text stringlengths 1 18.8k | meta dict |
|---|---|
Introduction {#sec1-1}
============
With the better understanding of the developmental neurobiology, it is now a well recognized fact that nervous system is sufficiently sensitive to nociception even before birth, and thus, children should not be undertreated for pain. This aspect has received considerable attention since the landmark studies of Anand and colleagues.\[[@ref1][@ref2]\] They were of the opinion that infants and even preterm babies have the anatomical and functional ability to perceive pain. Infants show greater hemodynamic, immune, hormonal, and metabolic stress responses, which may result in impaired healing of damaged or infected tissue leading to increased morbidity.
The descending inhibitory pathways to the dorsal horn of the spinal cord are not developed at birth, which may lead to accentuation of pain in neonates. Moreover, the dorsal horns have wider receptive fields and lower excitatory thresholds than those in older children.\[[@ref3][@ref4]\]
Procedural sedation technique should ideally be individualized as per the requirement. For a child undergoing a procedure, a major deciding factor is whether it is painful or not \[[Table 1](#T1){ref-type="table"}\]. Pure sedation is sufficient for the imaging studies, while analgesia is required for all invasive procedures, which inflict pain to the child. Sedation is required during the procedures to allay the anxiety, pain, and movement. Coaxing and physical restraint is not an alternative and this may make the procedure not only difficult but also unsafe for the child. Moreover, the psychological trauma may be severe enough to even lead to stress disorder.\[[@ref5]\] If pain is not recognized and adequately treated, the resulting physiological and behavioral responses can lead to long-lasting negative effects on the developing nociception system.\[[@ref6][@ref7]\]
######
Procedures requiring sedation
Objective and quantitative measurement of pain in children is a herculean task for most anesthesiologists. Observational pain scales have been validated for neonates and infants to allow pain assessment in those unable to verbalize their pain \[[Table 2](#T2){ref-type="table"}\].\[[@ref8][@ref9][@ref10][@ref11]\]
######
Pain scales
Pre-sedation assessment for procedure {#sec2-1}
-------------------------------------
Children undergoing sedation should be evaluated beforehand according to the preoperative assessment guidelines of the American Society of Anesthesiologists (ASA). Laboratory workup has no role prior to procedural sedation. Informed consent should be obtained and documented prior to the procedure. ASA fasting guidelines for procedural sedation and analgesia (PSA) may not be followed in every case; the risk in individual patients must be weighed against the risk of delaying an emergent procedure.\[[@ref11]\]
Equipment and emergency drugs {#sec2-2}
-----------------------------
It is necessary to have appropriate equipment, monitoring, and reliable back up help before instituting sedation for a procedure in a child. Age and body weight of the child has to be recorded so that appropriate airway and resuscitation equipment be made available. Emergency medications namely atropine, epinephrine, hydrocortisone, flumazenil, naloxone etc., should be available.
Monitoring {#sec2-3}
----------
Standard non-invasive monitoring should be used in all patients, which includes ECG, BP, pulse oximetry, respiratory rate, and capnography. Sadhasivam *et al*.\[[@ref12]\] concluded that the BIS monitor is a quantitative, non-disruptive, and easy to use depth of sedation monitor in children more than one year.
Special considerations for infants and children {#sec2-4}
-----------------------------------------------
Most analgesics (including opioids and local anesthetics) are conjugated in the liver. Hepatic enzyme systems are not mature in newborns and premature infants. Glomerular filtration rates are diminished in neonates and reach adult levels by one year of age. Newborns have a higher percentage of body weight as water and less fat as compared with older patients. Water-soluble drugs, therefore, often have larger volumes of distribution. Neonates have reduced plasma concentrations of both albumin and alpha-1 acid glycoprotein than older children and adults. This may result in higher concentration of active drug leading to greater drug effect or drug toxicity.\[[@ref13]\] Application of eutectic mixture of local anesthetics (EMLA) before venous cannulation can be helpful in reducing pain.
Pharmacology of the drugs {#sec2-5}
-------------------------
The guiding principle for analgesic administration is the step ladder approach to pain. This is a three-step approach for selecting drugs according to their analgesic potency based on the child\'s pain level. The non-steroidal anti-inflammatory drugs (NSAIDS) are used for mild to moderate pain by themselves or in combination with other agents for moderate to severe pain. However, opioids are used for moderate to severe pain.
