. Datos: $G = 6,67 \times 10^{-11}$ S.I.; $M_{Tierra} = 5,98 \times 10^{24}$ Kg. Sol: $T = 2,33 \times 10^6$ s = 26,97 días 21) (P Jun99) Un satélite artificial de 500 Kg de masa se lanza desde la superficie terrestre hasta una altura $H$ de dicha superficie. En esa posición se le comunica una velocidad de 5000 m/s para ponerlo en órbita circular alrededor de la Tierra. Se pide: 1. Altura $H$ a la que debe situarse el satélite, para que las órbitas sean circulares. 2. Energía necesaria para llevarlo hasta dicha altura $H$. Datos: $G = 6,67 \times 10^{-11}$ S.I. $M_{Tierra} = 5,98 \times 10^{24}$ kg; $R_{Tierra} = 6370$ Km. Sol: $H = 9584640$ m; $E_C = 2,5 \times 10^{10}$ J 22) (C Jun99) Si un cuerpo tiene un peso de 100 N sobre la superficie terrestre, calcular su peso en la superficie de otro planeta cuya masa sea el doble que la de la Tierra y su radio sea el triple que el de la Tierra. Sol: $F_T = \frac{2}{9} F_T = 22,22$ N 23) (C Sept99) ¿A qué distancia de la superficie terrestre un objeto, de 2 Kg de masa, tendrá un peso de 10 N? Datos: $G = 6,67 \times 10^{-11}$ Nm$^2$/Kg$^2$; $M_{Tierra} = 5,98 \times 10^{24}$ Kg; $R_{Tierra} = 6370$ Km Sol: $h = 2561584,4$ m 24) (P Sep99) Calcular el trabajo necesario para trasladar una masa de 40 kg, desde la superficie de la Luna hasta una altura de 25 m. Comparar el resultado obtenido con el trabajo que habría que realizar si el proceso se llevara a cabo en la Tierra ($g = 9,8$ ms$^{-2}$) Datos: $G = 6,67 \times 10^{-11}$ Nm$^2$/Kg$^2$; $M_{Luna} = 7,3 \times 10^{22}$ kg; $R_{Luna} = 1740$ Km. Sol: $W_L = 1608,2$ J; $W_T = 9800$ J; $W_T = 6 W_L$ 25) (C Jun00) Para los planetas del sistema solar, según la tercera ley de Kepler, la relación $R^3 / T^2$ es constante y vale $3,35 \times 10^{18}$ m$^3$/s$^2$, siendo $R$ el radio de sus órbitas y $T$ el periodo de rotación. Suponiendo que las órbitas son circulares, calcular la masa del Sol. Dato: $G = 6,67 \times 10^{-11}$ S.I. Sol: $M_S = 1,98 \times 10^{30}$ kg 26) (P Sept00) Se desea colocar en órbita un satélite de comunicaciones, de tal forma que se encuentre siempre sobre el mismo punto de la superficie terrestre (órbita “geoestacionaria”). Si la masa del satélite es de 1500 kg, se pide calcular: 1. Altura sobre la superficie terrestre a la que hay que situar el satélite. 2. Energía total del satélite cuando se encuentre en órbita. Datos: $G = 6,67 \times 10^{-11}$ S.I.; $M_{Tierra} = 5,98 \times 10^{24}$ Kg; $R_{Tierra} = 6370$ km. Sol: $h = 35880474$ m. $E_T = -7,68 \times 10^9$ J 27) (P Sept00) Sean dos masas puntuales de 100 kg y 150 kg, situadas en los puntos A(-2,0) m y B(3,0) m, respectivamente. Se pide calcular: 1. Campo gravitatorio en el punto C(0,4) m. 2. Trabajo necesario para desplazar una partícula de 10 kg de masa desde el punto C(0,4) m hasta el punto O(0,0) m. Dato: $G = 6,67 \times 10^{-11}$ S.I. Sol: $g = (0,9 \cdot 10^{-10}, 6,185 \cdot 10^{-10})$ m/s$^2$. $W_{axi} = -3,18 \cdot 10^{-8}$ J. 28) (C Jun01) Si la Luna siguiera una órbita circular en torno a la Tierra, pero con un radio igual a la cuarta parte de su valor actual, ¿cuál sería su período de revolución?. Dato: Tomar el periodo actual igual a 28 días. 29) (C Jun01) ¿Cuál debería ser la velocidad inicial de la Tierra para que escapase del Sol y se dirigiera hacia el infinito? Supóngase que la Tierra se encuentra describiendo una órbita circular alrededor del Sol. Datos: Distancia Tierra-Sol=1,5x10$^{11}$ m; $M_{Sol} = 2 \times 10^{30}$ kg, $G = 6,67 \times 10^{-11}$ Nm$^2$/kg$^2$. 30) (C Sept01) Enunciar las leyes de Kepler. Demostrar la tercera de ellas, para el caso de órbitas circulares, a partir de las leyes de la mecánica newtoniana. 31) (C Sept01) El satélite Europa tiene un periodo de rotación alrededor de Júpiter de 85 horas y su órbita, prácticamente circular, tiene un radio de $6,67 \times 10^4$ km. Calcular la masa de Júpiter. DATO: $G = 6,67 \times 10^{-11}$ S.I. Sol: $M_J = 1,88 \times 10^{27}$ kg 32) (P Jun02) Se determina, experimentalmente, la aceleración con la que cae un cuerpo en el campo gravitatorio terrestre en dos laboratorios diferentes, uno situado al nivel del mar y otro situado en un globo que se encuentra a una altura $h = 19570$ m sobre el nivel del mar. Los resultados obtenidos son $g = 9,81$ m/s$^2$ en el primer laboratorio y $g = 9,75$ m/s$^2$ en el segundo laboratorio. Se pide: 1. Determinar el valor del radio terrestre. 2. Sabiendo que la densidad media de la tierra es $\rho_T = 5523$ kg/m$^3$, determinar el valor de la constante de gravitación G. 33) (P Jun02) Un satélite de 500kg de masa se mueve alrededor de Marte, describiendo una órbita circular a $6 \times 10^6$ m de su superficie. Sabiendo que la aceleración de la gravedad en la superficie de Marte es 3,7 m/s$^2$ y que su radio es 3400 km, se pide: 1) Fuerza gravitatoria sobre el satélite. 2) Velocidad y periodo del satélite. 3) ¿A qué altura debería encontrarse el satélite para que su periodo fuese el doble? 34) (C Sept02) Un astronauta que se encuentra dentro de un satélite en órbita alrededor de la Tierra a 250 km, observa que no pesa. ¿Cuál es la razón de este fenómeno? Calcula la intensidad del campo gravitatorio a esa altura. Comenta el resultado. Datos: G=6,67x10$^{-11}$ S.I.; M$_{\text{Tierra}}$=5,98X10$^{24}$ kg; R$_{\text{Tierra}}$=6370 km 35) (C Sept02) La Tierra gira alrededor del Sol realizando una órbita aproximadamente circular. Si por cualquier causa, el Sol perdiera instantáneamente las tres cuartas partes de su masa, ¿continuaría la Tierra en órbita alrededor de éste? Razona la respuesta. 36) (C Jun 2003) Calcula el cociente entre la energía potencial y la energía cinética de un satélite en órbita circular. Sol: Ep/Ec=-2 37) (C Jun 2003) Una partícula puntual de masa 3M se coloca en el origen de un cierto sistema de coordenadas, mientras que otra de masa M se coloca sobre el eje X a una distancia de 1 m respecto del origen. Calcula las coordenadas del punto donde el campo gravitatorio es nulo. Sol: P(0,634 , 0) 38) (C Sept 2003) Si consideramos que las órbitas de la Tierra y de Marte alrededor del Sol son circulares, ¿cuántos años terrestres dura un año marciano? El radio de la órbita de Marte es 1,486 veces mayor que el terrestre. Sol: T$_{\text{M}}$= 1,811 T$_{\text{T}}$ 39) (C Sept 2003) Dibuja las líneas de campo del campo gravitatorio producido por dos masas puntuales iguales separadas una cierta distancia. ¿Existe algún punto en el que la intensidad del campo gravitatorio sea nula? En caso afirmativo indica en que punto. ¿Existe algún punto en el que el potencial gravitatorio sea nulo? En caso afirmativo indica en que punto. 40) (P Jun 2004) Un satélite artificial de 500 kg de masa se mueve alrededor de un planeta, describiendo una órbita circular con un periodo de 42,47 horas y un radio de 419.000 km. Se pide: 1) Fuerza gravitatoria que actúa sobre el satélite. 2) La energía cinética, la energía potencial y la energía total del satélite en su órbita. 3) Si, por cualquier causa, el satélite duplica repentinamente su velocidad sin cambiar la dirección, ¿se alejará éste indefinidamente del planeta? Sol 1) 353,81N, 2) Ec=7,41·10$^{10}$ J; Ep = -1,48·10$^{11}$ J ; Et = -7,41·10$^{10}$ J 3) Si 41) (P Jun 2004) Una partícula puntual de masa m=10 kg está situada en el origen O de un cierto sistema de coordenadas. Una segunda partícula puntual de masa $m_2$=30 kg está situada, sobre el eje X, en el punto A de coordenadas (6,0) m. Se pide: 1) El módulo, la dirección y el sentido del campo gravitatorio en el punto B de coordenadas (2,0) m. 2) El punto sobre el eje X para el cual el campo gravitatorio es nulo. 3) El trabajo realizado por el campo gravitatorio cuando la masa $m_2$ se traslada desde el punto A hasta el punto C de coordenadas (0,6) m. Dato: G=6,67x10$^{-11}$ Nm$^2$/kg$^2$. Sol: 1) -4,167·10$^{-11}$ iN/kg; 2) P(2,196 , 0); 3) W=0 42) (P Sept 2004) La órbita de una de las lunas de Júpiter, Io, es aproximadamente circular con un radio de 4,20x10$^6$ m. El periodo de la órbita vale 1,53x10$^5$ s. Se pide: 1) El radio de la órbita circular de la luna de Júpiter Calisto que tiene un periodo de 1,44x10$^6$s. 2) La masa de Júpiter. 3) El valor de la aceleración de la gravedad en la superficie de Júpiter. Datos: Radio de Júpiter $R_J$=71400 km; G=6,67x10$^{-11}$ Nm$^2$/kg$^2$. Sol: 1) 1,872·10$^6$m; 2) 1,873·10$^2$kg; 3) 24,5 m/s$^2$ 43) (P Sept 2004) Un satélite geoestacionario es aquel que se encuentra siempre en la misma posición respecto a un punto de la superficie de la Tierra. Se pide: 1) La distancia sobre la superficie terrestre a la que ha de situarse un satélite geoestacionario. 2) La velocidad que llevará dicho satélite en su órbita geoestacionaria. Sol: 1) 35927m; 2) 3075,9 m/s Datos: Masa de la Tierra $M_T$=6X10$^{24}$ kg; Radio de la Tierra $R_T$=6370 km; G=6,67·10$^{-11}$ Nm$^2$/kg$^2$. 44) (C Jun 2005) Calcula el radio de la Tierra $R_T$ sabiendo que la energía potencial gravitatoria de un cuerpo de masa 20 kg, situado a una altura $R_T$ sobre la superficie terrestre, es $E_P = -1,2446 \times 10^9$ J. Toma como dato el valor de la aceleración de la gravedad sobre la superficie terrestre $g=9,8$ m/s$^2$. Sol: 12700km 45) (C Jun 2005) Un satélite de masa $m$ describe una órbita circular de radio $R$ alrededor de un planeta de masa $M$, con velocidad constante $v$. ¿Qué trabajo realiza la fuerza que actúa sobre el satélite durante una vuelta completa? Razona la respuesta. Sol: 0 46) (P Sept 2005) Un objeto de masa $ m = 1000 \, \text{kg} $ se acerca en dirección radial a un planeta, de radio $ R_P = 6000 \, \text{km} $, que tiene una gravedad $ g = 10 \, \text{m/s}^2 $ en su superficie. Cuando se observa este objeto por primera vez se encuentra a una distancia $ R_O = 6 \, R_P $ del centro del planeta. Se pide: 1) ¿Qué energía potencial tiene ese objeto cuando se encuentra a la distancia $ R_O $? 2) Determina la velocidad inicial del objeto $ v_0 $, o sea cuando está a la distancia $ R_O $, sabiendo que llega a la superficie del planeta con una velocidad $ v = 12 \, \text{km/s} $. Sol: 1) $-1 \cdot 10^{10} \, \text{J}$ 2) 6633,25$\text{m/s}$ 47) (P Sept 2005) Dos partículas puntuales con la misma masa $ m_1 = m_2 = 100 \, \text{kg} $ se encuentran situadas en los puntos $(0,0)$ y $(2,0) \, \text{m}$, respectivamente. Se pide 1) ¿Qué valor tiene el potencial gravitatorio en el punto $(1,0) \, \text{m}$? Tómese el origen de potenciales en el infinito. Calcula el campo gravitatorio, módulo, dirección y sentido, que generan esas dos masas en el punto $(1,0) \, \text{m}$. 2) Si la masa $ m_2 $ se dejara en libertad, la fuerza gravitatoria haría que se acercara a la masa $ m_1 $. Si no actúa ninguna otra fuerza, ¿qué velocidad tendrá cuando esté a una distancia de $ 30 \, \text{cm} $ de $ m_1 $? Dato: $ G=6,7 \times 10^{-11} \, \text{Nm}^2/\text{kg}^2 $ Sol: 1) $ V=1,34 \times 10^{-8} \, \text{J/kg}; g=0 $ 2) $ 1,95 \times 10^{-4} \, \text{m/s} $ 48) (PJun 2006) Una sonda espacial de masa $ m = 1200 \, \text{kg} $ se sitúa en una órbita circular de radio $ r = 6000 \, \text{km} $, alrededor de un planeta. Si la energía cinética de la sonda es $ E_C = 5,4 \times 10^8 \, \text{J} $, calcula: 1) El periodo orbital de la sonda. 2) La masa del planeta. Dato: $ G = 6,7 \times 10^{-11} \, \text{Nm}^2/\text{kg}^2 $ S:1)12566s 2) 8,1 \times 10^{22} \, \text{kg} \) 49) (PJun 2006) Fobos es un satélite que gira en una órbita circular de radio $ r = 14460 \, \text{km} $ alrededor del planeta Marte con un período de 14 horas, 39 minutos y 25 segundos. Sabiendo que el radio de Marte es $ R_M = 3394 \, \text{km} $, calcula: 1) La aceleración de la gravedad en la superficie de Marte. 2) La velocidad de escape de Marte de una nave espacial situada en Fobos. Sol: 1) 3,72$\text{m/s}^2$ 2) 2435,1$\text{m/s}$ 50) (C Sept 2006, 2008) Enuncia las leyes de Kepler. 51) (C Sept 2006) Calcula la velocidad a la que orbita un satélite artificial situado en una órbita que dista 1000 km de la superficie terrestre. Datos: $ R_T = 6370 \, \text{km}, M_T = 5,98 \times 10^{24} \, \text{kg}, G = 6,7 \times 10^{-11} \, \text{Nm}^2/\text{kg}^2 $ Sol: 7356,6 $\text{m/s}$ 52) (P Jun 2007) Un objeto de masa $ M_1 = 100 \, \text{kg} $ está situado en el punto $ A $ de coordenadas $(6, 0) \, \text{m}$. Un segundo objeto de masa $ M_2 = 300 \, \text{kg} $ está situado en el punto $ B $ de coordenadas $(-6, 0) \, \text{m}$. Calcular: 1) El punto sobre el eje $ X $ para el cual el campo gravitatorio es nulo. Sol: P(1,6077 , 0) 2) El trabajo realizado por el campo gravitatorio cuando la masa $ M_1 $ se traslada desde el punto $ A $ hasta el punto $ C $ de coordenadas . Dato: $ G = 6,7 \times 10^{-11} \, \text{Nm}^2/\text{kg}^2 $. Sol: 1,67 \times 10^{-7} \, \text{J} 53) (P Jun 2007) Sabiendo que el radio orbital de la luna es de 3,8 \times 10^8 \, \text{m} y que tiene un periodo de 27 días, se quiere calcular: 1) El radio de la órbita de un satélite de comunicaciones que da una vuelta a la Tierra cada 24 horas (satélite geoestacionario). 2) La velocidad de dicho satélite. Sol:42222km ;3070$\text{m/s}$ 54) (C Sept 2007) Define el momento angular de una partícula de masa $ m $ y velocidad $ v $ respecto a un punto O. Pon un ejemplo razonado de ley o fenómeno físico que sea una aplicación de la conservación del momento angular 55) (C Sept 2007) Calcula el trabajo necesario para poner en órbita de radio $ r $ un satélite de masa $ m $, situado inicialmente sobre la superficie de un planeta que tiene radio $ R $ y masa $ M $. Expresar el resultado en función de los datos anteriores y de la constante de gravitación universal $ G $. Sol: $ GMm \left( \frac{1}{2r} + \frac{1}{R} \right) $ 56) (P Jun 2008) Una sonda espacial de 200 kg de masa se encuentra en órbita circular alrededor de la Luna, a 160 km de su superficie. Calcula: 1) La energía mecánica y la velocidad orbital de la sonda. 2) La velocidad de escape de la atracción lunar desde esa posición. Datos: $ G = 6,7 \times 10^{-11} \, \text{Nm}^2/\text{kg}^2 $, masa de la Luna 7,4 \times 10^{22} \, \text{kg}, \) radio de la Luna 1740 km. Sol: 1) $-2,6 \times 10^7 \, \text{J}; 1611,8 \, \text{m/s}$ 2) 2279,4$\text{m/s}$ 57) (PJun 2008) Disponemos de dos masas esféricas cuyos diámetros son 8 y 2 cm, respectivamente. Considerando únicamente la interacción gravitatoria entre estos dos cuerpos, calcula: 1) La relación entre sus masas $ m_1/m_2 $ sabiendo que si ponemos ambos cuerpos en contacto el campo gravitatorio en el punto donde se tocan es nulo. 2) El valor de cada masa sabiendo que el trabajo necesario para separar los cuerpos, desde la posición de contacto hasta otra donde sus centros distan 20 cm, es: $ W=1,6 \times 10^{-12} \, \text{J} $. Sol 1) $ m_1/m_2=16; $ 2) $ m_2=0,01 \, \text{kg}, $ $ m_1=0,16 \, \text{kg} $ 58) (C Sept 2008) ¿A qué altitud sobre la superficie terrestre la intensidad del campo gravitatorio es el 20% de su valor sobre la superficie de la tierra? Dato: Radio de la Tierra $ R = 6300 \, \text{km} $. Sol: 7787,23$\text{km}$ 59) (P Jun 2009) Un sistema estelar es una agrupación de varias estrellas que interactúan gravitatoriamente. En un sistema estelar binario, una de las estrellas, situada en el origen de coordenadas, tiene masa $ m_1 = 1 \cdot 10^{30} \text{ kg} $, y la otra tiene masa $ m_2 = 2 \cdot 10^{30} \text{ kg} $ y se encuentra sobre el eje X en la posición $(d, 0)$, con $ d = 2 \cdot 10^6 \text{ km} $. Suponiendo que dichas estrellas se pueden considerar masas puntuales, calcula: 1) El módulo, dirección y sentido del campo gravitatorio en el punto intermedio entre las dos estrellas. 2) El punto sobre el eje X para el cual el potencial gravitatorio debido a la masa $ m_1 $ es igual al de la masa $ m_2 $. 3) El módulo, dirección y sentido del momento angular de $ m_2 $ respecto al origen, sabiendo que su velocidad es $(0, v)$, siendo $ v = 3 \cdot 10^5 \text{ m/s} $. Dato: $ G = 6,67 \cdot 10^{-11} \text{ Nm}^2/\text{kg}^2 $ Sol: 1) $ 66,7 \frac{\text{N}}{\text{kg}} $; 2) $ P(2/3 \cdot 10^9, 0) \text{ m} $; 3) $ 1,2 \cdot 10^{45} \frac{\text{kg}}{\text{s}^2} $ 60) (P Jun 2009) Hay tres medidas que se pueden realizar con relativa facilidad en la superficie de la Tierra: la aceleración de la gravedad en dicha superficie $(9,8 \text{ m/s}^2)$, el radio terrestre $(6,37 \cdot 10^6 \text{ m})$ y el periodo de la órbita lunar $(27 \text{ días}, 7 \text{ h}, 44 \text{ s})$: 1) Utilizando exclusivamente estos valores y suponiendo que se desconoce la masa de la Tierra, calcula la distancia entre el centro de la Tierra y el centro de la Luna. 2) Calcula la densidad de la Tierra sabiendo que $ G = 6,67 \cdot 10^{-11} \text{ Nm}^2/\text{kg}^2 $ Sol: 1) $ 3,826 \cdot 10^8 \text{ m} $; 2) $ 5506,5 \text{ kg/m}^3 $ 61) (C Sept 2009) Determina la aceleración de la gravedad en la superficie de Marte sabiendo que su densidad media es 0,72 veces la densidad media de la Tierra y que el radio de dicho planeta es 0,53 veces el radio terrestre .Dato: aceleración de la gravedad en la superficie terrestre $ 9,8 \text{ m/s}^2 $. Sol: $ 3,74 \text{ m/s}^2 $ 62) (C Sept 2009) Dos masas puntuales $ M $ y $ m $ se encuentran separadas una distancia $ d $. Indica si el campo o el potencial gravitatorios creados por estas masas pueden ser nulos en algún punto del segmento que las une. Justifica la respuesta 63) (C Jun 2010) Un planeta gira alrededor del sol con una trayectoria elíptica. Razona en qué punto de dicha trayectoria la velocidad del planeta es máxima. Sol: perihelio 64) (P Jun 2010) Un objeto de masa $ m_1 $ se encuentra situado en el origen de coordenadas, mientras que un segundo objeto de masa $ m_2 $ se encuentra en un punto de coordenadas $(8, 0) \text{ m} $. Considerando únicamente la interacción gravitatoria y suponiendo que son masas puntuales, calcula: 1) La relación entre las masas $ m_1/m_2 $ si el campo gravitatorio en el punto $(2, 0) \text{ m} $ es nulo. 2) El módulo, dirección y sentido del momento angular de la masa $ m_2 $ con respecto al origen de coordenadas si $ m_2 = 200 \text{ kg} $ y su velocidad es $(0, 100) \text{ m/s} $ Sol: 1) $ m_1/m_2 = 1/9 $; 2) $ 160000 \frac{\text{kg}}{\text{m}^2} \text{s} $ 65) (C Sept 2010) Explica brevemente el significado de la velocidad de escape. ¿Qué valor adquiere la velocidad de escape en la superficie terrestre? Calcúlala utilizando exclusivamente los siguientes datos: el radio terrestre $ = 6,4 \cdot 10^6 \text{ m} $ y la aceleración de la gravedad $ g = 9,8 \text{ m/s}^2 $. Sol: $ 11200 \text{ m/s} $ 66) (P Sept 2010) Un satélite se sitúa en órbita circular alrededor de la Tierra. Si su velocidad orbital es de $ 7,6 \cdot 10^3 \text{ m/s} $, calcula: a) El radio de la órbita y el periodo orbital del satélite. b) La velocidad de escape del satélite desde ese punto. Utilizar exclusivamente estos datos: aceleración de la gravedad en la superficie terrestre $ g = 9,8 \text{ m/s}^2 $; radio de la Tierra $ R = 6,4 \cdot 10^6 \text{ m} $. Sol: 1) $ 6,96 \cdot 10^{10} \text{ m}; 5745 \text{ s} $; 2) $ 10748 \text{ m/s} $ 67) (P Jun 2011) Se quiere situar un satélite en órbita circular a una distancia de 450 km desde la superficie de la Tierra. A) Calcula la velocidad que debe tener el satélite en esa órbita. b) Calcula la velocidad con la que debe lanzarse desde la superficie terrestre para que alcance esa órbita con esa velocidad (supón que no actúa rozamiento alguno). Datos: Radio de la Tierra. $ R_T = 6370 \text{ km} $; masa de la Tierra. $ M_T = 5,9 \cdot 10^{24} \text{ kg} $; $ G = 6,67 \cdot 10^{-11} \text{ Nm}^2/\text{kg}^2 $ Sol: a) $ 7596 \text{ m/s} $; b) $ 8115 \text{ m/s} $ 68) (C Sept 2011) Suponiendo que el planeta Neptuno describe una órbita circular alrededor del Sol y que tarda 165 años terrestres en recorrerla, calcula el radio de dicha órbita. Datos: $ G = 6,67 \cdot 10^{-11} \text{ Nm}^2/\text{kg}^2 $; masa del Sol. $ M_S = 1,99 \cdot 10^{30} \text{ kg} $ Sol: $ 4,5 \cdot 10^{12} \text{ m} $ 69) (P Sept 2011) La distancia entre el Sol y Mercurio es de $ 58 \cdot 10^6 \text{ km} $ y entre el Sol y la Tierra es de $ 150 \cdot 10^6 \text{ km} $. Suponiendo que las órbitas de ambos planetas alrededor del Sol son circulares, calcula la velocidad orbital de: a) La Tierra. b) Mercurio. Justifica los cálculos adecuadamente. Sol: a) $ 29886 \text{ m/s} $; b) $ 48061 \text{ m/s} $ 70) (C Sept 2011) El Apolo 11 fue la primera misión espacial tripulada que aterrizó en la Luna. Calcula el campo gravitatorio en el que se encontraba el vehículo espacial cuando había recorrido $ 2/3 $ de la distancia desde la Tierra a la Luna (considera sólo el campo originado por ambos cuerpos). Datos: Distancia Tierra-Luna, $ d = 3,84 \cdot 10^5 \text{ km} $; masa de la Tierra, $ M_T = 5,9 \cdot 10^{24} \text{ kg} $; masa de la Luna, $ M_L = 7,4 \cdot 10^{22} \text{ kg} $; $ G = 6,67 \cdot 10^{-11} \text{ Nm}^2/\text{kg}^2 $. Sol: $ -5,7 \cdot 10^{-3} \text{ N/kg} $ 71) (C Jun 2012) El módulo del campo gravitatorio de la Tierra en su superficie es una constante de valor $g_0$. Calcula a qué altura $h$ desde la superficie el valor del campo se reduce a la cuarta parte de $g_0$. Realiza primero el cálculo teórico y después el numérico, utilizando únicamente este dato: radio de la Tierra, $R_T = 6370$ km. Sol: $R = R_T = 6370$ km 72) (C Jun 2012) Se sabe que la energía mecánica de la Luna en su órbita alrededor de la Tierra aumenta con el tiempo. Escribe la expresión de la energía mecánica de la Luna en función del radio de su órbita, y discute si se está alejando o acercando a la Tierra. Justifica la respuesta prestando especial atención a los signos de las energías. Sol: $E_m = -\frac{1}{2} G M m / r$; Se está alejando. 73) (P Sept 2012) La estación espacial internacional gira alrededor de la Tierra siguiendo una órbita circular a una altura $h = 340$ km sobre la superficie terrestre. Deduce la expresión teórica y calcula el valor numérico de: a) La velocidad de la estación espacial en su movimiento alrededor de la Tierra. ¿Cuántas órbitas completa al día? b) La aceleración de la gravedad a la altura a la que se encuentra la estación espacial. Datos: Constante de gravitación universal $G = 6,67 \cdot 10^{-11}$ N.m$^2$/kg$^2$; radio de la Tierra $R = 6400$ km; masa de la Tierra $M = 6 \cdot 10^{24}$ kg Sol: a) $7705$ m/s; $15,72$ vueltas /día; b) $8,81$ m/s$^2$ 74) (C Sept 2012) La velocidad de escape de un objeto desde la superficie de la Luna es de $2375$ m/s. Calcula la velocidad de escape de dicho objeto desde la superficie de un planeta de radio 4 veces el de la Luna y masa 80 veces la de la Luna. Sol: $10621$ m/s 75) (P Jun 2013) En el mes de febrero de este año, la Agencia Espacial Europea colocó en órbita circular alrededor de la Tierra un nuevo satélite denominado Amazonas 3. Sabiendo que la velocidad de dicho satélite es de $3072$ m/s, calcula: a) La altura $h$ a la que se encuentra desde la superficie terrestre (en km). b) Su periodo (en horas). Datos: constante de gravitación universal, $G = 6,67 \cdot 10^{-11}$ N.m$^2$/kg$^2$; masa de la Tierra, $M_T = 6 \cdot 10^{24}$ kg; radio de la Tierra, $R_T = 6400$ km Sol: a) $3,6 \cdot 10^4$ km, b) $24,1$ hr 76) (C Jun 2013) Para escalar cierta montaña, un alpinista puede emplear dos caminos diferentes, uno de pendiente suave y otro más empinado ¿Es distinto el valor del trabajo realizado por la fuerza gravitatoria sobre el cuerpo del montañero según el camino elegido? Razona la respuesta. Sol: no 77) (C Jul 2013) La energía cinética de una partícula se incrementa en $1500$ J por la acción de una fuerza conservativa. Deduce razonadamente la variación de la energía mecánica y la variación de la energía potencial, de la partícula. Sol: $\Delta E_m = 0$; $\Delta E_p = -1500$ J 78) (P Jul 2013) Tres planetas se encuentran situados, en un cierto instante, en las posiciones representadas en la figura, siendo $a = 10^5$ m. Considerando que son masas puntuales de valores $m_2 = m_3 = 2m_1 = 2 \cdot 10^{21}$ kg, calcula: El vector campo gravitatorio originado por los 3 planetas en el punto $O(0,0)$ m. El potencial gravitatorio (energía potencial por unidad de masa) originado por los 3 planetas en el punto $P(a,0)$ m. Datos: constante de gravitación universal, $G = 6,67 \cdot 10^{-11}$ N.m$^2$/kg$^2$ Sol: a) $-6,67 \vec{r}$ N/kg, b) $-2,22 \cdot 10^5$ J/kg 79) (C Jun 2014) La Luna tarda 27 días y 8 horas aproximadamente en completar una órbita circular alrededor de la Tierra, con un radio de $3,84 \cdot 10^5$ km. Calcula razonadamente la masa de la Tierra. Dato: constante de gravitación universal, $G = 6,67 \cdot 10^{-11}$ N.m$^2$/kg$^2$ Sol: $6,01 \cdot 10^{24}$ kg 80) (C Jun 2014) Nos encontramos en la superficie de la Luna. Ponemos una piedra sobre una báscula en reposo y ésta indica $1,58$ N. Determina razonadamente la intensidad de campo gravitatorio en la superficie lunar y la masa de la piedra sabiendo que el radio de la Luna es $0,27$ veces el radio de la Tierra y que la masa de la Luna es $1/85$ la masa de la Tierra. Dato: aceleración de la gravedad en la superficie terrestre, $g_{TIERRA} = 9,8$ m/s$^2$ Sol: $1,58$ m/s$^2$; $1$ kg 81) (C Jul 2014) El planeta Tatooine, de masa $m$, se encuentra a una distancia $r$ del centro de una estrella de masa $M$. Deduce la expresión de la velocidad del planeta en su órbita circular alrededor de la estrella y razona el valor que tendría dicha velocidad si la distancia a la estrella fuera $4r$. Sol: $v_2 = \frac{1}{2} v_1$ 82) (C Jul 2014) Un objeto de masa $m_1 = 4m_2$ se encuentra situado en el origen de coordenadas, mientras que un segundo objeto de masa $m_2$ se encuentra en un punto de coordenadas $(9,0)$ m. Considerando únicamente la interacción gravitatoria y suponiendo que son masas puntuales, calcula razonadamente: a) El punto en el que el campo gravitatorio es nulo. b) El vector momento angular de la masa $m_2$ con respecto al origen de coordenadas si $m_2 = 100$ kg y su velocidad es $\vec{v}(0,50)$ m/s. Sol: a) $P(6,0)$ m; b) $\vec{L} = 45000 \vec{k}$ kg·m$^2$/s	<urn:uuid:cb5dbe2f-d618-48df-a6c4-1e454640370a>	HuggingFaceFW/finepdfs/tree/main/data/spa_Latn/train	finepdfs	spa_Latn	33,645
Sente Sente Sente Sente SENTE työraportteja 16/2007 Special Working Paper on Self-Renewal Capacity Kaupunkiseutujen kehitys ja itseuudistuminen Käsitteellistä perustaa etsimässä Juha Kostiainen Alueellisen kehittämisen tutkimusyksikkö Kaupunkiseutujen kehitys ja itseuudistuminen Käsitteellistä perustaa etsimässä Juha Kostiainen Johdanto 1. Osaamispohjaisen talouden kehittymisen myötä innovaatioista on tullut keskeinen taloudellisen kasvun lähde. Globaalissa kilpailussa kilpailuetu riippuu korkeammasta tuottavuudesta eli paremmasta suhteesta muuntaa panokset tuotoksiksi. Tämä voi perustua alhaisempaan panoshintaan, muuntoprosessin tehokkuuteen tai tuotoksen korkeampaan lisäarvoon, joka tulee innovaatioista. (Himanen 2007, 12-13.) Innovaatioiden merkityksen korostuessa myös ymmärrys niiden luonteesta on syventynyt. On huomattu, että innovaatio liittyy kaikkeen liiketoimintaan, ei vain korkean teknologian yrityksiin tai ylipäätään teolliseen toimintaan. Innovaatio liittyy myös julkiseen palvelutuotantoon. Erityisesti palveluinnovaatioihin näyttää pätevän se, että tarvittavan uuden tiedon lähteet eivät välttämättä liity mitenkään edes systemaattiseen tutkimus- ja kehittämistoimintaan, vaan radikaalitkin innovaatiot voivat perustua organisaation sisäisen hiljaisen tiedon yhdistämiseen vapaasti ulkopuolelta saatavan tiedon kanssa (Maliranta & Ylä-Anttila 2007, 10). Chesbrouhg'n (2003) lanseeraama avoimen innovaation malli onkin siirtämässä painopistettä pois yrityksen sisäisistä prosesseista. Hänen mukaansa oleellisempaa kuin keskittyminen vain yrityksen sisäisiin innovaatioprosesseihin on työskennellä osaavien ihmisten kanssa, olivatpa he sitten yrityksen sisällä tai ulkopuolella ja hyödyntää aktiivisesti yrityksen ulkoista T&K:a (emt. 2003, xxvi). Loppukäyttäjien tärkeydestä muistutti von Hippel jo vuonna 1988 puhuessaan lead usereiden merkityksestä (von Hippel 1988). Democratization of Innovation -teoksessaan (2005, 1) hän kehittelee teemaa edelleen todeten, että satoja vuosia vallinnut valmistaja-keskeinen innovaatiomalli on tullut tiensä päähän ja että loppukäyttäjät - kuluttajat tai yritykset - ovat yhä kykenevämpiä innovoimaan itse. Leonard (2007, 154) on tuonut esiin suunnittelijoiden roolin aktiivisina harrastajina ja lopputuotteiden kokeilija-kehittäjinä. Lash (2002) on puolestaan nostanut esiin disorganisaatiot, eräänlaiset itseorganisoituvat heimot tai rihmastot, joissa monet uudet ideat kehittyvät ennen kuin ne siirtyvät jonkin muodollisen organisaation kehitysprosessiin. Lester ja Piore (2004) erottavat toisistaan analyyttisen innovaatioprosessin - selkeä tavoite, aikataulu, budjetti ja osavaiheet - sekä tulkinnallisen innovaatioprosessin, jossa pikemminkin tiedetään etenemissuunta, mutta jossa lopputuloksesta ei ole selkeää käsitystä. Todella uuden luominen edellyttää heidän mukaansa nimenomaan tulkinnallisen prosessin hyödyntämistä. Innovaatioiden luonteen paremman ymmärtämisen myötä myös tietämys innovaatioiden ja innovaatioympäristöjen suhteesta on jalostunut. Castells (1996) osoitti kiistattomasti paikkojen strategisen roolin globaalissa virtojen tilassa. Nonakan kumppaneineen (Nonaka & Takeuchi 1995, Nonaka & Konno 1998) kehittämä SECI-malli ja Ba-konsepti toivat esiin fyysisen läsnäolon tärkeyden uuden tiedon luomisessa. Himanen (2007) on taas empiirisellä aineistolla osoittanut, että innovaatiot todellakin keskittyvät tiettyihin paikkoihin, ja itse asiassa ovat tehneet niin jo Sokrateen ajoista lähtien. Aluetieteessä on pitkään kehitetty erilaisia teorioita ja lähestymistapoja - innovatiiviset miljööt, alueelliset innovaatiojärjestelmät, oppivat alueet jne. - joissa on pyritty osoittamaan paikallisen toimintaympäristön merkitys innovaatioiden synnylle 1 . Florida (2002, 2005) nosti keskiöön osaavat ihmiset, hänen termeillään luovan luokan, joka on ratkaiseva joukko osaamispohjaisessa taloudessa, ja sitä kautta osa paikkojen vetovoimaa. Floridan ydinväitteen voisi kiteyttää siten, että enää ihminen ei seuraa työtä, vaan työ seuraa ihmistä. Kaupunkiseudut eivät kilpailekaan pelkästään investoinneista, vaan yhä enemmän ihmisistä, mikä pakottaa kehittämään myös asuin- ja elinympäristöistä entistä kiinnostavampia. Suomessa innovaatiopolitiikkaa on harjoitettu aktiivisesti noin neljännesvuosisata. Melko pitkään pääpaino on ollut teknologisissa innovaatioissa ja teollisissa yrityksissä. Innovaatiopolitiikkaa on leimannut kansallisen hallinnoinnin näkökulma (Kostiainen & Sotarauta 2000). Paikallinen kehittäminen on karkeasti ottaen seurannut käsitystä innovaatioiden luonteesta. Teknologiakeskuksia ryhdyttiin rakentamaan 1980-luvulla teknillisten yliopistojen ja tiedekuntien läheisyyteen, koska innovaatioiden ajateltiin olevan pääasiassa teknologisia. Uusia ideoita haudottiin hautomoissa. 1990-luvun puolivälissä lanseerattiin kansallinen osaamiskeskusohjelma, joskin edelleen viime kädessä valtioneuvosto päätti mikä kaupunkiseutu on minkäkin alan osaamiskeskus. Kun käsitys innovaatioiden luoneesta kehittyi ja paikkojen merkitystä ymmärrettiin paremmin, ryhdyttiin kaupunkiseuduilla kokoamaan laajoja ohjelmia, joissa pyrittiin systemaattisemmin verkottamaan yrityksiä, julkista hallintoa ja tutkimusta. Ensimmäinen tämänkaltainen ja kansainvälistäkin huomiota saanut ohjelma oli eTampere 132 miljoonan euron budjetteineen 2 . Viimeisimpänä ja jo kuluttajien merkityksen innovaatioissa tunnistavana seuraavan sukupolven ohjelmana on mainittava Forum Virium Helsinki 3 . Oleellista näille ohjelmille on, että ne ovat paikallisesti synnytettyjä ja pääosin paikallisesti rahoitettuja ja toimivat ilman kansallista ohjausta tai statusta. Inovaatioprosessien tunnistettu monimuotoisuus, globalisoituva kilpailu niin yritysten kuin kaupunkiseutujenkin välillä sekä inhimillisten ja aineellisten resurssien yhä suurempi liikkuvuus luovat paineita kaupunkiseutujen innovaatiopolitiikan uudistamiselle. Innovaatiopolitiikkaa joudutaan toteuttamaan toimintaympäristössä, jossa muutos on yhä nopeampaa ja kompleksisempaa. Perinteisiä keinoja - innovaatio- ja elinkeinostrategioita, kehittämisyhtiöitä ja -ohjelmia sekä erillisaloitteita - tarvitaan varmasti edelleen, mutta samalla tarvitaan myös uusia ja dynaamisempia tapoja vastata muutokseen. Pysyvässä muutoksessa erityisesti systeemin kyky jatkuvaan itseuudistumiseen muodostuu tärkeäksi. Siis kyky sekä sopeutua joustavasti muuttuvaan ympäristöön että suunnata nopeasti politiikkaa uusien mahdollisuuksien ilmaantuessa. 1 Katso esimerkiksi Kostiainen (2002a) ja Lagendijk (2006). 2 Ohjelman yksityiskohdista katso esimerkiksi Kostiainen (2001). 3 Katso www.forumvirium.fi (1.9.2007). Käsillä olevassa artikkelissa kaupunkiseutujen innovaatiopolitiikkaa lähestytään evolutionäärisen taloustieteen näkökulmasta pyrkien hyödyntämään sen tarjoamia oppeja alueellisessa viitekehyksessä. Erityisesti paneudutaan itseuudistumisen kapasiteettiin, itseuudistumisen edellytyksiin ja itseuudistumisen vahvistamiseen. Luvussa kaksi avataan evolutionäärisen taloustieteen teoriaa ja lähestymistapoja, luvussa 3 käsitellään itseuudistumista ja luku 4 on yhteenvetoluku. Evolutionäärinen taloustiede ja talousmaantiede 2. Evolutionäärisen taloustieteen perustajana voidaan pitää itävaltalaista taloustieteilijää Joseph Schumpeteriä. Hänen keskeisiä ajatuksiaan oli luovan tuhon periaate, mikä tarkoittaa talouden uudistumista yrittäjävetoisten innovaatioiden kautta ja epäkelpojen yritysten ja tuotteiden poistumista markkinoilta. Schumpeterin mukaan talous on jatkuvassa kehittymisen tai kehkeytymisen (evolve) tilassa (Boschma & Martin 2007, 537). Evolutiivisen taloustieteen keskeisiä kehittäjiä Scumpeterin jälkeen ovat olleet mm. Richard Nelson, Sidney Winter, Christoffer Freeman ja Giovanni Dosi 4 . Essletzbichler ja Rigby (2007, 551) jakavat evolutionääriset lähestymistavat kolmeen eri "strategiatyyppiin". Ensimmäinen strategiatyyppi hyödyntää uusdarwinistista luonnon valinnan teoriaa ja soveltaa sitä inhimilliseen käyttäytymiseen ollen lähellä sosio-biologiaa. Koska ihmiset ovat luonnonvalinnan tuotteita ja talous on inhimillistä toimintaa, viime kädessä taloudellinen käyttäytyminen voidaan kytkeä yksilöiden geneettiseen kuntoisuuteen. Toinen strategiatyyppi puolestaan käyttää darwinistisia käsitteitä puhtaasti heuristisessa ja metaforisessa mielessä. Käsitteitä tuodaan metaforisen inspiraation lähteeksi ja niiden avulla rakennetaan analogiaa biologian ja taloustieteiden välille. Tämä strategia on laajasti käytössä evolutionäärisessä taloustieteessä. Kolmas strategiatyyppi perustuu yleiseen darwinismiin (Generalized Darwinism) ja lähtee siitä, että evoluution pääperiaatteet tarjoavat yleisen teoreettisen viitekehyksen, jonka avulla evolutiivista muutosta voidaan ymmärtää eri aloilla ja erilaisissa systeemeissä. Periaatteiden merkitys ja niiden toimintatapa on kuitenkin spesifiä kullekin alalla tai systeemille. Viime vuosina aluetieteessä on mielenkiinnon kohteeksi noussut evolutionäärinen talousmaantiede, jonka pyrkimyksenä on soveltaa evolutionäärisen taloustieteen oppeja aluetasolla. Uutta lähestymistapaa ollaan vasta kehittämässä, eikä mitään yhtenäistä teoriaa ole vielä olemassa. Yleisellä tasolla määriteltynä voidaan sanoa, että evolutiivinen lähestymistapa talousmaantieteessä tarkoittaa keskittymistä niihin prosesseihin, joiden myötä taloudellinen maisema (landscape) eli tuotannon, jakelun ja kulutuksen spatiaalinen organisoituminen muuttuu ajan kuluessa (Boschma & Martin 2007, 539). Kaupunkiseudut puolestaan pyrkivät vaikuttamaan taloudellisen maiseman muuttumiseen itsensä kannalta edulliseen suuntaan, ja yhä keskeisempi vaikuttamiskeino on innovaatiopolitiikka. Taloudellisen maiseman muutoksen nopeutuessa innovaatiopolitiikan mielenkiinnon kohteeksi on nousemassa itseuudistuminen. Tähän asti kehittelyssä on hyödynnetty lähinnä Nelsonin ja Winterin (1982) teoriaa yhdistettynä uusdarwinilaisiin analogioihin ja metaforiin kuten vaihtelu, valinta, uutuus ja perimä (Martin & Sunley 2007, 537). Essletzbichler ja Rigby (2007, 551-552) pitävät kuitenkin edellä mainittua kolmatta strategiatyyppiä kaikkein kiinnostavimpana talousmaantieteen kannalta, koska yleisen darwinismin periaatteiden soveltaminen talouden dynamiikkaan tarjoaa mahdollisuuden uudenlaiseen näkemykseen taloudellisen maiseman historiallisesta muutoksesta. 4 Keskeisiä teoksia ovat esimerkiksi Nelson & Winter (1982) sekä Dosi ym. (1988). Uusdarwinistinen tai ylipäätään evoluutiobiologiaan liittyvä viitekehys ei ole kuitenkaan ainoa mahdollinen evolutiivinen näkökulma talousmaantieteeseen. Martin ja Sunley (2007) lähestyvätkin evolutionääristä taloustiedettä kompleksisuusajattelun kautta. Kompleksisuusajattelun tai -teorian juuret ovat systeemiteoriassa. Ståhle (2004, 227-228) jakaa systeemiajattelun kolmeen eri paradigmaan. Ensimmäinen paradigma liittyy mekaanisiin järjestelmiin ja keskittyy universaaleihin lakeihin. Tässä paradigmassa systeemit nähdään konemaisina järjestelminä. Toinen paradigma perustuu avointen systeemien yleiseen teoriaan, jota on kehittänyt varsinkin von Bertalanffy. Avoimet systeemit ovat ympäristönsä kanssa kommunikoivia, jatkuvasti kehittyviä organismeja. Kolmas paradigma keskittyy systeemin sisäiseen ja omaehtoiseen dynamiikkaan. Siinä systeemi nähdään äärimmäisen kompleksisena kokonaisuutena, jonka normaalitila on tasapainoton tai kaoottinen. Systeemiajattelun paradigmoja on kuvattu tarkemmin taulukossa 1. Taulukko 1. Systeemiajattelun paradigmat (Ståhle 2004, 228). \| Paradigma \| Alkuperä \| Ominaisuus \| Tutkimusintressi \| \|---\|---\|---\|---\| \| I - suljetut systeemit \| Newton \| staattinen, deterministinen, mekaaninen \| periaatteet, sään- nönmukaisuudet, lainalaisuudet \| \| II - avoimet systeemit \| von Bertalanffy \| tasapainoinen, itseohjautuva, elävä \| palauteprosessit, muutokset, adaptoituminen \| \| III - dynaamiset systeemit \| Lorenz, Progine, Maturana, Varela \| epätasapaino, kompleksisuus, kaoottisuus \| itseorganisoitumi- nen, itseuudistu- minen, systeemin sisäinen dynamiikka \| Kaupunkiseudun innovaatiopolitiikan ja itseuudistumisen kannalta kiinnostavia ovat erityisesti kolmannen paradigman systeemit, joiden avulla voidaan selittää radikaaleja muutoksia ja innovaatioita. Martin ja Sunley (2007, 585) toteavat, että kaupunkeja voidaan tarkastella itseorganisoituvina kompleksisina systeemeinä, jos ne ovat voimaakkasti vuorovakutteisia ja jos toimijoiden välinen riippuvuus (interdependence) on luonteeltaan globaalia. Keskeisiä teoreetikkoja dynaamisten systeemien osalta ovat olleet erityisesti Prigogine, joka on kehittänyt itseorganisoituvien systeemien teoriaa 5 , Maturana ja Varela, autopoieettiset systeemit 6 , sekä Luhmann, joka on laajentanut teorian sosiaalisiin systeemeihin 7 . Kaupunkiseudun innovaatiopolitiikkaa voidaan lähestyä nimenomaan sosiaalisena systeeminä. Perinteisen taloustieteen ja "kompleksisuustaloustieteen", kuten Beinhocker (2006) sitä kutsuu, erot voidaan nyt kiteyttää taulukon 3 mukaisesti. 5 Katso Prigogine & Stengers (1984). 6 Katso Maturana & Varela (1987). 7 Katso Luhmann (1995). Taulukko 2. Perinteisen taloustieteen ja "kompleksisuustaloustieteen" eroja (Beinhocker 2006, 97). Kaupunkiseutujen kehittämisen ja innovaatiopolitiikan näkökulmasta, jos ja kun kaupunkiseutu nähdään kompleksisena systeeminä, keskeinen kysymys on intentionaalisen toiminnan eli aktiivisten kehittämispyrkimysten suhde emergenttiin kehitykseen ja sopeutumiseen. Emergentti kehitys tarkoittaa uusien ominaisuuksien syntymistä ikään kuin tyhjästä itseorganisoitumisen tuloksena systeemin osien ja kokonaisuuden vuorovaikutuksen seurauksena (Sotarauta & Kosonen 2004, 25-26). Ovatko strategiat ja politiikat turhia, jos kehitys on emergenttiä ja nousee lukemattomista mikrotason päätöksistä ja vuorovaikutustilanteista? Sotarauta (2005, 13) lähtee siitä, että emergentti kehitys painottaa sopeutumista, kun taas politiikkaintentiot painottavat päämäärähakuisuutta tai tarkoituksellisuutta. Emergenssi ja politiikkaintentiot ovat hänen mukaansa evolutiivisessa vuorovaikutuksessa tai yhteisevoluutiossa keskenään, ja tuon yhteisevoluution ytimessä on itseuudistumisen kapasiteetti, jonka luonteeseen paneudumme seuraavassa luvussa. Itseuudistuminen 3. Itseuudistumisen kapasiteetti 3.1 Kaupunkiseutujen innovaatiopolitiikan tai perinteisemmin elinkeinopolitiikan näkökulmasta toimintaympäristön kehitystä voidaan tarkastella sekä muutoksen luonteen että muutoksen nopeuden näkökulmasta. Kuvassa 1 on hahmotettu itse muutoskenttää sekä kehittämispolitiikkoja suomalaisesta näkökulmasta. Muutoksen nopeus Kompleksinen/ systeeminen Yksinkertainen/ lineaarinen Nopea Hidas Elinkeinoyhtiöt, kehittämisyhtiöt, teknologiakeskukset Strateginen suunnittelu: maakuntastrategiat, elinkeinostrategiat, osaamiskeskukset Itseuudistumisen kapasiteetti Yrityskohtaiset interventiot, neuvonta, toimitilat Muutoksen luonne Kuva 1. Kaupunkiseudun innovaatiopolitiikan muuttuva toimintaympäristö 8 . Muutoksen ollessa yksinkertainen ja lineaarinen ja muutosnopeuden ollessa hidasta kaupunkiseutujen kehittämispolitiikat perustuivat yrityskohtaisiin interventioihin, erilaisiin neuvontapalveluihin sekä toimitilojen tarjontaan. Erityisesti 1970- ja 1980 -luvuilla harjoitettiin tämänkaltaista elinkeino- ja kehittämispolitiikkaa 9 . Muutosnopeuden lisääntyessä pyrittiin joustavampiin toimintamuotoihin ja nopeampaan reagointiin aivan kuten suurissa yrityksissäkin siirryttiin "corporate entrepreneurship" -tyyppisiin ratkaisuihin, joissa vastuuta ja valtaa annettiin tulosyksiköille (Doz & Kosonen 2007). Kaupunkiseuduilla tällaisia ratkaisuja olivat esimerkiksi elinkeino- ja kehittämisyhtiöiden perustaminen sekä teknologiakeskusten rakentaminen. Muutoksen luonteen kompleksisoituessa niin yritysmaailmassa (Doz & Kosonen 2007) kuin kaupunkiseuduillakin siirryttiin strategiseen suunnitteluun. Esimerkiksi Tampereella näin tehtiin 1990-luvun lopulla (Kostiainen & Sotarauta 2003). Myös valtakunnallinen osaamiskeskusohjelma voidaan katsoa yritykseksi vastata kompleksiseen muutokseen strategisen suunnittelun keinoin. Kun muutos on sekä nopeaa että kompleksista, strateginen suunnittelu tai useaksi vuodeksi valitut osaamispainotukset eivät kuitenkaan ole riittävän dynaamisia työkaluja muutoksen hallintaan. Doz & Kosonen (2007) tarjoavat yrityksille strategista ketteryyttä, kaupunkiseutujen näkökulmasta itseuudistumisen kapasiteetti tarjoaa mahdollisuuden muutoksen hallintaan tai ehkä pikemminkin muutoksen kanssa elämiseen. Sotarauta (2005, 14) määrittelee itseuudistumisen kapasiteetin kyvykkyyksien kokonaisuudeksi, joka on kohdistettu itsensä uudistamiseen jatkuvassa prosessissa. Kysymys on kyvykkyyksistä, jotka mahdollistavat uudistumisen nopeasti ja systeemisesti muuttuvassa ympäristössä. Kaupunkiseudun innovaatiopolitiikan näkökulmasta itseuudistumisen tekee haasteelliseksi toimijoiden monimuotoisuus. Innovaatiopolitiikkaa määritellään ja toteutetaan usean eri toimijan toimesta, ei vain yhden organisaation. Itseuudistumisen kapasiteetin vahvistaminen tarkoittaa käytännön tasolla sellaisten prosessien ja toimintamallien kehittämistä, jotka antavat mahdollisuuden tuottaa Sotaraudan ja Srinivasin (2005, 4) sanojen mukaan suunnattua emergenssiä (directed emergence). Ajatuksena on siis se, että politiikkaintentioilla voitaisiin ohjata emergenttiä kehitystä. 8 Nelikenttää ovat käyttäneet Doz ja Kosonen (2007) kuvatakseen kehittämäänsä strategisen ketteryyden lähestymistapaa. Heidän sovelluksensa on kuitenkin tehty yrityksille. 9 Suomalaisen paikallisen elinkeinopolitiikan historiasta katso esim. Linnamaa (1998). Itseuudistumisen perusedellytykset 3.2 Ståhle (2004, 246-247) esittää Luhmanniin tukeutuen kompleksisten systeemien itse-uudistumisen perusedellytykset. Nämä ovat kaksoisriippuvuus, informaation laatu ja kollektiivisesti tuotettujen merkitysten luonti. Sosiaalisten suhteiden laatu on olennaista systeemin itseuudistumisen kyvylle. Toisin sanoen osallistujien tulee kohdata toisensa samalla tasolla. Molemminpuolinen riippuvuus täytyy tunnustaa, ja riski luottamussuhteiden muodostamisessa tulee ottaa huomioon ja toimia sen pohjalta. Sinänsä kaksoisriippuvuus ei edellytä yhteisiä arvoja, symboleita tai edes konsensusta. Välttämätön ja riittävä ehto vuorovaikutukselle on molemminpuolinen luottamus ja tunnustettu riippuvuussuhde. Aivan liian usein kaupunkiseutujen kehittämisessä pohditaan yhteisiä arvoja strategiatyön perustaksi, etsitään yhteistä visiota ja sitoutumista päämääriin, kun riittävää ja hyödyllistä olisikin keskittyä kommunikaation edellytyksiin ja hyväksyä moniäänisyys ja -muotoisuus. Kommunikaatio eli informaation vaihto on edellytys systeemin toiminnalle, koska vain kommunikointi tuottaa toimintaa, mutta se ei vielä takaa itseuudistumista. Itseuudistuminen riippuu vaihdettavan informaation laadusta. Informaation tulee olla laadultaan sellaista, että se liittyy puhujan omaan kokemukseen ja herättää samalla kokemuksen kuulijassa. Kokemuksellinen informaatio vaikuttaa systeemin ihmisiin ja samalla muuttaa systeemin tilaa. Informaatio, joka ei muuta systeemin tilaa, on tässä mielessä merkityksetöntä. Itseuudistumisen kolmas perusedellytys liittyy merkityksiin. Merkityksiä luodaan kollektiivisesti systeemin sisällä, yhdessä tuotettujen tapahtumien seurauksena. Merkitykset eivät ole koskaan täysin valmiita, eikä niitä siksi voida siirtää suoraan muille. Merkitysten luonti vaatii kaksoisriippuvuussuhteita, jotka vuorostaan tuottavat toimintaa. Kaikki systeemin operaatiot perustuvat merkityksille ja merkitykset ohjaavat toimintaa. Luhmannilaisille sosiaalisille systeemeille on lisäksi ominaista se, että ne vaihtavat informaatiota ympäristönsä kanssa, mutta ne voivat säädellä informaation vaihtoa avaamalla ja sulkemalla systeemin rajoja tarpeen mukaan (Ståhle 2004, 244). Itseuudistumisen keskeiset perusedellytykset liittyvät kommunikaatioon, luottamukseen sekä informaation laatuun ja merkitykseen. Mitään yhtä yhteistä strategiaa tai toimintasuunnitelmaa ei kuitenkaan tarvita. Pikemminkin sellaiset syntyvät aidossa mielessä eli vapaaehtoisen sitoutumisen myötä toimijoiden välisessä kommunikaatiossa itseohjautuvasti, jos ovat syntyäkseen. Itseuudistumisen toiminnot 3.3 Itseuudistumisen perusedellytykset eivät anna vielä kovinkaan paljon suuntaviivoja innovaatiopolitiikan kehittämiseksi, vaikka korostavatkin kommunikaatiota. Askeleen lähemmäksi pääsemme paneutumalla niihin toimintoihin ja prosesseihin, joihin itseuudistumisen kapasiteetti perustuu. Sotaraudan (2005, 14) mukaan itseuudistumisen kapasiteetti perustuu uuden etsintään (exploration), ongelmanratkaisuun, imeytymiseen (absorption), integraatioon sekä johtajuuteen. Nämä toiminnot voidaan intentionaalisesti suunnitella tulevaisuutta varten, mutta ne ovat myös sopeutumisen välineitä (emt., 13). Voidaan oikeastaan sanoa, että itseuudistuminen tapahtuu näiden yleisten toimintojen myötä tai kautta. Innovaatiopolitiikan näkökulmasta uuden etsimistä eli radikaalisti uusien ratkaisujen etsimistä täytyy harjoittaa useilla tasoilla kuten kaupunkiseudun tasolla, klustereiden tasolla, yritysten tasolla ja ehkäpä teknologioidenkin tasolla. Etsiminen kurkottaa olemassa olevan osaamisperustan ulkopuolelle ja edellyttää pääsyä uuden tiedon lähteille kaupunkiseudun ulkopuolella. Bathelt ym. (2002) ovat kiteyttäneet paikallisen kehittämisen ytimen siten, että tarvitaan sekä paikallista pörinää (buzz) että globaaleja kanavia (pipelines) erilaisiin valintaympäristöihin, jotka avaavat erilaisia mahdollisuuksia ja jotka ruokkivat paikallisia tulkintoja. Mitä enemmän esimerkiksi yhden klusterin yritykset luovat tällaisia kanavia, sitä enemmän informaatiota siirtyy niiden paikallisiin verkostoihin. Samaan suuntaa viittaa Asheim (2006, 50) puhuessaan hajautetuista tietoverkostoista ja niiden tärkeydestä. Nämä verkostot voivat olla joko monikansallisten yritysten eri toimipaikkojen välisiä tai eri puolille maailmaa hajautuneiden tutkijayhteisöjen välisiä. Vaikka monissa tapauksissa hiljaisen tiedon merkitys korostuukin, näiden verkostojen avulla saatavalla kodifioidulla tiedolla on edelleen merkitystä varsinkin aloilla, jotka perustuvat historiallisiin teknologisiin trajektoreihin. Niin sisäisistä kuin ulkoisistakin lähteistä olevaa tietoa on tulkittava ja annettava mahdollisuus uuden luomiseen. Sitä varten tarvitaan tulkitsevia tai Lesterin ja Pioren (2004) termein julkisia tiloja. Lesterin ja Sotaraudan (2007, 33) mukaan erityisesti yliopistot voivat toimia tällaisina tiloina, joissa alueen toimijat arvioivat itse alueen ja sen monien toimijoiden tilaa ja etsivät uusia tulevaisuuden kehityskulkuja. Ongelmanratkaisu 10 puolestaan perustuu olemassa olevan tietämysperustan ja tyypillisesti analyyttisen innovaatioprosessin hyödyntämiseen selkeästi määriteltyine tavoitteineen. von Hippel (2005) kyseenalaistaa tämän tyyppisen innovaatioajattelun kyvyn tuottaa uusia innovaatioita. Varsinkin kun asiakkaat eivät ole läheskään aina kykeneviä määrittelemään tarpeitaan. Tosin menetelmät piilevien tarpeiden tunnistamiseen ovat kehittyneet 11 . Jo aikaisemmin mainituista innovaatioprosesseista analyyttinen prosessi vastaa ongelmanratkaisun tarpeisiin, sen sijaan tulkinnallinen prosessi uuden etsimisen tarpeisiin. Taulukossa 3 on kiteytetty eri prosessien tunnusomaiset piirteet. Taulukko 3. Innovaatioprosessien päätyypit ja niiden tunnuspiirteet (Lester & Piore 2004). Uuden etsimisen ohella tarvitaan myös kykyä tunnistaa ulkopuolisen tiedon arvo, sulauttaa se olemassa olevaan tietoperustaan sekä soveltaa sitä kaupallisiin tarkoituksiin. Tätä kutsutaan imeyttämiseksi (absorption). Toimijoiden ympäristössä on jatkuvasti monenlaista tietoa, mutta oleellista on osata ottaa siitä haltuun vain oman toiminnan kannalta merkityksellinen. Imeyttämiskyky liittyy yrityksen (tai organisaation) jo hallussa olevaan tietoon, koska tiedolla on taipumus kumuloitua. (Saarivirta 2007, 6.) 10 Itseuudistumiseen perustuvan innovaatiopolitiikan käsitteellisessä jatkokehittämisessä olemme siirtyneet käyttämään termiä hyödyntäminen, joka ehkä kuvaa vielä paremmin sitä, että toimitaan olemassa olevan osaamisperustan varassa. 11 Katso esimerkiksi Leonard (2007). Integraatio viittaa kaikkiin niihin toimintoihin ja prosesseihin, jotka mahdollistavat moninaisen informaation, erilaisten toimijoiden sekä niiden kompetenssien ja resurssien yhdistämisen sopeutumisen ja alueellisen kilpailukyvyn edistämiseksi (Sotarauta 2005, 19). Saarivirta (2007, 7) liittää integraatioon myös sosiaalisen pääoman ja katsoo sen vahvistavan itseuudistumista. Integraatioon kuuluvat myös kehittämistoimintaa raamittavat instituutiot sekä erilaisiin verkostoihin kuuluminen. Ilman johtajuutta itseuudistumisen kapasiteetti jää staattiseksi ja pelkäksi tyhjäksi kuoreksi. Johtajuus tässä yhteydessä on nähtävä "driving force" -tyyppisenä energian synnyttäjänä ja visioiden luojana, mikä tarjoaa uuden etsimiselle, ongelmanratkaisulle, imeyttämiselle ja integraatiolle suunnan. Kaupunkiseudun kehittämisessä johtajuuden täytyy ylittää organisaatioiden, instituutioiden ja kulttuurien väliset rajat voidakseen orkestroida ponnistuksia emergenssin ja suunnittelun välisellä kapealla kannaksella. (Sotarauta 2005, 20.) Itseuudistumisen toiminnot ovat kaupunkiseudulle juurtuneita innovaatioita edistäviä käytäntöjä. Näitä toimintoja tarvitaan eri tasoilla ja eri organisaatioissa, mutta yksiselitteisesti ei voida sanoa missä ne sijaitsevat tai kenen niistä pitäisi vastata. Siitä huolimatta niitä voidaan tietoisesti suunnitella. Johtajuuskin on luonteeltaan verkostojen johtamista, jossa johtajuus ei sinänsä kuulu itseoikeutetusti kenellekään. "Kompleksisuustaloustieteen" näkökulmasta tässä ei ole mitään ongelmaa, perinteisen hallinnollisen ajattelun näkökulmasta taas on. Itseuudistuminen ja toimialarakenne 3.4 Asheim (2006, 14) korostaa, että alueellinen kehittäminen tulee ymmärtää evolutiivisena prosessina, joka perustuu teknologisiin kehityspolkuihin, ja jotka myös rajoittavat kehitysmahdollisuuksia. Tästä syystä muutokset toimialarakenteessa ja innovaatiokyvykkyydessä ottavat aikaa. Hänen mukaansa kaupunkiseutujen kilpailukykyä on aktiivisesti kehitettävä ja seuraavan sukupolven kehittämiskonseptiksi hän tarjoaa alueellisen edun rakentamista (constructing regional advantage). Alueellisen edun rakentamiseen liittyy tavoiteltava toimialarakenne ja erilaisten tietämysperustojen tunnistaminen. Toimialarakenteen osalta keskustelua on perinteisesti käyty kahden pääsuunnan välillä: erikoistuminen ja monipuolisuus. Moss Kanter (1995) toi uuden näkökulman keskusteluun ehdottamalla, että kaupunkiseutujen pitäisi erikoistua tuotannolliseen osaamiseen (competence), uusien innovaatioiden kehittämiseen (concepts) tai kansainväliseen kauppaan ja muuhun välittämiseen (connections). Himanen (2007, 13) tarkastelee asiaa Suomen näkökulmasta ja vaatii absoluuttisen johtajuuden saavuttamista spesifeillä alueilla. Asheim (2006, 46) suosittelee yhteenkietoutuneen moninaisuuden (related variety) tavoittelua. Hän tekee eron yhteenkietoutuneen moninaisuuden, joka mahdollistaa spill over -efektin, ja ei-yhteenkietoutuneen moninaisuuden (unrelated variety) välille, joka tarkoittaa riskien jakoa panostamalla erilaisiin toimialoihin. Yhteenkietoutuneessa moninaisuudessa tavoitellaan rakennetta, jossa osaamiset ja toimialat ovat toisiaan täydentäviä, jolloin riskien hajauttamisen ohella voidaan saavuttaa positiivisia ulkoisvaikutuksia. Alueen taloudellista perustaa laajennetaan olemassa olevaan osaamisperustaan nojautuen. Siitä huolimatta uusien toimialojen ja klustereiden kehittyminen saattaa kestää kymmeniä vuosia (Kostiainen & Sotarauta 2003). Yhteenkietoutuneessa moninaisuudessakin on globaalista kilpailusta johtuen tavoiteltava absoluuttista johtajuutta, kysymys on viime kädessä vain määrittelyjen kapeudesta. Yhteenkietoutunut moninaisuus tarjoaa itseuudistumiselle enemmän tilaa ja mahdollisuuksia kuin erillisten toimialojen portfolio. Erilliset toimialat ovat todennäköisemmin teknologisten kehityspolkujen vankeja, kun taas yhteenkietoutuneiden toimialojen rajapinnoilla avautuu mahdollisuus emergenttiin ja yllättävään kehitykseen. Itseuudistumisen suunniteltuja toimintoja taas tarvitaan näiden mahdollisuuksien hyödyntämiseksi. Innovaatiopolitiikan työkaluja kehitettäessä toimiala- ja osaamisrakenteen ohella on tunnistettava niiden taustalla olevat tietämysperustat, jotka johtavat huomattavan erilaisiin innovaatioprosesseihin. Asheim (2006, 49) on tunnistanut kolme erilaista tietämysperustaa taulukon 4 mukaisesti. Taulukko 4. Kolme erilaista tietämysperustaa (Asheim 2006, 49). \| Analyyttinen \| Synteettinen \| \|---\|---\| \| Uuden tiedon luomiseen perustuva innovaatio \| Olemassa olevan tiedon soveltamiseen tai yhdistelyyn perustuva innovaatio \| \| Keskeistä deduktiivisiin proses- seihin ja formaaleihin malleihin perustuva tieteellinen tieto \| Keskeistä sovellettu ongelmasi- donnainen tieto perustuen usein induktiivisiin prosesseihin \| \| Tutkimuslaitosten ja yritysten T&K-osastojen välinen yhteistyö \| Vuorovaikutteinen oppimi- nen asiakkaiden ja toimittajien kanssa \| \| Hallitseva tiedon muoto kodi- fioitu; dokumentit, patentit ja julkaisut \| Hallitseva tiedon muoto hiljai- nen; tekemiseen, käytöntöihin ja kädentaitoihin liittyvä tieto \| Analyyttisen tietämysperustan aloja ovat vaikkapa bioteknologia ja lääketeollisuus, joissa T&K jo pelkästään lainsäädännöstä ja erilaisista viranomaishyväksymisistä johtuen (esim. CE, FDA) on tiukasti kodifioitua. Synteettisen tietämysperustan aloja ovat esimerkiksi autoteollisuus ja rakentaminen ja symbolisen tietämysperustan aloja esimerkiksi markkinointiviestintä ja elokuvateollisuus. Käytännössä kaikilla toimialoilla on piirteitä jokaisesta tietämysperustan tyypistä, mutta kysymys on lähinnä hallitsevasta tietämysperustasta. Sovellettaessa open innovation- ja lead user-tyyppisiä konsepteja on syytä harkita niiden sopivuutta ao. tietämysperustaan. On esimerkiksi vaikea kuvitella mitä tarkoittaisi kuluttajavetoinen innovointi lääketeollisuudessa. Joka tapauksessa erilaisten tietämysperustojen tunnistaminen avaa näkemään innovaatiomahdollisuuksia muuallakin kuin teollisuudessa ja pakottaa myös suunnittelemaan itseuudistumisen toimintoja eri perustat huomioiden. Tietämysperustojen sisällä innovaatioprosessit ovat luonteeltaan toisistaan poikkeavia, mutta eri tietämysperustoista nousevien toimialojen välisillä tietoisesti rakennettavilla kytkennöillä luodaan edellytyksiä itseuudistumiselle. Kytkennät voivat olla luonteeltaan teknologisia kuten ICT:n soveltaminen tai materiaalitieteellinen osaaminen tai liiketoiminnan logiikkaan ja liiketoimintamalleihin liittyviä. 10 Itseuudistumisen vahvistaminen ja innovaatiopolitiikan käytännön 3.5 kehittämistyökalut Itseuudistumisen kapasiteetin vahvistaminen on seuraavan sukupolven innovaatiopolitiikan ydintä, eivät pelkästään erilaiset ohjelmat, strategiat tai palveluprosessit, vaikka niitäkin edelleen tarvitaan. Kommunikaation lisääminen jo itsessään vahvistaa itseuudistumista, ja itseuudistumisen perustoimintoja on kehitettävä jatkuvasti. Kommunikaation edellytyksien vahvistamiseen uusia ajatuksia voi etsiä esimerkiksi jo mainitun nonakalaisen Ba-konseptin suunnasta 12 . Itseuudistumista voidaan vahvistaa myös sellaisilla uusilla toiminnoilla ja työkaluilla, joita aikaisemmin ei ole ollut laajasti käytettävissä. Alla on lyhyesti kuvattu muutamia mielenkiintoisia ja uusia kehittämisen työkaluja. Kehitysalustat 3.5.1 Kehitysalustat ovat innovaatioympäristöjä, jotka kokoavat yhteen tuotteiden ja palveluiden tarjoajat, jotka kehittävät niitä yhdessä kehittäjien kanssa, sekä niitä hyödyntävät loppukäyttäjät. Kehitysalustojen kaksi päätyyppiä ovat testbedit ja living labit. Rönkä ym. (2007, 9) määrittelevät testbedin toiminnallista ja/tai teknologista tuote- ja palveluinnovointia varten rakennetuksi innovaatioympäristöksi, jossa tuotteiden ja palveluiden teknologia on kehittämisen keskipisteessä. Loppukäyttäjät ja muut kehittäjätahot ovat mukana avustavassa roolissa. Testbedien ideana on todentaa teknologian toimivuus. Esimerkkejä suomalaisista testbedeistä ovat RFID Lab Finland ja Well Life Center. Sen sijaan living labit ovat aitoja elämisen ympäristöjä, jotka on valjastettu innovaatiokäyttöön. Living labin keskipisteessä on tuotteen tai palvelun loppukäyttäjä aidossa käyttötilanteessa. Muut kehittämiseen liittyvät toimijat, kuten tuotteiden ja palveluiden tarjoajat sekä mahdolliset kehittäjät tukevat omilla toimillaan loppukäyttäjien pyrkimyksiä tuoda esille tuotteen tai palvelun käyttöön liittyviä ideoita ja ajatuksia. (emt., 9.) Suomalaisia living labeja ovat esimerkiksi Arabianranta Helsingissä sekä ainakin osittain Forum Virium Helsinki 13 . Myös jo päättyneessä eTampere-ohjelmassa oli living lab -piirteitä. Eurooppalaisten living labien verkosto, European Network of Living Labs, toteaa, että living labien pyrkimyksenä on kehittää nimenomaan ICT-pohjaisia tuotteita ja palveluita 14 . Jatkossa living labien hyödyntämistä on paikallaan harkita myös esimerkiksi asumisen kehittämisessä. Asheim (2006, 51) puhuu yleisemmällä tasolla kehitysalustoista termillä policy platforms, tarkoittaen sillä "joukkoa erilaisia instrumentteja sisältäen ja integroiden avainkomponentteja useilta politiikkalohkoilta". Politiikka-alustojen ideana on ylittää perinteiset sektorirajat ja tukea yhteenkietoutuneen monimuotoisuuden kehittymistä. Nopeassa ja kompleksisessa muutoksessa ei ole mahdollista operoida vain erillisillä toimiala- ja klusterikohtaisilla kehittämisaloitteilla, vaan on myös luotava yleisempiä alustoja, joiden sisällä voidaan toteuttaa spesifejä kehittämisaktiviteetteja. Esimerkiksi Tampereella eTampere, BioNext ja LuovaTampere -ohjelmien kokemusten pohjalta olisi mahdollista rakentaa yleispätevämpi politiikka-alusta. Itseuudistuminen toteutuu siten suunnittelun (alusta) ja emergentisti nousevan teeman, ongelman tai mahdollisuuden (sisältö) yhdistyessä. 12 Ba-konseptin soveltamisesta kaupunkiseutujen kehittämiseen katso Kostiainen (2002b). 13 Tarkemmat kuvaukset suomalaisista testbedeistä ja living labeista katso Rönkä ym. (2007). 14 http://www.cdt.ltu.se/projectweb/4421cddc626cb/Index.html (2.9.2007). 11 Julkiset hankinnat 3.5.2 Monissa maissa julkinen hallinto on suuri tilaaja ja tuotteiden ja palveluiden loppukäyttäjä. Toimimalla aktiivisena loppukäyttäjänä se voi olla osaltaan edistämässä innovaatioiden syntyä. Euroopan valtiot käyttävät vuosittain yli 170 miljardia euroa julkisiin hankintoihin, mutta tästä vain yksi prosentti käytetään tutkimukseen ja kehittämiseen, kun vastaava osuus Yhdysvalloissa on 15 prosenttia (Rönkä ym. 2007, 16) Rothwell pohdiskeli jo vuonna 1992 julkisten toimijoiden mahdollisia rooleja innovaatioprosessissa, joita voivat olla: vaikuttaminen emergoivien teknologioiden kehityspolkuihin -- toimia itse keksijänä -- olla aloitteellinen uusien teknologisten ratkaisujen etsinnässä radikaalisti uusiin ongelmiin -- olla tietolähteenä uusien ja esiinnousevien tarpeiden osalta -- toimia yhteistyössä T&K-projekteissa -- Kuvatut roolit ovat edelleen ajankohtaisia. Rahoituksellisessa mielessä julkiset hankinnat ovat sikälikin kiinnostavia, että niiden avulla voidaan edistää uusia innovaatioita ilman erillisrahoitusta ikään kuin osana normaalia julkisen hallinnon toimintaa. Lisäksi hyvin nopeasti päästään suuriin projektivolyymeihin, jos yksittäisiä hankintoja voitaisiin ajatella tässä mielessä projekteina. Hyvän esimerkin julkisten hankintojen myönteisestä kehityksestä tarjoaa valtion Tiehallinto, joka on tarjouskilpailuissaan siirtynyt pelkän hintakilpailun sijaan ns. laatupisteiden käyttöön antaen näin tilaa toimijoiden innovaatioille. Asia ei ole julkishallinnolle täysin uusi, esimerkiksi Tampereen kaupungin elinkeinostrategiassa vuodelta 1998 (Tampereen… 1998) todettiin mainittu näkökulma, mutta todennäköisesti se jäikin vain toteamiseksi. Tosin vuoden 2007 alusta käyttöönotettu tilaaja-tuottaja-malli tukeekin paremmin kuvatun kaltaista ajattelua. Helsingin kaupungin uudessa elinkeinostrategiassa (Yritysmyönteiseksi… 2007) on asia myös nostettu esiin innovatiivisten hankintojen nimellä ja käytännön toteutuksiinkin kaupunki näyttäisi olevan valmis Forum Viriumin puitteissa, esimerkkinä vaikkapa Terveellinen kaupunginosa -hanke 15 . Itseuudistumisen näkökulmasta "innovatiiviset hankinnat" luovat systemaattisesti käytettynä hajautetun ja useita klustereita tai toimialoja koskevan sisäänrakennetun mallin edistää uusien tuotteiden ja palveluiden kehittämistä. Hyvä puoli on helposti saavutettava suuri volyymi ja keskitetyn sisällöllisen ohjauksen puuttuminen. Ongelmanratkaisun lisäksi voidaan päästä myös uuden etsimisen alueelle hankintayksikön luovuudesta riippuen. Osallistuminen ja neloskierre 3.5.3 Maankäyttö- ja rakennuslaki määrittelee osallistumisen periaatteet kaavoituksen ja uusien alueiden kehittämisen yhteydessä. Tosin pienenä epäkohtana voidaan mainita, että varsinaiset loppukäyttäjät eli tulevat asukkaat eivät ole lain mukaan osallisia (Kuronen & Majamaa 2006, Majamaa et al. 2007a). Osallistumisen saatua kuitenkin virallisen statuksen on keskustelu laajentunut koskemaan osallisuutta myös muuhun julkiseen toimintaan, erityisesti palvelutuotantoon 16 . Pohjimmiltaan kysymys on siis samasta asiasta, josta esimerkiksi von Hippel (2005) puhuu, eli hyödynnetään loppukäyttäjien innovaatiopotentiaalia. Julkisten hankintojen ohella huomattavaa innovaatiopotentiaalia 15 Katso www.forumvirium.fi (1.9.2007) 16 Katso esimerkiksi Tampereen kaupungin strategia Kaikem paree Tampere. 12 liittyy julkisten palveluiden kehittämiseen käyttäjänäkökulmasta. Living lab -tyyppiset kehitysalustat tarjoavat yhden käytännön sovelluksen. Asumisen kehittämisestä aidosta loppukäyttäjänäkökulmasta hyvän esimerkin tarjoaa Espoon Nupurinkartano (Majamaa et al. 2007b). Kun innovaatiopolitiikkaan yhdistetään "perinteisten elementtien" eli yritysten, yliopistojen ja julkisen hallinnon lisäksi ajatus loppukäyttäjistä kuluttajana ja osallistuvana kansalaisena, voidaan esittää ajatus neloskierteestä (Rönkä et al. 2007, 60; katso myös Sotarauta ym. 2007), jossa eri osat toimivat systeemisessä vuorovaikutuksessa. Kuva 2. Neloskierre eli kehittäjien, hyödyntäjien, julkisen hallinnon ja käyttäjien yhteistyöroolit innovaatioprosessissa (Rönkä ym. 2007, 60). Work, live & play -rooleissa Yritykset, yhteisöt Kunta, valtio Korkeakoulut, Kibs-toimijat, järjestöt Käyttäjälähtöisyyden kehittäminen, Käyttäjätarpeet ja -arvostukset Kansalaisvaikuttaminen, Kunnallispolitiikka, Aluevaikuttaminen T&K-hankkeet (rahoitus), Julkiset hankinnat, Yritysten kilpailukyky, PK-yritysten tukeminen, Infrastruktuuri, Palvelujen mahdollistaminen T&K-hankkeet, Työvoiman koulutus, Kaupallistaminen, Kansainvälistyminen, Yrittäjyys Markkinointi, Myynti, Kaupallistaminen, Kuluttajatrendit Tutkimusrahoitus, Koulutusrahoitus, Kv-tuki, Yrittäjyystuki KÄYTTÄJÄT MAHDOLLISTAJAT HYÖDYNTÄJÄT KEHITTÄJÄT Work, live & play -rooleissa Yritykset, yhteisöt Kunta, valtio Korkeakoulut, Kibs-toimijat, järjestöt Käyttäjälähtöisyyden kehittäminen, Käyttäjätarpeet ja -arvostukset Kansalaisvaikuttaminen, Kunnallispolitiikka, Aluevaikuttaminen T&K-hankkeet (rahoitus), Julkiset hankinnat, Yritysten kilpailukyky, PK-yritysten tukeminen, Infrastruktuuri, Palvelujen mahdollistaminen T&K-hankkeet, Työvoiman koulutus, Kaupallistaminen, Kansainvälistyminen, Yrittäjyys Markkinointi, Myynti, Kaupallistaminen, Kuluttajatrendit Tutkimusrahoitus, Koulutusrahoitus, Kv-tuki, Yrittäjyystuki KÄYTTÄJÄT MAHDOLLISTAJAT HYÖDYNTÄJÄT KEHITTÄJÄT Yllä esitetty neloskierre-viitekehys tunnistaa julkishallinnon roolin innovatiivisten hankintojen toteuttajana ja uusien palveluiden mahdollistajana, huomioi myös osallistumisen näkökulman sekä nostaa loppukäyttäjät tasavertaiseksi toimijaryhmäksi. Viitekehystä on täydennettävä korostamalla globaaleja yhteyksiä (Bathelt ym. 2002) ja globaalisti hajautettuja tietoverkostoja (Asheim 2006). Aivan kuten innovatiivisten hankintojenkin osalta ottamalla kuluttaja-kansalaiset mukaan julkisten palveluiden kehittämiseen voidaan moninkertaistaa mahdollisuudet palveluinnovaatioiden syntymiseen. Kysymys on tietysti myös kaupunkiseutujen vetovoimasta; monimuotoistuviin tarpeisiin ei voida vastata universaalimallilla ja standardipalveluilla, vaan yhdessä kehitettävillä erilaistuvilla palveluilla. Yhteenveto 4. Kaupunkiseudun innovaatiopolitiikan näkökulmasta keskeisiä muutosvoimia ovat: innovaatioiden merkityksen korostuminen talouskasvun lähteenä -- innovaatioprosessien kehittyminen tuottajalähtöisistä ja analyyttisistä prosesseista kohti käyttäjäve- -toisia ja tulkinnallisia prosesseja innovaatiotoimintojen globaali keskittyminen vetovoimaisimpiin paikkoihin ja paikkojen välinen -globaali kilpailu vetovoimakilpailun painopisteen siirtyminen investoinneista ja organisaatioista ihmisiin -- 13 Lisäksi suomalaisesta näkökulmasta kuvaan tulevat mukaan alhainen ulkomaalaisväestön osuus (Kostiainen 2007), paheneva työvoimapula sekä julkisen talouden, erityisesti kuntatalouksien tiukkuus sosiaali- ja terveysmenojen kasvaessa. Nopeasti ja systeemisesti muuttuvassa toimintaympäristössä perinteiset kehittämiskeinot eivät pelkästään riitä. Tarvitaan samanaikaista kykyä sopeutua emergenttiin kehitykseen sekä toteuttaa tavoitteellisia politiikkoja. Emergenssi ja tavoitteellisuus kehkeytyvät yhteisevoluutioissa. Innovaatiopolitiikan kannalta keskeinen kaupunkiseudun kyvykkyys on itseuudistumisen kapasiteetti, jonka avulla voidaan parhaimmillaan päästä suunnattuun emergenttiin kehitykseen. Itseuudistumisen perusedellytykset liittyvät kommunikaatioon, luottamukseen ja informaation laatuun. Itseuudistuminen toteutuu, toimii tai tapahtuu perustoimintojen avulla tai myötä, jotka ovat uuden etsiminen, ongelmanratkaisu, imeyttäminen, integraatio ja johtaminen. Toimintoja voidaan ja niitä pitää suunnitella tietoisesti. Suunnittelussa on tunnistettava tavoiteltava toimialarakenne ja erilaiset tietämysperustat. Käytännön kehittämistyökaluista kiinnostaviksi nousevat erilaiset kehitysalustat, esimerkiksi living labit ja testbedit, mutta myös yleisemmät politiikka-alustat, jotka mahdollistavat sektorirajat ylittävien aktiviteettien toteuttamisen. Myös osallistumisen ja julkisten hankintojen kehittämisellä voidaan vahvistaa itseuudistumista. Käsillä olevassa artikkelissa on etsitty teoreettista pohjaa itseuudistumisen kapasiteetille ja itseuudistumisen vahvistamiselle evolutionäärisen taloustieteen ja kompleksisuusajattelun suunnasta. Itseuudistumisen keskeiset edellytykset on tunnistettu ja joitakin käytännön kehittämissuuntia on esitetty. Teoria vaatii edelleen kehittämistä ja käsitteellistä työtä ollakseen soveltamiskelpoinen aluetasolla. 14 Lähteet ASHEIM, B. (2006). Constructing Regional Advantage. Principles – perspectives -policies. Euroopan Komissio, Brysseli. BATHELT, H. & MALMBERG, A. & MASKELL, P. (2002). Clusters and Knowledge: Local Buzz, Global Pipelines and the Process of Knowledge Creation. DRUID Working Papers No 02-12. BEINHOCKER, E. (2006). The Origin of Wealth: Evolution, Complexity and the Radical Remaking of Economics. Random House, London. BOSCHMA, R. & MARTIN, R. (2007). Editorial: Constructing an evolutionary economic geography. Journal of Economic Geography 7, s. 537-548. CASTELLS, M. (1996). The Rise of the Network Society – The Information Age: Economy, Society and Culture. Blackwell Publishers. CHESBROUGH, H. (2003). Open innovation. The Imperative for Creating and Profiting from Technology. Harvard Business School Press. DOSI, G. & FREEMAN, C. & NELSON, R. & SILVERBERG, G. & SOETE, L. (1988) (toim.) Technical Change and Economic Theory. Pinter Publishers. DOZ, Y. & KOSONEN, M. (2007). Esitys Strategic Agility -konferenssissa, Helsingin kauppakorkeakoulu, 26-27.6.2007. ESSLETZBICHLER, J. & RIGBY, D. (2007). Exploring evolutionary economic geographies. Journal of Economic Geography 7, s. 549-571. FLORIDA, R. (2002). The Rise of the Creative Class. Basic Books, New York. FLORIDA, R. (2005). The Flight of the Creative Class. Basic Books, New York. HIMANEN, P. (2007). Suomalainen unelma. Teknologiateollisuuden 100-vuotissäätiö, Helsinki. von Hippel, E. (1988). The Sources of Innovation. Oxford University Press, New York. von Hippel, E. (2005). Democratizing Innovation. Saatavilla osoitteesta http://web.mit.edu/evhippel/www/books. htm. (1.9.2007) Kaikem paree Tampere. Tampereen tasapainoinen kaupunkistrategia vuoteen 2016. Kaupunginvaltuuston hyväksymä 22.6.2005. KOSTIAINEN, J. (2001). eTampere – Generating Growth through Collaboration. Teoksessa Kasvio, A. & Laitalainen, V. & Salonen, H. & Mero, P. (toim.) Cities and the New Information Economy. Materials from an international Conference in Helsinki 14.-15.12.2000. Palmenia-kustannus, Helsinki. KOSTIAINEN, J. (2002a). Urban Economic Development Policy in the Network Society. Tekniikan Akateemisten Liitto, Helsinki. (väitöskirja) KOSTIAINEN, J. (2002b). Learning and the "Ba" in the Development Network of an Urban Region. European Planning Studies , Vol 10, No. 5, s. 613-631. KOSTIAINEN, J. (2007). Esitys Catellan seminaarissa 13.7.2007. Saatavilla osoitteesta www.juhakostiainen.net. (1.9.2007) KOSTIAINEN, J. & SOTARAUTA, M. (2000). Kansallisesta hallinnoinnista kohti innovatiivisten toimintaympäristöjen luomista. Teoksessa Sotarauta, M. & Kostiainen, J. (toim.) Kaupunkiseudut innovatiivisina toimintaympäristöinä. Tekniikan Akateemisten Liitto, Helsinki. KOSTIAINEN, J. & SOTARAUTA, M. (2003). Great Leap or Long March to Knowledge Economy: Institutions, Actors and Power in the Development of Tampere, Finland. European Planning Studies, Vol. 11, No. 4, s. 415-438. KURONEN, M & MAJAMAA, W. (2006). The Problem of Future Inhabitants. CIRM 2006 Contemporary Issues in Retail Marketing - Destinations and locations: Exploring the Multiple Identities of Place, 6th and 7th September, Manchester Metropolitan University, England. LAGENDIJK, A. (2006). Learning from Conceptual Flow in Regional Studies: Framing Present Debates, Unbracketing Past Debates. Regional Studies Vol 40, No 4, s. 385-399. LASH, S. (2002). Critique of Information. Sage Publications. LEONARD, D. (2007). Market Research in Product Development. In Ichijo, K. & Nonaka, I. (eds.) Knowledge Creation and Management. Oxford University Press. LESTER, R. & PIORE, M. (2004). Innovation-The Missing Dimension. Harvard University Press, Cambridge. 15 LESTER, R. & SOTARAUTA, M. (2007). Yliopistot, innovaatio ja alueiden kilpailukyky: Huomioita ja johtopäätöksiä "Local Innovation System-projektista". In Lester, R. & Sotarauta, M. (toim.) Universities, Industrial Innovation and Regional Economic Development. A Report of Local Innovation Systems Project. Industrial Performance Center, MIT, Cambridge. LINNAMAA, R. (1998). Paikallinen elinkeinopolitiikka ja verkostojen haaste. Tampereen yliopisto. Aluetieteen ja ympäristöpolitiikan laitos. Julkaisematon lisensiaatin tutkimus. LUHMANN, N. (1995). Social Systems. Stanford University Press; Stanford, California. MAJAMAA, W. & KOSTIAINEN, J. & KURONEN, M. (2007a). Residential housing based on consumer's lifestyles. XXXV World Congress on Housing Science 4-7th September 2007, Melbourne, Australia. MAJAMAA, W. & KUROEN, M. & RAISBECK P. & HEYWOOD C. (2007b). Future inhabitants in urban development process in Finland. Hyväksytty julkaistavaksi 8/2007 International Journal of Housing Markets and Analysis. MALIRANTA, M. & YLÄ-ANTTILA, P. (2007). Tavoitteet ja teoriatausta. Teoksessa Maliranta, M. ja Ylä-Anttila, P. (toim.) Kilpailu, innovaatio ja tuottavuus. Taloustieto Oy, Helsinki. MARTIN, R. & SUNLEY, P. (2007). Complexity thinking and evolutionary economic geography. Journal of Economic Geography 7, s. 573-601. MATURANA, H. & VARELA, F. (1987). The Tree of Knowledge: The biological roots of human understanding. New Science Library, Boston. MOSS KANTER, R. (1995). World Class. Simon & Schuster, New York. NELSON, R. & WINTER, S (1982). An evolutionary Theory of Economic Change. The Belknap Press of Harvard University Press, Cambridge. NONAKA, I. & TAKEUCHI, H. (1995). The Knowledge-Creating Company. Oxford University Press. NONAKA, I. & KONNO, N. (1998). The Concept of "Ba": Building a Foundation for Knowledge Creation. California Management Review, Vol. 40, No. 3, spring 1998, s. 40-54. PRIGOGINE, I. & STENGERS, I. (1984). Order out of chaos: Man's dialogue with nature. Bantam, New York. ROTHWELL, R. (1992). Issues in user-producer relations: role of governement. Paper prepared for Six Countries Programme Conference on: User Producer Relations in the Innovation Process. Dipoli Congress Centre, Espoo, Finland. 26-27.11.1992. RÖNKÄ, K. & ORAVA, J. & NIITAMO, V-P. & MIKKELÄ, K. (2007). Kehitysalustoilla neloskierteeseen. Käyttäjälähtöiset living lab- ja testbed-innovaatioympäristöt. Culminatum Oy ja TEKES. SAARIVIRTA, T. (2007). In Search of Self-Renewal Capacity. Defining concept and its theoretical framework. Sente Työpapereita 10/2007. Tampere. SOTARAUTA, M. (2005). Resilient City-Regions - Mission Impossible? The Tales from Finland and Beyond about how to Build Self-Renewal Capacity. Observatory Pascal. Place management, Social Capital anf Lifelong Learning. Saatavilla osoittesta http://www.obs-pascal.com/resources/markkusotarautaaugust2005.pdf. (1.9.2007) SOTARAUTA, M. & KOSONEN, K-J. (2004). Strategiarituaaleja koneistoyhteiskunnassa vai dynaamisia prosesseja tietämystaloudessa. Teoksessa Sotarauta, M. & Kosonen, K-J. (toim.) Yksilö, kulttuuri ja innovaatioympäristö. Avauksia aluekehityksen dynamikkaan. Tampere University Press, Tampere. SOTARAUTA, M. & SRINIVAS, S. (2005). The Co-evolution of Policy and Economic Develoment. A Discussion on Innovative Regions. Massachusetts Institute of Technology, Industrial Permformance Center, Special working paper series on local innovation systems. SOTARAUTA, M. & KOSONEN, K-J. & VILJAMAA, K. (2007). Aluekehittäminen generatiivisena johtajuutena - 2000-luvun aluekehittäjän työnkuvaa ja kompetensseja etsimässä. Tampereen yliopisto, Alueellisen kehittämisen tutkimusyksikkö, Sente-julkaisuja 23/2007. STÅHLE, P. (2004). Itseuudistumisen dynamiikka: Systeemiajattelu kehitysprosessien ymmärtämisen perustana. Teoksessa Sotarauta, M. & Kosonen, K-J. (toim.) Yksilö, kulttuuri ja innovaatioympäristö. Avauksia aluekehityksen dynamikkaan. Tampere University Press, Tampere. Tampereen tulevaisuus on tiedossa. Kaupunkipolitiikan suuntaviivat 2000-luvulle. Elinkeinostrategia. 1998. Tampereen kaupunki. Yritysmyönteiseksi kumppaniksi - Helsingin elinkeinostrategia 2007. Helsingin talous- ja suunnittelukeskuksen julkaisuja 2/2007 16 Kaupunkiseutujen kehitys ja itseuudistuminen 17	<urn:uuid:cc0db1c4-b33e-4bb8-8b88-6d4ea4070803>	HuggingFaceFW/finepdfs/tree/main/data/fin_Latn/train	finepdfs	fin_Latn	50,790
For personal use only ASIAN CENTRE FOR LIVER DISEASES & TRANSPLANTATION 6A Napier Rd, Gleneagles Hospital Annexe Block #02-37 Singapore 258500 Tel: +65 6476-2088 Fax: +65 6476-3088 ASX-listed, Singapore-based liver centre ACLDT and US healthcare leader UPMC to collaborate on Comprehensive Transplant Centre (CTC) in Singapore Singapore, 15 December 2011 – Singapore-based and Australia-listed Asian Centre for Liver Diseases & Transplantation ("ACLDT") and UPMC ("UPMC"), a US$9 billion worldrenowned healthcare enterprise based in Pittsburgh, USA, announced today that they have signed an interim service agreement to collaborate to establish a Comprehensive Transplant Centre (CTC), to be owned and operated by ACLDT, to serve Asia and the Middle East. The proposed CTC will offer transplantation capabilities in liver, kidney, stem cell and bone marrow. This partnership will improve and enhance the existing capabilities of ACLDT in liver diseases and further offer kidney, stem cell and bone marrow transplant programmes with the technological expertise of UPMC. Being the first of its kind, the establishment of a Singapore-based CTC will advance and transform the way healthcare is provided in Asia. ACLDT is one of Asia‟s foremost Liver Centres with out-patient facilities and a dedicated in-patient Liver Ward and Intensive Care Unit to complement its successful Living Donor Liver Transplantation Programme thus providing seamless care for patients with liver diseases. Based in Gleneagles Hospital, it is the first private medical centre in South-east Asia to have performed close to 190 living donor liver transplants. UPMC is an integrated global healthcare enterprise based in Pittsburgh, Pennsylvania. With renowned centres of excellence in transplantation, cancer, neurosurgery, psychiatry, rehabilitation, geriatrics, and women‟s health, it is ranked among "America‟s Best Hospitals" by U.S. News & World Report. UPMC‟s Thomas E. Starzl Transplantation Institute in Pittsburgh is considered a pioneer in solid organ transplant procedures and it has performed more than 17,000 such operations, including liver, heart, kidney, multivisceral and hand. UPMC‟s Istituto Mediterraneo per i Trapianti e Terapie ad Alta Specializzazione (ISMETT) in Sicily is one of the leading organ transplant centres in Italy and the Mediterranean. Under the interim agreement, UPMC aims to share its expertise in delivering world-class healthcare, advanced technologies, including telemedicine and electronic medical records, and management skills with ACLDT. Amongst a number of public and private medical companies in Singapore, this collaboration is recognition of ACLDT‟s work and reputation in Asia in delivering high quality and standard of service to patients with liver and gastro diseases. "UPMC is world-renowned for its solid organ transplant expertise and advanced technology. ACLDT is greatly honoured to collaborate with one of the top medical institutions in the US. I believe this collaboration will elevate the quality of medical care For personal use only Media Release – ASX-listed, Singapore-based liver centre ACLDT and US healthcare leader UPMC to collaborate on Comprehensive Transplant Centre (CTC) in Singapore 15 December 2011 Page 2 of 4 _______________________________________________________________________________ and telemedicine in the region," said Dato‟ Dr Tan Kai Chah, ACLDT‟s lead surgeon and Executive Chairman. Dr Tan added that he expects the collaboration to help increase ACLDT‟s ability to handle more patients from the region, including the Middle East, widen its scope of transplant activities, raise the quality of clinical outcomes and improve operational efficiencies. "We are excited at the prospect of working with ACLDT‟s fine team of surgeons and physicians to establish comprehensive transplant care for more patients. This partnership in a new country for UPMC will generate knowledge and resources that support our healthcare mission in western Pennsylvania and beyond," said Mr Charles Bogosta, president of UPMC‟s International and Commercial Services Division. Mr Ted Tan, Deputy Chief Executive of SPRING Singapore said, "The partnership between ACLDT and UPMC is testament to Singapore small and medium enterprises (SMEs) having built up the necessary capabilities and reputation to partner worldrenowned enterprises. A key feature of this partnership is the cross-sector synergy between a healthcare provider like ACLDT and technology expertise in UPMC. Through ACLDT's strong foundation in liver transplants and UPMC's strength in clinical excellence, technology and innovation, both enterprises will reach out to a wider international market. SPRING Singapore hopes to see more SMEs exploring such collaborations for business growth and global excellence." "By strengthening capabilities through professional exchanges and access to innovation in medical technology, the collaboration between ACLDT and UPMC will broaden and deepen the suite of advanced medical care treatments for both local and international patients in Singapore. In addition, this partnership is expected to further entrench Singapore‟s reputation as a quality healthcare destination for advanced and patient-centric medical care," said Ms Melissa Ow, Assistant Chief Executive of the Singapore Tourism Board. The collaboration with UPMC is not expected to have any material impact on the Group‟s earnings and net assets for the financial year ending 31 August 2012. - End of Release - For personal use only 15 December 2011 Page 3 of 4 _______________________________________________________________________________ About Asian Centre for Liver Diseases & Transplantation Asian Centre for Liver Diseases & Transplantation ("ACLDT") was established in 1994 in Singapore. Today, it is one of Asia‟s foremost Liver Centres with out-patient facilities as well as a dedicated in-patient Liver Ward and Intensive Care Unit to complement its highly successful Living Donor Liver Transplantation (LDLT) Programme. ACLDT is led by renowned hepatobiliary expert and liver transplant surgeon, Dr Tan Kai Chah (Dr K C Tan), who started the Liver Transplant Programme at the King‟s College Hospital London, the UK. Together with a multi-disciplinary team of experienced specialist physicians and surgeons, Dr Tan developed it into one of the largest in Europe and performed many pioneering operations including the first „split-liver‟ transplant from a single donor to two recipients. ACLDT is the first private medical centre in South-east Asia to have performed close to 190 living donor liver transplants as at 30 Nov 2011. Dr K C Tan has personally performed more than 600 liver transplants. On average, ACLDT treats 8,000 patients a year, of which over 90% are international patients from South-east Asia, South Asia, Indochina, the Middle East and Russia. With a team of highly-trained specialists, state-of-the-art facilities and equipment, ACLDT is a one-stop specialist medical hub that provides seamless and comprehensive treatment for adults and children with liver and gastro diseases. Given the vast experience of ACLDT and its highly successful LDLT Programme, it has also become an important referral centre for treatment of acute liver failure and liver transplants. ACLDT was listed on the Australian Securities Exchange in September 2009 (ASX:AJJ). It opened its first overseas liver centre in Ho Chi Minh City, Vietnam, in September 2010. For further information, please visit www.asianlivercentre.com.sg Investor Relations contact: WeR1 Consultants Pte Ltd 38A Circular Road Singapore 049394 Tel: +65 6737 4844, Fax: +65 6737 4944 Josephine Auxilio, Email: email@example.com About UPMC UPMC is a US$9 billion global health enterprise with more than 54,000 employees headquartered in Pittsburgh, PA., and is transforming healthcare by integrating more than 20 hospitals, 400 doctors‟ offices and outpatient sites, a health insurance services division, and international and commercial services. Affiliated with the University of Pittsburgh Schools of the Health Sciences, UPMC is redefining healthcare by using innovative science, technology, and medicine to invent new models of accountable, cost-efficient, and For personal use only Media Release – ASX-listed, Singapore-based liver centre ACLDT and US healthcare leader UPMC to collaborate on Comprehensive Transplant Centre (CTC) in Singapore 15 December 2011 Page 4 of 4 _______________________________________________________________________________ patient-centered care. For more information on how UPMC is taking medicine from where it is to where it needs to be, go to www.UPMC.com. Investor Relations contact: UPMC - University of Pittsburgh Medical Center U.S. Steel Tower, 57th Floor 600 Grant St., Pittsburgh, PA 15219 Wendy Zellner Director, UPMC Media Relations Tel: +1 412-586-9777, Email: firstname.lastname@example.org	<urn:uuid:c869373b-f75a-4e78-bb59-47f3e4ae4201>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	8,977
DEPARTMENT OF DEFENSE FISCAL YEAR (FY) 2017 OVERSEAS CONTINGENCY OPERATIONS AMENDED REQUEST MILITARY PERSONNEL, ARMY JUSTIFICATION BOOK NOVEMBER 2016 2 The estimated cost of this report for the Department of Defense is approximately $6,384 for Fiscal Year 2016. This includes approximately $750 in expenses and approximately $5,634in DoD labor. TABLE OF CONTENTS MILITARY PERSONNEL OVERVIEW ARMY NATIONAL GUARD PERSONNEL COSTS MILITARY PERSONNEL OVERVIEW Introduction The FY 2017 amended Overseas Contingency Operations (OCO) Military Personnel request supports Operation Freedom's Sentinel (OFS), Operation Inherent Resolve (OIR) and European Reassurance Initiative (ERI) requirements. Support to OFS encompasses all actions to restore stability, support counter terrorism operations against the remnants of al Qaeda in Afghanistan, the Horn of Africa, the Philippines, and detainee operations on U.S. Naval Station Guantanamo Bay, Cuba. Support to OIR focuses on the operations to eliminate the Islamic State of Iraq and the Levant (ISIL). The Army's amended OCO request is primarily based on the Army's portion of the approximately 8,400 U.S. troops in Afghanistan, troops in other Southwest Asian countries engaged in support operations and, Soldiers remaining in Continental United States (CONUS) supporting combat operations in theater. The request funds pay, allowances, subsistence, and other personnel costs for Reserve Component (RC) Soldiers on Active Duty and incremental costs for deployed AC Soldiers. Requirements in support of ERI are to assure NATO allies and bolster the security and capacity of partners across the following lines of effort: [x] Increased U. S. military presence in Europe [x] Additional bilateral and multinational exercises and training with allies and partners [x] Further activities to build partner capacity for newer NATO members and other partners AC end strength funded in OCO concluded in FY 2015 as the strength drawdown will be at 490,000 at the end of FY 2015. Major Budget Drivers Military Pay Appropriation Manpower Drivers Manpower drivers include a combination of Active and Reserve Component requirements. FY 2015 includes actual execution, FY 2016 displays latest execution projections, and FY 2017 includes anticipated requirements based on updated FY 2016 forecasts. Requirements include: - Reserve Component on Active Duty - includes soldier deployed to Theater, as well as those remaining in CONUS supporting ongoing combat operations in Theater. - Deployed Active Component Soldiers – funds incremental deployment pays associated with Soldiers deployed in support of OFS, OIR and ERI. The following table reflects assumptions for mobilization: Average Strength Rate Changes The following rate assumptions were incorporated into the FY 2017 budget request: Pay Raise - The FY 2015 execution includes a 1.0% military pay raise, effective 1 January 2015 (1.0% over the fiscal year). - The FY 2016 request includes a 1.3% military pay raise, effective 1 January 2016 (1.2% over the fiscal year). - The FY 2017 request includes a 1.6% military pay raise, effective 1 January 2017 (1.5% over the fiscal year). Basic Allowance for Subsistence - The rate for subsistence, effective 1 January 2015, is 2.9% (2.6% over the fiscal year). - The rate for subsistence, effective 1 January 2016, is 0.1% (0.8% over the fiscal year). - The rate for subsistence, effective 1 January 2017, is 3.4% (2.6% over the fiscal year). Basic Allowance for Housing - The rate for Basic Allowance for Housing, effective 1 January 2015, is 1.4% (2.8% over the fiscal year). - The rate for Basic Allowance for Housing, effective 1 January 2016, is 1.3% (1.3% over the fiscal year). - The rate for Basic Allowance for Housing, effective 1 January 2017, is 2.9% (2.5% over the fiscal year). Retired Pay Accrual - Retired Pay Accrual as a percentage of Basic Pay is 31.4% for full-time and 23.0% for part-time Soldiers in FY 2016. - Retired Pay Accrual as a percentage of Basic Pay is 32.2% for full-time and 22.5% for part-time Soldiers in FY 2015. - Retired Pay Accrual as a percentage of Basic Pay is 29.5% for full-time and 23.6% for part-time Soldiers in FY 2017. Pre/Post Mobilization Training The request includes funding for Army Reserve National Guard (ARNG) and United States Army Reserve (USAR) requirements to provide pre-mobilization training necessary to maximize Boots On the Ground (BOG) time in theater, and provides resources for the post deployment activities that include the post deployment health reassessments and the Yellow Ribbon Reintegration Program (YRRP) programs. These programs are designed to ensure that Soldiers and their families are provided the information, services, referrals and outreach programs necessary for comprehensive Soldier fitness through all phases of the deployment cycle. Integrated Disability Evaluation Systems Impact on Readiness and Dwell The Integrated Disability Evaluation System (IDES) is the DoD management tool used to determine the disposition of a Service member who develops a medical condition that calls into question the member's ability to continue to serve in the military. The population of Soldiers in IDES negatively impacts the readiness of the Army. As the Army draws down its strength to 450,000 by FY 2018, throughput of the IDES population directly impacts the rate at which the Army can reduce strength. The Army is aggressively working with our partners in the Department of Veterans Affairs (VA) to decrease the IDES population. Together both parties are working to meet the established processing times in order to ensure efficient handling of IDES cases. Military Pay Execution and Funding Requirement The FY 2017 request includes $2,291 million for Army's military personnel costs as shown in the following summary table: ($ Thousands) * Medicare Eligible Retiree Health Care Fund FY 2017 Request Summary The FY 2017 amended request of $2,385 million for Army's military personnel costs are comprised of the following major cost categories: National Guard & Army Reserve Mobilization ($1,667 million) - Basic military pay and entitlements (i.e., Basic Pay, Basic Allowance for Housing (BAH), Retired Pay Accrual (RPA), social security contributions, and incentive pays) for National Guard and Army Reserve members on active duty to provide essential military operation support or backfill for those active personnel deployed overseas in support of OFS, OIR and ERI. This includes funding for Reserve Component members mobilized to support Wounded Warrior Transition Units. - Special Pays for Mobilized National Guard and Army Reserve Personnel, primarily includes: [x] Hostile Fire Pay ($7.50 per day up to $225 per month) [x] Family Separation Allowance ($250 per month) [x] Hardship Duty-location Pay ($100 per month if deployed for less than 12 months and $300 per month if deployed for more than 12 months) [x] Basic Allowance for Subsistence – for Reserve Component Soldiers in support of OFS, OIR and ERI. Active Component Deployment Costs ($97 million) - Active Component Deployment Costs fund the incremental deployment pays required to support deployed Soldiers. These deployment pays include: [x] Hostile Fire Pay ($7.50 per day up to $225 per month) [x] Family Separation Allowance ($250 per month) [x] Hardship Duty-location Pay ($100 per month if deployed for less than 12 months and $300 per month if deployed for more than 12 months) Other Mobilization and Deployment Costs ($92 million) - Additional mobilization / deployment benefits for unemployment benefits to Soldiers who are discharged or released under honorable conditions, the Reserve Income Replacement Program, and Interest on Uniformed Services Savings Deposits payments. Subsistence-In-Kind Costs ($228 million) - Funds support Subsistence-in-Kind (SIK) to all US military personnel while deployed in support of OFS, OIR and ERI. SIK includes the cost of procuring subsistence for garrison dining facilities (subsistence in messes), operational rations, and augmentation rations. As the executive agent, the Army provides subsistence in mess facilities and operational rations for members of all military services. Permanent Change of Station ($45 million) - The Permanent Change of Station (PCS) program pays for the travel, transportation, storage, and dislocation allowances for reassignment of military members and families traveling individually for operational or rotational moves in support of OFS, OIR and ERI. Casualty and Disability Benefits ($16 million) - Provides funds to the Department of Veterans Affairs (VA) to cover the increased number of Soldiers Group Life Insurance (SGLI) / Traumatic-SGLI (T-SGLI) claims directly associated with contingency operations. - Casualty benefits associated with the death and traumatic injury of service members (T-SGLI). - Death Gratuity payments to survivors of members dying on active duty. - Provides reimbursement of SGLI/T-SGLI premiums to deployed Soldiers. Pre and Post Mobilization Training ($239 million) - Basic pay and allowance costs for training of members in Guard and Reserve Soldiers prior to mobilization and post deployment to recertify skills not utilized during extended deployments. - European Reassurance Initiative (ERI) in support of Operation Atlantic Resolve, funds additional full time equivalent (FTE) mandays for key unit personnel to assure NATO allies and bolster the security and capacity of partners. 