text stringlengths 1 18.8k | meta dict |
|---|---|
Published: July 5, 2018
Introduction {#sec1}
============
The small GTPase RAS family proteins (KRAS, NRAS, and HRAS) are controlled through the exchange of the GDP-bound form for the GTP-bound one, which then allows RAS to bind various effectors, such as RAF, phosphoinositide 3-kinase (PI3K), and RALGDS ([@bib6], [@bib10], [@bib26], [@bib42], [@bib44]). RAS-associated signaling pathways play important roles in multiple cellular functions, such as cell growth, migration, adhesion, survival, and differentiation. The mutations at hotspots (G12, G13, and G61) in the *RAS* genes cause accumulation of the GTP-bound form due to defective intrinsic GTP hydrolysis activity and resistance to GTPase-activating proteins ([@bib34]). These oncogenic mutations in the *RAS* genes are observed in approximately 30% of all human cancers. *KRAS* is one of the most widely known oncogenes and is frequently found to be mutated in colorectal, pancreatic, and lung cancers ([@bib1]).
Oncogenic *KRAS* has been reported to play a significant role in stem cell activities in some types of cancers. For example, it has been shown that oncogenic *KRAS* in colon cancers enhances the embryonic stem (ES) cell-like program during human colon cancer initiation from adenoma to carcinoma, and activates cancer stem cell (CSC) properties in *APC*-mutated cells through the MAPK pathway ([@bib20], [@bib27]). In addition, oncogenic *KRAS* has been reported to enhance stemness in CSCs in pancreatic cancers through the PI3K/AKT/mammalian target of rapamycin pathways ([@bib24]).
The mutations in the RAS pathway are known to be involved not only in cancers, but also in other disorders including a series of congenital diseases and an acquired hemato-immunological disease, namely, RAS-associated autoimmune lymphoproliferative syndrome (ALPS)-like disease (RALD). RALD has been reported as a disease affecting the hemato-immune system, caused by a somatic *KRAS* or *NRAS* mutation in hematopoietic lineage cells. RALD patients exhibit ALPS- and/or juvenile myelomonocytic leukemia-like symptoms, including autoimmune cytopenia, lymphadenopathy, and hepatosplenomegaly ([@bib29], [@bib38], [@bib39]). Moreover, a RALD patient exhibiting intestinal Behcet\'s disease-like phenotypes was reported ([@bib28]). In RALD, individual patients have clones with *KRAS* or *NRAS* mutation and wild-type clones together in hematopoietic lineage cells in a mosaic state, allowing the generation of a set of isogenic induced pluripotent stem cell (iPSC) clones from the same patients. RALD patient-derived iPSCs therefore represent a unique experimental tool that is useful for studying basic RAS biology, particularly the roles of KRAS on stemness maintenance in the context of PSCs.
In the culture of human embryonic stem cells (ESCs) and iPSCs, basic fibroblast growth factor (bFGF) is essential to maintain their stemness through activating the MAPK and PI3K pathways. If human ESCs and iPSCs are cultured without bFGF, they lose their stemness and start to differentiate ([@bib8], [@bib12], [@bib19], [@bib21], [@bib22]). These observations clearly demonstrate the importance of bFGF-mediated signaling for the maintenance of human iPSCs and ESCs. However, it remains largely unknown how the status of effector molecules including KRAS located downstream in bFGF signals affects stemness maintenance in human iPSCs.
Here, we investigated the roles of KRAS on stemness maintenance in the context of human iPSCs by using isogenic *KRAS* mutant (G13C/WT) and wild-type (WT/WT) iPSCs, generated from two RALD patients with the same somatic *KRAS* mutation. By genome-editing techniques, we succeeded in generation of "gene-corrected" wild-type iPSCs (WT^ed^/WT) and heterozygous knockout iPSCs (Δ^ed^/WT), both of which could serve as relevant controls for the experiments. Using this series of isogenic iPSCs, we determined how the status of *KRAS* could impact upon stemness maintenance in human iPSCs and differentiation propensity under permissive conditions.
Results {#sec2}
=======
Establishment of iPSC Clones from RALD Patients {#sec2.1}
-----------------------------------------------
We generated iPSCs from CD34^+^ hematopoietic stem/progenitor cells of two RALD patients with the same somatic G13C heterozygous mutation in the *KRAS* gene ([Tables S1](#mmc1){ref-type="supplementary-material"} and [S2](#mmc1){ref-type="supplementary-material"}). We obtained mutant (G13C/WT) and isogenic wild-type (WT/WT) iPSC clones from each patient as confirmed by direct sequencing ([Figure 1](#fig1){ref-type="fig"}A). The presence of oncogenic mutations other than *KRAS* was excluded by whole exome sequencing ([Table S3](#mmc2){ref-type="supplementary-material"}). Karyotyping showed that all RALD patient-derived iPSC clones exhibited a normal 46XY karyotype ([Figure 1](#fig1){ref-type="fig"}B). All iPSC clones expressed the markers, OCT4, NANOG, TRA-1-60, and SSEA4 ([Figure 1](#fig1){ref-type="fig"}C).Figure 1Establishment and Characterization of iPSC Clones Generated from Two RALD Patients(A) *KRAS* sequences of wild-type (WT/WT) and mutant (G13C/WT) iPSC lines derived from two RALD patients (cases no. 1 and no. 2). A position of mutation (G to T) is indicated by red letters.(B) Karyotypes of WT/WT and G13C/WT iPSC lines derived from case no. 2 (RALD patient).(C) Immunocytochemistry of iPSC markers (OCT4, NANOG, TRA-1-60, and SSEA4) in WT/WT and G13C/WT iPSC clones. Ho, Hoechst 33342. Scale bar, 100 μm.See also [Tables S1](#mmc1){ref-type="supplementary-material"} and [S2](#mmc1){ref-type="supplementary-material"}.
To assess how the status of KRAS affects stemness and differentiation in these iPSC clones, we investigated changes in gene expression levels of stemness and lineage markers after *in vitro* embryoid body (EB)-mediated differentiation for 16 days. In the suspension culture to induce differentiation, all iPSC clones formed EBs ([Figures 2](#fig2){ref-type="fig"}A and [S1](#mmc1){ref-type="supplementary-material"}A). However, RNA sequencing (RNA-seq) analysis showed that there were clear differences in stemness and lineage marker expression between WT/WT and G13C/WT genotypes in case no. 2 ([Figure 2](#fig2){ref-type="fig"}B). Following 16-day differentiation, mRNA levels of stemness markers decreased over time in the WT/WT genotype, whereas they seemed to remain high in the G13C/WT cells, especially R2-1 clone. In general, mRNA levels of lineage markers were elevated upon differentiation in both WT/WT and G13C/WT cells. The expression levels of endodermal and early mesodermal markers were higher in the G13C/WT cells than in the WT/WT counterparts, whereas those of ectodermal markers in the G13C/WT genotype were lower. The same trend in expression differences of stemness (*POU5F1* and *NANOG*), mesodermal (*EOMES* and *T*), and ectodermal markers (*PAX6* and *ASCL1*) was confirmed in qRT-PCR analysis of case no. 2 ([Figure 2](#fig2){ref-type="fig"}C). However, mRNA levels were comparable in two genotypes regarding endodermal markers (*FOXA2* and *SOX17*) after differentiation. Although *PAX6* mRNA levels after differentiation were comparable between groups, the clear difference in two genotypes was also observed on *POU5F1*, *NANOG*, and *ASCL1* in qRT-PCR analysis of case no. 1 ([Figure S1](#mmc1){ref-type="supplementary-material"}B). Thus, we focused on the marked differences of stemness and ectodermal markers in the two genotypes.Figure 2Different Differentiation Propensity between WT/WT and G13C/WT iPSCs Generated from Two RALD Patients(A) Embryoid body formation of WT/WT and G13C/WT iPSC clones from case no. 2. Scale bar, 200 μm.(B) RNA-seq data showing gene expression levels of stemness and lineage markers from case no. 2 samples before and after 16-day *in vitro* differentiation. Undiff. and Diff., undifferentiated iPSCs and differentiated cells, respectively.(C) qRT-PCR analysis of 16-day *in vitro* differentiated cells from WT/WT and G13C/WT iPSC clones derived from case no. 2 (n = 3 independent experiments; mean ± SEM).( | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Spinal cord injury (SCI) is among the issues that affect individual lives and almost can be said all the individuals in society are at equal risk. In 2004, 11000 cases have been diagnosed in United States of America with this condition. SCI is one of the most serious clinical diseases and its prevalence is increasing year by year, although mortality rate from SCI has a decrement about 5%, but disability rate from SCI is almost remained at high level. Among these disabilities, \"paraplegia\" can be mentioned as one of the most important complications. Therefore expedition of locomotor recovery after spinal injury has been a subject of interest to researchers and professionals in neuroscience ([@R1]). The extension of spinal injury can be different in individuals depends on type and area of injury ([@R2]). The most common form of spinal cord injury is contusion that may damages spinal cord because of the physical impact and secondary cell damage by creating glial scarring around the injured spinal cord ([@R3]). Recovery after spinal cord injury will be difficult due to axonal damage ([@R4]), demyelination and scar ([@R5]). Spinal cord injury has two stages: Primary mechanical injuries and secondary injuries that exist through inflammatory responses. Neuropathology demonstrations of SCI contains: Edema, axonal damage, infiltration of inflammatory cells and increased astroglia ([@R6]). Improvement of locomotor recovery after spinal cord injury depends on intensity of tissue damage. Spontaneous recovery after spinal cord injuries is very low ([@R7]). In spinal Restoration process and Further Restoration, macrophages and astrocytes play significant roles through signals activation ([@R8]). The efforts which may be done to improve the performance of injured spinal cord include: reduction of secondary injury development, intervention in neuro-inhibitory environment in injured area, replacing lost tissue cells through cells implantation, renewal of axon myelin loss, increasing potential recovery of local progenitor cells ([@R9]). Different types of cells have been used by researchers to improve locomotor recovery in spinal cord injury ([@R1], [@R10], [@R11]). One of these cells, stem cells derived from human adipose tissue (hADSCs), due to the production of neurotrophic factors such as nerve growth factor, brain-derived neurotrophic factor and glial-derived neurotrophic factor, can be efficient for restoration of function because of supplying appropriate neurological environment at the site of spinal cord injury. In this regard, many studies have shown that stem cells derived from human adipose tissue have the ability to repair traumatic nerve damage ([@R12]). Cells that are extracted from the surface layer of abdominal fat have greater ability to create such an environment rather than cells that are extracted from deep layer ([@R12]). One of the reasons that inhibit axonal regeneration after CNS injury is existence of impermeable cement scar in the site of injury ([@R13], [@R14]). Several family of inhibitory molecules in the extracellular matrix along with reactive astrocytes create dense scar in site of injury that acts as a barrier to axonal regeneration ([@R15]). Chondroitin sulfate proteoglycan (CSPG) produced by astrocytes and oligodendrocytes in site of injury is increased drastically, which results in limiting axonal regeneration ([@R16]). Researchers have shown that CSPG is most abundant extracellular matrix molecules at the site of spinal cord injury and is associated with a Scar ([@R17]). Other therapeutic strategies in the treatment of spinal cord injury that can be used are scar elimination. Chondroitinase ABC has the ability to eliminate these scars and deal with Neuro-inhibitory environment that has been created at the site of spinal cord injury. ChondroitinaseABC (ChABC) is a bacterial enzyme that digests glycosaminoglycan chains (GAG) in CSPG, which is the main component of the extracellular matrix. One of the effects of ChABC which have focused recently by researchers is that the axonal regeneration and functional improvement after lesions of the central nervous system can be done through digestion of GAC and CSPG chains by ChABC ([@R18]-[@R20]).
According to the above description, the aim of present study was to answer to the question: which one is more efficient for Improvement of locomotor recovery after a spinal cord contusion model? Transplantation of hADSCs or injection of ChABC.
Materials and Methods
=====================
Animals
-------
In this study we used adult male wistar rats (N=24) weighting between 250-350g (Pasteur Institute, Tehran). The study approved by medical ethics committee of Iran University of Medical Sciences. Animals kept in animal house standard conditions (temperature 21±3°C, 12 hr light/dark cycle) with free access to food and water.
Isolation of hADSCs
-------------------
After attainment of patients written consents, fatty tissue was prepared from superficial layer of abdomen during liposuction surgery from 25-46 years individuals in Rasul Akram hospital (Iran-Tehran). Isolation of human adipose-derived stem cells was performed according to Dubois *et al* protocol ([@R21]). Fatty tissue was warmed in 37°C water bath before the initiation of Isolation. Then all the Isolation stages were performed under hood sterilized condition. 200 mg of fatty tissue for washing purpose was transferred to the tube containing 1% Penicillin/Streptomycin (Invitrogen) dissolved with warm phosphate-buffered saline (PBS, Invitrogen) and washing was continued until elimination of blood vessels, and connective tissue (commonly 2 times washing). Fatty tissue sample was minced by sterilized scissors and was transferred to the tube containing collagenase type I (Gibco,17100-017, USA) 0.1% and BSA 1% (dissolved with warm PBS)(Invitrogen) for digestion, then kept in water bath for 30 min for total digestion and homogenization of sample. After tissue digestion, the tube containing the sample was centrifuged at room temperature for 5 min at 1200 rpm speed. After discharging supernatant, formed plate was resuspended with BSA 1% solution and was again centrifuged to remove red blood cells using RBC lysis buffer. Ultimately after centrifugation and discharging supernatant, formed plate was resuspended with medium containing DMEM/Ham\'s F-12, FBS 10% and Penicillin/Streptomycin 1% and transferred to the tissue culture flasks. Flasks were maintained in incubator (temperature 37°C, CO~2~ 5%, humidity 98%).
Flowcytometry analysis
----------------------
In order to characterization of hADSCs, isolated cells were fixed in 5^th^ passages (after being harvested by trypsin) in paraformaldehyde 2% for 30 min. After two times washing with PBS, cells were incubated with antibodies against CD90, CD73, CD45, CD44, and CD31 for 30 min. CD44 and CD90 antibodies were directly conjugated with the allophycocyanin (APC). The Rat IgG2b was used for control isotope of CD90 and CD44 as substitute antibody. Goat anti-Rabbit IgG-FITC was used as a secondary antibody for CD31 and CD45 and Goat anti-mouse IgG-FITC was used as a secondary antibody for CD73. Rabbit polyclonal IgG was used as a substitute antibody for control isotope of CD31, CD45 and CD73. Flowcytometry was performed with a BD FACScalibur flow cytometer device (BD Biosciences, USA). Details of used antibodies are summarized in Table [1](#T1){ref-type="table"}.
Tagging Human Adipose- derived Stem cells (hADSCs) with GFP+ Recombinant lentiviral virus
-----------------------------------------------------------------------------------------
Lentivral vector carry Copa-GFP gens under EF1 promoter produce under calcium phosphate standard protocol. lentiviral vector pCDH-311B with EF1-CopGFP (System Bio Inc.) , pMD.2 and p.sPAx.2 (Kindly gift from Dr Trono) was used for transfection HEK293T in 10cm plate with CoPo4 reagents. After 18 h we change medium with fresh DMEM -10% FBS. Recombinant viral collected in 24, 48 and 72 hr after change the medium and any time add 12 ml fresh medium to plate. Collected recombinant viral titer measured with transduction HEK 293T in 6 well plate in different log. Titer was about 1×10^6^-3×10^6^vp/ml. hADSCs transduction achieved with application of polyberen and spinfection enhanced transduction protocol with MOI 4-6. For maximum transduction spinfection repeated with fresh recombinant viruses for 3 times. hADSCs transduction assay with florescent microscope after 72 hr (Figure [2](#F2){ref-type="fig"}).
Spinal cord injury model
------------------------
Animals were anesthetized with IP injection of ketamine (80 mg/kg) and xylazine (10 mg/kg). Animals were placed in the prone position on the covered operating table with warm blankets. After shaving the skin in the thoracic spines area and prepping with Betadine, midline incision was created with a scalpel. After Pushing the subcutaneous fat and muscle to expose the vertebral lamina, laminectomy was performed at T8-T9 levels of spinal cord. Metal cylinder (weighing 10 g and 2 mm in diameter) was released on the exposed spinal cord from distance of 12.5 cm. Then the muscles and skin were sutured with 3/0 Suture. Postoperative care included: Ringer\'s solution administered to prevent dehydration (3 ml IP after surgery), administered gentamicin (0.8 mg/100 g, IP) for 4 days postoperatively and bladder massage twice a day, for all animals was performed.
Contusion model confirmation
----------------------------
To confirm contusion model, seven days after spinal cord injury one animal were selected to evaluation of cavity formation in lesion site. In order to this, mentioned animal | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
The prevalence of coronary artery disease (CAD) is growing rapidly nowadays, which makes it the leading cause of death in many developed and developing countries. CAD is responsible for 17.7 million deaths, which account for 31% of all global deaths every year. In China, the overall number of estimated prevalent cases of CAD was 93.8 million according to recent data, which resulted in about 4 million deaths annually \[[@B1]\]. Traditionally, CAD is strongly associated with age, obesity, diabetes, and hyperlipidemia. Even sufficient attention was devoted to those traditional risk factors, prevalence rate for CAD still increased remarkably by 14.7% from 1990 to 2016 \[[@B2]--[@B4]\]. Particularly, some individuals with severe artery stenosis (≥90% in coronary arteries) do not exhibit obvious clinical symptom, which may hinder the diagnosis and prevention of CAD. Given this unfulfilled need for deeper understanding and effective preventive for CAD, uncovering new risk factors and biomarkers for CAD is of great importance.
Recently, multiple studies have suggested strong association of gut microbiota with CAD pathogenesis and progression \[[@B4], [@B5]\]. The gut microbiota is influenced by dietary intake and in turn produce metabolites that contribute to affecting the metabolism and immunity of the host. Remarkably, trimethylamine N-oxide (TMAO), a gut microbial metabolite, was indicated to be a proatherogenic factor. Study conducted by Hazen firstly reported elevated TMAO in both atherosclerosis patients and mice model in 2011 \[[@B5]\]. Afterwards, several studies indicated that elevated TMAO level could predict an increased risk of major adverse cardiovascular events \[[@B6]--[@B8]\]. TMAO arises from gut microbiota-mediated metabolism of dietary trimethylamine-containing compounds including choline, betaine, and L-carnitine. Those predecessor products of TMAO were also suggested to be associated with atherosclerosis and/or myocardial ischemia risks. Dietary supplement with choline could enhance atherosclerosis in mice \[[@B9]\]. Plasma level of L-carnitine, which is abundant in red meat, contributed to the prediction of increased risks of cardiovascular disease and major adverse cardiac events \[[@B10]\]. A study which involved 3924 African-American participants indicated higher risk of CAD incident with higher dietary betaine intake \[[@B11]\]. However, the relationship between plasma TMAO, choline, L-carnitine, and betaine levels and extent of arterial stenosis of cardiovascular in CAD patients has not been investigated, and whether the combination of TMAO and its predecessors could help to diagnose CAD and predict the risk of severe stenosis in different gender is still unknown. In this study, we aimed to explore the relationship between plasma TMAO, choline, L-carnitine, and betaine concentrations with CAD incidence and severity of arterial stenosis in male and female CAD patients.
2. Materials and Methods {#sec2}
========================
2.1. Study Population {#sec2.1}
---------------------
We recruited 73 healthy controls (CON group) and 94 CAD patients (CAD group) who were hospitalized for coronary angiography. At least one main coronary artery with luminal stenosis diameter ≥ 50% (determined by quantitative coronary angiogram analysis) was diagnosed as CAD (18 ≤ age ≤ 75 years). Age- and sex-matched CON group was an independently recruited set who underwent coronary artery CT or coronary angiography for chest pain but showed negative results. The CAD group was further divided into severe artery stenosis group (S, *n* = 45) and mild artery stenosis group (M, *n* = 49). Severe artery stenosis was defined as ≥90% stenosis in at least one of the main coronary arteries.
We exclude subjects with an active infection, malignancy, severe liver or heart cerebrovascular diseases, and severe proteinuria (\>3.5 g/day) and those who received probiotics or antibiotic treatment within 1 month of enrollment to minimize potential confusing factors.
Study subjects underwent complete clinical history and physical examination in the study duration. General information including age, sex, weight, and body mass index (BMI) was retrospectively collected from each subject\'s medical records. All subjects were informed before being enrolled in the study.
2.2. Laboratory Test {#sec2.2}
--------------------
Fasting blood samples (5 mL) were collected using EDTA-K treated tubes. Blood samples were centrifuged at 1000 ×*g* for 10 min and stored at −80°C until analysis. Plasma TMAO, choline, L-carnitine, and betaine were measured by high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS) using D9-TMAO, D9-choline, D3-L-carnitine, and D9-betaine internal standards as described previously \[[@B12]\]. Hemoglobin (HGB), fasting blood glucose (Glu), creatinine (Cr), triglyceride (TG), total cholesterol (TCHO), alanine aminotransferase (ALT), glutamic-pyruvic transaminase (AST), low-density lipoprotein (LDL), and high-density lipoprotein cholesterol (HDL-C) were measured using HITACHI7170S automatic biochemical analyzer. Blood pressure (systolic blood pressure (SBP) and diastolic blood pressure (DBP)) and heart rate (HR) were measured after rest for at least 15 min.
2.3. Statistical Analysis {#sec2.3}
-------------------------
Statistical presentation and analysis of the current study were performed using the computer SPSS program (Statistical Package for the Social Science, Chicago). Categorical variables are presented as numbers and percentages. Continuous data are presented as means ± standard deviations (SD) for normal distribution parameters or medians (interquartile ranges, IQR) for nonnormal distribution parameters to investigate the dynamic change of TMAO and its predecessors in study cohort. Student\'s *t-*test or the Mann--Whitney *U* test was used for differences evaluation between two groups. Logistic regression analysis was performed to examine the odds ratio (OR) and 95% confidence interval (95% CI) of TMAO and its predecessor products for CAD and severe artery stenosis in male, female, and all participants; adjustments were made for variables including age, gender, BMI, SBP, DBP, Glu, TG, and Cr. Because the distribution of TMAO, choline, L-carnitine, and betaine was skewed, they were log-transformed in logistic analysis. The area under the receiver-operating characteristic curve (AUC) was calculated to evaluate the value of betaine, choline, L-carnitine, and TMAO in predicting the risk of CAD and severe artery stenosis. A two-tailed *p*-value \< 0.05 was considered statistically significant.
3. Results {#sec3}
==========
3.1. Patients Characteristics {#sec3.1}
-----------------------------
Of the 94 CAD patients and 73 healthy controls, the baseline patient characteristics are displayed in [Table 1](#tab1){ref-type="table"} as categorized by CAD and CON group. 42.47% of CON and 42.55% of CAD group were male. A comparison of the baseline characteristics between groups with or without CAD showed that CAD patients tended to exhibit higher blood pressure (SBP = 138 ± 3; DBP = 81 ± 1 in CAD versus SBP = 128 ± 3; DBP = 75 ± 2 in CON, *p*=0.01) and to have higher Glu (5.46(4.77--6.64) mmol/L in CAD versus 4.96(4.57--5.73) mmol/L in CON, *p*=0.01) and TG (1.85(1.31--2.65) in CAD versus 1.31(0.97--1.85) mmol/L in CON, *p* \< 0.01) concentrations than CON subjects. However, other factors like age, gender, height, weight, BMI, HR, TCHO, HDL, LDL, HGB, Cr, ALT, and AST were similar between two groups (*p* \> 0.05, [Table 1](#tab1){ref-type="table"}).
3.2. Relationship between Plasma TMAO, Choline, L-Carnitine, and Betaine Levels and CAD {#sec3.2}
---------------------------------------------------------------------------------------
We performed a cross-sectional comparison of TMAO, choline, L-carnitine, and betaine concentrations between CAD patients and CON group at first. We observed remarkably higher TMAO concentration in CAD group than CON group (1.46(0.8--2.32) *μ*M versus 1.18(0.67--1.7) *μ*M, *p*=0.03) ([Table 1](#tab1){ref-type="table"} and [Figure 1](#fig1){ref-type="fig"}). No significant difference was found in choline, L-carnitine, and betaine among CAD and CON group. Then we divided the CAD group as severe artery stenosis group (S, *n* = 45) and mild artery stenosis group (M, *n* = 49) to see if the concentrations of those metabolites could further increase in severe artery lesion patients. As showed in [Figure 2](#fig2){ref-type="fig"}, only TMAO showed significantly elevated concentration in S group compared with M group (1.62(0.91--2.81) *μ*M versus 1.27(0.77--1.82) *μ*M | {
"pile_set_name": "PubMed Central"
} |
Introduction {#section1-2324709618757259}
============
Takotsubo cardiomyopathy (TTC), also called "broken heart syndrome," "transient apical ballooning," and "stress cardiomyopathy," is an acute cardiac syndrome that mimics myocardial infarction and characterized by transient cardiac wall motion abnormalities. This occurs in the absence of any coronary artery obstruction or acute plaque rupture.^[@bibr1-2324709618757259],[@bibr2-2324709618757259]^ In most cases of TTC, the cardiac wall motion abnormality does not follow a single epicardial coronary artery territory. It is usually characterized by depressed function or akinesis of the mid and apical segments of the left ventricle along with hyperkinesis of the basal walls.^[@bibr1-2324709618757259]^ On the other hand, reverse TTC (r-TTC), or inverted TTC, has been recognized as a variant with a hypocontractile ventricular basal segment along with a hypercontractile apex.^[@bibr2-2324709618757259]^ Cases of r-TTC following surgery seems to be unusual and rare.^[@bibr3-2324709618757259],[@bibr4-2324709618757259]^ In this article, we report a case of r-TTC in a patient who underwent exploratory laparotomy for small bowel obstruction.
Case Presentation {#section2-2324709618757259}
=================
A 44-year-old female patient with a known history of multiple sclerosis (MS) maintained on immunomodulatory agents presented to our emergency department with abdominal pain, nausea, and vomiting. Her past surgical history was only remarkable for appendectomy and partial small bowel resection. The patient was diagnosed with small bowel obstruction after a computed tomography (CT) scan of her abdomen was performed. She was admitted to the surgical service subsequently. However, her clinical status deteriorated and she underwent exploratory laparotomy on the next day. One day after surgery, she started experiencing shortness of breath. Her physical examination was otherwise unremarkable. An electrocardiogram was remarkable only for sinus tachycardia. A CT angiography of the chest for suspected pulmonary embolism was performed and was unremarkable. Serum troponin-T levels done were elevated and peaked at 2.19 ng/mL (reference range: \<0.05 ng/mL). CT angiography of the coronary arteries was normal with a calcium score of zero. Echocardiographic examination done revealed a hyperkinetic apical wall along with a hypokinetic basilar wall of the myocardium suggestive of r-TTC with a left ventricular ejection fraction (LVeF) of 30% ([Video 1](http://journals.sagepub.com/doi/suppl/10.1177/2324709618757259); available in the online version of the article). Therapy with a β-blocker and an angiotensin-converting-enzyme inhibitor was initiated and the patient was discharged on postoperative day 8 with a persistent LVeF of 30%. A follow-up cardiac magnetic resonance imaging was done 14 days later after discharge revealed an improvement in the myocardial function with an LVeF of 54%. A repeat echocardiography also showed normalization of the LVeF.
Discussion {#section3-2324709618757259}
==========
The pathogenesis of both TTC and r-TTC is not well understood. Several mechanisms were postulated. The most widely accepted underlying etiological mechanism behind both types is sympathetic nervous system overactivation. Among the various neurochemical substances associated with cardiac wall motion abnormalities, epinephrine and norepinephrine seem to be the most crucial. This catecholamine surge is believed to mediate a vascular dysfunction leading to coronary artery vasospasm, microvascular dysfunction, hyperdynamic contractility, and direct myocardial toxicity via free radicals formation.^[@bibr5-2324709618757259]^
Furthermore, there seems to be a role in protein signaling within the myocardial cells that mediates a paradoxical negative inotropic effect to protect against the intense activation of β-adrenoceptors. This effect is greatest at the apical myocardium where the β-adrenoceptor density is highest.^[@bibr5-2324709618757259]^ This has been also proven by 123-meta-iodobenzylguanidine myocardial scintigraphy that implied more myocardial sympathetic innervation in the apex.^[@bibr6-2324709618757259]^ This might explain the myocardial stunning affecting the apical wall in TTC. However, it does not explain the hyperkinetic apical wall motion in r-TTC, neither the hypokinesis of the basal wall. It has also been postulated that as catecholamine levels subside after a surge, a quicker apical recovery might happen leading to r-TTC pattern.^[@bibr6-2324709618757259]^ Nevertheless, this again does not explain the hypokinesis observed in the basal wall.
Additionally, it is worth noting that certain clinical features differ between TTC and r-TTC.^[@bibr2-2324709618757259],[@bibr7-2324709618757259]^ Song et al^[@bibr8-2324709618757259]^ and Ramaraj et al^[@bibr9-2324709618757259]^ observed that in r-TTC patients are usually younger, tend to have a lower LVeF, and sustains a quicker myocardial recovery in comparison to TTC. Moreover, since the basilar part of the ventricle is the main involved region in r-TTC, which has more myocardial tissue, cardiac biomarkers are usually more elevated in comparison to TTC.^[@bibr2-2324709618757259],[@bibr9-2324709618757259]^
In the literature, most reported cases of r-TTC occurred after physical or emotional stress. Although surgery is considered a form of stress, it is less described. Nevertheless, it remains unclear whether r-TTC occurring after surgery is secondary to physical or emotional stress solely, or whether there is a role for anesthetic agents in triggering this cardiomyopathy. Furthermore, TTC and r-TTC have been reported in several neurological diseases such as subarachnoid hemorrhage, seizure, and ischemic stroke but rarely in MS patients.^[@bibr10-2324709618757259][@bibr11-2324709618757259][@bibr12-2324709618757259]-[@bibr13-2324709618757259]^ Biesbroek et al^[@bibr11-2324709618757259]^ and Kozu et al^[@bibr12-2324709618757259]^ both reported r-TTC in association with new MS lesion occurrence. They have speculated a possible role for demyelinating brain lesions interfering with sympathetic nervous system regulation. On the other hand, Peller et al^[@bibr10-2324709618757259]^ reported r-TTC in a patient with stable MS, which is similar to our case; however, our patient had the complication after surgery and without any acute electrocardiogram changes, in comparison to the previous cases. It is unclear in our case whether MS had a role in triggering r-TTC or whether surgery itself was the sole stress triggering factor.
Conclusion {#section4-2324709618757259}
==========
Reverse takotsubo cardiomyopathy is a rare type of stress-induced cardiomyopathy that is described mainly following neurological insults. Cases of r-TTC following surgery are less described in the literature. We presented a case of r-TTC in a patient with stable MS who underwent exploratory laparotomy for small bowel obstruction.
Supplementary Material
======================
###### Supplementary material
**Declaration of Conflicting Interests:** The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
**Funding:** The author(s) received no financial support for the research, authorship, and/or publication of this article.
**Ethics Approval:** Our institution does not require ethical approval for reporting individual cases or case series.
**Informed Consent:** Verbal informed consent was obtained from the patient(s) for their anonymized information to be published in this article.
**ORCID iD:** Tamer Akel  <https://orcid.org/0000-0002-5632-5571>
**Supplemental Material:** Supplementary material is available for this article online.
| {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION
============
Recent studies have demonstrated that the resting membrane conductance (*G~M~*) of skeletal muscle is highly regulated during repetitive firing of short trains of action potentials (APs) that replicate excitation patterns occurring during activity in skeletal muscle ([@bib30],[@bib31]). In fast-twitch rat muscle, this regulation of *G~M~* has two distinct phases. At the onset of AP firing, Phase I involves the inhibition of ClC-1 channels through a PKC-mediated mechanism causing a decline in *G~M~* to ∼40% of its resting value. Then, during prolonged activity, Phase II changes involve the opening of ClC-1 and K~ATP~ channels, increasing *G~M~* to four to five times its value in quiescent fibers. Upon cessation of AP firing, *G~M~* recovers to its level before AP firing in 1--5 min.
In our companion paper (see Pedersen et al. in this issue), we demonstrated the significance of this *G~M~* regulation for subthreshold electrical properties in muscle fibers, and from this predicted the effects of such *G~M~* changes upon their excitability. In particular, our study described the relative sensitivity of the different aspects of muscle excitability, including neuromuscular transmission, sarcolemmal AP propagation, and tubular (t)-system excitation, to such regulation. The study used a linear circuit analysis appropriate for subthreshold electrical membrane phenomena. This approach first allowed for the development of analytical solutions for three cable models of muscle fibers. To determine which of these models gave the best representation of the electrical properties of rat extensor digitorum longus (EDL) muscle fibers in which the *G~M~* regulation has been observed, experimental measurements of membrane impedance properties were compared with the electrical characteristics of the cable models. This demonstrated that circuit models of rat EDL muscle fibers require a substantial luminal t-system resistance to account for experimental observations of their impedance properties and the velocity with which APs propagate in these fibers.
The study went on to predict that such a luminal resistance enhances the propagation velocity of sarcolemmal APs. It also showed that a luminal resistance in series with the t-system membrane divides the voltage gradient between the intracellular and interstitial spaces into voltage drops across the t-system membrane and the luminal resistance. Because this voltage division is highly frequency dependent, the luminal resistance has important consequences for t-system excitation. Thus, high-frequency current will predominantly generate voltage gradients across the luminal resistance, whereas lower frequency components will be important for t-system excitation. The analytic approach of the previous study therefore demonstrated that *G~M~* changes predominantly affect the low-frequency membrane impedance. It was further demonstrated, by convolving experimental APs with the circuit models, that t-system excitation is a low-frequency phenomenon that is highly dependent on *G~M~*. Collectively, our companion study thus demonstrates that models of rat EDL muscle fibers must include a luminal resistance and suggests that neuromuscular transmission and t-system excitation are more sensitive to *G~M~* regulation than is sarcolemmal AP propagation.
The linear circuit analysis used in our companion study was also useful in providing analytic expressions that could distinguish the appropriate equivalent circuit model for rat EDL muscle fibers and quantify the t-system luminal resistance. However, such a linear analysis is necessarily incomplete when exploring the possible physiological roles of the t-system luminal resistance and *G~M~* regulation for the nonlinear membrane phenomena involved in AP propagation. Such nonlinear properties, explored in the present study, include voltage-dependent, time-dependent, and rectifying and Na^+^/K^+^-ATPase-mediated currents, as well as alterations in intracellular and t-system ionic concentrations during repetitive activity.
The aim of the present study was therefore to quantify the influence of t-system luminal resistances and *G~M~* regulation in skeletal muscle excitability and t-system ionic homeostasis. It uses a nonlinear, iterative approach based upon the charge--difference (CD) model of [@bib10] and [@bib12],[@bib13]). The development of a new model was necessary because no existing model simulates the full range of physical and electrophysiological properties that underlie t-system ionic homeostasis and its relationship with the membrane potential. Thus, early models applying circuit theory with voltage- and time-dependent conductances allow for the simulation of individual APs in the absence of ionic concentration or osmotic changes and are therefore unsuitable for simulating trains of APs where ionic concentrations shift substantially ([@bib2]; [@bib1]). Subsequent, more realistic models permitting the simulation of APs within the restricted extracellular space of a whole muscle ([@bib20]), and of t-system K^+^ handling during AP firing ([@bib38]), do not incorporate osmotic water movements. Therefore, they do not reach unique steady-state solutions that are independent of the initial values of key modeled variables, such as intracellular and intra--t-system ion concentrations ([@bib11]).
The modeling approach adopted here encompasses the known determinants of AP propagation and reaches a true history-independent steady state, thereby remaining applicable despite large perturbations in ionic concentration. It incorporates terms describing voltage- and time-dependent ion conductances and Na^+^/K^+^ pump activity; represents muscle fiber surface geometry using 99 linearly connected fiber segments permitting simulation of surface conduction; represents tubular geometry in terms of 20 concentric shells per fiber segment, each separated by a small luminal series resistance as was experimentally verified in our companion study ([@bib32]); and simulates osmotic water fluxes, thereby permitting it to reach a unique history-independent steady state ([@bib11]).
History independence of the modeled variables was demonstrated by initiating the new model from several sets of widely divergent unphysiological values for all ion concentration variables. In each case, the model relaxed to an identical and physiologically reasonable steady state, thereby demonstrating that it was capable of investigating the determinants of intracellular and intra--t-system ionic homeostasis, and additionally allowing for the use of model-derived initial values for variables such as intra--t-system ion concentrations for which there is little available experimental data.
The initial application of this model confirmed the prediction from the preceding analytical study that the t-system luminal resistance enhances the sarcolemmal AP propagation velocity and reduces t-system excitation. It further demonstrated the influence of active AP generation within the t-system on t-system excitation and t-system ionic homeostasis, and the effect of these upon the surface membrane potential. It was then used to explore the role of *G~M~* regulation in determining the threshold stimulus for AP firing, for t-system excitability, and for the homeostasis of K^+^ ions within the t-system during repetitive AP firing. The outputs of simulated trains of APs were shown to be in close quantitative agreement with experimental intracellular recordings of AP trains obtained from rat EDL muscle fibers.
Theory
------
Development of a CD model of rat skeletal muscle
------------------------------------------------
The electrical properties of rat EDL skeletal muscle fibers were modeled on CD principles ([@bib11]), adapting and extending the model of [@bib10] and [@bib12],[@bib13]) to include key nonlinear membrane phenomena of AP excitation and conduction and t-system excitation, as depicted in [Fig. 1](#fig1){ref-type="fig"}. The new model thus simulated the following features: longitudinal subdivision of the model fibers into multiple subsections connected to form a cable model; subdivision of the t-system into a series of concentric shells separated by series resistances representing the t-system luminal resistance; voltage- and time-dependent ion channels within the surface and t-tubular membranes; and ion and osmotic water fluxes across the surface and t-system membranes and the t-system luminal resistances.
{#fig1}
The model parameters were calibrated to the passive electrical properties of rat fast-twitch EDL muscle fibers that were obtained using the analytic model in our companion study ([@bib32]). This allowed its subsequent use in evaluating the physiological significance of the t-system luminal resistance and *G~M~* regulation in active muscle fibers that has been observed previously in AP-firing EDL fibers ([@bib30]). The model was developed to adhere strictly to four key principles: (a) current continuity; (b) conservation of charge and mass; (c) electrodiffusion | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Kidney cancer is a common malignant illness [@B1]. Around 90% pathological type of renal cancers is renal cell carcinoma (RCC), majority of which are subtyped as clear cell renal cell carcinoma (ccRCC) [@B2]. Based on the size and metastasis of tumor, the degree of invasion external of the kidney and the involvement of lymph node, ccRCC is classified into pathological T stages, pathological N stage, metastasis and clinical stage [@B3]. It is well known that the prognosis of this disease is correlated to the pathological stage and the five-year survival rates of these four pathological stages are 95%, 88%, 59% and 20% for the aforementioned stages, respectively [@B4]. Indeed, localized ccRCC can be cured with radical nephrectomy but the prognosis is poor when the disease turned to be metastatic. In case of the late staged ccRCC, traditional chemotherapies are usually tolerant. In recent decades, different oncogenes related to ccRCC had been identified with high-throughput microarray technology [@B5]-[@B7]. Treatments targeted on these discovered genes have been proved more effective than chemotherapies, duo to the target specificity and low adverse effect [@B8]. A number of targeted therapies have been accepted for clinical use, such as anti-vascular endothelial growth factor (VEGF) antibodies, mammalian target of rapamycin (mTOR) and multi-kinase inhibitors [@B9]. Although patients\' survival have been ameliorated with these new treatments, median overall survival and progression-free are virtually 2 years and most cases finally become surrender and resistance [@B8]. Ignorance of interconnection between genes could contribute to the failure of these targeted therapies, as carcinogenesis progression is not only the consequence of deregulation of some tumor suppressors or oncogenes but also the result of complex molecular mechanisms, including the strong interconnection between genes with similar expression patterns. Therefore, to achieve effective individualized treatments for ccRCC, more therapeutic targets should be identified and their interconnection should be determined.
Langfelder et al. firstly used weighted gene co-expression network analysis (WGCNA) to explore a thorough association between different gene sets or between gene sets and clinical characteristics [@B10]. With emerging plenty of microarray or RNA sequencing data, WGCNA has been widely performed to filter modules and hub genes that are correlated to clinical features like grade, metastasis and tumor stages among various tumor types such as hepatocellular carcinoma [@B11] and papillary renal cell carcinoma [@B12]. With regarding to ccRCC, our center analyzed a microarray data with WGCNA and discovered six hub genes (*CCNB2*,*CDC20*,*CEP55*,*TOP2A*,*KIF20A* and*UBE2C*) that were highly correlated with pathologic stage of ccRCC [@B13]. Also in our center, Chen et al. identified a hub gene *FCER1G* through co-expression network analysis of another microarray data and demonstrated this hub gene had connection with progression and prognosis of ccRCC via influencing immune-related pathways [@B14]. In current study, we downloaded a different microarray dataset and tried to build a co-expression network with a systematical biology process of WGCNA. Furthermore, ccRCC and adjacent normal kidney tissues wer harvested to verify the bioinformatic analysis. We aimed to seek and validate other different hub genes which are associated with clinical stages and survival of ccRCC [@B15]-[@B17].
Materials and Methods
=====================
Data collection
---------------
GSE36895 microarray dataset, containing 29 homo ccRCC tissues and 23 homo normal kidney tissues, was downloaded from Gene Expression Omnibus (GEO) database (<http://www.ncbi.nlm.nih.gov/geo/>) for constructing co-expression networks and exploring hub genes. Patient\'s clinical information of ccRCC tissues included age, gender, different grades (I \-- Ⅳ), pathological T stages (I \-- Ⅳ), pathological N stages (I \-- Ⅲ), metastasis (M0 and M1) and clinical stages (I \-- Ⅳ). We also downloaded RNA-sequencing dataset with detailed clinical information from The Cancer Genome Atlas (TCGA) database (<https://genome-cancer.ucsc.edu/>) to validate the gene expression based on the RNA-sequencing technology of IlluminaHiseq.
Data preconditioning
--------------------
The raw data were background corrected, log2 transformed and quantile normalized by Robust Multi-array Averaging (RMA). The \"Affy\" R package was used to summarize median polish probesets which were annotated with the files of Affymetrix annotation. Finally, sample clustering was applied to evaluate the quality of GSE36895 dataset.
Differential expression genes (DEGs) screening
----------------------------------------------
DEGs between ccRCC and normal renal tissues were screened using R software based on \"limma\" R package at a preset threshold with \|log2 fold change (FC)\| \> 1 and p value \< 0.05.
Co-expression network construction
----------------------------------
After verifying the qualification of DEGs\' expression data, a co-expression network was set for the DEGs using R software based on the \"WGCNA\" R package. Pearson\'s correlation matrices were conducted and a weighted adjacency matrix were performed by a formula amn = \|cmn\|^β^ (cmn represents Pearson\'s correlation between genes, amn represents adjacency between genes and the soft-thresholding parameter (β) was able to magnify the correlation between genes through enhancing high correlations and weakening low correlations). In current study, β = 6 was chosen to guarantee a scale-free network. Subsequently, the adjacency was transformed into topological overlap matrix (TOM) and identified modules including similar genes by hierarchically clustering genes [@B18]. To categorize genes with analogous expression into gene modules, an average linkage hierarchical clustering was carried out based on TOM dissimilarity measure with a minimal gene size of 30 for constructing a dendrogram [@B19]. Finally, a cut-line was selected for module dendrogram and merged some modules after dissimilarity of estimated module eigengenes being evaluated.
Discovering the interesting module
----------------------------------
Module eigengenes (MEs) were considered as the most principal component and all genes were summarized into a single characteristic expression profile. The interesting module was identified by calculating the relevance between MEs and clinical feature. The log10 transformation of the p value was defined as gene significance (GS) and the average GS for all genes in the module was defined as the module significance (MS). The module with the highest MS score was chosen as the one related to clinical feature.
In order to investigate the possible mechanism of the association between the interesting module genes and correlated clinical characters, all genes in brown module were uploaded into the DAVID database and analyzed by GO functional enrichment analysis with a cutoff criterion of false discovery rate (FDR) \< 0.01.
Identification and validation of hub genes
------------------------------------------
For interesting module, the hub genes were defined based on module connectivity (Pearson\'s correlation of module membership \> 0.8) and clinical characteristic relation (Pearson\'s correlation of GS \> 0.2). Moreover, protein-protein interaction (PPI) network was built through putting all relevant genes from the module into the Search Tool for Interacting Genes\' Retrieval (STRING). The common hub genes in both co-expression network and PPI network were regarded as "real" hub genes for further analyses.
Efficacy evaluation and survival analysis
-----------------------------------------
TCGA data were utilized to evaluate the association between the expression of the most interesting hub genes and the different pathological stages of ccRCC using Gene Expression Profiling Interactive Analysis (GEPIA) database (<http://www.gepia.cancer-pku.cn>). The survival rate analysis was conducted based on the TCGA database for the assessment of the identified genes\' effects on the prognosis of ccRCC patients. Firstly, patients with mRNA data were classified in two different categories in accordance with each gene\'s median expressions (low vs. high). Patients with methylation data were similarly analyzed. Secondly, analysis was conducted on patients with both mRNA expression and different ccRCC grades data. Finally, we performed Kaplan-Meier survival analysis and the log-rank test by adopting the "survival" R package. One-way analysis of variance (ANOVA) and paired 2-tailed Student\'s t tests were used to analyze the statistical significance of differences of data.
Gene set enrichment analysis (GSEA)
-----------------------------------
Two categories (high vs. low) of the most interesting hub genes in 539 ccRCC patients were classified and the median value of gene expression was applied as the cut-off point. GSEA (<http://software.broadinstitute.org/gsea/index.jsp>) was carried out to investigate potential functions of the most interesting hub genes with a cut-off criteria of \|Enrichment score (ES) \| \> 0.5 and p value \< 0.05.
Human ccRCC and adjacent normal kidney tissues
----------------------------------------------
ccRCC and adjacent normal kidney tissues (n = 15) were obtained from patients undergoing laparoscopic nephrectomy at Zhongnan Hospital of Wuhan University. Two pathologists independently confirmed the histological diagnosis. Half of each specimen was immediately fixed in 4% PFA (paraformaldehyde) and half stored in liquid nitrogen. The use of these ccRCC specimens was approved by the Ethics Committee at Zhongnan Hospital of Wuhan University, and informed consent was obtained from all patients.
Total RNA extraction and real-time RT-PCR
-----------------------------------------
Total RNA was isolated from the frozen tissues using Takara RNAiso Plus (Takara Bio. Inc., Otsu, Shiga, Japan) according to the manufacturer\'s protocol. Genomic DNA (gDNA | {
"pile_set_name": "PubMed Central"
} |
**A**SUM would like to draw your attention to recent research conducted by the University of London and the Katholieke Universiteit Leuven, Belgium, published in the November 2011 issue of *Ultrasound in Obstetrics and Gynaecology*.
The studies suggest that given inter‐observer variability in ultrasound measurements and the significant variation in early embryonic growth, a more conservative approach to the diagnosis of early pregnancy loss is warranted.
The recommendation which has been temporarily endorsed by the RCOG suggests a mean sac diameter (MSD) cut off \> 25 mm and a crown rump length (CRL) cut off\> 7 mm be introduced to minimise the risk of a false positive diagnosis of miscarriage.
While this research awaits confirmation from other centres ASUM suggests interim caution and highlights the importance of transvaginal confirmation of early pregnancy failure.
It should also be noted that many other factors are used when assessing early pregnancy failure, including the presence of a yolk sac, shape of the gestation sac, position within the uterine cavity or cervix, progress from a previous scan and correlation with known gestational age especially in IVF pregnancies.
| {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-nutrients-10-00274}
===============
Humans are holobionts, a complex ecosystem of host-derived cells together with transient and stable microbial symbionts \[[@B1-nutrients-10-00274]\]. A typical human body contains up to 100 trillion microorganisms, equivalent to \~10 times the total number of nucleated cells in the body \[[@B2-nutrients-10-00274],[@B3-nutrients-10-00274],[@B4-nutrients-10-00274],[@B5-nutrients-10-00274]\]. The large intestine is the greatest single human reservoir of microbes, containing at least 30 identified genera and as many as 500 different species \[[@B2-nutrients-10-00274],[@B6-nutrients-10-00274],[@B7-nutrients-10-00274]\]. The inter-relationships that occur within this ecosystem are complex and affect the development and health of the individual \[[@B8-nutrients-10-00274]\].
The association between the development of the gut microbiota and the host's genotype and phenotype has received increasing attention as technological advances in culture-independent techniques (e.g., genomic, transcriptomic, proteomic, and metabolomic) have facilitated the detection of a greater diversity of microbes \[[@B9-nutrients-10-00274]\]. These studies have demonstrated that the composition of the gut microbiota in each infant is idiosyncratic with significant inter-individual variation being evident from the first day after birth \[[@B10-nutrients-10-00274],[@B11-nutrients-10-00274],[@B12-nutrients-10-00274]\]. Individuality, time from birth and mode of feeding were the strongest contributors to variation in the microbiota in 8 infants sampled seventeen times over the first 12 weeks from birth \[[@B13-nutrients-10-00274]\]. Notably, the impact of individuality on microbiota development was more pronounced in breast-fed babies consistent with the impact of fluctuations in environmental effects (e.g., mother-specific fluctuations in milk composition) \[[@B13-nutrients-10-00274]\]. The infant's gut microbial composition increases in number and diversity as they age \[[@B14-nutrients-10-00274],[@B15-nutrients-10-00274]\]. By around three years of age, the infants' gut microbiota will attain a diversity and complexity of composition that resembles the mature adult anaerobic gut microbiota \[[@B4-nutrients-10-00274],[@B14-nutrients-10-00274],[@B16-nutrients-10-00274],[@B17-nutrients-10-00274]\].
It is clear that under "normal" circumstances, the gut microbiota has a symbiotic relationship with the host during which, among other things, it contributes to: the storage and harvesting of energy \[[@B18-nutrients-10-00274]\]; development of the host immune system \[[@B6-nutrients-10-00274],[@B19-nutrients-10-00274],[@B20-nutrients-10-00274],[@B21-nutrients-10-00274]\]; maintenance of intestinal homeostasis \[[@B22-nutrients-10-00274]\]; and, nutrient processing \[[@B12-nutrients-10-00274]\]. Interactions between gut microbes and the host also have a profound effect on an individual's health later in life \[[@B23-nutrients-10-00274]\], while perturbation of the gut microbiota population structure (i.e., dysbiosis) is associated with pathological conditions \[[@B24-nutrients-10-00274]\] that include inflammatory bowel disease (IBD) \[[@B25-nutrients-10-00274]\], obesity, allergic \[[@B26-nutrients-10-00274]\], and autoimmune diseases \[[@B27-nutrients-10-00274]\].
Despite our awareness of the significance of maintaining the mutual relationship between the host and gut microbiota across the life-span, conclusive evidence of the factors that affect the development of the microbiome are not yet available. Various factors have been proposed to affect the early-life development of the microbiota, including: the composition of the maternal microbiome \[[@B28-nutrients-10-00274]\]; mode of birth \[[@B10-nutrients-10-00274],[@B24-nutrients-10-00274],[@B29-nutrients-10-00274]\]; antibiotic usage \[[@B30-nutrients-10-00274]\]; and, length of gestation \[[@B31-nutrients-10-00274],[@B32-nutrients-10-00274]\] ([Figure 1](#nutrients-10-00274-f001){ref-type="fig"}). In this review, we will focus on factors that are known to affect the establishment of the biggest human microbial reservoir---the GI tract and the reciprocal relationship between GI microbiota and GI tract development from in utero to post-natal life.
2. Development of the GI Tract {#sec2-nutrients-10-00274}
==============================
The human gastrointestinal tract or alimentary canal starts from the mouth, extending through well-defined anatomical regions---the oesophagus, stomach, small intestine, colon, rectum---and ending at the anus \[[@B6-nutrients-10-00274]\]. The functional and structural development of the GI tract is a crucial part of human development as the gut must accommodate the diversity of dietary inputs and foreign antigens that are introduced into the human body together with food throughout different stages of life \[[@B33-nutrients-10-00274]\].
The maturation of the human GI tract starts in utero but continues after birth with some functions, such as epithelial barrier mechanisms, accessory structures (e.g., glands), and the intestinal immune system, only becoming fully developed several months or years after birth \[[@B33-nutrients-10-00274]\]. The primitive gut forms from the dorsal section of the yolk sac approximately 22 days after conception, leading to the appearance of the foregut, midgut, and hindgut approximately 25 days after conception \[[@B34-nutrients-10-00274]\]. The stomach appears approximately five weeks post-conception. The midgut rapidly increases in length until it can no longer fit within the developing abdominal cavity and herniates into the vitelline sac before undergoing complex rotations and returning to the abdominal cavity after approximately 10 to 12 weeks of gestation \[[@B34-nutrients-10-00274]\]. GI tract development continues until all the major tissue components of the mature gut are present after approximately 20 weeks' post-conception \[[@B33-nutrients-10-00274]\]. Despite the fact that the GI tract originates from the dorsal section of the yolk sac, there are regional-specific tissue features (e.g., gastric pits, glands villi, and crypts) that differentiate between the different sections of the gut \[[@B33-nutrients-10-00274]\].
Comparative studies have identified abnormalities in gut-associated lymphoid tissue development and decreased antibody production in germ-free mice \[[@B35-nutrients-10-00274]\]. Similarly, germ-free piglets have been shown to have alterations to their intestinal physiology that include reduced turnover of the intestinal epithelial cell and a reduction in mucosal biosynthetic rate when compared to control animals \[[@B36-nutrients-10-00274],[@B37-nutrients-10-00274]\]. Collectively, these findings are consistent with the structural and functional development of the GI tract being affected by the composition and the activity of an individual's microbial flora. Because of the nature of GI tract development, these microbe-specific effects are likely to be due to impacts on developmental processes that occur both in utero and postnatally.
3. Microbial Impacts on In Utero GI Development {#sec3-nutrients-10-00274}
===============================================
We have long assumed that the gut is sterile before birth \[[@B38-nutrients-10-00274],[@B39-nutrients-10-00274],[@B40-nutrients-10-00274],[@B41-nutrients-10-00274],[@B42-nutrients-10-00274]\]. However, this dogma was challenged when several studies identified bacteria, bacterial DNA, or bacterial products in meconium \[[@B10-nutrients-10-00274],[@B43-nutrients-10-00274],[@B44-nutrients-10-00274]\], amniotic fluid \[[@B23-nutrients-10-00274],[@B45-nutrients-10-00274]\], and the placenta \[[@B23-nutrients-10-00274],[@B46-nutrients-10-00274]\]. Yet, evidence of live bacterial culture from placental and amniotic fluid samples remains limited \[[@B23-nutrients-10-00274]\]. Despite the limited evidence, these findings raise the possibility that intrauterine human gut development that prepares the protective barrier necessary for enteral feeding after birth is affected by the development of stage-specific microbiota that begins in utero \[[@B23-nutrients-10-00274]\].
4. The Importance of Fetal Swallowing for GI Development {#sec4-nutrients-10-00274}
========================================================
In order for the microbiome to affect GI development in utero, there must be a mechanism to ensure the selection and exposure of the appropriate microbial population or factors. The obvious medium for such a system is the amniotic fluid that bathes the developing fetus. Notably, the composition of amniotic fluid varies over the course of gestation \[[@B47-nutrients-10-00274]\]. Amniotic fluid is composed primarily of fetal urine, with contributions from secreted lung liquid, buccal secretions, and transmembrane flow \[[@B33-nutrients-10-00274]\]. Amniotic fluid also contains hormones and growth regulators \[[@B48-nutrients-10-00274]\], immune modulating proteins, and microbial components \[[@B23-nutrients-10-00274]\]. It remains unclear how the selection of particular microbes would | {
"pile_set_name": "PubMed Central"
} |
Introduction {#S0001}
============
The circadian system adjusts physiology and behaviour to the varied demands of the day--night cycle (Czeisler et al. [1999](#CIT0006); Wright et al. [2001](#CIT0040); Roenneberg et al. [2003a](#CIT0026)). To ensure synchrony with the astronomical day, the circadian system entrains to daily environmental signals (zeitgebers = time givers). The light--dark cycle is the most significant zeitgeber for most organisms, including humans (Honma et al. [1987](#CIT0013); Roenneberg et al. [2007](#CIT0029)). Differences in the relationships between an individual's circadian phase and external local time give rise to a distribution of chronotypes across the population, ranging from *early* chronotypes, the proverbial "larks", to *late* chronotypes termed "owls" (Roenneberg et al. [2003a](#CIT0026)).
The timing of light exposure has a differential effect upon circadian phase: early light exposure advances the cycle whilst light late in the internal day delays circadian phase (Czeisler et al. [1989](#CIT0007); Khalsa et al. [2003](#CIT0016)). Thus, exposure to bright artificial light in the evening before bedtime has been associated with a delay in circadian phase, as assessed by measures of subjective chronotype (Martin et al. [2012](#CIT0020); Vollmer et al. [2012](#CIT0037)), subjective sleep timing (Koo et al. [2016](#CIT0018)), salivary melatonin levels (Gordijn et al. [1999](#CIT0011); Benloucif et al. [2008](#CIT0002); Cajochen et al. [2011](#CIT0004)) and core body temperature (Krauchi et al. [1997](#CIT0019)). Furthermore, adolescents living in urban areas and exposed to bright artificial light at night have a later chronotype as assessed by the Munich ChronoType Questionnaire (MCTQ) and Morningness--Eveningness Questionnaire (MEQ), compared to those living in more rural settings (Vollmer et al. [2012](#CIT0037)). By contrast exposure to bright light in the morning results in an advance of the circadian phase of melatonin synthesis and release (Dijk et al. [1989](#CIT0008); Gordijn et al. [1999](#CIT0011); Revell et al. [2005](#CIT0024)). In addition, bright morning light has been used as a therapy for advancing sleep timings in patients with delayed sleep--wake phase disorders (Rosenthal et al. [1990](#CIT0032); Saxvig et al. [2014](#CIT0033)) and, more recently, with social jet lag (SJL) (Geerdink et al. [2016](#CIT0010)).
Despite society's increasing detachment from the natural light--dark cycle, sunlight can still be seen to impact chronotype. Living further east within the same time zone in the Northern Hemisphere is associated with an earlier subjective chronotype in adults assessed using the MCTQ (Roenneberg et al. [2007](#CIT0029)) and in adolescents assessed with the MEQ (Randler [2008](#CIT0022)), most likely as a result of an earlier sunrise time. Seasonal changes are also apparent, such that during the months of increasing day length, subjective chronotype advances with individuals rising earlier (Kantermann et al. [2007](#CIT0014); Allebrandt et al. [2014](#CIT0001)). There is also some evidence that geographical location has an impact upon chronotype. For example, in a study conducted in Brazil, subjective chronotype was assessed using the MCTQ and MEQ in two cities: São Paulo at latitude 23° 32\' S and longitude 46° 38\' W and Natal at 05° 47\' S and 35° 12\' W. Chronotype was found to be earlier in individuals living in Natal, the city closest to the equator (Miguel et al. [2014](#CIT0021)).
Clearly, the pattern of natural light within a particular environment will be critical in defining an individual's phase of entrainment. However, an individual's behaviour within that environment will also play an important role. A recent study compared the same individuals living under their normal urban routines (including artificial light at night) with a period under natural light exposure (camping without artificial light). The findings demonstrated that increased exposure to natural light advanced the circadian phase of all individuals (Wright et al. [2013](#CIT0041); Stothard et al. [2017](#CIT0035)). Increasing photic zeitgeber strength by spending more time outside has also been correlated with self-reported chronotype: the more time spent outside, the earlier the chronotype (Roenneberg and Merrow [2007](#CIT0030); Roenneberg et al. [2015](#CIT0027)).
By studying populations across the Northern Hemisphere and Southern Hemisphere, specifically Oxford, Groningen, Munich, Perth, Melbourne and Auckland, we aimed to investigate the association between geographical location and chronotype and how different aspect(s) of environmental light (timing; length of time spent outside; intensity of light, sleep timings relative to sunrise and sunset) might influence chronotype.
Materials and methods {#S0002}
=====================
Students were recruited from six universities: University of Oxford, UK (51° 45\' N, 1° 15\' W); University of Groningen, The Netherlands (53° 13\' N, 6° 33\' E); LMU, Munich, Germany (48° 8\' N, 11° 34\' E); University of Western Australia, Perth, Australia (31° 57\' S, 115° 51\' E); Monash University, Melbourne, Australia (37° 48\' S, 144° 57\' E) and University of Auckland, New Zealand (36° 50\' S, 174° 44\' E). Students were asked to complete the online version of the MCTQ twice, in May and October of 2010, to control for seasonal influences. Overall, 13 299 individuals completed the MCTQ online. Over half of the participants were excluded from the analysis (see section on 'Data processing'). 6 441 students (mean age 21.5 ± 2.2 years, 67.5% female, see [Table 1](#T0001) for group demographics) were included in the analysis. Daily irradiance, sunrise and sunset times were obtained for May and October 2010. Ethical approval for this study was obtained from the local ethics committee for each university involved in the study.10.1080/07420528.2018.1482556-T0001Table 1.Average demographics, sleep timings and social jet lag for each city. Oxford (*n* = 302)Groningen (*n* = 3050)Munich (*n* = 1919)Perth (*n* = 342)Melbourne (*n* = 368)Auckland (*n* = 460)Age (years)21.1 ± 2.0921.54 ± 2.1422.50 ± 1.9318.96 ± 1.3820.51 ± 1.9020.00 ± 1.98Gender: females (%)161(53.3)1996(65.4)1401(73.0)202(59.1)271(73.6)314(68.3)Workdays (local time) Bedtime00:42 ± 01:0900:19 ± 01:0700:02 ± 01:0623:02 ± 01:3000:12 ± 01:2323:01 ± 01:10Wake-up time07:55 ± 00:5308:02 ± 01:0307:30 ± 01:0107:28 ± 01:1307:20 ± 01:0407:00 ± 01:02Free days (local time) Bedtime01:30 ± 01:2401:14 ± 01:2201:09 ± 01:2300:46 ± 01:3900:59 ± 01:3200:46 ± 01:27Wake-up time09:52 ± 01:2009:53 ± 01:2009:41 ± 01:2309:23 ± 01:3209:45 ± 01:3209:10 ± 01:28Social jet lag (hours)1.44 ± 0.831.39 ± 0.911.66 ± 0.931.46 ± 0.921.65 ± 0.981.62 ± 0.95[^2]
Materials {#S0003}
=========
The Munich ChronoType Questionnaire {#S0003-S2001}
-----------------------------------
The online version of the MCTQ (Roenneberg et al. [2003b](#CIT0031)) was used in the native language of the country of each university. The MCTQ consists of questions concerning sleep timings for both workdays and free days separately, work time and time spent outside. The MCTQ has been validated against actigraphic recordings (Vetter et al. [2015](#CIT0036)) and melatonin rhythms (Kitamura et al. [2014](#CIT0017)). The MCTQ is used to calculate the MSF as the mid-point between sleep onset and sleep end. MSF was corrected for oversleep | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
Chargaff\'s first parity rule based on the nucleotide composition of double-stranded DNA states that the complementary nucleotides have the same abundance values.^[@DSP021C1],[@DSP021C2]^ This is explained by the DNA double-helix model in which A pairs only with T and G pairs only with C.^[@DSP021C3]^ Chargaff and his colleagues^[@DSP021C4],[@DSP021C5]^ came with a similar observation of compositional relationship between the complementary nucleotides even within individual DNA strands of bacterial chromosomes. In the post-genomic era, this intra-strand relationship between the complementary nucleotides is observed in double-stranded genomes of viruses, bacteria, archaea and eukaryotes, which is known as Chargaff\'s second parity rule or intra-strand parity (ISP).^[@DSP021C2]^ There is no such defined rule to describe ISP in chromosomes like the base-pairing rule in Chargaff\'s first parity. ISP is also observed between the complementary oligonucleotides in chromosomes,^[@DSP021C6]--[@DSP021C9]^ which has been attributed to genome-wide large-scale inversion, inversion transposition^[@DSP021C10]^ and coding sequence compositional symmetry between the strands.^[@DSP021C9]^ Violation of ISP is observed with respect to organellar (mitochondria and plastids) genomes of some organisms, single-stranded viral genomes or any RNA genome.^[@DSP021C11]--[@DSP021C13]^
Theoretically, under no strand bias in terms of mutation and selection, the base complementary relationship easily explains the presence of ISP in chromosomes.^[@DSP021C14],[@DSP021C15]^ However, several evidences now prove that both the strands are not identical in terms of mutation/selection.^[@DSP021C16]^ This results into violation of ISP in sub-chromosomal regions. Longer the sub-chromosomal region, smaller is the violation of ISP observed.^[@DSP021C17]^ The mechanisms that are responsible to cause violation are defined under three categories.^[@DSP021C18]^ First, DNA replication: leading strand (LeS) is found to be composed of more K nucleotides (G and T) than the complementary M (A and C) nucleotides and the reverse holds true for the lagging strand (LaS).^[@DSP021C19]^ This is due to the fact that the LeS which functions as the template for Okazaki fragment synthesis (functions as template for LaS) remains exposed more as single-stranded than the LaS (functions as template for LeS) during replication that results into higher deamination of the cytosine residues^[@DSP021C20],[@DSP021C21]^ in LeS (cytosine gets deaminated 140 times faster in ssDNA than in dsDNA^[@DSP021C22]^). In addition, the influence of Okazaki fragments and the sliding DNA clamp proteins associated with the synthesis of LaS create functional asymmetry of the mismatch repairing system on DNA.^[@DSP021C23]^ Second, transcription: genes are preferentially located in the LeS than in the LaS to avoid head on collision between the machineries of replication and transcription.^[@DSP021C24]^ During transcription, the non-template strand remains more exposed as single-stranded than the template strand, which causes asymmetry in cytosine deamination between the strands.^[@DSP021C22]^ The transcription-coupled repair system also acts only upon the template strand and thereby contributes to the strand asymmetry.^[@DSP021C25]^ Third, translation: uses of synonymous codons are influenced by differential abundance of tRNA molecules which results into the differential abundance of complementary nucleotides at the third position of family box codons. This causes parity violation.^[@DSP021C14]^ In spite of these factors favoring violations of the parity in chromosomes, ISP is observed in an entire chromosome due to the cancellation effect of the local violations in opposite directions.^[@DSP021C14]^
Evolutionary biologists are more interested to understand the role of mutation and/or selection in the violation of ISP by analyzing the weakly selected or selectively neutral regions (third position of family box codons and non-coding regions) in chromosomes.^[@DSP021C14],[@DSP021C26]^ Whether any specific feature(s) is/are associated with chromosomes exhibiting ISP is yet to be understood. Shioiri and Takahata^[@DSP021C27]^ studied ISP by finding out the total AT skew (ATS) and GC skew (GCS) in the chromosomes of several bacteria. In their study, out of 36 bacterial chromosomes, *Xylella fastidiosa* exhibited maximum ATS and GCS. They observed variable ATS/GCS among chromosomes of different strains of a species as well as chromosomes within a bacterial cell. They also observed ATS and GCS may be different from each other within a chromosome. Since, they did not do any statistical analysis of the skew, the significance of the variability observed among chromosomes was not discussed by them. The usual statistical tool used to find out ISP in chromosomes is a correlation analysis of oligonucleotides abundance described by Prabhu.^[@DSP021C6]^ The ISP study between the complimentary mononucleotides is important because it has been proven that oligonucleotide parity and mononucleotide parity are independent.^[@DSP021C8]^ Baisnée *et al*.^[@DSP021C8]^ studied parity in chromosomes by measuring the S^1^ index which is defined as the sum of the absolute values of the differences between complementary oligonucleotides (*n* mer) frequencies (*n* varies from 1 to 9 mer). Both these methods do not measure the statistical significance of differences between the abundance values of a mono/oligonucleotide and its reverse complement. For example, if a chromosome carries significant similarity between the abundance values of A and T but carries significant difference between the abundance values of G and C, this will not be identified separately. Similarly, the above methods are unable to find out parity violations in chromosomes with respect to the abundance values of an oligonucleotide and its reverse complement. We have developed a methodology here that can independently study ISP between S nucleotides (any oligonucleotide and its reverse complement) as well as between W nucleotides using the abundance values of mononucleotides. We use the well-known Kolmogorov--Smirnov (KS) test to study the frequency distribution of the compositional abundance values of the mononucleotides in a chromosome sequence, which gives the statistical significance of the similarity between the distributions of complementary nucleotides. This we called as intra-strand frequency distribution parity (ISFDP), which has been used here to study the chromosomes of bacteria, archaea and eukaryotes.
Materials and methods {#s2}
=====================
Frequency distribution calculation {#s2a}
----------------------------------
Chromosome sequences of different bacteria, archaea and eukaryotes (Tables [1](#DSP021TB1){ref-type="table"}[](#DSP021TB2){ref-type="table"}--[3](#DSP021TB3){ref-type="table"}) were obtained from the genome information broker, DDBJ site ([www.gib.genes.nig.ac.jp](www.gib.genes.nig.ac.jp)). Bacterial chromosomes were chosen randomly from the database starting the genus name from A to Z. Chromosome sequences of different strains belonging to the same species in the case of bacteria were taken in several cases to do the intra-species comparison. Each chromosome sequence was divided into smaller-size sequences of 1000 nucleotides each starting from the beginning, and the abundance value of the four nucleotides was determined using the computer program (developed for this study). The distribution of the abundance values of complementary nucleotides in different fragments were analyzed by the KS non-parametric test using XLSTAT program^[@DSP021C28]--[@DSP021C30]^ (Kovach Computing Services, Anglesey, Wales). *H*~0~: distribution patterns of any two nucleotides/oligonucleotides in a chromosome are similar; *H*~A~: there is a difference between the two distributions. Owing to the large sample size, similarity was considered at the *P*-value of \>0.01, weak similarity was considered at the *P*-value between 0.01 and 10^−4^, and the value of \<10^−4^ was considered as strong violation similarity. Group-frequency distributions of the abundance values were plotted to observe the frequency-distribution parity. In the case of the di- and trinucleotides, the abundance values were determined using a different computer program (developed here for this study) in the segments for the 16 dinucleotides and 64 trinucleotides. The analysis was done as described for the mononucleotides earlier.
Angular replication asymmetry of the chromosomes was calculated with the help of the information on *ori* (origin) and *ter* (termination) cited in the websites (<http://www.cbs.dtu.dk/services/GenomeAtlas/suppl/origin/> and <http://pbil.univ-lyon1.fr/software/Oriloc/oriloc.html>). The chromosomal region starting from *ori* to *ter* was considered as the leading region in the Watson strand (Ws) and the remaining portion of the chromosome as the lagging region. For a circular chromosome, the angular replication asymmetry was calculated as the amount of angular distance of leading region deviating from 180°.
Proportionate distribution of forward- and reverse-encoded sequences in a DNA strand {#s2b}
------------------------------------------------------------------------------------
From the DDBJ site, only coding sequences were downloaded. A continuous stretch of the nucleotide sequence was made from all the sequences by removing the gene names. This resembled a DNA strand only composed of forward-encoded sequences. Frequency distribution analysis was | {
"pile_set_name": "PubMed Central"
} |
1. Introduction
===============
Cholelithiasis is a major health problem easily encountered in clinics and 120,000 Koreans visited the hospital for gallstone diseases in 2012 with an annual increase rate of 7.3% from 2007 to 2012. Health burden related to cholelithiasis in Korea has been great with costs of nearly \$1.6 billion in 2012 and an annual increase rate of 8.6% from 2007 to 2012.^\[[@R1]\]^ The increasing prevalence and health burden of cholelithiasis should be addressed.
The prevalence and risk factors of asymptomatic cholelithiasis vary with race, diet, culture, and geographic differences. Prevalence of 13.3% to 50.5% has been reported for asymptomatic cholelithiasis in Western countries, including United States and Europe,^\[[@R2],[@R3]\]^ whereas the prevalence of asymptomatic cholelithiasis in Eastern countries, including Korea, has been reported to be lower than that of Western countries with 2.0% to 10.7%.^\[[@R4]--[@R6]\]^ Age, female sex, obesity, dyslipidemia, diabetes mellitus, metabolic syndrome, rapid weight loss, total parenteral nutrition, chronic disease including Crohn disease, cystic fibrosis, and chronic liver disease, and drugs including octreotide, ceftriaxone, and statin were previously identified as risk factors for asymptomatic cholelithiasis.^\[[@R7]\]^
However, previous studies reported conflicting results for some risk factors of asymptomatic cholelithiasis. In some reports from Eastern countries, female sex was not found to be a risk factor for asymptomatic cholelithiasis and the prevalence of asymptomatic cholelithiasis was not significantly different between sexes or even higher in males than females.^\[[@R4],[@R6]\]^ In a study on sex differences in risk factors for asymptomatic cholelithiasis including 3573 subjects from China, a high level of fasting plasma glucose was a risk factor in males and hypertriglyceridemia or obesity in females.^\[[@R5]\]^ Identifying differences in the prevalence and risk factors for asymptomatic cholelithiasis might be important in management of asymptomatic cholelithiasis and planning preventive strategies for asymptomatic cholelithiasis.
The aim of this study was to evaluate sex differences in the prevalence and risk factors for asymptomatic cholelithiasis in Korean health screening examinees.
2. Methods
==========
2.1. Subjects and measurements
------------------------------
Examinees who underwent examinations through health promotion center at 5 hospitals in Daegu-Gyeongbuk province from January 2014 to December 2014 were included and analyzed retrospectively. Examinees younger than 18 years were excluded. All examinees were checked for height, weight, waist circumference (WC), and blood pressure (BP), and underwent laboratory tests after overnight fasting, including fasting plasma glucose, triglyceride, total cholesterol, high-density lipoprotein (HDL) cholesterol, low-density lipoprotein (LDL) cholesterol concentration, hepatitis B surface antigen (HBsAg), and hepatitis C virus antibody (anti-HCV). Ultrasonography of the abdomen was performed in all examinees.
The prevalence and risk factors for asymptomatic cholelithiasis were compared between male and female. Institutional review board approval was obtained for this study (2015--07--046).
2.2. Definition of variables
----------------------------
Diagnosis of cholelithiasis was made by abdominal ultrasound if there was the presence of echogenic densities casting distal acoustic shadow or mobile upon postural change with or without distal acoustic shadowing.^\[[@R8]\]^ Overweight was defined if body mass index (BMI) score was between 23 and 25 kg/m^2^ and obesity as BMI score \>25 kg/m^2^ in both sexes according to definition suggested by World Health Organization criteria for the Asia Pacific region.^\[[@R9]\]^ Central obesity was defined as WC \>90 cm in male and \>80 cm in female^\[[@R10]\]^ or waist-to-height ratio (WHtR) \>0.5.^\[[@R11]\]^ High BP was defined as systolic BP \>140 mmHg or diastolic BP \>90 mmHg. Hypertriglyceridemia was defined as a triglyceride level ≥150 mg/dL, hypercholesterolemia as a total cholesterol level ≥200 mg/dL, low HDL-cholesterol level as a HDL-cholesterol level \<40 mg/dL in male and \<60 mg/dL in female and high LDL-cholesterol as LDL-cholesterol level ≥130 mg/dL. High fasting glucose was defined as fasting plasma glucose level ≥110 mg/dL. Chronic hepatitis B infection was defined if examinee showed positive result for HBsAg and chronic hepatitis C if positive for anti-HCV.
2.3. Statistical analysis
-------------------------
Categorical data were presented as the number of cases and percentages. Continuous variables were shown as mean ± standard deviation. Differences were tested for statistical significance using the Student *t* test and the Pearson *χ*^2^ test. A Cox regression analysis was performed for identification of risk factors for asymptomatic cholelithiasis. Regardless of the statistical tests, the level of significance was defined as *P* \< 0.05. Statistical analyses of the data were performed using SPSS 20 (IBM SPSS, Chicago, IL).
3. Results
==========
3.1. Baseline characteristics and prevalence of asymptomatic cholelithiasis
---------------------------------------------------------------------------
Among a total of 30,556 examinees who underwent health screening examination, 12 examinees under age 18 years were excluded. Mean age of the 30,544 examinees included in this study was 47.3 ± 10.9 years and male to female ratio was 1.4:1 (17,966:12,578). Asymptomatic cholelithiasis was diagnosed in 1268 examinees with overall prevalence of 4.2%. No significant difference in overall prevalence of asymptomatic cholelithiasis was observed between male and female (4.3% vs. 4.0%, *P* = 0.159).
In both sexes, the prevalence of asymptomatic cholelithiasis increased with age (*P* \< 0.05). The prevalence of asymptomatic cholelithiasis in females and males in their 20s, 30s, 40s, 50s, 60s, and over 70 s was 2.2% vs. 1.4%, 2.9% vs. 2.0%, 3.8% vs. 3.5%, 4.0% vs. 5.5%, 6.1% vs. 7.0%, and 8.8% vs. 9.1%, respectively (Fig. [1](#F1){ref-type="fig"}). The average increase in the prevalence of asymptomatic cholelithiasis every decade of age was 1.46-fold in males and 1.32-fold in females. In age \<40 years, significantly higher prevalence of asymptomatic cholelithiasis was observed in females compared with males (2.7% vs. 1.9%, *P* = 0.020), whereas males showed significantly higher prevalence than females at age over 50 years (6.2% vs. 5.1%, *P* = 0.012) (Fig. [2](#F2){ref-type="fig"}).
{#F1}
{#F2}
The mean age of males and females was 47.7 ± 10.5 years and 46.7 ± 11.4 years, respectively (*P* \< 0.001). Proportion of obesity was 39.0% (7014/17,966) in male examinees and 18.7% (2357/12,578) in female examinees (*P* \< 0.001). Central obesity was observed in 8522 (47.4%) male examinees and 4225 (33.8%) female examinees (*P* \< 0.001). Hypertriglyceridemia was observed in 6370 (35.5%) male examinees and 1600 (12.7%) female examinees (*P* \< 0.001). High fasting glucose was observed in 2235 (12.4%) males and 710 (5.6%) females (*P* \< 0.001). Chronic hepatitis B infection was observed in 815 (4.6%) male examinees and 472 (3.8%) in female examinees (*P* = 0.001). Chronic hepatitis C infection was observed in 90 (0.5%) males and 42 (0.3%) females (*P* = 0.032) (Table [1](#T1){ref-type="table"}).
######
Baseline characteristics of examinees.

Age, serum triglyceride and HDL-cholesterol, fasting plasma glucose, and proportion of obesity, central obesity, chronic hepatitis B infection, and high BP were significantly higher in examinees with asymptomatic cholelithiasis compared to examinees without asymptomatic cholelithiasis (*P* \< 0.05) (Table [2](#T2){ref-type="table"}).
######
Comparison of baseline characteristics of examinees according to presence of asymptomatic cholelithiasis.