NSAIDS, though used extensively in older children and adults, are not preferred in neonates because of their increased risk of side-effects. Commonly used drugs are acetaminophen and ketorolac. These drugs have to be used along with sedative agents for procedures.
Acetaminophen is the most commonly used NSAID, particularly for mild pain. However, it has limited efficacy for mitigating procedural pain. It is available in oral, rectal, and intravenous (i.v) form. Acetaminophen is administered in dose of 35-45 mg/kg by rectal route. Repeated dosing is 20 mg/kg every 6 hours in infants and children and every 12 hours in newborns. Paracetamol i.v is administrated in a dose of 7.5 mg/kg up to 4 times a day, by infusion over 15 minutes in children weighing less than 10 kg. The minimum interval between each administration must be 4 hours, and the maximum daily dose must not exceed 30 mg/kg. For children weighing more than 10 kg (and less than 33 kg), 15 mg/kg, up to 4 times a day, with maximum daily dose not exceeding 60 mg/kg is recommended (without exceeding 2 g). It has been shown to be effective in treating post-operative pain.\[[@ref14][@ref15]\]
Ketorolac is available both as oral tablets (10 mg) or i.v injections (15 mg/ml and 30 mg/ml). It is efficacious as a sole analgesic for minor procedures. However, in acute renal failure,\[[@ref16]\] prolonged prothrombin time and hypersensitivity have been reported to occur with its usage. Dose of ketorolac is 0.5 mg/kg i.v, every 6 hours for less than 5 days.
### Opioids {#sec3-1}
With the advent of short-acting opioids, morphine is no longer preferred for short procedures. For procedural sedation, shorter acting opioids like fentanyl are preferable. A single intravenous dose of fentanyl 1-4 μg/kg has rapid onset (\<30 s) with a peak at 2-3 min and brief clinical duration (20-60 min). The initial i.v boluses of 0.5-2 μg/kg may be given over 2-5 min titrated to effect, followed by infusion of 0.2-2 μg/kg/h for maintenance of analgesia. As sedation does not occur at low doses (1-2 μg/kg), the concurrent administration of midazolam is required. The combination of fentanyl and midazolam is a safe and popular regimen for procedural sedation and analgesia in children.\[[@ref17]\] When given in concert, both should be given in reduced doses to minimize the chance of hemodynamic or respiratory compromise. The effectiveness of oral transmucosal preparation of fentanyl is variable, titration is difficult, and the incidence of emesis is as high as 31-45%\[[@ref18]\] Remifentanil is an ultra-short-acting opioid agent that has an onset of action of about 1 min and an elimination half-life of less than 10 min. It has been used successfully as a sedative agent in children.\[[@ref19][@ref20]\] It is given as an infusion of 0.05- 0.10 μg/kg/min in combination with midazolam. In case of invasive procedures, before cessation of the remifentanil infusion, a longer acting analgesic may be administered to ensure analgesia when the patient awakens from sedation.
### Benzodiazepines {#sec3-2}
By activating γ-aminobutyric acid, benzodiazepines produce sedation, anxiolysis, amnesia, and anticonvulsant effects.\[[@ref21]\] After administration, respiratory depression should be watched for. Time to peak effect for midazolam is brief with i.v administration (2-3 min) and duration is short (45-60 min). Midazolam can also be administered via the intramuscular, oral, intranasal, and rectal routes. The oral route can lead to unreliable concentrations in serum and clinical effect due to first pass hepatic metabolism. The intranasal route irritates the mucosa, which is painful and produces anxiety in the child. It does not have any analgesic properties and requires supplemental analgesia for painful procedures. Paradoxical reactions, characterized by inconsolable crying, disorientation, agitation, and restlessness, have been reported in children receiving midazolam, especially after rapid i.v injection.\[[@ref22]\] For upper gastrointestinal endoscopy or bronchoscopy, use of additional topical anesthetic is useful.
### Barbiturates {#sec3-3}
Pentobar | {
"pile_set_name": "PubMed Central"
} |
The interstitial lung disease clinical nurse specialist {#s2}
=======================================================
Interstitial lung diseases (ILDs) are associated with fibrotic changes in the interstitium of the lung \[[@C1]\]. Whilst some forms of ILD are short lived, many are irreversible. ILDs are associated with high morbidity and mortality, particularly idiopathic pulmonary fibrosis (IPF) an interstitial pneumonia of unknown cause.