10 U.S.C. §12304b: Selective Reserve: Order to Active Duty for Preplanned Missions in Support of the Combatant Commands FY 2017 Requested Levels: 11,124 Man-Years; $1,060 million The National Defense Authorization Act (NDAA) 2012, authorizes the use of 10 U.S.C. §12304b, which provides the Secretary of the Army the authority to involuntarily activate members of the Selected Reserves for not more than 365 consecutive days. In FY 2017, the Army plans to utilize 12304b in support of pre-planned and OCO funded missions identified by Combatant Commanders. The Army will use authority granted in 10 U.S.C. §12301(d) for Soldiers volunteering to support these missions. U. S. Central Command, U.S. Africa Command, U.S. Pacific Command and U.S. South Command: Peace Keeping, Theater Security and Stability Operations - Provides capability to deter hostility and threats, establish a secure environment and ensure public safety and order, support the international humanitarian effort and coordinate with and support the international civil presence to prevent any violation of established treaties and promote regional cooperation and security. Appropriation Summary by Category FY 2015 through FY 2017 appropriation execution and requirements are displayed in the following tables: FY 2015 Appropriations Summary By Category ($ in thousands) Active Army Army * Includes Other Military Personnel Costs (Unemployment (UCX), Reserve Income Replacement Program (RIRP) and Service Savings Deposits) FY 2016 Appropriations Summary By Category ($ in thousands) * Includes Other Military Personnel Costs (Unemployment (UCX), Reserve Income Replacement Program (RIRP) and Service Savings Deposits) *ERI funding included FY 2017 Appropriations Summary By Category ($ in thousands) Includes Other Military Personnel Costs (Unemployment (UCX), Reserve Income Replacement Program (RIRP) and Service Savings Deposits) *ERI funding included in the non-amendment column Army M-1 995 Army M-1 (Continued) US Army National Guard and US Army Reserve M-1 ANALYSIS of FY 2016 APPROPRIATION CHANGES The FY 2016 estimates reflect current projections based on the most recent level of execution; however the potential reporgramming amount has not been approved by the Office of Management and Budget, and could be revised before an Omnibus Reprogramming is submitted to Congress. ANALYSIS of FY 2016 APPROPRIATION CHANGES 0 *The FY 2016 estimates reflect current projections based on the most recent level of execution; however the potential reporgramming amount has not been approved by the Office of Management and Budget, and could be revised before an Omnibus Reprogramming is submitted to Congress. ACTIVE DEPLOYMENT AND NATIONAL GUARD & ARMY RESERVE MOBILIZATION Appropriation: Military Personnel, Army Budget Activity 1: Pay and Allowances of Officers Budget Line Item: Basic Pay FY 2017 ($ in Thousands) $315,786 $327,915 Part I - Purpose and Scope Funds provide for incremental basic compensation and length of service pay increments for active duty officers under provision of 37 U.S.C. 201, 203, 204, 205 and 1009. Funds also provide for the compensation of officers of the Reserve Components who have entered active duty as members of the Active Component under provision of 10 U.S.C. 12301, 12302 and 12304B. Part II - Justification of Funds Required The request provides funding for mobilization of Army National Guard and Army Reserve officer personnel in support of ongoing combat operations in support of Operation Freedom's Sentinel, Operation Inherent Resolve and European Reassurance Intuitive. The growth in the pay rate reflects a 1.3% across-the-board pay raise effective 1 January 2016 and a 1.6% pay raise effective 1 January 2017. The request increases by $43.2M from FY 2016 to PB 2017. This change is driven by: 1. Mobilized requirements increase from FY 2016 to FY 2017 as a result of pay raise inflation ($4.2M) 2. Increased number of reserved component Soldiers mobilized in support of European Reassurance Initiative (ERI) ($39.0M) The FY 2017 amended request provides additional funds to support approved increases in military personnel levels associated with Operations FREEDOM'S SENTINEL (OFS) and INHERENT RESOLVE (OIR) in Afghanistan and Iraq. Summary cost computations are provided in the following table: Appropriation: Active Military Personnel Budget Activity 1: Pay and Allowances of Officers Budget Line Item: Retired Pay Accrual FY 2017 ($ in Thousands) $74,526 $77,388 Part I - Purpose and Scope Funds provide for the Department of Army's contribution to its Military Retirement Fund, in accordance with 10 U.S.C. 1466. Funds provide the Retired Pay Accrual (RPA) payments for Active Component and Reserve Component officer personnel. Part II - Justification of Funds Required The budget estimates are derived as a product of: - The total amount of the basic pay expected to be paid during the fiscal year. - The actuarial calculated percentage of basic pay for FY 2016 and FY 2017 required for the RPA trust fund account. The actuarial estimate assumes a part-time Normal Cost Percentage (NCP) of 23.6% for National Guard and Army Reserve Soldiers. The request increases by $12.5M from FY 2016 to PB 2017. This change is driven: 1. Increase in the part-time NCP rate ($2.6M) 2. Increased number of reserved component Soldiers mobilized in support of European Reassurance Initiative (ERI) ($9.9M) The FY 2017 amended request provides additional funds to support approved increases in military personnel levels associated with Operations FREEDOM'S SENTINEL (OFS) and INHERENT RESOLVE (OIR) in Afghanistan and Iraq. Summary cost computations are provided in the following table: Appropriation: Active Military Personnel Budget Activity 1: Pay and Allowances of Officers FY 2017 ($ in Thousands) Budget Line Item: Basic Allowance for Housing $133,911 $139,055 Part I - Purpose and Scope In the FY 1998 National Defense Authorization Act (NDAA), Congress approved the payment of a Basic Allowance for Housing (BAH) to Soldiers. BAH provides members a monthly allowance for housing and consists of BAH Domestic, BAH Differential, Partial BAH, and Overseas Housing Allowance (OHA). BAH combines housing payments formerly provided by Basic Allowance for Quarters (BAQ) and Variable Housing Allowance (VHA). Payment to Soldiers is authorized by revisions to Title 37 U.S.C. 403. Part II - Justification of Funds Required Funds provide the BAH allowance for mobilized Army National Guard and Army Reserve officers in support of operations directly associated with Operation Freedom's Sentinel, Operation Inherent Resolve and European Reassurance Intuitive. The overall increase of $19.4M from FY 2016 to PB 2017 is driven by two factors: 1. Increase in the basic allowance for housing inflation rate ($2.9M) 2. Increased number of reserved component Soldiers mobilized in support of European Reassurance Initiative (ERI) ($16.5M) The FY 2017 amended request provides additional funds to support approved increases in military personnel levels associated with Operations FREEDOM'S SENTINEL (OFS) and INHERENT RESOLVE (OIR) in Afghanistan and Iraq. Summary cost computations are provided in the following table: Appropriation: Active Military Personnel Budget Activity 1: Pay and Allowances of Officers Budget Line Item: Basic Allowance for Subsistence FY 2017 ($ in Thousands) $11,866 $12,316 Part I - Purpose and Scope Funds provide for subsistence allowance for Active Component and Reserve Component officers authorized by 37 U.S.C. 402. Part II - Justification of Funds Required All officers, regardless of dependency status, deployment status, and pay grade, are paid a monthly Basic Allowance for Subsistence at the same statutory rate. Subsistence allowance costs are obtained by multiplying the projected average number eligible by the annual statutory rate. The increase of $1.8M from FY 2016 to FY 2017 is driven by: 1. Increase in the basic allowance for subsistence inflation rate ($0.3M) 2. Increased number of reserved component Soldiers mobilized in support of European Reassurance Initiative (ERI) ($1.5M) The FY 2017 amended request provides additional funds to support approved increases in military personnel levels associated with Operations FREEDOM'S SENTINEL (OFS) and INHERENT RESOLVE (OIR) in Afghanistan and Iraq. Summary cost computations are provided in the following table: Appropriation: Active Military Personnel Budget Activity 1: Pay and Allowances of Officers FY 2017 ($ in Thousands) Budget Line Item: Incentive Pay for Hazardous Duty - Officer $1,543 $1,602 Part I - Purpose and Scope Funds provide for payments to officers for the following special pays: Demolition Duty: Paid to officers performing duties involving demolition of explosives as a primary part of duty. Incentive pay includes training for such duty. Beginning in FY 2010, the Army combat engineers and Special Forces were assigned to demolition billets and began performing hazardous duty as their primary duty to neutralize and execute Explosive Ordinance Disposal (EOD) tasks. Payment is $150 per month. (37 U.S.C. 301 (a) (4)) Flying Duty: Category includes the combination of the following and accounts for fluctuation in the average rate per Soldiers: Aviation Career Incentive Pay (ACIP) - Paid to officers as a financial incentive for members to serve as military aviators throughout their military career as prescribed by the Aviation Career Incentive Act of 1974. Last rate changes made by the FY 1998 NDAA (to establish $840 rate level) and by the FY 1999 NDAA to facilitate payments of ACIP to Warrant Officers. Payments range from $125 to $840 per month determined by years of aviation service. (37 U.S.C. 301a) Flight Crew Member/Non-crew member (Non-rated) - Paid to officers assigned to a position that requires at least four hours of aerial flight each month. Non-crew members perform duties directly related to the in-flight mission of the aircraft, e.g., ground liaison officers, aviation maintenance technicians, or aero-medical physician's assistants. The duties performed by crew members are essential to the mission of the aircraft, e.g., aerial observers and airborne electrical equipment sensor operators. (37 U.S.C. 301a) Other Special Incentive Pays: Category includes other miscellaneous incentive pay categories, including Save Pay, Toxic Pesticides pay and Experimental Stress (insider Observer or Test Subject Duty). Parachute Jumping: Paid to officers assigned to a permanent parachute position or airborne unit which requires parachute jumping as an essential part of military duty, or while undergoing related training, or performing short-term parachute duty. Continuous payment of hazardous duty pay for parachute duty requires at least one parachute jump every three months. Payment is $150 per month for regular jumps. Officers who perform parachute jumping at a high altitude with a low opening (HALO) as an essential part of duty are entitled to $225 per month. (37 U.S.C. 301 (a) (3)). Part II - Justification of Funds Requested Funding requirements are based on the estimated number of officers eligible for each type of payment and rate of payment. The increase from FY 2016 to FY 2017 of $0.2M is driven by the increase in reserved component Soldiers mobilized in support of European Reassurance Initiative (ERI). The FY 2017 amended request provides additional funds to support approved increases in military personnel levels associated with Operations FREEDOM'S SENTINEL (OFS) and INHERENT RESOLVE (OIR) in Afghanistan and Iraq. Summary cost computations are provided by the following table: BA1 Appropriation: Active Military Personnel Budget Activity 1: Pay and Allowances of Officers FY 2017 ($ in Thousands) Budget Line Item: Special Pay $15,411 $19,894 Part I - Purpose and Scope Funds provide for payments to Active Component and Reserve Component officer personnel for the following special pays: Assignment Incentive Pay: Monthly incentive paid for Soldiers who are voluntarily ($300 to $500 per month) or involuntarily ($1,000 per month) extended beyond 12 month Boots-On-the-Ground (BOG) in Kuwait staging areas and Afghanistan and as part of assignment to certain theater units. Certain theater units are defined as units that routinely conduct operations in or support units in Afghanistan but are not based in Afghanistan. (37 U.S.C. 307). Foreign Language Proficiency Pay (FLPP) - Monthly incentive paid to all military personnel who qualify for and maintain the required proficiency in designated foreign languages. The monthly rate may not exceed $500 per individual for a single foreign language or $1,000 for any combination of more than one language (37 U.S.C. 316). Hostile Fire/Imminent Danger Pay: Paid at the rate of $7.50 per day up to $225 per month for personnel subject to hostile fire or in an area in which they are in imminent danger of being exposed to hostile fire (37 U.S.C. 310). Hardship Duty Pay: Paid to officers performing duty in a location that is designated by the Secretary of Defense as hardship duty. The monthly rate may not exceed $1,500 per individual from all three sources, hardship duty (location), hardship duty (mission) and hardship duty (involuntary extension) (37 U.S.C. 305). Various Medical Special Pays: Special pay for Health Professionals on active duty are authorized under provisions of Title 37 U.S.C. 301 through 355 of the FY 2008 National Defense Authorization Act (NDAA) (P.L. 110-181) and policies of the Office of the Assistant Secretary of Defense for Health Affairs (HA) and the Undersecretary of Defense. New implementation of Title 37 U.S.C. 335, allows board certification pay and incentive pay. This includes a combination of medically related special pays, including: dental, nurse, optometrists, veterinarians, psychologists, pharmacy, physician assistant, social work and board certified pay for non-physician health care providers special pays. Part II - Justification of Funds Requested The projected average number of personnel is based on the total spaces where each type of pay is authorized to meet force structure requirements. Funding requirements are based on the estimated number of officers eligible for each type of payment and rate of payment. The decrease of $0.8M from FY 2016 to PB FY 2017 initial request is driven by the following factors: 1. Decrease to Active Component Hardship Duty and Hostile Fire Pays from reduction in Soldiers deployed for support to Operation Freedom's Sentinel (-$1.1M) 2. Increased number of reserved component Soldiers mobilized in support of European Reassurance Initiative (ERI) ($0.3M) The FY 2017 amended request provides additional funds to support approved increases in military personnel levels associated with Operations FREEDOM'S SENTINEL (OFS) and INHERENT RESOLVE (OIR) in Afghanistan and Iraq. Summary cost computations are provided by the following table: Appropriation: Active Military Personnel Budget Activity 1: Pay and Allowances of Officers FY 2017 ($ in Thousands) Budget Line Item: Allowances Pay $11,971 $14,327 Part I - Purpose and Scope Funds provide for payments to Active Component and Reserve Component officer personnel for the following special pays: Clothing Allowance: Allowance for initial payment and additional purchases of required uniforms under provisions of 37 U.S.C. 415 and 416. Also included are funds for civilian clothing allowance for officers assigned to a permanent duty station outside the United States who are required to wear civilian clothing in the performance of official duty in accordance with 37 U.S.C. 419. Family Separation Allowance (FSA): Paid at the rate of $250 per month to members with dependents who are on duty away from home for a period of more than 30 continuous days (37 U.S.C. 427). Overseas Station Allowance (OSA): Per diem allowance to officers on duty outside the United States considering all elements of the cost of living, including quarters, subsistence, and other necessary incidental expenses as prescribed by Joint Travel Regulation and authorized under provisions of 37 U.S.C. 405. OSA includes Cost of Living Allowance (COLA) and Temporary Lodging Allowances (TLA). Continental United States (CONUS) Cost of Living Allowance (COLA): Allowance to officers who are assigned to high cost Military Housing Areas (MHA) in CONUS. A high cost area is defined as a locality where the cost of living exceeds the average cost of living in CONUS by an established threshold percentage during a base period. The current established threshold is 108 percent of the national cost of living average. The amount of COLA payable is the product of spendable income (based on regular military compensation level) times the difference between the COLA index for the individual's high cost area and the threshold percentage. Allowance is paid in accordance with 37 U.S.C. 403b. Part II - Justification of Funds Requested The projected average number of personnel is based on the total eligible spaces for each type of pay to meet force structure requirements. Funding requirements are based on the estimated number of officers eligible for each type of payment and rate of payment. The increase of $0.2M from FY 2016 to PB 2017 is primarily driven by the increased number of reserved component Soldiers mobilized in support of European Reassurance Initiative (ERI). The FY 2017 amended request provides additional funds to support approved increases in military personnel levels associated with Operations FREEDOM'S SENTINEL (OFS) and INHERENT RESOLVE (OIR) in Afghanistan and Iraq. Summary cost computations are provided by the following table: Appropriation: Active Military Personnel Budget Activity 1: Pay and Allowances of Officers FY 2017 ($ in Thousands) Budget Line Item: Separation Pays $4,541 $4,718 Part I - Purpose and Scope Funds provide for payments to Active Component and Reserve Component officer personnel for the following special pays: Accrued Leave Pay (Lump Sum Terminal Leave Payments) - Pays for unused accrued leave at time of discharge, retirement, or death under provisions in 37 U.S.C. 501 and 10 U.S.C. 701. Leave payments will not exceed the career total of 60 days. Severance Pay, Disability and Severance Pay - Payments made to officers who are involuntarily discharged or released from active duty. Disability severance pay is paid to a member separated from the service for a physical disability under provisions in 10 U.S.C. 1212. Part II - Justification of Funds Requested The projected average number of personnel is based on the total eligible spaces for each type of pay to meet force structure requirements. Funding requirements are based on the estimated number of officers eligible for each type of payment and rate of payment. The $0.6M increase from FY 2016 to PB 2017 is driven by the increased number of reserved component Soldiers mobilized in support of European Reassurance Initiative (ERI). The FY 2017 amended request provides additional funds to support approved increases in military personnel levels associated with Operations FREEDOM'S SENTINEL (OFS) and INHERENT RESOLVE (OIR) in Afghanistan and Iraq. Summary cost computations are provided by the following table: Appropriation: Military Personnel, Army Budget Activity 1: Pay and Allowances of Officers FY 2017 ($ in Thousands) Budget Line Item: Social Security Tax Employer Contribution – Officer $24,158 $25,086 Part I - Purpose and Scope Funds provide for the employer's tax to Social Security Administration as required by the Federal Insurance Contribution Act (FICA). Funds provide the employer's Social Security Tax payment for Active Component and Reserve Component officer personnel in support of operations directly associated with Overseas Contingency Operations (OCO). Part II - Justification of Funds Required The FICA tax is developed by multiplying the total earnings for FICA tax purposes by the applicable percent. The Old Age, Survivor, and Disability Insurance rate is 6.2% and the Hospital Insurance rate is 1.45%. Funds provide basic compensation for mobilized Army National Guard and Army Reserve officer personnel. The growth in the pay rate reflects a 1.3% across-the-board pay raise effective January 1, 2016 and a 1.6% pay raise effective 1 January 2017. The request increases by $3.3M from FY 2016 to PB 2017. This change is driven by: 1. Mobilized requirements increase from FY 2016 to FY 2017 as a result of pay raise inflation ($.3M) 2. Increased number of reserved component Soldiers mobilized in support of European Reassurance Initiative (ERI) ($3.0M) The FY 2017 amended request provides additional funds to support approved increases in military personnel levels associated with Operations FREEDOM'S SENTINEL (OFS) and INHERENT RESOLVE (OIR) in Afghanistan and Iraq. Summary cost computations are provided in the following table: BA 1 Social Security Appropriation: Military Personnel, Army Budget Activity 2: Pay and Allowances of Enlisted Budget Line Item: Basic Pay FY 2017 ($ in Thousands) $506,209 $525,653 Part I - Purpose and Scope Funds provide for incremental basic compensation and length of service pay increments for active duty enlisted under provision of 37 U.S.C. 201, 203, 204, 205 and 1009. Funds also provide for the compensation of enlisted Soldiers of the Reserve Components who have entered active duty as members of the Active Component under provision of 10 U.S.C. 12301, 12302 and 12304B. Part II - Justification of Funds Required The request provides funding for mobilization of Army National Guard and Army Reserve officer personnel in support of ongoing combat operations in support of Operation Freedom's Sentinel, Operation Inherent Resolve and European Reassurance Intuitive. The growth in the pay rate reflects a 1.3% across-the-board pay raise effective 1 January 2016 and a 1.6% pay raise effective 1 January 2017. The request increases by $46.3M from FY 2016 to PB 2017. This change is driven by: 1. Mobilized requirements increase from FY 2016 to FY 2017 as a result of pay raise inflation ($7.0M) 2. Increased number of reserved component Soldiers mobilized in support of European Reassurance Initiative (ERI) ($39.3M) The FY 2017 amended request provides additional funds to support approved increases in military personnel levels associated with Operations FREEDOM'S SENTINEL (OFS) and INHERENT RESOLVE (OIR) in Afghanistan and Iraq. Summary cost computations are provided in the following table: Appropriation: Military Personnel, Army Budget Activity 2: Pay and Allowances of Enlisted Budget Line Item: Retired Pay Accrual FY 2017 ($ in Thousands) $119,465 $124,059 Part I - Purpose and Scope Funds provide for the Department of Army's contribution to its Military Retirement Fund, in accordance with 10 U.S.C. 1466. Funds provide the Retired Pay Accrual payments for Active Component and Reserve Component enlisted Soldiers. Part II - Justification of Funds Required The budget estimates are derived as a product of: - The total amount of the basic pay expected to be paid during the fiscal year. - The actuarial calculated percentage of basic pay for FY 2016 and FY 2017 required for the RPA trust fund account. The actuarial estimate assumes a part-time Normal Cost Percentage (NCP) of 23.6% for National Guard and Army Reserve Soldiers. The request increases by $16.1M from FY 2016 to PB 2017. This change is driven: 1. Increase in the part-time NCP rate ($6.8M) 2. Increased number of reserved component Soldiers mobilized in support of European Reassurance Initiative (ERI) ($9.3M) The FY 2017 amended request provides additional funds to support approved increases in military personnel levels associated with Operations FREEDOM'S SENTINEL (OFS) and INHERENT RESOLVE (OIR) in Afghanistan and Iraq. Summary cost computations are provided in the following table: Appropriation: Military Personnel, Army Budget Activity 2: Pay and Allowances of Enlisted Budget Line Item: Basic Allowance for Housing FY 2017 ($ in Thousands) $255,613 $265,431 Part I - Purpose and Scope In the FY 1998 National Defense Authorization Act (NDAA), Congress approved the payment of a Basic Allowance for Housing (BAH) to Soldiers. BAH provides members a monthly allowance for housing, and consists of BAH-Domestic, BAH Differential, Partial BAH, and Overseas Housing Allowance (OHA). The BAH combines housing payments formerly provided by Basic Allowance for Quarters (BAQ) and Variable Housing Allowance (VHA). Payment to Soldiers is authorized by revisions to Title 37 U.S.C. 403. Part II - Justification of Funds Required Funds provide the BAH allowance for mobilized Army National Guard and Army Reserve officers in support of operations directly associated with Operation Freedom's Sentinel, Operation Inherent Resolve and European Reassurance Intuitive. The overall increase of $25.6M from FY 2016 to PB 2017 is driven by two factors: 1. Increase in the basic allowance for housing inflation rate ($6.2M) 2. Increased number of reserved component Soldiers mobilized in support of European Reassurance Initiative (ERI) ($19.4M) The FY 2017 amended request provides additional funds to support approved increases in military personnel levels associated with Operations FREEDOM'S SENTINEL (OFS) and INHERENT RESOLVE (OIR) in Afghanistan and Iraq. Summary cost computations are provided in the following table: Appropriation: Military Personnel, Army Budget Activity 2: Pay and Allowances of Enlisted FY 2017 ($ in Thousands) Budget Line Item: Incentive Pays $959 $995 Part I - Purpose and Scope Funds provide for payments to enlisted Soldiers for the following special pays: Demolition Duty: Paid to enlisted personnel performing duties involving demolition of explosives as a primary part of duty. Incentive pay includes training for such duty. Beginning in FY 2010 the Army combat engineers and Special Forces were assigned to demolition billets and performing hazardous duty as their primary duty to neutralize and execute Explosive Ordinance Disposal (EOD) tasks. Payment is $150 per month. (37 U.S.C. 301 (a) (4)) Flying Duty: Category includes the combination of the following and accounts for fluctuation in the average rate per Soldier: Flying Duty (Crew) - Assigned to a position which requires at least four hours of aerial flight each month. The duties are essential to the operation of aircraft in-flight, or the duties are required to complete specific missions of the aircraft. The members perform duties as crew chiefs, medical airmen, firefighter crash rescue specialists, airborne electronic system operators, and air observers. Flying Duty (Non-Crew) - Assigned to a position which requires at least four hours of aerial flight each month. The duties are directly related to in-flight missions of the aircraft that crew members do perform. The members perform duties as aircraft maintenance personnel, aerial photographers, helicopter weapons systems repairmen, and medical personnel. Other Pays and Allowances: Toxic Pesticides: Paid to enlisted personnel for duty involving exposure to toxic fuels and laboratory work that utilizes live dangerous viruses or bacteria. Payment is $150 per month. (37 U.S.C. 301 (a) (9), (10)). Experimental Stress (Inside Observer or Test Subject Duty) : Paid to enlisted personnel serving in duties involving an unusually high level of physiological or other stress; specifically (a) duty inside a high (hyperbaric) or low (altitude) pressure chamber, (b) duty as a human acceleration/deceleration test subject, and (c) duty as a human test subject in thermal stress experiments. Payment is $150 per month. (37 U.S.C. 301 (a) (5), (6), (7)) Parachute Jumping: Paid to enlisted members assigned to a permanent parachute position or airborne unit which requires parachute jumping as an essential part of military duty, or while undergoing related training, or performing short-term parachute duty. Continuous payment of hazardous duty pay for parachute duty requires at least one parachute jump every three months. Payment is $150 per month for regular jumps. Members who perform parachute jumping at a high altitude with a low opening as an essential part of duty are entitled to $225 per month (37 U.S.C. 301 (a) (3)). Part II - Justification of Funds Requested The projected average number of enlisted Soldiers is based on the total spaces where each type of pay is authorized to meet force structure requirements. Funding requirements are based on the estimated number of enlisted personnel eligible for each type of payment and rate of payment. The increase from FY 2016 to FY 2017 of $0.1M is driven by the increase in reserved component Soldiers mobilized in support of European Reassurance Initiative (ERI). The FY 2017 amended request provides additional funds to support approved increases in military personnel levels associated with Operations FREEDOM'S SENTINEL (OFS) and INHERENT RESOLVE (OIR) in Afghanistan and Iraq. Summary cost computations are provided by the following table: BA2 Incentive Pays Appropriation: Military Personnel, Army Budget Activity 2: Pay and Allowances of Enlisted FY 2017 ($ in Thousands) Budget Line Item: Special Pays $47,347 $60,782 Part I - Purpose and Scope Funds provide for payments to enlisted Soldiers for the following special pays: Assignment Incentive Pay: Monthly incentive paid for Soldiers who are voluntarily ($300 to $500 per month) or involuntarily ($1,000 per month) extended beyond 12 month Boots-On-the-Ground (BOG) in Kuwait staging areas and Afghanistan and as part of assignment to certain theater units. Certain theater units are defined as units that routinely conduct operations in or support units in Afghanistan but are not based in Afghanistan. Foreign Language Proficiency Pay (FLPP): Monthly incentive paid to all military personnel who qualify for and maintain the required proficiency in designated foreign languages. The monthly rate may not exceed $500 per individual for a single foreign language or $1,000 for any combination of more than one language (37 U.S.C. 316). Hardship Duty Pay: Paid to Soldiers performing duty in a location that is designated by the Secretary of Defense as hardship duty. The monthly rate may not exceed $1,500 per individual from all three sources, hardship duty (location), hardship duty (mission) and hardship duty (involuntary extension) (37 U.S.C. 305). Hostile Fire/Imminent Danger Pay: Paid at the rate of $225 per month to personnel subject to hostile fire or in an area in which they are in imminent danger of being exposed to hostile fire (37 U.S.C. 310). Special Duty Assignment Pay (SDAP): A monetary incentive that is paid to enlisted members who qualify for and serve in designated special duty assignments. These funds are utilized for recruiters, guidance counselors, retention NCOs, drill sergeants, and specially designated personnel who have extremely demanding duties requiring extraordinary effort for satisfactory performance, and/or an unusual level of responsibility. Monthly payment should not exceed $3,000 (37 U.S.C. 307). Stop Loss Special Pay: Deployment Extension Incentive Pay (DEIP) - Program designed to replace involuntary "Stop Loss" and authorized in 37 U.S.C. Sec 307a for active Army Soldiers who choose to remain with their deployed unit. Soldiers who execute an extension between 9 months prior to unit Latest Arrival Date (LAD -270) and 6 months prior to unit LAD (LAD-180) will receive $500 per month for each full month they extend their service commitment. Soldiers who execute an extension after unit LAD-180 and before Expiration Term of Service (ETS) (ETS – 90) will receive $350 per month for each full month they extend their service commitment. Deployment Extension Stabilization Pay (DESP) - Program designed to replace involuntary "Stop Loss" and authorized in 37 U.S.C. Sec 307a for mobilized Army National Guard Soldiers who choose to remain with a deploying unit past end-of-service date. Soldiers that extend from 180 days to 365 days prior to the mobilization date receive $500 a month for each month under Title 10 mobilization status. $350 will be paid for Soldiers that extend between 179 days and 90 days before the mobilization date. Part II - Justification of Funds Requested The projected average number of personnel is based on the total spaces where each type of pay is authorized to meet force structure requirements. Funding requirements are based on the estimated number of enlisted Soldiers eligible for each type of payment and rate of payment. The decrease of $0.8M from FY 2016 to PB 2017 is driven by the following factors: 1. Decrease to Active Component Hostile Fire Pays from reduction in Soldiers deployed for support to Operation Freedom's Sentinel (-$1.9M) 2. Increased number of reserved component Soldiers mobilized in support of European Reassurance Initiative (ERI) ($1.1M) The FY 2017 amended request provides additional funds to support approved increases in military personnel levels associated with Operations FREEDOM'S SENTINEL (OFS) and INHERENT RESOLVE (OIR) in Afghanistan and Iraq. Summary cost computations are provided by the following table: Appropriation: Military Personnel, Army Budget Activity 2: Pay and Allowances of Enlisted FY 2017 ($ in Thousands) Budget Line Item: Allowance Pays $46,094 $52,923 Part I - Purpose and Scope Funds provide for payments to enlisted Soldiers for the following special pays: Clothing Allowance: Allowance for initial payment and additional purchases of required uniforms under provisions of 37 U.S.C. 415 and 416. Also included are funds for civilian clothing allowance for enlisted personnel assigned to a permanent duty station outside the United States who are required to wear civilian clothing in the performance of official duty in accordance with 37 U.S.C. 419. Family Separation Allowance (FSA): Paid at the rate of $250 per month to members with dependents who are on duty away from home for a period of more than 30 continuous days (37 U.S.C. 427). Overseas Station Allowance (OSA): Per diem allowance to enlisted personnel on duty outside the United States considering all elements of the cost of living, including quarters, subsistence, and other necessary incidental expenses as prescribed by Joint Travel Regulation and authorized under provisions of 37 U.S.C. 405. OSA includes Cost of Living Allowance (COLA) and Temporary Lodging Allowances (TLA). Continental United States (CONUS) Cost of Living Allowance (COLA): Allowance to enlisted personnel who are assigned to high cost Military Housing Areas (MHA) in CONUS. A high cost area is defined as a locality where the cost of living exceeds the average cost of living in CONUS by an established threshold percentage during a base period. The current established threshold is 108 percent of the national cost of living average. The amount of COLA payable is the product of spendable income (based on regular military compensation level) times the difference between the COLA index for the individual's high cost area and the threshold percentage. Allowance is paid in accordance with 37 U.S.C. 403b. Part II - Justification of Funds Requested The projected average number of personnel is based on the total spaces where each type of pay is authorized to meet force structure requirements. Funding requirements are based on the estimated number of enlisted eligible for each type of payment and rate of payment. The increase of $1.4M from FY 2016 to PB 2017 is primarily driven by the increased number of reserved component Soldiers mobilized in support of European Reassurance Initiative (ERI). The FY 2017 amended request provides additional funds to support approved increases in military personnel levels associated with Operations FREEDOM'S SENTINEL (OFS) and INHERENT RESOLVE (OIR) in Afghanistan and Iraq. Summary cost computations are provided by the following table: Appropriation: Active Military Personnel Budget Activity 2: Pay and Allowances of Enlisted FY 2017 ($ in Thousands) Budget Line Item: Separation Pays $10,063 $10,447 Part I - Purpose and Scope Funds provide for payments to for Active Component and Reserve Component enlisted personnel for the following special pays: Accrued Leave Pay (Lump Sum Terminal Leave Payments) - Pays for unused accrued leave at time of discharge, retirement, or death under provisions in 37 U.S.C. 501 and 10 U.S.C. 701. Leave payments will not exceed the career total of 60 days. Severance Pay, Disability and Severance Pay - Payments made to enlisted personnel who are involuntarily discharged or released from active duty. Disability severance pay is paid to a member separated from the service for a physical disability under provisions in 10 U.S.C. 1212. Part II - Justification of Funds Requested The projected average number of personnel is based on the total spaces where each type of pay is authorized to meet force structure requirements. Funding requirements are based on the estimated number of enlisted eligible for each type of payment and rate of payment. The $1.0M increase from FY 2016 to FY 2017 is driven by the increased number of reserved component Soldiers mobilized in support of European Reassurance Initiative (ERI). The FY 2017 amended request provides additional funds to support approved increases in military personnel levels associated with Operations FREEDOM'S SENTINEL (OFS) and INHERENT RESOLVE (OIR) in Afghanistan and Iraq. Summary cost computations are provided by the following table: Appropriation: Military Personnel, Army Budget Activity 2: Pay and Allowances of Enlisted FY 2017 ($ in Thousands) Budget Line Item: Social Security Tax Employer Contribution – Enlisted $38,726 $40,212 Part I - Purpose and Scope Funds provide for the employer's tax to the Social Security Administration as required by the Federal Insurance Contribution Act (FICA). Funds provide the employer's Social Security Tax payment for Active Component and Reserve Component Soldiers. Part II - Justification of Funds Required The FICA tax is developed by multiplying the total earnings for FICA tax purposes by the applicable percent. The Old Age, Survivor, and Disability Insurance rate is 6.2% and the Hospital Insurance rate is 1.45%. Funds provide basic compensation for mobilized Army National Guard and Army Reserve officer personnel. The growth in the pay rate reflects a 1.3% across-the-board pay raise effective January 1, 2016 and a 1.6% pay raise effective 1 January 2017. The request increases by $3.5M from FY 2016 to PB 2017. This change is driven by: 1. Mobilized requirements increase from FY 2016 to FY 2017 as a result of pay raise inflation ($.5M) 2. Increased number of reserved component Soldiers mobilized in support of European Reassurance Initiative (ERI) ($3.0M) The FY 2017 amended request provides additional funds to support approved increases in military personnel levels associated with Operations FREEDOM'S SENTINEL (OFS) and INHERENT RESOLVE (OIR) in Afghanistan and Iraq. Summary cost computations are provided in the following table: Appropriation: Military Personnel, Army Budget Activity 4: Subsistence of Enlisted Personnel FY 2017 ($ in Thousands) Budget Line Item: Basic Allowance for Subsistence/Subsistence-in-Kind (SIK) $281,820 $289,619 Part I - Purpose and Scope Funds provide for the payment of authorized Basic Allowance for Subsistence (BAS) and Subsistence-in-Kind (SIK) for Active Component and Reserve Component Soldiers. Basic Allowance for Subsistence (BAS): BAS is linked to the Department of Agriculture food plan indices. All enlisted members (except recruits and holdees) are entitled to BAS. BAS is paid under the following conditions: (1) when authorized to mess separately, (2) while on authorized leave, and (3) when subsistence-in-kind is not available. Members continue to receive BAS while deployed. The request also includes funds for un-realized BAS collections. Collections for Soldiers residing on Army installations are assumed in the base military pay subsistence budget. These collections offset the cost of food in Army dining facilities. Because many of these Soldiers are deployed, the collection rates assumed in the base will not materialize and the under-execution is requested in the OCO budget below. Subsistence allowance costs are obtained by multiplying the projected average number eligible for the allowance by the annual statutory rate. The FY 2017 BAS inflation rate is 3.4%, effective 1 January 2017 and is based on an increase in the US Department of Agriculture Cost of Food Index. The budgeted BAS composite annual rate for FY 2017 is $4,532.16. Subsistence in Kind (SIK): SIK includes the cost of procuring subsistence (food and drink) for dining facilities (Subsistence in Messes) and operational rations. The Army provides subsistence in mess facilities and operational rations for members of all military services participating in Operation Freedom's Sentinel (OFS), Operation Inherent Resolve (OIR) and European Reassurance Intuitive (ERI) and supports both officer and enlisted Soldiers. The number of active duty Soldiers, the type of operational rations served, and the length of training events determine costs for operational rations. As the executive agent, the Army provides subsistence in mess facilities and operational rations for members of all military services participating in OFS and OIR. Subsistence-in-Messes: Cost of bulk subsistence for dining facilities operated in support of OFS and OIR. This requirement is dependent on the number of personnel using the dining facilities and the cost of food. This is an additional cost above the BAS since members are authorized to continue receiving their BAS even though food is provided in theater. Operational Rations: Rations used for field subsistence and include the Meal-Ready-to-Eat (MRE), Unitized Group Rations (UGR) that include "heat and serve" and A-ration varieties, and other operational rations, such as Cold Weather Rations. Civilian and Contractor Meals: To help provide additional visibility to the total cost of subsistence in theater, the budget display includes total SIK costs. Since MPA only pays for food provided to U.S. service members, food costs associated with feeding civilians and contractors are displayed as a negative amount, as those costs are transferred from MPA to Operation and Maintenance, Army. Part II - Justification of Funds Required The FY 2017 subsistence requirement is decreasing by $12.8M. This increase is due to the following factors: 1. Increase in BAS of $6.4M from FY 2016 to FY 2017 driven by a combination of an increase in the annual statutory subsistence rate ($1.3M) and increased number of reserved component Soldiers mobilized in support of European Reassurance Initiative (ERI) ($5.1M) 2. Decrease in SIK of $6.4M from FY 2016 to FY 2017 driven primarily by food cost inflation. The FY 2017 amended request provides additional funds to support approved increases in military personnel levels associated with Operations FREEDOM'S SENTINEL (OFS) and INHERENT RESOLVE (OIR) in Afghanistan and Iraq. Summary cost computations are provided in the following table: Appropriation: Military Personnel, Army Budget Activity 5: Permanent Change of Station (PCS) FY 2017 ($ in Thousands) Budget Line Item: Permanent Change of Station (PCS) $44,656 Part I – Purpose and Scope The Permanent Change of Station (PCS) program pays for travel, transportation, storage, and dislocation allowances for reassignment of military members and their families who are traveling individually or as part of an organized unit in support of Operation Freedom's Sentinel (OFS). Costs are for the dislocation allowance, shipment of household goods, temporary and non-temporary storage of household goods, temporary lodging expense, and member mileage and per diem (37 U.S.C. 7). Part II – Justification of Funds Requested FY 2017 rates are based on FY 2015 actual execution and funding for these moves provides support for: 1. Reset the force to authorized fill levels in support of deploying units for OFS and OIR. 2. Support the headquarters staff function and individual augmentees of the deployed US Forces in support of OFS and OIR which are engaged in establishing security, restoring effective government and overseeing reconstruction projects in Afghanistan. The request increases by $3.1M from FY 2016 to PB 2017. This change is primarily driven by a slight increase in the projected number of Reserve Component Soldiers deployed to OCONUS location on individual fill orders vs. unit orders which a typically in a TDY status. Summary cost computations are provided in the following table: Appropriation: Military Personnel, Army Budget Activity 6: Other Military Personnel Costs FY 2017 ($ in Thousands) Budget Line Item: Casualty & Disability Benefits $15,256 $16,178 Part I – Purpose and Scope The Casualty and Disability Benefit funds support the Service Members' Group Life Insurance (SGLI) program, Traumatic Service Members' Group Life Insurance (T-SGLI) and Death Gratuity payments. SGLI is a low cost group life insurance for service members on active duty. These payments are required to the Department of Veterans Affairs (VA), under Section 1969(b) of title 38, United States Code, when actual mortality rates exceed peacetime mortality rates. The T-SGLI program provides automatic traumatic injury coverage to all service members covered under the Service Members' Group Life Insurance (SGLI) program. Every member who has SGLI also has T-SGLI, effective December 1, 2005 under Section 1032 of the FY 2005 DoD Emergency Supplemental Appropriations for the Global War on terror and Tsunami Relief (P.L. 109-13). SGLI and T-SGLI insurance premiums were enacted under Section 606 of the FY 2008 National Defense Authorization Act. The act directs the Department to pay the full premium for coverage under SGLI program during service in OFS AND OIR. Effective January 1, 2014, the SGLI monthly premium was changed to $0.065 per $1,000 coverage. The amount the Department pays is $29 per month or $348 per year for each member. Death gratuity payments are payable under Sections 1475-1477 of Title 10 U.S.C. in the amount of $100,000 per death to beneficiaries of active military personnel. Part II – Justification of Funds Requested The request decreases by $0.9M in PB 2017. Decrease driven by reduction in Soldiers deployed for support to Operations FREEDOM'S SENTINEL (OFS) The FY 2017 amended request provides additional funds to support approved increases in military personnel levels associated with Operations FREEDOM'S SENTINEL (OFS) and INHERENT RESOLVE (OIR) in Afghanistan and Iraq. Summary cost computations are provided in the following table: Appropriation: Military Personnel, Army Budget Activity 6: Other Military Personnel Costs FY 2017 ($ in Thousands) Budget Line Item: Additional Mobilization/Deployment Costs $91,658 $92,356 Part I – Purpose and Scope Funds provide benefits associated with disability and other mobilization/deployment costs. Unemployment Benefits: Payments to Soldiers who are discharged or released under honorable conditions as prescribed in paragraph (1) of section 8521(a) of Title 5, United States Code as amended by Section 301, PL. 102-164. The Emergency Unemployment Compensation Act of 1991 (P.L. 102-164) extended unemployment compensation benefits for former military personnel up to 26 weeks with a one-week waiting period. The law also reduced the amount of active duty days required in a reserve status from 180 continuous days to 90 continuous days to be considered as "federal service" for claim purposes. Interest on Uniformed Services Savings Deposits: In accordance with Section 1035 Title 10, U.S.C. this program allows members to deposit up to $10,000 of their pay into the Savings Deposit Program (SDP) and be reimbursed up to 10% interest on all deposits. Interest will accrue up to 90 days after the Soldier redeploys. Any Soldier serving in an area that has been designated a combat zone or in an area designated in direct support of a combat zone for at least 30 days or at least one (1) day in each of three (3) consecutive months is eligible to enroll in the SDP. Part II – Justification of Funds Requested The request increases by $17.0M from FY 2016 to PB 2017. This change is primarily driven by a projected increase to the number of Reserve Component Soldiers who will be eligible to receive unemployment compensation benefits following redeployment from OCO operations. Army projects the increase to be driven by greater number of Soldiers mobilized in FY 2017. The FY 2017 amended request provides additional funds to support approved increases in military personnel levels associated with Operations FREEDOM'S SENTINEL (OFS) and INHERENT RESOLVE (OIR) in Afghanistan and Iraq. Summary cost computations are provided in the following table: Appropriation: Military Personnel, Army Budget Activity 6: Other Military Personnel Costs FY 2017 ($ in Thousands) Budget Line Item: Stop-Loss Special Compensation $0 PART I – PURPOSE AND SCOPE Public Law 111-32, Section 310 appropriated $534.4 million in FY 2009 supplemental appropriations to compensate Service members, including members of the Reserve Components, and former and retired members under the jurisdiction of the Secretary who, at any time during the period beginning on September 11, 2001, and ending on September 30, 2009, served on active duty while the members' enlistment or period of obligated service was extended, or whose eligibility for retirement was suspended, pursuant to section 123 or 12305 of title 10, United States Code, or any other provision of law (commonly referred to as a ''stop-loss authority'') authorizing the President to extend an enlistment or period of obligated service, or suspend an eligibility for retirement, of a Service member in time of war or of national emergency declared by Congress or the President. PART II – JUSTIFICATION OF FUNDS REQUESTED The amount to be paid to or on behalf of an eligible member, retired member, or former member described above shall be $500 per month for each month or portion of a month during the period specified above that the member was retained on active duty as a result of application of the stop-loss authority. Section 310 stated that the military departments may not pay claims that are submitted more than I year after the date on which the implementing rules for claims take effect. The program would have expired on October 21, 2010; however, the deadline for processing new claims was extended through October 21, 2012. Although not available for new claims, the funds are available for obligation until expended on claims received prior to the deadline. The Army's share of the $534.4 million for this program was $405.6 million. As of August 2015, $313.2 million has been obligated in total and recorded as an Overseas Contingency Operation obligation. At the beginning of FY 2015, Army funds were rescinded leaving an available balance of $865K to cover any additional activity that may occur beyond the $313.2 million in obligations to date. Summary cost computations are provided in the following table: MEDICARE-ELIGIBLE RETIREE HEALTH CARE FUND (MERHCF) CONTRIBUTION FOR TEMPORARY OVERSTRENGTH Appropriation: Medicare-Eligible Retiree Health Care Fund Budget Activity 1 and 2: Officer Medicare-Eligible Retiree Health Care Fund FY 2017 ($ in Thousands) Budget Line Item: Medicare-Eligible Retiree Health Care Fund $0 Part I - Purpose and Scope The funds requested will provide for the Medicare Eligible Retiree Health Care Fund (MERHCF) contributions for active military personnel that are above the baseline strength levels. Part II - Justification of Funds Requested The Medicare Eligible Retiree Health Care Fund is an accrual account to pay for future Medicare-eligible retiree health care. The Fund covers Medicare-eligible beneficiaries, regardless of age, to include retirees as well as their dependents and survivors. The DoD Board of Actuaries determines the per capita accrual rates. There are no MERHCF requirements due to all Active Component requirements funded in the baseline request. Summary cost computations are provided in the following table: NATIONAL GUARD PRE-MOB/POST RE-DEPLOYMENT TRAINING Appropriation: National Guard Personnel, Army Budget Activity 1: Reserve Component Training and Support Budget Line Item: Pay Group A Training FY 2017 ($ in Thousands) $33,702 Part I – Purpose and Scope Pay Group A provides funding for additional pre-mobilization training periods. These training periods are required to increase unit readiness, reduce post-mobilization training time and maximize Soldier in-theater time (boots on the ground) for Overseas Contingency Operations in support of named operations. Additional pre-mobilization training enhances the required readiness of units at the home station rather than at the mobilization station. This training strategy is a direct result of the Secretary of Defense Reserve Component Utilization policy signed on January 19, 2007, which limits Reserve Component (RC) mobilizations to 12 months. There are several advantages for the Army National Guard (ARNG) as a result of this policy, including reduced time away from family, reduced pre-mobilization time prior to deployment, and increased predictability for civilian employers of ARNG Soldiers. Additional Pay Group A training periods are conducted by units in the first and second years prior to the mobilization date. The additional training periods provide units with additional training capacity to certify for theater-specific full-spectrum operations in individual and collective training at platoon level. In addition to providing funds for the additional Pay Group A pre-mobilization training, funds are provided for the European Reassurance Initiative (ERI) starting in FY 2016. Part II – Justification of Funds Requested Additional Pay Group A Training Periods – $13,702: Pay Group A funds pay and allowances for Soldiers participating in required training related to Overseas Contingency Operations (OCO) in the first and second years prior to mobilization. Training includes Unit Soldier Readiness Processing (SRP), Warrior Task Testing, Military Tactical Vehicle Drivers Training, Individual/Crew Weapon certification, and other theater-specific tasks. These tasks are completed during additional authorized days of Annual Training (AT) and additional Unit Training Assemblies (UTAs). Current base funding allows for platoon level proficiency training. OCO funds requirements above base funding authorizations to achieve required collective proficiency levels prior to mobilization. The AT and UTA periods are for instruction and training of Army National Guard personnel and prepares Soldiers for all phases of the unit mission. The Reserve Component Utilization policy requires that units obtain higher readiness levels of soldier training, administrative readiness, and medical readiness than in previous years. This is due to the reduced amount of time available at mobilization stations. Prior to the 12-month mob policy, units spent from four to six months at mobilization stations. Under the current mobilization policy, post-mobilization, in-theater, and demobilization time must not exceed 12 months total. Therefore, units must now arrive at the mobilization station at an increased readiness level so that the unit can accomplish nine to ten months boots on the ground executing their assigned mission. Annual Training RC Pay and Allowances in support of Operation Atlantic Resolve - $20,000: Current Operation Atlantic Resolve requirements are well suited for Reserve Component employment to include engineer projects in Bulgaria and Romania, increased Army exercise participation leveraging the National Guard State Partnership Program and Mission Command/ Liaison capabilities to the Baltic States and Poland. Reserve Component employment will ensure a Total Force approach in reassuring allies, while building on well established relationships between the United States military and our European partners. The willingness to project Reserve Component forces is a key element of assurance and deterrence. This request allows United States Army Europe (USAREUR) to accomplish exercise and training objectives with force structure not organic to USAREUR and outside of the active component Regionally Aligned Force construct. Summary cost computations are provided in the following table: Appropriation: National Guard Personnel, Army Budget Activity 1: Reserve Component Training and Support Budget Line Item: Special Training FY 2017 ($ in Thousands) $105,939 Part I – Purpose and Scope Special Training provides funding to support the pre-mobilization training for units mobilizing for Overseas Contingency Operations in support of named operations and to support the additional post-redeployment activities required for units returning from theater. Support to these Soldiers allows the units to build the required readiness of a unit at home station rather than at the mobilization station by providing the additional training and support man-days prior to the units being mobilized. Given this new strategy, only two to three months of additional training for the units specified as mission in-theater are required at the mobilization station which allows for nine to ten months in-theater combat time. This category also provides additional man-days to support the increased requirements to care for Soldiers and to repair/ inventory equipment returning from theater after deployment to ensure the continued availability for domestic response mission is not degraded upon return. Part II – Justification of Funds Requested Additional Special Training Days – $19,440: Additional Special Training Days provide Reset Man-Days, Pre-Mobilization Training Assistance Element (PTAE) support, Tri-care Early Eligibility Administrative Support, and Active Duty Operational Support (ADOS) to mobilizing units. Reset Man-Days provide redeploying units with additional manpower to retrieve equipment from deployment and conduct required inventories and maintenance to properly account for ARNG equipment. PTAE teams provide full-time equivalents (FTE) to instruct, train, and certify personnel in the ARNG during the pre-mobilization phase. Tri-care Early Eligibility provides one soldier per state as a vital liaison between TRICARE, ARNG, the unit, and service members to ensure the validity and eligibility of all mobilizing soldiers in that particular state. Individual and collective training events are conducted during the pre-mobilization periods. These periods of instruction prepare Soldiers for all phases of the unit mission. Additional ADOS personnel provide necessary support to plan and conduct training as units prepare for pending missions. Additional Active Duty Training Days (ADT) – $65,655: Additional Active Duty Training days support the organization, administration, instruction, training, and unit readiness for mobilized units. Additional funding allows for Company Maneuver Exercises, Battalion Field Training Exercises, Soldier Readiness Processing, and theater-specific training requirements determined by the Combatant Commanders. This funding will assist the sourced units in meeting training requirements for increased readiness and certification of training prior to mobilization. Post Deployment Health Reassessment (PDHRA) – $1,254: The Post Deployment Health Reassessment is a program mandated by the Assistant Secretary of Defense for Health Affairs in March 2005 designed to identify and address health concerns emphasizing mental health issues that emerge after deployment. The PDHRA program provides for a second health assessment three to six months after return from deployment, ideally at the three to four month mark. The reassessment is scheduled by the end of 180 days after return so that Reserve Component members have the option of treatment using the TRICARE health benefit. Yellow Ribbon Reintegration Program – $19,590: The Yellow Ribbon Reintegration Program supports mobilizing Soldiers throughout the deployment period. Funding for this program provides mandays to support the planning, organizing, and execution of Yellow Ribbon events that are conducted during the deployment cycle. Funding for the Yellow Ribbon Reintegration Program also supports the VOW (Veterans Opportunity to Work) to Hire Heroes Act of 2011. Section 582 of the FY 2008 National Defense Authorization Act directs the establishment of "a national combat veteran reintegration program to provide National Guard and Reserve members and their families with sufficient information, services, referral and proactive outreach opportunities through the entire deployment cycle." The pre-deployment phase (from first notification of mobilization until deployment of the mobilized unit) focuses on educating members, families and affected communities on combat deployment. The postdeployment phase (from arrival at home station until 180 days following demobilization) consists of reintegration activities at the 30-60-90 day interval after unit demobilization. The focus is on reconnecting members and their families with the service providers (e.g. TRICARE, JAG, Department of Veterans Affairs, etc.) to ensure a clear understanding of the entitled benefits. In addition, combat stress, transition, and how members and their families can address these issues is integral to this post-deployment phase. Summary cost computations are provided in the following table: Appropriation: National Guard Personnel, Army Budget Activity 1: Reserve Component Training and Support Budget Line Item: Schools FY 2017 ($ in Thousands) $47,658 Part I – Purpose and Scope Schools provides funding for individuals who require "cross leveling" from other units within the State to bring the unit to 100% manning. Often times, the additional personnel are from a different Military Occupational Specialty (MOS). These individuals require certification training that they would not require if they were not filling a slot in a mobilizing unit. Soldiers require both Duty Military Occupational Specialty (DMOSQ) and functional training. Some Soldiers require un-programmed functional training as a direct result of mission analysis. Other Soldiers need un-resourced DMOSQ requirements. These requirements are also generated from mission analysis and are DMOSQ requirements for Soldiers to deploy, but are not related to requirements built into the Structure Manning Decision Review (SMDR). Part II – Justification of Funds Requested Schools Training – $2,816: The requirement for Schools represents costs that are above the base Schools budget needed to support requirements generated as a direct result of mobilizations and pre-mobilization training requirements of ARNG units. Training includes Duty Military Occupation Specialty Qualification (DMOSQ) and functional training such as air-assault, combat lifesaver, counter mine training, and other courses as specified by the Combatant Commanders. Bipartisan Budget Act of 2015, Base to OCO - $44, 842: Increase in funding supports home station training requirements funded in the Overseas Contingency Operations to comply with the Bipartisan Budget Act of 2015 Summary cost computations are provided in the following table: Appropriation: National Guard Personnel, Army Budget Activity 1: Reserve Component Training and Support Budget Line Item: Administration and Support FY 2017 ($ in Thousands) $9,173 Part I – Purpose and Scope Administration and Support funds provide additional mandays to compliment full-time operations on a day-to-day basis. ARNG units experience an increase in Operational Tempo (OPTEMPO) during the year prior to mobilization which results in additional full-time support requirements. Additional support to the full-time Active Guard and Reserve (AGR) force provides critical relief in operational planning, logistical support, supply/inventory accountability, and SRP in the year prior to mobilization. This requirement also includes incremental costs to facilitate incapacitation (INCAP) pay and allowances for the increasing number of service members who have been injured training for or participating in OCO. Incapacitation pay provides pay and allowances in accordance with Public Law (USC§ 204 g-h), Department of Defense guidelines (DOD Directive 1241.1) and Army policy (AR 135-381) to Soldiers who are injured in the line of duty and are unable to perform their military and/or civilian occupation. Part II – Justification of Funds Requested Pre-Mobilization AGR Augmentation – $4,436: Pre-Mobilization AGR Augmentation supports units that are one year from mobilization and are authorized to fill vacancies in order to bring their AGR personnel unit strength up to 100% of the levels validated by the US Army Manpower Analysis Agency (USAMAA). These additional temporary AGR fills are vital to the unit and fill critical roles in order to assist the unit in completing training, supply, maintenance, logistics, and individual Soldier Readiness Processing requirements. Incapacitation Pay – $5,483: Incapacitation pay supports Soldiers who are injured while training for/or participating in OCO missions and are unable return to their civilian occupations or military duties. The Incapacitation Pay is also used to pay Soldiers for time spent traveling to and from medical appointments, medical treatment facilities, and Army Medical Board appearances while seeking treatment. This program funds pay and allowances in accordance with Public Law (USC§ 204 g-h), Department of Defense guidelines (DOD Directive 1241.1) and Army policy (AR 135-381) to Soldiers who are injured in the line of duty and are unable to perform their military and/or civilian occupation. Summary cost computations are provided in the following table: UNITED STATES ARMY RESERVE PRE/POST MOBILIZATION TRAINING Appropriation: Reserve Personnel, Army Budget Activity 1: Reserve Component Training and Support Budget Line Item: Pay Group A Training FY 2017 ($ in thousands) $2,773 Part I – Purpose and Scope Funds support additional annual training days to conduct pre-mobilization training for deploying units. Funds also support Soldier pay, allowances, and travel costs for reintegration training through pre-and post-deployment phases. Part II – Justification of Funds Requested Yellow Ribbon Reintegration Program, ($2,773): Funds support Soldier pay, allowances, and travel costs for reintegration training through pre-and post-deployment. The pre-deployment phase (from first notification of mobilization until deployment of the mobilized unit) focuses on educating Soldiers, families and affected communities on combat deployment. The post-deployment phase (from arrival at home station until 180 days following demobilization) consists of reintegration activities at the 30-60-90 day interval after unit demobilization. The focus is on reconnecting members with their families and with service providers (i.e. TRICARE, Judge Advocate General (JAG), Department of Veterans Affairs, etc.) to ensure a clear understanding of entitlements. In addition, methods for coping with combat stress and transition are integral to this post-deployment program. From FY 2016 to FY 2017 the $3.2 million funding realignment from PG A (decrease) to Special Training (increase) allows Soldiers maximum flexibility to attend Yellow Ribbon events. Summary cost computations for Pay Group A are provided in the following tables: $K Yellow Ribbon Reintegration Program Appropriation: Reserve Personnel, Army Budget Activity 1: Reserve Component Training and Support Budget Line Item: Special Training FY 2017 ($ in thousands) $39,733 Part I – Purpose and Scope Program provides funding for pre-mobilization training to deploying units. The U.S. Army Reserve (USAR) has limited mandays to accomplish the train, mobilize, deploy paradigm and must rely on additional mandays to train and support mobilizing units. Part II – Justification of Funds Requested Pre-mobilization Training, ($26,343K): Provides pre-mobilization training, both collective and individual, that directly supports readiness training strategies related to the 12-month mobilization policy. Training activities include supply, maintenance, medical, planning, administration, pay, logistics, and other categories of mobilization support to maximize pre-mobilization support and minimize time at the mobilization station. Funding provides mandays for personnel to certify units following pre-mobilization training. Funding is also provided for brigade level units to conduct mobilization site surveys. This request also funds Army Reserve Soldiers in high demand, low density Military Occupational Specialties (MOS) such as Civil Affairs and Psychological Operations and funding to support Combat Lifesaver Course Certification requirements for mobilizing Soldiers. The nine month Boots on the Ground policy now allows soldiers to receive most of their training after they reach their mobilization station and before they deploy overseas. Due to the increase in the mobilization assumption, the Army Reserve requires significantly more pre-mobilization training days using OCO funding. The Bipartisan Budget Act of 2015 provides additional funding of $18,123 thousand aligned to pre-mobilization training resulting in compliance with legislation. Defense Health Assessment Program ($750K): This program supports proactive health screening for Soldiers 90 to 180 days postdeployment from Operation Freedom's Sentinel/Operation Inherent Resolve. Post-Deployment Health Assessment Program focuses on behavioral and physical health issues that may emerge over time after deployments. Foreign Army Training Command, ($2,214K): Foreign Army Training provides pre-mobilization training for select USAR units that train Afghanistan forces. This program funds travel, per diem, pay and allowances of select Soldier instructors who deploy to Afghanistan to train foreign Soldiers to perform at a level of combat readiness sustainable without U.S. assistance. Pre-mobilization training includes theaterspecific training, weapons (marksmanship), tactics, and navigation, rules of land warfare, Improvised Explosive Device recognition, and cultural awareness. Yellow Ribbon Reintegration Program, ($5,900K): Funds support Soldier pay, allowances, and travel costs for reintegration training through pre (Soldier)-and post (Soldier and family)-deployment. The pre-deployment phase (from first notification of mobilization until deployment of the mobilized unit) focuses on educating Soldiers, families and affected communities on combat deployment. The postdeployment phase (from arrival at home station until 180 days following demobilization) consists of reintegration activities at the 30-60-90 day interval after unit demobilization. The focus is on reconnecting members with their families and with service providers (i.e. TRICARE, JAG, Department of Veterans Affairs, etc.) to ensure a clear understanding of entitlements. In addition, methods for coping with combat stress and transition are integral to this post-deployment program. In FY 2017, funding increase of $3.2 million in Special Training from Pay Group A budget lines for the Yellow Ribbon Reintegration Program in order to allow Soldiers maximum flexibility to attend Yellow Ribbon events. European Reassurance Initiative (ERI), ($4,526): Funds support the President's European Reassurance Initiative (ERI) additional full time equivalent (FTE) mandays for key unit personnel to assure North Atlantic Treaty Organization (NATO) allies and bolster the security and capacity of partners across the following five lines of effort: Increased U. S. military presence in Europe, additional bilateral and multinational exercises and training with allies and partners; improved infrastructure to allow for greater responsiveness, enhanced prepositioning of U.S. equipment in Europe and intensified borders to build partner capacity for newer NATO members and other partners. Summary cost computations are provided by the following tables: $K Premobilization Training FY 2015 Actual $K Defense Health Assessment Program FY 2015 Actual $K Yellow Ribbon Reintegration Program FY 2015 Actual $K Foreign Army Training Command FY 2015 Actual FY 2016 Estimate FY 2016 Estimate FY 2016 Estimate FY 2016 Estimate FY 2017 Estimate Officer Enlisted Total FY 2017 Estimate Officer Enlisted Total FY 2017 Estimate Officer Enlisted Total FY 2017 Estimate Officer Enlisted Total $K European Reassurance Initiave $K Total Special Training FY 2015 Actual 15,972 FY 2016 Estimate FY 2016 Estimate 18,462 Officer Enlisted Total FY 2017 Estimate Mandays Rate 2,399 18,528 $396 $193 20,927 FY 2017 Estimate 39,733 Amount $950 $3,576 $4,526	<urn:uuid:fc1ecbd8-992d-4764-9d6c-c5b442e73825>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	84,786
SAV NATATION - savoir nager NOM: PRENOM: Date de Naissance: Nationalité: Adresse: code postal: Ville: N° Tél parent 1 N° Tél parent 2 N° Tél nageur adresse électronique parents : adresse électronique nageur: Autre sport pratiqué: Profession maman: Ecole fréquentée: Profession papa: DU LUNDI AU VENDREDI DU 7 AU 25 JUILLET 2013 15 COURS POUR 15€ COURS SAMEDI 12 JUILLET ET PAS LUNDI 14 JUILLET 2013 COURS DE 9H00-10H00 on choisit un cours on y reste COURS DE 10H00-11H00 Règlement accepté par Chèque Bancaire, espèces, Coupons MSA loisir, Coupons ANCV. Je soussigné(e)________________________________, exerçant l'autorité parentale, Autorise l'enfant _______________________________à signer une licence au SAV NATATION. Si vous ne désirez pas que votre enfant soit pris en photo merci de nous adresser un courrier en ce sens. µ RESPECT DU REGLEMENT INTERIEUR J'ai pris connaissance du règlement intérieur, l'ai fait lire à mon enfant et nous nous engageons à le respecter. Je m'engage à donner une adresse mail valide afin de recevoir les informations du club. Fait à Verdun le Signature FICHE D'ADHESION PIECES A FOURNIR AUTORISATION POUR LES MINEURS	<urn:uuid:84cce4c0-d210-4a15-9579-826645771473>	HuggingFaceFW/finepdfs/tree/main/data/fra_Latn/train	finepdfs	fra_Latn	1,189
Jääkartta Iskarta Ice Chart N:o 4 14.11.2016 Likeraportitiedot - Traffic routing notices - Rensestörts i Navigasjon Suomi - Finland \| Datova \| Haju- \| Jäämäärä \| Jäämäärän kuvio \| Varmuuskuvio \| Varmuusluokitus \| \|--------\|-------\|----------\|-----------------\|--------------\|----------------\| \| 12.11.2016 \| II \| 1500 \| Sarapuu, Puhos, Joensuu © IL, Jääpalvelu, ISSN 1786-0185 \| Satama \| Minimi kantavuus \| Jääluokka \| Voimaantulopäivä \| \|-----------------\|------------------\|-----------\|------------------\| \| Hamn \| Minimidräktighet \| Isklass \| Datum för ikraftträdande \| \| Harbour \| Minimum tonnage \| Ice Class \| First day of validity \| \| Satama \| Minimi kantavuus \| Jääluokka \| Voimaantulopäivä \| \|-----------------\|------------------\|-----------\|------------------\| \| Hamn \| Minimidräktighet \| Isklass \| Datum för ikraftträdande \| \| Harbour \| Minimum tonnage \| Ice Class \| First day of validity \| \| Satama \| Rajoitus \| Jääluokka \| Voimaantulopäivä \| \|-----------------\|----------\|-----------\|------------------\| \| Hamn \| Restriktion \| Isklass \| Datum för ikraftträdande \| \| Harbour \| Restriction \| Ice Class \| First day of validity \| \| Satama \| Minimi koneteho \| Jääluokka \| Voimaantulopäivä \| \|-----------------\|-----------------\|-----------\|------------------\| \| Hamn \| Minimimaskineffekt \| Isklass \| Datum för ikraftträdande \| \| Harbour \| Minimum engine power \| Ice Class \| First day of validity \| \| Satama \| Minimi kantavuus \| Jääluokka \| Voimaantulopäivä \| \|-----------------\|------------------\|-----------\|------------------\| \| Hamn \| Minimidräktighet \| Isklass \| Datum för ikraftträdande \| \| Harbour \| Minimum tonnage \| Ice Class \| First day of validity \| \| Satama \| Minimi koneteho \| Jääluokka \| Voimaantulopäivä \| \|-----------------\|-----------------\|-----------\|------------------\| \| Hamn \| Minimimaskineffekt \| Isklass \| Datum för ikraftträdande \| \| Harbour \| Minimum engine power \| Ice Class \| First day of validity \| \| Satama \| Rajoitus \| Jääluokka \| Voimaantulopäivä \| \|-----------------\|----------\|-----------\|------------------\| \| Hamn \| Restriktion \| Isklass \| Datum för ikraftträdande \| \| Harbour \| Restriction \| Ice Class \| First day of validity \|	f0e2e21f-9d23-41ee-8e4e-e330b39fe567	HuggingFaceFW/finepdfs/tree/main/data/fin_Latn/train	finepdfs	fin_Latn	2,397
15 th July 2020 Dear Parent/Carer Year 11 Pupils 2019-2020 As we approach the end of term, I am writing to update you about our arrangements for the examination grade collection. We can provide a few options for your child to collect their results. If your child wishes their results to be sent in the post or emailed, they should contact Mrs Hendry (email@example.com) and provide a valid email address or confirm their postal address. Results will be posted and emailed out on the afternoon of 20 th August. If your child wishes to collect their results in person, this must be done under social distancing regulations and they can collect their results from the school during the following times on 20 th August: On arrival, pupils should follow the signs which will direct them to a desk where they can collect their results and, if ordered, their leavers' hoodies and yearbooks. Under the current circumstances, we must ask pupils to adhere to their allocated time slot and not to gather on the premises outside of this time slot. We will have senior staff available both on the day of results and the day after to support with enrolling into our sixth form. If your child should have any textbooks please could we ask that they be returned on this day. We are sad to not be able to celebrate our students' successes as we normally would at the end of the year, but we are very much hoping we will be able to have the prom on the proposed new date of 17 th September. Although I will now say we wish them all the best for the future, we are very much hoping to do that in person, one way or another next term. Our Year 11 pupils (Class of 2020) have been a superb year group and our staff have enjoyed teaching them over the past five years. It has been a very difficult end to their secondary education, but we know their resilience and independence will help them put the year's events into perspective. It has been a unique situation, but they have bright futures ahead of them and I am sure they will take every opportunity to make the most of that. We have kept in contact with all pupils and we are aware of most of their plans for the next stage of their careers. If any pupil wishes to discuss this further, they can contact any member of the senior staff or Mr P Anstee for some individual support and guidance. I will finish by thanking you for all your ongoing support for Brentwood County High School and wishing you all a healthy and safe summer. We look forward to welcoming many of you back to our sixth form in September. Kind regards Miss M Ryan Head Teacher	<urn:uuid:0dab4e1d-9cd5-4b36-88f7-ffc90869c99e>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	2,600
ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ----- ΓΕΝΙΚΗ ΓΡΑΜΜΑΤΕΙΑ ΠΡΩΤΟΒΑΘΜΙΑΣ, ΔΕΥΤΕΡΟΒΑΘΜΙΑΣ ΕΚΠΑΙΔΕΥΣΗΣ ΚΑΙ ΕΙΔΙΚΗΣ ΑΓΩΓΗΣ ΓΕΝΙΚΗ ΔΙΕΥΘΥΝΣΗ ΕΚΠΑΙΔΕΥΤΙΚΟΥ ΠΡΟΣΩΠΙΚΟΥ ΠΡΩΤΟΒΑΘΜΙΑΣ ΔΕΥΤΕΡΟΒΑΘΜΙΑΣ ΕΚΠΑΙΔΕΥΣΗΣ ΔΙΕΥΘΥΝΣΗ ΔΙΟΙΚΗΣΗΣ ΕΚΠΑΙΔΕΥΤΙΚΟΥ ΠΡΟΣΩΠΙΚΟΥ ΠΡΩΤΟΒΑΘΜΙΑΣ ΚΑΙ ΔΕΥΤΕΡΟΒΑΘΜΙΑΣ ΕΚΠΑΙΔΕΥΣΗΣ ΤΜΗΜΑ Β΄ ΚΙΝΗΤΙΚΟΤΗΤΑΣ ΕΚΠΑΙΔΕΥΤΙΚΟΥ ΠΡΟΣΩΠΙΚΟΥ ΔΕΥΤΕΡΟΒΑΘΜΙΑΣ ΕΚΠΑΙΔΕΥΣΗΣ Διεκπεραίωση: μόνο με ηλεκτρονικό ταχυδρομείο Βαθμός Ασφαλείας: Βαθμός Προτεραιότητας: ----- Ταχ. Δ/νση: Ανδρέα Παπανδρέου 37 Τ.Κ. – Πόλη: 15180 – Μαρούσι Ιστοσελίδα: http://www.minedu.gov.gr Πληροφορίες: Ε. Μπακιρτζή, Π. Μπεκρή, Α. Παναγιώταρου Email: email@example.com Τηλέφωνα: 210 3442180, 2750, 2192 Μαρούσι, 8-9-2020 Αρ. Πρωτοκόλλου: 117485 /Ε2 ΑΠΟΦΑΣΗ ΠΡΟΣ: Διευθύνσεις Δευτεροβάθμιας Εκπαίδευσης ΚΟΙΝ.: Περιφερειακές Διευθύνσεις Πρωτοβάθμιας και Δευτεροβάθμιας Εκπαίδευσης ΘΕΜΑ: Ανακλήσεις αποσπάσεων από ΠΥΣΔΕ σε ΠΥΣΔΕ εκπαιδευτικών Δευτεροβάθμιας Εκπαίδευσης για το διδακτικό έτος 2020-2021. H ΥΠΟΥΡΓΟΣ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ Έχοντας υπόψη: 1. Τις διατάξεις: α) του άρθρου 16 περ. Γ΄ παρ. 5 του ν. 1566/85 (Α 167), όπως συμπληρώθηκε με τη διάταξη της παρ. 3 του άρθρου 6 του ν. 1674/86 (Α 203). β) της παρ. 3 του άρθρου 50 του ν. 1756/1988 (Α 35), όπως αντικαταστάθηκε με την παρ. 1 του άρθρου 94 του ν. 4055/2012 (Α 51). γ) της παρ. 3 του άρθρου 47 του ν. 2304/1995 (Α 83). δ) της παρ. 7 του άρθρου 46 του ν. 2413/1996 (Α 124). ε) της παρ. 20 του άρθρου 19 του ν. 2386/1996 (Α 43). στ) της παρ. 1 του άρθρου 21 του ν. 2946/2001 (Α 224), όπως αντικαταστάθηκε με το άρθρο 151 του ν. 4600/2019 (Α 43). ζ) της παρ. 4 του άρθρου 6 του ν. 3027/2002 (Α 152), όπως αντικαταστάθηκε με την παρ. 12 του άρθρου 44Α του ν. 4115/2013 (Α 159). η) της παρ. 8 του άρθρου 1 του ν. 3194/2003 (Α 267). θ) του άρθρου 17 του ν. 3402/2005 (Α 258). ι) των παρ. 1, 2 και 3 του άρθρου 6 του ν. 3454/2006 (Α 75). ια) της παρ. 4 του άρθρου 17 του ν. 3649/2008 (Α 39). ιβ) της παρ. 7 του άρθρου 93 του ν. 3852/2010 (Α 87), όπως αντικαταστάθηκε από το άρθρο 7 παρ. 2 του ν. 4071/2012 (Α 85). ιγ) της παρ. 10 του άρθρου 182 του ν. 3852/2010 (Α 87). ιδ) των παρ. 1 και 2 του άρθρου 31 του ν. 3848/2010 (Α 71), όπως αντικαταστάθηκε με την παρ. 2 του άρθρου 37 του ν. 4351/2015 (Α 164) και τροποποιήθηκε με την παρ. 3 του άρθρου 33 του ν. 4386/2016 (Α 83). ιε) της παρ. 5α του άρθρου 2 του ν. 3868/2010 (Α 129). ιστ) της παρ. 1 του άρθρου 12 του ν. 4071/2012 (Α 85). ιζ) του άρθρου 52 του ν. 4115/2013 (Α 24), όπως αντικαταστάθηκε με την παρ. 2 του άρθρου 39 του ν. 4403/16 (Α 125) ιη) της παρ. 12β του άρθρου 27 του ν. 4386/2016 (Α 83). ιθ) του άρθρου 29 του ν. 4521/2018 (Α 38). κ) της παρ. 17 του άρθρου 19 του ν. 4692/2020 (Α 111). κα) του Π.Δ. 50/1996 (Α 45) και του Π.Δ. 100/1997 (Α 94). 2. Το Π.Δ. 18/2018 (Α 31) «Οργανισμός Υπουργείου Παιδείας, Έρευνας και Θρησκευμάτων». 3. To Π.Δ. 81/2019 (Α 119) «Σύσταση, συγχώνευση, μετονομασία και κατάργηση Υπουργείων και καθορισμός των αρμοδιοτήτων τους – Μεταφορά υπηρεσιών και αρμοδιοτήτων μεταξύ Υπουργείων». 4. To Π.Δ. 83/2019 (Α 121) «Διορισμός Αντιπροέδρου της Κυβέρνησης, Υπουργών, Αναπληρωτών Υπουργών και Υφυπουργών». 5. Το Π.Δ. 84/2019 (Α 123) «Σύσταση και κατάργηση Γενικών Γραμματειών και Ειδικών Γραμματειών/ Ενιαίων Διοικητικών Τομέων Υπουργείων». 6. Την υπ' αριθμ. 47130/E2/16-04-2020 (ΑΔΑ: 6ΩΘΝ46ΜΤΛΗ-Π9Ω) εγκύκλιο αποσπάσεων εκπαιδευτικών. 7. Την υπ'αριθμ. 93856/Ε2/16-7-2020 Υ.Α. αποσπάσεων από ΠΥΣΔΕ σε ΠΥΣΔΕ. 8. Τις υπ' αριθμ. 18 και 19/2020 Πράξεις του Κ.Υ.Σ.Δ.Ε.. 9. Τις αιτήσεις των ενδιαφερόμενων εκπαιδευτικών. Αποφασίζουμε A. Ανακαλούμε την υπ΄ αριθμ. πρωτ. 93856/Ε2/16-7-2020 Υ.Α. μόνο ως προς το μέρος που αφορά στην απόσπαση κατά προτεραιότητα της παρακάτω εκπαιδευτικού Δ.Ε. ως ακολούθως: \| \| Α/Α \| Α.Μ \| Επώνυμο \| Όνομα \| Κλάδος \| ΠΥΣΔΕ Οργανικής \| ΠΥΣΔΕ Απόσπασης \| \|---\|---\|---\|---\|---\|---\|---\|---\| \| 1 \| \| 199653 \| ΚΑΤΡΑΚΟΥ \| ΧΡΙΣΤΙΝΑ \| ΠΕ88.05 \| ΑΝΑΤ.ΑΤΤΙΚΗΣ \| ΕΒΡΟΥ \| Β. Ανακαλούμε την υπ΄ αριθμ. πρωτ. 93856/Ε2/16-7-2020 Υ.Α. μόνο ως προς το μέρος που αφορά στην απόσπαση των παρακάτω εκπαιδευτικών Δ.Ε. ως ακολούθως: \| \| Α/Α \| \| Α.Μ. \| \| Επώνυμο \| \| Όνομα \| \| Κλάδος \| \| ΠΥΣΔΕ Οργανικής \| ΠΥΣΔΕ Απόσπασης \| \|---\|---\|---\|---\|---\|---\|---\|---\|---\|---\|---\|---\|---\| \| 1 \| \| 201210 \| \| ΑΔΑΜΟΠΟΥΛΟΣ \| \| ΒΑΣΙΛΕΙΟΣ \| \| ΠΕ02 \| \| ΚΙΛΚΙΣ \| \| \| \| 2 \| \| 703028 \| \| ΑΝΑΓΝΩΣΤΟΥ \| \| ΓΕΩΡΓΙΟΣ \| \| ΠΕ04.02 \| \| ΧΑΛΚΙΔΙΚΗ \| \| \| \| 3 \| \| 211673 \| \| ΑΝΔΡΕΑΔΑΚΗΣ \| \| ΠΕΤΡΟΣ \| \| ΠΕ01 \| \| ΚΥΚΛΑΔΕΣ \| \| \| \| 4 \| \| 211837 \| \| ΑΝΤΩΝΙΟΥ \| \| ΖΩΗ \| \| ΠΕ02 \| \| ΠΕΛΛΑ \| \| \| \| 5 \| \| 196917 \| \| ΑΡΒΑΝΙΤΟΥ \| \| ΜΕΛΑΧΡΟΙΝΗ \| \| ΠΕ02 \| \| Β ΘΕΣΣΑΛΟΝΙΚΗΣ \| \| \| \| 6 \| \| 704719 \| \| ΑΡΝΑΟΥΤΗ \| \| ΕΥΘΥΜΙΑ \| \| ΠΕ02 \| \| ΔΩΔΕΚΑΝΗΣΑ \| \| \| Α/Α 7 8 Α.Μ. 190520 190742 Επώνυμο ΑΡΝΑΟΥΤΙΔΟΥ ΑΣΔΡΕ Όνομα ΠΑΡΑΣΚΕΥΗ ΑΙΚΑΤΕΡΙΝΗ Κλάδος ΠΕ11 ΠΕ86 ΠΥΣΔΕ Οργανικής ΧΑΛΚΙΔΙΚΗ ΠΙΕΡΙΑ ΠΥΣΔΕ Απόσπασης Β ΘΕΣΣΑΛΟΝΙΚΗΣ Β ΘΕΣΣΑΛΟΝΙΚΗΣ \| 9 \| 203008 \| ΒΑΡΕΛΑΣ \| ΙΩΑΝΝΗΣ \| ΠΕ05 \| ΑΙΤΩΛΟΑΚΑΡΝΑΝΙΑ \| \|---\|---\|---\|---\|---\|---\| \| 10 \| 210429 \| ΒΑΡΣΑΜΟΠΟΥΛΟΥ \| ΜΑΡΙΑ \| ΠΕ06 \| ΘΕΣΠΡΩΤΙΑ \| \| 11 \| 208015 \| ΒΑΡΥΤΙΜΙΔΗΣ \| ΘΕΟΧΑΡΗΣ \| ΠΕ11 \| ΦΘΙΩΤΙΔΑ \| \| 12 \| 229482 \| ΒΑΣΙΛΕΙΟΥ \| ΑΛΕΞΙΟΣ \| ΠΕ86 \| ΚΥΚΛΑΔΕΣ \| \| 13 \| 203876 \| ΒΑΣΙΛΕΙΟΥ \| ΧΡΗΣΤΟΣ \| ΠΕ11 \| ΚΕΡΚΥΡΑ \| \| 14 \| 180735 \| ΒΛΑΧΟΥ \| ΜΑΡΙΑ \| ΠΕ05 \| ΒΟΙΩΤΙΑ \| \| 15 \| 704812 \| ΒΟΥΓΙΟΥΚΛΗ \| ΑΝΘΗ \| ΠΕ02 \| ΡΟΔΟΠΗ \| \| 16 \| 172411 \| ΒΟΥΛΓΑΡΗ \| ΣΩΤΗΡΙΑ \| ΠΕ87.09 \| Γ ΑΘΗΝΩΝ \| \| 17 \| 221944 \| ΓΑΛΙΟΥ \| ΙΩΑΝΝΑ \| ΠΕ02 \| ΚΟΖΑΝΗ \| \| 18 \| 199531 \| ΓΑΡΑΝΤΖΩΤΗΣ \| ΙΩΑΝΝΗΣ \| ΠΕ84 \| ΞΑΝΘΗ \| \| 19 \| 226397 \| ΓΕΩΡΓΑΡΑΚΟΣ \| ΛΕΩΝΙΔΑΣ \| ΠΕ02 \| ΠΕΙΡΑΙΑΣ \| \| 20 \| 205129 \| ΓΕΩΡΓΟΥΛΑΣ \| ΚΩΝΣΤΑΝΤΙΝΟΣ \| ΠΕ86 \| ΑΙΤΩΛΟΑΚΑΡΝΑΝΙΑ \| \| 21 \| 703797 \| ΓΙΑΝΝΟΠΟΥΛΟΣ \| ΝΙΚΟΛΑΟΣ \| ΠΕ83 \| ΑΙΤΩΛΟΑΚΑΡΝΑΝΙΑ \| \| 22 \| 227845 \| ΓΙΑΝΝΟΠΟΥΛΟΣ \| ΓΕΩΡΓΙΟΣ \| ΠΕ11 \| ΛΑΣΙΘΙΟΥ \| \| 23 \| 192895 \| ΓΙΟΝΤΖΗ \| ΕΛΕΝΗ \| ΠΕ02 \| ΤΡΙΚΑΛΑ \| \| 24 \| 221983 \| ΓΚΛΑΒΑΝΟΥ \| ΕΛΕΝΗ \| ΠΕ02 \| ΦΩΚΙΔΑ \| \| 25 \| 203898 \| ΓΟΥΛΑΣ \| ΕΥΘΥΜΙΟΣ \| ΠΕ11 \| ΕΥΒΟΙΑ \| \| 26 \| 702749 \| ΓΟΥΡΝΑ \| ΚΥΡΙΑΚΗ \| ΠΕ02 \| ΠΕΙΡΑΙΑΣ \| \| 27 \| 224627 \| ΔΑΜΙΑΝΑΚΗ \| ΦΑΝΗ \| ΠΕ08 \| ΜΕΣΣΗΝΙΑ \| \| 28 \| 700996 \| ΔΗΜΗΤΡΑΚΟΠΟΥΛΟΥ \| ΜΑΡΙΑ \| ΠΕ80 \| ΔΩΔΕΚΑΝΗΣΑ \| \| 29 \| 222032 \| ΔΟΣΗ \| ΠΑΡΑΣΚΕΥΗ \| ΠΕ02 \| ΠΡΕΒΕΖΑ \| \| 30 \| 219021 \| ΔΟΥΜΟΥΡΑ \| ΑΚΡΙΒΗ \| ΠΕ05 \| ΧΙΟΣ \| \| 31 \| 229499 \| ΖΑΦΕΙΡΔΟΥΔΗ \| ΕΥΑΓΓΕΛΙΑ \| ΠΕ86 \| ΚΥΚΛΑΔΕΣ \| \| 32 \| 180002 \| ΘΕΟΔΩΡΟΠΟΥΛΟΣ \| ΦΡΑΓΚΙΣΚΟΣ \| ΠΕ03 \| ΔΥΤ. ΑΤΤΙΚΗ \| \| 33 \| 153434 \| ΘΕΟΛΟΓΙΤΟΥ \| ΦΩΤΕΙΝΗ \| ΠΕ02 \| ΠΕΙΡΑΙΑΣ \| \| 34 \| 205011 \| ΙΩΑΝΝΟΥ \| ΜΑΡΙΑ \| ΠΕ87.09 \| Δ ΑΘΗΝΩΝ \| \| 35 \| 214973 \| ΚΑΛΑΜΑΡΑΣ \| ΣΩΤΗΡΙΟΣ \| ΠΕ82 \| ΠΕΙΡΑΙΑΣ \| \| 36 \| 198147 \| ΚΑΛΛΙΠΟΛΙΤΗΣ \| ΑΘΑΝΑΣΙΟΣ \| ΠΕ04.02 \| ΧΑΛΚΙΔΙΚΗ \| \| 37 \| 703873 \| ΚΑΛΟΥΔΗΣ \| ΠΟΛΥΧΡΟΝΗΣ \| ΠΕ82 \| ΑΝΑΤ. ΑΤΤΙΚΗ \| \| 38 \| 195929 \| ΚΑΝΕΛΛΟΠΟΥΛΟΣ \| ΘΕΟΔΩΡΟΣ \| ΠΕ83 \| ΑΡΚΑΔΙΑ \| \| 39 \| 216063 \| ΚΑΠΕΤΑΝΑΚΗ \| ΑΙΚΑΤΕΡΙΝΗ \| ΠΕ86 \| ΛΑΣΙΘΙ \| \| 40 \| 207880 \| ΚΑΡΑΓΙΑΝΝΟΠΟΥΛΟΣ \| ΙΩΑΝΝΗΣ \| ΠΕ80 \| ΘΕΣΠΡΩΤΙΑ \| \| 41 \| 222943 \| ΚΑΡΑΓΚΟΥΝΗΣ \| ΠΑΝΑΓΙΩΤΗΣ \| ΠΕ03 \| ΜΑΓΝΗΣΙΑΣ \| \| 42 \| 203966 \| ΚΑΡΑΔΗΜΗΤΡΙΟΥ \| ΔΙΑΜΑΝΤΗΣ \| ΠΕ11 \| ΣΑΜΟΥ \| \| 43 \| 205245 \| ΚΑΡΑΛΗ \| ΕΥΑΝΘΙΑ \| ΠΕ86 \| ΠΕΙΡΑΙΑΣ \| \| 44 \| 204677 \| ΚΑΡΑΠΕΤΑΚΟΣ \| ΑΡΙΣΤΕΙΔΗΣ \| ΠΕ82 \| ΔΥΤ. ΑΤΤΙΚΗ \| \| 45 \| 199406 \| ΚΕΛΛΑΡΟΥ \| ΑΘΑΝΑΣΙΑ \| ΠΕ81 \| ΡΟΔΟΠΗ \| \| 46 \| 229263 \| ΚΟΚΚΙΝΑΚΗ \| ΑΙΚΑΤΕΡΙΝΗ \| ΠΕ08 \| ΗΡΑΚΛΕΙΟ \| \| 47 \| 215492 \| ΚΟΝΔΥΛΗΣ \| ΝΙΚΟΛΑΟΣ \| ΠΕ86 \| ΑΝΑΤ. ΑΤΤΙΚΗ \| \| 48 \| 220393 \| ΚΟΝΤΟΝΙΚΑ \| ΠΑΝΩΡΑΙΑ \| ΠΕ02 \| ΑΝΑΤ. ΑΤΤΙΚΗ \| \| 49 \| 173051 \| ΚΟΡΔΑ \| ΑΦΕΝΤΟΥΛΑ \| ΠΕ79.01 \| ΚΕΡΚΥΡΑ \| \| 50 \| 198559 \| ΚΟΤΡΩΝΗ \| ΜΑΡΙΑ \| ΠΕ06 \| ΤΡΙΚΑΛΑ \| \| 51 \| 703648 \| ΚΟΥΚΙΟΓΛΟΥ \| ΣΤΑΥΡΟΣ \| ΠΕ04.01 \| ΕΒΡΟΣ \| \| 52 \| 203312 \| ΚΟΥΛΑ \| ΘΕΟΔΩΡΑ \| ΠΕ06 \| Β ΘΕΣΣΑΛΟΝΙΚΗΣ \| \| 53 \| 197747 \| ΚΟΥΜΚΟΥΜΗΣ \| ΠΑΝΑΓΙΩΤΗΣ \| ΠΕ03 \| ΚΟΖΑΝΗ \| Α/Α 54 55 Α.Μ. 224973 217975 Επώνυμο ΚΟΥΡΟΣ ΚΟΥΤΑΝΤΟΣ Όνομα ΒΑΣΙΛΕΙΟΣ ΙΩΑΝΝΗΣ Κλάδος ΠΕ11 ΠΕ03 ΠΥΣΔΕ Οργανικής ΚΕΡΚΥΡΑ ΗΡΑΚΛΕΙΟ ΠΥΣΔΕ Απόσπασης Β ΘΕΣΣΑΛΟΝΙΚΗΣ ΚΑΣΤΟΡΙΑ \| 56 \| 227283 \| ΚΥΡΙΤΣΗΣ \| ΚΩΝΣΤΑΝΤΙΝΟΣ \| ΠΕ04.01 \| Δ ΑΘΗΝΩΝ \| \|---\|---\|---\|---\|---\|---\| \| 57 \| 219279 \| ΚΥΡΜΑΝΙΔΟΥ \| ΕΛΛΗ \| ΠΕ06 \| ΛΕΥΚΑΔΑ \| \| 58 \| 194374 \| ΚΩΣΤΗΣ \| ΛΑΜΠΡΟΣ \| ΠΕ11 \| ΦΩΚΙΔΑ \| \| 59 \| 223418 \| ΛΑΜΠΡΟΠΟΥΛΟΣ \| ΙΩΑΝΝΗΣ \| ΠΕ04.01 \| ΚΟΖΑΝΗ \| \| 60 \| 700662 \| ΛΙΑΡΑΚΟΣ \| ΓΕΩΡΓΙΟΣ \| ΠΕ04.02 \| ΑΝΑΤ. ΑΤΤΙΚΗ \| \| 61 \| 703066 \| ΛΙΤΙΝΑΣ \| ΑΝΤΩΝΙΟΣ \| ΠΕ04.01 \| ΗΛΕΙΑ \| \| 62 \| 227986 \| ΛΥΚΟΥΔΗΣ \| ΓΕΡΑΣΙΜΟΣ \| ΠΕ11 \| ΑΝΑΤ. ΑΤΤΙΚΗ \| \| 63 \| 220118 \| ΛΥΜΠΕΡΑΤΟΥ \| ΑΝΤΩΝΙΑ \| ΠΕ87.02 \| Δ ΑΘΗΝΩΝ \| \| 64 \| 704624 \| ΜΑΓΙΑΦΟΓΛΟΥ \| ΕΥΣΤΡΑΤΙΑ \| ΠΕ02 \| ΚΥΚΛΑΔΕΣ \| \| 65 \| 217551 \| ΜΑΚΚΑ \| ΛΑΜΠΡΙΝΗ ΦΙΛ \| ΠΕ02 \| ΦΩΚΙΔΑ \| \| 66 \| 227994 \| ΜΑΛΛΙΑΡΙΔΟΥ \| ΧΡΥΣΟΥΛΑ \| ΠΕ11 \| ΔΩΔΕΚΑΝΗΣΑ \| \| 67 \| 702226 \| ΜΑΡΑΓΚΟΥ \| ΑΙΚΑΤΕΡΙΝΗ \| ΠΕ02 \| ΛΕΥΚΑΔΑ \| \| 68 \| 202896 \| ΜΑΡΟΥΛΗΣ \| ΓΕΩΡΓΙΟΣ \| ΠΕ04.04 \| ΑΧΑΙΑ \| \| 69 \| 207903 \| ΜΑΤΑΛΙΩΤΑΚΗ \| ΔΗΜΗΤΡΑ \| ΠΕ80 \| ΗΡΑΚΛΕΙΟ \| \| 70 \| 216433 \| ΜΑΤΣΙΚΑΣ \| ΘΕΟΔΩΡΟΣ \| ΠΕ80 \| Α ΘΕΣΣΑΛΟΝΙΚΗΣ \| \| 71 \| 224162 \| ΜΑΤΣΙΟΥ \| ΒΗΘΛΕΕΜ \| ΠΕ06 \| ΚΕΡΚΥΡΑ \| \| 72 \| 178324 \| ΜΑΥΡΟΥΔΗ \| ΕΛΙΣΑΒΕΤ \| ΠΕ86 \| ΔΩΔΕΚΑΝΗΣΑ \| \| 73 \| 703043 \| ΜΕΣΘΕΝΕΑ \| ΑΝΑΣΤΑΣΙΑ \| ΠΕ03 \| Β ΘΕΣΣΑΛΟΝΙΚΗΣ \| \| 74 \| 213253 \| ΜΕΤΑΞΑΣ \| ΠΑΝΑΓΙΩΤΗΣ \| ΠΕ04.01 \| Β ΑΘΗΝΩΝ \| \| 75 \| 225722 \| ΜΗΛΙΟΥ \| ΧΡΙΣΤΙΝΑ \| ΠΕ03 \| Β ΘΕΣΣΑΛΟΝΙΚΗΣ \| \| 76 \| 210944 \| ΜΙΣΑΗΛΙΔΗΣ \| ΑΝΘΙΜΟΣ \| ΠΕ86 \| ΦΩΚΙΔΑ \| \| 77 \| 701844 \| ΜΙΧΑΗΛΙΔΗΣ \| ΣΤΕΦΑΝΟΣ \| ΠΕ84 \| ΠΕΛΛΑ (ΚΕΣΥ) \| \| 78 \| 171133 \| ΜΟΥΜΟΥΡΗ \| ΕΛΕΝΗ \| ΠΕ06 \| Α ΘΕΣΣΑΛΟΝΙΚΗΣ \| \| 79 \| 214582 \| ΜΟΥΡΑΤΙΔΟΥ \| ΜΑΡΙΑ \| ΠΕ11 \| ΒΟΙΩΤΙΑ \| \| 80 \| 190911 \| ΜΠΑΝΤΑΒΗ \| ΕΛΕΝΗ \| ΠΕ86 \| ΗΜΑΘΙΑ \| \| 81 \| 190562 \| ΜΠΑΧΑΣ \| ΙΩΑΝΝΗΣ \| ΠΕ11 \| ΒΟΙΩΤΙΑ \| \| 82 \| 196283 \| ΜΠΙΤΖΙΚΟΥΔΗ \| ΜΑΤΕΝΙΑ \| ΠΕ86 \| Γ ΑΘΗΝΑΣ \| \| 83 \| 205424 \| ΜΠΟΥΡΝΤΕΝΑΣ \| ΛΕΩΝΙΔΑΣ \| ΠΕ86 \| ΡΟΔΟΠΗ \| \| 84 \| 700515 \| ΜΩΥΣΙΑΔΟΥ \| ΜΑΡΘΑ \| ΠΕ02 \| ΧΑΛΚΙΔΙΚΗ \| \| 85 \| 704426 \| ΝΑΣΤΑ \| ΠΑΡΑΣΚΕΥΗ \| ΠΕ02 \| ΜΑΓΝΗΣΙΑΣ \| \| 86 \| 700889 \| ΝΕΡΑΝΤΖΗΣ \| ΝΙΚΟΛΑΟΣ \| ΠΕ11 \| ΔΩΔΕΚΑΝΗΣΑ \| \| 87 \| 218513 \| ΝΙΚΟΛΑΪΔΟΥ \| ΑΛΕΞΑΝΔΡΑ \| ΠΕ04.01 \| Β ΘΕΣΣΑΛΟΝΙΚΗΣ \| \| 88 \| 168440 \| ΝΙΚΟΛΑΟΥ \| ΑΝΤΙΓΟΝΗ \| ΠΕ06 \| ΣΕΡΡΕΣ \| \| 89 \| 208939 \| ΝΙΚΟΛΑΟΥ \| ΜΑΡΙΑ \| ΠΕ87.09 \| ΔΥΤ. ΑΤΤΙΚΗ \| \| 90 \| 226694 \| ΝΙΚΟΛΟΠΟΥΛΟΥ \| ΕΛΕΝΗ \| ΠΕ02 \| ΑΝΑΤ. ΑΤΤΙΚΗ \| \| 91 \| 203387 \| ΝΤΕΒΕΤΖΗ \| ΕΛΙΣΑΒΕΤ \| ΠΕ06 \| ΚΕΡΚΥΡΑ \| \| 92 \| 220488 \| ΝΤΟΓΚΑ \| ΓΕΩΡΓΙΑ \| ΠΕ02 \| ΠΕΙΡΑΙΑΣ \| \| 93 \| 226300 \| ΞΥΔΑΚΗΣ \| ΙΩΑΝΝΗΣ \| ΠΕ01 \| ΠΕΙΡΑΙΑΣ \| \| 94 \| 194883 \| ΟΥΖΟΥΝΟΓΛΟΥ \| ΔΕΣΠΟΙΝΑ \| ΠΕ88.03 \| ΚΟΖΑΝΗ \| \| 95 \| 194466 \| ΠΑΓΚΑΛΙΔΗΣ \| ΙΩΑΝΝΗΣ \| ΠΕ11 \| ΚΟΖΑΝΗ \| \| 96 \| 225086 \| ΠΑΝΑΓΟΠΟΥΛΟΥ \| ΕΛΕΝΗ \| ΠΕ11 \| ΖΑΚΥΝΘΟΣ \| \| 97 \| 704686 \| ΠΑΠΑΓΕΩΡΓΙΟΥ \| ΙΩΑΝΝΑ \| ΠΕ03 \| ΠΕΙΡΑΙΑΣ \| \| 98 \| 218535 \| ΠΑΠΑΓΙΑΝΝΟΠΟΥΛΟΥ \| ΕΛΕΥΘΕΡΙΑ \| ΠΕ04.01 \| ΑΝΑΤ. ΑΤΤΙΚΗ \| \| 99 \| 215653 \| ΠΑΠΑΙΩΑΝΝΟΥ \| ΠΑΝΑΓΙΩΤΗΣ \| ΠΕ86 \| ΗΛΕΙΑ \| \| 100 \| 208233 \| ΠΑΤΡΑΣ \| ΧΡΗΣΤΟΣ \| ΠΕ11 \| ΚΕΡΚΥΡΑ \| \| \| Α/Α \| \| Α.Μ. \| \| Επώνυμο \| \| Όνομα \| \| Κλάδος \| \| ΠΥΣΔΕ Οργανικής \| ΠΥΣΔΕ Απόσπασης \| \|---\|---\|---\|---\|---\|---\|---\|---\|---\|---\|---\|---\|---\| \| 101 \| \| 218950 \| \| ΠΕΤΡΑΚΗΣ \| \| ΒΑΣΙΛΕΙΟΣ \| \| ΠΕ04.05 \| \| ΣΑΜΟΥ \| \| \| \| 102 \| \| 209690 \| \| ΠΕΤΡΟΧΕΙΛΟΥ \| \| ΙΩΑΝΝΑ \| \| ΠΕ02 \| \| ΠΕΙΡΑΙΑΣ \| \| \| \| 103 \| \| 222546 \| \| ΠΥΡΓΟΛΙΟΥ \| \| ΧΡΥΣΟΥΛΑ \| \| ΠΕ02 \| \| ΕΥΡΥΤΑΝΙΑ \| \| \| \| 104 \| \| 219864 \| \| ΡΑΓΓΟΣ \| \| ΒΑΪΟΣ \| \| ΠΕ11 \| \| ΠΕΙΡΑΙΑΣ \| \| \| \| 105 \| \| 171171 \| \| ΡΟΒΟΛΗ \| \| ΜΑΡΙΑ \| \| ΠΕ06 \| \| ΜΕΣΣΗΝΙΑ \| \| \| \| 106 \| \| 212404 \| \| ΣΑΜΟΪΛΗΣ \| \| ΓΡΗΓΟΡΙΟΣ \| \| ΠΕ02 \| \| ΚΕΡΚΥΡΑ \| \| \| \| 107 \| \| 171646 \| \| ΣΑΡΙΔΟΥ \| \| ΖΩΗ \| \| ΠΕ11 \| \| ΠΕΙΡΑΙΑΣ \| \| \| \| 108 \| \| 218203 \| \| ΣΙΑΠΚΑΣ \| \| ΣΩΤΗΡΙΟΣ \| \| ΠΕ03 \| \| ΙΩΑΝΝΙΝΩΝ \| \| \| \| 109 \| \| 182402 \| \| ΣΙΔΗΡΟΠΟΥΛΟΥ ΚΟΥΤΣΟΥΠΙΑ \| \| ΑΝΑΣΤΑΣΙΑ \| \| ΠΕ01 \| \| ΗΜΑΘΙΑ \| \| \| \| 110 \| \| 209238 \| \| ΣΙΜΟΡΕΛΗ \| \| ΔΗΜΗΤΡΑ \| \| ΠΕ86 \| \| ΚΑΣΤΟΡΙΑ \| \| \| \| 111 \| \| 208534 \| \| ΣΙΝΟΥ \| \| ΜΑΡΙΑ \| \| ΠΕ80 \| \| ΦΘΙΩΤΙΔΑ \| \| \| \| 112 \| \| 200150 \| \| ΣΙΩΚΑ \| \| ΧΡΙΣΤΙΝΑ \| \| ΠΕ86 \| \| ΚΙΛΚΙΣ \| \| \| \| 113 \| \| 170070 \| \| ΣΚΟΥΦΗ \| \| ΒΑΣΙΛΙΚΗ \| \| ΠΕ02 \| \| ΑΡΓΟΛΙΔΑ \| \| \| \| 114 \| \| 184875 \| \| ΣΟΦΤΣΗΣ \| \| ΘΑΝΟΣ \| \| ΠΕ11 \| \| ΑΝΑΤ. ΑΤΤΙΚΗ \| \| \| \| 115 \| \| 210721 \| \| ΣΠΑΝΑΚΗ \| \| ΑΝΝΑ \| \| ΠΕ05 \| \| ΛΕΣΒΟΥ \| \| \| \| 116 \| \| 210722 \| \| ΣΤΑΘΟΠΟΥΛΟΥ \| \| ΒΑΣΙΛΙΚΗ \| \| ΠΕ05 \| \| ΚΥΚΛΑΔΕΣ \| \| \| \| 117 \| \| 227510 \| \| ΣΤΑΪΚΙΔΗΣ \| \| ΧΡΗΣΤΟΣ \| \| ΠΕ04.04 \| \| Β ΘΕΣΣΑΛΟΝΙΚΗΣ \| \| \| \| 118 \| \| 199167 \| \| ΤΕΡΖΗΣ \| \| ΑΘΑΝΑΣΙΟΣ \| \| ΠΕ11 \| \| ΔΩΔΕΚΑΝΗΣΑ \| \| \| \| 119 \| \| 192825 \| \| ΤΕΣΣΕΡΗ \| \| ΜΑΓΔΑΛΗΝΗ \| \| ΠΕ01 \| \| Β ΑΘΗΝΩΝ \| \| \| \| 120 \| \| 190244 \| \| ΤΖΙΜΟΓΙΑΝΝΗΣ \| \| ΔΗΜΗΤΡΙΟΣ \| \| ΠΕ04.04 \| \| ΚΑΒΑΛΑΣ \| \| \| \| 121 \| \| 212467 \| \| ΤΖΩΡΤΖΗΣ \| \| ΕΜΜΑΝΟΥΗΛ \| \| ΠΕ02 \| \| ΦΛΩΡΙΝΑ \| \| \| \| 122 \| \| 210725 \| \| ΤΟΜΑΡΑ \| \| ΜΑΡΙΝΑ \| \| ΠΕ05 \| \| ΦΛΩΡΙΝΑ \| \| \| \| 123 \| \| 228158 \| \| ΤΟΠΑΛΙΔΗΣ \| \| ΝΙΚΟΛΑΟΣ \| \| ΠΕ11 \| \| ΚΥΚΛΑΔΕΣ \| \| \| \| 124 \| \| 215780 \| \| ΤΣΑΚΑΛΗΣ \| \| ΔΗΜΗΤΡΙΟΣ \| \| ΠΕ86 \| \| ΧΙΟΣ \| \| \| \| 125 \| \| 199631 \| \| ΤΣΑΥΛΟΥ \| \| ΜΑΡΙΑ \| \| ΠΕ88.02 \| \| Α ΘΕΣΣΑΛΟΝΙΚΗΣ \| \| \| \| 126 \| \| 704628 \| \| ΤΣΕΛΙΟΥ \| \| ΧΡΙΣΤΙΝΑ \| \| ΠΕ02 \| \| ΔΩΔΕΚΑΝΗΣΑ \| \| \| \| 127 \| \| 398178 \| \| ΤΣΙΑΓΚΙΡΗΣ \| \| ΔΙΑΜΑΝΤΗΣ \| \| ΠΕ04.01 \| \| Α ΘΕΣΣΑΛΟΝΙΚΗΣ \| \| \| \| 128 \| \| 225211 \| \| ΤΣΙΑΜΗΣ \| \| ΑΣΤΕΡΙΟΣ \| \| ΠΕ11 \| \| ΛΑΡΙΣΑΣ \| \| \| \| 129 \| \| 207694 \| \| ΤΣΙΟΥΜΑ \| \| ΓΙΑΝΝΟΥΛΑ \| \| ΠΕ06 \| \| ΑΙΤΩΛΟΑΚΑΡΝΑΝΙΑ \| \| \| \| 130 \| \| 177509 \| \| ΤΥΡΙΚΟΣ ΕΡΓΑΣ \| \| ΠΑΝΟΡΜΙΤΗΣ \| \| ΠΕ82 \| \| ΔΩΔΕΚΑΝΗΣΑ \| \| \| \| 131 \| \| 229283 \| \| ΦΩΤΕΙΝΑΚΗ \| \| ΜΑΡΙΑ \| \| ΠΕ08 \| \| ΧΑΝΙΑ \| \| \| \| 132 \| \| 197586 \| \| ΧΑΛΙΑΣΟΥ \| \| ΚΩΝΣΤΑΝΤΙΑ \| \| ΠΕ02 \| \| ΠΡΕΒΕΖΑ \| \| \| \| 133 \| \| 228201 \| \| ΧΕΡΙΣΤΑΝΙΔΗΣ \| \| ΠΑΝΑΓΙΩΤΗΣ \| \| ΠΕ11 \| \| ΚΥΚΛΑΔΕΣ \| \| \| \| 134 \| \| 214874 \| \| ΧΟΥΛΙΑΡΑΣ \| \| ΓΕΩΡΓΙΟΣ \| \| ΠΕ88.01 \| \| ΑΝΑΤ. ΑΤΤΙΚΗ \| \| \| \| 135 \| \| 207795 \| \| ΧΡΕΒΒΑΤΑΚΗ \| \| ΣΟΥΛΤΑΝΑ \| \| ΠΕ07 \| \| ΣΕΡΡΕΣ \| \| \| Παρακαλούνται οι Διευθυντές Δευτεροβάθμιας Εκπαίδευσης των περιοχών οργανικής των εκπαιδευτικών να κοινοποιήσουν την απόφαση αυτή στους ενδιαφερόμενους και να τη γνωστοποιήσουν στις σχολικές μονάδες στις οποίες υπηρετούν. Η ΥΠΟΥΡΓΟΣ Εσωτερική Διανομή: 1. Γραφείο Υπουργού 2. Γραφείο Γενικής Γραμματέως Α/θμιας, Β/θμιας Εκπ/σης και Ειδικής Αγωγής 3. Γενική Διεύθυνση Εκπ/κού Προσωπικού Π.Ε. & Δ.Ε. 4. Δ/νση Διοίκησης Εκπ/κού Προσωπικού Π.Ε. & Δ.Ε. - Τμήμα Β΄ 5. Δ/νση Ανάπτυξης Πληροφοριακών Συστημάτων – Τμήμα Β΄ 6. Δ/νση Εκπαιδευτικής Τεχνολογίας & Καινοτομίας - Τμήμα Α΄ 7. Κ.Υ.Σ.Δ.Ε.	<urn:uuid:764916df-905f-4031-9f9a-a174790349fa>	HuggingFaceFW/finepdfs/tree/main/data/ell_Grek/train	finepdfs	ell_Grek	13,860
Parson to Person ROMANS 4 PART 3 "What then shall we say that Abraham our father has found according to the flesh? For if Abraham was justified by works, he has something to boast about, but not before God. For what does the Scripture say? 'Abraham believed God, and it was accounted to him for righteousness.' Now to him who works, the wages are not counted as grace but as debt. But to him who does not work but believes on Him who justifies the ungodly, his faith is accounted for righteousness, just as David also describes the blessedness of the man to whom God imputes righteousness apart from works: 'Blessed are those whose lawless deeds are forgiven, and whose sins are covered; Blessed is the man to whom the LORD shall not impute sin.' Does this blessedness then come upon the circumcised only, or upon the uncircumcised also? For we say that faith was accounted to Abraham for righteousness. How then was it accounted? While he was circumcised, or uncircumcised? Not while circumcised, but while uncircumcised. And he received the sign of circumcision, a seal of the righteousness of the faith which he had while still uncircumcised, that he might be the father of all those who believe, though they are uncircumcised, that righteousness might be imputed to them also, and the father of circumcision to those who not only are of the circumcision, but who also walk in the steps of the faith which our father Abraham had while still uncircumcised. For the promise that he would be the heir of the world was not to Abraham or to his seed through the law, but through the righteousness of faith. For if those who are of the law are heirs, faith is made void and the promise made of no effect, because the law brings about wrath; for where there is no law there is no transgression. Therefore it is of faith that it might be according to grace, so that the promise might be sure to all the seed, not only to those who are of the law, but also to those who are of the faith of Abraham, who is the father of us all (as it is written, 'I have made you a father of many nations') in the presence of Him whom he believed—God, who gives life to the dead and calls those things which do not exist as though they did; who, contrary to hope, in hope believed, so that he became the father of many nations, according to what was spoken, 'So shall your descendants be.' And not being weak in faith, he did not consider his own body, already dead (since he was about a hundred years old), and the deadness of Sarah's womb. He did not waver at the promise of God through unbelief, but was strengthened in faith, giving glory to God, and being fully convinced that what He had promised He was also able to perform. And therefore 'it was accounted to him for righteousness.' Now it was not written for his sake alone that it was imputed to him, but also for us. It shall be imputed to us who believe in Him who raised up Jesus our Lord from the dead, who was delivered up because of our offenses, and was raised because of our justification" (Romans 4:1–25 NKJV). When we talk about justification by faith, and give focus to the word "justification" through the definition, "just-if-I'd" never sinned, we tend to think that God forgives our sins but remembers them nonetheless. In doing this, we get the Gospel wrong! God did say, "Their sins and their lawless deeds I will remember no more" (Hebrews 10:17 NKJV). This blessing and promise is part of the New Covenant promised to Israel and enjoyed by all the people of (the) faith. Paul, when reciting David, gave special attention to this when he wrote, "blessed is the man to whom the LORD shall not impute sin" (vs. 8). Of interest is also the hidden gem here recorded in chapter 4. Last week I mentioned that, "Abraham was called by God at the age of 75 (Genesis 12:1–4). At that time, God began to communicate His promise to him. Closely thereafter, Abraham and Sarah journeyed to Canaan for a brief period. Then, as the result of famine in the land of Canaan, they sojourned to Egypt for the space of about 10 years. Following their return, God once again confirmed His promise to Abraham (Genesis 13:14–16 and 15:1–7) by an unconditional, one-sided covenant. Shortly thereafter, Sarah encouraged Abraham to take her handmaiden (Hagar) in order to help fulfill the promises of God. This was a big mistake. The result was the birth of a son (by Hagar) named Ishmael. However, God had promised Abraham and Sarah a son—a son of promise. Nonetheless, Abraham (through the flesh) attempted to assist God in the fulfillment of that promise. This, among other things, was what Abraham learned 'according to the flesh'—that God did not need his help and that the promises and blessings of God would come through faith—not by works." However, here in chapter 4 Paul makes no mention of Abraham's shortcomings. He simply recalls the history by saying, he, "not being weak in faith…did not waver at the promise of God through unbelief, but was strengthened in faith, giving glory to God…and therefore 'it was accounted to him for righteousness'" (vss. 19–22). Paul provided no mention of Abraham's lapses—and there were many. Abraham lied about his wife, required his wife to lie. He demonstrated a lapse in faith when allowing his wife to lead him toward trust in the flesh (with Hagar), and when doing as she suggested. Abraham clearly was not one who lived in "unwavering faith." However, the way the Holy Spirit inspired Paul to recall the history "remembers" it like this: "He did not waver at the promise of God through unbelief, but was strengthened in faith" (vs. 20). Praise the Lord! My friends, the same is true for you and me. History can faithfully tell the story of our lives and of all our shortcomings. However, God remembers our sin no more. "Blessed are those whose lawless deeds are forgiven, and whose sins are covered; blessed is the man to whom the LORD shall not impute sin" (vss. 7–8). I love you all, Pastor Paul	<urn:uuid:a906c801-7f6d-4aa6-9f25-b387fb3bf9b6>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	5,987
CORRELATION OF OBJECTIVE AND SUBJECTIVE PARAMETERS IN RESEARCH OF URBAN GREEN SPACES ACCESSIBILITY ON THE EXAMPLE OF BRATISLAVA PETER BAUS, IVANA KOHUTKOVÁ, RASTISLAV KRIVOSUDSKÝ Department of Landscape Ecology, Comenius University in Bratislava, Faculty of Natural Sciences, Mlynská dolina, 842 15 Bratislava, Slovakia, e-mail: email@example.com, firstname.lastname@example.org, email@example.com Received: 11 th April 2011,Accepted: 27 th May 2012 ABSTRACT The article deals with the accessibility of urban green spaces in Bratislava city. These areas are considered to be a significant part of urban environment as they fulfil many crucial functions. The research is focused on greenery of Bratislava - an important landshaping component of urban landscape - which influences residents´ quality of life as a place for regeneration and rest. The main goal of the research is evaluation of green urban spaces accessibility in Bratislava from the time perspective by different types of transport using a questionnaire survey and available network analysis method. We use correlations of objective data gained by network analysis and subjective data obtained from the questionnaire survey. By using these methods, we were able to determine areas within Bratislava city specific in high or low correlation results. These results may be used in urban planning process focused on urban green spaces distribution. Key words: urban green spaces; accessibility; Bratislava city, network analysis; questionnaire. INTRODUCTION Urban green spaces have been designated in the cities since the 1880s in order to avoid the environmental impacts of urban expansion and intensification. Urban green spaces are public green areas, mostly covered by vegetation and situated in the urban space. First of all, these areas serve as places for active or passive recreation and in general, they also have positive effects on urban setting (Reháčková and Pauditšová 2006). Plants, notably trees, provide a wide range of environmental benefits and functions, and urban green spaces often accommodate varied assemblages of flora and small animals, providing readily accessible sites with natural ingredients or surrogates of nature for the enjoyment of the people who are otherwise detached from nature (Liu and Liu 2008: 353). When we think about the cities in terms of competitiveness, in international meaning, one of the major aspects to take into account is the presence of public facilities such as urban parks or various types of green spaces. Another significant aspect is the accessibility to these green spaces. These notions can be viewed as differences between an industrial society, in which the primary focus is on economic efficiency and productivity, versus aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa a more cultural oriented society where a higher quality of life is prioritized (Oh and Jeong 2007). Urban green spaces play a central role, both physically and functionally, in urban planning and development (Pasaogullari and Doratli 2004). They support urban ecological and social systems: a fact recognised in public policy commitments in Europe. Provision, the distribution of green space and the ease of access to such spaces are the key contributors to social and ecological function in urban environments. The condition of urban green spaces underpins the functionality of urban ecosystems. Urban green spaces play a key role in maintenance or restoration of biodiversity and provide important ecosystem services in urban areas (Gaston et al. 2005). Many urban theorists state the significance of urban green spaces as one of the principal components of a healthy urban setting (Pasaogullari and Doratli 2004). Recently, they have become less significant, because they are neglected in the urban planning process or because so of them are lost. Additionally, accessibility and utilization of these areas decreases, since urban green spaces have been neglected in urban planning and development processes. Accessibility and utilization of urban green spaces and their physical and functional structures are among the issues that are negatively affected by rapid urban growth. Especially in developing economies, green spaces in urban settlements are far behind reaching the contemporary standards of better endowed cities (Pasaogullari and Doratli 2004). Many studies demonstrated that the quality and accessibility of green spaces are, from the social perspective, more important factors than their numbers in a particular area. Hence, the accessibility of green spaces in urban areas is considered to be a significant indicator of quality of life assessment (Reháčková and Pauditšová 2006). Accessibility is a frequently-used concept but there is no consensus about its definition and formulation. It is a common term experienced by various individuals (i.e. characterised by different needs, abilities and opportunities) at any place and moment of the day, which results in considerable variation in components included in the measure, and in how it is formulated (Vandenbulcke et al. 2009: 40). According to Lau and Chiu (2003: 197) accessibility is defined as the freedom or ability of people to achieve their basic needs in order to sustain their quality of life. In Europe, the European Environment Agency (EEA) recommends that people should have access to green space within 15 minutes walking distance (Barbosa et al. 2007). English Nature (now Natural England) provides a set of standards for evaluating the provision of and access to natural places in the Accessible Natural Greenspace Standards (ANGSt). The ANGSt model specifies guidelines for greenspace access provision (Comber et al. 2008: 104): * No person should live more than 300m from their nearest area of natural green space of at least 2ha in size. * There should be at least one accessible 20ha site within 2km from home. * There should be one accessible 100ha site within 5km. * There should be one accessible 500ha site within 10km. This model was developed in the early 1990s and was based on research into minimum distances people would travel to the natural environment. However, no scientific publication could be found specifically discussing this model. According to the authors´ research a number of issues raised which were seen as problems for the implementation of the ANGSt model. The main difficulty was seen in the lack of clear guidance for the application of the model (Handley et al. 2003). Although the distances and areas did not match any logical order, model gives us the basic view or guideline for people's needs within the green spaces in measurable variables. During our research we followed the mathematical order of numbers. We established 450m distance as a limit which is approximately 5 minutes walking distance. Based on the stated above, we may agree with Calthorpe (1993 in Pasaogullari and Doratli 2004: 226) that public parks and similar areas are fundamental features of livable and enjoyable higher-density communities. The aim of our research is to find out the correlation between the subjective opinions of Bratislava inhabitants and objective data relating to the distance between their homes and the urban green spaces. The selected method has the potential to provide a tool for optimalization of urban green spaces network and inhabitants satisfaction with it. MATERIALS The model area Bratislava, the capital city of the Slovak Republic, was selected as a model area for the analysis of urban green spaces accessibility. Bratislava is situated in the south-western part of Slovakia, between the Danubian Plain and the Small Carpathians Mountains, near to the border with Hungary and Austria.The altitude of the city ranges from 125 m to 514 m (Mazúr and Lukniš 1986). According to administrative divisions, the city belongs to Bratislava County and is divided into 5 districts and 17 city parts (CP). The area of Bratislava reaches approximately 368 km 2 with the population of 429,000 people. The average density is of 1,166 inhabitants per square kilometer (Štatistický úrad SR 2009). Relating to the means of transport, cars, public transport, bicycle and walking are the most utilized means when people move from one place to another across Bratislava (Magistrát hlavného mesta SR Bratislavy 1996). Due to the status of capital city, its geographical location, proximity of Vienna (the capital of Austria) and Budapest (the capital of Hungary) and high number of unbuilt areas, it represents one of the fastest growing cities in Central Europe. Urban greenery in Bratislava We chose 28 urban green places, which are accessible to the public and fulfil the recreation function and 11 entry points to forests and forestparks. The selection and characteristics of particular areas follows the publications of Reháčková and Pauditšová (2003, 2004, 2006), Reháčková et al. (2007) and Reháčková (2009) specialized in urban greenery analysis in Bratislava. We define the minimum area of green spaces as 0.5 ha and we also consider the significance and visit rate of the places. Selected urban green spaces are divided into following categories (Reháčková and Pauditšová 2003): Parks, arboretums and ZOOs; Landscaped areas around housing estates; Historical cemeteries; Forests and forestparks (see table 1). Within the first category, the ZOOs were not taken into the consideration as the research targeted parks and arboretums only. Parks are representational and significant areas with interesting composition of species, landscaped areas around housing estates with existing paths. They are covered by planted trees and shrubs, various flower decorations and mobiliari (benches, fountains, sculptures, etc.). The recreational, aesthetic and ecological aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa functions prevail. Parks are divided into two categories - historical and modern parks. Historical types of parks comprise of various garden styles with high cultural value in general. Modern parks have been established within the landscaped surroundings of new blocks of flats in 1960's - 1980's. Table 1: Categories of surveyed urban green spaces in Bratislava Second category includes areas which do not match the criteria for parks, where the greenery within blocks of flats is dominant. Their primary function is short-term recreation in proximate people´s home surroundings (with components of benches and playgrounds including sandpiles, climbing frames, etc.). Furthermore, the research was focused on landscaped areas near water courses. Historical cemeteries, belonging to the third category, are areas with a reverent character with long history and typically rich in greenery. They are popular due to the recreational and ecological functions what means they serve more as parks than cemeteries. Forests and forest parks, in the fourth category, comprise of the forest land fund and are characterized by the presence of natural or nature close vegetation. These areas are situated mostly in the marginal parts of urban settings. The ecological function (especially when they are part of a protected area) is dominant, although the additional recreational function is also important. In city parts Vajnory, Rača, New Town and Záhorská Bystrica, the surveyed areas are part of Small Carpathians Mts. Protected Landscape Area. Moreover, for the purpose of our research we added 11 entry points to the forests and forestparks in the Bratislava surrounding because the data gained during the questionnaire survey show high satisfaction of residents, who live near the forests or forest parks, with urban green spaces. This fact suggests that respondents consider forests and forestparks to be a significant part of urban green spaces. METHODS Our research was carried out in several phases. In the first step, we realized the questionnaire survey among Bratislava citizens (people with permanent or temporary address in the city). The questionnaire form consisted of simple closed questions. Moreover, respondents were also asked to provide their address. In order to maintain respondents´ anonymity, they covered only the name of the street they live in. This allowed us to allocate individual answers to almost exact geographical location within the city. The geographical location was generated through the Google Maps API application. It also allows to measure the network distance between two geographical points and enabled us to calculate the time needed for moving between these points by certain means of transport. We identified the entire list of urban green spaces of Bratislava and for each position we conducted a network analysis of accessibility from respondents' addresses and chose the nearest green area. Thereby, we obtained data relating to time needed for walk (in seconds) from respondent´s home to each urban green space in Bratislava which were inserted into the database. Then we were able to find out what time each respondent needs to reach the nearest green space. According to Barbosa et al. (2007) we set the average value of intervals to 15 minutes (900 seconds). We divided data relating to accessibility, collected from all respondents, to four intervals: 0 - 450; 451 - 900; 901 - 1350; 1351 - ∞. Moreover, we divided the answers into four categories and afterwards, compared questionnaire results with the network analysis results in the virtual settings by GIS tools. RESULTS Questionnaire survey Questionnaire survey was carried out among 428 citizens of Bratislava. Respondents were selected randomly, however with the requirement of visiting the urban green space at least occasionally. The questionnaire included six questions related to the quality and aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa accessibility of urban green spaces. However, for purposes of this article we present results of only two of them: 1. What kind of transport do you use when you visit urban green spaces? (Options: bicycle, public transport, car, walking) 2. Are you satisfied with the accessibility of parks in the surroundings of your home? (Options: very satisfied, satisfied, less satisfied, not satisfied) The results showed that most of the respondents (66 %) walk or take public transport (25 %) when they feel the need to visit green spaces. Only 5 % of them use the bicycle and 4 % go by car. Due to these facts, the research was focused especially on the walking accessibility. Regarding the satisfaction with accessibility to the green areas, 42 % of respondents were satisfied, 24 % of them were very satisfied and 26 % were less satisfied. Only 8 % of them were not satisfied. Network analysis The distance between geographical location of respondents´ home and location of each green space was measured in the Google Maps API application. Data were defined in seconds because the application is able to estimate the approximate time needed to walk between two selected points. Obtained data ranged between 79 and 3932 seconds. The average value was 938.86 seconds, what means that the average time needed to walk from respondents´ home to the nearest green area is approximately 15.6 minutes. However, in real settings the number is likely to be lower because the network of roads, used within selected methodical approach, does not include footpaths, byways, walk-throughs, etc., which can make the walk quicker. Creation of such complete network would be extremely demanding hence the road network is recently the optimal available alternative. Correlation analysis Results of questionnaire and network analysis research were analysed by statistical method of correlation coefficient in MS Excel 2010. Consequential correlation coefficient of these two data sets was 0.12 which we consider as low or no correlation. This would mean that we were not able to achieve results through the selected method which would have mutual coherence with respondent´s opinions and the distance from their homes to the urban green spaces. Despite of this fact, we were convinced that the mutual connection between data exists. Therefore, we attempt to apply the spatial element in detection of mutual correlation. As stated above, data gained by network analysis were divided into four intervals. By this, we obtained (along with questionnaire results) two types of data that were comparable. We detected the correlation between respondents´ opinions and computed distance to the nearest urban green space. We regarded the correlation as very high when one of the four eventual respondents´ answers was in accordance with the network analysis interval. If they differ in one degree it was regarded as a high correlation, if the difference was in two degrees it was considered as a low correlation. And in the case of difference in three degrees and more there was no correlation. The results of the research are displayed in Figure 1 where the level of correlation is represented by colour scale. Through the display we revealed the hidden pattern. The colour of each point determines the level of its correlation. In the map, areas with the different levels of correlation are clearly identified. Fig.1: Respondent's address position and correlation between their opinion and their distance to nearest urban green space in Bratislava DISCUSSION Partial spatial orderliness of correlations in terms of urban space leads us to deduction that the selected approach was appropriate and of value. We can allege that the opinions of respondents largely depend on the real distance between their home and the closest urban green space, although they are affected by other variables. High correlation in some areas indicated that it is feasible (by improvement of the methodical approach) to simulate the opinions of inhabitants towards the green space accessibility in urban space with sufficient accuracy only with data gained from aerial photos. Opinions of residents are unpredictable because they are influenced by a broad range of factors – from macro-local conditions and settlement characteristics to their psychological profiles. The results obtained by this method are not required to achieve the perfect correlation, but can be an instrument for data acquisition by simpler and cheaper methods. Similar instruments would be exercisable in urban greenery planning and decision-making related to urban parks, park areas and greenery in general. CONCLUSIONS The undertaken research showed unexpected results. We can state that the perception of accessibility of urban green spaces depends on the real walking distance to the nearest green area, but also on the general perception of the inhabitants´ environment and their personal characteristics. We combined classic methodological approaches - GIS and sociological research. Presented type of research might be of high importance, mainly in aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa studies focused on city areas, when taking into account the urban areas affected by both, physical conditions and human activities. From the perspective of different disciplines, combination of these approaches may lead to better understanding of urban processes and people living in urban environment. REFERENCES Barbosa, O., Tratalos, J.A., Armsworth, P.R., Davies, R.G., Fuller, R.A., Johnson, P. & Gaston, K.J. (2007). Who benefits from access to green space? A case study from Sheffield, UK. Landscape and Urban Planning, 83 (2-3): 187-195; Štatistický úrad SR (2009). Štatistická ročenka hlavného mesta SR Bratislavy. Štatistický úrad SR, Bratislava, Slovakia; Calthorpe, P. (1993). The Next American Metropolis. In Pasaogullari, N., Doratli, N. (2004): Measuring accessibility and utilization of public spaces in Famagusta Cities. Cities, 21 (3): 225–232; Comber, A., Brunsdon, Ch. & Green, E. (2008). Using a GIS-based network analysis to determine urban greenspace accessibility for different ethnic and religious groups. Landscape and Urban Planning, 86 (1): 103–114; Gaston, K.J., Warren, P.H., Thompson, K. & Smith, R.M. (2005). Urban domestic gardens (IV): the etxtent of the resource and its associated features. Biodiversity and conservation, 14: 3327-3349; Handley, J., Pauleit, S., Slinn, P., Barber, A., Baker, M., Jones, C. & Lindley, S. (2003). Accessible Natural Green Space Standards in Towns and Cities: A Review and Toolkit for their Implementation. English Nature Research Report Number 526. English Nature, Peterborough, UK, 97 pp. Oh, K., Jeong, S. (2007). Assessing the spatial distribution of urban parks using GIS Landscape and Urban Planning, 82 (1-2): 25-32; . Lau, J.C.Y., Chiu, C.C.H. (2003). Accessibility of low-income workers in Hong Kong. Cities, 20 (3): 197-204; Liu, S., Liu, B. (2008). Using GIS to Assess the Ecological-niche for Urban Green Space Planning in Wuxi City. Retrieved February 2011, from http://www.kolleg.loel.hsanhalt.de/landschafts informatik/fileadmin/user_upload/_temp_/2008/2008_Beitraege/ 004/Buh_353-363.pdf Magistrát hlavného mesta SR Bratislavy (1996). Územný plán hlavného mesta SR Bratislavy – Prieskumy a rozbory. Oddelenie tvorby mesta a oddelenie odvetvových generelov, Bratislava, Slovakia. Mazúr, E., Lukniš, M. (1986). Geomorfologické členenie SSR a ČSSR. Časť Slovensko. Slovenská kartografia, Bratislava Pasaogullari, N., Doratli, N. (2004). Measuring accessibility and utilization of public spaces in Famagusta Cities. Cities, 21 (3): 225–232; Reháčková, T. (2009). Cudzokrajné druhy drevín v historických parkoch Bratislavy. Cicero, Bratislava, Slovakia; Reháčková T., Pauditšová E. (2003). Priemet najvýznamnejších plôch zelene na území Bratislavy – podklad pre návrh územného plánu. Magistrát hlavného mesta, Bratislava, Slovakia Reháčková, T., Pauditšová, E. (2004). Evolution of green spaces in Bratislava. Boreal Environment Research, 9: 469-477; Reháčková, T., Pauditšová, E. (2006). Vegetácia v urbánnom prostredí. Cicero, Bratislava, Slovakia; Reháčková, T., Lehotská, B., Nevřelová, M., Pauditšová, E. & Ružičková, J. (2007). Fragmenty lesov v zastavanom území Bratislavy. Cicero, Bratislava, Slovakia Vandenbulcke, G., Steenberghen, T. & Thomas, I. (2009). Mapping accessibility in Belgium: a tool for land-use and transport planning? Journal of Transport Geography, 17 (1): 39-53;	<urn:uuid:29ba6a42-f3dd-47e0-84a3-6a51fd044ad7>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	22,375