In examinees older than 50 years, higher fasting plasma glucose and proportion of obesity and central | {
"pile_set_name": "PubMed Central"
} |
Index
=====
1. Introduction to Cholesterol-Based Compounds
1
2. Drug Delivery Applications..............................................................................
3
3. Anticancer, Antimicrobial, and Antioxidant Compounds.......................................
15
4. Cholesterol-Based Liquid Crystals.....................................................................
27
5. Cholesterol-Based Gelators...............................................................................
35
6. Bioimaging Applications..................................................................................
41
7. Synthetic Applications.....................................................................................
48
8. Miscellaneous................................................................................................
56
9. Conclusions...................................................................................................
59
Funding..............................................................................................................
60
Conflicts of Interest..............................................................................................
60
Abbreviations List.................................................................................................
60
References............................................................................................................
62
1. Introduction to Cholesterol-Based Compounds {#sec1-molecules-24-00116}
==============================================
Cholesterol (cholest-5-en-3β-ol) is considered to be a lipid-type molecule, being one of the most important structural components of cell membranes. Chemically, cholesterol is a rigid and almost planar molecule with a steroid skeleton of four fused rings, three six-membered and one five-membered, conventionally lettered from A to D (1,2-cyclopentanoperhydrophenanthrene ring system) ([Figure 1](#molecules-24-00116-f001){ref-type="fig"}A). Therefore, the cholesterol molecule comprises four essential domains ([Figure 1](#molecules-24-00116-f001){ref-type="fig"}B). In domain I, the polarity of the 3-hydroxy group constitutes an active site for hydrogen bond interactions with a myriad of biological molecules (e.g., phospholipids in membranes) \[[@B1-molecules-24-00116]\]. In domain II, the absence of methyl groups at C-4 and C-14 influences directly the planarity of the molecule, while in domain III, the natural (*R*) configuration at C-20 determines the "right-handed" conformation of the side chain. Finally, in domain IV, the conformation and length of the side chain is of prime relevance to intermolecular contacts \[[@B2-molecules-24-00116]\]. The presence of a hydrophilic 3-hydroxy headgroup on the A-ring, together with a hydrophobic hydrocarbon body, give the molecule an amphiphilic nature, which makes cholesterol the most recognized sterol.
Cholesterol plays a vital role in life, particularly in cell membranes and as a precursor to the biosynthesis of several steroid hormones. In cell membranes, which are essentially constituted by a double layer of phospholipids, cholesterol has great influence on membrane fluidity, microdomain structure (lipid rafts), and permeability by interacting with both the hydrophilic headgroups and the hydrophobic tails of phospholipids. In addition, modifications of the stereochemistry and oxidation states of the fused rings, the side chain, as well as the functional groups of cholesterol, lead to a wide variety of biologically important molecules, such as bile acids, vitamin D, and several steroid hormones \[[@B1-molecules-24-00116],[@B2-molecules-24-00116]\]. Interestingly, 13 Nobel Prizes have been awarded to scientists who studied the structure of cholesterol, its biosynthetic pathway, and metabolic regulation. Unfortunately, cholesterol has gained a bad reputation because it is increasingly associated with several cardiovascular and neurodegenerative diseases, among others \[[@B1-molecules-24-00116],[@B3-molecules-24-00116]\].
Over the years, cholesterol has risen as an attractive starting material or a model system for organic synthesis due to its easily derivatized functional groups, availability, and low cost. Many useful chemical and enzymatic reactions are now widely used for multistep steroid transformations, leading to products of practical importance. The chemical transformations range from simple ones, such as manipulations of functional groups, to more complex ones, such as C-H activation or C-C bond formation with organometallic reagents. In 2014, a purely synthetic chemistry review was published, dealing only with the advances in cholesterol chemistry since 2000, focusing on cholesterol oxidation reactions, substitution of the 3β-hydroxy group, addition to the C5=C6 double bond, C-H functionalization, and C-C bond forming reactions. However, this review paper excluded simple derivatization reactions of cholesterol such as the preparation of carboxylic and inorganic acid esters, aliphatic and aromatic ethers, simple acetals, or glycosides \[[@B4-molecules-24-00116]\]. From our perspective, the simpler chemical transformations very often lead to the preparation of new cholesterol-based molecules with potential applications in several important research fields. Therefore, in this review, we focused our attention on publications from 2014 to date and described not only the synthesis of cholesterol-based new molecules, but also the application of these molecules in different fields, such as drug delivery; bioimaging; liquid crystals; gelators; anticancer, antimicrobial, and antioxidant applications; as well as purely synthetic applications. However, some interesting papers published before 2014 were included to fill some of the lacking papers from the 2014 review paper. Throughout the text, several reaction schemes will be depicted to describe the chemical reaction involved in the preparation of the cholesterol-based compounds. For simplification purposes, the structures of cholesterol will consistently be represented using the abbreviations depicted in [Figure 2](#molecules-24-00116-f002){ref-type="fig"}.
2. Drug Delivery Applications {#sec2-molecules-24-00116}
=============================
Drug delivery is a method or process of administering a pharmaceutical compound to achieve a therapeutic effect in humans or animals. Drug delivery systems can in principle provide enhanced efficacy, reduced toxicity, or both for various types of drugs. Liposomes are the most common and well-investigated nanocarriers for targeted drug delivery because they have demonstrated efficiency in several biomedical applications by stabilizing therapeutic compounds, overcoming obstacles to cellular and tissue uptake, and improving the biodistribution of compounds to target sites in vivo \[[@B5-molecules-24-00116]\].
In 2014, Vabbilisetty and Sun reported a study of terminal triphenylphosphine carrying anchor lipid effects on a liposome surface by postchemically selective functionalization via Staudinger ligation, using lactosyl azide as a model ligand. They synthesized two different anchor lipids, one of them based on the cholesterol molecule (Chol-PEG~2000~-thiphenylphosphine **3**), which was synthesized through an amidation reaction of synthetic Chol-PEG~2000~-NH~2~ **1** with 3-diphenylphosphino-4-methoxycarbonylbenzoic acid *N*-hydroxysuccinimide (NHS) active ester **2** ([Scheme 1](#molecules-24-00116-sch001){ref-type="scheme"}) \[[@B6-molecules-24-00116]\].
The authors verified that the Staudinger ligation could be carried out under mild reaction conditions in aqueous buffers without a catalyst and in high yields. The encapsulation and releasing capacity of the glycosylated liposome based on cholesterol were evaluated, respectively, by entrapping 5,6-carboxyfluorescein (CF) dye and monitoring the fluorescence leakage. It was concluded that Chol-PEG~2000~-thiphenylphosphine **3** is particularly suitable for the ligation of water-soluble molecules and can accommodate many chemical functions, being potentially useful in the coupling of many other ligands onto liposomes for drug delivery purposes \[[@B6-molecules-24-00116]\].
In 2015, a new method was reported for the deposition of a single lipid bilayer onto a hard polymer bead starting from discoidal bicelles and using chemoselective chemistry to hydrophobically anchor the lipid assemblies, using cholesterol bearing an oxyamine linker. The synthesis of oxyamine-terminated cholesterol **6** involved two steps, starting with a Mitsunobu reaction of compound **4**, followed by a reaction of **5** with hydrazine hydrate ([Scheme 2](#molecules-24-00116-sch002){ref-type="scheme"}) \[[@B7-molecules-24-00116]\].
The discoidal bicelles were prepared in water media upon mixing dimyristoylphosphatidylcholine (DMPC), dihexanoylphosphatidylcholine (DHPC), dimyristoyltrimethylammonium propane (DMTAP), and the oxyamine-terminated cholesterol derivative **6**, in a specific molar ratio. These bicelles were exposed to aldehyde-bearing polystyrene (PS) beads and readily underwent a change to a stable single lipid bilayer coating at the bead surface. This approach may be advantageous in depositing membrane proteins at such surfaces for analytical, diagnostic, or therapeutic applications (namely drug delivery) \[[@B7-molecules-24-00116]\].
Cholesterol chloroformate **7** was used as a lipid anchor for hydrophobization of arabinogalactan (AG), a liver-specific high galactose containing a branched polysaccharide, through a two-step reaction sequence that yielded a novel polysaccharide lipid, conjugated ligand **9** (**Chol**-**AL**-**AG**), with a bifunctional spacer β-alanine (AL) ([Scheme 3](#molecules-24-00116-sch003){ref-type="scheme"}) \[[@B8-molecules-24-00116]\].
Ligand **9** was used to prepare conventional liposomes (CLs) and surface-modified liposomes (SMLs) through the reverse phase evaporation technique. These new liposomes were characterized by different techniques exhibiting the | {
"pile_set_name": "PubMed Central"
} |
Introduction {#sec1}
============
Several recent papers have highlighted the importance of the gut microbiome and its potential role in the human body in functions such as immune response, physiology, and metabolism.^[@ref1]−[@ref6]^ Imbalance in the gut microbiota, also known as dysbiosis, has been linked to various diseases including inflammatory bowel disease, atopy, arthritis, certain cancers, and obesity.^[@ref7]−[@ref11]^ In recent years, the analysis of metabolites in fecal matter has become an important aspect of the study of functional aspects of the gut microbiome and its relationship with human health. Metabolomics has emerged as an important approach for the measurement of metabolites. Using metabolomics, one can identify and quantify many small molecules or metabolites in biological samples such as urine, plasma, or feces using analytical techniques such as nuclear magnetic resonance (NMR) and mass spectrometry coupled to chromatography.^[@ref12],[@ref13]^ Examination of these metabolites allows detailed metabolic phenotyping and examination of altered pathways under certain conditions.^[@ref14],[@ref15]^ To this end, application of metabolomics to fecal samples has enhanced our understanding of certain conditions and provided evidence for the link between diet and gut microbiota activity.^[@ref16]−[@ref18]^
However, despite the increasing application of metabolomics to fecal samples, there is a lack of studies in examining the stability of fecal samples. Metabolites and microbial DNA can be degraded in a fecal sample through oxidation, enzymatic degradation, and hydrolysis which can occur during fecal collection and storage before the sample is prepared for analysis.^[@ref19],[@ref20]^ Owing to this degradation, it is essential to have an optimized method for fecal collection and storage in order to reduce degradation of metabolites and DNA which would allow for more accurate and reproducible results in the area of gut microbiome investigation.^[@ref20]^ There are few studies available which investigate the different collection and storage methods and their impact on metabolite and bacteria levels.
Gratton et al. demonstrated that storing a fecal sample over time at different temperatures before processing for analysis has a large impact on the metabolic profiles of human feces. An increase in branched-chain amino acids (BCAAs) and aromatic amino acids was reported after a fecal sample underwent a freeze--thaw cycle before extracting fecal water.^[@ref21]^ This information has supported a previous paper by Saric et al. which has also demonstrated an increase in BCAAs after freeze--thaw cycles of the fecal sample prior to fecal water extraction.^[@ref22]^ Furthermore, a number of studies have illustrated the effects of different sample-processing procedures on the metabolite levels. An overview of the impact of steps such as homogenization, filtration, centrifugation, and solvent extraction has been previously presented.^[@ref23]−[@ref25]^
The impact of storage conditions on bacterial community levels has been examined. Roesch et al. demonstrated a 10% change in bacterial community levels in a fecal sample when stored at −80 °C at different time points post receiving the sample.^[@ref26]^ However, other studies have reported no significant difference in results because of differing storage conditions on bacterial community levels in fecal samples, and^[@ref27],[@ref28]^ others have recommended a collection protocol to minimize the impact.^[@ref29]^ With respect to the fecal metabolome, there is no such consensus, and further studies are warranted.
In summary, analyzing the gut microbiome has become an integral part of many human studies, and assessment of the fecal water metabolome can yield valuable information. However, more work is needed to examine the impact of storage and processing procedures on the metabolite levels in fecal water. The objective of this study was to examine the impact of different storage conditions prior to metabolite extraction on the fecal water metabolome. The work highlights the need for standardized procedures.
Results {#sec2}
=======
A total of nine healthy participants were included in this study including four males and five females. Two of the individuals supplied samples on two separate occasions resulting in a total of 11 sample sets. The mean age was 34 years and participants had a mean body mass index (BMI) of 24.1 ± 2.78 kg/m^2^. A summary of the baseline characteristics of the participants is presented in [Table [1](#tbl1){ref-type="other"}](#tbl1){ref-type="other"}.
###### Demographic Data of Participants Included in the Study[a](#t1fn1){ref-type="table-fn"}
characteristics male (*n* = 4) female (*n* = 5)
-------------------- ---------------- ------------------
age (years) 34 ± 9 35 ± 14
weight (kg) 77.55 ± 7.91 66.00 ± 12.24
height (m) 1.76 ± 0.08 1.68 ± 0.08
BMI (kg/m^2^) 25.1 ± 2.6 23.2 ± 2.9
waist to hip ratio 0.87 ± 0.05 0.82 ± 0.09
All values shown are mean ± SD.
Examination of the principal component analysis (PCA) revealed that the interindividual variation was the dominant source of variation on the dataset. The samples of the individuals were grouped together in the PCA scores plot ([Figure [1](#fig1){ref-type="fig"}](#fig1){ref-type="fig"}A). To explore the impact of storage, we employed a row-wise centering of the data and this resulted in separation of the samples according to the storage type ([Figure [1](#fig1){ref-type="fig"}](#fig1){ref-type="fig"} B).
{#fig1}
To examine the impact of the storage further, a univariate analysis approach was employed. A total of 14 compounds from the fecal water analysis were significantly different across the three storage conditions. Significant metabolites from repeated measures ANOVA corrected by the false discovery rate (FDR) are presented in [Table [2](#tbl2){ref-type="other"}](#tbl2){ref-type="other"}. Interestingly, the metabolites were predominantly increased following freezing at −80 °C prior to preparation of fecal water ([Figure [2](#fig2){ref-type="fig"}](#fig2){ref-type="fig"}). The sample stored on ice for 24 h had the highest fidelity to the freshly prepared samples. Closer examination of the significantly different metabolites revealed that the BCAAs, aromatic amino acids, Krebs cycle intermediates, and monosaccharides were found at higher levels in fecal water prepared from frozen samples. However, the short chain fatty acid (SCFA), butyrate, was lower in fecal water from frozen/defrosted, and on ice samples. [Figure [3](#fig3){ref-type="fig"}](#fig3){ref-type="fig"} shows the typical spectra of fecal water analyzed from fresh, frozen, and on ice samples.
{#fig2}
{#fig3}
###### Differential Fecal Metabolites between the Different Conditions of Sample Storage[a](#t2fn1){ref-type="table-fn"}
metabolite *P*-value FDR description
--------------- ----------- ------- ----------------------------------------------------------
aspartate \<0.001 0.008 Krebs cycle: oxaloacetate transamination
butyrate \<0.001 0.017 short chain fatty acid
fructose \<0.001 0.008 monosaccharide
fumarate \<0.001 0.004 dicarboxylic acid related to the Krebs cycle
glucose \<0.001 0.008 monosaccharide
glutamate \<0.001 0.008 proteinogenic amino acid related to cellular metabolism.
isobutyrate 0.001 0.017 BCAA-derivative
isoleucine \<0.001 0.004 BCAA
leucine \<0.001 0.004 BCAA
nicotinate \<0.001 0.004 energy metabolism in the living cell and DNA repair
phenylalanine \<0.001 0.009 aromatic amino acid
threonine \<0.001 0.008 alpha amino acid
tyrosine \<0. | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION {#sec1_1}
============
Diarrhoeal disease causes an estimated 1.8 million deaths per year ([@B1]). Despite evidence of reduction in mortality over the last 50 years ([@B2],[@B3]), diarrhoeal disease continues to be a major killer of children aged less than five years and a principal cause of morbidity for most impoverished children of the world. It is well-known that most of these deaths are preventable with existing disease- control strategies ([@B4]).
Although there are numerous causes for the lack of greater progress in the control of diarrhoeal diseases, it is clear that our investments in related research over the last 20 years have not had the greatest attainable impact. It is now increasingly recognized that research priorities do not optimally address the needs of children in developing countries ([@B5],[@B6]). Setting research priorities is clearly a challenging and imperfect process that relies on the best data available and the knowledge of experts in the field to fill in knowledge gaps. Clearly, data regarding the number and cause of deaths and the coverage of interventions are limited and imperfect. How to integrate available data with expert opinion is an evolving area. Classically, they were derived from expert group meetings and, more recently, Delphi exercises have been employed as an improved strategy to incorporate expert opinion in decision-making processes. Cost-effectiveness analyses have been used for prioritizing among health interventions but have not been systematically used for determining the most promising research. In any case, cost-effectiveness analysis would have limited usefulness without a critical assessment of the likelihood that investments in research would result in reduction in the burden of disease. The Child Health and Nutrition Research Initiative (CHNRI) was founded to encourage and support research on the important child health problems in low- and middle-income countries. The CHNRI developed a structured process that was designed to measure the likelihood that funding-specific research questions would be successful in reducing child morbidity and mortality. This novel methodology was used here for assessing the priority for funding particular avenues of research to address the burden of disease caused by childhood diarrhoea ([@B7],[@B8]).
MATERIALS AND METHODS {#sec1_2}
=====================
Selection of group members and research options {#sec1_2_1}
-----------------------------------------------
As part of a larger exercise of assessing research priorities for major child health conditions, the CHNRI decided that the exercise should consider research for burden of reduction of diarrhoeal disease by 2015 among children aged less than five years. Since the currently-accepted disease-burden measure is the disability-adjusted life-year (DALY), which incorporated both mortality and morbidity components of disease, our scoring exercise included both mortality and morbidity components. However, due to the current thinking on disease weighting, most burden of diarrhoeal disease is related to mortality rather than morbidity, and scorers were asked to respect this current thinking. The CHNRI Secretariat selected two group members (CL and MK). These two members defined the list of research options in communication with IR, based on a systematic framework for listing research options relating to a single disease developed by the CHNRI ([@B7],[@B8]). This systematic approach enables comprehensive listing and equal treatment of research options in different broad research domains: epidemiologic research, health policy and systems research (HSPR), research intended to improve existing interventions, and research to develop new interventions. The list of research questions was intentionally limited to less than 50 to allow individuals to be able to complete the scoring process in a single day. These research options included different strategies in diarrhoeal disease control encompassing those aimed at improving water and sanitation infrastructure, those targeting healthcare-delivery strategies, those addressing nutritional deficiencies, and research to evaluate novel diagnostics and vaccines. The research options were then categorized as either: (a) Health policy and systems research (HSPR) that aimed to improve the efficiency and coverage of known interventions; (b) Research that improved existing interventions by making them more affordable or deliverable; or (c) Research options to develop entirely new interventions. Although a research option could encompass multiple different research questions, it was made sufficiently narrow in scope to be able to anticipate specific research project derivatives that could be evaluated by the scoring process.
A further 17 experts were invited to participate, of whom eight completed and returned priority scores for a total group of scorers comprising 10 individuals \[Group of scorers: Shinjini Bhatnager, Zulfiqar A. Bhutta, Olivier Fontaine, Margaret Kosek, Claudio F. Lanata, Dilip Mahalanabis, Mohammed Abdus Salam, John D. Snyder, Cesar Victora, and Damian G. Walker\].
These individuals were categorized as physicians with expertise in infectious diseases, gastroenterologists, public-health researchers specialized in programmatic issues, a health economist, and public-health researchers in areas other than programme development and evaluation. Each one scored the individual research options independently using a five-component structured model developed by the CHNRI to evaluate health research. The five components consist of the following: (a) likelihood that the research option can yield new knowledge in an ethical manner; (b) likelihood that the research findings will lead to efficacious and effective interventions; (c) likelihood that the intervention derived from the research would be affordable and deliverable to the population of interest; (d) most likely maximum burden of disease reduction that could be derived from interventions resulting from research within the option; and (e) likely impact that the derivates of the research will have on equity.
Scores were computed as percentage of maximal obtainable points for each of the major five components being evaluated and then combined for an overall score. The scores outline both limitations and strengths of each research option. Each of the five intermediate scores reflect the likelihood that the research option will be answerable, that it will result in an effective intervention, that the resulting intervention will be deliverable, that the resulting intervention will increase equity, and an estimation of the maximal disease-burden impact an intervention resulting from the research is foreseen to have. When added together, this overall score becomes a quantitative measure of the collective optimism that research in that area can have substantial impact prior to 2015. Although this system easily accommodates weighting of these five options by donors or regional agencies or other stakeholders, we have presented the unweighted results. The process of scoring is presented in greater detail elsewhere ([@B7]-[@B10]).
RESULTS {#sec1_3}
=======
The listing of research options yielded 46 options. Twenty-one research options were designed as health policy and systems research to increase the efficiency of interventions already in place, 10 options addressed research to improve the affordability and deliverability of known interventions, and 15 options were primary research to develop new interventions. The complete list of the 46 research options is presented in Table [1](#T1){ref-type="table"}. The questions guiding the scoring of the research options by each criteria are shown in Table [2](#T2){ref-type="table"}. An excel file that facilitates the scoring exercise by providing a spreadsheet for the input of scores is available online (<http://www.icddrb.org/jhpn>).
######
List of 46 research options scored by diarrhoeal disease experts
Research option
----------------- ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
RO1: Health policy and systems research (HPSR) to increase access to ORS packets at all times in all sites for all children who may need it
RO2: Research to generate new knowledge (mostly effectiveness studies) to increase the use of low-osmolarity ORS
RO3: Health policy, systems, and education/behaviour modification research to increase the percentage of infants with exclusive breastfeeding at \<6 month of age
RO4: Health policy, systems, and education/behaviour modification research to increase the percentage of infants and children, aged less than 2 years, who are breastfed
RO5: Health system research to increase the coverage of measles vaccine
RO6: HPSR to improve the coverage of rotavirus vaccine in countries with the greatest needs
RO7: Systems and education/behaviour modification research to increase water consumed per person per day
RO8: System research to measure the effectiveness of piped water systems on diarrhoea if they are installed at the community vs in the home
RO9: System research to measure the effectiveness of piped water systems on diarrhoea if they are installed so as to provide intermittent vs 24-hour availability
RO10: Systems and education/behaviour modification research to increase the coverage of sewage systems
RO11: Systems and education/behaviour modification research to increase the prevalence of effective latrines
RO12: Health policy, systems, and education/behaviour modification research to increase the proportion of women and children washing their hands effectively to improve hand-washing promotion
RO13: Education/behaviour modification research to increase the energy density of weaning foods at the household level (in areas with food availability)
RO14: HPSR to allow that all mothers with a child with diarrhoea will know how to recognize danger-signs for timely referral/self-referral of severe cases
RO15: HPSR to improve the quality of care of moderate/severe diarrhoea cases through standardized case management
RO16: HPSR to improve prescription of appropriate antibiotics for dysentery
RO17: Efficacy/effectiveness studies of interventions of behaviour modification to reduce baby bottle-use
RO18: Education/behaviour modification research to increase the use of refrigerators for storage of weaning foods
RO19: | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Botulinum toxins have been used for over 20 years for aesthetic procedures to improve the appearance of the face.[@b1-ccid-5-053],[@b2-ccid-5-053] Botulinum toxin type A injections are the most common nonsurgical procedures performed in the US with almost 2.5 million procedures carried out in 2010.[@b3-ccid-5-053]
There are several commercially available botulinum toxin type A products. OnabotulinumtoxinA (Botox^®^/Vistabel^®^; Allergan Inc, Irvine, CA) is indicated for the treatment of glabellar frown lines and is commonly used for the treatment of facial wrinkles.[@b4-ccid-5-053] The terms "incobotulinumtoxinA", "NT 201", "Xeomin^®^", and "Bocouture^®^" (Merz Pharmaceuticals GmbH, Frankfurt, Germany) all refer to the same botulinum toxin type A (150 kDa) that, unlike onabotulinumtoxinA, is free from complexing proteins. IncobotulinumtoxinA is currently licensed widely across Europe, the US, and parts of South America and Asia for aesthetic indications. IncobotulinumtoxinA has demonstrated clinical efficacy in aesthetic indications in a number of clinical trials.[@b5-ccid-5-053]--[@b7-ccid-5-053]
In comparative, head-to-head trials in healthy volunteers, and in the therapeutic indications of blepharospasm and cervical dystonia, incobotulinumtoxinA had an identical time course of action (eg, time to onset, duration of effect, and time to waning of effect) as onabotulinumtoxinA.[@b8-ccid-5-053] Furthermore, in a large head-to-head study comparing incobotulinumtoxinA with onabotulinumtoxinA for the treatment of glabellar frown lines, the percentage of responders 4 and 12 weeks after injection of the same number of units (U) of either preparation were similar, and demonstrated that both treatments were highly effective according to the assessment of independent raters, investigators, and subjects.[@b7-ccid-5-053] No statistically significant difference in efficacy was observed in a proof-of-concept study in the treatment of crow's feet[@b6-ccid-5-053] and in the treatment of forehead lines[@b9-ccid-5-053] using a 1:1 dose ratio of the two products.
The aim of this retrospective analysis was to investigate the clinical efficacy of incobotulinumtoxinA compared with onabotulinumtoxinA or abobotulinumtoxinA (Dysport^®^/Azzalure^®^; Ipsen Ltd, Berkshire, UK) when used in daily practice by physicians to treat wrinkles of the upper face. IncobotulinumtoxinA was launched in Germany in 2005, making it the best suited location for this study by ensuring sufficient data could be obtained for this analysis including in off-label indications.
Parameters relating to subject and physician satisfaction, the time interval between doses administered (duration between treatment cycles), dosages used, and adverse effects experienced were investigated. Any differences in these parameters may indicate that the product with lower subject and physician satisfaction, shorter interval between treatments, or higher dosages was less clinically effective.
Materials and methods
=====================
The parameters used as indicators of clinical efficacy in daily practice were subject and physician satisfaction, the time interval between injections, dosage, and adverse effects. In order to collect the relevant data to address these questions, physicians known to use incobotulinumtoxinA at 41 sites in Germany were contacted and asked to complete questionnaires ([Table 1](#t1-ccid-5-053){ref-type="table"}) based on an inspection of files for those subjects who had received at least two consecutive botulinum toxin type A injections, but not more than three, in the upper face within 12 months during the last 2 years (ie, to treat glabellar frown lines, lateral periorbital wrinkles, and/or horizontal forehead lines, which includes common on- and off-label usage in clinical practice). A different questionnaire was filled in for each indication, giving a maximum of three completed questionnaires per subject. The selected subjects had therefore been treated according to the treatment flows shown in [Figure 1](#f1-ccid-5-053){ref-type="fig"}. For the analysis, subjects were divided into two groups: subjects who did not change product and subjects who changed product (irrespective of whether the change occurred at visit 2 or visit 3 or both).
The documentation period was from March 2011 to June 2011 and data that would allow a subject to be identified were not collected. Male or female subjects aged 18 years and over who had received treatment with botulinum toxin type A were eligible for inclusion in this study. Initial treatments and touch-up treatments were reasons to exclude a subject from the study. No ethics committee approval was required for this retrospective study without invasive measures.
In daily practice, it is very common to treat "aesthetic units", for example the "upper face", rather than single isolated areas, such as forehead lines, the glabella or crow's feet. Consequently, analysis was performed on all treatments of the upper face rather than single isolated areas. Differences between treatment groups were assessed using appropriate statistical analyses. Any differences in subject and physician satisfaction and adverse effects were analyzed using Fisher's Exact test, while analysis of doses at each visit and treatment intervals used the Wilcoxon--Mann--Whitney test. The Student's *t*-test was used to analyze the total mean dose across all visits. Data were collected from a sufficient number of subjects (n = 1256) to enable statistical analyses to be carried out.
Results
=======
Of the 41 sites contacted, 21 sites returned completed questionnaires. In total, 2316 questionnaires were returned and 46 were excluded. Forty-five questionnaires were excluded because they only recorded one visit (rather than the required minimum of two) and one was excluded because it was a duplicate, leaving 2270 evaluable questionnaires. In total, data from 1256 subjects were included. Demographic and baseline characteristics are shown in [Table 2](#t2-ccid-5-053){ref-type="table"}. Subject numbers in the incobotulinumtoxinA and onabotulinumtoxinA treatment groups were sufficient to ensure that robust statistical data could be obtained, but the number of abobotulinumtoxinA injections was so low (1.6%, which might reflect daily practice in Germany), that no statistical evidence could be conveyed. Hence, these were removed from the analysis. Most subjects received incobotulinumtoxinA injections and the majority of subjects did not change product within the time limits of this retrospective analysis ([Table 2](#t2-ccid-5-053){ref-type="table"}). The most common reason for product change given was that the usual product was unavailable at the time of treatment.
Subject and physician satisfaction
----------------------------------
The vast majority of subjects were satisfied with their treatment (96.4% for incobotulinumtoxinA and 95.8% for onabotulinumtoxinA). There was no statistically significant difference in subject satisfaction between the two products (*P* = 1.000). Similarly, the rates of physician satisfaction were also very high for both products: 96.3% and 95.3% were satisfied with incobotulinumtoxinA and onabotulinumtoxinA, respectively (*P* = 0.825).
Interval between two treatments
-------------------------------
Any difference in the mean treatment interval (ie, the time between the first and second injections \[interval 1\] or the second and third injections \[interval 2\]; [Figure 1](#f1-ccid-5-053){ref-type="fig"}) was assessed separately in subjects who did not change product in order to give an indication of the duration of the effect. There was no statistically significant difference between the treatment intervals in subjects who did not change product ([Table 3](#t3-ccid-5-053){ref-type="table"}). The mean length of interval 1 was 25.25 weeks and 24.90 weeks for subjects treated with incobotulinumtoxinA and onabotulinumtoxinA, respectively (*P* = 0.9646). For interval 2, the mean length was 22.43 weeks and 21.95 weeks, respectively (*P* = 0.8696).
Because the group of subjects who did change product included subjects who changed product at visit 2 or visit 3 or both, no conclusions could be drawn from any differences between the lengths of the treatment intervals in this group of subjects.
Dosage
------
In order to analyze the dosages administered, subjects were again divided into two groups: those who did not change product and those who did. Within these two groups, the mean dosage of each product was calculated at each visit. For the subjects who did not change product, the mean dosages for incobotulinumtoxinA and onabotulinumtoxinA were 18.92 U and 18.79 U at visit 1 (*P* = 0.4335), 18.12 U and 18.44 U at visit 2 (*P* = 0.4262), and 18.20 U and 18.94 U at visit 3 (*P* = 0.6900), respectively. In the group of subjects who did change product, the mean dosages for incobotulin | {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
A large number of studies have focused on subjective well-being[1](#Fn1){ref-type="fn"} (see Diener [@CR14]; Helliwell [@CR25]; Kahneman et al. [@CR30]), and many have found that married people have higher subjective well-being (Mikucka [@CR49]; Stutzer and Frey [@CR71]; Waite and Gallagher [@CR79]). Yet the increase in cohabitation---not just as a prelude to marriage but also as an alternative partnership type and an accepted setting for parenthood (Perelli-Harris et al. [@CR59])---raises questions as to whether only marriage has beneficial effects. Given that cohabitation shares many of the same characteristics as marriage---for example, intimacy, emotional and social support, and joint residence---cohabitors may have similar well-being to those who are married (Soons et al. [@CR70]; Zimmerman and Easterlin [@CR83]).
One of the key issues when analyzing the relationship between partnership status and subjective well-being (SWB) is selection. Cross-sectional studies have often recognized the inability to disentangle selection and causality (e.g., Lee and Ono [@CR41]; Soons and Kalmijn [@CR69]). Longitudinal studies tend to use fixed-effects (FE) models, which focus on within-individual transitions in partnership status, a process usually occurring in younger adulthood and covering a relatively short period of the life course (Kalmijn [@CR32]; Musick and Bumpass [@CR53]; Soons et al. [@CR70]). These studies did not examine the long-term effects of partnership in midlife, after the majority of individuals have made decisions about marriage and childbearing. Midlife[2](#Fn2){ref-type="fn"}---after women's prime reproductive period, and when being married may influence one's identity and well-being---is an understudied part of the life course (Lachman [@CR37]). At this point in life, the initial boost in happiness may have declined (Soons et al. [@CR70]; Zimmermann and Easterlin [@CR83]), and raising children may confound SWB (Balbo and Arpino [@CR5]; Margolis and Myrskylä [@CR47]).
FE models also do not directly consider individuals who do not experience a change in partnership status: that is, those who cohabit and never marry. Thus, we cannot tell whether certain groups---for example, those living in a coresidential partnership who have a low propensity to marry---would benefit if they married rather than cohabited; or alternatively, whether the benefits to marriage may be more pronounced for those who have a higher propensity to marry. Given the interest in marriage promotion policies, targeting low-income individuals in countries such as the United Kingdom, it is important to examine whether those unlikely to marry would be happier if they did marry. To address these selection processes, we use propensity score--weighted regression analysis to pinpoint how early life and/or current conditions influence conditions in midlife. This method allows us to address baseline bias and differential treatment bias (Morgan and Winship [@CR52]), which occur when the link between marriage and well-being varies across subgroups.
Cross-sectional research has found a "happiness gap" between cohabitation and marriage in most countries, but the size of the gap appears to vary and may be linked to the acceptance and prevalence of cohabitation in a society (Soons and Kalmijn [@CR69]) or gender context and religious norms (Lee and Ono [@CR41]). However, it is unclear whether the long-term effects of selection in different countries operate similarly, especially because union duration, childbearing experience, and meanings of cohabitation differ across countries (Hiekel et al. [@CR27]; Perelli-Harris et al. [@CR60]). In addition, the heterogeneity of treatment effects may vary, indicating that marriage has different benefits for different groups, depending on the country. Here we compare the association between partnership type and SWB in the United Kingdom, Australia, Germany, and Norway, which have experienced substantial increases in cohabitation over the past few decades but have different family policies (Perelli-Harris and Sánchez Gassen [@CR61]) and cultural orientations toward marriage (Perelli-Harris et al. [@CR60]). Each of these contexts leads us to predict a certain relationship between partnership status and SWB.
This study addresses a number of gaps in the literature. First, we provide new insights into selection due to childhood background and current characteristics for the association between union type and SWB. Second, we examine whether marriage may be especially advantageous for partnered individuals who have a lower or higher propensity to marry. Third, we analyze the extent to which the relationship between partnership type and SWB varies by country and gender. More broadly, analyzing how cohabitation differs from marriage for individuals' well-being will contribute to our understanding of the meaning and consequences of cohabitation as well as the extent to which these meanings differ across contexts.
Theoretical Background {#Sec2}
======================
A large body of research has investigated the beneficial aspects of marriage for well-being (for reviews, see Nelson-Coffey [@CR56]; Waite and Gallagher [@CR79]). These studies posited that married partners benefit from sexual and emotional intimacy, companionship, and daily interaction (Kamp Dush and Amato [@CR33]; Umberson et al. [@CR75]). Spouses help each other cope with stress by providing social and emotional support. Recognition from a spouse may provide symbolic meaning in life (Umberson et al. [@CR75]). Additionally, sharing a household can lead to economies of scale, and married spouses could profit from a larger friendship and kin network (Ross and Mirowsky [@CR66]; Umberson and Montez [@CR76]). All these mechanisms could enhance SWB.
Nonetheless, given dramatic social change over the past decades, the benefits to marriage may be declining (Liu and Umberson [@CR43]). A recent study comparing 87 countries found that the life satisfaction advantage of married men compared with unmarried men has waned over the last three decades, suggesting that marriage has become less advantageous (Mikucka [@CR49]). This decline may be partially due to the increase in cohabitation, especially in high-income countries. Cohabitation may be taking on much of the form and function of marriage (Cherlin [@CR10]), especially as cohabiting unions become longer and involve children. Similar to married couples, cohabiting couples share a household and may benefit from similar intimacy, support, care, and family networks. Normative expectations to marry have become weaker, and the tolerance for nonmarital arrangements has increased in most countries (Treas et al. [@CR74]).
A large body of research, however, has found that cohabitors often differ from married couples. Across countries, cohabitors have lower second birth rates (Perelli-Harris [@CR57]), are less likely to pool incomes (Gray and Evans [@CR22]; Lyngstad et al. [@CR45]), have lower relationship quality (Wiik et al. [@CR81]), and are more likely to dissolve their relationships (Galezewska et al. 2017), even if they have children (Musick and Michelmore [@CR54]). Qualitative research from Europe and Australia has suggested that many still think of cohabitation as a less-committed type of union than marriage and instead oriented toward freedom and independence (Perelli-Harris et al. [@CR60]). Marriage may thus still be desired by most people but more as a cultural ideal or status symbol.
Recently, most scholars have used FE models to examine whether cohabitation is similar to marriage in increasing SWB. This approach allows the testing of set-point theory, which posits that individuals have a baseline level of happiness that cannot be permanently modified by life events, such as union formation. This theory has been tested in a range of settings, and the findings support a positive effect of marriage and cohabitation on SWB (Musick and Bumpass [@CR53]; Soons et al. [@CR70]; Zimmermann and Easterlin [@CR83]), with cohabitation having a weaker effect (Kalmijin 2017). Some studies, however, have questioned set-point theory and found that different model specifications can result in long-term improvements for marriage (Anusic et al. [@CR3]). Overall, however, most studies indicated that, on average, marriage provides a boost to well-being, with cohabitation providing a weaker boost, and individuals return to original happiness levels in the long term.
Selection Processes {#Sec3}
-------------------
Selection processes---also referred to as *baseline bias* (Morgan and Winship [@CR52])---select people into marriage and may be responsible for higher SWB in midlife. These processes can begin early in childhood and continue into adulthood (Elo [@CR17]; Kuh et al. [@CR36]; Umberson et al. [@CR75]). For example, parents' education and socioeconomic status (SES) are strongly associated with adult life satisfaction (Frijters et al. [@CR20]; Layard et al. [@CR40]), but can also influence decisions about cohabitation and marriage, especially around the time of a first birth (Koops et al. [@CR35]; Wiik [@CR80]). Parental divorce in childhood may have long-term effects on future SWB, both emotionally and financially (Amato [@CR2]), and lead the children of divorced parents to choose coh | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-molecules-23-00890}
===============
As an important predecessor of submicron particles (PM2.5) and ozone pollution in the atmosphere, volatile organic compounds (VOCs) emitted from industrial manufacturing have received increasing attention in recent years \[[@B1-molecules-23-00890],[@B2-molecules-23-00890]\]. Among the VOCs, the benzene series (BTEX) and acetone have always been simultaneously utilized in paints, solvents, and raw materials in the chemical and printing industry \[[@B3-molecules-23-00890],[@B4-molecules-23-00890],[@B5-molecules-23-00890]\]. Exposure usually causes a number of environment-related health problems, including dizziness, nausea, organ damage, and even cancer \[[@B6-molecules-23-00890]\]. Thus, developing suitable abatement methods for BTEX/acetone emission control is urgent and significant. Conventional technologies for VOC removal include adsorption, thermal combustion, chemical absorption, and catalytic oxidation. However, such methods are not sufficiently cost-effective or suitable for removal of dilute concentrations (\<1000 ppm) of contaminants under high space velocity because of low efficiencies and high energy consumption \[[@B7-molecules-23-00890]\]
In recent years, non-thermal plasma (NTP) has been regarded as an energy-saving, efficient, and promising method for low-concentration VOC abatement due to its environmentally-friendly nature, fast ignition response, and strong oxidative degradation ability \[[@B8-molecules-23-00890],[@B9-molecules-23-00890]\]. At room temperature, quantities of highly energetic electrons and reactive species generated in the discharge area trigger a cascade of plasma chemistry reactions, resulting in the removal of pollutants \[[@B10-molecules-23-00890],[@B11-molecules-23-00890],[@B12-molecules-23-00890]\]. Several studies on BTEX removal, side product analysis, and degradation mechanisms by NTP have been reported over the past few years. Satoh et al. explored the effect of O~2~ proportion in carrier gas on the removal of benzene by different manners of discharge. The results shows that at low oxygen concentration, the byproducts are primarily C~2~H~2~, HCN, NO, and HCOOH, while only HCOOH is found at high oxygen concentrations \[[@B13-molecules-23-00890]\]. Stefan et al. investigated the degradation of cyclohexene and BTEX in an NTP air purifying system, and the degradation efficiency order of benzene (\<1%) \< xylene (3%) ≈ ethylbenzene \< toluene (11%) ≈ cyclohexene was found \[[@B14-molecules-23-00890]\]. Our previous research indicates that the conversion of low-concentration benzene, toluene, and *p*-xylene increases from 2%, 19%, and 49%, respectively, at an energy density (ED) of 10 J·L^−1^ under positive corona discharge for BTEX \[[@B15-molecules-23-00890]\]. Unlike BTEX, there are few reports focused on acetone degradation by NTP. In research, monolithic ceramic catalysts and CuO/γ-Al~2~O~3~ are often added into the plasma reactor or after the reaction to intensify the decomposition of acetone plasma \[[@B16-molecules-23-00890],[@B17-molecules-23-00890]\]. With respect to byproduct investigation, Narengerile et al. evaluated the acetone decomposition efficiency in DC water plasmas at atmospheric pressure. It was found that aqueous acetone can be successfully decomposed into H~2~, CO~2~, CO, and CH~4~, but unwanted byproducts, such as HCOOH and HCHO, also form \[[@B18-molecules-23-00890]\].
However, some limitations on the study of acetone and BTEX removal by NTP still exist as follows. Firstly, acetone, as a representative of oxygen-containing VOCs, is hardly decomposed, but has the highest emission limit (100 mg·m^−3^) among VOCs from petrochemical industry emissions \[[@B19-molecules-23-00890]\]. However, few studies have focused on its removal effectiveness, especially at low concentrations. Secondly, in general typical industrial emissions contain a blend of VOCs \[[@B20-molecules-23-00890],[@B21-molecules-23-00890]\]. However, research often focuses on single-component VOCs rather than mixtures of VOCs, which is not in accordance with real emission conditions. Thirdly, though BTEX concentrations are far below those of acetone in real life, their compounds are characteristic constituents of the gaseous effluents of wastewater treatments in petrochemical plants \[[@B19-molecules-23-00890]\]. Whether there is an interaction between acetone and BTEX when treated together remains unknown.
Accordingly, this study focuses on a mixture of acetone and BTEX degradation using corona discharge that aims at investigating possible influencing mechanisms in removal efficiency and COx selectivity under NTP treatment. In addition, the impact of BTEX types on NO~x~, O~3~, organic byproduct formation, and the acetone degradation pathway are also studied by experimental and theory calculations in this paper.
2. Experimental {#sec2-molecules-23-00890}
===============
2.1. Experimental System {#sec2dot1-molecules-23-00890}
------------------------
The experimental system is shown in [Figure 1](#molecules-23-00890-f001){ref-type="fig"}. It consists of a coaxial link tooth wheel-cylinder plasma reactor with a 25 kV/5 mA negative direct current (DC) high voltage power supply, reaction gas supply, and analytical instrumentation. It is a stainless steel cylinder with an inner diameter of 42 mm and a length of 300 mm that serves as the ground electrode of the plasma reactor. The high voltage electrode is a stainless steel rod (o.d. 6 mm) through which 10 discharge teeth wheels are linked with a space interval of 10 mm, while each wheel has six discharge cusps. The effective discharge length and discharge intervals are 100 and 16 mm, respectively. The visual appearance of the discharge is that of a gleamy plasma column completely filling the inter-electrode space, representing a streamer-like corona discharge.
2.2. Experimental Methods {#sec2dot2-molecules-23-00890}
-------------------------
Experiments with both the single acetone and acetone with BTEX (benzene, toluene, or *p*-xylene) were conducted in this study. Gaseous VOCs and water vapor were introduced by passing air through a temperature-controlled bubble tower and they were then mixed with dilution air in a mixing chamber to reach the desired concentration. Relative humidity (RH) of the reaction gas was controlled at 50% at room temperature (298 K). The concentrations of benzene, toluene and *p*-xylene were all 50 ppm, while that of acetone was 250 ppm. The total flow rate was 2.0 L·min^−1^. All the reagents used in this study were analytically pure, obtained from the Beijing Chemical Corporation (Beijing, China).
The outlet concentrations of the VOCs, CO~x~ (CO and CO~2~), O~3~, NO~x~ (NO and NO~2~) were respectively detected. The VOCs in the gas stream were analyzed by an online gas chromatograph (Agilent, model 6890N, Santa Clara, CA, USA), equipped with a flame ionization detector (FID) and a 30.0 m × 320 μm HP-5 capillary column. The column temperature was 373 K and that of the detector was 423 K. The conversion of each VOC by non-thermal plasma (NTP) decomposition was defined by η, calculated according to Equation (1). The energy density (ED, J·L^−1^) was used to evaluate the validity of NTP technology, which was calculated according to Equation (2). In the present work, all the decomposition results were compared and discussed based on the ED. The outlet concentrations of CO and CO~2~ were analyzed by a gas chromatograph (Techcomp, model GC7890II, Beijing, China) equipped with an FID detector, a TDX-01 packed column, and a methane conversion oven prior to the detector. The CO~x~ selectivity was adopted to characterize the mineralization degrees of the VOCs in the present work, defined by SCO~x~ according to Equation (3). O~3~ was monitored by the Ozone Monitor (2B Technologies, 106-L, Boulder, CO, USA) according to the ultraviolet absorption method, while NO~x~ was monitored according to the *N*-(1-naphthyl) ethylene diamine dihydrochloride spectrophotometric method. $$\eta = \frac{C_{inlet} - C_{outlet}}{C_{inlet}} \times 100\text{\%},$$ $$ED = \frac{U \times I}{Q} \times 60$$ $${~S}_{{CO}_{x}} = \frac{\left( {2 - x} \right)C_{CO} + \left( {x - 1} \right)C_{{CO}_{2}}}{\sum n_{inlet}C_{inlet}^{\prime}\eta} \times 100\text{\%}$$ where *C~inlet~* and *C~outlet~* are inlet and outlet concentrations of the pollutant (ppm), respectively; *U* and *I* are the applied voltage (kV) and discharge current (mA), respectively, both of which can be automatically | {
"pile_set_name": "PubMed Central"
} |
All relevant data are within the paper.
Introduction {#sec005}
============
Acute airway infections are common causes of early childhood hospitalization. Among these infections, acute bronchiolitis is a viral infection commonly encountered in infants and toddlers with acute symptoms of wheezy cough and dyspnea \[[@pone.0121906.ref001], [@pone.0121906.ref002]\]. In addition, an increasing trend in medical visits and total hospitalizations along with the diagnosis of bronchiolitis has been reported in young children in recent decades \[[@pone.0121906.ref003], [@pone.0121906.ref004]\]. Asthma is a severe form of hyperactive airway disease which may present as an acute attack or chronic persistent pattern, and the influence on daily activities can be a serious problem. The clinical symptoms of wheezing and dyspnea in acute asthmatic attacks are similar to acute bronchiolitis. Therefore, whether there is a relationship between bronchiolitis and later childhood asthma, and even adulthood asthma has been investigated for many years \[[@pone.0121906.ref005]--[@pone.0121906.ref009]\]. It has been reported that recurrent wheezing, reduced pulmonary function, and the development of later asthma may occur in young children with bronchiolitis \[[@pone.0121906.ref010]--[@pone.0121906.ref023]\], however there is currently no conclusive evidence \[[@pone.0121906.ref024], [@pone.0121906.ref025]\].
In addition to bronchiolitis, other acute airway infections are not unusual in hospitalized infants and toddlers. Airway inflammation caused by infections may also be related to later childhood asthma. Elucidating the potential relationship between childhood asthma and various kinds of acute airway infections occurring in infants and toddlers is therefore warranted.
Taiwan′s National Health Insurance Research Database (NHIRD) includes comprehensive claims data from the National Health Insurance (NHI) program. This program covers more than 99.5% of residents in Taiwan, and children younger than 18 years of age account for approximately 23% of the whole population in Taiwan \[[@pone.0121906.ref026]\]. The NHIRD provides reliable data for population-based disease research \[[@pone.0121906.ref027]--[@pone.0121906.ref030]\]. These datasets contain aggregated secondary data without personal identification, including patient′s age, gender, admission date, discharge date, diagnosis, expenses, laboratory examination items, detail drug prescription codes and operational codes \[[@pone.0121906.ref031]\]. They have been used in extensive medical research fields from neonates to adults \[[@pone.0121906.ref026]--[@pone.0121906.ref028], [@pone.0121906.ref032]--[@pone.0121906.ref038]\]. It is trustworthy to analyze the population-based relationship between early acute airway infections and later childhood asthma development using these datasets.
We hypothesized that children with a history of early hospitalization due to acute airway infections may have a higher risk of childhood asthma. The purpose of this study was to analyze the relationship between early hospitalization due to acute airway infections, including acute bronchiolitis and other airway infections, in children younger than 3 years of age and subsequent childhood asthma when they are 3 to 10 years of age.
Materials and Methods {#sec006}
=====================
Study population {#sec007}
----------------
Claims data from the Longitudinal Health Insurance Database (LHID) 2010 of the National Health Insurance Research Database (NHIRD) of Taiwan between 1997 and 2010 were retrieved for analysis and comparisons. The LHID 2010 includes claims data of 1,000,000 randomly sampled beneficiaries from the 2010 registry of beneficiaries from the NHIRD. There are no significant differences in age distribution, gender distribution, or average insured payroll-related amount between the patients in the LHID 2010 and the original NHIRD according to the Bureau of National Health Insurance (NHI) in Taiwan \[[@pone.0121906.ref039], [@pone.0121906.ref040]\]. This study was approved by the Institutional Review Board of Taipei Veterans General Hospital, Taipei, Taiwan (VGHIRB No.:2013-06-011BC). There was no consent given because the data were analyzed anonymously and no personal information could be connected in this study.
Information of children younger than 36 months who were hospitalized from 1997 to 2000 were retrieved, and those diagnosed with acute bronchiolitis and other acute airway infections on discharge were enrolled into our study group. The diagnostic codes were based on the International Classification of Diseases, 9th Revision, Clinical Modification (ICD-9-CM) codes, including acute bronchiolitis (466.1), and other acute airway infections (464.1--464.5, 466.0, and 480--486) ([Table 1](#pone.0121906.t001){ref-type="table"}) \[[@pone.0121906.ref041]\]. The children in the control group were selected from the remaining patients during the same enrollment period who did not have any admission records or outpatient records of the above diagnoses. We randomly enrolled four times the number of age- and gender-matched children for the control group for comparisons. The exclusion criteria were a diagnostic record of asthma (ICD-9-CM: 493) at age younger than 3 years. The remaining children were grouped into hospitalized airway infection (HAI) and control groups, and the HAI group was further sub-grouped into bronchiolitis and other HAI subgroups ([Fig 1](#pone.0121906.g001){ref-type="fig"}). The basic data of the enrolled children, including age and gender were recorded and analyzed. Data on potential comorbidities including preterm (ICD-9-CM: 765), congenital heart disease (CHD) (ICD-9-CM: 745, 746, 747), congenital respiratory disease (ICD-9-CM: 748), and chronic lung disease (ICD-9-CM: 770.7) were also retrieved.
10.1371/journal.pone.0121906.t001
###### Diagnostic Codes Defined as Acute Bronchiolitis, Other Acute Airway Infections and Asthma of the Enrolled Children.
[^a^](#t001fn001){ref-type="table-fn"}
{#pone.0121906.t001g}
ICD-9-CM Code Diagnosis
----------------------------------- ------------------------------------------------------
**Acute bronchiolitis**
**466.1** Acute bronchiolitis
**Other acute airway infections**
**464.1** Acute tracheitis
**464.2** Acute laryngotracheitis
**464.3** Acute epiglottitis
**464.4** Croup
**464.5** Supraglottitis, unspecified
**466.0** Acute bronchitis
**480** Viral pneumonia
**481** Pneumococcal pneumonia
**482** Other bacteria pneumonia
**483** Pneumonia-other specified organism
**484** Pneumonia in infectious disease classified elsewhere
**485** Bronchopneumonia, organism unspecified
**486** Pneumonia, organism unspecified
**Asthma**
**493** Asthma
^a^Based on International Classification of Diseases, 9th Revision, Clinical Modification (ICD-9-CM) code.
{#pone.0121906.g001}
Each child was then individually tracked by medical care records from 3 to 10 years of age. The record of a diagnosis of asthma (ICD-9-CM: 493) from the admission datasets (≥ 1 admission with discharge diagnosis of asthma) or outpatient datasets were recorded and analyzed. The diagnosis of asthma in the outpatient dataset was included only if they had 4 or more records of visits due to asthma, and having used one of the following anti-asthmatic medicines at each visit: adrenergics (Anatomical Therapeutic Chemical (ATC) codes: R03A, R03C), xanthines (R03DA), or steroids/β2 agonists (R03BA, R03AK06, R03AK07). The age at first diagnosis of asthma between 3 to 10 years was defined as the age at onset. Medical care conditions including ambulatory visit frequency, admission frequency, admission diagnosis, and medical expenses between 3 to 10 years of age were also retrieved and compared among groups.
Data analysis {#sec008}
-------------
The dataset from the NHIRD was retrieved using Microsoft SQL Server 2008 R2 for database decoding, and SPSS (version 19, SPSS Inc., Chicago, IL, USA) was used for data analysis. SigmaPlot 12.0 (Systat Software Inc. San Jose, CA, USA) and SPSS were used to create graphical representations. One way ANOVA followed by post hoc Student Newman Keul or *t* tests were used to compare means of continuous variables as appropriate, and the chi-square test was used to compare categorical data among different groups. Logistic regression modeling was used to analyze odds ratios (ORs) of the study group compared to the control group. Kaplan-Meier survival analysis with the log rank test, Breslow test, and Tarone-Ware test was | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
With the increase in life expectancy, there is, proportionately, a dramatic increase in age-related health conditions including, in particular, eye diseases. Among all the eye pathologies, diabetic retinopathy (DR) is currently one of the leading causes of blindness in the working-age population in developed countries \[[@B1]--[@B3]\]. Epidemiological data show that the prevalence of DR is around 30% in the diabetic population and that the annual incidence varies from 2% to 6% \[[@B4]\]. Every year, up to 1% of diabetic patients develop serious ocular complications leading to both poor quality of life and a socioeconomic burden \[[@B5]\].
With regard to the Italian setting, a study conducted in the Veneto Region, using clinical fundus examination, confirmed literature data with a prevalence of DR of 26.6% \[[@B6]\]. A significant worldwide increase in the number of persons affected by diabetes has been estimated for the next 10 years, reaching approximately 380 million by 2025, mostly in developing countries. In Europe, compared with 2007, there is expected to be an increase of 10 million persons with a prevalence of diabetes below 10% \[[@B7]\].
As the prevalence of diabetes is expected to rise in the future, an associated increase in DR cases should also be expected. However, recently, data suggest that the prevalence of DR may decrease, due to the intensification of the screening programmes and better control of risk-factors, thus underlying their effectiveness and the significance \[[@B8]\]. In this view, scholars and practitioners widely agreed that DR, at any stage of progression, requires specific management: from the screening programmes (useful for an early diagnosis) to the definition of pharmacological treatments needed. In recent years, the strategies for DR prevention have moved from the traditional ophthalmological examination to a faster digital retinal imaging acquisition and grading of DR. The application of these new screening programmes, followed by prompt diagnosis and a better timely management, is well known to prevent significantly the risk of diabetic blindness \[[@B9], [@B10]\], as well as to decrease all the costs related to the investigated pathology. In fact, from an economic point of view, the annual cost per patient affected by DR is approximately twice as high as those patients with diabetes only \[[@B11]\]: thus, the implementation of effective and recognized screening programmes could represent cost-effective strategies \[[@B12], [@B13]\], one useful to narrow both the economic and the social burden of DR.
Despite the implementation of successful national screening programmes worldwide, the lack of diffuse screening activities for DR in Italy is delaying the diagnosis and prompt treatment of DR.
Public screening programmes and prompt treatments have been shown to reduce lifetime costs related to visual disability \[[@B14], [@B15]\]. For these reasons, vision impairments as a result of DR should be considered easy to prevent, and the development of systematic programmes of screening should represent an urgent and primary healthcare need.
Moving on from these premises, since DR should be one of the major priorities for the healthcare services, the present study aimed at investigating the feasibility related to the introduction of a specific and accurate screening programme in the catchment area of Treviso (defined as ULSS 9), in comparison with the "no prevention" strategy, including also the costs averted to blindness, in terms of the validity of the intervention and the direct costs absorbed (efficiency) by the regional healthcare service. The analysis was designed assuming the regional healthcare service (Veneto Region) point of view.
2. Materials and Methods {#sec2}
========================
2.1. Study Design {#sec2.1}
-----------------
In order to achieve the previously mentioned objective, a perspective study for the implementation of a screening programme devoted to DR was planned to be performed between September and December 2012, after receiving the approval from Ethic Committee of the Local Health Authority. As DR is a multiprofessional and a multidimensional eye disease, a multidisciplinary group was involved in the project, including general practitioners, diabetes experts, administrative staff, nurses, epidemiologists, and ophthalmologists. The involvement of different healthcare professionals in the screening programme could influence the resources absorption and the optimisation of the screening pathway \[[@B12], [@B13], [@B16]--[@B18]\].
The screening involved all types (type 1 and type 2) of diabetic patients living in the area of Ponzano (Treviso) that has 5.000 inhabitants and is part of one of the Local Health Authorities of the Veneto Region: the ULSS 9 of Treviso. Diabetic subjects were accurately identified by crossing different databases: primary and secondary diagnosis for hospitalisation, drugs and delivery systems, prescriptions, health care procedures covered by the diabetic code, and the diabetic code assigned to patients. In particular, the following patients were invited to attend the screening programme: (i) outpatients going to a hospital specialist visit to the diabetologists, or first visit to ophthalmologist; (ii) patients going to the territorial pharmacist, in order to retrieve the specific diabetes drugs; and (iii) patients referring to the general practitioners, with a diagnosis of diabetes. Individuals who were already diagnosed with DR were not included in the study.
Initially, a personal letter of invitation was sent to all the diabetic target population (*N* = 498) to be enrolled in the screening programme. All the patients attending the screening procedure have signed a specific informed consent form, consistent with ethical aspects. Screening for diabetic retinopathy was made using a nonmydriatic fundus camera. A semiobscured visiting room was used to optimise physiological mydriasis before each exam. Three nonmydriatic, 45° field, digital retinal images were captured, in accordance with a previously validated technique. The three fundus images encompassed the following retinal fields: field 1 centred on the macula, field 2 centred on optic disc, and field 3 midperipheral superior-temporal field \[[@B19]\]. The images were obtained by trained paramedical staff (in particular, nurses). All images were electronically transmitted to the reading centre and stored in an online secured database called "Eye Knowledge Network" for the second step, online examination. Retinal images were graded for DR at the Ca\' Foncello Treviso Hospital, where the Ophthalmology Unit is located, by two experts and certified readers who were members of the Reading Centre staff of the University of Padova. DR and diabetic macular edema (DME) were graded in accordance with the International Classification proposed by the American Academy of Ophthalmologists \[[@B20]\]. When the quality of the images was "inadequate" for the clinical evaluation and when fundus images were graded as "positive," the patients were referred for further ophthalmologic examination. "Positive" findings included retinal changes that required specialist management: moderate and severe nonproliferative DR, proliferative DR, DME, and/or any other retinal abnormality. Further ocular and diagnostic examinations or treatments, if necessary, were then planned. Fundus images were graded as "negative" if no DR or nonsight threatening DR was detected. A report, with the results of the screening and the correct follow-up timetable for the "negative" screened population, was sent to the patient\'s general practitioner within 1 month after the screening.
2.2. Economic Evaluation {#sec2.2}
------------------------
From a methodological point of view, in order to quantify the impact of the introduction of screening programme in the clinical practice, both an activity based costing (ABC) analysis and a budget impact analysis (BIA) were conducted.
The ABC \[[@B21], [@B22]\] is useful for the enhancement of the average costs related to each phase of the screening pathway. In particular, the main objective of the ABC is the measurement of the costs and the performance activities, taking into account also the related human and materials resources for the proper development of the procedure. In this view, the economic impact of each patient was determined utilising the following components: (i) human resources (i.e., individuals involved in the different phases of the screening programme, such as administrative staff, nurses, and ophthalmologists); (ii) materials and equipment; (iii) pharmacological and/or laser treatment. The ABC did not take into consideration the costs related to the delivery of the invitation letter: different technologies could be implemented in order to carry out this task (telephonic invitation, e-mail contact, personal contact, or letter), differing for the related economic value.
After the implementation of the ABC, the BIA was applied. A BIA allows the prediction of the potential financial impact of a new technology adoption, into a healthcare system \[[@B23]\]; influencing, in a positive or in a negative manner, the healthcare expenditure and considering both a specific point of view and a determined time horizon. In this view, two scenarios were simulated, thus comparing the so-called "do nothing strategy" with the implementation of a proper screening programme. In particular, in both scenarios, the occurrence and the related cost of blindness were taken into consideration as direct healthcare costs. Since the analysis assumed the Healthcare Regional Services point of view, the intangible and indirect items of expenditure were excluded from the study.
The economic analysis used the 2015 Italian Outpatients and Hospital Admissions Reimbursement Tariffs. Drug costs were derived from the officially published NHS price list. If necessary, economic values were reported in "euros," considering the 2015 inflation rate, using the Consumer Price Index for healthcare expenditure, thus making economic measures comparable, and being based on the same year of reference.
In order to ensure the robustness of the result, a sensitivity analysis was carried out. In particular, both the attendance rate to the screening programme and the percentage of patients undergoing the complete eye examination were modified, thus understanding if significant changes in the feasibility of the programme occur.
Literature | {
"pile_set_name": "PubMed Central"
} |
1. Introduction
===============
The ATP-binding cassette transporter A1 (ABCA1) acts as a vehicle for cellular cholesterol which after crossing cell membrane bounds to acceptor molecule such as apolipoprotein (apo) A \[[@B1]-[@B3]\]. Thus, ABCA1 influences the initial steps in high density lipoprotein (HDL) formation and in reverse cholesterol transport. The ABCA1 protein belongs to ABC proteins family, which are ingredients of biological membranes and use ATP to transfer various particles such as lipids \[[@B1]\]. The ABCA1 protein gene is located in the chromosome 9 in the area 9q31.1. This gene encodes a protein which is expressed in many tissues such as liver, macrophages, intestines, lungs etc. Several ABCA1 gene polymorphisms were identified, including rs2230806 (R219K) and rs2230808 (R1587K), which are mainly associated with the HDL cholesterol (HDL-C) concentration. The R219K results in a single amino acid change in codon 219 from arginine to lysine. The K allele of the R219K polymorphism has been related to low coronary artery disease (CAD) risk \[[@B4]\] and to lower triglycerides (TGs) concentration \[[@B5]\]. As far as concern the levels of HDL-C the reports are still confusing \[[@B4],[@B6]\]. The R1587K which is located in the extracellular loop of the ABCA1 protein, results in a single amino acid change in codon 1587. This polymorphism has been consistently associated with low HDL-C concentration \[[@B7],[@B8]\].
This study was undergone to evaluate the influence of these two ABCA1 gene polymorphisms on lipid profile \[total cholesterol, TGs, HDL-C and low density lipoprotein cholesterol (LDL-C)\] in young nurses. We also tested if there are any differences in frequency of ABCA1 gene polymorphisms between individuals with low and high HDL-C concentration.
2. Materials and methods
========================
Subjects
--------
The genotyping of 308 Greek female students aged 22.5 (±2.3) years who were attended to the University of Nursing of Technological and Educational Institution was performed. All students had no personal history of CAD and were not taking any drugs. Also, exclusion criteria were diabetes mellitus, thyroid and liver disease, high alcohol consumption, professional athleticism and any chronic disease.
All women were attended to the University every day and were staying for 8-10 hours. Women were eating at the school canteen which served typical Mediterranean food. Only one (evening) meal daily was most likely to be different in each student.
Additionally, subject were divided to those with high (HDL-C \>70 mg/dl) and low (HDL-C \<40 mg/dl) HDL-C concentration.
The University of Nursing of Technological and Educational Institution ethics committee approved the protocol of this study. All subjects signed an informed consent form.
Blood Chemistry
---------------
Plasma total cholesterol, TGs, HDL-C and apo A1 were measured using enzymatic colorimetric methods on Roche Integra Biochemical analyzer with commercially available kits (Roche). The serum LDL-C concentration was calculated using the Friedewald formula only in patients with TGs concentration \< 400 mg/dl.
DNA analysis and determination of blood lipids
----------------------------------------------
The ABCA1 gene polymorphisms (R219K and R1587K) were detected using polymerase chain reaction (PCR) and restricted fragment length polymorphism analysis (RFLP\'s). The PCR was performed using Taq polymerase KAPATaq. For R219K polymorphism the oligonucleotide primers which were used are AAAGACTTCAAGGACCCAGCTT and CCTCACATTCCGAAAGCATTA \[[@B9]\]. PCR was subjected to 95°C for 5 min, thirty cycles of 95°C for 30 s, 55°C for 30 s and 72°C for 30s and final extension to 72°C for 7 min, producing a fragment of 309 bp. This fragment was subsequently cleaved by EcoNI, creating fragments for R allele 309 bp and for K allele 184 bp and 125 bp, which were subjected to electrophoresis on an agarose gel 4% and visualized with ethidium bromide.
For R1587K polymorphism the oligonucleotide primers which were used are AAGATTTATGACAGGACTGGACACGA and TGAATGCCCCTGCCAACTTTAC \[[@B8]\]. PCR was subjected to 95°C for 5 min, thirty cycles of 95°C for 30 s, 60°C for 30 s and 72°C for 30s and final extension to 72°C for 7 min, producing a fragment of 139 bp. This fragment was subsequently cleaved by BssSI, creating fragments for R allele 117 bp and 22 bp and for K allele 139 bp, which were subjected to electrophoresis on an agarose gel 4% and visualized with ethidium bromide (Figure [1](#F1){ref-type="fig"}, Figure [2](#F2){ref-type="fig"}).
{#F1}
{#F2}
Statistical analysis
--------------------
The results are given as mean ± standard deviation (SD) or as median and interquartile range (IQR) according to normality of continuous variables. All qualitative variables are presented as absolute or relative frequencies. All biochemical variables were assessed for normality of distribution employing the Shapiro-Wilk test and non parametric statistical tests were used if appropriate. However, non parametric variables were initially normalized; TGLs by the log10 transformation - apoA1 and TC by square root transformation and parametric criteria were employed, all providing the same results as non parametric tests. However, TGL variable was extremely skewed and we decided to use the median \[IQR\] presentation and keep the result of the non parametric test that was employed.
Differences in lipid levels for the various genotypes were evaluated with one - way analysis of variance (ANOVA) or its non-parametric analogue Kruskal - Wallis H statistic. The Pearson\'s chi-square test was employed for the categorical variables.
All tests were two-tailed and statistical significance was established at 5% (p \< 0.05). Data were analyzed using Stata™ (Version 10.1 MP, Stata Corporation, College Station, TX 77845, USA).
3. Results
==========
Clinical and laboratory parameters
----------------------------------
Demographic data, clinical characteristics and lipid profile of the study cohort are shown in Table [1](#T1){ref-type="table"}. R and K allele frequencies appear to have equal distributions in both ABCA1 polymorphisms (p \> 0.05) (Table [2](#T2){ref-type="table"}). The frequencies of R219K genotypes were 50.97% for RR, 40.91% for RK and 8.12% for KK, whereas the frequencies of R1587K genotypes were 47.08% for RR, 41.56% for RK and 11.36% for KK. Both frequencies were found in Hardy-Weinberg equilibrium.
######
Characteristics of the study population.
*Demographic data* *Lipid profile(in mg/dl)*
-------------------------------- --------------------------- ------------------- -------------------
Number of subjects 308 Total Cholesterol 196.6 (59.7)
Age (ys) 22.5 (2.3) TGs 87 \[60.5 - 149\]
BMI (Kg/m^2^) 21.5 \[19.8 - 24.2\] HDL-C 69.2 (25.9)
Waist (cm) 87.0 (12.5) LDL-C 103.5 (38.8)
Apo A 152.8 (53.5)
***Clinical characteristics***
Smoking (yes/no) 110/176 (38.5%/61.5%)
HDL-C: high density lipoprotein cholesterol, LDL-C: low density lipoprotein cholesterol, ApoA1: Apolipoprotein A1, TGs: triglycerides. Data are expressed as mean ± standard deviation (SD) or as median and interquartile range (IQR) according to normality of continuous variables. Qualitative variables are presented as absolute and relative frequencies.
######
R and K allele frequencies according to R219K and R1587K polymorphisms.
ABCA1 R allele frequency K allele frequency p value\*
------------ -------------------- -------------------- -----------
**R219K** 0.72 0.28 0.11
**R1587K** 0.68 0.32
Fisher\'s exact test
R219K and R1587K polymorphisms
------------------------------
The distribution of R219K and R1587K polymorphisms was investigated according to Low HDL-C (n = 46) and High HDL-C concentration (n = 104). No statistical difference was observed in both polymorphisms when compared to Low vs High HDL-C concentration (p = 0.44 and p = 0.48, respectively). Moreover, no difference in the distribution of the R219K genotypes was detected according to lipid profile (Table [2](#T2){ref-type="table"}). Also, no differences in the distribution of K and R carriers of R219K polymorphism was detected according to lipid profile (p = 0.87).
The R1587K genotypes differed significantly according to total cholesterol, LDL-C and TGs concentration (p = 0. | {
"pile_set_name": "PubMed Central"
} |
To the Editor,
I read with great interest the paper by Temiz et al. ([@ref1]) entitled "Effects of cinacalcet treatment on QT interval in hemodialysis patients" published as Epub ahead of print for The Anatolian Journal of Cardiology 2015. They aimed to evaluate the effects of a calcimimetic drug (cinacalcet) on corrected QT values (QTc) in patients with end-stage renal disease (ESRD). They found a prolongation of QTc value compared with baseline QTc value after cinacalcet treatment. I have a few comments.
QTc interval is the time from beginning of QRS to the end of T wave. In other words, it consists of depolarization and repolarization phases of cardiac tissue. Prolongation of QTc represents delayed cardiac repolarization and can be related to ventricular arrhythmias and sudden cardiac death ([@ref2], [@ref3]). Although it is well-known that QTc prolongation is common in patients with ESRD, the exact mechanism of this cardiac repolarization abnormality has not been established ([@ref2]--[@ref5]). Hemodialysis is one reason QTc interval may be affected. Researchers have demonstrated increased QTc intervals in patients with ESRD, especially after end of hemodialysis. This is largely attributed to rapid changes in plasma electrolyte levels during hemodialysis ([@ref4]). Therefore, it is crucial exactly when electrocardiography (ECG) is performed. In the study by Temiz et al. ([@ref1]), it is possible that the timing of ECG may have influenced measurement of QTc.
Electrolyte disturbances are common in patients with ESRD and can cause changes in cardiac ionic polarization, resulting in altered QTc interval ([@ref2]--[@ref5]). Foglia et al. ([@ref5]) determined QT prolongation in patients with primary renal hypokalemia-hypomagnesemia, and demonstrated that decreased levels of potassium and magnesium could alter duration of action potential in cardiac cell membrane. In the study by Temiz et al. ([@ref1]), it may be helpful to present electrolyte levels of the patients at the time of ECG whether electrolytes have influential effects on QTc measurements or not.
Finally, measurement of QTc interval has some technical difficulties such as presence of U waves or inverted T waves and intraobserver variability, which are not mentioned clearly in the study by Temiz et al. ([@ref1]) and can affect the precise measurement of QTc value ([@ref2]--[@ref5]).
In conclusion, I think that this study would be stronger with these additional data mentioned above and we can easily understand the role of cinacalcet on QTc interval in patients with ESRD.
| {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-micromachines-11-00622}
===============
The limitations of traditional computer architectures have become explicit as the industry reaches to the end of Dennard scaling \[[@B1-micromachines-11-00622]\] and Moore's law \[[@B2-micromachines-11-00622]\] where the data movement is dominated over both overall system energy and performance. More than 90% of the energy consumed by an instruction is spent on memory access \[[@B3-micromachines-11-00622]\]. Considering the current station in which 90% of the overall data has been produced in the last two years, which corresponds to a 9× increase in the total amount \[[@B4-micromachines-11-00622]\], the computer architectures responsible in the processing of all these data must be optimized in terms of data handling methodology. Certainly, the most important domain that needs such a massive amount of data is signal processing. The emergence of artificial intelligence (AI) and big data has dramatically increased the importance of signal processing since the raw data must be processed to obtain better accuracy achievement. On the other hand, there is no corresponding development in computer architectures to handle such an enormous amount of data at the same rate. Excessive increase in the amount of data to be processed and increasing complexity of computational tasks force the researchers towards more data-centric architectures rather than today's processor-centric ones. One such application that highly requires data-centric computational platforms is stencil codes that are used in many computational domains \[[@B5-micromachines-11-00622],[@B6-micromachines-11-00622]\].
The bottleneck of the current systems is generally caused by the communication between processor and memory. The memory systems cannot supply the data to the processor at the required processing rate. Moreover, the energy consumption spent on data access is an order of magnitude higher than the computation cost due to the out of chip access \[[@B3-micromachines-11-00622],[@B7-micromachines-11-00622]\]. The ideal solution is combining processor and memory at the same location to alleviate the limited connection link between them. For this reason, there are recently many research attempts aiming either bringing the processor near the memory (i.e., near-memory computing) \[[@B8-micromachines-11-00622]\] or integrating them (i.e., in-memory computing) \[[@B9-micromachines-11-00622],[@B10-micromachines-11-00622]\]. In-memory computation architectures are very diverse, ranging from analog computation by using the non-volatile memories \[[@B11-micromachines-11-00622],[@B12-micromachines-11-00622],[@B13-micromachines-11-00622],[@B14-micromachines-11-00622]\] through the in-DRAM processing between the DRAM rows \[[@B15-micromachines-11-00622]\]. Among them, associative processors (APs) propose an applicable solution that performs the noise-free digital computation through the binary memory devices (e.g., memristor, SRAM, STT-RAM) \[[@B16-micromachines-11-00622],[@B17-micromachines-11-00622]\]. Associative processors can be considered as a type of single instruction multiple data (SIMD) processor that combines the functionalities of processor and memory in the same location \[[@B16-micromachines-11-00622]\]. In AP, the operations are performed directly on the data residing in memory without moving them. Each memory row behaves as an individual processor together with its own special set of registers. Since an operation can be performed on all memory words in parallel, the execution time of operations does not depend on the vector size. This feature solves the memory-wall problem of traditional von Neumann architectures since there is no inter-dependence between memory and processor \[[@B18-micromachines-11-00622]\]. Even though the inherent latency of associative processors is much higher than the traditional architectures, it can result in better throughput and energy efficiency if the required degree of parallelism is demonstrated by the application \[[@B19-micromachines-11-00622]\]. In applications characterized by data parallelism, associative processors (APs) accomplish a remarkable acceleration \[[@B20-micromachines-11-00622]\], and can be employed as an accelerator near the main processor \[[@B21-micromachines-11-00622]\].
Stencil codes are a class of iterative kernels which update a given array (generally 2D or 3D) with respect to a specific pattern \[[@B22-micromachines-11-00622]\]. This pattern is called as a stencil. The code performs a sequence of iterations through a given array. In each iteration, all the elements of the arrays (i.e., cells) are updated. Stencil computations are highly used in the scientific computation domain for many purposes, including image processing, solving differential equations, computational fluid dynamics simulations (e.g., weather prediction), etc. Due to its importance, there are many studies in the literature that aims to propose an efficient architecture implementation for stencil codes \[[@B23-micromachines-11-00622],[@B24-micromachines-11-00622],[@B25-micromachines-11-00622]\]. Most of the studies are headed towards to field-programmable gate arrays (FPGAs) or graphical processing units (GPUs) based implementations since traditional central processing unit (CPU)-based solutions cannot fulfill the parallel processing requirements. As an example, the study in \[[@B26-micromachines-11-00622]\] proposes a GPU-based 2D stencil implementation using CUDA. The implementation exploits the multi-threading and optimizes the shared memory usage in GPUs. In \[[@B27-micromachines-11-00622]\], OpenCL implementation of four 3D stencil computations is proposed for GPU architectures, which exhibits superior performance than CUDA-based alternatives. In \[[@B28-micromachines-11-00622]\], a multi-core CPU based implementation is proposed together with the corresponding software optimization. In \[[@B29-micromachines-11-00622]\], an OpenCL-based FPGA implementation of some stencil codes is proposed in which a high-level synthesis language is used to generate the stencil codes. Similarly, in \[[@B30-micromachines-11-00622]\], a custom optimized high-level synthesis flow is presented for both area and throughput optimization. The FPGA-based approaches can be considered as near-memory architecture where the memory bottleneck problem is mitigated through the distributed internal memory inside the FPGA fabric. The study in \[[@B31-micromachines-11-00622]\] proposes a multi FPGA-based stencil implementation. The study in \[[@B32-micromachines-11-00622]\] proposes a parameterizable, generic VHDL template for parallel 2D stencil code applications on FPGAs instead of high-level synthesis solutions. In FPGA-based solutions, the performance is limited by both memory bandwidth and the amount of internal memory and logical resources inside the FPGA. After reaching their limits, increasing the parallelism does not increase the performance. The same rule also applies to GPU and CPU based implementations as well. Therefore these architectures limit the degree of parallelism to the number of cores that can be fit in a given chip area and available energy budgets. Considering the case that size and quality of the data are increasing rapidly, it is obvious that there is a need for more efficient domain-specific processor architectures to manage an enormous amount of data for stencil codes as pointed by the computational trends for beyond the Moore's Law and Dennard Scaling \[[@B33-micromachines-11-00622]\].
The stencil computation generally requires basic operational complexity (i.e., a sum of weighted products), but large external memory bandwidth \[[@B26-micromachines-11-00622],[@B29-micromachines-11-00622]\]. This is due to that it requires a number of accesses to the memory while updating each point. Therefore, most implementations of stencil code on traditional architectures suffer from bandwidth limitations \[[@B26-micromachines-11-00622],[@B34-micromachines-11-00622]\]. As a promising solution, associative in-memory processors take advantage of content addressable memories, which provides an area-efficient, in-memory processing solution by integrating the computation and storage. In in-memory solutions, memory bandwidth can be considered as the amount of whole memory. For this reason, this study proposes a 2D stencil kernel architecture based on associative in-memory processing to eliminate the memory bottleneck. The study shows the two implementations by using both SRAMs and memristors. Since stencil codes are memory bound (i.e., the ratio of memory access to computation is high), APs provide a good processing environment for them. Furthermore, the implementation provides a considerable amount of energy savings and speedups in the system through approximate computing at some reasonable level. The rest of the study is organized as follows: In the following section, the background knowledge of both associative processors and stencil codes is presented. [Section 3](#sec3-micromachines-11-00622){ref-type="sec"} introduces the proposed accelerator architecture in detail. Experimentation and evaluation results are discussed in [Section 4](#sec4-micromachines-11-00622){ref-type="sec"}. The final section concludes the work.
2. Background {#sec2-micromachines-11-00622}
=============
2.1. Associate Processor {#sec2dot1-micromachines-11-00622}
------------------------
Almost all computer architectures use traditional Boolean logic to perform logical and arithmetic operations. On the other hand, there are many other techniques as well to perform the operations non traditionally. Associative computing is one of them that exploits the associativity principles of memories for logical and arithmetic computations. The architecture of an associative processor (AP) is presented in [Figure 1](#micromachines-11-00622-f001){ref-type="fig"}, which consists of a content addressable | {
"pile_set_name": "PubMed Central"
} |
Research in contextEvidence before this studyEar and mastoid disease is a common disease, which demands early and appropriate diagnosis with otoscopy or otoendoscopy, but is not trivial in local clinics and the diagnosis rate even by otolaryngologists using ear images show an unsatisfactory accuracy, as low as 73%. So far, the best known study for automatic diagnosis of ear disease using images has been done with tympanic membrane using a shallow neural network of relatively small data size (n \~ 390) with an accuracy of 86.84%, however, the previous method is only capable of partially diagnosing middle ear disease.Added value of this studyThis is the first study to utilize a deep learning scheme to classify tympanic membrane otoendoscopic images into six diagnostic categories, especially including attic retractions and tumors, using a large database (*n* = 10,544), and the deep learning model covers most of the ear diseases in the clinic, not only on the middle ear but also on the external ear. It also deals with an unstandardized clinical image set as-is without image quality control, which makes the current system adaptable to the real-world clinical setting. The ensemble classifier, which we propose, shows better performance than using a single transferred deep learning model with an accuracy of 93·67%.Implications of all the available evidenceAccording to our evaluation on the relationship between database size and the performance of the transfer deep learning models, current study suggests the need for a sufficient size of the database for a reliable classification performance in the medical image domain.Due to the high accuracy and the diagnostic coverage in the proposed model, clinicians with less experience in otoendoscopy, or other specialty physicians such as pediatricians, emergency, or family medicine doctors could be benefitted from the model and thus it may result in alleviating the burden of the growing number of patients with hearing impairment.Alt-text: Unlabelled Box
1. Introduction {#s0020}
===============
Ear and mastoid disease (International Statistical Classification of Diseases and Related Health Problems (ICD) code H.60-H.95) is a common disease that can easily be treated with early medical care. Nevertheless, if one does not receive timely detection and appropriate treatment, it may leave sequelae, such as hearing impairment. In the evaluation of ear and mastoid disease in the clinic, physical examination using conventional otoscopy or otoendoscopy as well as history taking is the first step. However, diagnosis by non-otolaryngologists using otoscopy or otoendoscopy is highly susceptible to misdiagnosis \[[@bb0005]\]. In a study by Pichichero, Poole \[[@bb0010]\], the correct diagnosis rate of otitis media diagnosed by 514 pediatricians using pneumatic otoscope was an average rate of 50%. The study also shows a higher (compared to pediatricians) but not a satisfactory accuracy of 73% when diagnosed by 188 otolaryngologists. This low diagnostic accuracy implies that diagnosis of ear disease without the help of additional resources such as imaging or acoustic testing is difficult even for specialists. The short of specialists in the local clinic and their relatively low diagnostic accuracy calls for a new way of diagnostic strategy, in which machine learning may play a significant role.
As far as we know, relatively few machine learning studies have been conducted for automated diagnosis of ear disease using otoscopic images. Myburgh and colleagues reported auto-diagnosis of otitis media, with an accuracy of 81·58% by decision tree and 86·84% by neural network method \[[@bb0015]\], which conducted a classification of tympanic membrane into five groups between normal eardrum, otitis media with perforation, acute otitis media, otitis media with effusion and cerumen impaction. However, the classification categories lack important and critical diagnosis such as attic retraction.
For clinical use, the current study is conducted to provide a reliable diagnosis of otitis media, attic retraction, atelectasis, tumors, and otitis externa, using deep learning for otoscopy photos of the eardrum and external auditory canal (EAC). These categories cover most of the domain of ear diseases that could be diagnosed using otoendoscopy in the clinics. For this, we proposed an ensemble classifier of two best-performing deep neural networks evaluated for ear images.
Deep learning or deep neural network has been introduced to various fields of medicine successfully. For example, in the field of ophthalmology, the machine learning result is comparable to a level of specialist \[[@bb0020], [@bb0025], [@bb0030]\]. Most of these studies utilize convolutional neural network (CNN), a supervised deep learning method. However, building CNN from scratch requires a large amount of dataset and computational power, which is not practical in many application areas. Instead, public CNN models pretrained for natural images could be reused and fine-tuned to a specific application, which is called transfer learning. In transfer learning, most network layers in a public network model are transferred to a new model, followed by a new fully-connected layer that classifies those features into a new set of classes. Studies with transfer learning for medical imaging showed high classification accuracy comparable to, or even better to building CNN from scratch \[[@bb0035],[@bb0040]\].
This study is composed of the following three main parts. First, we evaluated the performance of nine public models to choose the best models in terms of accuracy and training time for the current application. Based on this evaluation, ensemble classifier to combine multiple models\' classification results was proposed, which is expected to increase the overall classification performance than using a single classifier. Second, although transfer learning is known to be efficient in a relatively small dataset (as in labelled medical images), the dependency of the classification accuracy and model type on the size of the dataset is not exampled yet. Thus, we tested the performance of the classifier depending on the data size. We also conducted optimization of the model configuration, by assigning a hidden layer in the fully connected network layer, and changing colour channels in the image database. Finally, we showed and discussed the characteristics of the proposed model for diagnosing ear diseases in the clinical setting.
2. Materials and methods {#s0025}
========================
2.1. Patient selection and data acquisition {#s0030}
-------------------------------------------
Data from patients who visited the outpatient clinic in Severance Hospital otorhinolaryngology department from the year 2013 to 2017 were used. As a routine, patients had their otoendoscopic photo taken upon visit. Drum photos were taken with either 4 mm or 2.7 mm OTOLUX 0-degree telescope (MGB Endoskopische Geräte GmbH Berlin, Germany) tethered to Olympus OTV-SP1 video imaging system (Olympus Corporation, Japan), by otolaryngology residents, faculty or experienced nurses. The image resolution was 640 by 480 pixels. A total of 19,496 endoscope photos were reviewed for labelling. Since otoendoscopic findings of post-surgery status are mostly subjective and rely on the surgeon, 7602 photos were excluded. Additionally, 1350 photos were excluded since the photos were not appropriate for examination, for example, sites not related to eardrum or EAC, duplicates, the picture was significantly blurred due to handshakes or focus problems, or the author could not agree despite attending physician\'s medical records, acoustic and radiologic test results. Since photos were taken by several clinicians, and the external auditory canal is subject to individual variation, the composition of photography was not standardized; colour arrangements, white balance, eardrum size, location, rotation, angle, and light reflection in images were variable, but the photo was analyzed as-is to reflect real-life clinical setting. In addition, partially visible eardrums due to the image\'s field of view not containing the whole eardrum were included in the analysis. Finally, a total of 10,544 otoendoscopic images of eardrum and EAC from patients were analyzed. This retrospective study was approved by the Severance Hospital Institutional Review Boards.
2.2. Labelling of images {#s0035}
------------------------
Photos of eardrums and its surrounding EAC were taken with otoendoscope and were labelled into six categories. The classification was done according to *Colour Atlas of Endo-Otoscopy* \[[@bb0045]\]. A normal eardrum and EAC included: 1) completely normal eardrum, 2) normal but showing healed perforation, 3) normal with some tympanosclerosis. Abnormal findings included: 1) tumorous condition which includes middle ear tumors, EAC tumors, and cerumen impaction, 2) otitis media with effusion, 3) eardrum erosions, otitis externa, 4) perforation of the eardrum, 5) attic retraction/atelectasis ([Fig. 1](#f0005){ref-type="fig"}). Some classes have relatively small numbers of samples for training. In order to balance the sample size for each class, we merged several sub-classes into a class according to their similarity in diagnosis and treatment. Three normal diagnoses are trained as one big "Normal" class. "Tumor" class include cerumen impaction, EAC tumors, and middle ear tumors since they share a common property that the eardrum is not well-visible, and since they often require surgical procedures. Attic retraction (or destruction) and eardrum atelectasis has been merged into "Aradom" class, since it shares common pathogenesis and physical findings, and often requires surgical intervention. Otitis externa and myringitis have been merged into "Myriaom-otex" class since otorrhea is the main symptom, the physical finding is similar, and first-line treatment is antibiotics.Fig. 1Decision tree for labelling of otoendoscopy image and six diagnostic classes. Classes | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
Fasciolosis is a zoonotic parasitic disease caused by infection with the digenetic trematode flukes of the genus *Fasciola*. While *Fasciola hepatica* is prevalent in temperate regions, *F. gigantica* is more widespread in Africa and Asia \[[@CR1], [@CR2]\]. Migration of these flukes inside the body of the host causes severe damage to the liver parenchyma and gall-bladder \[[@CR3]--[@CR5]\]. Buffaloes are economically important animals for the farming communities in developing countries. Infection of buffaloes with *F. gigantica* is common in southern China and other geographic regions of the world \[[@CR6]\]. Infection can cause poor animal health and significant loss of meat and milk production, with considerable financial implications \[[@CR3], [@CR7]\]. *Fasciola gigantica* flukes specifically target the liver of their definitive host. Effective and balanced local immunity is therefore essential for detecting and controlling these hepatotropic parasites, and for limiting hepatic damage.
Liver flukes are, however, efficient immune-modulators and produce many effectors in order to exploit the host immune response to ensure their survival. A recent study in experimentally infected buffaloes reported a modest increase in the level of Th2-type immune cytokines during early *F. gigantica* colonization and immunosuppression during chronic *F. gigantica* infection \[[@CR8]\]. Other studies reported a pro-inflammatory or a mixed Th1/Th2 immune response during early infection, and heightened Th2 and Treg responses during chronic infection. This heightened response was assumed to play roles in restoring the host tissue integrity by damping excessive inflammatory response \[[@CR9], [@CR10]\]. How inflammation contributes to the pathogenesis of *F. gigantica* is a complex and multi-faceted story that is still unfolding.
Hepatic immune-inflammatory mechanisms are essential to maintain liver homeostasis and, if dysregulated (e.g. due to parasite infection), can lead to liver pathology and dysfunction. The abnormal production of cytokines and/or transcription factors can lead to inadequate control of *Fasciola* infection \[[@CR11], [@CR12]\]. CD4^+^ T-cells are subdivided into Th1, Th2, Th17 and regulatory T-cells (Treg) subsets, based on their pattern of cytokine production \[[@CR13]\]. Transcription factors T-bet, GATA-3, Foxp3 and ROR-γτ play important roles in the differentiation of Th1, Th2, Treg and Th17 cells respectively, and mediate the production of cytokines in these cells \[[@CR14]--[@CR16]\]. Although immunological impairment and polarization of the Th1/Th2 balance are major consequences of *F. gigantica*-induced liver pathology, the expression profile and dynamic changes of Th1/Th2 cytokines during *F. gigantica* infection has not been completely elucidated. Also, the role of Th17 and Treg cells in the pathogenesis of *F. gigantica* infection is still not well-defined.
In the present study, we hypothesized that *F. gigantica* infection impairs the balance of Th subsets (Th1/Th2/Th17) and Treg, thus contributing to the immune-pathogenesis of fasciolosis. A temporal study of gene expression of nine cytokines (IFN-γ, IL-1β, IL-12B, IL-4, IL-6, IL-10, IL-13, IL-17A and TGF-β) and four transcription factors (T-bet, GATA-3, Foxp3 and ROR-γτ) in the livers from buffaloes infected with *F. gigantica* was conducted using quantitative real-time PCR (qRT-PCR). Data analyses revealed a large number of differentially regulated genes, which exhibited temporal profiles of expression across the time course study. Our results showed evidence of a step-change in gene expression from an 'early' TGF-β-associated immune-suppersive response (3--10 dpi), to a mixed Th1/Th2 immune response (28--70 dpi) and a 'late' predominantly Th1/Treg-driven response (98 dpi). These results provide new insights into the dynamic immune response of buffaloes to *F. gigantica* over the course of experimental infection.
Methods {#Sec2}
=======
Parasite strain {#Sec3}
---------------
Eggs of *F. gigantica* were obtained from the gall bladder and faeces of naturally infected buffaloes slaughtered for human consumption at local abattoirs (Nanning, Guangxi, P.R. China). Protocols used for the preparation of *F. gigantica* eggs, snail infection with miracidia and harvesting of encysted metacercariae (EM), were performed as previously described \[[@CR16]\]. EM were stored in sterile phosphate buffered solution (PBS) at 4 °C. We employed PCR amplification and sequencing of the second internal transcribed spacer (ITS-2) of ribosomal DNA (rDNA) to genotype EM, as described previously \[[@CR17]\]. Species identity was confirmed as *F. gigantica* based on absolute homology to the known ITS-2 sequence of *F. gigantica* from Guangxi province (GenBank: AJ557569). The viability of EM was examined microscopically and only those with viability greater than 90% were used.
Animals {#Sec4}
=======
Eight to ten month-old (80--100 kg body weight) water buffaloes (*n* = 35) were obtained from a local breeder and were identified as swamp type by karyotypic analysis. Buffaloes were kept in separate concrete floor pens. Commercial feed and clean water were provided ad libitum for all animals during the entire study period. None of the buffaloes had been used previously for any experimental procedure. Animals were confirmed as negative in terms of prior infection with liver flukes, by negative fecal examination and negative serum *F. gigantica*-specific IgG-antibody-based ELISA prior to the start of the study. All animals were treated with a single dose of triclabendazole (5% *w*/*v*) in order to eliminate any potential existing fluke infection that may have been missed on laboratory examination. Following triclabendazole treatment, buffaloes were allowed to acclimatize for 30 days to avoid any residual efficacy of the treatment on the establishment of experimental *F. gigantica* infection.
Animal inoculation and tissue collection {#Sec5}
----------------------------------------
Thirty-five buffaloes were assigned randomly to seven different groups (5 buffaloes/group). Group I was composed of 5 buffaloes that were mock-incoulated with PBS only. Buffaloes in Groups II-VII were each infected with 500 viable metacercariae by oral gavage. Control buffaloes were euthanized at the start of the experiment to obtain baseline values for hepatic tissue pathology and gene expression. Animals from each of the six infected groups were sacrificed and their livers were harvested at 3, 10, 28, 42, 70 and 98 days post infection (dpi), for histopathological and molecular studies. Group III-VII buffaloes were examined clinically on a weekly basis for the development of clinical signs of fasciolosis. The control group served as a baseline point of reference for monitoring the progressive changes in gene expression over the course of infection. However, the inclusion of matched control groups receiving placebo (treated with vehicle only) and euthanized at the same time points as infected groups would have strengthened the power of the study. Alternatively, control buffaloes could have been kept alive (rather than killing them at the start) and liver punch biopsy samples obtained from them at each of the above time points. Despite the early sacrifice of the control animals for reasons of economy and resources, we believe the effects we have observed to be due to the experimental manipulation.
Gross examination and histopathological evaluation {#Sec6}
--------------------------------------------------
At six time points after infection (indicated above), animals in each infected group were sacrificed, their livers were harvested and examined for pathological lesions and the presence of the flukes. Parasite eggs were recovered by filtering bile fluid through a 0.15 mm pore size mesh. *Fasciola gigantica* infection was confirmed by observing gross pathological lesions, associated with flukes in the livers and/or by the presence of flukes and eggs in the bile ducts. Samples of liver tissue (\~8 g) showing pathological lesions were collected from each animal. Tissue samples were resuspended in 10% PBS-buffered formalin solution overnight, then dehydrated in alcohol, rinsed in xylene, and embedded in paraffin. 3 μm sections of paraffin-embedded tissue were mounted onto glass slides, and stained with hematoxylin and eosin (H&E). Stained tissue sections were examined microscopically at 400× magnification and imaged using a Zeiss Axio Imager manual upright research microscope. Additional liver tissue samples for RNA extraction were collected and kept in RNA store buffer (Tiangen Biotech, Beijing, China), snap frozen in liquid nitrogen and stored at -80 °C.
RNA isolation {#Sec7}
-------------
Total RNA was extracted from frozen liver tissue samples by RNAprep Pure Tissue Kit (Tiangen Biotech, Beijing, China) following the manufacturer's instructions. RNA integrity was examined by 2% agarose gel electrophoresis and quantified by NanoDrop 2000/2000c Spectrophotometer analysis (Thermo Scientific, Waltham, US).
Quantification of cytokine and transcription factor gene expression {#Sec8}
-------------------------------------------------------------------
Quantitative gene | {
"pile_set_name": "PubMed Central"
} |
All sequences were deposited in GenBank Sequence Read Archives ([www.ncbi.nlm.nih.gov](http://www.ncbi.nlm.nih.gov)) under accession number SRP001226. All environmental metadata are available in S1 Table.
Introduction {#sec001}
============
Globally, over a quarter-million square kilometers of marine ecosystems are threatened by low dissolved oxygen (DO) levels, or hypoxia, which can result in the exclusion or death of resident macroorganisms creating so-called 'dead-zones' \[[@pone.0135731.ref001]\]. The number of hypoxic coastal areas has grown at an exponential rate of 5.54% year^-1^ \[[@pone.0135731.ref002]\], largely due to increased eutrophication \[[@pone.0135731.ref003],[@pone.0135731.ref004]\]. Seasonal hypoxia is detrimental to coastal ecosystems and is known to have negative effects on fish \[[@pone.0135731.ref005]\], crustacea \[[@pone.0135731.ref006]\], benthic invertebrate communities \[[@pone.0135731.ref007]\], and trophic interactions and energy flow \[[@pone.0135731.ref008]\]. However, Bacteria and Archaea remain active in hypoxic waters and perform important functions in mineralization of organic matter and other biogeochemical cycling \[[@pone.0135731.ref001],[@pone.0135731.ref009]\].
Extensive research has gone into understanding the thresholds of hypoxia for management strategies aimed at avoiding catastrophic collapses of ecosystems. In a review of over 800 published experiments, Vaquer-Sunyer and Duarte \[[@pone.0135731.ref002]\] report that published thresholds of hypoxia span a broad range from 0.29 mg O~2~ L^-1^ to 4 mg O~2~ L^-1^, but on average, sublethal effects on marine benthic macroorganisms occur when DO concentration drops below 2.61 ± 0.17 mg O~2~ L^-1^ and lethal effects occur at 2.05 ± 0.09 mg O~2~ L^-1^, with many taxa of Crustacea and Fishes demonstrating negative effects of hypoxia near 4 mg O~2~ L^-1^. It is worth noting, however, that thresholds for hypoxia likely differ between coastal open ocean hypoxic zones, as the organisms in each may be adapted to different durations of hypoxia \[[@pone.0135731.ref010]\]. Lacking from our current knowledge is whether a threshold of hypoxia for bacterial communities exists, and, if so, at what DO concentration do bacterial communities experience taxonomic and functional shifts.
Understanding the effect of hypoxia on lower trophic levels including plankton assemblages is crucial for elucidating whole ecosystem effects and interactions among trophic levels. Many microbial studies have focused on truly oxygen deficient zones where anaerobic metabolisms dominate including the Eastern Tropical South Pacific \[[@pone.0135731.ref011]\] and North Pacific \[[@pone.0135731.ref012]\], Arabian Sea \[[@pone.0135731.ref013],[@pone.0135731.ref014]\], Cariaco Basin \[[@pone.0135731.ref015],[@pone.0135731.ref016]\], Baltic Sea \[[@pone.0135731.ref017]\], Black Sea \[[@pone.0135731.ref018]--[@pone.0135731.ref020]\], and Saanich Inlet \[[@pone.0135731.ref021]\]. A recent meta-analysis examining global patterns of microbial community composition in oxygen-minimum zones found that particular bacterial and archaeal taxa, specifically Proteobacteria, Bacteroidetes, marine group A, Actinobacteria, and Planctomycetes, are common in suboxic waters and that these taxa tend to co-occur in a non-random pattern along the oxycline \[[@pone.0135731.ref022]\]. Only some of the members of these suboxic-associated phyla are known to use electron acceptors alternative to oxygen, which might suggest that mechanisms other than oxygen-depletion drive changes in the bacterial community. Though these previous studies have demonstrated that particular bacterial taxa persist in oxygen-minimum zones, the threshold concentration of DO at which bacterial communities change remains unclear. The bacterial community that exists at dysoxic (0.66--2.96 mg O~2~ L^-1^) and suboxic (0.03--0.66 mg O~2~ L^-1^) levels has the potential to become increasingly important in global biogeochemical cycles as oxygen-minimum zones in both the open and coastal ocean continue to expand with climate change \[[@pone.0135731.ref023]\], thus emphasizing the importance of defining a threshold DO concentration for Bacteria.
We examined spatial and temporal variation in bacterial communities in Hood Canal, WA, USA between April and October of 2007. Hood Canal is a long and narrow glacial fjord located 80 miles west of Seattle, Washington, USA ([Fig 1A](#pone.0135731.g001){ref-type="fig"}), that seasonally experiences periods of low and even completely depleted DO concentrations as a result of naturally occurring physical and hydrographical conditions \[[@pone.0135731.ref024]\]. This system has relatively small-scale, enclosed circulation patterns and rapidly changing abiotic conditions. Throughout the year, Hood Canal remains highly stratified, which limits the movement of oxygenated waters \[[@pone.0135731.ref025]\]. Furthermore, human activity over the past few decades has exacerbated nutrient loading particularly in the southern reaches of Hood Canal \[[@pone.0135731.ref026]\], in turn increasing the frequency and duration of recent hypoxia events \[[@pone.0135731.ref027]\]. Fish and macroinvertebrates in Hood Canal are directly affected by hypoxia through mortality or distributional shifts \[[@pone.0135731.ref028],[@pone.0135731.ref029]\]. Particularly significant fish kill events near the southern reaches of the canal have occurred in the Falls of 2002, 2003, 2004, and 2006 as well as in the Spring of 2006 when the oxygen-deprived deep-water mass shoaled to the surface as a result of a combination of southerly winds and fresh-water intrusion from the Puget Sound at the North end of the canal \[[@pone.0135731.ref030]\]. Additionally, mesozooplankton assemblages in Hood Canal demonstrated altered composition and behavior when DO dropped below \~1.5 mg O~2~ L^-1^ \[[@pone.0135731.ref031]\]. These shifts have implications for predator-prey dynamics and trophic energy transfer and suggest that hypoxia may affect the entire biologic community in Hood Canal. We examined the bacterial communities associated with the seasonal variability in abiotic factors in Hood Canal, including depleted DO concentration. We hypothesized that bacterial communities in Hood Canal demonstrate non-random changes in composition and taxa richness related to variation in abiotic factors, and that these community patterns are associated particularly with changing levels of DO.
). Note changes in scale on both the x- and y-axes.](pone.0135731.g001){#pone.0135731.g001}
Methods {#sec002}
=======
Sample collection {#sec003}
-----------------
High resolution depth profiles of DO and chlorophyll *a* for two mid Hood Canal, WA stations, Hama Hama and Sister's Point, were obtained via Oceanic Remote Chemical Analyzer (ORCA) buoys maintained by the Northwest Association of Networked Ocean Observing Systems ([http://www.nanoos.org](http://www.nanoos.org/)) \[[@pone.0135731.ref032]\]. Water samples were collected during April, June, and October of 2007 into Niskin bottles mounted on a rosette, equipped with a CTD (conductivity, temperature, and depth) sampler (Sea-Bird Electronics, Bellevue, WA, USA) that measured in-situ temperature and salinity. April and October samples were collected from two stations near the middle of Hood Canal: Hama Hama and Sister's Point. During the June sample collection, two additional stations (Bangor and Lynch Cove) were added in order to survey a full north to south transect of the Canal. At each sampling station and time, samples were collected both at five meters depth (herein referred to as surface samples) as well as ten meters above the bottom substrate (herein referred to as deep samples). These so-called deep samples varied in depth from 140−145 m at Hama Hama, 125 m at Bangor, 40−50 m at Sister's Point, and 12 m at Lynch Cove, as the depth of the water column decreases near the southern reaches of the canal. The timing of the collection points were intended to coincide with the late spring algal bloom (April), subsequent die-off (June), and a smaller autumn algal bloom (October), which affect DO concentration and nutrient availability ([S1 Table](#pone.0135731.s003){ref-type="supplementary-material"}). A field permit was not required for the sampling in this study, as there are no protections in place for the waters or organisms that would be impacted by our sampling and sampling did not affect any endangered or protected species.
Immediately upon | {
"pile_set_name": "PubMed Central"
} |
1. Background {#sec1}
=============
A woman\'s probability of death due to pregnancy is unacceptably high in low and middle‐income countries than in high‐income countries \[[@B1]\]. It is estimated that nearly 30 million women in Africa become pregnant each year and about 250,000 of them die from pregnancy and childbirth‐related causes \[[@B2]\] even though most pregnancy and childbirth complications can be prevented or treated by skilled care during pregnancy, childbirth, and the immediate postnatal period \[[@B1]\]. Furthermore, antenatal care (ANC) reduces maternal and perinatal morbidity and mortality both directly, through early detection and treatment of pregnancy‐related complications, and indirectly, through the identification of women and girls at increased risk of developing complications during labour and delivery \[[@B3]\]. For instance, antenatal care decreases the likelihood of maternal anaemia during pregnancy and the delivery of a premature or low birth weight baby \[[@B3], [@B4]\]. Notwithstanding the crucial role of antenatal care in maternal and new‐born health, only 40% of all pregnant women in low‐income countries had the recommended antenatal care visits in 2015 \[[@B1]\].
Globally, several studies and reports have highlighted the positive influence male involvement has on the successful implementation of maternal and child health programmes and interventions. For instance, available evidence suggests that in patriarchal societies such as Ghana, access to and survival of maternal and child healthcare services requires the active involvement of men \[[@B5], [@B6]\]. Men in patriarchal settings have tremendous control over their spouses and a woman must receive permission and money from her husband to seek healthcare \[[@B7]--[@B9]\]. As decision‐makers for families, men in some parts of Northern Ghana consult with soothsayers to decide treatment for pregnant women and serve as the final authority on where and when pregnant women should seek medical care \[[@B10]\]. This is regardless of the fact that for some obstetric complications such as haemorrhage, the window of opportunity to respond and save the life of the mother may be measured in hours \[[@B2]\].