Symptom management and palliative care are the hallmarks of ILD clinical nurse specialist (CNS) management. The key focus is on assessing and managing breathlessness, fatigue, cough and psychological distress. The plan of care requires frequent adjustment as the condition progresses, particularly after an exacerbation or "flare". Emphasis is on empowering patients to self-care in the context of their family.
Nurses are considered to be central to healthcare provision and highly valued by patients particularly in the ILD specialism \[[@C2]--[@C5]\]. The ILD CNS plays a key role in coordinating care and liaising with the multidisciplinary and interdisciplinary teams. In the UK, 90% of patients reported that an ILD specialist nurse was their main clinical contact for IPF healthcare \[[@C4]\]. The CNS provides expert knowledge and advice to patients, their families and carers, throughout all stages of their care \[[@C4], [@C5]\]. This includes lifestyle advice, access to and management of oxygen, and medication including management of adverse side-effects and signposting to patient support organisations. CNSs are often required to discuss complex test results, treatment options and other concerns that the patient and/or their family may raise. Given the complexity of ILD it is not surprising that patients express a need to have 3-monthly contact with their CNS \[[@C6]\]. Many patients also have comorbidities which require additional generic clinical knowledge.
The National Institute for Health and Care Excellence (NICE) published a quality statement in 2015 recommending that minimally "People with idiopathic pulmonary fibrosis have an ILD specialist nurse available to them" \[[@C7]\]. The rationale for this is that *"*An ILD specialist nurse can ensure that people with idiopathic pulmonary fibrosis, and their families and carers, receive all the information and support they need throughout the care pathway ... specialist nurses can sensitively discuss prognosis, disease severity and progression, and life expectancy*"* \[[@C7]\].
This quality standard is supported by the IPF NICE guidelines \[[@C8]\]. It requires commissioners (NHS England specialised services area teams) to ensure that commissioned services employ an ILD CNS as part of their multidisciplinary team.
However, there is some evidence of disparity in healthcare provision. A UK national patient survey of 122 patient and carer respondents from the British Lung Foundation reported that only 39% of patients have frequent contact with an ILD specialist nurse, 36% of patients say they have no access at all and only eight UK trusts routinely allocated patients a named ILD specialist nurse within 6 months of diagnosis \[[@C2]\].
These findings are supported by Action for Pulmonary Fibrosis \[[@C3]\] who further report that 60% of patients surveyed consider the ILD CNS as the best single point of contact for their care. More recently the British Lung Foundation have highlighted that "more specialist nurses with ILD training and expertise are still needed" \[[@C9]\].
Specialist centres are being developed across the UK and Europe creating a greater need for ILD CNSs. Given the limited number of experienced well-trained ILD CNS already established in practice and the lack of robust accredited training course, many nurses will most likely require "on the job" training in the short term. This compounds existing issues of standardisation of nursing roles that can inform clear pathways of professional development and advancement of careers.
Expansion of nursing practice {#s3}
=============================
In 2002 a UK government paper offered new opportunities to develop advanced and specialist nursing roles \[[@C10]\]. It promised greater freedom to innovate and make decisions about the services and care provided, for nurses to become effective leaders and to take on new roles and ways of working to deliver improvements for patients and communities. Autonomous practice was promoted, matching accountability with individual professional judgment. This was reinforced by the modernising nursing careers initiative received with enthusiasm by the nursing community \[[@C11]\].
Nursing roles have progressively expanded and diversified in the ensuing 15 years, partly in response to the increasing demands on healthcare services. The political drivers have remained consistent: to improve healthcare quality and efficiency in service delivery \[[@C12]\]. Changes to the training and roles of junior doctors have impacted on nursing, so that nursing roles may have developed to plug gaps in the healthcare system rather than advance nursing skills *per se*. CNS and advanced nurse practitioners (ANP) roles emerged but without standardisation in the UK and Europe, giving rise to confusion amongst professionals and patients \[[@C13]--[@C15]\]. ANPs were perceived as delivering a higher level of care at a strategic level whilst clinical specialists rated higher for continuity of care and carer \[[@C16]\].
Critical thinking, an ability to work strategically and continuity of care are prerequisites for the ILD CNS thereby incorporating elements of advanced practice implying that this is a hybrid role. There are some differences in the academic training of the CNS and ANP ([table 1](#TB1){ref-type="table"}) whilst both ANPs and many CNS practice autonomously in the UK. This raises two important questions: 1) how do we develop and support a specialist nursing team fit for the future?; 2) how do we deliver the standardised high-quality care that patients should expect?