Allgemeine Geschäftsbedingungen von Salz & Sinn COVID-19 – MASSNAHMEN UND EINSCHRÄNKUNGEN BETRIFFT ALLE VERANSTALTUNGEN von Salz & Sinn Die Vertragsparteien gehen davon aus, dass die Durchführung von Veranstaltungen maßgeblich davon abhängen wird, wie sich die Pandemie des Erregers SARS-CoV-2 („Coronavirus") in den nächsten Wochen und Monaten entwickelt. Sollten Veranstaltungen von Salz & Sinn infolge von Allgemeinverfügungen, Verbotsverordnungen oder infolge behördlicher Anordnung, die den Zeitraum der Veranstaltung einschließen, nicht durchgeführt werden können und müssen aus den vorstehend genannten Gründen Veranstaltungen Salz & Sinn somit auf ein späteres Datum verlegt werden, sind Kunden nicht berechtigt, Rückforderungen bereits bezahlter Teilnahmegebühren geltend zu machen. Alle möglicherweise betroffenen Veranstaltungen von Salz & Sinn finden statt, wenn auch zu einem späteren Datum, an denen die vorgenannten Bedingungen fortgefallen sind. Allgemeine Geschäftsbedingungen Salz & Sinn für Seminare, Workshops, NETWORK Treffen, 1-zu-1 Trainings, Online-Programme, Buchprojekte 1. Vertragsgestaltung 1.1. Der Abschluss von Verträgen zwischen Seminar-/Workshop-/NETWORK Treffen/ Congress-/1-zu-1 Trainings-/Online-Programm-Teilnehmer/Buchprojekte (nachfolgend Teilnehmer genannt) und Veranstalter/Auftragnehmer Salz & Sinn (nachfolgend Veranstalter genannt) über die beiderseitig zu erbringenden Leistungen, sowie Änderungen und/oder Ergänzungen hierzu, bedürfen der Schrift/Textform (eMail). 1.2. Die vorliegenden Geschäftsbedingungen haben Vorrang vor entgegenstehenden Geschäftsbedingungen des Teilnehmers. 1.3. Der Teilnehmer erkennt das Hausrecht des Veranstalters während der Veranstaltung an. 2. Leistungen 2.1. Der Veranstalter ist berechtigt, erforderliche oder ihm angemessen erscheinende Änderungen der Programme vorzunehmen. Dies gilt insbesondere für die Stellung eines Ersatzreferenten bei Ausfall der Trainerin und eine damit einhergehende Änderung des Seminartermins und -ortes. Kann ein Termin zur Erbringung der Leistung durch die Trainerin, wegen höherer Gewalt, Krankheit, Unfall oder sonstigen, von der Trainerin nicht zu vertretenden Umständen, nicht eingehalten werden, oder kann der Vermieter der gebuchten Räumlichkeiten den Veranstaltungsort nicht zur Verfügung stellen, ist der Veranstalter unter Ausschluss jeglicher Schadensersatzpflichten berechtigt, einen Ersatztermin und/oder -ort zu benennen. Bei kurzfristigen Ausfällen besteht seitens Salz & Sinn keine Ersatzpflicht. 2.2. Umfang, Form, Thematik und Ziel der Leistungen sind dem Teilnehmer bekannt. 2.3. Der Teilnehmer erkennt das Urheberrecht von Salz & Sinn an den von Salz & Sinn erstellten Werken (Trainingsunterlagen, usw.) an. Eine Vervielfältigung und/oder Verbreitung der vorgenannten Werke durch den Teilnehmer bedarf der vorherigen, schriftlichen Einwilligung von Salz & Sinn. 2.4. Mit der Buchung eines Seminars/Workshops/NETWORK Treffen/1-zu-1 Trainings/Online-Programme/Buchprojekte erklärt sich der Teilnehmer damit einverstanden, dass während der Veranstaltung Foto-, Ton- und Filmaufnahmen aufgezeichnet werden. Diese dürfen für die Medien und für Werbemaßnahmen des Veranstalters verwendet werden. 3. Sicherung der Leistung 3.1. Bei Buchungen von Seminaren/Workshops/NETWORK Treffen/ 1-zu-1Trainings, Online-Programmen und Buchprojekte des Veranstalters sind die Seminar-/NETWORK Treffen/Workshop- Gebühren (in Höhe von 100 %) sofort nach Rechnungserhalt zu leisten. 3.2. Ein Abzug von Skonti, Rabatten, etc. vom Rechnungsbetrag ist nicht gestattet. 3.3. Sollte am Tag des Seminars ein Teil des Rechnungsbetrages oder der Seminargebühr offen stehen, besteht KEIN Anspruch des Teilnehmers auf Teilnahme an der Veranstaltung. Die Anmeldung ist für den Seminarteilnehmer verbindlich. 3.4. Kann ein Teilnehmer wegen Krankheit, Todesfall, Unfall oder sonstigen Umständen an den gebuchten Veranstaltungen, 1-zu-1 Trainings, NETWORK Treffen, Online-Programmen/Buchprojekten nicht teilnehmen, so hat er keinen Anspruch auf eine Erstattung des gezahlten Seminar-/Workshop-/NETWORK Treffen/1-zu-1 Trainings-/Online-Programm-/Buchprojekt-Preises. Dem Veranstalter steht es frei, den Teilnehmer aus Kulanz und nach Vorlage eines entsprechenden Nachweises, auf ein anderes Seminar umzubuchen (siehe Punkt 3.5.). Die Erklärung bedarf der Schrift-/Textform (eMail). 3.5. Umbuchungen sind nur im Einverständnis mit dem Veranstalter möglich. Ein Anspruch hierauf besteht nicht. Die Umbuchung auf einen anderen Termin ist möglich, sobald die Bezahlung in Höhe von 100 % geleistet wurde. 3.6. Für Hotelreservierungen und die Hotelrechnung (und für eventuelle Stornierungen) ist der Teilnehmer selbst zuständig und verantwortlich. 3.7. Der Teilnehmer ist verpflichtet, den vollen Rechnungsbetrag auf das Konto des Veranstalters einzuzahlen, eventuell anfallende Bankspesen sind ebenso vom Teilnehmer zu tragen. 3.8. Rückerstattungen erfolgen ausschließlich in Form von Gutscheinen, die zur Teilnahme an anderen Veranstaltungen des Anbieters berechtigen. Es erfolgen keine Bar-Erstattungen oder Rück-Überweisung der Teilnahmegebühren; dies bezieht sich auf alle Seminare, Workshops, NETWORK Treffen, 1-zu-1 Trainings, OnlineProgramme und Buchprojekte. 4. Widerruf Kein Widerrufsrecht besteht bei Verträgen mit Unternehmern (das sind natürliche oder juristische Personen oder rechtsfähige Personengesellschaften), die bei Abschluss des Vertrages in Ausübung ihrer gewerblichen oder selbständigen beruflichen Tätigkeit handeln. Sollten Sie Verbraucher sein, so haben Sie das nachfolgend beschriebene Widerrufsrecht. Widerrufsbelehrung/Widerrufsrecht Sie haben das Recht, binnen vierzehn Tagen ohne Angabe von Gründen den Vertrag zu widerrufen. Die Widerrufsfrist beträgt vierzehn Tage ab dem Tag des Vertragsabschlusses. Um Ihr Widerrufsrecht auszuüben, müssen Sie uns (Salz & Sinn, Hasenbuschfeld 19, 21629 Neu Wulmstorf, firstname.lastname@example.org) mittels einer eindeutigen Erklärung (z. B. ein mit der Post versandter Brief oder eMail) über Ihren Entschluss, diesen Vertrag zu widerrufen, informieren. Zur Wahrung der Widerrufsfrist reicht es aus, dass Sie die Mitteilung über die Ausübung des Widerrufsrechts vor Ablauf der Widerrufsfrist absenden. Folgen des Widerrufs Wenn Sie den Vertrag widerrufen, werden wir Ihnen alle Zahlungen, die wir von Ihnen erhalten haben, unverzüglich und spätestens binnen vier Tagen ab dem Tag des Widerrufs durch den Versand eines Gutscheines für eine andere Veranstaltung, Seminar, Workshops, NETWORK Treffen, 1-zu-1 Training, Online-Programm oder Buchprojekt in der Gesamthöhe der von Ihnen geleisteten Zahlung Ersatz leisten, an dem Ihre Mitteilung über den Widerruf des Vertrags bei uns eingegangen ist. Bei der Rückerstattung verwenden wir für den Versand des Gutscheins den gleichen Versandweg, den Sie bei der ursprünglichen Transaktion eingesetzt haben, es sei denn, mit Ihnen wurde ausdrücklich etwas anderes vereinbart; in keinem Fall werden Ihnen wegen dieser Erstattung Entgelte berechnet. Es erfolgen keine BarErstattungen oder Rück-Überweisung der Teilnahmegebühren; dies bezieht sich auf alle Seminare, Workshops, NETWORK Treffen, 1-zu-1 Trainings, Online-Programme und Buchprojekte. Haben Sie verlangt, dass die Dienstleistung während der Widerrufsfrist beginnen soll, so haben Sie uns einen angemessenen Betrag zu zahlen, der dem Anteil der bis zu dem Zeitpunkt, zu dem Sie uns von der Ausübung des Widerrufsrechts hinsichtlich dieses Vertrages unterrichten, bereits erbrachten Dienstleistungen im Vergleich zum Gesamtumfang der im Vertrag vorgesehenen Dienstleistungen entspricht. 5. Datenspeicherung/Datenschutz 5.1. Es wird darauf aufmerksam gemacht, dass die im Rahmen der Geschäftsabwicklung notwendigen Daten mittels einer EDV-Anlage verarbeitet und gespeichert werden. Persönliche Daten werden selbstverständlich vertraulich behandelt und nur innerhalb des Veranstalters und seiner Partner genutzt. 5.2. Der Veranstalter ist berechtigt, die Bestandsdaten des Kunden an Dritte zu übermitteln, soweit es zum Zwecke der Abtretung oder des Einzugs von Forderungen erforderlich ist. Die gesetzlich zulässige Übermittlung weiterer Daten des Kunden zum Zwecke des Forderungseinzugs bleibt unberührt. Dem Kunden wird die Beauftragung eines Inkassoinstitutes schriftlich mitgeteilt. 6. Allgemeine Bedingungen 6.1. Sollten einzelne Bestimmungen dieser Allgemeinen Geschäftsbedingungen unwirksam sein oder werden, wird dadurch die Wirksamkeit der Bedingungen im Übrigen nicht berührt. Die Parteien werden die Bedingung als dann mit einer wirksamen Ersatzregelung durchführen, die dem mit der weggefallenen Bestimmung verfolgten Zweck am nächsten kommt. 6.2. Für die Bedingungen und deren Durchführung gilt ausschließlich Deutsches Recht. 6.3. Ausschließlicher Gerichtsstand für alle Ansprüche aus dem mit diesen Geschäftsbedingungen zusammenhängenden Vertrag und diesen Bedingungen ist der Sitz des Veranstalters. 6.4. Der Teilnehmer erklärt sich damit einverstanden vom Veranstalter via eMail und Mobile über Neuigkeiten und Veranstaltungen informiert zu werden. Salz & Sinn Stand: 01.08.2022	<urn:uuid:947fdb30-f75a-407c-9644-4f04345c1fe1>	HuggingFaceFW/finepdfs/tree/main/data/deu_Latn/train	finepdfs	deu_Latn	9,173
Calibration of Advanced Virgo+ and verification of the reconstructed gravitational wave signal with a photon calibrator Paul LAGABBE - email@example.com Laboratoire d’Annecy de Physique des Particules (LAPP) Virgo July 9, 2021 Supervisor: Loïc ROLLAND 2020-2023 Gravitational waves detector network - LIGO Hanford - LIGO Livingston - GEO Virgo - KAGRA - LIGO India (approved) My PhD within the evolution of the detector network - O1: 3 detections, first gravitational waves detection, - O2: 8 detections, first binary neutron stars merger detection + electromagnetic counterpart, - O3a: 39 detections, and 56 alerts during full O3 first neutron star black hole merger detection, - O4 objective: 1 detection per day Gravitational waves Interferometer operation Strain signal reconstruction Photon calibrator (my thesis subject) Gravitational waves and effect on matter Propagation of space time deformations, Predicted by Einstein in 1916, Order of magnitude of a gravitational wave produced the merger of two neutron stars at 10 Mpc \[ h \approx 10^{-22} \] \[ \delta L = \frac{1}{2} \times h \times L_0 \] Effect of a gravitational wave propagating perpendicularly to a circle of free masses, for + and x polarizations. Aerial view of Virgo interferometer \[ \delta L \sim 10^{-19} \text{ m} \] \[ L_0 = 3 \text{ km} \] Control loops reduce signals mainly at the frequency bandwidth $10\text{Hz} - 100\text{Hz}$. Below 100 Hz, the gravitational waves signal is mainly contained in $z_{corr}$, and in $\epsilon$ above 100 Hz. Reconstruction of detector strain and calibration Reconstruction of the interferometer strain signal $h_{rec}(t) = \frac{\Delta L}{L_0}$, $\Delta L$ is the differential arm length. We need to calibrate: - Electromagnetic actuators response $A_{MIR}$, in $[m/V]$ - Optical response of the interferometer $O_{ITF}$, in $[W/m]$ - The response of the photodetector $S$, in $[V/W]$ $h_{rec}(t)$ uncertainty during O3 in the bandwidth 20 Hz - 20 kHz - 5% amplitude, - 35 mrad phase, - 10 µs timing, $\implies h_{rec}(t)$ uncertainty objective for O4: reduce uncertainties, frequency dependent uncertainty Calibration of the electromagnetic actuators Method 1. Make the mirror move by a known motion $\Delta L_{PCal}$ in [m] with the photon calibrator (PCal), and observe the output of the interferometer $\epsilon(PCal)$ in [W]. 2. Then, make the mirror move with the electromagnetic actuators, and observe the output of the interferometer $\epsilon(MIR)$. 3. And compute $A_{MIR}$ with the formula below, comparing the effects of the known and unknown motion in [m/V]. \[ A_{MIR} = \frac{\epsilon(MIR)}{z_{corr}} \times \frac{\Delta L_{PCal}}{\epsilon(PCal)} \] Working principle of the photon calibrator Mirror pushed by the radiation pressure of a laser. \[ \Delta L(f) = -\frac{2 \cos(\theta)}{cM(2\pi f)^2} \Delta P_{\text{ref}}(f) \] Typical values at 60 Hz: \[ <P_{\text{ref}}> = 2 \text{W} \] \[ \Delta P_{\text{ref}} = 0.1 \text{W} \] \[ \Delta L \approx 10^{-16} \text{m} \] Photodiode $ \rightarrow \Delta P_{\text{ref}} \rightarrow \Delta L $ Photodiodes need to be absolutely calibrated. O3: Uncertainty on $ \Delta L $: 1.5% $ \implies $ O4: Objective $ \approx 1\% $ New optical setup reflexion bench injection bench bench design drawn with Optocad Calibration of photodiodes reflexion bench injection bench bench design drawn with Optocad Photon calibrator installed in April 50 mW Photodiode 20 mW Photodiode 2W Viewport to WE mirror Intercalibration with LIGO and KAGRA Scheme of the intercalibration process during O3 run NIST → Gold Standard - Virgo Integrating Sphere → Virgo PCal - Working Standard Hanford → Hanford PCal - Working Standard Livingstone → Livingstone PCal Future intercalibration process >1% uncertainty due to VIS We stop using it Virgo, LIGO and KAGRA will use the same model of integrating sphere Calibration stability issue during O3 Scheme of the PCal during O3 Improvements on the PCal for O4 - Use non polarizing cubes for splitting the beam, - Put an integrating sphere on the reflexion bench, - Si photodiodes → InGaAs photodiodes, Time evolution of the ratio between the powers measured by PD1 and PD2 at 60 Hz 6% variations 6 months ratio between powers measured by two photodiodes 0.1% variations 1 week New issue: Response of photodiodes $f_p = 1.9 \text{ Hz}$ and $f_z = 2.3 \text{ Hz}$ We need to measure the ratio between the frequencies of the pole and the zero $f_p/f_z$ Measure of the frequency response of photodiodes 1. Close and open a shutter in front of the photodiode. 2. Measure of the time response of the photodiodes. 3. Fitting with the step response of a pole/zero filter. 4. Compute the ratio between the frequencies of the pole and zero. Time response of the photodiode and model and residual. Ratio between pole frequency and zero frequency, measured with different shutters - method tested and already usable for interferometer photodiode (sensing S) - need to select/install shutters to calibrate the PCal photodiodes Continuing the preparation and calibration of O4 run Future improvements on the PCal: - Check if the PCal stable for a long time (months), - Install a second PCal on an other mirror, - Build and install the sphere on reflexion bench, - Improve control loop of the laser to reduce power noise, - Start intercalibration, - Measure absolute timing of the photodiodes Future tasks using the photon calibrator: - Calibrate actuators, - Measure the optical response of the optical response of the interferometer, - Verify $h_{rec}$, Thanks for your attention Results: Laser noise Sensing noise laser noise, control loop open laser noise, control loop on Tx_PD2	c909f9dc-0067-4a48-a126-257f1c02c4b0	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	5,782
COMMENT Brexit Deal Series: The Westminster Politics Could Be Unpredictable to the End Anthony Salamone \| 16 November 2018 © 2018 European Union After months of negotiations intertwined with political wrangling, a Brexit deal is, to use a phrase often repeated by EU leaders this week, finally on the table. The resulting political drama which has unfolded in the UK over the past 48 or so hours has been as predictable as it has been intense. The Prime Minister presented her deal, and it is already severely threatened. Labour will not support it, as it does not meet its Brexit tests and in any case its leadership has made clear its desire for a general election. The SNP will not back it, as the direction of travel does not point towards the single market and customs union option for the whole UK which it has advocated since December 2016. Theresa May's erstwhile Westminster allies, the DUP, will not vote for it either, as despite its provisions intended to maintain peace and stability in Northern Ireland the deal apparently does not satisfy their concerns on the UK's political union. Brexiteer backbenchers – the vast majority Tories, though a few Labour – will equally reject the deal, due to it not meeting their conception of what pure Brexit should mean. These political developments were predicted in their entirety. It was practically a pre-recorded segment, ready to play on cue. Watching the Prime Minister's three-hour appearance in the House of Commons on Thursday, it was nevertheless striking to witness the manifested depth of opposition to her Brexit deal from all sides of the chamber. While expressing their criticism, many MPs made a point of praising her determination, hard work and commitment to public service – valedictory comments normally reserved for a leader on the way out. At present then, Theresa May appears left with only the payroll vote plus moderate Conservatives to back her deal – with the current parliamentary arithmetic, hardly enough to win the day. It is undoubtedly not lost on politicians in Westminster that their opposition has only been given real weight by the government's concession on holding a 'meaningful vote' on the deal. Recent events have made plain why the Prime Minister originally hoped to avoid one. If the Brexit deal is rejected The UK government has been in free fall yet, just as she has done throughout the Brexit process, May has committed to carrying on with her plan. During the Commons marathon, she rejected seeking an extension of the Article 50 process, expressed vociferous opposition to a referendum and reaffirmed her view of no early general election. Regardless, it is highly probable that the current Brexit deal could indeed be voted down by the Commons. So what would actually happen after that? Rejection of the Brexit deal would lead to an even more acute UK political crisis. It is difficult to predict what might unfold. However, the main options would be to attempt to renegotiate the deal, to call a general election or to organise a further referendum. Under any of these scenarios, the government or parliament might decide to request an extension of Article 50. The default outcome if no way forward could be found would be the UK's withdrawal from the EU by default with no deal. The primary substance of this week has been the full draft withdrawal agreement. The accompanying political declaration on future EU-UK relations is currently only seven pages long. While Northern Ireland and the backstop are incorporated in the withdrawal agreement and the debate really does focus on the treaty, much of the political rancour has actually concentrated on the future relationship – and the lack of certainty or detail. Theresa May stated on Thursday in the Commons and at her evening press conference, also confirmed by the European Commission, that the political declaration will be expanded on by the negotiators between now and the Commons vote. Presumably then her main remaining hope is that the revised declaration will convince a sufficient number of MPs to support the deal – at present at least, that prospect seems somewhat remote. The EU's response to the Brexit tumult Equally predictably, now that the deal has been provisionally agreed, EU institution and member state leaders have enunciated their view that the withdrawal text will not be substantially renegotiated and that this overall proposal is the final offer. Although they all regret Brexit, they will advocate this deal, subject to its approval by the EU27 at the special European Council scheduled for 25 November, as the means of ensuring an orderly exit. It is also clear that a majority exists in the Commons against no deal. However, the UK parliament cannot decree an outcome to Brexit – it is a negotiation and both sides must agree. The Commons can only mandate the government to pursue a particular objective. However, it might have one unilateral option – to revoke (or, moreover, to instruct the government to revoke) the UK's Article 50 notification before the departure date. The current reference to the CJEU from the Court of Session on this question should clarify whether that mechanism would be possible. The EU27, currently observing the tumult in Westminster, will have to decide how they would respond if the deal is voted down by the Commons. The planned sequence of events will not make recovering after a parliamentary defeat easier. The European Council summit will take place later this month, and the meaningful vote should follow in December. That schedule will reduce the amount of time available to cope with the Commons fallout. The European Parliament will also eventually have its say, but that should take place closer to Brexit day. In the face of a no-deal outcome instead, the EU27's position on two issues will be crucial – renegotiating the deal and extending Article 50. Despite the current line that the present deal will not be negotiated further, the EU has a history of final concessions and last-minute compromises. It should not be ruled out that the EU27 might have one or two points on which they are ready to be flexible as a means of winning the requisite support in the UK, should that prove necessary – but nothing fundamentally important or manifestly counter to the EU's interests. If the failure of the Brexit deal in the Commons leads to a general election or further referendum, the EU27 might well be persuaded to extend Article 50 – but that is not guaranteed. A sufficiently long extension would likely run past May, and therefore ostensibly require the UK to participate in the upcoming European Parliament elections that month. That eventuality would surely annoy the EU27, as the UK's seats have already been redistributed (with some in reserve) – though the relevant European Council decision makes clear that the reallocation only has effect if the UK has left the EU. The uncertain path ahead Despite British politics seemingly crumbling around her, Theresa May has resolutely maintained her course. This Brexit deal is unquestionably her Brexit deal – all the more so given the various ministerial resignations along the way and the sidelining of her Brexit secretaries in the negotiations. If the deal is not approved by the House of Commons, then the hourglass on her premiership must surely begin to run down. The Westminster politics are unpredictable and could remain so to the end on Brexit. For now, it does not appear as though the sufficient votes will be forthcoming to pass the Prime Minister's Brexit deal. Additional detail on the political declaration, which will nevertheless not be binding, might persuade some opponents to back the agreement. May's ultimate gamble is that, faced with the alternative of no deal and the risk of being seen to be responsible for that outcome, enough MPs will support her deal. The Prime Minister is correct that her deal would indeed deliver a Brexit outcome. Considering that the UK parliament voted both to activate Article 50 and to enact EU withdrawal legislation, it is somewhat ironic that the Commons does not currently appear to be in a position to support the Brexit deal on the table. However, that awaiting impasse is rooted in the differing expectations between and within the parties in Westminster of what Brexit should mean in practice. Nevertheless, the withdrawal agreement at the heart of this debate primarily concerns the UK's arrangements for exiting the EU, with the important exception of the Irish backstop and its implications for Northern Ireland and the whole UK (particularly on customs and trade policy). The future relationship still remains to be negotiated, and would be shaped by whoever is in power in the near future. Whatever happens, the UK seems set to continue with its introspective political battles – and the EU will look on with resigned dismay.	<urn:uuid:97b29e98-2ac9-480d-8fe0-c8a3441378fb>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	8,905
Jugendkalender 2018 Hinweis: Trainingstage LP und LG sowie Traingslager noch nicht terminiert 23 24 25 26 Stand 07.02.2018 Jugendkalender 2018 Hinweis: Trainingstage LP und LG sowie Traingslager noch nicht terminiert Stand 07.02.2018 49 50 51 52 1 Angaben ohne Gewähr	<urn:uuid:d6b670ac-fc15-4798-a038-bef4859cd037>	HuggingFaceFW/finepdfs/tree/main/data/deu_Latn/train	finepdfs	deu_Latn	284
Tobias Lacher stellt Schlussgang am Buebeschwinget in Wil Der junge Riedner Turnerschwinger Tobias Lacher, der mit seiner wuchtigen und taktisch geprägten Schwingweise sehr an seinen Grossvater Franz Schatt sel. erinnert, stand erneut im Schlussgang der Kategorie 2005/06. Der Gang endete gestellt und sein Gegner Salomon Lazzarotto aus Chur behielt dank seines minimalen Vorsprings von einem Viertelpunkt den Kategoriensieg. Lacher wurde somit Zweiter. Der Benkner Fadri Widmer wagte sich nach seiner Verletzung im Frühjahr auf den Schwingplatz zurück. Ihm fehlte seinerseits der Viertelpunkt für die Auszeichnung. Manuel Lüthi wurde in der Kategorie 2003/04 mit vier Siegen Vierter. Im letzten Gang machte er gar um den Zweiten Platz, diesen Gang verlor er allerdings gegen den Stadt- St. Galler Andy Signer. Remo Büchler	<urn:uuid:a3bd73ed-13d2-47d1-ad69-d2966751cb24>	HuggingFaceFW/finepdfs/tree/main/data/deu_Latn/train	finepdfs	deu_Latn	826
: The Lail Family proprietors –Robin, Jon, Erin and Shannon the wine: 100% Cabernet Sauvignon winemaker: Philippe Melka production: 885 cases (bottled as 1770 units of 6x750ml) vineyardS: Howell Mountain and Oakville release: Summer 2010 LailVineyards 2007 J. Daniel Cuvee Cabernet Sauvignon, Napa Valley the people Lail Vineyards traces its Napa Valley roots back five generations to the founding of Inglenook in 1879 by Gustav Niebaum, great-grand uncle of Robin Daniel Lail. Passed down to third generation owner John Daniel, Jr., Inglenook thrived under his direction from 1933 to 1964 as he played a major role in the development of the Napa Valley appellation. The winery's flagship wine, "J. Daniel Cuvee", is named in his honor. Lail Vineyards was founded in 1995 by fourth generation vintner Robin Lail and her family to carry the unique family legacy forward into the 21 st century. Generations five and six are woven into the tapestry of the venture with the involvement of daughters Erin and Shannon, and with the "Georgia" Sauvignon Blanc named for the first member of the sixth generation. Each year the family continues its passionate quest to produce the very finest wines in the world from the blend of their ingredients – the land, the seasons, the winemaking team and the spirit of the generations who led the way. the wine "The perfect weather conditions during the growing season allowed us to harvest amazing grapes. The Cabernet blocks were harvested in late September and early October, aged 20 months in 75% new French oak, then bottled unfined and unfiltered in June 2009. If I had to use one word to describe this wine, it would be 'seamless.' Complex notes of cocoa, charcoal, black fruits, and pencil lead give a sense of amazing complexity. Powerful and seductive, this wine lingers on the palate for more than 20 seconds. As the 2006 reminded us of Chateau Latour from Pauillac in Bordeaux, the 2007 would be more reminiscent of the great wines from Chateau Margaux." —Philippe Melka, Winemaker "A dense purple color is accompanied by notes of graphite, licorice, black cherry liqueur, black currants, crushed rocks, spice box, and cedar. With Pauillac-like aromatic and flavor profiles, this opulent, full-bodied, rich 2007 reveals superb purity as well as definition. It may even grow in stature over the next five years, and is capable of lasting 20-25+ years. 96+ points." — Robert Parker, The Wine Advocate	<urn:uuid:59e3d33d-1918-4f8d-80b5-152c7e0aa106>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	2,459
EINLADUNG Das Dokumentationszentrum NS-Zwangsarbeit Berlin-Schöneweide, der Förderverein für ein Dokumentations- und Begegnungszentrum zur NS-Zwangsarbeit, das Aktive Museum Faschismus und Widerstand in Berlin e.V. und das Museum Lichtenberg im Stadthaus laden ein zur Vortragsveranstaltung: Donnerstag, den 14. Mai 2009, um 19.00 Uhr Arbeitshaus und Zwangsarbeit Das „Arbeits- und Bewahrungshaus" Rummelsburg in der NS-Zeit Dr. Christine Glauning Begrüßung: Vortrag: Thomas Irmer, Berlin Ausblick: Christine Steer, Berlin Die Zwangsarbeit von Insassen der sogenannten Arbeitshäuser in der NS-Zeit ist bislang nur ein Randthema der NS-Zwangsarbeitsforschung. Im Mittelpunkt des Vortrages von Thomas Irmer steht die Geschichte des 1877/79 als „größte und modernste" Einrichtung dieser Art errichteten „Arbeitsund Bewahrungshauses" Berlin-Rummelsburg in der NS-Zeit. Obwohl die Nationalsozialisten seit der „Aktion Arbeitsscheu Reich" 1938 verstärkt „Asoziale" in die Konzentrationslager einwiesen, blieb das Arbeitshaus Rummelsburg ein kommunaler Ort der Zwangsverwahrung von Bettlern und Landstreichern, Prostituierten, sogenannten säumigen Unterhaltspflichtigen oder „selbstverschuldeten Hilfsbedürftigen der öffentlichen Fürsorge". Auf der Grundlage neuer Forschungsergebnisse, die im Rahmen einer Arbeitsgruppe des Aktiven Museums entstanden sind, soll insbesondere der Arbeitseinsatz der Rummelsburg-Insassen näher beleuchtet werden. Diese wurden in zahlreichen Arbeitskommandos innerhalb und außerhalb des Arbeitshauses eingesetzt. Seit 2007 haben es sich verschiedene Initiativen in Berlin zur Aufgabe gemacht, die Geschichte des „Arbeits- und Bewahrungshauses" Rummelsburg zu erforschen. Im Anschluss an den Vortrag wird Christine Steer die Bedeutung des historischen Ortes „Arbeitshaus Rummelsburg" darstellen und einen Ausblick auf die geplanten Aktivitäten von Museum und Bezirk Lichtenberg geben. Dr. Christine Glauning, Leiterin des Dokumentationszentrums NS-Zwangsarbeit Berlin-Schöneweide Thomas Irmer, Historiker, zahlreiche Veröffentlichungen zur NS-Zwangsarbeit in Berlin; forscht zur Geschichte von AEG/Telefunken; Mitglied der AG Rummelsburg des Aktiven Museums e.V.; Vorsitzender des Fördervereins für ein Dokumentations- und Begegnungszentrum zur NS-Zwangsarbeit. Christine Steer, Leiterin des Museums Lichtenberg im Stadthaus. Ort: Dokumentationszentrum NS-Zwangsarbeit Britzer Str. 5 ı 12439 Berlin ı www.topographie.de/schoeneweide S-Bhf Schöneweide, dann 10 min. Fußweg oder Bus 160/167 (HS „Britzer Straße") DOKUMENTATIONSZENTRUM NS-ZWANGSARBEIT BRITZER STR. 5 ן 12439 BERLIN TELEFON (030) 639 02 88-0 FAX (030) 639 02 88-29 firstname.lastname@example.org TOPOGRAPHIE DES TERRORS AUSSTELLUNG IM FREIEN NIEDERKIRCHNERSTR. 8 D-10963 BERLIN TELEFON (030) 25 48 67 03 FAX (030) 262 71 56 email@example.com STIFTUNG TOPOGRAPHIE DES TERRORS GESCHÄFTSSTELLE STRESEMANNSTR. 111 D-10963 BERLIN TELEFON (030) 25 45 09-0 FAX (030) 25 45 09-99 firstname.lastname@example.org BIBLIOTHEK TELEFON (030) 25 45 09-23 email@example.com WWW.TOPOGRAPHIE.DE	<urn:uuid:dc7c090c-ff82-467c-b562-e7a70911a195>	HuggingFaceFW/finepdfs/tree/main/data/deu_Latn/train	finepdfs	deu_Latn	3,106
Samferdselsdepartementet Postboks 8010 Dep 0030 OSLO Behandlende enhet: Vår referanse: Deres referanse: Vår dato: Vegdirektoratet 17/90129-3 01.09.2017 Saksbehandler/telefon: Kirsti Jørstad Bjørnaas / 22073073 Sivilombudsmannens rapport om politiets saksbehandling i førerkortsaker Vi viser til brev av 22. juni 2017 fra Samferdselsdepartementet om Sivilombudsmannens undersøkelse av politiets saksbehandling i saker om førerkort og kjøreseddel. Sivilombudsmannen har bedt Samferdselsdepartementet om å gjennomgå og vurdere eventuelle behov for regelendringer i saker som gjelder helse ved førerkort og kjøreseddel. I brevet fra Samferdselsdepartementet bes Vegdirektoratet om vår vurdering av de forhold som gjelder førerkort og kjøreseddel i Sivilombudsmannens rapport, og om vår tilrådning om videre oppfølging. Historikk Hvordan forvaltningsmyndigheten best kan organiseres i saker som gjelder helse og førerkort, og eventuelle behov for endringer, er et tema som også har vært oppe tidligere. Vegdirektoratet viser til vårt brev av 15. januar 2010, hvor vi foreslår en revisjon av vegtrafikkloven § 34 med sikte på å overføre politiets myndighet ved inndragning av førerkort som følge av manglende oppfyllelse av helsekrav til vegmyndighetene. I brev av 18. februar 2010 ber Samferdselsdepartementet Vegdirektoratet om å utrede nærmere spørsmålet om en eventuell overføring av hjemmelsgrunnlaget etter vegtrafikkloven § 34 fra politiet til Statens vegvesen. Vegdirektoratet har de siste årene ikke hatt ressurser til å gjennomføre denne utredningen. Prosjektet «Vilkår for førerett» Vegdirektoratet deltar i dag i et samarbeidsprosjekt med Helsedirektoratet og Politidirektoratet om bl.a. en framtidig organisering av området helse og førerett. Også prosjektgruppen er kjent med Sivilombudsmannens rapport og finner, ifølge referat fra møte i prosjektets styringsgruppe, at poengene i rapporten når det gjelder førerkort stemmer godt Postadresse Statens vegvesen Vegdirektoratet Postboks 8142 Dep 0033 OSLO Telefon: 22 07 30 00 Kontoradresse Brynsengfaret 6A 0667 OSLO Fakturaadresse Statens vegvesen Regnskap Postboks 702 9815 Vadsø firstname.lastname@example.org Org.nr: 971032081 overens med gruppens funn. Det er besluttet videre arbeid mot en løsning hvor politiet tas ut av saksgangen. Vurdering og tilråding Vegdirektoratet deler Sivilombudsmannens oppfatning om at den todelte ansvarsmodellen mellom politiet og helsemyndighetene i helsesaker er uheldig. Vi deler også ombudsmannens syn på at ordningen er vanskelig tilgjengelig for publikum, og ser at det er behov for å gjennomgå ansvarsforholdene. Når det gjelder førerkort, er arbeidet med dette allerede påbegynt, i form av prosjektet «Vilkår for førerett». Vi viser også til at det ble tatt grep for å gjøre helsekravene mer konkrete, oversiktlige og tilgjengelige for publikum i form av endrede helsekrav som trådte i kraft 1. oktober 2016. Endringen skulle også medføre mindre belastning på fylkesmannsembetene. Dette hører også med til helheten i denne sammenheng. Vegdirektoratets vurdering er at det bør arbeides med en endring av vegtrafikkloven § 34, og kan eventuelt sette av ressurser til dette arbeidet i 2017 og 2018. Arbeidet og anbefalingene til prosjektgruppen «Vilkår for førerett» vil bli fulgt opp på en hensiktsmessig måte. Sivilombudsmannen kritiserer politiet for at de i sin saksbehandling legger helsemyndighetenes medisinskfaglige vurderinger til grunn uten videre undersøkelse, og anser ikke det som godt nok i henhold til forvaltningsloven. Statens vegvesen er i samme situasjon som politiet, da vi ikke har medisinskfaglig kompetanse hos våre ansatte, og derfor ikke kan gjøre en selvstendig faglig vurdering av en medisinsk uttalelse fra lege eller fylkesmann. Den løsning som velges for framtiden må sørge for at den enkelte førerkortinnehavers rettssikkerhet ivaretas i form av riktig kompetanse hos vedtaksmyndigheten. Vegdirektoratet mener derfor at det er svært viktig at man innfører et prinsipp som sier at den myndighet som har fagkompetanse også har vedtaksmyndighet. Det vil sikre at den etat som i framtiden skal ha vedtaksmyndighet i saker om tilbakekall av førerett som følge av ikke oppfylte helsekrav også har den nødvendige faglige kompetansen til å gjøre de undersøkelser som kreves for en tilstrekkelig utredning av saken i tråd med forvaltningslovens krav. I praksis vil det etter vår oppfatning være fylkesmannen (fylkeslegen). Helseklage vil da være klageinstans. Tilsvarende vil politiet ha kompetanse ved inndragning i forbindelse med straffesaker, med Politidirektoratet som klageinstans. Statens vegvesen vil kunne motta melding fra fylkesmannen til Autosys førerkortregister når saken er avgjort tilsvarende hva som gjøres elektronisk fra politiet i dag når det gjelder vurderinger av vandel. Da temaet var oppe i forbindelse med Ersdal-utvalget, mottok Vegdirektoratet brev fra Helsedirektoratet 28. april 2008, hvor det også fra dem ble fremholdt som viktig å beholde vurderingene av helse hos et organ med helsefaglig kompetanse. Når det gjelder kjøreseddel bør det vurderes om det kan etableres en tilsvarende organisering. Her er det politiet som står som utsteder og har ansvar for registeret. Ved tilbakekall i helsesaker kan fylkesmannen i kjøreseddelsaker melde avgjørelsen til politiet slik de gjør i førerkortsaker til Statens vegvesen. Endringen i § 34 i vegtrafikkloven får ingen konsekvenser for eventuelle endringer i yrkestransportlova, hvor vi oppfatter at det er behov for både klargjøring av hjemmelen og fremtidig organisering. Det ville likevel være en fordel om disse prosessene kunne foregå noenlunde parallelt. Problemstillinger knyttet til organiseringen i saker om helse og førerkort har vært utredet av flere utvalg uten at det har resultert i endringer. For at det videre arbeidet med § 34 skal bli en prioritet i de tre involverte etatene, anser Vegdirektoratet det som viktig at dette får forankring på departementalt nivå. Vi anbefaler derfor at Samferdselsdepartementet involverer Helse- og omsorgsdepartementet og Justis- og beredskapsdepartementet. Det må sørges for tett samarbeid og enighet om løsningene mellom sektorene. Dette mener vi er nødvendig for at man skal kunne gjennomføre en endring i praksis. Trafikant- og kjøretøyavdelingen Med hilsen Bodil Rønning Dreyer direktør Bente Skjetne Dokumentet er godkjent elektronisk og har derfor ingen håndskrevne signaturer. 3	<urn:uuid:064cd8cf-7059-42c4-a14a-9211b878ca1a>	HuggingFaceFW/finepdfs/tree/main/data/nob_Latn/train	finepdfs	nob_Latn	6,471
Etogrammipohja ni Tilanne: Lisätietoja eläimestä (esim. motivaatio, allergiat, pohjataidot): Ympäristö: Materiaalit eläinavusteiseen työskentelyyn Voimatassun verkkokaupasta www.kauppa.voimatassu.fi Sivu 1 Eläimen nimi: Eläimen ikä: Eläimen omistaja: Päivämäärä: Etogrammipohja ni Omia huomioita: Sivu 2	<urn:uuid:52d399e5-83f5-4376-a2d8-ae77486a838f>	HuggingFaceFW/finepdfs/tree/main/data/fin_Latn/train	finepdfs	fin_Latn	317
Upozorňujeme, že níže uvedené emisní podmínky nejsou pobídkou k nákupu ani k prodeji níže uvedených dluhopisů, ani nejsou investičním doporučením. Dluhopisy jsou určeny výhradně investorům, pro které případná ztráta části nebo dokonce celé investice nebude znamenat významné zhoršení finanční situace. Každý případný investor si musí sám zhodnotit, zda je pro něho investice do těchto dluhopisů vhodná. Dluhopisům ani Emitentovi nebyl udělen žádný rating, ani jiné ohodnocení ekonomické způsobilosti. Pro vydání těchto Dluhopisů není nutný souhlas státních orgánů, tedy emise Dluhopisů nebyla schválena žádným orgánem státní správy, zejména ne Českou národní bankou. Česká národní banka NEVYKONÁVÁ žádný dohled nad touto emisi Dluhopisů ani nad jejich Emitentem. EMISNÍ PODMÍNKY DLUHOPISŮ Rezidence Branka II 6%/22 Tyto emisní podmínky (dále jen „Emisní podmínky“) upravují práva a povinnosti Emitenta a Vlastníků dluhopisů (jak je tento pojem definován níže), jakož i podrobnější informace o emisi nepodřízených dluhopisů (dále jen „Dluhopisy“) splatných v roce 2022, v celkové předpokládané jmenovité hodnotě do 11 500 000 Kč (jedenáct milionů pět set tisíc korun českých), vydávaných společností: Bytové družstvo Rezidence Branka, se sídlem Dělnická 397/39, Komin, 624 00 Brno, IČO 06012086, založenou podle českého práva, zapsanou v obchodním rejstříku vedeném Krajským soudem v Brně, oddíl Dr, vložka 5648, LEI 3157004UDFVG7XTLBH09 (dále jen „Emitent“). Dluhopisy budou úročeny pevnou úrokovou sazbou ve výši 6,0 % ročně. V souvislosti se závazky z Dluhopisů Emitent a Agent pro zajištění uzavřou zástavní smlouvu, nebo smlouvu, k zastavené Nemovitosti, jak je tento pojem definován níže, (dále jen „Zástavní smlouva“), na jejímž základě dojde ke zřízení zástavního práva k Nemovitosti, jak je blíže specifikováno v článku 3.2. Emisních podmínek. Zástavní smlouva bude po jejím uzavření k dispozici k nahlédnutí Vlastníkům dluhopisů v běžné pracovní době v Určené provozovně Administrátora, jak je vymezena v článku 11.1.1 těchto Emisních podmínek. Pro případ, že hodnota zastavené Nemovitosti nedosáhne při případném nuceném rozprodeji Agentem pro zajištění výše objemu emise s příslušenstvím, vystavil Emitent vlastní blankosměnku na případné pokrytí tohoto rozdílu, kterou avalovala mateřská společnost Emitenta, All Inclusive Development a.s., IČO 27737438, se sídlem Dělnická 397/39, 624 00, a Ivor Ševčík, dat. nar. 15. 2. 1981, bytem Foltýnova 1019/43, 635 00 Brno. Činnosti Administrátora spojené s výplatami výnosů z Dluhopisů a splacením Dluhopisů („Administrátor“) bude zajišťovat pro Emitenta společnost CYRRUS CORPORATE FINANCE, a.s., se sídlem Brno, Jana Babáka 11, 612 00 Brno, IČO: 27758419, zapsaná v obchodním rejstříku vedeném Krajským soudem v Brně, oddíl B, vložka 5249, která byla touto činností pověřena na základě Příkazní smlouvy (dále jen „CCF“). Agentem pro zajištění Dluhopisů je CCF (dále jen „Agent pro zajištění“). Vztah mezi Emitentem a Agentem pro zajištění v souvislosti s případnou realizací Zajištění (jak je tento pojem definován níže) ve prospěch Vlastníků dluhopisů a v souvislosti s některými dalšími administrativními úkony v souvislosti se Zajištěním je upraven smlouvou uzavřenou mezi Emitentem a Agentem pro zajištění (dále jen „Smlouva s agentem pro zajištění“). Stejnopis Smlouvy s agentem pro zajištění je k dispozici k nahlédnutí Vlastníkům dluhopisů v běžné pracovní době v sídle Agenta pro zajištění. Agent pro zajištění vyjadřuje svůj souhlas s právy a povinnostmi uvedenými v Emisních podmínkách, které má činit ve vztahu k jednotlivým Vlastníkům dluhopisů v Prohlášení společnosti CCF, které je součástí Emisních podmínek a které je k dispozici k nahlédnutí Vlastníkům dluhopisů v běžné pracovní době v sídle Agenta pro zajištění. Činnosti agenta pro výpočty spojené s prováděním výpočtů ve vztahu k Dluhopisům pro Emitenta bude vykonávat společnost CCF, která byla touto činností pověřena na základě Příkazní smlouvy. Emitent může pověřit výkonem činnosti agenta pro výpočty spojené s prováděním výpočtů v souvislosti s Dluhopisy jinou osobu s příslušným oprávněním k výkonu takové činnosti (CCF nebo taková jiná osoba dále také jen „Agent pro výpočty“). K Datu emise Emitent nemá v úmyslu požadat o přijetí Dluhopisů k obchodování na jakémkoli regulovaném trhu ani v mnohostranném obchodním systému. Emisní podmínky byly vyhotoveny v souladu se zákonem č. 190/2004 Sb., o dluhopisech, ve znění pozdějších předpisů (dále jen „Zákon o dluhopisech“). Název Dluhopisu je „Rezidence Branka II 6%/22“. 1. OBECNÁ CHARAKTERISTIKA DLUHOPISŮ 1.1. Emitent 1.1.1 Bytové družstvo Rezidence Branka, se sídlem Dělnická 397/39, Komín, 624 00 Brno, IČO 06012086, založenou podle českého práva, zapsanou v obchodním rejstříku vedeném Krajským soudem v Brně, oddíl Dr, vložka 5648 1.1.2 Emitent byl založen v průběhu roku 2017 jako jednoúčelová společnost za účelem nákupu nemovitosti specifikované v článku 1.1.4, její kompletnej rekonstrukce a následného prodeje. 1.1.3 Účelem této emise je restrukturalizace – prolongace části závazků Emitenta plynoucích z předchozí emise Rezidence Branka 5%/20, ISIN CZ0003520769. 1.1.4 Nemovitostí se rozumí parcela vedená v katastrálním území Brno, Komín pod LV č. 441, parcelní číslo 365/2, jejíž součástí je budova, rodinný dům, s číslem popisným 205, adresní místo Branka 205/8 (dále jen „Nemovitost”) 1.2. Podoba, forma, jmenovitá hodnota, druh Dluhopisy jsou vydány jako zaknihované ve formě na řad, v celkovém předpokládaném počtu 2 300 kusů, každý ve jmenovité hodnotě 5 000 Kč (pět tisíc korun českých). S Dluhopisy nejsou spojena žádná předkupní nebo výměnná práva. Dluhopisům je přidělen ISIN CZ0003531352. 1.3. Vlastníci dluhopisů; převod Dluhopisů 1.3.1. Vlastníci dluhopisů Pro účely Emisních podmínek se Vlastníkem dluhopisů rozmíí osoba, na jejímž účtu vlastník, případně na jejímž podúčtu v rámci účtu zákazníků v rámci navazující evidence, v Centrálním depozitáři, je Dluhopic evidován. Centrální depozitář (také „CDCP”) znamená společnost Centrální depozitář cenných papírů, a.s., se sídlem Praha 1, Rybná 14, PSČ 110 05, IČO: 250 81 489, zapsanou v obchodním rejstříku vedeném Městským soudem v Praze, spisová značka B 4308. Dokud nebudou Emitent a Administrátor přesvědčivým způsobem informování o skutečnostech prokazujících, že Vlastník dluhopisů není vlastníkem dotčených zaknihovaných cenných papírů, budou Emitent i Administrátor pokládat každého Vlastníka dluhopisů za jejich oprávněného vlastníka ve všech ohledech a provádět mu platby v souladu s těmito Emisními podmínkami. Osoby, které budou vlastníky Dluhopisu a které nebudou mít Dluhopic z jakýchkoli důvodů zapsán na svém účtu vlastníka v příslušné evidenci zaknihovaných cenných papírů, jsou povinný o této skutečnosti a titulu nabytí vlastnictví k Dluhopisům neprodleně informovat Emitenta a Administrátora. 1.3.2. Převoditelnost Dluhopisů Převoditelnost Dluhopisů není omezena. K převodu Dluhopisů dochází registrací převodu dluhopisu v evidenci vlastníků dle článku 1.3. Jakákoliv změna v seznamu Vlastníků dluhopisů se považuje za změnu provedenou až v průběhu příslušného dne, tj. nelze provést změnu v seznamu Vlastníků dluhopisů s účinností k počátku dne, ve kterém je změna provedená. 1.4. Oddělení práva na výnos Oddělení práva na výnos Dluhopisů formou vydání kupónů jako samostatných cenných papírů se vylučuje. 1.5. Některé závazky Emitenta Emitent tímto prohlašuje, že dluží jmenovitou hodnotu a narostlý výnos každého Dluhopisu příslušnému Vlastníkovi Dluhopisu. Emitent se zavazuje, že bude vyplácet úrokové výnosy z Dluhopisu a splati jmenovitou hodnotu Dluhopisu a narostlý výnos Dluhopisu v souladu s těmito Emisními podmínkami. Emitent se dále zavazuje zacházet za stejných podmínek se všemi Vlastníky dluhopisů stejně. 1.6. Rating Ani Emitentovi ani Dluhopisům nebylo uděleno ohodnocení finanční způsobilosti (rating) žádnou ratingovou agenturou, ani se neočekává, že pro účely této emise bude ohodnocení finanční způsobilosti (rating) Emitenta či Dluhopisů uděleno. 2. DATUM A ZPŮSOB ÚPISU EMISE DLUHOPISŮ; EMISNÍ KURZ 2.1. Datum emise Datum emise Dluhopisů je stanoven na 1. 4. 2021 (dále jen „Datum emise“). 2.2. Předpokládaná celková jmenovitá hodnota emise Dluhopisů a Lhůta pro upisování emise dluhopisů Předpokládaná jmenovitá hodnota emise Dluhopisů činí 11 500 000 Kč (jedenáct milionů pět set tisíc korun českých). Emisní lhůta pro upisování dluhopisů začne běžet 0:00 dne 25. 3. 2021 a skončí dne 30. 6. 2021 (dále jen „Lhůta pro upisování emise dluhopisů“). Pokud Emitent nevydá k Datu emise všechny Dluhopisy, může zbylé Dluhopisy vydat kdykoli v průběhu Lhůty pro upisování emise dluhopisů, a případně i po uplynutí Lhůty pro upisování emise dluhopisů v průběhu dodatečné emisní lhůty, kterou Emitent případně stanoví a uveřejní v souladu s platnými právními předpisy (dále jen „Dodatečná lhůta pro upisování emise dluhopisů“). Emitent je oprávněn vydat Dluhopisy v menším objemu, než byla předpokládaná celková jmenovitá hodnota emise Dluhopisů. Emitent je oprávněn vydávat emisi Dluhopisů postupně (v tranších), a to jak během Lhůty pro upisování emise dluhopisů, tak i během Dodatečné lhůty pro upisování emise dluhopisů (bude-li Dodatečná lhůta pro upisování emise dluhopisů Emitentem stanovena). Bez zbytečného odkladu po uplynutí Lhůty pro upisování emise dluhopisů a/nebo Dodatečné lhůty pro upisování emise dluhopisů oznamí Emitent Vlastníkům dluhopisů způsobem stanoveným příslušnými platnými právními předpisy celkovou jmenovitou hodnotu všech vydaných Dluhopisů, avšak jen v případě, že taková celková jmenovitá hodnota všech vydaných Dluhopisů je vyšší než celková předpokládaná jmenovitá hodnota emise Dluhopisů. Emitent je také oprávněn vydat k datum emise Dluhopisy v celém předpokládaném objemu nejprve na svůj majetkový účet v souladu s § 15/4 zákona 190/2004 Sb. o dluhopisech a teprve následně z tohoto svého účtu převádět Dluhopisy na účty investorů. V takovém případě se za Emisní kurs považuje kupní cena tohoto převodu. 2.3. Způsob a místo úpisu či nabytí Dluhopisů Předpokládaný objem emise Dluhopisů bude nabídnut: 1. Přednostně investorům, kteří vlastní podíl(y) na Původním dluhopisu, případně pohledávku za Emitentem v souvislosti s Původním dluhopisem, jimž se rozumí imobilizovaný dluhopis Rezidence Branka 5%/20, ISIN CZ0003520769 a to poměrně, podle poměrů jimi vlastněných podílů na Původním dluhopisu, tedy za každý jeden vlastněný podíl (pohledávku) na Původním dluhopisu může investor přednostně upsat/nabýt jeden Dluhopis. 2. Ostatním investorům v rámci nabídky s časovou prioritou, tedy požadavky na úpis budou odbavovány dle data a času jejich doručení Administrátorovi. Emisní kurs dle bodu 1. tohoto odstavce bude přednostně uhrazen zápočtem pohledávky investora na splacení jistiny Původního dluhopisu Emitentem. Emisní kurs dle bodu 2. bude uhrazen investorem výhradně bankovním převodem na účet Administrátora. Emisní kurz všech Dluhopisů vydaných k Datum emise činí 100 % jejich jmenovité hodnoty (dále jen „Emisní kurz“). Tam, kde je to relevantní, bude Emisní kurz navýšen o AÜV (zejména pokud budou Dluhopisy upsány či koupeny od Emitenta po Datu emise). 3. STATUS ZÁVAZKŮ Z DLUHOPISŮ A ZAJIŠTĚNÍ 3.1. Status závazků Emitenta Závazky z Dluhopisů (a všechny platební závazky Emitenta vůči Vlastníkům dluhopisů vyplývající z Dluhopisů) zakládají přímé, obecné, nepodmíněné a nepodřízené závazky Emitenta zajištěné Zajištěním (po vzniku Zajištění v souladu s ustanovením článku 3.2. těchto Emisních podmínek), které jsou a budou co do pořadí svého uspokojení (a) rovnocenné (pari passu) mezi sebou navzájem a (b) alespoň rovnocenné (pari passu) vůči všem dalším současným i budoucím nepodřízeným a stejným způsobem zajištěným závazkům Emitenta, s výjimkou těch závazků Emitenta, u nichž stanoví jinak kogentní ustanovení právních předpisů. Emitent zajistí rovně zacházení se všemi Vlastníky dluhopisů stejné Emise dluhopisů. 3.2. Zajištění dluhopisů a Agent pro Zajištění 3.2.1. Zajištění Dluhopisů K Datu emise nebudou závazky Emitenta vyplývající z Dluhopisů zajištěny. Po Datu emise budou závazky Emitenta vyplývající z Dluhopisů v souladu s článkem 3.2.4 těchto Emisních podmínek zajištěny ve prospěch Agentu pro zajištění a jeho prostřednictvím pro Vlastníky dluhopisů zástavním právem k Nemovitosti. (dále jen „Zajištění“). 3.2.2. Uvolnění zástavního práva Uvolnění Zajištění k zastavené Nemovitosti podléhá předchozímu schválení Agentu pro zajištění. Emitent předpokládá, že v rámci přípravy rozprodeje Nemovitosti dojde k rozdělení Nemovitosti na pět (5) bytových a jednu (1) nebytovou jednotku. Zajištění Nemovitostí se v takovém případě změní na šest (6) samostatných zástav. V případě prodeje po jednotlivých jednotkách původní Nemovitosti uvolní Agent pro zajištění vždy příslušnou zástavu na prodávané jednotce, a to proti splacení kupní ceny na účet Agenta, jak zpodrobněno níže, a to v minimální výši 60.000,- CZK (slovy šedesát tisíc korun českých) za každý čtvereční metr plochy prodávané jednotky. Agent pro zajištění bude stranou (možno i vedlejší) úschovní či obdobné smlouvy, pokud nebude sjednaná částka kupní ceny hrazena přímo na účet Agenta pro zajištění. V případě, že by byla celá částka kupní ceny hrazena na účet Agenta pro zajištění, vyplatí Agent pro zajištění následně částku převyšující 60.000,- CZK za prodaný čtvereční metr jednotky na vlastní bankovní účet Emitenta, který mu pro tyto účely zadá písemný pokyn. V případě, že má být zastavená Nemovitost uvolněna ze Zajištění za účelem směny, je Agent pro zajištění oprávněn uvolnit Zajištění pouze v případě, pokud mu Emitent navrhně jiné nemovitosti k zajištění, přičemž hodnota takových nemovitostí musí být rovna nebo vyšší než hodnota uvolňované Nemovitosti. K nově navrženým (směňovaným) nemovitostem musí Emitent zřídit Zajištění do 60 dnů od uvolnění původního Zajištění Emitentem. 3.2.3. Agent pro zajištění Agent pro zajištění vykonává práva věřitele a zástavního věřitele nebo příjemce jiného zajištění, včetně práv plnoucích nebo souvisejících se Zajišťovací dokumentací (jak je definována níže v článku 3.2.4. Emisních podmínek), vlastním jménem ve prospěch Vlastníků dluhopisů, a to i v případě insolvenčního řízení, výkonu rozhodnutí nebo exekuce týkající se Emitenta. Vztah mezi Emitentem a Agentem pro zajištění je upraven Smlouvou s agentem pro zajištění. Plnění získané ze Zajištění náleží Vlastníkům dluhopisů (poměrně podle počtu jimi vlastněných Dluhopisů) a Agentovi pro zajištění tak, jak je upraveno v těchto Emisních podmínkách, přičemž v souladu s ustanovením § 20 odst. 2 Zákona o dluhopisech se toto plnění považuje za majetek zákazníka podle ZPKT. Při výkonu práv ze Zajištění, Zajišťovací dokumentace, Smlouvy s agentem pro zajištění a Emisních podmínek a dalších práv plnoucích ze Zákona o dluhopisech souvisejících se Zajištěním se na Agenta pro zajištění hledí, jako by byl věřitelem každé zajištěné pohledávky v souladu s ustanovením § 20a odst. 6 Zákona o dluhopisech. V rozsahu, v jakém taková práva (včetně práv uvedených v ustanovení § 20a odst. 5 Zákona o dluhopisech) uplatňuje Agent pro zajištění, není žádný Vlastník dluhopisů oprávněn uplatňovat taková práva samostatně. Prodloužení Agentu pro zajištění s výkonem nebo uplatňováním práv nebo plněním povinnosti po dobu delší než 30 Pracovních dnů zakládá důvod, pro který může dojít k ukončení funkce Agenta pro zajištění podle Smlouvy s agentem pro zajištění a Emitent je povinen svolat Schůzi podle článku 14.1.2 Emisních podmínek. Podstatné dokumenty týkající se Zajištění včetně Zajišťovací dokumentace budou k dispozici k nahlédnutí Vlastníkům dluhopisů a potenciálním investorům do Dluhopisů v běžné pracovní době v Určené provozovně. Úpisem či koupí Dluhopisů souhlasí každý Vlastník dluhopisů s ustanovením Agenta pro zajištění jako agenta pro zajištění podle ustanovení § 20 a násled. Zákona o dluhopisech. Každý Vlastník dluhopisů dále souhlasí, aby Agent pro zajištění svým jménem a ve prospěch Vlastníků dluhopisů vykonával všechna práva věřitele, zástavního věřitele nebo jiného příjemce zajištění, která vyplývají ze Zajištění, Zajišťovací dokumentace, Emisních podmínek, Smlouvy s agentem pro zajištění a Zákona o dluhopisech nebo jiných příslušných právních předpisů. Agent pro zajištění souhlasí se svým ustanovením jako agenta pro zajištění a dalšími zmocněními podle Emisních podmínek, ustanovení § 20 a násled. Zákona o dluhopisech v souvislosti s Dluhopisy a Zajištěním obsaženými ve Smlouvě s agentem pro zajištění a v Zajišťovací dokumentaci. Smlouva s agentem pro zajištění a Zajišťovací dokumentace mohou obsahovat blížší úpravu týkající se práv a povinností Agenta pro zajištění, včetně případného výkonu Zajištění ve prospěch Vlastníků dluhopisů a Agenta pro zajištění. Při plnění funkce Agenta pro zajištění je Agent pro zajištění povinen postupovat s odbornou péčí, v souladu se zájmy Vlastníků dluhopisů a je vázan jejich pokyny ve formě rozhodnutí schůze Vlastníků dluhopisů (dále jen „Schůze“), jak je uvedeno níže. V případě, že Agent pro zajištění zanikne bez právního nástupce nebo nebude moci vykonávat svou běžnou podnikatelskou činnost či v případě hrubého porušení povinnosti při výkonu funkce Agenta pro zajištění ze strany Agenta pro zajištění nebo jiného ukončení Smlouvy s agentem pro zajištění, Emitent bez zbytečného odkladu svolá Schůzi a navrhně, aby Schůze vyslovila souhlas s tím, aby výkonem funkce Agenta pro zajištění v souvislosti s Dluhopisy byla pověřena jiná osoba s oprávněním k výkonu takové činnosti (dále jen „Nový agent pro zajištění“). Tato změna však nesmí způsobit Vlastníkům dluhopisů újmu. Za tímto účelem pak Emitent neprodleně uzavře s Novým agentem pro zajištění novou zajišťovací dokumentaci, která bude ve všech podstatných ohledech shodná se stávající zajišťovací dokumentací a stávající Agent pro zajištění je povinen poskytnout v souvislosti s výměnou Agenta pro zajištění veškerou součinnost. Výměnu Agenta pro zajištění Emitent bez zbytečného odkladu oznámí Vlastníkům dluhopisů v souladu s článkem 13 těchto Emisních podmínek. 3.2.4. Zřízení Zajištění Vzhledem k návaznosti emise Dluhopisů na emisi Původních dluhopisů se úprava Zajištění stanoví takto: Emitent se zavazuje zřídit zástavní právo k Nemovitosti ve prospěch Agenta pro zajištění, jakožto druhé v pořadí, kde právem prvním v pořadí je pouze zástavní právo ve prospěch Agenta, vyplývající ze zajištění Původních dluhopisů. Po upsání emise Dluhopisů a zároveň za podmínky splacení 50 % jmenovité hodnoty Původních dluhopisů Emitentem a také splacení úroků a ostatních závazků Emitenta z Původních dluhopisů. Emitent v součinnosti s Agentem pro zajištění zruší zástavní právo ve prospěch Agenta, vyplývající ze zajištění Původních dluhopisů a zástavní právo ve prospěch Agenta pro zajištění vyplývající ze zajištění emise Dluhopisů bude první v pořadí. Emitent se zavazuje Zajištění řádně udržovat v rozsahu dle čl. 3.2.1. až do okamžiku splnění veškerých svých závazků vyplývajících z Dluhopisů, nebo do dne prodeje zastavené Nemovitosti, nebo její části Emitentem za přiměřenou protihodnotu. Za účelem zřízení Zajištění Agent pro zajištění uzavře s Emitentem zástavní smlouvu (dále jen „Zástavní smlouva“) a Emitent podá návrh na vklad příslušného zástavního práva do katastru nemovitostí či jiné příslušné evidence a jeho provedení. Emitent se zavazuje postupovat tak, aby zástavní právo k Nemovitosti, ve prospěch Agenta pro zajištění, vyplývající ze zajištění emise Dluhopisů, bylo jediným a prvním v pořadí nejpozději do tří měsíců od Data emise. Pro posílení Zajištění, vystavil Emitent vlastní směnku na řad Agentu pro zajištění na případné pokrytí rozdílu mezi výší objemu emise Dluhopisů s příslušenstvím a případnou výší realizace zastavené Nemovitosti. Směnka je vystavena jako blankosměnka, kterou avalovala mateřská společnost Emitenta, obchodní společnost All Inclusive Development a.s., IČO 27737438, se sídlem Dělnická 397/39, 624 00 a Ivor Ševčík, dat. nar. 15. 2. 1981, bytem Foltýnova 1019/43, 635 00 Brno, přičemž doplnění směněné částky je oprávněn provést Agent pro zajištění po realizaci zástav tak, aby směněnčná částka pokryla rozdíl mezi hodnotou získanou realizací zástav a nároky Vlastníků dluhopisů vyplývající z vlastnictví Dluhopisů. 3.2.5. Postup v případě prodloužení se zřízením Zajištění Pokud nedojde ke zřízení a vzniku Zajištění ve lhůtách uvedených v článku 3.2.4 těchto Emisních podmínek či pokud dojde částečně či zcela k zániku Zajištění ve lhůrce uvedeném rozsahu bez získání přiměřené protihodnoty z prodeje zastavené Nemovitosti Emitentem, je Emitent povinen neprodleně svolat Schůze, na které odůvodní tuto skutečnost. Schůze následně rozhodne prostou většinou hlasů přítomných Vlastníků dluhopisů o dalším postupu, včetně např. o případném prodloužení lhůty ke zřízení a vzniku Zajištění a stanovení lhůty k novému zřízení Zajištění. V případě, že v době od svolání schůze do data konání Schůze dojde ke zřízení a vzniku Zajištění v rozsahu stanoveném těmito Emisními podmínkami, Emitent Schůzi odvolá stejným způsobem, jakým byla svolána. Pokud Schůze nebude odvolána a Zajištění bylo zřízeno a vzniklo v souladu s těmito Emisními podmínkami, Emitent na počátku Schůze informuje přítomné Vlastníky dluhopisů o této skutečnosti a Schůze dále nerozhoduje. Ve výše uvedeném případě je také každý z Vlastníků dluhopisů oprávněn požádat o předčasné splacení Dluhopisů. 3.2.6. Vymáhání závazků Emitenta prostřednictvím Agenta pro zajištění Agent pro zajištění je oprávněn jako společný a nerozdílný věřitel s každým příslušným jednotlivým Vlastníkem dluhopisů (ohledně peněžitého závazku Emitenta vyplývajícího z Dluhopisů vůči takovému Vlastníkovi dluhopisů) požadovat po Emitentovi uhranění jakékoli částky, kterou je Emitent povinen uhradit kterémukoli Vlastníkovi dluhopisů ohledně peněžitého závazku Emitenta vyplývajícího z Dluhopisů, včetně jejich vymáhání prostřednictvím realizace Zajištění (které je zřízeno pouze ve prospěch Agenta pro zajištění). Z tohoto důvodu jsou všichni Vlastníci dluhopisů povinni vykonávat svá práva z Dluhopisů, která by mohla jakkoli ohrozit existenci nebo kvalitu Zajištění (včetně uplatnění a vymáhání jakékoli peněžité pohledávky vůči Emitentovi na základě Dluhopisů prostřednictvím realizace Zajištění), pouze v součinnosti s Agentem pro zajištění a jeho prostřednictvím. O vymáhání závazků Emitenta prostřednictvím Agenta pro zajištění, včetně realizace Zajištění pak rozhoduje Schůze svolaná v souladu s těmito Emisními podmínkami, pokud nastane kterýkoliv Případ neplnění závazků (jak je tento pojem definován níže v těchto Emisních podmínkách). O vymáhání závazků Emitenta prostřednictvím Agenta pro zajištění, postupu a způsobu takového vymáhání, včetně realizace Zajištění, rozhodne Schůze prostou většinou hlasů přítomných Vlastníků dluhopisů s tím, že zároveň určí i společný postup a způsob realizace zástavy v souladu s právními předpisy a se zástavní smlouvou. 3.2.7. Jednání agenta pro zajištění (a) Agent pro zajištění: (i) je povinen, s výhradou odstavce (d) níže, vykonat jakékoli právo či zdržet se výkonu jakéhokoli práva, které mu náleží jako Agentovi pro zajištění, v souladu s jakýmkoliv pokynem schváleným Schůzí prostou většinou hlasů přítomných Vlastníků dluhopisů ("Pokyn schůze"); a (ii) není odpovědný za žádné jednání (nebo opomenutí), pokud jedná (nebo se zdržuje jednání) v souladu s Pokynem schůze. (b) Upřesnění pokynu (i) Agent pro zajištění je oprávněn žádat (ii) svolání Schůze k udělení Pokynu schůze nebo upřesnění rozhodnutí předchozích Pokynů schůze, nebo, (iii) jsou-li splněny zákonné podmínky pro rozhodnutí záležitostí, které nebyly zařazeny na navrhovaný program Schůze, o udělení Pokynu schůze nebo upřesnění Pokynu schůze přímo v rámci konání Schůze, pokud jde o to, zda a jakým způsobem by měl vykonat jakékoli právo nebo se zdržet výkonu jakéhokoli práva, oprávnění nebo uvážení a Agent pro zajištění se může zdržet jednání, dokud neobdrží takový Pokyn schůze nebo upřesnění. Tím není dotčeno právo, nikoli povinnost, Agenta pro zajištění vykonat jakékoli právo nebo zdržet se výkonu jakéhokoli práva v případě, že by prodlení podle uvážení Agenta pro zajištění mohlo Vlastníkům dluhopisů způsobit závažnou újmu. (c) Závaznost pokynu Jakékoli Pokyny schůže budou závazné pro všechny Vlastníky dluhopisů. (d) Při výkonu jakéhokoli práva Agenta pro zajištění podle Zajišťovací dokumentace nebo jakéhokoli práva s ní souvisejícího, včetně výkonu práv věřitele podle § 20a odst. 5 Zákona o dluhopisech, kdy: (i) Agent pro zajištění neobdržel žádný pokyn týkající se výkonu tohoto práva; nebo (ii) je dle názoru Agenta pro zajištění Pokyn schůže v rozporu s právními předpisy nebo dobrými mravy, bude Agent pro zajištění jednat dle svého volného uvážení s ohledem na zájmy všech Vlastníků dluhopisů. (e) Agent pro zajištění může požadovat, aby mu v souvislosti s Pokynem schůže bylo poskytnuto dostatečné zajištění nebo příslibeno odškodnění ze strany Vlastníků dluhopisů (jež bylo schváleno Schůží) či Emitenta (podle názoru Agenta pro zajištění v dostatečném rozsahu) pro případ vzniku jakékoliv majetkové či nemajetkové újmy. Aniž jsou dotčena ustanovení článku 3.2.9 Emisních podmínek či další ustanovení tohoto článku 3.2.7 při absenci Pokynu schůže může Agent pro zajištění jednat (nebo se zdržet jednání), jak považuje podle svého uvážení za vhodné, avšak vždy v nejlepším zájmu Vlastníků dluhopisů. 3.2.8. Akcelerace Dojde-li k Případu porušení (jak je tento pojem definován v článku 9.1 Emisních podmínek) a tento Případ porušení trvá, Agent pro zajištění může, pokud je to podle jeho názoru nutné pro ochranu práv ze Zajištění rozhodnout o tom, že všechny dluhy z Dluhopisů včetně dosud nevyplaceného narostlého úrokového či jiného výnosu na těchto Dluhopisech v souladu s článkem 5 Emisních podmínek se stávají splatnými (Akcelerace), přičemž však o Akceleraci musí rozhodnout vždy v následujících případech: (a) doručili-li Vlastníci dluhopisů držící souhrnně alespoň 35 % jmenovité hodnoty všech vydaných a dosud nesplacených Dluhopisů Oznámení o předčasném splacení Administrátorovi podle článku 6.2 a jejich pohledávky za Emitentem vyplynující z Dluhopisů zůstávají neuhraněny, nebo (b) dojde-li k Případu porušení dle článku 9.1 (d) nebo (e) a tento Případ porušení trvá, nebo (c) rozhodne-li tak Schůze Kvalifikovanou většinou. Dojde-li k Akceleraci, stávají se všechny částky splatné Emitentem Vlastníkům dluhopisů splatnými (nestali-li se splatnými již dříve) k poslednímu Pracovnímu dni v měsíci následujícím po měsíci, kdy Agent pro zajištění rozhodl o Akceleraci (Den předčasné splatnosti dluhopisů) a tuto skutečnost oznámil Emitentovi a Vlastníkům dluhopisů na svých internetových stránkách www.cyrruscf.cz Na jedné Schůzi může být přijato jak rozhodnutí o Akceleraci, tak Rozhodnutí o výkonu (jak je tento pojem definován v článku 3.2.9 Emisních podmínek), přičemž platí, že nejdříve musí být přijato rozhodnutí o Akceleraci a až následně může být přijato Rozhodnutí o výkonu a ve vztahu ke každému z těchto rozhodnutí platí příslušné rozhodovací většiny. 3.2.9. Výkon zajištění a další rozhodnutí V souladu s ustanovením § 20a odst. 7 Zákona o dluhopisech nebudu Vlastníkům dluhopisů náležet žádná přímá práva vyplynující ze Zajišťovací dokumentace a nebudu moci vykonat žádné samostatné oprávnění, právo nebo opravný prostředek ohledně jakéhokoli Zajištění nebo udělit souhlas nebo se vzdát práva k Zajištění nebo jakkoli přímo využívat jakékoliv Zajištění, pokud tato práva vykonává Agent pro zajištění. Žádný z Vlastníků dluhopisů nebude ani oprávněn samostatně žádat Agenta pro zajištění, aby jakkoli jednal ve vztahu k Zajištění. Dojde-li k Akceleraci, Agent pro zajištění zvolí podle vlastního uvážení, jednající v dobré víře a s odbornou péčí, vhodný způsob výkonu nebo jiné vhodné jednání podle příslušných předpisů ohledně Zajištění v souladu s podmínkami Zajišťovací dokumentace. Předtím, než Agent pro zajištění zahájí výkon Zajištění, musí svolat na náklady Emitenta Schůži podle článku 14.1.1 Emisních podmínek. Schůze rozhodne, zda má Agent pro zajištění započít s výkonem Zajištění nebo uskutečnit jiné kroky ve vztahu k Zajištění („Rozhodnutí o výkonu“). Rozhodnutí o výkonu musí být schváleno prostou většinou hlasů přítomných Vlastníků dluhopisů a musí obsahovat způsob výkonu Zajištění v souladu se Zajišťovací dokumentací a příslušnými předpisy. Rozhodnutí o výkonu je závazné pro Agenta pro zajištění a všechny Vlastníky dluhopisů. Rozhodnutí o výkonu je možné učinit pouze, pokud již došlo k Akceleraci. Agent pro zajištění začne postupovat v souladu s Rozhodnutím o výkonu bez zbytečného odkladu poté, co mu bylo Rozhodnutí o výkonu doručeno. Agent pro zajištění informuje Vlastníky dluhopisů o stavu výkonu Zajištění uveřejněním na svých internetových stránkách na adrese www.cyrruscf.cz a dokumenty týkající se výkonu Zajištění budou k dispozici k nahlédnutí Vlastníkům dluhopisů v běžné pracovní době v Určené provozovně. 3.3. Použití výtěžku Agent pro zajištění použije (a je povinen tak postupovat podle Smlouvy s agentem pro zajištění) jakýkoli výtěžek ze Zajištění následujícím způsobem: 1. na úhradu všech plateb splatných Agentovi pro zajištění v souvislosti s výkonem jeho funkce (výjma odměny pro Agenta pro zajištění), včetně jakéhokoli nákladů a výdajů výkonu Zajištění, ledaže takové platby byly uhrazeny jinak; 2. na úhradu odměny pro Agenta pro zajištění v maximální výši 5 % z výtěžku realizace Zajištění; 3. na úhradu poměrné výše jakékoliv částky odškodnění uhrazené Agentovi pro zajištění Vlastníky dluhopisů; 4. na úhradu poměrné výše jakékoliv splatné, avšak neuhraněné jistiny a splatného, avšak neuhraněného úroku z Dluhopisů Vlastníkům dluhopisů; a 5. Případné pohledávky Administrátora za Emitentem, z titulu Smlouvy s Administrátorem, či jinými pohledávkami Administrátora za Emitentem v souvislosti s Dluhopisy; a 6. k vrácení jakéhokoli přebytku Emitentovi, jako poskytovateli zajištění. Úhradu jistiny a naběhlého úroku z Dluhopisů z výtěžku ze dle odstavce výše uhradí Agent pro zajištění prostřednictvím Administrátora. Agent pro zajištění informuje Vlastníky dluhopisů o rozdělení tohoto výtěžku mezi Vlastníky dluhopisů, a to uveřejněním na svých internetových stránkách na adrese www.cyrruscf.cz. V případě výkonu Zajištění v rámci insolvenčního řízení Emitenta budou pravidla pro rozdělení výtěžku ze zpěněnění Zajištění upravena v souladu se zákonnými podmínkami. 4. ZÁVAZKY A PROHLÁŠENÍ EMITENTA 4.1. Využití prostředků získaných emisí Dluhopisů 4.1.1. Emitent se zavazuje, že prostředky z emise nebudou využity na splacení úvěrů, zápůjček ani jiných závazků Emitenta, vyjma takových, které souvisejí s restrukturalizací závazků plynoucích z emise Původních dluhopisů a s financováním rekonstrukce Nemovitosti. Emitent se zároveň zavazuje, že prostředky nebudou využity na pořízení jiných nemovitostí. 4.2. Negativní závazek Emitent se zavazuje, že do doby splnění všech svých platebních závazků vyplývajících ze všech Dluhopisů vydaných a dosud nesplacených v souladu s těmito Emisními podmínkami nezřídí ani neumožní zřízení žádného zajištění jakýchkoli svých Závazků, zástavními nebo jinými obdobnými právy třetích osob, která by omezoila práva Emitenta k jeho současnému nebo budoucímu majetku nebo příjmům, pokud nebude usnesením Schůze schváleno jinak. Ustanovení předchozího odstavce se nevztahuje na: (a) jakákoli práva třetích osob (s výjimkou zástavních práv), jaká se obvykle poskytují v rámci podnikatelské činnosti provozované Emitentem nebo zřízená v souvislosti s obvyklými operacemi Emitenta, včetně běžných zatížení (věcných břemén) zřízených ve prospěch provozovatelů standardních inženýrských sítí; nebo (b) jakákoli zástavní nebo jiná obdobná práva třetích osob (stávající či budoucí) vyplývající ze smluvních ujednání Emitenta existující k Datu emise Dluhopisů; nebo (c) zástavní nebo jiná obdobná práva bank nebo jiných finančních ústavů financujících koupi Nemovitosti, nebo části Nemovitosti, zapsaných jako druhá v pořadí; nebo (d) jakákoli zástavní nebo jiná obdobná práva vázoucí na obchodním majetku Emitenta v době jeho nabytí, nebo za účelem zajištění Závazků Emitenta vzniklých výhradně v souvislosti s pořízením takového majetku nebo jeho části; nebo (e) jakákoli zástavní nebo jiná obdobná práva třetích osob vyplývající ze zákona nebo vzniklá na základě soudního nebo správního rozhodnutí. Pro účely těchto Emisních podmínek znamenají „Závazky“ závazky Emitenta zaplatit jakékoli dlužné částky a dále ručitelské závazky Emitenta převzaté za závazky třetích osob zaplatit jakékoli dlužné částky. Pro účely této definice Závazků znamenají „ručitelské závazky“ závazky Emitenta převzaté za závazky třetích osob ve formě ručitelského prohlášení či jiné formy ručení, směnečného rukojemství či převzetí společného a nerozdílného závazku. 4.3. Další závazky Emitenta 4.3.1. Úkony vyžadující předchozí schválení Schůze Emitent se zavazuje, že do doby splnění všech svých platebních závazků vyplývajících ze všech Dluhopisů vydaných a dosud nesplacených v souladu s těmito Emisními podmínkami bez předchozího schválení usnesením Schůze podle článku 14 těchto Emisních podmínek: (a) nezmění ani nezruší hlavní předmět svého podnikání (s výjimkou změn vyvolaných výlučně změnou právních předpisů), bude ve všech podstatných ohledech zachovávat rozsah svého podnikatelského oprávnění, a bude zachovávat v platnosti všechna povolení a licence nezbytné k řádnému výkonu své hlavní podnikatelské činnosti i/nebo plnění svých závazků; (b) nezvyší či nesníží základní kapitál Emitenta ani neuzavře smlouvu o převodu zisku ani ovládací smlouvu; (c) neposkytne za závazky jakékoli osoby ručení ani se nezaváže jakoukoli formou uhradit závazek jakékoli třetí osoby (zejména nepřistoupí k dluhu nebo závazku nebo nepřevezme dluh), ani neposkytne slib odškodnění v celkové částce vyšší než =500.000,- Kč (slovy: pět set tisíc korun českých). Emitent se zavazuje, že od Data emise do doby splnění všech svých platebních závazků vyplývajících ze všech Dluhopisů vydaných a dosud nesplacených v souladu s těmito Emisními podmínkami: (a) neprodá, nedaruje ani jinak nezicí jednou nebo více smlouvami nebo sérií souvisejících smluv svá reálná ani finanční aktiva (nebo jakoukoli jejich část) pokud by výše protiplnění při zcizení těchto reálných, či finančních, aktiv měla být nižší než cena obvyklá; Emitent se zavazuje, že do doby splnění všech svých platebních závazků vyplývajících ze všech Dluhopisů vydaných a dosud nesplacených v souladu s těmito Emisními podmínkami bez předchozího oznámení Emitentovi: (a) nezvyší jakoukoli svou Finanční zadluženost o více než =500.000,- Kč (slovy: pět set tisíc korun českých), přičemž zvýšení Finanční zadluženosti může být pouze ve formě úvěru nebo půjčky, které nebudou zajištěny jakýmkoli aktivy Emitenta. „Finanční zadlužeností“ se pro účely těchto Emisních podmínek rozumí ve vztahu k určité osobě jakékoli její peněžité závazky, které vyplývají: (i) ze smlouvy o úvěru či smlouvy o půjčce, (ii) ze smlouvy o otevření akreditivu či jiné obdobné smlouvy, (iii) z vydání či vydávání jakýchkoliv dluhových cenných papírů či obdobných nástrojů finančního trhu, (iv) z jakéhokoli závazku vztahujícího se k užívání jakéhokoli předmětu právních vztahů, pokud by takovýto závazek byl podle účetních standardů považován za finanční nebo kapitálový leasing, (v) z postoupení nebo diskontu pohledávek, (vi) z jakékoli jiné transakce (včetně kupní smlouvy s odloženou dobou dodání zboží či splatnosti kupní ceny delší než 180 dnů), která má stejný ekonomický účinek jako půjčka či úvěr, (v) z jakékoli derivátové transakce, která má chránit před pohybem sazby či ceny nebo která má z takovéto fluktuace těžit (když hodnota této derivátové transakce bude vypočtena pouze na základě její aktuálně přeceněné tržní hodnoty), (vi) z jakéhokoli závazku zpětného odškodnění nebo náhrady závazků vztahujícího se k ručení, odškodnění, akreditivu, dluhopisu nebo jakémukoli jinému instrumentu vydanému bankou nebo jinou finanční institucí a (vii) z ručení nebo závazku odškodnění vztahujícím se ke skutečnostem uvedeným v bodech (i) až (vi) výše. Finanční zadlužeností není přijetí jakékoli dotace nebo účast v dotačním programu, respektive investice Emitenta snížená o takovou dotaci. Omezení uvedená v tomto článku se nevztahují na oprávnění Emitenta zvýšit svou Finanční zadluženost za účelem: (b) splacení závazků, vyplývajících z předchozí emise Rezidence Branka 5%/20, ISIN CZ0003520769; (c) financování rekonstrukce, dostavby a následného prodeje Nemovitosti nebo její části. 4.3.2. Další závazky Emitent se zavazuje, že od Data emise do doby splnění všech svých platebních závazků vyplývajících ze všech Dluhopisů vydaných a dosud nesplacených v souladu s těmito Emisními podmínkami: (a) bude s péčí řádného hospodáře činit veškeré obchodně přiměřené právní a faktické úkony řádně tak, aby nebyla snižena hodnota zastavené Nemovitosti, zejména bude řádně a včas opravovat a udržovat v dobrém stavu veškeré budovy a stavby (přičemž primárně bude vymáhat udržování v dobrém stavu od nájemců v souladu s nájemními smlouvami), stroje a zařízení a jiné věci, které budou v kterékoliv době tvořit jakoukoliv část, součást, příslušenství nebo budou jinak patřit k zastavené Nemovitosti a bude řádně chránit své vlastnické právo k zastavené Nemovitosti proti jakýmkoliv nárokům třetích osob, nikoli však k újmeň Vlastníků dluhopisů; (b) bude řádně a včas plnit veškeré své informační povinnosti vůči Sbírce listin Obchodního rejstříku, a to v rozsahu, v jakém je Emitent povinen finanční výkazy zveřejňovat; (c) poskytne veškerou potřebnou součinnost a bude činit veškeré potřebné úkony a kroky k tomu, aby bylo zřízeno a vzniklo platné, účinné a vymahatelné Zajištění a dále k zachování, ochraně nebo případnému vymáhání Zajištění v souladu s těmito Emisními podmínkami a/nebo Zástavní smlouvou k nemovitosti. 5. VÝNOS DLUHOPISŮ Dluhopisy budou úročeny pevnou úrokovou sazbou ve výši 6,00 % ročně (p. a.). Splatnost výnosu dluhopisů je jedenkrát ročně. První úrokový výnos je tedy splatný k 1. 4. 2022. Druhý a zároveň poslední úrokový výnos je splatný ke dni konečné splatnosti emise, tedy k 31. 12. 2022. Každý takový den dále jen také jako „Den splatnosti výnosu“. Částka poměrného (alikvotního) úrokového výnosu Dluhopisu (AUV) za výnosové období, nebo za jeho část, se vypočte jako součin jmenovité hodnoty Dluhopisu, příslušné roční úrokové sazby a příslušného zlomku dní dle standardu 30e/360. 6. SPLACENÍ A ODKOUPEŇ DLUHOPISŮ 6.1. Konečné splacení Pokud nedojde k předčasnému splacení Dluhopisů Emitentem nebo k odkoupení Dluhopisů Emitentem nebo k jejich zániku, jak je stanoveno níže, bude celá jmenovitá hodnota Dluhopisů splacena jednorázově dne 31. 12. 2022 (dále jen „Den konečné splatnosti dluhopisů“), a to v souladu s článkem 7 těchto Emisních podmínek. 6.2. Předčasné splacení z rozhodnutí Emitenta Emitent je oprávněn na základě svého rozhodnutí učinit Dluhopisy předčasně splatnými. Oznámení Emitenta o předčasné splatnosti Dluhopisů musí být oznámeno alespoň 30 dnů předem a Den předčasné splatnosti (jak je definován dále) bude Emitentem v oznámení stanoven. Oznámení Emitenta o předčasné splatnosti Dluhopisů je neodvolatelné a zavazuje Emitenta k předčasnému splacení všech Dluhopisů dané emise v souladu s těmito Emisními podmínkami. V takovém případě budou všechny nesplacené Dluhopisy dané emise Emitentem splaceny v jejich jmenovité hodnotě zvýšené o narostlý úrokový výnos k Datu předčasné splatnosti. Emitent je dále oprávněn k předčasnému splacení Dluhopisů ve svém vlastnictví v souladu s článkem 6.5. těchto Emisních podmínek. 6.3. Odkoupení Dluhopisů Emitent je oprávněn Dluhopisy za podmínek níže uvedených kdykoliv odkupovat na trhu nebo jinak jakýmkoli způsobem za jakoukoli cenu. 6.4. Zrušení Dluhopisů odkoupených Emitentem Dluhopisy odkoupené Emitentem nezanikají a je na uvážení Emitenta, zda je bude držet v majetku Emitenta a případně je znovu prodá, či zda je, za podmínek uvedených níže, oznámením Administrátorovi učiní předčasně splatnými dnem doručení oznámení o předčasné splatnosti Administrátorovi, nestanovi-li oznámení Emitenta datum pozdější. V takovém případě práva a povinnosti z (odkoupených) Dluhopisů bez dalšího zanikají z titulu splnění práva a povinnosti (závazku) v jedné osobě (přičemž pro vyloučení pochybností platí, že ustanovení článku 6.3 těchto Emisních podmínek se nepoužije). 6.5. Domněnka splacení V případě, že Emitent uhradí Administrátorovi celou částku jmenovité hodnoty Dluhopisů ve jmenovité hodnotě (případě Diskontované hodnoty, jedná-li se o předčasné splacení Dluhopisů) splatnou v souvislosti se splacením Dluhopisů ve smyslu ustanovení článků 5, 6, 8, 14.4.1 a 14.4.2 těchto Emisních podmínek všechny závazky Emitenta z Dluhopisů budou pro účely článku 4 těchto Emisních podmínek považovány za plně splacené ke dni připsání příslušných částek na příslušný účet Administrátora. 6.6. Dispozice s prostředky na účtu u Administrátora S prostředky, které Emitent uhradí na účet u Administrátora za účelem výplaty úrokového výnosu z Dluhopisů nebo splacení jmenovité hodnoty Dluhopisů není Emitent oprávněn disponovat (s výjimkou úrokových výnosů z nich) a Administrátor je v souladu s těmito Emisními podmínkami použije k výplatě Vlastníkům dluhopisů. 7. PLATBY 7.1. Měna plateb Emitent se zavazuje splatit jmenovitou hodnotu Dluhopisů a narostlý výnos výlučně v českých korunách, případně jiné zákonné měně České republiky, která by českou korunu nahradila. Jmenovitá hodnota Dluhopisů a narostlý výnos budou splaceny Vlastníkům dluhopisů za podmínek stanovených těmito Emisními podmínkami a daňovými, devizovými a jinými příslušnými právními předpisy České republiky platnými a účinnými v době provedení příslušné platby a v souladu s nimi. V případě, že (a) česká koruna, případně jiná zákonná měna České republiky, která by českou korunu nahradila, zanikne a bude nahrazena měnou EUR a (b) pokud to nebude v rozporu s kogentním ustanovením právního předpisu, bude (i) denominace takových Dluhopisů změněna na EUR, a to v souladu s platnými právními předpisy, a (ii) všechny peněžité závazky z takových Dluhopisů budou automaticky a bez dalšího oznámení Vlastníkům dluhopisů splatné v EUR, přičemž jako směnný kurz předmětné měny nebo národní měnové jednotky na EUR bude použit oficiální kurz (tj. pevný přepočítací koeficient) v souladu s platnými právními předpisy. Takové nahrazení příslušné měny nebo národní měnové jednotky (i) se v žádném ohledu nedotkně existence závazků Emitenta vyplývajících z Dluhopisů nebo jejich vymahatelnosti a (ii) pro vyloučení pochybností nebude považováno ani za změnu Emisních podmínek ani za Případ neplnění závazků dle těchto Emisních podmínek. 7.2. Den výplaty Splácení jmenovité hodnoty Dluhopisů (popřípadě Diskontované hodnoty, jedná-li se o předčasné splacení Dluhopisů) bude Emitentem prováděno vždy podle relevantních ustanovení těchto emisních podmínek samostatně nebo prostřednictvím Administrátora k datům uvedeným v těchto Emisních podmínkách (každý takový den podle smyslu dále také jen „Den konečné splatnosti dluhopisů“ nebo „Den předčasné splatnosti dluhopisů“ nebo „Den splatnosti výnosu“ nebo každý z těchto dnů také jen „Den výplaty“). Připadne-li Den výplaty na jiný než Pracovní den, vznikne Emitentovi povinnost zaplatit předmětné částky v nejbližší následující Pracovní den (dále jen „Konvence pracovního dne“), aniž by byl povinen platit úrok z prodlení nebo jakékoli jiné dodatečné částky za takový časový odklad. „Pracovním dnem“ se pro účely těchto Emisních podmínek rozumí jakýkoliv kalendářní den (vyjma soboty a nedělí), v němž jsou banky v České republice běžně otevřeny pro veřejnost a v němž se provádí vypořádání mezikbankovních plateb v eurech. 7.3. Určení práva na obdržení výplat souvisejících s Dluhopisy Není-li v těchto Emisních podmínkách stanoveno jinak, oprávněné osoby, kterým Emitent prostřednictvím Administrátora splatí jmenovitou hodnotu Dluhopisů a příslušný AÚV, (dále jen „Oprávněné osoby“), jsou osoby, které budou Vlastníky dluhopisů k rozhodnému dni, který předchází o 10 dní příslušný Den výplaty. 7.4. Provádění plateb Administrátor bude provádět platby Oprávněným osobám bezhotovostním převodem na jejich účet vedený v seznamu Vlastníků dluhopisů, v souladu s článkem 7.2. Emisních podmínek. Závazek splatit jmenovitou hodnotu Dluhopisu a narostlý výnos se považuje za splněný řádně a včas, pokud je příslušná částka poukázána Oprávněné osobě v souladu s článkem 7.2. Emisních podmínek, pokud je nejpozději v příslušný Den výplaty takové částky odepsána z účtu Administrátora. Emitent ani Administrátor nejsou odpovědný za zpoždění výplaty jakékoli dlužné částky způsobené tím, že (i) Oprávněná osoba včas nedodala do seznamu vlastníků údaj o svém bankovním účtu nebo další dokumenty nebo informace požadované v tomto článku 7.4., (ii) takové dokumenty nebo informace byly neúplné, nesprávné nebo neprávě nebo (iii) takové zpoždění bylo způsobeno okolnostmi, které nemohl Emitent nebo Administrátor ovlivnit, a Oprávněné osobě v takovém případě nevzniká žádný nárok na jakýkoli doplatek či úrok nebo jiný výnos za takto způsobený časový odklad příslušné platby. 7.5. Změna způsobu a místa provádění výplat Emitent společně s Administrátorem je oprávněn rozhodnout o změně způsobu a místa provádění výplat, přičemž taková změna nesmí způsobit Vlastníkům dluhopisů újmu. Toto rozhodnutí bude Vlastníkům dluhopisů oznameno v souladu s článkem 13 těchto Emisních podmínek. 8. ZDAŇENÍ 8.1. Obecná úprava Nabídka bude organizována v České republice, daňové poměry Vlastníků dluhopisů se budou řídit platnou zákonnou úpravou ČR, tedy zejména zákonem č. 586/1992 Sb., o daních z příjmů (dále jen „ZDP“). Nabyvatelem Dluhopisů však může být i cizozemec. Následující stručné shrnutí zdaňování Dluhopisů a devizové regulace v České republice vychází zejména ze zákona č. 586/1992 Sb., o daních z příjmů, v platném znění, k datu vyhotovení těchto Emisních podmínek. Veškeré informace uvedené níže se mohou měnit v závislosti na změnách v příslušných právních předpisech, které mohou nastat po tomto datu, nebo ve výkladu těchto právních předpisů, který může být po tomto datu uplatňován. V případě změny příslušných právních předpisů nebo jejich výkladů v oblasti zdaňování Dluhopisů oproti režimu uvedenému níže, bude Emitent postupovat dle takového nového režimu. Pokud bude Emitent na základě změny právních předpisů nebo jejich výkladů povinen provést srážky nebo odvody daně z příjmů z Dluhopisů, nevznikne Emitentovi v souvislosti s provedením takového srážek nebo odvodů vůči vlastníkům Dluhopisů povinnost doplatit jakékoli dodatečné částky jako náhradu za takto provedené srážky či odvody. Emittent dále nebude povinen hradit Vlastníkům dluhopisů žádné další částky jako náhradu srážky daní nebo poplatků, pokud k takové srážce dojde pouze z toho důvodu, že takový Vlastník dluhopisů nepředal Emittentovi včas řádné doklady prokazující, že Vlastník dluhopisů je oprávněn obdržet splátku nebo vypлатu uvedenou v první větě tohoto odstavce bez takové srážky. V následujícím shrnutí nejsou uvedeny daňové dopady související s držbou nebo prodejem Dluhopisů pro investory, kteří v České republice podléhají zvláštnímu režimu zdanění (např. investiční, podílové nebo penzijní fondy). Pro odstranění pochybností tento článek 8 je pouze informativní povahy pro Vlastníky dluhopisů, nepředstavuje závazky Emittenta vůči Vlastníkům dluhopisů a není profesní radou, ať již daňové, účetní, právní či jiné povahy. 8.2. Fyzické osoby (a) Zisky/ztráty z prodeje Dluhopisů třetím osobám Zisky z prodeje dluhopisů třetím osobám realizované fyzickou osobou, která je českým daňovým rezidentem, anebo která není českým daňovým rezidentem a zároveň podniká v České republice prostřednictvím stálé provozovny, anebo která není českým daňovým rezidentem a příjem z prodeje dluhopisů ji plyne od kupujícího, který je českým daňovým rezidentem nebo od české stálé provozovny kupujícího, který není českým daňovým rezidentem, se zahrnují do dílčího daňového základu ostatní příjmy u nepodnikatele nebo dílčího daňového základu daně u podnikajících fyzických osob, jež zahrnuly tyto dluhopisy do svého obchodního majetku, a podléhají daní z příjmů fyzických osob v sazbě 15 % pro část základu daně do 48násobku průměrné mzdy a v sazbě 23 % pro část základu daně přesahující 48násobek průměrné mzdy. Ztráty z prodeje dluhopisů jsou u nepodnikajících fyzických osob obecně daňově neuznatelné, ledaže jsou v témtěž zdanovacím období zároveň vykázány zdánitelné zisky z prodeje jiných cenných papírů; v tom případě je možné ztráty z prodeje dluhopisů až do výše zisků z prodeje ostatních cenných papírů vzájemně započít. Věcná osvobození příjmů z prodeje u fyzických osob Vlastník Dluhopisu, který je fyzickou osobou, může dle ZDP využít daňové osvobození příjmů z prodeje dluhopisu v případě, že doba mezi nabytím dluhopisu a jeho prodejem přesáhne 3 roky. Toto osvobození může být uplatněno při splnění podmínky, že prodávající vlastník neměl a nemá dluhopisy zahrnuté v obchodním majetku. Pokud fyzická osoba – podnikatel zařídil tyto Dluhopisy do svého obchodního majetku, pak může uplatnit toto osvobození teprve po 3 letech od ukončení podnikatelské činnosti. Příjem fyzické osoby, jež nezahrnula tyto Dluhopisy do svého obchodního majetku a jež jako vlastník Dluhopisů při jeho prodeji nesplnil výše uvedený časový test držby po dobu 3 let, ale jejíž celkové příjmy (nikoliv zisky) z prodeje všech cenných papírů nepřesáhnou v daném zdanovacím období limit ve výši 100 tis. Kč, bude osvobozen od daně z příjmů fyzických osob. (b) Zpětný odkup (i předčasný) Příjem z kapitálového majetku Ačkoliv fyzické osoby (nepodnikatele) vždy realizují svůj příjem ze zpětného prodeje (i předčasného) Dluhopisů emittentovi z pohledu práva jako příjem z prodeje cenných papírů, pro účely ZDP se příjem vlastníka Dluhopisu: - při předčasném zpětném odkupu Dluhopisu emittentem ve výši kladného rozdílu mezi jmenovitou hodnotou dluhopisu vyplacenou při jeho splacení nebo částkou při jeho předčasném splacení a cenou, za kterou poplatník dluhopis nabyl, nebo cenou určenou podle zákona upravující oceňování majetku ke dni jeho bezúplatného nabytí se považuje za příjem fyzické osoby z kapitálového majetku je dle § 8 odst. 2) ZDP. Jedná se daňovou fikci, dle které takový příjem ze zpětného (i předčasného) odkupu Dluhopisů reprezentuje samostatnou daňovou kategorii podléhající daní z příjmů fyzických osob v dílčím kapitálovém majetku dle § 8 ZDP. Nejedná se z daňového pohledu o úrok nebo podobný příjem. Srážková daň Tento příjem vlastníka Dluhopisů je zdaňován v samostatném základu daně pro zdanění zvláštní sazbou daně dle § 36 odst. 2 písm. a) ZDP. Sažba srážkové daně dle českých daňových předpisů činí 15 %. Tato srážka daně představuje konečné zdanění úroku v České republice. V souvislosti se stanovením základu daně pro uplatnění srážkové daně u úroků z dluhopisů upozorňujeme, že dle § 36 odst. 3 ZDP se základ daně a sražená daň z jednotlivých dluhopisů nezaokrouhluje. Na celé koruny dolů se zaokrouhluje až celková částka sražené daně za všechny Dluhopisy vlastněné jedním vlastníkem Dluhopisů. Neuplatnění osvobození V této souvislosti upozorňujeme, že v případě zpětného odkupu nelze dle názoru GFŘ aplikovat osvobození příjmů z „prodeje“ dluhopisů dle § 4 odst. 1 písm. w) ZDP (při splnění obecných podmínek pro osvobození), ačkoliv je toto ustanovení ZDP nadřazeno ustanovení § 8 odst. 2) ZDP a z pohledu práva se jedná o příjem z prodeje cenných papírů. Fyzická osoba – podnikatel Vzhledem k nejednoznačnosti daňové legislativy u podnikajících fyzických osob – účetních jednotek, které zahrnujou Dluhopisy do svého obchodního majetku, bude režim zdanění příjmů souvisejících s dluhopisy ve vlastnictví těchto fyzických osob primárně záviset na záměru fyzické osoby, se kterým takové dluhopisy nabyla. Doporučujeme proto takovým podnikajícím fyzickým osobám – účetním jednotkám probrat se svými právními a daňovými poradci o daňových a účetních důsledcích koupě, prodeje a držení Dluhopisů podle daňových a účetních předpisů platných v České republice. ### 8.3. Právnické osoby Právnická osoba jako vlastník Dluhopisu účtuje obecně v souladu s platnými účetními předpisy o nabíhajícím alikvotním úrokovém výnosu ve prospěch výnosů a na vrub zvýšení účetní hodnoty daného cenného papíru. Nabíhající alikvotní úrokový výnos je tedy jako běžný průběžně zdaňován v rámci obecného základu daně z příjmů právnických osob sazbou daně ve výši 19 %. Zisky z prodeje dluhopisů třetím osobám nebo při odkupu emitentovi realizované právnickou osobou, která je českým daňovým rezidentem, anebo která není českým daňovým rezidentem a zároveň podniká v České republice prostřednictvím stálé provozovny, anebo která není českým daňovým rezidentem a příjem z prodeje dluhopisů ji plyne od kupujícího, který je českým daňovým rezidentem nebo od české stálé provozovny kupujícího, který není českým daňovým rezidentem, se zahrnují do obecného základu daně z příjmů právnických osob a podléhají daní v sazbě 19 % (pro rok 2021). Ztraty z prodeje dluhopisů jsou u této kategorie osob obecně daňově uznatelné. ### 8.4. Čeští daňoví nerezidenti – specifika (a) Obecný princip Obecně, v případě prodeje dluhopisů vlastníkem, který není českým daňovým rezidentem a současně není daňovým rezidentem členského státu Evropské unie nebo Evropského hospodářského prostoru, kupujícím, který je českým daňovým rezidentem, nebo osobě, která není českým daňovým rezidentem a která zároveň podniká v České republice prostřednictvím stálé provozovny nebo v České republice zaměstnává zaměstnance po dobu delší než 183 dnů, je kupující obecně povinen při úhradě kupní ceny dluhopisu srazit zajištění daně z příjmů ve výši 1 % z tohoto příjmu. Správce daně může, avšak nemusí, považovat daňovou povinnost poplatníka (prodávajícího) uskutečněním srážky podle předchozí věty za splněnou. Prodávající je v tom případě obecně povinen podat v České republice daňové přiznání, přičemž sražené zajištění daně se započítává na jeho celkovou daňovou povinnost. Částka zajištění daně se zaokrouhluje na celé Kč nahoru (pro rok 2021). (b) Zpětný odkup – fyzické osoby Nicméně, v případě zpětného prodeje dluhopisů vlastníkem – fyzickou osobou, který není českým daňovým rezidentem, emitentovi (i předčasného odkup), který je českým daňovým rezidentem, nebo emitentovi, která není českým daňovým rezidentem a která zároveň podniká v České republice prostřednictvím stálé provozovny nebo v České republice zaměstnává zaměstnance po dobu delší než 183 dnů, podléhá rozdíl při zpětném odkupu mezi jmenovitou hodnotou dluhopisu a emisním kurzem při jeho vydání a při předčasnému zpětném odkupu Dluhopisu emitentem rozdíl mezi cenou zpětného odkupu a emisním kurzem při jeho vydání zdanění v samostatném základu daně srážkovou daně ve výši 15 %. (c) Smlouvy o zamezení dvojího zdanění Smlouva o zamezení dvojího zdanění mezi Českou republikou a zemí, jejímž je vlastník dluhopisů rezidentem, může zdanění zisků z prodeje dluhopisů v České republice považovaté vyloučit nebo snížit sazbu případné srážkové daně nebo zajištění daně. Nárok na uplatnění daňového režimu upraveného smlouvou o zamezení dvojího zdanění může být podmíněn prokázáním skutečností dokládajících, že příslušná smlouva o zamezení dvojího zdanění se na příjemce platby skutečně vztahuje. 9. PŘEDČASNÁ SPLATNOST DLUHOPISŮ V PŘÍPADECH NEPLNĚNÍ ZÁVAZKŮ 9.1. Případy neplnění závazků Pokud nastane kterákoli z níže uvedených skutečností a taková skutečnost bude trvat (každá z takových skutečností dále také jen „Případ neplnění závazků“): (a) Prodlení s peněžitým plněním jakákoli platba související s Dluhopisy nebude vyplacena v souladu s těmito Emisními podmínkami déle než 10 (deset) Pracovních dnů po dni její splatnosti; nebo (b) Porušení jiných závazků z Emisních podmínek Emitent nesplní nebo nedodrží jakýkoli svůj podstatný závazek (jiný než uvedený výše v odst. (a) tohoto článku 9.1. vyplývající z těchto Emisních podmínek (včetně závazku uvedeného v článku 4 těchto Emisních podmínek) a takové porušení zůstane nenapraveno déle než 60 (šedesát) dnů ode dne, kdy byl Emitent na tuto skutečnost písemně upozorněn kterýmkoli Vlastníkem dluhopisu (který nebyl k takovému datu splacen nebo odkoupen nebo zrušen) dopisem doručeným Emitentovi nebo Administrátorovi do místa Určené provozovny; nebo (c) Neplnění ostatních závazků Emitenta (Cross-Default) jakékoli Závazky Emitenta (i) nebudeho uhrazeny ve splatnosti nebo během jakékoli původně stanovené dodatečné lhůty splatnosti (tzv. grace period) nebo náhradní lhůty dodatečné dohodnuté s věřitelem, popř. nedojde k jiné dohodě s věřitelem o době splatnosti těchto Závazků, nebo (ii) jakýkoli takový Závazek bude prohlášen za splatný před původním datem splatnosti v důsledku existence případu porušení (jak je definován v příslušné smlouvě, jejíž stranou je Emitent). Případ porušení dle tohoto odst. (c) nenastane, pokud úhrnná výše Závazků dle bodu (i) nebo (ii) je v případě Emitenta nižší než =1.000.000,- Kč (slovy: jeden milion korun českých), nebo ekvivalent uvedené částky v jiné měně nebo měnách. Případ porušení uvedený v tomto odst. (c) rovněž nenastane, když Emitent v dobré víře a řádně namítá zákonem předepsaným způsobem neexistenci povinnosti plnit co do její výše nebo důvodu a platbu uskuteční ve lhůtě uložené pravomocným rozhodnutím příslušného soudu nebo jiného orgánu, kterým byl uznán povinným tuto povinnost plnit. „Závazky“ znamenají pro účely tohoto odstavce jakýkoli závazek nebo závazky Emitenta k peněžitému plnění vyplývající z (i) bankovních a jiných úvěrů a půjček a k nim náležejících příslušenství, (ii) všech ostatních forem dluhového financování, (iii) swapových smluv, termínovaných měnových a úrokových obchodů a ostatních derivátů a (iv) jakýchkoli ručení poskytnutých Emitentem; nebo (d) Platební neschopnost, likvidace, insolvence apod. nastane jakákoli níže uvedená událost: (i) Emitent se stane platebně neschopným, zastavi platby svých závazků a/nebo není schopen po delší dobu plnit své splatné závazky, nebo (ii) je jmenován insolvenční správce nebo likvidátor ve vztahu k Emitentovi nebo k jakékoli části jeho majetku, aktiv nebo příjmů, nebo (iii) Emitent na sebe podá insolvenční návrh nebo návrh na moratorium, nebo (iv) bude zjištěn úpadek nebo hrozící úpadek Emitenta jakýmkoliv soudem, nebo (v) insolvenční návrh bude příslušným soudem zamítnut pro nedostatek majetku dlužníka, nebo (vi) příslušným soudem bude vydáno pravomocné rozhodnutí nebo bude přijato platné usnesení o zrušení Emitenta s likvidací, nebo (vii) bude realizováno zástavní nebo jiné obdobné právo třetí osoby, které by omezilo právo Emitenta k jeho současnému nebo budoucímu majetku nebo příjmul, jehož celková hodnota přesahuje v případě Emitenta částku =2.500.000,- Kč (slovy: dva miliony pět set tisíc korun českých), nebo její ekvivalent v jakékoli jiné měně, nebo (viii) bude realizováno exekuční řízení na majetek Emitenta pro vymožení pohledávky, jejíž celková hodnota přesahuje částku =1.000.000,- Kč (slovy: jeden milion korun českých), nebo ekvivalent v jakékoliv jiné měně; nebo (e) Přeměny v důsledku přeměny Emitenta, kde bude Emitent vystupovat jako zúčastněná osoba (zejména sloučení, splnění, převod jmění na společníka, rozdělení či odštěpení), nebo převodu podniku či jeho části přejdou závazky z Dluhopisů na osobu, která výslovně nepřijme (právně platným a vynutitelným způsobem) všechny závazky Emitenta vyplývající z Dluhopisů, s výjimkou případů, kdy (i) takové převzeti závazků Emitenta z Dluhopisů vyplývá ze zákona (přičemž o tomto účinku takového sloučení, splnění, rozdělení nebo převodu podniku či jeho části není rozmunných pochyb); nebo (ii) Schůze předem takovou přeměnu Emitenta nebo převod podniku či jeho části schválí; nebo (f) Zánik povolení Emitent pozbude jakékoli povolení, souhlasy a licence, které jsou nezbytné k vykonávání jeho hlavní podnikatelské činnosti nebo taková povolení, souhlasy či licence přestanou být platné a účinné a Emitent nezajistí nápravu ve lhůtě 60 (šedesát) dnů ode dne, kdy došlo k pozbytí nebo ukončení platnosti a účinnosti takových povolení; nebo (g) Porušení soudních rozhodnutí Emitent je v prodloužení s plněním peněžitého závazku převyšujícího částku =1.000.000,- Kč (slovy: jeden milion korun českých) (nebo ekvivalent uvedené částky v jiné měně nebo měnách), který mu bylo uloženo na základě vykonatelného soudního, rozhodčího nebo správního rozhodnutí či jiného opatření s obdobnými účinky po dobu delší než 30 (třicet) kalendářních dnů; nebo (h) Porušení či zpochybňení Zajištění Emitent jakýmkoli podstatným způsobem poruší jakoukoli svou povinnost vyplývající ze Závastní smlouvy a/nebo zpochybň jakýmkoli způsobem své závazky vyplývající ze Závastní smlouvy nebo je učiní jakýmkoli způsobem neplatnými, neúčinnými či nevmahatelnými. Emitent učiní jakýkoli úkon směřující ke zhoršení právního postavení Vlastníků dluhopisů, pokud takový úkon může jakýmkoli podstatným způsobem zhoršit schopnost Emitenta splnit řádně a včas veškeré své závazky z Dluhopisů. pak: může kterýkoli Vlastník dluhopisů dle své úvahy písemným oznámením určeným Emitentovi a doručeným Administrátorovi na adresu Určené provozovny (dále jen „Oznámení o předčasném splacení“) požádat o předčasné splacení všech Dluhopisů, jejichž je vlastníkem, a to v jejich Jmenovité hodnotě navýšené o narostlý AÚV ke Dni předčasné splatnosti dluhopisů (jak je definován dále), a Emitent je povinen takové Dluhopisy takto splatit v souladu s článekem 9.2 těchto Emisních podmínek. 