Despite the crucial role of men in maternal and child health, it is extremely unlikely to find a husband at an antenatal clinic or in a delivery room in many low and middle‐income countries. In a study conducted in Johannesburg, only 14% of women reported that a partner had attended ANC with them during their current pregnancy \[[@B11]\]. Similarly, a study among married men in Nepal reported 39.3% of male involvement in ANC \[[@B8]\]. Men understand antenatal care as an affair for women and thus inappropriate for them. In some communities, men who rise above these strict gender roles to support their wives during pregnancy and accompany them to the antenatal clinic are ridiculed and stigmatised by other members of their community \[[@B10]\].
Active male participation in antenatal care and childbirth can play an important role in addressing the first and second delays in seeking care: thus delay in recognising problems and deciding to seek care and delay in reaching care \[[@B8], [@B12]\]. The presence of a male partner in a delivery room will provide emotional support for the mother, decrease pain perception, establish an early relationship between a father and the infant and perhaps encourage the practice of family planning \[[@B13]\]. Notwithstanding the benefits of involving men in maternal and child healthcare, it is unclear how women view such new developments in Sub‐Saharan Africa \[[@B6]\]. In addition, many studies in the area focus on self‐reported behaviours of men on the barriers and determinants of male involvement without seeking the perspectives of women on the subject \[[@B8], [@B14], [@B15]\]. Interventions to promote men\'s involvement in maternal and child health care are less likely to succeed if the views and concerns of women are not considered \[[@B6]\]. This study provides an understanding of women\'s perspective on men\'s involvement in antenatal care, labour, and childbirth in the Northern Region of Ghana.
2. Materials and Methods {#sec2}
========================
This cross‐sectional study was conducted at the antenatal clinic of Tamale Teaching Hospital (TTH), a tertiary health facility in the Northern Region of Ghana. The hospital serves as a referral centre for all the primary and secondary health facilities in the three regions of the North and the northern part of Brong‐Ahafo Region. It provides advanced clinical health services, collaborates with the University for Development Studies, Tamale, for the training of undergraduate and postgraduate students, and undertakes research that influences treatment and policy in the health sector \[[@B16]\]. The institutional review committee of the Tamale Teaching Hospital reviewed the study protocol and granted approval for the study. The purpose of the study and the rights of participants during the study were clearly explained to each participant and written consent obtained for their participation. The participants were informed they could refuse to answer any questionnaire they are not comfortable with or withdraw from the study at any point without any condition or threat. Only the authors had access to the information collected from participants and the confidentiality of the information was ensured in accordance with the data protection act.
2.1. Study Population, Sample Size, and Sampling Method {#sec2.1}
-------------------------------------------------------
Three hundred pregnant women were recruited for the study. In line with the inclusion criteria of the study, only pregnant women who were attending ANC at the Tamale Teaching Hospital were enrolled into the study. Pregnant women who were unwilling to give consent and those who did not attend ANC at TTH were excluded from the study. Cochran\'s formula was used to estimate the sample size for the study using 14% prevalence of male partner attendance at the antenatal clinic \[[@B11]\], an assumption of 95% confidence interval, and 5% degree of error. A minimum sample size of 185 was estimated. However, the final sample size was increased to 300 to boost the power of the study. Systematic random sampling method was used to recruit pregnant women for the study. In this type of probability sampling method, study participants are chosen at regular intervals (estimated by dividing the projected population size by the sample size) from a sample frame after randomly selecting the first participant \[[@B17]\]. A review of the ANC attendance register for the month prior to the period of data collection showed that an average of 80 pregnant women visits the clinic for ANC services daily. Data collection for the study was scheduled to take place within a month during which nearly 1800 pregnant women were expected to visit the antenatal clinic. The estimated monthly attendance was divided by the sample size (300) to give a sampling interval of 6. The first participant for each day of data collection was randomly selected. After that, every sixth (6^th^) eligible pregnant woman was selected to participate in the study until the sample size was obtained.
2.2. Data Collection Procedure {#sec2.2}
------------------------------
A structured questionnaire was used to collect data from the participants on socio‐demographic characteristics such as age, marital status, religion, ethnicity, educational level, and occupation; male involvement in antenatal care; and male partner companionship during labour and childbirth. For the purposes of this study, "male involvement" was defined as the attendance and participation of men in antenatal care services during the visits of their spouse and their presence and support during childbirth. The items for the questionnaire were designed after a thorough literature review of similar studies in peer‐reviewed journals \[[@B11], [@B13], [@B18]\]. A senior midwife and a public health specialist reviewed the questionnaire and deemed the items appropriate and content valid. Three final year nursing students administered the questionnaire to participants. They were trained on how to obtain consent and administer the study questionnaire to the participants. Women visiting the antenatal clinic were informed about the study during health talk at the clinic and assessed for eligibility afterwards. Voluntary consent for participation was sought from eligible participants and the study questionnaire was only administered to women who agreed to participate in the study after the health talk. The research assistants and the principal investigator explained to the participants how to complete the questionnaire and addressed their concerns. Participants who had no formal education and could not read or write were assisted by the research assistants to complete the questionnaire, this was reported in less than 20% of the participants. Prior to data collection, a native speaker proficient in both English language and the main local language (Dagbani) translated the questionnaire into Dagbani. A second native speaker reviewed the translated instrument to ensure clarity and to eliminate ambiguities. The data collectors, who were native speakers of the main local language, then used the translated questionnaire for all participants with no formal education. The principal investigator supervised the data collection exercise and reviewed all completed questionnaires at the end of each day.
2.3. Data Analysis {#sec2.3}
------------------
Data were cross‐checked for completeness, coded in Microsoft Excel spreadsheet, and analysed using STATA Version 14.0 (College Station, Texas 77845, USA). Socio‐demographic characteristics and women\'s perspectives on men\'s involvement in antenatal care, labour, and childbirth were described in tables using frequencies and percentages. Univariate and multivariable logistic regression models were used to determine socio‐demographic factors associated with women\'s perspectives on men\'s involvement in antenatal care, labour, and childbirth estimating Odds ratio with 95% confidence intervals and *p* values. The univariate logistic regression was applied in the initial analysis and factors with *p*‐value \< .05 were selected for inclusion in the multivariable logistic regression analysis to determine independent predictors of women\'s perspectives on men\'s involvement in antenatal care, labour, and childbirth. In both the Univariate and multivariable regression models, the significance level was set at \<.05.
3. Results {#sec3}
==========
[Table 1](#tab1 | {
"pile_set_name": "PubMed Central"
} |
1.. Introduction
================
Polyaniline (PANI) has been used in the fabrication of various types of enzyme-based biosensors because of its porous structure, as well as its adequate conductivity and thermal stability \[[@b1-sensors-09-04635]-[@b6-sensors-09-04635]\]. To stabilize the immobilized enzyme in the matrix of PANI film, glutaraldehyde (GA) is usually employed as a bifunctional agent to crosslink enzyme molecules \[[@b7-sensors-09-04635]-[@b10-sensors-09-04635]\], but the crosslinking efficiency under standard conditions is not always satisfactory \[[@b10-sensors-09-04635],[@b11-sensors-09-04635]\], which results in the lower sensitivity and poor stability of the resulting biosensor. Previously, we have electrochemically synthesized the PANI film on a Pt electrode in the presence of bovine serum albumin (BSA), a lysine-rich enzyme, which provides extra free *ε*-amino groups for the further crosslinking of HRP with glutaraldehyde and has significantly improved the effectiveness of a PANI modified biosensor \[[@b1-sensors-09-04635]\]. Nevertheless, to enhance the efficiency and stability of enzyme immobilization on an electrode is still the major issue of fabricating enzyme-based biosensors.
Over the past few years, immobilizations of enzymes in well-defined mesoporous silica materials have been proven to be promising for enhancing the thermal stabilities and maintaining the catalytic activities of enzymes \[[@b12-sensors-09-04635]-[@b14-sensors-09-04635]\]. Enzymes entrapped inside the silica mesopores are less susceptible to pH and temperature alternations and organic solvents as well \[[@b12-sensors-09-04635],[@b15-sensors-09-04635],[@b16-sensors-09-04635]\]. Among them, SBA-15, which is synthesized in the presence of nonionic triblock copolymer P123 as a template under acidic conditions, exhibits well-ordered hexagonal pore arrays of uniform pore size \[[@b17-sensors-09-04635],[@b18-sensors-09-04635]\]. Meanwhile, SBA-15 possesses a large surface area and internal silanol hydroxyls that have affinities for physical adsorption of enzyme molecules \[[@b19-sensors-09-04635]-[@b23-sensors-09-04635]\]. Recently, SBA-15 has been successfully employed to entrap glucose oxidase (GOD) to construct a glucose biosensor, achieving with enhanced sensitivity, long-term stability and reproducibility \[[@b24-sensors-09-04635],[@b25-sensors-09-04635]\]. In addition, monoclonal antibodies were immobilized in SBA-15 for the detection of antigen (cTnI) in the serum of patients, which is more convenient and superior to the conventional enzyme-linked immunoadsorbent assay (ELISA) \[[@b26-sensors-09-04635]\]. For the detection of hydrogen peroxide (H~2~O~2~), SBA-15 loaded with hemoglobin (Hb) has shown a fast amperometric response, a low detection limit, and good stability \[[@b27-sensors-09-04635]\].
In this study, we further exploited the application of mesoporous SBA-15 in entrapping HRP and constructed an amperometric GA/SBA-15(HRP)/PANI/Pt biosensor by immobilizing the SBA-15(HRP) on the electrochemically synthesized PANI film on a Pt electrode. The composite biosensor was then characterized and evaluated for the detection of H~2~O~2~ with cyclic voltammetry. In addition, its linear correlation, sensitivity and stability were investigated.
2.. Results and Discussion
==========================
2.1.. Characterizations of SBA-15 Mesoporous Silica
---------------------------------------------------
The X-ray diffraction (XRD) pattern of calcined SBA-15 \[line (a) in [Figure 1](#f1-sensors-09-04635){ref-type="fig"}\] revealed well-resolved peaks of 2θ at 0.812, 1.392 and 1.588, which represented the characteristic (100), (110), and (200) reflections of hexagonal mesoporous materials with *p6mm* symmetry \[[@b17-sensors-09-04635]\]. The total specific surface area, total pore volume, and BJH pore diameter of the SBA-15 were estimated by N~2~ adsorption-desorption isotherm ([Figure 2](#f2-sensors-09-04635){ref-type="fig"}) and Barrett-Joyner-Halenda (BJH) calculation ([Table 1](#t1-sensors-09-04635){ref-type="table"}).
[Figure 3](#f3-sensors-09-04635){ref-type="fig"} shows the TEM image of calcined SBA-15 with well-ordered hexagonal array mesopores. The pore diameter was approximately 100 Å, which was close to the center of the pore size distribution (*ca.* 92 Å) shown in the inset of [Figure 2](#f2-sensors-09-04635){ref-type="fig"}. The pore size distribution indicated the major pore diameter of mesopores ranged between 80 and 110 Å, which permitted the easier access of HRP molecules because the dimension of the native HRP (MW: ∼ 44 kDa) in a neutral buffer solution was predicted to be 62 × 43 × 12 (Å)^3^ by a scanning tunneling microscopy (STE) study \[[@b28-sensors-09-04635]\]. Meanwhile, the average pore diameter of SBA-15 estimated by the BJH method was *ca.* 76 Å ([Table 1](#t1-sensors-09-04635){ref-type="table"}), which was below the major pore size distribution (80∼110 Å), suggesting the presence of micro-channels in the interior of SBA-15.
2.2.. Immobilization of HRP in SBA-15 Mesopores
-----------------------------------------------
When compared with SBA-15, the total specific surface area and the total pore volume of SBA-15(HRP), decreased modestly by about 11% and 8%, respectively, indicating the successful entrapment of HRP within the pores of SBA-15 ([Figure 2](#f2-sensors-09-04635){ref-type="fig"} and [Table 1](#t1-sensors-09-04635){ref-type="table"}). The loading of HRP in SBA-15 was also confirmed with ABTS enzymatic assay, which nearly 395 units of HRP was stably retained by one gram of SBA-15 with the procedure described in the Experimental section. On the other hand, the XRD pattern of SBA-15(HRP) \[line (b) in [Figure 1](#f1-sensors-09-04635){ref-type="fig"}\] matched with that of unloaded SBA-15 \[line (a) in [Figure 1](#f1-sensors-09-04635){ref-type="fig"}\] although the intensity was decreased, and exhibited the similar mesoporous parameters listed in [Table 1](#t1-sensors-09-04635){ref-type="table"}, suggesting SBA-15(HRP) had an analogous mesoporous structure to that of SBA-15. Furthermore, the similar pore distribution of SBA-15 and SBA-15(HRP), shown in the inset of [Figure 2](#f2-sensors-09-04635){ref-type="fig"}, implied that the retained HRP did not block the entrances of mesopores, but rather resided in the inner space of mesopores. This conclusion was further supported by the identical BJH pore diameters before and after loading of HRP ([Table 1](#t1-sensors-09-04635){ref-type="table"}).
Furthermore, we utilized the Coomasie Brilliant Blue R-250, which is commonly employed to stain proteins in SDS-PAGE gel analysis, to stain SBA-15 and SBA-15(HRP), respectively. Both were then washed with de-staining solution several times. Our result showed that the blue dye was retained by SBA-15(HRP), but not by SBA-15, suggesting HRP was stably immobilized in SBA-15(HRP). In order to investigate whether the immobilized HRP in SBA-15(HRP) was entrapped inside the pore of SBA-15 or was adsorbed on the surface of SBA-15, we examined another mesoporous silica, MCM-41, which was synthesized by a similar approach as that used for SBA-15, but its pore diameter was estimated as 25 Å, therefore, HRP was supposed to be completely excluded by MCM-41. We found that the adsorption of HRP on the surface of silica MCM-41 was relatively unstable and most of the blue stain was washed away. Therefore, the stably immobilized HRP in SBA-15(HRP) was most likely entrapped inside the pores of SBA-15.
2.3.. The Surface Morphology of Electrodes
------------------------------------------
After depositing the SBA-15 on the electrochemically synthesized PANI/Pt electrode, SEM was employed to illustrate the surface morphology of the constructed electrodes. As shown in [Figure 4a](#f4-sensors-09-04635){ref-type="fig"}, the SBA-15 formed aggregations with the size of several micrometers, in which stably attached to the surface or filled in the inner | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-molecules-23-01525}
===============
*Hedyotis diffuse* Willd. (HD) is a well-known Chinese folk-medicine with a spectrum of pharmacological activities, including anti-cancer, antioxidant, anti-inflammatory, anti-fibroblast, immunomodulatory and neuroprotective effects, especially the anti-cancer effect in practice \[[@B1-molecules-23-01525]\]. Almost 200 compounds have been identified in HD, including iridoids, flavonoids, anthraquinones, phenylpropanoids, phenolics and their derivatives, sphingolipids, volatile oils and miscellaneous compounds \[[@B1-molecules-23-01525],[@B2-molecules-23-01525],[@B3-molecules-23-01525]\].
*Hedyotis corymbosa* (L.) Lam. (HC), another species of the same genus, is also used interchangeably in China as a health supplement and for disease prevention. It is reported to possess antioxidant \[[@B4-molecules-23-01525],[@B5-molecules-23-01525]\], anti-inflammatory \[[@B6-molecules-23-01525]\], hepatoprotective \[[@B7-molecules-23-01525],[@B8-molecules-23-01525]\], antitumor \[[@B9-molecules-23-01525],[@B10-molecules-23-01525]\], antimalarial \[[@B11-molecules-23-01525]\] and anti-nociceptive \[[@B12-molecules-23-01525]\] activities. Iridoids, carboxylic acids, flavonoids, phenolics and their derivatives, triterpenes, anthranquinones and coumarins were isolated from HC \[[@B13-molecules-23-01525],[@B14-molecules-23-01525],[@B15-molecules-23-01525]\]. Iridoid glycosides were reported as the main constituents \[[@B16-molecules-23-01525]\]. Oleanolic acid and ursolic acid were also considered as biologically active ingredients \[[@B17-molecules-23-01525],[@B18-molecules-23-01525]\].
HD and HC are closely related species of the Rubiaceae family. Due to their similar morphology, they are often mixed up. Recently, a systematic survey on confusable Chinese herbal medicines has revealed that HC is indiscriminately sold as HD in wholesale markets or food markets \[[@B19-molecules-23-01525]\]. This confusion in the market has led to a growing concern about the identification and quality evaluation of HD and HC.
Several methods using various techniques have been established to distinguish between these two species, such as loop-mediated isothermal amplification technique (LAMP) \[[@B20-molecules-23-01525]\], fluorescence microscopy \[[@B21-molecules-23-01525]\], thin layer chromatography (TLC) \[[@B22-molecules-23-01525]\], DNA sequencing of the complete internal transcribed spacer region and chemical analysis \[[@B23-molecules-23-01525]\], phylogenetic utility of nuclear ribosomal DNA (nrDNA) internal transcribed spacers (ITS) \[[@B24-molecules-23-01525]\], high-performance liquid chromatography (HPLC) \[[@B25-molecules-23-01525]\], etc. As a result, markers such as hedyotiscone A \[[@B22-molecules-23-01525]\], scandoside methyl ester \[[@B25-molecules-23-01525]\], (9*R*,10*S*,7*E*)-6,9,10-trihydroxyoctadec-7-enoic acid \[[@B26-molecules-23-01525]\] for HC, 6-*O*-(*E*)-*p*-coumaroyl scandoside methyl ester \[[@B23-molecules-23-01525],[@B25-molecules-23-01525]\], (10*S*)-hydroxypheophytin a \[[@B23-molecules-23-01525]\], 6-*O*-(*E*)-*p*-coumaroyl scandoside methyl ester-10-methyl ether and 6-*O*-*p*-feruloyl scandoside methyl ester \[[@B25-molecules-23-01525]\] for HD have been found. The UPLC-UV (detection wavelength at 254 nm) fingerprint of HC was also established to distinguish it from HD \[[@B27-molecules-23-01525]\]. The contents of oleanolic acid and ursolic acid were significantly different \[[@B28-molecules-23-01525]\].
Untargeted metabolomics, with the ability to profile diverse classes of metabolites, is primarily used to compare the overall small-molecule metabolites of different samples \[[@B29-molecules-23-01525]\]. It is mainly applied in metabolites identification through mass-based search strategy followed by manual or automated verification. The combination of ultra-high performance liquid chromatography (UPLC) separation, quadrupole time-of-flight tandem mass spectrometry (Q/TOF-MS) detection and the automated data processing software UNIFI with a scientific library is frequently applied in the characterization of chemical constituents of herbal medicines \[[@B30-molecules-23-01525],[@B31-molecules-23-01525],[@B32-molecules-23-01525],[@B33-molecules-23-01525]\] and traditional Chinese medicine injection recently \[[@B34-molecules-23-01525]\]. High-resolution tandem mass spectrum can provide an accurate and specific mass when the coeluting components possess different *m*/*z* values. UNIFI, a high throughput, comprehensive, simple and efficient platform, offers the approach to integrate data acquisition, data mining, library searching and report generation. The Traditional Medicine Library within the platform contains more than 6000 compounds from 600 herbs.
The aim of the study was search for potential biomarkers in order to systematically screen chemical components and the non-targeted metabolomic analysis of the two species, and in turn providing the basis for establishment of HC and HD quality criterion in the future. UPLC-QTOF-MS^E^, UNIFI platform and multivariate statistical analyses, such as principal component analysis (PCA) and orthogonal partial least squares discriminant analysis (OPLS-DA) were used to profile these two herbs. The established method could enable us to find the similarities and differences between them, and provide data for the establishment of HC and HD quality criterion in the future. This comprehensive and unique phytochemical profile study revealed the structural diversity of secondary metabolites and the different patterns in HC and HD. The method developed in this study can be used as a standard protocol for identifying and discriminating species of HC and HD.
2. Experimental {#sec2-molecules-23-01525}
===============
2.1. Materials and Reagents {#sec2dot1-molecules-23-01525}
---------------------------
HC and HD were purchased from herbal markets or collected from their respective cultivation areas in China ([Table 1](#molecules-23-01525-t001){ref-type="table"}). The corresponding voucher specimens had been deposited in the Research Center of Natural Drug, School of Pharmaceutical Sciences, Jilin University, China. All the HC and HD samples were identified with the macroscopic and microscopic characters according to the *Standard of Chinese Medicinal Materials in Guangdong Province* (2004 Edition) and the *Standard of Chinese Medicinal Materials in Shaanxi Province* (2015 Edition). In these Standards, the identified methods only focus on the different macroscopic and microscopic characters. As the chemical constitutes are concerned, both oleanolic acid and ursolic acid are used to quality control. That is to say, there are no biomarkers to distinguish HC from HD.
Acetonitrile and methanol were UPLC-MS pure grade (Fisher Chemical Company, Geel, Belgium). Formic acid for UPLC was purchased from Sigma-Aldrich Company (St. Louis, MO, USA). Deionized water was purified using a Millipore water purification system (Millipore, Billerica, MA, USA). All other chemicals were of analytical grade. For reference substance, ursolic acid (110742-201622), citric acid (111679-201602), chlorogenic-acid (110753-201716), geniposide (110749-201718), luteolin 7-*O*-*β*-[d]{.smallcaps}-glucopyranoside (111968-201602), rutin (100080-201409), quercetin (100081-201610), kaempferol (110861-201611), hesperidin (110721-201617) were purchased from the National Institutes for Food and Drug Control (Beijing, China). Scandoside (20170503), alizarin 1-methyl ether (20170608) were purchased from Nanjing DASF Biotechnology Co., Ltd. (Nanjing, China). Scandoside methyl ester (20171001), 5,6,7,4′-tetramethoxyflavone (20171011), geniposidic acid (20171024) were purchased from Sichuan Weikeqi Biotechnology Co., Ltd. (Chengdu, China). 6-Methoxy-8-methylcoumarin (16018), sanlengdiphenyllactone (15025) were provided by the Research Center of Natural Drugs, School of Pharmaceutical Sciences, Jilin University, China.
2.2. Sample Preparation and Extraction {#sec2dot2-molecules-23-01525}
--------------------------------------
All the whole plants, including HC (HC1\~HC10) and HD (HD1\~HD10), were air-dried, grinded and sieved (40 mesh) to get the homogeneous powder respectively. Then, the powder of 20 samples (200 mg per | {
"pile_set_name": "PubMed Central"
} |
{
"pile_set_name": "PubMed Central"
} | |
Tunçalp Ӧ, Were WM, MacLennan C, Oladapo OT, Gülmezoglu AM, Bahl R, Daelmans B, Mathai M, Say L, Kristensen F, Temmerman M, Bustreo F. Quality of care for pregnant women and newborns---the WHO vision. BJOG 2015;122:1045--1049.25929823
In any reproduction of this article there should not be any suggestion that WHO or the article endorse any specific organization or products. The use of the WHO logo is not permitted. This notice should be preserved along with the article\'s URL.
In 2015, as we review progress towards Millennium Development Goals (MDGs), despite significant progress in reduction of mortality, we still have unacceptably high numbers of maternal and newborn deaths globally. Efforts over the past decade to reduce adverse outcomes for pregnant women and newborns have been directed at increasing skilled birth attendance.[1](#bjo13451-bib-0001){ref-type="ref"}, [2](#bjo13451-bib-0002){ref-type="ref"} This has resulted in higher rates of births in health facilities in all regions.[3](#bjo13451-bib-0003){ref-type="ref"} The proportion of deliveries reportedly attended by skilled health personnel in developing countries rose from 56% in 1990 to 68% in 2012.[4](#bjo13451-bib-0004){ref-type="ref"} With increasing utilisation of health services, a higher proportion of avoidable maternal and perinatal mortality and morbidity have moved to health facilities. In this context, poor quality of care (QoC) in many facilities becomes a paramount roadblock in our quest to end preventable mortality and morbidity.
QoC during childbirth in health facilities reflects the available physical infrastructure, supplies, management, and human resources with the knowledge, skills and capacity to deal with pregnancy and childbirth---normal physiological, social and cultural processes, but prone to complications that may require prompt life‐saving interventions. Research shows that it is necessary to go beyond maximising coverage of essential interventions to accelerate reductions in maternal and perinatal mortality and severe morbidity.[5](#bjo13451-bib-0005){ref-type="ref"} Moreover, there is a complex interplay of experiences of mistreatment and lack of support that impact women\'s childbirth experiences and outcomes.[6](#bjo13451-bib-0006){ref-type="ref"}
Moving beyond 2015, the World Health Organization (WHO) envisions a world where 'every pregnant woman and newborn receives quality care throughout pregnancy, childbirth and the postnatal period.' This vision is in alignment with two complementary global action agendas conceptualised by WHO and partners in 2013--2014---\'Strategies toward Ending Preventable Maternal Mortality (EPMM)\' and 'Every Newborn Action Plan (ENAP)'.[7](#bjo13451-bib-0007){ref-type="ref"}, [8](#bjo13451-bib-0008){ref-type="ref"} It is articulated at a critical time when the global community is developing the new Global Strategy for Women\'s, Children\'s and Adolescents\' Health (2016--2030) for the post‐2015 Sustainable Development Goal era.[9](#bjo13451-bib-0009){ref-type="ref"}
Although indirect causes of maternal death are increasing (27.5% of maternal deaths), globally, over 70% of maternal deaths occur as a result of complications of pregnancy and childbirth such as haemorrhage, hypertensive disorders, sepsis and abortion.[10](#bjo13451-bib-0010){ref-type="ref"} Complications of preterm birth, birth asphyxia, intrapartum‐related neonatal death and neonatal infections together account for more than 85% of newborn mortality.[11](#bjo13451-bib-0011){ref-type="ref"} Therefore, the time of childbirth and the period immediately after birth are particularly critical for maternal, fetal and neonatal survival and well‐being. Effective care to prevent and manage complications during this critical period is likely to have a significant impact on reducing maternal deaths, stillbirths and early neonatal deaths---a triple return on investment.[12](#bjo13451-bib-0012){ref-type="ref"} Within this critical period, quality of care improvement efforts would target essential maternal and newborn care and additional care for management of complications that could achieve the highest impact on maternal, fetal and newborn survival and well‐being. Based on the current evidence on burden and impact, the following specific thematic areas have been identified as high priority for this vision:[10](#bjo13451-bib-0010){ref-type="ref"}, [11](#bjo13451-bib-0011){ref-type="ref"}, [12](#bjo13451-bib-0012){ref-type="ref"}
Essential childbirth care including labour monitoring and action and essential newborn care at birth and during the first week;Management of pre‐eclampsia, eclampsia and its complications;Management of postpartum haemorrhage;Management of difficult labour by enabling safe and appropriate use of medical technologies during childbirth;Newborn resuscitation;Management of preterm labour, birth and appropriate care for preterm and small babies;Management of maternal and newborn infections.
To end preventable maternal and newborn morbidity and mortality, every pregnant woman and newborn need skilled care at birth with evidence‐based practices delivered in a humane, supportive environment. Good quality of care requires appropriate use of effective clinical and non‐clinical interventions, strengthened health infrastructure and optimum skills and attitude of health providers, resulting in improved health outcomes and positive experience of women and providers. Moreover, quality of care is considered a key component of the right to health, and the route to equity and dignity for women and children.[13](#bjo13451-bib-0013){ref-type="ref"}
So, what is quality of care? To underpin this vision, we need a common understanding of what it means. This WHO vision defines quality of care as 'the extent to which health care services provided to individuals and patient populations improve desired health outcomes. In order to achieve this, health care needs to be safe, effective, timely, efficient, equitable, and people‐centred.'[14](#bjo13451-bib-0014){ref-type="ref"}, [15](#bjo13451-bib-0015){ref-type="ref"} Operational definitions for the characteristics of quality of care are defined in Box [1](#bjo13451-fea-0001){ref-type="boxed-text"}.
###### Operational definitions for the characteristics of QoC definition[14](#bjo13451-bib-0014){ref-type="ref"}, [15](#bjo13451-bib-0015){ref-type="ref"}
{#bjo13451-sec-1001}
*Safe---*delivering health care which minimises risks and harm to service users, including avoiding preventable injuries and reducing medical errors*Effective---*providing services based on scientific knowledge and evidence‐based guidelines*Timely---*reducing delays in providing/receiving health care*Efficient---*delivering health care in a manner which maximises resource use and avoids wastage*Equitable---*delivering health care which does not vary in quality because of personal characteristics such as gender, race, ethnicity, geographical location or socioeconomic status*People‐centred---*providing care which takes into account the preferences and aspirations of individual service users and the cultures of their communities
Quality of care is a multi‐dimensional concept. Therefore, a framework with important domains of measurement and pathways to achieve the desired health outcomes is required to identify the action points to improve the quality of care. Since the Donabedian model of quality of care for health facilities was proposed in 1988, WHO and others have developed strategic thinking to operationalise key characteristics of QoC, using different elements from the provision of care as well as the experience of care, integral to maternal and newborn care provided in the facilities.[15](#bjo13451-bib-0015){ref-type="ref"}, [16](#bjo13451-bib-0016){ref-type="ref"}, [17](#bjo13451-bib-0017){ref-type="ref"}, [18](#bjo13451-bib-0018){ref-type="ref"}, [19](#bjo13451-bib-0019){ref-type="ref"} WHO has also advanced health systems thinking by identifying six building blocks---service delivery; health workforce; information, medical products, vaccines and technologies; financing, and leadership/governance---creating a structure from where health systems analysis and intervention points can be established.[20](#bjo13451-bib-0020){ref-type="ref"}
Building on these developments, the framework (Figure [1](#bjo13451-fig-0001){ref-type="fig"}) conceptualises QoC for maternal and newborn health by identifying domains of QoC which should be targeted to assess, improve and monitor care within the context of the health system as the foundation. Health systems create the structure which enables access to quality care and allows for the process of care to occur along two important and inter‐linked dimensions of provision and experience of care.
{#bjo13451-fig-0001}
Based on this framework, QoC for pregnant women and newborns in facilities requires competent and motivated human resources and the availability of essential physical resources. Also, evidence‐based practices for routine and emergency care, actionable | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Background
----------
Hypertension, diabetes, and hypercholesterolemia are the global leading risks of cardiovascular mortality \[[@ref1]-[@ref3]\]. Health behaviors such as engaging in exercise, balanced diet, and weight control reduce one's risk of cardiovascular mortality. Therefore, in addition to medication, the management of health behavior is crucial in patients with multiple risks of cardiovascular mortality \[[@ref4]\]. Clinical guidelines recommend a combined self-management strategy of health behaviors and appropriate medication use \[[@ref3],[@ref5]\] A recent self-management approach in line with the Chronic Care Model (CCM) specifies that health behavior management should be used to manage coexisting illnesses \[[@ref6]-[@ref8]\]. Owing to the importance of self-management in patient-centered health care in combination with the increased use of mobile devices (including smartphones and tablets), there is a need to develop an efficient, affordable, and sustainable self-management strategy-based elecronig program that targets high-risk individuals \[[@ref9]-[@ref11]\].
Research concerning mobile health (mHealth) innovations to support populations with chronic illnesses and improve their health behaviors is growing \[[@ref4],[@ref9],[@ref11]\]. A systematic review showed that the use of apps in mHealth has the potential to improve health outcomes among patients with chronic diseases through enhanced self-management \[[@ref12]\]. A number of randomized controlled trials (RCTs) have assessed the effectiveness of mobile phone- or tablet-assisted self-management programs in addressing cardiovascular disease \[[@ref13]\] or chronic hepatitis \[[@ref14]\]. Although there is a need to organize intervention programs to improve the health outcomes of patients with chronic illnesses \[[@ref6]\], few mHealth trials have addressed this \[[@ref3],[@ref5]\].
Objectives
----------
We therefore aimed to determine the efficacy of a self-management strategy-based electronic program for patients who had been treated for hypertension, diabetes, or hypercholesterolemia and who had at least one indicator of poor disease control. To do so, we provided patients with an intervention program via a Web-based health management program (mobile app or PC-Web-based) \[[@ref15]\].
Methods
=======
Study Design
------------
We conducted this study with 106 patients within 2 months of treatment termination, and the patients were randomly assigned to either the control group or the intervention group (ie, *Smart Healthing*; [Multimedia Appendices 1](#app1){ref-type="supplementary-material"} and [2](#app2){ref-type="supplementary-material"}). Each physician from 2 study hospitals screened patients for the eligibility criteria by reviewing their medical records and blood test results at outpatient clinics. A clinical research coordinator at each hospital explained the study details to the participants who met the eligibility criteria ([Figure 1](#figure1){ref-type="fig"}). The patients who were eligible to participate were recruited by the physician in-charge and were asked to provide written informed consent to the researchers. The institutional review boards at the 2 hospitals approved the study protocol (numbers 1707-084-870 and B-1802/453-401). The trial was performed in accordance with the Good Clinical Practice guidelines and the Declaration of Helsinki. All staff who were involved in screening and recruiting participants were certified by their institutions for ethical conduct of research (Collaborative Institutional Training Initiatives).
{#figure1}
Participants
------------
From November 2017 to March 2018, we identified patients with at least one indicator of poor disease control among patients who had been treated for hypertension, diabetes, or hypercholesterolemia. We recruited patients who met the following criteria: (1) aged ≥19 years; (2) diagnosed with hypertension, diabetes, or hypercholesterolemia; (3) failed to meet 1 or more of the following clinical goals: (i) glycated hemoglobin (HbA~1c~) \<7.0%, (ii) systolic blood pressure (SBP) \<140 mmHg, or (iii) low-density lipoprotein (LDL) cholesterol \<130 mg/dL; (4) had a smartphone and personal computer (for the electronic program-based health care program); and (5) understood the study's purpose.
Patients were excluded from the study if they met any of the following criteria: (1) had medical conditions that would limit participation adherence (as confirmed by their referring physician \[eg, dyspnea and severe depression\]); (2) could not speak, understand, or write Korean; or (3) could not understand the content of the provided materials owing to poor eyesight and/or hearing.
Randomization
-------------
We used an internet-based Clinical Research and Trial management system by the Centers for Disease Control and Prevention for participant randomization. The patients were randomly assigned (1:1) to the intervention or control group based on a random computer-generated number. To minimize the effects of potential confounding variables, we randomized participants stratified by disease type with the clinical indicators (hypertension, diabetes, or hypercholesterolemia). The research assistants executed face-to-face procedures and therefore could not be blinded when assigning participants to groups.
Control
-------
The attention control group was encouraged to continue their usual care and routine medications and to study a health educational booklet about chronic diseases. The booklet noted 12 healthy life habits: positive thinking, regular exercise, balanced diet, proactive living, regular checks-ups, helping others, regular religious life, quitting smoking, drinking cessation, work-life balance, living with loved ones, and taking medication.
Intervention
------------
The intervention group received the self-management strategy-based electronic program, whereas the control group received basic educational material about disease content. We developed the Smart Management Strategy for Health--based electronic program and utilized the comprehensive and multifaceted Smart Management Strategy for Health strategies. The self-management strategy-based electronic program used in this study was a 3-month Smart Management Strategy for Health Intervention, and it is comprised of an app and a Web-based program. On the basis of our literature review and interviews, we developed a conceptual framework for the Smart Management Strategy for Health intervention that incorporates management strategies for overcoming crises and developing healthy management strategies. The Smart Management Strategy for Health intervention includes the following 9 strategies: (1) assessment, (2) reality acceptance, (3) preparation for change, (4) decision making, (5) planning, (6) environment creation, (7) action, (8) feedback and maintenance, and (9) core strategies. All of these strategies can help patients overcome a disease crisis and develop healthy self-management skills \[[@ref16],[@ref17]\].
The program covered 4 areas: self-assessment, self-planning, self-learning, and self-monitoring by automatic feedback. We targeted 4 priority areas for intervention---positive thinking, balanced diet, physical activity, and medication. The 20 learning sessions included *12 Rules for Highly Effective Health Behavior* and health management strategies.
The self-management strategy-based electronic program was used for 12 weeks. The patients were provided with a manual with detailed instructions on how to use the program to both increase its usage rate and decrease the dropout rate. Self-evaluations were conducted with regard to the participants' self-management competence and health practices before and after the program (excellent, moderate, and poor). In addition, the patients wrote health mission statements that included their life goals, health practice goals, obstacles, and methods to overcome them and detailed promises in relation to the self-management strategy-based electronic program. Self-learning was structured with the health management strategy and health information on 12 health behavior rules. The patients received daily health educational content from the self-management strategy-based electronic program. Every week, the patients learned 1 health behavior among the 4 essential rules, and they could selectively study the other 8 health behavior rules. By graphically displaying the participants' blood glucose levels, blood pressure, and weight to them, it was possible for the participants to track any changes.
The patients could create their own health management weekly plan for the 4 essential health behavior rules and monitor their progress and health. The weekly plan addressed dieting, vegetable and fruit consumption, physical activity, and daily medication schedule. More specifically, the weekly physical activity plan included the activity's type, length of time, intensity, and schedule. The self-management strategy-based electronic program included an automatic push function and alarms for the scheduled physical activities, medications, and assessments to remind participants of their plans. After 1 week, the patients were provided with feedback to motivate and help them plan for the following week. Through periodic monthly assessments, the program identified changes in their essential health behaviors and provided feedback on monthly changes through a comparison of their prior month's results to help patients change their behavior.
Measures
--------
The primary outcome was the percentage of subjects that met the target clinical indicators (HbA~1c~ \<7.0%, SB*P*\<140 mmHg in clinic, or LDL cholesterol \<130 mg/dL).
The secondary outcomes included the originally proposed clinical indicator outcomes---physical activity, depression, self-management strategies, and health behaviors after 12 weeks in the program. The patients' self-management strategies were assessed with a short form of the Smart Management Strategy for Health, which is a 3-set, 16-factor, 30-item tool (ie, core strategies, 10 items; preparation strategies, 10 items; and implementation strategies, 10 items) that assesses patients' abilities to overcome health-related crises \[[@ref17]\]. Physical activity was measured with the modified version of the Godin Leisure-time Exercise Questionnaire, which is widely used, reliable, and valid \[[@ref16]\]. The modified version adds average duration to the original questions of average | {
"pile_set_name": "PubMed Central"
} |
We read with interest the recent paper by Wang et al. \[[@B1]\]. Authors analyzed the results of the published literature where Chinese herbs were used as osteoporosis therapy (as measured by BMD). And authors concluded that Chinese herbs have merits in improving lumbar spine BMD as compared to the placebo or other standard antiosteoporotic drugs.
However, there was a serious issue with this papaer. Due to significant differences existed among participants, study design, intervention, and outcome measurement, statistical heterogeneity was noted in the analysis of this study. According to the Cochrane Handbook for Systematic Reviews \[[@B2]\], *I* ^2^ ranges between 0% and 100%; *I* ^2^ values of 25%, 50%, and 75% are referred to as low, moderate, and high estimates. *I* ^2^ statistic greater than 50% suggested moderate heterogeneity, and a random effects model should be used. Instead, a fixed effects model was used for *I* ^2^ statistic less than 50%, which showed that heterogeneity could be neglected \[[@B2]\]. In the present study by Wang et al. \[[@B1]\], *I* ^2^ value was 94% in the analysis of Chinese herbs versus placebo on spine BMD; 96% in the analysis of Chinese herbs versus placebo on femoral neck BMD; 84% in the analysis of Chinese herbs versus standard antiosteoporotic drugs on lumber spine BMD; and 0% in the analysis of Chinese herbs versus standard antiosteoporotic drugs on the femoral neck BMD. But all the authors used fixed effects model regardless of the heterogeneity which was 0% or 96%. Is this reasonable?
In my opinion, the present study by Wang et al. \[[@B1]\] gives us an important message: Chinese herb is effective in treatment of bone loss among patients with osteoporosis. Authors have done excellent job, and credit should be given to this work. But analysis method used in this study was irrational and should not be neglected, for this may influence the final results.
The author declare that there is no conflict of interests.
[^1]: Academic Editor: Alexandra Deters
| {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
The Chilean population is rapidly ageing due to a process of fast demographic transition in the second half of the twentieth century ([@R19]). Further understanding of possible influences on health in later life, including mental health, is therefore important particularly as the prevalence of depression among older people in Chile is high in comparison with other Latin American countries ([@R1]; [@R31]). In this study, we investigate Chilean grandparents' help to grandchildren and associations between providing such help and grandparents' subsequent mental well-being.
Numerous studies have documented the contributions that grandparents make to the support of younger family members, including providing assistance with the care of grandchildren. The benefits of this support for the recipients, and for society as a whole, are well recognised ([@R7]; [@R21]) but evidence on implications for grandparents is mixed. Altruistic behaviours and balanced intergenerational exchanges are hypothesised to have mental health benefits ([@R6]; [@R8]) but caring for children can be stressful and may limit opportunities for other forms of activity, social engagement and self-care with consequent negative health implications ([@R11]; [@R14]; [@R27]).
Much previous research on grandparenting and mental health has been based on studies from the US and has focussed on grandparents providing custodial or intensive care for grandchildren. In general, these studies have reported poorer mental (and physical) health for grandparents in 'skipped generation' households with primary responsibility for grandchildren, and for grandparents living with grandchildren in three generation households ([@R8]; [@R14]; [@R15]; [@R17]) although some longitudinal studies suggest that negative effects reduce over time ([@R2]; [@R27]).
However, it is unclear to what extent these findings may reflect prior characteristics and experiences of the grandparents involved ([@R26]), especially as custodial grandparenting in the US is often precipitated by mental health or addiction problems of the child\'s mother ([@R14]), or whether similar associations apply to grandparents providing lesser amounts of help. [@R10] found that grandparent carers had poorer mental health than other grandparents even before assuming care for a grandchild and some indications that grandmothers providing less intensive help to grandchildren had reduced risks of depression. Similarly, [@R6] in analyses of another US longitudinal study in which baseline mental health characteristics were controlled, found that providing moderate amounts of help to grandchildren was protective against depression two-three years later for grandfathers, although not for grandmothers. Some other studies have also reported gender differences in associations between grandparenting and mental health. Analyses of the US National Survey of Families and Households undertaken by [@R16], for example, found more depression among caregiving grandmothers than equivalent grandfathers.
The applicability of results from studies of grand-parenting in the US or other high-ncome Western countries to low- or mid-income societies with different patterns of family and household organisation is also questionable. In Latin America, three generation households are much more prevalent than in North America or Europe ([@R5]; [@R28]) and involvement in extended family life may be beneficial for older people\'s mental health. Previous longitudinal studies of grandparenthood and mental health are lacking but results from cross sectional analyses suggest that for older Cubans, for example, social networks centred on children and the extended family are associated with a low frequency of depressive symptoms ([@R23]). Results from China also show a different pattern of associations from those reported in the US. One cross sectional study of a rural Chinese population found that older parents living in three-generation households or with grandchildren in skipped-generation households had better psychological well-being than those living in single-generation households, a finding attributed in part to the cultural value attached to multi-generational co-residence ([@R24]).
In this article, we use longitudinal data on a representative sample of older people resident in the Greater Santiago area of Chile to investigate the relationship between providing help to grandchildren and mental health. To our knowledge, this is the first longitudinal investigation of the implications of providing grandchild care for the mental health of grandparents in a Latin American population.
Aims and hypotheses {#s2}
===================
The first aim of the research reported here was to analyse factors associated with the provision of help to grandchildren in a sample of Chilean grandparents. On the basis of previous studies, we expected that women would be more involved in providing care for grandchildren than men but that grandfathers might provide more material assistance. We also expected that factors related either to potential demand for grandparent help (number of grandchildren, age of youngest grandchild and grandchild in the household) or ability of grandparents to provide it (health status and competing activities) would be associated with differentials in provision.
The second aim of the study was to investigate associations between provision of this help and mental health outcomes two years later. As summarised in the introduction, previous research and theory provide conflicting evidence on the possible direction of any such association in the older Chilean population. Studies from the US suggest that coresidential or custodial grandparenting, but possibly not provision of lesser amounts of help, has negative effects on mental health. In Latin American societies, three generational family connections, including co-residence, may be more 'normative' and possibly beneficial for older people\'s mental health. On the other hand, the poorer economic and physical health status ([@R31]) of older Chileans compared with North Americans may increase vulnerability to stresses attendant on providing care for grandchildren.
Data {#s3}
====
We used data collected in 2005 from a sample of people aged 66--68 resident in low or middle income areas of the Santiago Metropolitan area of Chile. The sample comprised participants in a cluster randomised controlled trial primarily designed to investigate the cost effectiveness of a nutritional supplement and/or exercise programme on pneumonia incidence, walking capacity and body mass index. The restricted age range was chosen in order to include respondents just below the threshold age for automatically receiving the nutritional supplement the effectiveness of which the trial aimed to evaluate. Full details of the trial methodology and primary findings have been reported elsewhere ([@R3], [@R4]). In brief, the sampling strategy involved recruiting from age-eligible people registered with 20 health centres in low- or middle-income areas of Santiago. Exclusion criteria were inability to walk unaided; having sought medical advice for unplanned weight loss in the past three months; already consuming the nutritional supplements the trial was designed to evaluate; planning to move house within the next three months or poor cognitive function (Mini Mental State Examination short form test score of \< 13 and Pfeffer score of 6 or more). This sampling strategy resulted in identification of 2649 eligible participants of whom 2002 were recruited to the trial, a response rate of 76%. All participants gave signed informed consent and the trial was approved by the Institutional Review Board at INTA, University of Chile and the London School of Hygiene & Tropical Medicine Ethics Committee.
Participants were interviewed at baseline in their local community centre or at home if unable to visit the community centre. Information was collected on physical and mental health status; on socio-economic and demographic characteristics, including level of education, family and household structure and number of grandchildren, and on participation in various activities. These included provision of help to grandchildren, participation in community organisations, and paid and unpaid work. At the end of the trial, 24 months after enrolment, respondents were re-interviewed when the baseline questionnaire (with a few minor amendments) was re-administered. By the time of this follow up, 28 respondents had died; 1669 of the remainder (85%) were successfully interviewed. Most loss to follow-up was due to inability to locate respondents at their previous address, despite several attempts. Additionally, small proportions were known to have moved out of the study area or refused reinterview.
Measures {#s4}
========
Grandchildren, help to grandchildren and family and household characteristics {#s5}
-----------------------------------------------------------------------------
Respondents were asked how many grandchildren they had and for the ages of the youngest and oldest. A social definition of grandchildren was chosen as being most appropriate to the study population with interpretation of who constituted a grandchild left to respondents. An additional question asked about 'other children you consider to be like grandchildren' who were included with grandchildren. Respondents were asked whether they 'regularly helped' grandchildren (including children considered to be like grandchildren) and approximate hours per week spent helping (none; less than 2; 2--4 or 4 or more). They were also asked if they regularly provided help with money or material goods that grandchildren needed. Information collected on all household members and their relationship to the respondent was used to derive a three-category household type variable distinguishing those living alone or just with a spouse/ partner; those living with other relatives (whether or not they also lived with a partner) not including a grandchild, and those living with other relatives (with or without a partner) including one or more grandchildren. Information on marital or partnership status was dichotomised into married or living with a partner versus unmarried/unpartnered.
Mental health and well-being outcomes {#s6}
-------------------------------------
Life satisfaction was measured using an indicator derived from responses to four items from Neugarten\'s life satisfaction scale ([@R18]): 'As I grow older things seem better than I thought they would be'; 'These are the best years of my life'; 'I feel my age but it doesn\'t worry me' and 'These are the worst years of my life'. Respondents were asked whether they agreed, disagreed or neither agreed nor disagreed with these statements and a score was derived distinguishing those with positive attitudes (yes to the first three items and no to the fourth); those with negative attitudes (no to the first three items and yes to the fourth) and an intermediate group, termed neutral, with other mixtures of responses. The second indicator of mental health was score on the | {
"pile_set_name": "PubMed Central"
} |
{.601}
| {
"pile_set_name": "PubMed Central"
} |
Arthur Amman, President of Global Strategies for HIV Prevention ( <http://www.globalstrategies.org>), tells this story: "I recently met a physician from southern Africa, engaged in perinatal HIV prevention, whose primary access to information was abstracts posted on the Internet. Based on a single abstract, they had altered their perinatal HIV prevention program from an effective therapy to one with lesser efficacy. Had they read the full text article they would have undoubtedly realized that the study results were based on short-term follow-up, a small pivotal group, incomplete data, and unlikely to be applicable to their country situation. Their decision to alter treatment based solely on the abstract\'s conclusions may have resulted in increased perinatal HIV transmission."
Amman\'s story shows the potentially deadly gap between the information-rich and the information-poor. This gap is not the result of lack of technology or of money, but of a failure of imagination. We live in the most information-rich era of history, when the Internet allows immediate global dissemination of crucial health information, and the interlinking of online information creates an integrated, living body of information---the ultimate vision of which is the semantic Web ( <http://www.w3.org>).
What is preventing such a living Web? For scientific and medical information, two obstacles are vested interests and traditions. The role of copyright, which was developed when the dissemination of work was on paper, is crucial. Initially, applying copyright to medical articles protected both the intellectual investment of authors and the commercial investment of publishers. Authors of scientific articles handed over their copyright to publishers to prevent unauthorized print copying. Thus, the prevention of unauthorized copying helped to disseminate information by providing a valid business model for publishers. But the proliferation of subscription-based medical and scientific journals led to readers having to pay more and more to publishers in order to keep up with current knowledge, and also led to an increasing fragmentation of knowledge between different publishers.
The Internet provides the means to revolutionize publishing in two crucial ways. First, it makes it possible to disseminate health information at no charge to anyone in the world with online access. Although it costs money to peer review, edit, produce, and host an online article, this is a onetime, fixed cost. If research funders are willing to pay this cost, then the published work can be made freely available to all readers worldwide, and there would be no need for journal subscriptions. This is one way of financing an open-access model of publishing ( <http://www.earlham.edu/~peters/fos/overview.htm>).
Second, because the internet allows not just ease of access but ease of reuse, an article\'s usefulness is limited only by a user\'s imagination. To allow this, the traditional role of copyright has to change. Instead of publishers using copyright to restrict use, authors can retain copyright and grant the public the right to creatively reuse their work. Licenses such as those developed by Creative Commons ( <http://creativecommons.org>), which facilitate rather than prohibit reuse, are used by the open-access publishers PLoS (DOI: [10.1371/journal.pbio.0020228](10.1371/journal.pbio.0020228)) and BioMed Central (BMC). The result as Jan Velterop, Director of Open Access at Springer, says is that "copyright can be used for what it is meant to in science, not to make the articles artificially scarce and in the process restrict their distribution, but instead, to ensure that their potential for maximum possible dissemination can be realised" ( <http://www.soros.org/openaccess/scholarly_guide.shtml>).
The potential benefits of such a change are vast. No longer will physicians have to base their practice on half truths. Instead, everyone from patients to policymakers can read for themselves the evidence on which crucial science and health policy decisions are made. One example of a paper with potentially profound public health implications is the first randomized trial of male circumcision to prevent HIV infection (DOI: [10.1371/journal.pmed.0020298](10.1371/journal.pmed.0020298))---having this paper and all related discussions freely available has allowed a lively, informed debate to flourish.
Will poorly funded researchers be excluded from publishing in open-access journals? This concern is addressed by publishers such as PLoS and BMC, who waive fees for authors who cannot pay, and who strictly separate decisions on publication from ability to pay. This is not a radical departure into subsidies, but an accepted part of distributing publishing costs across the scientific community.
Increasingly, funders of research also realize the benefit of an open-access model of publishing. The United Kingdom\'s Wellcome Trust ( <http://www.wellcome.ac.uk/doc_WTD002766.html>) mandates its funded authors to make their work publicly available; the United States National Institutes of Health are encouraging it ( <http://publicaccess.nih.gov>), and governments and funding bodies are signing up to declarations on open access ( <http://www.zim.mpg.de/openaccess-berlin/berlindeclaration.html>).
By regaining control of copyright, the medical and scientific communities could ensure that publishing is no longer driven by the interests of publishers, but rather by the needs of society.
**Citation:** The *PLoS Medicine* Editors (2006) The impact of open access upon public health. PLoS Med 3(5): e252.
This Editorial is co-published in *The Bulletin of the World Health Organization* as part of a theme issue on intellectual property and public health. DOI: 10.2471/BLT.06.032409
[^1]: E-mail: <medicine_editors@plos.org>
| {
"pile_set_name": "PubMed Central"
} |
Introduction {#sec1_1}
============
Parsonage-Turner syndrome (PTS), also known as neuralgic amyotrophy or acute brachial plexus neuritis, is a disorder characterized by the sudden appearance of severe shoulder pain, usually unilateral, followed a few days to a week later by progressive motor weakness. At times, some dysesthesiae and numbness may coexist. The key to establishing the diagnosis is the sequence of symptoms and confirmation by electroneuromyography.
We report the case of an 86-year-old man referred to our internal medicine department for severe left shoulder pain. In this patient, diagnosis was complicated by the occurrence of herpetic lesions on the upper left arm and thoracic region.
Case Presentation {#sec1_2}
=================
An 86-year-old right-handed man presented to his general practitioner with complaints of acute left shoulder pain that awoke him one night. There was no history of previous shoulder trauma. The patient had suffered from a low-grade stage IV non-Hodgkin B-cell lymphoma 4 years earlier that was treated with rituximab chemotherapy alone without radiotherapy, which led to remission. An ultrasound of his shoulder revealed a scapulohumeral periarthritis. An intra-articular corticoid infiltration was performed on an outpatient basis. He was referred to our department 7 days after the onset of the symptoms because of persistent shoulder pain.
At admission, the patient presented a hypertensive crisis that was attributed to the severe shoulder pain and was managed with nitroglycerin and calcium-channel blockers. The patient denied any neck pain, headache, fever, chills or weight loss. Neurologic examination was normal at the time, with preserved sensory and motor functions of the left arm. The patient was oriented and showed no signs of meningeal irritation. Routine laboratory tests were normal.
Two days following hospital admission, i.e. 9 days after the beginning of the left shoulder pain, he presented a vesicular rash over the left D1 and D2 dermatomes. An immunofluorescence test of a skin sample was positive for herpes varicella-zoster virus. A 10-day treatment of intravenous acyclovir in conjunction with prednisone was started. Pain was managed with paracetamol, morphine, pregabalin and physiotherapy. Two days after the vesicular eruption, i.e. 11 days after the beginning of the shoulder pain, he developed a marked weakness of the left arm. This weakness was severe on elbow flexion (1/5), shoulder abduction (1/5) and arm external rotation (1/5), whereas elbow extension and handgrip remained normal (5/5). There was no sensory loss. Deep left bicipital tendon reflex was absent.
Needle electromyography (table [1](#T1){ref-type="table"}) showed evidence of partial denervation of the left biceps, brachioradialis and deltoid muscles, consistent with peripheral motor nerve involvement of the C5 and C6 myotomes. As the rhomboid and serratus anterior muscles were not affected, it is possible that the denervation was related to motor axonal lesions within the upper trunk of the brachial plexus. Neurography showed responses of small but symmetric amplitudes, in particular for the sensory nerve conductions (table [2](#T2){ref-type="table"}). A CT scan of the cervical spine showed mild cervical osteoarthritis without spinal compromise. A thoracic CT scan showed no adenopathy or mass associated with the lymphoma and ruled out a local root or plexus compression. MRI of the brain showed a global cerebral atrophy that was attributed to the age of the patient. MRI of the brachial plexus was not performed.
The diagnosis of troncular, motor neurological lesions due to herpes zoster infection was initially suspected. However, the symptoms, their timing, as well as the neurological territories affected -- upper brachial plexus for the motor deficit, dermatomes of the lower brachial plexus D1 and upper thoracic region D2 for the vesicular rash -- casted doubts on this hypothesis. The symptoms seemed more probably related to PTS rather than to herpes zoster infection of the upper left arm. The clinical presentation, the results of the CT scan of the cervical and thoracic spine, and the motor-evoked potentials made cervical myelopathy unlikely.
Over the course of the following days, the weakness persisted. The patient was transferred to a rehabilitation unit to continue physiotherapy. A second electroneuromyography was performed 24 days after the first, i.e. 6 weeks after the onset of the shoulder pain (tables [1](#T1){ref-type="table"}, [2](#T2){ref-type="table"}). It showed signs of severe denervation of the left biceps, deltoid, supraspinatus and brachioradialis muscles. The neurological findings and normal transcranial motor-evoked potentials were not suggestive of cervical myelopathy.
Subsequently, the patient experienced a general deterioration and sepsis caused by *Staphylococcus aureus* infection. Despite antibiotic therapy, he died 2 months after admission to the rehabilitation unit, i.e. 3 months after the onset of the symptoms.
Discussion {#sec1_3}
==========
The clinical presentation of a herpetic eruption and a motor deficit in the same limb may lead to diagnostic pitfalls. The first diagnosis that may come to mind in this situation is a motor monoparesis due to herpes zoster infection. However, this early impression may be challenged in this situation. Our hypothesis is that the patient presented two different successive conditions. First, left shoulder pain followed 11 days later by left arm weakness, possibly related to PTS, then a vesicular eruption of the left arm caused by varicella-zoster virus reactivation, as confirmed by immunofluorescence. The time elapsed between the eruption and the weakness, only 2 days, is rather short to be explained by a herpes zoster motor monoparesis. Moreover, the distance between the lesions of the sensory ganglions causing the skin vesicular rash (dermatomes D1 and D2) and the motor axonal lesions causing denervation within the upper myotomes of the brachial plexus (C5-C6) also makes the diagnosis of herpes zoster monoparesis unlikely. Sensory findings, if present, are usually much less prominent than motor deficits in PTS. The contrary is true in zoster neuropathies, in which sensory lesions are usual and motor deficits rare (with the notable exception of zoster facial palsy).
Although all weak muscles observed to exhibit denervation belonged to the C5 and C6 myotomes, a radiculopathy appears unlikely in this patient since (1) it should have very seriously affected both C5 and C6 roots simultaneously in order to explain the complete or subcomplete denervation of the muscles of the anterior arm, and, in such a case, it would then probably have affected the spinatus and brachioradialis muscles with a similar severity; (2) a mechanical lesion of the roots would have caused sensory symptoms in the C5 and C6 dermatomes; (3) denervation would have concerned the rhomboid and serratus muscles. The severe, incomplete axonal lesion was thus more likely localized within the upper trunk. Symmetrical sensory neurography (from the C6 dermatome; digit I) without clinical sensory loss (in particular in the C5-C6 dermatomes), points to a lesion that essentially affected the motor axons. This is in line with the possibility of a selective targeted immunologic lesion, and thus in good agreement with the suspected causal mechanism of PTS. We hypothesize, therefore, that the development of herpes zoster was a consecutive phenomenon, possibly favored by the PTS itself, the lymphoma and the intra-articular corticoid infiltration.
PTS is a neuritis of unknown cause affecting the brachial plexus with an overall incidence of 1.64 cases per 100,000 individuals \[[@B1], [@B2], [@B3], [@B4]\]. The classic description of PTS is a condition in which the patient first develops an abrupt, severe and constant unilateral shoulder pain that can extend proximally to the neck but also distally to the upper arm, forearm and hand. Pain lasts from a few hours to several weeks, with an average duration of 4 weeks. The weakness appears within 24 h of the onset of pain in approximately one-third of patients but can take up to 4 weeks to occur \[[@B5]\]. A sensory deficit may also occur but its prevalence varies, depending on studies, from 66% to only a minority of patients \[[@B6], [@B7], [@B8]\]. The upper trunk of the brachial plexus is the most frequent site of the lesion \[[@B6]\]. Clinical observation and electromyogram studies suggest that the lesions are often multifocal within the plexus or in the individual branches \[[@B9], [@B10]\]. Electroneuromyography is helpful to confirm the diagnosis, to rule out other possible causes of painful weakness of the upper limb (radiculopathies, thoracic outlet syndrome or mononeuropathies), and to define the prognosis. Frequently, the syndrome is initially mistaken for an arthropathy of the shoulder, as was the case in this patient. Blood and cerebrospinal fluid analyses are generally unhelpful. A chest radiograph or CT scan can be performed if there is any suspicion of malignancy.
The treatment is based on pain management, NSAIDs, prednisolone and neuroleptics \[[@B11], [@B12]\]. This condition generally carries a good prognosis, as about 75% of all patients recover completely within 2 years, and 89% by the end of the third year. Patients with predominantly lower | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION {#s1}
============
Biological responses to radiation are induced in irradiated cells mainly as a result of DNA damage. However, many studies indicate that biological responses to radiation are not always limited to the irradiated cells but can be induced in neighboring unirradiated 'bystander' cells. This phenomenon, often called radiation-induced bystander response, was first described by Nagasawa and Little in 1992 \[[@RRT068C1]\]. So far the range of biological effects demonstrated to be induced in bystander cells via signals from irradiated cells includes sister chromatid exchange \[[@RRT068C1], [@RRT068C2]\], cell death \[[@RRT068C3]--[@RRT068C8]\], chromosomal instability \[[@RRT068C9]\], and mutations \[[@RRT068C10], [@RRT068C11]\]. These findings have had a large impact on radiobiology because they may have important implications for the estimation of risk to human health associated with exposure to low-dose radiation. The risks associated with low-dose ionizing radiation are estimated by extrapolating data obtained after exposure to intermediate doses using a linear non-threshold (LNT) model. The discovery of radiation-induced bystander responses and other non-targeted effects has triggered a dispute over the validity of the LNT model because a non-linear response at a low dose is a characteristic of these phenomena. The controversy over this issue has not been resolved, in part, because the number and location of the radiation-track traversals cannot be monitored or controlled for each cell when a broad radiation field is used, which is often true in low-dose radiation experiments. The microbeam cell irradiation system, which enables observation of cellular responses of individual irradiated and non-irradiated cells equally, is a powerful tool to elucidate the mechanisms underlying the biological responses to low-dose radiation, including bystander responses.
We used a synchrotron X-ray microbeam irradiation system developed at the Photon Factory, High Energy Accelerator Research Organization, KEK \[[@RRT068C12]--[@RRT068C15]\], and found that cell death is more prevalent in cells irradiated with X-ray microbeams when only nuclei, rather than the whole cells, are irradiated \[[@RRT068C16], [@RRT068C17]\]. Furthermore, we recently showed that the biphasic increase in bystander cell death was dose-dependent when nuclei of targeted cells were exposed to X-ray microbeams \[[@RRT068C7], [@RRT068C18]\]. Our findings indicated that cell death, both in irradiated and bystander cells, was modified by the site of energy deposition within the cells.
As a next step, we measured the mutation frequency in bystander cells neighboring those with irradiated nuclei. Because mutations are a prerequisite of carcinogenesis, our results may provide fundamental information for evaluating the carcinogenic risk posed by exposure to low doses of ionizing radiation.
MATERIALS AND METHODS {#s2}
=====================
Cell culture and sample preparation {#s2a}
-----------------------------------
V79 Chinese hamster lung cells were cultured in minimum essential medium-alpha (MEMα; Nacalai Tesque Inc., Nakagyo-ku, Kyoto, Japan) containing 10% fetal bovine serum (FBS; Nichirei Biosciences Inc., Chuo-ku, Tokyo, Japan), 100 U/ml penicillin (Invitrogen Corp, Carlsbad, California, USA), 100 µg/ml streptomycin (Invitrogen), and 15 mM 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES; Nacalai Tesque) and then incubated in a humidified incubator maintained at 37°C in an atmosphere containing 5% CO~2~. To irradiate cells with microbeams, 1.0 × 10^5^ V79 cells were seeded on custom-designed polypropylene-based dishes (34 mm in diameter), the bottoms of which were composed of a 3-µm polypropylene film (Toray Industries Inc., Chuo-ku, Tokyo, Japan), and incubated overnight. Before X-ray irradiation, the cell nuclei were stained with a 2 µM solution of Hoechst 33258 (Dojindo Molecular Technologies Inc., Kamimashiki-gun, Kumamoto, Japan) for 1 h. At the time of irradiation, the Hoechst solution was replaced with 5 ml of fresh medium.
Microbeam irradiation {#s2b}
---------------------
Monochromatic X-ray microbeam irradiation was performed using the synchrotron X-ray microbeam irradiation system installed at the BL-27B station in the Photon Factory \[[@RRT068C12]--[@RRT068C15]\]. The procedures for microbeam irradiation and dosimetry have been previously described \[[@RRT068C7], [@RRT068C17]\]. To ensure that the irradiation for initial stimulation was similar to that used in previous studies \[[@RRT068C7], [@RRT068C18]\], nuclei of five isolated single cells located at the center of each dish were selected as targets. The positions of these nuclei, defined as the center of mass of Hoechst33258-stained nuclei images, were stored in the controlling computer of the system. We irradiated the five targeted cell nuclei with 10 × 10 µm^2^ 5.35 keV X-ray beams, and the exposure rates were 8.5 × 10^−3^ ± 3.4 × 10^−5^ C/kg/s (1.0 × 10^4^ ± 4.2 × 10^1^ photons/s in 10 × 10 µm^2^ beam). In our study, the 'nuclear-averaged dose', at which the absorbed energy is divided by the mass of nucleus as described in Maeda *et al.* \[[@RRT068C17]\], was used as a measure of radiation doses and the dose rate was 1.8 × 10^−1^ ± 7.3 × 10^−4^ Gy/s.
Determination of bystander cell survival {#s2c}
----------------------------------------
The fraction of bystander cells that survived was measured using a colony-formation assay. After irradiation, the culture medium was removed, and the cells were washed twice with phosphate buffered saline (PBS). Immediately thereafter, 2 ml of fresh medium was added to the dishes, and the cells were cultured for 3 h. Next the cells were harvested using a trypsin-ethylene diamine tetraacetic acid (EDTA) solution (0.05% trypsin, 0.53 mM EDTA•4Na; Invitrogen); the harvested cells were diluted and plated in a 100-mm cell culture dish at approximately 150 viable cells per dish. After incubation for 6 days, the cells were fixed with HC Tissue Fixative MB (Amresco Inc., Solon, Ohio, USA) for 25 min at room temperature and rinsed twice with PBS. Following that the cells were stained with 1% methylene blue (Wako Pure Chemical Industries Ltd, Chuo-ku, Osaka, Japan) solution. Colonies containing more than 50 cells were counted as survivors.
*HPRT* mutation assay {#s2d}
---------------------
The *HPRT* mutation assay is a method commonly used to study the genetic changes and genomic instability \[[@RRT068C19], [@RRT068C20]\]. After irradiation, the culture medium was removed, and the cells were washed twice with PBS. Immediately thereafter, 2 ml of fresh medium was added to the dishes, and the cells were cultured for 3 h. Cells were harvested by trypsinization and transferred to a T-75 cell culture flask containing fresh medium. Cells were maintained for 8 days and were subcultivated every 2 days to allow for phenotypic expression. Then, 1 × 10^6^ cells were harvested and seeded onto 100-mm cell culture dishes with fresh medium containing 10 µg/ml 6-thioguanine (Wako) and incubated for 6 days. Cells in dishes were fixed and stained using the same method described above for the colony-formation assay, and the colonies (i.e. *HPRT* mutants) were scored. The mutation frequency was expressed as the number of resistant colonies divided by the total number of viable cells at the time of selection.
Cell culture with NO scavenger after irradiation {#s2e}
------------------------------------------------
2-(4-Carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide, sodium salt (carboxy-PTIO; Dojindo Molecular Technologies Inc.) is a specific scavenger of NO \[21, 22\]. Directly after irradiation, the cells were incubated with medium containing carboxy-PTIO instead of normal fresh medium. During the clonogenic assays for the measurement of surviving fractions and of mutation frequencies, cells were also incubated with medium containing carboxy-PTIO instead of normal fresh medium. The concentration of carboxy-PTIO in the medium was set to 20 µM, because the concentration of NO in the medium was not expected to exceed 20 µM after irradiation \[[@RRT068C7]\], as indicated by studies in which the concentration of NO~2~^−^, an oxidization product of NO, in the medium after irradiation was measured with Griess reagent \[[@RRT068C23]\].
Statistical analysis {#s2f}
--------------------
Statistical analysis was performed on the data obtained from at least three independent experiments. All the results are expressed as means ± standard error (SE). Significant levels were assessed using Student\'s *t* test. Analysis of the correlations between bystander cell death and mutation frequency in the bystander cells was assessed using analysis of variance (ANOVA). A probability (*P*) value \< 0.05 was considered to indicate statistical significance.
RESULTS {#s3}
=======
Determination of the incubation period for the assays | {
"pile_set_name": "PubMed Central"
} |
{#sp1 .438}
{#sp2 .439}
{#sp3 .440}
| {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
In 2010 there were estimated 70,530 new cases of bladder cancer in the United States, and over 500,000 current survivors \[[@B1], [@B2]\]. The standard of care in the United States for muscle-invasive bladder cancer is radical cystoprostatectomy for men and anterior exenteration for women. There is also evidence that earlier cystectomy in high-risk superficial bladder cancer improves long-term survival \[[@B3]\]. Options for urinary diversion after cystectomy include noncontinent conduits, continent cutaneous diversions, and orthotopic bladder substitutes. With the improvement of surgical technique in recent years, continent diversions and orthotopic bladder substitutes have been shown to have similar perioperative complication rates, cancer control, and morbidity \[[@B4], [@B5]\].
With the proliferation of urinary diversion options for bladder cancer that have comparable cancer control and complication rates, quality of life becomes an important factor to consider. Health-related quality of life (HRQOL) refers to the physical, psychological, and social domains of health that are influenced by a person\'s experiences, beliefs, expectations, and perceptions \[[@B6]\]. The task of translating the subjective components of health into a quantitative value is a complex one, drawing from a variety of fields in the social sciences. HRQOL is measured with questions, or items, whose answers can be converted to numerical scores. Many questionnaires, or instruments, have been developed to assess the various aspects of HRQOL. An ideal instrument should be valid (measures what it reports to measure), reliable (able to give the same result on several occasions given stable disease), and responsive (able to detect true but clinically meaningful changes). The process of psychometric and clinical testing is beyond the scope of this article, but an instrument can only be correctly considered "validated" if it has undergone the established rigors of developmental testing so that its validity, reliability, and responsiveness can be described quantitatively \[[@B7]\].
This article reviews the methods for defining HRQOL, the challenges in measuring HRQOL in bladder cancer and the existing literature comparing HRQOL after various methods of urinary diversion.
2. Measuring HRQOL {#sec2}
==================
HRQOL instruments can be either generic or disease-specific. Generic instruments are applicable to all patients regardless of their illness. They may address issues like bodily pain, energy or fatigue, and limitations in physical activity that are common to many disease processes. Examples of generic instruments are the Medical Outcomes Study 36-Item Short Form (SF-36) \[[@B8]\] and the Sickness Impact Profile (SIP) \[[@B9]\].
There are multiple instruments that assess cancer-specific HRQOL, including the European Organization for Research and Treatment of Cancer-QOL (EORTC-QLQ-C30) \[[@B10]\] and the Functional Assessment of Cancer Therapy general form (FACT-G) \[[@B11]\]. The current version of the EORTC-QLQ-C30 contains 30 items that are grouped into five functional scales (physical, role, emotional, cognitive, and social), three symptoms scales (fatigue, nausea and vomiting, and pain), and an overall HRQOL scale. The broadness of this instrument makes it generally applicable to all cancer states, but it lacks the specificity to address issues that may be unique to a particular type of cancer \[[@B12]\].
Disease-specific instruments focus on the issues that are relevant to patients with a particular disease state. Some disease-specific instruments are developed from validated generic instruments, with additional items added to make them more specific to the disease of interest. For example, 12 items focusing on urinary tract symptoms, intestinal symptoms, sexual symptoms, and stoma concerns were added to the FACT-G to create the FACT-BL, designed to address HRQOL in bladder cancer. Likewise, 17 items were added to the FACT-G questionnaire to create the Vanderbilt Cystectomy Index (FACT-VCI), which has been separately validated to measure HRQOL following radical cystectomy and urinary diversion for bladder cancer \[[@B13]\]. The European Organization for Research and Treatment of Cancer (EORTC) has also added items to the EORTC-QLQ-C30 core questionnaire to make it specific for superficial and invasive bladder cancer, and is in the process of validating these instruments \[[@B14]\]. More recently, the Bladder Cancer Index (BCI) has been developed and validated to assess health outcomes specific to localized bladder cancer \[[@B15]\]. Refer to [Table 1](#tab1){ref-type="table"} for a comparison of bladder cancer specific HRQOL instruments.
3. Challenges of Measuring HRQOL in Bladder Cancer {#sec3}
==================================================
Measuring HRQOL in bladder cancer has its unique difficulties. All of the currently available bladder cancer-specific instruments contain items evaluating the urinary domain, but the items mostly address general problems with urinary control (e.g., "I have trouble controlling my urine" or "I urinate more frequently than usual"). Leaking from a stoma, however, may be a very different experience than leaking per urethra. Different diversions also come with a different set of potential side effects (e.g., metabolic derangements) and impact on body image. It is difficult to account for all these factors in a single questionnaire that can be applied to all patients with bladder cancer.
Consequently, many of the bladder cancer-specific instruments target an even narrower population of bladder cancer patients. As shown in [Table 1](#tab1){ref-type="table"}, the EORTC QLQ-BLS24 is targeted to superficial bladder cancer and will include items related to the bother of repeated cystoscopies, whereas the FACT-VCI was validated to target patients who undergo radical cystectomy for bladder cancer.
In addition, sexual function is an important domain when discussing the impact of bladder cancer and its treatment. Since men and women experience different issues related to sexual function, it is challenging to create a questionnaire that is applicable to both sexes. The BCI sexual domain asks gender-neutral questions addressing sexual desire and arousal, ability to climax, and genital sensation. But men may experience issues with erection and ejaculation, while women may have problems with vaginal lubrication and dyspareunia, which even a disease-specific instrument like the BCI would not be specific enough to distinguish \[[@B16]\].
On the other hand, as instruments are tailored more specifically to the disease of interest, they may be less likely to detect unanticipated effects of the disease. For example, the BCI contains 36 items distributed among the 3 primary domains that are expected to be relevant in bladder cancer: urinary, bowel, and sexual. If a treatment for localized bladder cancer were to unexpectedly cause a neurologic side effect, this disease-specific instrument would not be sensitive enough to detect this change.
4. Current Literature: HRQOL after Cystectomy {#sec4}
=============================================
In 2005, Porter and Penson published a systematic review examining HRQOL outcomes among different types of urinary diversion after radical cystectomy \[[@B17]\]. After excluding studies that did not specifically address bladder cancer patients, studies that included radiotherapy as treatment, and studies that did not compare at least 2 types of urinary diversion (ileal conduit, orthotopic neobladder, or continent cutaneous urinary reservoir), 15 studies were appropriate for analysis. The review found no randomized, controlled studies. Only 1 study was performed prospectively and included preoperative baseline measurements \[[@B18]\]. The other studies were cross-sectional, consisting of a single-mailed or clinic-administered instrument. Of 15 studies, 10 (67%) used a previously validated health-related quality of life instrument, while 10 (67%) used an instrument developed by the investigators without previous validation, either in conjunction with a validated instrument or as the sole measure of quality of life. The authors concluded that the available data did not conclusively show that any form of urinary diversion was superior to another in terms of HRQOL.
They also noted that limitations to the literature included the lack of baseline assessment before cystectomy, the lack of longitudinal data to evaluate the impact over time, and the lack of a bladder cancer-specific and validated instrument to measure quality of life. Despite the inability to draw conclusions regarding the superiority of any method of diversion after cystectomy, some common patterns were identified across the studies that may help future research. Three studies indicated that urinary leakage was more of a problem with conduit diversion than with continent diversion \[[@B19]--[@B21]\]. Three studies indicated that patients with neobladder or continent reservoir were more likely to travel than patients with conduit diversion \[[@B22]--[@B24]\]. Two studies indicated that patients with continent diversions scored better on social function domains than those with conduit diversions \[[@B25], [@B26]\].
In 2005, Gerharz et al. published a review that rated studies by levels of evidence and grades of recommendations set out by the International Consultation on Urological Diseases modification of the Oxford Centre for Evidence-Based Medicine \[[@B27]\]. They identified no studies with level I evidence and also concluded that there was no evidence to claim that continent reconstruction provides better quality of life than conduit diversion.
Since the publication of these reviews, there have been a handful of studies published in the last 5 years that evaluate HRQOL after cystectomy in bladder cancer. In 2007 Gilbert et al. used the recently validated bladder cancer-specific instrument, the Bladder Cancer Index (BCI), to assess HRQOL in patients treated with a variety of interventions, including cystectomy and endoscopic procedures \[[@B28]\]. They identified all bladder cancer patients in an institutional bladder cancer database from a high-volume tertiary referral center. From this population, 315 (45%) completed the B | {
"pile_set_name": "PubMed Central"
} |
The content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus.
Introduction
============
Percutaneous coronary intervention with stent implantation is a successful treatment for patients with obstructive coronary artery disease and has been shown to improve symptoms and reduce mortality \[[@REF1],[@REF2]\]. Previously, bare metal stents (BMS) were used, and now the majority of recently used stents are drug-eluting stents (DES). First and second-generation DES and BMS present the risk of in-stent thrombosis, with newer second-generations demonstrating the lowest risk of late stent thrombosis \[[@REF3],[@REF4]\]. This serious complication can occur acutely (within the first 24 hours of stent deployment), subacutely (within 30 days), late (within the first year), or very late (more than a year post deployment). Most patients with stent thrombosis present with ST-segment elevation on electrocardiogram (STEMI). It is caused by a total or near total thrombotic occlusion of the intracoronary stent. Few cases of very long stent thrombosis are reported in the literature with the longest reported period being 11 years \[[@REF5],[@REF6]\]. We report a patient who presented with a very late stent thrombosis (VLST) that occurred 12 years after implantation. It is unique being the longest duration reported so far in the literature. We will cover in our discussion the possible underlying mechanisms and risk factors, as well as the implications of stent thrombosis on our practice.
Case presentation
=================
A 78-year-old man presented to our emergency department because of acute onset chest pain that started two hours prior to presentation. The pain was retrosternal, pressure-like, moderate in intensity and started upon awakening from sleep. His past medical history is significant for type II diabetes mellitus and pancreatic cancer that was treated with the Whipple procedure 27 years ago. He had coronary artery disease status post percutaneous angioplasty with stenting of the mid right coronary artery (RCA) 12 years ago, and stenting of the proximal circumflex and proximal RCA 17 years ago. A paclitaxel drug-eluting stent (PES) 3.0 x 24 mm was used to stent the mid RCA 12 years ago (Figure [1](#FIG1){ref-type="fig"}).
{#FIG1}
The patient is a former cigarette smoker, and does not consume alcohol, caffeine, or illicit drugs. At presentation, he was in mild distress, complaining of typical chest pain persistent despite aspirin administration. On physical examination, the patient was noted to be diaphoretic. His heart rate was 60 bpm, and blood pressure was 110/75 mmHg. Electrocardiogram (ECG) showed ST-segment elevation in the inferior leads II, II, and avF (Figure [2](#FIG2){ref-type="fig"}).
{#FIG2}
The patient was loaded with aspirin and clopidogrel and emergently taken to the cardiac catheterization laboratory. Coronary angiography showed thrombotic occlusion of mid RCA DES placed 12 years ago. Immediate percutaneous coronary balloon angioplasty was performed followed by a 3.5 x 16 mm everolimus drug-eluting stent (EES) deployment at a maximum inflation pressure of 14 atm. Following the intervention, excellent angiographic appearance of the artery was obtained with a 0% residual stenosis (Figure [3](#FIG3){ref-type="fig"}).
{#FIG3}
Due to the acuity of the situation and the patient's unstable hemodynamic status, it was difficult to obtain intravascular images of the lesion and tell with certainty what mechanism led to this event. The patient was stabilized and monitored for the following 24 hours with no further complications, and was then successfully discharged home.
Discussion
==========
Stent thrombosis occurring at any time is a serious complication carrying a significant risk of death. Although VLST is infrequent, it is being reported more in the literature with DES. According to the academic research consortium, our patient fits the criteria of having a "definite stent thrombosis" even with the absence of intravascular imaging. Angiographic diagnosis is made by identifying a thrombus originating in or within 5 mm of the stent along with the presence of one of the following criteria: acute onset of ischemic symptoms, new ischemic ECG changes, typical rise and fall in cardiac biomarkers, or pathologic confirmation following thrombectomy or by autopsy \[[@REF7]\]. Etiology, pathogenesis, and predictive factors have not yet been established due to relatively low prevalence of this condition and its multifactorial nature. The possible mechanisms of thrombosis that have been evaluated through real-time imaging studies using intravascular ultrasound, angioscopy, or optical coherence tomography, and tissue histology are still not fully understood. However, potential mechanisms and explanations of this late in-stent thrombosis include (1) delayed neointimal coverage (uncovered stent struts), (2) stent underexpension, (3) ongoing vessel inflammation, (4) neoatherosclerosis rupture, and (5) late stent malapposition, the latter being the most common \[[@REF8]-[@REF10]\]. Risk factors for stent thrombosis in general are well known, but some of these factors have been specifically associated with VLST. These include smoking history at the time of the stent implantation, presence of thrombus, multivessel disease, type C lesions, longer total stented length, and overlapping stents \[[@REF11]\]. Another major factor affecting the risk of stent thrombosis is the type of stent used. Several concerns have emerged about the higher risk of VLST with first-generation DES: paclitaxel drug-eluting stent (PES) and sirolimus drug-eluting stent (SES) \[[@REF12],[@REF13]\]. Studies comparing PES to newer generation DES showed that EES is associated with a significant reduction of ST at long-term follow-up, and PES having a higher risk of VLST \[[@REF4],[@REF14],[@REF15]\].
Conclusions
===========
As we report the longest case of stent thrombosis so far in the literature, we advocate the need of heightened awareness of these risks especially with first-generation PES and the other risk factors mentioned above. Further studies are needed to better understand the exact pathology behind very late in-stent thrombosis and help preventing them. Until then, we advise physicians to address as much as possible the underlying modifiable risk factors mentioned above. And when available, the use of intravascular imaging pre- and post-stenting is highly encouraged to guide selecting the appropriate stent size and adequate deployment of the stent on a healthy endothelium, and ensuring well apposition and expansion of the stent, particularly when dealing with proximal lesions.
The authors have declared that no competing interests exist.
Consent was obtained by all participants in this study
| {
"pile_set_name": "PubMed Central"
} |
Despite the significant progress in structure determination of membrane transporters, elucidating the dynamics of substrate movement through a transporter or a channel has remained a challenge ([@bib11]; [@bib23]). Crystal structures provide a static snapshot of the membrane transporter, but the substantial conformational changes that occur during substrate movement are far more difficult to capture. This latter aspect requires additional biochemical, genetic, or spectroscopic inputs to provide insights into the nature of the conformational changes ([@bib11]).
Over the years, a number of genetic and biochemical techniques have been exploited to obtain insights into the mechanistic workings of membrane transporters. These approaches have provided key support for our understanding, such as in the \"alternating access model\" of substrate transport seen in LacY permease and other transporters ([@bib1]; [@bib15]; [@bib23]). The primary focus of these approaches, however, has been to target the residues involved in substrate binding and substrate access. An aspect that has lagged behind in these studies is the nature of the conformational changes in regions not directly involved in substrate access, and how these other global changes in conformation in the protein contribute toward the transport process.
Here, we have attempted to partially address this lacuna and describe an approach we used to perform "charged/polar residue scanning" of the hydrophobic face of a transmembrane helix of a membrane transporter; we followed this with detailed biochemical and genetic analysis. [Hgt1p](http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000003748) is a high-affinity glutathione transporter of the yeast *Saccharomyces cerevisiae* ([@bib5]) that belongs to the relatively uncharacterized Oligopeptide Transporter family ([@bib14]; [@bib17]; [@bib24]; [@bib25]). Homologs in other yeasts have also been shown to function in glutathione transport ([@bib4]; [@bib9]; [@bib34]; [@bib35]; [@bib36]) and in some cases oligopeptide transport ([@bib27]; [@bib29]), whereas more remote members are transporters of metal--amino acid conjugates ([@bib6]; [@bib7]; [@bib18]; [@bib37]). The *S. cerevisiae* paralogue, [OPT2](http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000006398), also appears to have a role in glutathione homeostasis while functioning at the yeast peroxisomes ([@bib10]).Very little structure--function information is available for members of this family, and the lack of functionality of a cysteine-free mutant has made it difficult to apply methods, such as the Substituted Cysteine Accessibility Method (SCAM) ([@bib13]; [@bib21]). The TMD9 of [Hgt1p](http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000003748) has been identified as being important in substrate binding, and two key residues, F523 and Q526, are thought to line the channel on the hydrophilic face of the helix ([@bib19]; [@bib34]).On the basis of the helical wheel arrangement of TMD9, it appears that the hydrophobic side of the helix might interact with the lipid matrix and/or other transmembrane segments of the protein. Residues of this face of the TMD9 helix were systematically replaced with lysine, glutamine, and glutamic acid. These replacements in the hydrophobic patch are expected to be deleterious to the protein and would then be subjected to mutagenesis to identify functional suppressors in other parts of the protein, with the premise that critical interaction disrupted by the primary mutation would be compensated by mutations at second sites.
Among the different charged mutants created, only six were nonfunctional, revealing a surprising tolerance of charged residues in the hydrophobic part of TM helices. I524, proximal to the substrate binding residues, was the only position that did not tolerate any charged residues. Suppressor analysis of all the nonfunctional mutants yielded second-site suppressors only in the case of I524K and I524Q, both of which involved a G202Q, G202K, or G202I substitution in the hydrophilic loop of [Hgt1p](http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000003748) between TMD3 and TMD4, but G202Q/K/I alone was not deficient in transport activity. Charged and polar residue mutagenesis of P525, another residue close to the substrate binding residues, revealed that mere proximity to these residues was not responsible for the observations with I524. The results suggest that I524 in the hydrophobic face is in a conformationally critical region for substrate translocation and requires the involvement and possible interaction with region G202, near TMD3.
Materials and Methods {#s1}
=====================
Chemicals and reagents {#s2}
----------------------
All the chemicals used in this study were analytical grade and obtained from commercial sources. Media components were purchased from Difco (Detroit, MI) Sigma Aldrich, (St. Louis, MO), HiMedia, (Mumbai, India), Merck India Ltd (Mumbai, India), and USB Corporation (Cleveland, OH). Oligonucleotides were purchased from Sigma India. Restriction enzymes, Vent DNA polymerase, and other DNA-modifying enzymes were obtained from New England Biolabs (Beverly, MA). DNA sequencing kit (ABI PRISM 310 XL with dye termination cycle sequencing ready reaction kit) was obtained from Perkin Elmer, (Norwalk, CT). Gel-extraction kits and plasmid miniprep columns were obtained from QIAGEN (Valencia, CA) or Sigma (St. Louis, MO). \[^35^S\] GSH (specific activity 1000 Ci mmol^-1^) was purchased from Bhabha Atomic Research Centre, Mumbai, India. HA-Tag (6E2) mouse monoclonal antibody and horse anti-mouse HRP-linked antibody were bought from Cell Signaling (Danvers, MA). Alexa Flour 488 conjugated goat anti-mouse antibody was obtained from Molecular Probes (Eugene, OR). Hybond ECL (nitrocellulose) membrane and ECL plus Western blotting detection reagents were purchased from Amersham Biosciences (UK).
Strains, media, and growth conditions {#s3}
-------------------------------------
The *Escherichia coli* strain DH5α was used as a cloning host. The *Saccharomyces cerevisiae* strain used in this study was ABC 817 *(MATa [his3](http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000005728)Δ1 [leu2](http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000000523)Δ0 [met15](http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000004294)Δ*-0 *[ura3](http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000000747)Δ0 [hgt1](http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000003748)Δ*::*[LEU2](http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000000523))* ([@bib5]). *S. cerevisiae* was regularly maintained on yeast extract, peptone, and dextrose (YPD) medium. *S. cerevisiae* synthetic defined minimal medium (SD) contained yeast nitrogen base, ammonium sulfate, and dextrose supplemented with histidine, leucine, and methionine (when required) at 50 mg/liter ([@bib16]). Glutathione was added as required. Growth, handling of bacteria and yeast, and all the molecular techniques used in the study were according to standard protocols ([@bib31]).
Site-directed mutagenesis {#s4}
-------------------------
*[HGT1](http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000003748)*, tagged with a Hemagglutinin (HA) tag at the C-terminus, was subcloned downstream of the TEF promoter at the *Bam* HI and *Eco* RI sites of a modified p416TEF vector ([@bib21]). This construct was used as a template for site-directed mutagenesis for creation of different site-directed mutants of [Hgt1p](http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000003748) by splice overlap extension strategy. The mutations, K,Q,E, for each residue were generated using a single mutagenic oligonucleotide exploiting degenerate base pairs at the desired position in the different mutagenic oligonucleotides ([Supporting Information](http://www.g3journal.org/content/suppl/2015/03/16/g3.115.017079.DC1/017079SI.pdf), [Table S1](http://www.g3journal.org/content/suppl/2015/03/16/g3.115.017079.DC1/TableS1.pdf)). The PCR products generated with these oligonucleotides were subcloned back into the TEF vector background using appropriate restriction sites for subsequent analyses. The resulting mutants were sequenced to confirm the presence of the desired nucleotides changes and to rule out any undesired mutations introduced during the mutagenic procedure.
The dual complementation-cum-toxicity plate assay for assessing *HGT1* functionality {#s5}
------------------------------------------------------------------------------------
| {
"pile_set_name": "PubMed Central"
} |
The left atrium (LA) serves three major roles in maintaining left ventricular (LV) filling and overall cardiovascular performance: a reservoir that stores pulmonary venous return during LV contraction \[[@r11]\], a conduit that continues to passively transfer pulmonary venous flow during LV diastole, and a booster pump function that actively augments LV filling during atrial systole \[[@r31]\]. LA function helps to preserve cardiac output and maintain an effective LV stroke volume \[[@r21], [@r22], [@r29]\]. In patients with LV dysfunction, the importance of the atrial contribution to ventricular filling is emphasized by the development of clinical signs and symptoms of heart failure when LA contraction is impaired \[[@r24], [@r30]\].
In humans, the method that accurately determines the values of LA area and volume are two-dimensional (2D) echocardiography, multislice computed tomography, cardiac magnetic resonance imaging, and real time three-dimensional echocardiography \[[@r12], [@r32]\]. In veterinary patients, the phasic size of the LA (area and volume) \[[@r1], [@r2], [@r6], [@r13], [@r14], [@r19], [@r26], [@r28], [@r34]\] and the percentage fractional area change using 2D echocardiography have been an area of focus because of their utility in measuring LA function \[[@r14], [@r19], [@r26], [@r28]\].
A novel echocardiographic technique on the basis of the 2D speckle tracking method enabled automatic analysis of the time-LA area or volume curve representing LA phasic function in humans \[[@r20], [@r23]\] and dogs \[[@r14], [@r28]\]. The LA fractional area change during booster pump function (LA-FAC~act~) obtained via two-dimensional speckle tracking echocardiography (2D-STE) was lower in dogs with progressively more severe myxomatous mitral valvular heart disease \[[@r1], [@r26]\].
Moreover, strain imaging using 2D-STE is currently being developed for quantification of LA myocardial deformation by tracking the LA wall from frame to frame throughout the cardiac cycle and focuses on calculating the deformation parameter (strain) and the rate of deformation change (strain rate \[SR\]) automatically \[[@r1], [@r5], [@r25]\]. Notably, LA booster pump dysfunction indicated by strain imaging using 2D-STE was shown to be the best predictor of heart failure complications in dogs and had a higher predictive power for evaluating congestive heart failure over the LA-FAC~act~ \[[@r25]\].
Volume load dependency of echocardiographic indices is of clinical concern when using the indices in heart diseases associated with volume overload: LA dysfunction can be masked by the enhancing effect of the volume loading on LA function indices \[[@r31]\]. In a previous experimental study using healthy beagles, we have shown that the volumetric LA function indices (i.e., LA fractional area changes) determined with 2D-STE are volume load-dependent and enhanced by cardiac volume loading \[[@r27]\]. On the other hand, the degree of volume load dependency on LA function indices derived from strain imaging using 2D-STE remains unclear in dogs.
Therefore, the aim of this study is to elucidate the effect of clinically relevant changes of acute volume loading on strain and SR parameters derived using the 2D-STE method in dog models. The results of the present study could describe the degree of volume load dependency on LA myocardial deformation for further therapeutic strategy and prognostic information of the LA.
MATERIALS AND METHODS {#s1}
=====================
Animals
-------
Six laboratory beagles (aged 1--3 years, with body weight of 8.8 to 11.4 kg), which were part of an experimental unit at Hokkaido University, were enrolled in this study. All dogs were healthy and had no abnormalities of cardiac function on the basis of routine physical examination, including blood examination, electrocardiogram (ECG), and standard echocardiography (including M-mode, pulsed-wave Doppler, and color flow Doppler--based imaging). All procedures were reviewed and approved by the laboratory animal experimentation committee of the Graduate School of Veterinary Medicine, Hokkaido University (approval No. 15-0087).
Procedure
---------
The protocol used in this study was the same as in a previous report \[[@r27]\]. An intravenous infusion route was established in each dog on the left and right cephalic veins with a 20-gauge over-the-needle catheter, and a 24-gauge over-the-needle catheter was placed in the left or right dorsal pedal artery to directly monitor arterial blood pressure. Each dog was administered atropine sulfate (Mitsubishi Tanabe Pharma Corp., Osaka, Japan) 0.05 mg/kg, subcutaneously, cefazolin sodium hydrate (Astellas Pharma Inc., Tokyo, Japan) 20 mg/kg intravenously (IV), and heparin sodium (Ajinomoto Pharmaceuticals Co., Ltd., Tokyo, Japan) 100 units/kg IV, and sedated with butorphanol tartate (Meiji Seika Pharma Co., Ltd., Tokyo, Japan) 0.2 mg/kg IV and midazolam hydrochloride (Astellas Pharma Inc., Tokyo, Japan) 0.1 mg/kg IV. Then, anesthesia was induced with administration of propofol (Mylan Inc., Canonsburg, PA, U.S.A.) 6 mg/kg IV. Thereafter, each dog was endotracheally intubated, and anesthesia was maintained with isoflurane (DS Pharma Animal Health Co., Ltd., Osaka, Japan) 1.75 to 2.0% in 100% oxygen. End-tidal partial pressure of carbon dioxide was continuously monitored and maintained between 35 and 45 mmHg with mechanical ventilation, with a tidal volume of 10 to 15 m*l*/kg and a respiratory rate of 10 to 12 breaths/min. Heart rate and arterial pressure measured with arterial catheterization were continuously recorded with a commercial polygraph instrument (Nihon Kohden Co., Ltd., Tokyo, Japan).
A 6F, 12-cm introducer sheath (St. Jude Medical Inc., Minnetonka, MN, U.S.A.) was percutaneously inserted into the right external jugular vein using the Seldinger technique in each dog which was positioned in the position of left lateral recumbency. A 5F, 75-cm Swan-Ganz catheter (Edwards Lifesciences Corp., Irvine, CA, U.S.A.) was advanced into the pulmonary artery with fluoroscopy guidance. The catheter was connected to polygraph equipment for acquisition of hemodynamic data.
Following a stabilization period of about 10 min, baseline recordings of hemodynamic and echocardiographic indices were performed. Thereafter, cardiac preload was increased by IV infusion of warmed lactated Ringer solution (Terumo Corp., Tokyo, Japan) at 150 m*l*/kg/hr for 90 min \[[@r27]\]. This dose was modified from the dose used in previous studies \[[@r16], [@r17]\].
After the fluid infusion began, hemodynamic and echocardiographic evaluations were performed every 15 min. The hemodynamic data were obtained before echocardiography at each time point assessment. Following the final echocardiographic examination, each dog was administered furosemide (Sanofi K K, Tokyo, Japan) 4 to 6 mg/kg IV and allowed to recovery from anesthesia.
Hemodynamic assessment
----------------------
All hemodynamic data including heart rate, mean arterial blood pressure, mean pulmonary arterial pressure, pulmonary capillary wedge pressure (PCWP), mean right atrial pressure, and cardiac output were recorded by a polygraph instrument and digitally stored. Mechanical ventilation was briefly stopped during the recordings of hemodynamic indices. The distal and proximal ports of a Swan-Ganz catheter were used to measure pulmonary arterial and right atrial pressures, respectively. The PCWP was determined when the balloon at the end of the Swan-Ganz catheter was inflated to be wedged in a small pulmonary artery. After pressure recordings, cardiac output was determined using the thermodilution method with the injection of a 5 m*l* bolus of cold saline (0.9% NaCl) into the right atrium through the proximal port of a Swan-Ganz catheter. Stroke volume was calculated by dividing cardiac output by heart rate. For pressure measurements, the mean of five consecutive cardiac cycles was calculated, and the average of four measurements was calculated for cardiac output.
Standard echocardiographic methods
----------------------------------
Echocardiography was performed by the same experienced investigator (KN) using a Toshiba Artida^TM^ echocardiographic system (Toshiba Medical System Corp., Tochigi, Japan) with a 3- to 7-MHz sector probe transducer array. All echocardiographic indices were recorded when dogs were in an expiratory phase. An ECG trace (lead II) was recorded simultaneously with echocardiographic imaging by the ECG equipment on the ultrasonographic device, in addition to that on the polygraph instrument. The mean of 3 consecutive cardiac cycles was calculated for all echocardiographic indices, including those determined by 2D-STE.
Pulsed-wave Doppler echocardiography was performed to measure the transmitral flow velocity from the left apical four-chamber view. The sample gate for transmitral flow was placed at the tip of the mitral valve leaflets when they were opened \[[@r3]\]. The following indices were measured: peak velocity of the early diastolic wave (E wave), peak velocity of the late diastolic wave (A wave), and the ratio of the peak velocity of the E wave to the peak velocity of the A wave. These indices were not determined when the E and A waves were completely or partially fused.
The aortic Doppler flow profile was obtained with the sample gate positioned immediately below the aortic valve from the left apical five-chamber view. Left ventricular ejection time (ET) was | {
"pile_set_name": "PubMed Central"
} |
Symptomatic patients {#s1}
====================
Background {#s1a}
----------
Patients are traditionally considered 'recently symptomatic' if they have suffered a carotid territory transient ischaemic attack or stroke within the preceding 6 months. In the 1980s, there was controversy as to whether carotid endarterectomy (CEA) conferred any benefit over best medical therapy (BMT) in patients with an ipsilateral carotid stenosis. Two landmark randomised controlled trials (RCTs), the European Carotid Surgery Trial (ECST) and the North American Symptomatic Carotid Endarterectomy Trial (NASCET), determined that CEA conferred significant benefit over BMT in patients with an ipsilateral 50%--99% internal carotid artery (ICA) stenosis,[@R1] using the NASCET method for measuring carotid stenosis severity.[@R2] Subgroup analyses suggested that it was possible to identify certain imaging/clinical features that were associated with a higher risk of stroke on BMT.[@R3] Clinical features of increased benefit conferred by CEA include: increasing age (especially patients aged \>75 years), recency of symptoms, male sex, hemispheric versus ocular symptoms, cortical versus lacunar stroke and increasing medical comorbidities.[@R3] Imaging features associated with an increased risk of stroke on medical therapy include: irregular versus smooth plaques, increasing stenosis severity (but not subocclusion), contralateral occlusion, tandem intracranial disease and a failure to recruit the intracranial collateral circulation.[@R3]
CEA versus CAS in recently symptomatic patients {#s1b}
-----------------------------------------------
### 30-day outcomes {#s1b1}
Nine RCTs recruited symptomatic patients only,[@R4] while five randomised both symptomatic and asymptomatic patients between CEA and carotid artery stenting (CAS).[@R13] The most influential national/international RCTs comparing CEA with CAS in symptomatic patients include: the Endarterectomy Versus Angioplasty in Patients with Symptomatic Severe Carotid Stenosis (EVA-3S) trial, the Stent-Protected Angioplasty versus Carotid Endarterectomy (SPACE) study, the International Carotid Stenting Study and the Carotid Revascularisation versus Stenting Trial (CREST).[@R8] The principle 30-day endpoints for these four RCTs are detailed in [table 1](#T1){ref-type="table"}.
######
30-day risks following CEA and CAS in trials that randomised \>500 recently symptomatic patients into EVA-3S, SPACE, International Carotid Stenting Study (ICSS) and CREST[@R8]
30-day risks EVA-3S[@R8] SPACE[@R9] ICSS[@R11] CREST\*[@R18]
------------------------ ------------- ------------ ------------ --------------- ------ ------ ------ ------
Death 1.2% 0.8% 0.9% 1.0% 0.8% 2.3%
Any stroke 3.5% 9.2% 6.2% 7.2% 4.1% 7.7% 3.2% 5.5%
Death/any stroke 3.9% 9.6% 6.5% 7.4% 4.7% 8.5% 3.2% 6.0%
Death/disabling stroke 1.5% 3.4% 3.8% 5.1% 3.2% 4%
Death/stroke/MI 5.2% 8.5% 5.4% 6.7%
Cranial nerve injury 7.7% 1.1% 5.3% 0.1% 5.1% 0.5%
\*Only includes symptomatic patients from CREST.
CAS, carotid artery stenting; CEA, carotid endarterectomy; CREST, Carotid Revascularisation versus Stenting Trial; EVA-3S, Endarterectomy Versus Angioplasty in Patients with Symptomatic Severe Carotid Stenosis; MI, myocardial infarction; SPACE, Stent-Protected Angioplasty versus Carotid Endarterectomy.
[Table 2](#T2){ref-type="table"} details ORs (95% CIs) for 30-day death/stroke in the four main RCTs, where only the symptomatic patients randomised within CREST were included within the meta-analysis.
######
ORs (95% CIs) for 30-day death/stroke for CEA versus CAS in EVA-3S, SPACE, ICSS and CREST\*
Trial OR (95% CI)
--------------- ---------------------
EVA-3S[@R8] 0.38 (0.16 to 0.84)
SPACE[@R9] 0.89 (0.55 to 1.42)
ICSS[@R11] 0.53 (0.35 to 0.80)
CREST\*[@R18] 0.52 (0.29 to 0.92)
Meta-analysis 0.59 (0.42 to 0.81)
\*Only symptomatic patients from CREST were included.
CAS, carotid artery stenting; CEA, carotid endarterectomy; CREST, Carotid Revascularisation versus Stenting Trial; EVA-3S, Endarterectomy Versus Angioplasty in Patients with Symptomatic Severe Carotid Stenosis; SPACE, Stent-Protected Angioplasty versus Carotid Endarterectomy.
The Carotid Stent Trialists Collaboration (CSTC) have undertaken a number of subgroup analyses to determine factors associated with poorer outcomes after CAS and CEA, which may influence how individual symptomatic patients are treated.
#### CAS operator experience {#s1b1a}
In EVA-3S, SPACE and ICSS, the 30-day rate of death/stroke was not influenced by lifetime CAS practitioner stenting experience (P=0.8). However, the 30-day rate of death/stroke was significantly higher in symptomatic patients who were treated by CAS practitioners with a low annual CAS volume (≤3 procedures per annum; 30-day death/stroke=10.1%; adjusted risk ratio=2.30 (95% CI 1.36 to 3.87)), versus intermediate in-trial CAS volumes (3--6 procedures per annum; 30-day death/stroke=8.4%; adjusted risk ratio=1.93 (95% CI 1.14 to 3.27)), compared with patients treated by higher annual in-trial volume practitioners (\>6 procedures per year; 30-day death stroke=5.1%).[@R19]
#### Effect of age in recently symptomatic patients {#s1b1b}
The CSTC pooled data from EVA-3S, SPACE, ICSS and CREST, regarding the effect of increasing age on 30-day death/stroke after CEA and CAS.[@R20] There was no evidence of any association between increasing patient age and an increased risk of death/stroke after CEA. However, increasing age was associated with increasing procedural risks in symptomatic patients undergoing CAS. Compared with CAS patients aged \<60 years, performing CAS in patients aged 70--74 years was associated with a significant increase in 30-day death/stroke (OR 4.01 (95% CI 2.19 to 7.32)). In CAS patients aged \>80 years (compared with CAS patients\<60 years), the 30-day risk of death/stroke was increased by 4.15 (95% CI 2.20 to 7.84).[@R20]
Compared with CEA, 30-day rates of death/stroke were no different after CAS in recently symptomatic patients aged \<70 years of age. However, there was a progressive increase in the risk of death/stroke after CAS (compared with CEA) which became significant at age 70--74 (OR 2.09 (95% CI 1.32 to 2.32)), increasing to an OR of 2.43 (95% CI 1.35 to 4.38) for CAS patients aged \>80 years.[@R20]
#### Recency of symptoms {#s1b1c}
There is now a worldwide drive towards performing carotid interventions as soon as possible after onset of symptoms. This is because evidence suggests that the risk of stroke in the first 7--14 days after onset of symptoms is significantly higher than previously thought, while delays to CEA are associated with significant reductions in the benefit conferred by CEA.[@R3] The CSTC undertook an individual patient meta-analysis of outcomes, stratified for the time delay between symptom onset and undergoing CEA/CAS.[@R21] Patients undergoing CAS within 0--7 days after symptom onset were significantly more likely to suffer a perioperative stroke (9.4%), compared with CEA (2.8%) (OR 3.4 (95% CI 1.01 to 11.8)). Patients undergoing CAS within 8--14 days after symptom onset were also significantly more likely to suffer a perioperative stroke (8.1%) compared with CEA (3.4%) (OR 2.4 (95% CI 1.0 to 5.7)).[@R21]
### Late outcomes after CEA/CAS in symptomatic patients {#s1b2}
#### | {
"pile_set_name": "PubMed Central"
} |
Introduction {#sec1-1}
============
Thrombosis of the cerebral venous sinuses (CVT) has been described in adults and children with nephrotic syndrome.\[[@ref1][@ref2]\] Acute post-infectious glomerulonephritis (APIGN), the prototype of acute nephritic syndrome is not reported to increase the risk for venous thrombosis. Here we report a case of CVT in a patient with APIGN.
Case Report {#sec1-2}
===========
A 13-year-old girl presented with recent onset generalized edema, decreased urine output, high-colored urine, and persistent vomiting. Two weeks ago she had fever and cough, which was successfully treated with a short course of antibiotics. On admission her blood pressure was 160/100 mm of Hg, urine showed 2+ protein and dysmorphic red blood cells. The other relevant investigations are shown in [Table 1](#T1){ref-type="table"}. Ultrasound abdomen revealed normal sized kidneys. She was treated with anti-hypertensives and diuretics. Over next 3 days, her blood pressure came down and urine output improved, but serum creatinine increased to 5.1 mg/dl. Hence, she was started on intravenous methylprednisolone injections at a dose of 750 mg/day for 3 days, followed by oral prednisolone at 1 mg/kg.
######
Laboratory parameters at admission