######
Attributes of specialist nurse and advanced nurse practitioners
-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
**Specialist nursing practice** **Advanced nursing practice**
------------------------------------ ------------------------------------------- ------------------------------- ------------------------------------------------------ -----------------------------------
**Experience** Long-term clinical experience Long-term clinical experience
**Qualifications** Qualification in specialist field (BSc) MA/MSc MA/MSc Qualification in specialist field
**Role functions** Prescribing\ Diagnosing\ Autonomous practice\ Inter-professional working
Linking with other agencies/coordination\ Assessing\ Diagnosing/assessing/physical examination/admitting\
Research\ Leadership management\ Prescribing\
Quality improvement Teaching\ Leadership/management\
Education Staff development/supervision\
Research\
Quality improvement\
Promote evidence-based practice\
Teaching/education
**Additional nursing competences** Advanced communication skills Advanced communication skills Critical appraisal
-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Reproduced from \[17\].
UK case study {#s4}
=============
In the UK, agenda for change was introduced in 2004. Its aim was to harmonise pay scales and career progression for nurses and NHS staff, with the exception of doctors, dentists and some senior managers. The agenda for change system allocates the post to a set pay band based on the skills required for the job. The Knowledge and Skills Framework, a competency-based framework for job evaluation, is integral to the agenda for change system \[[@C18]\]. Staff are matched to a job profile and corresponding pay band \[[@C19]\]. It was perhaps perceived as a way to standardise practise and the plethora of professional titles that exist; however, this has not been the case. Whilst agenda for change is designed to evaluate the job irrespective of the individual's strengths, this approach to standardisation has given rise to depersonalisation. The rationale was commendable; to ensure equity between similar posts in different geographical areas. However, the depersonalising of roles risks the skill set of the individual not being appropriately rewarded. As an individual develops their scope of practice, financial remuneration may not keep pace and may negatively impact on staff morale.
Progression up the agenda for change scale will require a re-grading of the post which requires substantial change to the job description, including the role and responsibilities through detailed in-house assessment. This is because the structure is focussed on the position not the person. It does not reward the development of professional skill, clinical experience and increased level of responsibilities beyond the scope of the post. An individual's professional development beyond this scope would not be regarded as sufficient for re-grading that post. This can be perceived as a barrier to career progression for nurses, pharmacists and allied health professionals, and may also impact retention of staff.
Given the mortality, morbidity, co-morbidities and complexities associated with ILDs, nursing staff require a technical skill set in-keeping with Masters level (critical) thinking \[[@C20]\]. The ILD CNS role thus appears to be even more closely aligned with advanced level nursing practice.
An ILD CNS working to the principles of advanced practice should be commensurate with the band 7 grading on agenda for change. To progress to agenda for change band 8 Masters level study is essential ([table 1](#TB1){ref-type="table"}) with capacity for doctoral level study. However, informal clinical conversations suggest that lower pay bands (by implication lower skill levels) are often applied to respiratory CNS roles, particularly those without Master's qualifications.
In the UK some CNSs undertake additional training in non-medical prescribing. There are now drivers to ensure that undergraduate nurse training programmes prepare nurses for non-medical prescribing practice to embed these skills as usual practice.
All nursing posts in the UK have to fit within the Knowledge and Skills Framework while core standards for CNS and ANP roles are set by the Nursing and Midwifery | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
Most patients with acute pancreatitis (AP) present a mild course while 10%--20% of them develop severe disease with significant mortality \[[@B1]\]. Early prediction of disease severity of AP would be helpful for triaging patients to the appropriate level of care and intervention \[[@B2]\]. It was reported that clinical scoring systems such as Harmless Acute Pancreatitis Score (HAPS) and Bedside Index for Severity in Acute pancreatitis (BISAP) show moderate diagnostic accuracy in the prediction of SAP \[[@B3]\]. Simple, routine, and widespread individual laboratory parameters, such as Blood Urea Nitrogen (BUN) and serum creatinine (Scr), have been proposed as markers of disease severity \[[@B4]\]. However, to the best of our knowledge, information about serum creatinine at 24 hours after admission as a predictor of SAP in the literature is limited \[[@B5]\].
It was noticed that severe acute pancreatitis can alter serum lipid levels \[[@B6]\]. Recently, a small sample size (66 patients) study by Peng et al. \[[@B7]\] reported that low levels of High-Density Lipoprotein Cholesterol (HDL-C) are associated with high risk of persistent organ failure in AP. It should be stressed that only the patients hospitalized in Intensive Care Unit (ICU) were enrolled in the above study, thus limiting the possibility of applying their results to general ward and to community hospital.