9.2. Splatnost předčasné splatných Dluhopisů Všechny částky splatné Emitentem kterémukoli Vlastníkovi dluhopisů dle posledního odstavce článku 9.1 těchto Emisních podmínek se stávají splatnými k poslednímu Pracovnímu dni v měsíci následujícím po měsíci, ve kterém Vlastník dluhopisů doručil Administrátorovi do Určené provozovny příslušné oprávněné Oznámení o předčasném splacení určené Emitentovi (takový den, vedle jiných dnů takto označených v těchto Emisních podmínkách, také „Den předčasné splatnosti dluhopisů“). 9.3. Zpětvzetí Oznámení o předčasném splacení Dluhopisů Oznámení o předčasnému splacení může být jednotlivým Vlastníkem dluhopisů vzato zpět, avšak jen ve vztahu k jím vlastněným Dluhopisům a jen pokud takové odvolání je adresováno Emitentovi a doručeno Administrátorovi na adresu Určené provozovny dříve, než se příslušné částky stávají podle předchozího článku 9.2 těchto Emisních podmínek splatnými. Zpětvzetí Oznámení o předčasném splacení však nemá vliv na Oznámení o předčasném splacení ostatních Vlastníků dluhopisů. 9.4. Další podmínky předčasného splacení Dluhopisů Pro předčasné splacení Dluhopisů podle tohoto článku 9 se jinak přiměřeně použijí ustanovení článku 6 těchto Emisních podmínek. 10. PROMLČENÍ Práva z Dluhopisů se promlčují uplynutím 10 (deseti) let ode dne, kdy mohla být poprvé uplatněna. 11. ADMINISTRÁTOR A AGENT PRO VÝPOČTY 11.1. Administrátor 11.1.1. Administrátor a Určená provozovna Administrátorem je CCF a určená provozovna a výplatní místo Administrátora (dále jen „Určená provozovna“) jsou na následující adrese: Jana Babáka 11, Brno, 612 00 11.1.2. Vztah Administrátora a Vlastníků dluhopisů Administrátor jedná v souvislosti s plněním povinností vyplývajících ze Smlouvy s administrátorem jako zástupce Emitenta a jeho právní vztah k Vlastníkům dluhopisů vyplývá pouze ze Smlouvy s administrátorem. 11.2. Agent pro výpočty 11.2.1. Agent pro výpočty Agentem pro výpočty je CCF. 11.2.2. Vztah Agenta pro výpočty a Vlastníků dluhopisů Agent pro výpočty jedná v souvislosti s plněním povinností Agenta pro výpočty jako zástupce Emitenta a není v žádném právním vztahu s Vlastníky dluhopisů. 12. ZMĚNY A VZDÁNÍ SE NÁROKŮ Emitent a Administrátor se mohou bez souhlasu Vlastníků dluhopisů dohodnout na (i) jakékoli změně kteréhokoli ustanovení Smlouvy s administrátorem, pokud jde výlučně o změnu formální, vedlejší nebo technické povahy, je-li provedena k opravě zřejmého omylu nebo je vyžadována platnou právní úpravou a (ii) jakékoli jiné změně a vzdání se nároků z jakéhokoli porušení některého z článků Smlouvy s administrátorem, které podle rozumného názoru Emitenta a Administrátora nezpůsobí Vlastníkům dluhopisů újmu. 13. OZNÁMENÍ Jakékoli oznámení Vlastníkům dluhopisů dle Emisních podmínek bude platné, pokud bude uveřejněno v českém jazyce na webových stránkách Emitenta, v oddělené části, v níž Emitent uveřejňuje informace o jím vydávaných dluhopisech, tedy na adrese [https://www.aidevelop.cz/branka](https://www.aidevelop.cz/branka). Stanoví-li kogentní právní předpisy pro uveřejnění některého z oznámení podle těchto Emisních podmínek jiný způsob, bude takové oznámení považováno za platné uveřejněné jeho uveřejněním předepsaným příslušným právním předpisem. V případě, že bude některé oznámení uveřejňováno více způsoby, bude se za datum takového oznámení považovat datum jeho prvního uveřejnění. Jakékoli oznámení Emitentovi ve smyslu těchto Emisních podmínek bude řádně učiněno, pokud bude doručeno na adresu jeho sídla. 14. SCHÚZE VLASTNÍKŮ DLUHOPISŮ 14.1. Působnost a svolání Schůze 14.1.1. Právo svolat Schůzi Emitent, Vlastník dluhopisu nebo Vlastníci dluhopisů mohou svolat schůzi Vlastníků dluhopisů (Schůze) pouze v případech: (a) stanovených Emisními podmínkami, platnými právními předpisy a v souladu s nimi, (b) kdy Emitent Schůzi nesvolal, přestože měl povinnost tak učinit a (c) kdy je konání Schůze předpokládáno v článku 9. Agent pro zajištění je povinen bez zbytečného odkladu svolat na náklady Emitenta Schůzi v každém z následujících případů: (a) Emitent Schůzi nesvolal, přestože měl povinnost tak učinit podle článku 14.1.2 písm. (a) až (e) a (b) konání Schůze je předpokládáno v článku 3.2.9. Agent pro zajištění je dále oprávněn svolat Schůzi v případech, kdy je konání Schůze předpokládáno v těchto Emisních podmínkách. V případech, kdy je Schůze svolána Agentem pro zajištění, je Emitent povinen poskytnout Agentovi pro zajištění veškerou součinnost. Náklady na organizaci, svolání a konání Schůze hradí svolavatel, ledaže jde o případ, kdy Emitent porušil svou povinnost svolat Schůzi, přičemž v takovém případě hradí náklady na organizaci, svolání a konání Schůze Emitent. Náklady na organizaci, svolání a konání Schůze v případě, kdy je svolána Schůze, jejíž konání je předpokládáno v článku 9.1, hradí Emitent. Náklady spojené s účastí na Schůzi si hradí každý účastník sám. Svolavatel, pokud jím je Agent pro zajištění, Vlastník dluhopisů nebo Vlastníci dluhopisů, je povinen nejpozději v den rozeslání či uveřejnění oznámení o svolání Schůze podle článku 14.1.3. (i) doručit Administrátorovi žádost o obstarání výpisu z evidence Emise (tj. dokladu o počtu všech Dluhopisů opravňujících k účasti na Schůzi) a (ii) uhradit Administrátorovi zálohu na jeho náklady související s přípravou a konáním Schůze (podmínky (i) a (ii) jsou předpokladem pro účinné svolání Schůze). 14.1.2. Schůze svolávaná Emitentem Emitent je povinen neprodleně svolat Schůzi a vyžádat si jejím prostřednictvím stanovisko Vlastníků dluhopisů pouze v případě: (a) návrhu změny Emisních podmínek Dluhopisů, pokud se souhlas Schůze ke změně emisních podmínek podle Zákona o dluhopisech vyžaduje (Změna emisních podmínek) (b) že nastaly důvody, pro které může dojít k ukončení činnosti Agenta pro zajištění podle Smlouvy s agentem pro zajištění (Ukončení činnosti agenta pro zajištění) (c) že nastaly jiné důvody, z kterých je svolání a konání Schůze vyžadováno podle Zákona o dluhopisech včetně § 21 odst. 1 písm. a) tohoto zákona (společně se Změnou emisních podmínek a Ukončením činnosti agenta pro zajištění Změna zásadní povahy) (d) kdy je svolání a konání Schůze předpokládáno v článku 9.1 a k navržení společného postupu, pokud došlo k Případu porušení. Emitent je oprávněn svolat Schůzi k navržení společného postupu, pokud by podle jeho názoru mohlo dojít k Případu porušení. Emitent není povinen svolat Schůzi v jiných případech než ve vyše stanovených. 14.1.3. Oznámení o svolání Schůze Oznámení o svolání Schůze je svolavatel povinen oznámit či uveřejnit způsobem uvedeným v článku 13, a to nejpozději 15 dnů před dnem konání Schůze. Je-li svolavatelem Agent pro zajištění, Vlastník dluhopisů nebo Vlastníci dluhopisů, je povinen ve stejné lhůtě doručit oznámení o svolání Schůze (se všemi zákonnými náležitostmi) určené Emitentovi prostřednictvím Administrátora do Určené provozovny, přičemž Emitent zajistí uveřejnění takového oznámení podle článku 13. Oznámení o svolání Schůze musí obsahovat alespoň (i) obchodní firmu, IČO a sídlo Emitenta (ii) označení Dluhopisů obsahující alespoň název Dluhopisu, Datum emise a ISIN (iii) místo, datum a hodinu konání Schůze, přičemž datum konání Schůze musí připadat na Pracovní den a hodina konání Schůze nesmí být dříve než v 11.00 hod., (iv) program jednání Schůze a, je-li navrhována změna ve smyslu článku 14.1.2, vymezení návrhu změny a její zdůvodnění a (v) Rozhodný den pro účast na schůzi. Schůze je oprávněna rozhodovat pouze o návrzích usnesení uvedených v oznámení o jejím svolání. Záležitosti, které nebyly zařazeny na navrhovaný program jednání Schůze, lze rozhodnout jen za účasti a se souhlasem všech Vlastníků dluhopisů. Odpadne-li důvod pro svolání Schůze, odvolá ji svolavatel stejným způsobem, jakým byla svolána. 14.2. Osoby oprávněné účastnit se Schůze a hlasovat na ní 14.2.1. Osoba oprávněná k účasti na Schůzi Schůze je oprávněn se účastnit a hlasovat na ní pouze (i) Vlastník dluhopisů, který byl evidován jako Vlastník dluhopisů v evidenci Emise vedené Centrálním depozitářem a je uveden ve výpisu z evidence Emise ke konci sedmého dne před datem příslušné Schůze (Rozhodný den pro účast na schůzi), nebo (ii) osoba, která Administrátorovi poskytne potvrzení od správce, na jehož účtu zákazníka v Centrálním depozitáři byl příslušný počet Dluhopisů evidován k Rozhodnému dni pro účast na schůzi, o tom, že k Rozhodnému dni pro účast na schůzi byla Vlastníkem dluhopisů a že Dluhopisy držené touto osobou jsou evidovány na účtu správce z důvodu jejich správy (Osoba oprávněná k účasti na schůzi). Potvrzení podle předchozí věty musí být písemné (s úředně ověřenými podpisy) a v souladu s požadavky Administrátora ohledně obsahu i formy. Pokud je správce právnickou osobou, Administrátor je oprávněn požadovat, aby k tomuto potvrzení byl přiložen originál nebo úředně ověřená kopie výpisu správce z obchodního rejstříku nebo jiného příslušného rejstříku ne starší než tři měsíce před datem příslušné Schůze. K případným převodům Dluhopisů uskutečněným po Rozhodném dni pro účast na schůzi se nepřihlíží. 14.2.2. Hlasovací právo Počet hlasů náležejících Osobě oprávněné k účasti na schůzi odpovídá poměru nespacelené jmenovité hodnoty Dluhopisů, které vlastní k Rozhodnému dni pro účast na schůzi, a celkové nespacelené jmenovité hodnoty Emise k Rozhodnému dni pro účast na schůzi. S Dluhopisy, které byly v majetku Emitenta k Rozhodnému dni pro účast na schůzi a které k tomuto dni nezanikly z rozhradnutí Emitenta ve smyslu článku 6.4, není spojeno hlasovací právo. Rozhoduje-li Schůze o odvolání společného zástupce, nemůže společný zástupce (je-li Osobou oprávněnou k účasti na schůzi) hlasovat. Plná moc udělená Vlastníkem dluhopisů jakémukoli zmocněnci musí být v písemné formě a jeho podpis musí být úředně ověřen. Pokud je Vlastník dluhopisů právnickou osobou, může Administrátor po fyzické osobě, která je oprávněna Vlastníka dluhopisů zastupovat na Schůzi na základě plné moci či jinak, požadovat originál nebo úředně ověřenou kopii výpisu Vlastníka dluhopisů z obchodního rejstříku nebo jiného příslušného rejstříku ne starší než tři měsíce před datem příslušné Schůze. 14.2.3. Účast dalších osob na Schůzi Emitent je povinen účastnit se Schůze, a to buď osobně, nebo prostřednictvím zmocněnce. Dále jsou oprávněni účastnit se Schůze zástupci Administrátora, společný zástupce Vlastníků dluhopisů podle článku 14.3.3 (není-li Osobou oprávněnou k účasti na schůzi) a hosté přizváni Emitentem nebo Administrátorem. V případě, že je Schůze svolaná Agentem pro zajištění, konána z důvodu, který se Agenta pro zajištění týká nebo v jiném případě, kdy je vyžadována jeho přítomnost zákonem nebo témito Emisními podmínkami (včetně článku 3), je Agent pro zajištění povinen se Schůze zúčastnit. 14.3. Průběh Schůze; rozhodování Schůze 14.3.1. Usnášeníschopnost Schůze je usnášeníschopná, pokud se jí účastní Osoby oprávněné k účasti na schůzi, které byly k Rozhodnému dni pro účast na schůzi Vlastníky dluhopisů, jejichž nesplacená jmenovitá hodnota představuje více než 30 % celkové jmenovité hodnoty vydané a dosud nesplacené části Emise. Dluhopisy, které byly v majetku Emitenta k Rozhodnému dni pro účast na schůzi a které k tomuto dni nezanikly z rozhodnutí Emitenta ve smyslu článku 6.4, se pro účely usnášeníschopnosti Schůze nezapočítávají. Rozhoduje-li Schůze o odvolání společného zástupce, nepřihlíží se k jeho hlasům, je-li současně Osobou oprávněnou k účasti na schůzi. Před zahájením Schůze poskytne svolavatel informaci o počtu všech Dluhopisů a Osobách oprávněných k účasti na schůzi v souladu s Emisními podmínkami. 14.3.2. Předseda Schůze Schůzi svolané Emitentem předsedá předseda jmenovaný Emitentem. Schůzi svolané Agentem pro zajištění, Vlastníkem dluhopisů nebo Vlastníky dluhopisů předsedá předseda zvolený prostou většinou hlasů přítomných Osob oprávněných k účasti na schůzi. Do zvolení předsedy předsedá Schůzi osoba určená svolávajícím Agentem pro zajištění, Vlastníkem dluhopisů nebo svolávajícími Vlastníky dluhopisů, přičemž volba předsedy musí být prvním bodem programu Schůze nesvolané Emitentem. 14.3.3. Společný zástupce Schůze může usnesením zvolit fyzickou nebo právnickou osobu za společného zástupce. Společný zástupce je v souladu se Zákonem o dluhopisech oprávněn (i) uplatňovat ve prospěch všech Vlastníků dluhopisů práva spojená s Dluhopisy v rozsahu vymezeném rozhodnutím Schůze, (ii) kontrolovat plnění Emisních podmínek ze strany Emitenta a (iii) činit ve prospěch všech Vlastníků dluhopisů další jednání a chránit jejich zájmy, a to způsobem a v rozsahu podle rozhodnutí Schůze. Společného zástupce může Schůze odvolat stejným způsobem, jakým byl zvolen, nebo jej nahradit jiným společným zástupcem. Případná smlouva o ustanovení společného zástupce bude přistupná způsobem uvedeným v článku 13. 14.3.4. Rozhodování Schůze Schůze o předložených otázkách rozhoduje formou usnesení. K přijetí usnesení, jímž se: (i) schvaluje návrh podle článku 14.1.2 nebo (ii) volí a odvolává společný zástupce, je třeba Kvalifikované většiny. Kvalifikovaná většina znamená tři čtvrtinová většina hlasů přítomných Osob oprávněných k účasti na svolané Schůzi. Pokud nestanoví zákon či tyto Emisní podmínky jinak, stačí k přijetí ostatních usnesení Schůze prostá většina hlasů přítomných Osob oprávněných k účasti na schůzi. 14.3.5. Odročení Schůze Pokud do jedné hodiny od stanoveného začátku Schůze není usnášeníschopná, bude bez dalšího rozpuštěna. Není-li Schůze, která má rozhodovat o změně Emisních podmínek podle článku 14.1.2, usnášeníschopná do jedné hodiny od stanoveného začátku, svolá Emitent nebo jiný svolavatel Schůze, je-li to nadále potřebné, náhradní Schůzi tak, aby se konala do šesti týdnů od původního termínu. Konání náhradní Schůze s nezměněným programem jednání bude Vlastníkům dluhopisů oznamena nejpozději do 15 dnů ode dne původního termínu Schůze. Náhradní Schůze rozhodující o změně Emisních podmínek podle článku 14.1.2 je schopna se usnášet bez ohledu na podmínky pro usnášeníschopnost podle článku 14.3.1. 14.3.6. Konání a usnesení Schůze pomocí technických prostředků komunikace na dálku a korespondenčně Schůze se může též konat na dálku s využitím elektronických prostředků komunikace, zejména s pomocí zařízení umožňujících přenos jednání Schůze zvukem a případně i obrazem. Usnesení schůze lze přijmout i korespondenčně („per rollam“), a to i za použití elektronických prostředků komunikace na dálku. O konání Schůze tímto způsobem rozhodne její svolavatel a své rozhodnutí sdělí v oznámení o svolání Schůze, ve kterém bude zároveň uveden konkrétní způsob konání Schůze, případně konkrétní způsob (hlasování o) přijetí usnesení Schůze. 14.4. Některá další práva Vlastníků dluhopisů 14.4.1. Důsledek hlasování proti některým usnesením Schůze Pokud Schůze (i) souhlasila se Změnou zásadní povahy podle článku 14.1.2, (ii) nebo v rámci svého rozhodování na základě článku 6.2 nerozhodla o předčasném splacení Dluhopisů a zároveň nerozhodla o prodloužení lhůty ke zřízení Zajištění a Zajištění do dne konání Schůze nevzniklo. Osoba oprávněná k účasti na schůzi, která podle zápisu ze Schůze hlasovala proti nebo se příslušné Schůze nezúčastnila (Žadatel), je oprávněna požadovat vyplacení dosud nesplacené jmenovité hodnoty Dluhopisů, jichž byla vlastníkem k Rozhodnému dni pro účast na schůzi, jakož i poměrného úrokového výnosu, pokud Dluhopisy po konání Schůze následně nepřevede. Žadatel musí toto právo uplatnit do 30 dnů od zprístupnění usnesení Schůze podle článku 14.5 písemnou žádostí (Žádost) určenou Emitentovi a doručenou Administrátorovi na adresu Určené provozovny, jinak zaniká. Výše uvedené částky jsou splatné do 30 dnů po doručení Žádosti Administrátorovi (Den předčasné splatnosti dluhopisů). Pokud Schůze nesouhlasila se Změnou zásadní povahy s výjimkou změny Emisních podmínek ve smyslu § 21 odst. 1 písm. a) Zákona o dluhopisech, tj. kdy souhlas Schůze s jejich změnou vyžaduje zákon, může Schůze současně rozhodnout, že pokud bude Emitent postupovat v rozporu s rozhodnutím Schůze, může Vlastník dluhopisů požadovat vyplacení dosud nesplacené jmenovité hodnoty Dluhopisů, jichž byl vlastníkem k Rozhodnému dni pro účast na Schůzi, přičemž Dluhopisy není oprávněn od tohoto okamžiku převést, jakož i poměrného úrokového výnosu k takovým Dluhopisům narostlého v souladu s těmito Emisními podmínkami. Toto právo musí být Žadatelem uplatněno do 30 dnů ode dne zprístupnění takového usnesení Schůze v souladu s článkem 14.5 Žádosti určenou Emitentovi a doručenou Administrátorovi na adresu Určené provozovny, jinak zaniká. Výše uvedené částky jsou splatné v Den předčasné splatnosti dluhopisů, tj. 30 dnů ode dne, kdy byla Žádost doručena Administrátorovi. 14.4.2. Náležitosti Žádosti V Žádosti je nutné uvést počet Dluhopisů, o jejichž předčasné splacení se žádá, a majetkový účet. Žádost musí být písemná, podepsaná osobami oprávněnými jednat jménem Žadatele, přičemž jejich podpisy musejí být úředně ověřeny. Žadatel musí ve stejně lhůtě doručit Administrátorovi na adresu Určené provozovny i veškeré dokumenty požadované pro provedení výplaty podle článku 7. 14.5. Zápis z jednání O jednání Schůze pořizuje svolavatel, sám nebo prostřednictvím jím pověřené osoby, do 30 dnů od konání Schůze zápis obsahující závěry Schůze, zejména přijatá usnesení. Pokud svolavatelem Schůze je Vlastník dluhopisů nebo Vlastníci dluhopisů, musí být zápis nejpozději do 30 dnů od konání Schůze rovněž doručen Emitentovi a Administrátorovi na adresu Určené provozovny. Zápis ze Schůze je Emitent povinen uschovat, dokud neuplyne promlčecí doba pro uplatnění práv z Dluhopisů. Zápis ze Schůze je k nahlédnutí Vlastníkům dluhopisů v běžné pracovní době v Určené provozovně. Emitent je povinen ve lhůtě do 30 dnů od konání Schůze uveřejnit sám nebo prostřednictvím jím pověřené osoby (zejména Administrátora) všechna rozhodnutí Schůze, a to způsobem uvedeným v článku 13. Pokud Schůze projednávala usnesení o Změně zásadní povahy podle článku 14.1.2, musí být o účasti na Schůzi a o rozhodnutích Schůze pořízen notářský zápis s uvedením jmén Osob oprávněných k účasti na schůzi, které hlasovaly pro přijetí usnesení a počtů Dluhopisů, které tyto osoby vlastnily k Rozhodnému dni pro účast na schůzi. 15. RIZIKA 15.1. Rizika spojená s Emitentem 15.1.1. Riziko začínající společnosti Emitent, jakožto právnická osoba, je mladá, začínající společnost, bez historie, a tudíž bez vytvořených rezervních fondů, které by umožnily pokrýt případné ztráty z neúspěšných obchodních transakcí. 15.1.2. Kreditní (úvěrové) riziko Emitent se může v důsledku nepříznivého tržního prostředí, chybného rozhodnutí svého managementu nebo jiných vnějších či vnitřních faktorů stát neschopným plnit své splatné dluhy včetně těch z vydaných Dluhopisů. Emitent aplikuje řídící a kontrolní mechanismy zaměřené na snižování tohoto rizika včetně nastavení systému řízení rizik podstupovaných Emitentem, plánování krátkodobé a dlouhodobé likvidity. 15.1.3. Riziko přijetí dalšího dluhového financování Přijetí dalšího dluhového financování Emitentem může znamenat, že v případě jeho úpadku budou dluhy z Dluhopisů v insolvenčním řízení uspokojeny v menší míře, než kdyby k přijetí dalšího dluhového financování nedošlo. 15.1.4. Riziko nepříznivého stavu realitního trhu Emitent působí jako realitní developer i investor v oblasti residenčních nemovitostí a je vystaven specifickým rizikům realitního trhu, jakými jsou zejména cyklicnost, výkyvy v makroekonomickém prostředí, dynamika poptávky kupujících nebo nájemců v jednotlivých segmentech realitního trhu, pohyby cen nájemného, či aktivitou konkurenčních developerů. Během období zpomalení nebo recese nebo s ohledem na případné dopady pandemie COVID-19 může dojít ke snížení poptávky v oblasti realitního trhu, který může způsobit pokles poptávky nájemců nebo investorů kupujících hotové nemovitosti. Toto snížení poptávky může mít nepříznivý vliv na ceny nájemného či výnosy z prodaných projektů a tím se negativně projevit na hospodářských výsledcích emitenta. 15.1.5. Riziko spojené se změnou obchodní strategie Emitent o změnách v obchodní strategii rozhoduje vždy s nejlepšími úmysly a při důkladném zvážení všech dostupných informací. Přesto Emitent nemůže rizika spojená s rozšiřováním svých obchodních aktivit a změnami v obchodní strategii vyloučit. 15.1.6. Riziko konkurence Existuje riziko, že obchodní protistrany Emitenta začnou z různých důvodů preferovat jiné obchodní partnery a Emitentovi se nepodaří umístit všechny prostředky z Dluhopisů. 15.1.7. Riziko změny ve vedení a riziko ztráty klíčových osob Podnikání Emitenta vyžaduje vysokou úroveň odborných znalostí a zkušeností jeho zaměstnanců a členů jeho orgánů. Pro Emitenta je proto klíčové udržet si osoby, které splňují tuto úroveň nároků. Odchod takových zaměstnanců a nemožnost je adekvátně nahradit mohou mít podstatný nepříznivý vliv na schopnost Emitenta udržet si a zvyšovat současnou pozici na trhu s přímým vlivem na hospodářské výsledky Emitenta. 15.2. Rizika spojená s Dluhopisy 15.2.1. Dluhopisy jako závazky Dluhopisy představují přímé, nepodmíněné a nepodřízené dluhy Emitenta, které jsou a budou co do pořadí svého uspokojení (i) rovnocenné (pari passu) mezi sebou navzájem a (ii) alespoň rovnocenně vůči všem dalším současným i budoucím nezajištěným dluhům Emitenta vyjma těch, u nichž stanoví jinak donucující ustanovení právního předpisu. Splacení Dluhopisů je sice zajištěno zástavním právem k Emitentem pořízeným nemovitostem ve prospěch osoby, která je v postavení společného věřitele s vlastníky dluhopisů (Agentem pro zajištění, jak je definován v těchto emisních podmínkách), nicméně statut Agentu pro zajištění je pouze na smluvní, nikoli institucionální bázi. Dále existuje riziko, že i v případě bezproblémové realizace zástavního práva, a i přes vynaloženou odbornou péči Agenta pro zajištění nemusí realizované zástavy pokrýt veškeré nároky vlastníků z Dluhopisů. 15.2.2. Riziko úrokové Vlastník Dluhopisu je vystaven riziku poklesu ceny Dluhopisu v důsledku změn tržních úrokových sazeb. Zatímco je nominální výnos Dluhopisu za dobu od data emise do data konečné splatnosti pevný, aktuální tržní úroková sazba se na kapitálovém trhu zpravidla denně mění. Se změnou tržní úrokové sazby se mění také cena Dluhopisu, ale v opačném směru. Jestliže se tržní úroková sazba zvýší, cena Dluhopisu zpravidla klesne na úroveň, kdy je jeho výnos přibližně roven tržní úrokové sazbě. Pokud se tržní úroková sazba sníží, cena Dluhopisu se zpravidla zvýší na úroveň, kdy je jeho výnos přibližně roven tržní úrokové sazbě. Tato skutečnost může mít negativní vliv na hodnotu a vývoj investice do Dluhopisů. 15.2.3. Riziko inflace Dluhopisy neobsahují inflační doložku. Vlastník Dluhopisu je vystaven riziku, že výnos z Dluhopisu očištěný o míru inflace bude nižší než očekávaný v případě, že míra inflace za dobu držení Dluhopisu investorem bude vyšší než investorem předpokládaná. Přesáhne-li míra inflace nominální výnos Dluhopisu, reálný výnos investorů z investice do Dluhopisu bude záporný. 15.2.4. Riziko likvidity Emittent nemá v úmyslu k Datu emise, jak je tento pojem v Emisních podmínkách definován, ani kdykoliv později požádat o přijetí Dluhopisů k obchodování na jakémkoliv regulovaném trhu nebo v mnohostranném obchodním systému. Nemůže proto existovat ujištění, že se vytvoří sekundární trh s Dluhopisy, nebo pokud se vytvoří, že takový sekundární trh bude trvat či bude likvidní. Může být proto obtížné ocenit Dluhopisy, což může mít také negativní dopad na jejich likviditu. Investor nemusí být schopen až do jejich splatnosti Dluhopisy prodat za adekvátní tržní cenu. Emittent, ani žádná jiná osoba nezajišťují likviditu Dluhopisů. Emittent je oprávněn, nikoliv však povinen, odkoupit Dluhopisy přede dnem jejich konečné splatnosti za jakoukoliv cenu dle své úvahy dle článku 6.3. Emisních podmínek. 15.2.5. Riziko předčasného splacení Emittent je oprávněn předčasně splatit všechny dosud nesplacené Dluhopisy v případech a za podmínek stanovených v článku 6.2. Emisních podmínek. Vlastníci dluhopisů jsou oprávněni žádat předčasné splacení Dluhopisů v případech a za podmínek uvedených v článcích 9 a 14.4. Emisních podmínek. V případě předčasného splacení Vlastník dluhopisu neobdrží výnos za dobu mezi dnem předčasného splacení Dluhopisu a dnem jeho původní (konečné) splatnosti. Vlastník Dluhopisu je tak vystaven riziku nižšího než předpokládaného výnosu v případě předčasného splacení Dluhopisu. 15.2.6. Riziko zdanění Příjmy plynucí z prodeje, splacení nebo držby Dluhopisu mohou podléhat zdanění, jehož parametry se mohou v čase měnit. V důsledku tohoto může být investorovi při prodeji nebo splacení Dluhopisu vyplacena nižší částka, než původně předpokládal. Investor může být rovněž povinen v souvislosti s nabytím, držbou a prodejem či splacením Dluhopisu sám daň přiznat a odvést. Výnos z Dluhopisu po zdanění tak může být nižší než investorem původně očekávaný. Bližší informace o zdaňování výnosů z dluhopisů jsou uvedeny v článku 8 Emisních podmínek. Uvedené informace však nelze považovat za vyčerpávající a vždy platné. Investorům se proto doporučuje konzultovat daňové aspekty investice do Dluhopisů s daňovými a jinými poradci. 16. ROZHODNÉ PRAVO, JAZYK, SPORY Dluhopisy jsou vydávány na základě platných a účinných právních předpisů České republiky, zejména na základě Zákona o dluhopisech. Práva a povinnosti vyplynující z Dluhopisů se budou řídit a vykládat v souladu s právem České republiky. Tyto Emisní podmínky mohou být přeloženy do angličtiny, případně i do dalších jazyků. V takovém případě, pokud dojde k rozporu mezi různými jazykovými verzemi, bude rozhodující verze česká. Jakékoli případné spory mezi Emisní podmínky dluhopisů vyplývající z Dluhopisů, těchto Emisních podmínek a kteréhokoli Doplňku dluhopisového programu nebo s nimi související budou řešeny Krajským soudem v Brně. V Brně 24. března 2021 Bytové družstvo Rezidence Branka JITKA ŠEVČÍKOVÁ, předseda družstva	6151a2be-bce1-474d-aa2a-472cd5e42c7c	HuggingFaceFW/finepdfs/tree/main/data/ces_Latn/train	finepdfs	ces_Latn	88,179
December 19, 2003 To: Commercial Paving From: Anthony P. Giunta, P.G. Director, Waste Management Division Department of Environmental Services Subject: Certified Waste-Derived Product No. 17, “AGGRAPHALT” Pursuant to Env-Wm 3207.05 and Env-Wm 3208 of the New Hampshire Solid Waste Rules (Rules), the Department of Environmental Services, Waste Management Division (Department) has added “AGGRAPHALT” (product) made with asphalt roofing shingles (waste) to the Department’s list of certified waste derived products. Use of the waste must adhere to Part Env-Wm 3202.04 of the Rules which are designed to protect public health and the environment. Before using the waste to produce the product, be sure to note any specifications or restrictions that have been placed on the use, storage, handling, and production of the waste and/or product. Waste and product specifications and restrictions are attached. Product shall only be produced by Commercial Recycling Systems of Portland, Maine. This certification granted by the Department shall not affect the user’s obligation to obtain all requisite federal, state, or local permits, licenses or approvals, and to comply with all other applicable federal, state, district or local permits, ordinances, laws or approvals or conditions pertaining to the use of the product. For permitting information and questions, please call the Department’s Permitting and Design Review Section at (603) 271-2925 for assistance. cc: PDRS CWDP File Certified Waste-Derived Product No. 17 “Aggraphalt” Specifications and Restrictions A. Definitions 1. “Surface Course” means one or more layers of a specified material of designed thickness, to accommodate the traffic load, placed on base courses. The top layer is sometimes called the “wearing course”. 2. “Base Course” means the layer or layers of specified or selected material placed on a subbase or subgrade to support pavement or other structure. 3. “Subbase” means the layer or layers of specified or selected material placed on a subgrade to support a base course. 4. “Subgrade” means the top soil surface upon which a subbase or base courses are placed. B. Asphalt Shingle Acceptance Limitations The following acceptance limitations are currently in existence for the product: 1. No commercial asphalt roofing; 2. No asphalt siding shingles; 3. No asbestos fibers; and 4. No hazardous waste, hazardous substances, toxic substances, or toxic pollutants as those terms are used in the Resource Conservation and Recovery Act, the Comprehensive Environmental Response, Comprehensive and Liability Act, the Hazardous Materials Transportation Act, the Toxic Substance Control Act, the Clean Air Act and the Clean Water Act. C. Specifications Product is manufactured from crushed and screened demolition aggregate-based materials. This crusher processed and sized material may include brick, concrete, asphalt pavement, stone tailings, ledge and similar aggregate-based demolition materials. Ground asphalt roofing shingles are added to the product in varying proportions to meet the varying compaction requirements of the crushed materials. The uses of product are as described below. The following specifications shall be met for the product: 1. Maximum roofing shingle content: 40% (by weight) 2. Fines: maximum passing No. 100 sieve: 15% (by weight) maximum passing No. 200 sieve: 7% (by weight) 3. Maximum deleterious matter (i.e., organics, paper, metal, etc.): 1% (by weight) 4. Maximum Screening Concentrations (mg/kg): \| PAHs \| Screening Concentrations (mg/kg) \| \|---------------\|----------------------------------\| \| Benzo(a)pyrene\| 35.7 \| \| Metals \| Screening Concentrations (mg/kg) \| \|----------------\|----------------------------------\| \| Arsenic \| 11 \| \| Barium \| 750 \| \| Cadmium \| 32 \| \| Chromium VI \| 130 \| \| Lead \| 400 \| \| Mercury \| 13 \| \| Selenium \| 260 \| \| Silver \| 45 \| Notes: 1. Product health based screening concentration calculated by the New Hampshire Department of Health and Human Services. 2. Equivalent to Risk Characterization and Management Policy (RCMP) S-1 standards for protecting groundwater. D. Permissible Uses 1. Base course and subbase aggregate for the construction of a portland cement concrete or asphaltic concrete paved lot; 2. Base course and subbase aggregate for the construction of a paved federal, state, or municipal roadway; 3. Unbonded surface course, including the use as a surface course for municipal roads, non-residential driveways, non-residential parking areas, and recreation or exercise trails; and 4. Roadway shoulder aggregate. E. Non-Permissible Uses 1. Surface course for residential driveways; 2. Surface course for residential parking lots; and 3. Playgrounds. F. Storage and Transportation 1. Stockpile is to be actively managed and shall comply with the universal facility requirements of Env-Wm 2700 of the Rules. 2. Vehicles or containers used to transport product shall be loaded and hauled in such a manner that the contents do not fall, spill or leak. Covers shall be provided to prevent littering and spillage as necessary. 3. Upon the delivery of each load of the product, a “Recommended Use Guidelines” form, contained in Exhibit A, must be signed by an authorized representative of the user. A copy of the form must be maintained at the offices of Commercial Recycling Systems. F. Quality Assurance/Quality Control Procedures 1. One representative composite sample shall be collected from the product for every 10,000 tons of shingles processed and tested at a certified lab for the following: a. Metals per EPA Method 6010 and 7471 (mercury). b. Poly Aromatic Hydrocarbons (PAHs) per EPA Method 8270. 2. One representative composite sample shall be collected from the product for every 25 tons of shingles processed and tested at a certified lab for the presence of asbestos fibers, using Polarized Light Microscopy (PLM) testing methods. 3. All testing must be completed and the results received by the facility prior to releasing the product for distribution. G. Third Party Inspections 1. A qualified and experienced third party licensed asbestos inspector retained by the facility shall inspect the facility twice during the asphalt-manufacturing season (approximately April through December). The first inspection should occur approximately in the midpoint of the season and the second inspection should occur prior to the close of the season. 2. During the inspection, the inspector shall: 2. During the inspection, the inspector shall: a. Evaluate acceptance and sampling programs, including any approved modifications, as required by this determination. Identify any deviations from compliance conditions set forth in this determination. b. Identify any modifications in the facility’s process that are not identified in the application. Identify changes that may modify the physical or chemical nature of the processed shingles, or that may present a situation of nuisance or a threat of adverse impacts from the use of this material. c. Sample both a randomly selected truckload of material and a randomly selected stockpile of processed material for the presence of asbestos. The sample shall be analyzed using PLM testing methods. d. Following the inspection, the inspector shall file a report of the findings with the permitted facility. Said report shall be maintained in a file at the facility and any recommendations made by the inspection shall be promptly implemented. H. Reporting 1. Commercial Recycling Systems shall be required to submit an annual report to the Department by March 31 of the year following the calendar year being reported, containing the minimum information and in the format of the sample annual report contained in Exhibit B. 2. Commercial Recycling Systems shall be required to submit Third Party Inspection Reports to the Department within two (2) weeks of receipt. EXHIBIT A RECOMMENDED USE GUIDELINES AGGRAPHALT™ MANUFACTURED BY COMMERCIAL RECYCLING SYSTEMS (CRS) FOR DISTRIBUTION AND USE IN THE STATE OF NEW HAMPSHIRE AS A CERTIFIED WASTE DERIVED PRODUCT Product Description AGGRAPHALT™ is an environmental and beneficial recycled product manufactured from miscellaneous crushed and screened demolition aggregate-based materials. In addition asphaltic materials may be added to develop specific gradations for road maintenance and construction materials. The addition of asphaltic materials enhances the superior compaction traits resulting in the prevention of soil erosion and dust. AGGRAPHALT™ may be used as a substitute for virgin crushed aggregates in a wide range of construction products. Usage AGGRAPHALT™ makes an excellent road surface for non-paved rural roads. AGGRAPHALT™ is also used in roadways and parking lot construction, including bridge approach ramps, embankment, shoulder, sub-base, base, and roadbed materials. Applications and Restrictions AGGRAPHALT™ can be applied at up to a 2-to-1 slope. Developed and marketed by CRS as a safe and environmentally beneficial construction material, AGGRAPHALT™ should consistently be utilized in a manner that meets or favorably exceeds all applicable local, state, or federal regulatory guidelines or construction codes. The use of AGGRAPHALT™ in residential driveway surface course, residential parking lot surface course, and playground construction is prohibited in the State of New Hampshire. I understand and accept Commercial Recycling Systems' recommended use guidelines and use restrictions for this product. Date: ____________ Customer (Company/Municipality): ________________________________ Name (Please Print): _______________ Signature: _______________________________ Intended Use: _____________________________________________________________ EXHIBIT B February 1, 2005 New Hampshire Department of Environmental Services Waste Management Division 29 Hazen Drive, P.O. Box 95 Concord, NH 03302-0095 Attn: Richard S. Reed, Administrator Solid Waste Management Bureau RE: AGGRAPHALT™ Waste Derived Product Annual Report Submittal for 2004 Dear Mr. Reed: Commercial Recycling Systems (CRS) is pleased to submit our AGGRAPHALT™ Annual Report for 2004, as required by the New Hampshire Department of Environmental Services, Waste Management Division for Certification of this Waste Derived Product. Annual Report for AGGRAPHALT™ Incoming Roofing Shingle Wastes As shown on Table 1, a total of __________ tons of roofing shingles was received from the State of New Hampshire generators from January 1, 2004 through December 31, 2004. Product Distribution As shown on Table 2, a total of __________ tons of AGGRAPHALT™ was distributed in the State of New Hampshire from January 1, 2004 through December 31, 2004. Chemical and Physical Testing Table 3 summarizes the results of required chemical testing of AGGRAPHALT™ distributed in New Hampshire from January 1, 2004 through December 31, 2004. I certify that there were no exceedances of the maximum roofing shingle content (40% by weight), percent fines passing the #100 sieve (15% by weight), percent fines passing the #200 sieve (7% by weight), maximum deleterious matter (1% by weight), or maximum screening concentrations for eight (8) metals or benzo(a)pyrene in the ______ tons of AGGRAPHALT™ processed for distribution in the State of New Hampshire in 2004. Table 4 contains asbestos tests preformed for every 25 tons of AGGRAPHALT™ distributed in New Hampshire from January 1, 2004 through December 31, 2004. I certify that there were no asbestos fibers detected in the ______ tons of AGGRAPHALT™ processed for distribution in the State of New Hampshire in 2004. If you have any questions regarding any of the information provided, please call me at (207) 883-3325. Sincerely, Compliance Manager Attachments Cc: D. Gleason J. Adelman Table 1 New Hampshire Unprocessed Roofing Shingle Wastes Received January 1 through December 31, 2004 \| New Hampshire Shingles Received \| Tons \| \|-------------------------------\|------\| \| January \| \| \| February \| \| \| March \| \| \| April \| \| \| May \| \| \| June \| \| \| July \| \| \| August \| \| \| September \| \| \| October \| \| \| November \| \| \| December \| \| \| TOTAL \| \| Table 2 AGGRAPHALT™ New Hampshire Distribution Sites January 1 through December 31, 2004 \| Customer Name / Address \| Distribution Site \| Use \| Tons \| \|-------------------------\|-------------------\|-----\|------\| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \| Note: Copies of signed “Recommended Use Guidelines” forms for all users of AGGRAPHALT™ are available for review at the offices of Commercial Recycling Systems. ### TABLE 3 AGGRAPHALT™ New Hampshire Chemical and Physical Testing Results¹ January 1 through December 31, 2004 \| Parameter \| Insert Date (10,000 tons) \| Insert Date (20,000 tons) \| Insert Date (30,000 tons) \| \|----------------------------\|---------------------------\|---------------------------\|---------------------------\| \| Metals \| \| \| \| \| Arsenic \| \| \| \| \| Barium \| \| \| \| \| Cadmium \| \| \| \| \| Chromium VI \| \| \| \| \| Lead \| \| \| \| \| Mercury \| \| \| \| \| Selenium \| \| \| \| \| Silver \| \| \| \| \| Polynuclear Aromatic Hydrocarbons \| \| \| \| \| Benzo(a)pyrene \| \| \| \| \| Gradation (% by weight) \| \| \| \| \| Maximum roofing shingle content \| \| \| \| \| Maximum passing #100 sieve \| \| \| \| \| Maximum passing #200 sieve \| \| \| \| \| Deleterious Matter (% by weight) \| \| \| \| \| Percent \| \| \| \| ¹ Testing conducted for every 10,000 tons of shingles processed. ### TABLE 4 AGGRAPHALT™ New Hampshire Asbestos Testing Results¹ January 1 through December 31, 2004 \| Date \| Detected (pass or fail) \| \|------\|-------------------------\| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \| ¹ Testing conducted on every 25 tons of product processed. I. PRODUCT / PRODUCT NAME: Certified Waste-Derived Product No. 17, “Aggraphalt” II. WASTE TYPE: Asphalt shingle aggregate III. TRADE NAME: “Aggraphalt” &/OR PROPRIETORS NAME: Commercial Paving Co., Inc. IV. AUTHORIZED USE: Refer to specifications. V. SPECIFICATIONS AND/OR RESTRICTIONS: ✓ Specifications and Restrictions are attached VI. APPLICATION LOG NUMBER: WMD Log # 200200169 APPLICANT: Commercial Paving Co., Inc. VII. DATE APPROVED: December 19, 2003 VIII. COMMENTS: IX. REVIEWED BY: WW Note: This form is filled out when a waste derived product becomes certified, it is a record of that particular certification, and also provides the necessary input data for the database on Waste Derived Products Certified for Distribution and Use.	<urn:uuid:bad580a8-8c53-4770-bb97-1e61b7bf828e>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	17,262
Please return form by 9/28/21 Business Name: Address: Contact: Phone: Email: Please make all checks payable to VETS Charitable Corp. Please circle your choice of sponsorship: Please return payment and form to: 1st place sponsorship 200.00 $ VETS Eagle Sponsorship 200.00 $ PO Box 201 Birdie Sponsorship 100.00 $ Lawrenceburg KY 40342 Event Sponsorship __________ For more information, please contact: Or payable via Venmo @VetsCharitableCorp Jim (502) 330 - 4925 Please email form to email@example.com Pam (502) 680 - 1268	<urn:uuid:6916823e-74f2-43d9-84c8-1f72bdcf48e6>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	546
Prefeitura de Santos – SP Auxiliar de Veterinário Língua Portuguesa Conhecimento de EPI ́s utilizados nos ambientes citados	<urn:uuid:e1603890-f252-4359-95cb-66515910ac35>	HuggingFaceFW/finepdfs/tree/main/data/por_Latn/train	finepdfs	por_Latn	126
Plan Senja iz 1785. god. (snimka iz 1894. god. preuzeta od M. Vili~i}, Arhitektonski spomenici Senja, »Rad JAZU«, knj. 360, Zagreb, 1971, str. 65–129) Map of Senj from 1785 (photo from 1894 provided by M. Vili~i}, Architectural monuments of Senj, »Rad JAZU«, book 360, Zagreb 1971, pp. 65–129) Damir Demonja Institut za povijest umjetnosti, Zagreb Prilog interpretaciji crkve Sv. Franje u Senju Izvorni znanstveni rad – Original scientific paper predano 4. 9. 1998. Sa'etak Crkva Sv. Franje u Senju, sru{ena u Drugom svjetskom ratu, uvr{tava se u niz od oko ~etrdesetak crkava na hrvatskoj jadranskoj obali koje su gra\|ene u razdoblju od sredine 13. stolje}a do svr{etka 16. stolje}a. Svojom arhitekturom ova je franjeva~ka crkva prostorno bila oblikovana u duhu tradicije franjeva~kih crkava, izbjegavaju}i dekorativnost, tek s plasti~ki rije{enim portalom u renesansnom duhu. Franjeva~ke crkve gra\|ene na spomenutom prostoru i vremenu pokazuju jednom usvojenu i njegovanu tipologiju franjeva~ke sakralne arhitekture kojoj je osnovno obilje'je da la\|a svojom {irinom funkcionalno prelazi u duga~ko i {iroko sveti{te, {to odgovara duhu Franjeva~kog reda kome je te'nja {to ve}a povezanost s vjernicima, te izbjegavanje svake ve}e dekorativnosti. Premda je franjeva~ka crkva u Senju obra\|ivana u stru~noj literaturi, nitko nije cjelovitije i detaljnije razradio i protuma~io njene tlocrtne dispozicje. Stoga se u ovom tekstu na temelju arhitektonskih nacrta, grafi~kih priloga i sa~uvanih fotografija rekonstruira izvorna tlocrtna dispozicija crkve Sv. Franje u Senju, objedinjuje se i kriti~ki raspravlja njena zastupljenost u dostupnoj stru~noj literaturi i dokumentima, kao i povijest njezine izgradnje. U samom sredi{tu grada Senja nalazila se crkva Sv. Franje od koje sada postoji samo zvonik. Crkva je sru{ena u Drugom svjetskom ratu tijekom njema~kog bombardiranja Senja 1943. godine. Njezina vrijednost bila je vi{estruka. Franjeva~ka crkva sa samostanom ~inila je kompleks i zna~ila mjesto i prostor zelenila i ~istog zraka u gradskom sklopu, ne mijenjaju}i bitno svojim smje{tajem karakter trgova i ulica protezanja koji su rezultat stoljetnih tokova razvoja gradske jezgre. Crkva Sv. Franje u Senju bila je tijekom 16. i po~etkom 17. stolje}a mauzolej senjskih uskoka i uglednih gra\|ana, i u tome je njezina povijesna i kulturolo{ka vrijednost. Tada je cijela glavna la\|a crkve bila poplo~ana nadgrobnim plo~ama usko~kih junaka i vojvoda, te uglednih senjskih patricija. Svojom arhitekturom senjska franjeva~ka crkva prostorno je bila oblikovana u duhu tradicije franjeva~kih crkava, izbjegavaju}i dekorativnost, tek s plasti~ki rije{enim portalom u renesansnom duhu. Ova se franjeva~ka crkva mo'e uvrstiti u niz od oko ~etrdesetak crkava na hrvatskoj jadranskoj obali koje su gra\|ene u vremenskom rasponu od sredine 13. stolje}a do svr{etka 16. stolje}a. One pokazuju jednom usvojenu i njegovanu tipologiju franjeva~ke sakralne arhitekture kojoj je osnovno obilje'je da la\|a svojom {irinom funkcionalno prelazi u duga~ko i {iroko sveti{te, {to odgovara duhu franjeva~kog reda kome je te'nja {to ve}a povezanost s vjernicima, te izbjegavanje svake ve}e dekorativnosti. Premda je crkva Sv. Franje u Senju obra\|ivana u stru~noj literaturi, 1 nitko nije cjelovitije i detaljnije razradio i protuma~io njezine tlocrtne dispozicije. Stoga mi se ~inilo potrebnim da na temelju arhitektonskih nacrta, grafi~kih priloga i sa~uvanih fotografija poku{am rekonstruirati izvornu tlocrtnu dispoziciju senjske franjeva~ke crkve, te da njezinu zastupljenost u dostupnoj stru~noj literaturi i dokumentima, kao i povijest njezine izgradnje objedinim i kriti~ki raspravim na jednome mjestu u cjelovitom prikazu i time dam prilog korpusu franjeva~kih crkava na hrvatskoj obali nastalih do svr{etka 16. stolje}a. Kriti~ki osvrt na literaturu o crkvi Sv. Franje u Senju zapo~injem s njezinim najranijim opisom koji donosi I. Kukuljevi}-Sakcinski, 2 a njemu je sli~an opis M. Magdi}a koji se razlikuje tek u pojedinostima. 3 To su jezgrovite, vrlo op}enite deskripcije crkve kojima je namjera bila da u osnovnim crtama upoznaju ~itatelje s gra\|evinom. No one donose i neke detalje koji su bitni za cjelovito zahva}anje arhitekture crkve, poglavito njezine unutra{njosti (o tome }e biti rije~i u nastavku teksta). Godine 1894. crkvu Sv. Franje arhitektonski je snimio ing. V. Hora~ek, koji je tada upravljao i vodio preure\|enje vodovoda u Senju, te su publicirani tlocrt, uzdu'ni i popre~ni presjeci, glavno pro~elje kao i opis i osnovne mjere. 4 Vrijednost tih tekstova upravo je u tome {to donose arhitektonske priloge, te to~ne mjere crkve kao i sa'et, ali stru~an opis zate~enog arhitektonskog stanja crkve. To su i jedini nacrti s to~nim mjerama koji su dospjeli do dana{njih dana i kao takvi, s obzirom da crkva vi{e ne postoji, vrijedan dokument o samoj gra\|evini. Najop{irniji opis crkve Sv. Franje u Senju, do tada, dao je senjski kanonik i profesor bogoslovije J. Fran~i{kovi} prikazav{i njeno tada{nje stanje. Premda je uo~io i naknadne intervencije, nije se kriti~kije pozabavio njima, niti ih je poku{ao razlu~iti, pa je njegov rad ostao na razini faktografskog bilje'enja, no zbog okolnosti da crkve vi{e nema, koristan je pri bavljenju njome. 5 D. Hirc 6 se u deskripcijama mjesta hrvatskog Primorja osvrnuo i na franjeva~ku crkvu u Senju i njezinu povijest, a autori poput P. Tijana, 7 A. Glavi~i}a 8 i B. Ljubovi} – E. Ljubovi}a 9 u svojim pregledima senjskih znamenitosti obra\|ivali su crkvu Sv. Franje, no tek u osnovnim crtama donose}i osnovne povijesne podatke i jezgrovite deskripcije. Gj. Szabo 10 je jednu knjigu u cijelosti posvetio Senju, a posebno poglavlje crkvi franjevaca, no njegov je tekst samo uobi~ajena povijest i opis crkve uz citiranje tek nekoliko ranijih autora i bez kriti~kih opaski. Najcjelovitije prikaze povijesti i deskripcije crkve Sv. Franje u Senju, kao i problema uz nju vezanih, sa iscrpnim znanstvenim aparatom, dalo je dvoje istra'iva~a: J. Frkovi} i M. Vili~i}. J. Frkovi} 11 je stru~no i detaljno obradio senjsku sakralnu arhitekturu, a posebno je poglavlje posvetio crkvi i samostanu Sv. Franje unutar gradskih zidina Senja. Raspravljaju}i o toj temi, podijelio ju je u nekoliko cjelina koje su obra\|ivale nastanak i povijest crkve i samostana, zastupljenost u stru~noj literaturi, a posebnu je pozornost posvetio grobovima senjskih uskoka u crkvi poradi kojih je senjska franjeva~ka crkva i bila zanimljiva ve}ini autora. Njegov rad je sa~uvan tek u rukopisu, te tako nedostupan {iroj stru~noj javnosti. Brojno{}u dokumenata, posebice grafi~kih prikaza i karata iz be~kih biblioteka i arhiva, arhitektonskih priloga i fotografija, te najcjelovitijim, do sada, zahva}anjem arhitekture franjeva~ke crkve i u urbanisti~kom i kulturolo{kom, a ne samo arhitektonskom smislu, svojim je radovima podastrijela M. Vili~i}, 12 dav{i tako vrijedne priloge poznavanju te problematike. Povijest franjevaca u Senju i u senjskoj biskupiji obra\|ivali su M. Boloni} 13 i M. Bogovi}. 14 Istra'uju}i pojavu i razloge, te posljedice dolaska i pribivanja franjevaca u Senju i senjskoj biskupiji, oba su se autora osvrtali na nastanak franje- Church of St. Francis in Senj, exterior and details (Photo: Town Museum, Senj) va~kog samostana i crkve, podastrijev{i niz korisnih i dokumentima potkrijepljenih podataka. I naposljetku, posljednji, vrijedan prilog prou~avanju senjske franjeva~ke crkve dala je B. Ljubovi} 15 koja je sakupila, popisala i stru~no obradila sav dostupan inventar crkve, te je njezin doprinos va'an za cjelovitije sagledavanje i prou~avanje crkve Sv. Franje u Senju. * * * Franjevci se u Senju prvi puta spominju 1272. godine, o ~emu svjedo~i darovnica datirana 13. o'ujka 1272. godine u kojoj se prvi puta spominje franjeva~ka crkva u Senju. 16 Pojedini autori, primjerice J. Fran~i{kovi} 17 ili, pak, M. Vili~i} 18 misle da se ta prva, starija crkva Sv. Franje u Senju, vjerojatno skromnih proporcija, nalazila na mjestu na kojem je u 16. stolje}u sagra\|ena nova crkva Sv. Franje sa samostanom. Ovu pretpostavku detaljnije }u raspraviti u nastavku teksta. M. Boloni} 19 pi{e da o tome postoji i potvrda u dokumentu koji se nalazi u Biskupskom arhivu u Senju u kojem pi{e da su 1272. godine franjevcima u Senju darovana dva vrta. Dakle, uzimaju}i u obzir darovnicu i spomenuti dokument, mo'e se zaklju~iti da su ve} 1272. godine franjevci svakako pribivali na senjskom podru~ju, premda se ne isklju~uje da su ve} otprije bili u Senju. Jo{ nekoliko darovnica spominje franjevce u Senju. Tako darovnicom od 18. travnja 1292. Kr~anin Mihovil de Vezanello daruje franjevcima jednu svoju ku}u u Senju; 20 13. listopada 1293. Zadranin Petar Barte poklanja franjevcima svoju ku}u u Senju, 21 a darovnicom od 10. studenog 1295. knez Stjepan Ugrin, sporazumno s knezovima Leonardom Frankopanom i njegovim sinovcem Bartolom, daje franjeva~kom samostanu svoj vrt u Senju. 22 Osim ove franjeva~ke crkve i samostana koji su se nalazili unutar gradskih zidina, postojala je druga franjeva~ka crkva sa samostanom koja se nalazila izvan gradskih zidina, u pravcu Senjske Drage, najvjerojatnije na podru~ju Sv. Petra. Potvrda o toj franjeva~koj crkvi i samostanu izvan gradskih zidina nalazi se kod Farlatija, 23 koji navodi da je samostan sa crkvom bio izvan grada, odnosno »suburbanum«, kao i u darovnici kneza Dujma Frankopana od 14. rujna 1481. godine u kojoj je pobli'e ozna~en smje{taj samostana sa crkvom izvan gradskih zidina. 24 (Pitanje postojanja dviju franjeva~kih crkava u Senju obradit }u u nastavku teksta). Ina~e o franjeva~koj crkvi izvan gradskih zidina prona{ao sam tek podatak da je jedan od bo~nih oltara bio posve}en Sv. Marku. 25 Brojne darovnice kr~kih knezova i potestata toj crkvi i samostanu upu}uju na vezu dolaska franjevaca s dolaskom kr~kih knezova Frankopana u Senj. 26 Potkraj 15. i po~etkom 16. stolje}a, zbog prijete}e turske opasnosti, kralj Ferdinand I naredio je da se poru{e sve gra\|evine izvan gradskih zidina Senja da ne bi poslu'ile Turcima da se u njima utvrde. 27 Me\|u tim je gra\|evinama bio i franjeva~ki samostan sa crkvom. Naredbu o ru{enju, koju je i papa Pavao III potvrdio 1547. godine, 28 izvr{io je general i senjski kapetan Ivan Lenkovi} sredinom 16. stolje}a. 29 O tome je postojao i kameni natpis koji je oko 1891. godine u jednoj prostoriji na drugom katu tvr\|ave Nehaj vidio I. Kukuljevi}-Sakcinski. 30 M. Sladovi}, 31 pak, donosi podatak da su crkva i samostan izvan grada Senja poru{eni 1558. godine, kada je I. Lenkovi} sagradio tvr\|avu Nehaj, a M. Bogovi} 32 navodi da su crkva i samostan izvan gradskih zidina poru{eni ve} 1540. godine. Da su franjeva~ka crkva i samostan izvan gradskih zidina poru{eni prije 1558. godine, potvr\|uje i pismo pape Pavla III datirano 4. srpnja 1547. godine, koje se odnosi na problem ru{enja starog i podizanja novog samostana. Tim pismom papa senjskim franjevcima, zbog toga {to su im poru{eni stara crkva i samostan izvan gradskih zidina, potvr\|uje pismenu dozvolu kralja Ferdinanda I da mogu sagraditi novu crkvu i samostan unutar gradskih zidina. 33 Da su franjeva~ka crkva i samostan izvan gradskih zidina poru{eni prije – potvr\|uje i ~injenica da je gradnja tvr\|ave Nehaj zapo~eta ve} 1553. godine, a da je bila sagra\|ena 1558. godine, te da je za njezinu gradnju upotrijebljen materijal poru{ene crkve i samostana, 34 kao i nadgrobne plo~e koje su pripadale frankopanskoj zadu'bini na mjestu stare crkve izvan zidina grada, u Sv. Petru, u kojoj su od 1297. do 1474. godine bile obiteljske grobnice Frankopana. 35 Glede mjesta izgradnje nove crkve i samostana unutar gradskih zidina Senja, J. Fran~i{kovi} 36 je mi{ljenja da su oni sagra\|eni na mjestu gdje se nalazila mala, i vjerojatno ru{evna, crkva Sv. Franje. Svoju tvrdnju potkrijepljuje nadgrobnim spomenicima, konkretno jednom od najstarijih nadgrobnih plo~a, onom frankopanske kneginje I'ote iz 1456. godine, koja je bila uzidana u lijevom kutu apside, a vjerojatno prenesena iz stare crkve u Sv. Petru. Na temelju toga Fran~i{kovi} zaklju~uje da je na tome mjestu postojala crkva Sv. Franje koja je bila vlasni{tvo franjevaca, pa kada su izgubili onu izvan grada, preselili su nadgrobne spomenike u crkvu u gradu, a potom je sagra\|ena nova, ve}a crkva sa samostanom 1558. godine. 37 A. Glavi~i}, 38 pak, pretpostavlja da su franjevcima nova crkva i samostan podignuti u blizini crkve Sv. Duha kojima je tek privremeno slu'ila do izgradnje nove, a istom se mi{ljenju priklanja i M. Vili~i}. 39 J. Frkovi}, 40 poput J. Fran~i{kovi}a, misli da su franjevci za poru{eni samostan i crkvu izvan gradskih zidina dobili u samom Senju crkvu, a s obzirom da je bila mala i mo'da u ru{evnom stanju, u cijelosti su je preuredili i pro{irili 1558. g. Me\|utim, iz pisma pape Pavla III od 2. lipnja 1547. godine, kojim dopu{ta ru{enje franjeva~kog samostana i crkve izvan zidina, u Sv. Petru, i gradnju novog samostana i crkve Sv. Franje u gradu, proistje~e kako je franjevcima na uporabu najprije dana crkva Sv. Duha u gradu, a potom im je podignuta nova crkva i samostan u gradu, upravo pokraj te crkve Sv. Duha. 41 Kod Farlatija 42 prona{ao sam podatak o povelji iz godine 1389. kojom Antonius de Trinciis de Fuligna, episcopus Lacedaemonsis, Vicarius et Internuntius P. Urbani VI daje oproste od 140 dana svima koji se ispovijede, pri~este i posjete crkvu senjskoga gostinjca Sv. Duha. Povelja je izdana: Segniae apud divina Providentia PP VI die 17. men Augusti. 43 Iste ~injenice navodi i M. Sladovi}. 44 Uzimaju}i u obzir sve navedeno, mogu zaklju~iti da su franjevci, nakon ru{enja crkve i samostana izvan gradskih zidina, na privremenu uporabu dobili crkvu Sv. Duha pokraj koje, ili na mjestu koje im je sagra\|ena nova. S obzirom da sam potkrijepljenje ove tvrdnje na{ao u izvorima i relevantnoj literaturi, ~ini mi se dovoljno argumentirana da bi je se, do novog i opse'nijeg istra'ivanja, moglo smatrati vjerodostojnom i tako zaklju~iti problem pribivanja franjevaca unutar gradskih zidina Senja nakon ru{enja njihove crkve izvan gradskih zidina i gradnje nove. Novi samostan i crkva Sv. Franje u gradu gra\|eni su istovremeno kada i tvr\|ava Nehaj, dakle od 1553. do 1558. godine. To se zaklju~uje iz natpisa na kamenoj plo~i koja je bila uzidana na pro~elju crkve, sjeverno od portala, a na kojem je pisalo da je crkva sagra\|ena 1558. godine za vladavine kralja Ferdinanda I i u vrijeme kad je u Senju bio graditelj tvr\|ave Nehaj, kapetan I. Lenkovi}. 45 Mislim da je taj natpis siguran dokaz da je gradnja crkve zavr{ena upravo 1558. godine. Isti~em tu godinu stoga {to se u literaturi mogu prona}i razli~ite godine zavr{etka gradnje crkve Sv. Franje u Senju. Tako, primjerice, A. Glavi~i} na jednome mjestu, bez ikakve argumentacije, kao godinu izgradnje senjske franjeva~ke crkve navodi 1552., 46 a na drugom, pak, se odlu~uje za 1558. godinu. 47 I. Kukuljevi}-Sakcinski 48 navodi da je »…crkva Sv. Franje zidana god. 1552….«, a Gj. Szabo isti~e da je »postanak ove senjske crkve poznat«, 49 ali nigdje u tekstu ne navodi godinu njezine izgradnje. M. Vili~i} je neto~no prepisala natpis koji donosi I. Kukuljevi}-Sakcinski, pa je stoga kao zavr{etak gradnje crkve Sv. Franje u Senju pro~itala 1559. godinu, umjesto 1558. godine. 50 Izgled crkve Sv. Franje u Senju mogu}e je rekonstruirati slu'e}i se opisima ranijih istra'iva~a, starim fotografijama i postoje}im grafi~kim prilozima. Kriti~ku interpretaciju tlocrta dat }u u nastavku teksta. Ve} sam spomenuo da je prvu stru~niju deskripciju crkve dao J. Chvala 51 koji donosi i arhitektonske priloge ~iji je autor V. Hora~ek. Chvala opisuje crkvu kao »romani~ku baziliku s tri la\|e«. 52 Srednja la\|a, prema Hora~ekovim izmjerima, bila je duga 14,90 m, {iroka 8,55 m i visoka 9,15 m. Duljina dviju bo~nih la\|a bila je 15,80 m, a visina 3 m. Srednja la\|a imala je ravni strop, dok su bo~ne la\|e imale {iljaste svodove. Sveti{te, koje se nastavljalo na srednju la\|u u istoj {irini, imalo je, poput te la\|e, ravni strop. Srednju la\|u od bo~nih dijelili su polukru'ni lukovi koji su po~ivali na masivnim stupovima. Nad lukovima u srednjoj la\|i nema pro- zora, dok su bo~ne la\|e izvorno imale po tri polukru'na prozor~i}a, te naknadno pridodane ~etverokutne prozore, {est na svakoj la\|i. Chvala posebno isti~e tlocrtnu sli~nost senjske franjeva~ke crkve s prvostolnicom, crkvom Sv. Marije koja je bila sagra\|ena po~etkom 13. stolje}a. 53 Premda Chvala spominje da su na crkvi provo\|eni zahvati, on ih ne razlu~uje, ve} isti~e samo posljednju ve}u obnovu iz 1888. godine, kada su s poda crkve odstranjene brojne nadgrobne plo~e, srednja la\|a pokrivena betonom, pobo~ne kamenim plo~ama, prozori i vrata promijenjeni, rastavljene orgulje koje su zaklanjale veliku pro~elnu rozetu, obnovljen glavni oltar i crkva oslikana. 54 I Gj. Szabo navodi: Crkva je sazidana posve poput stolne, ima ravnim stropom prekritu srednju la\|u i po tri kapele u pobo~nim la\|ama koje su svo\|ene. 55 Sli~an opis tlocrta i unutra{njosti franjeva~ke crkve u Senju, no bogatiji pojedinostima, daje i J. Fran~i{kovi}, 56 ne trude}i se posebno razlu~iti razli~ite gra\|evne faze. Opise J. Chvale i J. Fran~i{kovi}a, te Hora~ekove arhitektonske priloge, preuzimali su svi kasniji autori koji su pisali o crkvi Sv. Franje u Senju, pa i oni istra'iva~i koji su se crkvom temeljitije bavili, ne uznastojav{i razlu~iti, na temelju postoje}ih navoda u literaturi, arhitektonskih priloga i raspolo'ivih rijetkih dokumenata, gra\|evinske faze senjske franjeva~ke crkve, kao niti Church of St. Francis in Senj, longitudinal section (photo from 1894 provided by M. Vili~i}, Architectural monuments of Senj, »Rad JAZU«, book 360, Zagreb 1971, pp. 65–129) ponovno interpretirati njezin tlocrt i ispraviti i ukloniti pogre{ne tvrdnje ranijih autora, posebice onu da je crkva Sv. Franje u Senju trobrodna i poput romani~ke bazilike. Tako, primjerice, J. Frkovi} tek preuzima opis crkve koji je donio J. Fran~i{kovi}, 57 no i dalje je potpuno pogre{no odre\|uje kao »tipi~no ranogoti~ku franjeva~ku baziliku«. 58 U istoj radnji, kada govori o gotici i tipu arhitekture koji u na{e krajeve donose franjevci i dominikanci, J. Frkovi} navodi da oni »svu konstruktivnost gotike primjenjuju vrlo skromno, strop ostavljaju ravan, drven, izbjegavaju svu dekorativnost i reCrkva Sv. Franje u Senju, pretpostavljeni perimetar crkve prije izgradnje bo~nih kapela Church of St. Francis in Senj, supposed church perimeter before the construction of the side chapels dovno izgra\|uju prostrane, jednobrodne propovjedni~ke gra\|evine.« 59 Gotovo identi~an opis, s usvajanjem arhitektonskog odre\|enja crkve Sv. Franje u Senju kao trobrodne bazilike, usvaja i M. Vili~i}. 60 Premda je prema oskudnoj dokumentaciji te{ko vjerno rekonstruirati povijest izgradnje crkve Sv. Franje u Senju, poku{at }u, koriste}i se vi{ekratno spominjanom i analiziranom literaturom, sa~uvanim fotografijama i arhitektonskim prilozima, te novim saznanjima temeljenima na prou~avanju franjeva~kih crkava na hrvatskoj obali Jadrana u rasponu od polovice 13. do kraja 16. stolje}a, ispraviti neke pogre{no interpretirane i usvojene tvrdnje glede arhitekture senjske franjeva~ke crkve. Habsbur{kog koji sa svake strane pridr'ava po jedan genij. 64 Ju'no od portala bio je uzidan grb kr~kih knezova Frankopana. Njegov je {tit bio razdijeljen u dva nejednaka dijela: u gornjem se nalazila osmerokraka zvijezda, stari frankopanski grb, a u donjem su bila dva lava koja uspravno stoje i lome kruh, dok je iznad svakog od njih kruna. Sa svake strane {tit s grbom pridr'avao je po jedan genij, a do genija sa svake strane po jedan an\|eo. Mogu}e da jedan predstavlja franjevca, a drugi benediktinca. Od grba je sa~uvan samo donji dio koji se nalazi u tvr\|avi Nehaj, dok se dva ulomka s prikazima genija ili an\|ela nalaze u kripti katedrale Bla'ene Djevice Marije u Senju. 65 Pro~elje crkve Sv. Franje u Senju mogu}e je najvjerodostojnije interpretirati jer je sa~uvan arhitektonski snimak i stare fotografije. Bilo je izgra\|eno od pravilno klesanog kamena, u osi je bio portal, a ponad njega okrugli prozor – rozeta. Ispod rozete nalazio se plitki reljef s prikazima sedam svetaca. 61 J. Fran~i{kovi} 62 je mi{ljenja da taj reljef sa sveta~kim likovima mogu}e potje~e od prija{nje crkve Sv. Franje ili je, pak, prenesen iz crkve Sv. Petra koja se nalazila izvan gradskih zidina. Portal je bio pravokutnog oblika sa dva polustupa uz dovratnike; povrh nadvratne grede bio je zabat u ~ijoj se povr{ini nalazio reljef sa Sv. Franjom koji prima rane s kri'a. Sjeverno od portala bio je uzidan detaljno izra\|en grb senjskog kapetana Ivana Lenkovi}a ispod kojeg se nalazila ~etverokutna plo~a s latinskim natpisom koji govori da je crkva bila podignuta 1558. godine. 63 U polukru'nom {titu grba, u gornjem polju, isklesan je krilati zmaj. Iznad {tita je kaciga, nad njom kruna, ista kao u {titu, a iz nje raste zmaj. Iznad toga grba nalazio se grb nadvojvode Ferdinanda I Godine 1863. naknadno su, uz rozetu, probijena dva pravokutna prozora, a patricij Jo'e Markovi} je pred glavnim ulazom sagradio stepeni{te. 66 Godine 1888. G. Bedini, senjski kanonik i gvardijan samostana Sv. Franje, posljednji put, sude}i prema podacima, provodi obnovu crkve. Tada je odstranjen luk izme\|u la\|e i sveti{ta, te umjesto njega postavljen ravan zid visok oko jednog metra, a s poda crkve pova\|ene su nadgrobne plo~e i ugra\|ene u zidove crkve i sveti{ta. 67 Uz pro~elje, u jugoisto~nom uglu, nalazio se zvonik ~etverokutnog tlocrta sa pet katova otvorenih pravokutnim prozor~i}ima kamenih okvira, dok je zavr{ni kat u kojem su se nalazila zvona bio na svakoj strani otvoren po jednim velikim prozorom polukru'nog zavr{etka. Dogra\|en je kasnije. Ve} sam naglasio da se ni jedan istra'iva~ nije temeljitije bavio prou~avanjem tlocrtne dispozicije crkve Sv. Franje u Senju. Stoga }u je sam poku{ati detaljnije razraditi. S obzirom na spomenike franjeva~ke arhitekture na hrvatskoj obali Jadrana od sredine 13. do kraja 16. stolje}a, oblikovali su se tipovi tlocrta koji nose tradicionalna rje{enja udoma}ena u lokalnim okvirima i odjeke novih tipova tlocrta koje donose franjevci, a uz njih i dominikanci, iz svojih centara u Italiji – Umbrije i Toskane. Na tim je tlocrtima la\|a jasno oblikovana kao osnovni prostor sakralne gra\|evine; ona je jednostavna pregledna prostorija pravokutnog oblika. Na njezinu prostornu dispoziciju nisu utjecali mogu}i oltari uz bo~ne zidove, a to je uo~ljivo i u primjeru tlocrta senjske franjeva~ke crkve gdje su bile oblikovane zasebne kapele otvorene pre- ma la\|i i me\|usobno povezane, koje su sadr'avale oltare. U jednobrodnoj franjeva~koj crkvi, koja se odri~e komplicirane tlocrtne osnove, zadr'ani su bitni elementi razvijenog tlocrta – la\|a i sveti{te – koji su omogu}avali slu'enje uobi~ajene liturgije. Usvajanje jednostavnog i lakog za izvedbu tipa jednobrodne crkve s drvenom krovnom konstrukcijom, bilo je u velikoj mjeri potaknuto i materijalnim razlozima. Pod utjecajem propisa o skromnosti i siroma{tvu otpo~etka se usvajaju jednostavna, jednobrodna arhitektonska rje{enja. Arhitektonska dekoracija je do siroma{tva jednostavna, a zidne povr{ine su ravne i gole. Tek su detalji arhitekture, obi~no otvori, primjerice portali, kao ovaj crkve Sv. Franje u Senju, ili prozori, imali skromne i jednostavne plasti~ke naglaske. Dakle, mogu}e varijacije uo~ljive su tek u pojedinostima. Takav tip crkve, jednobrodne pravokutne gra\|evine s drvenom krovnom konstrukcijom i s pravokutnom presvo\|enom apsidom, nastao je, prema mome mi{ljenju, po uzoru na srednjotalijanski tip propovjedni~ke crkve iz 13. i 14. stolje}a. Premda nema pisanih izvora koji bi potkrijepljivali moje mi{ljenje, ~ini mi se logi~nim da utemeljitelji franjeva~kih crkava na podru~ju hrvatskog Jadrana uzimaju za uzor crkve u mati~nom podru~ju jer su gradovi na tom podru~ju cijeli srednji vijek odr'avali trgova~ke i umjetni~ke veze s Italijom. S obzirom da je te'nja franjeva~ke arhitekture da se oblikuje {to ve}i, jednostavniji i pregledniji prostor namijenjen mno{tvu vjernika, nelogi~no bi bilo o~ekivati da se takovi prostori optere}uju bazilikalnom tlocrtnom dispozicijom, odnosno gradnjom paralelnih, bo~nih brodova. Ta se potreba, mogu}e, javila kasnije, kada se pove}avao broj vjernika, kao {to je mo'da slu~aj i sa senjskom franjeva~kom crkvom jer vjernici ~esto naru~uju posebne obrede koji se obna{aju upravo u zasebnim oltarnim prostorima, poglavito u kapelama, a ne u bo~nim brodovima. Mislim, stoga, da je na primjeru franjeva~ke crkve u Senju, u izvornom obliku rije~ o, za franjeva~ku sakralnu arhitekturu uobi~ajenoj, jednobrodnoj pravokutnoj gra\|evini s jednom pravokutnom apsidom. U nekom od nedokumentiranih, ali sigurno provedenih restauriranja, la\|i su dodane kapele, po tri sa svake strane, koje su s njom povezane lukovima, ali i me\|usobno tako da je tlocrt dobio oblik trobrodne bazilike, a debljinu stupova uvjetovalo je svo\|enje tih kapela kri'nim svodovima. 68 I. Kukuljevi}-Sakcinski 69 donosi prijepis natpisa iz 1740. godine koji je bio uzidan u kapeli Sv. Vincenta franjeva~ke crkve u Senju, nad vratima sakristije. Taj natpis o posve}enju crkve Sv. Franje u Senju spominje biskupa ^oli}a koji je obnovio senjsku katedralu, a pripisuje mu se i dogradnja bo~nih la\|a senjske franjeva~ke crkve, 70 no nije poznato u kojem opsegu. Ako bi se taj podatak pokazao to~nim, bio bi to vrijedan prilog mojoj pretpostavci da je izvorno crkva Sv. Franje u Senju odista imala tlocrtnu shemu uobi~ajenu za propovjedni~ke crkve. Ve} je 1763. godine crkva Sv. Franje u Senju imala bo~ne kapele jer je u planu grada iz te godine ucrtana kao trobrodna bazilika. 71 Ranije sveti{te senjske franjeva~ke crkve, koje je obi~no bilo tek neznatno u'e od la\|e, a i time se i nagla{avala razlika prostora za vjernike i redovnike, tijekom jednoga od restauriranja, mogu}e je da je bilo odstranjeno i zamijenjeno novim, {irokim poput la\|e. Na tlocrtu nije vidljivo nagla{avanje prijelaza iz la\|e u sveti{te, {to je bilo uobi~ajeno, trijumfalnim lukom. Me\|utim, presjek pokazuje da je sveti{te trima stubama bilo povi{eno od la\|e. Pojedini raniji istra'iva~i navode podatak da je prilikom re- stauriranja 1888. godine odstranjen luk koji je dijelio sveti{te od glavne la\|e. 72 Ako prihvatim ovaj podatak vjerodostojnim, on bi potvr\|ivao da je, dakle, u izvornom stanju crkva Sv. Franje u Senju imala trijumfalni luk koji je dijelio la\|u i sveti{te, ina~e uobi~ajen u franjeva~kim crkvama. Da sveti{te nije izvorno i da se u njemu interveniralo, svjedo~e jo{ neki podaci. Tako je na tlocrtu nastalom 1894. godine sveti{te prikazano bez ikakvih otvora, a 1931. godine J. Fran~i{kovi} detaljno opisuje crkvu i navodi da su »sveti{te rasvjetljavala dva polukru'na prozora« , 73 od kojih je jedan zatvoren, po njegovu mnijenju, 1693. godine, kada je dogra\|en drugi kat samostana i podignuta i ure\|ena blagovaonica kako se razabiralo iz natpisa na njezinim vratima. 74 Tako\|er i zapadni perimetar tih, kako su ih prija{nji istra'iva~i nazivali bo~nih brodova, nije jedinstven s pro~eljem la\|e. Pojedini istra'iva~i smatrali su da su sve tri la\|e bile u istoj razini, a da je glavna, srednja la\|a, produ`ena do pro~elja koje je, zapravo, od ranije crkve. 75 U nedostatku konkretnih dokaza, ovo shva}am tek kao jednu mogu}nost koju bi trebalo dokazati. Ako se zanemari ~injenica kakva tlocrtno i prostorno jest uobi~ajena franjeva~ka crkva, onda bi ova senjska, ako je izvorno gra\|ena kao trobrodna crkva, dakle bazilika, bila izuzetak s obzirom na vrijeme i mjesto nastanka u {irem podru~ju, a ne samo na hrvatskoj obali Jadrana. No, upravo sa~uvani nacrti iz 1894. godine, koji u presjecima pokazuju naknadno unesene klasicisti~ke profilacije, opovrgavaju takovu mogu}nost. Dakle, franjeva~ku arhitekturu obilje'ava jednostavnost i racionalizam. Ta obilje'ja imala je, prema mome mi{ljenju, i crkva Sv. Franje u Senju. S obzirom na tu pretpostavku, potrebno je tu crkvu promatrati kao jednu u nizu crkava iste tlocrtne dispozicije i neznatnih arhitektonskih razlika, tek u pojedinostima, nagla{avanjem otvora, posebice portala, s ostalim crkvama franjevaca na hrvatskoj obali Jadrana. Njezina je tlocrtna dispozicija bila jedna la\|a i sveti{te gotovo iste {irine. Moju pretpostavku o jedinstvenoj liniji razvoja franjeva~kih crkava na spomenutom podru~ju potvr\|ivalo bi obilje'je sredine u kojoj je crkva Sv. Franje i izgra\|ena, u kojoj jednom usvojeni oblici, uz tek neznatne razlike u pojedinostima, kontinuiraju dugo kroz vrijeme. Gotika, koja s franjeva~kim crkvama polako prodire i u na{e krajeve, zapo~inje jasnom konstruktivnom arhitekturom kojoj su obilje'ja velike gra\|evine i arhitektonski u~inak uz ~istu upotrebu gra\|evnog materijala, ostvarenje stroge oblikovne i stati~ke funkcije i neuporaba svakog suvi{nog ukrasa {to rezultira trijeznim i ozbiljnim karakterom rijetke dekoracije. To su obilje'ja i franjeva~ke crkve u Senju sagra\|ene 1558. godine, dakle u vrijeme kada gotiku polako zamjenjuje renesansni duh. Stvaranje cjelovitije slike o prvotnom tlocrtu crkve Sv. Franje u Senju nu'no tra'i nove dokaze koji }e, siguran sam, proiste}i iz daljnjih temeljitijih istra'ivanja. A ovaj skroman prilog treba shvatiti jednim od poticaja tim budu}im istra'ivanjima. Bilje{ke 1 Crkvu Sv. Franje u Senju obra\|ivao je niz autora. Ne navodim ih na ovome mjestu poimence jer }u se na ve}inu njih podrobnije osvrtati u nastavku teksta. 2 I. Kukuljevi}-Sakcinski, Putne uspomene iz Hrvatske, Dalmacije, Arbanije, Krfa i Italije, Zagreb, 1873, str. 24. 3 M. Magdi},Topografija i poviest grada Senja, Senj, 1877, str. 57. 4 Rije~ je o radovima J. Chvale, Preuredba vodovoda u Senju, »Viesti dru'tva in'inira i arhitekata«, Zagreb, 1984, 5, str. 63 i isti; Crkva Sv. Franje u Senju, »Viesti dru'tva in'inira i arhitekata«, Zagreb, 1894, XV/1, str. 1–2. 5 Crkva Sv. Franje u Senju J. Fran~i{kovi}, XIX, br. 4, Zagreb, 1931, str. 411–423. 6 D. Hirc,Hrvatsko primorje, Zagreb, 1891, str. 211–212. 7 P. Tijan, Senj, Zagreb, 1931, str. 35–38.; isti, Grad Senj u povijesti i kulturi hrvatskog naroda, »Hrvatski kulturni spomenici I: Senj«, JAZU, Zagreb, 1940, str. 1–34. 8 A. Glavi~i} je vi{ekratno pisao o senjskoj crkvi. Njegove opise nalazimo u tekstovima: A. Glavi~i}, Kulturno-povijesni vodi~ po Senju, »Senjski zbornik«, I, Senj, 1965, str. 264–314.; isti, Arheolo{ki nalazi Senja i okolice, »Senjski zbornik«, II, Senj, 1966, str. 383–420.; isti, Informacija za obnovu tvr\|ave »Nehaj« i izgradnju »Usko~kog mauzoleja« u gradu Senju 1972–1975. godine, »Senjski zbornik«, IV, Senj, 1969–1970, str. 205–223.; isti, Vodi~ po Senju i okolici, Senj, 1974, str. 25–26. 9 B. Ljubovi} – E. Ljubovi}, Grbovi i natpisi na kamenim spomenicima grada Senja, »Senjsko knji'evno ognji{te«, Senj, 1996. 10 Arhitektura grada Senja Gj. Szabo, Senj«, Zagreb, 1940, str. 42–43. 11 Sakralni objekti Senja J. Frkovi}, , »Hrvatski kulturni spomenici I: , Senj, 1979. (rukopis), str. 34–37. 12 M. Vili~i} je u nizu tekstova obra\|ivala franjeva~ku crkvu u Senju. Isti~u se tako tekstovi: M. Vili~i}, Povijesno-urbanisti~ki razvoj Senja, »Senjski zbornik«, I, Senj, 1965, str. 94–100.; ista, Kakvu namjenu dati prostoru poru{ene memorijalne crkve Sv. Franje u Senju, »Senjski zbornik«, IV, Senj, 1970, str. 225–240, dok je nacjelovitiji pristup dala u radu: Arhitektonski spomenici Senja, »Rad JAZU«, Zagreb, 1971, str. 65–129. 13 M. Boloni}, Crkveni patronat na podru~ju senjsko-modru{ke biskupije, »Senjski zbornik«, V, Senj, 1971–1973, str. 219–318. 14 M. Bogovi}, Prijelazno stolje}e senjske crkve (1450–1550), »Senjski zbornik«, 17, Senj, 1990, str. 69–92. 15 B. Ljubovi}, Inventarizacija i za{tita gra\|e iz razru{ene crkve Sv. Franje u Senju (rukopis), Senj, 1997. , »Bogoslovska smotra«, 16 T. Smi~iklas, Codex diplomaticus regni Croatiae, Dalmatiae et Slavoniae, Zagreb, 1981, V, str. 620: »…Ego quidem Jacobus…do et concedo…fratribus minoribus de Segnia duos ortos meos positos Segnie apud ecclesiam et ortum ipsorum fratrum minorum…« 17 J. Fran~i{kovi}, 1913, str. 413. 18 M. Vili~i}, 1970, str. 228–229. 19 , 1971–1973, str. 255. M. Boloni} 20 T. Smi~iklas, CD, VII, str. 80–82. 21 T. Smi~iklas 22 T. Smi~iklas, CD, VII, str. 212–213. 23 D. Farlati,Illyricum sacrum, Venetiis 1765, IV, str. 229. 24 M. Sladovi}, Poviesti biskupijah senjske i modru{ke ili krbavske, Trst, 1856, str. 243.: »…quam praedecesores nostri…Eclesion cum monasterio prope muros civitatis fundaverunt…« 25 T. Smi~iklas, CD, XIII, str. 482. 26 M. Sladovi}, 1856, str. 243. navodi darovnicu Dujma Frankopana od 14. rujna 1481. kojom knezovi Frankopani poklanjaju ovom samostanu velike posjede i druga dobra, a ta darovnica potvr\|uje da su samostan i crkva bili posve}eni upravo Sv. Franji. Neke od darovnica knezova Frankopana prona{ao sam i kod T. Smi~iklasa, CD, XI, str. 216–218; isti, CD, XI, str. 584. i drugdje. 27 M. Magdi}, 1877, str. 57. 28 , 1856, str. 234. M. Sladovi} 29 I. Kukuljevi}-Sakcinski, Njeke gradine i gradovi u kraljevini Hrvatskoj, sv. II: Grad Senj, Zagreb, 1869, str. 3; V. Klai}, Gra\|a za topografiju li~ko-krbavske 'upanije u srednjem vijeku, »Vjesnik hrvatskog arheolo{kog dru{tva«, VI, Zagreb, 1902, str. 4–5, M. Sladovi}, 1856, str. 243; M. Magdi}, 1877, str. 57; A. Glavi~i}, Informacija o obnovi tvr\|ave Nehaj 1968–1970. i izgradnji usko~kog mauzoleja u Senju, »Vijesti muzealaca i konzervatora Hrvatske«, XX, Zagreb, 1971, br. 1, str. 26–27.; M. Boloni}, 1971–1973, str. 259; M. Bogovi}, 1990, str. 86. 30 I. Kukuljevi}-Sakcinski, Nadpisi sredovje~ni i novovjeki u Hrvatskoj i Slavoniji, Zagreb, 1891, str. 245, br. 819.: »U senjskoj tvr\|i (fortezzi) na drugom podu u jednoj sobi nazvanoj od Padillona: Na dan priblazene D. Marie Svicharizze ali od kandelabra, dosli jesu Turci do grada Senja, ali Senju nisu nista naudili, niti skode napravili jer su se Senjani hrabreno odnasli. Nego samo Turci opalise Klostar i crikvu Sv. Petra, od kojega Klostra nije nista ostalo nego samo stina od koje stine nachinio je pervi Ban Lenkovich napravit Fortizzu, da se brane od Turakah, na postenje Senjanov, i crikve sv. Franje, da ih brani Bog i sveti Duh. Letta Gospodinova 1558.« 31 , 1856, str. 236. M. Sladovi} , CD, VII, str. 157–158. 31 32 M. Bogovi}, 1990, str. 86. 33 , 1856, str. 234–236.; M. Sladovi} 261. 34 , 1971–1973, str. 261. M. Boloni} 35 Detaljnije vidi u: J. Fran~i{kovi}, 1931, str. 413. 36 J. Fran~i{kovi} 37 Ibidem. 38 A. Glavi~i}, Arheolo{ki nalazi Senja i okolice, »Senjski zbornik«, II, Senj 1966, str. 412. 39 M. Vili~i}, 1970, str. 231. 40 , 1979, str. 35. J. Frkovi} 41 , 1856, str. 234. M. Sladovi} 42 , 1765, str. 123. D. Farlati 43 Ibidem. 44 , 1856, str. 257. M. Sladovi} 45 Natpis donosi I. Kukuljevi}-Sakcinski, 1891, str. 244, br. 816, a preuzimaju M. Magdi}, 1877, str. 19, M. Vili~i}, 1970, str. 231 i M. Boloni}, 1971–1973, str. 262, a glasi: REGNANTE SERENISSIMO PRINCIPE ET DNO DNO. FERDINANDO DIVINA FAVENTE CLEMENTIA ROMANORUM. HUNGARIAE BOHEMIE DALMATIE CROATIE ET.C. REGE INFANTE HISPANIE ARCIDUCE AUSTRIE.ET.C INVICTISSIMO TEMPORE CAPITANEATUS DOMINI JOHANIS LENCOVIC SVE MAESTAS COM MISARII ET CAPITANEI MDLVIII 46 , 1965, str. 295. A. Glavi~i} 47 , 1974, str. 25. A. Glavi~i} 48 , 1873, str. 24. I. Kukuljevi}-Sakcinski 49 Gj. Szabo, 1940, str. 42. 50 M. Vili~i}, 1970, str. 105. 51 J. Chvala, Crkva Sv. Franje u Senju, »Viesti dru'tva in'inira i arhitekata«, Zagreb, 1894, XV/1, str. 1–2; isti, Preuredba vodovoda u Senju, »Viesti dru'tva in'inira i arhitekata«, Zagreb, 1894, 5, str. 63. 52 Ibidem. 32 , 1931, str. 413–414. , 1971–1973., str. 260– M. Boloni} 53 Mo'da je upravo sli~nost crkve Sv. Franje u Senju sa senjskom katedralom sagra\|enom u 13. stolje}u nagnala sve kasnije autore tekstova o senjskoj franjeva~koj crkvi da je tlocrtno odre\|uju »romani~kom bazilikom«. Vidi primjerice: J. Fran~i{kovi}, 1931, str. 414; M. Boloni}, 1971–1973, str. 262. i drugi. 54 Ibidem. 55 Gj. Szabo, 1940, str. 42. 56 J. Fran~i{kovi}, 1931, str. 414. 57 , 1979, str. 36-44. J. Frkovi} 58 , n. dj., str. 44. J. Frkovi} 59 Ibidem. Frkovi} samo preuzima dio teksta koji je o franjevcima napisao A. [enoa. Detaljnije vidi: A. [enoa, Franjevci, Hrvatska, »Enciklopedija likovnih umjetnosti«, 2, Zagreb, 1962, str. 324. 60 M. Vili~i}, 1971, str. 105–107. 61 B. Ljubovi}, koja je provela cjelovitu inventarizaciju spomenika crkve Sv. Franje u Senju, smatra ovaj reljef jednim od najzna~ajnijih romani~kih ili ranogoti~kih spomenika iz Senja s kraja 13. i po~etka 14. stolje}a. Reljef je o{te}en, nedostaje jedan svetac od ukupno sedam, a danas se nalazi u Muzeju sakralne ba{tine u Senju. Detaljnije vidi u: , 1996, str. 17 i B. Ljubovi} – E. Ljubovi} B. Ljubovi}, 1997. 62 J. Fran~i{kovi}, 1931, str. 414. Mi{ljenje J. Fran~i{kovi}a preuzima i M. Vili~i}. Uz to ona misli da ~itavo pro~elje potje~e od ranije crkve, mo'da one Sv. Franje unutar gradskih zidina, ili pak one Sv. Petra izvan gradskih zidina, no svoju tvrdnju ne potkrijepljuje. Detaljnije vidi: M. Vili~i}, 1970, str. 105. 63 Cjeloviti natpis sam naveo u bilj. 45. 64 Grb I. Lenkovi}a je prilikom ru{enja crkve uni{ten, ali postoji njegova fotografija. Opisan je u djelima: I. Kukuljevi}-Sakcinski, 1873, str. 24; M. Magdi}, 1877, str. 57; B. Ljubovi} – E. Ljubovi}, 1996, str. 17; B. Ljubovi}, 1997, str. 42. 65 Detaljnije vidi kod: J. Fran~i{kovi}, 1931, str. 414; B. Ljubovi} – E. Ljubovi}, 1996, str. 16; B. Ljubovi}, 1997, str. 40–41. 66 J. Fran~i{kovi}, 1931, str. 414; str. 41; P. Tijan M. Vili~i}, 1971, str. 105. 67 , 1965, str. 295; A. Glavi~i} J. Chvala 1931, str. 411–419; , 1894, str. 2; Gj. Szabo , 1940, bilje{ke uz slike na J. Fran~i{kovi}, , 1940, str. 42–43; 35. 68 J. Fran~i{kovi}, 1931, str. 414. 69 I. Kukuljevi}-Sakcinski, 1891, str. 253–254. 70 , 1979, str. 37. J. Frkovi} , 1940, str. P. Tijan 71 Ibidem. 72 U najstarijem opisu crkve Sv. Franje u Senju, onom I. Kukuljevi}aSakcinskog, 1873, str. 24, on navodi: »Sveti{te dijeli od srednjeg broda obli luk po~ivaju}i na polupilonima«. M. Magdi}, 1877, str. 19 prvi daje podatak da je restauracijom 1888. godine, me\|u inim, bio odstranjen luk koji je po~ivao na polustupovima, a izme\|u sveti{ta i la\|e je umjesto njega podignut ravan zid. Ovaj podatak najvjerojatnije preuzimaju od Magdi}a i drugi raniji istra'iva~i. Vidi detaljnije: P. Tijan, 1931, str. 35; J. Fran~i{kovi}, 1931, str. 415, 418; Gj. Szabo, 1940, str. 42. Summary Damir Demonja A Contribution to the Interpretation of the Church of St. Francis in Senj Regarding the monuments of Franciscan architecture on the Croatian coast of the Adriatic, from mid-13 th until the late 16 th century ground-plan types have been formed which contain the traditional local designs and traces of new groundplan types brought by the Franciscans, and also Dominicans, from their centers in Italy, Umbria and Tuscany. In these ground-plans the nave clearly constitutes the basic area of a sacral building. It is a simple well laid-out rectangular room. Its spatial arrangement was not affected by possible altars along the side walls. This can be seen in the example of the ground plan of the church of St. Francis in Senj which had separate interconnected chapels open towards the nave, which contained altars. In the single-naved Franciscan church, which abandons the complicated ground-plan design, the essential elements of the detailed ground plan – the nave and the shrine – have been kept. Adoption of a simple and easy-to-construct single-naved church type with a wooden roof frame, was to a large extent inspired by material reasons. Under the influence of regulations regarding modesty and poverty, simple single-naved architectural solutions were adopted from the very beginning. Architectural decoration is simple to the point of poverty, and walls are flat and bare. Only the architectural details, usually openings, for example portals, like the one in the church of St. Francis in Senj, or windows, had modest and simple plastic ornaments. In other words, possible variations are visible only in details. I believe that this church type, a single-naved rectangular building with a wooden roof frame and a rectangular vaulated apse, has developed on the model of the Central Italian preachers' church type of the 13 th and 14 th centuries. Although there are no written sources which would substantiate my opinion, it seems logical that the founders of Franciscan churches on the Croatian Adriatic modelled their churches after the ones in their home region because the towns in this area maintained trade and art relations with Italy throughout the Middle Ages. Since Franciscan architecture aspires to create the biggest and simplest possible space intended for large congregations, it would not be logical to expect these spaces to be burdened with a basilican ground-plan arrangement, i.e. parallel, side naves. This need probably appeared later, when the congregation grew in number, which is perhaps the case with the Franciscan church in Senj, because churchgoers often commission special ceremonies which are held at separate altars, chiefly in chapels, and not in side naves. I believe, therefore, that the Franciscan 73 J. Fran~i{kovi}, 1931, str. 415, 418. On donosi i natpis koji dokazuje spomenutu dogradnju, nalazio se nad vratima biv{e blagovaonice, u prizemlju, a glasi: »1693. O.A.M.D.G« (Omnia ad maiorem Dei gloriam). 74 J. Fran~i{kovi}, 1931, str. 417; J. Frkovi}, 1979, str. 36. 75 J. Frkovi}, 1979, str. 40. church in Senj was originally a single-naved rectangular building with a single rectangular apse, common in Franciscan sacral architecture. In one of the undocumented, but definitely performed restorations, the chapels were added to the nave, three on each side, connected with it by arches, but also interconnected, so that the ground-plan acquired the form of a three-naved basilica, and the thickness of the columns was the result of the groin vaults in the chapels. The former shrine of the Franciscan church in Senj, which was usually only slightly narrower than the nave, which emphasized the difference between the area intended for the congregation and the one intended for the monks, was probably removed and replaced by a new shrine of the same width as the nave during one of the restorations. The emphasizing of the line between the nave and the shrine by a triumphal arch, which was common, is not visible in the ground-plan. If we disregard the usual ground plan and space arrangement of a Franciscan church, then the one in Senj, if it had been originally built as a three-naved church, i.e. a basilica, would be an exception in terms of the time and place of its construction in a greater area, and not only on the Croatian coast of the Adriatic. However, the preserved designs from 1894 which in sections show the subsequently entered classicist features refute such a possibility. Franciscan architecture is characterized by simplicity and rationalism. In my opinion, the church of St. Francis in Senj had the same characteristics. Given that assumption, this church should be viewed as one of a number of churches of the same ground-plan arrangement and slight architectural differences, only in the details, by emphasizing the openings, especially the portals, with the other Franciscan churches on the Croatian coast of the Adriatic. Its ground-plan arrangement was a single nave and a shrine of almost the same width. My hypothesis about a unique line of development of Franciscan churches in the mentioned area, would be substantiated by the features of the environment in which the church of St. Francis was built, in which once adopted forms, with slight differences in the details, exist with continuity for a long time. The Gothic, which with Franciscan churches slowly spread to our regions, began with a clear constructive architecture characterized by large structures and architectural effect with a pure use of building material, realization of a strict formative and static function and absence of any superfluous decoration resulting in a sober and sombre character of few decorations. These are also the features of the Franciscan church in Senj built in 1558, i.e. at the time when the Gothic style was being slowly replaced by the spirit of the Renaissance. For the forming of a more complete picture about the original ground-plan of the church of St. Francis in Senj, new evidence is necessary, which will, I am sure, appear in further research.	<urn:uuid:a841f53a-b7fe-485c-b052-b512d49daa11>	HuggingFaceFW/finepdfs/tree/main/data/hrv_Latn/train	finepdfs	hrv_Latn	44,596
PAROISSE CATHOLIQUE ST VINCENT DES BUIS - Buxy Diocèse d'Autun, Chalon et Mâcon (Saône et Loire) Préparation à la Confirmation et catéchuménat des adultes Programme des rencontres 2024-2025 Les dimanches suivants de 9h15 à 10h30 à la cure de Buxy, suivi de la messe à 10h45 à Buxy	<urn:uuid:b8b45b4d-d378-4a49-9549-edc98b12aade>	HuggingFaceFW/finepdfs/tree/main/data/fra_Latn/train	finepdfs	fra_Latn	284
California Tahoe Conservancy Agenda Item 2a March 16, 2023 BOARD MEETING MINUTES December 15, 2022 December 15, 2022 (9:30 a.m.) Board Meeting Staff prepared the minutes from the same-day audio recording and transcription by Foothill Transcription Company, which were certified on December 31, 2022. Agenda Item 1. Roll Call Chair Sue Novasel called the meeting to order at 9:33 a.m. The meeting was held virtually via the Zoom Webinar Platform only. Members Present: Sue Novasel, Chair, El Dorado County Adam Acosta, Public Member Bryan Cash, California Natural Resources Agency Cindy Gustafson, Vice Chair, Placer County Jay Hansen, Public Member Tamara Wallace, City of South Lake Tahoe Members Absent: Gayle Miller, Department of Finance Erick Walker, USDA Forest Service, Lake Tahoe Basin Management Unit (ex officio) Others Present: Jason Vasques, Executive Director Jane Freeman, Deputy Director Michael Steeves, General Counsel Danae Aitchison, Deputy Attorney General Agenda Item 2. Consent Items a. Approval of September Minutes (action) The Board considered the approval of Item 2a. Ms. Wallace recused herself from the vote since she was not present at the September meeting. Mr. Hansen moved for approval of Item 2a and Mr. Cash seconded the motion. Resolution 22-12-01 passed unanimously by roll call vote. Agenda Item 3. Executive Director's Report Jason Vasques, Executive Director, presented Item 3. Mr. Vasques shared highlights for the year 2022, including: re-opening of the office to the public and the presence of staff at the office more regularly; holding the first in-person staff retreat since the pandemic; demolishing the Urgent Care building; the City's groundbreaking for the Sugar Pine Village Housing Project; dedicating the Dennis T. Machida Memorial Greenway; releasing the Lake Tahoe Climate Resilience Action Strategy; adding a sixth goal to the Conservancy's Strategic Plan; awarding the Access for All Grants; using the Tahoe Program Timberland Environmental Impact Report; and completing construction of the Upper Truckee Marsh restoration project. Mr. Vasques also mentioned that Conservancy staff are initiating rulemaking to assist with the management of Conservancy lands. In addition, Mr. Vasques noted recent personnel updates at the Conservancy. Included in those updates, Mr. Vasques announced the retirement of Sue Ewbank. Matt Whalen, Accounting and Budget Supervisor, then presented Ms. Ewbank a Lake Tahoe license plate plaque for her service. Mr. Vasques then thanked Chair Novasel for serving on the Conservancy Board and as Board Chair, given that this meeting was the end of her term on the Board. Ms. Gustafson followed with a few words recognizing Chair Novasel and her contributions during her five years on the Conservancy Board. Mr. Hansen, Mr. Acosta, and Ms. Wallace also said a few words thanking Chair Novasel for her work. Chair Novasel then thanked the Board members and Conservancy staff. Agenda Item 4. Chair's Report Chair Novasel stated she did not have anything beyond an additional thank you to the Board and to the Conservancy staff. Agenda Item 5. California Department of Transportation South Lake Tahoe Safety Project Easements, Transfer of Jurisdiction, and Right of Entry Agreement (action) Nick Meyer, Associate Environmental Planner, presented Item 5. There were no Board or public comments on this item. Mr. Hansen moved to approve Resolution 22-12-02 and Ms. Wallace seconded the motion. Resolution 22-12-02 passed unanimously by roll call vote. Mr. Acosta moved to approve Resolution 22-12-03 and Ms. Wallace seconded the motion. Resolution 22-12-03 passed unanimously by roll call vote. Agenda Item 6. Pioneer Trail/U.S. Highway 50 Intersection Safety Improvements Project Short Term License Agreement and Permanent Easements (action) Stuart Roll, Acting Director of Natural Resources, presented Item 6. Chair Novasel commented that the roundabout will be a positive addition to the community of Meyers and will provide increased connectivity and access for the bike trail. There were no additional Board or public comments on this item. Mr. Hansen moved to approve Resolution 22-12-04 and Ms. Gustafson seconded the motion. Resolution 22-12-04 passed unanimously by roll call vote. Agenda Item 7. Environmentally Sensitive Land Acquisition – Motel 6 and Knox Johnson Parcels (Update) (action) Aimee Rutledge, Acquisitions Specialist, presented Item 7. Vice Chair Gustafson and Chair Novasel both thanked Conservancy staff for the work on this acquisition effort. Chair Novasel then called for public comments. Laura Patten with the League to Save Lake Tahoe expressed the League's support for the acquisition. Ed Moser, a resident of South Lake Tahoe, expressed his opposition to the acquisition. There were no additional Board or public comments on this item. Ms. Wallace moved to approve Resolution 22-12-05 and Mr. Acosta seconded the motion. Resolution 22-12-05 passed unanimously by roll call vote. Agenda Item 8. Forestry Program Update (discussion only) Milan Yeates, Community Forestry Program Supervisor, and Erin Ernst, Tahoe-Central Sierra Initiative Coordinator, presented Item 8, which included a video presentation highlighting the benefits of the Conservancy's community forestry treatments. Mr. Acosta, Mr. Cash, and Vice Chair Gustafson thanked the Conservancy for the hard work on these efforts. Vice Chair Gustafson, Ms. Wallace, and Chair Novasel noted the importance of educating the public on the Conservancy's forestry work. Ms. Wallace asked that this presentation be shared with the South Lake Tahoe City Council and offered her assistance. Chair Novasel also asked about treatments within the wildlandurban interface near Tahoma on the west shore. There were no additional Board comments on this item. Mr. Vasques also thanked the Conservancy staff for putting the video together. There were no public comments on this item. Agenda Item 9. Lake Tahoe Destination Stewardship Plan Update (discussion only) Chris Mertens, Senior Policy Analyst and North Tahoe Liaison, presented Item 9. Julie Regan, Executive Director at the Tahoe Regional Planning Agency (TRPA), and Jennifer Self, TRPA's Long-Range Planning Director, also presented on this item. Vice Chair Gustafson asked about outreach to visitors in terms of marketing the efforts of Destination Stewardship. Julie Regan responded that this is an important part of the conversation and that efforts are underway to incorporate such concerns into the Destination Stewardship strategies and plan moving forward. Mr. Hansen added that he is generally in favor of the plan and wanted to reiterate the importance that the efforts are focused on making the Lake Tahoe Basin accessible to all visitors. There was one public comment on this item from Ed Moser, who commented generally on strategies for marketing of the Lake Tahoe Basin and ways to control visitation and tourism impacts. There were no additional Board or public comments on this item. Agenda Item 10. Board Member Comment There were no additional Board member comments. Agenda Item 11. Public Comment on Items Not on the Agenda There were no additional public comments. Agenda Item 12. Adjourn Chair Novasel adjourned the meeting at 11:38 a.m. California Tahoe Conservancy Adopted: March 16, 2023 Resolution 23-03-01 APPROVAL OF MINUTES I hereby certify that the foregoing is a true and correct copy of the minutes of the December 15, 2022 meeting of the California Tahoe Conservancy adopted on March 16, 2023. IN WITNESS THEREOF, I have hereunto set my hand this 16th day of March, 2023. __________________________ Jason Vasques Executive Director	<urn:uuid:72e3c554-3a9f-4769-be46-6aecff4d94f0>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	7,739
PROGRAMMA: EVENTO RESIDENZIALE TITOLO EVENTO: LA GESTIONE DELL'EMERGENZA: BLS-D – RIANIMAZIONE CARDIOPOLMONARE DI BASE E DEFIBRILLAZIONE PRECOCE CON DEFIBRILLATORE SEMIAUTOMATICO (tipo BLS-D) Linee guida ERC – IRC durante pandemia COVID-19 Tipologia formativa: FORMAZIONE RESIDENZIALE CLASSICA ID evento: 169458.1 ID provider: RL0214 - 6448 Sede svolgimento in presenza: Istituto Clinico Città Studi S.p.A. – Via Ampère, 47 – 20131 - Milano Indirizzo collegamento da remoto/streaming: ---- DESCRIZIONE EVENTO: In ambito intraospedaliero il riconoscimento precoce degli arresti cardiaci e dei pazienti critici e il loro trattamento puntuale e tempestivo possono consentire di ridurre l'evoluzione negativa degli arresti cardiaci, di prevenire il numero dei decessi, e di ricoveri imprevisti in terapia intensiva. La conoscenza delle linee guida internazionali ERC è un'ottima base di partenza per tutti gli operatori sanitari, che dovranno poi adattarle al proprio contesto di lavoro. Inoltre, in tempo di pandemia, è estremamente importante conoscere quale sia l'approccio corretto da utilizzare sia per la propria incolumità che per quella della comunità in cui si vive, salvaguardando la RCP del paziente secondo i criteri etici e di giustizia. OBIETTIVI FORMATIVI (tecnico – professionali, di processo, di sistema): OBIETTIVI FORMATIVI TECNICO-PROFESSIONALI OBIETTIVI SPECIFICI: Acquisire le abilità teoriche e pratiche del BLS-D in soggetti sia COVID-free, sia sospetti o accertati COVID, secondo la metafora della catena della sopravvivenza che si basa su quattro anelli: riconoscimento precoce e chiamata di aiuto, rianimazione cardiopolmonare precoce, defibrillazione precoce e soccorso avanzato precoce, seguendo le linee guida internazionali ERC. METODOLOGIA DIDATTICA: Corso teorico-pratico, lezioni frontali con l'ausilio di diapositive ed esercitazioni pratiche su manichino. AREA DI RIFERIMENTO (obiettivi nazionali): Contenuti tecnico-professionali (conoscenze e competenze) specifici di ciascuna professione, di ciascuna specializzazione e di ciascuna attività ultraspecialistica, ivi incluse le malattie rare e la medicina di genere. DESTINATARI: RESPONSABILE SCIENTIFICO Dott. Angelo Giovanni Virtuani – Medico Anestesista – LP esterno DOCENTI Dott. Angelo Giovanni Virtuani – Medico Anestesista – LP esterno Dott. Luca Tuccinardi – Medico Anestesista – Ospedale San Gerardo di Monza MODDRUF09_b rev. 11 14/02/2022 USO INTERNO Pagina 1 di 3 SEGRETERIA ORGANIZZATIVA: Cognome e nome Rebolini Marina Ente Istituto Clinico Città Studi S.p.A. Telefono ufficio 02 2393 4407 Fax ufficio 02 2393 4252 E-mail firstname.lastname@example.org Sito internet www.ic-cittastudi.it PROGRAMMA Durata: 8 ore Data: 20/04/2022 (Dal conteggio dei crediti è escluso il tempo destinato alla registrazione dei partecipanti, saluti introduttivi, pause/intervalli, la valutazione della qualità percepita e il tempo dedicato alla verifica dell'apprendimento qualora gli esiti della valutazione non vengano condivisi con i partecipanti) MODDRUF09_b rev. 11 14/02/2022 USO INTERNO Pagina 2 di 3 PARTECIPAZIONE E CREDITI ECM: La soglia di partecipazione richiesta è del 100% delle ore totali previste dal programma per eventi formativi di durata uguale o inferiore a 6 ore; la soglia minima dell'80% è, invece, prevista per eventi formativi superiori alle 6 ore, fatta eccezione per l'attività di ricerca, che ha una durata minima di 6 mesi, e per la FAD asincrona (E-learning - FAD con strumenti informatici/cartacei), che prevede come soglia di partecipazione richiesta il 100% delle ore totali previste dal programma. Si precisa inoltre che deve essere rispettata la percentuale di partecipazione prevista per vincoli legislativi come ad esempio la formazione ex D. Lgs. N. 81/2008, che prevede una frequenza obbligatoria pari al 90%. Secondo le indicazioni contenute nel Decreto Direzione Generale Welfare n. 18429 del 23/12/2021, all'evento sono stati preassegnati n. 10,4 crediti ECM. L'attestato crediti relativo a ciascuna tipologia di evento sarà rilasciato solo ed esclusivamente ai partecipanti che avranno superato la soglia dell'80% del questionario di apprendimento, che avranno raggiunto la soglia minima di partecipazione, che avranno compilato e riconsegnato il questionario di gradimento. MODALITA' DI ISCRIZIONE ALL'EVENTO: Iscrizione tramite Struttura Formativa ICCS. VALUTAZIONE GRADIMENTO: Valutazione tramite somministrazione Customer Satisfaction. EVENTO SPONSORIZZATO: (S/N) NO DESCRIZIONE MODALITA' DI VALUTAZIONE DELL'EVENTO: Valutazione tramite somministrazione di test a scelta multipla e prove pratiche con scheda di osservazione diretta. RICADUTE ORGANIZZATIVE ATTESE/INDICATORI: NO MODDRUF09_b rev. 11 14/02/2022 USO INTERNO Pagina 3 di 3	<urn:uuid:03cc5a33-6268-43e2-a76f-430e00778fa0>	HuggingFaceFW/finepdfs/tree/main/data/ita_Latn/train	finepdfs	ita_Latn	5,004
Dissociation energies for the electronic ground states of BeCi, Gall and LiH N RAJAMANICKAM, U D PRAHLLAD and B NARASIMHAMURTHY Department of Physics, University of Mysore, Mysore 570 006, India On leave from VaNSN College, Virudhunagar 626 001, India MS received 1 December 1981 Abstract. The dissociation energies of the diatomic molecules BeCI, Gall and LiH have been computed by fitting empirical potential functions to the true potential energy curves for the electronic ground states of the molecules. The Lippincott three-parameter potential function, the five-parameter Hulburt-Hirschfelder potential function and the Sz~Ske and Baitz electronegativity potential function have been used. The estimated dissociation energies De e are 4.50, 3.09 and 2.94 eV for BeCI, Gall and LiH respectively. These values compare well with the experimental values. Keywords. Dissociation energy; BeC1; Gall; LiH; modified Lippincott function; Hulburt-Hirsehfelder potential function; Sz~ke and Baitz function; eleetronegativity function; curve fitting method. 1. Introduction Dissociation energies of diatomic molecules are of great interest in thermochemistry, combustion physics, astrophysics and likewise. In quantitative problems of valency, statistical calculations of equilibria at high temperatures, in chemical bonding and in many other problems the dissociation energy plays a fundamental role. Spectroscopists and chemists are concerned with the determination of reliable values of dissociation energies for the diatomic molecules. In the case of BeCI molecule, the thermochemical value of dissociation energy D~o is 4.51 eV (Farber and Srivastava 1974), the mass-spectrometric method gives 3"98 eV (Hildenbrand and Theard 1969); Carleer et al (1977)report a value of 3.45 eV by inverse predissociation method, and Gaydon (1968) suggests 3-0 eV. For Gall molecule, Kronekvist et al (1971) report that the dissociation energy D O is less than 2.84 eV by predissociation method, Neuhaus (1959) reports 2.92 eV and Ginter and Innes (1961) report 2.94 eV. Way and Stwalley (1973) report that D o value for LiH as 2.43 eV by fitting the predissoeiation data with the calculated long range potential. Since then the molecular constants for the ground state of LiH have been revised, the dissociation energy of LiH is estimated in the present work with the new data. It is proposed here to estimate the dissociation energies of the molecules of BeCI, Gall and LiH. For these molecules many investigators have determined the values of dissociation energy by different methods (Huber and Herzberg 1979). It is found that these values differ. P~'-I Curve fitting method has been found to yield reliable dissociation energies for a large number of diatomie molecules (Singh et al 1970). The procedure consists in fixing the empirical potential function which best fits the true potential energy curve for the electronic ground state of the molecule. Many empirieaI potential functions are known for the diatomic molecules. Of these, functions given by Lippincott et al (1961) in the modified form, by Hulburt and Hirschfelder (1941), and by Sz/~ke and Baitz (1968) have been found to describe adequately the potential energies of many molecules. These functions are therefore adopted in the present work to estimate the dissociation energies of BeC1, Gall and LiH. 2. The empirical potential functions The empirical potential functions used are given below. (i) The three parameter Lippincott function in the modified form: where (ii) The five parameter Hulburt-Hirschfelder (H-H) function: (iii) The Sz6ke and Baitz eleetronegativity function: Sz6ke and Baitz (1968) have constructed this electronegativity potential energy function by the aid of parameters other than spectroscopic constants to render the possibility of linking different areas in chemical physics and they have replaced the force constant ke of diatomie molecule by an expression connected with Pauling (1960) electronegativities el, e2 as In these functions, U(r) is the potential energy (in cm -x) for the internuclear separation r(in cm) in terms of the spectroscopic constants of dissociation energy DeOn eV); and in units of cm -1, the vibrational frequency o~e, the anharmonicity % xe, the rotational constants, Be, ae, all corresponding to re, the equilibrium internuclear separation of the molecule. 3. Method of evaluating the dissociation energy For the electronic ground state of the molecule, the true potential energy curve can be constructed from the experimental energy levels by the procedure of Vandersliee et al (1960) for the Rydberg-Klein-Rees (RKR) method. The curve is represented by rmi n and rma x values for the observed vibrational levels. For these r values, the energies U(r) are calculated with the empirical potential functions by varying the D e value. An average percentage deviation is determined between the calculated U(r) and the experimental G(v) values. The dissociation energy from any function is that value of De which gives the least deviation. And the function leading to smallest deviation determines the dissociation energy of the molecule. The dissociation energy referred to v = 0 level is given by D°o = De -- G(o). The molecular constants used in the present study are listed in table 1. The true potential energy curves for BeC1, Gall and LiH have been taken respectively from the works of Janardan Singh and Prabhuram (1975), Girte and Battino (1965) and, Orth Table 1. Molecular constants for the electronic ground states of BeCI, Gall and LiH. Table 2. Estimated dissociation energies of the electronic ground states of BeCI, Gall and LiH. First row: D ° in eV Second row: Average percentage deviation. Table 3. Energy values from the H4t fuaction for BeCI. deviation Table 4. Energy values from the H-S function for Gall. and Stwalley (1979). Table 2 displays the dissociation energies determined by different potential functions, and also the average percentage deviations. Only relevant results of U(r) are given in tables 3, 4 and 5 for BeCI, Gall and LiH respectively. The calculations were carried out on the DC~t mere SYSa~M 1101 in steps of 0.01 eV for values of De ranging from 1.5 to 6.0 eV for each molecule. 4. Conclusions The Hulburt-Hirschfelder function leads to the dissociation energies of BeCI, Gall and LiH as the deviation is the least. For BeC1, the estimated dissociation energy of 4.50 -4- 0.12 eV agrees with the thermochemical value of 4.51 eV (Farber and Srivastava 1974). We note that the Gaydon's (1968) value 3.0 eV is different from the experimental value. Experimental dissociation energy of Gall is found to be less than 2.84 eV by predissociation method (Kronekvist et al 1971). The estimated value of 3.09 q- 0.20 eV agrees within 9 %, and also it is close to other reported values. The estimated dissociation energy for LiH is 2.94 q-0.07 eV. Since the HulburtHirschfelder function fits adequately the experimental data, this value can be considered as satisfactory. The error indicated in the results takes into account the error of 2% inherent to Table 5. Energy values from the n-n function for LiH. Hulburt-Hirschfelder function (Steele et al 1962) and the error involved in the curve fitting. Acknowledgements Authors thank Prof. B Sanjeevaiah for encouragement. One of us (NR) thanks the University Grants Commission (New Delhi) and the University of Mysore for the award of Fir fellowship. References Carlecr M, Burtin B and Colin R 1977 Can. J. Phys. 55 582 Gaydon A G Farber and Srivastava 1974 J. Chem. Soc. Faraday Trans. I70 1581 Chapman and Hall) 1968 Dissociation energies and spectra of diatomic molecules, Ginter M L and lnnes K K 1961 J. Mol. Spectrosc. 7 64 3rd ¢d. (London: Girte M L and Battino R 1965 J. Chem. Phys. 42 3222 Huber K P and Herzberg G 1979 Constants ofdiatomic molecules (New York: Van Nostrand Reinhold) Hildenbrand D L and Theard L P 1969 J. Chem. Phys. 50 5350 Hulburt H M and Hirschf©Idcr J O 1941 J. Chem. Phys. 9 61 Kron©kvist M, Lagerqvist A and Neuhaus H 1971 £. Mol. Spectrosc. 39 516 Janardan Singh and Prabhuram 1975 Indian J. Pure Appl. Phys. 13 133 Lippincott E R, Steele D and Caldwell P 1961 J. Chem. Phys. 35 123 Orth F B and Stwalley W C 1979 J. Mol. Spectrosc. 76 17 Neuhaus H 1959 Ark. Fys. 14 551 Pauling L 1960 The nature of chemical bond (New York: Cornell University Press) Steele D, Lippincott E R and Vanderslice J T 1962 Rev. Mod. Phys. 34 2 Singh J, Nair K P R and Rai D K 1970 J. Mol. Struct 5 492 SzSke S and Baitz E 1968 Can. J. Phys. 46 2563 Way K R and Stwalley W C 1973 J. Chem. Phys. 59 5298 Vanderslice J T, Mason E A, Maisch W G and Lippincott E R 1960 J. Mol. Spectrosc. 33 614	<urn:uuid:4e1f5643-28a3-4f62-ad02-8469bacafd71>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	8,769