On the 5^th^ day after initiation of steroid therapy, she developed recurrent episodes of generalized tonic-clonic seizures associated with altered sensorium. Her blood pressure at the time of seizures was 130/80 mm of Hg. On examination, she was found to have left sided hemiparesis. Non-enhanced computed tomography (CT) brain showed an infarct in the left temporo-parietal region, mild midline shift, and cerebral edema. Hyperdensities were observed in the sagittal sinus, right sigmoid, and transverse sinuses \[[Figure 1a](#F1){ref-type="fig"}\]. A CT venogram showed an empty delta sign with filling defects in right transverse and sigmoid sinus extending to the right internal jugular vein \[Figures [1b](#F1){ref-type="fig"}, [2a](#F2){ref-type="fig"} and [b](#F2){ref-type="fig"}\]. She was started on anticoagulation with continuous infusion of unfractionated heparin (UFH). Hemodialysis was initiated through right femoral catheter in view of persistent renal failure. The seizures were controlled and sensorium improved over the next 1-week. Heparin was switched over to warfarin at the end of 7 days. She was supported with hemodialysis for 1-week, subsequently her renal function started to improve. After the initial decline, the serum creatinine remained static at 4.8 mg/dl. Her ANA, lupus anticoagulant (LA), anticardiolipin antibody, and ANCA were negative. We could not proceed with thrombophilia work up due to financial constraints.
{#F1}
{#F2}
Renal biopsy revealed enlarged glomeruli showing endocapillary proliferation, with neutrophils and occasional eosinophils in the capillary lumina. Glomerular basement membrane (GBM) thickness was normal. A segmental cellular crescent was present in one glomerulus. Tubules, interstitium, and vessels were normal. Immunofluorescence microscopy (IF) showed diffuse granular deposits of IgG and C3 (3+ intensity) along the capillary loops. Tubules showed simplification of the lining epithelium. Interstitium and vessels were unremarkable. The renal biopsy was consistent with post-infectious glomerulonephritis \[[Figure 3a](#F3){ref-type="fig"}--[d](#F3){ref-type="fig"}\].
{#F3}
Even though the biopsy was suggestive of post-infectious glomerulonephritis, we decided to continue corticosteroids in view of incomplete recovery of renal function. The patient was discharged on prednisolone 40 mg/day, warfarin and antiepileptics. Over the next 6 weeks, her serum creatinine decreased to 1 mg/dl. Her erythrocyte sedimentation rate decreased to 20 mm/1^st^ h. Prednisolone was given for a total duration of 3 months. Anti-epileptics and anticoagulants were stopped after 6 months. Currently, the patient is off anticoagulation for the last 8 months; without any recurrent episodes of thrombosis. On last follow-up, her blood pressure was 120/80 mm of Hg, serum creatinine 0.8 mg/dl, and 24 h urine protein was \<150 mg/dl with normal urine sediment.
Discussion {#sec1-3}
==========
CVT is considered to be less common when compared to thrombosis of other vascular beds. Apart from a few case series and single case reports, there are no reliable estimates on the prevalence of CVT in glomerular diseases. CVT has been described in patients with idiopathic nephrotic syndrome, minimal change disease, and membranous nephropathy.\[[@ref1][@ref2]\] Nephrotic syndrome induces a hypercoagulable state due to increased blood viscosity, elevated levels of procoagulant proteins like fibrinogen, factor V, VIII, and X, and deficiency of coagulation inhibitors like antithrombin III, protein S and C. CVT is reported to occur at the onset of nephrotic syndrome as well as during relapses. A poorly controlled nephrotic state, as well as steroid resistance confer a high risk for the development of CVT.
Apart from disease related factors, drugs can also trigger venous thrombosis. The volume depletion induced by aggressive diuretic therapy can trigger thrombosis in individuals with significant proteinuria. Exogenous corticosteroid administration is associated with increased thromboembolic tendencies in the initial days of exposure.\[[@ref3]\] There have been reports of high dose corticosteroid therapy predisposing to CVT in patients with multiple sclerosis with no additional risk factors for thrombosis.\[[@ref4]\] The proposed mechanisms include increased release of von Willebrand factor, shortened prothrombin time (PT) and impaired fibrinolytic activity.
The association between PIGN and CVT does not appear to be direct. The patient had hypoalbuminemia and elevated lipid levels suggestive of a nephrotic state. The coexisting acute tubular necrosis would have been responsible for the lower rates of urinary protein excretion. The volume depletion induced by loop diuretics in conjunction with low serum albumin levels, elevated lipids, and high dose corticosteroids might have precipitated CVT in this patient. There was no evidence of SLE or antiphospholipid antibodies. We did not test for deficiencies of protein C, protein S, antithrombin III, factor V, and prothrombin gene mutations due to financial constraints. The current evidence does not recommend routine thrombophilia testing in all patients with first episode of CVT as it has a low value for predicting recurrences.\[[@ref5][@ref6][@ref7]\] It is possible that the patient might be having a preexisting mild thrombophilia, which in the presence of appropriate triggers might have precipitated CVT.
Seizure is not an uncommon complication of PIGN. The most common cause of seizures in PIGN is hypertensive encephalopathy. There have been few reports of posterior reversible encephalopathy syndrome causing recurrent seizures in PIGN. Since CVT can also present as seizures, a high index of suspicion and appropriate early investigations are required to identify this entity.
Conclusions {#sec1-4}
===========
We wanted to highlight the occurrence of CVT in a patient with APIGN, a disease which is not usually associated with a hypercoagulable state. The nephrotic state resulting from APIGN combined with the volume depletion would have precipitated CVT in this patient. It is possible that CVT might be underdiagnosed because of the wide variability in clinical presentation. Recognizing this rare complication is important because of the potentially devastating outcome, if left untreated.
Financial support and sponsorship {#sec2-1}
---------------------------------
Nil.
Conflicts of interest {#sec2-2}
---------------------
There are no conflicts of interest.
| {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-sensors-20-02144}
===============
In the 4th industrial revolution, Structural Health Monitoring(SHM) is becoming a hot issue in the construction industry \[[@B1-sensors-20-02144],[@B2-sensors-20-02144]\] in which nondestructive evaluation and serviceability monitoring are essential features. Nondestructive evaluation plays a critical role in assuring that structural components and systems perform in a reliable and cost-effective fashion. This mechanism does not affect the future usefulness of the object or material. On the other hand, serviceability monitoring is performed in real time throughout its service life span \[[@B3-sensors-20-02144],[@B4-sensors-20-02144]\]; this is directly related to controlling the structural responses caused by either deflection, cracks, vibration, creep, or a combination of them. Various techniques have been utilized for the assessment of structure performance \[[@B5-sensors-20-02144]\]. Sensors are essential components and have different purposes based on the nature of the techniques. In general, we can classify sensors into two types based on the connection. Contact sensors which are commonly known for having physical interactions with the target structure. A Linear Variable Differential Transformer(LVDT), piezoelectric transducer, fiber optic sensor and acoustic emission sensor are common examples of this type \[[@B6-sensors-20-02144],[@B7-sensors-20-02144],[@B8-sensors-20-02144]\]. On the other hand, non-contact sensors are known for acquiring responses from the target material without making direct or indirect contact. Laser sensor systems, drones with vision-based sensors using cameras, wireless rechargeable sensor networks, radar sensor networks and lidar sensor systems are grouped as this type \[[@B9-sensors-20-02144],[@B10-sensors-20-02144],[@B11-sensors-20-02144]\]. Recently, non-contact sensors are being commonly utilized due to their portability, easy use in harsh surroundings, and so on. Knowing about the deflection of a beam or any structure using TLS has a big advantage from the perspective of site conditions. For the sake of describing the benefits of this study in the real world, aged structures, considering their spatial positions and site conditions, are not safe due to perilous structural conditions, inconvenience, insecurities and slippery site conditions. Consequently, the Light Detection And Ranging (LiDAR) system has become prominent in structural health monitoring. Despite such sensors being used for detection, measurement and characterization of hidden and/or apparent defects using advanced techniques, there are still many questions regarding the dimensions of the sensors for structural health monitoring.
Terrestrial Laser Scanning (TLS), or lidar, is a crucial non-contact optical sensor that analyzes the structural Three Dimensional(3D) shape in terms of a very dense 3D point cloud. This technology is a recent innovation in the spatial information of data acquisition, allowing for a scanned area to be digitally captured with unprecedented resolution and precision. However, the acquired data are influenced by several factors. Among them, random errors due to inherent physical properties are often difficult to eliminate while error due to environmental and scanning geometry issues can be removed through analysis \[[@B12-sensors-20-02144]\]. Consequently, attention should be given to data acquisition by considering the position, incidence angle, and color of a specimen \[[@B13-sensors-20-02144]\]. As a result, it is possible to dwindle noises tremendously.
In recent years, various approaches have been used to estimate the elements for serviceability limit states such as accumulated deflection, crack and dynamic displacement \[[@B14-sensors-20-02144],[@B15-sensors-20-02144],[@B16-sensors-20-02144]\]. Several researchers have published papers concerning the serviceability assessment in support of structural health monitoring \[[@B17-sensors-20-02144],[@B18-sensors-20-02144],[@B19-sensors-20-02144]\]. Park et al. conducted an experiment to define the deflection of a steel structure element via TLS using the geometrical shape of the specimen \[[@B20-sensors-20-02144]\]. Even though the model of Cabaleiro et al. is not valid due to torsion, they tried to model a deformed beam caused by concentric loads and torsional forces on the specimen after scrutinizing the max deflection with respect to the allowable building codes \[[@B21-sensors-20-02144]\]. Some researchers proposed how to estimate the deflection of a structural element, i.e., a beam, by integrating photogrammetry with TLS. For instance, Gordon measured the beam deflection with respect to benchmark photogrammetric data \[[@B22-sensors-20-02144]\]. Zogg and Ingensand tried to monitor a deformation of real structure called Felsenau Viaduct(CH) bridge which is a part of Swiss highway via with TLS. The deformation on their study is mainly caused by settlement and tilting of a structure. Eventually, they showed that TLS could replace the area wide precise levelling in monitoring of a structure deformation since the maximum difference in between these two system is less than 1 mm \[[@B23-sensors-20-02144]\]. Olsen et al. conducted a damage assessment for full scale structural test specimen by identifying volumetric change and its deformation \[[@B24-sensors-20-02144]\]. Cabaleiro et al. utilized TLS data for checking of a deflection and stresses caused by torsion especially for open cross section which have a very low torsional strength. They compared the result obtained from the proposed methodology with the measurement taken during an experiment and Finite Element Modeling(FEM). As a result, they could show that their proposed algorithm is much closer to the measurement taken directly which is considered as a ground truth data \[[@B25-sensors-20-02144]\].
Naturally, Lidar data are highly vulnerable and easily affected by noise \[[@B26-sensors-20-02144]\]. Different scholars have been studying the factors which affect the Lidar data regarding structural health monitoring \[[@B13-sensors-20-02144],[@B27-sensors-20-02144]\]. On the other hand, some researchers have used different types of denoising methods and optimization techniques in order to diminish their effect \[[@B28-sensors-20-02144],[@B29-sensors-20-02144]\]. Notice that, outliers and noise are differing conceptually. Indeed, these two terms have really ambiguous meaning to differentiate by the researchers. However, Sagado et al. defined outliers and noise individually. According to their definition, an outlier is a data point which is different from the remaining data whereas noise can be defined as mislabeled examples (class noise) or errors in the values of attributes (attribute noise) \[[@B30-sensors-20-02144]\]. Genetic Algorithm(GA) is also one of the crucial optimization methods used in order to attain the target effectively without the noise affection. GA has been conducted in different topics of structural health monitoring by different scholars. Optimization of sensor placement which provides the best possible performance is one of many critical topics \[[@B31-sensors-20-02144]\]. However, estimating a structural deflection for the purpose of assessing the performance via a genetic algorithm is not prominently conducted so far. Rather, many researchers have performed this optimization method to determine a structure deflection both analytically and numerically \[[@B32-sensors-20-02144]\]. GA can be also incorporated with a regression methodology to increase the robustness of curve fitting. Indeed, there are many techniques that are capable to increase the robustness of a curve fitting technique when we have numerous numbers of outliers in the data; Least Absolute Deviation (LAD), M-estimation, and S estimation are popular schemes which can considerably improve estimation precision \[[@B33-sensors-20-02144]\].
This study presents an effective algorithm for measuring the structural deflection by enriching previous studies. Improvements are made according to the following five main steps of the procedure listed; the acquisition of TLS data for the loading and unloading scenarios, fitting of a plane for the point cloud acquired during the unloading scenario using a robust genetic algorithm, transformation of the scanner coordinates into local structural coordinates, curve fitting of transformed data for the loading case, and eventually, estimation and comparison of deflection between contact sensors. Furthermore, our research illustrates the performance of the proposed procedure with a validating experiment in which deflection measurements are simulated based on the loading scenario.
2. Basic Principles {#sec2-sensors-20-02144}
===================
2.1. Least Square Regression {#sec2dot1-sensors-20-02144}
----------------------------
A plane can be described by a normal vector $n = \left\lbrack A,B,D \right\rbrack^{T}$ perpendicular to the plane, and a vector on the plane connected to a known point $p_{1}$ = ($x_{1}$, $y_{1}$, $z_{1}$) and an arbitrary point $p_{2}$ = (*x*, *y*, *z*) is described by $p_{2} - p_{1}$ since the normal vector and vector in the plane are perpendicular to each other, the dot product of these two vectors should be null \[[@B34-sensors-20-02144]\]. $${\overset{\rightarrow}{n} \cdot \left( {\overset{\rightarrow}{P_{2}} - \overset{\rightarrow}{P_{1}}} \right) = 0}\,\,\,\because\,\,\,\left( \overset{\rightarrow}{n}\bot\left( \overset{\rightarrow}{P_{2}} - \overset{\rightarrow}{P_{1}} \right) \right)$$ For the sake of simplifying the over-determined problem, begin by removing one component by constraining the solution space. Thus we assume the coefficient D is the | {
"pile_set_name": "PubMed Central"
} |
WAN files are available from the <https://figshare.com/s/5297ddc238766def6afc> database. Wireless data are within the paper and its Supporting Information files.
Introduction {#sec001}
============
Vehicular cloud computing is a promising paradigm that aims at merging mobile cloud computing and vehicular networking, in order to give arise to integrated communication-computing platforms \[[@pone.0191577.ref001]\]. In vehicular cloud computing, vehicles can be either the service providers to enrich existing cloud services by providing various on-road information (e.g., traffic condition like Pics-on-Wheels proposed by \[[@pone.0191577.ref002]\]) or be the service consumers to enjoy existing centralized Internet cloud services \[[@pone.0191577.ref003]--[@pone.0191577.ref005]\]. One of the key features of vehicular cloud computing is high mobility \[[@pone.0191577.ref005]--[@pone.0191577.ref009]\]. The running job may be interrupted by the random arrival and departure of vehicles \[[@pone.0191577.ref003],[@pone.0191577.ref008]\]. We must be able to address the mobility and provide an effective control scheme to guide service conditions and cloud resources \[[@pone.0191577.ref010]--[@pone.0191577.ref011]\]. Thus fault-tolerant schemes are designed to provide reliable and continuous services in vehicular cloud computing despite the unavailable of some vehicles \[[@pone.0191577.ref012]--[@pone.0191577.ref017]\]. As an essential building block of the fault-tolerant scheme, a failure detector (FD) plays a critical role in the engineering of such dependable systems \[[@pone.0191577.ref018]--[@pone.0191577.ref019]\]. An optimized FD should find the vehicles' failure in a timely and accurate manner \[[@pone.0191577.ref020]\].
To improve connectivity of vehicular cloud computing, the Roadside Unit (RSU) is deployed along the road \[[@pone.0191577.ref021]--[@pone.0191577.ref023]\]. For example, many future Internet applications \[[@pone.0191577.ref024]\] which are delay and delay-jitter sensitive (such as Netflix and VTube) are benefit from RSU. Normally, they use the solar as power input due to the unavailability or excess expense of wired electrical power \[[@pone.0191577.ref025]--[@pone.0191577.ref028]\]. The solar power are easily affected by the natural environment, e.g., solar power cannot be acquired at night or cloudy day. The energy supply of RSU is unstable, so the energy capacity of RSU is limited. According to the U.S. Department of Transportation \[[@pone.0191577.ref029]\], it is estimated that 40% of all initial rural freeway roadside infrastructure would have to be solar powered by 2050. A breakdown of the deployment costs also found that over 63% of these roadside infrastructure costs would be consumed by solar energy provisioning, e.g., solar panels, batteries, and their associated electronics. Thus, it is important to reduce the energy consumption of RSUs \[[@pone.0191577.ref028],[@pone.0191577.ref030]\].
Existing main adaptive FDs (such as Chen FD \[[@pone.0191577.ref031]\], *φ*-FD \[[@pone.0191577.ref032]\], ED FD \[[@pone.0191577.ref033]\] etc.) keep a sliding window (*WS*) that contains information about received messages to make an estimate of the state (trusted or suspected of having failed) of a monitored node. These FDs need a certain memory space to save a large history message window. At each detection cycle, a large amount of calculation is needed to compute the probability distribution parameters and detector parameters \[[@pone.0191577.ref034]\]. For most RSUs with battery, these overhead of FDs can exacerbate the battery consumption.
In this paper, aiming at the RSUs with battery, we have presented the Energy-Efficient Failure Detector (2E-FD). It does not rely on the probability distribution of message transmission delay, or on the maintenance of history message windows. We use the arrival time of last message to estimate the arrival time of next message. In addition, the dynamic safety margin, which is computed by the single exponential smoothing method, is used to improve the accuracy of failure detection. To evaluate the performance of 2E-FD, some best-known existing FDs are selected in terms of detection time, mistake rate and query accuracy probability. Besides, we also measure the battery consumption of RSU with different FDs. The experimental results show that 2E-FD is able to reduce the battery consumption of RSU and provide an adaptive failure detection service with high accuracy.
The rest of this paper is organized as follows. In section 2, the related work of vehicular cloud computing and failure detectors is introduced. Section 3 introduces the system model and presents the implementation of 2E-FD. Section 4 carries out the experiments on real traces and tests the battery consumption of RSU with different FDs. Finally, the work is concluded in section 5.
Related work {#sec002}
============
In this section, vehicular cloud computing is firstly introduced. Second, the quality of service (QoS) metrics of FD is introduced. Finally, several existing main adaptive FDs are presented.
Vehicular cloud computing {#sec003}
-------------------------
Olariu et al. \[[@pone.0191577.ref035]--[@pone.0191577.ref037]\] advocate the concept of vehicular cloud, which coordinates the computing, sensing, communication and storage resources to provide services to authorized users. Different from conventional Internet cloud with dedicatedly installed hardware, vehicular cloud leverages the already available resources on vehicles. In vehicular cloud computing, vehicles communicate with the data centers where the wanted cloud services locate using vehicles-to-infrastructure (V2I) communications, e.g., LTE, WiMax. In addition, vehicles can also work in an autonomous way solely relying on the vehicle-to-vehicle (V2V) communication capabilities. Accordingly, we think that vehicular cloud can be described by a loose two-tier architecture. The first-tier is the Internet cloud computing platform (e.g., data centers) while the second-tier consists of many vehicular cloudlet \[[@pone.0191577.ref003]\]. The vehicular cloudlet is made up of RSU and vehicles. A user can acquire cloud services from either the first-tier data center or the second-tier vehicular cloudlet. An architecture example is illustrated in [Fig 1](#pone.0191577.g001){ref-type="fig"}.
{#pone.0191577.g001}
QoS metrics of failure detector {#sec004}
-------------------------------
Many distributed applications have some timing constraint on the behaviors of FDs \[[@pone.0191577.ref019],[@pone.0191577.ref038]\]. It is not acceptable that a node is suspected hours after than it has crashed or the FD outputs several false positives. To solve this problem, Chen \[[@pone.0191577.ref031]\] proposed a series of metrics to specify the QoS of FD: how fast it detects actual failures and how well it avoids false detections. These metrics can quantitatively represent the detection speed and accuracy. We use *T* or *S* to represent whether a node is trusted or suspected. *T*-transition means that the output of the detector changes from *S* to *T*, while *S*-transition means that the output of the detector changes from *T* to *S*. The following three primary metrics are used to describe the QoS of a FD.
Detection time (*T*~*D*~) is the time that elapses from the moment when a node crashes to the time when it starts being suspected, i.e., when the final *S*-transition occurs.
Mistake rate (*λ*~*M*~) is the number of mistakes that a FD makes per unit time, i.e., it represents how frequently a FD makes mistakes.
Query accuracy probability (*P*~*A*~) is the probability that the output of a FD is correct at a random time.
The first metric is related to a failure detector's speed, while the remaining relate to its accuracy. In many cases, the mistake rate is not sufficient to describe the accuracy of a FD; simultaneously, the query accuracy probability is also needed. For example, [Fig 2](#pone.0191577.g002){ref-type="fig"} shows that both FD~1~ and FD~2~ are detecting the node *p*. The two FDs have the same mistake rate (0.125) but different query accuracy probabilities (0.75 and 0.5).
{#pone.0191577.g002}
Adaptive failure detector {#sec005}
-------------------------
The adaptive FDs are designed to adapt to changing network conditions and application requirements \[[@pone.0191577.ref039]\]. In most adaptive FDs, their implementations are based on a heartbeat strategy. Existing main adaptive FDs (Chen FD, *φ* FD and ED FD) work as follows:
Chen et al. \[[@pone.0191577.ref031]\] proposed the QoS-based adaptive failure detection algorithm based on a probability network model. This algorithm assumes that node *p* sends heartbeat message *m* to node * | {
"pile_set_name": "PubMed Central"
} |
###### Article summary
Strengths and limitations of this study
=======================================
- This study protocol is based on well-established methodological standards.
- While great efforts were made to ensure inclusion of the most relevant predictors of panic-like anxiety, it is possible that some unidentified but relevant variables were missed.
Introduction {#s1}
============
Chest pain in Emergency Medicine {#s1a}
--------------------------------
Chest pain accounts for approximately 5% of all emergency department (ED) consultations,[@R1] and over 50% of cases remain unexplained at discharge.[@R2; @R3; @R4; @R5; @R6] In Canada, approximately 400 000 patients/year present in the ED with unexplained chest pain (UCP).[@R2] [@R4]
Burden of UCP {#s1b}
-------------
Despite a generally favourable prognosis, 80% of cases of UCP persist for up to 12 years after initial medical evaluation.[@R7; @R8; @R9; @R10; @R11; @R12; @R13] Many patients with UCP (41--60%) report limitations in daily functioning (eg, housework, walking and exercising) and work absenteeism or disability (17--35%).[@R7] [@R8] [@R10; @R11; @R12] [@R14; @R15; @R16; @R17; @R18; @R19; @R20; @R21; @R22] Moreover, the occupational impairments associated with UCP are comparable or more severe than those associated with cardiac chest pain.[@R7] [@R22] The negative impact of UCP on quality of life and day-to-day functioning is considerable and may be observed for up to 10 years after symptom onset.[@R7]^--^[@R9] [@R11] [@R12] [@R14; @R15; @R16; @R17; @R18; @R19; @R20; @R21; @R22]
Despite the benign origin of their pain, patients with UCP report persistent fear of serious health conditions.[@R11] [@R20] [@R22] [@R23] They are frequent users of healthcare services, including emergency care, and often undergo multiple invasive tests (eg, coronary angiograms).[@R9] [@R14] [@R22] [@R24]^--^[@R27] In Canada, the average duration of an ED consultation for a UCP patient is 11 h and one in four patients arrives in the ED by ambulance.[@R3] The direct annual cost associated with UCP in the USA is estimated to amount to eight billion US dollars.[@R28] [@R29]
UCP is also associated with significant psychological distress that can become chronic in the absence of targeted interventions.[@R30; @R31; @R32] In fact, 20--40% of patients present a psychiatric disorder at the time of ED consultation [@R3] [@R6] [@R33; @R34; @R35] and 15% report suicidal ideation.[@R3] [@R33] [@R34] [@R36] Unfortunately, fewer than 5% of patients are referred to a mental health professional for psychiatric or psychological treatment.[@R3]
While the cause of UCP may be unclear, the literature clearly demonstrates that UCP is highly prevalent and often chronic, and that it constitutes a significant burden for patients and society alike.
Aetiology of UCP {#s1c}
----------------
Although pathologies such as microvascular angina and gastroesophageal reflux may be at the origin of some cases of UCP,[@R29] panic attacks are the most prevalent condition associated with UCP in ED.[@R3] [@R34] [@R35] [@R37; @R38; @R39] As many as 44% of patients with UCP experience panic attacks in the month prior to ED consultation.[@R3] [@R34] [@R35] [@R37; @R38; @R39]
A panic attack is defined as a discrete period of intense fear or discomfort that peaks in a few minutes.[@R40] [@R41] Fear or discomfort is accompanied by at least four of the following symptoms: chest pain, palpitations, dyspnoea, a feeling of suffocation, hot or cold flashes, sweating, nausea, feeling faint, paraesthesia, trembling, fear of death, depersonalisation and fear of losing control or going crazy.[@R40] [@R41] Panic attacks may be an isolated phenomenon or may occur in the context of a psychiatric disorder; the most common psychiatric disorder in which panic attacks occur is panic disorder.[@R42] The 1-year prevalence of panic attacks in the general adult population is 8--11%;[@R42] [@R43] the prevalence is four to six times higher among patients presenting with UCP.[@R3] [@R42] [@R43]
The literature clearly demonstrates that panic attacks with and without panic disorder constitute a significant mental health problem with serious consequences.[@R3] [@R36] [@R42; @R43; @R44; @R45; @R46; @R47] For simplicity, the term *panic-like anxiety* (PLA) will be used to refer to panic attacks with or without panic disorder.
Consequences of PLA in patients with UCP {#s1d}
----------------------------------------
PLA may be responsible for a significant portion of the negative consequences of UCP.[@R3] [@R6] [@R15] [@R30; @R31; @R32] [@R34] [@R35] [@R37] PLA is associated with a greater frequency of UCP episodes and increased risk of chronicity.[@R15] [@R30; @R31; @R32] Quality of life is lower and functional limitations levels are higher in patients with UCP and PLA.[@R15] [@R30] [@R31] [@R37] Moreover, in patients with UCP, PLA is associated with at least a threefold increase in psychiatric morbidity and suicidal ideation.[@R3] [@R34] Similarly, use of medical resources nearly doubles when PLA is present.[@R31] [@R32]
In patients with UCP, PLA is associated with elevated morbidity, excessive health services use and a negative prognosis. Unfortunately, more than 92% of cases of PLA remain undiagnosed at the time of discharge from ED.[@R3] [@R34] [@R35]
Identifying PLA in patients with UCP {#s1e}
------------------------------------
Several factors may contribute to the current low rate of PLA identification in patients in ED. First, PLA patients and physicians alike tend to focus on physical symptoms and on potential organic causes.[@R48] Second, the identification of PLA is complicated by the similarity between PLA symptoms and symptoms of medical conditions such as coronary artery disease. Third, the limited time available for clinical evaluation in ED settings may be insufficient to identify psychological causes of symptoms.[@R49] Finally, some ED physicians are unfamiliar with PLA or believe that it is not their role to identify psychiatric problems.[@R50] However, other physicians recognise the importance of improving identification and treatment of PLA in the ED settings.[@R51; @R52; @R53]
Researchers and clinicians seeking methods for increasing PLA identification rates must take into consideration certain constraints related to the clinical practice of emergency medicine, notably the brief period of time available to assess patients.
Importance of screening for PLA in ED patients with UCP {#s1f}
-------------------------------------------------------
Increasing the rate of identification of a problem is not in itself sufficient to improve clinical outcomes for patients.[@R54] [@R55] Gates [@R54] and Stiell and Wells [@R55] propose five criteria for determining the importance of a detection procedure and its potential impact on patients' clinical outcomes: (1) the problem has an impact on public health; (2) the problem is sufficiently prevalent; (3) effective treatments are available to reduce morbidity; (4) early diagnosis improves patient prognosis and (5) additional investigations or treatments are acceptable to patients.
The current data demonstrate that more accurate identification of PLA in ED patients with UCP could improve clinical outcomes. First, PLA in patients with UCP is a prevalent health problem with serious consequences for patients and society. Second, research demonstrates that morbidity associated with PLA in patients suffering from UCP can be greatly reduced via evidence-based treatments.[@R56; @R57; @R58] For example, 80--95% of patients with PLA show significant improvement and attain an adequate level of functioning following cognitive-behavioural therapy.[@R57] [@R59] [@R60] Several evidence-based treatment methods for PLA have proven to be effective in patients with UCP.[@R38] [@R61; @R62; @R63] Third, given that PLA tends to worsen over time,[@R32] [@R42] [@R64; @R65; @R66; @R67] negatively influencing treatment response, early diagnosis improves prognosis.[@R25] [@R42] [@R64] [@R66] [@R68; @R69; @R70; @R71] Finally, the criterion of acceptability to patients appears to have been met. Participation rates for patients with PLA and UCP approached for inclusion in a study are generally over 70%.[@R38] [@R61; @R62; @R63] In addition, 80% of primary care patients with PLA agreed to receive psychiatric care.[@R72]
The | {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
There were an estimated 65,500 new cases of ovarian cancer in 2012 in Europe with 42,700 deaths^[@CR1]^. It ranks fifth as the cause of cancer death in women and is the most deadly gynecological cancer due to late stage diagnosis^[@CR2]^. Ovarian cancer is not a single disease, but a group of tumors classified depending on the cells it involves. Thereby, there are ovarian epithelial tumors, sex cord-stromal tumors (implicating granulosa and theca cells) and germ cell tumors^[@CR3]^.
Advanced ovarian epithelial cancer patients undergo surgery, in order to reduce all macroscopic visible disease. Early and advanced stage epithelial cancers are treated with a combination therapy of platinum and taxane. Unfortunately, approximately 70% of the patients present a relapse during the first 3 years^[@CR4]^. The most common therapy regimen for sex cord- stromal ovarian tumors is the combination of bleomycin, etoposide and cisplatin (BEP)^[@CR5]^. Even though these tumors show a good response rate after BEP treatment, a high relapse rate is observed several months after the completion of the treatment^[@CR6]^.
Overexpression of Fibroblast Growth Factor 1 (FGF1) has been linked to high grade serous ovarian tumors and poor survival^[@CR7],[@CR8]^. Furthermore, FGF1 has been associated with tumor growth in nude mice injected with ovarian cells overexpressing FGF1^[@CR9]^. In ovarian epithelial cisplatin-resistant cell lines overexpressing FGF1, its knock-down by shRNA, restores sensitivity to cisplatin^[@CR8]^.
FGF1 belongs to the FGF family that counts 22 members^[@CR10],[@CR11]^. FGF1 regulates cell proliferation, differentiation and survival^[@CR12]--[@CR19]^. FGF1 acts through FGFR--dependent or FGFR--independent pathways^[@CR16],[@CR19]--[@CR21]^. Indeed, FGF1 is mainly intracellular under physiological conditions and secreted only under specific stress conditions^[@CR22]--[@CR24]^. Whereas FGF1 has been shown to interact with intracellular proteins such as CK2, FIBP, p34, nucleolin, and p53^[@CR18],[@CR21],[@CR25]--[@CR28]^, its intracellular activities are not fully understood. Nevertheless, FGF1 intracellular activities are crucial for cell survival since FGF1 represses the pro-apoptotic activity of p53. We previously showed in rat embryonic fibroblasts and pheochromocytoma PC12 cell line that FGF1 promotes p53 degradation and inhibits both p53 phosphorylation on serine 15 and p53 transcriptional activities^[@CR16],[@CR17]^. We also showed that FGF1 interacts with p53 in PC12 cells^[@CR18]^.
p53 is a key regulator of apoptosis^[@CR29]^. Its ability to induce apoptosis is mediated by the transactivation of pro-apoptotic genes such as *Bax*^[@CR30]^, *NOXA* and *PUMA*^[@CR31]^. p53 also triggers apoptosis by relocating at the mitochondrion. Indeed, p53 mitochondrial translocation allows its interaction with both the anti-apoptotic proteins BCL-X~L~ and Bcl-2, leading to their inhibition^[@CR32]^, and the pro-apoptotic proteins Bax and BAK, provoking their activation^[@CR33],[@CR34]^.
As FGF1 can inhibit p53-dependent apoptosis, we hypothesized that FGF1 could affect the apoptotic response to etoposide (an activator of p53-dependent apoptosis) in ovarian tumor cells. We tested our hypothesis in the ovarian granulosa cell line COV434 that expresses wild-type p53 protein^[@CR35]^. In the present study, we showed that FGF1 is able to attenuate etoposide and cisplatin-induced apoptosis in COV434 cells. Under etoposide treatment, FGF1 only shows a moderate impact on p53 stability or activation and p53 transcriptional activities do not appear to be involved in COV434 cells apoptosis. However, p53 mitochondrial activities are important for COV434 cells apoptosis and FGF1 regulates p53 mitochondrial translocation.
Results {#Sec2}
=======
FGF1 overexpression protects COV434 ovarian granulosa cells from etoposide-induced apoptosis {#Sec3}
--------------------------------------------------------------------------------------------
We first determined whether FGF1 overexpression could be sufficient to induce resistance to chemotherapeutic agents such as cisplatin or etoposide in ovarian cells. We thus established stable cell lines constitutively overexpressing FGF1 (COV434-FGF1). To induce p53-dependent cell death, we used the well-known genotoxic stress inducer etoposide. Among the hallmarks of apoptosis, we monitored (i) the decrease of the inner mitochondrial membrane potential (ΔΨm) that reflects mitochondrial depolarization during apoptosis, (ii) cytochrome c release arising from mitochondrial outer membrane permeabilization (MOMP) and (iii) caspases activation.
Cell condensation and loss of ΔΨm reflected by low DiOC~6~(3) staining were first examined by flow cytometry analysis. Following a 16 h-long etoposide treatment, the percentage of COV434-FGF1 cells with small size and low ΔΨm (apoptotic cells) was significantly lower than for parental or mock-transfected COV434 cells (Fig. [1a](#Fig1){ref-type="fig"}). Similar results were obtained using cisplatin instead of etoposide (Supplementary Fig. [S1A](#MOESM1){ref-type="media"}). Therefore, FGF1 overexpression partially inhibits etoposide- and cisplatin-induced apoptosis in COV434 cells.Fig. 1FGF1 overexpression protects COV434 cells from etoposide-induced apoptosis.**a** Upper panel: Average flow cytometry quantification of apoptotic cells characterized by their low DIOC staining and cell condensation (DIOC^-^, Size^-^) ± SEM for 3 experiments done in triplicate. Non-transfected COV434 (NT), two COV434-Mock clonal cell lines and three COV434-FGF1 clonal cell lines were treated with etoposide (25 µg/mL) for 16 h, or not treated (Ctl), The t-tests compare to NT Eto. Lower panel: FGF1 levels in non-transfected, mock and FGF1 overexpressing clones using western blot analysis. Total proteins are visualized with the Biorad stain free system. **b** Immunofluorescence study for cytochrome c release. COV434-Mock C1 and -FGF1 C1 cells were treated with 25 µg/mL etoposide for 4 h. Cells were stained with an anti-cytochrome c antibody (green) and TO-PRO-3 (blue) to visualize nuclei (left panels). Scale bar represents 40 µm. The histogram presents the average percentages ± SEM for 3 independent experiments of cells exhibiting cytochrome c release (right panel). The t-test compares to Mock cells similarly treated. **c** Upper panel: Western blot analysis of total proteins for procaspase-9, cleaved caspase-9 and −3 and PARP levels. COV434-Mock and -FGF1 cells were treated or not (0 h) with 25 µg/mL etoposide for 2, 4, 6, or 16 h. Lower panel: histograms present the average fold-change decrease of cleaved caspase-9, cleaved caspase-3 and cleaved PARP in COV434-FGF1 cells ± SEM from pooled results of three FGF1 overexpressing clones (*n* = 8). Two-tailed unpaired t-tests results are shown as \* for *P* ≤ 0.05, \*\* for *P* ≤ 0.01 and \*\*\* for *P* ≤ 0.001
Release of cytochrome c from intermembrane mitochondrial space was then studied using immunofluorescence. Following 4 h of etoposide treatment, FGF1 significantly decreased the release of cytochrome c (Fig. [1b](#Fig1){ref-type="fig"}). This suggests that FGF1 inhibits MOMP during etoposide-induced cell death.
We further examined the effect of FGF1 overexpression on the cleavage of procaspase-9 and procaspase−3 and the caspase target PARP following an etoposide treatment. In COV434-FGF1 cells, the cleavage of these apoptotic markers is delayed and less pronounced than in COV434-Mock cells (Fig. [1c](#Fig1){ref-type="fig"}). Similar results were obtained with cisplatin instead of etoposide (Supplementary Figs. [S1B](#MOESM1){ref-type="media"}, [S1C](#MOESM1){ref-type="media"}).
Therefore, FGF1 overexpression in COV434 cells is able to prevent a decrease in ΔΨm, cytochrome c release and the subsequent activation of caspases arising during etoposide and cisplatin-induced apoptosis. These results suggest that FGF1 acts either upstream or at the mitochondrial level to promote survival.
FGF1 overexpression attenuates the etoposide-induced G2/M cell cycle arrest {#Sec4}
---------------------------------------------------------------------------
As etoposide provokes an S phase delay and a G2 phase accumulation of treated cells^[@CR36]^, we explored the effect of FGF1 overexpression on cell cycle. This was done by cytometry analysis after Hoechst 33342 staining.
Distribution of cells in the different cell cycle phases was similar for COV434 (COV434-NT), COV434-Mock and COV434-FGF1 cells in the absence of etoposide (Fig. [2a, b](#Fig2){ref-type="fig"}). After 16 h of etoposide treatment, we observed a decrease of the percentage of cells in G1 phase and an increase of the percentage of cells in S and G2/M phases in all cell | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION {#sec1-1}
============
In an era of increased complexity and escalating costs of clinical research, a focus on personalized medicine and patient empowerment, drug development is undergoing a metamorphosis. Typically, when a clinical trial is conducted, clinicians and patients collaborate with the sponsor for determining the safety and effectiveness of a molecule under experimental treatment. Trials are usually designed keeping in mind the feasibility and ease with which the sponsor can conduct the study. This can lead to a large number of costly and complex trials being conducted, without addressing the patient\'s convenience or needs. As per an IMS Health Study forecast, global spending on medicines is targeted to increase 30% to \$1.3 trillion by 2018.\[[@ref1]\] The spend has grown, but patient\'s needs are not being met. Thus, patient-centric drug development is now becoming the model that the industry is following. Today, patients are aware, technology-driven, and informed-driving the change in mindset and way clinical trials are being approached and conducted.
DIGITAL PATIENT -- PATIENT AT THE CENTER OF THE NETWORK ENVIRONMENT {#sec1-2}
===================================================================
A number of factors can influence a patient\'s decision to participate in a clinical trial including financial, social, philanthropic or altruistic.\[[@ref2]\] Prior to enrolling in trials, patients today invest time in learning about the disease of interest, the drug mechanism for cure, locations where trials are being conducted and results from similar trials to name a few, through the internet. This has enhanced the quality of discussions occurring between the physician and patient. Benefits of engaging these "digital patients" have been realized. Contract research organizations (CROs) are offering a ready repository of patients who have enrolled in different trials to pharma companies keen on conducting trials-driving cost and effort saving. For example, quintiles have more than three million patients under their "Digital Patient Unit" program which also helps to use real world patients for the faster testing of inclusion/exclusion criteria and allows sponsors to prescreen the subjects and refer them, if needed, to clinical trial sites.\[[@ref3]\]
INVOLVING PATIENTS FROM THE INITIAL STAGES IN DRUG DEVELOPMENT {#sec1-3}
==============================================================
Pharma are using technology to run contests and competitions to gather ideas and feedback on trial designs, informed consent forms (ICFs) and protocols. Open discussions on draft protocols specially focused on endpoints and visited structure are encouraged, and updates are made based on the responses received. Some of the areas where patients are being actively engaged are listed below.
Seeking patient inputs in informed consent forms {#sec2-1}
------------------------------------------------
The draft guidelines on the informed consent released by the Food and Drug Administration (FDA) in July 2014 could be used as a ready reference for building effective ICFs. While building ICFs, an approach, which is behavioral but science-based helps uncover patient insights. The usage of simple language easily deciphered by the participating subject will establish expectations regarding foreseen and unforeseen risks. ICFs that are short and precise will hold the attention. Clearly defining study objectives, end points and providing a detailed summary would retain the interest of the patient. It could also help in understanding the enrollment risks and also highlight factors that could be adjusted in the protocol for minimizing those risks.\[[@ref3]\] Having the ICF reviewed by a layman could also be considered as it would shed light on content that is too scientific in nature. Understanding the section of the protocol that led to distress while review (e.g., surgical procedure related requirement) could help one make amendments, if needed, in earlier stages of protocol development. Seeking clarification from patients on their understanding of the protocol could provide insights on building ICFs that would be better accepted by a larger patient population.\[[@ref4]\]
Building patient friendly protocols and grooming study staff {#sec2-2}
------------------------------------------------------------
While designing the study protocols, time should be invested in understanding the lifestyle of the patient population. Real world patients providing their inputs to building study protocols and study designs, which are more real and closer to life experiences, cost-effective and patient-centric is needed. Designing patient friendly visit schedules that are more flexible is important. In the case, patients are dependent on caregivers, considering the schedule of a caregiver would be beneficial. For better retention, care should be taken to provide facilities and an environment conducive to patients, especially during prolonged on-site visits, or visits that require patients to be in a fasted state. By being sensitive to a patient\'s comfort and needs, a better retention rate could be achieved.\[[@ref5]\]
Companies should provide appropriate trainings to the study staff and groom them to handle sensitive situations, especially when invasive procedures are followed.
PROMOTING OPEN COMMUNICATION CHANNELS BETWEEN BIOPHARMA, PHYSICIANS, PATIENTS, AND MEDIA {#sec1-4}
========================================================================================
The traditional communication mechanisms where Biopharma companies were at the center and messages were directed toward physicians, who in turn shared the messages with patients, have changed. There is a need to adopt newer tools and technologies that drive two-way communication. Promoting and accelerating direct to consumer advertising where companies still control the delivery of the messages, but the loop in media for a greater effect. Companies are actively using social listening techniques to review what patients are discussing online regarding disease state and issues to drive better patient participation and relationships.\[[@ref6]\] Researchers are skeptical regarding the type and extent of clinical information that is being shared and discussed by patients via online chats, such as protocol details, their experience of participating in trials, adverse event reactions etc., that can introduce bias for future trials.\[[@ref7]\]
Understanding the importance social media and its role in the dissemination of information, FDA has released draft guidance for industry on social media usage in June 2014. It provides recommendations for presenting benefit and risk information for FDA regulated prescription drugs or devices using social media such as Twitter, Yahoo, and Google.\[[@ref8]\] Medicine\'s New Zealand also released its updated code of practice in June 2014 where it has included its guidance on social media usage by the pharmaceuticals. This was done to separate social media from other type of advertising and clearly outline pathway for pharma companies keen to use social media channels -- an indication of increasing global acceptance of social media usage.\[[@ref9]\]
ENHANCING THE FOCUS ON PATIENT EDUCATION, ENGAGEMENT AND RETENTION USING TECHNOLOGY {#sec1-5}
===================================================================================
To improve clinical outcomes, increase patient satisfaction and incur profit revenue, engaging patients in their own healthcare is critical. The US government is encouraging the use of Electronic Health Records (EHRs) via HealthIT.gov and promoting incentives to doctors who use EHRs meaningfully to reduce medical errors and improve the quality of care. CROs and independent service providers are designing educative websites that can be accessed via mobiles or the internet for educating patients on diseases.
A few examples of available websites and tools below
Agency for Health Research and Quality maintained by US Department of Health and Human ServicesClinicalResearch.comWELVU -- Mobile First, an iPad- and iPhone-based educative tool providing medical illustration, quality scores, and health outcomes to engage patientsKrames patient education from StayWellExitCare OnScreen™ video solutions for patient education.\[[@ref10][@ref11][@ref12][@ref13]\]
The retention of patients in a trial is the key to the success of the overall project. Acurian, a service provider for recruitment and retention services uses platforms such as Facebook and Myspace for patient referrals and retention strategies.\[[@ref14]\] The easier it is to be compliant to study schedule, the better is the retention till the end. Dose compliance tracking tools like MediGuard™ enable reminders to be set up for dose intake.
USE OF CROWDSOURCING TECHNIQUES FOR ASSESSING THE PULSE OF THE PUBLIC {#sec1-6}
=====================================================================
Crowdsourcing has been used since long as a powerful tool to engage the masses in other industries. Wikipedia is one classic example. To maintain 23 million articles rich in content, the company uses crowd participation where the site is maintained by a community of passionate 80,000 users, who in turn are incentivized via a gamified award mechanism.\[[@ref15]\]
Companies are holding contests where relevant stakeholders, including medical communities, patient communities, and researchers are looped in to provide responses to survey questions via tools like "protocol builder." The FDAs approval of the first completely crowd-sourced protocol for multiple sclerosis by Transparency Life Science\'s reconfirms the potential that regulatory agencies see in the application of crowdsourcing. Online patient communities such as Mediguard.org and Clinical research.com are instrumental in changing face of healthcare, clinical trials and outcomes. They are beneficial to patients as connections can be developed between people with similar conditions, sharing clinical trials information and advice on management of diseases. The communities also aid in patient recruitment by prescreening potential participants online. Digital observational research where data are directly collected from patients and compared to data results in healthcare records (with reduced physician involvement) can be especially helpful for postmarketing surveillance of products consumed for extended periods.\[[@ref16]\]
Researchers, however, still feel concerned while opening complex clinical problems to a large number of strangers. Issues related to the misuse of intellectual property, the lack of surety in receiving solutions-raises questions on the effectiveness of crowdsourcing. However, companies can leverage on the potential of crowdsourcing and actively engage patients via several methods. Survey questions could be targeted to seek public views on inclusion-exclusion criteria, visit | {
"pile_set_name": "PubMed Central"
} |
Introduction {#sec1}
============
The minute pirate bugs (Hemiptera: Heteroptera: Anthocoridae) comprise 500 to 600 species of Heteroptera worldwide. These insects are important as natural members of the predatory fauna ([@bibr17]) and as biological control agents in many agroecosystems ([@bibr31]; [@bibr34]; [@bibr36] ). Two species of pirate bugs, *Orius insidiosus* (Say) and *Orius pumilio* (Champion), were found coexisting on an organic farm in north central Florida ([@bibr26]). Reports of both species have been made from Central America, Mexico, Jamaica, Cuba, and the United States ([@bibr08]; [@bibr16]; [@bibr09]; [@bibr07]; [@bibr26]). In the continental U.S., the range of *O. insidiosus* encompasses the areas east of the Rocky Mountains, north to Canada, and south to Florida. It is the most widespread species of *Orius* in the western hemisphere. The coexistence of *O. insidiosus* and *O. pumilio* in the United States has only been observed in Florida, where the northerly limit of *O. pumilio* appears to be Alachua County, Florida. The two species were found together during the spring on the flowers of two umbelliferous plants, false Queen Anne\'s lace (*Ammi majus* L.) and Queen Anne\'s lace (*Daucus carota* L.) (Apiales: Umbelliferae \[Apiaceae\]), where both pirate bugs apparently preyed on Florida flower thrips, *Frankliniella bispinosa* (Morgan) (Thysanoptera: Thripidae). Throughout the four weeks of study, the demographics for the two species differed markedly. The *O. insidiosus* population was heavily weighted toward males, with a sex ratio of 2.7 males: females ([@bibr26]), and the *O. insidiosus* outnumbered the *O. pumilio* population by 3.6-fold. These observations have led to questions about ecological niches, interspecific competition, and the potential for interspecific mating competition and sexual conflict between the two species.
Fundamental to understanding these interactions is a clear grasp of the taxonomic relationships between *O. insidiosus* and *O. pumilio*. Genital morphologies have conventionally served as key taxonomic characters for the Heteroptera in general and for the Anthocoridae in particular. The size, shape, and orientation of the copulatory tube in the female ([@bibr05]; [@bibr22]; [@bibr35]; [@bibr03]; [@bibr30]) and the shape of the paramere in the male ([@bibr23]; [@bibr09]; [@bibr22]) are used as diagnostic characters in identifying *Orius* species. In addition to genitalic morphologies, the appearance, coloration, and morphometrics of antennal segments, head, thorax, scent glands, and wings have all contributed to the taxonomic identity of genera and species (e.g. [@bibr09], [@bibr10]).
However, these conventional identifying characters do not assure certainty in discriminating interacting field populations of other anthocorids. For example, *Anthocoris antevolens* White (Heteroptera: Anthocoridae) has a broad range in North America. Comparison of specimens from various regions results in a high degree of morphological variability and uncertainty in differentiating them from the closely related species *Anthocoris musculus* (Say) ([@bibr12]; [@bibr13], [@bibr14], [@bibr15]). Because the morphologically different populations of *A. antevolens* are overlapping and sympatric with *A. musculus* populations, potential inter- and intraspecific matings among all these groups could occur. Indeed, laboratory trials showed that insemination can occur in certain heterospecific pairings ([@bibr13], [@bibr15]). Thus, the identity of these species was re-examined based on morphologies of various body parts and genitalia, and included examining the relatedness of mitochondrial DNA sequences. These investigators demonstrated that there was significant uncertainty in identifying any of the populations as a species especially when utilizing the current taxonomic keys.
With their widespread distributions, *Orius* species may also prove to be adapted and reproductively isolated as local and regional populations along with closely related species. In Japan, *Orius* species have been shown to be adapted latitudinally in their diapause characteristics perhaps reflecting their genetic relatedness and adaptations that have led to speciation ([@bibr18]; [@bibr19]; [@bibr29]). Whether other aspects of physiological and behavioral adaptation in anthocorids, both to changes in the physical environment and to pressures exerted by closely related species, result in divergence of populations and ultimately to speciation remains to be discovered.
In order to more reliably assess the relationship between these two species of *Orius*, the morphologies of male and female genitalia, the abilities to cross-mate and produce subsequent egg development, and comparisons of genomic sequence have been examined here. While both species had previously been reported to occur in Florida ([@bibr02]; [@bibr16]; [@bibr09]), only limited observations have been made for the two species in areas where they coexist; these observations included limited monitoring of populations over a period of weeks during the daylight hours in the spring of 2008 ([@bibr26]; unpublished data, 2009) in the flower heads of two species of Umbelliferae (*A. majus* and *D. carota*). A more detailed morphological and genetic description of the relationship between these two species in Florida may contribute to a discussion of interspecific convergence (or divergence) in genitalic morphology and gene sequences, and the potential significance of inter- and conspecific mating competition, sexual conflict, and competition for resources such as prey and pollen.
Materials and Methods {#sec2}
=====================
Insect colonies {#sec2a}
---------------
A colony of *O. insidiosus* was established from a field population collected in Alachua County, Florida in 2008 ([@bibr26]). A colony of *O. pumilio* was established in 2002 from insects collected in Bronson, Levy County, Florida, 18 miles southwest of the site from where the *O. insidiosus* population was collected ([@bibr26]). Subcolonies of 24 h egg collections from each species were set up from primary colonies, and insects were allowed to develop for 13--14 d before use.
Interspecific matings {#sec2b}
---------------------
From sub-colonies of each species, unsexed 5^th^ instar nymphs were individually isolated by species and allowed to molt to adults in microtiter plate wells. Adults were anaesthetized in place with CO2 0--2 d following the adult molt, sexed, and mating was initiated at day 0 in conspecific and heterospecific crosses. Each replicate consisted of 10 males and 10 females in a Petri dish (50 ×× 9-mm) covered with a nylonscreened (23-mm diameter, 0.2-mm sieve size) tight-fit lid, containing 0.2 g shredded parchment paper and 0.75 g of 5% sucrose Hydrocapsules (ARS Inc.). Each group was moved into a 0.6-L Mason jar for oviposition at day 7. Jars contained 1 green bean, 3.5 g buckwheat hulls, 1.0 g Hydrocapsules®®, and 0.1 g *Ephestia kuehniella* eggs. Every 2--3 days until day 21, eggs were counted, beans were replaced, and 0.15 ml *E. kuehniella* eggs were added. At day 18, surviving adults were counted and their species identities were noted. Oviposition was terminated at day 21. For yolk protein ELISA analysis, adult mating groups were set up and mated as above at day 0 and collected at day 6, survivors were counted, and 3 females were collected for each replicate and stored at -80°°C in a 2-ml microcentrifuge tube.
Scanning electron microscopy {#sec2c}
----------------------------
Terminal segments or isolated parameres were dissected from males anaesthetized with CO2 or preserved in 100% ethanol and then transferred into 20% KOH for 2 d at room temperature for clearing. Segments and parameres were transferred from KOH through H~2~O, 25%, 50%, and 100% ethanol in succession over \<1 hr, and stored in 100% ethanol. Segments or parameres were dried from ethanol and mounted with carbon adhesive tabs on aluminum stubs. Specimens were Au/Pd sputter-coated (Denton DeskII sputter coater, Denton Vacuum, [www.dentonvacuum.com](www.dentonvacuum.com)) and then examined with an S-4000 FE-SEM microscope (Hitachi, [www.hitachi-hta.com](www.hitachi-hta.com)). Digital images were acquired and analyzed with Quartz PCI v8 software (Quartz Imaging Corp., [www.qrtz.com](www.qrtz.com)). Ten specimens of each species were examined from multiple perspectives and magnifications.
Light microscopy {#sec2d}
----------------
The copulatory tubes of adult females were examined in seven specimens of *O. pumilio* and six specimens of *O. insidiosus* from the Gainesville laboratory cultures. In addition, the copulatory | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION {#sec1}
============
Invasive cytomegalovirus (CMV) disease is a well-recognized complication following solid organ transplant; however CMV is infrequently reported to cause significant small bowel pathology. Most commonly CMV manifests as a viral syndrome with fever and neutropenia, with common gastrointestinal manifestations including esophagitis, gastritis, colitis, or hepatitis \[[@ref1]\]. Further, the reported cases and series of CMV causing gastrointestinal stricturing are often reported in pediatric patient groups, generally with birth prematurity \[[@ref2], [@ref3]\]. Adult cases of CMV-associated stricture are unusual and have heretofore been reported only in those with acquired immune deficiency syndrome and severe immunodeficiency, but these reports highlight esophageal strictures due to CMV \[[@ref4], [@ref5]\]. To our knowledge, there are no reported instances of CMV-associated small intestinal stricture in a relatively immunocompetent adult.
CASE REPORT {#sec2}
===========
Our patient is a 69-year-old gentleman who underwent orthotopic liver transplant in April of 2010 for cryptogenic cirrhosis. His maintenance therapy consisted of rapamune due to chronic kidney disease but was transitioned to mycophenolate mofetil (MMF) monotherapy in 2014 and continued to have normal allograft function. In the spring of 2018, he developed CMV viremia; immunosuppression was held, and CMV therapy was initiated with valganciclovir. Within a month he had cleared the CMV viremia and was restarted on MMF for immunosuppression; however he proceeded to be readmitted to the hospital service approximately six times over the following 2 months for intolerance of solid foods. He was ultimately taken to surgery for lysis of adhesions, where a strictured segment of the ileum was identified 20 cm from the ileocecal value. Six centimeters of the small intestine were resected, and primary bowel anastomosis was performed. The mucosal surface was remarkable for a centrally located area of stricture with 60% luminal narrowing. Pathology of the resected segment showed no ischemic changes but ulcerations of the mucosa causing the stricture, with immunostaining positive for invasive CMV disease. The patient has subsequently had no recurrence of or readmittance for small bowel obstruction or food intolerance.
DISCUSSION {#sec3}
==========
CMV disease is a well-reported posttransplant infection, most frequently causing allograft hepatitis and infrequently causing biliary strictures \[[@ref6], [@ref7]\]. Stricturing manifestations of intestinal CMV disease more commonly present in term or preterm neonates \[[@ref2]\]. Series reporting episodes of CMV enteritis demonstrate about a 40% incidence of small intestinal disease, with the esophagus and colon compromising an equal percent of cases \[[@ref8]\]. To our knowledge, there is one report of CMV enteritis an adolescent liver transplant recipient, who presented with duodenal bleeding requiring pancreas preserving duodenectomy but no stricture \[[@ref9]\]. The reports of intestinal CMV infections in children emphasize that all patients had significant causes for immunodeficiency, such as HIV, prematurity, or age less than 6 months. There appears to be no other report in the literature of *adult* posttransplant patients suffering from CMV stricturing small bowel enteritis.
| {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION {#s1}
============
Breast cancer is the most frequently diagnosed cancer and the leading cause of cancer death among females worldwide \[[@R1]\]. Accumulating publications have reported that genetic factors play important roles in the pathogenesis of both sporadic and familial breast cancer \[[@R2]--[@R6]\]. Recent genome-wide association studies (GWASs) focusing on evaluating common single nucleotide polymorphisms (SNPs) have identified more than 70 genetic susceptibility loci for breast cancer \[[@R6]--[@R12]\]. However, these newly identified genetic factors, along with known high-penetrance breast cancer susceptibility genes, only explain a small portion of the heritability for this cancer \[[@R9]\].
The discovery of submicroscopic copy number variations (CNVs) present in our genomes has changed dramatically our perspective on DNA structural variation and disease. It is now thought that CNVs encompass more total nucleotides and arise more frequently than SNPs. CNVs may account for 13% of the human genome and have been supposed to explain some of the missing heritability for complex diseases after the findings from GWASs \[[@R13]--[@R16]\].
Recently a deletion in the APOBEC3 gene cluster was identified \[[@R17], [@R18]\]. This CNV is a deletion located between exon 5 of APOBEC3A and exon 8 of APOBEC3B, resulting in a fusion gene with a protein sequence identical to APOBEC3A, but with a 3'-UTR of APOBEC3B. It has been found that the deletion frequency was highly variable, rare in African and European populations (frequency of 0.9% and 6%, respectively), more common in East Asian and American populations (36.9% and 57.7%), and almost fixed in Oceanic populations (92.9%) \[[@R17]\]. Komatsu et al. first discovered an increased but statistically non-significant risk of breast cancer associated with APOBEC3 deletion in Japanese \[[@R19]\]. Then Long\'s study strongly indicated a positive correlation of APOBEC3 deletion with an elevated breast cancer risk in Chinese \[[@R20]\]. Later, Xuan\'s study in European and Rezaei\'s study in Iranian both showed the similar positive correlation with statistical power \[[@R21], [@R22]\]. However, the latest study by Göhler only revealed statistically non-significant results in Sweden and Marouf\'s study in Moroccans even indicated contrary results \[[@R23], [@R24]\]. As mentioned above, the results derived from current publications are inconclusive and even conflicting to each other, therefore we believe that it\'s necessary to perform a meta-analysis of available patient data to gain greater statistical power on this issue, with an expectation to obtain a pooled estimate much closer to the unknown truth and consequently to provide useful evidences and suggestions for early breast cancer screening and future investigation.
RESULTS {#s2}
=======
Study identification {#s2_1}
--------------------
For the process of eligible studies' identification and selection, 16 publications were initially retrieved from PubMed and Embase databases. After further screening according to the inclusion and exclusion criteria, 6 relevant reviews and 4 molecular mechanism research studies were excluded. Finally, a total of 6 case-control studies with 18241 subjects were identified to be eligible for this meta-analysis \[[@R19]--[@R24]\]. The main characteristics of included studies were summarized in Table [1](#T1){ref-type="table"}.
###### Characteristics of studies on association between APOBEC3 gene deletion and breast cancer
Author Year Area Ethnicity Sample size Source of Controls Cases Controls Genotyping Method *P* for HWE in controls Quality Score
--------- ------ --------- ----------- ------------- -------------------- ------- ---------- ------------------- ------------------------- --------------- ------ ----- ------------------------------------ ------ ---
Marouf 2016 Morocco Caucasian 226 200 PB 207 19 0 175 25 0 Real-time qualitative PCR (Taqman) 0.35 8
Göhler 2016 Sweden Caucasian 782 1559 PB 633 142 5 1295 251 13 KASPar or Life Technologies assays 0.83 8
Rezaei 2015 Iran Caucasian 262 217 PB 154 103 5 148 63 6 Real-time qualitative PCR 0.82 9
Xuan 2013 Europe Caucasian 1671 1602 PB 1275 376 20 1279 314 9 Real-time qualitative PCR 0.03 8
Long 2013 China Asian 5792 5830 PB 2045 2805 942 2530 2638 662 Real-time qualitative PCR 0.52 9
Komatsu 2008 Japan Asian 50 50 PB 22 21 7 21 23 2 Real-time qualitative PCR 0.16 8
PB, population-based; PCR, polymerase chain reaction; HWE, Hardy-Weinberg equilibrium.
Quantitative data analyses {#s2_2}
--------------------------
Finally, 6 epidemiological individual studies including 8783 cases and 9458 controls were enrolled in this meta-analysis. All studies reported detailed number of three genotypes Insertion/Insertion (I/I), Insertion/Deletion (I/D), Deletion/Deletion (D/D). To be comprehensive, the correlation of APOBEC3 CNVs with breast cancer risk was analyzed by five different comparison models: allele contrast, dominant, recessive, homozygous, and heterozygous.
Firstly, in the allele contrast model, the APOBEC3 deletion variation was found to be significantly correlated with a higher breast cancer risk compared with the no-deletion allele (D *vs* I: OR = 1.29, 95% CI = 1.23-1.36) (Figure [1A](#F1){ref-type="fig"}). For the ethnicity-specific subgroup analysis, the results indicated that both Asians and Caucasians with the APOBEC3 deletion allele possessed an increased breast cancer susceptibility. Summary of the ORs and 95% CIs for breast cancer risk and APOBEC3 deletion under different genetic models was shown in Table [2](#T2){ref-type="table"}.
{#F1}
###### ORs and 95% CI for breast cancer risk and APOBEC3 deletion under different genetic models
Genetic models n OR \[95% CI\] *P*~(OR)~ Model (method) *I*-square (%) *P* ~(H)~ *P* ~(Begg)~ *P* ~(Egger)~
------------------------------------ --- ---------------------- ----------- ---------------- ---------------- ----------- -------------- ---------------
Allele contrast (D *vs* I)
All 6 1.29 \[1.23 - 1.36\] \< 0.001 F (M-H) 36.4 0.164 0.260 0.115
Caucasian 4 1.18 \[1.05 - 1.32\] 0.005 F (M-H) 34.3 0.207 \- \-
Asian 2 1.32 \[1.25 - 1.39\] \< 0.001 F (M-H) 0.0 0.951 \- \-
Dominant model (D/D+I/D *vs* I/I)
All 6 1.34 \[1.26 - 1.43\] \< 0.001 F (M-H) 52.3 0.063 0.452 0.119
Caucasian 4 1.20 \[1.06 - 1.35\] 0.004 F (M-H) 45.0 0.141 \- \-
Asian 2 1.40 \[1.30 - 1.51\] \< 0.001 F (M-H) 0.0 0.508 \- \-
Recessive model (D/D *vs* I/D+I/I)
All 5 1.51 \[1.36 - 1.68\] \< 0.001 F (M-H) 22.5 0.271 1.000 0.809
Caucasian 3 1.26 \[0.74 - 2.15\] 0.389 F (M-H) 44.7 0.164 \- \-
Asian 2 1.52 \[1.37 - 1.69\] \< 0.001 F (M-H) 6.4 0.301 \- \-
Homozygous model (D/D *vs* I/I)
All 5 1.75 \[1.56 - 1.95\] \< 0.001 F (M-H) 17.2 | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
Amyloid aggregates formed by misfolded intrinsically disordered proteins are implicated in many diseases \[[@B1]\]. Here, we focus on human islet amyloid polypeptides (hIAPPs) that aggregate into parallel *β*-sheets upon the interaction with membrane surfaces \[[@B2]--[@B4]\]. The resulting aggregates are detrimental to pancreas *β*-cells, leading to the onset of type II diabetes \[[@B5]--[@B7]\], since they disrupt the membrane integrity \[[@B8]--[@B13]\], increasing the membrane permeability to water and ions \[[@B14]\]. Understanding surface-specific biomolecular interactions between hIAPP aggregates and lipid membranes at the molecular level is therefore crucial for revealing the molecular factors controlling amyloidogenesis.
Previous studies have relied mainly on bulk detection techniques, including circular dichroism (CD) \[[@B15]\], NMR \[[@B16]--[@B18]\], EPR \[[@B19], [@B20]\], 2D-IR \[[@B21]--[@B23]\], AIR-FTIR \[[@B24]--[@B26]\], fluorescence spectroscopy \[[@B27], [@B28]\], Raman spectroscopy \[[@B29]\], and infrared reflection absorption spectroscopy (IRRAS) \[[@B30], [@B31]\]. However, many specific questions concerning the interfacial region of interactions between membranes and proteins remain unclear. Some of the outstanding questions are as follows: Do the amyloid aggregates start forming at membrane surfaces, or in the bulk solution? How do the aggregates orient on membrane surfaces? Are the aggregation products parallel or antiparallel *β*-sheets? Does the orientation of the aggregate affect the integrity of cell membranes? What is the kinetics of misfolding at membrane surfaces? Is it different from misfolding in the bulk solution? Do molecular inhibitors affect aggregation on membrane surfaces? Recent developments in nonlinear sum frequency generation (SFG) vibrational spectroscopy have demonstrated SFG as an intrinsically surface-selective technique with submonolayer sensitivity and label-free detection capability, thus showing great promise to address the above questions, shedding light on the role of the membrane during the aggregation of hIAPP and other amyloid proteins \[[@B32], [@B33]\].
During the last three decades, we have witnessed the emergence and fast development of nonlinear optical spectroscopic techniques, among which SFG vibrational spectroscopy has gained tremendous attention. Unique advantages of SFG include surface selectivity, submonolayer sensitivity, chiral-selectivity, phase-sensitivity, and label-free detection capabilities \[[@B34]--[@B36]\], which make SFG a promising tool for structural characterization of interfaces, including a wide range of applications in material science \[[@B37]\], characterization of polymers \[[@B38], [@B39]\], and catalytic systems \[[@B40], [@B41]\]. Recently, applications have been extended to environmental \[[@B42]--[@B44]\] and biological systems \[[@B32], [@B33], [@B45]--[@B52]\] with unprecedented discoveries beyond the capabilities of conventional tools. For example, SFG has been used to study a variety of atmospherically significant systems at the vapor/aqueous interface to elucidate the organization and reactions in aerosols that contain inorganic/organic compounds \[[@B42]--[@B44]\], small molecules \[[@B42]\], and fatty acids \[[@B42]\] as solutes. Furthermore, SFG has been applied to probe the interfacial structures, orientation, and kinetics of biologically relevant molecules at interfaces, such as proteins \[[@B32], [@B33], [@B45]--[@B47]\], DNAs \[[@B48], [@B49]\], and lipids \[[@B45], [@B50]--[@B52]\], providing insights into the functions of these molecules at biological interfaces and facilitating further research into biomedical science and engineering. Nowadays, SFG is established as a valuable technique to understand physical, chemical, and biological processes at the molecular level \[[@B53]\]. In particular, applications to interfacial biological systems span across important research topics in membrane biophysics \[[@B54]\], surface self-assembly \[[@B55], [@B56]\], peptides at cell surfaces \[[@B57], [@B58]\], DNA hybridization \[[@B48], [@B59]\] and adsorption \[[@B60]\], and amyloid interactions with membrane surfaces \[[@B61]--[@B63]\].
This review focuses on the recent development and application of SFG for probing hIAPP interacting with lipid membranes and discusses the implications of hIAPP/membrane interactions in the studies of type II diabetes \[[@B14], [@B61], [@B62], [@B64], [@B65]\]. The review also summarizes the basic theoretical background and experimental methods of SFG, supplemented with a brief discussion about the application of SFG to other amyloidogenic proteins, and concludes with an outlook of SFG in applications to systems of interest in biological and medical sciences.
2. The SFG Method {#sec2}
=================
2.1. Basic Principles of SFG {#sec2.1}
----------------------------
Sum frequency generation (SFG) vibrational spectroscopy applies two laser beams that interact with the system of interest simultaneously \[[@B34]--[@B36], [@B66]--[@B69]\], one with visible (e.g., 532 nm) or near-infrared (e.g., 800 nm) frequency *ω* ~vis~ and the other with infrared (IR) frequency *ω* ~IR~ ([Scheme 1](#sch1){ref-type="fig"}). When the visible and infrared pulses overlap in time and space, light with the sum of the two frequencies *ω* ~SFG~ = *ω* ~vis~ + *ω* ~IR~ is generated by the interaction of the incident beams with the system at the interface. Fixing *ω* ~vis~ and scanning or dispersing IR frequencies *ω* ~IR~ over a range, the SFG spectra are recorded by monitoring the SFG intensity as a function of *ω* ~SFG~ with a monochromator and a CCD. The SFG signal is dramatically enhanced when *ω* ~IR~ is in resonance with a vibrational frequency of a molecule at an interface, thus showing a peak in the spectrum. The SFG peaks typically exhibit homogeneous and inhomogeneous broadening, leading to various line-shapes due to the constructive or destructive interference with neighboring bands modulated by changes in the molecular orientation as induced by interactions with the surface and the surrounding environment \[[@B70]\]. Thus, the SFG spectra contain detailed structural information reported in terms of line-shape, peak position, and polarization dependence. Extracting that structural information from the SFG spectra, however, requires rigorous theoretical modeling and computer simulations. Hence, the combination of SFG and computational modeling can be used as a label-free and*in situ* analytical methodology for effective characterization of systems at interfaces. In the following sections, we will illustrate the applications of SFG to the studies of IAPP at membrane surfaces \[[@B14], [@B61], [@B62], [@B64], [@B65]\].
2.2. Surface-Specificity, Monolayer Sensitivity, and Polarization Dependence of SFG Spectroscopy {#sec2.2}
------------------------------------------------------------------------------------------------
As a nonlinear optical technique, SFG measures the second-order susceptibility, *χ* ^(2)^, that gives intrinsic surface selectivity \[[@B33], [@B34], [@B71]--[@B74]\]. The second-order susceptibility, *χ* ^(2)^, is the direct product of the complex conjugate of the Raman polarizability derivative matrix (the same as the original matrix when derivative values are real numbers) and the IR dipole derivative vector and thus is a second-order tensor. The generated electric field of SFG signal is related to the electric field of the two incident laser beams, *E* ~vis~ and *E* ~IR~, via the tensor elements *χ* ~*ijk*~ ^(2)^:$$\begin{matrix}
{E_{\text{SFG}}^{i} \propto {\sum\limits_{j,k}{\chi_{ijk}^{(2)}E_{\text{vis}}^{j}E_{\text{IR}}^{k}}},} \\
\end{matrix}$$where *i*, *j*, and *k* specify the direction of the Cartesian component of the optical fields and can be denoted by *x*, *y*, and *z*, in the laboratory coordinates.
The tensor elements of bulk phases with inversion symmetry (e.g., gas, solution, and amorphous solid) are isotropically averaged to zero, so long as the frequency of the visible beam is not in resonance with an electronic excitation \[[@B33], [@B73], [@B74]\]. This is because molecules rotate freely and diffuse, adopting random orientations. In contrast, molecules at surfaces give prominent SFG signals since they have ordered alignment across the surface region, and thereby their tensor elements are nonzero. Furthermore, the second-order susceptibility is proportional to the square of the molecular density at surfaces and thus is sensitive to the change of molecular coverage, enabling SFG to detect a monolayer of molecules at an interface. The monolayer sensitivity is critical for the characterization of biological samples that are difficult to purify in large quantities. As a result of such unique surface-specificity and monolayer sensitivity, the SFG method is free from contributions of the bulk medium and is thus an ideal optical method to probe membrane surfaces and their interactions with other biomolecules.
SFG spectroscopy has the intrinsic sensitivity to chiral structures because the measured second-order susceptibility tensor elements *χ* ~*ijk*~ ^(2)^ are three-dimensional. When the three indices *i*, *j*, and *k* are distinct from one another (i.e., *i* ≠ *j* ≠ *k*), the susceptibility tensor captures the features of the chiral Cartesian coordinate system with three distinct axes and thus comprises information about the chirality at interfaces \[[@B33]\]. Therefore, surface chirality can be directly measured through *χ* ~*ijk* (*i*≠*j*≠* | {
"pile_set_name": "PubMed Central"
} |
**Core tip:** Always review a peripheral blood film in all cases of multiple myeloma and be aware of an entity called plasma cell leukemia, a rare and aggressive form of leukemia.
INTRODUCTION
============
Primary plasma cell leukemia (pPCL) is a malignant plasma cell disorder characterized by the presence of 2 × 10^9^/μL peripheral blood clonal plasma cells or \> 20% plasma cells in the peripheral blood. It is very rare, accounting for 0.6%-4% of all plasma cell neoplasms, and is reported to occur in \< 1 in a million. PCL has a relatively poor prognosis, due to its very aggressive nature involving extramedullary organs, lytic bone lesions, destruction of red blood cells, and bone marrow failure. Treatment includes immunomodulators, proteasome inhibitors, and autologous stem cell transplantation. Outcomes are not promising, however, even after treatment; median survival after rigorous chemotherapy and transplant is not more than three years\[[@B1]\]. It is important to consider PCL as a possible diagnosis as well as multiple myeloma (MM), whenever we encounter the typical constellation of "Hypercalcemia, Renal Failure, Anemia, and Lytic Bone lesions", and to contemplate the peripheral smear, a basic test, which, in our case study, showed \> 20% plasma cells, hence leading to the diagnosis of PCL.
CASE PRESENTATION
=================
Chief complaints
----------------
A 56-year-old male with a history of hypertension was referred to the hospital by his primary care physician after a routine, yearly laboratory exam showed abnormal hemoglobin of 5.1 mg/dL.
History of present illness
--------------------------
The patient complained of some pain in the left flank area, which started around four months prior to admission.
History of past illness
-----------------------
He denied any history of smoking and did not have any significant family history.
Physical examination
--------------------
On admission, his vital signs were stable and physical exam was completely benign.
Laboratory examination
----------------------
His laboratory evaluation revealed hemoglobin of 5.1 mg/dL, white blood cell count 6.6 × 10^9^/μL with 16% atypical lymphocytes, and platelet count of 51000/μL. Chemistries were significant for a sodium of 125 meq/L, creatinine of 2.79 mg/dL, calcium of 8.3 mg/dL, and normal liver enzymes with a total bilirubin of 3.1 mg/dL. Total protein was 15.3 g/dL.
Imaging examination
-------------------
A Computed tomography (CT) scan was ordered to evaluate the left flank pain, which showed a lytic lesion at T11 (11^th^ thoracic vertebra), right anterior 7^th^ rib with a pathological fracture, and multiple small lucencies in the vertebrae.
Further diagnostic work-up
--------------------------
Peripheral smear showed more than 10%-15% plasma cells (Figure [1](#F1){ref-type="fig"}), and flow cytometry of peripheral blood confirmed PCL with 24% plasma cells (CD138+). Serum protein electrophoresis showed a kappa/lambda ratio of 43 and a monoclonal spike of 8.44 g/dL in the IgG kappa region on immunofixation. Beta-2 microglobulin was also high at 19 μg/mL. A 24-h urine collection showed a total protein of 1557 mg and urine protein electrophoresis (UPEP) showed two spikes of 15 g/dL (IgG kappa) and 2 g/dL (free kappa). Bone marrow biopsy (Figure [2A](#F2){ref-type="fig"} and B) demonstrated 80% plasma cells (38+, 138+, 117+, 10-, 19-, 20-, 56-) with 90% cellularity. Fluorescence in situ hybridization (FISH) and chromosome analysis showed 13q deletion among many other aberrancies.
{#F1}
{#F2}
FINAL DIAGNOSIS
===============
pPCL.
TREATMENT
=========
VCD therapy was started \[cytoxan (750 mg/m^2^), velcade (0.7 mg/m^2^ on day 1, 4, 8, 11) with dexamethasone (40 mg)\]. The patient received a total of five units of blood transfused during his 15-d hospital stay. After completing therapy at 1, 4, 8, and 11 days, the patient was discharged home.
OUTCOME AND FOLLOW-UP
=====================
The patient responded well to chemotherapy and on discharge he was being considered for bone marrow transplant evaluation within two months.
DISCUSSION
==========
PCL is established by the presence of \> 20% circulating plasma cells or an absolute plasma cell count \> 2 × 10^9^/L on peripheral smear. It is a very uncommon and aggressive form of monoclonal gammopathy characterized by a poor prognosis with a rapidly fatal outcome. Complications usually lead to death within the first few months of diagnosis. Outcome is thought to be poor because of the absence of effective treatment for this condition\[[@B1]\]. PCL is classified as "primary" (occurring de novo), or "secondary" (occurring in patients with MM).
There are a few differences between these two disease processes. Patients with PCL are usually younger (aged 50-59 years). PCL has a predisposition to develop malignant plasma cells, which circulate in peripheral blood and lead to extramedullary spread involving the liver, spleen, lymph nodes, pleura, peritoneum, and less often the bone, resulting in lytic lesions. The extramedullary spread is explained by negative CD56, a cell adhesion molecule which anchors plasma cells to the bone marrow stroma in contrast to MM, where most of the plasma cell population is found in bone marrow\[[@B2]\]. Hypercalcemia, low platelet count, and destruction of erythrocytes is found in both diseases, but it is more pronounced in PCL than in MM. PCL differs in biology compared to MM with more immature cells in the bone marrow. Most PCL patients have abnormal karyotypes. The FISH probes should be directed against genetic abnormalities, such as del(17p13), del(13q), del(1p21), and (1q21) amplification, and chromosome 14 abnormalities, such as t(11;14), t(4;14), t(14;20) and t(14;16). About 87% of the PCL cases can be attributed to IGH (14q32) translocation, which is hence the most common mutation, followed by t(11;14), which accounts for 25%-65%. In our patient, however, 13q deletion was observed, which is seen in \< 20% of patients\[[@B3],[@B4]\]. Plasma cell markers, which can be identified in PCL on immunophenotyping, include CD38 and CD138, which were both present in our patient. Flow cytometry should be performed on peripheral blood to confirm the presence of plasma cells that typically have immunophenotypes of CD138+, CD38+, CD19--, and CD45+/--. Our finding of negative expression of CD10, CD19, CD20, CD56 was consistent with previously published cases\[[@B5],[@B6]\].
Patients having pPCL must undergo a detailed history and physical examination. A comprehensive laboratory evaluation of their blood should be performed, including a complete blood count with differential, peripheral blood smear, electrolyte panel, urea and creatinine levels, liver enzymes, bilirubin, lactate dehydrogenase, uric acid, β2 microglobulin, albumin, serum protein electrophoresis, and serum free light chain analysis. Chest X-ray along with whole body imaging with either MRI or CT should be performed to look for metastasis. Sometimes 18F-FDG PET/CT imaging to look for both lytic bone lesions and extramedullary plasmacytomas is necessary. A 24-h urine collection for electrophoresis and total protein assessment should also be obtained. Finally, it is imperative to perform a bone marrow biopsy and aspiration to assess morphology, proliferation rate, immunophenotyping, and cytogenetic analysis by FISH\[[@B7]\].
Managing patients with PCL requires an intensive risk-adapted approach. Induction therapy with novel triplet therapy using immunomodulators and proteasome inhibitors such as VRd (bortezomib, lenalidomide, and dexamethasone) or KRd (carfilzomib, lenalidomide, and dexamethasone), is usually a satisfactory choice. In some patients with pPCL who have an aggressive form of disease, more aggressive combination regimen, such as VDT-PACE (bortezomib, dexamethasone, thalidomide or lenalidomide, cisplatin, doxorubicin, cyclophosphamide, and etoposide) or HyperCVAD (High dose Cyclophosphamide, vincristine, adriamycin and thalidomide or lenalidomide) should be used, because cyclophosphamide and doxorubicin are particularly effective in proliferative disease. For elderly patients who may not be able to tolerate such an intense regimen, CyBorD (cyclophosphamide, bortezomib, and dexamethasone) or PAD (bortezomib, doxorubicin, and dexa-methasone) can be used as a milder alternative\[[@B8]\].
After induction | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION {#sec1-1}
============
Post pandemic 2009 H1N1 viral infection, multiple small epidemic outbreaks have been reported worldwide.\[[@ref1]\] Mortality up to 45% among patients admitted to intensive care units (ICUs) has been reported in a recent epidemic.\[[@ref2][@ref3]\] The main cause of death in patients with pneumonia caused by H1N1 viral infection is multiorgan failure secondary to hypoxemia because of acute respiratory distress syndrome (ARDS) and secondary bacterial infection.\[[@ref4][@ref5]\] As with other causes of ARDS, management of H1N1 viral infection ARDS is focused on lung protective ventilation (LPV) strategies, but despite that mortality remains high.\[[@ref6]\] Other measures to improve survival include prone position ventilation (PPV) and extracorporeal membrane oxygenation (ECMO); although enough evidences showed that PPV reduces mortality (16%) compared to supine position ventilation (32.8%),\[[@ref2][@ref7][@ref8]\] there are underutilization of this strategy, which is found in recent trials.\[[@ref5][@ref9]\] In addition, there is scarcity of literature on the use of prone ventilation in H1N1 ARDS patients.\[[@ref10][@ref11][@ref12]\] We studied the effect of prone ventilation in severe ARDS patients admitted with the diagnosis of H1N1 during an epidemic in the winter months of 2014--2015 in a southern state of India.
METHODS {#sec1-2}
=======
This study was conducted at a tertiary health-care center in southern part of India. All patients admitted to medical ICU with H1N1 viral pneumonia having severe ARDS requiring prone ventilation as a rescue therapy for severe hypoxemia were reviewed prospectively. Polymerase chain reaction-confirmed H1N1 was included in this series. ARDS was defined as per the Berlin definition.\[[@ref13]\] Patients with cardiogenic pulmonary edema and spinal instability were excluded from the study. All the included patients were studied while sedated with fentanyl and midazolam and paralyzed with atracurium. The ventilatory settings were set as per the treating physician. Positive end-expiratory pressure (PEEP) and FiO~2~ were adjusted according to the PEEP-FiO~2~ table of ARDSnet trial.\[[@ref6]\] Measurements were obtained in supine (baseline) and PPV, after 30--60 min and then 4--6 hourly. The patients were considered to turn prone if PaO~2~/FiO~2~ ratio was \<100 cmH~2~O and PaCO~2~ was \>45 cmH~2~O. Patients were classified as nonresponders if the PaO~2~/FiO~2~ ratio does not increase by \>20% and PaCO~2~ decrease by 6 cmH~2~O. In PPV, if no progressive improvement was seen in PaO~2~/FiO~2~ and PaCO~2~ over a period of 4 h, then the patients were considered to turn supine. In this descriptive study, parametric and nonparametric data were presented as means (standard deviation) and medians, respectively.
RESULTS {#sec1-3}
=======
Between September 1, 2014, and March 15, 2015, 93 patients were treated for H1N1 viral pneumonia. Of these, 11 adult patients developed severe ARDS which did not responded to lung-protective ventilator strategies and were ventilated in prone position \[[Table 1](#T1){ref-type="table"}\]. Their age range was 26--59 years (median: 48), with four patients under the age of 40 years. Seven patients were female, including one postpartum. All presented with fever, cough, and dyspnea for 4--12 days. The number of days from symptom onset to invasive ventilation ranged from 7 to 12 days (median: 8). Five patients had comorbid illness, the common being morbid obesity and diabetes mellitus. On the day of ICU admission, the median Acute Physiological and Chronic Health Evaluation-II and Sequential Organ Failure Assessment scores were 20 (range: 16--27) and 7 (range: 5--12), respectively. Noninvasive ventilation trial was given in eight patients before invasive ventilation, out of which two required invasive ventilation within 12 h and the rest in 48 h. The worst PaO~2~/FiO~2~ ratio range on the day of invasive ventilation was 48--100 (median: 79). Out of 11 patients, PPV was started within 24 h in 8 patients and within 48 h in 3 patients. Preprone, ventilator, and blood gas parameters are summarized in [Table 2](#T2){ref-type="table"}; the response of PaO~2~/FiO~2~ ratio to prone ventilation is shown in [Figure 1](#F1){ref-type="fig"}. Four patients had cardiac dysfunction, with one having viral myocarditis (global hypokinesia ejection fraction of 23%), and three patients had pulmonary arterial hypertension with acute right heart failure. A total of 39 PPV sessions were done, with a range of 1--8 prone sessions per patient (median: 3). A total of 580 h of prone ventilation was done with an average of 14 h 52 min/session (range: 8--24) of prone ventilation. Out of the 39 PPV sessions, PaO~2~/FiO~2~ ratio and PaCO~2~ responder were 38 (97.4%) and 27 (69.2%) sessions, respectively.
######
Demographic and clinical characteristic of patients
Patient number Age Gender Comorbid At ICU admission Days of illness before invasive ventilation Severity of ARDS: PaO~2~/FiO~2~ ratio on the day of prone ventilation Intubation to prone ventilation in days Number of prone ventilation sessions MV days ICU days Outcome at discharge
---------------- ----- -------- -------------------------------- ------------------ --------------------------------------------- ----------------------------------------------------------------------- ----------------------------------------- -------------------------------------- --------- ---------- ---------------------- ----------
1 48 Female \- 27 12 8 55 1 4 12 16 Survived
2 55 Female \- 22 7 8 100 2 5 15 19 Survived
3 40 Female DM 20 8 8 57 0 3 14 15 Survived
4 59 Female HTN, COPD 18 5 8 79 1 5 19 22 Survived
5 52 Male \- 19 10 7 75 2 8 16 21 Survived
6 52 Male CKD, Ca tongue on chemotherapy 24 10 8 73 1 3 9 10 Died
7 35 Male \- 19 5 12 79 1 2 7 9 Survived
8 44 Female DM, morbid obesity 22 7 9 90 2 4 22 26 Survived
9 26 Female \- 16 6 9 90 1 2 12 14 Survived
10 54 Male Morbid obesity 23 10 11 48 0 1 3 3 Died
11 26 Female Postpartum 16 6 8 82 1 2 9 12 Survived
APACHE-II score: Acute Physiological and Chronic Health Evaluation score, SOFA score: Sequential Organ Failure Assessment score, ARDS: Acute respiratory distress syndrome, PaO2/FiO~2~: Partial pressure of oxygen in arterial blood/fractional inspired oxygen concentration, MV: Minute ventilation, ICU: Intensive care unit, DM: Diabetes mellitus, HTN: Hypertension, COPD: Chronic obstructive pulmonary disease, CKD: Chronic kidney disease, Ca: Carcinoma
######
Ventilator parameters and blood gases before the first prone session
Patient number PBW Preprone ventilator parameters
---------------- ----- -------------------------------- ----- ---- ---- ---- ---- ----- ------ ------
1 58 90 62 49 12 31 18 360 3.5 10.6
2 60 80 48 58 14 32 16 360 3.75 12
3 52 80 57 38 12 31 18 320 3.5 10
4 56 70 100 56 11 30 28 340 3 13
5 70 80 75 38 14 31 22 420 3 11.8
6 62 70 52 40 12 31 22 370 3 10.6
7 68 65 80 57 14 32 20 400 3 10.2
8 56 80 70 49 14 32 14 340 3 12.4
9 52 75 90 40 12 30 19 320 2.5 10.2
10 60 | {
"pile_set_name": "PubMed Central"
} |
Background
==========
MicroRNAs (miRNAs) are endogenous \~22 nt RNAs that can play important regulatory roles in a variety of biological processes. They are genome-encoded, endogenous negative regulators of translation and mRNA stability originating from long primary transcripts with local hairpin structures \[[@B1]\]. Conserved seed pairing indicates that over one third of human genes appear to be conserved miRNA targets \[[@B2]\]. MiRNAs are involved in cell proliferation, intercellular signaling, cell growth, cell death \[[@B3],[@B4]\], cellular differentiation, apoptosis \[[@B5]\] and cellular metabolism \[[@B6],[@B7]\]. Meanwhile they have emerged as key post-transcriptional regulators of gene expression, and their dysregulation may lead to abnormal gene expression, which is associated to human diseases such as cancer. For example, miR-378\* (expressed from the 3\'-arm), which mediates metabolic shift in breast cancer cells, leading to a reduction in tricarboxylic acid cycle gene expression and oxygen consumption as well as an increase in lactate production, via the PGC-1β/ERRγ transcriptional pathway \[[@B8]\].
Recent studies have shown that miRNAs play important roles in energy metabolism, including glucose and lipid metabolism and amino acid biogenesis \[[@B9]\] (Table [1](#T1){ref-type="table"}). Besides, miRNAs are also able to recognize and modulate metabolic factors in transcriptional levels, relevant both in non-neoplastic and in cancer cells \[[@B10]\]. The altered metabolism of tumor cells may be a potential means to evade programmed cell death in order to favor survival and growth. The best characterized metabolic phenotype observed in tumor cells is the Warburg effect, in which the deregulation of miRNAs contributes to high glycolysis \[[@B11],[@B12]\].
######
Summary of miRNA regulation in energy metabolism
**miRNA** **Tissue / cell lines** **miRNA functions** **Target gene/Pathway** **Reference**
-------------- ------------------------------------------------------------------- --------------------------------------------------------------------------------------------------------------- -------------------------------------- ---------------------
miR-103/107 obese mice: ob/ob mice and diet-induced-obese (DIO) C57BL/6J mice regulate insulin sensitivity caveolin-1 41
miR-122 primary mouse hepatocytes and AML12 regulator of cholesterol and fatty-acid metabolism 23,26,38,49,5054,60
miR-133 293FT cells decreased GLUT4 expression and reduced insulin-mediated glucose uptake in cardio myocytes 31,34
miR-14 *Drosophila* regulate fat metabolism 36
miR-143 liver of obese mouse models impairs insulin-stimulated AKT activation and glucose homeostasis *Orp8* / *Akt* pathway 12,26,35,36, 37,91
miR-146 diabetic db/db mice islets / MIN6B1 cells cell death *Irak1* &*Traf6*/ AP-1 pathway 52
miR-15a/16-1 leukemic cell line model (MEG-01) and in primary CLL samples directly or indirectly affect apoptosis and cell cycle *MCL1, BCL2, ETS1,or JUN* 27
miR-195-5p bladder cancer T24 cells inhibited cell growth and promoted cell apoptosis through suppression of GLUT3 expression 25
miR-210 human pulmonary arterial endothelial cells (HPAECs) cellular metabolism and adaptation to cellular stress *ISCU1/2* 42
miR-23a/b human P-493 B cells regulate expression of glutaminase and glutamine metabolism *c-Myc* 6
miR-277 *D. melanogaster* a metabolic switch controlling amino acid catabolism 61
miR-27a 3T3-L1 suppress adipocyte differentiation PPARγ 51
Male C57BL/6J mice and 3T3-L1 cells a negative regulator of adipocyte differentiation
miR-29b human kidney cells (HEK293) control metabolic pathway of amino acid catabolism mRNA for DBT 62
miR-335 liver of obese mouse affects adipocyte differentiation and lipid accumulation *PPAR*γ &*aP2* 53
miR-33a/b mouse peritoneal macrophages regulate both HDL biogenesis in the liver and cellular cholesterol efflux ABCA1 58
miR-34a diabetic db/db mice islets / MIN6B1 cells sensitization to apoptosis and impaired nutrient-induced secretion *BclII* / p53 pathway 52,68
miR-370 liver of mouse affects lipid metabolism *Cpt1*α 54
miR-375 pancreatic endocrine cells (MIN6 cells) suppressed glucose-induced insulin secretion *Mtpn* 45,76
miR-378 NMuMG cells and NT2196 reduce tricarboxylic acid cycle gene expression and oxygen consumption as well as increase lactate production ERRγ and GABPA 8
INS-1E cells/primary rat islets decreased glucose-stimulatory action on insulin gene expression and DNA synthesis
Cell growth *Eef1e1* 76
cell growth *Cadm1* 76
negatively regulate cellular growth and proliferation *C1qbp* 76
regulate cell cycle and cellular proliferation *Cav1* / p53 pathway or MAPK pathway 76,79
angiogenesis and cell proliferation *Id3* / VEGF pathway or MAPK pathway 76,79
regulate cell growth/survival *Rasd1 / Ras* pathway 76,81
cell-cell signaling *Rgs16* 76
mitochondrial morphology and cristae structure, cell survival and death *Aifm1* 76
negative regulation of proliferative activity *HuD* 76,83
MiRNAs participate in controlling cancer cell metabolism by regulating the expression of genes whose protein products either directly regulate metabolic machinery or indirectly modulate the expression of metabolic enzymes, serving as master regulators. Generally, miRNA signatures may distinguish physiological, pathologic from cancerous states, which could be useful biomarkers in targeted therapeutic-diagnostics for cancer. Therefore, this review will focus on discussing the important roles of miRNA expression and deregulation in the altered metabolism in cancer cells.
MiRNAs involved in cancer cell metabolism
-----------------------------------------
The biogenesis of miRNAs is tightly associated with their action mechanism (Figure [1](#F1){ref-type="fig"}). Most miRNAs derived from independent transcription units \[[@B13],[@B14]\] and are encoded by a bewildering array of genes. Their transcription is typically performed by RNA polymerase II, with transcripts capped and polyadenylated. The resulting primary or pri-miRNA transcript extends both 5' and 3' from the miRNA sequence. The sequential processing reaction excises the stem-loop from the remainder of the transcript to create a pre-miRNA product, which occurs in the nucleus and is mostly carried out by a nuclear member of the RNase III family (Drosha). The following step excises the terminal loop from the pre-miRNA stem to create a mature miRNA duplex of approximately 22 bp length, which is carried out by the canonical Dicer enzyme in the cytoplasm. Either of the strands becomes stably associated with RNA-induced silenced complex (RISC), which can be called miRISC complex \[[@B15],[@B16]\]. The miRISC complex acts as a regulator of target gene by specially recognizing and regulating particular mRNAs to inhibit target genes \[[@B17]\].
{#F1}
A shift in glucose metabolism from oxidative phosphorylation to aerobic glycolysis was a key biochemical hallmark of tumor cells | {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
In recent years, there has been intense research on the microscopic interactions of energetic radiation with organic and biological relevant molecules. An important motivation is the application of radiation in medical treatment like radiation therapy and the desire to understand the underlying mechanisms and possibly to improve its effectiveness^[@CR1]^. The primary X-rays or swift charged particles, while penetrating biological tissue, produce large numbers of secondary electrons that in turn cause cellular damage either directly via ionization or indirectly by producing radicals such as OH in the aqueous environment^[@CR2]--[@CR5]^. To get insight into the reaction mechanisms, on one hand, gas-phase experiments were conducted on building blocks of macro-molecules such as DNA or proteins, where bulk effects do not mask the intrinsic molecular properties. On the other hand, one has to recognize the influence of the natural environment on biomolecules, in particular through hydrogen bonding, which can modify their structure and functionality. Examples are the hydrogen bonds between DNA base pairs linking both strands and the structural water molecules, which are hydrogen-bonded to the DNA with roughly 22 hydration sites per base pair^[@CR6]^.
Consequently, a number of studies on pure and nano-hydrated biomolecular clusters have been performed using different mass spectrometric techniques for both cations and anions^[@CR7]--[@CR16]^. The effect of solvation on the fragmentation of biomolecules after collisions with various projectiles was studied by measuring the yields of different fragment ions. A general observation was that although monomer ionization results in a large number of fragmentation channels for larger clusters, essentially only cations with integer number of intact molecules were found in the mass spectra. It was concluded that the environment has an overall "protective" effect on the systems and that the cluster environment acts as a buffer that rapidly redistributes excess energy, leading to suppression of molecular dissociation in clusters. On the other hand, for the smallest clusters, i.e., for dimers and trimers, some new molecular fragment species can be identified in the mass spectra, which are not consistent with the aforementioned protection effect^[@CR9]--[@CR12]^. The authors did not discuss or clarify the formation mechanisms of these species. Therefore, in the present study we go beyond pure fragment mass measurements and identify the initial ionized states from which the fragmentation process starts. This information accompanied by high-level quantum-chemistry calculations gives insight into the molecular geometry evolution and intermediate transition states (TS), which must be overcome.
We investigate the electron-collision-induced ionization and dissociation processes in clusters consisting of water and tetrahydrofuran (THF). Here, the THF (C~4~H~8~O) molecule is considered as a molecular analog of the deoxyribose sugar-ring in the DNA backbone (see Fig. [1a](#Fig1){ref-type="fig"}). It provides a simple model to probe possible mechanisms of electron-induced deoxyribose decomposition^[@CR17]--[@CR19]^. Water (H~2~O) is the predominant medium in which biological chemistry takes place^[@CR20]^. An accurate description of the energetic and structural aspects of the interaction of water with biomolecules is essential for a better understanding of their functions in biological processes^[@CR21]--[@CR28]^. The present study aims to understand how the reaction properties of the isolated THF molecule are affected when a water or second THF molecule is attached to it via hydrogen bonding, to mimic a chemical environment. We elucidate the electron-driven fragmentation dynamics of hydrated and pure THF clusters, i.e., H~2~O·THF and THF·THF dimers (Fig. [1b, c](#Fig1){ref-type="fig"}) in comparison with the isolated THF molecule.Fig. 1Chemical structure of the studied systems and schematic of the ring-break process.**a** A section of DNA containing the four bases and the sugar-phosphate backbone. **b**, **c** Chemical structure of H~2~O·THF (**b**) and THF·THF (**c**) dimers for the hydrated and pure THF model systems. **d** Schematic of the electron-induced ionization and ring-break process in the H~2~O·THF dimer. Here ionization of THF initiates significant rearrangement of the dimer structure resulting in THF ring opening and finally in THF ring-break. In **b**, **c**, **d** the white, gray, and red balls represent to hydrogen, carbon, and oxygen atoms, respectively. In **d**, the green balls labeled e~1~ and e~2~, and the green lines indicate electrons and their trajectories, respectively.
Experiments were carried out using a multi-particle (electrons plus ions) imaging spectrometer with a supersonic gas jet target and a pulsed low-energy electron beam^[@CR29],[@CR30]^. The projectile energy of 65 eV was chosen close to the mean energy of secondary electrons produced by high-energy primary radiation in a condensed medium such as water^[@CR4]^. We find that the removal of an electron from the highest occupied molecular orbital (HOMO), which leads to a stable parent ion for the THF monomer, for the dimer initiates a THF ring-break reaction. Our ab-initio calculations show that THF ring-break after HOMO ionization requires geometrical changes via several TSs, including those requiring structural rearrangement like ring-opening and proton transfer (PT). The highest barrier to overcome is a C--C bond-break for the ring-opening. For the THF molecule embedded in a THF·THF or H~2~O·THF dimer, the energy of the respective TS is reduced in comparison with the isolated THF molecule. This reduced barrier can activate ring-break for the dimers, while this channel is closed in the isolated THF molecule. In addition, PT takes place during the molecular relaxation, which releases some amount of internal energy to the system. As a consequence, the cluster cation finally dissociates, i.e., H~2~O·THF^+^ → H~2~O·C~2~H~4~O^+^ + C~2~H~4~, (see in Fig. [1d](#Fig1){ref-type="fig"}). These observations reveal a so-far unnoticed role of the water environment in enhancing the ring-break of the THF molecule after ionization of the HOMO. It can be inferred that noncovalent hydrogen bonding can considerably weaken the covalent bonds in a neighboring molecule. This can be important for a better understanding of the reaction mechanisms concerning ionizing radiation in biological matter^[@CR3],[@CR5]^.
Results {#Sec2}
=======
Sample composition and characterization of reaction products {#Sec3}
------------------------------------------------------------
In our experiments, two kinds of gas jet targets were employed, a pure THF jet containing about 10--15% dimers THF·THF and a mixed THF water jet with about 4% THF dimers and 4% H~2~O·THF dimers. The abundance of larger clusters goes down by a factor of roughly 5 for each additional molecule (these numbers are discussed in Methods). Therefore, most of the ionizing collisions concern monomers and the identification of dimer ionization processes is according to the characteristic mass of the ionic fragment species. For each ionizing collision, the ion and the two outgoing electrons are detected in coincidence. During offline analysis, the mass-over-charge ratios, the momentum vectors and the kinetic energies for all three charged particles are determined (see Methods). In case there is not more than one neutral fragment, its momentum can also be reconstructed from the measured momenta and momentum conservation, and the measurement is kinematically complete. We deduce the correlation of the ionic fragment species with the ionized electron's binding energy (BE) from which the ionized orbital is identified. Here, the BE *E*~*b*~ is determined as the initial projectile energy *E*~0~ minus the sum energy of the two final state electrons *E*~1~ + *E*~2~, i.e., *E*~*b*~ = *E*~0~ − (*E*~1~ + *E*~2~). *E*~*b*~ constitutes the vertical transition energy between the electronic ground state and an ionized state of the molecule.
Fragment mass spectra for monomers and clusters {#Sec4}
-----------------------------------------------
The measured mass spectra of pure and hydrated THF clusters are presented in Fig. [2](#Fig2){ref-type="fig"} in the range from 10 to 150 u (atomic mass units). The spectra are normalized at mass 72 u corresponding to the intact C~4~H~8~O^+^ cation. Hydrogen abstraction from THF monomers gives rise to C~4~H~7~O^+^. Ring-break reactions in THF monomers yield the ions C~2~H~*n*~^+^, C~3~H~*n*~^+^, and C~2~H~*n*~O^+^ assigned in Fig. [2](#Fig2){ref-type="fig"}. The fragmentation of the THF ion was studied before by us and other groups^[@CR12],[@CR31]^. Briefly, ionization of the HOMO gives rise to a stable parent ion while hydrogen abstraction occurs for HOMO-1 ionization which is 1.5 eV above the ionic ground state. The behavior of the ring-break channels complies with an unimolecular statistical decay: electronically excited states produced by ionization of inner orbitals quickly evolve to the ionic ground state (internal conversion) giving rise to vibrational excitation. The excess energy of 2.5 eV is sufficient for ring-opening and subsequent dissociation of the resulting linear molecule^[@CR31]^. For higher internal energies, additional hydrogen atoms can be | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION
============
Helping behavior has been observed throughout the animal kingdom, from social insects to primates ([@R1]). Rescue behavior observed in ants can arise in predator-prey interactions, by rescuing nestmates that have fallen into an antlion trap by digging, pulling the ant out and attacking the antlion, or excavating ants trapped under sand or soil ([@R2]--[@R5]). All hitherto observed types of rescue behavior in social insects were always directed toward individuals under an imminent threat ([@R1], [@R6], [@R7]), that is, suffocation or being eaten. *Megaponera analis* is a strictly termitophagous ponerine ant species, found in sub-Saharan Africa from 25°S to 12°N ([@R8]) that specializes in raiding termites of the subfamily Macrotermitinae at their foraging sites ([@R9]--[@R13]). A scout ant that has returned to its nest after having found an active termite foraging site initiates a raid. It will recruit approximately 200 to 500 nestmates and lead them to the termites in a column-like march formation, which can be up to 50 m away from the nest ([@R11], [@R13], [@R14]). During the raid, division of labor occurs ([@R15]): larger ants (majors) break open the protective soil cover created by the termites, whereas the smaller ants (minors) rush into these openings to kill and pull out the prey ([@R16]). Afterward, the majors collect the dead termites, the column forms again, and the hunting party returns to the nest. These raids occur two to four times a day ([@R9], [@R11]--[@R13], [@R17]). Termites have evolved various ways to defend themselves effectively against predators such as *M. analis*, of which a specialized soldier caste with strong sclerotized heads and big mandibles is the main defensive force ([@R18], [@R19]). Consequently, ants involved in the hunting process incur high injury risks. We observed a unique helping behavior in *M. analis* to compensate for this high injury rate by carrying back injured ants to the nest. The carrying of ants after the hunt was also observed in Kenya ([@R13]) and the Democratic Republic of Congo ([@R20]); however, no attempt was made in those studies to explore the adaptive value of this behavior to the colony or the individual. We further observed the removal of termites, still clinging on to ant extremities in the ant nest, and the rescue behavior toward ants that carry long-term injuries in the form of lost extremities. This specialized rescue behavior is unanticipated in insects, where the value of individuals is generally underestimated, and could provide further proof that empathy is not necessary for helping behavior to emerge in animals ([@R21]).
RESULTS
=======
Injured *M. analis* ants were antennated by their nestmates at the hunting ground, whereupon they adopted a pupal pose, most likely for ease of transportation back to the nest (movie S1 and fig. S1A). On an average raid, a median of 3 ± 2.9 ants (of 416 ± 153 ants) were carried back (*n* = 53 raids with 154 carried ants), for a total of 9 to 15 rescued ants per day (3 to 5 raids per day). Only in 11% (6 of 53) of the raids were no ants carried back to the nest, and in half of those cases, the raid itself was unsuccessful (no encounter with termites at the hunting ground). If we consider a mean estimated birth rate of 13.3 ± 3.8 ants per day (*n* = 5; for estimate calculation, see the "Quantification of model" section in Materials and Methods), the rescued ants make up a large proportion of the daily turnover in the colony.
Value of rescue behavior for the individual
-------------------------------------------
We classified carried ants into three mutually exclusive categories: (i) ants that partially or completely lost an extremity (antenna or leg), (ii) ants that have termites clinging to their bodies, and (iii) ants that appear to carry no obvious injury (fig. S1B). Most carried ants had a termite clinging on an extremity ([Fig. 1A](#F1){ref-type="fig"} and table S1). This handicap reduces the speed of the ant the most (4.5% of the mean speed of a healthy individual; [Fig. 1B](#F1){ref-type="fig"} and table S1) and, if removed successfully, has no long-term consequences. When 20 randomly selected individuals from each of the three categories of carried ants were forced to return alone from the hunting ground, 32% (*n* = 19 of 60) of them died ([Fig. 2A](#F2){ref-type="fig"}), in contrast to 10% of healthy individuals (*n* = 2 of 20). Ants that were carried back to the nest were never observed to be under any threat of predation (*n* = 420 raids observed during the entire field phase), thereby reducing return journey mortality of injured ants from 32% to close to 0%. The main cause of death when ants were forced to return alone was predation by spiders (57.1%: *n* = 12 of the 21 ants killed during the return journey alone from the hunting ground; [Fig. 2](#F2){ref-type="fig"}, B to E). Ants that had a termite clinging on an extremity had the highest mortality rate (50%, *n* = 10 of 20; [Fig. 2A](#F2){ref-type="fig"}). In nature, injured individuals were never observed to return alone without help, but six fatal injuries were observed at the hunting ground (in a total of 53 raids): removed head, thorax, gaster, or multiple legs. These ants were left behind at the hunting ground.
{#F1}
{#F2}
Ants that were carried back to the nest were observed again in subsequent raids 95% of the time (*n* = 38 of 40), sometimes less than an hour after the injury (individuals were marked with acrylic color codes for recognition). Termites clinging onto extremities were removed in 90% of the cases in the following 24 hours without removing the extremity (*n* = 20), thereby completely rehabilitating the handicapped individual. Ants that had lost two randomly selected legs were able to recover in the safe confines of the nest. Twenty-four hours after their injury, they reached mean running speeds 32.1% faster than freshly injured ants, a speed not significantly different from that of healthy individuals ([Fig. 3](#F3){ref-type="fig"} and table S2).
![Speed of injured ants at different times after injury.\
Box-and-whisker plot showing median (horizontal line), interquartile range (box), distance from upper and lower quartiles times 1.5 interquartile range (whiskers), and significant differences (different letters) of the different running speeds 5 min after removing two legs (Fresh injury) and 24 hours later \[Old injury (+24 hours)\] and of healthy ants (Healthy) (Kruskal-Wallis rank sum test, followed by a Dunn's test with Bonferroni correction; *n* = 20 trials with five colonies). See also table S2 for detailed statistical results.](1602187-F3){#F3}
Of the carried | {
"pile_set_name": "PubMed Central"
} |
The article by Kweon TD et al. entitled, \"Heart rate variability as a predictor of hypotension after spinal anesthesia in hypertensive patients\" (Korean J Anesthesiol 2013 October 65(4): 317-321) contained an error in Accepted date.
**Before correction:**
Received: January 2, 2013. Revised: 1st, February 27, 2013; 2nd, March 18, 2013; 3rd, April 11, 2013. Accepted: April 24, 2012.
**The correct information is found below:**
Received: January 2, 2013. Revised: 1st, February 27, 2013; 2nd, March 18, 2013; 3rd, April 11, 2013. Accepted: April 24, 2013.
The Accepted date was misspelled as April 24, 2012. The correct spelling is April 24, 2013.
We apologize for any inconvenience this mistake may have caused.
| {
"pile_set_name": "PubMed Central"
} |
Background
==========
Alcohol use has been ranked high as a risk factor for death and loss of healthy life years, as well as being a source of personal and social harm \[[@B1]-[@B3]\]. Policies and interventions exist that can reduce alcohol use, but there is still a need to understand more about why alcohol use and abuse change in populations and how alcohol-related harm can be reduced \[[@B4]\].
Studies in Europe have generally found that immigrants from non-Western countries tend to drink less or less often than the host population. In the Netherlands, Turkish and Moroccan immigrants reported less alcohol use than the Dutch population in both the first and second generation, and their alcohol consumption did not converge towards the higher rates in the host population \[[@B5],[@B6]\]. In another study from the Netherlands mono-ethnic immigrants in secondary schools from the Antilles and Surinam were also included in addition to Turks and Moroccans, all reporting a lower prevalence of drinking than the Dutch students \[[@B7]\]. In the United Kingdom, African Caribbeans have reported lower alcohol consumption than their white counterparts in studies from 1986 to 1995 \[[@B8]\]. Asian Muslims reported a very low level of alcohol consumption in the United Kingdom \[[@B9]\]. Muslim 15-16-year-olds in England, as well as Hindus and Sikhs in the same age group, reported a far lower level of consumption than white adolescents \[[@B10]\]. In Germany, among 9^th^ graders, the largest immigrant group (Turks) reported less than half the level of binge drinking in the previous four weeks than those of German descent. The drinking behaviour of the second largest group of immigrants in Germany (from the former Soviet Union) was similar to those of German descent. Otherwise adolescents from Islamic countries living in Germany had a lower lifetime prevalence of drinking than German and Western European adolescents, with the exception of students from Iran \[[@B11]\]. In a study from Oslo, Norway, 15-16- year-olds with an ethnic Norwegian background reported a higher frequency of drinking than their age-peers from Pakistan, Somalia, Turkey and Morocco where Islam was the predominant religion. The frequency of drinking among youth from Iran, another country where Islam is the predominant religion, was also lower than among Norwegians, but not as low as among youth from the Islamic countries already mentioned. A large proportion of youth from Vietnam had tasted alcohol, but fewer drank often and fewer got drunk compared to ethnic Norwegians \[[@B12]\]. Albanians in Florence, Italy, reported more drinking, however, than Albanians in the home country and among Italians \[[@B13]\]. Also, in a study of recent Hispanic immigrants to Spain over the age of 15, there were no significant differences between the previous 12 months' drinking among immigrants compared to the native population. Almost 40% of the immigrants reported a higher level of drinking than in their country of origin \[[@B14]\].
In the United States (US) adolescents of Chinese origin were less likely to be drinkers then Chinese adolescents in Hong Kong and American adolescents in the United States \[[@B15]\]. Among Mexican-heritage youth (12--17 years old) living in the US, 13% of those born in Mexico reported use of alcohol, while 19% of the US-born reported such use \[[@B16]\]. In two studies (one among adolescents and one among those 18 years old and over) comparing alcohol use in white and Asian subgroups, the prevalence of increased drinking behaviour ranked highest for whites, followed by Japanese or Filipinos, Koreans, Chinese and Vietnamese. Other studies show somewhat different ranks for people of Asian background \[[@B17]\]. Numerous studies have been carried out on alcohol use and misuse according to race/ethnicity in the US, but the country of origin is seldom included since this requires very large or country-specific samples \[[@B18]\]. Finally, in Australia, Vietnamese were found to consume alcohol at a lower rate than that of Australians in general \[[@B19]\].
Thus, alcohol use among immigrants to Western countries tended to be less prevalent among non-Western immigrants, but more prevalent and more frequent among those residing in the host country for a longer period, i.e., among second-generation immigrants (as compared to first-generation). In addition those immigrants who spoke the language of the receiving country drank more often \[[@B11],[@B15],[@B20]-[@B22]\].
Drinking is strongly influenced by other drinkers in a person's personal network. It has been argued that society at large, or at least large segments of society, behave collectively regarding drinking \[[@B23]\]. A higher level of contact with one's own dry culture will thus predict a lower level of drinking, while a higher level of contact with the host's 'wet' culture will predict a higher level of drinking. Immigrants from dry alcohol cultures may influence alcohol use in the whole population in a 'wetter' host country, however, not only by being a low-consumption group themselves. In general, the interaction between the host society and immigrant populations has an impact on the attitudes, values and behaviours of both collectives \[[@B24]\]. In Norway and the Netherlands it was found that the higher the percentage of Muslims in a school, the lower the frequency of drinking both among immigrant youth and native youth from the host country \[[@B7],[@B12]\]. A higher level of contact with a 'drier' drinking culture may thus reduce drinking also in the host population.
The pattern of drinking in Norway has been characterised by relatively infrequent consumption, but with a high level of consumption and drinking into intoxication, especially on festive occasions \[[@B25]\]. Alcohol sales increased by 40% from 1995 to 2009, but sales per capita in Norway were still the lowest of the Nordic countries. In 2010 sales per capita in Norway were almost half of sales in Germany, Spain and France. In a population survey from 2008 (15 years and above), 86% of women and 92% of men reported drinking during the last 12 months, while 16% of women and 27% of men reported drinking several times a week. Drinking alcohol every day with meals or in other contexts was thus not common; most alcohol was consumed on weekends \[[@B26]\]. There has been a reduction in drinking among young people in Norway in recent years, but still consumption and drinking into intoxication are widespread. Among 15-16-year-olds in Norway 63% of the boys and 70% of the girls reported in the 2007 ESPAD study that they had used alcohol last year, both figures at the lower end of European measurements. Boys usually drank more on each occasion than girls. Rated by the proportion of drinking into intoxication, however, young Norwegians were found in the mid-range of the European countries \[[@B27]\]. Non-Western immigrants to Norway have thus encountered a much 'wetter' drinking culture than in their country of origin, and social events on weekends included drinking from a young age.
The aim of the Norwegian government's alcohol policies has for many years been to reduce both individual and societal costs. The measures introduced have included imposing a monopoly for the import and sale of wine and stronger alcohol, limiting access to beer sold in shops (restricted hours of sale), imposing high taxes on all sales and disseminating information on the consequences of alcohol use. Such a system has not been given priority in the EU or in single member countries (with the exception of Finland before entering the EU and Sweden) \[[@B4]\]. Norwegian policies have moved in a liberal direction in recent years, however, for example by opening up for personal import of wine and stronger beverages \[[@B28]\].
Immigration to Norway started in the latter part of the 1960s. In 1970 1.5% of the population was registered as immigrants (born outside Norway of non-Norwegian parents or born in Norway with two non-Norwegian parents). Only 0.1% came from non-Western countries at that time (Asia, Africa, South or Central America, Turkey). In 2001, at the time of the study referred to here, comparable figures for immigrants were 6.6% in total and 3.4% non-Western at the national level and 19% in total and 13% non-Western in Oslo \[[@B29]\]. The third generation of immigrants from those countries who came in the late 60s to early 70s had started to enter primary school in 2001. By 2011, the proportion of non-Western immigrants had increased even further \[[@B30]\].
The availability of three health surveys in 2000--2002 covering adolescents, adults, and adults in the largest immigrant groups in Oslo, Norway, enabled us to study alcohol drinking among ethnic Norwegians and three of the five largest non-Western immigrant groups with Islam as the predominant religion in their home country: Iranians, Pakistanis and Turks. The first aim of this study was to describe frequency of drinking in two generations of immigrants in Oslo, comparing the result to drinking among ethnic Norwegians. The second aim was to study how frequency of drinking among adult immigrants was associated with social interaction with their own countrymen and ethnic Norwegians, acculturation factors, age, gender, socioeconomic factors and the Muslim religion.
Methods
=======
Sample surveys
--------------
This analysis was based on three sample surveys included in the Oslo Health Study (HUBRO), which was conducted in joint collaboration with the Oslo City Council, the University of Oslo and the Norwegian Institute of Public Health. The study protocol was approved by the Norwegian Data Inspectorate and the Regional Committee for Medical Research Ethics.
HUBRO was carried out in the city of Oslo from May 2000 to September 2001 \[[@B31]\]. An invitation for participation in the health survey was sent to birth cohorts of 1924, 1925, 1940--41, 1955, 1960 and 1970 who had resided in Oslo on 31 December 1999. The postal invitation included a standardised main questionnaire and an invitation to attend a clinical examination with a second questionnaire, which | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
In the past 20 years, enhanced recovery pathways (ERPs) have become increasingly integrated into most surgical fields as standard care in high income countries, as is exemplified by national priority programs \[[@CR1]--[@CR3]\], and the widespread acceptance of the Enhanced Recovery After Surgery (ERAS) society network \[[@CR4]\]. ERPs represent a fundamental shift towards a patient-centred, multidisciplinary-driven continuity of care that aim to attenuate surgical stress and expedite recovery \[[@CR5]\]. Studies on total joint arthroplasty (TJA) for both hips and knees have shown that implementation of an evidence-based, structured approach to patient care decreases postoperative morbidity and consequently length of stay without increasing readmission rate \[[@CR6]--[@CR8]\].
However, in low- and middle-income countries (LMICs), the value of implementing ERPs is yet to be explored. This may be because: i) the perception that current hospital resources may make it difficult to develop and implement structured and sustainable protocols to enhance postoperative recovery, and ii) short and long-term data collection on the quality of the work provided is scarce, inhibiting the ability to benchmark clinical results and improve the service provided to patients. Despite these challenges, a healthcare system in a middle-income country such as South Africa may benefit from the implementation of ERPs through reduced postoperative morbidity and the associated cost reductions, as has been demonstrated in high-income countries (HICs) \[[@CR9]\].
While the goals of implementing ERPs can be expected to be independent of a country's economic status, we believe the differences in patient demographics, healthcare infrastructure and healthcare resources between HICs and LMICs warrants a LMIC derived programme of enhanced care to facilitate practice change and improve patient outcomes in these settings. The aim of our study was therefore to establish multidisciplinary consensus on; i) preoperative risk factors associated with poor outcomes, ii) perioperative interventions considered necessary to improve outcomes, and iii) important postsurgical patient and clinical outcomes. This study was conducted in South Africa, which represents an upper-middle-income country, as defined by the World Bank \[[@CR10]\]. However, as this work was conducted in the public healthcare sector, and South Africa has one of the world's highest levels of inequality \[[@CR11]\], it is likely that this work reflects the state funded healthcare system of a LMIC, as opposed to high-middle-income countries. This assumption is supported by the South African public healthcare service data from the African Surgical Outcomes Study, where the median number of specialists per 100,000 population was 0.9 (IQR 0.2-1.9) (unpublished data) \[[@CR12]\], which is well below the recommended 20--40 specialists per 100,000 population \[[@CR13]\].
Methods {#Sec2}
=======
We conducted a Delphi survey with experts from different fields involved in the care of arthroplasty surgical patients in South Africa. The Delphi study is an accepted method for achieving convergence of opinions concerning knowledge solicited from experts within specific fields, and has been adopted for priority-setting in medicine \[[@CR14]\]. The technique is an iterative process which allows the participant to refine his or her prioritization of items, in an anonymous manner, based on the group's work from round to round and with controlled feedback of opinions \[[@CR15]\].
Participant recruitment {#Sec3}
-----------------------
Participants were recruited from all the hospitals which we knew had a history of performing elective TJAs. This approach was necessary, as currently there is no national arthroplasty database of public hospitals performing TJAs in South Africa. We invited orthopaedic arthroplasty surgeons, anaesthetists and physiotherapists from 18 regional and central hospitals in the public sector covering seven of the nine provinces in South Africa. They were contacted by email and asked to participate in four sequential studies aimed at improving perioperative care for patients scheduled for primary elective unilateral hip and knee TJA in South Africa. The Delphi study is the first of these four studies. For a hospital to participate we required participation of both the Anaesthesia and the Orthopaedic Departments in the project. With the use of telephone calls, face-to-face meetings and further email correspondence, 33 experts in the perioperative management of arthroplasty patients from 10 hospitals representing four provinces accepted the invitation to participate in these four studies. Reasons for exclusion from the study where i) not confirming their participation (5) or ii) declining to participate due to lack of interest or lack of resources to participate in this and future studies (3). Prior to commencement of the Delphi study, the participants were given detailed information of the Delphi process and how consensus would be defined.
The Delphi process {#Sec4}
------------------
This Delphi survey was conducted over 3 months from December 2016 to March 2017. In the first round participants submitted suggestions for; i) risk factors associated with poor outcome, ii) best practices for preoperative, intraoperative and postoperative interventions to improve postoperative outcomes and iii) important patient and clinical outcomes to benchmark care, deemed relevant in the South African context for patients scheduled for primary elective unilateral hip and knee TJA. Participants were encouraged to elaborate on how to quantify these components and provide supporting references. UP and BMB grouped the responses in each category into statements. The category statements and supporting references were shared with all participants. In the second Delphi round, the participants were asked to rank the top-ten statements in each category, and where possible, add further comments or relevant references. Based on participants' responses, statements that overlapped were grouped together prior to the third Delphi round. In the third round the participants were presented with their individual as well as the overall group ranking of the prioritised statements within each category. They were asked to re-evaluate their previous round's ranking, considering the group ranking and where possible when their rankings differed greatly from that of the group, to add further comments or references supporting their decision. In the fourth and final round, participants were given an opportunity to present any strong disagreement with the priority rankings from the third Delphi round with a Skype teleconference. Non-participation in the fourth round indicated agreement with the proposed Delphi priorities from the third round. Following the teleconference, the consensus of the group was taken as final. UP and BMB were neutral in the prioritization of statements throughout the study.
Statistical analysis {#Sec5}
--------------------
The rank order of the research priorities for each round was established using a reverse scoring system i.e. a respondent's rank of 1 received 10 points, down to a rank of 10, which received 1 point. The scores of the respondents were combined for each round to develop the research priority rank order**.**
Results {#Sec6}
=======
Participants and response rate {#Sec7}
------------------------------
The recruited participants included 13 arthroplasty surgeons, 12 anaesthetists and 8 physiotherapists involved in hip and knee arthroplasty. Response rate in the first round was 97% (32/33), 91% (30/33) in the second round and 91% (30/33) in the third round. In the fourth round, all 33 participants accepted the ranking of the prior third Delphi round. However, three participants contributed in the fourth round to a refinement of two of the Delphi statements. The first was an amalgamation of "peripheral nerve blocks" with "multimodal opioid-sparing analgesia regimen" in the postoperative intervention category, which changed the overall ranking in this category. This change clarified that non-opioid analgesic regimens can include regional anaesthesia. The second change was to define "long term survival" in the outcome category as "1-year mortality", to ensure an objective outcome variable.
Preoperative risk factors {#Sec8}
-------------------------
Two hundred forty-seven suggestions were submitted for round 1 for preoperative risk factors believed to be associated with poor outcomes in patients scheduled for primary elective unilateral hip and knee TJA. The suggestions were categorised into 36 broad statements for round 2 which were refined to 28 statements for round 3. The ten prioritised risk factors identified after the second round did not change in the subsequent rounds (Table [1](#Tab1){ref-type="table"}).Table 1The ten prioritised preoperative risk factors considered most important determinants of poor outcomes in patients scheduled for primary elective unilateral hip and knee total joint arthroplasty in South Africa1. Poor general health (ASA 3 and above)2. Impaired cardiovascular functional status3. Advanced age4. Preoperative mobility5. Obesity or chronic malnutrition6. Recent or current sources of infection (e.g. bladder, respiratory, dental etc.)7. Preoperative chronic pain7. Matching surgical complexity with surgical experience or skill9. Psychiatric disorders and/or cognitive impairment10. Preoperative anaemia*ASA* American Society of Anesthesiologists
Preoperative interventions {#Sec9}
--------------------------
Round 1 yielded 166 suggestions of preoperative interventions judged to be important to improve outcomes following primary elective unilateral hip and knee TJA. These were amalgamated into 14 statements in round 2 and further refined to 11 different statements for round 3. The ten priorities identified after the second round did not change in subsequent rounds (Table [2](#Tab2){ref-type="table"}).Table 2The ten prioritised preoperative interventions considered most important determinants to improve outcomes following primary elective unilateral hip and knee total joint arthroplasty in South Africa1. A patient optimisation clinic2. Multidisciplinary planning3. Patient education4. Infection prevention5. Establishing high-volume units6. Smoking cessation7. Optimisation of preoperative analgesia regimen8. Minimise preoperative fasting9. Establish a patient blood management programme10. Alcohol cessation
Intraoperative interventions {#Sec10}
----------------------------
One hundred forty-four suggestions for intraoperative interventions believed to improve postoperative outcomes following primary elective unilateral hip and | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
Tear film (TF) is a viscous and complex trilaminar fluid composed mainly of lipids, electrolytes, proteins and water \[[@CR1]\]. Normal TF dynamics require adequate tear production, tear retention on the ocular surface and balanced tear drainage. The TF is responsible for lubrication, nutrition and protection against microbial and toxic agents \[[@CR2]\]. Disruption of TF dynamics can lead to dry eye or the ocular surface can become more susceptible to the onset of diseases \[[@CR3]--[@CR5]\].
Different tools can be used to evaluate the ocular surface \[[@CR6]\]. Schirmer tear test-1 (STT-1) is considered the gold standard method for measuring tear production; however, it does not measure tear quality \[[@CR7]\]. The tear ferning test (TFT) is a qualitative test developed for humans, and it has become a useful diagnostic tool in tear ferning research. Various ferning patterns can be observed as a result of tear crystallization after evaporation of lacrimal samples, and these patterns depend mostly on TF composition \[[@CR8]\]. In addition, tear crystallization may be affected by humidity and temperature \[[@CR9], [@CR10]\]. Therefore, changes in ferning patterns are believed to reflect possible changes in both composition and stability of the TF \[[@CR10]\].
In humans, Rolando suggested the first grading scale for the TFT, wherein types I and II indicated normal TFs, while types III and IV indicated abnormal TFs \[[@CR9]\]. Thereafter, Masmali developed a TFT grading scale for humans, with the aim of addressing the gaps in previous classification systems. According to this scale, TFs with grades 0 and 1 were considered normal, while those with grades 2, 3 and 4 were considered abnormal \[[@CR10]\].
In addition to humans \[[@CR6], [@CR10], [@CR11]\], the Rolando and Masmali grading scales have been applied in horses \[[@CR12]\], dogs \[[@CR13], [@CR14]\], camels \[[@CR11]\] and capuchin monkeys \[[@CR15]\]. Although no record in the veterinary medicine literature documents the use of a grading scale specifically for animals, previous studies have successfully used the human grading scales in some animal species, thus showing that the TFT is a feasible and complementary test that is simple and inexpensive for ocular surface assessment \[[@CR12], [@CR13]\].
Increasing evidence suggests that qualitative TF deficiencies are an important cofactor or cause of some of the most common and challenging ocular diseases in cats, including conjunctivitis, corneal ulcer, spontaneous chronic corneal epithelial defects (SCCED), pigmentary keratitis, corneal sequestrum and dry eye syndrome \[[@CR16]--[@CR21]\]. Despite this, the TFT has not yet been performed in cats, even though it is already considered a complementary diagnostic tool in ocular surface research. Therefore, this lack of applied research on tear ferning in cats justifies an investigation of the application of the two TFT grading scales in healthy cats to understand the potential role of tear deficiency and the value of tear testing in cats.
Methods {#Sec2}
=======
Study population {#Sec3}
----------------
The study included 60 mixed breed cats (120 eyes) of which 33 were females (55.0%) and 27 were males (45.0%), aged between 1 and 8 years (mean 2.5 ± 1.86 years), with no complaint of illness. Additionally, they had to be vaccinated, without systemic or ocular signs of disease, without any history of ocular secretion or injury and with STT-1 values within the normal range for the species. The animals also had normal, complete blood counts and biochemical test results, including those for urea, creatinine, alanine aminotransferase and alkaline phosphatase. Moreover, all animals tested negative for feline coronavirus, feline leukemia virus and feline immunodeficiency virus.
Before data collection, the STT-1 (Schirmer Tear Test; Ophthalmos, São Paulo, Brazil) was performed and used as a screening method to measure tear production. The median value and interquartile range (median ± S-IQR) was 20 ± 7 mm/min, and the 95%-confidence intervals (CI) was between 18.4 and 19.8 mm/min.
Evaluations of the ocular adnexa and anterior segment were performed using a slit-lamp biomicroscope (Vision Class II BL IIIB/YZ30T; Ramos Mejia, São Paulo, Brazil). Intraocular pressure (IOP) was measured using a rebound tonometer (Icare tonometer; Icare Finland Oy, Vantaa, Finland); For IOP the median ± S-IQR value was 22 ± 6 mmHg, and the CI was between 22.3 and 24.1 mmHg. The ocular surface was evaluated using fluorescein dyes (Fluorescein test; Ophthalmos), TF breakup time (TFBT) (range 5--9 s) and lissamine green (Lissamine green test; Ophthalmos). The IOP, fluorescein, TFBT and lissamine green tests were performed after tear sampling to avoid any interference with tear crystallization. All data were collected in a room in which the temperature and humidity were controlled.
This study was approved by the Ethics Committee on Animal Experimentation of the Use of Animals from the State University of Santa Cruz, Brazil (protocol no. 003/17). All procedures were conducted in accordance with the Association for Research in Vision and Ophthalmology's (ARVO) Statement for the Use of Animals in Ophthalmic and Vision Research and NIH statement.
Sample collection and TFT {#Sec4}
-------------------------
Tear samples were collected between 8:00 a.m. and 11:30 a.m., first from the right eye and then the left eye. Once the tear wetted 30 mm on the Schirmer strips, which were the same ones used for STT-1, the strips were immediately placed in a 0.5 ml microtube (Protein LoBind Tubes; Eppendorf, São Paulo, Brazil) and conditioned in a thermal box until centrifugation. Immediately before centrifugation, the bottom of the 0.5 mL microtube was punctured and it was inserted into a larger 2.0 mL microcentrifuge tube (Protein LoBind Tubes; Eppendorf) for extracting the tear fluid as previously described by Oria et al. \[[@CR13]\]. The tear fluid was obtained through centrifugation (25.830 *g* for 10 min at 4 °C) of the Schirmer strips (Schirmer Tear Test; Ophthalmos).
During sample collection and processing, the temperature and humidity ranged from 20.9 to 27.1 °C and 42 to 62%, respectively. A teardrop of approximately 2 µL was deposited on a glass slide, at the center of a circle made previously and the tear ferning time (i.e., from tear deposition until drying) was measured using a digital timer. After complete drying, the slides were evaluated under a 10× lens magnification polarized light microscope with a camera (Microscope Scope A.1/AX10 Axion Cam ICc5; Zeiss, São Paulo, Brazil). The acquired images were classified and the formation of branches, angulations and zones of transitions were evaluated according to the proposed scales of Rolando et al. \[[@CR9]\] and Masmali et al. \[[@CR10]\].
The images of the ferning patterns were classified by three separate blinded examiners (APO, ACSR and AJL) from the Veterinary Ophthalmology Research Group of the School of Veterinary Medicine and Zootechny of Federal University of Bahia. All the examiners had experience of and expertise in the use of the scales. The final grading was assigned on the basis of agreement between the classifications of at least two of the three examiners. Tear ferning patterns were classified according to the Rolando grading scale (types I, II, III and IV) and according to the Masmali grading scale (grades 0, 1, 2, 3 and 4).
Statistical analysis {#Sec5}
--------------------
Statistical analysis was conducted using IBM SPSS Statistics for Windows, Version 22.0 (IBM Corp.), and the R Software for Windows, Version 3.6.1 with package irr was used for Cohen's kappa coefficient (k). The level of significance was set at 5% (P \< 0.05) and CI at 95%. The Shapiro--Wilk test was used to test data normality of the TFT values. Wilcoxon test was used for comparison of the same variables between eyes on each scale. The Mann--Whitney test was used to compare classification (both scales) with sex. Age was correlated with the classifications obtained through the Spearman test. Cohen's kappa coefficient was used to verify the agreement among the examiners in each scale.
Results {#Sec6}
=======
Crystallization occurred in the tear samples of all animals submitted to the test, with an average time of 14.6 ± 4.3 min. The crystallization patterns that received lower grades showed full crystallization with high density, without gaps between the ferns and branches, forming several nuclei that were easily distinguished. The branches showed medium length and were thin, with well-defined primary and secondary ramifications. As the grade increased, the nuclei lost definition, gaps were observed between the branches and, sometimes, coarse crystals were formed. Nevertheless, crystallization was observed even in the higher grades.
As described in methodology, after the ferning, the images were classified by resemblance to Rolando scale (Fig. [1](#Fig1){ref-type="fig"}a--c) and Masmali scale (Fig. [ | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
Genome-wide association studies (GWAS) have been widely used as a reliable method for identifying genetic variants associated with a trait or complex disease. A high density of SNPs increases the chance of finding either a causal mutation for the trait or SNPs close enough to the mutation to confidently suggest a gene or another sequence feature underlying the trait. One way to overcome this problem is using imputation, a process in which samples are genotyped using a low-density SNP array and imputed with information from a reference panel genotyped on a high-density SNP array. This method will also recover genotypes that are missing because of technical issues.
Imputation has successfully helped to identify genetic susceptibilities to various diseases and phenotypes that were not recognized in a genotyped panel \[[@CR1], [@CR2]\]. The method relies on the number of SNPs being shared between the two panels and the amount of linkage disequilibrium (LD) between genotyped and non-genotyped SNPs \[[@CR3]\]. A low average LD will reduce the accuracy and might require more typed SNPs. The quality of imputation also depends on the choice of reference \[[@CR1]\]. If the reference contains genetic variants not present in the actual sample population, it will increase the noise in the data and reduce the usefulness of the imputation. One study of malaria resistance in Gambian children only identified a previously known hemoglobin S variant in the hemoglobin-β gene when a Gambian-specific reference was used \[[@CR1]\]. Although this problem is more likely to occur in Africa, where there is a considerably lower LD compared to Europe and Asia \[[@CR4]\], determining how to choose the best reference is relevant for any study performing imputation with publicly available reference sets.
Many studies have validated the accuracy and reliability of imputation \[[@CR5]--[@CR7]\], but most of these studies focused on populations of European descent \[[@CR5], [@CR7]\]. One study showed that the accuracy of using a publicly available database varied across human populations with Europeans having the highest accuracy and Africans having the lowest \[[@CR6]\]. Because Asian populations have some unique genetic characteristics \[[@CR8]\], it is not always possible to directly adapt information about genetics or genomics from studies in Caucasian populations \[[@CR9]\].
Several types of software are currently available for performing genotype imputation \[[@CR10]--[@CR13]\]. Similarly, many publicly available genetics databases are accessible for public use \[[@CR14], [@CR15]\]. One of these is the Pan-Asian SNP genotyping database (PanSNPdb), which collects SNPs and copy number variations from 1719 samples in 71 populations from China, India, Indonesia, Japan, Malaysia, the Philippines, Singapore, South Korea, Taiwan, and Thailand \[[@CR16], [@CR17]\]. The genotyping process was performed using the Affymetrix GeneChip Human Mapping 50 K Xba Array.
Most of the studies on imputation have looked at the overall outcome of all SNPs \[[@CR5], [@CR18]\], and a few have focused on a particular region within a gene, not the whole genome \[[@CR19], [@CR20]\]. We proposed two objectives for the current study. The first was to identify the most preferred reference for imputation in Southeast Asian populations. Using two publicly available haplotype databases, the International HapMap Project (HMII) and the 1000 Genomes project (1000G), we compared the accuracy and yield of imputation in several Southeast Asian populations. Additionally, we looked at imputed results using genotyped samples from a study of a Thai genome cohort. The second objective was to evaluate the imputation results of different regions in the human genome using a real dataset from the Thai dengue study as a model. This is the first extensive study of imputation in Southeast Asian populations and the first illustration of imputation differences between SNPs in different regions of the genome.
Methods {#Sec2}
=======
This study was divided into two parts. The first part aimed at showing the difference in imputation accuracy by using different criteria for selecting a reference database. Additionally, using data from populations within the Southeast Asian region illustrated the variation in accuracy when going from one population to another. The second part used real genotype data in all autosomes to classify SNPs into different groups according to their location within genes. Imputation accuracy, GWAS significance and allele frequency were then correlated with the classification.
Sample datasets {#Sec3}
---------------
We performed the first part of our analysis using data from PanSNPdb \[[@CR16]\]. To illustrate the imputation accuracy in Southeast Asian populations, we selected all available samples from Indonesia (ID, *n* = 288), Malaysia (MY, *n* = 217), the Philippines (PI, *n* = 125), Singapore (SG, *n* = 90), and Thailand (TH, *n* = 245). Only SNPs that were polymorphic in all populations were used in this study (*n* = 52,160).
The second part was imputation accuracy and yield in a patient dataset in which we had access to phenotypes because the phenotypes allowed us to observe the effect of imputation on subsequent association tests. The subjects were 609 Thai dengue patients who were 1--15 years-old from Siriraj, Ramathibodi, and Khon Kaen hospitals. A total of 468,987 SNPs from Illumina Human Hap610 array (Illumina Inc., San Diego, CA) passed the quality control requirements (QC). The accuracy of imputation was tested for each SNP from the dengue dataset by first randomly choosing half of the SNPs from the genotyping panel to create a mutually exclusive set of SNPs: *Set 1* and *Set 2*. Then, *Set 1* SNPs were used to impute *Set 2* to create a complete SNP panel*. Set 2* was also used to impute *Set 1* to create a complete SNP panel. Based on our results in the previous section, HMII data were used as a reference for imputing the SNPs from the dengue dataset. The total number of SNPs after imputation was 1,417,081. Post-imputation QC reduced these numbers to 858,480.
Quality control and multidimensional scaling {#Sec4}
--------------------------------------------
For all of the sample datasets, QC was performed in PLINK v1.07 \[[@CR12]\] using standard procedures for GWAS \[[@CR21]\]. We included all markers with a call rate \> 0.95, a minor allele frequency (MAF) \> 0.01, and a Hardy--Weinberg equilibrium (HWE) \> 10^− 7^. Samples with call rates \< 0.95 were excluded from the analysis along with samples that had first-degree relationship agreement, as evaluated by expected IBD sharing in PLINK v1.07. Multidimensional scaling (MDS) of Southeast Asian populations from PanSNPdb was performed in PLINK v1.07. This method allowed for visualization of principle components in the admixed population. Plotting of the MDS was conducted in R version 3.0.2 (<http://www.r-project.org/>).
Imputation procedure {#Sec5}
--------------------
In the first part of the study, each population from PanSNPdb was analyzed independently. Five percent of SNPs were randomly selected and removed. The same SNPs set of the removed SNPs were applied to all populations. SHAPEIT version 2 software was used to pre-phase the SNPs \[[@CR22]\]. Imputation was accomplished with IMPUTE2 to recover the removed SNPs \[[@CR23]\]. Each population was phased and imputed using both references in turn. According to guidelines from IMPUTE2, we imputed each chromosome separately and used windows of 5 Mb with an additional 250 kb buffer region on both sides of the analysis interval. The options used in the program were -buffer 1000, −iter 30, −burnin 10, and -k 80. The processes for random removal, phasing, and imputation were repeated five times.
The second part of our study used all the autosomal SNPs from the dengue dataset. Half of the autosomal SNPs from Thai dengue patients were removed by every second SNP (*Set 1*). Another dataset (*Set 2*) was then created in which the other half of the SNPs (*Set 1*) were removed. In this way, all SNPs were imputed once. Imputation was performed with HMII as described above. After imputation, SNPs were filtered using a QC process similar to the initial filtering of raw genotypes. Post-imputation QC excluded SNPs with MAF \< 0.01, call rate \< 0.95, and HWE \< 5 × 10^− 7^. These datasets were used in the GWAS analyses. We then selected only the imputed SNPs from the two datasets and merged them into a single dataset in which all SNPs had been imputed. This dataset was used to compare imputation accuracies of SNPs according to their location relative to known genes.
References used for the imputation were downloaded prior to the imputation process from the Impute website (<http://mathgen.stats.ox.ac.uk/impute/impute.html>). The references were labeled on the website as International HapMap project phase II release \#22 (HMII) and 1000G phase I. A total of 1,417,081 SNPs from 90 Chinese and Japanese samples were used from HMII with an additional 39,343,900 SNPs from 1092 worldwide sample populations in the combined reference from 1000G. PanSNPdb shared 47,870 SNPs with the HapMap reference and 51,849 with the 1000G reference. The Thai dengue dataset shared 493,846 SNPs with the HapMap reference and 565,912 with the 1000G reference.
Imputation yield and accuracy {#Sec6}
-----------------------------
IMPUTE2 gives each imputed genotype a posterior probability score (info | {
"pile_set_name": "PubMed Central"
} |
1. INTRODUCTION {#sec1-1}
===============
The World Health Organization (WHO) has defined *preterm birth* as delivery before 37 completed weeks of gestation (gestational age is reported in terms of completed weeks (i.e., one never rounds gestational age up, so 36 weeks and 6 days of gestation is 36 weeks and not 37 weeks of gestation)) ([@ref1]). All newborns are subject to decline in hemoglobin levels in the first weeks after birth. In neonatology, this condition is often called physiological anemia of the newborn. In healthy term infants, clinical signs or symptoms of anemia are absent; this normal decline in Hb is referred to as "physiologic" or "early anemia of infancy" ([@ref2]). It was noted that the lowest value of hemoglobin in term infants rarely fall below 100 g/L in age from 10 to 12 weeks ([@ref3]). In contrast, anemia in preterm infants (anemia of prematurity) is the pathophysiological process with larger and faster drop in hemoglobin. Consequently, there is a need for blood transfusion and application of human recombinant erythropoietin. Generally, it is considered that at the age of 4-6 weeks, premature infants of birth weight between 1000 and 1500 grams have hemoglobin value about 80 g/L, while premature infants of birth weight less then 1000 grams have hemoglobin value about 70 g/L ([@ref3]). Preterm infants are faced with the appearance of anemia of prematurity due to several main reasons ([@ref4]). The first is the shortened gestational age - when it is shorter the clinical presentation is more severe. Another reason is the underdevelopment of the hematopoietic system in preterm infants ([@ref2]). The third, very important cause of anemia are repeated acts of taking blood for laboratory analysis.
2. AIM {#sec1-2}
======
The aim of this study was to determine the frequency of clinical manifestations of anemia in premature infants at the Pediatric Clinic, University Clinical Center Sarajevo, accompanied by a drastic drop in hemoglobin and hematocrit in the blood count and a need for treatment in high-risk groups of premature infants of gestational age below 32 weeks, compared to a group of premature infants over 32 weeks and the linkage of perinatal and neonatal risk factors with the development of anemia of prematurity as well.
3. PATIENTS AND METHODS {#sec1-3}
=======================
Research has been set as a retrospective analysis of the characteristics of anemia of prematurity in the period of the first six months of year 2014. The study included 100 patients, gestational age \< 37 weeks (premature infants), who were admitted to, after giving birth, at the Department of Neonatal Intensive Care at the Pediatric Clinic, of Clinical Center of Sarajevo University (UCCS). Inclusion criteria in the study were: the patient is a premature infant gestational age \< 37 weeks and the patient's first admission at the Department of Neonatal Intensive Care. Exclusion criteria were no data on: gestational age of the patient, the blood count at the admission, the number of received transfusions and administration of iron therapy. Analytical and descriptive methods were used. Data were collected by examining the medical records of patients at the Pediatric Clinic, UCCS. Statistical analysis of the collected data was performed through SPSS ver. 21.0. Data obtained after statistical analysis were presented in tables and figures, using Microsoft Office Excel 2007. Statistical analysis was performed by it-test. The level of significance of P \< 0.05 was considered statistically significant.
4. RESULTS {#sec1-4}
==========
There were two groups of patients, the first, children of gestational age ≤ 32 weeks, and the second, children of gestational age 33--37 weeks. In the first group there were 62/100 patients (62 %), while in the second 38/100 (38 %) patients . The larger number of patients in each group were males ([Table 1](#T1){ref-type="table"}). Data analysis demonstrated a statistically significant difference (P \<0.01) between the two groups of patients, in terms of body weight at birth ([Table 2](#T2){ref-type="table"}).
######
The gender structure of patients by the groups