On the other hand, these simple parameter variables demonstrate low sensitivity despite high negative predictive values for prediction of SAP \[[@B3]\]. It is hypothesized that combining several clinical parameters may improve predictive sensitivity \[[@B2]\].
Therefore, the primary aim of the study was to develop a multivariable model for prediction of SAP. The secondary one was to assess the ability of serum creatinine at 24 hours after admission and HDL-C as predictors of SAP in a large sample study.
2. Materials and Methods {#sec2}
========================
2.1. Patient Population, Data Collection, and Ethics {#sec2.1}
----------------------------------------------------
A total of 647 patients suffering from acute pancreatitis that attended First Affiliated Hospital of Wenzhou Medical University between January 2013 and December 2015 were enrolled in the study. Exclusion criteria included \[[@B2], [@B5]\] onset time \> 3 days, recurrent pancreatitis, organ failure before data collection, malignancy, previous pancreatic surgery, gestation, intoxication, endoscopic retrograde cholangiopancreatography (ERCP) or trauma-induced pancreatitis, chronic pancreatitis, AP in a moribund patient as a component of the terminal illness, and complete data being unavailable.
The following information was collected for each patient: age, gender, Body Mass Index (BMI), etiology, hematocrit, High-Density Lipoprotein Cholesterol (HDL-C) at admission. Blood Urea Nitrogen (BUN) and serum creatinine (Scr) were registered at the time of admission and 24 hrs after hospitalization.
This study protocol was approved by the Ethic Committee of the First Affiliated Hospital of Wenzhou Medical University and it was performed according to the principles expressed in the Declaration of Helsinki. Informed consent was obtained by the subjects.
2.2. Definitions and Outcomes {#sec2.2}
-----------------------------
The diagnosis of AP requires two of the following three features in the revised Atlanta criteria \[[@B5], [@B8]\]: (1) abdominal pain; (2) level of serum amylase or lipase at least three times greater than the upper limit of normal; and (3) characteristic findings of AP on abdominal image. According to these criteria, mild AP is defined as no organ failure or systemic or local complications, while moderate/severe AP as one or more transient organ failure or systemic or local complications \[[@B1]\]. SAP consists of persistent organ failure for more than 48 hrs \[[@B1], [@B8]\]. Organ failure was detected through the Marshall score ≥ 2 for at least one of the three organs involved (cardiovascular failure, respiratory failure, and renal failure) \[[@B9]\]. Biliary AP was defined when gallstones or biliary sludge were observed on abdominal image. Alcohol was considered to be an etiological factor when patients had a history of alcohol consumption within 48 hours before symptom onset \[[@B10]\]. In the absence of gallstones and history of alcohol use, a serum triglyceride was considered the etiology if \>1000 mg/dL \[[@B11]\]. The etiology was considered idiopathic if causative factors could not be identified after detailed clinical, laboratory, and imaging investigations.
The primary endpoint was to develop a logistic regression equation to predict severe acute pancreatitis. The secondary one was to assess the ability of serum creatinine at 24 hours after admission and validate HDL-C predictors of SAP at initial admission entering the hospital.
2.3. Statistical Analysis {#sec2.3}
-------------------------
A Shapiro-Wilk test was used to evaluate whether the continuous data showed a normal distribution. According to its results, continuous values were expressed by mean ± SD or median and Interquartile Range (IQR) and compared using one-way analysis of variance or the Kruskal-Wallis nonparametric test. Categorical values were described by count and proportions and compared by the *χ*^2^ test or Fisher\'s exact test.
Linear trend of categorical and continuous variables was tested by a Royston extension of the Cochran-Armitage test \[[@B12]\] and a nonparametric Wilcoxon rank sum test \[[@B13]\], respectively.
All the variables found to be different between patients with and without severe acute pancreatitis on univariate analysis were included as eligible factors in a forward-conditional stepwise logistic regression analysis. For this analysis, the conditional probabilities for stepwise entry and removal of a factor were 0.05 and 0.10, respectively \[[@B14]\]. Based on the results of multiple logistic regression analysis, a logistic regression equation model was developed to predict severe acute pancreatitis. Model calibration, reflecting the link between predicted and observed risk, was evaluated by plotting the predicted versus observed deciles of predicted risk and checked by Hosmer-Lemeshow goodness-of-fit test \[[@B15], [@B16]\]. Odds ratios (OR) were calculated, with 95% CI \[[@B17]\]. Multicollinearity was considered to be significant if the largest variance inflation factor exceeded 10 \[[@B2]\].