DRs ÅRSRAPPORT 2016 DRs ÅRSRAPPORT 2016 DRs ÅRSRAPPORT 2016 – INDHOLD A. LEDELSESBERETNING B. LICENSREGNSKABET s.22 05 Licensregnskabet C. REGNSKAB D. LEDELSE A. DRs ÅRSRAPPORT 2016 LEDELSESBERETNING DRs ÅRSRAPPORT 2016 01. PRÆSENTATION AF DR DR er en selvstændig offentlig institution. Rammerne for DRs virksomhed fastsættes i lov om radio- og fjernsynsvirksomhed og tilhørende bekendtgørelser, herunder bekendtgørelse om vedtægt for DR, samt i public service-kontrakten mellem DR og kulturministeren. DRs digitale hovedindgang på nettet er dr.dk, hvor DRs brugere blandt andet kan tilgå nyheder, tv og radio. DRs virksomhed finansieres gennem DRs andel af licensmidlerne samt gennem indtægter ved salg af programmer og andre ydelser. DR skal udøve public service-virksomhed over for hele befolkningen efter principperne i radio- og tv-lovgivningen og i henhold til kravene i public service-kontrakten. DR formidler indhold via tv, radio og net med det formål at samle, udfordre og oplyse befolkningen. DR har seks tv-kanaler: DR1, DR2, DR3, DR K, DR Ultra og DR Ramasjang samt ni radiokanaler: P1, P2, P3, P4, P5, P6 Beat, P7 Mix, P8 Jazz og DR Nyheder. Brugerne kan desuden tilgå DRs indhold via apps til mobile enheder som tablets og smartphones, herunder DR TV-appen, DR Radio-appen og DR Nyheder-appen. Til børn og unge-målgrupperne tilbyder DR digitale indholdsuniverser, som er tilpasset de platforme, som målgrupperne anvender. DR Ramasjang og DR Ultra er både tilgængelige via web og app. DR producerer en bred vifte af indhold, der stilles til rådighed på tværs af DRs platforme, samt køber indhold hos eksterne producenter og andre indholdsudbydere i ind- og udland. DR driver, ud over tv, radio og net, DR Koncerthuset med tilhørende kor og ensembler. DRs ÅRSRAPPORT 2016 Der er i 2016 balance i DRs økonomi med et resultat for året på 3,6 mio. kr. Det flugter med det budgetterede og planlagte resultat for 2016. Med årets resultat har DR, efter et overgangsår i 2015, fuldt tilpasset økonomien til de nye rammer, der blev lagt med Medieaftale 2015-2018, hvor DRs indtægtsgrundlag blev reduceret som følge af afskaffelsen af erhvervslicensen. I 2016 vedtog DR en plan for at styrke DR i hele Danmark. DR besluttede at flytte en række redaktioner og indholdsområder til Aarhus og Aalborg for endnu bedre at kunne dække og afspejle hele Danmark. DR har i 2016 endvidere haft fokus på den digitale omstilling, der sikrer, at DR tager udgangspunkt i brugernes vaner og forbrugsmønstre. DR skal være tilgængelig med tilbud på de platforme, brugerne benytter, og det krævede i 2016 omprioriteringer til investeringer i digitale tilbud og platforme. Derudover er 2016 økonomisk påvirket af, at SKAT ikke inddriver DRs restancer i samme omfang som tidligere. SKATs stop af det automatiske inddrivelsessystem EFI indebærer således i 2016 en stigning i tilgodehavende medielicens samt i tilgodehavende renter og gebyrer. 02. DR I 2016 Den manglende inddrivelse i SKAT resulterer i stigende usikkerhed om, hvorvidt SKAT på sigt igen vil kunne inddrive DRs tilgodehavender effektivt. Derfor oplever DR en øget risiko for fremtidige tab. Størrelsen på hensættelserne til tab er behæftet med usikkerhed, da omfanget af fremtidige tab afhænger af SKATs fremtidige inddrivelseseffektivitet. Konsekvensen af, at restancerne stiger, og hensættelserne øges, er i 2016 et mindreprovenu, i forhold til licensloftet, på 21,9 mio. kr. Dette mindreprovenu dækkes i henhold til medieaftalen fuldt ud af DR. DR har fra årets start haft fokus på risikoen for ikke at nå licensloftet som følge af SKATs stop af EFI. Tilbageholdenhed i DRs driftsomkostninger indebærer, at DR på trods af mindreprovenuet fra licens samlet har et balanceret resultat i 2016. Fokus på indhold DR har fokus på at levere så meget public service-indhold som muligt for licensmidlerne. Det forudsætter, at der er fokus på kerneforretningen og på, at DRs licensmidler prioriteres til indhold til borgerne i Danmark. DR har uden at have fået tilført flere midler øget den andel af DRs økonomi, der bruges til programmer og indhold med ca. 25 pct. i løbet af de seneste fem år, jf. figur 1. DRs andel af licensprovenuet i 2016 er i Medieaftale 2015-2018 fastlagt til 3.696,7 mio. kr. ekskl. merlicensbevillinger mv. Mindreprovenuet på 21,9 mio. kr. betyder, at DRs andel af licensprovenuet er reduceret til 3.674,8 mio. kr. i 2016. I 2016 har DR blandt andet prioriteret midler til investeringer i teknologisk omstilling og nye digitale tilbud til brugerne, herunder eksempelvis nye apps til børn og nyheder. Dette afspejler, at DR fokuserer på at servicere brugerne både på traditionelle medier, såsom tv og radio, og på de nyere webbaserede platforme. Det indebærer flere investeringer og højere udgifter til apps og digitale platforme og dermed, at de senere års stigning i prioriteringen af midler til indhold flader ud på et lidt lavere niveau i 2016 end i 2015. DRs ÅRSRAPPORT 2016 Digital omstilling I 2016 reviderede DR strategien 'Værd at dele – stadig original, mere digital'. Fokus er på at fortsætte arbejdet med den digitale omstilling i DR, der afspejler de ændrede brugervaner i befolkningen – ikke mindst hos de yngre målgrupper. Brugernes, især børnenes og de yngre brugeres, forbrugsmønstre viser, at den digitale omstilling er afgørende for at sikre, at public service også i fremtiden opleves som relevant og nærværende for alle borgere. DR kan og skal ikke diktere, hvordan public service-indhold bruges, men skal tilbyde kvalitetsindhold på de platforme, danskerne benytter. DR i hele Danmark I april 2016 tog DR et stort skridt for at dække, spejle og være mere til stede i hele Danmark. DR besluttede at flytte flere centrale public service-områder til henholdsvis Aalborg og Aarhus. DRs aktiviteter i Aalborg blev udvidet med et nyt center for innovativ formidling af videnskab og undervisning. Centeret skal blandt andet lave radio- og tv-programmer om videnskab, udvikle DRs digitale undervisningsaktiviteter og stå for en ny satsning på videnskabsformidling. Centeret er etableret og udvides gradvist i løbet af 2017. DRs 'Mad og forbrugerstof' er ligeledes samlet, og redaktionerne bag 'Madmagasinet' og 'Kontant' er flyttet fra København til Aarhus. Derudover flytter 'DR Vejret' og 'DR Sporten' primo 2018 også til Aarhus, hvor der blandt andet sendes fra det nye kulturhus Dokk1 på Aarhus Havn. I 2016 udgjorde 'Madmagasinet', 'Kontant', 'DR Sporten' og 'DR Vejret' ca. 20 pct. af det samlede antal egenproducerede førstegangssendetimer i DR. Justeres andelen, således at den afspejler et almindeligt år, hvor der ikke sendes OL og EM i fodbold, er andelen ca. 10 pct. Der er i den reviderede strategi lagt særlig vægt på attraktive digitale tilbud. DR vil blandt andet udvikle DR TV, så indholdet opleves som et fuldt, ligeværdigt og selvstændigt tv-tilbud på linje med og som alternativ og supplement til DRs traditionelle flow-tv-kanaler. Derudover vil tv-kanalen DR Ultra som den første begynde rejsen fra en almindelig tvkanal til et tilbud, hvor det digitale tænkes først, og som på sigt kun kan tilgås på nettet. I DR Aarhus blev kulturredaktionen etableret i 2016. Kulturredaktionen styrker den kritiske kulturjournalistik, så den afspejles bedre i de daglige flader og er repræsentativ for hele landet gennem øget tilstedeværelse og nærhed til historierne og kilderne. Etableringen af kulturredaktionen falder sammen med Aarhus som Europæisk Kulturhovedstad 2017, hvilket er anledning til en ny magasinsatsning til DR2. Flytningen af redaktioner ligger i forlængelse af de senere års arbejde for at dække hele Danmark bedre. DR har generelt øget aktiviteterne uden for hovedstaden og blandt andet styrket de ni P4-distrikter rundt om i landet. Tidligere er DR Aarhus også blevet udvidet med blandt andet en ny velfærdsredaktion og B&U-afdeling, der producerer indhold til børn og unge. DR SPORTEN, DR VEJRET, KONTANT OG MADMAGASINET FLYTTES TIL AARHUS. I 2016 STOD DISSE REDAKTIONER BAG CA. 20% AF DET SAMLEDE ANTAL EGENPRODUCEREDE FØRSTEGANGSSENDETIMER DRs ÅRSRAPPORT 2016 GENNEM PROJEKTET HAR OVER 30.000 BØRN PRØVET KRÆFTER MED KILDEKRITIK OG NYHEDSFORMIDLING I SANDHEDENS TJENESTE Debatskabende public service DR har i 2016 haft fokus på at løfte ambitionerne om at samle, oplyse og udfordre hele befolkningen ved at rykke endnu tættere på danskernes virkelighed samt være til stede ved årets største begivenheder. 'Radioavisen' fejrede desuden 90-års jubilæum i 2016 og nåede i jubilæumsåret stadig omkring halvdelen af befolkningen med nyheder hver dag. Med store temasatsninger om ulighed og integration gik DR tæt på de økonomiske, geografiske, etniske og kulturelle skel i befolkningen og skabte oplysning og debat om levevilkår og livsopfattelser i forskellige dele af Danmark. Samtidig dækkede DR i løbet af året det amerikanske valg og satte i den forbindelse rekord i antallet af brugere på dr.dk, imens 'P1 Morgen' bragte danskerne tæt på begivenhederne i timerne efter valget med det højeste lyttertal i programmets historie. Nyt indhold som eksempelvis den prisvindende podcast-serie 'Nattens dronning' gik helt tæt på hidtil ikke belyste og svært tilgængelige miljøer i det danske samfund. DR3 skabte originale programmer med blandt andet 'Prinsesser fra blokken' og 'Menneskejagt', der undersøgte, om det er muligt at gemme sig i nutidens overvågningssamfund. DRs ÅRSRAPPORT 2016 Public service for børn og unge DR har i 2016 haft fokus på at udvikle nye tilbud til både de små og store børn med afsæt i børnenes egen virkelighed og deres lyst til involvering og medskabelse. Til de 7-12-årige lancerede DR i 2016 en ny Ultra-app og et nyt Ultra-website, der sammen med Ultras tv-kanal skabte rammen om et samlet indholdsunivers med nye muligheder for deltagelse og interaktion. Med fiktionsserien 'Klassen' benyttede DR mulighederne for på tværs af platforme at tilpasse tilbuddet til børnenes døgnrytme og behov og samlede her de store børn om genkendelige problematikker fra deres egen hverdag. De unge bruger i stigende grad mere tid på sociale medier. Derfor har DR3 og P3 i 2016 gennemført forsøg med formidling af public service-indhold på sociale medier. Publicering på sociale medier bringer DR i kontakt med brugere, der sjældent ser eller lytter til DRs øvrige programmer. DRs tilbud følger dermed brugerne, så alle borgere præsenteres for relevant public service-indhold på de platforme, de foretrækker. DR MODTOG I 2016 EN EMMY FOR GENNEM MANGE ÅR AT HAVE BIDRAGET TIL UDVIKLINGEN AF NY OG BANEBRYDENDE TV-DRAMATIK DRs ÅRSRAPPORT 2016 Dialog med befolkningen DR er dagligt i dialog med tusindvis af brugere om ris, ros, tips og kommentarer til DRs programmer og indhold. Mange brugere valgte derudover at møde DRs redaktioner og ledelse ved en lang række offentlige arrangementer, eksempelvis da alle P4's distrikter holdt åbent hus, og ved Kulturmødet på Mors. Derudover kom flere end 30.000 børn fra hele landet helt tæt på DRs nyhedsformidling, da de lærte om digital kildekritik i projektet 'I sandhedens tjeneste'. Stort sportsår Sportsåret 2016 var ekstraordinært med dækning af fodbold EM i Frankrig, PostNord Danmark Rundt og ikke mindst OL og Paralympiske Lege fra Rio. Samtidig har DR stillet skarpt på mindre idrætsgrene som orienteringsløb, atletik, TeamGym og meget mere. DR modtog Emmy for drama i verdensklasse DR modtog i 2016 en Emmy i kategorien 'International Emmy Directorate Award'. Det er en ærespris, som den internationale Emmy-komité giver for DRs vedholdende rolle i udviklingen af originalt tv-drama. Det er en pris, DR deler med alle de kreative talenter i branchen, som har været med til at skabe DRs dramaserier. Senest er 'Arvingerne' og 'Bedrag' på vej ud i verden. Emmy er en anerkendelse af mange års langsigtet investering i kreativ nyskabelse og talentudvikling, hvilket har været muligt, fordi tv-dramatik i Danmark er en væsentlig del af dansk public service. DR Koncerthuset og DRs ensembler DRs kor og orkestre er med en omfattende koncertvirksomhed en væsentlig bidragsyder til dansk musikliv. Hvert år indgår DRs kor og orkestre i omkring 500 tv- og radioudsendelser – fra torsdagskoncerterne på P2 til X Factor på DR1. 2,1 mio. danskere så i 2016 programmer på tv, hvor DRs kor og orkestre indgik. DRs musikere og sangere har ligeledes turneret rundt i landet med eksempelvis 'Messing spiller Mozart' på Koldinghus, H.C. Andersen Prisen i Odense og 'På sporet af julen' i form af musikalske indslag under jule - togtrafikken gennem hele landet. Derudover er 25 af DRs kor og orkestres koncerter også udsendt internationalt via DRs samarbejde med EBU. I 2016 har DR Koncerthuset slået sin egen rekord med 338.000 besøgende gæster til op mod 400 arrangementer. Ud over DRs egne kor og orkestre præsenterer DR Koncerthuset mere end 200 gæstende og turnerende kunstnere fra ind- og udland. Musikken dækker alle genrer og udtryk og henvender sig til alle målgrupper. DR lægger særlig vægt på, at de musikalske tilbud også gælder børn og unge. Takket være etableringen af DR Musikariet har DR i 2016 kunnet gennemføre mere end 100 koncerter for mere end 70.000 børn og unge fra hele landet. Tilgængelighed DR har under mottoet 'Få det hele med' i 2016 øget tilgængeligheden til DRs indhold for mennesker, der har svært ved at høre, se, læse eller forstå. For døve og hørehæmmede var nogle af årets mærkbare forbedringer live-tekstning af masser af sport under sommerens OL. Da Danmark tog guldet hjem i håndboldfinalen, var der også tilbud om tegnsprogstolkning. DRs blinde brugere har nydt godt af flere dramaserier og dokumentarer med synstolkning – ikke mindst årets julekalender 'Den anden verden', vakte glæde hos den yngre del af dette publikum. DR arbejder løbende på at gøre opmærksom på de mange tilbud på tilgængelighedsområdet. I 2016 er det blandt andet sket gennem kampagner til usikre læsere om oplæste undertekster og sitet 'Ligetil – nyheder, der er lette at læse'. HVERT ÅR INDGÅR DRs KOR OG ORKESTRE I OMKRING 500 TV- OG RADIOUDSENDELSER DRs ÅRSRAPPORT 2016 03. DR I HOVED- OG NØGLETAL Regnskab 2016 i hovedtræk Anden virksomhed I 2016 VAR DRs ØKONOMI I BALANCE MED ET ÅRSRESULTAT PÅ 3,6 MIO. KR. DET AFSPEJLER DRs FOKUS PÅ AT TILBYDE BRUGERNE MEST MULIGT KVALITETSINDHOLD DRs samlede resultat for 2016 er på 3,6 mio. kr., jf. tabel 1. Årets resultat flugter med forudsætningerne i DRs økonomiplan for 2015-2018, hvor økonomien i 2016 igen var forudsat at være i balance efter indfasningen af den nye medieaftale og et planlagt underskud i 2015. DR har i 2016 samlede indtægter for 4.133,2 mio. kr., hvilket er en stigning på 107,4 mio. kr. i forhold til 2015. Årsagen til stigningen er blandt andet prisregulering, at DR i 2016 har udsendt flere store dramaserier, der modtog støtte fra Nordvisionsfonden, og som dermed er indtægtsført i 2016, samt en stigning i indtægterne fra rykkergebyr vedrørende licens. DR har i 2016, som konsekvens af SKATs stop af det automatiske inddrivelsessystem EFI, oplevet en stigning i tilgodehavende medielicens samt tilgodehavende renter og gebyrer. Dette skyldes primært, at SKAT ikke inddriver DRs restancer i samme omfang som tidligere. Stigning i DRs tilgodehavende medfører en øget risiko for tab, hvilket medfører, at DR må hensætte en større andel af de udestående licensfordringer, renter og gebyrer til tab. Den økonomiske effekt af de øgede hensættelser i 2016 er et mindreprovenu i DRs licens på 21,9 mio. kr. DRs andel af licensprovenuet i 2016 er i Medieaftale 2015-2018 fastlagt til 3.696,7 mio. kr. ekskl. merlicensbevillinger mv. Mindreprovenuet på 21,9 mio. kr. betyder, at DRs andel af licensprovenuet er reduceret til 3.674,8 mio. kr. i 2016. DR har i hele 2016 haft fokus på risikoen for ikke at nå licensloftet som følge af SKATs stop af EFI. Tilbageholdenhed i DRs omkostninger har medført, at DR på trods af mindreprovenuet opnår et balanceret resultat i 2016. DRs ÅRSRAPPORT 2016 DR aflægger særskilt regnskab for anden virksomhed i henhold til Kulturministeriets bekendtgørelse om adskillelse af public serviceog anden virksomhed. Anden virksomhed udgør en delmængde af DRs samlede aktiviteter og indgår som en del af den samlede regnskabsaflæggelse. Anden virksomhed omfatter hovedsageligt udlejning og kommercielle koncerter mv. i DRs Koncerthus samt aktiviteter i DR Salg, der blandt andet videresælger DRs programmer og dramaserier til udlandet. Årets resultat for anden virksomhed i 2016 viser et overskud på 18,9 mio. kr. efter overførsel af 22 pct. til public service-virksomheden. Overskuddet er i 2016 17,9 mio. kr. højere end i 2015. DR følger kravene i bekendtgørelsen om anden virksomhed og sikrer en rimelig avance og fair konkurrence på markedet. Den øgede omsætning, i forhold til tidligere år, skyldes blandt andet den nye bekendtgørelse 62 af 11. januar 2016, der klassificerer alt salg/videresalg af programmer som aktiviteter, der skal henregnes til anden virksomhed. Bekendtgørelsen trådte i kraft for regnskabsåret 2016. Udvikling i antal ansatte I 2016 beskæftigede DR i gennemsnit 2.766 årsværk i fastere ansættelsesforhold, dette fremgår af tabel 2. DR anvender derudover i forbindelse med spidsbelastningsperioder mv. og ved behov for særlige kompetencer løst tilknyttede medarbejdere, herunder særligt freelancere, der omregnet til fuldtidsbeskæftigede årsværk samlet udgør 578 årsværk i 2016. Hertil kommer i alt 36 årsværk vedrørende fratrådte medarbejdere. Noter: Årsværk er opgjort på baggrund af atp-indbetalinger. Det 'gennemsnitlige antal fuldtidsbeskæftigede' dækker over alle beskæftigede i DR uanset tilknytning til DR, om medarbejderne er aktive i perioden eller på en fratrædelsesordning mv. 'Løst tilknyttede medarbejdere' er særligt freelancere, som i en kortere periode medvirker på en konkret produktion i DR. Endvidere indgår også medarbejdere på sabbat og orlov. 'Årsværk i DR' dækker over produktive fastansatte, tidsbegrænset ansatte, timelønnede og elever/lønnede praktikanter. Noter: 1. Seer- og lytterandel viser andelen af henholdsvis sete tv-minutter og lyttede radiominutter, der er forbrugt på DRs tilbud. 2. Dækning viser andelen af befolkningen, der forbruger DRs tv-tilbud mindst fem sammenhængende minutter om ugen. 3. Der gøres opmærksom på, at data vedr. DRs apps er afrundede. DRs ÅRSRAPPORT 2016 95% AF DEN DANSKE BEFOLKNING ANVENDER UGENTLIGT DRs TILBUD. Det teknisk beregnede samlede antal gennemsnitlige fuldtidsbeskæftigede er steget med 62 årsværk i 2016 i forhold til 2015 til i alt 3.380 årsværk. Dette skyldes primært, at DR har insourcet udvalgte opgaver, samt at 2016 har været et stort produktionsår med blandt andet store sportsbegivenheder. Udvikling i brugen af DRs tilbud Af tabel 3 fremgår udviklingen i DRs tv- og radiodækning, seer- og lytterandel samt brugen af de digitale medier. DR har i 2016 oplevet en samlet stigning i seerandelen på i alt 3 procentpoint, fra 34 pct. i 2015 til 37 pct. i 2016. Seerandelen er et udtryk for sete tv-minutter, der er forbrugt på DRs tilbud. Danskernes generelle forbrug af radio falder i 2016 med 4 minutter i forhold til 2015. I modsætning til tv-mediet taber DR mere lyttetid end det samlede radiomedie, hvilket medfører en faldende lytterandel. Det er særligt P3 og P7 mix, som har mistet lytterandele i 2016. DRs samlede dækning på radio er 82 pct. svarende til dækningen i 2015. Den samlede tid, danskerne bruger på nettet, er steget fra 2015 til 2016. I 2016 kom der en ny markedsmåling af brugen på nettet. Den nye markedsmåling indebærer et metodeskift, og det er derfor ikke muligt direkte at sammenligne brugertallene på nettet med 2015. På en gennemsnitlig uge er DRs digitale produkter i kontakt med 42 pct. af danskerne. Dr.dk når 1,6 mio. brugere på en gennemsnitsuge, og DRs apps har også godt fat i danskerne: tv-appen, DR TV, når bredest ud med 0,4 mio. brugere om ugen. Ekstern udlægning og filmpenge DRs samlede udlægning af produktioner og produktionsfaciliteter mv. til det private marked fremgår af tabel 4. DRs samlede udlægning udgjorde i 2016 473,6 mio. kr. Opgjort efter metoden i public servicekontrakten, hvor der kun kan medregnes udlægning af produktionsfaciliteter op til 60 mio. kr. årligt, udgjorde udlægningen i 2016 i alt 404,1 mio. kr. Udlægningen til det private marked er dermed væsentligt over det gennemsnitlige krav i public servicekontrakten på 300,0 mio. kr. årligt. DR skal i henhold til public service-kontrakten yde kulturstøtte til dansk filmproduktion for i alt 261,4 mio. kr. i perioden 2015-2018 (2016-niveau gennemsnit over kontraktperioden, som reguleres på baggrund af udviklingen i forbrugerprisindekset). Beløbet skal fordeles på spillefilm, kort- og dokumentarfilm og New Danish Screen. DRs afgivne tilsagn vedrørende kulturstøtte til dansk film samt de udbetalte tilskud i 2015 og 2016 fremgår af tabel 5 og 6. DRs ÅRSRAPPORT 2016 Der er i 2016 indgået kontrakter, det vil sige afgivet tilsagn, for 52,2 mio. kr. Samlet er der i 2015 og 2016 indgået kontrakter for 100,0 mio. kr. Det indebærer, at DR i 2017 og 2018 samlet skal støtte og erhverve visningsrettigheder til danske film for i alt 161,4 mio. kr. DR har af de indgåede kontrakter på 100,0 mio. kr. i alt udbetalt 84,9 mio. kr. Det er forventet, at størstedelen af støtten til dansk film sker sidst i medieaftaleperioden, blandt andet fordi store produktioner forsinkes, og nye projekter er under udvikling. DR har som public service-virksomhed et omfattende og gensidigt frugtbart samarbejde med det private marked. DRs indholdsrelaterede betalinger til det private marked udgør således samlet set i størrelsesordenen 1,5 mia. kr. årligt. Udgifterne dækker over blandt andet ekstern udlægning til private produktionsselskaber, kulturstøtte til dansk filmproduktion, kort- og dokumentarfilm samt talentudvikling, betaling til rettighedshavere, eksempelvis musikere, komponister, forfattere mv. og brug af freelancere mv. DR i langsigtet balance DR vil i 2017 fastholde fokus på at sikre langsigtet økonomisk balance, blandt andet ved at tilpasse virksomheden på baggrund af, at det ikke som forventet var muligt at afskaffe den betalte spisepause i DR uafhængigt af overenskomstforhandlingerne. Derudover fortsætter DR i 2017 den digitale omstilling, så både brugere på de mere traditionelle platforme og brugere på digitale medier serviceres bedst muligt. Den fortsatte suspendering af SKATs automatiske inddrivelsessystem EFI kan ligesom i 2016 have betydning for DRs økonomi i 2017. Dette kan betyde et mindreprovenu i licensindtægterne, ligesom det påvirker DRs likviditet. DR SENDTE I 2016 CA. 1,5 MIA. KR. VIDERE TIL ØVRIGE AKTØRER I MEDIE- OG KULTURBRANCHEN DRs ÅRSRAPPORT 2016 04. DRs SAMFUNDSANSVAR OG MILJØHENSYN DR er som Danmarks public service-medieinstitution opmærksom på sin rolle i det danske samfund, herunder at sikre, at alle borgere har fri og lige adgang til et mangfoldigt og originalt indhold af høj kvalitet, der styrker fælles kultur og sammenhængskraft. Etik DR har en række initiativer og målsætninger, der understøtter virksomhedens samfundsansvar og miljøhensyn. I det følgende er der redegjort for de væsentligste initiativer og målsætninger i 2016. DR VÆRNER OM SIN TROVÆRDIGHED OG UAFHÆNGIGHED DRs ÅRSRAPPORT 2016 DR værner om sin troværdighed og uafhængighed. DRs politikker på området er samlet i DRs etiske retningslinjer, der indeholder en række bestemmelser, som skal sikre, at troværdighed og uafhængighed ikke udfordres af personlige eller økonomiske interesser. DRs etiske retningslinjer kan tilgås på DRs hjemmeside dr.dk/etik. DR har eksempelvis en fast og transparent procedure for medarbejderes bibeskæftigelse. Bibeskæftigelse uden for DR forudsætter, at medarbejderen i hvert enkelt tilfælde på forhånd har indhentet en godkendelse fra sin chef. Ansøgningen skal rumme oplysninger om jobbets art og eventuel betaling. Ansøgning om tilladelse til bibeskæftigelse bliver i hvert enkelt tilfælde vurderet ud fra kriterier om, at der ikke må kunne rejses tvivl om interessekonflikter, medarbejderes troværdighed og uafhængighed, samt ud fra omfanget og aflønningen af bibeskæftigelsen. Det fremgår endvidere af de etiske retningslinjer, at medarbejdere eller redaktioner i DR ikke må udnytte deres stilling til at opnå private fordele. DRs ansatte skriver ved ansættelse under på, at de er bekendt med DRs etiske retningslinjer. Nyansatte får endvidere udleveret DRs etiske retningslinjer og modtager en orientering om blandt andet reglerne for bibeskæftigelse samt retningslinjer vedrørende modtagelse af gaver. DRs etik regulerer derudover en lang række øvrige forhold, blandt andet aftaler med medvirkende, ytringsfrihed og brug af sociale medier. DRs arbejde med etik vil også i 2017 være et centralt fokusområde, hvor der arbejdes på nye tiltag og initiativer, blandt andet sikring af DRs uafhængighed af kommercielle interesser i et arbejdsmarked, hvor man i stadig højere grad arbejder med korte ansættelser. Personalepolitik DR har er en værdibaseret personalepolitik. Den er en vigtig del af grundlaget for DRs virksomhed og skal til enhver tid understøtte DRs vision og strategiske mål samt medvirke til at styrke og binde DR sammen. Hovedpunkterne i DRs personalepolitik er at fremme en virksomhedskultur med samarbejde i højsædet, hvor der lægges vægt på et godt fysisk og psykisk arbejdsmiljø. DR ønsker løbende at sikre strategisk kompetenceudvikling med fokus på at fastholde og udfordre fagligt dygtige medarbejdere samt at sikre, at rekrutteringsprocesserne understøtter DRs ønske om mangfoldighed, således at det danske samfund afspejles f.eks. med hensyn til etnicitet, køn, religion, alder, handicap og nedsat arbejdsevne. Personalepolitikken har i 2016 været afsæt for en række forskellige aktiviteter. DR Akademiet er et kompetenceudviklingsforløb for medarbejdere og chefer, der arbejder med udviklingen af DRs digitale indhold og platforme. DR Akademiet bidrager til at skærpe deltagernes faglige kompetencer og skabe en kulturel forandring. DR tilbyder endvidere seks-otte gange om året alle medarbejdere deltagelse i pionermøder med korte faglige oplæg om de muligheder, udfordringer og tendenser, som påvirker og præger medieudviklingen. Pionermøderne fortsætter i 2017. DR bidrager hvert år til uddannelsen af studerende og elever ved at give mulighed for praktikophold i DR. Det gælder både journalistiske praktikanter, akademiske praktikanter, skolepraktikanter og elever/lærlinge fra en lang række erhvervsuddannelser som kontor, event, VVS, FTP, snedker m.v. I 2016 havde DR 90 journalistiske praktikanter, 154 akademiske praktikanter og 42 elever/ lærlinge under uddannelse. I DR samarbejder ledelse og medarbejdere i hele organisationen for at sikre en fremtidsorienteret og engagerende arbejdsplads. DR lægger stor vægt på medbestemmelse, inddragelse, gennemsigtighed og tillid. I forlængelse heraf har alle DRs samarbejdsudvalg gennemført et forløb om 'Den gode dialog som forandringsværktøj'. Forløbet tog sigte på at styrke anvendelsen af dialog som værktøj i samarbejdsudvalgene, hvor man sammen undersøger muligheden for at skabe en fælles, bæredygtig beslutning. Indkøb og krav til leverandører DRs indkøbspolitik sætter rammerne for indkøb i DR. Indkøbspolitikken fastsætter retningslinjerne for DRs anskaffelser med henblik på at sikre effektivt indkøb, transparens og gennemsigtighed via konkurrenceudsættelse samt fokus på sociale og miljømæssige hensyn. Af DRs politikker på området fremgår det blandt andet, at DR støtter internationale principper omkring social og samfundsmæssig ansvarlighed blandt andet i forhold til miljø og arbejdsmiljø. Igennem DRs standardkontrakter arbejdes der med social ansvarlighed i forhold til at overholde principperne i FN´s Global Compact inden for områderne menneskerettigheder, arbejdstagerrettigheder og antikorruption. DR anvender efter en konkret vurdering desuden arbejdsklausuler særligt ved byggeog anlægsprojekter og ved større drifts- og tjenesteydelseskontrakter med høj grad af manuelt arbejde, som rengøring, intern service, bygningsteknik mv., men også andre typer af kontrakter og aftaler. I 2016 har DR blandt andet opstillet særlige krav til sine leverandører på flere områder, herunder DRs EU-udbud af taxabefordring, hvor der stilles krav til miljø og energi ud fra en samlet vurdering af, hvor miljø- og energirigtige de tilbudte taxier er. I DRs EU-udbud af kontorartikelordninger er der arbejdet med at implementere mere 'grønne' og miljørigtige kontorartikler som erstatning for konventionelle produkter. Og i DRs nationalt udbudte U-landskalender 2016 blev der lagt vægt på blandt andet miljøcertificering, miljømærkestandarder og arbejdsmiljø i form af løft, arbejdsstillinger og støj mv. DRs ÅRSRAPPORT 2016 Balanceret kønsfordeling for ledere og ligeløn i DR DR prioriterer, at både mænd og kvinder kommer i betragtning ved rekruttering til lederstillinger. DRs fokus på en balanceret kønsfordeling blandt DRs ledere er formuleret i en politik, der har til formål at sikre, at kvinder og mænd har lige muligheder for at gøre chefkarriere i DR. DRs politik for en balanceret kønsfordeling indebærer blandt andet en målsætning om, at det underrepræsenterede køn blandt cheferne skal udgøre mindst 40 pct. af det samlede antal chefer i DR. DR følger årligt op på målsætningen og afrapporterer blandt andet i DRs årsrapport. DRs daglige, øverste ledelsesorgan er direktionen. Direktionen består af seks bestyrelsesansatte direktører, hvoraf to er mænd og fire er kvinder. Det underrepræsenterede køn udgør således 33 pct. Ligeløn i DR DR følger en gang om året op på den kønsmæssige lønforskel i organisationen. DR har fra 2016 foretaget beregningen ud fra vægtede gennemsnit, således at overenskomster, hvorpå der er mange ansatte, vægter forholdsmæssigt mere end overenskomster, hvorpå der er få ansatte. Beregning er foretaget både for 2015 og 2016 for at sikre et retvisende sammenligningsgrundlag. Ved udgangen af 2016 var mændenes lønniveau 3,4 pct. højere end kvindernes. Ved udgangen af 2015 var forskellen 3,7 pct. Forskellen på lønniveauet blandt kvinder og mænd skal ses i lyset af, at DR har en højere andel af kvinder i faggrupper, der generelt har et lønniveau, der ligger under gennemsnittet. Sammenlignes kvindernes og mændenes lønniveau inden for de enkelte overenskomstgrupper, er mændenes gennemsnitlige lønniveau 1,1 pct. højere end kvindernes i 2016, hvilket er på samme niveau som i 2015. DRs bestyrelse har 11 medlemmer. Heraf udpeges tre af kulturministeren, seks af Folketingets partier og to vælges af DRs medarbejdere. Ved udgangen af 2016 er fordelingen mellem kønnene fem mænd og fire kvinder blandt de politisk udpegede, mens de medarbejdervalgte medlemmer er én mand og én kvinde. DR FORTSÆTTER ARBEJDET MED AT SIKRE LIGE MULIGHEDER FOR, AT BÅDE MÆND OG KVINDER KOMMER I BETRAGTNING TIL LEDERSTILLINGER. DRs ÅRSRAPPORT 2016 Blandt øvrige chefer er status, at der er henholdsvis 34,9 pct. kvinder i DR ved udgangen af 2016 mod 36,5 pct. i 2015 og 65,1 pct. mænd ved udgangen af 2016 mod 63,5 pct. i 2015. I forhold til DRs politik om en balanceret kønsfordeling betyder det, at målet om, at det underrepræsenterede køn skal udgøre minimum 40 pct., ikke er opfyldt i 2016. DR vil i 2017 fortsætte arbejdet med at sikre, at både mænd og kvinder kommer i betragtning til lederstillingerne, så DR tilnærmer sig målsætningen om en mere balanceret kønsfordeling. DRs MANGEÅRIGE FOKUS PÅ SYSTEMATISK PROFESSIONEL STYRING OG OPTIMERING AF FACILITETER ER BELØNNET MED DRIFTSHERREPRISEN. Miljø og klima DRs miljø- og klimaregnskab for 2016 omfatter CO2-bidrag fra DRs direkte og indirekte energi- og brændstofforbrug i DR Byen, DRs bygninger rundt om i landet og TV-Byen i Søborg samt fra DRs affaldsbortskaffelse. Miljø- og klimaregnskabet for 2016 indeholder CO2-bidrag fra affaldsbortskaffelsen, fra el- og fjernvarmeselskabernes energitab under transmission og distribution samt fra medarbejdernes transport under arbejdet ved brug af tog, lejede biler og busser. DRs klimaregnskab i årsregnskabet for 2016 er baseret på Klimakompassets CO2-beregner. DRs samlede CO2-regnskab er med i alt ca. 11.559 tons udledt CO2 i 2016 på nogenlunde samme niveau som for 2015, med et marginalt fald. DRs primære kilde til CO2udledning er elforbruget. Energireduktion DR har kontinuerligt fokus på nedbringelse af miljøbelastningen. Hvert år afsætter DR en pulje til at gennemføre rentable energioptimeringsprojekter inden for ventilation, køl, varme og belysning. Herudover er der generelt fokus på at indkøbe energibesparende teknologi for på den måde at nedbringe CO2-udledningen. Når DR foretager bygningsvedligehold, bliver bygningsdelenes fremtidige drifts- og vedligeholdelsesomkostninger medtænkt i det enkelte projekt, da DR har fokus på totaløkonomien. På den måde formår DR hvert år at reducere virksomhedens CO2udledning samt at allokere flere penge til tvog radioproduktion. På baggrund af DRs fokus på systematisk professionel styring af faciliteter og fokus på balance mellem lave omkostninger og bedre faciliteter, skabt ud fra et fælles virksomhedsperspektiv, fik DR i 2017 Driftsherreprisen. Prisen er blandt andet uddelt på baggrund af, at DRs ejendomme og serviceafdeling har formået at understøtte DRs kerneforretning ved at levere pålidelige ydelser, skabe trivsel og sikre værdierne på alle DRs lokationer samt at blive betragtet som en strategisk samarbejdspartner for hele organisationen. DRs ÅRSRAPPORT 2016 I perioden fra 2011 til 2016 er der sket en reduktion af DRs samlede elforbrug på cirka 14 pct. Alene fra 2015 til 2016 er elforbruget reduceret med cirka 650 MWh, svarende til cirka 130 parcelhuses årlige elforbrug. Målet for 2017 er at reducere elforbruget med yderligere 400 MWh, hvilket svarer til 80 parcelhuses årlige elforbrug. I forbindelse med insourcing af udvalgte dele af ejendomsdriften i DR er der kommet endnu mere fokus på at minimere DRs varmeforbrug via byggetekniske tiltag og driftsoptimeringer.Det gradkorrigerede varmeforbrug, der tager højde for antallet af varme og kolde dage, var i 2016 på 15.871 MWh, hvilket er et fald på 0,24 pct. i forhold til det gradkorrigerede varmeforbrug i 2015 på 15.942 MWh. Vand DR brugte i 2016 i alt 34.276 m3 vand, hvilket er en stigning på 6,8 pct. i forhold til 2015. DR Byens opsamling af regnvand har isoleret set bidraget til at reducere vandforbruget med 1.787 m3, hvilket er en stigning på cirka 837 m3 i forhold til 2015. En del af årsagen til merforbruget på vand er, at DR for at reducere miljøbelastningen har fjernet plastservice i DR Byen, og at der derfor bruges mere vand til opvask af service. Affald DR har opbygget en velfungerende affaldssortering, der er baseret på medarbejdernes kildesortering. I 2016 var de samlede affaldsmængder 735 tons. Af affaldet gik 38 pct. til genanvendelse, mens 58 pct. gik til forbrænding. De sidste 4 pct. gik til deponi eller særlig behandling. Risici og risikostyring DR arbejder systematisk med at identificere væsentlige risici, der kan påvirke DRs drift og udviklingsmuligheder. Arbejdet tager udgangspunkt i et risikostyringskoncept med fokus på teknologiske, økonomiske og udsendelsesrelevante risici. Risikostyringen er implementeret som en integreret del af den løbende driftsstyring og økonomiopfølgning. DR har blandt andet fokus på økonomistyring, likviditetsstyring, IT-sikkerhed og fortrolige data. DR arbejder kontinuerligt på en omkostningseffektiv forbedring af processer, procedurer, overvågning mv., så sandsynligheden for forretningsskadelige hændelser reduceres mest muligt. B. DRs ÅRSRAPPORT 2016 LICENSREGNSKABET DRs ÅRSRAPPORT 2016 05. LICENSREGNSKABET Medieaftale 2015-2018 Den 26. juni 2014 indgik regeringen (Socialdemokraterne og Radikale Venstre) en ny mediepolitisk aftale med Venstre, Dansk Folkeparti, Socialistisk Folkeparti, Enhedslisten, Liberal Alliance og Det Konservative Folkeparti. Det fremgår heraf, at licensindtægterne giver DR en forpligtelse over for TV 2-regionerne og Kulturministeriet m.fl. på i alt 2.934,8 mio. kr. (2014-prisniveau) for den fireårige periode. Merprovenu i forhold til det forventede licensprovenu bliver fordelt af kulturministeren, jf. radio- og fjernsynslovens § 69, stk. 1, efter drøftelse med aftaleparterne. Det fremgår af Medieaftale 2015-2018, at halvdelen af merprovenuet som udgangspunkt tildeles DR. Den anden halvdel fordeles til øvrige formål. Et eventuelt mindreprovenu vil som hovedregel indebære en reduktion af licenstilførslen til DR. Medielicens i Danmark DR har ansvaret for opkrævning af medielicens på vegne af Kulturministeriet. DR modtager licensindtægter fra licensbetalerne i Danmark, afregner moms til staten og fordeler herefter licensindtægterne til licensmodtagerne. Det vil sige, at medielicensen fordeles til DR, TV 2-regionerne og Kulturministeriet, der viderefordeler til blandt andet lokalradio og -tv, Radio24syv, Public Service-Pulje mv., efter de retningslinjer, der er fastsat i regnskabsårets gældende medieaftale, for nuværende Medieaftale 2015-2018. Licensregnskabet Licensregnskabet viser et resultat på i alt 4.411,3 mio. kr. før fordeling, hvilket er et fald på 65,5 mio. kr. i forhold til 2015, jf. tabel 7. Faldet kan primært henføres til hensættelser til tab på licensdebitorer. I 2016 har der været en stigning af tilgodehavender fra licens, der i al væsentlighed kan henføres til SKATs suspendering af det automatiske inddrivelsessystem EFI. De øgede tilgodehavender fra licens medfører, at hensættelen til tab på LICENSEN FORDELES MELLEM DR, TV 2-REGIONERNE, RADIO24SYV, PUBLIC SERVICE-PULJEN MV. licensdebitorer i 2016 stiger. Modsatrettet er der en stigning i indtægterne fra husstandslicens. Stigningen i indtægter fra husstandslicensen skyldes prisregulering og en nettotilgang af tilmeldte husstande. Samlet resulterer disse modgående bevægelser i et fald på 65,5 mio. kr. på licensindtægterne. DRs licensloft er i Medieaftale 2015-2018 bestemt til 3.696,7 mio. kr. i 2016, jf. tabel 8. Grundet mindreprovenu på i alt 21,9 mio. kr., er DRs samlede licensindtægter reduceret fra 3.696,7 til 3.674,8 mio. kr. Medieaftale 2015-2018 angiver faste beløb pr. år, der – uanset de samlede licensindtægters størrelse – skal afregnes fuldt ud til henholdsvis TV 2-regionerne og Kulturministeriet m.fl. Medieaftale 2015-2018 indeholder endvidere et loft for DRs andel af licensindtægterne. Der er på den baggrund i 2016 et mindreprovenu på i alt 21,9 mio. kr. til DR i forhold til den i Medieaftale 2015-2018 fastsatte fordeling af licensindtægterne. DR modtog i 2016 i alt 3.674,8 mio. kr. efter fradrag af mindreprovenu på 21,9 mio. kr., TV 2's regionale virksomheder modtog som forudsat 515,8 mio. kr., mens Kulturministeriet m.fl. modtog 220,7 mio. kr., jf. tabel 7. Fordelingen indebærer, at DR, efter at moms på licensindtægterne er afregnet til staten, modtager 83,8 pct., TV 2's regionale virksomheder modtager 11,7 pct., og Kulturministeriet m.fl. modtager 5,0 pct. af de overførte midler i henhold til Medieaftale 2015-2018 og bilag hertil. DRs ÅRSRAPPORT 2016 Medielicensen er fastsat i Kulturministeriets bekendtgørelse om licens, jf. Bekendtgørelse om ændring af bekendtgørelse om medielicens nr. 1029 af 1. september 2015. I 2016 udgjorde en husstands medielicens 1.238,5 kr. pr. halvår, jf. tabel 9. Den årlige medielicens går til en række forskellige parter og formål. Af figur 2 fremgår det, hvordan den enkelte husstands årlige licens blev fordelt i 2016. Figuren tager udgangspunkt i den besluttede fordeling i Medieaftale 2015-2018. Det vil sige, at fordelingen af licensmidler er beregnet på baggrund af opnåelse af licensloftet. I realiteten betyder mindreprovenuet på 21,9 mio. kr., at DR modtager færre midler pr. husstandslicens. Af en samlet årlig husstandslicens i 2016 på 2.477 kr. gik 495 kr. til moms, mens DR modtog 1.652 kr. TV 2-regionerne modtog 231 kr. pr. husstandslicens. Radio24syv modtog 41 kr. pr. husstandslicens. Den resterende andel af husstandslicensen gik til lokalradio- og tv (23 kr.), Public ServicePuljen (16 kr.), Det Danske Filminstitut (11 kr.), Kulturstyrelsen (3 kr.), Station Next (3 kr.) og til mediestatistik (2 kr.). * ekskl. gebyr FIGUR 2 FORDELING AF HUSSTANDSLICENS I HELE KR. INKL. MOMS DRs ÅRSRAPPORT 2016 DR 1.652 kr. (66,7 %) MOMS 495 kr. (20,0 %) TV 2-REGIONERNE 231 kr. (9,3 %) RADIO24SYV 41 kr. (1,7 %) LOKALRADIO OG -TV 23 kr. (0,9 %) PUBLIC SERVICE-PULJEN 16 kr. (0,6 %) DET DANSKE FILMINSTITUT 11 kr. (0,5 %) KULTURSTYRELSEN 3 kr. (0,1 %) STATION NEXT 3 kr. (0,1 %) MEDIESTATISTIK 2 kr. (0,1 %) C. DRs ÅRSRAPPORT 2016 REGNSKAB DRs ÅRSRAPPORT 2016 LEDELSENS REGNSKABSPÅTEGNING 06. Bestyrelsen og direktionen har aflagt årsrapport for regnskabsåret 1. januar - 31. december 2016 for DR. Årsrapporten er behandlet og vedtaget dags dato. Årsrapporten er aflagt i overensstemmelse med bekendtgørelsen om vedtægt for DR, Kulturministeriets bekendtgørelse om regnskabsmæssig adskillelse mellem public service-virksomhed og anden virksomhed og årsregnskabslovens principper. Vi anser den valgte regnskabspraksis for hensigtsmæssig og de udøvede regnskabsmæssige skøn for forsvarlige, ligesom årsrapporten efter vores opfattelse indeholder de oplysninger, der er relevante for at bedømme DRs økonomiske forhold. Det er derfor vores opfattelse, at årsregnskabet giver et retvisende billede af DRs aktiver og passiver, den finansielle stilling samt af resultatet af DRs aktiviteter og pengestrømme for regnskabsåret 2016. Det er endvidere vores opfattelse, at ledelsesberetningen indeholder en retvisende redegørelse for udviklingen i DRs aktiviteter og økonomiske forhold, årets resultat og DRs finansielle stilling som helhed og en beskrivelse af de væsentligste risici og usikkerhedsfaktorer, som DR står over for. Årsrapporten indstilles til kulturministerens godkendelse. København, den 27. april 2017 Direktionen Maria Rørbye Rønn Generaldirektør Nikolas Lyhne-Knudsen Økonomidirektør Bestyrelsen Michael Christiansen Formand Trine Gregorius Næstformand Line Barfod Nanna Kalinka Bjerke Dan Boyter Katrine Winkel Holm Hanne Ried Larsen (medarbejdervalgt) Torben Dalby Larsen Lars L. Nielsen Dennis Nørmark Stig Paulsen (medarbejdervalgt) DRs ÅRSRAPPORT 2016 07. DEN UAFHÆNGIGE REVISORS PÅTEGNING Til kulturministeren Revisors ansvar for revisionen af årsregnskabet Revisionspåtegning på årsregnskabet Konklusion Vi har revideret årsregnskabet for DR for regnskabsåret 1. januar - 31. december 2016, der omfatter resultatopgørelse, balance, egenkapitalopgørelse, pengestrømsopgørelse og noter, herunder anvendt regnskabspraksis, som anført i noter til årsregnskabet, som fremgår af afsnit 12. Årsregnskabet udarbejdes efter årsregnskabslovens principper. Årsregnskabet aflægges efter lov om radio- og fjernsynsvirksomhed, bekendtgørelse om vedtægt for DR, bekendtgørelse om regnskabsmæssig adskillelse mellem public service-virksomhed og anden virksomhed samt årsregnskabslovens principper. Det er vores opfattelse, at årsregnskabet giver et retvisende billede af DRs aktiver, passiver og finansielle stilling pr. 31. december 2016 samt af resultatet af DRs aktiviteter og pengestrømme for regnskabsåret 1. januar - 31. december 2016 i overensstemmelse med årsregnskabslovens principper. Grundlag for konklusion Vi har udført vores revision i overensstemmelse med god offentlig revisionsskik, idet revisionen udføres på grundlag af bestemmelserne i rigsrevisorloven. God offentlig revisionsskik er baseret på de grundlæggende revisionsprincipper i rigsrevisionernes internationale standarder (ISSAI 100-999). Vores ansvar ifølge disse standarder og krav er nærmere beskrevet i revisionspåtegningens afsnit "Revisors ansvar for revisionen af årsregnskabet". Rigsrevisor er uafhængig af DR i overensstemmelse med rigsrevisorloven § 1, stk. 6. Det er vores opfattelse, at det opnåede revisionsbevis er tilstrækkeligt og egnet som grundlag for vores konklusion. Vores mål er at opnå høj grad af sikkerhed for, om årsregnskabet som helhed er uden væsentlig fejlinformation, uanset om denne skyldes besvigelser eller fejl, og at afgive en revisionspåtegning med en konklusion. Høj grad af sikkerhed er et højt niveau af sikkerhed, men er ikke en garanti for, at en revision, der udføres i overensstemmelse med god offentlig revisionsskik, altid vil afdække væsentlig fejlinformation, når sådan findes. Fejlinformationer kan opstå som følge af besvigelser eller fejl og kan betragtes som væsentlige, hvis det med rimelighed kan forventes, at de enkeltvis eller samlet har indflydelse på de økonomiske beslutninger, som regnskabsbrugerne træffer på grundlag af årsregnskabet. Som led i en revision, der udføres i overensstemmelse med god offentlig revisionsskik, foretager vi faglige vurderinger og opretholder professionel skepsis under revisionen. Herudover: — — Identificerer og vurderer vi risikoen for væsentlig fejlinformation i årsregnskabet, uanset om denne skyldes besvigelser eller fejl, udformer og udfører revisionshandlinger som reaktion på disse risici samt opnår revisionsbevis, der er tilstrækkeligt og egnet til at danne grundlag for vores konklusion. Risikoen for ikke at opdage væsentlig fejlinformation forårsaget af besvigelser er højere end ved væsentlig fejlinformation forårsaget af fejl, idet besvigelser kan omfatte sammensværgelser, dokumentfalsk, bevidste udeladelser, vildledning eller tilsidesættelse af intern kontrol. — — Opnår vi forståelse af den interne kontrol med relevans for revisionen for at kunne udforme revisionshandlinger, der er passende efter omstændighederne, men ikke for at kunne udtrykke en konklusion om effektiviteten af DRs interne kontrol. — — Tager vi stilling til, om den regnskabspraksis, som er anvendt af ledelsen, er passende, samt om de regnskabsmæssige skøn Fremhævelse af forhold i regnskabet DRs hensættelse til tab på licensdebitorer på 776 mio. kr. ud af et samlet licenstilgodehavende på 1.473 mio. kr. er forbundet med væsentlige regnskabsmæssige skøn og væsentlig usikkerhed. DRs ledelse omtaler i ledelsesberetningen, at størrelsen på hensættelsen er behæftet med stor usikkerhed. Hensættelsen og usikkerheden er en konsekvens af de aktuelle udfordringer med SKATs inddrivelse af licens gennem det fælles inddrivelsessystem EFI. Ledelsens ansvar for årsregnskabet Ledelsen har ansvaret for udarbejdelsen af et årsregnskab, der giver et retvisende billede i overensstemmelse med årsregnskabslovens principper. Ledelsen har endvidere ansvaret for den interne kontrol, som ledelsen anser for nødvendig for at udarbejde et årsregnskab uden væsentlig fejlinformation, uanset om denne skyldes besvigelser eller fejl. Ved udarbejdelsen af årsregnskabet er ledelsen ansvarlig for at vurdere DRs evne til at fortsætte driften; at oplyse om forhold vedrørende fortsat drift, hvor dette er relevant; samt at udarbejde årsregnskabet på grundlag af regnskabsprincippet om fortsat drift, medmindre ledelsen enten har til hensigt at likvidere DR, indstille driften eller ikke har andet realistisk alternativ end at gøre dette. DRs ÅRSRAPPORT 2016 og tilknyttede oplysninger, som ledelsen har udarbejdet, er rimelige. — — Konkluderer vi, om ledelsens udarbejdelse af årsregnskabet på grundlag af regnskabsprincippet om fortsat drift er passende, samt om der på grundlag af det opnåede revisionsbevis er væsentlig usikkerhed forbundet med begivenheder eller forhold, der kan skabe betydelig tvivl om DRs evne til at fortsætte driften. Hvis vi konkluderer, at der er en væsentlig usikkerhed, skal vi i vores revisionspåtegning gøre opmærksom på oplysninger herom i årsregnskabet eller, hvis sådanne oplysninger ikke er tilstrækkelige, modificere vores konklusion. Vores konklusioner er baseret på det revisionsbevis, der er opnået frem til datoen for vores revisionspåtegning. Fremtidige begivenheder eller forhold kan dog medføre, at DR ikke længere kan fortsætte driften. — — Tager vi stilling til den samlede præsentation, struktur og indhold af årsregnskabet, herunder noteoplysningerne, samt om årsregnskabet afspejler de underliggende transaktioner og begivenheder på en sådan måde, at der gives et retvisende billede heraf. Vi kommunikerer med den øverste ledelse om blandt andet det planlagte omfang og den tidsmæssige placering af revisionen samt betydelige revisionsmæssige observationer, herunder eventuelle betydelige mangler i intern kontrol, som vi identificerer under revisionen. Udtalelse om ledelsesberetningen Ledelsen er ansvarlig for ledelsesberetningen. Vores konklusion om årsregnskabet omfatter ikke ledelsesberetningen, og vi udtrykker ingen form for konklusion med sikkerhed om ledelsesberetningen. I tilknytning til vores revision af årsregnskabet er det vores ansvar at læse ledelsesberetningen og i den forbindelse overveje, om ledelsesberetningen er væsentligt inkonsistent med årsregnskabet eller vores viden opnået ved revisionen eller på anden måde synes at indeholde væsentlig fejlinformation. Vores ansvar er derudover at overveje, om ledelsesberetningen indeholder krævede oplysninger i henhold til årsregnskabsloven. Baseret på det udførte arbejde er det vores opfattelse, at ledelsesberetningen er i overensstemmelse med årsregnskabet og er udarbejdet i overensstemmelse med kravene i årsregnskabsloven. Vi har ikke fundet væsentlig fejlinformation i ledelsesberetningen. Udtalelse om juridisk-kritisk revision og forvaltningsrevision Ledelsen er ansvarlig for, at de dispositioner, der er omfattet af regnskabsaflæggelsen, er i overensstemmelse med meddelte bevillinger, love og andre forskrifter samt med indgåede aftaler og sædvanlig praksis; og at der er taget skyldige økonomiske hensyn ved forvaltningen af de midler og driften der er omfattet af regnskabet. I tilknytning til vores revision af årsregnskabet er det i overensstemmelse med god offentlig revisionsskik vores ansvar at udvælge relevante emner til såvel juridisk-kritisk revision som forvaltningsrevision. Ved juridisk-kritisk revision efterprøver vi med høj grad af sikkerhed for de udvalgte emner, om de dispositioner, der er omfattet af regnskabsaflæggelsen, er i overensstemmelse med meddelte bevillinger, love og andre forskrifter samt med indgåede aftaler og sædvanlig praksis. Ved forvaltningsrevision vurderer vi med høj grad af sikkerhed, om de undersøgte systemer, processer eller dispositioner understøtter skyldige økonomiske hensyn ved forvaltningen af de midler og driften, der er omfattet af regnskabet. Hvis vi på grundlag af det udførte arbejde konkluderer, at der er anledning til væsentlige kritiske bemærkninger, skal vi rapportere herom. Vi har ingen væsentlige kritiske bemærkninger at rapportere i den forbindelse. København, den 27. april 2017 Rigsrevisionen CVR-nr. 77 80 61 13 Lone Strøm Rigsrevisor Kai Nybo Kontorchef DRs ÅRSRAPPORT 2016 08. RESULTATOPGØRELSE 1. januar - 31. december DRs ÅRSRAPPORT 2016 31. december DRs ÅRSRAPPORT 2016 31. december Øvrige noter Eventualforpligtelser samt andre økonomiske forpligtelser Begivenheder efter balancedagen Nærtstående parter Honorar til underleverandør af revisionsydelser Delregnskab for public service-virksomhed og anden virksomhed Nettoomkostninger ved public service-virksomhed 24 25 26 27 28 29 DRs ÅRSRAPPORT 2016 10. EGENKAPITALOPGØRELSE DRs ÅRSRAPPORT 2016 11. PENGESTRØMS- OPGØRELSE DR har løbende en kassekredit på 100 mio. kr. til rådighed. DRs ÅRSRAPPORT 2016 NOTE 1 Anvendt regnskabspraksis Regnskabsgrundlag Årsrapporten for DR for 2016 er aflagt i overensstemmelse med årsregnskabslovens principper for store virksomheder i regnskabsklasse C (stor), vedtægternes krav og bekendtgørelse om regnskabsmæssig adskillelse mellem public service-virksomhed og anden virksomhed. Årsregnskabet for 2016 er aflagt i mio. kr. Regnskabspraksis er uændret i forhold til sidste år. Der er foretaget enkelte reklassifikationer af sammenligningstal, som ikke påvirker årets resultat eller egenkapitalen. Ny årsregnskabslov med virkning fra 1. januar 2016 DR aflægger regnskab i overensstemmelse med årsregnskabslovens principper. Årsregnskabsloven er ændret med ikrafttrædelse fra den 1. juli 2015 og med virkning for regnskabsår, der begynder den 1. januar 2016 eller senere. Effekten af de ændrede lovkrav er indarbejdet i årsregnskabet for 2016 og udgør i væsentligste forstand følgende ændringer: — — Aktuarmæssige reguleringer af hensættelser til tjenestemandspension, efterløn samt understøttelser føres direkte over egenkapitalen. Resultateffekten af denne ændring svarer til størrelsen af årets aktuarmæssige reguleringer, og har i 2016 en positiv påvirkning på 10,7 mio. kr. — — DR anvender muligheden for at undlade aktivering af IPO på anlægsaktiver. Som følge af årsregnskabslovens overgangsbestemmelser er denne ændring implementeret med fremadrettet virkning. Aktiveret IPO i regnskabsårene før 2016 er derfor fortsat indregnet i årsregnskabet for 2016 og afskrives efter hidtidig regnskabspraksis 12. NOTER TIL ÅRSREGNSKABET med en afskrivningshorisont på 3 år. I 2016 vil der på denne baggrund være en estimeret negativ resultateffekt på 9,2 mio. kr. som følge af afskrivning på den indregnede IPO på overgangstidspunktet. — — Tab på tilgodehavende renter ville have medført en utilsigtet forværring af DRs regnskab på ca. 0,9 mio. kr., såfremt hensættelsen ikke var justeret i forhold til DRs forventning om fremtidig inddrivelse. — — Aktiverede udviklingsomkostninger bindes som en individuel reserve på egenkapitalen. Bindingen opløses ved lineære afskrivninger og nedskrivninger, der følger anvendt regnskabspraksis for immaterielle anlægsaktiver. Bindingen har ingen resultatmæssig effekt for DRs årsregnskab. Ændringer i regnskabsmæssige skøn, jf. ÅRL §52, stk. 1 Det regnskabsmæssige skøn vedrørende hensættelse til forventet tab på licensdebitorer, er justeret pr. 31. december 2016. Justeringen afspejler primært, at DR forventer, at den stigende restancemængde, der er en konsekvens af de aktuelle udfordringer med SKATs inddrivelse gennem EFI (Et fælles inddrivelsessystem), på sigt vil blive reduceret, når SKATs inddrivelse normaliseres. DR forventer således, at de restancer, der opbygges på grund af situationen i SKAT, i væsentligt omfang vil blive inddrevet på sigt. Størrelsen på hensættelsen er dog behæftet med usikkerhed, da denne er direkte afhængig af SKATs fremtidige inddrivelseseffektivitet. Der er pr. 31. december 2016 foretaget en individuel vurdering af de anvendte hensættelsesprocenter, ud fra licensfordringernes aldersfordeling. Såfremt de regnskabsmæssige skøn vedrørende hensættelse til tab på henholdsvis tilgodehavender fra licens, renter og gebyrer, ikke var blevet justeret for at afspejle DRs forventning til SKATs fremtidige inddrivelsesevne, ville DRs regnskab være påvirket med følgende effekt: — — Tab på tilgodehavender fra licens ville have medført en utilsigtet forværring af licensregnskabet samt DRs regnskab på ca. 31 mio. kr., såfremt hensættelsen ikke var justeret i forhold til DRs forventning om fremtidig inddrivelse. DRs ÅRSRAPPORT 2016 — — Tab på tilgodehavende gebyrer ville have medført en utilsigtet forværring af DRs regnskab på ca. 4,6 mio. kr., såfremt hensættelsen ikke var justeret i forhold til DRs forventning om fremtidig inddrivelse. Herudover har DR foretaget en førstegangsindregning af tilgodehavende inddrivelsesrenter hos SKAT. Bruttoeffekten på DRs regnskab udgør en indtægt på 211 mio. kr. Heraf er hensat 181 mio. kr. til tab. Den samlede nettoeffekt på DRs regnskab udgør en indtægt på 30 mio. kr. Væsentlige regnskabsmæssige skøn Følgende regnskabsposter indeholder væsentlige regnskabsmæssige skøn: — — Afskrivninger og nedskrivninger af anlægsaktiver. — — Programrettigheder og forudbetalinger vedrørende programlagre. — — Hensættelser, herunder blandt andet udfald af retssager og tvister, aktuarmæssig opgjorte pensionsforpligtelser, nedskrivning til imødegåelse af tab på licenstilgodehavende mv. — — IPO, herunder blandt andet opgørelse og fordeling heraf. Ændringer i regnskabsmæssige skøn er indregnet i resultatopgørelsen og balancen på poster, hvor ændringer har effekt for DRs regnskab. Årlige ændringer i ledelsesvurdering og skøn følger blandt andet udviklingen i eksterne parametre og omfatter skønnede ændringer i behov for hensættelser til imødegåelse af tab på tilgodehavender eller kontrakter, vurderinger af økonomisk værdi eller levetid på omsætningsaktiver og materielle anlægsaktiver samt aktuarmæssigt opgjorte pensionsforpligtelser. De faktiske udfald kan afvige fra disse skøn, og ændringer som følge heraf indregnes, når de konstateres. Præsentation og klassifikation For at imødekomme særlige regnskabsog oplysningskrav er specifikke noteoplysninger indarbejdet, ligesom visse skemakrav for resultatopgørelsen er fraveget. Generelt om indregning og måling Regnskabet er udarbejdet med udgangspunkt i det historiske kostprisprincip. Indtægter indregnes i resultatopgørelsen, i takt med at de indtjenes. Herudover indregnes værdireguleringer af finansielle aktiver og forpligtelser, der måles til dagsværdi eller amortiseret kostpris. Endvidere indregnes i resultatopgørelsen alle omkostninger, der er afholdt for at opnå årets indtjening, herunder afskrivninger, nedskrivninger og hensatte forpligtelser samt tilbageførsler som følge af ændrede regnskabsmæssige skøn af beløb, der tidligere har været indregnet i resultatopgørelsen. Aktiver indregnes i balancen, når det er sandsynligt, at fremtidige økonomiske fordele vil tilflyde virksomheden, og aktivets værdi kan måles pålideligt. Forpligtelser indregnes i balancen, når det er sandsynligt, at fremtidige økonomiske fordele vil fragå virksomheden, og forpligtelsens værdi kan måles pålideligt. Ved første indregning måles aktiver og forpligtelser til kostpris. Efterfølgende måles aktiver og forpligtelser som beskrevet for hver enkelt regnskabspost. Visse finansielle aktiver og forpligtelser måles til amortiseret kostpris, hvorved der indregnes en konstant effektiv rente over løbetiden. Amortiseret kostpris opgøres som oprindelig kostpris med tillæg/ fradrag af den akkumulerede afskrivning af forskellen mellem kostprisen og det nominelle beløb. Herved fordeles kurstab og -gevinst over løbetiden. Ved indregning og måling tages hensyn til forudsigelige tab og risici, der fremkommer, inden årsrapporten aflægges, og som be- eller afkræfter forhold, der eksisterer på balancedagen. Som målevaluta anvendes DKK. Alle andre valutaer anses som fremmed valuta. Leasing Leasede aktiver, hvor DR reelt opnår de fordele og risici, der er forbundet med ejerskabet af aktivet, indregnes i balancen til laveste værdi af dagsværdi og nutidsværdi af minimumsleasingydelsen under materielle anlægsaktiver. Ved beregning af nutidsværdien af minimumsleasingydelser anvendes leasingaftalens interne rentefod som diskonteringsfaktor eller en tilnærmet værdi for denne. Finansielt leasede aktiver af- og nedskrives som DRs øvrige materielle anlægsaktiver. Alle øvrige leasingkontrakter betragtes som operationel leasing. Ydelser i forbindelse med operationel leasing indregnes i resultatopgørelsen over leasingperioden. Den kapitaliserede restleasingsforpligtelse indregnes i balancen som en gældsforpligtelse, og leasingydelsens rentedel resultatføres løbende. Omregning af fremmed valuta Transaktioner i fremmed valuta omregnes til danske kroner efter transaktionsdagens kurs. Gevinster og tab, der opstår mellem transaktionsdagens kurs og kursen på betalingsdagen, indregnes i resultatopgørelsen som en finansiel post. Monetære aktiver og forpligtelser i fremmed valuta, som ikke er afregnet på balancedagen, omregnes til balancedagens valutakurs. Forskelle mellem balancedagens kurs og transaktionsdagens kurs indregnes i resultatopgørelsen som en finansiel post. Afledte finansielle instrumenter Kursregulering af afledte finansielle instrumenter, indgået til sikring af dagsværdien af indregnede finansielle aktiver eller forpligtelser, tillægges eller fradrages den regnskabsmæssige værdi af det sikrede aktiv eller forpligtelsen. Kursregulering af afledte finansielle instrumenter indgået til sikring af forventede fremtidige pengestrømme indregnes i egenkapitalen, indtil den sikrede transaktion gennemføres. Såfremt transaktionen resulterer i et aktiv eller en forpligtelse, indregnes den akkumulerede kursregulering i kostprisen på aktivet eller forpligtelsen, og såfremt transaktionen resulterer i en indtægt eller en omkostning, indregnes den akkumulerede kursregulering i resultatopgørelsen sammen med den sikrede post. Kursregulering til dagsværdi af afledte finansielle instrumenter, der ikke opfylder betingelserne for behandling som sikringsinstrumenter, indregnes i resultatopgørelsen. Segmentoplysninger Der gives oplysninger om public servicevirksomhed og anden virksomhed i delregnskabet, jf. Bekendtgørelse nr. 62 om den regnskabsmæssige adskillelse mellem DRs og TV 2's public service-virksomhed og anden virksomhed. Public service-virksomheden og anden virksomhed anses som to forretningssegmenter. Segmentoplysningerne er udarbejdet i overensstemmelse med DRs ÅRSRAPPORT 2016 regnskabspraksis i DRs årsrapport med de afvigelser, der følger af bekendtgørelsen. For poster, som indgår i resultat før finansielle poster, foretages fordeling i det omfang, posterne direkte eller indirekte kan henføres til segmenterne. For de poster, som fordeles ved indirekte opgørelse, sker det ud fra fordelingsnøgler fastlagt ud fra segmentets træk på nøgleressourcer. Anlægsaktiver i segmenterne omfatter anlægsaktiver, som kan henføres direkte til det enkelte segment. Omsætningsaktiver, som anvendes direkte i segmenterne, omfatter varebeholdninger, tilgodehavender fra salg og tjenesteydelser samt andre tilgodehavender og periodeafgrænsningsposter. Gældsforpligtelser omfatter beløb, der direkte eller indirekte kan henføres til det enkelte segment. Segmentoplysninger fremgår af særskilte noter om delregnskab for public servicevirksomhed og anden virksomhed. Tilgodehavender Tilgodehavender måles til amortiseret kostpris eller en lavere nettorealisationsværdi, opgjort på grundlag af en individuel vurdering af de enkelte tilgodehavender. Periodeafgrænsningsposter Periodeafgrænsningsposter, indregnet under aktiver, omfatter afholdte omkostninger vedrørende efterfølgende regnskabsår. Dette udgør typisk forudbetalte omkostninger vedrørende løn, husleje, ejendomsskatter og systemlicenser. NOTE 2 Licensindtægter REGNSKABSPRAKSIS Licensindtægter omfatter DRs andel af den fakturerede licens for kalenderåret i henhold til public service-kontrakten. Licensindtægter omfatter endvidere specialbevillinger fra Kulturministeriet, der indtægtsføres i takt med, at arbejdet udføres. I licensindtægter modregnes tab på licensdebitorer, som opgøres på følgende måde: — — faktisk tab på debitorer (fordringer som SKAT har opgivet at opkræve, eller hvor debitor er afgået ved døden eller forsvundet) — — regulering af tab på tidligere afskrevne fordringer — — regulering af beregnet hensættelse til forventet tab på debitorer (skønsmæssig hensættelse) Den skønsmæssige hensættelse til forventet tab på debitorer er behæftet med en række usikkerheder knyttet til de anvendte regnskabsmæssige skøn, herunder blandt andet SKATs inddrivelsesevne. Licensindtægterne medtages i regnskabet på faktureringstidspunktet. Merlicensprovenu Eventuelt merlicensprovenu hensættes som gæld til Kulturministeriet i balancen (Overskydende licens under Kortfristede gældsforpligtelser). Dette merlicensprovenu fordeles af DR efter anvisninger fra Kulturministeriet. Merlicensmidler bevilget til DR, indtægtsføres i note 2, i takt med, at DR forbruger midlerne, det vil sige udsender i form af tv, radio, internet mv. Det vil sige, at projektet, der er bevilget midler til eller dele heraf, skal have været offentligt tilgængeligt, vist eller hørt. DRs andel af årets eventuelle licensprovenu er indregnet i henhold til Medieaftale 2015-2018 og public service-kontrakten mellem DR og kulturministeren for perioden 1. januar 2015 til 31. december 2018. DRs licensloft er i Medieaftale 2015-2018 bestemt til 3.696,7 mio. kr. i 2016. Grundet mindreprovenu på i alt 21,9 mio. kr. er DRs samlede licensindtægter reduceret fra 3.696,7 mio. kr. til 3.674,8 mio. kr. DRs ÅRSRAPPORT 2016 REGNSKABSKOMMENTARER Årets forbrug af midler vedrører følgende bevillinger: — — Midler til digitalisering af DRs arkiver 'Kulturarvsprojektet' (samlet bevilling: 75 mio. kr.). Der var primo 2016 anvendt 73,3 mio. kr. Der er pr. 31. december 2016 anvendt yderligere 1,7 mio. kr., og der er således 0,0 mio. kr. tilbage af den samlede bevilling. — — Midler til styrkelse af rytmisk musik (samlet bevilling: 15 mio. kr.). Primo 2016 var der anvendt 14,7 mio. kr. Der er pr. 31. december 2016 anvendt yderligere 0,3 mio. kr. Der er således 0,0 mio. kr. tilbage af den samlede bevilling. Midlerne er blandt andet gået til at lave en række produktioner omhandlende danske kunstnere og rytmiske festivaler. — — Midler til styrkelse af DRs programvirksomhed (samlet bevilling: 30 mio. kr.). Primo 2016 var der anvendt 2,0 mio. kr. Der er pr. 31. december 2016 anvendt 20,0 mio. kr. Der er således 8,0 mio. kr. tilbage af den samlede bevilling. Der er budgetteret anvendelse af midlerne i 2017. NOTE 3 Andre indtægter REGNSKABSPRAKSIS Andre indtægter indeholder regnskabsposter af sekundær karakter i forhold til DRs hovedaktivitet, herunder salg af medierelaterede varer og tjenesteydelser samt gevinst ved salg af anlægsaktiver. Andre indtægter indregnes efter leveringskriteriet. DR modtager produktionstilskud, der medregnes under Andre indtægter, når DR bærer risikoen for en produktion. Disse produktionstilskud indregnes i takt med, at omkostningerne afholdes. NOTE 4 Tilgodehavender fra licens REGNSKABSPRAKSIS Tilgodehavender fra licens består af hovedfordringen (Medielicens), renter og gebyrer tilknyttet hovedfordringen samt moms. Tilgodehavender måles til nettorealisationsværdien opgjort ud fra et skøn over, hvor stor en andel der forventes inddrevet af SKAT. Nedskrivningen er baseret på DRs erfaringer fra tidligere år. Der henvises til note 1 for omtale af regnskabsmæssige skøn. VÆSENTLIGE REGNSKABSMÆSSIGE SKØN Hensættelse til forventet tab på licensdebitorer er forbundet med væsentlige regnskabsmæssige skøn. Hensættelsen afspejler DRs forventning om, at den stigende restancemængde, der er en konsekvens af de aktuelle udfordringer med SKATs inddrivelse gennem EFI, på sigt vil falde, når SKATs inddrivelse normaliseres. DRs ÅRSRAPPORT 2016 REGNSKABSKOMMENTARER Tilgodehavende fra licens er steget i forhold til forrige år – primært på grund af SKATs inddrivelsesstop, og fordi flere debitorer ikke betaler deres DR- regninger til tiden. NOTE 5 Produktionsomkostninger, rettigheder mv. REGNSKABSPRAKSIS Produktionsomkostninger, rettigheder mv. omfatter de omkostninger, der er medgået årets programaktivitet. Omkostninger til direkte (live) og næsten direkte programmer (f.eks. nyhedsudsendelser og magasiner) resultatføres på udsendelsestidspunktet, idet tidspunktet for afholdelse af omkostningerne anses for sammenfaldende med udsendelsestidspunktet. NOTE 6 Andre eksterne omkostninger REGNSKABSPRAKSIS Andre eksterne omkostninger omfatter bygningsomkostninger mv., offentlige skatter og afgifter, konsulenter og rådgivning, itomkostninger, rejser og transport, personalerelaterede omkostninger samt tab på debitorer og tab ved salg af anlægsaktiver mv. Under produktionsomkostninger indregnes tillige omkostninger til investeringer i programmer, rettigheder mv., der resultatføres på tidspunktet for kontraktens indgåelse. DRs ÅRSRAPPORT 2016 NOTE 7 Personale omkostninger REGNSKABSPRAKSIS REGNSKABSKOMMENTARER Personaleomkostninger indeholder lønninger og gager, honorarer, pensioner samt andre omkostninger til social sikring til såvel fastansatte som freelancere. Stigningen fra 2015 til 2016 henføres blandt andet til løn- og prisudvikling. Antal årsværk opdelt i hovedgrupper: "Løn" omfatter fast løn. "Øvrigt" omfatter vederlag, særlige aftaler, beskatning af fri bil, feriepenge udbetalt ifb. med fratrædelse mv. DRs ÅRSRAPPORT 2016 NOTE 8 Af- og nedskrivninger på immaterielle og materielle anlægsaktiver REGNSKABSPRAKSIS Årets afskrivninger indregnes i overensstemmelse med aktivernes fastlagte afskrivningsprofil (se note 14 og 15). DRs ÅRSRAPPORT 2016 NOTE 9 Kapitalandele i associerede virksomheder REGNSKABSPRAKSIS Kapitalandele i associerede virksomheder måles efter den indre værdis metode. I resultatopgørelsen indregnes den forholdsmæssige andel af associerede virksomheders resultat. De samlede nettoopskrivninger af kapitalandele i associerede virksomheder henlægges ved overskudsdisponering til regnskabsposten Reserve for nettoopskrivning efter indre værdis metode. DRs ÅRSRAPPORT 2016 NOTE 10 Andre finansielle indtægter REGNSKABSPRAKSIS Finansielle indtægter omfatter renter vedrørende bankindeståender, realiserede og ikke realiserede kursgevinster vedrørende værdipapirer og kursgevinster vedrørende transaktioner i fremmed valuta. NOTE 11 Øvrige finansielle omkostninger REGNSKABSPRAKSIS Finansielle omkostninger omfatter renter vedrørende langfristet gæld, herunder renter vedrørende swaps, renter ved finansiel leasing, realiserede og ikke realiserede kurstab vedrørende værdipapirer og transaktioner i fremmed valuta. Valutakurselementet vedrørende swaps, indgået til afdækning af valutalån, medtages under finansielle poster. DRs ÅRSRAPPORT 2016 NOTE 12 Særlige poster Årsrapporten pr. 31. december 2016 indeholder ikke særlige poster. NOTE 13 Resultatdisponering NOTE 14 Immaterielle anlægsaktiver REGNSKABSPRAKSIS Immaterielle anlægsaktiver omfatter itsoftware og it-software under udvikling. Udviklingsomkostninger, der ikke opfylder kriterierne for indregning i balancen, indregnes som omkostninger i resultatopgørelsen, i takt med at omkostningerne afholdes. Aktiverede it-udviklingsomkostninger måles til kostpris med fradrag af akkumulerede afskrivninger eller nedskrivning til genindvindingsværdi, såfremt denne er lavere. For erhvervede aktiver omfatter kostprisen anskaffelsesprisen samt omkostninger direkte tilknyttet anskaffelsen indtil det tidspunkt, hvor aktivet er klar til at blive taget i brug. For egne fremstillede aktiver omfatter kostprisen direkte omkostninger til blandt andet lønforbrug, materialer, komponenter og underleverandører. Aktiverede udviklingsomkostninger afskrives lineært over den periode, hvori det forventes at frembringe økonomiske fordele. Afskrivningsperioden udgør maksimalt 6 år. DRs ÅRSRAPPORT 2016 NOTE 15 Materielle anlægsaktiver REGNSKABSPRAKSIS Materielle anlægsaktiver måles til kostpris med fradrag af akkumulerede af- og nedskrivninger. For erhvervede aktiver omfatter kostprisen anskaffelsesprisen samt omkostninger direkte tilknyttet anskaffelsen indtil det tidspunkt, hvor aktivet er klar til at blive taget i brug. For egne fremstillede aktiver omfatter kostprisen direkte omkostninger til lønforbrug, materialer, komponenter og underleverandører. Materielle anlægsaktiver, der er leasede og opfylder betingelserne for finansiel leasing, behandles efter samme retningslinjer som ejede aktiver. Afskrivningsgrundlaget, der opgøres som kostpris reduceret med akkumulerede nedskrivninger og eventuel restværdi, fordeles lineært over aktivernes forventede brugstid. Afskrivninger foretages ud fra en løbende vurdering af aktivernes afskrivningsforløb og brugstid. De materielle anlægsaktiver afskrives lineært over de enkelte aktivers forventede brugstid. Afskrivningsperioderne er fastlagt således: Fra - Til Bygninger 7 år - 50 år Sendenet 5 år - 20 år Tekniske anlæg 5 år - 20 år Andre anlæg, driftsmateriel og inventar 5 år - 20 år DRs ÅRSRAPPORT 2016 Gevinst og tab ved udskiftning af anlægsaktiver indregnes henholdsvis i regnskabsposterne Andre indtægter og Andre eksterne omkostninger. Gevinst og tab beregnes som forskellen mellem salgssum med fradrag af afhændelsesomkostninger og den regnskabsmæssige værdi på salgstidspunktet. Nedskrivning på anlægsaktiver Den regnskabsmæssige værdi af såvel immaterielle som materielle anlægsaktiver gennemgås årligt for at afgøre, om der er indikation af værdiforringelse ud over det, som udtrykkes ved normal afskrivning. Hvis dette er tilfældet, foretages nedskrivning til den lavere genindvindingsværdi. Genindvindingsværdien for aktivet opgøres som den højeste værdi af nettosalgsprisen og kapitalværdien. Såfremt det ikke er muligt at fastsætte genindvindingsværdien for det enkelte aktiv, vurderes nedskrivningsbehovet for den gruppe af aktiver, hvor det er muligt at opgøre genindvindingsværdien. NOTE 16 Programlager REGNSKABSPRAKSIS Programlageret omfatter egenproducerede programmer, eksterne programmer samt indkøbte tv-programrettigheder. Herudover indgår danske spillefilm, som er støttet af DR. Eksterne programmer omfatter programmer købt hos ekstern leverandør til brug for førstegangsvisning på DR. Indkøbte programrettigheder omfatter fremmedfilm, som DR har købt visningsrettigheder til. Programlageret måles til kostpris med fradrag af ukurans. Kostprisen omfatter købspris med tillæg af hjemtagelsesomkostninger samt øvrige direkte omkostninger tilknyttet anskaffelsen. Ukurans vurderes med udgangspunkt i skønnede priser for tilsvarende produkter. Kostprisen for egenproducerede programmer omfatter herudover tillige tillæg af indirekte produktionsomkostninger (IPO). IPO omfatter indirekte løn, materialer, administration, vedligeholdelse og afskrivninger på de i processen benyttede maskiner samt bygninger og udstyr. Programmer indregnes i programlageret ved levering og resultatføres fuldt ved førstegangsudsendelse. DRs ÅRSRAPPORT 2016 Nedskrivning af programlager Lagerposter vurderes løbende med henblik på at vurdere, hvorvidt der er indikationer på, at den forventede nettorealisationsværdi er lavere end kostprisen. Ved indikationer på et nedskrivningsbehov foretages nedskrivning til nettorealisationsværdien. Nettorealisationsværdien for danske spillefilm vurderes med udgangspunkt i et skøn over, hvad tilsvarende danske spillefilm ville koste, såfremt de skulle købes som visningsrettigheder på det aktive marked herfor. Herudover vurderes markedsprisen på de vurderede spillefilm som et samlet pakkekøb. Gennemsnittet af disse to vurderinger bruges som nettorealisationsværdien. Der foretages en samlet nedskrivning til denne nettorealisationsværdi. Produktioner, der ikke forventes at blive udsendt, resultatføres løbende. NOTE 17 Forudbetalinger vedrørende programlager mv. REGNSKABSPRAKSIS I programlageret indgår forudbetalinger på sportsrettigheder, filmrettigheder, eksterne programmer samt danske spillefilm, som er støttet af DR. Forudbetalingerne medtages på lageret til kostpris, i takt med at omkostningerne afholdes. Sportsrettigheder indregnes som forudbetalinger vedrørende programlager, idet udsendelse først kan ske på tidspunktet for afholdelse af den givne sportsbegivenhed. Værdien af støttede film, der indregnes som forudbetalinger, udgør afholdte omkostninger til danske spillefilm, indtil filmene er færdigproducerede og leverede. Modtagne eksterne tilskud, herunder produktionstilskud, betaling for visningsrettigheder og øvrige bidrag fra medproducenter, medtages under periodeafgrænsningsposter og indtægtsføres ved programudsendelse. Nedskrivning på forudbetalinger til rettigheder og eksterne programmer Forudbetalinger til programrettigheder gennemgås løbende med henblik på at identificere et nedskrivningsbehov. Der foretages nedskrivning til nettorealisationsværdien, såfremt denne vurderes at være lavere end kostprisen. Programmer, der ikke forventes at blive udsendt, bliver straks udgiftsført, når det konstateres, at et program ikke udsendes. DRs ÅRSRAPPORT 2016 NOTE 18 Andre tilgodehavender REGNSKABSPRAKSIS Tilgodehavender måles til amortiseret kostpris eller en lavere nettorealisationsværdi, opgjort på grundlag af en individuel vurdering af de enkelte tilgodehavender. NOTE 19 & 20 Hensatte forpligtelser REGNSKABSPRAKSIS Hensatte forpligtelser indregnes, når DR som følge af en begivenhed indtruffet senest på balancedagen har en retlig eller faktisk forpligtelse, og det er sandsynligt, at indfrielse vil medføre et forbrug af DRs økonomiske ressourcer. Pensionsforpligtelser og lignende indregnes på grundlag af den aktuarmæssigt opgjorte forpligtelse. Diskonteringsrenten er, grundet manglende likvidt marked for virksomhedsobligationer af høj kvalitet i Danmark, fastsat som renten, der svarer til et realistisk obligationsafkast. Hensættelsen til pensionsforpligtelser, herunder efterløn mv., er behæftet med de usikkerheder, der er knyttet til den af aktuaren anvendte model, skøn over fremtidig lønstigningstakt og renteudvikling samt individuel adfærd mv. Andre hensatte forpligtelser omfatter sandsynlige omkostninger i forbindelse med verserende voldgiftssager og retssager mv. Hensættelser til pensioner og lignende forpligtelser er opgjort med udgangspunkt i en aktuaropgørelse i henhold til kravene i IAS 19. Til sikring af DRs forpligtelse til at yde ikke-pensionssikret personale en løbende livsvarig understøttelse, som supplement til den sociale pension, har Kulturministeriet stillet en garanti på 75,0 mio. kr. Andre hensatte forpligtelser omfatter sandsynlige omkostninger i forbindelse med verserende voldgiftssager og retssager mv. DRs ÅRSRAPPORT 2016 NOTE 21 Kreditinstitutioner og pensionslån REGNSKABSPRAKSIS Rentebærende gældsforpligtelser, der ved lånoptagelsen forventes holdt til udløb, indregnes ved lånoptagelsen til det modtagne provenu efter fradrag af afholdte transaktionsomkostninger. I efterfølgende perioder måles gælden til amortiseret kostpris, således at forskellen mellem provenuet og den nominelle værdi (kursgevinsten/-tabet) indregnes i resultatopgørelsen over låneperioden. Gældsforpligtelser, som er dagsværdisikret ved valutaswap, værdireguleres endvidere for ændring i renteelementet af valutaswap. DRs ÅRSRAPPORT 2016 NOTE 22 Øvrig anden gæld REGNSKABSPRAKSIS Øvrige gældsforpligtelser måles til amortiseret kostpris, svarende til den nominelle gæld. NOTE 23 Periodeafgrænsningsposter REGNSKABSPRAKSIS Periodeafgrænsningsposter indregnet under Langfristede gældsforpligtelser omfatter modtagne betalinger vedrørende salg af master. DR anvender fortsat de frasolgte master, og i konsekvens heraf indregnes avancen i efterfølgende regnskabsår. Beløb under Langfristede gældsforpligtelser indregnes i resultatopgørelsen i regnskabsår, der begynder senere end 12 måneder efter balancedagen. Periodeafgrænsningsposter indregnet under Kortfristede gældsforpligtelser omfatter modtagne betalinger vedrørende indtægter i efterfølgende år. DRs ÅRSRAPPORT 2016 NOTE 24 Eventualforpligtelser samt andre økonomiske forpligtelser REGNSKABSPRAKSIS Hvis en forpligtelses eksistens først kan beeller afkræftes af usikre fremtidige begivenheder, eller hvis det ikke er muligt at opgøre størrelsen af forpligtelsen, oplyses forholdet som en eventualforpligtelse. Andre økonomiske forpligtelser omfatter ydelser på operationelle leasingkontrakter samt lejeforpligtelser. Finansielle leasingforpligtelser DR har i 2004/2005 indgået finansielle leasingaftaler over 15 år vedrørende udstyr til DAB-sendenettet. Sendenettet er indregnet som materielle leasingaktiver (note 15), mens den kapitaliserede restleasingforpligtelse er indregnet som gældsforpligtelse til kreditinstitutioner (note 21). Den årlige leasingydelse udgør ca. 5,4 mio. kr. (2015: 5,4 mio. kr.) Købsforpligtelser DR har indgået aftaler om køb af sportsrettigheder for i alt 187,7 mio. kr. (2015: 223,7 mio. kr.) og aftaler om køb af øvrige filmrettigheder for i alt 211,8 mio. kr. (2015: 187,5 mio. kr.). En del af valutakursrisikoen på indgåede aftaler om køb af sportsrettigheder er afdækket via swap-aftaler. DR har indgået aftaler om køb af licenser, serviceabonnementer mv. for i alt 591,0 mio. kr. (2015: 547,6 mio. kr.). DR er derudover lovmæssigt forpligtet til at betale til Pressenævnet. DR har vedtaget et væsentlighedsprincip, hvor kontrakter med en kontraktsum under 0,5 mio. kr. ikke medtages i opgørelsen. Kautionsforpligtelser DR har indgået aftaler med solidarisk hæftelse for medkontrahenters forpligtelser. DRs solidariske hæftelse udgør 302,0 mio. kr. Sikkerhedsstillelser Der er båndlagt 22,0 mio. kr. (for 2015: 17,4 mio. kr.) af DRs likvide beholdninger vedrørende Nordvisionsfonden, som kun kan frigives af bestyrelsen for Nordvisionsfonden. Interessenterne i I/S DIGI-TV hæfter direkte og solidarisk over for tredjemand for de forpligtelser, der påhviler interessentskabet. I note 9 er gældsforpligtelser pr. 31. december 2016 anført. Verserende retssager DR er part i verserende retssager, hovedsageligt vedrørende ophavsret og andre krænkelser i forbindelse med radio- og tvudsendelser. Der er i årsregnskabet foretaget hensættelser til de sager, ledelsen vurderer har en økonomisk risiko for DR. Øvrige eventualforpligtelser DR har i 2003 indgået en aftale med Københavns Kommune om aflysning af tilbagekøbsret til såvel TV-Byen som Radiohuset mod tinglysning af en køberet til DRs ejendom i Ørestad. Køberetten giver Københavns Kommune ret til at erhverve DRs ejendomme (grunde og bygninger) i Ørestad i 2073 til en købesum svarende til summen af den oprindelige købesum på 228 mio. kr. og en andel af forskelsværdien mellem oprindelig købesum og aktuel offentlig vurdering. Andel af forskelsværdi fastsættes endeligt, når grundene er bebygget, og endelig offentlig vurdering foreligger. DR har dispensation til terrænparkering på Optionsgrunden, matrikel 279. Dispensationen løber som udgangspunkt til udgangen af 2018. På ejendommen Ørestads Boulevard 19, 2300 København S er der tinglyst en hæftelse på ca. 0,5 mio. kr. vedrørende en hovedstol til Grundejerforeningen Ørestad Universitetskvarter. På ejendommen Emil Holms Kanal 20, 2300 København S er der tinglyst en hæftelse på ca. 2,5 mio. kr. vedrørende en hovedstol til Grundejerforeningen Ørestad Universitetskvarter. DR har meddelt Aarhus Kommune option til at tilbagekøbe ejendom i Aarhus, første gang i 2067. Tilbagekøbsretten kan gøres gældende, såfremt ejendommen til den tid ikke anvendes af DR eller anden offentlig myndighed. Salgsprisen skal da opgøres til købspris for grunden med tillæg af vurderet markedsværdi for bygninger. DRs ÅRSRAPPORT 2016 I henhold til public service-kontrakten med kulturministeren har DR pligt til at støtte dansk filmproduktion med 261,4 mio. kr. i perioden 2015-2018, eller gennemsnitligt 65,4 mio. kr. årligt (2016-niveau gennemsnit over kontraktperioden, som reguleres årligt på baggrund af udviklingen i forbrugerprisindekset). Heraf skal 45,9 mio. kr. vedrøre spillefilm, 11,5 mio. kr. kort- og dokumentarfilm og 8 mio. kr. talentudviklingsordningen. DRs samlede støttebeløb til disse formål har i 2016 udgjort 52,2 mio. kr. (2015: 47,8 mio. kr.) DR har underskrevne forhåndstilkendegivelser til en værdi af 17,9 mio. kr. Tilsagnene er afgivet til spillefilmsproduktioner, som hører under public-service kontrakten. Tilsagnene er indregnet som tabsgivende kontrakter med fradrag for nedskrivning under note 20. DR skal i kontraktperioden udlægge produktion til uafhængige producenter for 300 mio. kr. i gennemsnit pr. år over kontraktperioden. Af hensyn til DRs planlægning kan der accepteres udsving i de enkelte år, dog således at den samlede udlægning i kontraktperioden svarer til udlægningskravet. Udlægningen skal omfatte tv, radio og andre platforme samt digitale læringsspil rettet mod børn. Udliciteringen af rene produktionsfaciliteter mv. uden relation til programudlægningen kan alene indgå i opfyldelsen af udlægningskravet med op til 60 mio. kr. af det årlige udlægningsbeløb. DRs eksterne udlægning i henhold til public service-kontrakten har i 2016 udgjort 404,1 mio. kr. (2015: 460,5 mio. kr). Herudover har DR købt produktionsfaciliteter for yderligere 69,4 mio. kr., hvorved DRs samlede udlægning i 2016 er på 473,5 mio. kr. NOTE 25 Begivenheder efter balancedagen DRs udlejer af TV-Byen er pr. 1. januar 2017 gået konkurs. Der vurderes ikke at være væsentlige økonomiske risici for DRs regnskab forbundet med konkursen. Der er ikke indtruffet yderligere væsentlige begivenheder efter balancedagen, der har betydning for DRs årsrapport. NOTE 26 Nærtstående parter NOTE 26 NÆRTSTÅENDE PARTER Bestemmende indfyldelse Folketinget og Kulturministeriet er nærtstående parter med bestemmende indflydelse. Øvrige nærtstående parter Øvrige nærstående parter omfatter bestyrelsen, direktionen og associerede virksomheder. Associerede virksomheder: I/S DIGI-TV Ritzaus Bureau A/S Se note 9 for yderligere oplysninger. Transaktioner Der har, bortset fra normalt ledelsesvederlag, ikke været gennemført transaktioner med bestyrelsen, direktionen eller ledendende medarbejdere i årets løb. Alle transaktioner med nærstående parter er foregået på markedsvilkår. DRs ÅRSRAPPORT 2016 NOTE 27 Honorar til underleverandør af revisionsydelser Revisionen af DR er udført på baggrund af en § 9-aftale om intern revision, imellem rigsrevisor og DRs bestyrelse. Intern Revision udfører finansiel revision, og Rigsrevisionen fører tilsyn hermed. Herudover udfører Rigsrevisionen it-revision samt forvaltningsrevision på udvalgte områder herunder juridisk-kritisk revision. Herudover har DR i 2016 benyttet følgende leverandører af revisionsydelser, jf. nedenstående note. NOTE 28 Delregnskab for public servicevirksomhed og anden virksomhed REGNSKABSPRAKSIS Indregning af indtægter, omkostninger, aktiver og forpligtelser i delregnskabet følger de nuværende principper. Overhead udgør fordeling af indirekte omkostninger vedrørende støttefunktioner som deles af public service-virksomhed og anden virksomhed. 22 pct. af årets overskud i anden virksomhed overføres til public service-virksomheden i overensstemmelse med bekendtgørelse nr. 62 om den regnskabsmæssige adskillelse mellem DRs og TV 2's public service-virksomhed og anden virksomhed. DRs ÅRSRAPPORT 2016 NOTE 28 (FORTSAT) DELREGNSKAB FOR PUBLIC SERVICE-VIRKSOMHED OG ANDEN VIRKSOMHED MIO. KR. Public service- virksomhed 5.162,8 23,5 243,9 5.430,2 507,2 696,6 38,6 0,0 155,6 -242,1 236,7 1.392,6 6.822,8 44,1 -25,2 393,1 412,0 390,7 4.494,2 83,2 91,9 508,6 180,3 114,2 547,7 6.020,1 6.822,8 Anden virksomhed 0,0 19,8 0,0 19,8 0,0 0,0 1,2 0,0 2,6 242,1 0,0 245,9 265,7 0,0 25,2 201,7 226,9 3,9 0,0 0,0 0,0 0,0 26,6 0,0 8,3 34,9 265,7 2016 118,7 21,8 18,9 265,7 BALANCE 31. DECEMBER 2016 AKTIVER Immaterielle og materielle anlægsaktiver Kapitalandele i associerede virksomheder Andre tilgodehavender Anlægsaktiver Varebeholdninger Tilgodehavender fra licens Tilgodehavender fra salg og tjenesteydelser Tilgodehavender hos associerede virksomheder Andre tilgodehavender og periodeafgrænsningsposter Mellemregning public service-virksomhed Likvide beholdninger Omsætningsaktiver AKTIVER I ALT PASSIVER Reserver Kapitalindskud Overført resultat Egenkapital Hensatte Forpligtelser Kreditinstitutioner og pensionslån Langfristet anden gæld Langfristede periodeafgrænsningsposter Modtagne forudbetalinger fra licens Leverandører af varer og tjenesteydelser Overskydende licens Øvrig anden gæld og periodeafgrænsningsposter Gældsforpligtelser PASSIVER I ALT NOTE 28 SAMMENLIGNINGSTAL FOR ANDEN VIRKSOMHED MIO. KR. Andre indtægter Resultat før finansielle poster (EBIT) Årets resultat Balancesum I alt 5.162,8 43,3 243,9 5.450,0 507,2 696,6 39,8 0,0 158,2 0,0 236,7 1.638,5 7.088,5 44,1 0,0 594,8 638,9 394,6 4.494,2 83,2 91,9 508,6 206,9 114,2 556,0 6.055,0 7.088,5 2015 91,2 0,0 1,0 226,8 Egenkapital 226,9 208,0 DRs ÅRSRAPPORT 2016 NOTE 29 Nettoomkostninger ved public service-virksomhed REGNSKABSPRAKSIS Indregning af indtægter, omkostninger, aktiver og forpligtelser i delregnskabet følger de nuværende principper. Overhead udgør fordeling af indirekte omkostninger vedrørende støttefunktioner som deles af public service-virksomhed og anden virksomhed. Opgørelsen er udarbejdet i henhold til afsnit om finansiering i public service-kontrakten for 2015-2018. Dog er medtaget overhead fra note 28 jf. ovenfor. DRs ÅRSRAPPORT 2016 NOTE 30 & 31 Pengestrømsopgørelse REGNSKABSPRAKSIS Pengestrømsopgørelsen viser DRs pengestrømme for året opdelt på drifts-, investerings- og finansieringsaktivitet, årets forskydning i likvider samt DRs likvider ved årets begyndelse og slutning. Pengestrømme fra driftsaktivitet Pengestrømme fra driftsaktiviteten opgøres som resultatet reguleret for ændringer i driftskapitalen og ikke-kontante resultatposter som af- og nedskrivninger samt hensatte forpligtelser. Driftskapitalen omfatter omsætningsaktiver fratrukket kortfristede gældsforpligtelser, dog eksklusive de poster, der indgår i likvide beholdninger. Der er korrigeret for den del af langfristede gældsforpligtelser og periodeafgrænsningsposter, der forfalder inden for 12 måneder fra udgangen af regnskabsåret. DRs ÅRSRAPPORT 2016 Pengestrømme fra investeringsaktivitet Pengestrømme fra investeringsaktiviteten omfatter pengestrømme fra køb og salg af immaterielle, materielle og finansielle anlægsaktiver. Pengestrømme fra finansieringsaktivitet Pengestrømme fra finansieringsaktiviteten omfatter pengestrømme fra optagelse og tilbagebetaling af langfristede gældsforpligtelser samt kortfristet andel heraf. Likvide beholdninger Likvide beholdninger omfatter kontantbeholdninger og bankindeståender. D. DRs ÅRSRAPPORT 2016 LEDELSE DRs ÅRSRAPPORT 2016 13. LEDELSE I DR DR er en selvstændig offentlig institution. Rammerne for DRs virksomhed fastsættes i lov om radio- og fjernsynsvirksomhed og tilhørende bekendtgørelser, herunder bekendtgørelse om vedtægt for DR, samt i public service-kontrakten mellem DR og kulturministeren. DRs virksomhed finansieres gennem DRs andel af licensmidlerne samt gennem indtægter ved salg af programmer og andre ydelser. DR skal udøve public service-virksomhed over for hele befolkningen efter principperne i radio- og tv-lovgivningen og i henhold til kravene i public service-kontrakten. I dette afsnit beskrives den formelle ledelsesstruktur i DR, og der gives en præsentation af DRs bestyrelse og direktion samt en oversigt over DRs organisation. Bestyrelsen Bestyrelsesmøder DRs bestyrelse er DRs øverste ledelse. Bestyrelsen har ansvaret for, at DR overholder de krav, som lovgivningen stiller, og for, at public service-kontrakten overholdes. Det er således bestyrelsen, der har det overordnede programansvar. Bestyrelsen godkender den strategiske retning for DR og kontrollerer, at retningen følges. Det er også bestyrelsen, der ansætter og afskediger generaldirektøren og øvrige medlemmer af DRs direktion. Bestyrelsen består af 11 medlemmer, som beskikkes af kulturministeren for en periode på fire år. Kulturministeren udpeger tre medlemmer til bestyrelsen, heriblandt formanden. Folketinget udpeger seks medlemmer, og DRs medarbejdere to medlemmer. Kulturministeren udpeger næstformanden blandt de medlemmer, der er udpeget af Folketinget. Det tilstræbes, at bestyrelsen sammensættes, så den repræsenterer mediemæssig, kulturel, ledelsesmæssig og erhvervsmæssig indsigt. DRs ÅRSRAPPORT 2016 Generaldirektøren indkalder efter formandens bemyndigelse til bestyrelsesmøder, der afholdes mindst otte gange årligt. Bestyrelsens møder ledes af formanden og ved dennes forfald af næstformanden. Det er formanden, som tegner bestyrelsen, og det er alene formanden, der udtaler sig på bestyrelsens vegne. Generaldirektøren deltager i bestyrelsesmøderne og har ret til at deltage i forhandlingerne. Direktøren for Økonomi, Teknologi og Medieproduktion deltager normalt også i bestyrelsesmøderne, mens den øvrige direktion deltager efter aftale mellem formanden og generaldirektøren. Rigsrevisionen og Intern Revision deltager i bestyrelsesmøder under behandlingen af regnskaber mv., der påtegnes af Rigsrevisionen. Efter bestyrelsesmøderne sørger generaldirektøren for – efter formandens bemyndigelse – at der udarbejdes et beslutningsreferat fra bestyrelsesmøderne. Referatet udsendes til bestyrelsesmedlemmerne og godkendes med eventuelle korrektioner på det efterfølgende bestyrelsesmøde. Direktionen DRs generaldirektør har det daglige programansvar og er ansvarlig i forhold til medieansvarsloven. Direktionen består foruden generaldirektøren af en direktør for Økonomi, Teknologi og Medieproduktion, en mediedirektør og tre indholdsdirektører med ansvar for områderne DR Nyheder, DR Danmark og DR Kultur. Derudover deltager direktøren for Rådgivning, Strategi og Kommunikation i direktionsarbejdet. Sidstnævnte udpeges af generaldirektøren, mens de øvrige direktionsmedlemmer udpeges af bestyrelsen. Ud over det daglige programansvar har generaldirektøren – sammen med den øvrige direktion – ansvaret for DRs langsigtede strategi, DRs årlige publiceringsplan, DRs produktion samt den daglige administration, herunder den økonomiske og personalemæssige ledelse af DR. Herudover er det direktionens ansvar at kontrollere opfyldelsen af handlingsplaner for organisationen. Direktionen mødes som udgangspunkt en gang ugentligt. DRs ÅRSRAPPORT 2016 13.1 DRs BESTYRELSE DRs ÅRSRAPPORT 2016 Michael Christiansen Dennis Nørmark Formand Trine Gregorius Næstformand Katrine Winkel Holm Torben Dalby Larsen Lars L. Nielsen Nanna Kalinka Bjerke Line Barfod Dan Boyter Stig Paulsen Hanne Ried Larsen Michael Christiansen Bestyrelsesmedlem og formand for DRs bestyrelse siden november 2008. Uddannet cand. jur. fra Københavns Universitet i 1970. Ansat i Justitsministeriet 1970-1988. Departementschef i Forsvarsministeriet 1988-1992. Chef for Det Kongelige Teater 1992-2008. Lektor ved Københavns Universitet i strafferet 1971-1983. Michael Christiansen er bestyrelsesformand i følgende virksomheder og institutioner: Aarhus Universitet, Danske Universiteter, Dansk Retursystem A/S, Schmidt, Hammer & Lassen Architects, Jazzhus Montmartre, teatret S/H, Blackbox Teatret, Lead Agency A/S, Det Danske Kulturinstitut og Kraft & Partners A/S. Michael Christiansen er medlem af bestyrelsen for KMD A/S, Danish Fashion Institute, Gravity Board Games A/S, Holstebro Musikteater, Dansk Talentakademi, Fonden Nørre Vosborg og Bacon Group a/s. Trine Gregorius Bestyrelsesmedlem siden september 2008 og næstformand for DRs bestyrelse siden januar 2015. Uddannet journalist fra Danmarks Journalisthøjskole i 1989. Tidligere ansat i DR på blandt andet Radioavisen og P3. Senere ansat på TV 2. Siden 2003 freelancer, forfatter, oplægsholder, medietræner og underviser på Prime-Time Kommunikations medie- og tv-træningskurser. Katrine Winkel Holm Bestyrelsesmedlem i perioden januar 2007 til december 2014. Indtrådt i bestyrelsen igen i november 2015 i stedet for Ole Hyltoft. Uddannet cand.theol. fra Københavns Universitet 1997. Sognepræst i Borup-Nr. Dalby. Formand for Trykkefrihedsselskabet og kommentator i Jyllands-Posten. Torben Dalby Larsen Bestyrelsesmedlem siden januar 2007. Fungerende formand fra juni 2008 til november 2008. Chefredaktør for Dagbladet Ringsted-KøgeRoskilde fra 1985, for Frederiksborg Amts Avis fra 1992, for Sjællandske Næstved-Slagelse fra 2012 og for Nordvestnyt Holbæk-Kalundborg fra 2013, tillige administrerende direktør fra 1986 for Udgiverselskabet Dagbladet A/S, der i dag hedder Sjællandske Medier A/S. Siden 1983 bestyrelsesmedlem og formand i en række presseorganisationer, heriblandt Danske Dagblades Forening og Dagbladenes Bureau. Er formand for Dansk Arbejdsgiverforening og PFA Pension samt medlem af bestyrelsen for ATP, Lønmodtagernes Garantifond og Danske Mediers Arbejdsgiverforening. Lars L. Nielsen Bestyrelsesmedlem siden september 2008. PA-direktør i PrimeTime Kommunikation, PA-direktør i Finansrådet fra 2010-2012 og kommunikationsdirektør i Finansrådet 2006-2010, januar 2006 til juli 2006 pressechef i Teknik- og Miljøforvaltningen i Københavns Kommune, sekretariatsleder i Radikale Venstre 2004-2006, pressechef i Radikale Venstre 2004-2009. Medlem af bestyrelsen for Københavns Madhus fra 2012, medlem af bestyrelsen for teater GROB fra august 2016, tidligere medlem af TV 2 Lorrys bestyrelse. Nanna Kalinka Bjerke Bestyrelsesmedlem siden januar 2015. MA i Køn og Kulturstudier fra Syddansk Universitet 2005. Eget firma, Imperia Kommunikation ApS, siden 1991. Kernekompetencer: Kommunikationsrådgivning, kampagne- og idéudvikling, PR og projektledelse. Desuden skribent og tekstforfatter. Dennis Nørmark Bestyrelsesmedlem siden januar 2015. Uddannet cand.mag. i antropologi fra Aarhus Universitet. Selvstændig konsulent, forfatter og foredragsholder samt klummeskribent på Politiken. Ekstern lektor ved Aarhus Universitet 2006-2011. Fra 2008 til 2011 talsmand for Humanistisk Samfund, som han også er medstifter af. Foredragsholder og forfatter til flere bøger om samfundsforhold og kultur. Dennis Nørmark har desuden en fortid som skuespiller, manuskriptforfatter og sceneinstruktør. Formand for Egå Ungdoms-Højskole siden 2013 og bestyrelsesmedlem i Danish Institute for Parties and Democracy under Udviklingsministeriet fra 2010. Line Barfod Bestyrelsesmedlem siden januar 2015. Uddannet cand.jur. 1992. Ansat som advokat hos advokaterne Foldschack & Forchhammer. Medlem af Folketinget for Enhedslisten 2001-2011. Medlem af Nordisk Råd 2001-2011. Line Barfod er medlem af en lang række bestyrelser og repræsentantskaber for virksomheder og institutioner, blandt andet AFUK, Fonden Jagtvej 69, Danwatch, Fonden Filmtalent, Det lille Teater, projekt UDENFOR, Dialogforum for Samfundsansvar og Vækst, Komiteen for Socialøkonomiske Virksomheder, Foreningen Nordens Landsstyrelse, Kofoeds Skole, Rådet for menneskerettigheder, Den sociale Retshjælp og Kilden. DRs ÅRSRAPPORT 2016 Dan Boyter Bestyrelsesmedlem siden januar 2015. Direktør og bestyrelsesmedlem i Pressalit A/S og medlem af bestyrelsen for Pressalit Holding. Dan Boyter er bestyrelsesformand for Den Jyske Opera samt medlem af bestyrelsen i følgende virksomheder og institutioner: ARoS Aarhus Kunstmuseum, Moesgård Museum og formand for Moesgårds Venner. Dan Boyter er desuden medlem af Rådet for Bæredygtig Erhvervsudvikling, Kirkens Korshærs landsdækkende rådgivningsgruppe, ambassadør for Kofoeds Skole, Region Midtjyllands ambassadørkorps for indsatsen om psykisk sygdom, DI's specialudvalg for design og strategigruppen for Multimediehuset i Aarhus og formand for regeringens Dialogforum for Samfundsansvar og Vækst. Stig Paulsen Bestyrelsesmedlem (medarbejdervalgt) siden januar 2007. Tv-tekniker i DR siden 1986. Formand for de faglige DR-organisationers Kontaktudvalg siden 2001. Hanne Ried Larsen Bestyrelsesmedlem (medarbejdervalgt) siden januar 2015. Uddannet journalist fra Danmarks Journalisthøjskole i 1989. Journalist ved DR Midt og Vest siden 1994. Freelancer på Freelance Redaktionen 1990-1994. Tillidsmand siden 2006 og medlem af Journalistgruppen i DRs bestyrelse siden 2013. 13.2 DRs DIREKTION Maria Rørbye Rønn Nikolas Lyhne-Knudsen Gitte Rabøl DRs ÅRSRAPPORT 2016 Anne-Marie Dohm Tine Smedegaard Andersen Ulrik Haagerup Maria Rørbye Rønn Generaldirektør for DR fra februar 2011, konstitueret generaldirektør fra oktober 2010. Tidligere ansættelser: Direktør for DR Jura, Politik og Strategi fra 2009, underdirektør for DR Juridisk og Politisk Sekretariat fra 2007, chef for DR Jura fra 2001 og souschef fra 1999, advokat i DR Ophavsret fra 1995, fuldmægtig i Ophavsretskontoret, Kulturministeriet fra 1993, dommerfuldmægtig ved Retten i Odense fra 1990. Bestyrelsesposter: Medlem af bestyrelsen for IT- Universitetet og pr. 1. januar 2017 formand for bestyrelsen for IT- Universitetet, næstformand i Ritzaus Bureau A/S og medlem af bestyrelsen for Center for Ledelse samt medlem af Ordrupgaard Advisory Board. Nikolas Lyhne-Knudsen Direktør for Økonomi, Teknologi og Medieproduktion fra oktober 2014. Tidligere ansættelser: Afdelingschef i Finansministeriet fra 2013, kontorchef i Finansministeriet fra 2011, kontorchef for Statens Indkøb, Økonomistyrelsen fra 2009, fungerende kontorchef og chefkonsulent i Finansministeriet fra 2008, specialkonsulent i Finansministeriet fra 2007, fuldmægtig i Finansministeriet fra 2005, konsulent i Consia Consultants fra 2003. Bestyrelsesposter: Bestyrelsesmedlem i I/S DIGI-TV og bestyrelsesmedlem i Udbetaling Danmark. Gitte Rabøl Direktør for DR Medier fra maj 2011. Tidligere ansættelse: Direktør i DR Oplysning fra 2009, selvstændig rådgiver inden for medier, kommunikation og ledelse fra 2007, kanalchef for DR2 fra 2003, programredaktør på DR2 fra 2001, freelancer fra 1997, reporter på TV Avisen fra 1995, tilrettelægger på DR Dokumentar fra 1993, reporter på TV Avisen fra 1990, redaktionschef og studievært på TV 2 Lorry fra 1989, journalist på Det Fri Aktuelt fra 1987, reporter på TV Avisen fra 1985, journalist på Demokraten Weekend i 1984, freelancer på DR B&U, P4, P1 og på diverse dag- og ugeblade fra 1981. Bestyrelsesposter: Medlem af bestyrelsen for Danmarks Medie- og Journalisthøjskole Gitte Rabøl er efter eget ønske stoppet som direktør for DR Medier 31. marts 2017. Anne-Marie Dohm Direktør for DR Danmark fra september 2013. Tidligere ansættelser: Chefredaktør ved NORDJYSKE Medier fra 2011, rektor for Danmarks Medie- og Journalisthøjskole fra 2007, kommunikationschef og direktionsmedlem i DGI fra 2004, kommunikationschef og direktionsmedlem i Mejeriforeningen fra 2002, journalist og reportagechef ved Morgenavisen Jyllands-Posten fra 1993. Bestyrelsesposter: Medlem af bestyrelsen for Idrættens Analyseinstitut siden 2013, medlem af styrelsen for Center for Journalistik ved SDU. Tine Smedegaard Andersen Direktør for DR Kultur fra juni 2014. Tidligere ansættelser: Koncerndirektør i Gyldendal fra 2012, administrerende direktør i Rosinante & Co A/S fra 2006, marketingchef i Gyldendal fra 1999, centerleder ved Dansk Litteraturinformationscenter fra 1996, redaktør i Gyldendals Bogklubber fra 1992. Ulrik Haagerup Direktør for DR Nyheder fra januar 2010. Tidligere ansættelser: Divisionschef i DR Nyheder fra 2007, chefredaktør på NORDJYSKE Medier fra 2003, konsulent i Haagerup Consulting fra 2002, journalistisk chefredaktør for Morgenavisen JyllandsPosten fra 1994, ledende redaktionschef på Morgenavisen Jyllands-Posten fra 1992, undersøgende journalist og reporter på Morgenavisen Jyllands-Posten fra 1986. Bestyrelsesposter: Medlem af bestyrelsen for Verdens Bedste Nyheder siden 2016. Medlem af styrelsen for Folkeuniversitetet i Aarhus siden 2013. Modtager af Cavling Prisen 1990. Ulrik Haagerup forlader efter eget ønske DR. Han tiltræder en stilling som Direktør for Constructive Institute ved Aarhus Universitet 1. september 2017. DRs ÅRSRAPPORT 2016 14. ORGANISATION DR DANMARK DR NYHEDER LYTTER- OG SEER- REDAKTØR DR KULTUR GENERAL- DIREKTØR BESTYRELSE DR RÅDGIVNING, STRATEGI OG KOMMU- NIKATION DR MEDIER INTERN REVISION DR ØKONOMI, TEKNOLOGI OG MEDIE- PRODUKTION DRs ÅRSRAPPORT 2016 DR Emil Holms kanal 20 0999 København C Telefon: 35 20 30 40 Hjemmeside: www.dr.dk CVR-nr. 62 78 65 15 Hjemsted København Regnskabsår 1. januar - 31. december Bestyrelsesmøde Regnskabet er godkendt på bestyrelsesmødet den 27. april 2017 Juridisk form Selvstændig offentlig institution Skatter og afgifter DR er i henhold til Bekendtgørelse af lov om indkomstbeskatning af aktieselskaber mv. undtaget fra skattepligt. DR er en licensfinansieret, momspligtig public service-virksomhed, jf. Momslovens § 13, stk. 1, nr. 6 samt Momssystemdirektivets artikel 370 og gældende Bekendtgørelse om medielicens. 15. VIRKSOMHEDSOPLYSNINGER DRs ÅRSRAPPORT 2016 DRs ÅRSRAPPORT 2016 DRs ÅRSRAPPORT 2016 DRs ÅRSRAPPORT 2016	<urn:uuid:b39a058d-1582-4d9d-a0a8-eae8698b230b>	HuggingFaceFW/finepdfs/tree/main/data/dan_Latn/train	finepdfs	dan_Latn	104,363