######
The birth weight of patients

There was a statistically significant difference between the infants of gestational age ≤ 32 weeks and gestational age 33-37 weeks, in terms of APGAR score in the first minute (P \<0.001), and after 5 minutes (P \<0.004) ([Table 3](#T3){ref-type="table"}).
######
APGAR score in the first and fifth minute

In the first group, 16.13 % of children were reanimated, and in the second 5.26 %. The statistical analysis did not show any significant difference in the number of resuscitations of children between groups. In terms of deaths, 27.42 % of children in the first group had a lethal outcome, and 10.53 % of children in the other. It is proved a statistically significant difference in mortality between groups (P \<0.04).
######
The number of resuscitation and deaths

Statistical analysis demonstrated a statistically significant difference in the number of erythrocytes between groups of patients gestational age ≤ 32 weeks, and those of gestational age 33-37 weeks ([Table 5](#T5){ref-type="table"}.). However, there wasn't a significant difference in the level of hemoglobin and hematocrit between the two groups ([Table 6](#T6){ref-type="table"}-[T7](#T7){ref-type="table"}).
######
The number of erythrocytes in blood count at admission

######
The value of hemoglobin in blood count at admission

######
The value of hematocrit in blood count at admission

Out of 62 children, 18 children gestational age ≤ 32 weeks received a blood transfusion, while only 3/38 of children gestational age 33--37 weeks needed transfusion ([Table 8](#T8){ref-type="table"}). Statistical analysis showed a significant difference (P \<0.01) between mentioned groups in terms of the need for transfusion.
######
The number of patients with applied blood transfusion

It is observed that the bleeding occurred in patients of gestational age ≤ 32 weeks, and in other patients it did not occur. However, statistical analysis showed no significant difference between groups. [Table 9](#T9){ref-type="table"} provides information about the time of administration blood transfusions to patients which had an intracranial hemorrhage. 50% of these patients received blood transfusion in the first week of life, which is statistically significant (P = 0.000) in terms of association between intracranial hemorrhage and transfusion applications in the first week. However, this pattern is not sufficiently representative for the adoption of concrete conclusions, because of small number of such patients.
######
The connection of bleeding with the application of blood transfusion in the first week

In the group of patients ≤ 32 weeks of gestational age, iron is introduced into therapy on average 34^th^ day of life, while in second group of patients, it began on average on 32^th^ day ([Table 10](#T10){ref-type="table"}). There was no statistically significant difference between the two groups in term of iron therapy.
######
The beginning of iron therapy

There was a statistically significant difference (P \<0.005) in the length of treatment in patients of gestational age ≤ 32 weeks and those of gestational age 33--37 weeks ([Table 11](#T11){ref-type="table"}).
######
The length of treatment

5. DISCUSSION {#sec1-5}
=============
Anemia of prematurity is the focus of clinical trials in the last decade, with still uncoordinated approach, moving from observational approach and occasional controls of hematological status, limited use of erythropoietin, to liberal or today more often, restrictive practice of transfusion of packed RBCs. Based on research conducted in recent years, protocols are established, which include in evaluation the level of hemoglobin, the level of respiratory disease and the traditional signs and symptoms of pathological anemia. In this study, the premature infants are divided into two groups based on gestational age. Premature infants of gestational age ≤ 32 weeks (62 % of patients) were in the first group, while premature infants of gestational age between 33-37 weeks (38 % of patients) were in the second group. The division is modeled on other studies, which state that the anemia of prematurity is significantly more pronounced in infants gestational age ≤ 32 weeks, compared to the rest of preterm infants. Cassady G. and Rosenkrantz T. ([@ref5]) state that a half of prematurely born children, who belong to this group, develop anemia, as it typically does not occur in children of gestational age of 33-37 weeks. In a similar way, a study by Wardrop and associates was done ([@ref6]), with the difference that, they are the second group divided into two, where one did infants gestational age 33-35 weeks, and the other infants gestational age 35-37 weeks.
The | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-genes-10-00573}
===============
In monocotyledonous cereal crops, such as rice (*Oryza sativa* L.), wheat (*Triticum aestivum* L.), barley (*Hordeum vulgare* L.), and rye (*Secale cereale* L.), as well as several forage grasses, the inflorescence is characterized by bristle-like extensions, called awns, adhered at the tip end of the lemmas in the florets \[[@B1-genes-10-00573]\]. Awn formation and development rely on lemma primordium, which produces awn meristem as the lemma apex continues to elongate \[[@B2-genes-10-00573]\]. The sequence of awn development events is a complex process, involving morphological features, such as inflorescence density and glume length to control awn length \[[@B3-genes-10-00573]\], growing conditions \[[@B4-genes-10-00573]\], and genetic mechanisms \[[@B5-genes-10-00573]\]. Awns are beneficial in wild species because they aid in seed dispersal, as the barbed awns adhere the seed to animal fur \[[@B6-genes-10-00573]\]. They repel seed-eating birds and animals. Long awns are also easily controlled by external dispersal factors such as wind, and their movement may propel the seed into the ground, which enables self-planting \[[@B7-genes-10-00573]\]. Awns are also effective for light interception and CO~2~ uptake because photosynthates travel easily from awns to the growing kernels \[[@B8-genes-10-00573]\]. Evidence in barley \[[@B1-genes-10-00573],[@B5-genes-10-00573]\] and in wheat \[[@B8-genes-10-00573],[@B9-genes-10-00573]\] revealed that awns are coupled with grain yield increase, particularly in drier and warmer environments. Despite the undisputable importance of awns especially in nature, long and barbed awns deter manual harvesting and interfere with seed-processing activities, that is, malting and milling \[[@B10-genes-10-00573]\]. In forage barley cultivars, long and barbed awns increased bulky fibers, hindering forage quality and palatability \[[@B11-genes-10-00573]\].
In transverse sections, the awns of barley, wheat, oat, and rye are triangular-shaped with three vascular bundles and two strands of chlorenchyma tissues, and they may contribute to photosynthesis. Awns of rice, on the contrary, have a round shape in transverse section with single vascular bundles and a lack of chlorenchyma tissues, implying their minor contribution to photosynthesis \[[@B1-genes-10-00573]\]. Supporting this observation, awn removal experiments revealed a minor impact on grain yield and, consequently, rice species with shorter or nonexistent awns were preferred by early cultivators to enhance harvesting and postharvest processing. This is in contrast with some other domesticated cereals, such as barley and wheat, where the removal of awns led to yield loss. Thus, most cultivated barleys and wheats possess long awns \[[@B12-genes-10-00573]\].
Previous genetic studies identified several awn-related quantitative trait loci (QTLs) in several major cereals, and several genes were recently cloned in some. In this respect, the genetic basis of awn development was deeply investigated in rice, and allowed researchers to identify many QTLs associated with awn growth on almost all chromosomes \[[@B13-genes-10-00573],[@B14-genes-10-00573]\]; furthermore, some of their causal genes were dissected molecularly \[[@B12-genes-10-00573],[@B13-genes-10-00573],[@B14-genes-10-00573],[@B15-genes-10-00573],[@B16-genes-10-00573],[@B17-genes-10-00573]\]. In barley, functional advancements regarding genetic mechanisms of awn development emerged recently, with the cloning and characterization of genes such as *Lks1* \[[@B18-genes-10-00573]\] and *Lks2* \[[@B1-genes-10-00573]\]. Although genes causing awn development in wheat are not yet cloned, scientists identified the main inhibitors of awn development in some wheat cultivars \[[@B19-genes-10-00573]\].
Despite the undisputable role of awns for inflorescence architecture and their putative impact for yield determination, details regarding how the awn is formed and how its morphology is variable among species remain elusive, and a clear model explaining the awn developmental process is needed. As such, it demands solid and basic skills of the major plant developmental processes. Our aims in this review are (1) to discuss the phenotypic evolution of awns by illustrating morphological structures of the awn and physiological changes during awn development, and (2) to assess the genetic basis associated with awn development and variation in major cereal crops. Understanding awn development is essential for agriculture, with respect to improving yield and quality traits of grass species.
2. Morphological and Histological Characteristics of the Awn {#sec2-genes-10-00573}
============================================================
2.1. Morphological Features of the Grass Inflorescence {#sec2dot1-genes-10-00573}
------------------------------------------------------
The grass inflorescence is a unique, complex structure, different from those of most other plants. It comprises one to several structural units called florets, packed together in a spikelet \[[@B20-genes-10-00573]\]. The spikelet is the basic unit of the grass floral structure, usually comprising glumes (either empty glumes or rudimentary) and one to several florets. The floret, the spikelet's individual unit, consists of a lemma (which extends in the functional awn in some grasses), a palea, and reproductive organs, including the stamens, pistils, and lodicules \[[@B21-genes-10-00573]\]. The arrangement of spikelets and the number of florets are key determinants of inflorescence type in grass species. Based on the arrangement of spikelets, the three most well-known kinds of grass inflorescence are spike, raceme, and panicle. A spike is an unbranched inflorescence in which spikelets are attached directly to the main axis, as in wheat, barley, and rye. A raceme is an unbranched inflorescence in which spikelets are attached to the main stem by pedicels, as in *Festuca*, some *Danthonia*, and *Avena*. A panicle is a branched inflorescence with spikelets attached to the side branches rather than the main stem with or without pedicels, such as what is found in rice and oats \[[@B22-genes-10-00573]\]. The inflorescence meristem may be classified based on floral meristem determinacy. The inflorescence is determinate, when the main axis always ends in an apical spikelet, as in wheat, rye, and oats. The inflorescence is indeterminate, when the main axis never becomes terminated by a spikelet and continues to initiate branches and a number of fertile spikelets, as in barley and maize \[[@B2-genes-10-00573],[@B23-genes-10-00573]\].
Spikelets are modified units defining the inflorescence structure of grass species. Based on the presence or absence of pedicel, a small stalk or stem connecting the flower to the main axis, spikelets may be sessile or pedicelled. Sessile spikelets are connected directly to the axis, whereas pedicelled spikelets are attached to the axis by the stalk \[[@B22-genes-10-00573]\]. Scientists also classified spikelets referring to the position of the spikelets in the main inflorescence. Basal spikelets are located in the bottom, central spikelets in the center, and apical spikelets on the top of the inflorescence \[[@B23-genes-10-00573]\]. Variation of the grass floral morphology contributes greatly to the diversity of grass spikelets. For instance, the presence of fertile florets (those possessing a caryopsis) and sterile florets (empty glumes) raised arguments in the classification of spikelets. A fertile spikelet contains one to several fertile florets, whereas a sterile spikelet contains only sterile florets \[[@B2-genes-10-00573],[@B23-genes-10-00573]\]. Furthermore, the grass inflorescence is usually composed of both male and female structures. In some cases, the spikelet may possess imperfect flowers with only male or female structures. For instance, the staminate spikelet only contains stamens, whereas the pistillate spikelet only possesses pistils \[[@B24-genes-10-00573]\]. Spikelets can also be classified based on the presence or absence of awns. The awned spikelet possesses at least one but sometimes several awns, while the awnless spikelet possesses no awn in any form \[[@B25-genes-10-00573],[@B26-genes-10-00573],[@B27-genes-10-00573]\].
2.2. Awn Anatomy and Histology {#sec2dot2-genes-10-00573}
------------------------------
Awns are characteristic features of grass inflorescence \[[@B7-genes | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Patients with chronic kidney disease (CKD) are usually recommended to maintain low protein diet to slow down renal function deterioration [@B1]. It is well-recognized that progressive decline of renal function with aging is common [@B2]. However, higher protein intake can prevent protein-energy malnutrition in the elderly. Therefore, how to adjust protein intake appropriately for the elderly with CKD is an important issue. For elderly population without CKD, the recommended protein intake is over 0.8 g/kg/day [@B3]. It has been estimated that 10 to 35 % of elderly people take protein below minimal requirement (0.7 g/kg BW/day) [@B4]. In order to minimize the progression of sarcopenia, increased protein intake to 1.0-1.3 g/kg/day was suggested [@B5]. In a national-wide study, glomerular filtration rate (GFR) less than 30 mL/min/1.73 m^2^was an independent factor associated with malnutrition for older adults [@B6]. Collectively, it would be better to individualize the amount of protein intake by close monitoring renal function and muscle wasting status in the elderly. Previous studies of body compositions of patients with CKD are usually with small numbers and mostly included patients with age less than 60 [@B7], [@B8]. The concern on safety of low protein diet for elderly patients is raised but only little information is available.
Anorexia, dietary restriction, acidosis, and inflammation in CKD patients can increase the risks of cachexia and protein-energy wasting syndrome [@B9]. Muscle wasting is associated with increased mortality in patients with chronic illness [@B10]-[@B12]. Therefore, it is indicated to assess body composition and monitor muscle mass in these patients. Serial body composition measurements can detect changes in muscle mass and provide additional information of nutritional status than common nutritional markers, such as body weight, body mass index (BMI), and serum albumin [@B12], [@B13]. Dual energy X-ray absorptiometry (DXA) is the gold standard for body composition assessment. However, the machine occupies large space with high cost, and is not recommended for routine clinical use.
In the present study, bioelectrical impedance analysis (BIA) with tetra-polar impedance meter was employed for the determination of body composition. We analyzed the effects of low protein diet on body compositions of CKD patients. We also compared the alterations of body composition between elderly and non-elderly patients.
Patients and methods
====================
Patients with eGFR ≤ 45mL/min/1.73m^2^ (CKD stage 3b) regularly followed up in nephrology clinics were recruited. Patients were excluded if they had chronic heart failure (New York Heart Association Functional Classification System, ≥ stage III) or active infection, and any of which might affect dietary intake, such as swallowing difficulty or cancer under treatments. Subjects with contraceptive devices, metallic transplant, liquid filled catheter, or pregnancy were excluded as well. This study was approved by Chang Gung Medical Foundation Institutional Review Board (101-3599B). All participants involved gave written informed consent.
Demographic data including gender, age, body weight, body height, BMI were collected. Diabetes mellitus (DM) was defined as patients who were receiving oral anti-diabetic or insulin treatment; with fasting blood sugar ≥ 126 mg/dL or random blood sugar ≥ 200 mg/dL with associated symptoms. Blood pressure was measured at every visit. Laboratory data including serum creatinine, albumin, hemoglobin, glycosylated hemoglobin, total cholesterol, high-density lipoprotein, low-density lipoprotein, and triglyceride were measured at baseline and one year later. The eGFR was calculated by using Modification of Diet in Renal Disease (MDRD) formula [@B14]. The participants received dietary counselling and their body compositions were measured every three months for one year. The registered dietitians calculated the energy and protein intake of these CKD patients from each interview. Dietary counselling was individualized and focused on educating and advising patients about food portions, selections and preparations. For participants\' understanding and encouraging them doing exercise, the registered dietitians interpreted the results of body composition measurement to all participants. The low protein group was defined as average protein intake ≤ 0.8 g protein /kg/day [@B15]. The rest of enrolled patients were defined as non-low protein group. Age greater than 60 was defined as the elderly group in the present study.
Waist circumference was measured at the midway between the lowest rib and iliac crest. The participants were instructed to fast for 4-hours before body composition measurement. The assessment of body composition followed the manufactory\'s protocol of the bioelectrical impedance analysis (BIA) (ioi 353, Jawon Medical, S. Korea). The BIA device measured five body segments (right arm, right leg, left arm, left leg, and trunk) via tetra-polar electrode method using 8 touch electrodes. Appendicular skeletal muscle mass (ASM) index is calculated as muscle of limbs measured by BIA divided by height squared (kg/m^2^) [@B16], [@B17].
Statistical methods
-------------------
All statistical analyses were performed using statistical SPSS version 19 software (IBM Corporation). Data were presented as mean ± standard deviation or percentage as appropriate. Continuous variables were compared using ANOVA or the Mann-Whitney U test. Comparison of body compositions at baseline and every 3 months was analyzed by paired t test or Wilcoxon test. A p value \< 0.05 was considered as statistically significant.
Results
=======
A total of CKD patients including 103 elderly patients and 56 non-elderly patients were recruited. Table [1](#T1){ref-type="table"} displays their baseline characteristics of non-low protein and low protein groups in different age groups. The mean age of elderly CKD patients was significantly greater than the non-elderly group (70.2 ± 6.8 vs. 50.7 ± 8.9 and 70.2 ± 7.3 vs. 46.8 ± 9.5 in non-low and low protein groups respectively, both p \< 0.001). Diabetes accounts for 23% of enrolled patients. In elderly patients, protein and energy intake were significantly lower in low protein group than non-low protein group (0.71 ± 0.06 g/kg and 23.3 ± 2.5 kcal/kg vs. 1.01 ± 0.17 g/kg, 29.0 ± 4.2 kcal/kg, both p \< 0.001). There were no significant differences in blood pressure, BMI, waist circumference and eGFR. The biochemical data was similar between two groups. Elderly patients in low protein group had higher body fat percentage and lower muscle percentage than non-low protein group (p \< 0.05). No difference was noted in their ASM index. In the non-elderly patients, low protein group had lower protein intake and energy intake (both p \< 0.001). Their body compositions did not differ between two protein groups. We further compared elderly and non-elderly patients in either non-low or low protein groups. In non-low protein patients, diastolic blood pressure was higher in non-elderly patients (p \< 0.05). In the low protein groups, non-elderly patients had higher serum albumin levels and lower total cholesterol levels than the elderly patients (both p \< 0.05). Comparison in body composition revealed non-elderly patients had lower body fat percentage and higher muscle percentage than the elderly (both p \< 0.05).
Table [2](#T2){ref-type="table"} represents the baseline and 1-year follow-up data of non-elderly patients. In one year, we found there was significant decline of eGFR in non-low protein group while the eGFR was not influenced in low protein group. The biochemical data and body composition did not change significantly in 1-year follow up either in non-low or low protein groups. Table [3](#T3){ref-type="table"} presents the changes in elderly CKD patients. There was significant decrease in BMI and eGFR in the non-low protein group after 1-year follow-up. Modest but significant increase in albumin level was noted. Their hemoglobin level was decreased. Measurement in body composition indicated that a significant decrease in fat and increase in muscle component after 1 year (both p \< 0.05). In low protein group, their BMI was decreased and levels of serum albumin and triglyceride were increased significantly. Comparison in body composition revealed decrease in fat percentage, including total body and trunk fat. The muscle component was increased (p \< 0.05). Similar to the results of comparison in baseline, after 1 year, there were significant differences between non-low and low protein groups in fat and muscle distribution. Patients in low protein group had higher percentage of fat and lower percentage of muscle (both p \< 0.05). There was no significant change in ASM index after 1-year follow-up in both groups.
We further analyzed the serial changes of muscle percentage in every 3 months body composition measurements. As shown in figure [1](#F1){ref-type="fig"}, elderly CKD patients had lower muscle percentage than the non-elderly CKD patients. The percentage did not change significantly in non-elderly patients in one- year follow-up. There was significant increase at 12 months measurement in the elderly patients.
Discussion
==========
Our study clearly demonstrated that diet intervention with low protein therapy did not affect nutritional status in CKD patients. Furthermore, in elderly CKD patients, despite their progressive decrease in BMI, low protein diet was associated with increased serum albumin level and their muscle mass were preserved. In 1-year follow-up, there was a significant decline of eGFR in patients with non-low protein intake.
| {
"pile_set_name": "PubMed Central"
} |
1. Background {#sec1}
=============
The toxicity of anticancer drugs to noncancer cells is an important barrier that limits the efficacy of anticancer drugs \[[@B1]\]. In addition, drug resistance of cancer cells due to mechanisms such as increased drug efflux, alteration or mutation of drug targets, alterations in DNA repair, and evasion of apoptosis \[[@B2]\] often limits the efficacy of anticancer drugs. The presence of a subpopulation of cancer stem cells (CSCs) or cancer stem-like cells (CS-LCs) associated with chemoresistance and tumor relapse has been also linked to poor response to chemotherapy in many cancers \[[@B3]\]. Novel therapeutic options that selectively target cancer cells, especially those with high resistance to anticancer drugs, with little or no toxicity to normal cells have been the focus of intensive research but the success has been limited. For instance, the success of targeted therapies that interfere with specific proteins involved in tumorigenesis rather than using broad base cancer treatments has been limited by the difficulty in identifying specific cancer biomarkers \[[@B4]\] and to the development of acquired drug resistance through mutations in targeted proteins or through the adaptation of alternate cancer cell survival strategies \[[@B5]\]. Drugs that more selectively target CSCs/CS-LCs have been identified but once again toxicity to normal cells limits the clinical application of these drugs. For instance, Salinomycin has been identified as a highly specific drug toward cancer stem cells \[[@B6]\] but its use in humans has been limited probably due to the considerable toxicity observed in mammals \[[@B7]\].
Tumorspheres are useful model for screening of drugs since they are enriched in cancer stem cells (CSCs) or cancer stem-like cells (CS-LCs) that are usually more resistant compared to non-CSCs/CS-LCs \[[@B8]\], and it is thought that the ability to form clonal spheres is a unique characteristic of CSCs \[[@B9], [@B10]\]. The ability to sustain proliferative signaling and divide in the absence of exogenous mitogenic stimulation leading to unregulated proliferation is considered one hallmark of cancer cells \[[@B11]\]. This has been demonstrated for glioma \[[@B12], [@B13]\], lung \[[@B14]\], and breast CSCs/CS-LCs \[[@B15]\] that can form spheres in serum-free media without exogenous mitogens. Lung tumorspheres (LTs) and mammospheres (MSs) obtained in the absence of any external mitogenic stimulation showed increased resistance to conventional anticancer drugs such as Paclitaxel (PX), hydroxyurea (HU), Colchicine (CX), and Obatoclax (OBT). We have also reported that adherent H460 lung and breast cancer cells that survive prolonged periods of serum starvation divide slowly and become highly resistant to PX, HU, CX, OBT, and the PI3 kinase inhibitors Wortmannin (WT) and LY294002 (LY) \[[@B16], [@B17]\]. LTs showed elevated expression of stemness-associated markers that may contribute to the multiresistant phenotype associated with CSCs/CS-LCs. On the other hand, the multiresistant phenotype of cells growing under PPSS is likely the result of extensive rewiring of signaling pathways rather than increased stemness \[[@B16]\]. These traits make cells growing under PPSS and tumorspheres useful complementary models to screen drugs able to overcome multidrug resistance as well as to identify the underlying mechanism(s). VP is a calcium channel blocker that has been shown to inhibit the activity of the MDR1 protein and has shown potential as a sensitizing agent to overcome the chemoresistance of CSCs/CS-LCs in a variety of cancers including lung \[[@B18]\], pancreatic \[[@B19]\], and breast \[[@B20]\] cancer cells. Sorafenib (SF) is a multikinase inhibitor that also inhibits the activity of the ABGC2 multidrug-resistant protein. However, combinatorial treatment using VP and SF has not been extensively characterized.
The aim of this study was to evaluate the effect of VP in combination with SF in lung cancer cells growing under PPSS as well as tumorspheres. We found that short term-exposure to VP + SF selectively and irreversibly decrease the viability, likely by activating necroptotic cell death, of cancer cells growing under PPSS or as tumorspheres but have little or negligible effect on noncancer cells or in cancer cells growing under RCCs.
2. Methods {#sec2}
==========
2.1. Chemicals and Reagents {#sec2.1}
---------------------------
### 2.1.1. Drugs {#sec2.1.1}
Verapamil (VP), z-VAD-FMK (zVAD), chloroquine (CQ), poly-HEMA (poly(2-hydroxyethyl methacrylate)), and MTT (thiazolyl blue tetrazolium bromide) were purchased from Sigma-Aldrich (St. Louis, MT). Sorafenib (SF) necrostatin 1 (Nec1), and 1-methyl-D-tryptophan (1-D-M-T) were purchased from VWR (Radnor, PA). Stock solutions of SF (10 mM), Nec1 (10 mM), and zVAD (10 mM) were in DMSO and stored in aliquots at −20°C. CQ was prepared as stock solution (10 mM) in distilled sterile water and filter sterilized and stored in aliquots at −20°C. VP (50 mM) was freshly prepared in distilled sterile water and filter sterilized. 1-D-M-T (20 mM stock solution) was prepared by dissolving in 0.1 N NaOH, and the pH was adjusted to 7.5 using hydrochloric acid, filter sterilized \[[@B21]\], and stored in aliquots at −20°C. Final dilutions were freshly prepared in culture media before use.
### 2.1.2. Cell Culture {#sec2.1.2}
The human lung epithelial cancer cell line NCI-H460 and the noncancerous cell line Beas-2B were obtained from American Type Culture Collection (Manassas, VA). Beas-2B cells are epithelial cells that were isolated from normal human bronchial epithelium obtained from the autopsy of noncancerous individuals ([http://www.atcc.org](http://www.atcc.org/)). For routine culture conditions (RCCs), cells were plated and propagated in complete media (CM) = RPMI 1640 (for NCI-H460) or DMEM/high glucose (for Beas-2B) supplemented with 5% FBS, L-glutamine, 100 U/ml penicillin, and 100 mg/ml streptomycin. Glutamine concentrations in RPMI-1640 and DMEM/high-glucose media were 2 or 4 mM, respectively. All cells were cultured in a 5% CO~2~ environment at 37°C. For cells growing under routine culture conditions (PPSS) or growing as floating tumorspheres, cells were maintained in serum-free media (same as CM but without FBS, see details below).
### 2.1.3. Generation of Lung Tumorspheres (LTs) {#sec2.1.3}
A detailed protocol for the generation of floating tumorspheres grown in the absence of any external mitogenic stimulation can be found in Yakisich et al. \[[@B15]\]. Briefly, H460 cells grown in CM (70--80% confluency) were cultured overnight in serum-free media (SFM, same as CM but without FBS). Then, cells were trypsinized and incubated in SFM for at least 14 days in poly-HEMA-coated plated to prevent attachment. For maintenance of LTs, the SFM was replaced every 3-4 days. LTs grown in SFM for 14--21 days were used for subsequent experiments.
### 2.1.4. Short-Term Antiproliferative Assay (MTT Assay and CCK Assay) {#sec2.1.4}
For routine culture conditions and adherent cultures (parental H460 and Beas-2B), cells were plated in 96-well cell-culture microplates (Costar, USA) at \~2000 cells per well and incubated overnight in CM. For cells growing under prolonged periods of serum starvation (PPSS), cells (\~500 cells/well) were plated in 96-well cell-culture microplates and incubated overnight in CM to allow them to adhere and then maintained in SFM for 7--12 days. Then, the cells were exposed to the appropriate concentration of drug or vehicle for 24--72 h. Cell viability for adherent cells was evaluated by the MTT assay. The absorbance of solubilized formazan was read at 570 nm using Gen 5 2.0 All-In-One microplate reader (Bio-TEK, Instruments Inc.). For floating LTs and MSs, cells growing in poly-HEMA plates were collected in 15 ml Falcon tubes, centrifuged at 700 rpm × 3 min, and resuspended in fresh SFM. In order to plate the same number of cells, this cell suspension was split in 1 ml aliquots. Vehicle or drugs were added to each aliquot and then 150 *μ*l cell suspension was loaded into each microwell (in a 96-well plate) and incubated for 72 h. For floating LTs, cell viability was evaluated by the CCK-8 assay (Dojindo Laboratories).
In all cases, the highest concentration of DMSO was used in the control and this concentration was maintained below 0.01% (*v*/*v*). This DMSO concentration did not show any significant antiproliferative effect on the cell lines or tumorspheres in a short-term assay | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
The placental cells arising from the outer layer of the blastocyst, the trophoblast, differentiate along either the villous or extravillous pathways. Extravillous trophoblast (EVT), invade into the pregnant uterus (decidua) where they interact with maternal cells, including decidual natural killer (dNK) cells. These comprise ∼70% of the decidual immune cell population and are a distinct subset of NK cells. They display a large granular lymphocyte morphology and are CD56^bright^CD16^−^, as opposed to peripheral blood natural killer cells, where the predominant population is CD56^dim/−^CD16^bright^ ([@DEU017C21]). During early pregnancy, maternal uterine spiral arteries are remodelled from low-flow, high-resistance vessels into higher flow vessels with low-resistance. The extent of EVT invasion is critical for implantation and remodelling of the uterine spiral arteries ([@DEU017C32]), and EVT have been shown to play an active role in regulating the remodelling events ([@DEU017C2]; [@DEU017C19]; [@DEU017C14]). However, there is now considerable interest in the role that other cells, particularly the dNK cells, may have in regulating trophoblast invasion.
dNK cells produce a number of soluble factors such as cytokines, growth factors and pro-and anti-angiogenic proteins, in contrast to peripheral blood NK cells, which have a more cytotoxic role in defence ([@DEU017C39]). Trophoblast invasion and spiral artery remodelling are complex processes, with many interactions taking place between the various cell types in the decidual environment. The appropriate regulation of these processes is likely to be influenced by the levels of dNK cell-derived factors since they are located in close proximity to both invading EVT and remodelling vessels and several dNK-derived cytokines, chemokines and growth factors have been identified at the fetal--maternal interface ([@DEU017C13]; [@DEU017C25]). For example, interferon (IFN)-γ may modulate both chemokine expression and trophoblast activity to limit invasion ([@DEU017C29]).
In pregnancies complicated by pre-eclampsia and intrauterine growth restriction, shallow trophoblast invasion and insufficient spiral artery remodelling have been observed ([@DEU017C4]; [@DEU017C31]; [@DEU017C26]). Poor spiral artery remodelling is established in the first trimester of pregnancy. However, human studies are restricted by a lack of access to first trimester tissue with a known pregnancy outcome or a known stage of spiral artery remodelling. Doppler ultrasound scanning can be used to measure the resistance index (RI) of uterine artery blood flow, reflecting the level of remodelling in the spiral arteries, and therefore can be used as a proxy measure of the remodelling process. In this study, we have used this technique to identify pregnancies at the highest risk (21%) and at lowest risk (\<1%) of developing pre-eclampsia ([@DEU017C35]), with the highest and lowest evidence of first trimester poor spiral artery remodelling.
In this study, the factors produced by isolated dNK cells were examined and the role that two of these factors, angiogenin and endostatin, may play in modulation of trophoblast activity during pregnancy was investigated.
Materials and Methods {#s2}
=====================
Doppler ultrasound of uterine artery resistance and ethical approval {#s2a}
--------------------------------------------------------------------
Maternal uterine artery Doppler ultrasound scans were conducted on women attending a clinic for elective termination of pregnancy as previously described ([@DEU017C27]; [@DEU017C36]). Wandsworth Local Research Ethics Committee approval was in place for both the Doppler ultrasound before surgical termination and the use of first trimester tissue after the termination, and all women gave informed written consent. Terminations of pregnancy were carried out at 9--14 weeks of gestation. All were singleton pregnancies, with no known pre-existing medical conditions. High-RI cases were defined as those presenting with bilateral uterine diastolic notches and a mean RI above the 95th percentile, while normal-RI cases were defined as presenting with no diastolic notches and a mean RI below the 95th percentile. These two RI groups represent cases with the most (21%) and least (\<1%) likely chance of developing pre-eclampsia, had the pregnancy not been terminated ([@DEU017C27]).
Positive selection of dNK cells {#s2b}
-------------------------------
Products of conception were obtained immediately after surgical termination of pregnancy. NK cells were isolated from decidual tissue using positive selection with anti-CD56 antibody coated magnetic beads (Miltenyi Biotec, Surrey, UK) as previously described ([@DEU017C9]). Purity was 93.6 ± 1.3% (mean ± SEM, *n* = 19 patients).
Cell culture {#s2c}
------------
The well-characterized human EVT cell line, SGHPL-4, is derived from primary human first trimester EVT ([@DEU017C6]; [@DEU017C5]). SGHPL-4 cells were cultured in Hams F10 media supplemented with 10% (v/v) fetal bovine serum (FBS), containing [l]{.smallcaps}-glutamine (2 mmol/l), penicillin (100 IU/ml) and streptomycin (100 µg/ml). All cells were incubated with 95% air and 5% CO~2~ at 37°C in a humidified incubator.
The isolated CD56^+^ NK cells were centrifuged at 400*g* for 10 min at 22°C and cultured for 24 h at 6 × 10^6^cells/10 ml in RPMI 1640 medium (Invitrogen, Paisley, UK) with 10% FBS, containing 2.5 µg/ml amphotericin B (Sigma Aldrich, Dorset, UK), 2 mM [l]{.smallcaps}-glutamine, 50 µg/ml penicillin and 50 µg/ml streptomycin (Invitrogen), 50 ng/ml stem cell factor and 5 ng/ml IL-15 (Peprotech, London, UK) at 37°C in a 5% CO~2~ humidified incubator. There was no significant difference between the gestational ages of the patients in either of the two groups (*P* = 0.235, high-RI group: *n* = at least 18 per test, mean gestational age 74.8 ± 2.4, normal-RI group: *n* = at least 18 per test, mean gestational age 77.48 ± 1.87).
Multiplex array {#s2d}
---------------
Factors secreted by dNK cells were quantitatively analysed by bead-based multiplexing \[angiogenin, endostatin, placental growth factor (PLGF); R&D Systems, Abingdon, UK, all other factors; Invitrogen, Life Technologies Ltd\] according to manufacturer\'s protocols with detection on a Luminex 100 system (Luminex, Austin, TX, USA). Culture supernatants from dNK cells isolated from individual patients were examined (*n* = at least 18 normal- and high-RI samples per test). Supernatants were tested at three concentrations; concentrated 5-fold (Vivaspin columns, Sartorius Stedim UK Ltd, Surrey, UK), neat and diluted 3-fold in serum-free medium. Results were corrected according to the cellular protein concentration determined by Bradford assay (Bio-Rad, Hemel Hempstead, UK) of the pelleted cells after collection of the culture supernatant. In the case of a factor being undetected in \>15% of the culture supernatants, this factor was reported but not included in the analysis. Statistical comparisons were made between the patient groups for the remaining factors.
Motility assay {#s2e}
--------------
SGHPL-4 motility in response to endostatin and angiogenin was assessed as previously described using time-lapse microscopy ([@DEU017C12]). SGHPL-4 cells were seeded in Hams F10 media supplemented with 10% (v/v) FBS before overnight incubation in Hams F10 media supplemented with 0.5% (v/v) FBS. Recombinant human endostatin (Peprotech) was incubated with the SGHPL-4 cells in serum-free media alone or in the presence of 10 ng/ml epidermal growth factor (EGF) at concentrations of 50, 500 and 5000 ng/ml for 24 h (*n* = 4); angiogenin (R&D Systems) was incubated with the SGHPL-4 cells alone or in the presence of 10 ng/ml EGF at concentrations of 10, 100 and 1000 ng/ml for 24 h (*n* = 4). Cells were randomly chosen at the beginning of the experimental sequence and their movement was tracked manually using Image-J software (version 1.47d, National Institutes of Health, USA).
Invasion assay {#s2f}
--------------
Invasion of SGHPL-4 cells in response to recombinant endostatin and angiogenin was measured using a spheroid invasion assay as previously described ([@DEU017C45]). A volume of 100 µl of control medium or recombinant endostatin at 50, 500 and 500 ng/ml (*n* = 4) or angiogenin at 10, 100 and 1000 ng/ml (*n* = 4), with or without 10 ng/ml EGF, was added in serum-free media and spheroids were visualized after 24 h incubation using an Olympus 1X70 inverted microscope. Images were captured using a Hamamatsu C4742-95 digital camera. Invasion was measured as the average number and length of all invasive processes from each spheroid using Image-J software (version 1.47d).
Tube | {
"pile_set_name": "PubMed Central"
} |
1. Introduction
===============
According to the WHO \[[@B1-molecules-16-02726]\], about 450 million people in the entire world have suffered mental, neurological, or behavioral problems at some time in their life. Extensive research on plants and their derivatives has taken place in recent years that could provide some new alternative treatments and therapeutic uses for diseases of the central nervous system (CNS).
Epilepsy is the term used for a group of disorders characterized by recurrent spontaneous seizures that apparently result from complex processes involving several neurotransmitter systems such the glutamatergic, cholinergic, and gabaergic system. Actual estimations of the prevalence rate for epilepsy are 1--2% of the world population. Although a considerable number of classic and more modern anticonvulsant drugs are available for the pharmacological treatment of epilepsy patients worldwide, seizures remain refractory in more than 20% of the cases. In addition, all current antiepileptic drugs, which belong to several quite different chemical classes such as hydantoins, deoxybarbiturates, succinimides, benzodiazepines, iminostilbenes and carboxylic acids, have been obtained through chemical synthesis \[[@B2-molecules-16-02726]\].
Several species of aromatic plants are used medicinally because of their volatile oils or chemical components. In particular, some of them possess certain CNS properties, including antiepileptic action and have been traditionally used for a long time in folk medicine. Recent studies on essential oils and their main components have attracted the attention of many scientists and encouraged them to screen any of these natural products to study their chemical and pharmacological aspects that might potentially may lead to lead to the development of new anticonvulsant-like compounds with advantages over current therapeutic drugs \[[@B3-molecules-16-02726]\].
1.1. Chemistry of Essential Oils and Main Chemical Constituents
---------------------------------------------------------------
Aromatic plants are at present widely studied for their large therapeutic potential and benefits. These benefits depend largely on essential oils which, in general terms, occur in many herbs. The essential oils of the plant are the essence of their fragrance. They are called essential oils, ethereal oils, or volatile oils because they evaporate quickly when exposed to the air at ordinary temperatures. In general, the essential oils consist of chemical mixtures involving several tens to hundreds of different types of molecules. Only a few have a high percentage of a single component. These chemical constituents are divided into two broad classes: terpenes and phenylpropanoids. However, many volatile oils consist largely of monoterpenes, which are a group of terpenes having ten carbon atoms in the carbon skeleton and, therefore, are composed by two isoprene units \[[@B4-molecules-16-02726]\].
Essential oils are distilled from different parts of the plants including flowers, stem-bark, seeds, leaves, roots, and the whole herbs. They are used to give flavor to foods and drinks and as fragrances in the food and cosmetics industries, where numerous herbal plant and spice ingredients are components in the manufacture of skin creams, lip balms, shampoos, soaps and perfumes.
2. Methodology
==============
The present study was carried out based on the literature review of plants and their essential oils with anticonvulsant activity. All the information about 30 species with anticonvulsant activity is given in [Table 1](#molecules-16-02726-t001){ref-type="table"}. The list of plants is organized by family and botanical name, parts used and pharmacological activity, as described in the literature. Compounds isolated and references are also provided. The scientific names of the plants were based on W3Tropicos Database (<http://mobot.mobot.org/W3T/Search/vast.html>), and the abbreviations of author names are according to Brummitt and Powell \[[@B5-molecules-16-02726]\].
The plant species presented here were selected based on the effects shown by their essential oils in specific animal models used for evaluation of anticonvulsant activity and/or by complementary studies, aimed at elucidating the mechanism(s) of action of the oils or individual components.
The essential oils or the main constituents were deemed to display anticonvulsant activity when they had shown effects in one or more different seizure model, including the maximal electroshock (MES) model, the pentylenetetrazole seizures model (PTZ), the pilocarpine model and the prolonged PTZ-kindling model.
Some scientific publications that were excluded from this study because it was not possible to access their full text or because their abstracts were in a language different from English, included the following species, citing their psychopharmacological activities: *Apium graveolens* Cham., *Aralia continentalis* Kitag., *Asarum heterotropoides* F. Schmidt*, Asarum himalaicum* Hook. F. & Thomson ex Klotzsch*, Asarum ichangense* C.Y. Cheng & C. S. Yang, *Cumimum cyminum* L, *Eugenia uniflora* L*, Gardenia augusta* (L) Merr., *Gardenia jasminoides* J. Ellis, *Ligusticum sinense* Oliv., *Ocimum basilicum* L*. Oplopanax elatus, Radix bupleuri* and *Salvia sclarea.*
3. Results and Discussion
=========================
The plant diversity with confirmed activities in the central nervous system is dominated by higher plants, mainly by dicotyledons. In this review 30 species belonging to 13 families and 23 genera have been reported to possess anti-seizure activity.
The families in decreasing order of predominance of species with activity are Myrtaceae and Lamiaceae with five species each; Apiaceae with four species; Asteraceae and Poaceae with three species each and Araceae and Lauraceae with two species each. Six families, corresponding to 46 % of the total, are represented by only one species. Some of these species have other biological activities and are used for different purposes, like *Egletes viscosa* (L.) Less \[[@B6-molecules-16-02726]\], also mentioned for their antimicrobial activity.
The predominance of higher plants used for medicinal purposes confirms the results obtained in other ethno-medicinal surveys reported by Agra \[[@B7-molecules-16-02726],[@B8-molecules-16-02726]\]. This has also been documented by authors in different countries around the world such as Brazil \[[@B9-molecules-16-02726]\], Saudi Arabia \[[@B10-molecules-16-02726]\], Bolivia \[[@B11-molecules-16-02726]\] or Italy \[[@B12-molecules-16-02726]\], *inter alia*.
Several aromatic species had been employed since ancient times for their medicinal properties and also as aromatic agents and to give flavor to foods. The pharmacological uses of the plants are mainly attributed to their essential oils having a great variety of pharmacological activities such as prevention and treatment of cancer, against cardiovascular diseases and diabetes. They are also used as sources of gastro-protective, anti-inflammatory, antioxidant, and antibacterial agents. These varied effects are probably due to the high structural diversity of the essential oil constituents. The study of each individual chemical component is critical to understanding its mechanism of pharmacological action and toxicity, including potentially beneficial clinical effects on human health.
However, according to Lahlou \[[@B13-molecules-16-02726]\], the diversity of biological activities presented by the same essential oil has also stimulated discordance between researchers. Many reasons have been proposed for this variability, for example: (a) all the factors that have influence in the chemical composition; (b) the plant's state of maturation; and (c) the chemotypic difference, among others.
It is accepted that a refined assessment of the chemical composition of tested essential oils/constituents should be performed using GC/MS to perform a quantitative analysis, which would provides additional information of their contents and, consequently, confirmation of their therapeutic effects.
Thirty anticonvulsant chemical constituents of essential oils were mentioned. Most of these compounds are monoterpenes or phenylpropanoids ([Figure 1](#molecules-16-02726-f001){ref-type="fig"}). They are effective in several experimental models of seizure. These constituents must contribute to the anticonvulsant activity of bioactive essential oils, as presented in [Table 1](#molecules-16-02726-t001){ref-type="table"}. This pharmacological activity may be due to action of a major component or the effect of various bioactive components found in essential oil.
molecules-16-02726-t001_Table 1
######
Species and respective essential oils that showed anticonvulsant activity organized by botanical family, botanical name, part used, activity as described in the literature, compound isolated and references.
FAMILY *Species* PART USED ACTIVITY OF ESSENTIAL OILS (as described in the literature) MAIN COMPOUNDS ISOLATED/REFS.
----------------------------------------------------------------------------------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ------------------------------------------------------------------------------------------------------------------------------------------------------------------------
**APIACEAE** | {
"pile_set_name": "PubMed Central"
} |
{
"pile_set_name": "PubMed Central"
} | |
INTRODUCTION {#sec1-1}
============
Indoor air pollution is one of the environmental risk factor affecting mainly the rural population of developing countries. Comparative risk assessment by WHO attributes 1.6 million premature deaths annually to indoor smoke in developing countries.\[[@CIT1]\] The range of effects due to exposure to particulate matter due to combustion of biofuels is broad, affecting the respiratory and cardiovascular systems and extending to children and adults and to a number of large, susceptible groups within the general population.\[[@CIT2]\]
The mucociliary escalator is the primary defense mechanism against inhaled particulate matter. Mucociliary clearance comprises of the cephalad movement of mucus caused by the cilia lining the conducting airways until it can be swallowed or expectorated thereby protecting the human upper and lower airways from deleterious effects of inhaled pollutants, allergens, and pathogens.\[[@CIT3]\] The nasal mucociliary clearance (NMC) system transports the mucus layer that covers the nasal epithelium toward the nasopharynx by ciliary beating at a frequency of 7--16 Hz at body temperature and is controlled by certain physiological, anatomic, and biochemical variables.\[[@CIT4]\] Physiological factors such as age, sex, posture, sleep, exercise, temperature (\<10 °C and \>45°C) also influence the duration of NMC. When disruption of NMC occurs, respiratory secretions accumulate and impair pulmonary function, reduce lung defenses, and increase the risk for infection.\[[@CIT5]\] Tobacco smoke and environmental pollution due to combustion of biomass fuel are suspected to have a depressant effect on NMC and may lead to the development of various respiratory diseases. This also depends on factors such as pollutant concentration and the duration of exposure.\[[@CIT6]\] The underlying pathophysiology is stasis of sinonasal secretions due to ineffective sinonasal mucociliary clearance followed by subsequent bacterial overgrowth, frank infection, and/or inflammation. Nasal mucociliary clearance, the mirror image of bronchial mucociliary clearance is thus a biomarker of nasal mucosal function.\[[@CIT7]\]
Limited information is available regarding the effect of biomass fuel smoke on NMC in our country. Moreover, understanding the effect of biomass fuel smoke on NMC may advance our understanding of pathogenesis of chronic effects of such exposures. The mucociliary clearance of tracheobronchial tree can be assessed using bronchial spray mixed with radioactive compound and following with gamma camera, but it is a costly and cumbersome procedure and is not suited for field studies. Hence, this simple noninvasive method was chosen for this cross-sectional study to evaluate the mucociliary clearance in apparently healthy women dwelling in a periurban area using biomass fuel and clean fuel for cooking.
MATERIALS AND METHODS {#sec1-2}
=====================
This cross-sectional study was conducted in 30 apparently healthy biomass fuel users (life time users of wood, dung cake, crop residues) and 30 clean fuel users (life time liquefied petroleum gas users). Women with history of cooking exposure to either biomass fuel alone or clean fuel alone for a minimum period of 2 years were included in the study. These female subjects of age group ranging from 18 to 45 years were randomly selected from a periurban area in Chennai. Informed written consent was obtained from all the study subjects.
Details regarding cooking fuel, duration of exposure were collected using a pretested validated household questionnaire. Multiple fuel users (*n*=18), smokers/passive smokers (*n*=15), and tobacco chewers/snuff users (*n*=7), were excluded. A complete ear, nose, and throat examination was also performed to rule out diseases (sinusitis, nasal polyps, allergic rhinitis, and deviated nasal septum), which are known to affect the mucociliary clearance. Thereby, women with history of (h/o) deviated nasal septum/nasal polyp (*n*=2), allergic disorders (*n*=3), h/o intake of any medications particularly antihistaminics (*n*=2), respiratory or nasal symptoms within the preceding 2 weeks (*n*=2) were also excluded. Moreover, self-reported diabetes (*n*=3), and other factors such as primary ciliary dyskinesia, bronchiectasis, valvular heart diseases, bleeding diatheses, h/o exposure to formaldehyde, ammonia, phenols were also excluded from the study. Ten women refused to participate in the study in spite of their eligibility. Thus, 122 women were contacted in order to reach the desired sample size of 60 study subjects.
The nasal mucociliary clearance was studied using the saccharine method of Anderson *et al*.\[[@CIT8]\] A 1 mm particle of saccharine was placed on the floor of the nose, just behind the anterior end of the inferior turbinate and the test was carried out in sitting position with head flexed about 10° to avoid particle falling backwards and the time required by the subject to perceive the sweet taste was noted. The test was carried out on both nostrils with an interval of half an hour. The time of mucociliary clearance of each nostril was noted separately. Nasal mucociliary clearance time is the average time of the mucosal clearance of the two nostrils. The subjects were advised to avoid nasal manipulation, sniff, cough, inhale or exhale forcefully during the test, and were simply told to report any change in taste. Subjects were blinded about the nature of particle. (The subjects were informed that some harmless edible particle will be placed in the nostril and they were not informed about its nature.) A single examiner performed the test in all subjects to avoid inter observer variability. Peak Expiratory Flow Rate (PEFR) was recorded using the Wright's Peak flow meter. At least three readings were taken and the maximal value was noted down.
Access template was used for data entry and the analysis was performed using *R* statistical software version 2.8.1. Saccharin Transit Time (STT) and PEFR are expressed in terms of mean and standard deviation. Comparisons between the groups were analyzed by *t*-test and ANOVA and the significance was taken at 0.05 level.
RESULTS {#sec1-3}
=======
This study has compared NMC and PEFR between 30 clean fuel using women and 30 biomass fuel using women. Both STT and PEFR were considered as the outcome variables. The descriptive characteristics of the study population is given in [Table 1](#T0001){ref-type="table"}. NMC time was significantly (*P* = 0.007) prolonged in biomass fuel users (765.8 ± 378.16 s) in comparison to clean fuel users (545.4 ± 215.55 s) [Figure 1](#F0001){ref-type="fig"}. PEFR was significantly (*P* = 0.002) reduced in biomass fuel users (319.3 ± 67.21 l/min) when compared with LPG users (371.7 ± 59.49 l/min) \[[Figure 2](#F0002){ref-type="fig"}\]. In addition, both STT and PEFR were also compared across the several subcategories as shown in [Table 1](#T0001){ref-type="table"}. The prolongation of STT increased with increasing years of exposure (*r* = 0.47). NMC time was significantly prolonged in illiterates (*P* = 0.014), and the PEFR was also significantly reduced in this group (*P* = 0.000). Women from lower socioeconomic status (total family income \<Rs. 25 000 per annum) and lower literacy status (not able to read and write), women dwelling in kutcha houses, older women (40--50 years), undernourished women (BMI\<18), and women cooking for \>15 years had prolonged STT and reduced PEFR.
######
Comparison of STT and PEFR among different age, BMI, demographic and other sources of particulate matter categories of the study group
Study variables N STT (s) *P* value PEFR (l/min) *P* value
----------------------------- ------------------- ---- ------------------------------------------------- ----------- ------------------------------------------------- -----------
Age (20--29) 28 625.6 ± 352.00 0.586 363.9 ± 60.45 0.134
(30--39) 17 638.6 ± 237.99 334.1 ± 68.65
(40--50) 15 731 ± 364.09 324 ± 76.51
Income ≥25000 54 647.3 ± 339.8 0.556 351.5 ± 66.6[\*](#T000F1){ref-type="table-fn"} 0.041
\<25000 6 730.5 ± 115.07 291.7 ± 63.7
BMI ≥18 50 651.9 ± 323.93 0.844 348.2 ± 71.08 0.497
\<18 10 674.3 ± 345.98 332 ± 52.66
House type Pucca 20 586.6 ± 189.29 0.247 367.5 ± 69.2 0.077
Kutcha 40 690.1 ± 372.08 334.5 ± 65.87
Kitchen type Indoor 44 601.1 ± 258.61 0.029 350.5 ± 64.62 0.35
Outdoor 16 805.6 ± 436.39 331.9 ± 77.822 | {
"pile_set_name": "PubMed Central"
} |
Background
==========
In China, economic transition, urbanization, industrialization and an aging population have quickly increased the incidence and prevalence of coronary heart disease (CHD) in the past decades \[[@B1]\]. CHD has been ranked among the top three causes of death in China \[[@B2]\]. Anxiety and depression are common psychological problems associated with a diagnosis of CHD \[[@B3]-[@B5]\]. Importantly, depression and anxiety have been linked with the morbidity and mortality of CHD \[[@B6]\]. Therefore, valid and reliable screening for clinically significant anxiety and/or depression is paramount in this clinical group.
The Hospital Anxiety and Depression Scale (HADS) \[[@B7]\] is a widely used, self-administered questionnaire specifically developed to detect anxiety and depression states in hospital and medical out-patient clinic settings. It is composed of two 7-item scales, one for anxiety and one for depression.
The original English version has been translated into and validated in many languages, including Chinese \[[@B8]-[@B12]\]. The Chinese version of HADS is a popular instrument for assessing psychological distress in clinical studies in China \[[@B5],[@B12]-[@B14]\]. A number of studies have validated the Chinese version of this questionnaire both in Hong Kong (HK) and China \[[@B8],[@B12],[@B15]\]. Leung and colleagues \[[@B8]\] evaluated the psychometric properties of the Chinese version of HADS in 100 medical students. The results indicated factorial inconsistency with the English language version with a three-factor solution emerging. Despite this anomaly, the authors concluded the instrument was a valid Chinese translation. A more recent study of the Chinese version of the HADS \[[@B12]\] across a broad clinical range of in-patients again found three underlying factors to the instrument. These were interpreted as depression and two distinct factors of psychic anxiety and psychomotor agitation \[[@B12]\]. However, the utility of the instrument is based on the theoretical assumption of an underlying bi-dimensional (anxiety and depression) factor structure. Moreover, a underlying tri-dimensional structure of the HADS may have significant implications for both scoring and case detection accuracy \[[@B16],[@B17]\].
A recent review \[[@B16]\] of the HADS has suggested that the instrument may in reality have an underlying tri-dimensional factor structure in CHD patients and other clinical groups. Recent investigations of the psychometric properties of the HADS in CHD patients support the notion that the instrument essentially comprises three, rather than two sub-scales \[[@B18]-[@B20]\]. One study \[[@B20]\] of Cantonese-speaking Chinese CHD patients in Hong Kong has also furnished compelling evidence for the tri-dimensionality of the HADS. Hong Kong Chinese invariably speak Cantonese whereas in the Xi\'an province of China Mandarin is spoken. Due to the pictorial nature of Chinese writing, both Cantonese and Mandarin-speaking Chinese would be able to read the Chinese version of the HADS.
In Europe, the HADS has been applied extensively in the studies of patients with CHD as an index of both outcome and the effect of therapeutic intervention \[[@B21]-[@B23]\]. There have also been reports that the Chinese version of HADS may have some utility as a screening and assessment tool in patients with CHD \[[@B5]\]. However, the factorial structure of the Chinese version of the HADS has not been established in this clinical group with consequent implications for screening and case detection utility and accuracy \[[@B16]\]. The present study was designed to examine the underlying factor structure of the Chinese version of the HADS in a mainland Mandarin-speaking population of patients admitted to hospital with CHD.
Methods
=======
Design
------
The study used a cross-sectional design. To address the research question confirmatory factor analysis methods were used on a pooled HADS data set from mainland Mandarin-speaking patients admitted to hospital with CHD.
Statistical analysis
--------------------
The factor structure of the HADS was determined using confirmatory factor analysis using Mplus version 3 \[[@B24]\]. The weighted least-square with mean and variance correction estimator (WLSMV) was used to evaluate model fit as this estimation method can be both used reliably with ordered categorical level data, and be used dependably with modest samples sizes. Seven models developed from HADS validity and psychometric studies were tested \[[@B7],[@B17],[@B25]-[@B28]\]. The characteristics of each model tested and item-factor loading characteristics are shown in Table [1](#T1){ref-type="table"}. Confirmatory factor analysis represents a powerful statistical technique used to determine whether the number of factors and pattern of item-factor loadings is consistent with what would be expected by a priori theory. This represents a significant methodological advance over the more commonly used exploratory factor analysis where no prior assumptions of structure are explicitly made. Confirmatory factor analysis is a special case of structural equation modelling and is statistically and methodologically distinct from exploratory factor analysis. Though strictly speaking exploratory factor analysis should be used to determine the original factor structure of an instrument, and confirmatory factor analysis used to determine how well an a priori-defined factor structure fits data, it is common in the literature to see exploratory factor analysis used to investigate the factor structure of an instrument that has previously been investigated using exploratory factor analysis. Consequently, exploratory factor analysis is often found to be used where confirmatory factor analysis would be more desirable and more appropriate, this situation being widely observed in many previous studies of the factorial structure of the HADS.
######
Characteristics of each factor model tested
**Model** **Number of factors** **Clinical population** ***n*** **Factor extraction method**^**\#**^
--------------------------- ----------------------- ------------------------- ------------------- --------------------------------------
Zigmond and Snaith (1983) 2 Medical 100 No factor analysis
Moorey et al. (1991) 2 Cancer 568 PCA
Dunbar et al. (2000) 3 Non-clinical 2,547^+^ CFA
Friedman et al. (2001)\* 3 Depressed 2,669 PCA
Razavi et al. (1990) 1 Cancer 210 PCA
Caci et al. (2003)\*\* 3 Non-clinical 195 CFA
**FLI1**\*\* **FLI2** **FLI3**
Zigmond and Snaith (1983) 1,3,5,7,9,11,13 2,4,6,8,10,12,14 \-\-\-\-\-\-\-\--
Moorey et al. (1991) 1,3,5,9,11,13 2,4,6,7,8,10,12,14 \-\-\-\-\-\-\-\--
Dunbar et al. (2000) 1,5,7,11 2,4,6,7,8,10,12,14
Friedman et al. (2001)\* 1,7,11 2,4,6,8,10,12,14 3,5,9,13
Razavi et al. (1990) All items \-\-\-\-\-\-\-\-- \-\-\-\-\-\-\-\--
Caci et al. (2003)\*\* 1,3,5,9,13 2,4,6,8,10,12 7,11,14
\*The three-factors are correlated in this model. \*\* Two models based on Caci et al. are tested, the second model removing item 10. ^+^Based on CFA of three independent samples of N = 894, 829 and 824, the total cohort in this study is 2,547. ^\#^PCA: Principal Components Analysis; CFA: Confirmatory Factor Analysis. \*\*FLI: Factor Loading Items. The HADS items loading on each model tested.
Procedure
---------
The first author administered the Chinese version of HADS to patients for self-completion. Demographic data and medical history were also obtained from patients and medical charts.
Participants
------------
One hundred and sixty patients with CHD were initially enrolled into the study of which 154 completed the questionnaires. The patients ranged in age from 38 to 86 years with a mean age of 60 years (SD = 10.37). One hundred and twenty (77.9%) patients were males. In terms of the clinical data, over two thirds of subjects were angina patients. The study was conducted in the general cardiovascular wards of two large university-based teaching hospitals in Xi\'an City of China. Inclusion criteria were diagnoses of angina pectoris or myocardial infarction, no known psychiatric problems, and could understand Chinese. The study was conducted over a four-month period. The clinical ethical committee of the two university affiliated hospitals in Xi\'an approved the study. Informed consent was obtained from all patients prior to commencement of the study.
Results
=======
The mean HADS anxiety (HADS-A) sub-scale score was 6.16 (SD 3.86) and the mean HADS depression (HADS-D) sub-scale score was 6.43 (SD 4.12). Based on Snaith and Zigmond\'s \[[@B29]\] interpretation of HADS-A and HADS-D scores of 8 or over, approximately one-third of the patients screened positive for anxiety (32%) and/or depression (35%). The results of the CFA are summarised in Table [2](#T2){ref-type | {
"pile_set_name": "PubMed Central"
} |
All relevant data are within the paper and its Supporting Information files.
Introduction {#sec007}
============
The nematode *Anisakis* spp. is a parasite of marine mammals that can parasitize humans when a raw or undercooked fish containing live *Anisakis* spp. L3 is consumed. Ingestion of L3 causes an acute and self-limiting infection that can manifest with abdominal pain, nausea, vomiting or diarrhoea. Infection causes a strong polyclonal humoral immune response, and IgM, IgA, and IgG antibodies are detected after one month of infection \[[@pntd.0004864.ref001]\]. In some patients, an IgE-mediated immune response is also triggered, and in those patients, allergic symptoms, such as urticaria, angioedema and anaphylaxis can develop after sensitization and re-exposure to the allergens of this parasite. The rise in specific IgE is usually accompanied with an increase in total IgE in the first month after the presentation of allergic symptoms, and serial serological analysis of both specific and total IgE values have been proven useful in the diagnosis of gastro-allergic anisakiasis \[[@pntd.0004864.ref002]\]. To avoid the appearance of symptoms, sensitized patients are advised to consume frozen or heat-treated fishery products because these treatments kill larvae to prevent new parasitism \[[@pntd.0004864.ref003]--[@pntd.0004864.ref005]\].
Several groups have investigated the kinetics of specific antibody production in experimental animal models \[review in [@pntd.0004864.ref006]\], but the results of those studies may not be applicable to the human immune responses to this parasite. Studies of the changes over time of the level of specific IgE to *Anisakis* spp. in sensitized patients have shown the persistence of IgE sensitization up to 38 months after the onset of symptoms \[[@pntd.0004864.ref001], [@pntd.0004864.ref002], [@pntd.0004864.ref004], [@pntd.0004864.ref007]\]. However, those studies did not report variations in the specific IgE levels at different follow-up time points.
The aim of this study was to analyse the changes in *Anisakis* spp.-specific IgE levels through repeated measures during a longer follow-up period than previously reported and to compare IgE sensitization between patients whose diets did not include fishery products and subjects who regularly consumed fishery products.
Methods {#sec008}
=======
Patients {#sec009}
--------
To analyse the kinetics of the IgE response, *Anisakis* spp.-allergic patients with at least 30 months of follow-up after symptom presentation were selected for this study. A total of 17 patients (six males) with a median age of 53 years (IQR = 45--57 years) were diagnosed as being allergic to *Anisakis* spp. because they reported allergic (urticaria, angioedema or anaphylaxis) and/or gastrointestinal (vomiting, diarrhoea, or abdominal pain) symptoms within 24 h after eating raw or undercooked fish or seafood. One patient reported symptoms after eating cooked fish (scorpion fish cake). Five patients had grass pollen allergy and one of them had dog dander allergy. The data collected at the first visit are shown in [Table 1](#pntd.0004864.t001){ref-type="table"}. Allergy was confirmed by a positive prick test and/or detection of specific IgE to *Anisakis* spp. and undetectable levels of IgE to shrimp, *Ascaris lumbricoides*, fish and mites. To assess new sensitization to these allergens, specific IgE levels were quantified at the last visit, and they remained undetectable in all patients. Measurements of the levels of total and specific IgE to *Anisakis* spp. and clinical evaluations were performed during successive visits. All patients were advised at the first visit to avoid consumption of raw and undercooked fish and to eat farmed fish and deep-frozen fishery products; however, patients with levels of specific IgE to *Anisakis* spp. higher than 100 kU/L were initially instructed to consume a fish-free diet for six months.
10.1371/journal.pntd.0004864.t001
###### Patients' data at first visit and total and specific IgE values at first and last visits of follow-up.
{#pntd.0004864.t001g}
**Patient** **Sex** **Age** **Symptoms** **Te (months)** **Previous allergic episodes** **Fish** **Detection of rAni s 1/rAni s 4** **Follow-up (months)** **First/last total IgE (kU/L)** **First/last specific IgE (kU/L)**
------------- --------- --------- -------------- ----------------- -------------------------------- --------------------- ------------------------------------ ------------------------ --------------------------------- ------------------------------------
1 M 55 U, GI 0.6 n anchovy +/+ 96 658/605 \>100/23.7
2\* M 48 AN, GI 12 n anchovy, anglerfish +/- 71 28/20 5/2.1
3 M 63 AG, U, GI 0.6 n anchovy +/- 118 1740/437 32.4/21.7
4\* F 30 U, GI 4 n anchovy +/- 43 341/41 43.9/3.18
5 M 62 GI 0.7 y anchovy +/- 49 541/70 \>100/15.7
6 F 60 GI 1 n hake +/- 95 1196/384 \>100/52.5
7\* F 50 U, GI 1 y anchovy +/+ 50 1750/71 \>100/8.95
8 F 54 U 1 n anchovy +/- 61 786/338 \>100/37.8
9 F 64 AG, U, GI 5 y anchovy +/+ 38 213/70 72.6/13.3
10 F 53 AN, U 1 n anchovy +/- 44 2958/258 \>100/12.1
11\* F 50 U 12 n anchovy +/+ 38 57/45 4.3/1.1
12 M 27 U 1 n anchovy +/+ 37 1557/440 82.8/20.1
13 F 54 U, GI 4 y anchovy +/- 58 327/103 \>100/17.4
14 F 43 U 12 n scorpion fish cake +/+ 112 557/347 16.1/0.6
15 F 32 U 0.6 n anchovy +/- 31 271/478 9.5/6.1
16\* F 53 U, GI 3 n anchovy +/- 45 91/11 24.9/2.9
17 M 51 GI 9 n anchovy +/- 35 2423/184 79.2/20.6
U: urticaria; GI: gastrointestinal; AN: anaphylaxis; AG: angioedema; Te: Time elapsed from the allergic episode to the first visit; M: male; F: female; n: no; y: yes. Asterisks indicate patients who did not include fish or seafood in their diet during the follow-up period
This study was approved by the Ethics Committee of the Hospital Carlos III (Madrid, Spain), and all included subjects were asked to sign an informed consent form.
Total and specific IgE {#sec010}
----------------------
The serum total and specific IgE measurements were performed with a Phadia 250 instrument (Thermo Fischer Scientific, Phadia, Madrid, Spain) according to the manufacturer's instructions. The detection range for total IgE was 2--5000 kU/L. Regarding positivity for specific IgE antibodies, values \>0.7 kU/L \[[@pntd.0004864.ref008]\] were considered positive for IgE to *Anisakis* spp., and values \>0.35 kU/L were considered positive for IgE to the other allergens.
*Anisakis* spp. antigens {#sec011}
------------------------
Live *Anisakis* spp. larvae in the third stage of the life cycle (L3) were obtained from parasitized hake (*Merluccius merluccius*) at local markets in Madrid, Spain. L3 were extracted from fish tissue, washed in PBS and immediately frozen at -20°C until use. Then, L3 were ground in a Potter-ELV homogenizer and sonicated at 18 w for 5 s. Protein extracts were obtained after centrifugation at 16 | {
"pile_set_name": "PubMed Central"
} |
{#sp1 .697}
{#sp2 .698}
{#sp3 .699}
{#sp4 .700}
{#sp5 .701}
{#sp6 .702}
{#sp7 .703}
{#sp8 .704}
{#sp9 .705}
{#sp10 .706}
{#sp11 .707}
{#sp12 .708}
{#sp13 .709}
{#sp14 .710}
| {
"pile_set_name": "PubMed Central"
} |
Introduction {#s0005}
============
In 2017, pancreatic cancer (PC) represents 3.0% of all new cancer cases in the United States [@bb0005]. Compared to other cancers, PC is relatively rare. However, it is more common with increasing age and has an aggressive behavior with poor prognosis, resulting in an estimated 44,330 deaths in 2017 and making it the third leading cause of cancer death in the United States [@bb0005]. Because of its high frequency of chemoresistance, PC is relatively insensitive to conventional chemotherapy. Gemcitabine was recommended as the first first-line drug for chemotherapy of PC and chemotherapy using gemcitabine alone was the standard for about a decade, as a number of trials testing it in combination with other drugs failed to demonstrate significantly better outcomes [@bb0010], [@bb0015], [@bb0020]. Hence, how to further improve the sensitivity of PC cells to gemcitabine will provide clues for new targeted therapies.
Polo-like kinase 1(Plk1), a serine/threonine kinase that plays an essential role in cell mitosis, spindle assemble, DNA damage and so on, is a member of polo-like kinases family [@bb0025], [@bb0030]. It is an early trigger for G2/M transition and localizes to centrosomes during interphase. Plk1 is closely related with the occurrence of tumor development. Compared to normal tissues, it is over-expressed in a broad range of tumors, such as ovarian carcinoma, colorectal carcinoma, prostate cancer, skin cancer, and others [@bb0035], [@bb0040], [@bb0045], [@bb0050], and has been implicated in tumorigenesis and progression [@bb0055], [@bb0060]. Overexpression of Plk1 can inhibit the activity of p53 through phosphorylation p53, which cause the apoptosis process failure, then cancerous cells survival which bring out the occurrence of cancer eventually [@bb0055], [@bb0065]. As reported, Plk1 is over-expressed in PC, invasive pancreatic adenocarcinomas were Plk1 positive in 47.7% of cases [@bb0070], which means Plk1 overexpression is likely to be related to biological behavior of PC. Therefore, targeting Plk1 in developing small molecule inhibitors as anti-cancer drugs becomes a hotspot in the recent years. Such as Plk1 inhibitor BI2536 has been evaluated for patients with various cancers in clinical trials [@bb0075], [@bb0080], [@bb0085], [@bb0090].
The deregulation of PI3K/Akt pathway has been confirmed that plays an crucial role in human cancers including PC [@bb0095], [@bb0100]. PI3K/Akt pathway includes a series of cascade: PI3K generation PI3P through phosphorylation PI2P, and PI3P combination with the N-terminal of Akt, then activation of Akt, which activate or inhibit its downstream substrates, such as mTOR, Caspase-9, Bad, etc. [@bb0105]. Akt, a serine/threonine kinase which plays a core role in the PI3K/Akt signal pathway. Meanwhile, Akt contributes to cell plasticity in pancreas as a regulator and its overexpression has been proved to be a common phenomenon in PC [@bb0110], [@bb0115], [@bb0120]. Until now, several Akt inhibitors have been evaluated in clinical trials [@bb0125], [@bb0130]. Hence, the PI3K/Akt pathway plays a crucial role in the development of PC, and it can be a potential therapeutic target for PC.
Cell cycle is crucial for proliferation, differentiation, and growth both in normal cells and tumor cells. Hence, the factors affecting cell cycle can be used as a potential target of tumor therapy. Whether PI3K/Akt signaling pathway or Plk1 in cell cycle is the indispensable factors, keep unclear. It is reported PI3K/Akt-dependent phosphorylation of Plk1-Ser99 is required for metaphase-anaphase transition, and Plk1-dependent phosphorylation of IRS2-S556 inhibits mitotic exit through reducing Akt activity [@bb0135], [@bb0140]. Yu et al. showed that up-regulation of Plk1 were related to chemoresistance of PC, and Kim et al. found that inhibited PI3K/Akt pathway could increase the chemosensitivity of PC to gemcitabine [@bb0145], [@bb0150]. However, the mechanism of cell apoptosis induced by PI3K/Akt pathway and Plk1 still remains unclear. In current study, we combined the inhibition of PI3K/Akt pathway with down-regulation of Plk1 and observed that the chemosensitivity of PC to gemcitabine further increased. In addition, LY294002 and BI2536 (an inhibitor of Plk1), together with gemcitabine significantly suppressed the growth of xenografts in nude mice model, which made PI3K/Akt pathway inhibition as well as Plk1 down-regulation become a potential target to increase the chemosensitivity of PC.
Materials and Methods {#s0010}
=====================
Cell Culture and Reagents {#s0015}
-------------------------
PC cell lines were obtained from ATCC and were maintained in Dulbecco\'s Modified Eagle Medium supplemented with 10% fetal bovine serum (FBS) (BxPC-3 and PANC-1), in RPMI 1640 supplemented with 10% FBS (AsPC-1). Gemcitabine was purchased from Sigma (Sigma-Aldrich Co. LLC, USA), it was dissolved in 100% dimethyl sulfoxide (DMSO, Muskegon, MI, USA) to a stock concentration of 10 mM and stored at −20 °C. The PI3K inhibitor LY294002 was purchased from CST (Beverly, MA, USA). BI2536 (Plk1 inhibitor) was gained from Selleck (Houston, USA), it was dissolved in DMSO and stored at −80 °C. The following antibodies were purchased for Western blot: Plk1, p-Akt, Akt (Cell Signaling Technology, MA, USA); Bcl-2, BAX (Abcam, UK); and glyceraldehyde 3-phosphate dehydrogenase (GAPDH, Santa Cruz, CA, USA). Plk1 and Akt antibody for immunohistochemistry (IHC) was gained from Abcam (Abcam, UK).
Immunohistochemistry (IHC) and Clinical Specimens {#s0020}
-------------------------------------------------
The human pancreatic tissues and related clinical data were purchased from Xian Ailina Biotechnology Co. Ltd. (Xian Ailina Biotechnology Co. Ltd., China). Paraffin-embedded sections of human pancreatic tissues and mouse xenografts were subjected to specific antibodies for Plk1, Akt, Cleaved caspase 3, or isotype-matched controls at appropriate dilutions. IHC staining in human tissues were scored independently by two pathologists, by evaluating a semiquantitative immunoreactivity score (IRS) as described [@bb0155]. Then, tissues with IRS 0--5 and IRS 6--9 were defined as low and high expression of Plk1, respectively.
Construction of Recombinant Adenoviral rAd-EGFP and rAd-Plk1-shRNAs (rAd-shPlk1) {#s0025}
--------------------------------------------------------------------------------
Based on gene sequence (GenBank: [NM_005030](ncbi-n:NM_005030){#ir0005}), four shRNAs targeting different regions of the Plk1 transcript were synthesized with the vector pYr-1.1 (hU6/EGFP/Neo) (Changsha Yingrun Biotechnology Co. Ltd., China). After package and screen, both rAd-Plk1-shRNA2 and rAd-Plk1-shRNA4 worked effectively, especially rAd-Plk1-shRNA4 so that the latter was finally used for the following experiment and was set as rAd-shPlk1. The empty vector rAd-EGFP was constructed as an experimental control.
Western Blotting Analysis {#s0030}
-------------------------
Cells were lysed in RIPA Lysis Buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 1 mM PMSF) and resolved by SDS-PAGE. Samples were analyzed as described [@bb0160]. Phospho-specific antibody to Akt(S473) was detected to determine the level of activated protein, with antibody recognizing total Akt to control for total protein expression. Antibody to Plk1 was used to monitor total protein expression. Antibodies for BAX and Bcl2 were used to monitor apoptosis. Antibody for GAPDH was used to verify equivalent loading of total cellular protein.
RNA Isolation and Quantitative Real-Time PCR {#s0035}
--------------------------------------------
The mRNAs were extracted with Trizol reagent (Life Technologies, Ltd). The cDNAs were prepared with Superscript III (Life Technologies, Ltd) Takara Kit (Dalian, China)as indicated by the manufacturer. The cDNAs were amplified by PCR in an iQ5 Multicolor Real Time Detector System (Bio-Rad) with the fluorescent double-stranded DNA binding dye SYBR Green (Bio-Rad). The relative amounts of gene expression were calculated with GAPDH expression as an internal standard (calibrator). Primers used for the Akt gene: forward primer 5′-TCACCATCA CACCACCTG AC-3′ and reverse primer 5′-CTCAAATGCACCCGAGAA AT-3′. Primers used for the Plk1 gene: forward 5′-ACC AGC ACG TCG TAG GAT TC-3′ and reverse 5′-ATA ACT CGG TTT CGG TGC AG-3′. Primers used for the GAPDH gene were 5′-AAC GGA TTT GGT C | {
"pile_set_name": "PubMed Central"
} |
As with most other athletic movements, the biomechanics of baseball pitching is studied to improve performance and prevent and/or rehabilitate injury. As technology in the sports science field has developed over the past 20 years, the interest has skyrocketed in using these advancements to the benefit of athletes. The initial studies provided accurate descriptions of the pitching kinematics and kinetics,^[@bibr7-1941738109338546],[@bibr9-1941738109338546][@bibr10-1941738109338546][@bibr11-1941738109338546][@bibr12-1941738109338546]-[@bibr13-1941738109338546],[@bibr25-1941738109338546]^ which helped athletes, coaches, medical professionals, and scientists understand the demands of pitching. Subsequent research has analyzed factors that correlate to performance enhancement and/or injury. The purpose of this review is to assimilate all the available scientific research on baseball pitching biomechanics related to performance and injury. This information is grouped into 5 areas: kinematics and its relationship to velocity; the association among kinematics, kinetics, and injury; the effects of fatigue; the development of a pitcher from youth to adult; and the effect of pitch types on mechanics. Over the years, research has been collected from different institutions with assorted methodologies, thereby making it difficult to compare numbers directly. Despite variance in numbers, the commonalities among pathomechanical patterns are most interesting.
Kinematics and Velocity {#section1-1941738109338546}
=======================
If you ask baseball coaches what elements make a pitcher effective, their responses will be "velocity" and "accuracy." Pitching coaches and biomechanists have studied the motion of elite pitchers to discern how they consistently throw fast pitches in the strike zone. Limited scientific research exists on the biomechanical factors that affect accuracy, but a lot is known about kinematic measures that improve ball velocity. Implicit in higher ball velocity are higher kinetic values for the elbow and shoulder.^[@bibr9-1941738109338546]^ Pitching kinematic variables affecting velocity are found in upper and lower body measures.
Much of the focus in the literature has been on the upper body, but the lower body is the foundation for baseball pitchers; pitching utilizes the kinetic chain to transfer energy from the lower body to the upper body. MacWilliams et al^[@bibr25-1941738109338546]^ performed one of the first biomechanical studies to examine the contributions of the lower body to pitching. They found that maximum linear wrist velocity (used as an indicator of ball velocity) correlated highly with the maximal push-off force of the throwing leg in the direction of the pitch. Montgomery and Knudson^[@bibr29-1941738109338546]^ demonstrated that decreases in stride length lowered velocity whereas increases in stride length increased velocity without affecting accuracy. The underlying mechanism was unknown. The push-off force supplies the initial forward momentum of the body, whereas the braking force that is applied by the lead leg during and after lead foot contact (FC) is actually the source of the energy that is transmitted up the body to maximize power output.^[@bibr25-1941738109338546]^ Matsuo et al^[@bibr26-1941738109338546]^ compared high- and low-velocity groups of pitchers and found significantly more lead knee extension angular velocity near the time of ball release (BR) in the high-velocity group. They hypothesized that a properly flexed lead knee at FC, approximately 38° to 50°,^[@bibr8-1941738109338546],[@bibr10-1941738109338546],[@bibr14-1941738109338546],[@bibr17-1941738109338546],[@bibr37-1941738109338546]^ stabilizes the lead leg for trunk rotation.
Assuming that the lead leg adequately flexes at FC and extends thereafter, the next links in the kinetic chain are the rotations of the pelvis and upper trunk. Escamilla et al^[@bibr9-1941738109338546]^ found that Americans had significantly greater maximum pelvis rotation velocity and ball velocity, compared to Korean pitchers. A critical component to maximizing the contribution of each link of the kinetic chain is the proper timing between the rotation of the pelvis and the rotation of the upper trunk. If too much lag or not enough occurs between the movements, the unique contributions of the 2 segments are lost.^[@bibr16-1941738109338546]^ If pitch cycle time is normalized such that 0% represents FC and 100% represents BR, the instant of peak pelvis rotation velocity is between 28% and 35%, and the instant of peak upper trunk rotation velocity is between 47% and 53%, with a separation of approximately 18% to 22%.^[@bibr6-1941738109338546],[@bibr9-1941738109338546],[@bibr17-1941738109338546],[@bibr26-1941738109338546]^ Although Matsuo et al did not directly measure this separation timing,^[@bibr26-1941738109338546]^ the high-velocity group had a separation-timing mean difference of 23%, whereas the low- velocity group had a mean difference of 17%. Stodden et al^[@bibr38-1941738109338546]^ also found, when analyzing pitcher variations, that the pelvis orientation at the times of maximum shoulder external rotation (MER) and BR and the proper rotational velocities of the pelvis and upper trunk translated into higher ball velocities.
The shoulder and elbow are the 2 joints that channel the significant power created by the lower body and trunk through the pitching arm. Because the shoulder complex has 3 degrees of freedom and the elbow, forearm, and wrist have 2 degrees of freedom, the throwing arm has many unique positional combinations. Finding the optimal arm path for a dynamic, explosive movement such as a baseball pitch becomes a daunting task for any athlete. Ball velocity has been correlated with shoulder positioning at the instant of FC. Increased ball velocity correlates with increased horizontal abduction^[@bibr9-1941738109338546],[@bibr37-1941738109338546]^ and decreased external rotation.^[@bibr9-1941738109338546],[@bibr42-1941738109338546]^ These correlations apply only within a reasonable range. Excessive horizontal abduction puts additional strain on the anterior capsule of the glenohumeral joint, and late external rotation may disrupt the timing of the arm path. For the higher-velocity group in a study by Escamilla et al,^[@bibr9-1941738109338546]^ horizontal abduction was 27° ± 10° and external rotation was 45° ± 19°. As the delivery moves into the arm-cocking phase, the amount of MER is linked to increased ball velocity.^[@bibr9-1941738109338546],[@bibr26-1941738109338546]^ During arm acceleration, pitchers with higher velocity reach peak shoulder internal rotation velocity closer to the instant of BR (102.3% time versus 104.4% time), optimizing the timing of arm acceleration and BR to maximize ball velocity.^[@bibr26-1941738109338546]^ At the instant of BR, the combination of shoulder abduction and lateral trunk tilt creates the pitcher's arm slot. Matsuo et al^[@bibr28-1941738109338546]^ conducted simulations based on biomechanical data to determine the optimal shoulder abduction angle at BR. It was traditionally taught that 90° maximizes functional stability.^[@bibr33-1941738109338546]^ Matsuo et al suggested a fairly narrow range centered on 90° that was self-optimized by selecting a comfortable lateral trunk tilt angle to maximize wrist velocity and, therefore, ball velocity.
Kinematics, Kinetics, and Injury {#section2-1941738109338546}
================================
Performance enhancement and injury prevention often go hand-in-hand in biomechanics. Pitchers occasionally sustain groin and abdominal muscle strains, as well as knee and back soreness, but the overwhelming number of injuries have been at the elbow and shoulder.^[@bibr5-1941738109338546]^ The instants of maximum shoulder external rotation and BR are critical for upper extremity kinetics analysis during pitching.^[@bibr13-1941738109338546]^ At least 7 kinetic variables have been implicated as mechanisms of injury.^[@bibr13-1941738109338546]^ During the arm-cocking phase, which ends at maximum shoulder external rotation, the throwing arm produces maximum anterior shoulder force, horizontal adduction torque, internal rotation torque, and elbow varus torque. During the arm acceleration phase (between MER and BR), maximum elbow flexion torque is achieved. Immediately after BR, when the arm begins to decelerate, maximum proximal shoulder force and proximal elbow force occur.^[@bibr13-1941738109338546]^
Injuries are most likely when high forces and/or torques are repeatedly applied to vulnerable tissue and when the pitcher transitions through susceptible positions. Fleisig^[@bibr12-1941738109338546]^ hypothesized 8 mechanisms that increase kinetic values and the risk of injury. Five of these mechanisms had significant correlations to increased kinetics. An open lead foot angle (for a right-handed pitcher, foot pointing toward left-handed batter) or an open foot position (for a right-handed pitcher, foot landing toward first-base side) at FC can cause the pelvis to rotate too soon. At FC, the normative mechanics are 19° ± 11° closed for foot angle, 19 ± 14 cm closed for foot position, and 30% ± 17% for the timing of maximum pelvis rotation velocity.^[@bibr17-1941738109338546]^ These improper lead foot mechanics and pelvis rotation produce additional anterior shoulder force and medial elbow force. The timing of shoulder rotation is | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-ijerph-15-01734}
===============
Poultry slaughterhouses discharge a significant volume of highly polluted wastewater, principally during the slaughtering process and the periodic washing of residual particles, which cause a significant variation in the biodegradable organic matter concentration. Organic matter is considered the primary pollutant in the effluents of slaughterhouses \[[@B1-ijerph-15-01734]\]. The contribution of organic load to these effluents usually comes from different materials such as undigested food, blood, fat and lard, loose meat, paunch, colloidal particles, soluble proteins, and suspended materials \[[@B2-ijerph-15-01734],[@B3-ijerph-15-01734]\]. Due to the mentioned components in the slaughterhouses wastewater, these wastewaters have a high concentration of organics such as chemical oxygen demand (COD), biochemical oxygen demand (BOD), phosphorous, and nitrogen \[[@B4-ijerph-15-01734]\]. Therefore, before discharging these wastewaters into receiving water bodies, an efficient treatment process should be carried out to prevent severe environmental pollution. In the last few decades, several treatment methods for the slaughterhouse wastewater have been reported. Biological (aerobic and anaerobic) treatment methods have been traditionally used for slaughterhouse wastewater treatment. However, both biological techniques have some limitations. For example, aerobic treatment processes require high energy consumption for aeration and generate a high amount of sludge \[[@B1-ijerph-15-01734]\]. The anaerobic treatment process of the poultry slaughterhouse wastewater is often impaired or slowed down because of the accumulation of suspended solids and floating fats in the reactor, which in turn leads to reduction in methanogenic activity and biomass washout \[[@B2-ijerph-15-01734]\]. Moreover, the anaerobic treatment process is more suitable in treating high organic loading wastewater \[[@B5-ijerph-15-01734],[@B6-ijerph-15-01734]\].
Sequential Batch Reactors (SBR) are one of the biological processes applied to remove several types of pollutants. The SBR process is different from conventionally activated sludge techniques, because SBR merges all treatment units and operations into a single basin or tank, whereas traditional systems rely on various tanks. SBR has been successfully used for the treatment of domestic, municipal, industrial, dairy, synthetic, toxic and slaughterhouse wastewaters, swine manure, and landfill leachates \[[@B7-ijerph-15-01734],[@B8-ijerph-15-01734],[@B9-ijerph-15-01734],[@B10-ijerph-15-01734],[@B11-ijerph-15-01734],[@B12-ijerph-15-01734]\].
Recently, the application of biomass carriers in the SBR process has been investigated by various researchers \[[@B13-ijerph-15-01734],[@B14-ijerph-15-01734],[@B15-ijerph-15-01734]\]. Fiber-based biomass carriers exhibit a good performance in removing pollutants, especially nitrogenous substances \[[@B16-ijerph-15-01734],[@B17-ijerph-15-01734]\]. Previous studies that applied the swim bed technologies in SBR using bio-fringe (acryl fiber) revealed high treatment efficiency in removing pollutants, especially nitrogenous substances \[[@B17-ijerph-15-01734]\]. Several types of fibers have been used previously in wastewater treatments, such as plastic fibers \[[@B18-ijerph-15-01734],[@B19-ijerph-15-01734]\], geotextiles \[[@B20-ijerph-15-01734]\], bio fringe acryl fiber \[[@B17-ijerph-15-01734]\], fibrous packing \[[@B21-ijerph-15-01734]\], and polyester fiber \[[@B22-ijerph-15-01734]\]. However, the application of fibers as attachment materials in SBR for poultry slaughterhouses wastewater treatment has not been well investigated.
The aim of this paper is to examine the potential use of various types of fibers as biomass carriers for slaughterhouses wastewater treatment by evaluating the removal efficiency of the pollutants with and without fiber in the reactor. The fibers involved are natural white Jute fiber (JF), synthetic siliconised conjugated polyester fiber (SCPF), bio-fringe (acrylic fiber) (BF), and the combination of three fibers in the reactor, called composite fiber (CF). The treatment efficiency of the different reactors with and without fibers on BOD, COD, ammonia-nitrogen (NH~3~-N), phosphorus (P), nitrite (NO~2~-N), nitrate (NO~3~), TSS, and oil-grease were evaluated. Parameters, such as BOD, COD, and NH~3~-N, were monitored every day during the experiments. However, the other parameters were evaluated based on the optimum value obtained.
2. Materials and Methods {#sec2-ijerph-15-01734}
========================
2.1. Wastewater Source and Characteristics
------------------------------------------
The wastewater used in this study was collected from a local poultry slaughterhouse plant with a 13,000 birds per day capacity, located in the city of Nibong Tebal, Penang state, Malaysia, generating approximately 140 tons of wastewater daily. This wastewater, which is produced from different operations such as chickens cutting, chilling, scalding, packing and plant cleanup, was collected from the final collection tank after the screening of internal organs and feathers (partially treated using physical treatment). Wastewater samples of 150 to 200 L were collected twice per week, during the period from 23 May 2012 to 11 March 2013. Following the sampling procedure, the wastewater samples obtained were characterized based on pollutant concentration. Samples were preserved by storing in a cold room at 4 °C and were only taken out to room temperature 2 h before the experiment began. Characteristics of the raw wastewater are shown in [Table 1](#ijerph-15-01734-t001){ref-type="table"}.