Resonate Youth Philharmonic Are you, or is someone you know, looking for an opportunity to play orchestral music with like-minded young musicians? Would you like the chance to learn from Royal Liverpool Philharmonic musicians to build on your instrumental and orchestral technique and ensemble skills, and play music in a range of musical styles? Would you like to take part in exciting performances every term, and at least once a year in Liverpool Philharmonic Hall? If you answered yes to any of the above, contact us for more information about our brand new weekly orchestra, Resonate Youth Philharmonic, for children and young people learning an orchestral string, woodwind, brass or percussion instrument and playing at Grade 2-6 standard. Rehearsals are Tuesday evenings (4.15pm – 6.30pm) at Bellerive FCJ Catholic College, or Thursday evenings (4.15pm – 6.30pm) at Notre Dame Catholic College. For more information, and to join, contact Resonate Music Hub on 0151 330 5130 or visit www.resonatehub.co.uk	<urn:uuid:e4e743c7-1017-4892-9478-24aa2520d34b>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	1,017
## SOUPS \| Soups \| Price \| \|--------------------------------------------\|--------\| \| Fresh vegetable soup \| 290/170 P \| \| Pickle soup with giblets \| 360/220 P \| \| Soup with porcini mushrooms \| 380/230 P \| \| Pea soup with smoked meat \| 390/240 P \| \| Cream of pumpkin \| 390/240 P \| \| Russian cabbage soup with porcini mushrooms stored for 24 hours \| 390/240 P \| ## COLD STARTERS \| Cold Starters \| Price \| \|--------------------------------------------\|--------\| \| Pickled peppers stuffed with ricotta, feta and tuna \| 390 P \| \| Atlantic herring with warm boiled potatoes \| 390 P \| \| Veal liver pate with crispy toasts \| 420 P \| \| Herring forschmack with rye bread \| 430 P \| \| Cold boiled pork with mustard and horseradish \| 450 P \| \| Portuguese jamon (12 months) \| 490 P \| \| Cold appetiser of three types of meat (beef tongue, cold boiled pork, chicken roll) \| 550 P \| \| Murmansk cod under marinade \| 570 P \| \| Jellied meat \| 590 P \| \| Antipasti \| 790 P \| \| Mozzarella with seasonal tomatoes \| 790 P \| \| Smoked Bajkal omul \| 890 P \| \| Home-salted mackerel from Murmansk \| 890 P \| \| Burrata with Samarkand tomatoes \| 1590 P \| \| Faroe Island salmon carpaccio \| 790 P \| \| Prime Beef Carpaccio with arugula and parmesan \| 790 P \| \| Carpaccio made of Baku tomatoes \| 950 P \| ## HOT STARTERS \| Hot Starters \| Price \| \|-------------------------------------------\|--------\| \| Julienne with chicken and mushrooms \| 350 P \| \| Kidneys in wine sauce \| 450 P \| \| Homemade veal dumplings \| 490 P \| \| BBQ chicken wings \| 550 P \| \| Grilled Bavarian sausages \| 560 P \| \| Cabbage rolls with beef \| 590 P \| \| Beef tongue in broth with horseradish \| 690 P \| \| Argentinian style beef ribs \| 750 P \| \| Bone marrow with rye bread and smoked salt \| 790 P \| \| BBQ pork ribs with Coleslaw salad \| 830 P \| \| BBQ beef ribs with Coleslaw salad \| 890 P \| ## SALADS \| Salads \| Price \| \|--------------------------------------------\|--------\| \| Cabbage salad with fennel, carrot, celery and yoghurt \| 320 P \| \| - with crab \| 690 P \| \| Vinegret with Atlantic herring \| 390 P \| \| Russian salad with smoked turkey \| 450 P \| \| Salad with farm vegetables \| 490 P \| \| Cucumber salad with shrimps and zucchini \| 490 P \| \| Lettuce leaves with free range turkey and caramelized pear \| 520 P \| \| Baked beetroot with cheese, apple and grapefruit \| 550 P \| \| "Ribeye" green salad \| 590 P \| \| - with crab and shrimps \| 960 P \| \| Greek salad \| 590 P \| \| Caesar salad with chicken \| 690 P \| \| - with shrimps \| 750 P \| \| Arugula leaves with grilled marbled steak \| 690 P \| \| Arugula leaves with shrimps, cherry tomatoes and citrus dressing \| 820 P \| \| Cocktail salad in avocado \| 950 P \| \| Healthy Nioise salad with fresh tuna \| 950 P \| ## STEAKS ### BLACK ANGUS BEEF, 12 MONTHS #### GRAIN FED (BRYANSK) - Filet mignon ...........180/250 g 2790/3590 P - NY Striploin ..........350/500 g 2090/2890 P - Ribeye ..................350/500 g 3290/3790 P #### GRASS FED (ORENBURG) - Filet mignon ...........180/250 g 1990/2790 P - NY Striploin ..........350/500 g 1890/2690 P - Ribeye ..................350/500 g 2690/2890 P #### CHOICE STEAKS - Filet mignon ...........180/250 g 2690/3390 P - NY Striploin ..........350/500 g 1890/2690 P - Ribeye ..................350/500 g 2790/3590 P #### ALTERNATIVE STEAKS - Flap steak ...............300 g 1590 P - Top sirloin .............300 g 1890 P #### PREMIUM DRY AGED BEEF - NY Striploin ..........300/500 g 3790/4590 P - Ribeye ..................300/500 g 4390/4790 P #### DEGREES OF STEAK DONENESS - Blue, 36–39 °C - Rare, 40–42 °C - Medium rare, 45–47 °C - Medium, 50–53 °C - Medium well, 56–60 °C - Well done, 63–66 °C #### STEAKS ON THE BONE (GRAIN FED) - Striploin ..............100/700 g 750/5190 P - Porterhouse ............100/700 g 790/5390 P - T-bone ..................100/700 g 790/5390 P - Ribeye ..................100/700 g 890/6190 P ## HOT MEAT DISHES - Veal liver with fried onions ............... 650 P - Pozharskie cutlets with mashed potatoes .... 670 P - Home style zrazy with mushroom sauce ...... 670 P - Patties made of dry aged marbled beef with boiled potatoes ................. 690 P - Pork steak with orange-mustard sauce and AiolI mashed potatoes .............. 750 P - Beef stroganoff "Ribeye" with porcini mushrooms and mashed potatoes ........... 790 P - Chicken Kiev with Idaho potatoes ........... 850 P - Bobby veal cheeks ........................................ 890 P - Stewed veal tails ........................................ 970 P - Dry aged marbled beef brisket .............. 1190 P - Farm duck, baked in honey glaze ............ 1290 P - Baked lamb chuck with Provence herbs ........ 2990 P Dish to share for 2-4 people ## HOT FISH DISHES - Atlantic cod cutlets with shrimp sauce ........ 890 P - Grilled Dorado ........................................ 940 P - Halibut baked with zucchini .................... 1290 P - Murmansk scallop ..................................... 790 P - Royal shrimps ........................................ 890 P ## GRILLED FISH - Faroe Island salmon steak with tartare sauce .... 1490 P - Wild tuna steak ........................................ 1890 P ## SAUCES FOR FISH - Tartare .................................................. 90 P - Tomato sauce with horseradish .................. 90 P - Mayonnaise with tangerine .......................... 90 P - Caponata ................................................ 120 P - Fried lemon ............................................ 190 P ## PICKLES - Novgorodian pickled tomatoes .................. 150 P - Sauerkraut ............................................. 150 P - Pickled cucumbers .................................... 150 P - Quick pickled cucumbers ............................ 250 P - Pickled Arkhangelsk milk caps .................. 360 P - Vologda porcini mushrooms ...................... 490 P ## WILD GAME DISHES - Pelmeni with hare meat ............................ 590 P - Duck cutlets ........................................... 790 P - Venison tenderloin under cowberry sauce with vegetables .................. 1690 P ## GRILLED MEAT - Chicken breast with tomato sauce .............. 520 P - Farm chicken .......................................... 850 P - Chopped marbled beef steak ...................... 1090 P - Rack of lamb ........................................... 1790 P ## GARNISH - Stewed sauerkraut ................................... 190 P - Rice with vegetables ................................. 190 P - Corn in cream cheese sauce ........................ 290 P - Grilled green corn .................................... 320 P - Spinach saute .......................................... 360 P - Buckwheat with mushrooms .......................... 390 P - Quinoa with vegetables and guacamole sauce ...... 390 P - Steamed broccoli with cheddar cheese ............ 430 P - Charcoal grilled vegetables ........................ 450 P - Seasonal mushroom saute ............................. 450 P ## POTATOES - Mashed potatoes ...................................... 190 P - Sauteed potatoes with onion ........................ 230 P - French fries ........................................... 230 P - Baked potatoes with cream cheese and bacon ...... 230 P - "4 cheese" mashed potatoes .......................... 320 P ## SPECIALTY DISHES OF JAPANESE KOBE MARBLED BEEF Cooked at your table in two authentic ways - Boiled Shabu-Shabu .................. 5800 P 9800 P - Fried Yaki Shabu-Shabu ............. 5800 P 9800 P ## BURGERS \| Mini Burgers \| "Ribeye" Burger \| Burger with Crab Meat \| \|--------------\|-----------------\|-----------------------\| \| 680 P \| 860 P \| 890 P \| Bread basket 190 P --- This brochure is an advertising material. Price list with output weight and energy value is on the consumer information board. Available upon the first request. Please tell your waiter if you have any food allergy to certain products.	<urn:uuid:90fa7787-b7f6-4b6c-82e8-a17220bf742d>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	8,785
MODELO DE CARTA PARA LAS SOCIEDADES ANONIMAS COTIZADAS (ACCIONES) Madrid, 28 de diciembre de 2011 Ref. Informe Anual de Gobierno Corporativo e Informe de Remuneraciones de los Consejeros Muy Sr/Sra. Nuestro/a: En línea con los acuerdos internacionales para el incremento de la transparencia y la mejora del gobierno corporativo, el pasado 4 de marzo, se aprobó la Ley 2/2011, de Economía Sostenible, que ha modificado el régimen jurídico existente incorporando nuevas obligaciones de información a las sociedades anónimas cotizadas. En particular, la Ley de Economía Sostenible modificó la Ley 24/1988, de 28 de julio, del Mercado de Valores, introduciendo un nuevo capítulo VI que lleva por título “Del informe anual de gobierno corporativo”. Dicho capítulo VI contiene dos nuevos artículos 61 bis y 61 ter, sobre la difusión y contenidos del informe anual de gobierno corporativo (en adelante, IAGC) y el informe de remuneraciones de los consejeros (en adelante, IAR), respectivamente: - El mencionado artículo 61 bis deroga y refunde el contenido de los artículos 116 sobre el IAGC, y 116 bis que establecía la obligación de incluir información adicional en el informe de gestión. Además, requiere que el IAGC incluya una descripción de las principales características de los sistemas internos de control y gestión de riesgos, en relación con el proceso de emisión de la información financiera. - El nuevo artículo 61 ter establece la obligación de elaborar un IAR que deberá ser difundido y sometido a votación con carácter consultivo y como punto separado del orden del día a la junta general ordinaria de accionistas. Según dicho artículo, el IAR deberá incluir información completa, clara y comprensible sobre la política de remuneraciones de la sociedad aprobada por el consejo para el año en curso, así como, en su caso, la prevista para años futuros. Incluirá también un resumen global de cómo se aplicó la política de retribuciones durante el ejercicio, así como el detalle de las retribuciones individuales devengadas por cada uno de los consejeros. Por último, la Ley de Economía Sostenible encomienda al Ministerio de Economía y Hacienda y, con su habilitación expresa a la Comisión Nacional del Mercado de Valores, el desarrollo de los contenidos y estructura del IAGC y del IAR. Informe Anual de Gobierno Corporativo referido al 2011 Considerando todo lo anterior, y en tanto no hayan culminado los procesos legislativos correspondientes para el desarrollo del nuevo modelo de informe, el IAGC referido al ejercicio 2011 podrá formularse según los contenidos y estructura del modelo establecido en la Circular 4/2007, de 27 de diciembre, de la Comisión Nacional del Mercado de Valores y deberá ser publicado en el plazo establecido en dicha norma. El IAGC podrá ser elaborado a partir del formulario web actualmente disponible en la sede electrónica de la CNMV, utilizando el servicio CIFRADOC/CNMV del registro electrónico. La entidad podrá generar un fichero de extensión “.XML” similar al presentado en años anteriores. La incorporación de los contenidos incluidos en la Ley de Economía Sostenible sobre gobierno corporativo, no recogidos específicamente en ninguno de los apartados del modelo y formularios en vigor, podrá hacerse mediante la generación de un fichero en formato “PDF”, para su envío a la CNMV junto con el fichero “.XML” obtenido a partir del formulario web. En concreto, se les recuerda que los contenidos de información establecidos en el nuevo artículo 61 bis de la Ley del Mercado de Valores afectan a lo siguiente: - Valores que no se negocian en un mercado regulado comunitario, con indicación, en su caso, de las distintas clases de acciones y, para cada clase de acciones, los derechos y obligaciones que confiera. - Cualquier restricción a la transmisibilidad de valores y cualquier restricción al derecho de voto. - Normas aplicables a la modificación de los estatutos de la sociedad. - Acuerdos significativos que haya celebrado la sociedad y que entren en vigor, sean modificados o concluyan en caso de cambio de control de la sociedad a raíz de una oferta pública de adquisición, y sus efectos. - Acuerdos entre la sociedad y sus cargos de administración y dirección o empleados que dispongan indemnizaciones cuando éstos dimitan o sean despedidos de forma improcedente o si la relación laboral llega a su fin con motivo de una oferta pública de adquisición. - Una descripción de las principales características de los sistemas internos de control y gestión de riesgos en relación con el proceso de emisión de información financiera. Por tanto, para la remisión y registro del IAGC referido al año 2011 mediante el sistema CIFRADOC/CNMV, las entidades podrán generar y firmar un fichero comprimido (formato zip), en el que podrán incluir: - El documento “.XML”, generado a partir de la plantilla/formulario web disponible, tal y como se ha realizado en años anteriores. - Un documento “PDF” con los nuevos contenidos de información recogidos en la Ley de Economía Sostenible. Se recomienda que el trámite de presentación a la CNMV del IAGC referido al ejercicio 2011, se realice mediante la firma y envío del mencionado fichero comprimido (en formato zip), utilizando para ello el servicio CIFRADOC de la sede electrónica de la CNMV. Informe Anual de Retribuciones de los Consejeros 2011-2012 En relación con la difusión del IAR, las entidades podrán remitirlo a la CNMV a través del servicio CIFRADOC/CNMV del registro electrónico y podrán utilizar el trámite denominado "ZZZ", adjuntando y firmando un documento en formato "PDF" que recoja la nueva información definida en el artículo 61 ter de la Ley del Mercado de Valores. Los procedimientos y especificaciones técnicas para la firma y envío del IAGC y del IAR, se encuentran disponibles en los correspondientes apartados sobre trámites a través del servicio CIFRADOC de la sede electrónica de la CNMV. Para cualquier duda técnica no duden en contactar con el teléfono de Atención al Usuario 902 180 772 ó en el correo electrónico email@example.com. Además, si tuvieran alguna duda sobre el contenido de esta carta, pueden ponerse en contacto con el Departamento de Informes Financieros y Corporativos (teléfono 91.585.16.00). Aprovecho la ocasión para saludarle atentamente. Ángel Benito Director General	<urn:uuid:04c0b782-8dd4-4559-be1e-9ca37fce5c1b>	HuggingFaceFW/finepdfs/tree/main/data/spa_Latn/train	finepdfs	spa_Latn	6,346
PRODUKTINFORMATION Serie910-De-Ttwin_TY_DE - 22.11.2021 - www.vs-moebel.de Serie 910-Twin-De Doppelarbeitsplatz. Konstruktion entsprechend DIN EN 527-1 aus mittig platzierten Stahlrohrtraversen und verschweißten Konsolen. Unterbau bestehend aus jeweils zwei Säulenpaaren aus pulverbeschichtetem Metall in den Querschnitten rund und quadratisch. Optional mit geschlossenen Seitenteilen (Wangen) zwischen den Säulen. Elektromotorische Höhenverstellung mit 2-fach teleskopierten Säulen, mit Kollisionschutz und optional mit Display, Memory und Kindersicherung. Tischplatten aus einer melaminharz-, furnier- oder linoleumbeschichteten Spanplatte, einer melaminharz-beschichteten oder furnierten MDF-Platte bzw. aus einer HPL-Vollkernplatte. Die Ecken sind kantig oder gerundet. Standardmäßig mit Schiebeplatte. Kabelauslass durch maximal 3 Metall-Auslässen (links, mittig, rechts) oder einer links oder rechts positionierten E-Box, für Netz- und Datenanschlüssen je Arbeitsplatz. Elektrifizierung (optional) erfolgt mittels einer abklappbaren Blech-Kabel- bzw. einer beidseitig abklappbaren Textilwanne und einen verkettbaren Kabeltrog für die gemeinsame Verkabelung beider Tische. Zur Auswahl stehen es ein flexibler Textilkabelschlauch und eine runde bzw. rechteckige Kabelkette. Folgende Materialgruppen stehen zur Auswahl: Gestell aus Stahlrohr: M2; Platte aus Spanplatte, MDF, HPL: L6; Platte aus Linoleum: L8; Platte furniert: F1.	<urn:uuid:5f587645-3439-4389-b8eb-686e0c650580>	HuggingFaceFW/finepdfs/tree/main/data/deu_Latn/train	finepdfs	deu_Latn	1,437
Regidoria de Governació: Joan Santacana Vélez ÀREA DE RÈGIM INTERN Regidoria d´Hisenda: Jordi Pons Marimon ÀREA DE SERVEIS AL TERRITORI Regidoria de Serveis Municipals: Joan Santacana Vélez Regidoria d´Urbanisme: Meritxell Ramon Rius ÀREA DE PROMOCIÓ ECONÒMICA, TURISME, CULTURA I FESTES Regidoria de Cultura: Mercè Carulla Castells Regidoria de Festes: Mireia Brandon Trepat Regidoria de Promoció Econòmica i Turisme: Mercè Carulla Castells ÀREA DE DINAMITZACIÓ CIUTADANA Regidoria d´Educació: Ricard Vicente Martínez Regidoria de Joventut i Esports: Meritxell Ramon Rius Regidoria de Polítiques Feministes i LGBTI+: Mireia Brandon Trepat Regidoria de Ciutadania, Acció Social i Salut: Joan Santacana Vélez ÀREA DE SEGURETAT CIIUTADANA Regidoria de Mobilitat i Civisme: Jordi Pons Marimon Regidoria de Seguretat: Ricard Vicente Martínez O RGANIGRAMA G ENERAL Decret 0206/2020 de 16 de juny de 2020	<urn:uuid:d4b5a9f6-9e1e-4396-be16-3057ce3d3173>	HuggingFaceFW/finepdfs/tree/main/data/cat_Latn/train	finepdfs	cat_Latn	900
MAIN MEALS Chicken goujons, served with chips and a BBQ dip Chicken Goujons / 3.49 Classic Burger / 3.49 Beef burger in a soft brioche-style bun, served with chips and BBQ sauce Fish Fingers and Chips / 3.49 Crispy breaded fish fingers served with tartare sauce Quorn™ Sausages and Mash / 3.49 Two Quorn™ sausages served with mash and beans We will be happy to provide a complimentary salad bowl on request DESSERTS With vanilla ice cream and chocolate-flavoured sauce Chocolate Fudge Cake / 1.00 Vanilla Ice Cream / 1.00 With chocolate-flavoured sauce Do you have any allergies? Full allergen information is available for all dishes – please ask a team member before ordering food and drinks, as menus do not list all ingredients. Please see our main menu. See main menu for full Ts&Cs and allergen guidance. Fish and poultry dishes may contain bones. = This dish is suitable for vegetarians	<urn:uuid:c8011ec5-7687-428f-84dc-9c421aab580a>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	911
Winona Health provides medical care for Minnesotans living in the state's southeast corner and the college students who go there for an education. Unfortunately, the medical center's finances are grim enough that Rachelle Schultz, its president and CEO, is feeling the impact on her own health. In 2022, even with some federal pandemic aid still available, the nonprofit system posted a negative operating margin of 3%. The 2023 fiscal year began in October, and the losses are projected to continue, even accelerate. The workforce shortage remains a reality, limiting care capacity. Costs for labor, drugs and supplies continue to rise, and reimbursements, particularly from government programs, aren't keeping pace. Patients who could be discharged are "stuck" because nursing home and other transitional facilities' capacity is strained — a big problem because hospitals' reimbursement for these extended stays is limited at best and, more often, nonexistent. That negative operating margin could be 6% or even 8% at Winona Health when it's time to close 2023's books. Schultz, an industry veteran, said the nonprofit system has good years and bad, but this is sobering new territory. "I've never even seen something like this. It gives me chest pain," she said in an interview with an editorial writer on Thursday. Hospital executives in Minnesota and nationwide are likely feeling the same palpitations. The economic forces plaguing Winona Health are undermining the financial health of medical centers large and small, and in urban and rural settings. Congress and state lawmakers in St. Paul urgently need to recognize and ameliorate the cost pressures. According to the Minnesota Hospital Association (MHA), "41% of hospitals and health systems reported a negative operating margin in 2021. That number increased significantly with 56% of hospitals and health systems reporting negative operating margins in 2022." Vital signs for medical centers outside of Minnesota are alarming as well. A report released last fall by the Kaufman Hall consulting group projected "billions of dollars in losses" for 2022 as hospitals contend with the COVID-19 pandemic's aftermath. Headwinds include supply chain disruptions, inflation, the ebbing of government pandemic aid and staff burnout after the intense fight against the coronavirus. Well-known systems that posted eyebrow-raising losses in late 2022 included Mass General Brigham, a Bostonbased academic health center and Harvard Medical School's principal teaching affiliate. It lost $432 million and recorded a negative 2.6% operating margin. The factors driving these losses have no quick or easy solutions. While they may ease in 2023, expecting a swift let-up is unrealistic. Nor is it acceptable to leave hospitals to grapple with this alone. While they have financial reserves, those resources often have been tapped three years into a pandemic that upended business as usual. Relying on savings also isn't a sustainable business model, said North Memorial Health's CEO Dr. Kevin Croston in an interview with an editorial writer. Croston's Twin Cities-based health system is facing the same bottom-line pressures as Winona Health. In 2022, it posted a negative 2.1% operating margin. Despite these alarming results, this issue has not yet received the legislative attention so clearly required. While lawmakers have a crowded agenda, this serious matter deserves a spotlight at the Minnesota Capitol. Congressional attention is urgent as well. Longer-term solutions include increasing government reimbursements and funding incentives to entice more people into health care professions. It's also critical to ease pressure on providers with short-term fixes while implementing these broader remedies. The Star Tribune Editorial Board strongly recommends a targeted, temporary $50 million state grant program to offset hospital costs from delayed discharges. This bottleneck occurs when patients don't need hospitalization but still require additional care when no beds are available at nursing homes or other facilities. Delayed-discharge patients represent 22% of the patients hospitalized in Minnesota during a given week, according to the MHA. It's not hard to see why state aid is needed, given that the nation's byzantine health care payment policy generally leaves hospitals to shoulder the financial responsibility for these extended stays. The health of the state's hospitals is important for the economy and Minnesotans' well-being. Federal and state lawmakers quickly aided these institutions with loans and grants when the pandemic began. Continued assistance is critical in the wind-down of this historic public health emergency. Opinion editor's note: Editorials represent the opinions of the Star Tribune Editorial Board, which operates independently from the newsroom. Editorial Board members are David Banks, Jill Burcum, Scott Gillespie, Denise Johnson, Patricia Lopez, John Rash and D.J. Tice. Star Tribune Opinion staff members Maggie Kelly and Elena Neuzil also contribute, and Star Tribune Publisher and CEO Michael J. Klingensmith serves as an adviser to the board.	<urn:uuid:404c8453-1520-4003-b778-413d8d1db61c>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	5,161
Automatikwerk Self-winding movement J800 J840 J820 DEUTSCH 4 Herzlichen Glückwunsch zu einer Original Junghans. Junghans Uhren sind und waren schon immer etwas Besonderes. Sie haben Uhren- und Designgeschichte geschrieben. Und dies tun wir immer noch. Denn die Erfolgsgeschichte, die 1861 in Schramberg im Schwarzwald begann, wird mit jedem neuen Modell fortgesetzt. In jeder Uhr steckt das, was eine Junghans auszeichnet: Stil, Leidenschaft, Innovationsgeist und Präzision bis ins kleinste Detail. Anders gesagt: Wenn traditionelle Handwerkskunst, neueste Uhrentechnologie und ein stilvolles Design aufeinander treffen, dann ist es eine echte Junghans. Eine Uhr für alle, die ihren eigenen Stil leben – und dazu können wir Ihnen nur gratulieren. Ihre Uhrenfabrik Junghans GmbH & Co. KG 5 Inhalt Bedienungsanleitung Allgemeine Hinweise Seite 7 13 Bedienungsanleitung Wichtiger Hinweis: vornehmen, da in dieser Zeit das Datum automatisch vom Uhrwerk In der Zeit zwischen 20 und 2 Uhr dürfen Sie keine Datumskorrektur weitergeschaltet wird und der Schaltmechanismus beschädigt wer den könnte. Aufziehen der Uhr In Kronenposition A können Sie das automatische Uhrwerk von Hand aufziehen. Sollte Ihr Modell über eine verschraubte Krone verfügen, muss diese zur Inbetriebnahme durch Linksdrehen losgeschraubt werden. Zum Ingangsetzen des Werkes bedarf es mindestens 2 bis 3 Umdre hungen der Krone. Ist die Uhr längere Zeit nicht getragen worden und dadurch zum Stillstand gelangt, können Sie diese manuell aufzuziehen (siehe „Vollaufzug" Technische Informationen), ein Mindestaufzug von 20 Umdrehungen wird empfohlen. Wird die Uhr getragen, generiert sie die notwendige Energie durch die Bewegung am Arm. Bei Vollaufzug ist die maximale Gangreserve gewährleistet. 7 Bedienelemente und Funktionen 2 Sekundenzeiger 1 Stundenzeiger 3 Wochentagsanzeige (modellabhängig) 5 Krone 4 Minutenzeiger 6 Datumsanzeige (modellabhängig) Einstellung der Uhrzeit Ziehen Sie die Krone in Position C. Dadurch stoppen Sie das Uhrwerk. Für ein sekundengenaues Einstellen ist es vorteilhaft, wenn das Uhr werk beim Durchgang des Sekundenzeigers über der 60 angehalten wird. Nun können Sie den Minutenzeiger zum Minutenstrich positionieren und die gewünschte Uhrzeit einstellen. Zum Starten des Sekundenzeigers drücken Sie die Krone wieder in Position A. Einstellen des Datums (modellabhängig) Ziehen Sie die Krone in Position B. Durch Rechtsdrehen der Krone können Sie das Datum einstellen. In der Zeit zwischen 20 und 2 Uhr dürfen Sie keine Datumskorrektur vornehmen, da in dieser Zeit das Datum automatisch vom Uhrwerk weitergeschaltet wird und der Schaltmechanismus beschädigt werden könnte. Hat der Monat weniger als 31 Tage, stellen Sie das Datum manuell auf den 1. Tag des Folgemonats ein. Einstellen des Wochentages (modellabhängig) Ziehen Sie die Krone in Position B. Durch Linksdrehen der Krone können Sie den Wochentag einstellen. In der Zeit zwischen 20 und 2 Uhr dürfen Sie keine Datumskorrektur vornehmen, da in dieser Zeit das Datum automatisch vom Uhrwerk weitergeschaltet wird und der Schalt mechanismus beschädigt werden könnte. 9 Technische Informationen Kaliber J800 * Automatischer beidseitiger Aufzug * Automatikwerk mit Datumsanzeige (modellabhängig) * Vollaufzug: mind. 27 Kronenumdrehungen * Gangreserve 38 Stunden * 28.800 Halbschwingungen/Stunde * Antimagnetisch nach DIN 8309 * Unruh: Nickel vergoldet * Stoßsicherung: Incabloc Kaliber J820 * Automatikwerk mit Datumsanzeige Meister Chronometer/ Meister Classic * Automatischer beidseitiger Aufzug * 28.800 Halbschwingungen/Stunde * Vollaufzug: mind. 65 Kronenumdrehungen * Gangreserve 42 Stunden * Stoßsicherung: Incabloc * Antimagnetisch nach DIN 8309 * Unruh: Nickel vergoldet Kaliber J840 * Automaticwerk mit Datumsanzeige Meister Damen Automatic * Automatischer beidseitiger Aufzug * 28.800 Halbschwingungen/Stunde * Vollaufzug: mind. 20 Kronenumdrehungen * Gangreserve 38 Stunden * Stoßsicherung: Incabloc * Antimagnetisch nach DIN 8309 * Unruh: Nickel vergoldet 11 Wasserdichtheit Die Wasserdichtheit nach DIN ist ein Konstruktionsmerkmal, das durch äußere Einflüsse wie Stoß, Temperaturschwankungen, UV-Licht sowie durch den Kontakt mit Kosmetika und Reinigungsmitteln (Fetten und Säuren) beeinflusst werden kann. Der Zustand „3–30 BAR" gilt somit nur für fabrikneue Uhren. Wir empfehlen, die Uhr regelmäßig überprüfen zu lassen. Allgemeine Hinweise Die Wasserdichtheit kann durch äußere Einflüsse beeinflusst werden, wodurch Feuchtigkeit in die Uhr eindringen kann. Daher empfehlen wir Ihnen, Ihre Uhr regelmäßig von Ihrem Junghans Fachmann überprüfen zu lassen. Servicearbeiten und Armbandreparaturen sollten ebenfalls von einer autorisierten Junghans Werkstatt durchgeführt werden. Vermeiden Sie den direkten Kontakt mit alkoholhaltigem Parfüm, Desinfektionsmitteln sowie chemischen Reinigungsmitteln (z. B. Benzin oder Farbverdünner), da dadurch die Lebensdauer von Glas, Dichtungen und Lederband verkürzt wird. Ihre Uhr ist mit einem mehrfach in unserem Hause geprüften Qualitätsarmband ausgestattet. Sollten Sie Ihr Armband wechseln, verwenden Sie bitte ein Armband gleicher Qualität, am besten wieder ein Originalarmband. Uhr und Lederbänder können mit einem trockenen oder leicht angefeuchtetem Tuch gereinigt werden. Metallbänder reinigen Sie vorzugsweise mit einer kleinen Bürste und Seifenwasser. 13 Uhrenfabrik Junghans GmbH & Co. KG Geißhaldenstr. 49 · D-78713 Schramberg www.junghans.de · email@example.com	<urn:uuid:fbdb956b-062c-4175-a5c3-af96a1baffa1>	HuggingFaceFW/finepdfs/tree/main/data/deu_Latn/train	finepdfs	deu_Latn	5,544
Born in Wardell, MO to Harry H Harris and Beulah May {Bracey} Harris. Was preceded in death by his parents and wife of 29 years Juanita E {Dennison] Harris. Was an electrician by trade and served in the United States Army. He is survived by two children: Carol [Andrew] Carlson and Delores Stegall; 3 grandchildren: Belinda [David] English, John [Ashley] Flores and Matthew Carlson; and 3 great grandchildren: Serina [Eric] Grim, Gregory {Keri} English, and Claire Flores. Cemetery Events	<urn:uuid:8980dc19-60fb-4d9d-8f90-f7f86c05b796>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	490
En août, le fonds a progressé de 0,5%. En comparaison, l’indice FTSE All-Share a baissé de -1,7% et l’indice FTSE Govt All Stocks de -7,6% (ces chiffres sont des rendements totaux en livres sterling). Le mois d’août a commencé sous le soleil, alors que des chiffres d’inflation plus faibles que prévus alimentaient l’idée que l’économie américaine pouvait avoir passé son pic d’inflation sans aucun signe de faiblesse du marché du travail. Ce scénario digne de Boucle d’or (ni trop chaud, ni trop froid) était idéal pour les investisseurs mais nous semblait incompatible avec l’orientation de la politique monétaire. Pour nous, ce ‘rally’ était voué à l’échec puisque la hausse des actions (entre autres critères) participe à l’assouplissement des conditions financières – le contraire même du resserrement que la Fed tente d’imposer. Son président, Jerome Powell, s’est lui-même chargé de troubler la fête lors du symposium de Jackson Hole. Contrairement à de récentes communications interprétées comme plus accommodantes, M. Powell a laissé peu de doute sur le fait que son institution reste résolue dans la lutte contre la forte inflation en vigueur. Le fait qu’un président de Fed régionale se réjouisse publiquement de la chute des marchés qui a suivi ce discours montre à quel point les temps ont changé ! In fine ce fut un nouveau mois difficile dans une année déjà difficile. Les actions ont chuté, tandis que les obligations ont souffert d’une forte hausse des taux. Cette hausse a été la plus prononcée en Europe, en lien avec la crise de l’énergie et à l’anticipation de hausses des taux d’intérêt. Malgré une forte inflation attendue, que certains estiment supérieure à 20% au Royaume-Uni, les attentes à long terme restent ancrées aux moyennes historiques, ce qui crée un vent contraire pour nos gilts indexés à l’inflation à longue échéance. Malgré ce contexte défavorable, nos protections ont permis de finir le mois dans le vert. Le secteur de l’énergie a profité au fonds, BP ayant progressé de 10% sur le mois. Dans un monde où les taux d’intérêt augmentent et où les liquidités se retirent (le rythme du QT va doubler en septembre), nous nous concentrons fermement sur notre principal objectif : la préservation du capital. Après une décennie où le mantra de l’investissement se résumait à TINA (There Is No Alternative) menant à une recherche de rendement synonyme de toujours plus de risque, les investisseurs se voient maintenant offrir une alternative avec des taux à court terme plus élevés. Nous craignons que cela provoque une réduction des allocations en actifs risqués. Par conséquent, notre exposition actions est à un niveau historiquement bas et nous avons renforcé nos protections en cas de nouvelle chute des marchés. Il ne faut pas y voir un portefeuille à faible conviction, mais plutôt un portefeuille bien protégé en cas de turbulences. Objectif d’investissement L’objectif d’investissement du fonds Ruffer Total Return International (« le fonds ») est de générer une performance positive avec une faible volatilité à l’aide d’un portefeuille géré activement. Le fonds peut être exposé aux catégories d’actifs suivantes : liquidités, titres de créance de tous types (y compris des titres de créance d’États et de sociétés), actions et titres apparentés aux actions et matières premières (y compris métaux précieux). Une philosophie de préservation de capital prime sur cet objectif. Performance depuis le lancement (14 juillet 2011) Les performances passées ne préjugent pas des performances futures Parts I EUR capitalisation \| Performance % \| Valeur de la part au 31 août 2022 \| \|---------------\|----------------------------------\| \| Août 2022 \| 0,5 \| \| I EUR Capitalisation \| 167,27 \| \| Depuis le 1er janvier \| 1,9 \| \| I CHF Capitalisation \| 160,12 \| \| 1 an \| 3,4 \| \| I USD Capitalisation \| 190,74 \| \| 3 ans \| 25,7 \| \| I SEK Capitalisation \| 170,73 \| \| 5 ans \| 25,8 \| \| I CAD Capitalisation \| 153,82 \| \| 10 ans \| 68,4 \| \| I SGD Capitalisation \| 154,24 \| \| \| I GBP Capitalisation \| 183,47 \| Performance des 12 derniers mois à fin juin % \| 2018 \| 2019 \| 2020 \| 2021 \| 2022 \| \|------\|------\|------\|------\|------\| \| RTRI I cap € \| 0,4 \| -3,9 \| 9,6 \| 14,7 \| 2,4 \| \| RTRI I cap £ \| 1,5 \| -2,6 \| 10,8 \| 15,5 \| 3,4 \| \| FTSE All-Share TR £ \| 9,0 \| 0,6 \| -13,0 \| 21,5 \| 1,6 \| \| FTSE Govt All-Stocks TR £ \| 1,9 \| 4,9 \| 11,2 \| -6,2 \| -13,6 \| Source : Ruffer LLP, FTSE International (FTSE) © FTSE 2022. 'FTSE®' est une marque déposée du London Stock Exchange Group et est utilisée par FTSE sous licence. Tous les droits sur les données FTSE appartiennent à FTSE et/ou à ses concédants de licence. FTSE et ses concédants de licence n’acceptent aucune responsabilité en ce qui concerne les données FTSE. Aucune autre distribution des données FTSE n’est autorisée sans le consentement écrit de FTSE. Ruffer Total Return International au 31 août 2022 Allocation d'actifs - Obligations de court terme: 36,3% - Obligations liées à l'inflation UK: 20,1% - Obligations liées à l'inflation hors UK: 7,8% - Options et stratégies illiquides: 7,5% - Obligations de long terme liées à l'infl. UK: 6,6% - Liquidités: 4,7% - Exposition à l'or et actions aurifères: 1,6% Actions Europe et UK: 8,3% Actions Amérique du Nord: 3,5% Actions Japon: 2,4% Actions Asie ex-Japon: 0,4% Actions autres: 0,9% Allocation en devises - Livre sterling: 66,5% - Dollar US: 11,5% - Yen: 9,8% - Dollar australien: 7,8% - Euro: 2,2% - Autres devises: 2,2% Source: Ruffer LLP. Le total peut différer de 100 % en raison des arrondis. La devise de base du fonds est le GBP. Les parts libellées en autres devises sont couvertes pour limiter l'impact sur votre placement des mouvements entre la devise de base du fonds (GBP) et celle de la part. Les données du fonds affichées ne visent qu'à fournir des renseignements sommaires. Cette communication marketing n'explique pas les risques associés à ce placement. Toute décision d'investissement doit être fondée uniquement sur les informations contenues dans le prospectus, le document d'informations clés pour l'investisseur et les derniers états financiers. Veuillez noter que la SICAV Ruffer est un UCITS de droit luxembourgeois autorisé et supervisé par la Commission de Surveillance du Secteur Financier (CSSF) et reconnu par la Financial Conduct Authority (FCA) du Royaume-Uni. Ruffer Total Return International n'est éligible pour une distribution dans les pays suivants: l'Allemagne, la Belgique, la Danemark, la Finlande, la France, l'Irlande, l'Italie, l'Irlande (investisseurs qualifiés uniquement), le Luxembourg, les Pays-Bas, la Norvège, le Portugal, Singapour (investisseurs institutionnels et accrédités uniquement), l'Espagne, la Suède, la Suisse et le Royaume-Uni. Le prospectus du fonds est disponible en anglais et en français. Les documents d'information clés pour l'investisseur sont disponibles en plusieurs langues sur www.ruffer.co.uk ou sur demande. Un résumé des droits des investisseurs est disponible en anglais sur www.ruffer.co.uk/summary-of-rights. Ruffer LLP et Ruffer S.A. ne peuvent commercialiser RTRI dans d'autres pays, sauf sous certaines exemptions. Conformément au Prospectus, le fonds RTRI peut à tout moment investir plus de 35 % de ses actifs dans des valeurs mobilières émises ou garanties par un Etat membre de l'Espace Economique Européen (EEE), une ou plusieurs autorité(s) régionale(s), un pays tiers ou un organisme international auquel appartient un État membre de l'EEE ou de l'EEE. Les seules valeurs susmentionnées pour lesquelles Ruffer Total Return actuellement détiennent plus de 35 % consistent des valeurs mobilières émises par le gouvernement britannique ou américain. Cet investissement concerne l'acquisition de parts d'un fonds, et non d'un sous-jacent donné tel que des actions d'une société, car il ne s'agit uniquement de sous-jacents détenus par le fonds. Ruffer LLP ou FundPartner Solutions (Europe) S.A. peuvent arrêter les dispositifs de commercialisation du fonds dans le cadre du nouveau processus de notification de la Directive sur la Distribution Transfrontalière. Encours: €6 254,3m Informations générales \| Titre \| % du fonds \| \|------------------------\|------------\| \| BP \| 1,9 \| \| Ambev SA \| 0,9 \| \| Unilever \| 0,6 \| \| Hoya \| 0,5 \| \| Hertz \| 0,5 \| \| Deutsche Post \| 0,5 \| \| ORIX \| 0,5 \| \| NEC \| 0,5 \| \| Fujitsu \| 0,4 \| \| ArcelorMittal \| 0,4 \| Top 10 actions† \| Titre \| % du fonds \| \|------------------------\|------------\| \| UK Treasury index-linked 2.5% 2024 \| 8,1 \| \| US Treasury 0.625% TIPS 2023 \| 7,8 \| \| UK Treasury index-linked 1.875% 2022 \| 7,1 \| \| UK Treasury 0.125% 2023 \| 5,9 \| \| US Treasury FRN 2023 \| 5,3 \| Top 5 obligations \| Titre \| % du fonds \| \|------------------------\|------------\| \| ISIN et SEDOL \| EUR I cap LU0638558394 B4LVH08 \| \| \| CHF I cap LU0638558477 B4LOLM86 \| \| \| USD I cap LU0638558550 B4LO4N7 \| \| \| GBP I dis LU0779209195 B8BHYH0 \| \| \| SEK I cap LU0923103534 B94R6P6 \| \| \| USD I dis LU0955560437 BCDFYZK7 \| \| \| CAD I cap LU129676634 BYSW6J6 \| \| \| SGD I cap LU1400661093 BDZYGL3 \| \| \| GBP I cap LU0638558121 B4WP6C08 \| Structure: Compartiment de Ruffer SICAV, une SICAV UCITS domiciliée à Luxembourg Société de gestion, agent de transfert, agent administratif et agent payeur: FundPartner Solutions (Europe) S.A. Gestionnaire: Ruffer LLP Banque dépositaire: Pictet & Cie (Europe) S.A. Auditeurs: Ernst & Young S.A. Gérants Jacques Hirsch INVESTMENT DIRECTOR Diplômé de l'École Centrale Paris en 1999 et titulaire d'un MSc en Mathématiques de l'Université d'Oxford, Jacques rejoint Ruffer en 2011 après des expériences en gestion de fonds et recherche macro-économique chez Goldman Sachs, GLG Partners, Exane et Fulcrum AM. Alex Lennard INVESTMENT DIRECTOR Diplômé de l'Université d'Exeter avec un Bachelor en Finance et en Economie, il rejoint Ruffer en 2006 et devient analyste auprès de Jonathan Ruffer. Il est membre du Chartered Institute of Securities and Investment. Il est co-gérant de deux des principaux fonds de Ruffer. Renseignements Ruffer LLP +44 (0)20 7963 8254 80 Victoria Street London SW1E 5JL www.ruffer.co.uk Information pour les investisseurs suisses. Le prospectus, les documents d'informations clés pour l'investisseur, les statuts et les rapports annuels et semi-annuels de la SICAV Ruffer sont distribuables gratuitement à l'adresse du représentant en Suisse: FundPartner Solutions (Europe) S.A., 100, avenue des Acacias 60 CH – 1211 Geneva 73. L'agent payeur de la SICAV Ruffer en Suisse est la Banque Pictet & Cie S.A. à la même adresse. Publie par Ruffer S.A., 103 boulevard Haussmann, 75008 Paris. Cette communication marketing est émise par Ruffer S.A. qui est autorisée et régulée par l'ACPR et l'AMF. © Ruffer S.A. 2022 Les opinions exprimées dans la présente communication commerciale ne constituent pas une offre ou une sollicitation pour l'achat ou la vente d'un titre ou d'une unité ou d'un autre instrument financier. Les points de vue reflétant ceux de Ruffer LLP à la date du présent document et, bien que les opinions exprimées soient de bonne foi, elles ne sauraient constituer de garanties. Elles ne doivent pas être considérées comme telles et ne doivent être utilisées sans précaution. Les informations contenues dans ce document ne sauraient constituer un conseil en investissement et ne devraient pas servir de base à des décisions d'investissement. Les références à des titres spécifiques sont faites à titre d'exemple seulement et ne doivent pas être interprétées comme une recommandation d'acheter ou de vendre ces titres. Ruffer LLP n'a pas vérifié que les caractéristiques du fonds correspondent aux besoins spécifiques de l'investisseur et/ou à sa tolérance au risque. En cas de doute, veuillez contacter votre conseiller financier.	b558b951-3a08-43bb-99e4-bec4761bae3f	HuggingFaceFW/finepdfs/tree/main/data/fra_Latn/train	finepdfs	fra_Latn	12,777
PETIT GUIDE DES RETROUVAILLES À SAINTE-ANNE ÉTAPE 1 FIXER LA DATE DE L'ÉVÉNEMENT ET BROSSER LE PROGRAMME DE LA SOIRÉE Quand ? De 4 à 6 mois avant de lancer les invitations. Comment ? En tenant compte notamment : * des intérêts des participants et du but que vous poursuivez ; * du moment le plus propice (par exemple, éviter les dates qui coïncident avec de longs congés). ÉTAPE 2 RÉSERVER À SAINTE-ANNE Le Collège vous invite à réserver la cafétéria du Complexe pour la tenue de vos retrouvailles. Car se réunir à Sainte-Anne, c'est s'assurer de vivifier le sentiment d'appartenance à une grande famille tout en se facilitant l'organisation de l'événement sur plusieurs plans : les assurances et la sécurité, l'aménagement, les équipements… Quand ? Au moins 4 mois avant la date de l'événement. Coût ? Aucun (tables rectangulaires, chaises, porte-manteaux, matériel audiovisuel inclus). Un plaisir à offrir ? Il est possible d'organiser une visite guidée du Collège. ÉTAPE 3 ÉVALUER LE NOMBRE DE PARTICIPANTS ET PRÉCISER LE PROGRAMME DE LA SOIRÉE EN TENANT COMPTE : * des ressources financières disponibles ; * des besoins à combler à l'aide de services extérieurs (traiteur, location de matériel et d'équipements si requis...) ; * de la demande de permis de réunion; * etc. ÉTAPE 4 RÉSERVER UN TRAITEUR Quand ? Au moins 3 mois avant la date de l'événement. Qui ? Quelques bonnes adresses peuvent vous être référées au Collège. En plus des commerces extérieurs, la cafétéria du Collège, gérée par le Groupe Compass, offre la possibilité de vous préparer un repas ou des bouchées afin de répondre à vos besoins. À quelle adresse faire livrer ? 50, 12 e Avenue à Lachine. À retenir ? * le traiteur est sous la responsabilité des organisateurs ; * il n'a pas accès aux installations de la cuisine ni de la cafétéria ; * il doit laisser place propre avant de repartir. ÉTAPE 5 RÉSERVER CE QU'IL FAUT POUR DRESSER LES TABLES Quand ? Au moins 3 mois avant la date de l'événement. Quoi ? Les nappes, la vaisselle, les ustensiles, les verres à vin, les vases à fleurs… Où ? Dans les entreprises de location de matériel et d'équipement de réception ou auprès de votre traiteur. Coût ? En fonction du choix et de la quantité. ÉTAPE 6 LANCER L'INVITATION AU PLUS GRAND NOMBRE POSSIBLE D'ANCIENS ET D'ANCIENNES ET FIXER UNE DATE LIMITE DE RÉPONSE Quand ? Invitation : au moins 3 mois avant la date de l'événement / R.S.V.P. : au moins un mois avant la date de l'événement. Comment retracer le maximum d'anciens et d'anciennes ? * communiquer avec votre Association pour avoir accès au Bottin des anciens et anciennes ; * placer une annonce sur la page Facebook; * annoncer l'événement sur le site; * annoncer l'événement dans le Bulletin des anciens. ÉTAPE 7 PRÉVOIR LE MATÉRIEL AUDIOVISUEL NÉCESSAIRE Musique, danse, vidéo de documents d'archives, messages, discours, bien cuits, invité(s) surprise(s)… sont autant de moyens d'animer joyeusement des retrouvailles. Le Collège met gratuitement à votre disposition son matériel audiovisuel. Quand ? Au moins un mois avant la date de l'événement. Quoi ? Les micros, la chaine stéréo, le lecteur DVD, les écrans… Coût ? Aucun. Un conseil ? Assurez-vous de connaître le fonctionnement du matériel et de l'équipement avant le début de la soirée. À retenir ? Il est strictement interdit de modifier l'infrastructure et le système d'éclairage. Il est cependant possible d'apporter de l'équipement s'il répond aux normes en vigueur. ÉTAPE 8 DEMANDER UN PERMIS DE RÉUNION Il est en effet indispensable d'obtenir un permis de la Régie des alcools, des courses et des jeux du Québec pour arroser vos retrouvailles. Quand demander ? Au moins 15 jours (idéalement 30) avant la date de l'événement. Comment ? * En remplissant et en signant le formulaire prévu à cet effet (disponible au www.racj.gouv.qc.ca) ; * En obtenant une lettre du Collège qui confirme la tenue de l'événement. Coût ? Consulter le site de la Régie à l'adresse ci-haut indiquée. ÉTAPE 9 PENSER ASSURANCES ET SÉCURITÉ Il est impératif d'être protégé par une assurance et de prendre en compte la sécurité des lieux et des gens. Le Collège est assuré en tout temps pour l'usage normal de son établissement. Un gardien de sécurité étant sur place jusqu'à 23 h, c'est à lui que vous devrez communiquer toute urgence (poste 620). À retenir ? Si l'événement se poursuit au-delà de 23 h, il vous faut alors prévoir un gardien pour le reste de la soirée. ÉTAPE 10 AMÉNAGER LA SALLE Vous disposerez d'un temps raisonnable pour aménager et décorer la salle. Quand ? Le jour de la réception, dès 16 h. Indispensable ? Afficher le permis de réunion. ÉTAPE 11 RANGER AVANT DE QUITTER Sainte-Anne exige que tout soit rangé en fin de soirée. Par conséquent, il demande aux organisateurs de veiller à ce que tout soit remis en place avant de quitter la salle. Coût pour l'entretien ménager : Aucun, sauf si la salle nécessite plus qu'un nettoyage régulier. NOUS SOMMES LÀ POUR VOUS AIDER ! Pour organiser vos retrouvailles au Collège, rejoindre l'Association des anciens et anciennes, avoir accès au bottin ou pour publier votre annonce de retrouvailles : Linda Rodrigue, 514 637-3571 poste 863 ou firstname.lastname@example.org	<urn:uuid:801b4c29-36bb-48fc-8316-ea503c79a321>	HuggingFaceFW/finepdfs/tree/main/data/fra_Latn/train	finepdfs	fra_Latn	5,295
REPÚBLICA DE CHILE MINISTERIO DE TRANSPORTES Y TELECOMUNICACIONES SUBSECRETARÍA DE TELECOMUNICACIONES REF. REGLAMENTA LA FORMA Y CONDICIONES PARA GARANTIZAR LA LIBRE ELECCIÓN DE LOS USUARIOS EN LA CONTRATACIÓN Y RECEPCIÓN DE SERVICIOS DE TELECOMUNICACIONES EN LOTEOS, EDIFICACIONES Y COPROPRIEDAD INMOBILIARIA / DECRETO Nº 167 SANTIAGO, 15 SET. 2016 VISTOS: a) Lo dispuesto en los artículos 24°, 32° N° 6 y 35° de la Constitución Política de la República; b) La Ley N° 18.168, General de Telecomunicaciones, modificada por la Ley N° 20.808, publicada en el Diario Oficial con fecha 28 de enero de 2015; c) El Decreto con Fuerza de Ley N° 458, de 1975, del Ministerio de la Vivienda y Urbanismo, Ley General de Urbanismo y Construcciones, modificada por la Ley N° 20.808, antes señalada; d) La Ley N° 19.537, sobre Copropiedad Inmobiliaria; e) El Decreto Ley N° 1.762, de 1977, que creó la Subsecretaría de Telecomunicaciones; f) La Ley N° 19.880, que Establece Bases de los Procedimientos Administrativos que Rigen los Actos de los Órganos de la Administración del Estado; g) El Decreto Supremo N° 18, de 2014, del Ministerio de Transportes y Telecomunicaciones, que aprueba el Reglamento de Servicios de Telecomunicaciones que Indica; h) El Decreto Supremo N° 47, de 1992, del Ministerio de Vivienda y Urbanismo, Ordenanza General de Urbanismo y Construcciones; i) La Resolución N° 1.600, de 2008, de la Contraloría General de la República, que Fija Normas sobre Exención del Trámite de Toma de Razón, y; CONSIDERANDO: a) Que, la Ley N° 20.808 tiene por objeto proteger la libre elección de los servicios de cable, telefonía e internet en proyectos de edificación en altura y proyectos en extensión, nuevos; b) Que, asimismo, tiene por objeto garantizar la referida libre elección en el caso de edificaciones existentes; c) Que, para efectos de lo anterior, la ley citada modificó tanto la Ley N° 18.168, General de Telecomunicaciones como la Ley N° 19.537, sobre Copropiedad Inmobiliaria; d) Que, la mentada ley estableció que un reglamento dictado por el Ministerio de Transportes y Telecomunicaciones, con la concurrencia del Ministerio de Vivienda y Urbanismo, regulará la forma de inscripción de los proyectos en el registro a que hace mención la referida ley, la oportunidad en que ésta deberá llevarse a cabo, los supuestos que se encontrarían eximidos de dicha inscripción y la información que deberá acompañarse de cada proyecto, así como los aspectos técnicos que deberán cumplir las instalaciones con el objeto de que en su construcción se asegure el libre acceso de los operadores de telecomunicaciones; y, e) Que, atendido lo anterior, y en uso de mis atribuciones legales, dicto el siguiente: DECRETO: Apruébase el siguiente Reglamento sobre la forma y condiciones para garantizar la libre elección de los usuarios en la contratación y recepción de servicios de telecomunicaciones en proyectos de loteo o de edificación, conformados por varias unidades enajenables o de dominio exclusivo, estén o no acogidas al régimen de copropiedad inmobiliaria, de conformidad a lo previsto en la Ley N° 20.808, modificatoria de la Ley N° 18.168, General de Telecomunicaciones y de la Ley N° 19.537, sobre Copropiedad Inmobiliaria. TÍTULO I Disposiciones Generales Capítulo I Objeto del presente Reglamento Artículo 1° El presente Reglamento tiene por objeto regular los estándares técnicos que deberán cumplir, en su diseño y construcción, las instalaciones de telecomunicaciones de los proyectos de loteo o de edificación señalados en el artículo siguiente, pudiendo éstos estar conformados por uno o más predios o lotes, o por una o más unidades funcionales independientes o por varias unidades enajenables o de dominio exclusivo estén o no acogidas al régimen de copropiedad inmobiliaria, con el fin de asegurar al propietario o arrendatario de cada unidad la libre elección en la contratación y recepción de servicios de telecomunicaciones, así como el libre acceso a dichas unidades por parte de los proveedores u operadores de tales servicios, en los términos y condiciones aquí establecidos. Asimismo, regula la forma, oportunidad e información que deberá acompañarse a la inscripción de los proyectos señalados en el inciso anterior en el registro a que hace mención el artículo 7º quáter de la Ley Nº 18.168, General de Telecomunicaciones, así como los supuestos que se encuentran eximidos de dicha inscripción. Finalmente, establece disposiciones destinadas a garantizar, tanto procedimentalmente como en aspectos técnicos generales, la referida libre elección en el caso de edificaciones que hayan solicitado permiso de edificación o cuenten con recepción definitiva antes de la entrada en vigencia del presente Reglamento con el objeto de hacer factible el acceso de nuevos proveedores de servicios de telecomunicaciones, tanto al predio como a las respectivas unidades, así como la utilización por parte de dichos proveedores, de las instalaciones existentes. Capítulo II Ámbito de aplicación Artículo 2º El presente Reglamento se aplica a los predios o lotes resultantes de un proyecto de loteo y a las unidades funcionales independientes, enajenables o de dominio exclusivo del respectivo proyecto de edificación estén o no acogidos al régimen de copropiedad inmobiliaria, destinados a vivienda, comercio o servicios, incluidas las correspondientes obras de urbanización, y cuyos respectivos permisos se hubieren solicitado con posterioridad a la entrada en vigencia de este Reglamento, aun cuando cuenten con anteproyecto aprobado. A tales proyectos les serán plenamente aplicables las exigencias técnicas respecto del diseño, construcción y mantenimiento de las instalaciones de telecomunicaciones interiores y aquellas otras que permitan el acceso directo al predio, así como las normas sobre inscripción de dichos proyectos en el registro público y electrónico a que se refiere el Capítulo I del Título II de este Reglamento. Artículo 3º Será aplicable lo dispuesto en el Título VI del presente Reglamento a los loteos o edificaciones que a la fecha de entrada en vigencia de este Reglamento hayan solicitado permiso o cuenten con recepción definitiva, y estén conformados por varios predios o lotes, o por uno o más unidades funcionales independientes o por varias unidades enajenables o de dominio exclusivo, estén o no acogidas al régimen de copropiedad inmobiliaria y cuyo destino sea residencial, comercial o de servicios. Artículo 4º Se exceptúan del cumplimiento del presente Reglamento las unidades funcionales independientes o las unidades enajenables o de dominio exclusivo correspondientes a estacionamientos y bodegas, que formen parte de los loteos o edificaciones señalados en los artículos 2º y 3º precedentes, así como aquellas edificaciones destinadas exclusivamente a estacionamientos o bodegas, aun cuando estén compuestos por unidades enajenables o de dominio exclusivo. Artículo 5º En los proyectos de loteo en los cuales el cableado de las redes eléctricas sea desplegado de forma subterránea, las instalaciones de telecomunicaciones deberán someterse a las especificaciones establecidas en el presente Reglamento. Aquellos proyectos en los que el cableado de las redes eléctricas sea desplegado de forma aérea y deseen desplegar sus redes de telecomunicaciones de forma subterránea deberán someterse a las especificaciones establecidas del presente Reglamento. Capítulo III Definiciones generales Artículo 6° Para los efectos del presente Reglamento se entenderá por: a) Proveedores u operadores de servicios de telecomunicaciones: Aquellos que provean los servicios clasificados en el artículo 3° de la Ley N° 18.168. b) Red Interna de Telecomunicaciones (RIT): Conjunto de cámaras, canalizaciones, salas de operaciones de telecomunicaciones, ductos, bandejas, cajas o cámaras de distribución, cajas o cámaras de paso, cajas terminales, obras civiles, cables y demás elementos activos y/o pasivos necesarios para asegurar la prestación de servicios de telecomunicaciones a los usuarios finales de cada unidad enajenable o de dominio exclusivo. c) Instalaciones exteriores de telecomunicaciones: Cámaras, que sirven de acceso directo a predios edificados, así como ductos y canalizaciones de acceso directo al predio en el que se emplaza un proyecto de loteo o de edificación que, aun cuando formen parte de la RIT, se encuentran ubicados en bienes nacionales de uso público existentes o que pasarán a serlo cuando se efectúe la recepción de las obras. d) Registro de Proyectos Inmobiliarios (RPI): Registro público y electrónico, contemplado en el artículo 7° quáter de la Ley N° 18.168, implementado y mantenido por la Subsecretaría de Telecomunicaciones en su página web, para efectos de la inscripción de los proyectos a que se refiere el artículo 2° de este Reglamento, en la forma y oportunidad aquí establecida. e) Código de Registro de Proyectos Inmobiliarios (CRPI): Código de identificación del proyecto asignado por el Registro de Proyectos Inmobiliarios (RPI), f) Titular del proyecto inmobiliario: Persona natural o jurídica propietaria del permiso de loteo o de edificación, responsable del cumplimiento de las obligaciones establecidas en el presente reglamento en relación con un proyecto de loteo o edificación y encargada de inscribir el proyecto en el Registro de proyectos inmobiliarios. g) Proyecto de telecomunicaciones: Conjunto de antecedentes de los proyectos referidos en el artículo 2° de este Reglamento, concernientes directamente a las instalaciones de telecomunicaciones que incluye memoria, diseño, planos, materiales, especificaciones técnicas, cubicación y presupuesto. h) Proyectista de telecomunicaciones: Ingeniero o técnico especializado en telecomunicaciones, a quien el titular del proyecto inmobiliario encomienda tanto el diseño y dimensionamiento del proyecto de telecomunicaciones como la validación de su correcta ejecución. Se entenderá que corresponde al primero aquel ingeniero cuya especialidad sea telecomunicaciones y que corresponde al segundo aquel profesional de una carrera de formación equivalente en telecomunicaciones de, a lo menos, 8 semestres. i) Instalador de telecomunicaciones: Persona natural con formación técnica y/o experiencia en tendido, instalación, reparación y montaje de soluciones de telecomunicaciones, incluyendo técnicas de unión, fusión y manejo de elementos de fibra óptica, así como manejo de elementos de una red de cable coaxial, a la cual el titular del proyecto inmobiliario encomienda la ejecución material del proyecto de telecomunicaciones, de conformidad al diseño y dimensionamiento elaborado por el proyectista. j) Factibilidad Técnica: Capacidad de la infraestructura física de las redes de telecomunicaciones para alojar equipos de distribución, cables troncales y cables domiciliarios, necesarios para brindar un determinado servicio de telecomunicaciones. TÍTULO II Registro de Proyectos Inmobiliarios Artículo 7° Deberán inscribirse en el Registro de Proyectos Inmobiliarios (RPI) los proyectos referidos en el artículo 2° de este Reglamento. La solicitud de inscripción deberá efectuarse por el titular del proyecto, previa habilitación a través del perfil de usuario correspondiente, con una anticipación no mayor a diez días a la solicitud del correspondiente permiso de loteo o de edificación, acompañando la información y documentación del respectivo proyecto que sea requerida por el sistema diseñado al efecto por la Subsecretaría de Telecomunicaciones, de conformidad a lo dispuesto en el artículo 9° de este Reglamento. La solicitud deberá identificar una dirección de correo electrónico del titular del proyecto y un número telefónico, a los cuales los proveedores de servicios de telecomunicaciones puedan comunicarse directamente, para efectos de lo previsto en este Reglamento, vías de comunicación que deberán permanecer habilitadas, al menos, hasta la recepción definitiva del proyecto de edificación o de las obras de urbanización del loteo por parte de la Dirección de Obras Municipales respectiva. La solicitud de inscripción en el registro de proyectos inmobiliarios (RPI) deberá acompañarse a la solicitud del permiso de loteo o edificación correspondiente. A fin de formalizar la inscripción en el registro, obtenido el respectivo permiso, el titular del proyecto deberá incorporar copia de éste a la solicitud de inscripción en el registro previamente efectuada, dentro de un plazo de treinta días corridos a partir de su obtención. Cuando el proyecto de loteo o edificación fuere modificado, ya sea para cambiar su destino total o parcialmente, para cambiar la cantidad de lotes o predios, para cambiar la cantidad de unidades funcionales independientes o de dominio exclusivo, o la cantidad de pisos de la edificación, el titular del proyecto deberá previamente obtener la modificación de su permiso de loteo o edificación, no pudiendo tramitar la modificación del permiso junto con la recepción definitiva del proyecto; debiendo asimismo rectificar la inscripción efectuada en el registro de proyectos inmobiliarios (RPI), siguiéndose el mismo procedimiento establecido para la inscripción del proyecto establecido en los incisos anteriores. Lo dispuesto en el inciso precedente no será aplicable a aquellas modificaciones que resulten inferiores a un 20% en la cantidad de unidades funcionales independientes o de dominio exclusivo, salvo que ello implique su cambio de destino total o parcial. Artículo 8° Para efectos de la emisión del comprobante de inscripción en el registro de proyectos inmobiliarios (RPI), el interesado, junto con su solicitud, deberá acompañar un comprobante de solicitud de recepción definitiva de las obras respectivas, emitido por la Dirección de Obras Municipales, en el cual conste que presentó la respectiva solicitud acompañada de todos los antecedentes necesarios para dicho efecto y que sólo resta el correspondiente comprobante de inscripción en este registro. Verificado lo anterior, y verificado asimismo que el proyecto ha sido inscrito en forma oportuna en el registro de proyectos inmobiliarios (RPI), la Subsecretaría de Telecomunicaciones procederá a emitir dicho comprobante sin más trámite, el cual deberá ser adjuntado a la solicitud de recepción definitiva de las obras ante la DOM para la obtención de la misma. En caso que la incorporación del permiso de loteo o edificación, o de su modificación, a la inscripción en el registro de proyectos inmobiliarios (RPI), se hubiera efectuado fuera del plazo establecido para ello en el artículo anterior, no podrá emitirse el comprobante que acredita la inscripción en el registro de proyectos inmobiliarios sino hasta transcurrido un periodo de tiempo equivalente a la suma de los retrasos acumulados. En caso de modificación de proyectos, el comprobante que acredita la inscripción en el registro no podrá emitirse sino transcurrido un periodo de tiempo equivalente al plazo que medie entre la inscripción inicial del proyecto y la de su modificación, salvo que su titular acredite que la inscripción de la modificación del proyecto se efectuó con carácter previo a la ejecución de las obras de modificación. Artículo 9° Los antecedentes y datos del respectivo proyecto incorporados en el registro deberán permitir a los proveedores de servicios de telecomunicaciones conocer previamente el proyecto y sus características, para los efectos de favorecer el despliegue oportuno de sus redes a fin de acceder a los usuarios finales, cuya atención suponga la extensión de dichas redes. Lo anterior, de conformidad con lo previsto en los artículos 18° y 19° de la Ley N° 18.168 y en el artículo 36° del presente Reglamento. Se considerarán como antecedentes esenciales para efectos de este registro: 1) Tratándose un proyecto de loteo, el plano de loteo con plano de ubicación, y detalle de la o las cámaras de acceso así como ubicación de las mismas. 2) Tratándose de un proyecto de edificación, plano del conjunto con plano de ubicación y detalle de la o las cámaras de acceso así como ubicación de las mismas. El registro deberá permitir perfiles de consulta diferenciados, para titulares de los proyectos, proveedores de servicios de telecomunicaciones y público en general. Artículo 10° Para incorporar proyectos en el registro, los titulares de proyectos inmobiliarios deberán estar inscritos antes como usuarios en un portal creado especialmente al efecto en la página web institucional de la Subsecretaría. Esta inscripción estará a cargo de un responsable, previamente registrado ante la Subsecretaría, con el fin de crear y administrar a usuarios autorizados para ingresar proyectos en el registro de proyectos inmobiliarios (RPI), con su nombre o razón social, cédula de identidad o rol único tributario e identificación del representante legal o persona expresamente facultada para ello, según corresponda. Una vez ingresados los datos del responsable en la sección correspondiente del portal referido en el inciso primero, la Subsecretaría comunicará a aquél, a través de un medio electrónico y dentro del plazo de 10 días hábiles, la aceptación o rechazo de la solicitud que lo habilite para inscribir a uno o más titulares de permisos de edificación como usuarios de dicho portal, según corresponda, pudiendo estos últimos ingresar en lo sucesivo sus proyectos inmobiliarios y modificar la información, en caso de ser necesario. TÍTULO III Proyecto de telecomunicaciones Artículo 11° Los proyectos referidos en el artículo 2° de este Reglamento deberán contar, en su diseño y construcción, con la capacidad necesaria para que diversos operadores de telecomunicaciones puedan suministrar sus servicios en igualdad de condiciones, de conformidad con las especificaciones técnicas establecidas en el presente Reglamento y en las Normas Técnicas que al efecto se dicten por la Subsecretaría de Telecomunicaciones. Artículo 12° El proyectista de telecomunicaciones deberá asegurarse que el proyecto que suscriba cumpla con las especificaciones técnicas establecidas en el presente Reglamento y en las Normas Técnicas que al efecto se dicten por la Subsecretaría de Telecomunicaciones. El titular del proyecto incorporará el proyecto de telecomunicaciones en el proyecto de loteo o de edificación y deberá verificar que aquél haya sido suscrito por un proyectista de telecomunicaciones habilitado, para lo cual este último deberá adjuntar copia del título o certificado que acredite su condición profesional. Dichos antecedentes, incluido el proyecto de telecomunicaciones, se incorporarán a la solicitud de permiso de loteo o de edificación que se presente ante la respectiva Dirección de Obras Municipales. En caso que junto a la solicitud de permiso de loteo o edificación se acompañe el informe favorable de un revisor independiente, dicho informe deberá señalar que el proyecto de telecomunicaciones ha sido suscrito por un proyectista de telecomunicaciones habilitado, en los mismos términos señalados en el inciso precedente. No corresponderá al arquitecto ni al revisor independiente verificar la conformidad del proyecto de telecomunicaciones con las especificaciones técnicas establecidas en el presente Reglamento y en las Normas Técnicas que al efecto se dicten por la Subsecretaría de Telecomunicaciones. Artículo 13° El constructor y el instalador de telecomunicaciones ejecutarán las obras de acuerdo al proyecto de telecomunicaciones elaborado por el proyectista de telecomunicaciones, debiendo el instalador efectuar un registro de mediciones respecto de cada uno de los puntos instalados. Artículo 14° Finalizadas las obras del proyecto de telecomunicaciones, el proyectista de telecomunicaciones deberá verificar que éstas se hayan ejecutado conforme al proyecto y cumpliendo con las especificaciones técnicas establecidas en el presente Reglamento y en las Normas Técnicas que al efecto se dicten por la Subsecretaría de Telecomunicaciones. Lo anterior, sin perjuicio de las verificaciones parciales que se efectúen durante la ejecución de las obras. Para efectos de la verificación final, el instalador deberá entregar al proyectista el registro de las mediciones referido en el artículo precedente, sin perjuicio que éste siempre podrá solicitar la realización de pruebas o mediciones en terreno, antes de emitir su informe. Si durante la ejecución de las obras se hubieren efectuado modificaciones al proyecto de telecomunicaciones, éstas deberán ser validadas por el proyectista de telecomunicaciones, debiendo este último entregar los planos finales al titular del proyecto, para efectos de la aprobación de dichas modificaciones, conforme a lo dispuesto en la Ordenanza General de Urbanismo y Construcciones. El proyectista de telecomunicaciones deberá dejar constancia expresa que las obras se ejecutaron correctamente, mediante la emisión del correspondiente informe favorable. Artículo 15º Al solicitar la recepción definitiva de las obras, el titular del proyecto deberá acompañar el informe favorable del proyectista de telecomunicaciones, señalado en el artículo anterior, junto con los planos finales del proyecto de telecomunicaciones, en caso que éste hubiere sufrido modificaciones durante su ejecución. El formato y contenido del referido informe será definido por la Subsecretaría de Telecomunicaciones en las respectivas Normas Técnicas. TÍTULO IV Especificaciones Técnicas de la Red Interna de Telecomunicaciones (RIT) en edificaciones en altura y proyectos en extensión Artículo 16º Las infraestructuras descritas en este Título, estarán destinadas exclusivamente a servicios de telecomunicaciones, no pudiendo alojarse en ellas otro tipo de servicios o instalaciones, sean estos públicos o de uso interno de la edificación en altura o del proyecto en extensión. Artículo 17º Los proveedores de servicios de telecomunicaciones deberán utilizar la infraestructura, cableado y elementos activos y pasivos que el respectivo proyecto de loteo o edificación contemple para la prestación de servicios de telecomunicaciones, según corresponda, no pudiendo intervenirla ni alterarla, así como tampoco tender nuevas redes en dichas instalaciones mientras exista capacidad disponible. Artículo 18º Las especificaciones establecidas en el presente Título serán obligatorias para el diseño y construcción de la RIT, tanto en sus elementos físicos como para cada tipo de acceso, sea alámbrico o inalámbrico, de conformidad a lo que establezca al respecto las Normativas Técnicas que se dicten al efecto. Artículo 19º Cuando el proyecto contemple multiplicidad de edificaciones en altura, el diseño de la RIT podrá subdividirse por zonas para facilitar su dimensionamiento, de tal forma que cada una de éstas pueda atender adecuadamente a cada edificación. En el caso de proyectos en extensión el diseño de la RIT podrá subdividirse por zonas para facilitar su dimensionamiento. Cada una de ellas deberá atender a un mínimo de 48 unidades, sean enajenables o de dominio exclusivo, o bien de dominio común, tales como salas multiuso, salas de computación u otros similares. Tales subdivisiones podrán tratarse como una RIT independiente, aun cuando compartan alguno de los elementos de ella. Capítulo I Especificaciones técnicas de la infraestructura física de la Red Interna de Telecomunicaciones (RIT), glosario técnico y responsabilidades Artículo 20° El presente capítulo establece las especificaciones técnicas mínimas que debe cumplir la infraestructura física de la Red Interna de Telecomunicaciones (RIT) en edificaciones en altura y en proyectos en extensión, sean éstos últimos loteos o proyectos de edificación acogidos o no al régimen de copropiedad inmobiliaria, para efectos de lo previsto en el Capítulo I del Título I de este Reglamento. La infraestructura física de la RIT está compuesta por las cámaras, canalizaciones, salas de operaciones de telecomunicaciones, ductos, bandejas, cajas o cámaras de distribución, cajas o cámaras de paso, cajas terminales, obras civiles y demás elementos necesarios para facilitar el despliegue, mantenimiento y reparación del respectivo cableado. Artículo 21° La infraestructura física de la RIT deberá diseñarse y construirse de acuerdo a los siguientes esquemas gráficos, según corresponda a edificaciones en altura, en el primer caso, o a proyectos en extensión, en el segundo, sean estos últimos en modalidad condominio o en modalidad loteo: Red Interna de Telecomunicaciones (RIT) en Edificaciones en Altura Red Interna de Telecomunicaciones (RIT) en Proyectos en Extensión (condominio y loteo) Vista Perfil Red Interna de Telecomunicaciones (RIT) de edificación en altura Artículo 22º En el caso de edificaciones en altura, estén o no acogidas al régimen de copropiedad inmobiliaria, las redes de alimentación de los distintos proveedores de servicios de telecomunicaciones ingresarán a la RIT, tanto por la parte inferior como por la parte superior, en función del modo de acceso de cada servicio. En la parte inferior, tal ingreso deberá efectuarse a través de la Cámara de Acceso al Proyecto y de las Canalizaciones Externa y de Enlace Inferior, ingresando a la edificación a través de la Caja o Cámara de Paso, que de ser necesaria, se colocará para atravesar el muro, y llegando hasta la Sala de Operaciones de Telecomunicaciones Inferior (SOTI), donde se producirá la conexión con la Red Troncal de la RIT. En la parte superior, el ingreso deberá efectuarse desde los Sistemas de Captación, a través del muro, fachada o loza de la azotea, utilizando una Caja de Paso y de la Canalización de Enlace Superior, hasta los Registros Principales situados en la Sala de Operaciones de Telecomunicaciones Superior (SOTS), donde se producirá la conexión con la Red Troncal de la RIT. Artículo 23º En el caso de proyectos en extensión, sean éstos loteos o condominios acogidos al régimen de copropiedad inmobiliaria, la Red de Alimentación de los distintos proveedores de servicios de telecomunicaciones deberá ingresar a la RIT a través de la Cámara de Acceso al proyecto y de las Canalizaciones Externa y de Enlace, hasta llegar a la Sala de Operaciones de Telecomunicaciones Única (SOTU). Artículo 24º La función principal de la Red Troncal es llevar, a cada planta de una edificación en altura o a cada sector de un proyecto en extensión, los cables necesarios para alimentar las Redes Laterales. La infraestructura física de esta red está formada por la Canalización Troncal y por las Cajas o Cámaras de Distribución. En el caso de edificaciones en altura, la Red Troncal, además, unirá las Salas de Operaciones de Telecomunicaciones Inferior y Superior. Artículo 25º La función principal de la Red Lateral es llevar los cables de los diferentes servicios de telecomunicaciones desde las Cajas o Cámaras de Distribución de la Red Troncal hasta los Puntos de Acceso a Usuario (PAU) de cada una de las unidades enajenables o de dominio exclusivo del proyecto. La infraestructura física de esta red está formada por la Canalización Lateral y las Cajas de Terminación de Red. Artículo 26° La función principal de la Red Interna de Usuario es distribuir los cables de los diferentes servicios de telecomunicaciones desde los PAU hasta las diferentes Conexiones de Usuario, al interior de cada unidad enajenable o de dominio exclusivo del proyecto. La infraestructura física de esta red está formada por la Canalización Interna de Usuario, Cajas de Terminación de Red y Cajas de Conexiones de Usuario. Artículo 27° Para efectos del presente Reglamento, se entenderá que conforman la infraestructura física de la RIT, los siguientes elementos: a) Cámara de Acceso al Proyecto: Aquella donde los distintos proveedores de servicios de telecomunicaciones ingresan con su red de planta externa a la RIT del proyecto. Siempre estará emplazada en bienes nacionales de uso público existentes o que pasarán a serlo cuando se efectúe la recepción de las obras, y sólo podrá ser usada para dar servicio al proyecto correspondiente. b) Canalización Externa: Está constituida por los ductos que realizan la conexión entre la Cámara de Acceso al Proyecto y la Caja o Cámara de Paso. Su función es facilitar el acceso de los servicios de telecomunicaciones de los diferentes proveedores al proyecto. c) Caja o Cámara de Paso: Gabinete o recinto que se utiliza para seccionar o cambiar la dirección de las canalizaciones, para atravesar un muro o fachada, u otros usos según se requiera en función del diseño. d) Canalización de Enlace: Está formada por el conjunto de ductos que realizan la conexión desde la Caja o Cámara de Paso hasta la Sala de Operaciones de Telecomunicaciones. En el caso de edificaciones en altura y dependiendo del lugar por el cual se accede a éstas, se denominará Canalización de Enlace Inferior, si la entrada se realiza por la parte inferior del inmueble, y si la entrada se realiza por la parte superior del inmueble, se denominará Canalización de Enlace Superior. En el caso de proyectos en extensión, la Canalización de Enlace Inferior corresponderá a la canalización que soporta el cableado desde la Cámara de Paso hasta la Sala de Operaciones de Telecomunicaciones Única (SOTU), mientras que la Canalización de Enlace Superior corresponderá a la canalización que soporta el cableado desde los Sistemas de Captación de Señales hasta la Caja de Terminación de Red de cada usuario. e) Salas de Operaciones de Telecomunicaciones (SOTI, SOTS y SOTU): Corresponden a los gabinetes o recintos que contienen los elementos necesarios para proveer los servicios de telecomunicaciones en los proyectos. Existen los siguientes tipos de salas: 1. Sala de Operaciones de Telecomunicaciones Inferior (SOTI): Gabinete o recinto ubicado a nivel del suelo natural o en el subterráneo de una edificación en altura, en el que se recibe la entrada de la Canalización de Enlace Inferior y que corresponde al lugar donde comienza la Canalización Troncal de la RIT del edificio. En ella se instalarán: - Los Paneles de Conexión de Entrada, para proveer la conexión desde la central o nodo del proveedor de servicios de telecomunicaciones. - Los Paneles de Conexión de Salida, que dan inicio a la Canalización Troncal y que reflejan cada una de las unidades enajenables o de dominio exclusivo. En tales paneles también podrán reflejarse los predios destinados a equipamiento en los proyectos de loteo, así como los bienes de dominio común de un proyecto acogido a copropiedad inmobiliaria, tales como salas multiuso, salas de computación u otros similares. - Los cables de cruzada entre dichos Paneles de Conexión necesarios para proporcionar el servicio a los usuarios finales. 2. Sala de Operaciones de Telecomunicaciones Superior (SOTS): Gabinete o recinto ubicado en la planta alta o en la azotea de una edificación en altura, en el que se recibe la entrada de la Canalización de Enlace Superior y que corresponde al punto final de la Canalización Troncal de la RIT del edificio. 3. Sala de Operaciones de Telecomunicaciones Única (SOTU): En el caso de proyectos en extensión deberá contemplarse una Sala de Operaciones de Telecomunicaciones Única (SOTU), la que recibirá la Canalización de Enlace Inferior, cumpliendo con los requisitos respecto de la SOTI. Para el caso de edificaciones en altura y según se defina en las Normativas Técnicas, podrá contemplarse una Sala de Operaciones de Telecomunicaciones Única (SOTU), la que recibirá la Canalización de Enlace, tanto inferior como superior, alojando los elementos necesarios para sustituir a las dos salas descritas anteriormente (SOTI y SOTS). f) Canalización Troncal: Corresponde a las instalaciones que soportan la Red Troncal de la RIT de un proyecto. Está formada por el conjunto de ductos cerrados o accesibles, Cajas de Distribución y demás elementos necesarios para conectar verticalmente la SOTI con la SOTS, en el caso de edificaciones en altura y para unir la SOTU con las Cajas o Cámaras de Distribución, en el caso de proyectos en extensión. Las Normativas Técnicas establecerán el número y el tipo de esta canalización en función de las necesidades del proyecto asociado al número de viviendas y a las tecnologías. g) Cajas o Cámaras de Distribución: Gabinetes o recintos que conectan la Canalización Troncal con las Canalizaciones Laterales. Asimismo, sirven para seccionar o cambiar de dirección la Canalización Troncal, con el fin de favorecer la instalación y el mantenimiento de la misma. h) Canalización Lateral: Conjunto de ductos, cerrados o accesibles, necesarios para conectar las Cajas o Cámaras de Distribución con las Cajas de Terminación de Red. i) Cajas de Terminación de Red: Corresponden a las cajas que conectan las Canalizaciones Laterales con las Canalizaciones Internas de Usuario. Están ubicadas al interior de la unidad enajenable o de dominio exclusivo y en su interior se encuentran los Puntos de Acceso a los Usuarios (PAU). j) Canalización Interna de Usuario: Es la que conecta las Cajas de Terminación de Red y las Cajas de Conexión de Usuario. En ella se intercalan las Cajas de Paso, que facilitan el tendido de los cables de la Red Interna de Usuario. k) Caja de Conexión de Usuario: Caja en la que finaliza la Red Interna de Usuario y que contiene la Conexión de Usuario. l) Conexión de Usuario: Es aquella que permite realizar las conexiones de los equipos terminales de telecomunicaciones o los módulos de abonados con la RIT, para recibir los servicios proporcionados a través de ella. Artículo 28° El titular del proyecto inmobiliario será, en todo caso, responsable del cumplimiento de lo establecido respecto del diseño, dimensionamiento, ejecución e instalación de los elementos de infraestructura física necesaria para la RIT, conforme a las especificaciones técnicas mínimas descritas en el presente Capítulo y según los detalles que se establezcan en las Normas Técnicas que al efecto se dicten por la Subsecretaría de Telecomunicaciones. Capítulo II Especificaciones técnicas de la RIT para servicios con acceso por redes alámbricas, glosario técnico y responsabilidades Artículo 29° El presente capítulo establece las características técnicas mínimas que debe cumplir la Red Interna de Telecomunicaciones (RIT) en las edificaciones en altura y en los proyectos en extensión, con el objeto de facilitar el acceso de los usuarios a los servicios de telecomunicaciones provistos por los diferentes proveedores, de manera alámbrica y utilizando diferentes tecnologías, para efectos de lo previsto en el Capítulo I del Título I de este Reglamento. Artículo 30º Para efectos del presente Reglamento, en este artículo se define el conjunto de cables, elementos de conexión y equipos, tanto activos como pasivos, que es necesario instalar para establecer la unión entre la Red de Alimentación y las Conexiones de Usuario, cuando la prestación de servicios de telecomunicaciones se efectúa mediante redes alámbricas. a) Red de Alimentación: Es la parte de la red de planta externa del proveedor de servicios de telecomunicaciones, formada por los cables, Paneles de Conexión y otros elementos, activos y pasivos, necesarios para acceder a la RIT del proyecto y entregar la señal de servicio, en condiciones de ser distribuida. Para ello, el proveedor de telecomunicaciones debe ingresar en la RIT a través de la Cámara de Acceso al Proyecto, utilizando la Canalización Externa hasta la Cámara de Paso, continuando a través de la Canalización de Enlace Inferior, hasta llegar al Panel de Conexión ubicado en la correspondiente Sala de Operaciones de Telecomunicaciones. b) Registro Principal: Conecta cada una de las Redes de Alimentación de los Proveedores de Servicios de Telecomunicaciones con la Red Troncal de la RIT del proyecto. Se situará al interior de la SOTI o de la SOTU, según corresponda. Estará compuesto por una serie de Paneles de Conexión de Entrada, donde finalizarán las Redes de Alimentación de los distintos proveedores de servicios de telecomunicaciones; una serie de Paneles de Conexión de Salida, donde empezará la Red Troncal; y una serie de cables de cruzada que se encargarán de dar continuidad a las Redes de Alimentación hasta la Red Troncal, en función de los servicios contratados por los distintos usuarios. c) Red Troncal: Es la parte de la RIT formada por los cables, coaxiales y de fibra óptica, y demás elementos que transportan los servicios de los distintos proveedores, distribuyéndolos por la Canalización Troncal, comenzando en los Paneles de Conexión ubicados en la SOTI o SOTU, según corresponda, enlazando con la Red Lateral en las Cajas de Distribución y finalizando en la Caja de Distribución más alejada de la Sala de Operaciones de Telecomunicaciones inicial. d) Caja o Cámara de Distribución: Lugar donde se conectan las Redes Troncales y Laterales de la RIT. e) Red Lateral: Es la parte de la RIT, formada por el conjunto de cables de fibras ópticas y coaxiales y demás elementos, que une la Red Troncal con cada unidad enajenable o de dominio exclusivo. Se inicia en las Cajas o Cámaras de Distribución, y, a través de la Canalización Lateral, enlaza con la Red Interna de Usuario en los PAU de cada unidad enajenable o de dominio exclusivo. f) Punto de Acceso al Usuario (PAU): Conecta la Red Lateral y la Red Interna de Usuario de la RIT, ubicándose en la Caja de Terminación de Red situada en el interior de cada unidad enajenable o de dominio exclusivo. g) Red Interna de Usuario: Es la parte de la red formada por los cables y demás elementos que transcurren al interior de cada unidad enajenable o de dominio exclusivo, dando continuidad a la Red Lateral de la RIT, comenzando en los PAU y finalizando, a través de la Canalización Interna de Usuario, en las Cajas de Conexión de Usuario. h) Conexiones de Usuario: Corresponden a los puntos de terminación de la RIT, a través de los cuales el usuario conecta los diferentes equipos terminales. Artículo 31° El diseño, dimensionamiento, construcción, provisión e instalación de la infraestructura de la red de planta externa del proveedor de telecomunicaciones que sea necesario ejecutar para llegar a la Cámara de Acceso al Proyecto, será responsabilidad de cada proveedor que pretenda prestar sus servicios en la edificación en altura o en el proyecto en extensión, atendido que dicha infraestructura no forma parte de la RIT. Respecto a la Red de Alimentación, desde la Cámara de Acceso al proyecto hasta las Salas de Operaciones de Telecomunicaciones (SOTI o SOTU, según el caso), el cableado e instalación de equipos será responsabilidad de cada proveedor que pretenda prestar sus servicios en la edificación en altura o en el proyecto en extensión, utilizando para ello las infraestructuras que han sido ejecutadas por el constructor y los espacios destinados al efecto. Los Paneles de Conexión de Entrada, así como los cables de cruzada, serán diseñados, dimensionados, provisionados e instalados por los proveedores de servicio, quienes podrán dotarlos con los dispositivos de seguridad necesarios para evitar manipulaciones no autorizadas. En ningún caso dichas medidas podrán afectar al o los Paneles de Conexión de Salida impidiendo el cambio de proveedor de telecomunicaciones. El titular del proyecto inmobiliario será en todo caso responsable del cumplimiento de lo aquí establecido respecto del diseño, dimensionamiento, cableado, elementos de conexión y equipos integrantes de la Red Troncal y Lateral, así como de los Paneles de Conexión de Salida, de las Cajas o Cámaras de Distribución, de los PAU y de las Placas Ciegas Frontales, en base al proyecto elaborado por el Proyectista de Telecomunicaciones. Asimismo, será también responsable de la instalación de dichos elementos, por parte del Instalador de Telecomunicaciones. Lo anterior, conforme a las especificaciones técnicas mínimas descritas en el presente Capítulo y según los detalles que se establezcan en las Normas Técnicas que al efecto se dicten por la Subsecretaría de Telecomunicaciones. En el caso de la Red interna de usuario, el cableado e instalación de equipos, así como la remoción de las Placas Ciegas antes referidas y su reemplazo por aquellas del tipo específico del servicio contratado, será responsabilidad del proveedor que preste sus servicios en esa unidad enajenable o de dominio exclusivo, para cuyo efecto, necesariamente deberá utilizar la infraestructura que el proyecto contemple, no pudiendo, desplegar cable externamente dentro de esta, de existir capacidad disponible. Capítulo III Especificaciones técnicas de la RIT para servicios con acceso por redes inalámbricas, glosario técnico y responsabilidades Artículo 32° El presente capítulo establece las características técnicas mínimas que debe cumplir la Red Interna de Telecomunicaciones (RIT) en las edificaciones en altura con el objeto de captar, adaptar y distribuir las señales de los servicios de radiodifusión sonora y televisiva, así como de televisión satelital. Artículo 33° Para efectos del presente Reglamento, en este artículo se define el conjunto de cables, elementos de conexión y equipos necesarios para la captación, adaptación y distribución de señales de radiodifusión sonora y televisiva, así como de televisión satelital. a) Sistemas de Captación de Señales: Los Sistemas de Captación de Señales son aquellos elementos activos y pasivos encargados de recibir y adecuar las señales de radiodifusión sonora y televisiva, así como de televisión satelital, que serán entregadas al Equipamiento de Cabecera. Estarán ubicados en las azoteas o terrazas superiores de las edificaciones en altura o en la parte superior de las unidades, enajenables o de dominio exclusivo, en proyectos en extensión. b) Red de Enlace Superior: Es la parte de la RIT formada por los cables coaxiales y demás elementos que conectan la salida de los Sistemas de Captación de Señales con la entrada del Equipamiento de Cabecera, utilizando para ello la Canalización de Enlace Superior. c) Equipamiento de Cabecera: Está formado por los equipos encargados de recibir las señales procedentes de los Sistemas de Captación y de adecuar dichas señales para que puedan ser distribuidas a través de la RIT en condiciones de calidad y cantidad. Este será el punto de conexión a partir del cual comenzará la distribución de las señales a través de la Red Troncal. Para asegurar la calidad de las señales de televisión satelital, los proveedores de tales servicios podrán ubicar en la SOTS los elementos necesarios para la adecuación de la señal de entrada, en el espacio destinado para ello, y utilizando el punto de conexión del mezclador de señal establecido para ello, que será el punto de enlace con la Red Troncal, sin intervenir ni alterar la restante infraestructura disponible. d) Red Troncal: Es la parte de la RIT formada por los cables coaxiales y demás elementos que conectan el Equipamiento de Cabecera con la Red Lateral, comenzando en la Sala de Operaciones de Telecomunicaciones Superior (SOTS) y finalizando en la Caja de Distribución más alejada de la misma. La Red Troncal de cables coaxiales procedentes de la SOTS estará formada por dos redes de cables coaxiales independientes, cada uno de los cuales transportará la mezcla de las señales de radiodifusión sonora y televisiva con la señal de televisión satelital de cada proveedor. Cuando la Red Troncal esté formada por varias verticales, la red de cada vertical será tratada como una Red Troncal independiente. c) Caja de Distribución: Lugar donde se conectan las Redes Troncales y Laterales de la RIT. f) Red Lateral: Es la parte de la RIT formada por los cables coaxiales y demás elementos, que conectan la Red Troncal con la Caja de Terminación de Red de cada unidad enajenable o de dominio exclusivo. Se inicia en las Cajas de Distribución, y enlaza con la Red Interna de Usuario conectándose en el PAU. Se instalarán dos cables coaxiales, que serán continuidad de las dos redes de cables coaxiales procedentes de la Red Troncal. g) Punto de Acceso a Usuario (PAU): Punto donde comienza la Red Interna de usuario, siendo el punto de unión con la Red Lateral. Se ubicará en la Caja de Terminación de Red situada en el interior de cada unidad enajenable o de dominio exclusivo. h) Red Interna de Usuario: Está formada por los cables y demás elementos que se instalan al interior de cada unidad. Da continuidad a la Red Lateral de la RIT comenzando en los PAU y finalizando en las Cajas de Conexión de Usuario, a través de la Canalización Interna configurada en estrella. i) Conexiones de Usuario: Corresponde a los puntos de terminación de la RIT, a través de los cuales el usuario conecta los diferentes equipos terminales. Artículo 34° En el caso de edificaciones en altura, el diseño y el dimensionamiento del cableado, elementos de conexión y equipos que conforman los Sistemas de Captación de Señales, la Red de Enlace Superior y Equipamiento de cabecera, para radiodifusión sonora y televisiva, y el diseño y dimensionamiento de los Sistemas de la Red Troncal, las Cajas de Distribución, la Red Lateral, los PAU, la Red Interna de Usuario y las Placas para las Cajas de Conexión de Usuario, tanto para radiodifusión sonora y televisiva como para televisión satelital, será responsabilidad del titular del proyecto inmobiliario, en base al proyecto elaborado por el proyectista de telecomunicaciones y de conformidad a las especificaciones descritas en el presente Título y detalladas en las Normas Técnicas que al efecto dicte la Subsecretaría. Asimismo, será su responsabilidad la adecuada instalación de dichos elementos por el instalador de telecomunicaciones contratado para ello, conforme también a las especificaciones aquí descritas y detalladas en las Normas Técnicas que dicte la referida Subsecretaría. El diseño, dimensionamiento, construcción, provisión, cableado hasta la salida del mezclador e instalación de los Sistemas de Captación de televisión satelital y del Equipamiento de Cabecera necesario para las señales correspondientes, así como la adopción de medidas de seguridad respecto de estos últimos, será responsabilidad de cada proveedor que pretenda prestar sus servicios en la edificación en altura o en el proyecto en extensión. TÍTULO V Acceso a las Instalaciones y Responsabilidades Capítulo 1 Acceso a las instalaciones Artículo 35° La obligación de cerciorarse de que la infraestructura de soporte de redes de telecomunicaciones no sea intervenida por terceros, con el objeto o efecto de impedir el ingreso de distintos operadores de telecomunicaciones, es aplicable al titular del proyecto, durante el período que lo administre, y al administrador designado por la asamblea de copropietarios, según corresponda o al respectivo propietario, en este último caso cuando se trate de una o más unidades funcionales independientes. Del incumplimiento de esta obligación se derivará acción para el propietario o arrendatario que resulte afectado por el impedimento, quien podrá demandar la inmediata eliminación del mismo. Deberá mantenerse una bitácora común, donde queden registradas todas las intervenciones ejecutadas por cada proveedor de servicios de telecomunicaciones en las instalaciones correspondientes, la que estará a cargo del comité de administración o respectivo propietario, según corresponda, y cuyo contenido deberá ajustarse a lo que establezca la Normativa Técnica. Artículo 36° En el caso de un proyecto de loteo, publicado éste en el registro de proyectos inmobiliarios, los proveedores de servicios de telecomunicaciones interesados en brindar servicios en el mismo o en futuras urbanizaciones cuyo acceso requiera el tránsito por el respectivo proyecto, deberán, previa coordinación con el titular del proyecto, construir oportunamente la infraestructura necesaria para el despliegue y/o extensión de su planta externa dentro del predio urbanizable, sea para uso inmediato o futuro y cuyo emplazamiento definitivo quedará en bienes nacionales de uso público una vez recibidas las obras. De no ejecutarse por parte de los proveedores de servicios de telecomunicaciones el despliegue de su infraestructura de telecomunicaciones dentro del predio urbanizable, aquéllos no podrán extender nuevas redes en las vías públicas resultantes, sino una vez transcurrido el plazo de tres años, salvo que la municipalidad correspondiente indique lo contrario en sus ordenanzas y siempre de conformidad a lo que establezca el marco normativo técnico de gestión y mantenición de Redes previsto en el artículo 24°, letra b), de la Ley N°18.168. Artículo 37° En caso de negativa injustificada de parte del titular del proyecto inmobiliario para permitir el despliegue referido en el artículo anterior, podrá aplicarse lo previsto en el artículo 19° de la Ley N° 18.168. Capítulo II Responsabilidades Artículo 38° Los proveedores de servicios de telecomunicaciones que estén prestando sus servicios en edificaciones en altura, condominios en extensión o loteos, deberán ofrecer siempre servicios de mantenición y reparación de la Red Interior de Telecomunicaciones. Tratándose de aquellas instalaciones que resulten finalmente emplazadas en bienes nacionales de uso público, los proveedores de servicios de telecomunicaciones ahí existentes deberán asumir de común acuerdo la mantención y reparación de las mismas. TÍTULO VI Libre Elección en Edificaciones Existentes Capítulo I Instalaciones exteriores e interiores Artículo 39° Tratándose de edificaciones existentes, estén o no acogidas al régimen de copropiedad inmobiliaria, el propietario o arrendatario de cualquier unidad podrá requerir al Administrador del edificio, o al propietario si correspondiese, la ejecución de las obras necesarias para garantizar el ejercicio de su derecho a optar entre, al menos, dos proveedores en la contratación y recepción de servicios de telecomunicaciones, siéndoles absolutamente inoponibles los acuerdos de exclusividad que se hubieren celebrado para el uso de la infraestructura de telecomunicaciones por algún proveedor en particular. Artículo 40° El o los nuevos proveedores de servicios de telecomunicaciones podrán hacer uso de las instalaciones exteriores existentes que permitan el acceso inmediato a la respectiva edificación, tales como Cámaras de Acceso u otras instalaciones de acceso directo, independientemente de su titularidad y de la naturaleza de los bienes en que aquéllas se emplacen, siempre y cuando ello no afecte la provisión de los servicios que a esa fecha se prestan. En caso de esgrimirse, respecto de la Cámara y Canalización de Acceso directo a la edificación, ausencia de factibilidad técnica para el ingreso de otros proveedores de los referidos servicios, el o los nuevos proveedores interesados deberán ofrecer alternativas de solución o de mitigación de riesgos, en cuyo caso el proveedor existente sólo podrá oponerse acreditando plausibilidad de afectación de sus servicios. En caso de desacuerdo entre las partes, sea por motivos técnicos o económicos, las controversias que se susciten serán resueltas por un árbitro arbitrador de la forma establecida en el artículo 56° del presente Reglamento. Artículo 41° Al interior de las edificaciones existentes deberán compartirse todos los elementos de infraestructura soporte de telecomunicaciones cuyo uso sea necesario para que nuevos proveedores de servicios de telecomunicaciones presten servicio a clientes finales. Lo anterior, sin perjuicio de las autorizaciones que sean necesarias de conformidad a las disposiciones de la Ley N° 19.537. Con todo, cuando la materialización del derecho indicado en el presente artículo haga necesaria la ejecución de obras en bienes comunes, la asamblea extraordinaria de copropietarios sólo podrá denegar la autorización pertinente en caso de que con ello se pueda afectar la seguridad o apariencia exterior de la edificación, o bien, que dicha ejecución implique un gasto extra o adicional, superior al 10% de los gastos comunes de cada unidad, considerando para ello el valor dicho gasto común del mes anterior a la fecha de presentación del respectivo presupuesto. Asimismo, se entenderá que no afectan la apariencia exterior aquellas instalaciones armonizadas con el estilo arquitectónico de la edificación o con su forma. En este último caso y cuando la ejecución de las obras de armonización implique un gasto extra o adicional no superior al 10% de los gastos comunes de cada unidad, no será necesario convocar a la asamblea extraordinaria. El Administrador deberá velar para que la comunidad sea informada adecuadamente de los proyectos posibles y/o de los proveedores interesados en ingresar a la edificación, de manera tal de permitir la oportuna evaluación de los mismos. Asimismo, será responsable de la mantención de una bitácora común que registre todas las intervenciones ejecutadas por cada proveedor de servicios de telecomunicaciones en las instalaciones correspondientes y cuyo contenido deberá ajustarse a lo que establezca la Normativa Técnica. Artículo 42º Los proyectos y planes de trabajo al interior de edificios y/o condominios a que se refiere el artículo 43º del presente Reglamento, deberán siempre diseñarse e implementarse considerando la mínima intervención posible, o bien, una vez concluida la intervención, la restitución de los elementos y/o espacios intervenidos a su situación inicial o más cercana a esta última. De lo anterior, de las medidas a ejecutar y de su mitigación, se dará cuenta en el proyecto que deberá presentar el proveedor de telecomunicaciones interesado en ingresar a la edificación. Asimismo, deberá privilegiarse el uso de cualquier elemento o solución que permita optimizar la utilización de las instalaciones y elementos existentes. --- Capítulo II Procedimiento general Artículo 43º El o los proveedores de servicios de telecomunicaciones interesados en ingresar a la edificación ya atendida por otro proveedor, deberán acordar con el Comité de Administración una visita a aquél para constatar la disponibilidad de infraestructura que pueda ser utilizada. Tanto la utilización de bienes comunes como la ejecución de obras en los mismos, se sujetará a lo previsto en la Ley N°19.537, según corresponda a cada caso. Artículo 44º El proveedor de servicios de telecomunicaciones interesado en acceder a la edificación deberá presentar un proyecto y plan de trabajo al Comité de Administración, indicando los servicios de telecomunicaciones a proveer, las actividades necesarias para ello, el horario de las mismas y los plazos de ejecución comprometidos. Deberá acompañar planos y/o fotografías descriptivas de los espacios físicos e infraestructura a utilizar o intervenir, según sea el caso. Asimismo, deberá individualizarse un responsable de la ejecución del proyecto, con su teléfono y correo electrónico. Artículo 45º El Comité de Administración informará a la comunidad del proyecto y plan de trabajo presentados, sin perjuicio del eventual relacionamiento directo entre el propietario o arrendatario de cada unidad con el proveedor de servicios de telecomunicaciones, en aquello que diga relación con la instalación y habilitación de servicios en el interior de su vivienda. Según corresponda a la naturaleza de las obras o trabajos a ejecutar, se someterá o no la aprobación del plan de trabajo a la asamblea extraordinaria de copropietarios para su pronunciamiento, la cual siempre deberá sujetarse a lo previsto en el artículo 41° del presente Reglamento. Artículo 46° Una vez autorizado el plan de trabajo, el proveedor deberá llevarlo a cabo ciñéndose estrictamente al mismo y velando siempre porque su ejecución se traduzca en la mínima intervención posible, según sea el caso. Los trabajos se ejecutarán en los horarios autorizados, debiendo registrarse las visitas que ingresen por tal motivo en la mencionada bitácora, las cuales deberán portar una credencial de identificación al efecto. Una vez finalizadas las actividades o la ejecución de las obras necesarias, el proveedor de servicio de telecomunicaciones de que se trate, deberá dejar limpios y desocupados los espacios utilizados. Lo mismo, al final de cada jornada de trabajo, en la medida que ello no afecte directamente la continuidad de las labores. Capítulo III Uso de infraestructura disponible Artículo 47° En caso de existir factibilidad técnica para utilizar la infraestructura disponible, el o los proveedores de telecomunicaciones interesados en ingresar a la edificación deberán requerir al proveedor o proveedores ya instalados para que informen, dentro de un plazo de 7 días, de sus instalaciones activas en dicha infraestructura, con el fin de prevenir daños a las mismas. Transcurrido el plazo anterior, y no habiendo respuesta alguna sobre la necesidad de coordinaciones y/o adopción de resguardos específicos, se podrá dar inicio a los trabajos. Artículo 48° Con todo, el costo de las nuevas instalaciones, el retiro de cables en desuso, la desobstrucción de ductos o cualquier otra obra necesaria será de cargo del o los proveedores entrantes. Igualmente, la afectación en la provisión de servicios de telecomunicaciones y/o los daños materiales ocasionados a las instalaciones activas existentes, será responsabilidad del o los proveedores de servicios de telecomunicaciones entrantes, salvo que el proveedor ya existente, requerido oportunamente de información, no hubiere instruido sobre la aplicación de medidas especiales ni identificado adecuadamente sus instalaciones activas en uso y/o desuso dentro del plazo indicado en el artículo precedente. Capítulo IV Construcción de nueva infraestructura en edificaciones existentes Artículo 49° En caso de ser necesaria la ejecución de nuevas obras destinadas a suplir la indisponibilidad de infraestructura que pudiere ser compartida, o bien, a optimizar esta última, el proveedor interesado en ejecutar dichas obras deberá notificar a todos los demás proveedores de telecomunicaciones, a fin de promover la ejecución de un plan de trabajo común que viabilice el ingreso de todos aquellos que manifiesten adecuadamente su intención de participar, sin afectar con ello la provisión de los servicios actuales. Artículo 50° La notificación deberá referirse expresamente a lo siguiente: 1) Detalle de los trabajos planificados o plan de trabajo, adjuntando croquis y proyecto técnico, e indicando el lugar y la fecha de inicio y término de cada una de las fases, sean obras civiles, cableado o terminaciones. 2) Requerir que se informe por él o los proveedores de telecomunicaciones ya instalados en la edificación sobre las instalaciones activas en uso en la misma, a fin de prevenir eventuales afectaciones. 3) Indicar un encargado responsable del proyecto, con teléfono y dirección de correo electrónico de contacto. Artículo 51° Recibida la notificación, el o los proveedores también interesados en ingresar a prestar sus servicios, deberán manifestar dicho interés al proveedor que generó la notificación dentro del lapso de 10 días. Transcurrido este plazo y no habiéndose recibido respuesta alguna, se entenderá que no existe interés en participar en la ejecución de las nuevas obras; en caso contrario, deberá informarse por el operador invitante, a todos los destinatarios de la notificación antes referida, la identificación de la o las empresas que dentro de plazo sí manifestaron su interés en participar. Cada uno de los proveedores interesados dispondrá de 10 días adicionales para realizar una inspección en terreno y hacer llegar al proveedor que los invitó sus proyectos técnicos, adjuntando aquellos antecedentes necesarios para un adecuado entendimiento de sus requerimientos y valorización de los mismos, tales como planos, especificaciones técnicas y listado de materiales. Los antecedentes recibidos deberán ser analizados por el proveedor invitante, generando un presupuesto del proyecto que especificará los costos por compañía participante, valorizando cada ítem por separado y el cual deberá ser enviado dentro de un plazo de 10 días. Recibido el presupuesto por el o los demás interesados, aquél deberá ser aceptado o rechazado dentro de 5 días. Aceptado el presupuesto dentro de plazo, se entenderá confirmada la participación en la ejecución y costeo de las obras. En caso de silencio, se entenderá rechazado. Artículo 52° La ejecución del plan de trabajo estará a cargo del proveedor de servicios de telecomunicaciones invitante, el cual será responsable del relacionamiento con la comunidad en lo exclusivamente concerniente a dicho plan de trabajo, así como con el resto de las proveedoras participantes en lo referente a aquél. Cualquier afectación en la provisión de los servicios de telecomunicaciones derivada directamente de la ejecución de las obras del plan de trabajo y/o los daños materiales ocasionados a las instalaciones activas existentes, será también de responsabilidad del proveedor de servicios invitante, salvo que concurra, de parte del o los proveedores ya instalados, la omisión prevista en el inciso segundo del artículo 47°. Por su parte, una vez ejecutadas las obras, cualquier afectación en la provisión de los servicios de telecomunicaciones derivada directamente de la ejecución de las actividades específicas para proveer el servicio final de telecomunicaciones y/o los daños materiales ocasionados a las instalaciones activas existentes, será de responsabilidad del proveedor de servicios de telecomunicaciones entrante que la haya ocasionado, salvo que concurra, de parte del o los proveedores ya instalados, la omisión prevista en el inciso segundo del artículo 47°. Artículo 53° Para los efectos del presente Título, todos los proveedores dispondrán de una misma dirección de correo electrónico: accesoacopropiedad@((nombre de empresa).cl). Capítulo V Entrega de las instalaciones Artículo 54° La recepción conforme del proyecto ejecutado se realizará por el Comité de Administración en base al cumplimiento de los elementos objetivos definidos en el plan de trabajo. Artículo 55° Los daños a la propiedad común que se ocasionaren como consecuencia de la aplicación de este Título se sujetarán a lo previsto en el artículo 52° del presente Reglamento, sin perjuicio de lo previsto al respecto en la Ley Nº19.537, y otras instancias jurisdiccionales que sean procedentes. Las reclamaciones de los usuarios producto del incumplimiento de parte de las proveedoras de servicios de telecomunicaciones de las obligaciones aquí establecidas, serán resueltas por la Subsecretaría de Telecomunicaciones en virtud del procedimiento de tramitación y resolución de reclamos del artículo 28 bis de la Ley Nº18.168, General de Telecomunicaciones. Capítulo VI Resolución de controversias Artículo 56° Las controversias que se susciten entre los proveedores de servicios de telecomunicaciones respecto del uso y/o compartición de las instalaciones exteriores necesarias para acceder directamente al predio, serán resueltas por un árbitro arbitrador designado de conformidad con lo dispuesto en el artículo 232° del Código Orgánico de Tribunales. El árbitro estará obligado a fallar en favor de una de las proposiciones de las partes, y podrá en su caso establecer condiciones para materializar el acceso requerido. Sus honorarios serán de cargo de aquel proveedor cuya alegación sea totalmente desestimada o, en caso contrario, por partes iguales entre los intervinientes. Título VII.- Libre elección y portal web Artículo 57° Los proveedores de servicios de telecomunicaciones, de conformidad con lo establecido en el artículo 13° del Reglamento de Servicios de Telecomunicaciones, deberán publicar gráficamente en un vínculo visible y de fácil acceso desde su sitio web principal, la zona de cobertura de sus redes, con el propósito que los usuarios, al consultar, puedan ver si la ubicación de su interés se encuentra dentro de la zona de servicio de la concesión o permiso del operador y así ejercer de manera informada su derecho de libre elección. Asimismo, deberán incorporar un mecanismo de registro de las consultas y/o solicitudes de servicios que reciban por los distintos medios de atención al público, el cual deberá otorgar en el acto al interesado un número de identificación de su solicitud lo que deberá permitirle verificar en línea el estatus de la misma. Con el fin facilitar a los usuarios el acceso a la oferta de los proveedores aquí regulados, en las distintas zonas de servicio existentes, la Subsecretaría pondrá a disposición de éstos un portal web en el cual aquéllos podrán efectuar sus solicitudes de servicio. A dicho portal deberán concurrir todos los proveedores que brinden servicios en ese sector, respondiendo la solicitud realizada en un plazo máximo de 10 días y quedando constancia de su respuesta. En caso de negativa, deberán expresarse los motivos correspondientes, y especialmente, de aducirse carencia de factibilidad técnica, deberá especificarse la razón de la misma. TÍTULO VIII Disposiciones Finales Artículo 58° Los plazos establecidos en el presente Reglamento son de días hábiles, salvo que se señale expresamente lo contrario. DISPOSICIONES TRANSITORIAS Artículo Primero Transitorio.- Los proyectos inmobiliarios cuyos permisos de loteo o edificación se soliciten ante la Dirección de Obras Municipales a contar de la fecha de publicación de este decreto y hasta un plazo de 90 días desde su entrada en vigencia podrán presentar aquellos sin acompañar el proyecto de telecomunicaciones, en cuyo caso dispondrán del mismo plazo para adjuntar el proyecto de telecomunicaciones a la solicitud de permiso. En caso que ya se hubiera otorgado el permiso de loteo o edificación, dentro del mismo plazo de 90 días señalado en el inciso precedente, el titular deberá solicitar la modificación de su respectivo permiso a efectos de incorporar el correspondiente proyecto de telecomunicaciones, de acuerdo a lo dispuesto en los artículos 7°, 8° y 9° del Reglamento. En caso de no presentar la modificación antes señalada, e será aplicable lo dispuesto en el inciso cuarto del artículo 8°. Transcurrido un plazo de 90 días desde la entrada en vigencia del presente Reglamento, la solicitud de permiso deberá en todo caso acompañar un Proyecto de Telecomunicaciones en los términos señalados en el Título III de este Reglamento y la normativa técnica correspondiente. Artículo Segundo Transitorio.- La Norma Técnica a que se refiere el Título IV del presente Reglamento será dictada por la Subsecretaría de Telecomunicaciones dentro de los diez días corridos a contar de la publicación del presente Reglamento en el Diario Oficial. Artículo Tercero Transitorio.- Las exigencias previstas en el inciso primero del artículo 57° del presente Reglamento serán exigibles transcurridos 90 días corridos a contar de la publicación del mismo en el Diario Oficial. ANÓTESE, TÓMESE RAZÓN, COMUNÍQUESE Y PUBLÍQUESE EN EL DIARIO OFICIAL. MICHELLE BACHELET JERIA PRESIDENTA DE LA REPÚBLICA PAULINA SABALL ASTABURUAGA MINISTRA DE VIVIENDA Y URBANISMO ANDRÉS GÓMEZ ROBO ECHEÑIQUE MINISTRO DE TRANSPORTES Y TELECOMUNICACIONES	4358bd29-ca0b-49e5-a8e6-e21cbc4698b5	HuggingFaceFW/finepdfs/tree/main/data/spa_Latn/train	finepdfs	spa_Latn	67,536
B2 FICHA 12 ESTRUCTURAS DE VALORACIÓN Y CERTEZA EXPRESAR VALORACIÓN O CERTEZA Para expresar valoración o certeza en los textos o discursos utilizamos la estructura: SER, ESTAR, PARECER + ADJETIVO, SUSTANTIVO O ADVERBIO + (QUE) + INDICATIVO, SUBJUNTIVO O INFINITIVO Si el adjetivo, sustantivo o adverbio es sinónimo de verdad, el verbo va en INDICATIVO porque es una certeza. - Es evidente que la crisis financiera es muy seria. - Está claro que tenemos que hacer algo para evitar la contaminación en las grandes ciudades. Si el adjetivo, sustantivo o adverbio no es sinónimo de verdad, el verbo va en INFINITIVO o SUBJUNTIVO porque es una valoración. - Era imposible hablar con él, siempre estaba a la defensiva. - Era lógico que tuviéramos que utilizar toda nuestra labia para salir de la situación. *Con infinitivo es una valoración general y con subjuntivo es una valoración particular.	<urn:uuid:0882e006-bbe0-457b-a776-2b13ee17d70c>	HuggingFaceFW/finepdfs/tree/main/data/spa_Latn/train	finepdfs	spa_Latn	904
Eye Foundry Hook – Grade 80 - design factor 4:1 - Cert supplied on request Eye Hoist Hook -Grade 80 - design factor 5:1 - Maximum Proof Load is 2 x WLL - Cert supplied on request Sliding Choker Hook – Grade 80 - design factor 5:1 - Cert supplied on request	<urn:uuid:6295783b-c515-4eaf-b1d3-f576c09e2377>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	258
Jäätilannekatsaus 10.-11.3.2019 Teräsjään paksuus 8-24 cm riippuen mittauskohteesta Kohvajään osuus jo selvästi yli puolet kokonaisjäänpaksuudesta Etelä-Savon mittauskohteissa Etelä-Savon ELY-keskus mittasi jään paksuutta maanantaina 11.3.2019 neljällä järvellä maakunnan eteläja länsiosassa. Mittaukset tehtiin n. 100 metrin etäisyydellä rannasta. Jääpeitteen kokonaispaksuudet vaihtelivat mittauspaikasta riippuen 43-54 cm välillä. Helmi- ja maaliskuun vaihteen lämmin jakso aiheutti jään päälle olevan lumikerroksen sulamisen. Pian tämän jälkeen tullut pakkasjakso ei kuitenkaan vaikuttanut teräsjään paksuuteen. Teräsjään osuus kokonaisjäänpaksuudesta on siis edelleen säilynyt samana kuin tammikuun alussa tehdyissä mittauksissa. Viimeaikainen pakkasjakso jäädytti jääkerrosten välissä olevat vesi- ja kohvakerrokset yhtenäiseksi kohvajääksi kaikilla mittauspaikoilla. Kokonaisjäänpaksuus on kuitenkin pysynyt samana tai kasvanut vain vähän. Jäätymistä on siis tapahtunut lähinnä teräsjään päällä olevissa kerroksissa. Peru- ja Pyhävedellä kohvajään osuus on jo selvästi yli puolet jään kokonaispaksuudesta. Korpijärvellä sekä Yövedellä kohvajään osuus jään kokonaispaksuudesta on jo n. 80 %. Mäntyharjun Korpijärvellä teräsjään paksuus oli pienimmillään (8 cm) ja suurimmillaan Pertumaalla Peruvedellä (24 cm). Kaikissa mittauspaikoissa oli jään päällä lunta 5-7 cm. Jäänmittaustulokset 10-11.3.2019 \| \| \| Jään kokonais- \| \|---\|---\|---\| \| Kunta, kylä \| Järvi \| paksuus, cm \| \| \| \| (10-11.3.2019) \| \| Mikkeli, Haukivuori \| Kyyvesi \| 52 \| \| Savonlinna, Oravi \| Haukivesi \| 45 \| \| Mikkeli, Ristiina \| Yövesi, Kissalahti \| 43 \| \| Mäntyharju, Tommola \| Korpijärvi \| 47 \| \| Mäntyharju, Kirkonkylä \| Pyhävesi \| 50 \| \| Pertunmaa, Lihavanpää \| Peruvesi \| 54 \| Jäämittauskohteet kartalla Valtakunnallisista jäähavaintopaikoista Haukivuoren Kyyvedellä mitattiin 10.3. kokonaisjäänpaksuudeksi 52 cm, joten Kyyvedellä jää paksuni viime jakson aikana (20.2.-10.3) vain 2 cm. Tällä hetkellä teräsjään ja kohvajään osuus kokonaisjäänpaksuudesta on Kyyvedellä lähes yhtä suuri. Haukivedellä mitattiin vastaavaan aikaan kokonaisjäänpaksuudeksi 45 cm eli jää paksuni vastaavasti 9 cm. Mittaukset tehdään valtakunnallisilla jäähavaintopaikoilla 10 päivän välein, joten seuraava mittauspäivä on 20.3. Jään kokonaispaksuudet valtakunnallisilla mittauspaikoilla ovat lähellä vuosittaista keskiarvoa, mutta kohvajään osuus kantavasta jäästä kasvaa edelleen. Jäänpaksuuden erot vesistön eri osissa ovat tasoittuneet, mutta jäillä liikkujien tulee olla edelleen varovaisia. Vaikka rannalla jäätä on jo paikoin tukevasti, voi etenkin suurempien järvien selkävesillä jää olla vielä heikkoa. Ilmoitetut jäänpaksuudet eivät milloinkaan kerro kyseisen järven koko jäätilannetta, vaan pelkästään yhden tutkimuskohteen tuloksen. Mittauspaikat ovat korkeintaan 100 metrin etäisyydellä rannasta, eivätkä näin ollen kuvaa selkävesien jäätilannetta. Mittauspaikat eivät myöskään sijaitse virtapaikoissa. Huolimatta jään kokonaispaksuuden kasvamisesta, niin heikommin kestävän kohvajään ja vesikerrosten osuus on kaikilla mittauspaikoilla huomattavasti suurempi kuin teräsjään. Sääennusteen mukaan lämpötila lauhtuu, jolloin pakkaset muuttuvat lähinnä yöpakkasiksi ja päivällä lämpötila nousee yli nollan. Odotettavissa on myös lumi- ja vesisateita, joten jäät eivät vahvistune lähiaikoina. Kohvajään suuri osuus kokonaisjäänpaksuudesta vaikuttaa kuitenkin lopputalven jäänvahvuuksiin, joten jään kantavuus saattaa heiketä hyvinkin nopeasti. Vain teräsjää kantaa tarpeeksi Jään kantokyky on aina arvioitava teräsjään mukaan. Yksin kulkevan ihmisen alla on oltava vähintään viisi senttimetriä teräsjäätä. Moottorikelkalla ajettaessa teräsjäätä on oltava koko ajoreitin pituudella vähintään 15 senttimetriä. Vasta noin 20 senttimetriä paksu teräsjää kantaa henkilöauton. Teräsjää on kirkas, läpikuultava ja tasainen. Vaalea ja huokoinen lumisohjosta muodostunut jää on kohvajäätä, jonka kantavuus on enintään puolet teräsjään kantavuudesta. Oikeat varusteet mukaan jäälle Jäällä liikuttaessa on pidettävä mukana jäänaskaleita, joiden avulla voi vetää itsensä takaisin jäälle. Hyvä apuväline on myös tukeva keppi, jolla voi kokeilla jään laatua sekä auttaa hädän tullen itseään ja toisia. Heittoliinan voi tarvittaessa nopeasti heittää auttajalle tai autettavalle. Kelluntapuvut ja -takit sekä pelastusliivit suojaavat viimalta ja helpottavat onnettomuuden sattuessa pelastautumista. Jäällä liikuttaessa kannattaa aina pitää mukana myös pilliä, koska sen ääni kuuluu huutoa kauemmaksi. Linkit Vesistöjen jäänpaksuus -havaintokartta Järvien jäänpaksuuden ennustekartta Jään kantavuus mitataan teräsjään mukaan Kansalaishavaintoja jäätilanteesta (Järviwiki) Suomen vesistöjen jääolot –julkaisu (Korhonen 2005) Jäistä pelastautuminen (Suomen uimaopetus- ja hengenpelastusliitto) Lisätietoja Vesitalousasiantuntija Tarmo Muuri, Etelä-Savon ELY-keskus, p. 0295 024 031 Vesienhoidon asiantuntija Juho Kotanen, Etelä-Savon ELY-keskus, p. 0295 024 192 NÄKYMIÄ TAMMIKUU \| 2019 JÄÄTILANNEKATSAUS Etelä-Savon elinkeino-, liikenne- ja ympäristökeskus 31.1.2019 www.ely-keskus.fi/julkaisut \| www.doria.fi/ely-keskus	<urn:uuid:f202cca2-89d5-4e5a-ab96-d19e71e16b96>	HuggingFaceFW/finepdfs/tree/main/data/fin_Latn/train	finepdfs	fin_Latn	5,200
European Journal of Neuroscience European Journal of Neuroscience, Vol. 33, pp. 1139–1151, 2011 doi:10.1111/j.1460-9568.2011.07613.x Neurodegenerative disease and adult neurogenesis Beate Winner, 1,2 Zacharias Kohl 3 and Fred H. Gage 1 Laboratory of Genetics, The Salk Institute for Biological Studies, 10010 North Torrey Pines Road, La Jolla, CA 92037, USA 1 2 Junior Research Group III, Interdisciplinary Center for Clinical Research, Nikolaus-Fiebiger Center for Molecular Medicine, Friedrich-Alexander-University Erlangen-Nu¨rnberg, Erlangen, Germany 3 Division of Molecular Neurology, University Hospital Erlangen, Erlangen, Germany Keywords: adult neural progenitor cells, Alzheimer's disease, dentate gyrusHuntington's disease, olfactory bulb, Parkinson's disease Abstract The generation and cell death of newly generated cells have critical roles in brain development and maintenance in the embryonic and adult brain. Alterations in these processes are also seen in neurodegenerative diseases. Genes that are key players in neurodegenerative diseases (a-synuclein, presenilin-1, tau, huntingtin) are also physiologically involved in modulating brain plasticity. Interestingly, in some neurodegenerative diseases, the speciﬁc alterations in neurogenic areas such as the dentate gyrus and subventricular zone / olfactory bulb system parallel the early or premotor symptoms that are seen in the early stages of these diseases, such as depression, anxiety or olfactory dysfunction. We will review the modulation of neurogenesis in animal models and human brains of Parkinson's disease, Huntington's disease and Alzheimer's disease. Introduction Why study neurogenesis in neurodegenerative diseases? It might sound like a paradox to study an age-related disease in a newly generated young neuron. However, the elimination of axons, dendrites and synapses is a common theme during development of the nervous system and in response to acute or chronic injury (reviewed in Luo & O' Leary, 2005). Similarly, the generation and cell death of newly generated cells have critical roles in brain development and maintenance in the embryonic and adult brain, and alterations in these processes are seen in neurodegenerative diseases. Genes that are key players in neurodegenerative diseases [a-synuclein, presenilin (PSEN)1, tau, huntingtin] are also physiologically involved in modulating brain plasticity in the embryonic brain, speciﬁcally as membrane proteins and when concentrated in synapses. These proteins commonly show high conservation between species and are located close to membranes or are involved in microtubule transport. a-Synuclein is a protein that is physiologically enriched in presynaptic termini (Abeliovich et al., 2000). Initially shown to be upregulated in a discrete population of presynaptic terminals of the song bird brain during a period of acquisition-related synaptic rearrangement (George et al., 1995), a-synuclein can interact with tubulin (Alim et al., 2002). In addition, it is involved in dopamine (DA) synthesis, metabolism and release, and slight changes in concentration can have vast effects on neurotransmitter release (Nemani et al., 2010). a-Synuclein Correspondence : F. H. Gage, as above. E-mail: firstname.lastname@example.org belongs to a highly conserved family of proteins; whereas a-synuclein knock-out mice and ab-synuclein knock-out mice only present with subtle deﬁcits, prominent age-dependent changes in synaptic protein composition and axonal structure lead to severe neuronal dysfunction in the central nervous system in abc-synuclein knock-out mice (Greten-Harrison et al., 2010). PSENs are a family of transmembrane proteins that function as a part of the c-secretase protease complex and have high conservation between species. Presenilin 1 (PSEN1) is not only prominently expressed in the embryonic brain but is also a key regulator in Notch and Wnt signaling. In this respect it has an important role in the developmental maturation of glia and neurons (Lee et al., 1996). Tau is a highly soluble microtubule-associated protein that modulates the stability of axonal microtubules, but it is not present in dendrites and is mostly found in neurons rather than nonneuronal cells (Weingarten et al., 1975). Huntingtin is a cytoplasmatic protein that has a role in vesicular trafﬁcking but also functions in transcriptional regulation, and nucleo-cytoplasmatic shuttling and synaptic functions are proposed (Caviston & Holzbaur, 2009). Interestingly, in Parkinson's disease (PD) and Huntington's disease (HD), the speciﬁc alterations in neurogenic areas such as the dentate gyrus (DG) and subventricular zone (SVZ) / olfactory bulb (OB) system parallel the early or premotor symptoms that are seen in the early stages of neurodegenerative disease, such as depression, anxiety or olfactory dysfunction (Simuni & Sethi, 2008). Therefore, it is intriguing that the mechanisms of neurodegenerative diseases are closely linked to brain plasticity. Brain plasticity in the adult, originally conceived of as changes at the level of synaptic transmission, synaptic contacts and gene expression (reviewed in Buonomano & Merzenich, 1998), became a more complicated concept when the continuous generation of neural stem cells (NSCs) in the adult was ﬁrst reported by Altman and colleagues. They reported a constitutive production of new neurons in the hippocampal DG (Altman & Das, 1965) and in the SVZ / OB system (Altman, 1969). These newly generated neurons had the electrophysiological properties of functional neurons, connected with neighboring cells, and integrated into existing neuronal circuits (van Praag et al., 2002; Carleton et al., 2003). These ﬁndings overturned the long-held belief that the mammalian brain is a postmitotic structure incapable of generating new neurons. Adult neurogenesis involves several crucial steps, including the asymmetric cell division of a stem cell, resulting in one daughter stem cell and one with the potential to develop into a neuron. Next, the newly generated neuroblast migrates to its ﬁnal and appropriate destination in the brain, and the new neuron matures and integrates by forming efferent and afferent connections with neighboring cells (reviewed in Zhao et al., 2008). As described elsewhere in this issue (Lie, Kempermann, Kokaia and Hen), many layers of modulation and regulation of adult neurogenesis have been identiﬁed, including a variety of transcriptional and epigenetic regulation and signaling pathways but also environmental factors, age and diseases such as neurodegenerative diseases. The hippocampus- or OB-dependent functions in the formation of new memories, acquisition of new skills and olfactory learning may in part be attributable to adult neurogenesis at different stages (reviewed in Mu et al., 2010; Aimone et al., 2010; Ma et al., 2010). Human brain diseases are studied by analyzing neuropathological abnormalities in postmortem brain tissues. These brain tissues are not always well-preserved samples but rather often represent the end-stage of the disease. A signiﬁcant difﬁculty in understanding adult neurogenesis in these diseases comes from restrictions in labeling methods of neuroblasts in the human adult brain. Some reports describe doublecortin (DCX) as a marker of neurogenesis in the adult human hippocampus; however, the morphology of these cells is somewhat different from rodent brains (Knoth et al., 2010) and it remains questionable how well preserved the stained cells in human brains are and how they reﬂect the generation of new neurons. Moreover, DCX immunoreactivity appears to be rapidly reduced with increasing postmortem delay in rodent and human tissue (Boekhoorn et al., 2006; Monje et al., 2007). Improvements in imaging techniques, as previously described in neurogenesis reporter mice (Couillard-Despres et al., 2008), will lead to the development of techniques that hopefully will permit labeling newly generated cells. Progress in spatially resolved spectroscopy in vivo is still limited, as the signals reported for NSCs in magnetic resonance spectroscropy (e.g. lipid signal at 1.28 ppm) (Manganas et al., 2007) are not yet speciﬁc for reﬂecting NSCs, but may also indicate cell death (Ramm et al., 2009). Transgenic animal models mimic some aspects of a disease but, in rare cases, the transgene is expressed as observed in the human brain. The transgenic animals usually only present some, but rarely all, of the neuropathological ﬁndings in the respective brain regions. In contrast, the transgenes are in many cases strongly expressed in many brain regions, including regions of adult neurogenesis. Whether impaired adult neurogenesis contributes to deﬁcits observed in neurodegenerative diseases is still not clear; however, impaired olfaction and hippocampusrelated cognitive and emotional impairment are common ﬁndings in many different neurodegenerative diseases. The analysis of adult neurogenesis offers a unique chance to analyze the biology of NSCs in a pathological adult environment. Understanding how and at what level of development the generation of NSCs is impacted in brain diseases involving neurodegeneration will help to better understand these disease conditions at a cellular level. Understanding neurogenesis in neurodegenerative disease will lead to the identiﬁcation of disease-relevant signaling pathways and compounds for disease modiﬁcation; an additional goal might be to use stimulation of endogenous NSCs as a means to induce neuroregeneration. Neurodegenerative diseases comprise a wide range of diseases that share the common characteristic of progressive loss of structure or function of neurons and glial cells in the brain and spinal cord. Many neurodegenerative diseases are a result of neuronal loss, although glial cells are also involved (Glass et al., 2010). Although neuronal degeneration predominantly affects or starts with speciﬁc neuronal populations [including DAergic neurons in PD, striatal medium spiny neurons in HD, motor neurons in amyotrophic lateral sclerosis, and cortical and hippocampal neurons in Alzheimer's disease (AD)], there are many similarities between different neurodegenerative disorders. These include atypical protein assemblies and oligomerization as well as induced cell death. At a late disease stage, protein aggregation is no longer restricted to speciﬁc brain regions. Although both endogenous NSCs and fetal cell transplantation have been tested up to clinical studies (extensively reviewed in Lindvall & Kokaia, 2010), we will limit our review to the aspects of endogenous generation of new neurons in the adult brain. Adult neurogenesis increases after several acute pathologic stimuli, including stroke, seizure and acute trauma (Arvidsson et al., 2002; Rice et al., 2003; Parent, 2007). Neurodegenerative diseases present a chronic and slowly progressive process. Neurons in neurodegenerative diseases are affected by neuronal dysfunction at the level of synaptic transmission, synaptic contacts, and axonal and dendritic degeneration. In different neurodegenerative diseases, neurite degeneration and cell loss of neurons are present within speciﬁc neurotransmitter populations. In addition, numbers of functional neurons in neurogenic regions, and adult neurogenesis are altered or decreased. Brain regions differ in their vulnerability to aging; some regions that are very sensitive to age-related neurodegenerative changes are the DG of the hippocampus, subiculum (Small, 2003) and OB (Braak et al., 2003). Chronic neurodegeneration has different impacts on stem cell maintenance, proliferation, survival and functional integration. We will restrict our review to age-related neurodegenerative diseases and describe recent ﬁndings in AD, PD and HD. Alterations in adult neurogenesis in different neurodegenerative diseases When comparing studies of adult neurogenesis in animal models of neurodegenerative diseases, the results seem very diverse and variable. There are differences between different studies in transgenic animals. The models vary in promoters used, age of the animal and age of onset of the disease, transgene expression, neurotransmitter content and amount of overexpression / loss of the disease-causing protein. The amount of overexpression of the respective proteins is especially variable, depending on whether transgene knock-in is performed into knockouts of the same gene, which would more closely model the disease situation. The gene encoding the mutant precursor protein remains in its normal chromosomal location. In many transgenic animal models, the transgene is added with the existing functional gene. Alzheimer's disease The pathology of AD includes neuronal and synaptic loss, neuroﬁbrillary tangles due to hyperphosphorylated tau proteins and deposition of amyloid-b (Ab) protein in senile plaques in the basal forebrain cholinergic neurons as well as in the cortex, hippocampus and amygdala (Hardy & Selkoe, 2002). Ab is the product of proteolysis of amyloid precursor protein (APP) by b- and c-secretase enzymes (reviewed in Crews et al., 2010b). Ab accumulates intracellularly in the neuronal endoplasmic reticulum but also extracellularly (Trojanowski & Lee, 2000; Cuello, 2005). Although Ab plaques are the neuropathological hallmarks of AD, the small Ab oligomeric species rather than its amyloid counterpart is thought to be the toxic culprit in the disease. Evidence for this assumption includes a correlation between oligomerization and memory deﬁcit in both transgenic mice and humans, the presence of oligomers in the brains of transgenic mice, the toxicity of Ab dimer and trimer measured by long-term potentiation, and lack of a good correlation between plaque amount and AD (at least in the early phase of the disease) (Walsh et al., 2002; Walsh & Selkoe, 2007). Patient deﬁcits include olfactory deﬁcits, memory impairment, cognitive and functional decline, and death. These symptoms can be partly related to regions and functions of adult neurogenesis. Genetic studies have identiﬁed familial, early-onset and autosomal dominant mutations for AD. Expression of different mutant genes, among them those encoding APP, PSEN1 and presenilin 2 (PSEN2), causes familial AD. These mutations provide insight into the molecular mechanisms underlying AD in both its familial and sporadic forms. They enhance the Ab42 : Ab40 ratio and result in toxic Ab oligomers and deposition of the Ab42 peptide in Ab plaques (Selkoe, 1998; Walsh & Selkoe, 2007). A variety of mouse models expressing mutant forms of APP and combinations thereof have been generated (reviewed in Crews et al., 2010b). APP mutations include mutations in the N- and C-terminal domains that result in the accumulation of intracellular and / or extracellular Ab species (i.e. K670N / M671L, Swedish mutation; V717I, London mutation; V717F, Indiana mutation). Mutations in the central Ab region lead to the development of amyloid angiopathy (i.e. D23N, Iowa mutation). Presenilin is the catalytic component of c-secretase, which is responsible for the intramembranous proteolysis of membrane proteins, including APP (De Strooper, 2003). At the same time, presenilin plays a role in regulating the Notch and Wnt signaling mechanisms and is responsible for developmental maturation of glia and neurons (Gaiano & Fishell, 2002). c-Secretases sequentially cleave the notch receptor to generate a notch intracellular domain (Kojro & Fahrenholz, 2005). The notch intracellular domain activates nuclear genes such as hairy and enhancer of split 1 (HES1) and hairy and enhancer of split 5 (HES5) to facilitate neurogenesis during development and damage repair (reviewed in Kopan et al., 2009). For AD research, a model of great interest is the triple transgenic model [overexpression of Swedish mutant APP, mutant P301L Tau in a homozygous mutant of presenilin 1 (M146V)] knock-in mouse. These mice develop hippocampal tangle-like pathology, neurological deﬁcits and Ab deposition (Crews et al., 2010b). In different transgenic models, adult neurogenesis is compromised in AD and precedes neuronal loss; dysfunctional neurogenesis, both decreased and increased, has been reported for AD transgenic models in both regions of adult neurogenesis (reviewed in Lazarov & Marr, 2010; Marlatt & Lucassen, 2010). Experimental conditions largely differ, depending on the use of PSEN1, PSEN2 or different APP single mutations, knock-ins or combinations thereof. In addition, bromodeoxyuridine (BrdU) regimens, doses, time points analyzed after BrdU treatment, genetic backgrounds of the mice, and regions investigated vary considerably in all of the studies and have been extensively reviewed elsewhere (Lazarov & Marr, 2010; Marlatt & Lucassen, 2010), as summarized in Tables 1 and 2. Promoters determine speciﬁc neuronal populations and topographical distribution of the transgene. For example, the use of the platelet-derived growth factor (PDGF) promoter results in the production of diffuse plaques (Mucke et al., 2000), whereas prion protein and mouse THYmocyte differentiation antigen 1 (mThy1) promoters favor plaque formation in the hippocampus and neocortex. In human AD, Ab42 is broadly distributed. It can be found intracellularly and extracellularly and in and around vessels, speciﬁcally in a condition known as cerebral amyloid angiopathy, where amyloid is found to cause vascular fragility and hemorrhages (reviewed in Pezzini et al., 2009). One difﬁculty in characterizing adult neurogenesis in AD is that it is difﬁcult to delineate autonomous and non-autonomous effects of AD pathology on NSCs in the stem cell niche. In an aged APP23 transgenic mouse model of cerebral amyloidosis with strong Ab deposits, Ermini et al. (2008) reported a decrease of quiescent astrocyte type 1-like cells, in conjunction with strong attraction of granule cell layer-derived new neurons by Ab deposits. Under many conditions, adult neurogenesis is impaired in transgenic AD models (reviewed in Lazarov & Marr, 2010), speciﬁcally when a single mutation of PSEN1 (Wang et al., 2004; Wen et al., 2004; Choi et al., 2008) was studied. Although a single APP transgene mutation (Indiana mutation) has only negative effects on adult neurogenesis at an aged and symptomatic stage after amyloid deposition (Donovan et al., 2006), double and triple mutations of APP (APP Swedish and Indiana) under many circumstances result in increased proliferation and, in some cases, survival of new neurons (Haughey et al., 2002a,b; Mirochnic et al., 2009). BrdU injection paradigms differ between the different experiments as well as the BrdU cell numbers reported. Another possible explanation of these divergent results of increased or decreased proliferation in AD transgenic models might be other responses to damage due to protein overexpression, such as glia activation or aberrant cell cycle changes, as described in other brain regions (Yang et al., 2001; Varvel et al., 2009). These might in turn trigger either neurogenesis or pathology. An important study in adult neurogenesis was performed in a commonly used AD model, the triple transgenic mice (3· Tg-AD) harboring three mutant genes (APP, PSEN1 and tau). Decreased proliferation was found in male 3· transgenic-AD mice. This reduction in proliferation was directly associated with the presence of Ab plaques and an increase in the number of Ab-containing neurons in the hippocampus, which, in the case of 3· gTg females, was directly correlated (Rodriguez et al., 2008). Longer dendrites, increased spine density and functional responses in early-stage, newly generated neurons in APP transgenic mice have recently been reported (Sun et al., 2009), possibly as compensatory mechanisms. During later maturation, the morphology and functionality of these newly generated neurons were impaired, suggesting that an imbalance in GABAergic and glutamatergic neurotransmission was present in APP models. Longer time periods after BrdU injection and more retroviral labeling studies will therefore be necessary for future studies of adult neurogenesis. Detailed studies of the dendrites and spines of the newly generated neurons and their functional integration in different animal models will add important information. How the slow neurodegenerative process may also induce NSC proliferation is still a matter of debate. An important experiment would be to dissect out the impacts of intracellular vs. extracellular effects of Ab on newly generated neurons. Neural differentiation was increased in vitro when Ab peptide was added to striatal and hippocampal NSCs (Lopez-Toledano & Shelanski, 2004). Sisodia and colleagues studied the NSC autonomous vs. non-autonomous effect by performing coculture experiments of NSCs and microglia derived from PSEN mutants or controls. They reported a strong decrease in proliferation and neuronal lineage commitment when wild-type NSCs were cocultured with PSEN1 mutated microglia (Choi et al., 2008). These Table 1. Exemplary results for analysis of adult neurogenesis in neurodegenerative diseases in the hippocampal DG cells (SGZ) aCasp3+ cells (GCL) Cell death TUNEL TUNEL TUNEL AD, Alzheimer's disease; APP, amyloid precursor protein; CaMK, calcium / calmodulin-dependent protein kinase II alpha; M, months; NeuN, neuronal nuclear antigen; PDGF, platelet-derived growth factor; PSANCAM, polysialylated-neural cell adhesion molecule; Thy-1, THYmocyte differentiation antigen 1; TUNEL, Tdt-mediated dUTP-biotin nick end labeling. Table 2. Exemplary results for adult neurogenesis in neurodegenerative diseases in the SVZ / OB system Cell death TUNEL (GLOM) TUNEL (GLOM) TUNEL TUNEL TUNEL TUNEL TUNEL Cell death 6-OHDA, 6-hydroxydopamine; aCasp3, activated Caspase 3; AD, Alzheimer's disease; APP, amyloid precursor protein; b3tub, beta 3 tubulin; CA, Cornu amonis; CaMK, calcium / calmodulin-dependent protein kinase II alpha; CSF, cerebro spinal ﬂuid; GCL, granule cell layer; GFAP, glial ﬁbrillary acidic protein;GLOM, glomerular layer; HH3, phosphorylated Histone H3; M, months;MPTP, 1-methyl-4-phenyl-1,2,3,6- tetrahydropyridine; NeuN, neuronal nuclear antigen; NeuroD, neurogenic differentiation; NSE, neuron speciﬁc enolase; PDD, Parkinson disease dementia; PDGF, platelet-derived growth factor; PrP, prion protein; PSA-NCAM, polysialylated-neural cell adhesion molecule; Sox2, sex determining region Y-box 2; tg, transgenic; TH, tyrosine hydroxylase; Thy1, THYmocyte differentiation antigen 1; TUNEL, TdT-mediated dUTP-biotin nick end labeling; WT, wild-type. data indicate that the non-NSC autonomous mechanisms might be the key to understanding the divergent ﬁndings of how AD-related proteins act on newly generated neurons. A detailed summary of the divergent reports on adult neurogenesis in PSEN models (reviewed in van Tijn et al., 2010) recently indicated the difﬁculty that most of these studies were performed in young mice, and only one report investigated old PS1-P264L / KI mice and found a reduction of adult neurogenesis up to 18 months of age (Zhang et al., 2007). Interestingly, a recent study investigating global gene expression levels in human AD brains at different Braak stages indicated that the appearance of AD neuropathology in the prefrontal cortex is preceded by changes in gene expression that point to increased synaptic activity and plasticity (Bossers et al., 2010). It is also important to note that, under certain circumstances, an enriched environment in APP and PSEN1 transgenic mice not only improves memory function but also reduces Ab deposition in the central nervous system (Lazarov et al., 2005). However, depending on the mouse models and ages used, the results were variable. The APP / PS1KI mouse model failed to show signiﬁcant improvement after 4 months of continuous enrichment (physical activity plus social enrichment), possibly because the mice were not exposed to the enriched environment until after disease onset (Cotel et al., 2010). The investigation of adult neurogenesis in AD is involved in a larger picture of alterations in synaptic plasticity, spine morphology and axonal pathology. In summary, altered proliferation and survival are observed in many studies using APP transgenic models of familial AD with advanced progression of the disease (reviewed in Lazarov & Marr, 2010). Understanding the role of amyloid formation vs. oligomerization in adult NSCs will probably be a crucial next step in understanding the different effects. Similar to the analysis of mouse genetic backgrounds and their impact on neurogenesis (Kempermann et al., 2006), a systematic comparison of different AD transgenic models under the same promoter with a similar labeling paradigm, sex, age and background would be necessary to compare adult neurogenesis in these different models and draw relevant conclusions. An additional crucial component of these studies would be the functional implication of alterations in neurogenesis in these models. Studies of human AD have led to seemingly variable results; one study reported that hippocampal neurogenesis was increased in patients with AD, as shown by an increase in protein expression of DCX and polysialylated-neural cell adhesion molecule (PSANCAM), TOAD-64/Ulip/CRMP (TUC-4), and neurogenic differentiation (NeuroD) in Western blots from AD hippocampus (Jin et al., 2004b). This study suggested that the increase might be a compensatory mechanism in the neurodegenerative process. Recent reports indicate an increase in gliosis and vascular-associated changes in presenile AD human hippocampus (Boekhoorn et al., 2006). Masliah and colleagues performed cell counts and reported a decrease in DCX- and sex determining region Y-box 2 (Sox2)positive cells in human AD (Crews et al., 2010a). Bone morphogenetic protein 6 (BMP6) levels are increased in these human brains and in APP transgenic mice and are speculated to be crucial for the defective neurogenesis in AD (Crews et al., 2010a). More detailed studies during different disease stages will be necessary to understand the effects of AD on hippocampal neurogenesis. Huntington's disease Huntington's disease is a devastating autosomal dominant neurodegenerative disease that results from a CAG trinucleotide repeat expansion within the disease-causing huntingtin / IT15 gene. This gene encodes an extended polyglutamine tract in the huntingtin protein (The Huntington's Disease Collaborative Research Group, 1993). The clinical symptoms of HD are progressive involuntary choreatic movements, bradykinesia, cognitive decline and psychiatric syndromes (reviewed in Walker, 2007). Impaired olfactory function was noticed in patients and presymptomatic gene carriers (Mochel et al., 2007). Aggregation of the mutant huntingtin results in neuronal damage in the medium spiny neurons of the neostriatum and other neurons such as in the cortex (reviewed in Li & Li, 2004). Among several mechanisms, a recently suspected toxic mechanism is due to the presence of toxic oligomers (Sathasivam et al., 2010). Among the most widely used animal models for HD are transgenic mice (R6 / 1 and R6 / 2 lines) with the introduction of exon 1 of the human HD gene carrying highly expanded CAG repeats into the mouse germ line. They differ in their number of CAG repeats, age of onset and survival (Mangiarini et al., 1996), and they develop a progressive neurological phenotype that exhibits many of the features of HD, including involuntary stereotypic movements, tremor and epileptic seizures, as well as non-movement disorder components. Promising models for HD research that are considered closer to the human disease have also been a full-length human mutant huntingtin mouse with 97 glutamine repeats on a bacterial artiﬁcial chromosome (Gray et al., 2008) and yeast artiﬁcial chromosome mice expressing normal yeast artiﬁcial chromosome (YAC) 18 and mutant (yeast artiﬁcial chromosome 46 and yeast artiﬁcial chromosome 72) huntingtin (Hodgson et al., 1999). These mice exhibit progressive motor deﬁcits, neuronal synaptic dysfunction and late-onset cortical and striatal neuropathology. In addition, a rat model of huntingtin (von Horsten et al., 2003) has been established that carries a truncated huntingtin cDNA fragment encoding for 51 CAG repeats under the control of the rat huntingtin promoter (von Horsten et al., 2003). These rats exhibit adult onset of reduced anxiety, cognitive impairment and slowly progressive motor dysfunction. Adult neurogenesis in transgenic animal models of Huntington's disease Both the DG and SVZ have been studied for adult neurogenesis, mostly in R6 / 1 and R6 / 2 mice and the rat HD model. Several studies have reported reduced progenitor proliferation rates in both mouse models of HD in the DG. In the DG, a decline in proliferation was documented in the R6 / 1 (Lazic et al., 2004, 2006) and R6 / 2 (Gil et al., 2004, 2005; Phillips et al., 2005; Kohl et al., 2007) HD mouse models, which resulted in a reduction in newly generated neurons, although in most reports neuronal differentiation was not compromised. Different stimuli known to increase adult neurogenesis were tested. Physical activity and environmental enrichment (van Dellen et al., 2000; Spires et al., 2004) had positive effects on survival, cognitive performance and striatal brain-derived neurotrophic factor (BDNF) levels (Pang et al., 2006), as well as the reduction of the neuronal intranuclear inclusion load (Benn et al., 2010). Neither asialoerythropoietin (Gil et al., 2004), running (Kohl et al., 2007) nor seizures (Phillips et al., 2005) were able to reverse the reduction of adult neurogenesis in these HD models; only environmental enrichment could increase the levels of hippocampal neurogenesis to some extent (Lazic et al., 2006). In a transgenic rat model of HD (von Horsten et al., 2003), important molecular cues were found. This is an interesting model for translational research, as 51 CAG repeats more closely reﬂect the human disease, and the longer survival of these animals allows age-related studies. Adult neurogenesis was analyzed in 8- and 12-month-old HD rats. The decrease in hippocampal progenitor cells was accompanied by an expansion of the quiescent stem cell pool (characterized by BrdU and Sox2 coexpression) and diminished cAMP-responsive element-binding protein signaling (Kandasamy et al., 2010). Phospho-Smad 2, which is involved in transforming growth factor beta (TGF-b) signaling that is normally not present in subgranular stem cells, is increased in neural quiescent stem cells in these HD transgenic rats, indicating that TGF-b signaling is involved in modulating adult neurogenesis in HD (Kandasamy et al., 2010). In contrast to decreased proliferation in the DG, SVZ proliferation was reported to be unchanged in R6 / 2 mice (Phillips et al., 2005; Kohl et al., 2010). A reduction in newly generated neurons was present in the OB, which affected GABAergic more severely than DAergic newly generated neurons (Kohl et al., 2010). In the OB, huntingtin aggregates were described in mature neurons in the granule cell layer and glomerular layer, but not in glial ﬁbrillary acidic protein (GFAP)positive B cells or epidermal-growth-factor (EGF) receptor-positive C cells in the SVZ or DCX-positive newly generated neuroblasts in the SVZ or OB. This ﬁnding suggests a non-cell-autonomous mechanism of aggregated huntingtin on newly generated neurons (Kohl et al., 2010). Curtis and colleagues reported an increase in cell proliferation in the human SVZ (as determined by increased numbers of proliferating cell nuclear antigen (PCNA)-positive cells in the SVZ of human HD). Increased PCNA numbers correlated with the severity of disease and the number of CAG repeats. In the human ventricle wall, the PCNA / GFAPcolabeled cells were found in the most superﬁcial regions close to the ventricular edge (Curtis et al., 2003, 2005). The key to a better understanding of these processes might come from further investigation of the quiescent stem cell population in these brains, speciﬁcally NSCs that express Sox2 and GFAP. The PCNA / b-III tubulin-positive cells were reported to be close to the human caudate nucleus (Curtis et al., 2005), which suggests potential migration of neural precursors to the degenerating striatum. This phenomenon of neuroblasts migrating towards the striatum was also reported for R6 / 2 mice (Phillips et al., 2005; Kohl et al., 2010). However, these neuroblasts were not able to survive and form mature, functional neurons in the striatum, indicating that the striatal microenvironment provided a stimulus for abnormal migration of the newly generated cells but did not allow functional integration. This phenomenon of ectopic migration from the SVZ following changed microenvironmental cues has some similarities to what is observed after stroke (Arvidsson et al., 2002). An important observation in regard to striatal plasticity was that adenoviral overexpression of BDNF and Noggin in the ventricular wall increased the number of new neurons in the striatum of R6 / 2 huntingtin mutant mice. Under these conditions, newly recruited striatal neurons expressed striatal neuronal markers such as dopamineand cAMP-regulated neuronal phosphoprotein (DARPP-32) and glutamate decarboxylase (GAD) 67. In addition, extended neuronal ﬁbers to the ipsilateral globus pallidus were noted, indicating that these new striopallidal projection neurons survived and integrated as GABAergic striatal neurons. This integration was accompanied by substantial motor improvement and longer survival (Cho et al., 2007) and indicates that changing the striatal microenvironment will be crucial for survival of new neurons in HD. A next crucial step for this area of research will be a detailed analysis of stem-cell autonomous vs. non-autonomous actions in HD, as well as ﬁguring out the impact of different size aggregates for adult neurogenesis and testing compounds that have been shown to be protective to HD in rodent models, e.g. matrix metalloproteases, to determine whether they have an impact in modulating adult neurogenesis (Miller et al., 2010). In a quinolonic lesion model, migration of neuroblasts from the SVZ to the lesion site was reported (Tattersﬁeld, 2010). In this lesion model, even expression of neuronal markers was reported [neuronal nuclear antigen (NeuN) and microtuble-associated protein 2 (MAP2)] in the newly generated neurons between day 13 and 37 after lesioning (Tattersﬁeld et al., 2004). Parkinson's disease Loss of DAergic neurons in the substantia nigra of the midbrain and loss of other neurotransmitter phenotype neurons in other brain regions are characteristic neuropathological hallmarks (reviewed in Goedert, 2001). Prominent clinical features of PD are motor symptoms (bradykinesia, tremor, rigidity and postural instability) and non-motorrelated PD symptoms (olfactory deﬁcits, autonomic dysfunction, depression, cognitive deﬁcits and sleep disorders). Non-DA brain regions that are affected in PD have recently attracted increasing interest because the onsets of the non-motor symptoms linked to these neuropathological alterations are observed early in the course of the disease. They include rapid eye movement (REM) sleep behavior disorder, subtle cognitive deﬁcits, depression, olfactory dysfunction and constipation (for review see Tolosa & Poewe, 2009). As described above, a subset of these functions is connected to the stem and progenitor cell populations in the hippocampus and SVZ / OB system. Interestingly, several monogenetic forms of PD show a decreased gray matter volume in the hippocampal region (Reetz et al., 2010). a-Synuclein animal models Multiple genetic mutations can cause PD; the ﬁrst gene identiﬁed, and still one of the most important, was a-synuclein. a-Synuclein, a 140amino-acid protein physiologically found in presynaptic terminals of neurons, is the major ﬁbrillar protein in Lewy bodies and Lewy neurites in sporadic and inherited PD. Moreover, point mutations (A53T, A30P, E46K) and gene multiplications of human wild-type (hWT) a-synuclein are related to rare familial autosomal dominant forms of early-onset PD (Polymeropoulos et al., 1996; Kruger et al., 1998; Singleton et al., 2003; Zarranz et al., 2004). PD is a synucleinopathy, with accumulation of misfolded a-synuclein that forms intracellular inclusions in neurons: Lewy bodies and Lewy neurites. Overexpression of mutant a-synuclein in transgenic mice can lead to neurodegeneration, although these models cannot reﬂect all aspects of PD (reviewed in Sulzer, 2010). Although a-synuclein knock-out mice do not show severe neuropathological alterations, different a-synuclein-overexpressing and mutant mice under various promoters present certain aspects of PD and Lewy body dementia; however, they do not show Lewy bodies. The models studied for adult neurogenesis are mice under a platelet-derived growth factor (PDGF) promoter (Masliah et al., 2000; Hashimoto et al., 2003) and a conditional model under a calcium / calmodulin-dependent protein kinase II alpha promoter (Nuber et al., 2008). Adult neurogenesis in transgenic mouse models of Parkinson's disease The overexpression of hWT a-synuclein in transgenic mice has a negative impact on adult neurogenesis. Reduced levels of adult neurogenesis have been reported in both the DG (Winner et al., 2004; Crews et al., 2008; Nuber et al., 2008) and SVZ / OB systems (Winner et al., 2004, 2008b). Under the platelet-derived growth factor (PDGF) promoter, coexpression of hWT a-synuclein and neural progenitor cell markers in regions of neurogenesis is found as early as Sox2 expression. There is strong expression of a-synuclein in DCX-positive neuroblasts in both regions of adult neurogenesis (Winner et al., 2004). Although proliferation is not changed in hWT a-synucleinoverexpressing mice, a decrease in neuroblasts and newly generated neurons is present. This decrease is paralleled by an increase in cell death in regions of neurogenesis, indicative of reduced survival of newly generated neurons. Decreased adult neurogenesis in the DG and in both areas of the OB, the glomerular layer and granule cell layer, was found in transgenic mice (Winner et al., 2004). The promoter used determines the stage of expression of a-synuclein in newly generated neurons. The decrease in new neurons is present in hWT a-synuclein mice not only under a platelet-derived growth factor (PDGF) promoter but also under a calcium / calmodulindependent protein kinase II alpha promoter (Nuber et al., 2008). As the calcium / calmodulin-dependent protein kinase II alpha model is regulatable, we were able to show that adult hippocampal neurogenesis can be modulated by transiently switching off a-synuclein expression of a conditional mouse model of synucleinopathies. In this model, a correlation between decreased hippocampal neurogenesis and memory retention was present (Nuber et al., 2008). A decrease in adult neurogenesis was also present in the A53T mutant transgenic model. Here, a decrease in proliferation was present in the DG and OB (Crews et al., 2008; Winner et al., 2008a). Decreased adult neurogenesis was present in the OB of a mouse model with conditional expression of A30P a-synuclein. Suppression of the transgene was able to completely restore the negative inﬂuence of a-synuclein on OB neurogenesis (Marxreiter et al., 2009). The effect of decreased adult neurogenesis in a-synuclein models was still present in aging mice. Decreased neurogenesis was present in the OB in hWT a-synuclein and A53T mice (Winner et al., 2008b). Lesion Dopamine interacts with different receptors (D1-like receptors D1 and D5, D2-like receptors D2, D3 and D4) and speciﬁc intracellular signaling pathways and has a dual role in embryonic development and adult neurogenesis. D2-like receptors are involved in promoting the proliferative effect of DA, whereas D1-like receptors decrease proliferation at the level of cell cycle entry (Diaz et al., 1997; Ohtani et al., 2003). During brain development, DA receptors (mostly D3) are abundantly expressed in proliferative neuroepithelial zones (Diaz et al., 1997), resulting in an overall proliferative effect of DA on neural progenitors. In the adult brain, DA ﬁbers extending from the substantia nigra to the striatum also contact the transit-amplifying C cells in the SVZ (Hoglinger et al., 2004). D2-like receptors are expressed predominantly on transit-amplifying C cells (Coronas et al., 1997). The DA loss in the nigro-striatal pathway results in decreased proliferation in the adult rodent SVZ. These ﬁndings have been reported in 6-hydroxydopamine (6-OHDA)-lesioned rats by several groups (Baker et al., 2004; Hoglinger et al., 2004; Winner et al., 2006). In addition, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-injected mice have a reduction in numbers of proliferating cells in the SVZ. Here a decrease in PCNA-positive cells in the SVZ was noted shortly after the MPTP injection. Interestingly, the number of PCNA-positive cells returned to baseline during the DA reinnervation (Hoglinger et al., 2004), indicating a correlation between DA depletion and reduction of proliferating cells in the SVZ. The decrease in newly generated SVZ progenitor cells with a nigro-striatal DA deﬁcit can be reversed by DA stimulation. The important result is that speciﬁc DA D3 receptor stimulation increases SVZ proliferation. Effects of a similar size can be achieved by two frequently used DA agonists (ropinirole and pramipexole), which indicates that these two DA agonists have a regenerative effect (Hoglinger et al., 2004; Winner et al., 2009). Moreover, toxin-induced models show an increase in dopaminergic neurogenesis in the OB glomerular layer, which has been described for the MPTP (Yamada et al., 2004) and 6-OHDA (Winner et al., 2006) models. This ﬁnding is of particular interest because an increase in dopaminergic olfactory neurons has been described in the OB of patients with PD (Huisman et al., 2004), which seems to parallel these experimental ﬁndings but could only partially be conﬁrmed in a recent study (Huisman et al., 2008). Indications of decreased numbers of dividing SVZ cells / EGF-receptor-expressing cells in patients with PD have also been independently reported (Hoglinger et al., 2004; O' Keeffe et al., 2009). Common characteristics Taking into account the low numbers of newly generated DG neurons in an aging brain compared with the vast number of degenerating neurons in many brain regions, including, for example, the entorhinal cortex and neocortex in AD, it is unlikely that these newly generated neurons in the DG or SVZ / OB will be able to achieve global repair. However, given the crucial role of the hippocampus in processing information and speciﬁcally pattern separation (Clelland et al., 2009; Creer et al., 2010), it may be that, given that the initial deleterious stressors involved have been removed, stimulating DG adult neurogenesis might have some therapeutic potential. , In addition, the seeming discrepancies between increased and decreased proliferation in some human and transgenic animal models might be explained by studying in detail the different NSC populations and radial glial cells and ruling out their proliferative potential under diseased conditions. Recently, glial and immune cells have been shown to have increasing importance in these diseases (Glass et al. 2010). In addition, there are indications that knock-down of toll-like receptor 4 (Rolls et al., 2007) and toll-like receptor 3 has a positive impact on adult neurogenesis and memory (Okun et al., 2010). An additional common aspect is the process of protein aggregation in these diseases. It seems that oligomerization and early aggregates have a stronger toxic effect in AD, HD and PD. The interplay between NSCs and oligomers will require future studies. In addition, dissecting the intracellular and extracellular as well as stem cell autonomous vs. non-autonomous actions on NSCs will clarify the different actions of proteins. Again, the interaction of aggregating proteins with glial cells and reactive gliosis seems to have a common but as yet barely understood effect on NSCs. Investigating the role of adult NSCs is a way to understand disease pathology at different stages of neuronal development. The classical neuropathological hallmarks of AD, PD and HD are late-stage effects and therefore do not reﬂect early disease mechanisms. There is a need for early-stage disease models, as they will be important for testing compounds and therapies at a presymptomatic or early symptomatic stage. Imaging techniques for in-vivo measurements of adult neurogenesis combined with other biomarkers used to determine early stages of the disease might open up a totally new avenue of early diagnosis. Acknowledgements The authors are funded by the California Institute of Regenerative Medicine (CIRM). F.H.G. is supported by The Lookout Fund and the Picower Foundation. B.W. is a Feodor-Lynen fellow of the Alexander von Humboldt Foundation. Z.K. was supported by grants from the Bavarian State Ministry of Sciences, Research and the Arts, ForNeuroCell. The authors would like to thank M.L. Gage for editorial comments. Abbreviations Ab, amyloid-b; AD, Alzheimer's disease; APP, amyloid precursor protein; BrdU, bromodeoxyuridine; DCX, doublecortin; DG, dentate gyrus; HD, Huntington's disease; hWT, human wild-type; NSC, neural stem cell; OB, olfactory bulb; PD, Parkinson's disease; PCNA, proliferating cell nuclear antigen; PSEN, presenilin; SVZ, subventricular zone; 3· Tg-AD, triple transgenic mice. References Abeliovich, A., Schmitz, Y., Farin˜as, I., Choi-Lundberg, D., Ho, W.H., Castillo, P.E., Shinsky, N., Verdugo, J.M., Armanini, M., Ryan, A., Hynes, M., Phillips, H., Sulzer, D. & Rosenthal, A. (2000) Mice lacking alpha-synuclein display functional deﬁcits in the nigrostriatal dopamine system. Neuron, 25, 239–252. Aimone, J.B., Deng, W. & Gage, F.H. (2010) Adult neurogenesis: integrating theories and separating functions. Trends Cogn. Sci. , 14 , 325–337. Alim, M.A., Hossain, M.S., Arima, K., Takeda, K., Izumiyama, Y., Nakamura, M., Kaji, H., Shinoda, T., Hisanaga, S. & Ueda, K. (2002) Tubulin seeds alpha-synuclein ﬁbril formation. J. Biol. Chem., 277, 2112–2117. Altman, J. (1969) Autoradiographic and histological studies of postnatal neurogenesis. IV. Cell proliferation and migration in the anterior forebrain, with special reference to persisting neurogenesis in the olfactory bulb. J. Comp. Neurol., 137, 433–457. Altman, J. & Das, G.D. (1965) Autoradiographic and histological evidence of postnatal hippocampal neurogenesis in rats. J. Comp. Neurol., 124, 319–335. Arvidsson, A., Collin, T., Kirik, D., Kokaia, Z. & Lindvall, O. (2002) Neuronal replacement from endogenous precursors in the adult brain after stroke. Nat. Med., 8, 963–970. Baker, S.A., Baker, K.A. & Hagg, T. (2004) Dopaminergic nigrostriatal projections regulate neural precursor proliferation in the adult mouse subventricular zone. Eur. J. Neurosci., 20, 575–579. Benn, C.L., Luthi-Carter, R., Kuhn, A., Sadri-Vakili, G., Blankson, K.L., Dalai, S.C., Goldstein, D.R., Spires, T.L., Pritchard, J., Olson, J.M., van Dellen, A., Hannan, A.J. & Cha, J.H. (2010) Environmental enrichment reduces neuronal intranuclear inclusion load but has no effect on messenger RNA expression in a mouse model of Huntington disease. J. Neuropathol. Exp. Neurol., 69, 817–827. Boekhoorn, K., Joels, M. & Lucassen, P.J. (2006) Increased proliferation reﬂects glial and vascular-associated changes, but not neurogenesis in the presenile Alzheimer hippocampus. Neurobiol. Dis., 24, 1–14. Bossers, K., Wirz, K.T., Meerhoff, G.F., Essing, A.H., van Dongen, J.W., Houba, P., Kruse, C.G., Verhaagen, J. & Swaab, D.F. (2010) Concerted changes in transcripts in the prefrontal cortex precede neuropathology in Alzheimer's disease. Brain, 133, 3699–3723. Braak, H., Del Tredici, K., Rub, U., de Vos, R.A., Jansen Steur, E.N. & Braak, E. (2003) Staging of brain pathology related to sporadic Parkinson's disease. Neurobiol. Aging, 24, 197–211. Buonomano, D.V. & Merzenich, M.M. (1998) Cortical plasticity: from synapses to maps. Annu. Rev. Neurosci., 21, 149–186. Carleton, A., Petreanu, L.T., Lansford, R., Alvarez-Buylla, A. & Lledo, P.M. (2003) Becoming a new neuron in the adult olfactory bulb. Nat. Neurosci., 6, 507–518. Caviston, J.P. & Holzbaur, E.L. (2009) Huntingtin as an essential integrator of intracellular vesicular trafﬁcking. Trends Cell Biol., 19, 147–155. Cho, S.R., Benraiss, A., Chmielnicki, E., Samdani, A., Economides, A. & Goldman, S.A. (2007) Induction of neostriatal neurogenesis slows disease progression in a transgenic murine model of Huntington disease. J. Clin. Invest., 117, 2889–2902. Choi, S.H., Veeraraghavalu, K., Lazarov, O., Marler, S., Ransohoff, R.M., Ramirez, J.M. & Sisodia, S.S. (2008) Non-cell-autonomous effects of presenilin 1 variants on enrichment-mediated hippocampal progenitor cell proliferation and differentiation. Neuron, 59, 568–580. Clelland, C.D., Choi, M., Romberg, C., Clemenson, G.D. Jr., Fragniere, A., Tyers, P., Jessberger, S., Saksida, L.M., Barker, R.A., Gage, F.H. & Bussey, T.J. (2009) A functional role for adult hippocampal neurogenesis in spatial pattern separation. Science, 325, 210–213. Cooper-Kuhn, C.M., Winkler, J. & Kuhn, H.G. (2004) Decreased neurogenesis after cholinergic forebrain lesion in the adult rat. J. Neurosci. Res., 77, 155– 165. Coronas, V., Srivastava, L.K., Liang, J.J., Jourdan, F. & Moyse, E. (1997) Identiﬁcation and localization of dopamine receptor subtypes in rat olfactory mucosa and bulb: a combined in situ hybridization and ligand binding radioautographic approach. J. Chem. Neuroanat., 12, 243–257. Cotel, M.C., Jawhar, S., Christensen, D.Z., Bayer, T.A. & Wirths, O. (2010) Environmental enrichment fails to rescue working memory deﬁcits, neuron loss, and neurogenesis in APP / PS1KI mice. Neurobiol. Aging, doi: 10.1016/ j.neurobiolaging.2010.02.012; PMID: 20359774 [Epub ahead of print]. Couillard-Despres, S., Finkl, R., Winner, B., Ploetz, S., Wiedermann, D., Aigner, R., Bogdahn, U., Winkler, J., Hoehn, M. & Aigner, L. (2008) In vivo optical imaging of neurogenesis: watching new neurons in the intact brain. Mol. Imaging, 7, 28–34. Creer, D.J., Romberg, C., Saksida, L.M., van Praag, H. & Bussey, T.J. (2010) Running enhances spatial pattern separation in mice. Proc. Natl. Acad. Sci. USA, 107, 2367–2372. Crews, L., Mizuno, H., Desplats, P., Rockenstein, E., Adame, A., Patrick, C., Winner, B., Winkler, J. & Masliah, E. (2008) Alpha-synuclein alters Notch-1 expression and neurogenesis in mouse embryonic stem cells and in the hippocampus of transgenic mice. J. Neurosci., 28, 4250–4260. Crews, L., Adame, A., Patrick, C., Delaney, A., Pham, E., Rockenstein, E., Hansen, L. & Masliah, E. (2010a) Increased BMP6 levels in the brains of Alzheimer's disease patients and APP transgenic mice are accompanied by impaired neurogenesis. J. Neurosci., 30, 12252–12262. Crews, L., Rockenstein, E. & Masliah, E. (2010b) APP transgenic modeling of Alzheimer's disease: mechanisms of neurodegeneration and aberrant neurogenesis. Brain Struct. Funct., 214, 111–126. Cuello, A.C. (2005) Intracellular and extracellular Abeta, a tale of two neuropathologies. Brain Pathol., 15, 66–71. Curtis, M.A., Penney, E.B., Pearson, A.G., van Roon-Mom, W.M., Butterworth, N.J., Dragunow, M., Connor, B. & Faull, R.L. (2003) Increased cell proliferation and neurogenesis in the adult human Huntington's disease brain. Proc. Natl. Acad. Sci. USA, 100, 9023–9027. Curtis, M.A., Penney, E.B., Pearson, J., Dragunow, M., Connor, B. & Faull, R.L. (2005) The distribution of progenitor cells in the subependymal layer of the lateral ventricle in the normal and Huntington's disease human brain. Neuroscience, 132, 777–788. De Strooper, B. (2003) Aph-1, Pen-2, and Nicastrin with Presenilin generate an active gamma-Secretase complex. Neuron, 38, 9–12. van Dellen, A., Blakemore, C., Deacon, R., York, D. & Hannan, A.J. (2000) Delaying the onset of Huntington's in mice. Nature, 404, 721–722. Diaz, J., Ridray, S., Mignon, V., Griffon, N., Schwartz, J.C. & Sokoloff, P. (1997) Selective expression of dopamine D3 receptor mRNA in proliferative zones during embryonic development of the rat brain. J. Neurosci., 17, 4282–4292. Donovan, M.H., Yazdani, U., Norris, R.D., Games, D., German, D.C. & Eisch, A.J. (2006) Decreased adult hippocampal neurogenesis in the PDAPP mouse model of Alzheimer's disease. J. Comp. Neurol., 495, 70–83. Ermini, F.V., Grathwohl, S., Radde, R., Yamaguchi, M., Staufenbiel, M., Palmer, T.D. & Jucker, M. (2008) Neurogenesis and alterations of neural stem cells in mouse models of cerebral amyloidosis. Am. J. Pathol., 172, 1520–1528. Gaiano, N. & Fishell, G. (2002) The role of notch in promoting glial and neural stem cell fates. Annu. Rev. Neurosci., 25, 471–490. George, J.M., Jin, H., Woods, W.S. & Clayton, D.F. (1995) Characterization of a novel protein regulated during the critical period for song learning in the zebra ﬁnch. Neuron, 15, 361–372. Gil, J.M., Leist, M., Popovic, N., Brundin, P. & Petersen, A. (2004) Asialoerythropoietin is not effective in the R6 / 2 line of Huntington's disease mice. BMC Neurosci., 5, 17. Gil, J.M., Mohapel, P., Araujo, I.M., Popovic, N., Li, J.Y., Brundin, P. & Peterse´n, A. (2005) Reduced hippocampal neurogenesis in R6 / 2 transgenic Huntington's disease mice. Neurobiol. Dis., 20, 744–751. Glass, C.K., Saijo, K., Winner, B., Marchetto, M.C. & Gage, F.H. (2010) Mechanisms underlying inﬂammation in neurodegeneration. Cell, 140, 918– 934. Goedert, M. (2001) Alpha-synuclein and neurodegenerative diseases. Nat. Rev. Neurosci., 7, 492–501. Gray, M., Shirasaki, D.I., Cepeda, C., Andre, V.M., Wilburn, B., Lu, X.H., Tao, J., Yamazaki, I., Li, S.H., Sun, Y.E., Li, X.J., Levine, M.S. & Yang, X.W. (2008) Full-length human mutant huntingtin with a stable polyglutamine repeat can elicit progressive and selective neuropathogenesis in BACHD mice. J. Neurosci., 28, 6182–6195. Greten-Harrison, B., Polydoro, M., Morimoto-Tomita, M., Diao, L., Williams, A.M., Nie, E.H., Makani, S., Tian, N., Castillo, P.E., Buchman, V.L. & Chandra, S.S. (2010) alphabetagamma-Synuclein triple knockout mice reveal age-dependent neuronal dysfunction. Proc. Natl. Acad. Sci. USA, 107, 19573–19578. Hardy, J. & Selkoe, D.J. (2002) The amyloid hypothesis of Alzheimer's disease: progress and problems on the road to therapeutics. Science, 297, 353–356. Hashimoto, M., Rockenstein, E. & Masliah, E. (2003) Transgenic models of alpha-synuclein pathology: past, present, and future. Ann. N. Y. Acad. Sci., 991, 171–188. Haughey, N.J., Liu, D., Nath, A., Borchard, A.C. & Mattson, M.P. (2002a) Disruption of neurogenesis in the subventricular zone of adult mice, and in human cortical neuronal precursor cells in culture, by amyloid beta-peptide: implications for the pathogenesis of Alzheimer's disease. Neuromolecular Med., 1, 125–135. Haughey, N.J., Nath, A., Chan, S.L., Borchard, A.C., Rao, M.S. & Mattson, M.P. (2002b) Disruption of neurogenesis by amyloid beta-peptide, and perturbed neural progenitor cell homeostasis, in models of Alzheimer's disease. J. Neurochem., 83, 1509–1524. Hodgson, J.G., Agopyan, N., Gutekunst, C.A., Leavitt, B.R., LePiane, F., Singaraja, R., Smith, D.J., Bissada, N., McCutcheon, K., Nasir, J., Jamot, L., Li, X.J., Stevens, M.E., Rosemond, E., Roder, J.C., Phillips, A.G., Rubin, E.M., Hersch, S.M. & Hayden, M.R. (1999) A YAC mouse model for Huntington's disease with full-length mutant huntingtin, cytoplasmic toxicity, and selective striatal neurodegeneration. Neuron, 23, 181–192. Hoglinger, G.U., Rizk, P., Muriel, M.P., Duyckaerts, C., Oertel, W.H., Caille, I. & Hirsch, E.C. (2004) Dopamine depletion impairs precursor cell proliferation in Parkinson disease. Nat. Neurosci., 7, 726–735. von Horsten, S., Schmitt, I., Nguyen, H.P., Holzmann, C., Schmidt, T., Walther, T., Bader, M., Pabst, R., Kobber, P., Krotova, J., Stiller, D., Kask, A., Vaarmann, A., Rathke-Hartlieb, S., Schulz, J.B., Grasshoff, U., Bauer, I., Vieira-Saecker, A.M., Paul, M., Jones, L., Lindenberg, K.S., Landwehrmeyer, B., Bauer, A., Li, X.J. & Riess, O. (2003) Transgenic rat model of Huntington's disease. Hum. Mol. Genet., 12, 617–624. Huisman, E., Uylings, H.B. & Hoogland, P.V. (2004) A 100% increase of dopaminergic cells in the olfactory bulb may explain hyposmia in Parkinson's disease. Mov. Disord., 19, 687–692. Huisman, E., Uylings, H.B. & Hoogland, P.V. (2008) Gender-related changes in increase of dopaminergic neurons in the olfactory bulb of Parkinson's disease patients. Mov. Disord., 23, 1407–1413. Jin, K., Galvan, V., Xie, L., Mao, X.O., Gorostiza, O.F., Bredesen, D.E. & Greenberg, D.A. (2004a) Enhanced neurogenesis in Alzheimer's disease transgenic (PDGF-APPSw,Ind) mice. Proc. Natl. Acad. Sci. USA, 101, 13363–13367. Jin, K., Peel, A.L., Mao, X.O., Xie, L., Cottrell, B.A., Henshall, D.C. & Greenberg, D.A. (2004b) Increased hippocampal neurogenesis in Alzheimer's disease. Proc. Natl. Acad. Sci. USA, 101, 343–347. Kandasamy, M., Couillard-Despres, S., Raber, K.A., Stephan, M., Lehner, B., Winner, B., Kohl, Z., Rivera, F.J., Nguyen, H.P., Riess, O., Boddahn, U., Winkler, J., von Horsten, S. & Aigner, L. (2010) Stem cell quiescence in the hippocampalneurogenicnicheisassociatedwithelevatedtransforminggrowth factor-betasignalinginananimalmodelofHuntingtondisease. J.Neuropathol. Exp. Neurol., 69, 717–728. Kempermann, G., Chesler, E.J., Lu, L., Williams, R.W. & Gage, F.H. (2006) Natural variation and genetic covariance in adult hippocampal neurogenesis. Proc. Natl. Acad. Sci. USA, 103, 780–785. Knoth, R., Singec, I., Ditter, M., Pantazis, G., Capetian, P., Meyer, R.P., Horvat, V., Volk, B. & Kempermann, G. (2010) Murine features of neurogenesis in the human hippocampus across the lifespan from 0 to 100 years. PLoS ONE, 5, e8809. Kohl, Z., Kandasamy, M., Winner, B., Aigner, R., Gross, C., CouillardDespres, S., Bogdahn, U., Aigner, L. & Winkler, J. (2007) Physical activity fails to rescue hippocampal neurogenesis deﬁcits in the R6 / 2 mouse model of Huntington's disease. Brain Res., 1155, 24–33. Kohl, Z., Regensburger, M., Aigner, R., Kandasamy, M., Winner, B., Aigner, L. & Winkler, J. (2010) Impaired adult olfactory bulb neurogenesis in the R6 / 2 mouse model of Huntington's disease. BMC Neurosci., 11, 114. Kojro, E. & Fahrenholz, F. (2005) The non-amyloidogenic pathway: structure and function of alpha-secretases. Subcell. Biochem., 38, 105–127. Kopan, R. & Ilagan, M.X. (2009) The canonical Notch signaling pathway: unfolding the activation mechanism. Cell, 137, 216–233. Kruger, R., Kuhn, W., Muller, T., Woitalla, D., Graeber, M., Kosel, S., Przuntek, H., Epplen, J.T., Schols, L. & Riess, O. (1998) Ala30Pro mutation in the gene encoding alpha-synuclein in Parkinson's disease. Nat. Genet., 18, 106–108. Laske, C., Stellos, K., Stransky, E., Seizer, P., Akcay, O., Eschweiler, G.W., Leyhe, T. & Gawaz, M. (2008) Decreased plasma and cerebrospinal ﬂuid levels of stem cell factor in patients with early Alzheimer's disease. J. Alzheimers Dis., 15, 451–460. Lazarov, O. & Marr, R.A. (2010) Neurogenesis and Alzheimer's disease: at the crossroads. Exp. Neurol., 223, 267–281. Lazarov, O., Robinson, J., Tang, Y.P., Hairston, I.S., Korade-Mirnics, Z., Lee, V.M., Hersh, L.B., Sapolsky, R.M., Mirnics, K. & Sisodia, S.S. (2005) Environmental enrichment reduces Abeta levels and amyloid deposition in transgenic mice. Cell, 120, 701–713. Lazic, S.E., Grote, H., Armstrong, R.J., Blakemore, C., Hannan, A.J., van Dellen, A. & Barker, R.A. (2004) Decreased hippocampal cell proliferation in R6 / 1 Huntington's mice. Neuroreport, 15, 811–813. Lazic, S.E., Grote, H.E., Blakemore, C., Hannan, A.J., van Dellen, A., Phillips, W. & Barker, R.A. (2006) Neurogenesis in the R6 / 1 transgenic mouse model of Huntington's disease: effects of environmental enrichment. Eur. J. Neurosci., 23, 1829–1838. Lee, M.K., Slunt, H.H., Martin, L.J., Thinakaran, G., Kim, G., Gandy, S.E., Seeger, M., Koo, E., Price, D.L. & Sisodia, S.S. (1996) Expression of presenilin 1 and 2 (PS1 and PS2) in human and murine tissues. J. Neurosci., 16, 7513–7525. Li, S.H. & Li, X.J. (2004) Huntingtin and its role in neuronal degeneration. Neuroscientist, 10, 467–475. Lindvall, O. & Kokaia, Z. (2010) Stem cells in human neurodegenerative disorders - time for clinical translation? J. Clin. Invest., 120, 29–40. Lopez-Toledano, M.A. & Shelanski, M.L. (2004) Neurogenic effect of betaamyloid peptide in the development of neural stem cells. J. Neurosci., 24, 5439–5444. Luo, L. & O'Leary, D.D. (2005) Axon retraction and degeneration in development and disease. Annu. Rev. Neurosci., 28, 127–156. Ma, D.K., Marchetto, M.C., Guo, J.U., Ming, G.L., Gage, F.H. & Song, H. (2010) Epigenetic choreographers of neurogenesis in the adult mammalian brain. Nat. Neurosci., 13, 1338–1344. Manganas, L.N., Zhang, X., Li, Y., Hazel, R.D., Smith, S.D., Wagshul, M.E., Henn, F., Benveniste, H., Djuric, P.M., Enikolopov, G. & Maletic-Savatic, M. (2007) Magnetic resonance spectroscopy identiﬁes neural progenitor cells in the live human brain. Science, 318, 980–985. Mangiarini, L., Sathasivam, K., Seller, M., Cozens, B., Harper, A., Hetherington, C., Lawton, M., Trottier, Y., Lehrach, H., Davies, S.W. & Bates, G.P. (1996) Exon 1 of the HD gene with an expanded CAG repeat is sufﬁcient to cause a progressive neurological phenotype in transgenic mice. Cell, 87, 493–506. Marlatt, M.W. & Lucassen, P.J. (2010) Neurogenesis and Alzheimer's disease: biology and pathophysiology in mice and men. Curr. Alzheimer Res., 7, 113– 125. Marxreiter, F., Nuber, S., Kandasamy, M., Klucken, J., Aigner, R., Burgmayer, R., Couillard-Despres, S., Riess, O., Winkler, J. & Winner, B. (2009) Changes in adult olfactory bulb neurogenesis in mice expressing the A30P mutant form of alpha-synuclein. Eur. J. Neurosci., 29, 879–890. Masliah, E., Rockenstein, E., Veinbergs, I., Mallory, M., Hashimoto, M., Takeda, A., Sagara, Y., Sisk, A. & Mucke, L. (2000) Dopaminergic loss and inclusion body formation in alpha-synuclein mice: implications for neurodegenerative disorders. Science, 287, 1265–1269. Miller, J.P., Holcomb, J., Al-Ramahi, I., de Haro, M., Gafni, J., Zhang, N., Kim, E., Sanhueza, M., Torcassi, C., Kwak, S., Botas, J., Hughes, R.E. & Ellerby, L.M. (2010) Matrix metalloproteinases are modiﬁers of huntingtin proteolysis and toxicity in Huntington's disease. Neuron, 67, 199–212. Mirochnic, S., Wolf, S., Staufenbiel, M. & Kempermann, G. (2009) Age effects on the regulation of adult hippocampal neurogenesis by physical activity and environmental enrichment in the APP23 mouse model of Alzheimer disease. Hippocampus, 19, 1008–1018. Mochel, F., Charles, P., Seguin, F., Barritault, J., Coussieu, C., Perin, L., Le Bouc, Y., Gervais, C., Carcelain, G., Vassault, A., Feingold, J., Rabier, D. & Durr, A. (2007) Early energy deﬁcit in Huntington disease: identiﬁcation of a plasma biomarker traceable during disease progression. PLoS ONE, 2, e647. Monje, M.L., Vogel, H., Masek, M., Ligon, K.L., Fisher, P.G. & Palmer, T.D. (2007) Impaired human hippocampal neurogenesis after treatment for central nervous system malignancies. Ann. Neurol., 62, 515–520. Mu, Y., Lee, S.W. & Gage, F.H. (2010) Signaling in adult neurogenesis. Curr. Opin. Neurobiol., 20, 416–423. Mucke, L., Masliah, E., Yu, G.Q., Mallory, M., Rockenstein, E.M., Tatsuno, G., Hu, K., Kholodenko, D., Johnson-Wood, K. & McConlogue, L. (2000) High-level neuronal expression of abeta 1-42 in wild-type human amyloid protein precursor transgenic mice: synaptotoxicity without plaque formation. J. Neurosci., 20, 4050–4058. Nemani, V.M., Lu, W., Berge, V., Nakamura, K., Onoa, B., Lee, M.K., Chaudhry, F.A., Nicoll, R.A. & Edwards, R.H. (2010) Increased expression of alpha-synuclein reduces neurotransmitter release by inhibiting synaptic vesicle reclustering after endocytosis. Neuron, 65, 66–79. Nuber, S., Petrasch-Parwez, E., Winner, B., Winkler, J., von Horsten, S., Schmidt, T., Boy, J., Kuhn, M., Nguyen, H.P., Teismann, P., Schulz, J.B., Neumann, M., Pichler, B.J., Reischl, G., Holzmann, C., Schmitt, I., Bornemann, A., Kuhn, W., Zimmermann, F., Servadio, A. & Riess, O. (2008) Neurodegeneration and motor dysfunction in a conditional model of Parkinson's disease. J. Neurosci., 28, 2471–2484. O' Keeffe, G.C., Tyers, P., Aarsland, D., Dalley, J.W., Barker, R.A. & Caldwell, M.A. (2009) Dopamine-induced proliferation of adult neural precursor cells in the mammalian subventricular zone is mediated through EGF. Proc. Natl. Acad. Sci. USA, 106, 8754–8759. Ohtani, N., Goto, T., Waeber, C. & Bhide, P.G. (2003) Dopamine modulates cell cycle in the lateral ganglionic eminence. J. Neurosci., 23, 2840–2850. Okun, E., Grifﬁoen, K., Barak, B., Roberts, N.J., Castro, K., Pita, M.A., Cheng, A., Mughal, M.R., Wan, R., Ashery, U. & Mattson, M.P. (2010) Toll-like receptor 3 inhibits memory retention and constrains adult hippocampal neurogenesis. Proc. Natl. Acad. Sci. USA, 107, 15625–15630. Pang, T.Y., Stam, N.C., Nithianantharajah, J., Howard, M.L. & Hannan, A.J. (2006) Differential effects of voluntary physical exercise on behavioral and brain-derived neurotrophic factor expression deﬁcits in Huntington's disease transgenic mice. Neuroscience, 141, 569–584. Parent, J.M. (2007) Adult neurogenesis in the intact and epileptic dentate gyrus. Prog. Brain Res., 163, 529–540. Pezzini, A., Del Zotto, E., Volonghi, I., Giossi, A., Costa, P. & Padovani, A. (2009) Cerebral amyloid angiopathy: a common cause of cerebral hemorrhage. Curr. Med. Chem., 16, 2498–2513. Phillips, W., Morton, A.J. & Barker, R.A. (2005) Abnormalities of neurogenesis in the R6 / 2 mouse model of Huntington's disease are attributable to the in vivo microenvironment. J. Neurosci., 25, 11564–11576. Polymeropoulos, M.H., Higgins, J.J., Golbe, L.I., Johnson, W.G., Ide, S.E., Di Iorio, G., Sanges, G., Stenroos, E.S., Pho, L.T., Schaffer, A.A., Lazzarini, A.M., Nussbaum, R.L. & Duvoisim, R.C. (1996) Mapping of a gene for Parkinson's disease to chromosome 4q21–q23. Science, 274, 1197–1199. van Praag, H., Schinder, A.F., Christie, B.R., Toni, N., Palmer, T.D. & Gage, F.H. (2002) Functional neurogenesis in the adult hippocampus. Nature, 415, 1030–1034. Ramm, P., Couillard-Despres, S., Plotz, S., Rivera, F.J., Krampert, M., Lehner, B., Kremer, W., Bogdahn, U., Kalbitzer, H.R. & Aigner, L. (2009) A nuclear magnetic resonance biomarker for neural progenitor cells: is it all neurogenesis? Stem Cells, 27, 420–423. Reetz, K., Lencer, R., Hagenah, J.M., Gaser, C., Tadic, V., Walter, U., Wolters, A., Steinlechner, S., Zuhlke, C., Brockmann, K., Klein, C., Rolfs, A. & Binkofski, F. (2010) Structural changes associated with progression of motor deﬁcits in spinocerebellar ataxia 17. Cerebellum, 9, 210–217. Rice, A.C., Khaldi, A., Harvey, H.B., Salman, N.J., White, F., Fillmore, H. & Bullock, M.R. (2003) Proliferation and neuronal differentiation of mitotically active cells following traumatic brain injury. Exp. Neurol., 183, 406– 417. Rodriguez, J.J., Jones, V.C., Tabuchi, M., Allan, S.M., Knight, E.M., LaFerla, F.M., Oddo, S. & Verkhratsky, A. (2008) Impaired adult neurogenesis in the dentate gyrus of a triple transgenic mouse model of Alzheimer's disease. PLoS ONE, 3, e2935. Rolls, A., Shechter, R., London, A., Ziv, Y., Ronen, A., Levy, R. & Schwartz, M. (2007) Toll-like receptors modulate adult hippocampal neurogenesis. Nat. Cell Biol., 9, 1081–1088. Sathasivam, K., Lane, A., Legleiter, J., Warley, A., Woodman, B., Finkbeiner, S., Paganetti, P., Muchowski, P.J., Wilson, S. & Bates, G.P. (2010) Identical oligomeric and ﬁbrillar structures captured from the brains of R6 / 2 and knock-in mouse models of Huntington's disease. Hum. Mol. Genet., 19, 65– 78. Selkoe, D.J. (1998) The cell biology of beta-amyloid precursor protein and presenilin in Alzheimer's disease. Trends Cell Biol., 8, 447–453. Simuni, T. & Sethi, K. (2008) Nonmotor manifestations of Parkinson's disease. Ann. Neurol., 64(Suppl 2), S65–S80. Singleton, A.B., Farrer, M., Johnson, J., Singleton, A., Hague, S., Kachergus, J., Hulihan, M., Peuralinna, T., Dutra, A., Nussbaum, R., Lincoln, S., Crawley, A., Hanson, M., Maraganore, D., Adler, C., Cookson, M.R., Muenter, M., Baptista, M., Miller, D., Blancato, J., Hardy, J. & GwinnHardy, K. (2003) alpha-Synuclein locus triplication causes Parkinson's disease. Science, 302, 841. Small, S.A. (2003) Measuring correlates of brain metabolism with highresolution MRI: a promising approach for diagnosing Alzheimer disease and mapping its course. Alzheimer Dis. Assoc. Disord., 17, 154–161. Spires, T.L., Grote, H.E., Varshney, N.K., Cordery, P.M., van Dellen, A., Blakemore, C. & Hannan, A.J. (2004) Environmental enrichment rescues protein deﬁcits in a mouse model of Huntington's disease, indicating a possible disease mechanism. J. Neurosci., 24, 2270–2276. Sulzer, D. (2010) Clues to how alpha-synuclein damages neurons in Parkinson's disease. Mov. Disord., 25(Suppl 1), S27–S31. Sun, B., Halabisky, B., Zhou, Y., Palop, J.J., Yu, G., Mucke, L. & Gan, L. (2009) Imbalance between GABAergic and glutamatergic transmission impairs adult neurogenesis in an animal model of Alzheimer's disease. Cell Stem Cell, 5, 624–633. Tattersﬁeld, A.E. (2010) Is postmenopausal HRT a risk factor for adult-onset asthma? Thorax, 65, 282–284. Tattersﬁeld, A.S., Croon, R.J., Liu, Y.W., Kells, A.P., Faull, R.L. & Connor, B. (2004) Neurogenesis in the striatum of the quinolinic acid lesion model of Huntington's disease. Neuroscience, 127, 319–332. van Tijn, P., Kamphuis, W., Marlatt, M.W., Hol, E.M. & Lucassen, P.J. (2010) Presenilin mouse and zebraﬁsh models for dementia: focus on neurogenesis. Prog. Neurobiol., doi: 10.1016/j.pneurobio.2010.10.008; PMID: 21056616 [Epub ahead of print]. The Huntington's Disease Collaborative Research Group. (1993) A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's Disease chromosomes. Cell, 72, 971–983. Tolosa, E. & Poewe, W. (2009) Premotor Parkinson disease. Neurology, 72, S1. Trojanowski, J.Q. & Lee, V.M. (2000) ''Fatal attractions'' of proteins. A comprehensive hypothetical mechanism underlying Alzheimer's disease and other neurodegenerative disorders. Ann. N Y Acad. Sci., 924, 62–67. Varvel, N.H., Bhaskar, K., Kounnas, M.Z., Wagner, S.L., Yang, Y., Lamb, B.T. & Herrup, K. (2009) NSAIDs prevent, but do not reverse, neuronal cell cycle reentry in a mouse model of Alzheimer disease. J. Clin. Invest., 119, 3692– 3702. Walker, F.O. (2007) Huntington's disease. Semin. Neurol., 27, 143–150. Walsh, D.M. & Selkoe, D.J. (2007) A beta oligomers – a decade of discovery. J. Neurochem., 101, 1172–1184. Walsh, D.M., Klyubin, I., Fadeeva, J.V., Cullen, W.K., Anwyl, R., Wolfe, M.S., Rowan, M.J. & Selkoe, D.J. (2002) Naturally secreted oligomers of amyloid beta protein potently inhibit hippocampal long-term potentiation in vivo. Nature, 416, 535–539. Wang, R., Dineley, K.T., Sweatt, J.D. & Zheng, H. (2004) Presenilin 1 familial Alzheimer's disease mutation leads to defective associative learning and impaired adult neurogenesis. Neuroscience, 126, 305–312. Weingarten, M.D., Lockwood, A.H., Hwo, S.Y. & Kirschner, M.W. (1975) A protein factor essential for microtubule assembly. Proc. Natl. Acad. Sci. USA, 72, 1858–1862. Wen, P.H., Hof, P.R., Chen, X., Gluck, K., Austin, G., Younkin, S.G., Younkin, L.H., DeGasperi, R., Gama Sosa, M.A., Robakis, N.K., Haroutunian, V. & Elder, G.A. (2004) The presenilin-1 familial Alzheimer disease mutant P117L impairs neurogenesis in the hippocampus of adult mice. Exp. Neurol., 188, 224–237. Winner, B., Lie, D.C., Rockenstein, E., Aigner, R., Aigner, L., Masliah, E., Kuhn, H.G. & Winkler, J. (2004) Human wild-type alpha-synuclein impairs neurogenesis. J. Neuropathol. Exp. Neurol., 63, 1155–1166. Winner, B., Geyer, M., Couillard-Despres, S., Aigner, R., Bogdahn, U., Aigner, L., Kuhn, G. & Winkler, J. (2006) Striatal deafferentation increases dopaminergic neurogenesis in the adult olfactory bulb. Exp. Neurol., 197, 113–121. Winner, B., Couillard-Despres, S., Geyer, M., Aigner, R., Bogdahn, U., Aigner, L., Kuhn, H.G. & Winkler, J. (2008a) Dopaminergic lesion enhances growth factor-induced striatal neuroblast migration. J. Neuropathol. Exp. Neurol., 67, 105–116. Winner, B., Rockenstein, E., Lie, D.C., Aigner, R., Mante, M., Bogdahn, U., Couillard-Despres, S., Masliah, E. & Winkler, J. (2008b) Mutant alphasynuclein exacerbates age-related decrease of neurogenesis. Neurobiol. Aging, 29, 913–925. Winner, B., Desplats, P., Hagl, C., Klucken, J., Aigner, R., Ploetz, S., Laemke, J., Karl, A., Aigner, L., Masliah, E., Buerger, E. & Winkler, J. (2009) Dopamine receptor activation promotes adult neurogenesis in an acute Parkinson model. Exp. Neurol., 219, 543–552. (1993) A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. The Huntington's Disease Collaborative Research Group. Cell, 72, 971–983. Yamada, M., Onodera, M., Mizuno, Y. & Mochizuki, H. (2004) Neurogenesis in olfactory bulb identiﬁed by retroviral labeling in normal and 1-methyl-4phenyl-1,2,3,6-tetrahydropyridine-treated adult mice. Neuroscience, 124, 173–181. Yang, Y., Geldmacher, D.S. & Herrup, K. (2001) DNA replication precedes neuronal cell death in Alzheimer's disease. J. Neurosci., 21, 2661– 2668. Zarranz, J.J., Alegre, J., Gomez- Esteban, J.C., Lezcano, E., Ros, R., Ampuero, I., Vidal, L., Hoenicka, J., Rodriguez, O., Atares, B., Llorens, V., Gomez Tortosa, E., del Ser, T., Munoz, D.G. & de Yebenes, J.G. (2004) The new mutation, E46K, of alpha-synuclein causes Parkinson and Lewy body dementia. Ann. Neurol., 55, 164–173. Zhang, C., McNeil, E., Dressler, L. & Siman, R. (2007) Long-lasting impairment in hippocampal neurogenesis associated with amyloid deposition in a knock-in mouse model of familial Alzheimer's disease. Exp. Neurol., 204, 77–87. Zhao, C., Deng, W. & Gage, F.H. (2008) Mechanisms and functional implications of adult neurogenesis. Cell, 132, 645–660.	<urn:uuid:f3aeff37-068d-4ffe-85e7-be6701660d94>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	74,446
AZ ÁLTALÁNOS ISKOLA FELVÉTELI KÖRZETE A 2019/2020. TANÉVBEN GOMBA Köznevelési intézmény: Felvételi körzet: Fáy András Református Általános Iskola és Alapfokú Művészeti Iskola 2217 Gomba, Iskola utca 2. Gomba község közigazgatási területe	<urn:uuid:1c003761-c454-404f-a330-da7ff2a08448>	HuggingFaceFW/finepdfs/tree/main/data/hun_Latn/train	finepdfs	hun_Latn	243
AXCES FLANGES & GASKETS GRAPHITE GASKET TYPE FULL FACE ANSI 150 C \| Article No. \| Size (Inch) \| NB (mm) \| Pipe (mm) \| A (mm) \| B (mm) \| C (mm) \| D Number of holes \| E Diameter of holes (mm) \| F (mm) \| Weight (kg) \| \|---\|---\|---\|---\|---\|---\|---\|---\|---\|---\|---\| \| 213130020010 \| 1 \| 25 \| 33.4 \| 35 \| 79 \| 110 \| 4 \| 16 \| 2 \| 0.1 \| \| 213130020013 \| 1.25 \| 32 \| 42.2 \| 43 \| 89 \| 120 \| 4 \| 16 \| 2 \| 0.1 \| \| 213130020015 \| 1.5 \| 40 \| 48.3 \| 49 \| 99 \| 130 \| 4 \| 16 \| 2 \| 0.1 \| \| 213130020020 \| 2 \| 50 \| 60.3 \| 61 \| 121 \| 150 \| 4 \| 19 \| 2 \| 0.1 \| \| 213130020025 \| 2.5 \| 65 \| 76.1 \| 73 \| 140 \| 180 \| 4 \| 19 \| 2 \| 0.2 \| \| 213130020030 \| 3 \| 80 \| 88.9 \| 90 \| 153 \| 190 \| 4 \| 19 \| 2 \| 0.2 \| \| 213130020040 \| 4 \| 100 \| 114.3 \| 116 \| 191 \| 230 \| 8 \| 19 \| 2 \| 0.2 \| \| 213130020050 \| 5 \| 125 \| 139.7 \| 142 \| 216 \| 255 \| 8 \| 22 \| 2 \| 0.2 \| \| 213130020060 \| 6 \| 150 \| 168.3 \| 171 \| 242 \| 280 \| 8 \| 22 \| 2 \| 0.3 \| \| 213130020080 \| 8 \| 200 \| 219.1 \| 222 \| 299 \| 345 \| 8 \| 22 \| 2 \| 0.3 \| \| 213130020100 \| 10 \| 250 \| 273 \| 276 \| 362 \| 405 \| 12 \| 26 \| 2 \| 0.3 \| \| 213130020120 \| 12 \| 300 \| 323.9 \| 327 \| 432 \| 485 \| 12 \| 26 \| 2 \| 0.3 \| \| 213130020140 \| 14 \| 350 \| 355.6 \| 360 \| 476 \| 535 \| 12 \| 30 \| 2 \| 0.4 \| \| 213130020160 \| 16 \| 400 \| 406.4 \| 411 \| 540 \| 600 \| 16 \| 30 \| 2 \| 0.4 \| \| 213130020180 \| 18 \| 450 \| 457.2 \| 461 \| 578 \| 635 \| 16 \| 33 \| 2 \| 0.4 \| \| 213130020200 \| 20 \| 500 \| 508 \| 512 \| 635 \| 700 \| 20 \| 33 \| 2 \| 0.5 \| \| 213130020240 \| 24 \| 600 \| 609.6 \| 614 \| 750 \| 815 \| 20 \| 36 \| 2 \| 0.8 \| CHARACTERISTICS GasketsHole pattern according type ANSI 150 Standard MaterialGaskets are produced out of graphite RangeDiameter range from 33.4 mm up to 609.6 mm Thickness2 mm, with an option for 3 and 4 mm TemperatureThe maximum allowable temperature is 600°C 117	<urn:uuid:8a7b88c4-59b3-4e95-af5a-5b9193c05087>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	1,756