2.2. Activated Sludge and Characteristics {#sec2dot2-ijerph-15-01734}
-----------------------------------------
The activated sludge (AS) used in this study was collected from the sludge dewatering system at the Jelutong Sewerage Treatment Plant (JSTP), Penang State, Malaysia. The AS in this study acts as microorganisms that are responsible for transforming the pollutants into acceptable end products. The AS also followed the poultry slaughterhouses wastewater storing procedures. Characteristics of the AS are shown in [Table 1](#ijerph-15-01734-t001){ref-type="table"}.
2.3. Fiber Preparation {#sec2dot3-ijerph-15-01734}
----------------------
Three types of fibers were used in this study as mentioned earlier. The first type was bio-fringe (BF) fiber made of acrylic fiber and imported from Japan. The other two types were Jute fiber (JF) and siliconised conjugated polyester fiber (SCPF). Composite fibers (CF) are a combination of these three fibers where all types were put together in the reactor. Both JF and SCPF were prepared similar to the size of the ready-made BF. The fibers were sewed neatly into pieces of yarns. [Table 2](#ijerph-15-01734-t002){ref-type="table"} shows the physical properties of the fibers.
2.4. Reactor Setup {#sec2dot4-ijerph-15-01734}
------------------
Two identical, laboratory scale Plexiglas reactors were used as SBR reactors for this study. Each reactor has the following dimensions: 80 cm × 40 cm × 25 cm with a total volume of 80 L. However, the experimental volume of the liquid for each reactor was 60 L. The first reactor was only operated with activated sludge without adding the fibers, while the other reactor was operated with activated sludge in the presence of fibers. [Figure 1](#ijerph-15-01734-f001){ref-type="fig"} shows the schematic diagram of the SBR reactor. The first cycle started with seeding of the AS collected from the JSTP. Following this, the reactor was fed with the collected raw poultry slaughterhouse wastewater during the filling phase and was aerated and mixed for a certain period of time during the aerating phase. The pH was adjusted approximately to 7.0 ± 0.5 and the mixed liquor suspended solids (MLSS) were maintained at a minimum range of 1500 mg/L to 4000 mg/L during the whole experiment. The adjustments were conducted before the aeration phase. The pH value was adjusted by adding either acid (0.5 M of H~2~SO~4~) or base solutions (0.5 M of NaOH). A 24-h cycle was selected, and the wastewater was operated for 20 h with the aeration rate of 60 L/min to make sure the wastewater and AS were mixed homogeneously. The final MLSS was 3782 mg/L. An air pump was used for the aeration and water circulation in the reactors. The aerated phase was stopped at the end of the aeration phase (after 20 h) and before the start of the settling phase (3 h). The decanting and discharging phase was the last process in the cycle, which meant that a cycle had been completed. After the first cycle was completed, the SBR reactor was filled with raw poultry slaughterhouse wastewater, aerated, settled, and decanted to repeat the second day treatment. [Table 3](#ijerph-15-01734-t003){ref-type="table"} summarizes the operation design parameters of SBR reactor.
2.5. Operating Conditions {#sec2dot5-ijerph-15-01734}
-------------------------
To maintain 1500 mg/L of MLSS, the poultry slaughterhouse wastewater feed was set at 21 L/day | {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
Articular cartilage is a highly specialized and resilient connective tissue that functions to distribute physiological loads to the underlying bone without developing unacceptably high stresses^[@CR1]^. Cartilage function can be altered by degenerative changes in its structure and composition, often as a consequence of injury. Cartilage injuries may result in acute lesions, which without intervention may progress to post-traumatic osteoarthritis (PTOA)^[@CR2]^. Several techniques are available for cartilage repair, with recent research suggesting that pharmaceutical interventions may be effective in preventing the onset or halting the progression of PTOA if the injury is detected early^[@CR2],\ [@CR3]^. Thus, characterization of cartilage integrity and disease progression at the early disease stages is crucial for effective management and treatment of PTOA^[@CR2]^.
Current clinical diagnosis of joint pathologies often involves clinical examination, with radiographic (X-ray) examination and/or magnetic resonance imaging (MRI) conducted to verify diagnosis. This is then followed by repair surgery via arthroscopic intervention. Arthroscopy enables detailed description of lesion size and severity; however, the method is ineffective in detecting early degenerative changes in cartilage. In addition, the reproducibility of arthroscopy has been reported to be poor^[@CR4],\ [@CR5]^ due to its subjective nature. Thus, appropriate diagnostic methods capable of detecting the onset and progression of cartilage degeneration, both objectively and in real-time, is required.
Cartilage integrity can be characterized histologically using the Mankin grading system^[@CR6]^. Although this method is effective for overall tissue matrix characterization, it requires destructive (biopsy excision) and time-consuming protocols for histological evaluation of cartilage health. Direct application of this technique is therefore not feasible in surgical applications. Consequently, non-destructive approaches for determining articular cartilage health indirectly via the Mankin score have been proposed, including near infrared (NIR) spectroscopy^[@CR7]--[@CR14]^, mid-infrared spectroscopy^[@CR15],\ [@CR16]^ and optical coherence tomography (OCT)^[@CR17],\ [@CR18]^. This study investigates the capacity of NIR spectroscopy for detecting and characterizing progressive degenerative changes in articular cartilage.
NIR spectroscopy is a vibrational spectroscopic technique that is sensitive to specific molecular species containing CH, NH, OH and SH bonds, which constitute the fundamental chemical structure of biological tissues. NIR has been shown to be sensitive to micro- and macroscopic properties of cartilage^[@CR10],\ [@CR11],\ [@CR19],\ [@CR20]^, and a typical spectrum incorporates latent information on structural, compositional and morphological properties of the tissue. In addition, NIR spectroscopy is a rapid, non-destructive optical technique that penetrates deep into soft tissues^[@CR21]^, permitting full-depth cartilage probing^[@CR22],\ [@CR23]^. The potential of NIR spectroscopy for non-destructive probing of articular cartilage is currently gaining research attention^[@CR7]--[@CR14],\ [@CR19],\ [@CR24],\ [@CR25]^, and its capacity for evaluation of engineered cartilage has been demonstrated^[@CR26],\ [@CR27]^.
Earlier, we demonstrated the potential of NIR spectroscopy for estimating articular cartilage Mankin score from its spectral response, with respect to differentiating between types and severity of cartilage degeneration^[@CR7]^. However, no study has assessed the capacity of this optical method for monitoring progressive degenerative changes in cartilage. In this study, we hypothesized that NIR spectroscopy is capable of detecting and characterizing degenerative changes in articular cartilage, evaluated histologically and biochemically via Mankin score and glycosaminoglycans (GAG) content analyses, respectively. Multivariate techniques for classification (principal component analysis -- PCA, and support vector machines -- SVM) and regression (partial least squares regression -- PLSR) combined with variable selection were utilized for investigating changes/differences in the NIR spectrum associated with disease progression relative to the Mankin score and GAG content of articular cartilage.
Methodology {#Sec2}
===========
Animals {#Sec3}
-------
All animal experiment and protocols were approved by the Ethics Committee of Queensland University of Technology. The animal experiment and protocols were performed in accordance with relevant guidelines and regulations of the aforementioned committee. Male Wistar rats (n = 12, 8--10 weeks old) were purchased from the Animal Resource Centre (Perth, Western Australia, Australia), each animal weighing approximately 320 g. The animals were housed under conditions that included a controlled light cycle (light/dark: 12 h each) and controlled temperature (23 ± 1 °C), and were allowed to habituate themselves to the housing facilities for at least 7 days before surgeries.
Rat OA model and sample preparation {#Sec4}
-----------------------------------
Experimental osteoarthritis (OA) was induced in the rats by surgical removal of the medial meniscus (meniscectomy, MSX) of the right knee as described in our previous studies^[@CR7]^. The left knees were left intact and used as controls (sham). The animals were euthanized at four time points: 1, 2, 4, and 6 weeks (n = 3 animals/week) post-surgery and both knee joints, injured OA and control (sham) were removed by dissection. Subsequently, NIR spectral measurements were acquired from the tibial and femoral medial and lateral condyles of each joint. The first animal in week 1 post-injury was excluded from the study as a result of experimental error, resulting in a total of 58 measurement locations (**n** ~**sham**~ = 14; **n** ~**w1**~ ** = **8; **n** ~**w2**~ = 12; **n** ~**w4**~ = 12; **n** ~**w6**~ = 12). Although 44 sham sample locations were available, only 14 randomly selected locations were used in order to have similar number of samples from both sham and different diseased joints. The sham samples were randomly selected to include at least one sample location per animal. Following NIR spectral acquisition, the knee joints were processed for histological staining and sulphated glycosaminoglycan (sGAG) assay analysis.
NIR spectroscopy {#Sec5}
----------------
Diffuse reflectance NIR spectroscopy was performed using a Bruker MPA™ FT-NIR (Fourier Transform NIR) spectrometer (Bruker Optics, Germany), with detector spanning the full NIR spectral range (4,000--12,500 cm^−1^). The spectrometer was equipped with a custom-made fibre optic probe (dia. = 5 mm, optical window = 2 mm) consisting of seven 600 µm fibres: six peripherally positioned for transmitting the NIR light, and one centrally placed for collecting the diffusely reflected light from the tissue. The spectrometer was connected to a PC running OPUS 6.5 software (Bruker Optics, Germany) for data acquisition.
In preparation for spectral measurement, each joint is firmly held in a custom-built rig as described in our previous study^[@CR7]^. Prior to sample scanning, a reference spectrum was taken from a spectralon reflectance standard -- *SRS-99* (Labsphere Inc., North Sutton, USA). Spectral data was then obtained over the full wavelength range at 8 cm^−¹^ resolution, with each spectrum consisting of 16 co-added scans. The location of NIR measurement was visually noted to ensure that further analyses were conducted on tissue extracted from the same region where spectral data were acquired.
Morphological and histological characterization of OA samples {#Sec6}
-------------------------------------------------------------
After NIR spectroscopy, the joints were fixed in 4% paraformaldehyde and decalcified in 10% EDTA over a period of 2--3 weeks. Following decalcification, cartilage sections (surface-to-bone) from the region that was subjected to NIR spectroscopic probing were carefully extracted for histological evaluation based on Mankin score. After dehydration and paraffin embedding, two serial 5 μm sagittal sections obtained at 100 μm intervals from non-weight-bearing and weight-bearing regions, were cut from the joints and stained with safranin O--fast green. For Safranin-O/Fast Green staining, the paraffin-embedded sections were counterstained with Haematoxylin before being stained with 0.02% aqueous Fast Green for 4 min (followed by 3 dips in 1% acetic acid) and then 0.1% Safranin-O for 6 min. The slides were then dehydrated and mounted with crystal mount medium. OA severity in the joints was evaluated according to the modified Mankin histological grading system^[@CR6]^, and Mankin score was assigned for each sample location by three independent assessors. The Mankin score assesses structural integrity (0--6 points), cellularity (0--3 points), matrix staining (0--4 points), and tidemark integrity (0--1 points), with a maximum score of 14 points. The final score for each sample location was determined as the most severe histological change observed in multiple sections. In the case where the scores were different among the assessors, the highest Mankin score was selected. The inter-assessor agreement was assessed using the kappa (κ) coefficient, a chance-corrected estimate of agreement. κ values of 1.00--0.81 indicate excellent agreement, 0.80--0.61 substantial agreement, 0.60--0.41 moderate agreement, 0.40--0.21 fair agreement and 0.20--0.00 slight agreement^[@CR28]^.
Biochemical quantitation of GAG content {#Sec7}
---------------------------------------
Sulphated GAG (sGAG) assay was performed based on a protocol provided in the Blyscan sulfated Glycosaminoglycan assay kit (Biocolor Life Science Assays; Labtek, West Ips | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
Food poisoning of bacterial origins is widespread and a considerable public health concern both in the US and worldwide. In the US alone, the Centers for Disease Control and Prevention estimates that 9.4 million Americans contract foodborne illness each year \[[@B1]\]. Foodborne bacterial contaminants such as *Salmonella spp.*, *Listeria* *spp.*, *Campylobacter* *spp.*, and *Escherichia coli* (*E. coli*) account for a considerable portion of these cases, and these four pathogens are responsible for many of the most deadly outbreaks \[[@B2],[@B3]\]. *E. coli* strains expressing Shiga toxin (Stx), known as STEC (Shiga toxin-producing *E. coli*), can result in a wide variety of clinical manifestations, ranging in severity from innocuous diarrhea to hemorrhagic colitis and life-threatening hemolytic uremic syndrome (HUS) \[[@B4]\]. Phage encoded Stx is among the most important virulence factors for enterohaemorrhagic *E. coli* (EHEC) \[[@B5],[@B6]\] and enteroaggregative hemorrhagic *E. coli* (EAHEC) \[[@B7],[@B8]\]. Many serotypes of EHEC, a class of pathogenic *E. coli* that can cause bloody diarrhea, possess one or several *stx* genes. Enteroaggregative *E. coli* (EAEC) are characterized by their ability to attach to cells which line the intestine; EAHEC additionally have the ability to cause bloody diarrhea \[[@B9]\]. The O104:H4 strain of *E. coli* responsible for the most deadly recent outbreak of STEC in Germany (2011) is classified as EHAEC (or EAEC) and possesses a *stx* gene (*stx2*) \[[@B10]\].
The diversity of STEC strains, both in the genes repertoires they possess and the virulence factors they encode, is considerable. Although the *E. coli* O157:H7 serotype is the most infamous, non-O157 serotypes are responsible for a considerable number of STEC outbreaks. Six O groups (O26, O45, O111, O121, O103, and O145) cause approximately 71% of non-O157 outbreaks \[[@B11]\]. The EAEC strain O104:H4 caused one of the worst *E. coli* incidents in history, a mass outbreak of STEC in Germany in 2011, affecting 3816 people and resulting in 845 cases of HUS and 54 deaths \[[@B7],[@B8],[@B12]\]. These serotypes can harbor one or more *stx* genes, of which there are many varieties. These genes are carried by lambdoid bacteriophages, which can facilitate the transfer of *stx* sequences between STEC serotypes, non-pathogenic *E. coli* \[[@B13]\], and possibly other close relatives to *E. coli* in Enterobactericiae \[[@B14],[@B15]\]. The two main types of Stx include Stx1, which is nearly identical to the toxin from the *Shigella* genus, and Stx2, which is considerably different from Stx1 (only 56.6% amino acid identity between A subunits without signal sequences).
Like several other bacterial toxins, Stx has an AB~5~ structure: the catalytic A subunit is delivered to target cells by a B subunit pentamer. The B subunit pentamer binds the glycolipid receptors globotriaosylceramide (Gb3Cer) and/or globotetraosylceramide (Gb4Cer) on the surface of target cells, allowing entry of the A subunit which then inactivates ribosomes via its *N*-glycosidase activity \[[@B16],[@B17]\]. Although Stx1 seems to be more toxic to Vero cells \[[@B18]\], Stx2 is the much more potent toxin *in vivo*: Stx2 is around 100 times more toxic to mice than Stx1. Stx2 seems to have comparable catalytic activity to Stx1 \[[@B19]\]. The A and B subunits of Stx1 and Stx2 possess N-terminal signal sequences which facilitate their transport to the periplasm, where they assemble into mature toxin \[[@B20],[@B21]\]. Expression of Stx is driven by a late-phase phage promoter, which is strongly activated upon induction of the bacterial SOS response. Expression of Stx1 is additionally dependent upon a bacterial promoter that is responsive to iron concentration \[[@B22]\]. The SOS response also initiates lysis of *E. coli* cells by the phage, resulting in release of the toxin. Some antibiotics, such as the quinolones (e.g., ciprofloxacin), exacerbate the effects of Stx toxicity, presumably by inducing and releasing large amounts of toxin at once \[[@B23],[@B24]\]. Treatment of STEC by these antibiotics might actually worsen the symptoms of STEC infections \[[@B25]\]. Because of this, there are currently no widely accepted antibiotic treatments of STEC infections, although proper antibiotic treatment may ultimately improve the prognosis of patients with the potentially life-threatening HUS \[[@B26]\].
Within each Stx type (Stx1 and Stx2), there are a number of subtypes which vary in sequence, specificity, and toxicity. There are 3 characterized subtypes of Stx1 (Stx1a, Stx1c, and Stx1d) and 7 subtypes of Stx2 (Stx2a, 2b, 2c, 2d, 2e, 2f, and 2g) \[[@B27]\]. The subtypes of Stx1 are relatively conserved at the amino acid level, whereas those of Stx2 can be more diverse. However, the Stx2a, Stx2c, and Stx2d subtypes are very similar to each other, and these subtypes are typically associated with HUS \[[@B18],[@B28]\]. Stx2b, Stx2e, Stx2f, and Stx2g are less commonly found in serious human disease, although Stx2e can cause edema disease in neonatal piglets \[[@B29]\]. Stx2f (found mostly in avian isolates) \[[@B30]\] is the most unique of the Stx2 subtypes (73.9% identity to Stx2a in the A subunits), followed by 2b (93.3%), Stx2e (93.9%), and finally Stx2g (94.9%). Differences among the B subunits determine each subtype's receptor specificity. Stx2a, Stx2c, and Stx2d bind preferentially to Gb3Cer, while it has been reported that Stx2e prefers Gb4Cer (but can also bind Gb3Cer) \[[@B31]\]. Several amino acids in the C-terminus of the B subunit are critical for determining receptor preference. When the double mutation Q64E/K66Q is made to the Stx2e B subunit, it loses its ability to bind Gb4Cer, and has a receptor preference analogous to Stx2a \[[@B32]\]. The B subunit of Stx2f has Q64/K66 like Stx2e, and can bind both Gb3-LPS and Gb4-LPS, which are mimics of Gb3Cer and Gb4Cer, respectively \[[@B33]\].
Most Stx2 detection kits (both PCR and immunoassays) are optimized to Stx2a, and cross-react with closely related Stx2c and Stx2d. However, many do not recognize the divergent Stx2b, Stx2e, and Stx2f subtypes. Antibodies that recognize Stx2f have been reported, but few are commercially available and they are generally sold only as components of an assay kit, making them difficult to use as research tools and very expensive. Whether there is a reliable immunological method for detecting Stx2f is still a matter for debate. One of the primary means for detecting Stx1 and Stx2, the Premier EHEC kit from Meridian Biosciences, has been reported to detect Stx2f in two studies \[[@B30],[@B34]\] but is insensitive to Stx2f in another \[[@B6]\]. A reverse passive latex agglutination assay (VTEC-RPLA) has repeatedly been shown to recognize Stx2f, but the sensitivity of this assay to Stx2f is unknown (Denka Seiken, Japan) \[[@B30]\]. In this study, we detail and characterize a group of novel monoclonal antibodies (mAbs) that react robustly and uniquely to Stx2f. With these antibodies, we have developed an immunoassay for simple detection of the Stx2f subtype.
Materials and Methods {#s2}
=====================
Ethics Statement {#s2.1}
----------------
All procedures with animals were carried out according to institutional guidelines for husbandry approved by the Animal Care and Use Committee of the U.S. Department of Agriculture, Western Regional Research Center (USDA ACUC Protocol 09-J-10). Mice were euthanized using rapid cervical dislocation to minimize suffering.
*E. coli* strains and growth conditions {#s2.2}
---------------------------------------
Strains expressing Stx2a (RM10638) and Stx2f (RM7007) as well as a control strain (K12) were grown as previously described \[[@B33]\]. Briefly, *E. coli* strains were inoculated into 10 mL of LB overnight at 37°C with agitation, then diluted 1/10 into 500 mL LB with 50 ng/mL mitomycin C (MMC) (Sigma-Aldrich, St. Louis, MO) and grown | {
"pile_set_name": "PubMed Central"
} |
Background
==========
Every scientific field that processes information with the aid of computers needs to maintain and preserve its technical illustrations in a machine-readable fashion for later reuse. For this, the structure of an illustration has to be decomposed into its geometric primitives. The more previous knowledge of the image content is available to the computer, the less errors will occur during the decomposition process. Computer programs today digitally capture and archive decades-old architectural drawings, for which the usage of symbols, icons and font types is standardized. Conversely, no computer program can automatically convert arbitrarily shaped phylogenetic trees from an illustration into a machine-readable expression, e.g., the Newick format \[[@B1]\]. The styles in which phylogenetic trees have been published are as manifold as are the software packages used for the creation of the trees and the pictures. A comprehensive list of such programs is published in \[[@B2]\]. Because there are no strict design rules, a program intended for the recognition of arbitrary trees must not assume any previous knowledge beyond the existence of a depicted phylogeny.
TreeSnatcher Plus (Figure [1](#F1){ref-type="fig"}) is not the first program aimed at the digitization of phylogenies. Indeed, TreeThief \[[@B3]\] was the first application that converts a tree image into a computer-readable representation of the tree. It allowed the user to digitize a tree by clicking on each of its nodes in turn. It is restricted to Apple Macintosh computers running Mac OS 9. In 2007, we presented TreeSnatcher \[[@B4]\], an application that identified the topology of an arbitrarily shaped tree (e.g., a figure from a publication) semi-automatically with user interaction. However, it required the user to pre-process an image using an external drawing package, to follow a strict succession of program stages and lacked any Undo functionality. Finally, the program TreeRipper by Joseph Hughes \[[@B5]\] automatically converts images of rectangular trees that fulfil a strict set of criteria into the Newick format. However, TreeRipper's success rate is relatively low, with only about one third of sample images converted correctly \[[@B5]\].
{#F1}
Using already published trees in research projects would be trivial if all phylogeny related data were also published in open-access online repositories, e.g., TreeBASE \[[@B6]\], MorphoBank \[[@B7]\], or Dryad \[[@B8]\]. Leebens-Mack et al. \[[@B9]\] propose a roadmap for the development of minimal reporting standards for phylogenetic analyses, MIAPA (Minimal Information about a Phylogenetic Analysis). They maintain a website on which they discuss potential barriers to re-use data from scientific analyses \[[@B10]\]. In principle, electronic data could also be obtained from the authors. This obvious approach appears not to be practical. In an example from another field of study, 73% of the authors refused to share their data when approached \[[@B11]\].
Thus, to reuse most published phylogenetic results, it appears that reliable digitization of tree images is currently the only realistic option.
Implementation
--------------
TreeSnatcher Plus is an extended and fully re-conceptualized version of TreeSnatcher; it is both easier to use and more accurate than its predecessor. The new program features a graphical user interface that is based on the JAVA Swing API. A more flexible workflow is complemented with multiple Undo functionality and the possibility to restore the program state (\'snapshot\'). The user can now pre-process any image within TreeSnatcher Plus, selecting from a full range of pre-processing tools. The current state of processing can be saved as an image that may contain different layers of visual information. The program calculates the branch lengths in freeform and skewed rectangular trees and can mix calculated and user defined branch lengths. Additionally, the user can modify an existing tree or to construct a new tree.
The application opens image files in the formats PNG, JPG/JPEG or GIF. The PDF format is currently not supported, but tools for the extraction of images from PDF documents are readily available (e.g., the Xpdf suite for Linux operating systems \[[@B12]\]). The program offers the following pre-processing tools, most of which were modified from standard algorithms \[[@B13]\]: pencil, rubber, line, fill, stencil, histogram stretch, colour reduction, gray-scale conversion, local and global thresholding, colour manipulation, inversion, median and minimum filter, blurring and sharpening, lightening and darkening, and thinning \[[@B14]\].
Prior to automated node placement, the user has to prepare the image within TreeSnatcher Plus, analogous to the requirements of its predecessor \[[@B4]\]. In particular, the tree has to be converted into a line drawing without intersections with text or graphics unrelated to the tree topology. If the image does not meet those requirements when the automatic node placement is issued, the tree topology is unlikely to be identified correctly.
Working with TreeSnatcher Plus takes place along a general succession of global tasks, which are executed at least once, either on the whole image or on parts. The user supervises all image manipulations and recognition tasks performed by the program, makes corrections and repeats steps if necessary. This process is explained in detail in the tutorials accompanying the program.
The workflow is thus as follows:
1\. The program reads the specified image file. The user trims and cuts the image at will. In this way, one can select sub-trees or a subset of taxa from the image.
2\. Image pre-processing: The user prepares the image with the pre-processing tools.
3\. Binarization: The user thresholds the image to ensure that the foreground is black and the background is white and both are clearly separated.
4\. Skeletonization: The user semi-automatically thins the foreground of the image portion that contains the tree. This is necessary to enable the program to find the paths between the line intersections (step 8).
5\. Foreground flooding: The user marks a position in the tree. The program colours (\'floods\') the foreground reachable from there. In subsequent steps, the flooded area will be treated as the tree. Everything else is ignored.
6\. Inner nodes and outer nodes placement: The program suggests locations for line intersections and end of lines. These represent branching locations and tips. A logical node is assigned to each location. The user can move, remove and add nodes. In the thinned image, black pixels adjacent to exactly one other black pixel become a tip location. Black pixels adjacent to at least three black pixels are candidates for a branching location. If several candidate pixels are adjacent to each other, the branching location is averaged from their positions.
7\. Choice of tree type: The program can distinguish and calibrate freeform and rectangular trees. The choice of the tree type influences how the program treats branch lengths. The tree type must be chosen prior to step 8.
8\. Recognition of branches: The program traces gapless foreground paths between each pair of nodes in order to find the branches of the tree. If there are several candidate paths, the shortest is selected. If a branch is missing or wrong, the user either modifies the image with the drawing tools and repeats step 8, or he/she drags a new branch and manually specifies its length.
9\. Determination of branch lengths: The accuracy depends on the congruence of thinned tree structure, node placement, and original tree. For freeform trees, the branch length in pixels is based on the entire foreground path between the two defining nodes. For rectangular trees, the branch length is the sum of the lengths of the horizontal path segments. The user may type in self-defined branch lengths and mix them with the calculated lengths. The tree can be scaled using a line of known length in the image, e.g., a scale bar.
10\. Assignment of species names: The user right-clicks on each leaf node in turn in order to type in the corresponding species name.
11\. Choice of the tree root: The program, assisted by the user if necessary, chooses the inner node based on which the rooted Newick expression is calculated.
12\. Construction of the Newick string: The program calculates and displays the Newick tree code for the tree depicted. The user may save it to the clipboard or export it into a text file.
Results
=======
An image that shows a uniformly dark, rectangular phylogenetic tree on a uniformly light background in sufficient resolution, without foreground elements overlapping with the tree, will need almost no pre-processing. If the user then settles for consecutively numbered tip labels, the whole recognition process can be finished within minutes. However, in general there will be image portions which require manual correction, e.g., a branch of the tree is not clearly separated from other foreground elements such as lettering. TreeSnatcher Plus offers a special tool that surrounds black drawings with a white border.
For the determination of branch lengths, the program needs to assess the path length in pixels between branching positions on the skeletonized foreground. Additionally, it must reliably detect bends in a branch and horizontal branch portions. These tasks work better if the structures come with a sufficiently high number of pixels. The better the branches in the original image and those in the skeletonized image align, the | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-marinedrugs-15-00196}
===============
Under exposure of environmental ultraviolet (UV) radiation, certain living organisms have developed characteristic defense mechanisms to diminish the adverse effects of UV radiation, including DNA damage and the production of reactive oxygen species (ROS) \[[@B1-marinedrugs-15-00196],[@B2-marinedrugs-15-00196],[@B3-marinedrugs-15-00196]\]. Recent studies have reported that many photosynthetic marine organisms can synthesize secondary metabolites with UV-absorbing capacity such as mycosporine-like amino acids (MAAs), as one of the most effective UV protection mechanisms \[[@B4-marinedrugs-15-00196],[@B5-marinedrugs-15-00196]\]. These compounds have characteristic chemical structure with either an aminocyclohexenone or an aminocycloheximine ring, which provides them with ability to absorb UV radiation and be resilient to DNA damage by harmful UV radiation. MAAs have been found in a wide range of marine organism exposed to environmental UV radiation, and the chemical structures of more than 30 different MAAs have been characterized \[[@B6-marinedrugs-15-00196],[@B7-marinedrugs-15-00196],[@B8-marinedrugs-15-00196],[@B9-marinedrugs-15-00196]\]. Although a number of recent reports for MAAs in various marine organisms refers mostly to their UV protective ability, scientific evidence is increasingly accumulating that MAAs contribute other functional roles such as antioxidant activity and osmotic regulation. For example, porphyra-334, which has characteristic chemical structure for UV absorption ([Supplementary Materials](#app1-marinedrugs-15-00196){ref-type="app"}, [Figure S1](#app1-marinedrugs-15-00196){ref-type="app"}), exerts potent antioxidant activity and prevents cellular damage caused by UV-induced ROS with free radical scavenging capacity \[[@B10-marinedrugs-15-00196],[@B11-marinedrugs-15-00196],[@B12-marinedrugs-15-00196]\]. This fact suggests that MAAs can play crucial roles as antioxidant molecules to modulate cellular processes affected by ROS, such as DNA damage and apoptosis. In addition to antioxidant activity of MAAs, these compounds could regulate osmotic pressure within the cell \[[@B13-marinedrugs-15-00196]\]. To maintain the essential osmotic balance, most organisms accumulate small weight molecules without charge into cells, which can function as so-called "osmotic solutes". In this aspect, MAAs, which are small uncharged organic molecules, can contribute to intracellular osmotic pressure and provide organism with capability to adapt to extreme environments with high salt concentrations. Despite abundant ecological and physiological studies available on the functional roles of MAAs, our understanding of their roles at the molecular level remains poor. Recently, molecular biological studies on the roles of MAAs have been just begun. For example, MAAs from green algae protect skin against UV-induced skin damage through recovery of UV-suppressed expression of skin aging-related genes \[[@B14-marinedrugs-15-00196],[@B15-marinedrugs-15-00196],[@B16-marinedrugs-15-00196],[@B17-marinedrugs-15-00196],[@B18-marinedrugs-15-00196],[@B19-marinedrugs-15-00196]\]. In addition, they function as effective drugs on immunomodulatory effects \[[@B20-marinedrugs-15-00196]\] and the wound healing process in human keratinocytes through the activation of the various genes, such as focal adhesion kinases (FAK), extracellular signal-regulated kinases (ERK), and c-Jun *N*-terminal kinases (JNK) \[[@B21-marinedrugs-15-00196]\]. Nevertheless, there is a need for extensive molecular mechanism studies to explore the photoprotective roles of MAAs so that a range of industrial and pharmaceutical applications can be found. Many studies have focused on marine organisms as a source of natural bioactive molecules having a photoprotective role, their biosynthesis and commercial application \[[@B4-marinedrugs-15-00196],[@B5-marinedrugs-15-00196]\]. In this aspect, MAAs have attracted considerable research attention in both industrial and pharmacological fields. Recently, we have demonstrated that the expression of skin aging-related genes such as procollagen C proteinase enhancer (PCOLCE), elastin and involucrin were modulated by porphyra-334 in a dose dependent manner \[[@B11-marinedrugs-15-00196]\], and porphyra-334 significantly attenuates UV-induced apoptosis in HaCaT cells through the activation of caspase pathway \[[@B22-marinedrugs-15-00196]\]. In the present study, we firstly investigated the comprehensive molecular networks that are associated with the functional roles of porphyra-334 as an UV-absorbing substance in human keratinocyte.
2. Results and Discussion {#sec2-marinedrugs-15-00196}
=========================
2.1. Porphyra-334-Modulated Differentially Expressed Genes (DEGs) {#sec2dot1-marinedrugs-15-00196}
-----------------------------------------------------------------
Gene expression profiling by high throughput sequencing was performed to investigate the effect of porphyra-334 on UV-modulated transcriptome in UV-exposed HaCaT cells. We focused on the identification of genes whose expression was significantly altered in the porphyra-334 treated group compared with the non-treated group (*p* value \< 0.05). The application of this threshold led to the identification of 447 DEGs, of which 267 were over-expressed and 180 were under-expressed in porphyra-334 treated group ([Figure 1](#marinedrugs-15-00196-f001){ref-type="fig"}). The largest number of up- and down-regulated genes, 103 and 71, exhibited about two-fold increase in their transcriptional levels (2 ≤ x \< 3) or less than threefold decrease (0.3 ≤ x \< 0.4 or 0.4 ≤ x \< 0.5), respectively ([Figure 2](#marinedrugs-15-00196-f002){ref-type="fig"}). To gain a better understanding about their biological function, gene set enrichment analysis was performed to identify significantly over- and under-represented gene ontology (GO) categories ([Supplementary Materials](#app1-marinedrugs-15-00196){ref-type="app"}, [Tables S1 and S2](#app1-marinedrugs-15-00196){ref-type="app"}, respectively). Approximately 17% of up-regulated genes in porphyra-334 treated cells were in the top five canonical biological processes ([Figure 2](#marinedrugs-15-00196-f002){ref-type="fig"}B) which were strongly associated with the immune response, regulation of transcription and RNA metabolic process ([Figure 2](#marinedrugs-15-00196-f002){ref-type="fig"}A). Genes highly activated in response to the treatment of porphyra-334, including *Pla2g7*, *Pitx2*, *Gpr34* and *Fbf1* genes, are specifically expressed in the immune response or Wnt signaling pathway \[[@B22-marinedrugs-15-00196],[@B23-marinedrugs-15-00196],[@B24-marinedrugs-15-00196],[@B25-marinedrugs-15-00196]\] which is necessary for proper development and regeneration of various tissues including bone, heart and muscle. In addition, it has been known that this pathway was clinically important because its dysregulation can lead to various diseases, including breast, prostate, glioblastoma, and diabetes \[[@B26-marinedrugs-15-00196],[@B27-marinedrugs-15-00196],[@B28-marinedrugs-15-00196],[@B29-marinedrugs-15-00196]\]. The expression of these genes was verified by qRT-PCR analysis ([Supplementary Materials](#app1-marinedrugs-15-00196){ref-type="app"}, [Figure S2](#app1-marinedrugs-15-00196){ref-type="app"}). In contrast, approximately 14% of the total down-regulated genes in porphyra-334 treated cells involved in the top five biological process ([Figure 2](#marinedrugs-15-00196-f002){ref-type="fig"}A) which were strongly related to cell-cell adhesion, biological adhesion and regulation of transcription ([Figure 2](#marinedrugs-15-00196-f002){ref-type="fig"}B). Among them, the significantly down-regulated genes, such as *Rasd1*, *Fgf12*, *Nkx2-5* and *Cpeb1*, were involved in these categories. Notably, they are directly or indirectly involved in Notch signaling pathway \[[@B30-marinedrugs-15-00196],[@B31-marinedrugs-15-00196],[@B32-marinedrugs-15-00196],[@B33-marinedrugs-15-00196],[@B34-marinedrugs-15-00196],[@B35-marinedrugs-15-00196]\], which is evolutionarily conserved and responsible for cell fate determination in the developing embryo and mature tissue in a highly tissue context- and cell- type-dependent manner. For example, Rasd1 has been shown to interact with EAR2 \[[@B30-marinedrugs-15-00196]\], the orphan nuclear receptor, which can activate Notch signaling \[[@B31-marinedrugs-15-00196],[@B32-marinedrugs-15-00196]\]. In addition, Notch signaling can be promoted downstream of FGF in developmental processes such as stem cells \[[@B33-marinedrugs-15-00196]\], suggesting that FGF12, a component in the FGF signaling pathways, can be involved in Notch signaling. Many studies demonstrate that Notch signaling increases tumor cell proliferation and is activated in the cancer stem-cell pool \[[@B36-marinedrugs-15-00196],[@B | {
"pile_set_name": "PubMed Central"
} |
Background
==========
Treatment of children with the acquired immunodeficiency syndrome (AIDS) using antiretroviral drugs (ARVs) has been a major challenge in the fight against the human immunodeficiency virus (HIV), especially in resource-constrained settings. In many African countries, the shortage of human resources for health is one of the major barriers to achieve universal access to HIV treatment and care. In particular, reliance on doctor and hospital-centered care hampers the ability to scale-up antiretroviral treatment (ART), and task shifting, the process of delegation of tasks to health workers with lower qualifications, has become a recognized strategy \[[@B1]-[@B4]\].
While there have been a number of studies showing good outcomes in treating pediatric populations with ARVs in resource-constrained settings \[[@B5]-[@B16]\], these programs have essentially been carried out in hospital settings and/or with significant physician involvement. Although nurse-based ART provision in health centers could increase the coverage of ART, it is not clear whether this compromises quality in terms of outcomes. There are no published studies demonstrating detailed methods and treatment outcomes of children in health centers staffed by nurses. In particular, there is limited published information on how to address the psychosocial issues related to HIV, a major challenge for pediatric ART programs \[[@B17]\], in settings with few specialized personnel available.
As in most African countries, Rwanda has an acute shortage of physicians and is relatively better resourced with nurses \[[@B18]\]. In a recent simulation model, it was estimated that, relying on a physician-centered service provision model, 51% of the total physician capacity of the government of Rwanda would be absorbed by HIV care and treatment by the end of 2008 \[[@B19]\]. Thus, it is completely logical to make greater use of nurses to manage HIV care, but the question remains whether doing so leads to good quality outcomes, especially for pediatric patients.
This report describes the nurse-centered pediatric ARV program implemented in two government health centers in Kigali, Rwanda, with details of its psychosocial aspects and treatment outcomes.
Methods
=======
Design
------
Retrospective analysis of routinely collected outcomes from the ARV program in two health centers in Kigali, combined with interviews with key health center and Médecins Sans Frontières (MSF) staff. MSF reports since program inception were also reviewed.
Setting
-------
Rwanda, with a population of around 9 million inhabitants, has an overall HIV prevalence of 3% and more than 7% in urban areas \[[@B20]\]. The national ART program, launched in 2003, was first established mostly in the district hospitals, with subsequent decentralization to the health centers. From 2004 on, a gradual scaling-up was seen. The latest estimate in 2006 by TRAC (Treatment and Research AIDS Center) of the number of HIV-infected children was 13,901 with half of them (6951) in need of ARVs \[[@B21]\]. By the end of May 2007, almost half (3255) had benefited from ART.
Health worker distribution in Rwanda and their roles within the HIV care program
--------------------------------------------------------------------------------
With one physician/50,000 habitants and one nurse/3900 habitants, Rwanda is clearly short of physicians but is relatively better resourced with nurses \[[@B22]\]. In addition, 80--90% of the population is living in rural areas and mainly relies on care from primary health centers, staffed by nurses. Up to now, HIV/ART care delivery has essentially been provided by physicians, with nurses only playing a supporting role (see Table [1](#T1){ref-type="table"}). In the traditional model, physicians were responsible for all tasks. Equally, at primary health centers, the bulk of medical care was provided by the visiting physician, who was based in the district hospital. When relating to HIV care for children, this reliance on physicians/hospital-based care was even more pronounced as it was believed to be more difficult care.
######
Traditional and modified tasks for nurses and physicians within the HIV/ART care program
**MD-CENTERED** **NURSE-CENTERED**
------------------------------------ ----------------- -------------------- --- -------
**Pre-ART care**
Initial physical exam/staging X X
Ordering CD4 count X X X
Assessment of ART eligibility X X
FU of non-eligible patients X X
CTX refill X \-^b^
Complex medical cases X X
**ART care**
Ordering lab tests X X X
Interpretation of lab tests X X
ART initiation and FU
Non-complex cases X X
Complex cases^a^ X X
ART refill X \-^b^
Register keeping/reporting X \-^b^
Filing of results/medical records X \-^b^
Training/mentoring X
Supervision X
^a^Complex cases included those with advanced HIV disease, severe/persistent opportunistic infections, severe ART side-effects, suspicion of ART failure, severe or recurrent non-adherence to ART.
^b^Activities taken over from the ARV nurse by other staff.
ART: antiretroviral therapy; FU: follow-up; CTX: cotrimoxazole; MD: medical doctor
In the Rwandan health system, nurses are classified into three levels according to their level of training: 1) A3 nurses may have no/minimal secondary training and minimal health training; 2) A2 nurses (the bulk of the health workforce) have two years of secondary education and two years of nursing training; 3) A1 nurses have received two additional years of nursing training after finishing secondary school \[[@B22]\]. Whereas initially A1 nurses were rarely found at health centers, this is gradually changing. Currently, no other non-physician clinician cadres are being trained.
Study sites
-----------
The two clinics in this report were Kimironko and Kinyinya health centers, located in Kigali. Kimironko was an urban government health center with a catchment area of about 75,000 people while Kinyinya was semi-rural, being located at the outskirts of Kigali, with an estimated population of 17,000.
In addition to routine health care, the health centers provided comprehensive HIV care and started offering ARVs at a decentralized level, beginning in October 2003 in Kimironko and followed in January 2004 in Kinyinya. They were among the first services in the country to offer ART. By July 2007, 3252 patients had been started on ART within these two clinics and of these, 332 children were enrolled in the ART program. These two clinics have been supported by MSF since 2002.
Study population
----------------
The analysis included all children enrolled in the HIV program who qualified for ARVs from the launch of the ART program from October 2003 till Jan 1/2007. With data collected until June 30/2007, all children had been on ART for at least six months. See Figure [1](#F1){ref-type="fig"} for details about how children were selected for ARVs and their treatment paths.
{#F1}
Description of the Pediatric HIV program
----------------------------------------
### National government\'s commitment and external support
The pediatric program in the two clinics was part of the Rwandan national ART program, essentially run by government health care staff. The national program has seen a successful scaling-up over the last years, organized through the National AIDS Control Commission (NACC) and TRAC. A constructive collaboration with various international partners has taken place, with substantial financial support provided by the Global Fund to fight AIDS, Tuberculosis and Malaria. The government\'s commitment was demonstrated by providing additional nursing and laboratory staff as well as ongoing laboratory services, training and ARV procurement. MSF\'s contributions were essentially aimed at increasing the clinics capacity for ARV care and included training and supervising staff, refurbishing clinic buildings, upgrading the labs and providing financial incentives.
### Nurse-based treatment and care
#### Increase and retention of nursing staff
At the launch of the HIV program in 2002, the health centers were poorly staffed. The increased staffing by the Ministry of Health was a critical factor. Whereas the health center\'s staff included 7 trained nurses before the launch of the HIV program in 2002, this had gradually increased to 28 by the end of 2004 (mainly A2 nurses), when scaling-up began. Overall, around 50% of the entire staff\'s time was dedicated to HIV care. To compensate for the substantial increase in work-load associated with the fast scaling-up of the ART program, a performance-based financing mechanism was put in place, initially backed by MSF.
To avoid overloading the nurses, most of the tasks traditionally performed by nurses were taken over by new or reinforced cadres in the health centers: receptionists for administrative work and data collection/monitoring; counsellors and community support groups for counselling; and lab-staff for blood collection.
#### Training for nurse-based treatment and care | {
"pile_set_name": "PubMed Central"
} |
SEVERAL STUDIES IDENTIFY that the root cause of crowding in the emergency department is "boarding of patients." ([@R1]) This prolific problem involves "holding" admitted or pending transfer patients in the emergency department, resulting in loss of precious bed capacity. A 2009 white paper ([@R2]) by the American College of Emergency Physicians noted that 62.5% of emergency departments (and 85% of those with annual visit volumes more than 50,000) reported boarding ED patients for more than 2 hours. A 2012 American Hospital Association survey ([@R3]) revealed that 38% of hospital emergency departments were operating "at" or "over" capacity.
Numerous downstream effects result from the boarding burden, including loss of capacity to treat the queue of patients who predictably arrive in the emergency department, longer cycle times for emergency department patients, decreased bed utilization, suboptimal quality and safety for boarded patients, and poor perception of quality and confidentiality by boarded patients housed in hallways ([@R4]).
Although flow models such as split-flow can significantly reduce cycle times and throughput intervals ([@R5]), they do not displace or lessen the gravity of the boarding problem. To improve service and quality in the emergency department, hospitals must confront the institutional, systemic problem of boarding to free the emergency department of the undue burden of caring for inpatients. An essential means to achieving this is through the development of hospital-wide flow teams that engage inpatient unit leaders, physicians, and executives to promote the use of validated real-time systems, principals, and processes.
TIME MATTERS
============
Efficient disposition is critical for many reasons. ED consumers desire timely care. When ED beds are occupied by patients holding for admission, front-end flow is impacted. Patients then leave without treatment, perhaps the ultimate quality indicator for emergency care. In fact, many patient complaints across the industry are often rooted in excessive wait times to see a provider.
In addition, time-sensitive treatments are dependent on efficient ED throughput. As a result, the Centers for Medicare & Medicaid Services (CMS) now collects and reports throughput metrics, such as NQF 497 (Admit Decision to ED Departure Time), and has already begun to link throughput performance to reimbursement. (Data collection now will impact 2014 reimbursement.) The current benchmark for best practice is 97 minutes (based upon [hospitalcompare.gov](http://hospitalcompare.gov) benchmarking data between second quarter 2012 to first quarter 2013 ED visits).
The CMS also requires reporting time-sensitive clinical treatments dependent on ED throughput, such as acute myocardial infarction (door to balloon time less than 90 min), acute stroke (time to tissue plasminogen activator less than t3--4 hr), and sepsis: early goal-directed therapy. By connecting improvement efforts to clinical quality to meet best practice standards on these metrics, ED leaders can effectively engage inpatient clinical staff to improve throughput. In addition, physicians and hospitalists are increasingly contractually obligated to meet flow metrics, incentivizing their active partnership in improving throughput in the emergency department.
Facilitating Admissions From the Emergency Department
-----------------------------------------------------
Best practices for facilitating timely admissions from the emergency department include active identification and communication of potential admissions, the use of no-delay nurse reports, and faxed admission reports. However, before requesting assistance from inpatient leaders on back-end flow, it is critical that the emergency department has first addressed front-end and middle flow---those issues that it can address on its own---to ensure credibility with inpatient leaders.
### Identify and Communication Potential Admissions
Once the emergency department has made significant progress with throughput challenges it can impact on its own, it must next focus on proactive communication with inpatient leaders. The ED staff and providers must ensure timely communication to bed management (e.g., patient access, nursing supervisor, director on call) when a decision is made to admit a patient.
It is the emergency department\'s responsibility to ensure that information on the status of admitted ED patients is communicated through the appropriate bed management channels and current in the electronic health record or other bed management systems as applicable. To ensure accurate communication and anticipation of admissions, the ED attending physician and charge nurse should round at least every 4 hr at the ED tracking board to review patients\' status, identify need for admission, and assess ED crowding as well as the need to implement a surge protocol, if applicable.
### Utilizing No-Delay Nurse Reports
No-delay nurse reports reduce time from admit orders to arrival on inpatient units, decrease the potential for handoff errors (because they ensure that both the ED and inpatient nurses have the same information), and increase patients\' perception of care due to timely transfer of care.
A sample process might resemble the following: After the order is written and a request for a bed is made, the ED nurse opens a "transfer of care" report, which is also accessible to the floor nurse. The ED nurse then awaits the patient bed assignment (by monitoring the tracking board). Fifteen minutes after the bed has been assigned, either the unit clerk calls down to the emergency department to accept the patient or the accepting inpatient primary nurse or charge nurse will call to ask questions. In either case, the ED patient is transferred within 15 min of a bed becoming available. No-delay nurse reports are best included in the electronic health record, but a faxed paper report may also be used.
Best Practices for an Effective Hospital-Wide Throughput Committee
------------------------------------------------------------------
Beginning January 1, 2014, The Joint Commission (TJC) revised standards LD.04.03.11 and PC.01.01.01 ([@R7]; which govern patient flow through the emergency department) to include a requirement for goal setting and measurement to mitigate and better manage the boarding of patients. This includes a requirement for individuals to manage patient flow processes to review measurement results to goals and take action to improve patient flow when goals are not achieved.
An effective hospital-wide throughput committee addresses this need by meeting monthly and typically convening 12--15 individuals who can best drive process improvement and remove barriers for admitting patients quickly from the emergency department. It is an interdisciplinary team that typically includes hospitalists, leaders from the emergency department (e.g., director, manager, flow coordinator), and inpatient leaders from critical care, telemetry, and med-surg. "Although we may consider the operational components from the emergency department to inpatient to be a care transition, we must evolve our processes and mindset to one of a team approach to support a patient-centered continuum of care," notes Dan Smith, MD, FACEP, one of StuderGroup\'s medical directors and an expert on ED flow efficiency.
This group may include the environmental services leader, transport leader, admissions leader, administrative supervisor (nursing supervisor), risk manager, and discharge planner/case manager. Attendance by a senior leader sponsor is also important for buy-in and accountability.
The charter of the hospital throughput committee should clearly define its scope and focus. The scope and focus of this committee should promote the creation and monitoring of measurable outcomes that address the above mandates from CMS and TJC. The committee members must not lose sight of the importance to address back-end ED flow as a hospital-wide problem that only this type of interdisciplinary team can correct. The meeting agenda flows from these goals with a review of "wins," priority throughput indicators, clinical quality issues, financial impact from reducing length of stay, and review of the hospital\'s current "throughput dashboard." The purpose of this hospital-wide throughout dashboard is to collect and track current data on key metrics so that the team can identify trends and performance gaps, and when centered around it, teams can ensure that meetings are productive and actionable.
Dashboard data typically include measures such as disposition to admission by unit, disposition to admission by time of day, hospital discharge by time of day, staffing by hour (for ED nursing, environmental services, and hospitalists), and other inpatient admission process times. Process times may include total turnaround time for admitted patients, time of physician order to discharge to patient departure, patient departure to notification of housekeeping, notification of housekeeping to bed clean, bed clean to assignment of new patient to bed, and time of bed assignment to new patient in bed.
The team can also track bed assignment time to report received to ensure that no-delay nurse reports are occurring consistently. To ensure compliance with and tracking of NQF measures as required by CMS, the dashboard should include these metrics as well. Other optional metrics for this dashboard may include environmental service turnaround times, post anesthesia care unit (PACU) hold hours, and ED hold hours/diversion hours (see Figure [1](#F1){ref-type="fig"}).
.](aenj-37-65-g001){#F1}
As each leader reports out on next action steps with dates due, these are captured in the meeting minutes for follow-up. Goals to consider include times for inpatient to discharge, room assigned to occupied, discharge order goals, environmental service turnaround times, PACU hold hours, and ED hold hours.
It is recommended that this committee also assess and evaluate the effectiveness of the surge plan at least every 3 years to ensure that it is producing desired results on the basis of the charter and goals identified by this team. A strong and effective surge plan identifies specific actions for ED, inpatient, administrative, and ancillary leaders through a tiered response. Each of these tiered responses should have specific action items within them for all departments that impact transition of patients out of the ED. Each | {
"pile_set_name": "PubMed Central"
} |
{.258}
{.259}
| {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
Thoracic Insufficiency Syndrome (TIS) is defined as impairment in breathing and/or postnatal lung growth due to spine and thoracic cage deformity in children who are skeletally immature ([@B1]). It is defined by abnormal respiratory function but the specific indices used to identify impairment have not been standardized. Skeletal maturity is defined radiographically by the closure of growth plates in certain bones and indicates that further growth and hence spine and thoracic deformities that progress with growth are less likely to worsen. There is an international registry of more than 8,000 children at risk for TIS maintained by the Pediatric Spine Study Group ([@B2]). As of 2019, \<5% of the patients in this registry had interpretable pulmonary function data. Pediatric pulmonologists are not often intimately involved with the clinical decision making in the management of these patients. Yet their input can be of great value to surgeons, primary care providers, and families regarding the pulmonary status and functional impact of spine and chest wall deformities over time and with treatment.
This chapter addresses the input that pulmonologists can provide at all ages in children with EOS as an example of TIS, as part of an multi-disciplinary team, which ideally includes spine surgeons, pulmonologists, general surgeons, neurosurgeons, pediatric sleep specialists, nutritionists, genetic counselors, physical therapists, and bioethicists. The management of children with TIS begins on first encounter and ends for many with transition to adult care, i.e., over 15--20 years with multiple surgical procedures throughout that time. Pediatric pulmonologists are ideally involved with management questions that arise throughout this time period.
TIS and Etiologies of EOS {#s2}
=========================
TIS is often recognized in the newborn period by respiratory distress associated with hypoplastic thoraces due to inherited skeletal dysplasias. Small chest walls are classified by surgeons as thoracic "volume depletion" disorders due to the small size of the chest wall. Classic examples are Jeune\'s syndrome (asphyxiating thoracic dystrophy) and Jarcho-Levin syndrome (which includes both spondylocostal dysostosis and spondylothoracic dysplasia). Khombourlis has reviewed the more than 100 different skeletal dysplasias that can produce respiratory impairment in infancy ([@B3]). Many of these are lethal without invasive respiratory support in the first year of life. Several surgical techniques to enlarge the chest wall, such as sternal struts, rib-to-rib attachments, and rib-based expandable titanium arcs have been used in small case series to improve lung volumes. A recent review highlights the surgical options for children with hypoplastic thoraces ([@B4]). However case series reporting long-term outcomes are rare and not generalizable to all conditions.
A common condition producing TIS is early onset scoliosis (EOS) which presents before 10 years of age with a coronal curve spine curve \>10 degrees. The coronal degree of spine curvature is measured using the Cobb angle, illustrated in [Figure 1](#F1){ref-type="fig"}. The Cobb angle (and its progression over time) is the primary structural measure used by spine surgeons to make decisions about surgical and non-surgical interventions such as casting and bracing.
{#F1}
The etiologies for EOS include congenital, syndromic, thoracogenic, neuromuscular, and idiopathic scoliosis. *Congenita*l scoliosis is defined by the presence of vertebral and rib structural deformities such as vertebral hemi-vertebrae and failure of segmentation with fused or block vertebrae. These may be associated with multiple fused ribs which either constrain chest wall motion or provide large gaps between ribs that may produce a flail chest syndrome. Many *syndromes*, e.g., VACTERL syndrome, have multiple organ involvement and decisions must be made what to treat first. Up to 12% of children with congenital scoliosis also have congenital heart disease, and these children represent an overlap between congenital and syndromic categories ([@B4]). Children with *thoracogenic* scoliosis are those receiving thoracic surgery at an early age, either for diaphragmatic hernias, rib resections with tumors, pneumonectomies, or even cardiac repair ([@B5]). Up to 30% of children with congenital diaphragmatic hernias will develop subsequent scoliosis ([@B6]). This is compounded by pulmonary hypoplasia, which is worse on one side. Up to 10% of children undergoing thoracotomy for congenital heart disease will develop scoliosis.
The most common form of TIS due to EOS is scoliosis associated with *neuromuscular* diseases that produce spasticity or weakness. More than 90% of children with spinal muscular atrophy types I and II will develop scoliosis ([@B7], [@B8]). The frequency of scoliosis among children with cerebral palsy varies among reports from 5 to 80% ([@B7]). In one large series of 666 children, 17% had mild scoliosis and another 17% had moderate to severe scoliosis ([@B9]). Those with more severe cerebral palsy, based on GMFCS levels of 3--5, had a 50% prevalence with age of onset at 8 years. EOS accounts for \<10% of all scoliosis in childhood, with the vast majority presenting after age 10 years with adolescent idiopathic scoliosis.
*Infantile idiopathic* scoliosis begins before age 3 and can vary in severity on presentation. The posterior rib hump or abnormal posture is often the first finding identified by parents. Respiratory concerns are rare initially but may cause failure to thrive due to increased respiratory work with feeding. In young children (\<2 years) with infantile idiopathic scoliosis and small coronal spine curves (\<30 degrees) there is high rate of reversal to an almost normal spine shape with serial casting treatment over a period of years ([@B10], [@B11]). In these cases, there may be no pulmonary sequelae after orthopedic treatment. However, with larger spine curves, kyphosis, and etiologies for scoliosis other than idiopathic scoliosis, casting/bracing may not be sufficient to correct the deformity, or prevent curve progression and respiratory impairment. Casting is then used as a tactic to delay surgical intervention until the child is older. Thereafter, surgical use of "growth-friendly" expandable distraction rods are used to control scoliosis until pre-adolescence when spine fusion is often undertaken.
The etiology of scoliosis is important as it is one factor that dictates the risk and rate of progression of a spine/thorax deformity over time. Children with fused vertebrae and fused ribs are most likely to progress due to structural deformities ([@B12]). Duchenne\'s muscular dystrophy will produce scoliosis in 90% of boys but does so in young adulthood instead of early adolescence if they are treated early with steroid therapy ([@B13]). SMA I and II have new "natural histories" with the advent of nusinersin and adenoviral gene therapy. Scoliosis may present later in these children than previously reported as SMA-specific treatment becomes more common.
The heterogeneity of etiologies producing EOS has made assessments of management strategies, such as surgical and non-surgical interventions difficult to assess and predict. A classification system to address this heterogeneity has been devised for spine surgeons which includes age of onset, etiology of scoliosis, degree of coronal curve magnitude, degree of kyphosis, and rate of progression of the coronal curve deformity over time ([@B14]). Use of this classification system has enabled surgeons to estimate risk of post-operative complications ([@B15]). However, there are no functional elements in this system, such as pain, nutritional status, or lung function measures. This reflects the frequent lack of effective input by pediatric pulmonologists for these children.
Pathophysiology and Clinical Consequences of EOS and Other TIS Etiologies {#s3}
=========================================================================
The number of children with EOS that have TIS is uncertain due to the vague nature of the definition of TIS. However, there are common pathophysiologic processes regardless of the etiology. The majority have clinical evidence of restrictive respiratory disease. This is manifested earliest as tachypnea associated with activity or exercise and often is identified by families as exercise intolerance or easy fatigability with exertion. Dyspnea, used in one study to determine the functional consequences of EOS among children old enough to perform spirometry, did not occur frequently until FVC as a % predicted using arm span for height fell below 50% ([@B16]). Children with restrictive chest wall disease often adapt by reducing the intensity of their daily activities. They instead become sedentary to avoid dyspnea with activities. Restrictive changes have been measured both as reduced FVC with a normal FEV1 or alternatively by measuring Total Lung Capacity (TLC). Restrictive respiratory mechanics are produced by reduced chest wall compliance due to deformity and perhaps an additional reduction in lung compliance based on reduced lung volume in various lung regions. The reduction in chest wall compliance seems intuitive but data demonstrating this is rare. Motoyama measured total respiratory compliance in children with EOS during anesthesia and found it to be low prior to surgery and lower after titanium struts were attached to the chest in an effort to straighten the spine ([@B17]).
Decreases in total respiratory compliance leads to an increase in respiratory work and caloric expenditure and hence | {
"pile_set_name": "PubMed Central"
} |
Introduction {#S1}
============
All living organisms rely on cellular and physiological mechanisms of homeostasis in order to maintain an internal environment optimal for life and function. Mitochondria are the foundation of cellular homeostasis, *via* their multiple roles in energy production, biosynthesis, calcium regulation and signaling, redox balance, and generation of reactive oxygen species. Not surprisingly, cells have evolved multiple mechanisms of quality control to ensure that mitochondria function at their best. These include protein import ([@B1]), folding and degradation ([@B2]), antioxidant defense mechanisms ([@B3]), mitochondrial turnover *via* autophagy ([@B4]), mitochondrial biogenesis ([@B5]), mitochondrial shape changes and cristae remodeling ([@B6]), and communication with the nucleus to coordinate transcriptional responses ([@B7]).
Emerging evidence indicate that mitochondrial dysfunction is associated with disparate diseases, including aging ([@B8]), neurodegenerative diseases ([@B9]), mitochondrial diseases ([@B10]), obesity ([@B11]), diabetes, and cancer. Although some controversies remain regarding whether functional or dysfunctional mitochondria are responsible for metabolic disorders, there is a resurgence of interest in understanding the mechanisms responsible for such mitochondrial alterations in disease. This review focuses on the molecular regulators of mitochondrial dynamics (organelle's shape and localization) in cancer and metabolic pathologies.
Regulation of Mitochondrial Dynamics {#S2}
====================================
Mitochondria constantly undergo shape and number changes thanks to the two opposing processes of fission and fusion ([@B12]). In turn, changes in gross mitochondrial morphology and the interconnectivity of the mitochondrial network impact on energy production ([@B13]), calcium signaling, mitochondrial DNA distribution, apoptosis, mitophagy, and segregation of mitochondria between daughter cells ([@B6]). The fine-tuning of the fusion--fission balance is crucial for cellular fitness in response to extracellular stimuli and environmental stress ([@B14]). Thus, alterations of the fission--fusion balance lead to oxidative stress, mitochondrial dysfunction, and metabolic alterations.
At the molecular level, dynamin-like GTPases orchestrate mitochondria shape changes. The fission protein dynamin-related protein 1 (DRP1) assembles into ring-like structures to constrict mitochondrial membranes in a GTP-dependent manner ([@B6]). DRP1 is recruited to mitochondria by fission protein 1 (FIS1), mitochondrial fission factor (MFF), and the mitochondrial dynamic proteins of 49 (MiD49) and 51 kDa (MiD51). On the other hand, the fusogenic proteins mitofusin 1 and 2 (MFN1/2) are located in the outer mitochondrial membrane, and tether two mitochondria through homo- and hetero-typic dimerization ([@B13]). A single GTPase, optic atrophy protein 1 (OPA1), achieves fusion of the IMM.
An expanding number of degenerative disorders are associated with mutations in the genes encoding MFN2 and OPA1, including Charcot--Marie--Tooth disease type 2A and autosomal dominant optic atrophy ([@B15]). Defective mitochondrial dynamics seem to play a more general role in the molecular and cellular pathogenesis of common neurodegenerative diseases (Alzheimer's and Parkinson's) ([@B14]), as well as in cardiovascular disease ([@B16]), type 2 diabetes (T2D), and cancer.
Mitochondrial Dynamics in T2D {#S3}
=============================
The clinical complications of T2D include dyslipidemia, hyperglycemia ([@B17]), insulin resistance, and defects in insulin secretion from pancreatic beta cells ([@B18]). A major cause of such clinical complications is the increased production of mitochondrial ROS by hyperglycemia ([@B17], [@B19]). A common feature of mitochondrial morphology in T2D is an increased fragmentation (Figure [1](#F1){ref-type="fig"}), achieved *via* activation/upregulation of DRP1 and/or downregulation of MFN2 levels. In turn, increased fission and fragmentation of mitochondria was linked to HG-induced overproduction of ROS ([@B20]) and insulin secretion in mouse and human islets ([@B21]). Importantly, both HG-induced ROS and insulin secretion were blocked by inhibiting DRP1-induced fission. Furthermore, impaired mitochondrial fusion has been associated with insulin resistance in skeletal muscle ([@B22]) and with glucose intolerance and enhanced hepatic gluconeogenesis in a liver-specific MFN2 knockout (KO) mice ([@B23]). Interestingly, MFN2 KO led to increased ROS production, activation of JNK and endoplasmic reticulum (ER) stress response. Studies in rat models show that MFN2 overexpression improved insulin sensitivity and reduced lipid intermediates in muscle ([@B24]) and liver ([@B25]). At the molecular level, liver expression of MFN2 was associated with increased expression of the insulin receptor and the glucose transporter GLUT2, and activation of the PI3K/AKT2 pathway.
{#F1}
In addition, dyslipidemia models of T2D show increased mitochondrial fission (Figure [1](#F1){ref-type="fig"}). Excess palmitate (PA)-induced mitochondrial fragmentation and increased mitochondrion-associated DRP1 and FIS1 in differentiated muscle cells ([@B26]). In addition, PA induced mitochondrial depolarization, lower ATP synthesis and increased oxidative stress, and reduced insulin-stimulated glucose uptake (Figure [1](#F1){ref-type="fig"}). Both genetic and pharmacological inhibition of DRP1 attenuated PA-induced mitochondrial fragmentation and insulin resistance. In another study, DRP1 was induced in rat islets after stimulation by free fatty acids (FFAs), and this DRP-1 upregulation was accompanied by increased pancreatic β cell apoptosis ([@B27]).
Mitochondrial fission is associated with various processes that contribute to atherosclerosis in T2D (Figure [1](#F1){ref-type="fig"}), including endothelial dysfunction ([@B28]), collagen matrix alteration ([@B29]), and motility and proliferation of vascular smooth muscle cells ([@B30]). From a therapeutic standpoint, silencing FIS1 or DRP1 in venous endothelial cells isolated from patients with T2D blunted HG-induced mitochondrial fission and ROS production ([@B28]). Furthermore, metformin attenuated the development of atherosclerosis in diabetic mice by reducing DRP1-mediated mitochondrial fission in an AMP-activated protein kinase (AMPK)-dependent manner ([@B31]). Mitochondrial fission induced by DRP1 also plays a critical role in the pathogenesis of microvascular \[nephropathy ([@B32]), retinopathy ([@B33]), and neuropathy\] and macrovascular \[stroke and myocardial ischemia ([@B34])\] complications of diabetes.
In summary, we know that many of the clinical complications of T2D are associated with mitochondrial fragmentation. We also know that tipping the balance toward increased mitochondrial fragmentation in mice leads to models of T2D. Furthermore, blocking DRP1 (or increasing MFNs) ameliorated hyperglycemia, dyslipidemia, and atherosclerosis in T2D models. Less clear are the mechanisms of alterations in expression and/or activity of DRP1/MFNs. Up to date, most of the studies have shown correlation between the hallmarks of T2D and increased fragmentation of mitochondria (Table [1](#T1){ref-type="table"}). However, more studies should focus on understanding the spatiotemporal regulation of DRP1 and MFN1/2 levels during the natural progression of T2D. In this context, there are a number of open questions. For example, are there alterations on the regulation of DRP1/MFNs at the transcriptional, translational, or posttranslational level? Are DRP1/MFNs regulated by insulin, glucose, FFA signaling pathways? What are the tissue- and cell-specific differences in the regulation of mitochondrial shape in T2D? Identifying such molecular pathways controlling DRP1/MFN alterations in T2D might enable therapeutic efforts in prediabetic patients to prevent full-blown settlement of the disease.
######
Mitochondrial dynamics in T2D and cancer.
Disease Regulatory event Molecular pathway Cell function Reference
----------------------------------------- ------------------------------------------------------------------------------------------------------------------------------------------------------------------- --------------------------------------------------------------------------------------------------------------------------------------------------------------------- -------------------------------------------------------------- -----------
T2D DRP1 enrichment in calcified human carotid arteries DRP1 controls matrix mineralization, cytoskeletal rearrangement, mitochondrial dysfunction, and reduced type 1 collagen secretion and alkaline phosphatase activity Extracellular matrix changes in cardiovascular complications ([@B29])
FFA DRP1 leads to cytC release, caspase-3 activation, and generation of ROS Apoptosis ([@B27])
Hyperglycemia ROCK1 phosphorylates DRP1 Nepropathy ([@B32])
PA Fragmentation was associated with increased oxidative stress, mitochondrial depolarization, loss of ATP production, and reduced insulin-stimulated glucose uptake Insulin stimulated glucose uptake in skeletal muscle ([@B26])
FIS1 and DRP1 increased in T2D patients DRP1 induced ROS, and nitric oxide synthase activation Endothelial dysfunction ([@B28])
Hyperglycemia HG leads to DRP1-mediated fragmentation and ROS Cellular respiration ([@ | {
"pile_set_name": "PubMed Central"
} |
{#sp1 .150}
{#sp2 .151}
| {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Diamond-Blackfan Anemia (DBA) is a congenital disease, charactereized by a defective erythroid progenitor maturation and is associated with physical malformations.
Majority of cases are sporadic and dominant with 10% of the patients demonstrating recessive inheritance.
Mutations in the gene encoding for ribosomal protein RPS19 (DBA1) have been found in 25% of patients with either the dominant or the sporadic traits \[[@B1],[@B2]\].
It is noteworthy that these mutations are associated with mental retardation as well as with learning disabilities in DBA patients \[[@B1],[@B3]\].
Somatic abnormalities have been found in 47% of the patients registered with the DBA Registry of North America \[[@B4],[@B5]\].
Associated physical anomalies and growth retardation are common and outstanding even in patients with multifactorial etiology such as long term steroid treatment \[[@B3]\].
The combination of clinical and molecular findings suggests a contiguous gene syndrome with a gene focus for mental retardation and skeletal malformations.
Repetitive and stereotyped behaviors are as common as mental retardation and in some cases their manifestations reach the threshold for diagnosis of obsessive compulsive disorder (OCD) (according to the Diagnostic Statistical Manual of Mental Disease IV edition Text Revised DSM-IV TR criteria) \[[@B6]\].
In the following case we present a DBA patient with comorbidity of OCD. This case has tremendous significance due to the demonstration of the clinical and the pathophysiologic as well as therapeutic implications, involved in the assessment of behavioral abnormalities in DBA.
Case presentation
=================
L. is a 22 year old Italian male, diagnosed with DBA at the age of two. Since being diagnosed with DBA, L has been treated with monthly blood transfusions and subcutaneous injections of deferoxamine mesylate. Years later, he developed iatrogenic hepatitis due to multiple blood transfusions. Despite attending a special education program for children with learning disabilities, the patient has experienced major difficulties in carrying out daily activities since the age of six. He showed attention deficit at school, social isolation and, since the age of 12, verbal and motor repetitive behaviors, apparently cyclically worsening during mood instability episodes.
L was reluctant to speak about his repetitive behaviors. L\'s parents attributed their child\'s behaviours to the developmental disabilities. A standard psychiatric diagnosis was not reached, no treatment was established during childhood.
L\' s grandfather was diagnosed with OCD (checking compulsions) in comorbidity with an Impulsive Control Disorder (Intermittent Explosive Disorders), his grandmother was depressed and alcohol addict.
At the age of sixteen the patient had an episode of herpetic encephalitis with symptoms of delirium and therefore, he was treated for two years with carbamazepine. One year later he was diagnosed with polyendocrinopathy of hypothyroidism, hypoparathyroidism and hypogonadism. The encephalitis process had no consequences. Neither mental state nor cognition alteration were reported following the episode.
At the age of twenty one repetitive behaviors increased in frequency to a level that required psychiatric attention and pharmacological management. Trying to address both mood symptoms and repetitive behaviors, a treatment with low doses of olanzapine and venlafaxine was established, with no improvement in symptoms and a strong deterioration of patient\'s anemia. L was hospitalized and a more thorough psychiatric assessment was conducted.
The patient is in the lower normal range of height (164 cm) and IQ (87). He complained of impulsive sexual and aggressive thoughts that were intrusive, repetitive and distressing. He also complained of compulsive behaviors and rituals, such as hoarding, arranging, ordering, preoccupations with symmetry, exactness, rewriting and doubting. Interrupting the patient while carrying out his rituals lead to violence. The patient had moderate insight of his illness.
He fulfilled the DSM-IV TR criteria for OCD and diagnosis was established by the Structural Clinical Interview for DSM-IV Axis I Disorders (SCID-I) \[[@B7]\]. In order to determine the severity level of obsessive compulsive symptoms, the Yale Brown Obsessive Compulsive scale (YBOCS) \[[@B8]\], a clinician rated 10 item scale, each rated from 0 (no symptoms) to 4 (extremely severe symptoms), was performed on him and revealed a score of 28, which corresponds to a severe form. A treatment with sertaline 200 mg/day (addressing OCD symptoms) and valproic acid 600 mg/day (with the aim of reducing the impulsive features linked to obsessions and according to its efficacy reported in treatment of DBA) \[[@B9]\] has been started.
In the meantime an MRI exam was done as well and it showed low signal areas due to accumulation of paramagnetic substances in the right temporal lobe and in the ventricular choroid plexus, asymmetric sphenoid sinus and hypoplastic pituitary gland. Sellar region and parasellar structures appeared in a regular pattern. No anomalies in encephalic parenchyma were demonstrated after contrast medium injection.
The patient was assessed 12 weeks after the administration of the YBOCS and demonstrated an improved total score of 15, which corresponds to a mild form of OCD with a reduction of more than 45% of the symptoms.
Discussion
==========
For the first time we have described DBA with comorbid OCD. The above described case could demonstrate heuristically valuable clinical, therapeutic and pathophysiological implications if more DBA patients with comorbid OCD would be screened by hematologists and therefore deserves further discussion.
There is a great importance in the assessment of obsessive-compulsive symptoms in DBA patients with mental or behavioral disturbances. Since OCD often goes undiagnosed in the presence of more pervasive disturbances \[[@B10]\], our report assumes a \"Caveat\" value.
Distinguishing between mental retardation, learning disabilities, Asperger Syndrome and OCD can be challenging, especially when treating children. Precocious diagnosis of OCD can make a tremendous difference in terms of evolutionary trajectory and improved life quality of patients and their families.
Pediatricians should bear in mind the possibility of OCD when treating DBA children with behavioralor learning disabilities even in the absence of other malformations.
It has been shown that when adequate screening tools were adopted in clinical disciplines other than psychiatry (for instance in dermatology and immunology), a larger than expected number of undiagnosed OCD patients was revealed \[[@B11]\].
Also, OCD is potentially linked to brain iron accumulation in DBA. Studies done in animals demonstrated that brain iron accumulation leads to damage of neuronal dopaminergic function.
Intranigral iron injection in rats have shown a detrimental effect on dopamine (DA) release and concentration in the caudate putamen (CPu) as well as selective decrease of striatal dopamine (95%), 3,4-dihydroxyphenylacetic acid serotogenic activity (82%), and homovanillic acid (45%) with related behavioral changes, characterized by increased repetitive and compulsive behaviors.
Thus, hemosiderosis might be contributing to psychiatric symptoms in DBA patients \[[@B12]\]. In fact, OCD symptoms may be linked to hemosiderin deposition in the brain and the pituitary gland, just as hypopituitarism has been shown to be linked to hemosiderin deposition in the pituitary as it was hypothesized previously by Berdel \[[@B13],[@B14]\].
Moreover, since OCD has been related also to multiple regions of cortical thinning \[[@B15]\], the MRI imaging in our case of paramagnetic substance accumulation in the right temporal lobe, ventricular plexus and the hypoplastic pituitary gland is suggestive of the importance of neuroimaging assessment and recognition of complications caused by iron deposition due to long term blood transfusions in the management of DBA.
However a conclusion can not be drawn without a verification through larger studies on populations that have undergone blood transfusions at a young age.
Presenting this case report we have shown that OCD symptoms are treatable in DBA as effectively as in other conditions such as mental retardation \[[@B16]\] and Down Syndrome \[[@B17]\].
Despite the fact that some psychiatric medications have shown a worsening of the symptoms of anemia, SSRIs and valproate have been extremely beneficial and safe.
Authors\' contributions
=======================
SP established the treatment of the patient, conceived the case-report and drafted the manuscript, SM drafted the manuscript, SB drafted the manuscript, MM drafted the manuscript, AI collected information about the case and drafted the manuscript, EH drafted the manuscript. All authors read and approved the final manuscript.
Acknowledgements
================
Written informed consent was obtained from the patient for publication of this Case Report.
| {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
CCTGA has wide spectrum of structural and clinical features. The clinical presentation and prognosis of patients with CCTGA vary depending on the severity of the associated cardiac anomalies, the development of systemic ventricular dysfunction, and the development of arrhythmias. The patients with CCTGA have a progressive risk of spontaneous complete AV block throughout life (2% per year) \[[@R1]\]. The incidence of sudden cardiac death (SCD) in CHDs is approximately 1:1000 patients per year, which is 25-100 times greater than in the general population \[[@R2]\]. Despite the relatively common occurrence of SCD, ventricular tachycardia (VT) has been rarely described in the natural history of CCTGA.
Case Report {#s2}
===========
A 56-year-old male was referred to the emergency department (ED) for fatigue and shortness of breath on exertion, for 3 - 4 days. The patient was bradycardic, and his blood pressure was 160/70 mmHg. Electrocardiography (ECG) showed an atrial rhythm with 2:1 AV block ([Figure 1](#F1){ref-type="fig"}). The patient had no history of syncope. He was hospitalized and monitored in the Coronary Care Unit (CCU). His serial cardiac markers and laboratory data were normal, and there was no reversible cause to explain AV block. A chest X-ray showed slight cardiomegaly. A transthorasic echocardiographic evaluation detected an apically localized systemic AV valve, a dilated left atrium, a parallel arrangement of great arteries, significant systemic AV valve insufficiency, and ejection fraction (EF) of 32%. Multi-slice CT and MR angiography revealed AV and ventricular arterial discordance with persistent left superior vena cava and situs inversus abdominalis ([Figure 2](#F2){ref-type="fig"}). Cardiac catheterization was performed. Selective coronary arteriography demonstrated a well-developed right coronary system.
The patient experienced a sudden cardiac arrest during his follow-up in the CCU. The patient was monitored and intubated immediately. Pulseless ventricular tachycardia was detected ([Figure 3A](#F3){ref-type="fig"}), direct electrical cardioversion was accomplished, and rhythm was restored. The ECG showed atrial tachycardia ([Figure 3B](#F3){ref-type="fig"}) after the successful resuscitation. An electrophysiologic study was performed, but ventricular tachycardia was not induced again. The patient underwent dual-chamber ICD implantation with active fixation ([Figure C](#F3){ref-type="fig"}). The patient was then discharged in clinically stable condition with spironolactone 25 mg, lisinopril 10mg, and bisoprolol 5mg treatment. There were no complaints during routine follow up at one month.
In a routine follow up in the sixth month, the patient was admitted with palpitation. Paroxysmal atrial fibrillation was detected by 24-hour continuous ambulatory ECG. The ICD was checked, and atrial tachycardias with variable conductions were detected. Amiadarone 600 mg and warfarin 5mg daily were started. We did not detect any recurrent attack of atrial fibrillation during the 6 months follow-up after the amiodorane therapy.
Discussion {#s3}
==========
CCTGA, or synonym l-transposition, is a rare (less than 1% of all CHD) and complex heart defect. The characteristic feature of this CHD is AV and ventriculoarterial discordance. The great arteries are generally parallel to each other. The aorta is located closer to the anterior and more to the left than the pulmonary artery. The AV valves follow their respective ventricles. Because of the displacement of the AV node and the abnormal course of conduction tissue, there is an increased risk of spontaneous complete AV block. One study examined a series of patients with CCTGA, with complete AV block detected at 8% of diagnosis; the follow-up showed that 38% patients had been documented as experiencing atrial arrhytmias \[[@R3]\]. Associated cardiac defects are common; isolated CCTGA is an exception.
For a number of patients with CHD, life expectancy increases with the development of diagnostic and interventional techniques. SCD is still the leading cause of death in patients with CHD. CCTGA has the highest mortality among all CHD patients \[[@R4]\]. Despite the relatively common occurrence of SCD, VT has rarely been described in the natural history of CCTGA. Although the mechanism of VT in patients with CCTGA is not clear, it is likely related to triggered automaticity and reentry because of the progressive systemic ventricular dysfunction. There is a general acceptance of ICD implantation in patients with severe ventricular dysfunction for primary prevention. Patients with CHD, however, have not yet been shown to benefit from ICD placement for primary prevention. The Toronto study shows that sudden death is the most common mode of mortality in Tetralogy of Fallot, Ebstein's anomaly, CCTGA, and congenital aortic valve anomaly, suggesting that these groups may benefit even more from primary prevention ICD implant \[[@R5]\]. The main indications for ICD implantation, according to the existing guidelines for patients with CHD, are resuscitated cardiac arrest, sustained VT in the absence of a reversible cause, and syncope with inducible sustained ventricular arrhythmia at electrophysiological testing. On the other hand, 2008 ACC/AHA/HRS guidelines recommend ICD implantation as a Class 1b indication for primary prevention in patients with CHD.
To our knowledge, there are only a few documented cases of VT in a patient with CCTGA ([Table 1](#T1){ref-type="table"}) \[[@R6]-[@R9]\]. An alternative therapy is ablation; Baral et al. reported the successful ablation of monomorphic ventricular tachycardia in a 48-year-old woman with CCTGA, Ebstein\'s malformation of the tricuspid valve, and incessant VT \[[@R6]\]. On the other hand, atrial fibrillation or supraventricular tachycardia is very rare in the follow-up of patients with CCTGA.
Because of the increasing numbers and survival of patients with CHD, physicians will continue to encounter rhythm problems. ICDs and pacemakers do not solve all these problems, and medical therapies like beta-blockers or amiodarone are sometimes needed. Our patient is one of the oldest patients with CCTGA that has been documented in the literature, and interestingly the patient suffered from multiple arrhythmic problems on follow-up.
{#F1}
{#F2}
{#F3}
######
Documented cases of VT in patients with CCTGA in the literature