Author/s: Liu, YR;Delgado-Baquerizo, M;Bi, L;Zhu, J;He, JZ Title: Consistent responses of soil microbial taxonomic and functional attributes to mercury pollution across China Date: 2018-10-18 Citation: Liu, Y. R., Delgado-Baquerizo, M., Bi, L., Zhu, J. & He, J. Z. (2018). Consistent responses of soil microbial taxonomic and functional attributes to mercury pollution across China. Microbiome, 6 (1), https://doi.org/10.1186/s40168-018-0572-7. Persistent Link: https://hdl.handle.net/11343/253225 License: CC BY Consistent responses of soil microbial taxonomic and functional attributes to mercury pollution across China Yu-Rong Liu\textsuperscript{1,2,3}, Manuel Delgado-Baquerizo\textsuperscript{4,5}, Li Bi\textsuperscript{2}, Jun Zhu\textsuperscript{3} and Ji-Zheng He\textsuperscript{2,6} Abstract* Background: The ecological consequences of mercury (Hg) pollution—one of the major pollutants worldwide—on microbial taxonomic and functional attributes remain poorly understood and largely unexplored. Using soils from two typical Hg-impacted regions across China, here, we evaluated the role of Hg pollution in regulating bacterial abundance, diversity, and co-occurrence network. We also investigated the associations between Hg contents and the relative abundance of microbial functional genes by analyzing the soil metagenomes from a subset of those sites. Results: We found that soil Hg largely influenced the taxonomic and functional attributes of microbial communities in the two studied regions. In general, Hg pollution was negatively related to bacterial abundance, but positively related to the diversity of bacteria in two separate regions. We also found some consistent associations between soil Hg contents and the community composition of bacteria. For example, soil total Hg content was positively related to the relative abundance of \textit{Firmicutes} and \textit{Bacteroidetes} in both paddy and upland soils. In contrast, the methylmercury (MeHg) concentration was negatively correlated to the relative abundance of \textit{Nitrosipirae} in the two types of soils. Increases in soil Hg pollution correlated with drastic changes in the relative abundance of ecological clusters within the co-occurrence network of bacterial communities for the two regions. Using metagenomic data, we were also able to detect the effect of Hg pollution on multiple functional genes relevant to key soil processes such as element cycles and Hg transformations (e.g., methylation and reduction). Conclusions: Together, our study provides solid evidence that Hg pollution has predictable and significant effects on multiple taxonomic and functional attributes including bacterial abundance, diversity, and the relative abundance of ecological clusters and functional genes. Our results suggest an increase in soil Hg pollution linked to human activities will lead to predictable shifts in the taxonomic and functional attributes in the Hg-impacted areas, with potential implications for sustainable management of agricultural ecosystems and elsewhere. Keywords: Soil microbial community, Co-occurrence network, Functional gene, Metagenomics, Mercury pollution Background Environmental pollution resulting from human activities has a great impact on the biodiversity and functioning of terrestrial and aquatic ecosystems and is a major threat for human health across the globe [1–4]. Importantly, recent studies suggested that changing climate exacerbates global mercury (Hg) pollution by releasing historically stocked Hg in the permafrost [5, 6]. Such a threat is of global concern as Hg can be transported globally [7]. The elevated Hg inputs into environments could have significant effects on soil biodiversity and their associated ecosystem functions [8, 9]. Studies conducted at the local scale seemed to support the idea that Hg pollution can alter soil microbial communities [10–12]. Moreover, previous work based on short-term incubation experiments demonstrated that Hg amendments can alter the soil microbiome and its ecological functions [13, 14]. However, much less is known on the role of Hg pollution in shaping the taxonomic and functional... attributes of microbial communities in natural ecosystems across large spatial scale and different types of croplands. Recent studies suggested that microbial taxa strongly co-occur within ecological network that often are called ecological clusters or modules [15, 16]. Such ecological clusters are expected to have multiple implications for the maintenance of soil fertility, decomposition, and ecological services in terrestrial environments [17–19]. The reason is that different microbial ecological clusters often follow very specific environmental preferences. For example, taxa within some ecological clusters have been found to strongly correlate with low or high pH, mesic or arid ecosystem, and nutrient availability and processes rates [15]. However, despite the importance of these ecological clusters for the understanding of the soil microbiome, their response to long-term field Hg pollution remains largely unexplored [20]. Increasing Hg concentrations could potentially impact the relative abundance of major ecological clusters with implications for ecosystem functioning. However, empirical evidence for such assumptions is currently lacking. Moreover, the response of the functional attributes of the soil microbiome to Hg pollution has been rarely addressed. Such a task is challenging as soil microbial communities are highly diverse, and most soil microbial taxa remains uncharacterized [16, 21]. Recent advances in metagenomic sequencing can infer the functional traits of microbial communities [22, 23] and then determine which are sensitive to increased soil Hg pollution. We expect functional traits of soil microbial communities to follow predictable responses to Hg pollution. Such an expectation is based on the large body of literature reporting consistent microbial responses to other global changes such as climate change and nutrient additions [3, 23, 24]. Herein, we aimed to build a predictive understanding of the response of multiple soil taxonomic and functional attributes to increased Hg contents at the regional scale. Because Hg is a well-known pollutant with important implications for life on Earth [25], we hypothesized that soil Hg pollution will have consistent effects on taxonomic and functional attributes (e.g., relative abundance of functional genes) across different land use types. To do so, we collected three replicated soils at each of 47 sites (24 paddy fields and 23 adjacent upland fields), resulting in a total of 141 samples from Hg-impacted agricultural locations across two provinces in China. Most of the sites are surrounded by historical Hg mining areas with varying soil Hg contents, and their soils contained a wide range of Hg concentrations under similar vegetation types. These sites also included controls that are far away from the mining sites, with Hg contents similar to local background levels. As such, these locations provided a unique opportunity to empirically evaluate the response of microbial taxonomic and functional attributes to a gradient of soil Hg pollution. We characterized soil bacterial community composition via MiSeq Illumina platform. In addition, we investigated potential shifts in the relative abundance of functional genes linked to microbial communities by analyzing the soil metagenomes from a subset of those sites. Finally, we identified the associations between soil Hg concentrations and bacterial diversity, abundance, and ecological clusters (modules) using a combination of random forest analysis and structure equation modeling, after accounting for other critical environmental predictors. Results Mercury pollution altered soil bacterial abundance and diversity We found a consistent decrease in the abundance of bacteria with increases in soil total Hg in both paddy and upland soils (Fig. 1a, b). Bacterial abundance was also negatively related to methylmercury (MeHg) in paddy soils (d.f. = 1, 70, $ P = 0.008 $). In contrast, bacterial diversity (Shannon index) was positively correlated to total Hg (d.f. = 1, 70, $ P = 0.001 $) in the paddy soils and tended to increase with elevated MeHg contents (d.f. = 1, 70, $ P = 0.08 $) (Fig. 1c, d). We also found a cubic negative relationship (d.f. = 3, 65, $ P = 0.001 $) between total Hg and bacterial diversity for the upland soils. As expected, land use type had significant effects on soil bacterial abundance and diversity (Additional file 1: Figure S1a, b), and both bacterial abundance and diversity were higher (ANOVA, d.f. = 1, 139, $ P < 0.05 $) in paddy soils than those in upland soils. Mercury pollution altered the relative abundance of bacterial phyla We found consistent associations between of Hg contents and the relative abundance of some dominant bacterial phyla in both paddy and upland fields, though the bacterial community compositions were different between the two types of land use (Additional file 1: Figure S2). For example, increasing total Hg was positively related to the relative abundance of Firmicutes and Bacteroidetes in both paddy and upland soils (Fig. 2), while they were not related to MeHg. In contrast, increasing MeHg was negatively correlated to the relative abundance of Nitrospirae in the two soils, though it was not significantly correlated to soil total Hg ($ P > 0.05 $). In addition, we found some correlations, depending on land use type, between total Hg/MeHg and the relative abundance of other dominant phyla/classes (Additional file 1: Table S1). Random forest analysis allowed us to further identify what genera of Firmicutes and Bacteroidetes were associated with increases in Hg contents (Additional file 1: Figure S3a, $ P < 0.05 $). Thus, the relative abundance of Chitinophagaceae Ferruginibacter, Sphingobacteriaceae Pedobacter, and Clostridium sensu stricto_1 were positively correlated to soil total Hg (Additional file 1: Figure S3b, d.f. = 1, 139, $P < 0.05$), while the relative abundance of Nitrosipirae was negatively correlated to MeHg contents (Additional file 1: Figure S4, d.f. = 1, 139, $P < 0.01$). Mercury pollution shifted the relative abundance of ecological clusters within the correlation network The soil bacterial taxa could be grouped into five major ecological clusters (modules), comprised of strongly co-occurring bacterial taxa with one another (Fig. 3a). Not surprisingly, the two different soils were dominated by different ecological clusters in the two types of soil (Fig. 3b). Particularly, the relative abundance of module #0 was much higher (ANOVA, d.f. = 1, 139, $P < 0.05$) in the paddy soils than that in the upland soils, while the relative abundance of module #4 exhibited the opposite trend. Even so, we found consistent relationships between soil total Hg/MeHg and the relative abundance of the dominant ecological clusters (Fig. 3c). For example, the relative abundance of module #0 was negatively related to MeHg in both of soils, where the relative abundance of module #4 was positively related to MeHg. All modules were formed by multiple phyla/classes, and the membership of each module is shown in Additional file 2 (data S1). We also found some soil-type-specific effects of Hg on the relative abundance of ecological clusters. For instance, the relative abundance of modules #0 and #4 decreased and increased, respectively, with increasing total Hg in the paddy soil (Fig. 3c), but no similar trends were observed in the upland soil. Meanwhile, the relative abundance of module #2 and module #3 decreased and increased, respectively, with increasing total Hg for the upland soil, while no similar response was observed for the paddy soil. Mercury pollution is a significant predictor of soil bacterial community and ecological clusters after controlling for multiple environmental predictors Random forest analysis suggested that, in general, Hg variables are major predictors of bacterial diversity and abundance (Additional file 1: Figure S5a, b) and the relative abundance of ecological clusters (Additional file 1: Figure S6a, b). As expected, our results indicate that other environmental factors were also important predictors of microbial communities, although the relative importance of these predictors was highly taxa and module dependent. See Additional file 1: Table S2 for correlations between microbial attributes and environmental predictors. We then used structural equation modeling (SEM), to further clarify the role of Hg in predicting abundance, diversity, and the relative abundance of modules for both paddy and upland soils, after controlling for multiple other environmental predictors (Fig. 4a, b; Additional file 1: Table S3, S4). Remarkably, we found a consistent negative effect of total Hg on bacterial abundance in both soils. Our SEM shows direct effects of MeHg on the relative abundance of modules (Mod#3 and Mod#4) in upland soils and effects of total Hg and MeHg on the relative abundance of Mod#1 in paddy soils. Interestingly, we detected multiple indirect effects of Hg on the relative abundance of these modules via impacts on soil properties and other modules, though there may be interactions between these microbial attributes. The SEM also shows a direct effect of Hg on the bacterial diversity in upland soils, while the effect was not significant in the paddy soils. As expected, the SEM also shows strong effects of soil and spatial properties on these microbial attributes across the two types of land use. Functional gene relates to soil Hg pollution We conducted further random forest modeling to evaluate the link between functional genes and Hg pollution, and 22 functional genes that significantly predicted changes in total Hg across the soils were identified (Fig. 5a; Additional file 1: Table S5). Most of those genes are likely involved in soil nutrient metabolisms (e.g., reduction of nitrate and phosphate) and Hg transformations (e.g., Hg uptake and methylation). Furthermore, we found that the relative abundance of genes encoding member protein, diphosphate reductase, and dehydrogenase E1 component increased along elevated soil Hg contents, while the gene encoding 3-deoxy-D-manno-octulosonic-acid transferase accounting for glycan biosynthesis and metabolism, significantly decreased towards increased Hg (Fig. 5b). We also found 30 genes significantly predicting changes in soil MeHg, including the genes involved in CoA synthetase and iron transport, that are important enzymes involved in Hg uptake and methylation (Additional file 1: Figure S7). Discussion Effects of Hg pollution on soil bacterial abundance and diversity in agricultural ecosystems Both regression analysis and SEM demonstrate that long-term field Hg pollution had a negative effect on the bacterial abundance from the two land use types. Such a result is in contrast with a previous short-term incubation experiment where no effect of Hg pollution on bacterial abundance was found [13]. Both Hg and MeHg are toxic to life, and thus, long-term field Hg pollution may inhibit microbial growth and then cause a decrease in soil microbial abundance across centuries [8]. Importantly, the lack of an effect of Hg pollution on bacterial abundance in short-term experiments could be related to the fact that relic DNA from dead bacteria is also extracted and then quantified by qPCR [26, 27], obscuring the adverse effect of Hg on soil microbial abundance. Such an artifact should be largely diluted in long-term experiment and observational studies. Similarly, MeHg as the most toxic Hg speciation also negatively correlated to the bacterial abundance in the paddy soils, further emphasizing the strong effect of Hg pollution on bacterial abundance in soil. On the contrary, bacterial diversity tended to increase under moderate Hg content (<53 mg kg$^{-1}$, Fig. 1c), partially supporting the intermediate disturbance or stress hypothesis [12, 28]. However, our observations are different from those from short-term incubation experiments, in which Hg amendment has been reported to reduce soil bacterial diversity [13]. As such, our approach suggests that large-scale observational studies are needed to understand the response of bacterial diversity to Hg pollution in real-world ecosystems. The soils examined in this study belong to Hg-mining areas which suffered serious Hg pollution for more than 600 years [29]. Consequently, the microbial community from these soils might have had time to develop resistance to Hg stress [13]. Alternatively, increasing Hg pollution might increase bacterial diversity by releasing subordinate microbial taxa via competition. These results are partially supported by our SEM suggesting a positive effect of MeHg on the diversity in upland soils, while the effect became complicated in paddy soils where no direct effect of total Hg or MeHg on the diversity was observed. However, Hg pollution may indirectly influence the bacterial diversity through impacts on soil properties, which were important drivers of soil microbial diversity [17, 21]. All of these observations illustrate the importance of Hg pollution in regulating the abundance and diversity of soil bacteria. Importantly, these results were maintained after accounting for multiple other drivers including soil and spatial properties. Mercury pollution altered soil bacterial community composition and the distribution of ecological clusters Importantly, we also found that Hg pollution consistently related to the relative abundance of the dominant bacterial phyla. For example, the relative abundance of Firmicutes and Bacteroidetes increased in response to elevated total Hg, but the relative abundance of Nitrospirae was negatively related to MeHg contents. Firmicutes and Bacteroidetes are known to be fast-growing opportunistic types of organisms that might benefit from environmental disturbance by taking over niches commonly occupied by other bacterial taxa. We also detected the genera of bacteria within these groups influenced by Hg pollutions (Additional file 1: Figure S3; Figure S4). For example, Sphingobacteriaceae Pedobacter and Clostridium sensu stricto have been reported to be resistant to Hg or heavy metals [30, 31]; however, much less is known about the mechanisms linking the responses of Chitinophagaceae Ferruginibacter to Hg pollution. In addition, our large-scale data suggest a decrease in the relative abundance of Nitrospirae with elevated soil MeHg. Previous studies have found that this phylum is highly sensitive to heavy metal stress at the local scale [12, 32]. The reduction in the relative abundance of Nitrospirae was mainly attributed to a relative decrease in the genus Nitrosipirales 0319.6A21sp. in response to elevated MeHg. Increased Hg pollution is known to inhibit the processes of nitrogen cycle driven by soil functional assembles [9, 33], which could be an important result of the inhibiting effect of Hg to nitrifying bacteria such as Nitrospirae. These results suggest that the sensitive taxa could be used as potential ecological indicators for Hg pollution in terrestrial ecosystems. Our random forest analysis suggested that Hg, in general, is a significant predictor of the ecologically preferential modules within the bacterial co-occurrence network after accounting for other key environmental predictors (Additional file 1: Figure S6). Thus, increases in soil Hg content also led to drastic changes in the co-occurrence network of soil bacterial communities in the studied regions. Interestingly, we found significant patterns of the relative abundances in some modules along increased Hg and MeHg pollution (Fig. 3c; Additional file 1: Table S6). For example, the relative abundance of module #4 tended to increase with elevated total Hg and MeHg in both paddy and upland soils. This module mainly consisted of potentially Hg-resistant microbes such as Proteobacteria, Bacteroidetes, and Actinobacteria, which were reported to contain the Hg-resistance gene merA [34, 35]. We also provide a list of winner (positive effects) and loser (negative effects) community assemblies in response to Hg pollution (Additional file 2: Data S1), which can be used to test for similarities in the response of soil microbial communities to Hg pollution worldwide. Although SEM is quite a conservative procedure, the results support similar associations between Hg and the relative abundance of modules across the two types of land use. For example, soil Hg had direct effects on the relative abundance of module #1 in paddy soils (Fig. 4a), and a similar effect on this module in upland soils could be reflected through indirect impacts of Hg on other modules (i.e., Mod#2, Mod#3, and Mod#4) due to their interactions (Fig. 4b: BOX2). It is not surprising to note the interactions between the modules in the co-occurrence networks, because increases in a given ecological cluster were often followed by declines in the relative abundance of other ecological clusters [36]. These findings suggest that variability of Hg contents in the ecosystem might change the distributions of ecologically preferential clusters. Of course, as expected, other environmental predictors strongly associate with the relative abundance of microbial ecological clusters (Fig. 4, Additional file 1: Table S2; Additional file 1: Figure S6), which had been well recognized in many previous studies [15–17]. Predicting soil Hg pollution from the variability of microbial functional genes We found that Hg pollution was also associated with important functional traits within microbial communities. In fact, here, we provide a list of functional genes which were strongly correlated to Hg contents across soils. Of course, we acknowledge the current limitations for linking genes to Hg pollution across large spatial scales due to the correlative nature of these analyses (Fig. 5; Additional file 1: Figure S7). Such results are in agreement with previous studies emphasizing significant effects of Hg stress on microbially driven processes (e.g., nitrification potential and dehydrogenase enzyme activity) driven by diverse soil microorganisms [9, 37]. For example, the relative abundance of genes involved in member protein tended to increase with the level of soil Hg pollution, suggesting that moderated Hg stress may stimulate the enzyme activities responsible for Hg transportation through the cell membrane [38]. We also observed a significant increase in the relative abundances of genes associated with dehydrogenase with elevated Hg. These findings are consistent with those of previous studies showing upregulation of dehydrogenase activities exposed to metals [39]. In addition, we identified some genes that are relevant to Hg transport (i.e., iron transport system) and methylation processes (i.e., CoA synthetase) [40]. Previous studies has suggested that inorganic Hg(II) could be transported into microbial cells probably through ion transport system [41, 42], and the cellular Hg(II) is subsequent methylated to highly neurotoxic MeHg by methylating genes hgcAB [43]. Thus, our predicted iron transport system might be relevant to soil MeHg formation. Furthermore, Hg methylation is an enzyme-catalyzed process associated with the reductive CoA pathway [44], which may explain our results that the CoA synthetase is a significant predictor for MeHg in the soil. Overall, these gene predictors are associated with nutrient metabolisms and Hg transformations, which are also important biomarkers of soil Hg pollution. Conclusions Together, our study represents one of the first attempts to empirically assess how the soil microbiomes respond to long-term Hg pollution across large spatial scales and land use type. We provides solid evidence that Hg pollution has predictable and significant effects on multiple taxonomic and functional microbial attributes including bacterial abundance, diversity, and the relative abundance of ecological clusters and functional genes. Such results are maintained after accounting for other important environmental predictors of soil microbial communities. In general, Hg pollution was negatively related to the bacterial abundance. The relative abundance of Bacteroidetes and Firmicutes increased with elevated Hg pollution, while the relative abundance of Nitrospirae was negatively correlated to MeHg. Mercury-induced shifts in the ecological clusters of co-occurrence network and functional traits of microbial communities could have important implications for soil biogeochemical cycling and service functioning of the ecosystem. This work moves us towards a more predictable understanding of the response of microbial communities and their potential function to Hg pollution—a worldwide threat derived from both global warming and intensive anthropogenic activities. Methods Study area and sampling The soil samples were collected around two typical Hg mining areas (Fenghuang, FH and Wanshan, WS) in southwest China. Fenghuang is located in West Hunan Province, and Wanshan in East Guizhou Province. Both of them are the major grain-producing areas in China, with a long history Hg mining for more than 600 years [29]. Historical discharges from Hg mining operations and ongoing atmospheric deposition has led to heavy Hg pollution in these areas [45]. We collected soil samples from 24 locations (Additional file 1: Figure S8) along downstream the mining sites to obtain samples with a large gradient of soil Hg concentrations (ranges from 0.27 to 52.4 mg kg$^{-1}$), and most of them were above risk control value for paddy soils in China (0.6 mg kg$^{-1}$) [46]. Two typical types of land use including paddy fields (24 sub-sites) and adjacent uplands (23 sub-sites, maize planting) were chosen to compare the effects of land use on the microbial responses to long-term soil Hg pollution. We tried to choose locations where both paddy and upland fields are the main crop planting, and sporadic farmlands are excluded. Three replicated soil (0–15 cm depth) samples were collected at each of the 47 sites to account for small scale variation in Hg pollution. Consequently, a total of 141 soil samples were obtained from the 24 paddy (72 samples) and upland (69 samples) fields. These locations also included two control sites (paddy and adjacent upland fields) located in the natural reserve with little pollution (i.e., location no. 1 in Additional file 1: Figure S8). Total Hg concentrations in the control sites are similar the levels of local background values (0.5~0.7 mg kg$^{-1}$), which are similar to the Hg risk control value for paddy soil in China [46]. We omitted an upland site due to the lack of representative field in the location. Sampling was conducted in August 2016 before harvesting. Collected soil samples were homogenized and sieved (2.0 mm) to get a representative microbial community [20, 47]. The sieved samples were subsequently divided into two sub-samples. One sub-sample was stored at –20 °C for microbial analysis, while the other sub-sample was air-dried for the analysis of heavy metals and soil properties. Measurement of soil heavy metals and chemical indexes For Hg analysis, 0.20 g of each soil was digested with 10 mL mixed solution (2 mol L$^{-1}$ HNO$_3$ and 4 mol L$^{-1}$ HCl) in a Teflon tube at 95 °C for 2 h. The total amount of Hg in these extracts was determined via cold vapor atomic fluorescence spectrometry (CVAFS) [45], and the method detection limit was 0.2 ng L$^{-1}$. For the analysis of other heavy metals (i.e., Cu, Pb, Cd, Zn, Ni, and As), 0.30 g soil were digested by trace mixed acids (9.0 mL of HNO$_3$ and 3.0 mL of HF) in a MARS microwave digestion system (CEM, USA). The concentrations of the heavy metals in the final solution were measured using a 7700X Inductively Coupled Plasma-Mass Spectrometer (Agilent, USA). For MeHg, 0.40 g soil was used for MeHg extraction using CuSO$_4$-methanol. The amount MeHg was determined using an automated MeHg analyzer (TEKRAN 2700 GC-CVAFS) [48]. Soil pH was determined on a fresh soil to water ratio of 1: 2.5 using a Delta pH-meter. Soil organic carbon (SOC) was measured using the K$_2$CrO$_7$ oxidation titration method [49]. Total carbon (TC) and total nitrogen (TN) in soils were determined on a LECO TureMac Macro CN analyzer (LECO, St. Joseph, MI, USA). Dissolved organic carbon (DOC) in the soil was extracted with 0.5 M K$_2$SO$_4$ at a ratio of 1:5 by shaking at 200 rpm for 1 h and filtering through a 0.45-$\mu$m Millipore filter [50], and the DOC concentration was measured by a TOC analyzer (TOC-L Analyzer, Shimadzu, Japan). The ammonium and nitrate concentrations in the filtered extracts were analyzed within 24 h using a continuous flow analyzer (SAN++, Skalar, Breda, Holland). Analysis of soil bacterial communities through Illumina MiSeq sequencing The genomic DNA was isolated from 0.30 g of soil using the MoBio PowerSoil DNA Isolation Kit (QIAGEN Inc., USA) following the manufacturer’s instructions. The abundance of bacteria was estimated by quantifying the 16S rRNA gene copy number on an iCycler iQ5 thermocycler (Bio-Rad, USA) using the primer pairs Eub338F/Eub518R [51]. To evaluate the bacterial community composition, the V4 region of the bacterial 16S rRNA gene was amplified using the primer pairs of 338F/806R [47]. The 50 $\mu$L PCR reaction mixtures consisted of 25 $\mu$L PremixTaq™ (Takara Biotechnology, Dalian, China), 1 $\mu$L of each primer (10 $\mu$M), 3 $\mu$L of template DNA, and 20 $\mu$L of sterilized ddH$_2$O. The resultant PCR products were purified using the Wizard® SV Gel and PCR Clean-Up System (Promega, San Luis Obispo, USA). The purified amplicons were equimolarly mixed, and 2 $\times$ 250 bp paired-end sequencing was carried out on an Illumina MiSeq sequencer (Illumina Inc., San Diego, USA). Raw reads generated from the MiSeq paired-end sequencing were merged together using the Fast Length Adjustment of Short reads (FLASH). A chimera filtering approach UPARSE was employed as the Operational Taxonomic Unit (OTU or phylotype) picking strategy at 97% sequence similarity. We randomly selected an even number (30,212) of reads from each sample to account for variability in sequencing depth before downstream analysis (Additional file 1: Figure S9). Representative sequences from individual OTUs generated in UPARSE were processed using the Quantitative Insights into Microbial Ecology (QIIME) pipeline. The bacterial diversity index was calculated based on 97% OTU similarity of obtained bacterial sequences. The taxonomic identity of all phylotypes was determined using The SILVA ribosomal RNA gene database project [52]. Shotgun metagenomic sequencing and gene analysis Seven paddy soils and three upland soils were selected from our 141 samples for metagenomic analysis. These samples were chosen, after Hg analysis, to produce a wide range of Hg concentrations (ranged from 0.84 to 32.43 mg kg$^{-1}$). Sequencing was performed using an Illumina PE150 (Illumina Inc.) at Majorbio, Inc., Shanghai, China. Raw reads (150 bp in length) were trimmed to remove low-quality reads. Paired reads of shotgun metagenomic sequences were merged with FLASH using default parameters [53]. Using MBLASTX, merged reads were also mapped against the protein sequence of the KEGG database (E value cutoff $1e^{-6}$), and the relative abundance of each KO gene was also calculated. Additional details on methodology are provided in the Additional file 3. To estimate the influence of elevated Hg and MeHg contents on these genes, we focused on the KO genes related to microbial metabolism, Hg transformations, and other sensitive ones. Correlation network analyses We established a co-occurrence network to identify ecological clusters of bacterial taxa across the collected 141 soil samples. A single correlation network including all samples was conducted so that the identified ecological clusters are directly comparable across land use types. We kept those taxa accounting for more than 80% of the relative abundance of soil bacteria (1073 bacterial taxa in Additional file 2: Data S1). We then calculated all pairwise Spearman’s rank correlations ($\rho$) between all soil bacterial taxa using the psych package of the R statistical software ([http://cran.r-project.org/](http://cran.r-project.org/)) and focused exclusively on positive correlations as they provide information on bacterial taxa that may respond similarly to environmental conditions [54]. We considered a co-occurrence to be robust if the Spearman’s correlation coefficient was > 0.25 and $P < 0.01$ [17]. The network was visualized with the interactive platform Gephi [55]. Finally, we used default parameters from the interactive platform Gephi to identify ecological clusters (i.e., modules) of soil taxa strongly interacting with each other [55]. The relative abundance of each ecological cluster was computed by averaging the standardized relative abundances (z-score) of the taxa that belong to each ecological cluster [17]. Statistical analysis We first identified the correlations between total Hg and MeHg with soil bacterial abundance, diversity (Shannon), and the relative abundance of ecological clusters in both paddy and upland soil, using linear or cubic models. We used both regression analyses and Pearson correlation to evaluate correlations between total Hg and MeHg and the relative abundance of ecological clusters, and bacterial community composition for two land use types using one ANOVA, with land use type as the fixed factor. We conducted a classification random forest analysis [56, 57] to identify the statistically significant predictors of the bacterial diversity, total abundance, and the relative abundance of ecological clusters. The major aim of these analyses were to test whether total Hg or MeHg pollution are significant predictors of microbial attributes, after accounting for other key environmental predictors including location, soil properties, heavy metals, and nutrient availability. We also used random forest analysis to identify the genus predictors of the phyla/classes that were significantly correlated to soil Hg. The random forest model determined the importance of each predictor variable via evaluating the decrease in prediction accuracy (i.e., increase in the mean square error between observations and OOB predictions) when the data for that predictor are randomly permuted, as previously described [58]. These analyses were conducted using the rfPermute package [59] of the R statistical software ([http://cran.r-project.org/](http://cran.r-project.org/)). Additionally, we used Spearman’s correlation analyses to further evaluate the correlations between bacterial diversity (Shannon), total abundance, and the relative abundance of ecological clusters with environmental predictors. We also used random forest analysis to identify the major functional genes predicting the concentrations of Hg and MeHg in our soils. In these analysis, functional genes are used as predictors of Hg concentrations. After this, we used linear regressions to evaluate the direction of the relationships between the relative abundance of selected genes and soil total Hg concentrations. We then used structural equation modeling (SEM) [60] to further clarify associations of Hg (total Hg and MeHg) contents with the bacterial abundance, diversity, and the relative abundance of ecological clusters (modules). Unlike the analysis of regression or ANOVA, SEM allows the ability to separate multiple effect pathways and consider them as parts of a system and thus is useful for isolating the complex relationships among environmental factors commonly found in natural ecosystems [60, 61]. The probability that a path coefficient differs from zero was tested using bootstrap resampling. Bootstrapping is preferred to the classical maximum-likelihood estimation in these cases because in bootstrapping, probability assessments are not based on the assumption that the data match a particular theoretical distribution. Our model also includes spatial autocorrelation (latitude and longitude) and soil properties, which were represented by the three major components by performing principal component analysis of soil variables including pH, soil organic carbon (SOC), C:N, and others (Additional file 1: Table S3). We first established an a priori model according to our current knowledge of environmental variable impacts on soil microbiomes (Additional file 1: Figure S10). The data matrix was fitted to the model using the maximum-likelihood estimation method. There is no single universally accepted test of overall goodness of fit for SEM. Thus, we used the chi-square test ($\chi^2$; the model has a good fit when $0 \leq \chi^2$/d.o.f $\leq 2$ and $0.05 < P \leq 1.00$) and the root mean square error of approximation (RMSEA; the model has a good fit when RMSEA $0 \leq$ RMSEA $\leq 0.05$ and $0.10 < P \leq 1.00$ [62]. The SEM analyses were performed using AMOS 21.0 (SPSS Inc., Chicago, IL, USA). Additional files Additional file 1: Table S1. Correlation coefficients (Pearson’s $p$) between the dominant phyla/classes and soil Hg and MeHg contents. Table S2. Correlation coefficients (Spearman’s $\rho$) between bacterial abundance, richness and modules, and soil properties. Table S3. Correlation coefficients (Spearman’s $\rho$) between three major components from principal component analysis and soil properties. Table S4. Standardized direct effects from the SEM in Fig. 4. Table S5. The ID and names of the predicted functional genes (see Fig. 4) were annotated according to Kyoto Encyclopedia of Genes and Genomes (KEGG) using metagenomic data derived from a subset of our soil samples. Table S6. Correlation coefficients (Pearson’s $p$) between bacterial modules (Mod) of co-occurrence network and soil Hg and MeHg contents. Figure S1. Bacterial abundance and diversity in paddy and upland soils from Hg-impacted FH and WS areas in China. Figure S2. Relative abundances of the dominant phyla (classes) based on MiSeq sequencing of 16S rRNA gene in paddy and upland soils. Figure S3. Predictor importance of main genera in Firmicutes and Bacteroidetes pending to soil total Hg based on random forest analyses (a). Relationships between the predicted main species and soil total Hg (b). Figure S4. Relationship between the most important genus in Nitrosipirae and soil MeHg. Figure S5. Random forest (RF) analyses identifying environmental predictors of soil bacterial abundance and diversity. Figure S6. Random forest analyses identifying soil environmental predictors of the relative abundance of modules #0–4 of bacterial occurrence network in paddy soils. Figure S7. Random forest analyses identifying the main significant gene predictors of soil total MeHg. Figure S8. Map of the study area and 24 sampling locations around the Hg mining area in southwest China. Figure S9. Rarefaction and Shannon curves of 16S rRNA gene sequencing of the soils. Figure S10. An a priori model identifying effects of Hg on soil microbiome. (DOCX 1450 kb) Additional file 2: Taxa composition of each module (ecological cluster). (XLSX 48 kb) Additional file 3: Details regarding shotgun metagenomic sequencing and gene analysis. (DOCX 18 kb) Acknowledgements We thank Xinquan Zhou and Wenli Tang for their assistance in mercury analysis, and Penggen Xu for technical support in bioinformatics analysis. We gratefully acknowledge Chao Xiong and Anhui Ge for their assistance during field sampling. We thank Dr. PM Chalk (The University of Melbourne) for his language editing of this manuscript, and the anonymous reviewers for their constructive comments on this paper. Funding This research was supported in part by the National Natural Science Foundation of China (41877120, 41571453). M.D-B. acknowledges the support from the Marie Sklodowska-Curie Actions of the Horizon 2020 Framework Programme H2020-MSCA-IF-2016 under REA grant agreement no. 702057. Availability of data and materials The soil metagenomic dataset has been deposited to the NCBI Sequence Read Archive under accession number PRJNA450451. Authors’ contributions YRL and MDB planned the research; YRL and LB conducted the laboratory analyses and collected the raw data. MDB and YRL analyzed the output data and performed all the statistical analyses; YRL, MDB, IZ, and IZH wrote the first draft of the manuscript, and all authors contributed to revisions. All authors read and approved the final manuscript. Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Author details 1State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan 430070, People’s Republic of China. 2State Key Laboratory of Urban and Regional Ecology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085, China. 3College of Resources and Environment, Huazhong Agricultural University, Wuhan 430070, China. 4Cooperative Institute for Research in Environmental Sciences, University of Colorado, Boulder, CD 80309, USA. 5Departamento de Biología, Geología, Física y Química Inorgánica, Escuela Superior de Ciencias Experimentales y Tecnología, Universidad Rey Juan Carlos, c/Tulipán s/n, 28933 Móstoles, Spain. 6Faculty of Veterinary and Agricultural Sciences, The University of Melbourne, Parkville, Victoria 3010, Australia. Received: 5 July 2018 Accepted: 8 October 2018 Published online: 18 October 2018 References 1. Bissett A, Brown MV, Siciliano SD, Thrall PH. Microbial community responses to anthropogenically induced environmental change: towards a systems approach. Ecol Lett. 2013;16:128–39. 2. Griffiths BS, Philippot L. Insights into the resistance and resilience of the soil microbial community. FEMS Microbiol Rev. 2013;37(2):112–29. 3. Jiao S, Zhang Z, Yang F, Lin Y, Chen W, Wei G. Temporal dynamics of microbial communities in microcosms in response to pollutants. Mol Ecol. 2017;26(3):923–36. 4. Alava JJ, Cheung WWL, Ross PS, Sumaila UR. Climate change–contaminant interactions in marine food webs: toward a conceptual framework. Glob Chang Biol. 2017;23(10):3984–4001. 5. Obrist D, Agnani Y, Jiskra M, Olson CL, Colegrove DP, Hueber J, Moore CW, Sonke JE, Helmig D. Tundra uptake of atmospheric elemental mercury drives Arctic mercury pollution. Nature. 2017;547(7662):201–4. 6. Schuster PF, Schaefer KM, Aiken GR, Antweiler RC, Dewildt JF, Grysiez JD, Gusmeroli A, Hugelius G, Jafarov E, Krabbenhoft DP, et al. Permafrost stores a globally significant amount of mercury. Geophys Res Lett. 2018;45(3):1463–71. 7. Krabbenhoft DP, Sundeland EM. Global change and mercury. Science. 2013;341(6153):1457–8. 8. Mahbub KR, Krishnan K, Naidu R, Andrews S, Megharaj M. Mercury toxicity to terrestrial biota. Ecol Indic. 2017;74:451–62. 9. Liu Y-F, Zheng Y-M, Shen J-P, Zhang L-M, He J-Z. Effects of mercury on the activity and community composition of soil ammonia oxidizers. Environ Sci Pollut Res. 2010;17(6):1237–44. 10. Müller AK, Westergaard K, Christensen S, Sørensen SJ. The effect of long-term mercury pollution on the soil microbial community. FEMS Microbiol Ecol. 2001;36(1):11–9. 11. Harris-Hellal J, Vallaeyts T, Garnier-Zarli E, Bousserrhine N. Effects of mercury on soil microbial communities in tropical soils of French Guyana. Appl Soil Ecol. 2009;41(1):59–68. 12. Liu Y-F, Wang J-J, Zheng Y-M, Zhang L-M, He J-Z. Patterns of bacterial diversity along a long-term mercury-contaminated gradient in the paddy soils. Microb Ecol. 2014;68(3):575–83. 13. Frossard A, Hartmann M, Frey B. Tolerance of the forest soil microbiome to increasing mercury concentrations. Soil Biol Biochem. 2017;105:162–76. 14. Frey B, Rieder SR. Response of forest soil bacterial communities to mercury chloride application. Soil Biol Biochem. 2013;65:329–37. 15. Menezes AB, Prendergast-Miller MT, Richardson AE, Toscas P, Farrell M, Macdonald LM, Baker G, Wark T, Thrall PH. Network analysis reveals that bacteria and fungi form modules that correlate independently with soil parameters. Environ Microbiol. 2015;17(8):2677–89. 16. Delgado-Baquerizo M, Oliverio AM, Brewer TE, Benavent-Gonzalez A, Eldridge DJ, Bardgett RD, Maestre FT, Singh BK, Fierer N. A global atlas of the dominant bacteria found in soil. Science. 2018;358(6373):320–5. 17. Delgado-Baquerizo M, Reith F, Dennis PG, Hamonts K, Powell JR, Young A, Singh BK, Bissett A. Ecological drivers of soil microbial diversity and soil biological networks in the Southern Hemisphere. Ecology. 2018;99(3):583–96. 18. Van Der Heijden MGA, Bardgett RD, Van Straalen NM. The unseen majority: soil microbes as drivers of plant diversity and productivity in terrestrial ecosystems. Ecol Lett. 2008;11(3):296–310. 19. Shi Y, Li Y, Xiang X, Sun R, Yang T, He D, Zhang K, Ni Y, Zhu Y-G, Adams JM, et al. Spatial scale affects the relative role of stochasticity versus determinism in soil bacterial communities in wheat fields across the North China Plain. Microbiome. 2018;6(1):27. 20. Frossard A, Donhauser I, Mestrot A, Gygax S, Båth E, Frey B. Long- and short-term effects of mercury pollution on the soil microbiome. Soil Biol Biochem. 2018;120:191–9. 21. Fierer N. Embracing the unknown: disentangling the complexities of the soil microbiome. Nat Rev Micro. 2017;15(1):0579. 22. Zhang X, Johnston ER, Barberán A, Ren Y, Lü X, Han X. Decreased plant productivity resulting from plant group removal experiments constrains soil microbial functional diversity. Glob Chang Biol. 2017;23(10):4518–32. 23. Leff JW, Jones SE, Prober SM, Barberán A, Borer ET, Finn JL, Harpole WS, Hobble SE, Hofmockel KS, Knops JMH, et al. Consistent responses of soil microbial communities to elevated nutrient inputs in grasslands across the globe. Proc Natl Acad Sci U S A. 2015;112(35):10697–72. 24. Zhang X, Johnston ER, Li J, Konstantinidis KT, Han X. Experimental warming reveals positive feedbacks to climate change in the Eurasian Steppe. ISME J. 2017;11(4):885–95. 25. Obrist D, Kirk JL, Zhang L, Sunderland EM, Jiskra M, Selin NE. A review of global environmental mercury processes in response to human and natural perturbations: changes of emissions, climate, and land use. Ambio. 2018;47(2):116–40. 26. Frostellgård Å, Courtiols S, Ramisse V, Clerc S, Berriion D, Le Gall F, Jeannin P, Nesme X, Simonet P. Quantification of bias related to the extraction of DNA directly from soils. Appl Environ Microbiol. 1999;65(12):5409–20. 27. Carini P, Marsden PJ, Leff JW, Morgan EE, Strickland MS, Fierer N. Relic DNA is abundant in soil and obscures estimates of soil microbial diversity. Nat Microbiol. 2017;2:16242. 28. Connell JH. Diversity in tropical rain forests and coral reefs. Science. 1978;199(4335):1302–10. 29. Feng X, Li P, Qiu G, Wang S, Li G, Shang L, Meng B, Jiang H, Bai W, Li Z, et al. Human exposure to methylmercury through rice intake in mercury mining areas, Guizhou Province, China. Environ Sci Technol. 2008;42(1):326–32. 30. Lee J, Jung Y-J, Lee HK, Hong SG, Kim O-S. Complete genome sequence of Pedobacter cryoconitis PAMC 27485, a CRISPR-Cas system-containing psychrophile isolated from Antarctica. J Biotechnol. 2016;226:74–5. 31. Wu S, Li Y, Wang P, Zhong L, Qiu L, Chen J. Shifts of microbial community structure in soils of a photovoltaic plant observed using tag-encoded pyrosequencing of 16S rRNA. Appl Microbiol Biotechnol. 2016;100:3735–45. 32. Das S, Jean J-S, Kar S, Liu C-C. Changes in bacterial community structure and abundance in agricultural soils under varying levels of arsenic contamination. Geomicrobiol J. 2013;30(7):635–44. 33. Zhou Z, Zheng Y, Shen J, Zhang L, Liu Y, He J. Responses of activities, abundances and community structures of soil denitrifiers to short-term mercury stress. J Environm Sci. 2012;24(3):369–75. 34. Barkay T, Miller SM, Summers AO. FEMS Microbiol Rev. 2003;27:355–84. 35. Møller AK, Barkay T, Hansen MA, Norman A, Hansen LH, Sørensen SJ, Boyd ES, Kroer N. Microcine reductase genes (merA) and mercury resistance plasmids in high Arctic snow, freshwater and sea-ice brine. FEMS Microbiol Ecol. 2014;87(1):52–63. 36. Delgado-Baquerizo M, Eldridge David J, Travers Samantha K, Val J, Oliver I, Bissett A. Effects of climate legacies on above- and belowground community assembly. Glob Chang Biol. 2018;24:4330–9. 37. Mahbub KR, Krishnan K, Megharaj M, Naidu R. Mercury inhibits soil enzyme activity in a lower concentration than the guideline value. Bull Environ Contam Toxicol. 2016;96(1):76–82. 38. Barkay T, Wagner-Dobler I. Microbial transformations of mercury: potentials, challenges, and achievements in controlling mercury toxicity in the environment. Adv Appl Microbiol. 2005;57:1–52. 39. Lim JC, Thervarajo S, Selvaratnam C, Goh KM, Shamir MS, Ibrahim Z, Chong CS. Global transcriptomic response of Anoxybacillus sp. SK 3-4 to aluminum exposure. J Basic Microbiol. 2017;57(2):151–61. 40. Hsu-Kim H, Kucharyk KH, Zhang T, Deshusses MA. Mechanisms regulating mercury bioavailability for methylating microorganisms in the aquatic environment: a critical review. Environ Sci Technol. 2013;47(6):2441–56. 41. Szczuka A, Morel FMM, Schaefer JK. The effect of thiols, zinc, and redox conditions on Hg uptake in Shewanella oneidensis. Environ Sci Technol. 2015;49(12):7432–8. 42. Schaefer JK, Rocks SS, Zheng W, Liang L, Gu B, Morel FMM. Active transport, substrate specificity, and methylation of Hg(II) in anaerobic bacteria. Proc Natl Acad Sci U S A. 2011;108(21):8714–9. 43. Parks JM, Johns A, Podar M, Bridou R, Hurt RA, Smith SD, Tomancak SJ, Qian Y, Brown SD, Brandt CC, et al. The genetic basis for bacterial mercury methylation. Science. 2013;339(6151):1332–5. 44. Choi S-C, Chase T, Bartha R. Metabolic pathways leading to mercury methylation in Desulfovibrio desulfuricans LS. Appl Environ Microbiol. 1994;60(11):4072–7. 45. Meng M, Li B, Shao J-J, Wang T, He B, Shi J-J, Ye Z-H, Jiang G-B. Accumulation of total mercury and methylmercury in rice plants collected from different mining areas in China. Environ Pollut. 2014;184:179–86. 46. Ministry of Ecology and Environment of the People’s Republic of China. Soil environmental quality, risk control standard for soil contamination of agricultural land (GB 15618—2018). 2018. (in Chinese) 47. Delgado-Baquerizo M, Maestre FT, Reich PB, Jeffries TC, Gaitan JJ, Encinar D, Berdugo M, Campbell CD, Singh BK. Microbial diversity drives multifunctionality in terrestrial ecosystems. Nat Commun. 2016;7:10541. 48. Liu Y-F, Dong J-X, Zhang Q-Q, Wang J-T, Han L-L, Zeng J, He J-Z. Longitudinal occurrence of methylmercury in terrestrial ecosystems of the Tibetan Plateau. Environ Pollut. 2016;218:1342–9. 49. Walkley A, Black IA. An examination of the Degtjareff method for determining soil organic matter, and a proposed modification of the chromic acid titration method. Soil Sci. 1934;37(1):29–38. 50. Jones DL, Willett VB. Experimental evaluation of methods to quantify dissolved organic nitrogen (DON) and dissolved organic carbon (DOC) in soil. Soil Biol Biochem. 2006;38(5):991–9. 51. Cregger MA, Schadt CW, McDowell NG, Pockman WT, Classen AT. Response of the soil microbial community to changes in precipitation in a semiarid ecosystem. Appl Environ Microbiol. 2012;78(24):8587–94. 52. Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, Peplies J, Glöckner FO. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 2013;41(D1):D590–6. 53. Magoč T, Salzberg SL. FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatics. 2011;27(12):2652–63. 54. Barberán A, Casamayor EO, Fierer N. The microbial contribution to macroecology. Front Microbiol. 2014;5:203. 55. Bastian M, Heymann S, Jacomy M; Gephi: an open source software for exploring and manipulating networks; 2009. 56. Breiman L. Random forests. Mach Learn. 2001;45(1):5–32. 57. Trivedi P, Delgado-Baquerizo M, Trivedi C, Hu H-W, Anderson I-C, Jeffries T-C, Zhou J, Singh B. Microbial regulation of the soil carbon cycle: evidence from gene-enzyme relationships. ISME J. 2016;10:2593–604. 58. Delgado-Baquerizo M, Gallardo A, Covelo F, Prado-Comesaia A, Ochoa V, Maestre FT. Differences in thallus chemistry are related to species-specific effects of biocrust-forming lichens on soil nutrients and microbial communities. Funct Ecol. 2015;29:1087–98. 59. Archer E. rPermute, Estimate permutation p-values for random forest importance metrics. R package version 1.5.2. 2016. 60. Grace JB. Structural equation modeling and natural systems. Cambridge: Cambridge University Press; 2016. 61. Maestre FT, Quero JL, Gotelli NJ, Escudero A, Ochoa V, Delgado-Baquerizo M, García-Gómez M, Bowker MA, Soliveres S, Escolar C. Plant species richness and ecosystem multifunctionality in global drylands. Science. 2012;335:214–8. 62. Jing X, Sanders NJ, Shi Y, Chu H, Classen AT, Zhao K, Chen L, Shi Y, Jiang Y, He J-S. The links between ecosystem multifunctionality and above- and belowground biodiversity are mediated by climate. Nat Commun. 2015;6:8159.	b035f027-f4f7-4a99-9370-9b718825604b	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	53,879
Beitragsordnung Initiative Region Rendsburg e.V. § 1 Mitgliedsbeiträge 1. Der Initiative Region Rendsburg e. V. erhebt einen Jahresmitgliedsbeitrag für das Kalenderjahr in Höhe von 365,- Euro. Der Beitrag wird den Mitgliedern im Januar jedes Jahres, bzw. unmittelbar nach der Genehmigung des Beitritts, in Rechnung gestellt und ist mit einer Frist von 14 Tagen zur Zahlung fällig. Für den Eintritt des Zahlungsverzugs gilt § 286 BGB. 2. Der Jahresmitgliedsbeitrag ist von allen Mitgliedern, d. h. natürlichen und juristischen Personen, unabhängig vom Zeitpunkt ihres Beitritts für das jeweilige Kalenderjahr in ganzer Höhe zu zahlen. Eine Stundung oder Ratenzahlung ist nicht möglich. 3. Ehrenmitglieder sind von der Beitragspflicht befreit. § 2 Aufnahmegebühren Aufnahmegebühren werden nicht erhoben. § 3 Mahn- und Verzugsgebühren 1. Die Mahngebühr beträgt 10 EUR je Mahnung. Die erste Mahnung kann ausgesprochen werden, sobald ein Mitglied in Verzug gerät, die zweite Mahnung einen Monat danach. 2. Verzugsgebühren werden nicht erhoben. § 4 Ausschluss Wird innerhalb eines Jahres kein Zahlungseingang des Mitgliedsbeitrags festgestellt, hat der Vorstand des Initiative Region Rendsburg e. V. das Recht, das entsprechende Mitglied aus dem Verein auszuschließen. § 5 Verwendung der Gelder Die Beitragsgelder sind ausschließlich für die Erfüllung der Aufgaben des Vereins gemäß der geltenden Satzung zu verwenden. § 6 Inkrafttreten 1. Diese Beitragsordnung tritt mit Beschluss der Mitgliederversammlung vom 09.05.2017 zum 09.05.2017 in Kraft. 2. Die Beitragsordnung wird allen Mitgliedern des Vereins auf dem üblichen Weg bekannt gemacht. 3. Mitglieder, die nach dem Inkrafttreten der Beitragsordnung dem Verein beitreten, erhalten die Möglichkeit zur Einsichtnahme in die Beitragsordnung. Diese ist mit dem Beitritt auch für sie verbindlich. Stand: 09.05.2017	<urn:uuid:54987f2c-2e8f-400d-8712-6bd39e44c683>	HuggingFaceFW/finepdfs/tree/main/data/deu_Latn/train	finepdfs	deu_Latn	1,873
SETTORE III – SERVIZI SOCIALI, SCOLASTICI, CULTURA, TURISMO, SPORT, FARMACIA COMUNALE, GARE E CONTRATTI AVVISO Sportello informativo alle famiglie degli studenti che partecipano alla mensa scolastica. (presso il Palazzo Mele (Biblioteca) Orte Scalo, Largo Padre Geremia da Subiaco) Si comunica che il giorno giovedì 28/03/2024 e martedi 02/04/2024 lo sportello informativo rimarrà chiuso. Il servizio riprenderà il giorno 04/04/2024 dalle 15:00 alle 18:00	<urn:uuid:8429c360-8d03-47dd-91c9-7cf5b008db43>	HuggingFaceFW/finepdfs/tree/main/data/ita_Latn/train	finepdfs	ita_Latn	461
CARATTERIZZAZIONE MICROCLIMATICA DI UN AREA VITICOLA DELLA PROVINCIA DI CHIETI – PRIMI RISULTATI 1 Regione Abruzzo – Arssa- Centro Agrometeorologico Regionale- Scerni (Ch) Di Lena B. 1 , Antenucci F. 1 , Dias D. 2 , Giandomenico F. 2 , Odoardi M. 3 2 Consorzio Ricerca Viticola ed Enologica d'Abruzzo - Miglianico (Ch) Regione Abruzzo – Arssa - Servizio Difesa e Qualificazioni delle produzioni - Villanova di Cepagatti (Pe) 3 I rapporti tra clima e sviluppo della vite vengono definiti comunemente mediante l'ausilio di modelli basati sull'accumulo di gradi giorno. PT100 a 4 fili opportunamente schermato. Esso ha un precisione ±0,06°C a 0°C con una gamma di temperature rilevabili che va da –50°C a 250°C. Queste tematiche sono state affrontate nella Regione Abruzzo attraverso studi di macro-zonazione finalizzati alla spazializzazione delle risorse bio-climatiche sull'intero territorio e alla conoscenza dei fabbisogni termici dei vitigni (Matassa et al. 1992, Di Lena e Antenucci 2001) Il presente lavoro rappresenta la normale evoluzione degli studi gia effettuati in quanto è stata valutata nel 2003, e per una zona di limitata estensione, l'influenza dei parametri topografici sulla variabilità delle risorse bioclimatiche. Lo studio è stato effettuato in un'area altamente vocata alla viticoltura della provincia di Chieti ricadente nei comuni di Ari, Villamagna e Miglianico. Essa ha un estensione di circa 750 ha; geograficamente è posta tra 14°15'41" longitudine Est e 42°19'41" latitudine Nord, mentre, rispetto al sistema di riferimento internazionale U.T.M. (Universal Traverse Mercator), è compresa tra le coordinate x = 933161.98 e y =4699281.27 del 32° fuso nord. Dal punto di vista topografico è caratterizzata da due versanti che confluiscono in un crinale, il primo è esposto a est - sud est mentre il secondo è esposto a ovest – nord ovest. Tab. 1 Caratteristiche geografiche e topografiche dei punti di rilievo I valori di temperatura sono stati rilevati nel periodo aprile -settembre del 2003 tramite una rete di 14 stazioni termometriche dislocate, in funzione dell'orografia del terreno, in prossimità di vigneti rappresentativi del territorio . (Tab.1) Ciascuna stazione di acquisizione è costituita da un sensore Fig.2 - Distribuzione della sommatoria delle escursioni termiche giornaliere rilevate nei mesi agosto-settembre. I primi risultati dello studio hanno evidenziato che l'orografia del territorio, valutata attraverso l'analisi della quota, dell'esposizione e della pendenza, ha inciso in maniera significativa sulla variabilità del campo termico. Nelle aree poste a minore altitudine sono stati registrati valori più bassi delle temperature minime, a causa dello scivolamento delle masse d'aria freddo lungo i versanti, e valori più alti delle sommatorie delle escursioni termiche giornaliere dei mesi di agosto e settembre. Per quanto concerne la sommatoria delle temperature attive e l'Indice di Huglin i valori più alti sono stati registrati indicativamente nelle aree poste a maggiore altitudine. La spazializzazione delle informazioni, con il metodo multi-regressivo, è stata realizzata solo per le temperature minime (Fig. 1) e le escursioni termiche giornaliere (Fig. 2) per le quali sono stati ottenuti valori alti del coefficiente di determinazione (r 2 ). Le mappe sono state ottenute con il software SURFER 8. I risultati di questo studio preliminare forniscono indicazioni di massima per il corretto utilizzo del territorio dal punto di vista viticolo. Nelle aree caratterizzate da una minore disponibilità bioclimatica potrebbero essere inseriti vitigni a minore fabbisogno termico in un'ottica di ampliamento della piattaforma ampelografica. I vitigni precoci potrebbero avvantaggiarsi delle maggiori escursioni termiche, che si verificano nelle zone a minore altitudine, in quanto tale parametro influisce in maniera positiva sulla dotazione di sostanze aromatiche nelle bacche. Ringraziamenti Si ringrazia il Dott. Andrea Cicogna per gli utili suggerimenti e consigli forniti nell'utilizzazione di alcune procedure di spazializzazione del software SURFER	<urn:uuid:8227e5ba-5649-4bf9-8f0e-0fc402d47e7d>	HuggingFaceFW/finepdfs/tree/main/data/ita_Latn/train	finepdfs	ita_Latn	4,134
GOVERNMENT OF ANDHRA PRADESH ABSTRACT Municipal Administration & Urban Development Department – The Andhra Pradesh Capital City Land Pooling Scheme (Formulation and Implementation) Rules, 2015 Amendment – Issued. MUNICIPAL ADMINISTRATION & URBAN DEVELOPMENT (M2) DEPARTMENT G.O.Ms.No:61 Dated:24.03.2015 Read the following: 1. G.O.Ms.No.1, MA & UD (M2) Department, dated: 01.01.2015 2. G.O.Ms.No.43, MA & UD (M2) Department, dated: 09.03.2015 3. G.O.Ms.No.52, MA & UD (M2) Department, dated: 16.03.2015 4. G.O.Ms.No.58, MA & UD (M2) Department, dated: 19.03.2015 5. From the Commissioner, CRDA., Vijayawada, letter Rc.No. 405 / 2015 / CRDA / Dir.Estates / DT, Dt:18.03.2015. 6. G.O.Ms.No.59, MA & UD (M2) Department, dated: 20.03.2015 ***** The Government in G.O 1 st read above have issued the Andhra Pradesh Capital City Land Pooling Scheme (Formulation and Implementation) Rules, 2015 which is a voluntary scheme and subsequently certain amendments were also issued in G.Os 2 nd , 3 rd , 4 th and 6 th read above. 2. The Government in the light of clarification sought by the Commissioner, Capital Region Development Authority, Vijayawada in the letter 5 th read above, hereby issues the following amendment to the Andhra Pradesh Capital City Land Pooling Scheme (Formulation and Implementation) Rules, 2015 issued in G.O 2 nd read above and amendments from time to time. 3. Accordingly, the following notification will be published in an Extra-ordinary issue of Andhra Pradesh Gazette dated:24-03-2015. 4. The Commissioner, Printing, Stationery & Stores Purchase, AP, Hyderabad is requested to publish the said rules by notification and furnish 300 copies of the notification to the Government. 5. A copy of this order is available in the Internet and can be accessed at the address http://goir.ap.gov.in/ (BY ORDER AND IN THE NAME OF THE GOVERNOR OF ANDHRA PRADESH) GIRIDHAR ARAMANE PRINCIPAL SECRETARY TO GOVERNMENT To The Commissioner, Printing, Stationery & Stores Purchase, AP, Hyderabad. The Commissioner, Capital Region Development Authority, Vijayawada. The District Collector, Krishna District, The District Collector, Guntur District, The Commissioner, Guntur Municipal Corporation, Guntur, The Commissioner, Vijayawada Municipal Corporation, Vijayawada, The Commissioner & Director of Municipal Administration, A.P. Hyderabad. The Director of Town & Country Planning, Andhra Pradesh, Hyderabad. The Accountant General, Andhra Pradesh, Hyderabad. The Managing Director and Vice-Chairman of Andhra Pradesh Industrial Infrastructure Corporation (APIIC) The Vice-Chairman and Managing Director of Andhra Pradesh State Road Transport Corporation (APSRTC); The Vice-Chairman and Housing Commissioner of Andhra Pradesh Housing Board (APHB); The Chairman and Managing Director, APSPDCL; The Vice-Chairman & Managing Director, Infrastructure Corporation of AP Ltd; (P.T.O) The Commissioner, Panchayat Raj Department Engineer-in-Chief, Public Health Engineering Department All the Municipalities/ Nagar Panchayats in Capital Region through Commissioner & Director of Municipal Administration. Copy to The PS to Hon'ble Chief Minister The PS to Hon'ble Minister for MA&UD The PS to Hon'ble Minister for Finance The PS to Chief Secretary The PS to Principal Secretary to Government, Revenue Department The PS to Principal Secretary to Government, MA&UD Dept., The PS to Principal Secretary to Government Industries & Commerce Dept., The PS to Principal Secretary to Government, TR&B Dept., The PS to Principal Secretary to Government Finance Department; The PS to Principal Secretary to Government EFS&T Department; The PS to Principal Secretary to Government Housing Department; The PS to Principal Secretary to Government I&I Department; The PS to Principal Secretary to Government Panchayat Raj Department; The PS to Principal Secretary to Government Energy Department; All the Departments in AP Secretariat, Hyderabad. SF/SC //FORWARDED :: BY ORDER// SECTION OFFICER NOTIFICATION In exercise of the powers conferred by section 18 of Andhra Pradesh Capital Region Development Authority Act, 2014 [Act 11 of 2014], the Government of Andhra Pradesh hereby makes the following amendment. AMENDMENT In the G.O 2 nd and 6 th read above, the item (f) of para -A, shall be substituted with the following: (f)The owners who gave their land in revenue villages viz.,Bethapudi, Navuluru, Yerrabalem, Penumaka and Undavalli, will get 450 sq.yds. of Commercial reconstituted land and 1000 sq.yds. of Residential reconsituted land and yearly payment of Rs.50,000/- for 10 years, with an yearly increase of Rs.5000/irrespective of category of land. GIRIDHAR ARAMANE PRINCIPAL SECRETARY TO GOVERNMENT SECTION OFFICER	<urn:uuid:71d8cb12-a169-4d7e-b802-09616644da0f>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	4,761
Usnesení vědecké rady Agronomické fakulty Mendelovy zemědělské a lesnické univerzity v Brně ze dne 23.listopadu 2009 1. Vědecká rada schvaluje: a) výsledky habilitačního řízení paní Ing. Jindřišky Kučerové, Ph.D. z Ústavu technologie potravin AF MZLU v Brně pro obor Zpracování zemědělských produktů. b) výsledky habilitačního řízení pana Dr. Ing. Josefa Kučery. z Ústavu chovu a šlechtění zvířat pro obor Obecná a speciální zootechnika. c) předměty, garanty a zkoušející v rámci bakalářských a magisterských státních zkoušek – součástí Přílohy usnesení. Příští zasedání VR se koná dne 25.ledna 2010 Prof. Ing. Ladislav Zeman, CSc. děkan AF Prof. Ing. Petr Spurný, CSc. proděkan AF \| Obor \| Předměty \| Garant předmětu/zkoušející \| Zkoušející \| \|------\|----------\|-----------------------------\|------------\| \| N-BO-BMO \| Biologické zpracování odpadů \| Ing. Jaroslav Zahora, CSc. \| Prof. Ing. Bohumír Groša, DrSc. \| \| N-BO-BMO \| Biotechnologie zpracování odpadů \| Prof. Ing. Bohumír Groša, DrSc. \| Ing. Tomáš Vítěz, Ph.D. \| \| N-BO-BMO \| Čistá produkce \| Doc. RNDr. Jana Kotková, Ph.D \| Mgr. Ing. Magdalena Vaverková \| \| N-BO-BMO \| Environmentální management \| Dr. Ing. Petr Maranda \| Ing. Eva Králková, Ph.D. \| \| N-BO-BMO \| Environmentální audit \| Dr. Ing. Petr Maranda \| prof. Ing. Jan Mareček, DrSc. \| \| N-BO-BMO \| Legální podpovědné hospodářství \| Prof. Ing. Jan Mareček, CSc. \| Ing. Eva Králková, Ph.D. \| \| N-FYTO-BR \| Biochemie rostlin \| Doc. Ing. Josef Zehnalík, CSc. \| Ing. Eva Králková, Ph.D. \| \| N-FYTO-BR \| Biologická a chemická ochrana rostlin \| Doc. Ing. Radovan Pokorný, Ph.D. \| doc. RNDr. Miroslav Pídra, CSc. \| \| N-FYTO-BR \| Biotechnologie rostlin v praxi \| Prof. RNDr. Ladislav Havel, CSc. \| doc. Ing. Jiří Fryč, CSc. \| \| N-FYTO-BR \| Biotechnologie rostlin v ochranné ŽP \| Prof. RNDr. Ladislav Havel, CSc. \| doc. Ing. Jiří Fryč, CSc. \| \| N-FYTO-BR \| Fyziologie růstu a vývoje a molekulární fyziologie \| Prof. Ing. Stanislav Procházka, DrSc. \| doc. RNDr. Miroslav Pídra, CSc. \| \| N-FYTO-BR \| Genetika rostlin \| Ing. Tomáš Výmink, PhD. \| doc. RNDr. Miroslav Pídra, CSc. \| \| N-FYTO-F \| Fytopatologie a entomologie \| Ing. Ivana Šafáriková, Ph.D. \| Prof. Ing. Emil Svoboda, CSc. \| \| N-FYTO-F \| Mechanizace \| Doc. Ing. Jan Červinka, CSc. \| Prof. Ing. Emil Svoboda, CSc. \| \| N-FYTO-F \| Podnikový management \| Prof. Ing. Emil Svoboda, CSc. \| Prof. Ing. Jan Kten, CSc. \| \| N-FYTO-F \| Precizní zemědělství \| Prof. Ing. Jan Kten, CSc. \| Ing. Lubomír Neudert, PhD. \| \| N-RL-RL \| Rostlinná výroba II \| Doc. Ing. Miroslav Jíži, CSc. \| Prof. Ing. Jar. Ehrenbergová, CSc. \| \| N-FYTO-F \| Systémy hnojení poháněch plodin \| Prof. Ing. Jaroslav Hlúsek, CSc. \| Prof. Ing. Jaroslav Hlúsek, CSc. \| \| N-RL-RL \| Živčedlní šíření rostlin \| Prof. Ing. Jaroslava Ehrenbergová, CSc. \| Prof. Ing. O. Chlopek, Dr.Sc. \| \| N-RL-RL \| Kytopatologie \| Doc. Ing. Radovan Pokorný, PhD. \| Ing. Jan Winkler, Ph.D. \| \| N-RL-RL \| Herbologie \| Ing. Vladimír Smuný, Ph.D. \| Ing. Jan Winkler, Ph.D. \| \| N-RL-RL \| Obecná produkce rostlinná \| Prof. Ing. Jan Kten, CSc. \| Ing. Vladimír Smuný, Ph.D. \| \| N-RL-RL \| Pěstování rostlin \| Ing. Radim Čertkal, Ph.D. \| Ing. Blanka Koconková, CSc. \| \| N-RL-RL \| Živčedlní šíření rostlin \| Doc. Ing. Hana Šeřová, Ph.D. \| Prof. Ing. MVDr. Tomáš Kampýra, CSc. \| \| N-TP-TP \| Hygiena a kontrola potravin \| Prof. Ing. MVDr. Tomáš Kampýra, CSc. \| MVDr. Jaroslav Palášek, CSc. \| \| N-TP-TP \| Mikrobiologie II \| Ing. Libor Kalhořka, Ph.D. \| Ing. Jiří Sochor, Ph.D. \| \| N-TP-TP \| Seronická analýza potravin \| Doc. Ing. Alžběta Jarovská, Ph.D. \| Mgr. Monika Szokolová, PhD. \| \| N-TP-TP \| Technologie potravin rostlinného původu \| Ing. Hana Šulecova, Ph.D. \| Ing. Miroslav Jíži, Ph.D. \| \| N-TP-TP \| Technologie potravin živočišného původu \| Dr. Ing. Luděk Hrvna \| Ing. V. Somiková, Ph.D. \| \| N-TP-TP \| Technologie potravin rostlinného původu \| Prof. Ing. Alžběta Jarovská, Ph.D. \| Doc. Ing. K. Šustová, PhD. \| \| N-TP-ZP \| Chemická a instrumentální analýza potravin \| Prof. Mgr. Dušan Vojtěch, Ph.D. \| Doc. Ing. Pavel Veselý, CSc. \| \|---------\|------------------------------------------\|---------------------------------\|-----------------------------\| \| N-TP-ZP \| Mikrobiologická analýza potravin \| MVDr. Olga Cwiklová, Ph.D. \| Prof. MVDr. Ing. Tomáš Komprda, CSc. \| \| N-TP-ZP \| Obecná a speciální hygiena potravin \| Prof. MVDr. Ing. Tomáš Komprda, CSc. \| MVDr. Olga Cwiklová, Ph.D. \| \| N-TP-ZP \| Výžva a funkční potraviny \| Prof. MVDr. Ing. Tomáš Komprda, CSc. \| Ing. Doubravka Kolenčíková, Ph.D. \| \| N-TP-ZP \| Legislativa a kontrola jakosti potravin \| MVDr. Olga Cwiklová, Ph.D. \| MVDr. Jaroslav Pálisk, CSc. \| \| N-TP-ZP \| Technologie potravin rostlinného původu \| Ing. Jindřich Kučerová, Ph.D \| Ing. Tomáš Gregor, Ph.D. \| \| N-TP-ZP \| Technologie potravin živočišného původu \| Prof. Ing. Jana Simeonovová, CSc.\| Ing. Doubravka Kolenčíková, Ph.D. \| \| N-ZOO-CHK \| Agronutrištníka \| Ing. Vladimír Mikule, Ph.D \| Doc. Ing. Iva Jiskrová, Ph.D. \| \| N-ZOO-CHK \| Chov a šlechtění koní \| Prof. Ing. Ladislav Žeman, CSc. \| Prof. Ing. Ladislav Žeman, CSc. \| \| N-ZOO-CHK \| Výžva a krmení koní \| Doc. Ing. Iva Jiskrová, Ph.D \| Doc. Ing. Iva Jiskrová, Ph.D. \| \| N-ZOO-CHK \| Nemoci koní a zoohygiena \| Prof. Ing. Ladislav Mácha, Ph.D.\| Prof. Ing. Ladislav Mácha, Ph.D. \| \| N-ZOO-KRM \| Reprodukce koní \| Prof. Ing. Emil Svoboda, CSc. \| Prof. Ing. Emil Svoboda, CSc. \| \| N-ZOO-CHK \| Podnikový management \| Prof. Ing. Gustav Chládek, CSc.\| Ing. Libor Sládek, Ph.D. \| \| N-ZOO-KRM \| Chov hospodářských zvířat \| Prof. Ing. Ladislav Žeman, CSc.\| Prof. Ing. Ladislav Žeman, CSc. \| \| N-ZOO-KRM \| Krmivářství \| Prof. Ing. Radek Tlipsk, Ph.D. \| Prof. Ing. Radek Tlipsk, Ph.D. \| \| N-ZOO-KRM \| Šlechtění hospodářských zvířat \| Ing. Radek Tlipsk, Ph.D. \| Ing. Radek Tlipsk, Ph.D. \| \| N-ZOO-KRM \| Výžva a krmení hospodářských zvířat II \| Prof. Ing. Ladislav Žeman, CSc.\| Prof. Ing. Ladislav Žeman, CSc. \| \| N-ZOO-KRM \| Zoohygiena a prevence chorob \| Dr. Ing. Zdeněk Havlíček \| MVDr. Jaromír Švára \| \| N-ZOO-KRM \| Zpracování živočišných produktů \| Prof. Ing. Jana Simeonovová, CSc.\| Prof. Ing. Jana Simeonovová, CSc. \| \| N-ZOO-RH \| Ekologie vodního prostředí \| Doc. RNDr. Ivo Sukopp, CSc. \| Doc. RNDr. Ivo Sukopp, CSc. \| \| N-ZOO-RH \| Hydrobiotika \| Ing. Karel van Koppen, Ph.D. \| Ing. Karel van Koppen, Ph.D. \| \| N-ZOO-RH \| Chov ryb \| Doc. Dr. Ing. Jan Mareš \| Doc. Dr. Ing. Jan Mareš \| \| N-ZOO-RH \| Jakost a zpracování ryb \| Doc. Ing. Alžběta Jarosová, Ph.D.\| Doc. Ing. Alžběta Jarosová, Ph.D. \| \| N-ZOO-RH \| Rybářství v tekoucích vodách \| Prof. Ing. Petr Spurný, CSc. \| Prof. Ing. Petr Spurný, CSc. \| \| N-ZOO-RH \| Výžva a krmení ryb \| Doc. Dr. Ing. Jan Mareš \| Doc. Dr. Ing. Jan Mareš \| \| N-ZOO-ZB \| Biotechnologie \| doc. Ing. Tomáš Urban, Ph.D. \| doc. Ing. Tomáš Urban, Ph.D. \| \| N-ZOO-ZB \| Biotechnologie ve slechtění zvířat \| Doc. Ing. Iva Jiskrová, Ph.D. \| Doc. Ing. Iva Jiskrová, Ph.D. \| \| N-ZOO-ZB \| Genetika zvířectví \| Prof. Ing. Josef Dvořák, CSc. \| Prof. Ing. Josef Dvořák, CSc. \| \| N-ZOO-ZB \| Management výzkumu a vývoje \| Prof. Ing. Josef Dvořák, CSc. \| Prof. Ing. Josef Dvořák, CSc. \| \| N-ZOO-ZB \| Molekulární biologie a genetika zvířat \| Prof. RNDr. Aleš Knoll, Ph.D. \| Prof. RNDr. Aleš Knoll, Ph.D. \| \| N-ZOO-ZB \| Výžva a porovnávání biotechnologií \| Doc. Ing. Pavel Veselý, CSc. \| Doc. Ing. Pavel Veselý, CSc. \| \| Názov \| Obsah \| Prednášajúci \| Asistent \| \|-------\|-------\|--------------\|----------\| \| N-ZOO-ZO \| Biotechnika reprodukcie \| Prof. Ing. Ladislav Mácha, DSc. \| Ing. Daniel Fiala, PhD. \| \| N-ZOO-ZO \| Chov hospodárskych zvierat \| Prof. Ing. Gustav Chládek, CSc. \| Ing. Radek Filipčík, Ph.D. \| \| N-ZOO-ZO \| Šlechtění hospodárských zvířat \| Prof. Ing. Ladislav Mácha, DSc. \| Ing. Radek Filipčík, Ph.D. \| \| N-ZOO-ZO \| Výživa a krmení hospodárských zvířat II \| Prof. Ing. Ladislav Zeman, CSc. \| \| \| N-ZOO-ZO \| Zoohygiena a prevence chorob \| Dr. Ing. Zdeněk Havlíček \| MVDr. Jaronit Štavara \| \| N-ZSO-ZO \| Zpracování živočišných produktů \| Prof. Ing. Jana Simeonová, CSc. \| \| \| N-ZS-AD \| Motory a motorová vozidla \| Doc. Ing. Miroslav Havlíček, CSc. \| Prof. Ing. František Bauer, CSc. \| \| N-ZS-AD \| Příslušenství motorových vozidel \| Ing. Jiří Čupera, Ph.D. \| Doc. Ing. Miroslav Havlíček, CSc. \| \| N-ZS-AD \| Technologie silniční nákladní dopravy \| Doc. Ing. Pavel Sedlák, CSc. \| \| \| N-ZS-AD \| Údržba a diagnostika \| Doc. Ing. Vladimír Chrast, CSc. \| Ing. Jiří Čupera, Ph.D. \| \| N-ZS-AD \| Zkušebnictví a management jakosti \| Doc. Ing. Marta Ščeboňová, CSc. \| Ing. Martin Fajman, PhD. \| \| N-ZS-AE \| Čistiš produkce \| Doc. RNDr. Jana Kovačová, Ph.D. \| Mgr. Ing. Magdalena Vaverková \| \| N-ZS-AE \| Krajinna ekologie \| RNDr. Pavel Trnka, CSc. \| Ing. Zbyněk Ulčák, Ph.D. \| \| N-ZS-MT \| Krajinné inženýrství \| Ing. Jana Kozlovská Dufová, Ph.D \| Ing. Jana Pochrázková, Ph.D \| \| N-ZS-AE \| Lesnictví \| Ing. Robert Knott, Ph.D. \| Ing. Pavel Ondr, CSc. \| \| N-ZS-AE \| Samace a relikviance \| Doc. Ing. Eduard Pokorný, Ph.D. \| \| \| N-ZS-AE \| Vodní hospodářství \| Ing. Věra Holubčíková \| Ing. Petra Opetková, Ph.D. \| \| N-ZS-MT \| Management mobilní techniky \| Prof. Ing. František Bauer, CSc. \| Doc. Ing. Pavel Sedlák, CSc. \| \| N-ZS-MT \| Management potravinářských liniek \| Ing. Josef Los, Ph.D. \| prof. Ing. Bořivoj Groda, Dr.Sc. \| \| N-ZS-MT \| Management stacionární techniky \| Doc. Ing. Jiří Fryč, CSc. \| Ing. Josef Los, Ph.D. \| \| N-ZS-MT \| Technický audit \| prof. Ing. Jan Mareček, DrSc. \| doc. Ing. Jan Červinka, CSc. \| \| N-ZS-MT \| Zkušebnictví management jakosti \| Doc. Ing. Marta Ščeboňová, CSc. \| Ing. Martin Tajman, PhD. \| \| N-ZS-RV \| Krajinné ekologie \| RNDr. Pavel Trnka, CSc. \| Doc. Dr. Ing. Milada Šťastná \| \| N-ZS-RV \| Krajinné a územní plánování \| RNDr. Pavel Trnka, CSc. \| Mgr. Ing. Hana Mrázová, Ph.D. \| \| N-ZS-RV \| Obnova venkova \| Ing. Jan Prudký, Ph.D. \| Ing. Jan Prudký, Ph.D. \| \| N-ZS-RV \| Pozemkové úpravy \| Prof. Ing. František Toman, CSc. \| Ing. Radovan Kulka, Ph.D. \| \| N-ZS-RV \| Sociologie venkova \| RNDr. Antonín Vašíček, CSc. \| \| \| N-ZS-RV \| Agronmisika \| Ing. Vladimír Mikula, Ph.D \| Ing. Silvie Kozlovská \| \| N-ZS-ZEI \| Podnikový management \| Prof. Ing. Emil Svoboda, CSc. \| Ing. Jiří Duda, Ph.D. \| \| N-ZS-ZEI \| Produkční systémy HZ \| Prof. Ing. Gustav Chládek, CSc. \| Ing. Daniel Falta, Ph.D. \| \| N-ZS-ZEI \| Systémy hnojení polních plodin \| Prof. Ing. Jaroslav Hušek, CSc. \| Doc. Tomáš Lošák, Ph.D. \| \| N-ZS-ZEI \| Systémy rostlinné výroby \| Prof. Ing. Jan Krejčí, CSc. \| Ing. Blanka Procházková, CSc. \| \| Názov \| Špecializácia \| Pracovník \| Pracovník \| \|-------\|--------------\|-----------\|-----------\| \| N-ZS-ZEI \| Šlechtění hospodářských zvířat \| Prof. Ing. Ladislav Mácha, DSc. \| Ing. Lubomír Neudek, Ph.D. \| \| \| \| \| Ing. Vladimír Smutný, CSc. \| \| \| \| \| Ing. Radek Filipčík, Ph.D. \| \| obor \| předměty \| garant předmětu/zkoušející \| zkoušející \| zkoušející \| \|-----------------------\|-----------------------------------------------\|----------------------------\|---------------------------------------------------------------------------\|---------------------------------------------------------------------------\| \| agrotechnologie \| environmentalistika \| Doc. RNDr. Jana Kotová, Ph.D. \| RNDr. Pavel Tinka, CSc. \| Ing. Zbyněk Ulčák, Ph.D. \| \| agrotechnologie \| malé vodní toky \| Ing. Petra Oprechtová, Ph.D. \| Ing. Věra Hrubáčková \| \| \| agrotechnologie \| ochrana přírody a krajiny \| JUDr. Mgr. Jaroslav Knoteč, Ph.D. \| Mgr. Ing. Hana Mrázková, Ph.D. \| Mgr. Pavel Vaněk \| \| agrotechnologie s \| protivrození ochrana plodů \| Ing. Jana Kozlovská-Dufková, Ph.D. \| Ing. Hana Pokladnáková, Ph.D. \| \| \| biotechnologie rostlin\| anatomie a fyziologie rostlin \| Prof. RNDr. Ladislav Havlíček, CSc. \| \| \| \| biotechnologie rostlin\| biochemie \| Doc. Ing. Josef Žehníček, CSc. \| \| \| \| biotechnologie rostlin\| genetika a molekul. biologie \| Ing. Tomáš Vyhnaněk, Ph.D. \| Doc. RNDr. Miroslav Půdra, CSc. \| \| \| fyrotechnika \| podniková ekonomika a marketing \| Prof. Ing. Iva Živělová, CSc. \| \| \| \| fyrotechnika \| ochrana rostlin \| Doc. Ing. Hana Šeřová, Ph.D. \| \| \| \| fyrotechnika \| rostlinná výroba I \| Doc. Ing. Miroslav Hlúšek, Ph.D. \| Prof. Ing. Jan Křen, CSc. \| Ing. Tamara Dryšlová, Ph.D. \| \| fyrotechnika \| rostlinná výroba II \| Prof. Ing. Jaroslav Hlúšek, CSc. \| Doc. Ing. Tomáš Lošík, Ph.D. \| \| \| podnikání v agrobyzny \| výživa a hnojení rostlin \| Ing. Bohdan Stejskal, Ph.D. \| Ing. Jaroslav Záhorn, CSc. \| \| \| podnikání v hospodářství \| biologické základy k komunální odpadu \| prof. Ing. Beňo Groda, DSc. \| \| \| \| podnikání v hospodářství \| technická zajištění pro odpad, hospodářství \| Ing. Tomáš Vítěz, Ph.D. \| prof. Ing. Beňo Groda, DSc. \| \| \| podnikání v hospodářství \| technologie v energetice odpadů \| Prof. Ing. Boho Groda, DSc. \| \| \| \| podnikání v agrobyzny \| ekonomika podniků v agrárním sektoru \| Prof. Ing. Beňa Groda, CSc. \| \| \| \| podnikání v agrobyzny \| systémy zemědělské výroby \| Prof. Dr. Ing. Jan Kuchlík \| \| \| \| podnikání v agrobyzny \| právo v podnikání \| Prof. Ing. Jan Křen, CSc. \| Prof. Ing. Jar. Ehrenbergerová, CSc. \| \| \| podnikání v agrobyzny \| zpracování zemědělských produktů \| Doc. Ing. Jana Šimeonová, CSc. \| Doc. Ing. Alžběta Jarosová, Ph.D. \| \| \| pozemkové úpravy \| geodetické a kartografie \| Ing. Miroslav Mařejík, Ph.D. \| \| \| \| pozemkové úpravy \| pozemkové úpravy \| Prof. Ing. František Tomán, CSc. \| Ing. Radmila Grmelová, CSc. \| \| \| pozemkové úpravy \| půdovzdušnost a geologie \| Ing. Jiří Jančák, CSc. \| \| \| \| provoz techniky \| dopravní a manipulační technika \| Prof. Ing. František Bauer, CSc. \| Doc. Ing. Pavel Sedláček, CSc. \| \| \| provoz techniky \| zkušené techniky \| Doc. Ing. Vladimír Christ, CSc. \| Ing. Radovan Kuklík, Ph.D. \| \| \| provoz techniky \| zeměděl. a potravinářská technika \| Doc. Ing. Jiří Fryč, CSc. \| Ing. Josef Los, Ph.D. \| \| \| rostlinolékařství \| ochrana polínků a zahrad. plodin \| Doc. Ing. Radovan Pokorný, Ph.D. \| \| \| \| rostlinolékařství \| pěstování polínků plodin \| Doc. Ing. Miroslav Hlúšek, CSc. \| Prof. Ing. Jar. Ehrenbergerová, CSc. \| \| \| rostlinolékařství \| výživa a hnojení rostlin \| Prof. Ing. Jaroslav Hlúšek, CSc. \| Ing. Pavel Ryant, Ph.D. \| \| \| Technologie potravin \| Doc. Ing. Pavel Stranil, Ph.D. \| \|---------------------\|--------------------------------\| \| Chemie a analýza potravin \| \| \| Microbiologie I \| Ing. Libor Kahouta, PhD. \| \| Prof. MVDr. Ing. Tomáš Komprda, CSc. \| Ing. Doubravka Kolenčíková, Ph.D. \| \| Výživa člověka \| Prof. Ing. Jana Simeonovová, CSc. \| \| Ing. Jindřiška Kučerová, PhD. \| Dr. Ing. Luděk Hřivna \| \| Technologie potravin \| Doc. Ing. Kateřina Šustrová, Ph.D. \| \| Hygiena potravin \| Doc. Ing. Jiří Schor, PhD. \| \| Technologie potravin \| Prof. MVDr. Ing. Tomáš Komprda, CSc. \| \| Chemie potravin \| Doc. Ing. Pavel Stranil, Ph.D. \| \| Doc. Ing. Alžběta Jaroslavová, Ph.D. \| Doc. Ing. Kateřina Šustrová, Ph.D. \| \| Technologie potravin \| Ing. Libor Kahouta, PhD. \| \| Mikrobiologie \| Mgr. Monika Soukupová, PhD. \| \| Technologie potravin \| MVDr. Olga Čwiklová \| \| Porumínářská legislativa \| MVDr. Jaroslav Pelášek, CSc. \| \| Doc. Ing. Alžběta Jaroslavová, Ph.D. \| Ing. Jiří Schor, PhD. \| \| Technologie potravin \| Ing. Miroslav Holý, Ph.D. \| \| Serozorníkova analýza \| Ing. Hana Sušecrova, Ph.D. \| \| Všeobecné zemědělství \| Doc. RNDr. Jana Kotovcová, Ph.D. \| \| Ochrana životního prostředí \| Ing. Václav Žďámal, Ph.D. \| \| Všeobecné zemědělství \| Doc. Dr. Ing. Milada Šťastná \| \| Podniková ekonomika \| Prof. Ing. Iva Živčová, CSc. \| \| Všeobecné zemědělství \| Ing. Ivana Blažková, Ph.D. \| \| Zemědělská produkce \| Ing. Jiří Sládanka, Ph.D. \| \| Prof. Dr. Ing. Jan Kuchřík \| Ing. Martina Lichovníková, Ph.D. \| \| Zpracování zem. produktů \| Ing. Lubomír Neudert, Ph.D. \| \| Zemědělská produkce \| Prof. Ing. Jana Simeonovová, CSc. \| \| Chov zvířat \| Ing. Dr. Luděk Hřivna \| \| Zootechnika \| Prof. Ing. Gustav Chladek, CSc. \| \| Zootechnika \| Prof. Ing. Marie Čechová, CSc. \| \| Podniková ekonomika a marketing \| Ing. Daniel Fala, Ph.D. \| \| Zootechnika \| Prof. Ing. Iva Živčová, CSc. \| \| Reprodukce hospodářských zvířat \| Ing. Martin Hošek, Ph.D. \| \| Zootechnika \| Prof. Ing. Ladislav Zeman, CSc. \| \| Výživa a krm. hospodářských zvířat I \| Prof. MVDr. Ing. Petr Doležal, CSc. \| \| Zootechnika \| Prof. Ing. Jan Šubert, CSc. \| \| Obecná zootechnika \| Prof. Ing. Marie Čechová, CSc. \| \| Zootechnika s ekonomikou a marketing \| Ing. Radek Filipčík, Ph.D. \| \| Zootechnika \| Prof. Ing. Gustav Chladek, CSc. \| \| Zootechnika \| Ing. Daniel Fala, Ph.D. \| \| Zootechnika \| Ing. Radek Filipčík, Ph.D. \|	<urn:uuid:190c0593-3826-4b00-ac74-7b9c88dcc413>	HuggingFaceFW/finepdfs/tree/main/data/ces_Latn/train	finepdfs	ces_Latn	21,373
REVISION DU ZONAGE D'ASSAINISSEMENT DES EAUX USEES DE LA COMMUNE DE INZINZAC-LOCHRIST ENQUETE PUBLIQUE DU 2 SEPTEMBRE AU 4 OCTOBRE 2024 CONCLUSION DU COMMISSAIRE ENQUETEUR Table des matières INZINZAC-LOCHRIST .......................................................................................................................... 13 1.RAPPEL DU PROJET. OBJET DE L'ENQUETE Lorient Agglomération exerce la compétence assainissement sur le territoire de la commune d'Inzinzac-Lochrist et souhaite réviser le zonage d'assainissement des eaux usées de la commune, en parallèle avec la modification du PLU . Cette révision du zonage d'assainissement a pour but de proposer les solutions techniques le mieux adaptées à la collecte, au traitement et au rejet des eaux usées. Le dernier plan de zonage annexé au PLU a été approuvé au conseil communautaire du 4 avril 2017. Cependant , la commune a procédé depuis cette date à une révision de son PLU approuvée le 4 novembre 2019 et modifié le 9 juin 2023. Afin de suivre les évolutions de l'urbanisation de la commune , il convient de réviser le zonage d'assainissement des eaux usées pour le rendre cohérent avec le PLU. Pour se mettre en conformité avec la réglementation, il est nécessaire de soumettre ce zonage à enquête publique, conformément à l'article L 2224-10 du code général des collectivités territoriales (CGCT) qui précise que : Les communes ou leurs établissements publics de coopération délimitent après enquête publique réalisée conformément au chapitre 3 du titre 2 du livre 1 er du code de l'environnement : * Les zones d'assainissement collectif où elles sont tenues d'assurer la collecte des eaux usées domestiques et le stockage, l'épuration et le rejet ou la réutilisation de l'ensemble des eaux collectées ; * Les zones relevant de l'assainissement non collectif où elles sont tenues d'assurer le contrôle de ces installations et, si elles le décident, le traitement des matières de vidange, et à la demande des propriétaires, l'entretien et les travaux de réalisation et de réhabilitation des installations d'assainissement non collectif. PRESENTATION DE LA COMMUNE La commune d'Inzinzac-Lochrist, d'une superficie de 4467 hectares, est bordée par le Blavet sur ses contours sud et est. Elle se situe à un peu plus de 15 kms au nord du centre-ville de Lorient et à une vingtaine de kms du littoral atlantique. Le recensement de la population de l'INSEE de 2019 comptabilise 6 548 habitants, avec une densité moyenne de 147 habitants au km2. La population d'Inzinzac-Lochrist est en nette augmentation depuis 1968, avec une augmentation moyenne de +0,6%. Ces 20 dernières années, la tendance s'est accentuée avec une augmentation moyenne annuelle de 1,8%. Concernant l'habitat, le nombre de logements suit également une croissance importante depuis 1968. La part des résidences secondaires reste stable et représente 2,7% des logements. Le taux d'occupation des résidences principales est en moyenne de 2,4 habitants en moyenne. Le Plan Local d'Urbanisme d'Inzinzac-Lochrist approuvé le 4 novembre 2019 a fait l'objet d'une modification approuvée le 9 juin 2023 qui vise notamment à développer l'urbanisation sur le secteur de Pen er Prat avec la création d'environ 75 logements. Le document d'urbanisme prévoit également une OAP rue Ambroise Croizat pour 30 à 35 logements supplémentaires. Sur le territoire d'Inzinzac-Lochrist, on recense une ZNIEFF de type 2, le bois de Trémelin qui couvre une surface de 655 ha. Les zones humides de la commune ont été inventoriées (2017/2018) et couvrent une superficie de 310 ha ( 7% de la commune). La commune est concernée par plusieurs périmètres de protection de captages d'eau potable : * Le périmètre de protection du captage de Coet Er Ver , avec une usine de production de 1000m3/H située sur le Blavet en amont d'Hennebont * Le périmètre de protection du captage de Langroise et du Kersalo avec une usine de production de 1000m3/h située également sur le Blavet en aval immédiat de Coet Er Ver. La commune est également concernée par un Plan de Prévention des Risques d'Inondation du Blavet aval (PPRI) La commune d'Inzinzac-Lochrist n'accueille pas d'activité conchylicole. La zone la plus proche se situe sur le Blavet à hauteur de la commune d'Hennebont. La partie amont de l'estuaire est non classée. La partie aval de l'estuaire du blavet est classé en catégorie B (qualité bactériologique moyenne) pour les groupes 2 (bivalves fouisseurs) et les groupes 3 (bivalves non fouisseurs). La commune est dans le périmètre du SCOT de Lorient. En matière de gestion des eaux, elle est concernée par le SDAGE Loire-Bretagne et par le SAGE Blavet. 2. APPRECIATION SUR LA QUALITE DU DOSSIER SOUMIS A ENQUETE Le dossier d'enquête se compose de l'ensemble des pièces nécessaires à la compréhension du dossier à savoir le rapport du zonage d'assainissement, l'évaluation environnementale associée ainsi que le plan de zonage qui fait apparaître sous différentes couleurs le zonage d'assainissement collectif (AC) existant dans sa version approuvée en 2017, le zonage rajouté en AC et le zonage supprimé. Les plans font également apparaître le réseau de canalisations de collecte des eaux usées. La qualité du dossier n'appelle donc pas de commentaires particuliers de ma part même si je considère que les plans auraient pu être présentés à une plus grande échelle pour une meilleure facilité de lecture. 3.APPRECIATION GENERALE SUR LE DEROULEMENT ET LE BILAN DE L'ENQUETE. AVIS SUR LES OBSERVATIONS DU PUBLIC L'enquête a été ouverte le 2 septembre 2024 à 9H et clôturée 4 octobre 2024 à 17 heures, pendant 33 jours consécutifs. Durant cette période, le commissaire enquêteur a été à la disposition du public trois demi-journées conformément à l'arrêté du président de Lorient Agglomération : [x] Le 2 septembre de 9 heures à 12 heures, [x] Le 18 septembre de 9 heures à 12heures, [x] Le 4 octobre de 14 heures à 17 heures. Les permanences se sont déroulées dans la salle du conseil de la mairie. L'ensemble du dossier, ainsi que le registre d'enquête, était déposé à l'accueil de la mairie et mis à la disposition de ceux qui le souhaitaient, aux heures d'ouverture de la mairie, siège de l'enquête, du lundi au vendredi. L'avis d'ouverture d'enquête publique (format A2) a été affiché devant la mairie et en différents points de la commune jusqu'à la fin de l'enquête (voir annexes : 7 points d'affichage, les affiches étant distinctement visibles depuis la voie publique). L'avis d'enquête a également été publié sur le site internet de la commune. Un certificat d'affichage a été établi et signé du maire, daté du 12 août 2024. Les avis dans la presse ont été publiés dans les délais réglementaires dans les quotidiens Ouest France et Le Télégramme les 16 août et 10 septembre 2024. Le dossier pouvait également être consulté sur le site internet de Lorient Agglomération www.lorient-agglo.bzh ou depuis un lien présent sur le site de la mairie d'Inzinzac-Lochrist www.inzinzac-lochrist.fr Le public avait la possibilité d'adresser ses observations par courrier électronique à l'adresse électronique suivante : firstname.lastname@example.org ou par voie postale en mairie d'InzinzacLochrist. Le bilan de l'enquête est le suivant : Nombre de visites : 2 Nombre d'inscriptions au registre : 2 Nombre de courriers ou de courriels :1 courrier de la mairie comportant cinq demandes de modification de zonage Lorient agglomération a apporté des réponses aux différentes observations formulées par le public. Je considère que ces réponses sont satisfaisantes. J'ai complété le tableau en faisant apparaître mes propres appréciations, point que je développerai ultérieurement. Les échanges avec la commune et Lorient agglomération ont été de nature à permettre un bon déroulement de l'enquête et ont permis de compléter l'information du commissaire enquêteur. En particulier, Lorient Agglomération a mis à ma disposition les documents suivants : * Le schéma directeur des systèmes d'assainissement collectif de Lorient Agglomération ( bureau d'études ARTELIA- Août 2020) . * Le diagnostic du réseau d'assainissement collectif des eaux usées-bassin de collecte gravitaire du PR rive gauche-commune d'Hennebont- rapport de phase 1-juin 2024-réalisé par le bureau d'études RPQeau. J'ai également pu consulter le PLU de la commune. CONCLUSIONS DU COMMISSAIRE ENQUETEUR : Je considère que l'organisation de l'enquête publique et sa publicité ont été convenablement réalisées. L'enquête s'est déroulée dans des conditions satisfaisantes. Le public avait la possibilité de s'exprimer dans de bonnes conditions. La clôture du registre, la remise du procès-verbal de synthèse et la réponse de la collectivité out pu être effectuées sans difficulté et dans les délais prévus. Je regrette simplement que cette enquête n'ait pas pu être menée en même temps que l'enquête relative à la modification du PLU qui s'est déroulée en 2023, ce qui aurait permis d'améliorer la lisibilité de l'ensemble. 4. CONCLUSION ET AVIS CONCERNANT LE PROJET DE REVISION DU ZONAGE D'ASSAINISSEMENT DES EAUX USEES DE INZINZAC LOCHRIST 4.1 DESCRIPTIF DU SYSTEME D'ASSAINISSEMENT COLLECTIF Les stations d'épuration, les postes de refoulement et les réseaux d'Inzinzac-Lochrist sont gérés en régie par Lorient Agglomération depuis le 1 er janvier 2023. Le réseau de collecte comprend : * 35,5 kms de réseau séparatif dont 34,4 kms de réseau gravitaire et 1,1 km de réseau de refoulement. * 1705 branchements d'eaux usées, * 3 postes de refoulement : un à Penquesten, un au bourg d'Inzinzac et un au bourg de Lochrist. La commune d'Inzinzac-Lochrist compte une seule station sur son territoire : la station de Penquesten qui présente une capacité nominale de 700 équivalents habitants (EH). Les effluents des bourgs d'Inzinzac et de Lochrist sont transférés vers la station d'épuration de La Becquerie sur la commune d'Hennebont qui dispose d'une capacité de 26 000 EH. Le taux de charge de la station de la Becquerie est de 83%, celle de Penquesten est de 28%. 4.2 L'ASSAINISSEMENT NON COLLECTIF(ANC) Le service d'assainissement non collectif (SPANC) est géré en régie. La commune d'Inzinzac-Lochrist compte 696 installations d'ANC. Les filières ont fait l'objet de contrôles et sont classées suivant les critères de l'Agence de l'eau. D'après ce classement, 41% des installations de la commune d'Inzinzac-Lochrist, classées NA et Aseraient à réhabiliter dans le cadre d'une vente ou dans les quatre ans suivant le contrôle de fonctionnement. 4.3 APPRECIATION SUR LA DELIMITATION DU ZONAGE DES EAUX USEES Il s'agit ici d'apprécier la pertinence des zonages proposés, sachant qu'il s'agit ici d'une révision du zonage élaboré en 2017. Le nouveau zonage d'assainissement des eaux usées prend particulièrement en compte : * Une parcelle classée U au PLU (rue Ambroise Croizat) qui a été classée en zonage d'assainissement non collectif en 2017, et qui bascule en assainissement collectif : 19 lots avec un permis d'aménager en cours d'instruction. * L'ouverture à l'urbanisation du secteur de Pen Ar Prat (zonage 2AUa devenant 1AUb suite à la modification du PLU de 2023), qui prévoit la construction de 75 nouveaux logements sur une zone de 3ha avec une densité de 25 logements/ha. * Le complexe sportif et polyvalent à Mané Braz pour lequel le zonage est ajouté en assainissement collectif. Il est prévu un nouveau gymnase de 1000 places assises, un dojo et une salle polyvalente de 250 personnes (PC accordé en mars 2023) Le raccordement de ces 3 projets se fera sur la station d'épuration de La Becquerie à Hennebont et reposent sur les données de la modification du PLU de 2023. Concernant le secteur de Penquesten, l'urbanisation se fera dans le cadre de l'OAP n°4 « Penquesten » qui prévoit la création sur 3 emprises de 55 logements tous raccordés à l'assainissement collectif et déjà classés en zone d'assainissement collectif. Pour chaque secteur, une étude technico-économique a été réalisée pour déterminer la solution d'assainissement optimale qui conclut à proposer les secteurs de Pen Ar Prat et « Ambroise Croizat » en zonage d'assainissement collectif. Je rejoins cette analyse qui paraît justifiée et qui ne fait pas de doute compte tenu de la proximité des réseaux existants et la densité de construction au sein de chaque opération. Au cours de l'enquête plusieurs propositions ont été émises, notamment par la commune d'InzinzacLochrist, pour faire basculer en zone d'assainissement collectif des secteurs ou des parcelles classées agricoles (A) ou naturelles (N) . Je ne suis pas favorable à ces demandes de modifications, comme je l'ai exposé au chapitre 3 dans la mesure où le zonage d'assainissement doit être cohérent avec le document d'urbanisme. Le zonage d'assainissement n'est pas un document d'urbanisme. Par contre, le zonage d'assainissement est une annexe obligatoire du PLU au titre de l'article R151-53 du code de l'urbanisme, et à ce titre, il doit être cohérent avec les dispositions du PLU. CONCLUSION DU COMMISSAIRE ENQUETEUR SUR LE PROJET DE ZONAGE: J'émets un avis favorable au projet de zonage proposé par Lorient Agglomération, et mis à l'enquête, en proposant 2 modifications : * Intégration en zonage AC des équipements sportifs existants sur le secteur de Mané Braz dans les conditions précisées par Lorient Agglomération (observation C1-5) * Intégration en zonage AC de la parcelle AC 349 (observation R2), correction à apporter pour cet oubli sur le plan de zonage. 4.4 INCIDENCES DU ZONAGE SUR LA PRESERVATION DE LA QUALITE DU MILIEU RECEPTEUR J'ai interrogé Lorient agglomération sur plusieurs points concernant l'assainissement non collectif, les suites données au schéma directeur d'assainissement pour améliorer les conditions de fonctionnement du système d'assainissement de la Becquerie, et enfin sur le niveau de renouvellement des équipements Je n'ai pas interrogé Lorient Agglomération sur le système d'assainissement de Penquesten où le taux de charge est faible avec une station qui peut supporter la nouvelle urbanisation prévue dans ce secteur. A une question du commissaire enquêteur sur la fréquence des contrôles des ANC et les opérations groupées de réhabilitation, Lorient agglomération a apporté les réponses suivantes : Pour les installations existantes, la fréquence des contrôles de fonctionnement est fixée dans le règlement de service à 6 ans pour les installations de capacité inférieure à 20 EH. Les filières de traitement de capacité supérieure ou égale à 20 EH sont visitées chaque année. Les contrôles périodiques portent sur l'évaluation de la conformité et sur le fonctionnement à savoir la vérification de : - L'état des ouvrages, ventilations, accessibilité ; - L'écoulement des effluents dans l'ensemble du dispositif ; - L'accumulation normale des boues et flottants à l'intérieur de la fosse ; - L'état des bacs dégraisseurs lorsqu'ils existent et des ouvrages annexes éventuels ; - La qualité des rejets au milieu hydraulique superficiel si le type d'installation impose un rejet ; - Le bon entretien de l'installation et notamment la réalisation périodique des vidanges. Il n'y a plus d'opérations groupées de réhabilitation des ANC depuis que l'Agence de l'Eau ne finance plus ce type d'opérations. Lorient Agglomération fait des relances régulièrement des propriétaires dont l'installation n'est pas aux normes. Pour les installations d'assainissement non collectif, la priorité est donnée aux propriétés non conformes lors d'une cession immobilière. Les propriétaires ont un an pour se remettre aux normes. En cas de non-respect de ce délai, Lorient Agglomération envoie une mise en demeure et au bout d'un an sans travaux et applique une pénalité de 600 € par année tant que les travaux de mise en conformité ne sont pas réalisés. Commentaire du CE :la fréquence de contrôle des ANC est conforme aux préconisations du SAGE Blavet. Question du CE sur la station d'épuration d'Hennebont : Le schéma directeur d'assainissement réalisé par Artélia évoquait, pour retarder l'échéance de la saturation de la station d'épuration de Hennebont La Becquerie, la possibilité de délester une partie du réseau d'Hennebont et de le raccorder sur la station de Lanester. Cette possibilité de délestage n'est pas évoquée dans le dossier soumis à enquête. Est-ce toujours d'actualité ? La station de Lanester dispose-t-elle d'une réserve de capacité ? Réponse de Lorient Agglomération : Cette solution est toujours d'actualité mais nous n'avons pas programmé ces travaux pour l'instant. La STEP de Lanester est en capacité de recevoir ces eaux usées supplémentaires. Il faudra cependant travailler sur la réduction des eaux parasites sur le réseau d'Hennebont comme celui de Lanester avant de raccorder. A une question du commissaire enquêteur sur le diagnostic du bassin de collecte gravitaire du PR Rive gauche sur la commune de Hennebont (juin 2024), sur les suites qui seront données à cette étude en termes de planning et d'investissement, ainsi que le gain attendu sur le volume d'eaux parasites (ratio coût/bénéfice) ? Lorient Agglomération a apporté les réponses suivantes : Suite à cette 1 ère campagne d'investigations de terrain, nous allons lancer des travaux de réhabilitation du réseau d'assainissement proposés par RPQEAU et visant à la suppression des points d'entrée d'eaux claires parasites. Dans ces travaux, 110 anomalies se rapportent à la partie privée des branchements individuels. Nous allons donc lancer des contrôles de branchements sur les bâtiments afin de vérifier la conformité des branchements. Les propriétés non-conformes devront se mettre en conformité avant une contre visite. Cette phase travaux est programmée en automne 2024. Le montant global pour ces travaux de réhabilitation est estimé à 330 860 € HT. Le gain attendu est de 42.5 m3/h. Les anomalies de priorité 1 représente 64% du débit global d'eaux claires parasites d'infiltration. Après travaux, le diagnostic sera complété par une 2 ème campagne d'investigations complémentaires de terrain afin d'identifier les secteurs présentant des points d'entrées d'eaux claires parasites puisque l'on sait que lorsque les infiltrations seront réparées, l'eau cherchera un nouveau passage. Une seconde série de travaux sera donc réalisée avant un ultime contrôle des résultats. A la question du commissaire enquêteur sur les travaux de renouvellement de réseaux à Inzinzac Lochrist, Lorient Agglomération a apporté les réponses suivantes : Depuis 2015, date du Schéma directeur Lorient Agglomération a réalisé sur le territoire d'InzinzacLochrist 875 ml d'extension et a renouvelé ou réhabilité 4880,30 ml de réseau soit 13,74 % du réseau. Pour l'année 2025, il est prévu 325 ml de réhabilitation de réseau et une extension d'environ 300 ml. La plupart des réseaux identifiés au schéma directeur ont été réhabilités, ainsi que le poste du Gorée. Pour l'avenir, il faudra mener de nouvelles investigations sur la commune pour repérer les réseaux amenant des eaux parasites à la station de la Becquerie. Les contrôles de branchements vont également se poursuivre pour obtenir des remises aux normes. Question du CE :Lorient Agglomération a-t-elle défini une politique en matière de renouvellement des réseaux d'eaux usées afin de préserver les milieux récepteurs ? Réponse de Lorient Agglomération : La priorité est mise dans les secteurs où il existe des débordements et sur les systèmes d'assainissement non conformes, dont fait partie la STEP de la Becquerie. Pour le moment la côte, la rade au sens large et le secteur du Ter ont été identifiés comme étant les secteurs les plus sensibles. Cela a conduit Lorient Agglomération à lancer de nouvelles campagnes de diagnostic du réseau sur de grands bassins versants comprenant parfois plusieurs postes de relevage, dont le bassin versant Rive Gauche à Hennebont. Ce diagnostic réalisé par un bureau d'études est complet : - Analyse des données des postes pour repérer les secteurs potentiellement pourvoyeur en eaux parasites, - Inspections nocturnes, - Tests à la fumée, - Contrôles de branchement, - Inspections caméra pour repérer le moindre défaut qui peut aller d'une casse de réseau à une petite infiltration, un regard sous voirie ou des boites de branchements non étanches. A l'issue de ce travail de diagnostic, des fiches anomalies sont établies et des travaux réalisés pour rectifier ces défauts. Le second hiver et à la suite des premiers travaux le bureau d'études refait ce travail d'investigation complet pour vérifier s'il n'existe pas de nouvelles infiltrations. Cette nouvelle campagne est suivie de travaux et la dernière année le bureau d'études vérifie l'impact à partir de l'analyse des données. Pour finir, suite au schéma directeur l'objectif de renouvellement des réseaux sur le territoire de Lorient Agglomération a été fixé par les élus à hauteur de 1,15% du réseau total par an. Cet objectif est ambitieux mais pas toujours tenable selon les années et la complexité des projets. Pour l'année 2023, 1,19% du réseau a été renouvelé ou réhabilité. CONCLUSION DU COMMISSAIRE ENQUETEUR : je considère que la révision du zonage d'assainissement n'aura pas d'effet notable sur le fonctionnement des systèmes d'assainissement et sur la qualité des rejets. Je note que Lorient Agglomération mène une politique très volontariste avec la mise en œuvre de son schéma directeur, une politique de renouvellement de réseaux ambitieuse, et la réalisation d'opérations plus ciblées pour lutter contre les eaux parasites comme par exemple sur le bassin versant du poste de refoulement rive gauche à Hennebont. 4.5 AVIS SUR LE PROJET DE REVISION DU ZONAGE DES EAUX USEES DE LA COMMUNE DE INZINZAC-LOCHRIST Après avoir : * Pris connaissance du dossier d'enquête mis à disposition du public, * Procédé à une visite du territoire communal, et des équipements d'assainissement, * Tenu trois séances de permanence, * Entendu les personnes en charge de ce dossier à Lorient Agglomération et à la mairie de Inzinzac-Lochrist, * Pris connaissance du mémoire en réponse de Lorient Agglomération au procès-verbal de synthèse et aux questions du commissaire enquêteur, Estime : * Que l'objectif de mettre en cohérence le zonage d'assainissement des eaux usées avec les objectifs d'urbanisation du PLU de Inzinzac-Lochrist est atteint, * Que le projet de zonage des eaux usées est pertinent et cohérent avec le document d'urbanisme * Que le projet de zonage des eaux usées va permettre à la commune d'Inzinzac-Lochrist de mener à bien ses projets d'urbanisation sur des parcelles classées en zonage U au PLU mais qui étaient classées jusqu'à présent en zonage d'assainissement non collectif. * Que le projet de zonage des eaux usées ne produira pas d'effet négatifs sur le milieu récepteur et l'environnement, * Que des actions sont en cours pour limiter les surcharges hydrauliques sur le système d'assainissement alimentant la station de La Becquerie, * Que le projet est d'intérêt général, J'émets donc un AVIS FAVORABLE Au projet de révision du zonage des eaux usées de la commune de Inzinzac- Lochrist en proposant 2 modifications mineures développées au chapitre 4.3 Cet avis est assorti de la recommandation suivante : * Poursuivre les travaux du schéma directeur d'assainissement et mettre en œuvre les mesures préconisées pour supprimer les anomalies constatées sur le réseau (eaux parasites, mauvais branchements,…) Fait à Séné le 28/10/2024 Le commissaire enquêteur Jean Yves Kerdreux	<urn:uuid:8863ac92-6d42-4027-999b-a760064170d5>	HuggingFaceFW/finepdfs/tree/main/data/fra_Latn/train	finepdfs	fra_Latn	23,595
Zagraniczne praktyki drogą do rozwoju zawodowego Centrum Kształcenia Zawodowego i Ustawicznego w Mrągowie również umożliwi młodzieży wyjazd na zagraniczne staże do Hiszpanii. Starostwo Powiatowe w Mrągowie otrzymało dofinansowanie ze środków programu POWER - Program Operacyjny Wiedza Edukacja Rozwój 2014-2020, który jest współfinansowany z EFS w ramach projektu „Międzynarodowa mobilność edukacyjna uczniów i absolwentów oraz kadry kształcenia zawodowego”. W ramach projektu pn. „Zagraniczne praktyki drogą rozwoju zawodowego” realizowanego przez Centrum Kształcenia Zawodowego i Ustawicznego w Mrągowie uczniowie odbędą 4-tygodniowe staże zawodowe w Granadzie lub Alicante w Hiszpanii. Szanse na taki wyjazd będą mieli uczniowie klas trzecich w zawodach technik pojazdów samochodowych, technik informatyk, technik przetwórstwa mleczarskiego oraz technik organizacji reklamy. W związku z ograniczoną liczbą miejsc, do wyjazdu zostaną zakwalifikowani uczniowie spełniający warunki formalne i z największą liczbą uzyskanych punktów przed Komisją Rekrutacyjną. Wyjazdy na staże zagraniczne są w całości dla uczniów bezpłatne. Odbędą również bezpłatnie zajęcia z języka hiszpańskiego i angielskiego. Na miejscu w czasie wolnym czekają na nich ciekawe wycieczki i poznawanie regionów, gdzie będą przebywać. Otrzymają także kieszonkowe na drobne wydatki. Regulamin i stosowne formularze znajdują się poniżej w "Plikach do pobrania" oraz na stronie szkoły. „Międzynarodowa mobilność edukacyjna uczniów i absolwentów oraz kadry kształcenia zawodowego” Projekt realizowany ze środków PO WER na zasadach Programu Erasmus+ sektor Kształcenie i szkolenia zawodowe UCZNIOWIE I UCZENNICE CENTRUM KSZTAŁCENIA ZAWODOWEGO I USTAWICZNEGO w MRĄGOWIE III KLASY TECHNIK POJAZDÓW SAMOCHODOWYCH III KLASY TECHNIK INFORMATYK Skorzystajcie z szansy! Rozpoczynamy nabór do projektu „Zagraniczne praktyki drogą do rozwoju zawodowego” Udział w projekcie to niepowtarzalna szansa na odbycie w kwietniu/maju 2021 r. bezpłatnego 4-tygodniowego stażu zawodowego w Walencji lub Alicante (Hiszpania) co pozwoli na podniesienie kwalifikacji zawodowych oraz da możliwość zapoznania się z zagranicznym modelem pracy w branży samochodowej i informatycznej. Staż pozwoli także na doskonalenie języka angielskiego i poznanie języka hiszpańskiego. WARUNKI REKRUTACJI: WYMAGANIA FORMALNE: - złożenie formularza zgłoszeniowego wraz z załącznikami, - dobry stan zdrowia, - zgoda rodziców na wyjazd KRYTERIA PUNKTOWE: Kryteria opisane są w regulaminie rekrutacji oraz formularzu rekrutacyjnym. Zakwalifikowani uczestnicy wezmą udział przed wyjazdem w obowiązkowym przygotowaniu pedagogicznym, kulturowym i językowym. Formularz zgłoszeniowy należy złożyć wraz z załącznikami do Dyrektora szkoły. NA ZGŁOSZENIA CZEKAMY DO DNIA 5 listopada 2020 R. (godz. 14.00) Druk formularza zgłoszeniowego jest dostępny: - u Dyrektora - na stronie internetowej szkoły - na stronie internetowej Starostwa Powiatowego w Mrągowie “Międzynarodowa mobilność edukacyjna uczniów i absolwentów oraz kadry kształcenia zawodowego” Projekt realizowany ze środków PO WER na zasadach Programu Erasmus+ sektor Kształcenie i szkolenia zawodowe UCZNIOWIE I UCZENNICE CENTRUM KSZTAŁCENIA ZAWODOWEGO I USTAWICZNEGO w MRĄGOWIE III KLASY TECHNIK PRZETWÓRSTWA MLECZARSKIEGO III KLASY TECHNIK ORGANIZACJI REKLAMY Skorzystajcie z szansy! Rozpoczynamy nabór do projektu „Zagraniczne praktyki drogą do rozwoju zawodowego” Udział w projekcie to niepowtarzalna szansa na odbycie w maju/czerwcu 2021 r. bezpłatnego 4-tygodniowego stażu zawodowego w Granadzie lub Alicante (Hiszpania) co pozwoli na podniesienie kwalifikacji zawodowych oraz da możliwość zapoznania się z zagranicznym modelem pracy w branży mleczarskiej i reklamowej. Staż pozwoli także na poznanie języka hiszpańskiego oraz doskonalenie języka angielskiego WARUNKI REKRUTACJI: WYMAGANIA FORMALNE: - złożenie formularza zgłoszeniowego wraz z załącznikami, - dobry stan zdrowia, - zgoda rodziców na wyjazd KRYTERIA PUNKTOWE: Kryteria opisane są w regulaminie rekrutacji oraz formularzu rekrutacyjnym. Zakwalifikowani uczestnicy wezmą udział przed wyjazdem w obowiązkowym przygotowaniu pedagogicznym, kulturowym i językowym. Formularz zgłoszeniowy należy złożyć wraz z załącznikami do Dyrektora szkoły. NA ZGŁOSZENIA CZEKAMY DO DNIA 5 listopada 2020 R. (godz. 14.00) Druk formularza zgłoszeniowego jest dostępny: - u Dyrektora - na stronie internetowej szkoły - na stronie internetowej Starostwa Powiatowego w Mrągowie -	f56851d4-92dd-46fa-ac90-3e3b4844232e	HuggingFaceFW/finepdfs/tree/main/data/pol_Latn/train	finepdfs	pol_Latn	4,533
No, You Can't Claim Arctic Ice Is "Recovering" Drawing by lilmallugirl/Shutterstock Sigh. Here we go again. The Daily Mail and Mail Online are to scientific accuracy what a sledgehammer is to an egg. Especially when it comes to global warming. Advertisement David Rose is oftentimes the wielder of that sledgehammer. He's written error-laden climate articles in the past, like saying that global warming has stopped (no, it hasn't), that the world is cooling (no, it really really isn't), and that the Intergovernmental Panel on Climate Change had to hold a crisis meeting because Rose's articles have caused such a fuss (that meeting never happened, which Rose had been told several times, but he still made the claim). Other examples abound. This time, in Sunday's Mail Online he writes that Arctic sea ice, which hit a major record low in 2012, "has expanded for the second year in succession." This claim is a humdinger, and typical denial double-speak. It's technically true, but also really wrong. It's like examining someone who has a 106° fever and saying it's really made their skin glow. But what do you expect from an article that has this breathless headline: Myth of arctic meltdown: Stunning satellite images show summer ice cap is thicker and covers 1.7million square kilometres MORE than 2 years ago...despite Al Gore's prediction it would be ICE-FREE by now "Myth of arctic meltdown" is enough to tell you just how slanted and wrong the conclusions of this article will be … and the inclusion of Al Gore's name brings it home. Mentioning Gore is at best a distraction, red meat to the deniers. Gore isn't a climate scientist, and as we well know actual climate scientists overwhelmingly agree that the world is warming. One of the outcomes of this is the decline of Arctic sea ice. Briefly: Arctic sea ice reaches a minimum in late September every year. The overall trend for the amount of ice at that time is decreasing; in other words, there is less ice all the time. Some years there is more than others, some less. But the trend is down, down, down. In 2012, a mix of unusual causes created conditions where the minimum reached a record low, far below normal. The next year, in 2013, the ice didn't reach quite so low a minimum extent, and this year looks very much the same as 2013. But saying the ice is "recovering" is, to put it delicately, what comes out the south end of a north-facing bull. You can't compare two years with a record low the year before that was due to unusual circumstances; you have to look at the average over time. Of course, if you do, your claims that global warming isn't real melt away. Arctic ice extent for 2012–2014, with the average for 1981–2010 in black. Graph by NSIDC The black line is the average for 1981–2010. The gray region shows the ±2 standard deviation extent for that average; statistically speaking it's an expected range of extent (it's actually more subtle than that, but that's enough to understand what's going on here). The dashed line shows the 2012 ice extent, and is clearly very low, well outside the expected range. The brown line is 2013, and the light green line is this year, 2014, up to late August. Notice 2014 follows the year before pretty closely. Note also they are well below average, near the bottom of the expected range. If you look at any recent year's ice it's below average; you have to go back to 2001 to find an ice extent near the average. So the claim that the ice is "recovering" is made based on the wrong comparison. Compare the past two years to the overall trend and they fit in pretty well with overall decline. Also, that "recovery" claim cannot be made with only two data points. Two years is not a trend. There have been many times ice has gone up over a year or two in the Arctic, only to drop once again over the long run. Sea ice anomaly, showing annual ice extent versus an average value. Graph by NSIDC That's also from NSIDC, and it shows the ice extent for August of every year from 1979 to 2013. Yes, in 2013 it goes up, but note: 1) There are several times it jumps up for a year or so, but 2) the overall trend is down. Looking at two data points in a row and ignoring everything else is incredibly misleading at best. David Appell at Quark Soup shows this very clearly as well. There's plenty more to debunk about Rose's article, but this shows that his central premise is dead wrong. You absolutely cannot say Arctic ice is recovering, and in fact everything we know—like rising temperatures, and how the Arctic is more sensitive to warming than the rest of the world on average, and the obvious long-term trend—is that we are still losing Arctic sea ice at an alarming rate. And don't believe the tired malarkey you might hear about Antarctic sea ice increasing; that has nothing to do with any of this, and is hugely offset by the tremendous land ice loss every year anyway. What makes this even more aggravating is that there's nothing new here. This claim of Arctic ice recovering was made last year, and it was just as wrong then as it is now. It's shameful. Global warming is real, it's a huge problem, and it's our own damn fault. There's still time to fix this, though that breathing room is getting slimmer all the time … and it's not helping when media give air to deniers. Correction, Sept. 1, 2014: In the original version explaining the first graph, I wrote "temperature" when I meant "extent." My apologies for any confusion.	<urn:uuid:1cbf9562-7191-4900-bbc3-7d780bbcc2f5>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	5,484
Model NR50 Series Residential Tankless Water Heater Specification Sheet * Standard Input - gas consumption ranges from 19,000 BTUh (NG) and 20,000 BTUh (LPG) up to 120,000 BTUh * Capacity Range - flow rates from 0.5 gpm up to 5.0 gpm * Compact Design - ANSI Z21.10.3/CSA 4.3 certified design that can be installed outdoors * Durable Steel Casing with Polyester Coating * No Venting Required - Outdoor (-OD) model does not require any additional stainless steel venting * Direct Electronic Ignition * Energy Factor - 0.82 for NG and LP * Thermal Efficiency - 83% efficient for use with natural gas or propane * Temperature Controls - includes 120°F (default), 130°F, 135°F, or 140°F standard temperature settings* * Safety Devices - Flame Sensor, Overheat Prevention Device, Lightning Protection Device * Additional Features - Temperature Lockout, Flow Meter Alarm, Optional Freeze Protection * 12-Year** Limited Heat Exchanger Warranty for Residential Use * 5-Year Limited Parts Warranty * 1-Year Reasonable Labor * Approvals - CSA (US only), UPC*, NSF, Low NOx Approved By SCAQMD (Rule 1146.2), Suitable for Installation in a Manufactured (Mobile) Home** * Optional remote thermostat can precisely adjust the output temperature from 100°F to 160°F in 5°F intervals 3-Year Heat Exchanger warranty if supplied with pre-heated or circulated water, refer to the Noritz Limited Warranty for complete coverage details * This product complies with California AB 1953 Low Lead Law **** Manufactured (Mobile) Home approval is valid for OD models only NORITZ AMERICA CORPORATION 11160 Grace Avenue, Fountain Valley, CA 92708 Tel. 1-866-7NORITZwww.noritz.com This model is eligible for the Federal tax credit of up to 10% of the water heater and installation costs (up to $300) when installed in a residence between 1/1/2011 through 12/31/2011 Model NR50 - OD Accessories Remote Controller (#RC-7649M) Remote Controller Cord (#RC-CORD10) Pipe Cover (#PC-1S) Isolator Valves (#IK-WV-7) Recess Box for OD Model (#RB-500) Freeze Protection Kit (#SKG7772) Dimensions \| \| NR50-OD \| \|---\|---\| \| HOT WATER OUTLET \| 1.8" \| \| COLD WATER INLET \| 1.9" \| \| GAS INLET \| 2.0" \| Flow Rates Specifications \| Model Name \| \| \|---\|---\| \| Weight \| \| \| Water Holding Capacity \| \| \| Connection Sizes \| Water Inlet \| \| \| Hot Water Outlet \| \| \| Gas Inlet \| \| Power \| Supply \| \| \| Consumption \| \| Temperature Settings \| \| \| Default Temperature Options \| \| Noritz America reserves the right to discontinue, or change at any time, the designs and/or specifications of its products without notice. Rev. 2/11	<urn:uuid:55385898-5327-418a-bb64-5cd901c60bb6>	HuggingFaceFW/finepdfs/tree/main/data/eng_Latn/train	finepdfs	eng_Latn	2,607

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.