VT: ventricular tachycardia, CCTGA: Congenitally corrected transposition of the great arteries, ICD: implantable cardioverter defibrillator, AV: atrioventricular
| {
"pile_set_name": "PubMed Central"
} |
{.861}
{.862}
{.863}
{.864}
{.865}
{.866}
| {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
CIDP was first described in the mid-1900s as a progressive motor-dominant disease causing severe weakness ([@bib4]). It was later identified as an autoimmune disorder targeting myelin sheaths rather than axons themselves due to its lack of associated muscle atrophy ([@bib4]). While CIDP triggers have not been identified, the pathogenesis results from segmental inflammatory infiltrates in the perivascular space of nerves ([@bib16]). Its prevalence ranges from 1 to 8.9/100,000, and is typically higher in the male population and can occur at any age ([@bib2]; [@bib8]).
A wide range of symptoms exist, but common hallmarks of CIDP include relapsing-remitting, progressive motor and/or sensory loss of distal nerves ([@bib4]; [@bib16]; [@bib5]). Progressive and ongoing proximal or distal motor weakness typically worsens over 8 weeks ([@bib4]). Other symptoms with variable severity include sensory ataxia, areflexia, and decreased sensation ([@bib4]; [@bib16]).
The variable presentation of CIDP has several shared diagnostic findings, including elevated cerebrospinal fluid (CSF) protein levels and slowed conduction velocities on electrophysiological testing ([@bib16]; [@bib5]). The most commonly affected nerves are typically large fibers with plentiful myelin, like the sural, superficial peroneal, or gracilis motor nerves ([@bib2]; [@bib5]). As with most inflammatory conditions, steroids and intravenous immunoglobulins (IVIg) are the mainstay of treatment ([@bib4]; [@bib2]; [@bib5]).
Central nervous system involvement in CIDP may mimic multiple sclerosis (MS) ([@bib4]). However, MRI criteria supportive of MS classically involves periventricular white matter lesions ([@bib18]; [@bib17]). Whereas, MRI in CIDP demonstrates hypertrophy outside of the brain, most commonly the cauda equina and lumbosacral or cervical nerve roots ([@bib5]). Several reports of hypertrophic cranial nerves in CIDP as a result of blood-nerve barrier breakdown have been described ([@bib3]). These reports have involved a variety of cranial nerves, including the optic nerve ([@bib20]), oculomotor nerve ([@bib1]; [@bib11]), trigeminal nerve ([@bib3]; [@bib1]; [@bib11]; [@bib10]; [@bib7]; [@bib14]), and vestibulocochlear nerve ([@bib20]; [@bib9]; [@bib19]; [@bib15]; [@bib13]; [@bib6]). CSF analyses also differentiate the two: MS is supported by 2 or more oligoclonal bands ([@bib17]) and CIDP displays elevated protein and a leukocyte count less than 10/mm^3^ ([@bib2]; [@bib5]). These distinguishing characteristics are essential to prescribe proper treatment for each since IVIg is not the mainstay of treatment for MS ([@bib12]). This case recognizes a constellation of these findings in the setting of CIDP: bilateral cranial polyneuropathy with hearing loss.
2. Case study {#sec2}
=============
A 35-year-old male Iraqi immigrant was referred to our neurotology clinic for persistent conductive hearing loss despite multiple sets of tympanostomy tubes for serous otitis media. His hearing loss began seven years prior, with the left ear worse than right. He had been diagnosed with CIDP by a local neurologist three years prior based on fluctuating episodes of bilateral lower extremity weakness and numbness since age seven, elevated CSF protein levels, and slowed conduction velocities. He was actively receiving IVIg and steroids for the past two years.
He denied otorrhea, tinnitus, vertigo, or aural fullness. He had no history of frequent ear infections, previous ear surgery, head trauma, use of ototoxic medications or a family history of deafness. His only other surgery included bilateral lateral orbital wall decompression for Graves ophthalmopathy. On exam, he had bilateral ptosis, proptosis and myringosclerosis posteriorly with tympanostomy tubes in place. Audiogram revealed an air-bone gap at all frequencies, left worse than right ([Fig. 1](#fig1){ref-type="fig"}). The pure tone averages were 40 dB on the left and 32 dB on the right.Fig. 1Audiogram demonstrating conductive hearing loss. "O" = right unmasked air. "X" = left unmasked air. "\[" = right masked bone. "\]" = left masked bone.Fig. 1
An MRI ordered by his neurologist demonstrated multiple enlarged cranial nerves, including the tympanic and mastoid segments of both facial nerves ([Fig. 2](#fig2){ref-type="fig"}; [Fig. 2](#fig2){ref-type="fig"}a; [Fig. 2](#fig2){ref-type="fig"}b). Other findings included bilateral enlargement of the oculomotor and trigeminal nerves, extraocular muscles, foramen ovale ([Fig. 2](#fig2){ref-type="fig"}a), foramen rotundum and stylomastoid foramen. His extraocular muscle and oculomotor nerve enlargement likely both contributed to his ptosis and proptosis.Fig. 2Post contrast axial T1-weighted MRI demonstrating bilaterally thickened tympanic segments of the facial nerve (arrows). a: Non-contrast axial CT scan showing bilaterally enlarged fallopian canals in the mastoid segment (white arrows), as well as dilated foramen ovale (red arrow). b: Non-contrast axial CT scan showing ossicular erosion secondary to enlarged tympanic segment of the facial nerve.Fig. 2
The patient underwent left middle ear exploration with intraoperative facial nerve monitoring. After elevating a tympanomeatal flap, a significant soft tissue mass was identified just medial to the chorda tympani nerve ([Fig. 3](#fig3){ref-type="fig"}), suspicious for a grossly enlarged facial nerve sheath. This was confirmed with a stimulus from the facial nerve monitor. There was erosion of the incus and partial erosion of the stapes superstructure. The hypertrophic nerve was gently manipulated in an attempt to identify the stapes footplate, but it could not be well visualized, and given these findings, further ossicular chain reconstruction was contraindicated and the procedure was terminated. It was recommended that he pursue bilateral amplification.Fig. 3Intraoperative finding of the soft tissue mass (\*) just medial to the chorda tympani nerve (Chorda). The photo is in surgical position, with the left side of the photo as inferior and top half of the photo as anterior. There is a small piece of surgical packing anteroinferiorly. "RW" = round window. "Promontory" = cochlear promontory.Fig. 3
3. Discussion {#sec3}
=============
CIDP is rarely associated with hearing loss and only a few cases of sensorineural loss have been described ([@bib9]; [@bib19]; [@bib15]; [@bib13]). These reports describe the onset of hearing loss concurrent with the initial CIDP symptoms and were attributed to demyelination of segments of the vestibulocochlear nerve considering its proximity in presentation to CIDP onset ([@bib9]; [@bib19]; [@bib15]; [@bib13]). None had other cranial neuropathies ([@bib9]; [@bib19]; [@bib15]; [@bib13]). However, there is one report of primarily vestibular involvement, rather than cochlear ([@bib6]).
Two of the four reported cases completely recovered hearing with steroids and IVIg ([@bib9]; [@bib15]). The other three patients described in the literature did not have improvement in hearing with steroids or IVIg ([@bib19]; [@bib13]). This paper describes a novel case of conductive hearing loss and bilateral cranial polyneuropathy. His hearing loss persisted despite two years of steroids and IVIg therapy. Initially, the hearing loss was likely secondary to a mass effect on the ossicles with subsequent ossicular erosion from pressure necrosis. After further discussion with his neurology team, further treatment was not pursued and deemed unlikely to reduce facial nerve hypertrophy.
Facial nerve hypertrophy has rarely occurred in the setting of CIDP ([@bib21]). These findings of hypertrophy have been attributed to the frequent demyelination-remyelination cycles causing Schwann cell proliferation ([@bib10]). Our patient\'s symptoms had some similarities and differences compared to previous reports. He lacked facial paresthesias despite his thickened trigeminal nerves while another case reported mandibular hypesthesia ([@bib10]). However, he presented with ptosis and proptosis as described in previous case reports with oculomotor nerve or extraocular muscle thickening ([@bib3]; [@bib1]; [@bib10]). Some of these cases also involved Graves ophthalmopathy which may suggest an association between CIDP and increased incidence of autoimmune disease ([@bib1]; [@bib10]).
4. Conclusion {#sec4}
=============
CIDP has a wide range of symptoms with varying courses and severity of disease that should be distinguished from other autoimmune demyelinating disorders like MS. The patient presented in this case report exhibits a unique cranial polyneuropathy with resultant hearing loss from mass effect secondary to facial nerve hypertrophy and subsequent ossicular erosion.
Declarations of interest {#sec5}
========================
None.
Funding {#sec6}
=======
None.
| {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Plants have to face a broad range of invading pathogens. In response, they can deploy a large set of defense responses including constitutive pre-existing physical and chemical barriers as well as an innate immunity activated after pathogen perception ([@B68]; [@B5]). The first line of recognition is based on the detection *via* pattern recognition receptors (PRRs) of evolutionarily conserved elicitors, also called microbe-, pathogen-, or damage-associated molecular patterns (MAMPs; PAMPs; DAMPs) ([@B14]; [@B31]). MAMP-triggered immunity (MTI) is characterized by early and long-term physiological responses including reactive oxygen species (ROS), ethylene (ET) production, MAPK activation, reprogramming of transcriptome and metabolome (e.g., production of phytoalexins and SA), and callose deposition ([@B5]). One of the earliest responses at the time of pathogen assault is the production of ROS, which plays a crucial role to restrain pathogen development through programmed cell death at the site of infection ([@B58]; [@B38]). The second stage of perception corresponds to the direct or indirect recognition of pathogen effectors by intracellular immune receptors leading to effector-triggered immunity (ETI; [@B31]). MTI and ETI will answer to activate early signaling events in plant defense ([@B62]). Plant hormones, salicylic acid (SA), jasmonic acid (JA), ET, and abscisic acid (ABA) appear as key regulators in defense-signaling networks ([@B42]).
Pathogen attack not only affects plant defenses reactions but can also lead to changes in photosynthesis rates and consequently carbohydrates metabolism. Indeed, during the resistance response, the production of defense-related compounds becomes the high priority of the plant leading to reduced photosynthetic rates until the end of the pathogen growth ([@B46]). As plant defense responses may alter the pool size of a range of metabolic intermediates, photosynthetic metabolism likely will be influenced as it will be regulated to meet the cell/plant requests. The photosynthesis decreases through the infection process as a result of leaf metabolism perturbation attributed to sugar-mediated repression of photosynthetic gene expression ([@B7]). Cell wall invertase (Cw-Inv) catalyzes the cleavage of the sucrose into glucose and fructose, and supply sink organs with carbohydrates, playing thus a crucial role in the regulation of carbohydrate partitioning ([@B44]; [@B45]; [@B55]). Additionally, starch reserves may also be converted to soluble sugars ([@B11]) that may act as signals to induce pathogenesis-related (PR) protein genes and to increase plant resistance ([@B52]).
The use of plant growth-promoting rhizobacteria (PGPR) to induce plant resistance is one of the alternatives developed to protect crops against damages caused by various forms of stress ([@B67]). Induced resistance in grapevine against *Botrytis cinerea*, the gray mold agent, by beneficial rhizobacteria has been reported ([@B2]; [@B65], [@B64]; [@B24]). Among the plant-growth promoting bacteria, *Burkholderia phytofirmans* strain PsJN is able to colonize a variety of genetically unrelated plants such as potato and tomato ([@B13]; [@B40]), maize, switchgrass ([@B32]), both endophytically and at the rhizoplane. In addition to colonize grapevine tissues ([@B12]), *B. phytofirmans* PsJN promotes the growth of roots and also of the aerial part after root inoculation ([@B1]). In addition, during the interaction between *B. phytofirmans* PsJN and grapevine, the bacterium triggers a transient extracellular alkalinization, the production of SA and accumulation of defense-related transcripts, suggesting that this PGPR is perceived by grapevine cells potentially *via* MAMP detection ([@B8]). Moreover, [@B59] showed that flagellin from *B. phytofirmans* PsJN induced resistance against *B. cinerea* and suggest its implication to evade from plant's immune recognition system. The endophytic presence of *B. phytofirmans* PsJN leads to protection against abiotic stresses including cold in grapevine ([@B17]; [@B56]), drought in wheat ([@B39]) or salt and freezing in *Arabidopsis* ([@B43]; [@B53]). It has also been shown that this strain reduces damages caused by chilling in grapevine through a priming of plant defense responses and changes in primary metabolism, particularly an increase of soluble sugars concentration and an accumulation of proline ([@B3]; [@B17],[@B18]; [@B56]). In addition, the bacterium improves tolerance against biotic stress as *Verticillium* sp. in tomato ([@B50]) or *B. cinerea* in grapevine ([@B1]; [@B2]). However, the mechanisms involved beyond the observed induced resistance are not elucidated.
To decipher the mechanisms induced by *B. phytofirmans* PsJN to confer grapevine resistance against *B. cinerea*, we determined (i) the direct antimicrobial effect of PsJN on *B. cinerea* growth; (ii) the effect of *B. phytofirmans* PsJN on the early signaling events (callose, ROS), and on the induction of defense response signaling pathway (gene expression); and finally (iii) changes in leaf carbohydrate metabolism including gene expression, sugar levels and chlorophyll fluorescence imaging after *Botrytis* challenge.
Materials and Methods {#s1}
=====================
Plant Material
--------------
Plantlets of *Vitis vinifera* cv. Chardonnay (clone 7535) were micro-propagated by nodal explants grown on 15 ml of agar medium in 25 mm-culture tubes as described by [@B3]. Cultures were performed in a growth chamber under white fluorescent light (200 μmol/m^2^ s), with 16 h/8 h day/night photoperiod at a constant temperature of 26°C.
Microorganisms
--------------
*Burkholderia phytofirmans* strain PsJN tagged with GFP was cultivated in King's B liquid medium supplemented with kanamycin (50 μg/ml) for 24 h with agitation of 180 rpm at 28°C. Bacteria were collected after centrifugation at 4500 g at 4°C for 15 min and suspended in phosphate-buffer saline (PBS 10 mM, pH 6.5). The concentration of bacteria was determined by spectrophotometry (600 nm) and adjusted to 10^9^ CFU/ml with PBS (*D*~0~ = 0.8).
*Escherichia coli* was cultivated in LB liquid medium for 24 h with agitation of 180 rpm at 37°C. The concentration of bacteria was determined by spectrophotometry (600 nm) and adjusted to 10^9^ CFU/ml with PBS (*D*~0~ = 1).
*Botrytis cinerea* strain 630 was grown on solid medium tomato juice \[33% (v/v), agar 5% (w/v)\] at 20°C. For the inoculum preparation, conidia of *B. cinerea* were collected from 20-day-old culture plates by scratching the Petri dishes surface with sterile potato dextrose broth (PDB 12 g/l) and filtered to remove hyphae. Conidial concentrations were measured and the final density was adjusted to 10^5^ conidia/ml. After incubation during 3 h at 20°C and 150 rpm, germinated spores were used for plant inoculation.
Inoculation of *In vitro*-Plantlets with *B. phytofirmans* Strain PsJN and Infection by *B. cinerea*
----------------------------------------------------------------------------------------------------
Roots of 4-week-old grapevine plantlets were inoculated with 200 μl of bacterial (*E. coli* or PsJN) inoculum (10^9^ CFU/ml). Control and bacterized plantlets were then grown for an additional week before their transfer aseptically into sterile Magenta boxes containing 60 g of soil. After 3 days, each leaf of the plantlet was covered by 2 drops (5 μl each) of suspension of *B. cinerea* germinated spores. This protocol was used for measures of necrosis diameter.
For H~2~O~2~ production, callose deposition, analysis of gene expression, sugar/starch measures, and IMAGING-PAM analysis, plantlets were sprayed with the germinated spore suspension of *B. cinerea* in order to have a homogenous application. Plantlets were placed in growth chamber at 20°C. Leaves were then sampled at different time points after *B. cinerea* challenge.
Observation of *B. cinerea* Mycelium Development after Trypan Blue and Aniline Blue Staining
--------------------------------------------------------------------------------------------
Leaves of control and root-bacterized plantlets collected 24, 48, 72 hpi with *B. cinerea* were stained with lactophenol--trypan blue and destaining in saturated chloral hydrate as described in [@B33] or with 0.05% aniline blue. The mycelium development was then observed using 3D (Keyence, France) or epifluorescence microscope.
Rhizoplane and Endophytic Colonization
--------------------------------------
To determine rhizoplane colonization of *B. phytofirmans* PsJN in the roots, the samples were removed from soil and vortexed (240 rpm) with PBS for approximately 1 min. The homogenate was serially diluted in 10 fold steps and cultured on King's B medium plates (in triplicates) supplemented with kan | {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
A severely injured extremity poses difficult decisions for the patient and the treating surgeon. The degree of soft tissue injury, neurovascular damage, bone loss, presence of other injuries, patients' general physical and psychological condition are all important factors in decision-making. The majority of the patients were previously treated by amputation. However, with advances in surgical methods of fracture stabilization, soft tissue reconstruction and microsurgical techniques, some mangled limbs can now be salvaged.
Adequate soft tissue reconstruction is of utmost importance. Various treatment options have been suggested for managing the associated bone loss. These include internal fixation with bone grafting, distraction osteogenesis through circular external fixators; primary shortening followed by staged lengthening and allografts. However, these are associated with very prolonged recovery and the functional outcomes are unpredictable. We report a case of a woman presenting with severely injured lower limb and bone loss which was managed using a custom-made endoprosthetic replacement for successful functional outcome.
Case report {#Sec2}
===========
A 52-year-old woman sustained a severe crushing injury to her left lower limb having been trapped between a wall and a rapidly reversing car. She was conscious, coherent and haemodynamically stable. Her other injuries included a deformed right ankle and some bruising over the right cheek. There was no other major system injury. She was resuscitated according to the advanced trauma life support protocol and the bleeding from the leg was attended to. After she was clinically stabilized, a secondary survey was conducted to asses the limb status. Extensive soft tissue injury with degloving of skin and muscle damage from mid-thigh to lower calf was noted.
There was a significant comminution of the lower end of femur with loose fracture fragments visible. Distal pulses were palpable. Neurological assessment was found to be difficult at this stage. The mangled extremity severity score (MESS) was calculated to be 6 (3 for high energy injury, 1 for transient hypotension and 2 for age) and was utilised to asses the suitability for limb salvage. There was no significant past medical history or medication and allergy history of note.
The wound was covered with sterile dressings and the limb was splinted. Antibiotic and tetanus prophylaxis were administered. Adequate analgesia was provided. The right ankle and foot were found to be swollen, bruised, but with intact skin and were extremely tender. Trauma series radiographs and limb radiographs confirmed a comminuted distal end left femur fracture with bone loss (Fig. [1](#Fig1){ref-type="fig"}), a right ankle bi-malleolar fracture and an undisplaced base of right first metatarsal fracture.Fig. 1Soft tissue wound depicting the stretched common peroneal nerve
An emergency debridement and stabilization of the femur fracture were obtained using a bridging Hoffman uniaxial external fixator (Fig. [2](#Fig2){ref-type="fig"}). The devitalized bone fragments were debrided. Operative findings included loose femur fragments with contamination from fragments of plastic material, partially intact lateral gastrocnemius, partially detached iliotibial band and an avulsed biceps. The knee extensor mechanism and the neurovascular bundle were found to be intact. The right ankle fracture was also internally fixed on the same day.Fig. 2Plain radiograph confirming a comminuted distal end fracture of left femur with bone loss
At this stage, the patient was referred to us due to extensive soft tissue defect and a 12 cm femur bone loss. The aim was to reconstruct these defects using an endoprosthetic replacement. Option of an amputation and limb preservation was discussed with the patient. The patient preferred limb salvage. The plastic surgeon was also involved in the decision-making process and the patient was informed of the treatment plan. Over the next few days, a relook debridement was done and was followed by repeat debridement. The vascular status of the limb was normal, but there was a foot drop on clinical assessment. The wound exploration revealed that the common peroneal nerve was found to be intact, but had been stretched. A cement spacer to allow for the bone loss and a lateral gastrocnemius flap were harvested with input from the plastic surgeons. Unfortunately, this got infected with bacillus species. The wound was debrided, an across knee intramedullary rod and cement spacer was used to achieve stability. The infection was controlled by intravenous vancomycin.
In view of the ongoing infection and soft tissue problems, it was necessary to pursue on a cautious note. The next few weeks involved multiple wound washouts in the operating theatre to control infection. The wound swabs grew *Acinetobacter Baumannii* sensitive to the antibiotic merapenem. About 5 weeks after the initial injury, the leg was re-debrided and the cement spacer was revised. A left latismus dorsi free-flap was used for soft tissue reconstruction. The wound was assessed and redressed a few times in the operating theatre subsequently. With continued antibiotic treatment for 4 months, the infection was under control and repeated aspirated from the knee were negative.
The leg wound had healed well. However, the knee had only a jog of movement. A distal femur endoprosthetic replacement was planned for about 11 months from the initial injury (Figs. [3](#Fig3){ref-type="fig"}, [4](#Fig4){ref-type="fig"}). A custom-made distal femoral endoprosthesis, the SMILES implant (Stanmore Modular Individualised Lower Extremity System), Stanmore Implants Worldwide, UK, was used for reconstruction. Quadricepsplasty was needed to achieve sufficient access and the range of movement on table was 0°--60°.Fig. 3Long leg radiographs for preoperative planning for the endoprosthetic replacementFig. 4Manufacturer's proof of the custom-made distal femoral endoprosthesis
The patient underwent staged physiotherapy and gradual rehabilitation. The range of knee movement was of some concern and a manipulation under anaesthesia was performed 6 months after the reconstructive arthroplasty.
Current status {#Sec3}
==============
The patient is now 3 years from the endoprosthetic reconstruction. She is independently mobile and able to drive a car without limitations. The knee flexion remained limited to 0°--30° only. There is no evidence of infection. The prosthesis remained stable and well cemented. The limb is now 4 cm short. Functional score according to the Musculoskeletal Tumor Society-International Symposium on Limb Salvage System \[[@CR1]\] was 70% (21 out of a possible 30 points) and the Toronto Extremity Salvage Score \[[@CR2]\] was 62% (93 out of a possible 150 points). Figure [5](#Fig5){ref-type="fig"} shows the latest radiographs at 3 years after surgery.Fig. 5Plain radiograph of the endoprosthetic replacement at 3 years follow-up
Discussion {#Sec4}
==========
Mangled limbs with severe bone and soft tissue loss present a clinical challenge in terms of reconstructive surgery, prolonged rehabilitation, physical and psychological demands on the patient, and with no guarantee of a successful outcome. A question of primary amputation or limb reconstruction is a difficult one. Various scoring systems are available to asses the suitability for limb salvage in such situations such as the MESS; the limb salvage index; the predictive salvage index; the nerve injury, ischaemia, soft tissue injury, skeletal injury, shock and the age of patient score; and the Hannover fracture scale-97. Although a recent prospective study questions the clinical usefulness of any of these scores \[[@CR3]\], the most commonly used in the MESS system. Helfet et al. \[[@CR4]\] have reported that an MESS score of greater than or equal to 7 had a 100% predictable value for amputation.
The extents of soft tissue damage and neurovascular status are the important local factors in making the correct initial decision. Hence, significant experience with managing such patients and input from other relevant specialists are essential from the onset.
The goal of limb salvage surgery in such extremity injuries is to provide adequate soft tissue cover, skeletal stabilization, restore adequate length and alignment and most importantly, result in a functioning limb. Although various treatment modalities have been advocated in the management of limb injuries with bone loss, the common element in all these are the multiple reconstructive procedures, long term to recovery and the less than satisfactory functional results. Acute shortening followed by progressive lengthening \[[@CR5], [@CR6]\], bone transport using Ilizarov technique \[[@CR7]\], allografts to replace bone defects \[[@CR8], [@CR9]\] and free vascularised bone grafts \[[@CR10]\] have all been advocated for the reconstruction of the defects. However, the complications are many and the success limited. The major advantage of cemented endoprosthesis is early stabilization and recovery of function.
We have reconstructed a mangled extremity with 12 cm bone loss in the femur using a custom-made distal femoral endoprosthetic replacement. To our knowledge, this has so far not been reported in literature. Traditionally, endoprosthetic replacements are used for managing skeletal and soft tissue defects following the tumour resection and have had good long-term results \[[@CR11]\]. However, there seem to be additional applications afforded by these systems. Failed internal fixations of fracture, severe fractures with bone defects, failed joint arthroplasty with insufficient bone stock are the non-tumour indications for endoprosthesis' \[[@CR12]\]. The advantages with endoprosthetic replacement are the ability to reconstruct massive skeletal and soft tissue defects, ready availability and are relatively inexpensive \[[@CR13]\]. The | {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
The Ebola virus continues to re-emerge in lethal outbreaks, the most recent occurring in the Democratic Republic of the Congo, Africa in May 2018^[@CR1]^. As of December 11, 2018, the World Health Organization reported that the Ebola outbreak in the North Kivu and Ituri provinces of the DRC has included a total of 505 cases, with 457 confirmed and 48 probable, and has resulted in 296 deaths^[@CR2]^. Overall, to date there have been 34 Ebola virus disease outbreaks, 18 of which have involved Zaire ebolavirus since the initial emergence of this strain in 1976. This most recent outbreak, and the outbreaks occurring between 2014--2016, have refocused efforts of public health agencies such as the World Health Organization^[@CR2]^ on identifying approaches to reduce the spread of the disease from community to community and from nation to nation. Ebola virus disease is included in the World Health Organization's List of Blueprint Priority Diseases^[@CR3]^, a list of diseases for which: "... given their potential to cause a public health emergency and the absence of efficacious drugs and/or vaccines, there is an urgent need for accelerated research and development..."^[@CR3]^.
It is known that the Ebola virus may be transmitted by contact with infected corpses, infected environmental surfaces (fomites), and secretions and excretions from infected individuals^[@CR4]^. It has also been shown that fomites in the vicinity of infected patients may be contaminated with Ebola virus RNA^[@CR5]^. Environmental persistence of infectious EBOV Makona (EBOV/Mak) suspended in an organic soil load have been reported at eight days from experimentally contaminated surfaces^[@CR6]^. An important intervention approach might therefore involve the use of an effective virucidal agent for disinfecting surfaces and spills potentially contaminated with Ebola virus, thereby mitigating the risk of transmission to healthy individuals, including health-care providers.
There are relatively little suspension inactivation data for the Ebola virus itself. The efficacies of microbicides (disinfectants and antiseptics) for inactivation of Ebola virus typically been determined through evaluation of the inactivation, by such products, of appropriate surrogate viruses such as bacteriophages, enveloped viruses (animal coronaviruses, influenza viruses), or non-enveloped viruses such as caliciviruses or picornaviruses. The Ebola virus is a member of the *Filoviridae* family, and being an enveloped virus should be relatively susceptible to a variety of microbicidal inactivation approaches. In view of the lethality of the virus, however, the United States Centers for Disease Control and Prevention (CDC) has provided the following guidance^[@CR7]^: "... selection of a disinfection product with a higher potency than what is normally required for an enveloped virus is being recommended at this time. EPA-registered hospital disinfectants with label claims against non-enveloped viruses (noroviruses, rotavirus, adenovirus, poliovirus) are broadly antiviral and capable of inactivating both enveloped and non-enveloped viruses." Per the United States Environmental Protection Agency (EPA), in order to claim efficacy of a product for an emerging enveloped virus, the product needs to be approved by EPA for inactivating at least one large or one small non-enveloped virus^[@CR8]^.
Efficacy testing of microbicides through the study of inactivation of surrogate non-enveloped viruses theoretically should ensure their efficacy for inactivation of the Ebola virus. However testing conducted specifically with the high-risk pathogens including viruses is also needed, to provide assurance to critical facilities and personnel. In the present effort, efficacy studies were performed at the Canadian Science Centre for Human and Animal Health Biosafety Level 4 (BSL-4) facility.
In the present study, we evaluated the efficacy of a commercially available hygiene product, Dettol Antiseptic Liquid (DAL), for inactivating EBOV/Mak is suspension. Dettol is used in Europe, Africa, and Asia in homes and healthcare settings for various first aid antiseptic purposes, including wound cleansing^[@CR9]^. It is also used for personal hygiene purposes, and as a microbicide for decontaminating environmental surfaces, objects, and equipment. The microbicidal active ingredient in DAL is 4-chloro-3,5-dimethylphenol (chloroxylenol), also known by its non-systematic name para-chloro-meta-xylenol or PCMX^[@CR10]^. The concentration of the active in DAL is 4.8% (weight to volume) PCMX. Three concentrations each of DAL lots 15083E, 16004E, and 16005E were evaluated for inactivation of EBOV/Mak suspended in an organic soil load using the method specified in the ASTM 1052-11 international standard^[@CR11]^. This test method was developed by the American Society for Testing and Materials International (ASTM) to standardize the evaluation of virucidal activity of microbicidal products in suspension. Organic soil loads are added to the study design in order to better model viral inactivation by microbicides in relevant matrices such as human sputum or blood. Use of hard water as diluent was included in the study design to simulate water hardness in the field. Four contact times (0.5, 1, 5, and 10 min) were evaluated in triplicate for each of three independent lots of DAL. In addition to the methodology described in the ASTM standard, we also evaluated any residual infectious virus following exposure to DAL through inoculation of 500 µL of undiluted neutralized test sample into T-75 flasks of Vero E6 indicator cells. This was done to evaluate the possibility of virus being present at levels lower than the limit of detection of the tissue culture infectious dose~50~ (TCID~50~) assay performed in Vero E6 cells per the ASTM standard.
Results {#Sec2}
=======
Neutralization Effectiveness Evaluation {#Sec3}
---------------------------------------
During the evaluation of possible neutralizing agents, it was determined that 100% fetal calf serum (FCS) and 100% virus culture medium (VCM) failed to adequately terminate the viral inactivating effects of DAL. On the other hand, 1× Letheen broth in VCM (10× Letheen broth diluted 1:10 in VCM), added to the DAL dilutions prior to introduction of the EBOV/Mak in tripartite soil load^[@CR12],[@CR13]^, prevented inactivation of the virus. As shown in Supplemental Figs [S1](#MOESM1){ref-type="media"} and [S2](#MOESM1){ref-type="media"}, no statistically significant (*P* \< 0.05) differences in the viral titers obtained for the virus positive controls, the virus + DAL dilution + neutralizer, and virus + neutralizer conditions were observed when 1× Letheen broth was evaluated. The disinfectant neutralizing agent that was used in each of the inactivation efficacy studies described below was 1× Letheen broth.
Virucidal Efficacy Results {#Sec4}
--------------------------
Three different lots of DAL were evaluated at three dilutions of DAL each (1:10, 1:20, and 1:40 in hard water, corresponding to 0.48%, 0.24%, and 0.12% of PCMX active, respectively) in triplicate. Contact times of 0.5, 1, 5, and 10 min at ambient temperature were evaluated in a BSL-4 facility. An initial EBOV/Mak titer of 1.7 × 10^8^ log~10~ TCID~50~/mL in tripartite soil load was exposed to the various DAL dilutions and contact times using the methodology depicted in Fig. [1](#Fig1){ref-type="fig"}. The post-exposure/neutralization titers for the positive virus controls (virus alone) and the DAL test conditions were calculated. The log~10~ reduction values for each time point were calculated by subtracting the titers obtained for the DAL test conditions from the titers of the corresponding positive virus controls.Figure 1Schematic representation of the inactivation efficacy testing methodology employed. The entire procedure was performed once for each DAL lot.
For the 1:10 dilution of the three DAL lots at 0.5, 1, 5, and 10 min contact time, the mean ± standard deviation values for the log~10~ EBOV/Mak titers measured for the positive virus control condition (virus alone) and the post-exposure titers are displayed in Fig. [2](#Fig2){ref-type="fig"}. Complete inactivation (4.8 to 5.4 log~10~) of EBOV/Mak to the limit of detection of the assay (1.8 log~10~ TCID~50~/mL virus) was observed for all replicates and contact times.Figure 2Time kinetics for EBOV/Mak inactivation efficacy results for the 1:10 dilution of DAL lots 15083E, 16004E, and 16005E at ambient temperature. The values represent the mean ± standard deviation (n = three replicates, one for each DAL lot) of the log~10~ titer of the positive control (0 minutes contact time) and the post-neutralization samples (0.5, 1, 5, and 10 minutes contact time). Individual viral titers were calculated based on three replicate wells per dilution. The limit of detection (LOD) of the assay was 1.8 log~10~ TCID~50~/mL (shown in the plot as a blue line extending from y = 1.8 log~10~ TCID | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Epilepsy is a demanding neurological condition that affects many people worldwide. Selecting an appropriate antiepileptic drug (AED) is still challenging, because the selected drug should be effective, safe, and tolerable. Older generation of AEDs, such as phenobarbital and phenytoin are not widely accepted as a primary monotherapy and also long-term therapy for focal seizures, because of their side effects ([@B1]).
This problem is more common in pediatrics, particularly those over the age of one year. Only topiramate and oxcarbazepine are approved as monotherapy despite their side effects, such as leukopenia, aplastic anemia and drug-induced hepatitis. Because these drugs have the potential for drug interactions, reducing the serum level of other AEDs, and producing drug - drug interaction, it is important to consider the safety and efficacy of an AED separately for monotherapy and adjunctive therapy([@B2]).
The newer generation of AEDs have often more favorable side effects, including lesser somnolence and blood dyscrasia than the traditional AEDs. However, no comparative study has demonstrated the improved efficacy over carbamazepine (CBZ), phenytoin or valproic acid ([@B3]).
Levetiracetam (LEV), the *S*-enantiomer of alpha-ethyl-2-oxo-1-pyrrolidine acetamide, is a novel AED that has been approved for use as an add-on therapy for partial-onset seizures in children older than one year. In addition, LEV may provide effective seizure control when used as monotherapy ([@B4]). No serious toxicity has been reported for LEV ([@B5]). LEV does not affect the liver enzymes, like CYP450. Hence, there is no report on its major interaction with other AEDs ([@B2]).
Little evidence is available for LEV monotherapy in children younger than 16 years ([@B6](. Although several other studies have demonstrated successful conversion to monotherapy in a small number of children, the response rate with various durations of treatment in children with refractory epilepsy was as high as 66% ([@B7],[@B8]).
To date, there are limited comparative findings regarding older and newer generations of AEDs ([@B9]) and there is no prospective study for this comparison.
This study aimed at comparing the effects of LEV and CBZ as monotherapy in children with focal seizures.
Materials & Methods
===================
This Single-blind, randomized, prospective study (data recorder was blind to the drug administration) was conducted among 50 newly diagnosed children having focal epilepsy and referring to the Quaem Hospital Pediatric Neurology Ward, Mashhad, Iran from May 2013 to March 2014. The age range of patients was 1-16 years.
Research protocol was approved by the Ethics Committee of the Mashad University of Medical Sciences (t-3181) and the written informed consent was obtained from the parents of the subjects.
***Patients.***The age range of 1-16 years, newly diagnosed focal epilepsy, no history of refractory seizures, the lack of other systemic underlying disorders, especially renal, hepatic, or brain diseases, such as cerebral palsy and no history of previous AED use were the inclusion criteria. Those with pseudo- seizures, drug reaction and major side effects, such as Stevens-Johnson syndrome, drug-induced hepatitis, psychosis, renal disorders, severe agitation or any other minor problems, the lack of parents' willingness to participate in the study and clinical or electroencephalographic findings suggestive of idiopathic generalized epilepsy were the exclusion criteria.
***Study design.***The study participants were randomly assigned to the two treatment groups receiving either LEV or CBZ. LEV (Levebel) was initiated at an initial dose of 10mg/kg/d and increased by 10mg/kg weekly until it reached the usual dose of 30mg/kg/d and continued. In the other group, CBZ (Loqman) was initiated at an initial dose of 5mg/kg/d and increased by 5 mg/kg weekly until it reached the usual dose of 15mg/kg/d and then continued.
At first, all participants were subjected to electroencephalography (EEG). To evaluate hepatic and hematologic side effects, complete blood count (CBC), alkaline phosphatase (ALKP) and aminotransferases (AST and ALT) tests were done one month later. Participants were assessed for side effects, such as somnolence, agitation, urticaria or skin itching. The patients then were divided into two 25-member groups, one group received LEV and the other one received CBZ. These groups were then sub-divided into two groups: responsive and non-responsive to therapy. Patients who completed the trial were considered to receive the allocated treatment until data analysis.
***Statistics***
Due to the lack of relevant study, this study was done as a pilot research. The subjects were initially dichotomized into two groups: those who treated with LEV and those with CBZ. The Student *t-*test and Chi-square test were used to compare continuous parametric and nonparametric data, respectively. The Fisher\'s exact test was used for categorical variables. The seizure-free period was calculated for each subject. The occurrence of adverse events was compared between the two treatment groups using the dosage at the onset of the adverse events and the interval between the initiation of the AED administration and the occurrence of the adverse events.
Results
=======
The initial evaluation sowed 25 patients with seizures who were younger than 16 years treated with LEV and 25 cases treated with CBZ who met inclusion criteria. The demographic characteristics of the two treatment groups were comparable and all patients were followed for 6 months after the initiation of monotherapy ([Table 1](#T1){ref-type="table"}). Two participants receiving LEV were excluded from the study because they developed severe agitation. The final analysis was done on 48 participants. No other case was excluded to follow-up or discontinued taking the medication. There was no need to add adjunct AEDs during the follow-up period.
The mean age of the participants was 7.32±3 years in the CBZ group and 7.89±2.5 years in the LEV group. Based on the Independent sample *t*-test, there was no significant difference in terms of age between the groups (*P*value: 0.516). Twenty-three participants (47.9%) had normal EEG (12 participants in the CBZ group and 11 in the LEV group), whereas 25 participants (52.1%) had abnormal EEG (13 patients in the CBZ group and 12 patients in the LEV group). Chi-square test revealed no significant difference in the frequency of participants with normal and abnormal EEG between the two groups (*P* value: 0.990(. In the CBZ group, 10 participants (40%) (or 20.8% of the total participants) did not respond to the therapy and had one or more seizures during the follow-up period. In the LEV group, only three (13%) participants (6.3% of the total participants) did not respond to the therapy. Fifteen (60%) participants receiving CBZ and 20 participants (87%) receiving LEV responded to the therapy.
There was no significant difference between the participants who were free of seizure attacks during a six-month follow-up and those who had seizure attacks. Regardless of the seizure type, Chi-squared test revealed a statistically significant difference in the response to the therapy between the CBZ and LEV groups (*P* value: 0.035). The participants on LEV monotherapy had a significantly higher response rate. Moreover, in the LEV group, there was no significant difference between the participants who were free of seizure attacks through a six-month follow-up and those who were not.
In the CBZ monotherapy group, five participants (20%) had a complex partial seizure and 20 subjects (80%) had secondary generalized seizures. Moreover, in the LEV monotherapy group, 5 participants (21.7%) had complex partial seizures and 18 subjects (78.3%) had secondary generalized seizures during the follow-up period. Chi-square test revealed no statistically significant difference in the frequency and type of seizure between the two groups (*P* value: 0.882).
Totally, 16 subjects (32%) out of the 50 participants \[9 (36%) on CBZ and 7 (28%) on the LEV\] experienced at least one adverse event and none of the adverse events were life-threatening. Of the total participants, 68% subjects (34/50) did not show any adverse events \[16 cases (64%) in the CBZ group and 18 cases (72%) in the LEV group\]. in addition, the Chi-squared test revealed no statistically significant difference in the occurrence of complications between the two groups (*P* value 0.853).
Six (12.5%) participants in the CBZ group reported somnolence and impaired consciousness; however, no somnolence sign was reported in the LEV group. The Chi-squared test results showed a statistically significant difference between the two groups (*P* value: 0.012).
There were no reported agitation signs in the CBZ group, whereas 7 cases (30.4% of the total) in the LEV group reported agitation signs. Considering those who were excluded, 7 out of the 25 participants (36%) in the LEV group had agitation signs. The Chi-squared test results revealed a statistically significant difference in agitation signs between the two treatment groups (*P* value: 0.003).
On the other hand, dermatologic and hepatic complications were reported only in the CBZ group. However, there were no statistically significant | {
"pile_set_name": "PubMed Central"
} |
Spins misaligned to the magnetic field relax into the field direction by transferring their energy to the environment. The relaxation rate is governed by the magnetic damping constant (α) which reveals the interaction between the spins and the environment around the spins. Though α is a material-specific value, it can be actively controlled by the spin transfer torque[@b1][@b2]. The active reduction of α gives such interesting phenomena as magnetization reversal[@b3][@b4][@b5][@b6] and steady spin precession[@b7][@b8][@b9][@b10][@b11][@b12], which have given birth to the novel devices like the spin transfer torque magnetoresistive random access memory (STT-MRAM)[@b13][@b14] and the spin torque nano-oscillator (STNO)[@b15]. In general, these spintronic devices consist of two main spin layers called as free and pinned layer. Although each layer is coupled to the other by the dipolar interaction and the spin transfer torque, the spin dynamics driven by their coupling has not been considered seriously. Only recently, the spin dynamics coupled by the mutual spin transfer torque has been studied by micromagnetic calculation[@b16][@b17]. But the dipolar interaction was assumed to give only marginal effects because the dipolar field from the pinned layer is generally compensated by the antiferromagnetically coupled additional layer, i.e. synthetic antiferromagnet (SAF)[@b17][@b18][@b19]. Here in this report, however, we show that the dipolar coupling actually has a serious impact on the current driven spin dynamics. We observed that the current driven spin oscillation disappears at a specific magnetic field. The micromagnetic calculation and the numerical estimation of the eigenmodes on the model systems with different dipolar interactions show that the observed behavior originates from the dipolar coupling. As will be described later, the current driven magnetic damping of the dipolar-coupled spin system is closely related to the transfer of energy between the two layers. By changing the energy transfer rate with the external magnetic field, one can adjust the damping of the coupled spin system.
Results
=======
Anomalous discontinuity in spin oscillation mode observed in magnetic tunnel junction
-------------------------------------------------------------------------------------
The sample for our study is a typical magnetoresistive tunneling junction (MTJ), which consists of the bottom layer \[Si/SiO2/TiN(60)\], SAF \[PtMn(15)/Co~90~Fe~10~(1.5)/Ru(0.8)/Co~40~Fe~40~B~20~(1.5)\], tunneling barrier \[Mg(0.3)/MgO(0.53)\], magnetic free layer \[Co~20~Fe~60~B~20~(2.0)\], and capping layer\[Ta(5)/Ti(15)/Ru(15)\] as shown in [Fig. 1](#f1){ref-type="fig"}. Here the numbers in the parenthesis represent the nominal thickness in the unit of nanometer. In order to study the coupled motion between the free layer (FL) and the top pinned layer of the SAF (TPL), the thickness of the pinned layer was thin enough to be excited by the spin transfer torque. In previous studies that focus only on the dynamics of the FL spin, the thickness of the TPL was much thicker[@b20][@b21] or wider[@b22] than the FL, inhibiting the excitation of the TPL. The MTJ cell has a circular shape with a diameter of 90 nm, minimizing the in-plane shape anisotropy. The current driven spin precession yields a resistance oscillation in the circular MTJ cell, which has been measured under different external fields (*μ~0~H*). The polarity of *μ~0~H* was defined as positive when the magnetization of the FL is antiparallel with the TPL. The current bias polarity was defined as positive when the electron moves from the TPL to the FL.
[Figure 2a](#f2){ref-type="fig"} shows the resistance of the MTJ cell as a function of *μ~0~H* in the current density . Under the negative (positive) field, the spins in the FL are parallel (antiparallel) to the spins in the TPL, yielding the lower (higher) magnetoresistance level. The spins in the TPL begin to be tilted from the spin flop-field *μ~0~H~sf~* = 90 mT, where the external field becomes comparable to the exchange field between the TPL and bottom pinned layer (BPL) of the SAF. The alignments of the spins in the three layers are schematically shown in [Fig. 2a](#f2){ref-type="fig"} as arrow marks for the comparison with the resistance curve.
The color-coded power spectrums of the MTJ cell in the current biases and are shown in [Fig. 2b and 2c](#f2){ref-type="fig"}, respectively. In the field range 0 \< *μ~0~H* \< *μ~0~H~sf~*, one can observe distinctive dependence of the oscillation mode on the current bias polarity. In positive (negative) current bias, the spins in the FL (TPL) are dominantly excited, yielding a blue (red) frequency shift with the increasing field. Above the spin-flop transition *μ~0~H* \> *μ~0~H~sf~*, both the free and pinned layer show blue frequency shifts. These general features agree with the previous reports on the eigenmodes of the FL and TPL in the MTJ cell[@b23][@b24][@b25].
There are several interesting points in [Fig. 2b and 2c](#f2){ref-type="fig"}. A discontinuity is clearly observed in the oscillation mode. In [Fig. 2b](#f2){ref-type="fig"}, the free layer oscillation observed at low fields disappears at around *μ~0~H* = 40 mT, and reappears at *μ~0~H* \> 60 mT. One should note that the point by point discontinuity in the field range *μ~0~H* \< 30 mT is just due to the large interval of the sampling fields in our experiment. This is different from the real discontinuity of the oscillation mode.
One can also find a gap in the oscillation frequency at around the disconnected point. The extension of the lower field mode by the Kittel formula[@b26] does not matches well with the higher field mode. The oscillation mode of the TPL in [Fig. 2c](#f2){ref-type="fig"} also shows similar discontinuity and frequency gap, which implies that the observed feature is independent of the current polarity. The explanation of the observed anomalous breakdown of the oscillation mode is the main subject of this article.
Micromagnetic calculation : effect of dipolar coupling on spin oscillation
--------------------------------------------------------------------------
The magnetization dynamics of the coupled spin layers have been calculated using the Landau-Lifshits-Gilbert-Slonczewski-Slonczewski (LLGS) equation given by[@b3][@b27][@b28] where *γ*, *α*, *a~J~*, and ***p*** represents the gyromagnetic ratio, the intrinsic damping constant, the amplitude of the spin-torque in the unit of magnetic field, a unit vector parallel to the electron spin polarization. In order to study the effect of the dipolar coupling between the layers, the micromagnetic calculations have been carried out on several different separations (*s*) between the TPL and FL from 0.8 nm to 50 nm. Although electrons cannot tunnel through the oxide barriers in case of large *s* value in reality, we assumed the same tunneling current could pass through the MTJ in our calculations.
The color-coded microwave power calculated on the model system with *s* = 0.8 nm, 10 nm, 50 nm under the positive and negative current biases are depicted in [Fig. 3a--3c](#f3){ref-type="fig"} and in [Fig. 3d--3f](#f3){ref-type="fig"}, respectively. The case of *s* = 0.8 nm shows nearly the same oscillation feature with the experiment. There is a clear discontinuity and frequency gap in the oscillation mode at around 45 mT. As *s* increases, i.e., the dipolar interaction between the FL and TPL becomes weaker, the gap between the higher frequency mode and lower frequency mode decreases. At the separation of 50 nm, the oscillation mode is nearly connected with a negligible gap like the oscillation mode of a 'non-coupled' single spin system. This reveals that the observed breakdown and frequency gap in the oscillation mode at around 45 mT comes from the dipolar coupling between the FL and TPL.
Normal modes of dipolar coupled spin oscillation
------------------------------------------------
To deeply understand the coupled dynamics, we calculated the eigenmodes of the model system by solving the LLGS equation in a small excitation limit. The azimuthal and polar angles of the magnetization in each layer have been defined as and *θ~i~*, respectively. Here *i* represents the layer number of the BPL (*i* = 1), TPL (*i* = 2), FL (*i* = 3). The LLGS equation in Eq. 1 can be described according to the above six variables in the form A linearized form of the above equation around the stationary point ***X*~0~** = (*x*~10~, *x*~20~, *x*~30~, *x*~40~, *x*~50~, *x*~60~) following * | {
"pile_set_name": "PubMed Central"
} |
Prolonged symptom duration and disability are common in adults hospitalized with severe coronavirus disease 2019 (COVID-19). Characterizing return to baseline health among outpatients with milder COVID-19 illness is important for understanding the full spectrum of COVID-19--associated illness and tailoring public health messaging, interventions, and policy. During April 15--June 25, 2020, telephone interviews were conducted with a random sample of adults aged ≥18 years who had a first positive reverse transcription--polymerase chain reaction (RT-PCR) test for SARS-CoV-2, the virus that causes COVID-19, at an outpatient visit at one of 14 U.S. academic health care systems in 13 states. Interviews were conducted 14--21 days after the test date. Respondents were asked about demographic characteristics, baseline chronic medical conditions, symptoms present at the time of testing, whether those symptoms had resolved by the interview date, and whether they had returned to their usual state of health at the time of interview. Among 292 respondents, 94% (274) reported experiencing one or more symptoms at the time of testing; 35% of these symptomatic respondents reported not having returned to their usual state of health by the date of the interview (median = 16 days from testing date), including 26% among those aged 18--34 years, 32% among those aged 35--49 years, and 47% among those aged ≥50 years. Among respondents reporting cough, fatigue, or shortness of breath at the time of testing, 43%, 35%, and 29%, respectively, continued to experience these symptoms at the time of the interview. These findings indicate that COVID-19 can result in prolonged illness even among persons with milder outpatient illness, including young adults. Effective public health messaging targeting these groups is warranted. Preventative measures, including social distancing, frequent handwashing, and the consistent and correct use of face coverings in public, should be strongly encouraged to slow the spread of SARS-CoV-2.
Prolonged illness is well described in adults with severe COVID-19 requiring hospitalization, especially among older adults ([@R1],[@R2]). Recently, the number of SARS-CoV-2 infections in persons first evaluated as outpatients have increased, including cases among younger adults ([@R3]). A better understanding of convalescence and symptom duration among outpatients with COVID-19 can help direct care, inform interventions to reduce transmission, and tailor public health messaging.
The Influenza Vaccine Effectiveness in the Critically Ill (IVY) Network, a collaboration of U.S. health care systems, is conducting epidemiologic studies on COVID-19 in both inpatient and outpatient settings ([@R4],[@R5]). Fourteen predominantly urban academic health systems in 13 states each submitted a list of adults with positive SARS-CoV-2 RT-PCR test results obtained during March 31--June 4, 2020, to Vanderbilt University Medical Center. Site-specific random sampling was then performed on a subset of these patients who were tested as outpatients and included patients tested in the emergency department (ED) who were not admitted to the hospital at the testing encounter and those tested in other outpatient clinics. At 14--21 days from the test date, CDC personnel interviewed the randomly sampled patients or their proxies by telephone to obtain self-reported baseline demographic, socioeconomic, and underlying health information, including the presence of chronic medical conditions. Call attempts were made for up to seven consecutive days, and interviews were conducted in several languages ([@R4]). Respondents were asked to report the number of days they felt unwell before the test date, COVID-19--related symptoms experienced at the time of testing ([@R6]), whether symptoms had resolved by the date of the interview, and whether the patient had returned to their usual state of health. For this data analysis, respondents were excluded if they did not complete the interview, if a proxy (e.g., family member) completed the interview (because of their incomplete knowledge of symptoms), if they reported a previous positive SARS-CoV-2 test (because the reference date for symptoms questions was unclear), or (because this analysis focused on symptomatic persons) if they did not answer symptoms questions or denied all symptoms at testing.
Descriptive statistics were used to compare characteristics among respondents who reported returning and not returning to their usual state of health by the date of the interview. Generalized estimating equation regression models with exchangeable correlation structure accounting for clustering by site were fitted to evaluate the association between baseline characteristics and return to usual health, adjusting for potential a priori-selected confounders. Resolution and duration of individual symptoms were also assessed. Statistical analyses were conducted using Stata software (version 16; StataCorp).
At least one telephone call was attempted for 582 patients (including 175 \[30%\] who were tested in an ED and 407 \[70%\] in non-ED settings), with 325 (56%) interviews completed (89 \[27%\] ED and 236 \[73%\] non-ED). Among 257 nonrespondents, 178 could not be reached, 37 requested a callback but could not be reached on further call attempts, 28 refused the interview, and 14 had a language barrier. Among the 325 completed interviews, 31 were excluded: nine (3%) because a proxy was interviewed, 17 (5%) because a previous positive SARS-CoV-2 test was reported, and five (2%) who did not answer the symptoms questions. Two additional respondents were called prematurely at 7 days and were also excluded.[\*](#FN1){ref-type="fn"} Among the 292 remaining patient respondents, 274 (94%) reported one or more symptoms at testing and were included in this data analysis. Following outpatient testing, 7% (19 of 262 with available data) reported later being hospitalized, a median of 3.5 days after the test date. The median age of symptomatic respondents was 42.5 years (interquartile range \[IQR\] = 31--54 years), 142 (52%) were female, 98 (36%) were Hispanic, 96 (35%) were non-Hispanic white, 48 (18%) were non-Hispanic black, and 32 (12%) were other non-Hispanic race. Overall, 141 of 264 (53%) with available data reported one or more chronic medical conditions. The median interval from test to interview date was 16 days (IQR = 14--19 days); the median number of days respondents reported feeling unwell before being tested for SARS-CoV-2 was 3 (IQR = 2--7 days).
Return to Usual State of Health
===============================
Among the 270 of 274 interviewees with available data on return to usual health,[^†^](#FN2){ref-type="fn"} 175 (65%) reported that they had returned to their usual state of health a median of 7 days (IQR = 5--12 days) from the date of testing ([Table 1](#T1){ref-type="table"}). Ninety-five (35%) reported that they had not returned to their usual state of health at the time of interview. The proportion who had not returned to their usual state of health differed across age groups: 26% of interviewees aged 18--34 years, 32% aged 35--49 years, and 47% aged ≥50 years reported not having returned to their usual state of health (p = 0.010) within 14--21 days after receiving a positive test result. Presence of chronic conditions also affected return to health rates; among 180 persons with no or one chronic medical condition, 39 with two chronic medical conditions, and 44 with three or more chronic medical conditions, 28%, 46%, and 57%, respectively, reported not having returned to their usual state of health (p = 0.003) within 14--21 days after having a positive test result. Among respondents aged 18--34 years with no chronic medical condition, 19% (nine of 48) reported not having returned to their usual state of health. Adjusting for other factors, age ≥50 versus 18--34 years (adjusted odds ratio \[aOR\] = 2.29; 95% confidence interval \[CI\] = 1.14--4.58) and reporting three or more versus no chronic medical conditions (aOR = 2.29; 95% CI = 1.07--4.90) were associated with not having returned to usual health ([Table 2](#T2){ref-type="table"}). Obesity (body mass index ≥30 kg per m^2^) (aOR 2.31; 95% CI = 1.21--4.42) and reporting a psychiatric condition[^§^](#FN3){ref-type="fn"} (aOR 2.32; 95% CI = 1.17--4.58) also were associated with more than twofold odds of not returning to the patient's usual health after adjusting for age, sex, and race/ethnicity.
###### Characteristics of symptomatic outpatients with SARS-CoV-2 real-time reverse transcription--polymerase chain reaction (RT-PCR)---positive test results (N = 270)[\*](#FN1){ref-type="fn"} who reported returning to usual state of health or not returning to usual state of health at an interview conducted 14--21 days after testing --- 14 academic health care systems,[^†^](#FN2){ref-type="fn"} United States, March--June 2020
Characteristic Total Returned to usual health, no. (row %) P-value^§^
------------------------------------------------------ --------- --------------------------------------- ------------ -------
**Sex** 0.14
Women **140** 85 (61) 55 (39)
Men **130** 90 (69) 40 (31)
**Age group (yrs)** 0.010
18--34 **85** | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION
============
MicroRNAs (miRNAs) belong to a recently identified group of the large family of noncoding RNAs ([@B1]). The mature miRNA is usually 19--27 nt long and is derived from a larger precursor that folds into an imperfect stem-loop structure. The mode of action of the mature miRNA in mammalian systems is dependent on complementary base pairing primarily to the 3′-UTR region of the target mRNA, thereafter causing the inhibition of translation and/or the degradation of the mRNA.
According to recent estimates, while over 30% of vertebrate genomes is transcribed ([@B2]), only 1% consists of coding genes, suggesting that the rest must be various types of noncoding RNA genes. In addition, 701 human miRNA hairpin sequences are currently contained in the miRNA registry (miRBase, release 12.0), of which 92% have been experimentally verified, and it is anticipated that there may be thousands more. A recent estimate of the total number of miRNA genes in the human genome provided by the study of Miranda *et al*. ([@B3]) is in the range of ∼55 000, a number significantly larger than the experimentally verified human miRNAs currently in the registry. Searching through the entire genome of human and/or other species for novel miRNA genes is a complicated task for which fast, flexible and reliable identification methods are required. Currently available experimental approaches working towards this goal are complex and sub-optimal ([@B4]). Inefficiencies result from various sources, including difficulty in isolating certain miRNAs by cloning due to low expression, stability, tissue specificity and technical difficulties of the cloning procedure while selecting the right genomic region to investigate is often a very challenging task of its own. Computational prediction of miRNA genes from genomic sequences is an alternative technique which offers a much faster, cheaper and effective way of identifying putative miRNA genes. Moreover, by predicting the location of miRNA genes, these methods enable experimentalists to concentrate their efforts on genomic regions more likely to contain novel miRNA genes, thus facilitating the discovery process.
Accurate prediction of new miRNAs requires the consideration of certain characteristic properties of these molecules based on either experimental ([@B5; @B6; @B7]), or computational evidence ([@B8; @B9; @B10; @B11; @B12]) which can be used to build a classification scheme or predictive model. These general features include sequence composition, secondary structure and species conservation. MiRNA gene prediction can be achieved via the use of supervised algorithms that are trained on known miRNA biological features and then used to identify putative miRNAs, or un-supervised algorithms such as alignment or conservation. The prediction methodology can also vary significantly between different studies. It can be performed by: scanning for hairpins within sequences that are conserved between closely related organisms like *Caenorhabditis elegans* and *C. briggsae* ([@B10],[@B13]), looking for regions of homology between known miRNAs and other sites within aligned genomes, as for example between human and mouse ([@B14]) or looking for conserved regions of synteny---conserved clustering of miRNAs in the genomes of closely related organisms ([@B14]). Profile-based detection ([@B15]) and secondary structure alignment ([@B16]) of miRNAs have also been suggested using sequences across multiple, highly divergent, organisms (i.e. mouse and fugu). Support vector machines that take into account multiple biological features such as free energy, paired bases, loop length and stem conservation have also been used to predict novel miRNAs ([@B8],[@B9],[@B17]). Many of these prediction methods undertake a pipeline approach, whereby cut-offs are assigned and sequences are eliminated as the pipeline proceeds ([@B10],[@B13]). The drawback of these approaches is that they lose numerous true miRNAs along the line due to stringent cut-offs. Other approaches use homology to detect novel miRNAs based on their similarity to previously identified miRNAs ([@B14; @B15; @B16]). These methods obviously fail when scanning distantly related sequences and when novel miRNAs lack detectable homologs. Two studies ([@B12],[@B18]) used Hidden Markov Models (HMMs) and Bayesian classifiers, respectively, to simultaneously consider sequence and structure information for the identification of miRNA precursors (pre-miRNAs). However, conservation information, a very important characteristic of the majority of miRNA precursors, was not integrated in those algorithms. Finally, in a more recent study ([@B19]), an HMM approach that simultaneously considered structure and conservation features of miRNA genes was shown to achieve very high performance on identifying miRNAs in the human genome.
In addition to computational tools, large scale, high throughput methods such as tiling arrays or deep sequencing have recently been used for the identification of novel miRNA genes ([@B20; @B21; @B22]). These methods are particularly useful as they can provide a very sophisticated and accurate expression map for small RNAs in the genome. Moreover, if such data is coupled to computational tools, it can facilitate rapid and precise detection of novel miRNAs, while at the same time giving greater credence to computational predictions.
MiRNAs have been suggested to play a key regulatory role in numerous processes, including cancer ([@B23],[@B24]). For example, the expression levels of let-7 ([@B25]), miR-15a/miR-16-1 cluster ([@B26]) and neighboring miR-143/miR-145 ([@B27]), are found to be reduced in some malignancies, while other miRNAs such as the miR-17-92 cluster ([@B28; @B29; @B30]) and miR-155/BIC ([@B31]), are overexpressed in various cancers. Additionally it was recently shown that a high percentage of miRNA genes are located in cancer-associated genomic regions (CAGRs), thus implicating miRNAs in tumorigenic events ([@B32]). CAGRs take the form of (i) minimal regions of loss of heterozygosity (LOH), suggestive of the presence of tumor suppressor genes; (ii) minimal regions of amplification, suggestive of the presence of oncogenes; and (iii) common breakpoint regions in or near possible oncogenes or tumor suppressor genes. The identification of novel miRNA genes within these regions is very important as it may reveal putative gene players that exert a regulatory effect on different types of cancer, contribute to the better understanding of molecular pathways responsible for oncogenesis and provide potential targets for therapeutic intervention.
In this work, we present an efficient and freely available prediction tool (SSCprofiler) where *Profile* HMMs are trained to recognize key biological features of miRNAs such as sequence, structure and conservation in order to identify novel miRNA precursors. We first use our method to learn with high accuracy the characteristic features of 249 human miRNA precursors and then apply the trained model on CAGRs in search of novel miRNA genes. Predictions are ranked according to expression information from a recently published full genome tiling array ([@B21]) and the top four scoring candidates are verified experimentally using northern blot.
MATERIALS AND METHODS
=====================
Datasets
--------
The sequences of human pre-miRNAs used to train and test the HMMs were downloaded from the miRNA registry (version 12.0) (<http://microrna.sanger.ac.uk/sequences/>). For the training/validation sequences BLASTclust ([@B33]) was initially performed to cluster all miRNA sequences into groups by precursor similarity and the most conserved member (according to multiz files) was used to represent the cluster. This procedure was done to eliminate redundant pre-miRNAs and avoid over-representation of similar miRNA precursors. Following a set of filtering criteria detailed below, a total of 249 sequences (originally listed in version 8.0) were used for training/validation while a total of 219 sequences (not in version 8.0) were used as a blind test set. The negative miRNA sequences were derived from 3′-UTR regions of the human genome (release---May 2004) since no true miRNA has yet been reported to reside within these regions. They were generated by using a sliding window of 104 nt, shifted 11 nt at a time, over the 3′-UTR regions. RNAfold was executed for every shift and the free energy of the secondary structure was noted. Only sequences whose energy did not exceed a threshold of --14.44 kcal/mol and had at least 14% of their nucleotides conserved, were selected. This generated over 35 000 negative sequences.
Biological features
-------------------
SSCprofiler takes into account three different biological features: sequence, structure and conservation of miRNA precursors. In this study, conservation was retrieved from the multiz ([@B34]) full genome alignment files of the human May 2004 hg17 genome assembly and seven other vertebrate genomes: Mouse May 2004 (mm5), Rat June 2003 (rn3), Dog July 2004 (canFam1), Chicken February 2004 (galGal2), Fugu August 2002 (fr1), Zebrafish November 2003 (danRer1). Chimp data were not included due to high percentage similarity (∼95%) with humans. RNA secondary structure prediction was performed using the RNAfold function of the Vienna-RNA ([@B35]) package. A fixed window (104 nt) was used to align all sequences in order to generate a multiple sequence alignment (msa) required to train the HMM (see Training and Validation of the HMMs). This was achieved by enlarging sequences that fell shorter than this window using flanking genomic nucleotides and trimming sequences that exceeded the defined msa window. The window length was consequently used as the length of the training model and as the window size for querying genomic sequences.
Filtering
---------
To minimize the search space and reduce computational load, the data were first filtered using various secondary structure features of miRNA precursors. Filtering results were displayed as histograms that show the relative distributions of the positive and negative data with respect to eight features: Hairpin---the number of hairpinsBulges---the number | {
"pile_set_name": "PubMed Central"
} |
All relevant data are within the paper.
Introduction {#sec001}
============
Abscisic acid (ABA) is a phytohormone regulating fundamental physiological functions in plants \[[@pone.0140588.ref001], [@pone.0140588.ref002]\]. ABA is also an endogenous hormone in humans, regulating different cell responses and functions, including activation of innate immune cells and stimulation of insulin release and glucose uptake \[[@pone.0140588.ref003]--[@pone.0140588.ref006]\]. The signaling cascade of ABA in mammalian cells involves ABA binding to lanthionine synthetase C-like protein 2 (LANCL-2) and cAMP production \[[@pone.0140588.ref007]--[@pone.0140588.ref009]\]. Pro-inflammatory stimuli induce ABA production and release from human granulocytes, monocytes, keratinocytes and fibroblasts \[[@pone.0140588.ref003], [@pone.0140588.ref010]--[@pone.0140588.ref012]\] and ABA stimulates cell-specific functional activities in granulocytes (chemotaxis, phagocytosis, release of NO and reactive oxygen species), monocytes (chemotaxis, release of TNF-α, monocyte chemoattractant protein-1, metalloprotease 9 and prostaglandin E2), vascular smooth muscle cells (cell proliferation and migration), keratinocytes (release of NO, PGE2, and TNF-α) and fibroblasts (migration) \[[@pone.0140588.ref003], [@pone.0140588.ref010]--[@pone.0140588.ref012]\].
Several observations indicate that ABA is also involved in the regulation of glucose homeostasis in mammals as an endogenous hormone: i) ABA is released by human and murine pancreatic β-cells in response to high glucose, and nanomolar ABA triggers glucose-independent and potentiates glucose-dependent insulin secretion from these cells \[[@pone.0140588.ref004]\]; ii) oral glucose administration increases plasma ABA concentration (\[ABA\]~p~) in healthy human subjects \[[@pone.0140588.ref005]\]; iii) ABA stimulates glucose uptake by rodent adipocyte and myoblast cell lines \[[@pone.0140588.ref005]\]. In line with these data, Guri et al. observed that a chronic oral administration of exogenous ABA reduced the fasting plasma glucose concentration and ameliorated glucose tolerance in leptin receptor-deficient (db/db) mice \[[@pone.0140588.ref013]\].
Interestingly, the increase of \[ABA\]~p~ in response to an oral glucose load in healthy subjects was less consistently observed when the same subjects were administered glucose intravenously \[[@pone.0140588.ref005]\]. Oral, but not intravenous, glucose administration is followed by the release of the incretin glucagon-like peptide 1 (GLP-1), a gastrointestinal hormone secreted by enteroendocrine L-cells in response to nutrients, hormones and neurotransmitters. GLP-1 stimulates insulin and inhibits glucagon release, thereby contributing to the regulation of glycemia \[[@pone.0140588.ref014]--[@pone.0140588.ref016]\]. A possible explanation for the different effect of intravenously or orally administered glucose on \[ABA\]~p~ could come from the observation that GLP-1 stimulates ABA release by insulin-secreting cells, both in the presence of low- (2 mM) or of high- (25 mM) glucose concentrations \[[@pone.0140588.ref005]\].
In this study, we investigated whether ABA affects GLP-1 secretion by enteroendocrine cells, a process known to be regulated by the \[cAMP\]~i~ \[[@pone.0140588.ref014]\], thereby addressing the possible existence of a positive feed-back mechanism between ABA and GLP-1, regulating glucose homeostasis.
Methods {#sec002}
=======
hNCI-H716 cell culture and GLP-1 secretion studies {#sec003}
--------------------------------------------------
The human L cell line hNCI-H716, derived from a poorly differentiated adenocarcinoma of the cecum, was obtained from the American Type Culture Collection (Manassas, VA). Cells were grown in suspension in RPMI-1640 (Sigma, Milano, Italy), supplemented with 10% fetal bovine serum (FBS), 50 U/ml penicillin and 50 μg/ml streptomycin.
For GLP-1 secretion assays, a protocol similar to the one described in \[[@pone.0140588.ref017]\] was followed: briefly, hNCI-H716 cells were seeded on Matrigel matrix (Becton Dickinson, Bedford, MA), at the density of 2x10^5^ cells/well in 24-well plates, in DMEM medium supplemented with 10% FCS, 50 U/ml penicillin, and 50 μg/ml streptomycin. After 48 h, cells were washed in Hank's Balanced Salt Solution (HBSS) and then incubated for 2 h in Krebs Ringer Hepes buffer (KRH buffer: 130 mM NaCl, 5 mM KCl, 1.3 mM CaCl~2~, 25 mM HEPES, 10 mM Na~2~HPO~4~, 1.3 mM MgSO~4~, 0.2% BSA), in the presence or absence of the different treatments: glucose (200 mM), or glutamine (10 mM), or ABA (0.1, 10 or 200 μM).
After treatment~~s~~, medium and cells were collected separately: GLP-1 content in the supernatant was analyzed by GLP-1 Total ELISA Kit (Merck Millipore, Vimodrone, MI, Italy); total protein content in cells was analyzed by Bradford assay (Bio-Rad, Milano, Italy).
Quantitative real time-PCR {#sec004}
--------------------------
Total mRNA was extracted from hNCI-H716 using Qiazol (Qiagen, Milan, Italy) according to the manufacturer\'s instructions. Quality and quantity of RNA were analysed using a NanoDrop spectrophotometer (Nanodrop Technologies, Wilmington, DE). The cDNA was synthesized by the iScriptTM cDNA Synthesis Kit (Bio-Rad, Milan, Italy) starting from 1 μg of total RNA. PCR primers were designed through Beacon Designer 2.0 Software and their sequences were as indicated in [Table 1](#pone.0140588.t001){ref-type="table"}.
10.1371/journal.pone.0140588.t001
###### Primers.
{#pone.0140588.t001g}
Human gene Sequence, 5'-3'
-------------- ---------------------------- --------------------------
**GLP-1** Forward `GCTGAAGGGACCTTTACCAGT`
Reverse `CCTTTCACCAGCCAAGCATG`
**GLUCAGON** Forward `ATTCACAGGGCACATTCACCA`
Reverse `GGTATTCATCAACCACTGCAC`
**ACTIN** Forward `GCGAGAAGATGACCCAGATC`
Reverse `GGATAGCACAGCCTGGATAG`
**HPRT-1** Forward `GGTCAGGCAGTATAATCCAAAG`
Reverse `TTCATTATAGTCAAGGGCATATCC`
qPCR was performed in an iQ5 real-time PCR detection system (Bio-Rad) using 2× iQ Custom Sybr Green Supermix (Bio-Rad). Values were normalized on mRNA expression of human β-actin and HPRT. Statistical analysis of the qPCR was performed using the iQ5 Optical System Software version 1.0 (Bio-Rad) based on the ^2−^ΔCt method \[[@pone.0140588.ref007]\]. The dissociation curve for each amplification was analysed to confirm absence of unspecific PCR products. Experiments were repeated three times in triplicate.
Measurement of the intracellular cAMP concentration {#sec005}
---------------------------------------------------
hNCI-H716 cells were seeded at the density of 5x10^5^/well in 12-well, Matrigel matrix-coated plates. After 24 h, cells were washed with HBSS, pre-incubated for 10 min in HBSS containing 10 μM IBMX, an inhibitor of phosphodiesterases, and then stimulated with 10 mM glutamine or 200 μM ABA for 2.5 and 5 min.
Supernatant was removed and cells were lysed in 0.6 M PCA. Intracellular cAMP content was evaluated by EIA (Cayman, Ann Arbor, MI, USA) on neutralized extracts \[[@pone.0140588.ref018]\].
Vector construction {#sec006}
-------------------
The full length LANCL2 cDNA was amplified by PCR using cDNA obtained with reverse transcription of total RNA from human granulocytes and using the following primers: `5’-CACCATGGGCGAGACCATGTCAAAG-AG-3’`(foward); `5’-ATCCCTCTTCGAAGAGTCAAGTTC-3’` (reverse).
The PCR was performed in 25 μl containing undiluted reaction buffer, 200 μM dNTP, 5 pmol of primers and using 1.25 U of Herculase HotStart DNA polymerase. The PCR reaction profile was 1 cycle at 94°C for 2 min, 35 cycles at 94°C for 15 s, 62°C for 30 s and 72°C for 1 min with a final extension for 5 min at 72°C. The PCR product was purified with Nucleospin^®^ Extract Kit (Macherey-Nagel) and cloned into pcDNA3.1/V5-His-TOP | {
"pile_set_name": "PubMed Central"
} |
1. Introduction and Epidemiological Data {#sec1-ijms-21-03377}
========================================
In December 2019, the Chinese Government officially announced a severe form of pneumonia caused by a new coronavirus. It started in Wuhan, in the province of Hubei, and spread rapidly throughout China and then all over the world.
The World Health Organization (WHO) named the syndrome CoronaVirus Disease-2019 (COVID-19), but it was later renamed "severe acute respiratory syndrome" (SARS) Coronavirus (CoV)-2-related (SARS-CoV-2) by the coronavirus Study Group of the International Committee on Virus Taxonomy \[[@B1-ijms-21-03377],[@B2-ijms-21-03377]\]. SARS-CoV-2 is one of the seven beta coronaviruses belonging to the coronavirus family \[[@B3-ijms-21-03377],[@B4-ijms-21-03377]\], which are common in humans and other mammals \[[@B5-ijms-21-03377]\].
The WHO General Director, Tedros Adhanom Ghebreyesus, declared this infection pandemic in the press conference on 11 March 2020 (at [www.who.int/emergencies](www.who.int/emergencies)).
Although most human coronavirus infections are mild, before the current COVID-19 two severe coronavirus outbreaks affected humans in the past two decades: (1) the severe acute respiratory syndrome (SARS) that was caused by the SARS-CoV virus in 2002 \[[@B6-ijms-21-03377],[@B7-ijms-21-03377],[@B8-ijms-21-03377]\] and (2) the Middle East respiratory syndrome (MERS) that was caused by MERS-CoV in 2012 \[[@B9-ijms-21-03377],[@B10-ijms-21-03377]\], being responsible for more than 10,000 cumulative infected cases with 10% and 37% mortality rates, respectively ([www.who.int/csr/sars](www.who.int/csr/sars) and [www.who.int/emergencies/mers-cov](www.who.int/emergencies/mers-cov)). The SARS-CoV and SARS-CoV-2 strains use the same region, referred to as spike, to bind the same receptor, namely the angiotensin converting enzyme-2 \[[@B11-ijms-21-03377],[@B12-ijms-21-03377]\]. Their spike regions differ in terms of only few amino acids \[[@B13-ijms-21-03377],[@B14-ijms-21-03377]\].
Since its outbreak, the SARS-CoV-2 virus infection has spread rampantly, infecting 2,029,930 confirmed cases worldwide to date, and causing 136,320 deaths, in more than 200 countries (<https://gisanddata.maps.arcgis.com>, 1 April 2020).
At the time we write, the USA situation dominates the world scenario, with 639,644 clinically and laboratory confirmed cases and 30,985 deaths, followed by Spain (180,659 cases) and Italy, with 165,155 confirmed cases and the highest number of deaths, now 21,6454, then France, Germany, the United Kingdom, and China, with a prevalence rate between 0.2--0.3%. In Europe, of 978,632 confirmed cases, 84,628 have died (8.6% case fatality rate and 1,6 mortality rate) (<https://gisanddata.maps.arcgis.com/>, 16 April 2020).
A report on 30 March 2020, related to the 10,026 Italians who had died of coronavirus infection (<https://www.epicentro.iss.it/coronavirus/>), described a median age of 78 (range 30--100, InterQuartile Range---IQR 73-85; 30.8% females, median age 82). The median age was 15 years higher than that of the general SARS-CoV-2-positive population (median age 63 years). Of these 10,026 patients, 74% were aged between 74 and 89 years. Only 112 (1.1%) were younger than 50 years old and 23 patients were under 40. The latter included 15 patients with serious co-existing pathologies, six with no other comorbidities, while no clinical records were available for the remaining two patients.
In a subgroup of 909 (of the 10,026) deceased patients, for whom complete clinical records were available, 51.7% had more than three diseases, including arterial hypertension (73.5%), diabetes mellitus (31.5%), ischemic heart disease (27.4%), chronic renal failure (23.8%), atrial fibrillation (23%), active cancer in the last five years (16.5%), and heart failure (16.4%). In this group, death was caused by the acute respiratory distress syndrome (ARDS) (96.5% of cases) that was associated to acute renal failure (25.7%), acute cardiac injury (11.6%), and/or superinfections (11.2%) ([www.epicentro.iss.it/coronavirus](www.epicentro.iss.it/coronavirus)).
2. Clinical Features {#sec2-ijms-21-03377}
====================
Clinical presentations of COVID-19 range from asymptomatic (81.4%), through mildly symptomatic with or without seasonal flu-like symptoms, to severe pneumonia (13.9%) \[[@B15-ijms-21-03377]\]. Usually, respiratory problems manifest about one week after virus entry and dyspnea ranges from effort dyspnea to dyspnea occurring at rest \[[@B16-ijms-21-03377],[@B17-ijms-21-03377]\]. Patients with dyspnea can revert to an asymptomatic phase or progress to ARDS, requiring positive pressure oxygen therapy and intensive care therapy \[[@B18-ijms-21-03377]\] in 17--19.6% of symptomatic patients \[[@B19-ijms-21-03377],[@B20-ijms-21-03377]\]. ARDS, in turn, can progress to multi-organ failure \[[@B21-ijms-21-03377]\] and, in this phase, disseminated intravascular coagulation (DIC) can also be observed \[[@B22-ijms-21-03377]\]. The main cause of death worldwide in infected patients is a combination of both ARDS and DIC in 13.9% of cases \[[@B23-ijms-21-03377]\].
The ARDS-stage is preceded by a marked rise of inflammatory parameters, such as serum ferritin, C-reactive protein (CRP) levels, d-dimers, and the erythrocyte sedimentation rate, and it is characterized by severe edema of the alveolar wall and lung interstices, responsible for the ground glass picture seen at chest high resolution CT scan. When DIC occurs, d-dimers levels further increase, while increased liver and skeletal muscle enzymes and/or serum urea and creatinine indicate ongoing multiorgan failure.
Clinical recovery is possible at any of the above-mentioned stages, and it is generally associated to a complete clearance of the virus, rather than to its persistence. In the latter, rarer condition, according to preliminary studies \[[@B24-ijms-21-03377]\], the virus can be detected for a period of up to one month. Lastly, clinical recovery from the ARDS stage is rarely achieved (2.9%) \[[@B16-ijms-21-03377]\].
Thus, at a certain stage of the infection, in some individuals the virus becomes a powerful stimulator of inflammation at alveolar levels, leading to an alveolar capillary leak-like syndrome (CLLS), with edema, and a marked impairment of gas exchange requiring assisted ventilation.
3. Pathology and Laboratory Evidence of CLLS and Inflammation {#sec3-ijms-21-03377}
=============================================================
Autopsy studies of the lungs of patients in advanced stages of the disease are not yet available. However, histology revealed a pattern of alveolar wall edema, proteinaceous exudates, and focal reactive hyperplasia of pneumocytes with vascular congestion, patchy inflammatory cellular infiltration, and multinucleated giant cells in two patients who underwent lung lobectomy for adenocarcinoma and subsequently tested positive for SARS-CoV-2 \[[@B25-ijms-21-03377]\]. Post-mortem biopsies of a fifty-year-old Chinese patient who died of SARS-CoV-2 with severe acute respiratory syndrome showed evident desquamation of pneumocytes, bilateral pulmonary edema with hyaline membrane formation, interstitial mononuclear inflammatory infiltration, and multinucleated syncytial cells with atypical pneumocytes \[[@B26-ijms-21-03377]\]. These histological findings resemble those found at histological post-mortem examination in patients during the 2002 SARS infection \[[@B27-ijms-21-03377]\], as regards diffuse alveolar wall and airspace edema, and the presence of multinucleated cells. They suggest a common mechanism(s) underlying the clinical picture of SARS \[[@B27-ijms-21-03377]\] and COVID-19 \[[@B25-ijms-21-03377]\], culminating in ARDS, which is likely mediated by massive cytokines release.
Indeed, high levels of several pro-inflammatory cytokines, including IL-6, IL-1, TNF-α, have been demonstrated in advanced stage patients \[[@B18-ijms-21-03377],[@B28-ijms-21-03377]\], supporting the hypothesis that the onset of ARDS is driven by pro-inflammatory cytokines, which are responsible for the histological changes and clinically full-blown ARDS. Among pro-inflammatory cytokines, IL-6 appears to be heavily involved, as indicated | {
"pile_set_name": "PubMed Central"
} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.