The area under the receiver operating characteristic (ROC) curve, that is, AUC, was used to evaluate the performance of predictions. A variable with an AUC above 0.7 was considered useful, while an AUC between 0.8 and 0.9 indicated excellent diagnostic accuracy \[[@B14]\]. The c-index, which is equivalent to the area under receiver operating characteristic curve, was also used to assess the predictive accuracy of the model \[[@B18]\]. Bootstrap resample technique with 1000 bootstrap replications, as a method of internal validation, was used to estimate an unbiased optimism-corrected estimate of c-index \[[@B19]\]. Optimism is estimated as the average of the difference in performance of the model in the bootstrap sample and original dataset \[[@B16]\].
As described by Maksimow et al. \[[@B20]\], the best cut-off point was detected where the number of false positives is the lowest as possible (specificity \> 90%) by selecting a threshold value at a point where the longest increase in the sensitivity of the slope declines, since ICU beds are limited. The sensitivity, specificity, negative predictive value (NPV), and positive predictive value (PPV) were calculated for corresponding cut-off values.
Differences were considered to be statistically significant if the two-tailed *p* value was less than 0.05.
3. Results {#sec3}
==========
3.1. Patient Characteristics {#sec3.1}
----------------------------
The median age of the 647 patients included in the study was 47 (IQR 37--63), of which 406 (62.8%) were male. Biliary disease was the most common cause of the AP (272/647, 42.0%). The median BISAP score at the time of hospital admission was 1. There were 491 (75.9%), 98 (15.2%), and 58 (8.9%) with mild, moderate/severe, and severe acute pancreatitis, respectively. Among the 58 patients who developed SAP, multiple organ failure was noted in 27 (46.6%) of them. Respiratory failure (84.5%) was the most frequent manifestation. The median length of the hospital stay was 10 days (IQR 7--14 days), with 15.5 days (IQR 10--28 days) for SAP patients. Ten patients (1.55%) died during hospitalization.
3.2. Univariable and Multivariable Analysis {#sec3.2}
-------------------------------------------
As shown in [Table 1](#tab1){ref-type="table"}, univariate analysis suggested that BMI, etiology, hematocrit, HDL-C at admission, and BUN and Scr at the time of admission and 24 hours after hospitalization were significantly associated with severe acute pancreatitis. A multivariate analysis was performed by a logistic regression for all these variables. HDL-C at admission (OR 0.95; 95% CI 0.92--0.97; *p* \< 0.001), BUN at 24 hours (OR 1.07; 95% CI 1.03--1.11; *p* = 0.001); and Scr at 24 hrs (OR 1.94; 95% CI 1.03--3.66; *p* = 0.039) were independently associated with severe acute pancreatitis.
3.3. Model Development, Calibration, and Bootstrap Validation {#sec3.3}
-------------------------------------------------------------
A logistic regression function*(LR model)* was developed aiming to predict severe acute | {
"pile_set_name": "PubMed Central"
} |
What's new?Current remote-monitoring technology in implantable devices enables the identification of patient-specific slopes of atrial electrical remodelling (AER) during atrial fibrillation (AF) progression.Time-to-completion of AER can be estimated using the computed patient-specific slope of atrial activation rate changes and the underlying cardiac condition.The results represent a step forward in monitoring the progression of AER, which may further assist physicians in the stratification and personalized care of patients with AF.
Introduction
============
Atrial fibrillation (AF) is currently considered a growing and inevitable worldwide epidemic with important economic and social burden.[@euz331-B1]^,^[@euz331-B2] Atrial fibrillation diagnosis is simple when using non-invasive surface electrocardiographic (ECG) recordings,[@euz331-B3] although can also be obtained from intracardiac atrial recordings in patients with implantable devices and atrial leads.[@euz331-B4] Characteristically, both surface and intracardiac AF tracings will show fast atrial activation rate (AAR) and irregular activity.[@euz331-B3]^,^[@euz331-B4]
Atrial fibrillation is often a progressive cardiac arrhythmia from short-lasting episodes to long-standing persistent episodes,[@euz331-B3] which increases the risk of hospitalization and adverse cardiovascular events.[@euz331-B5] Atrial fibrillation itself induces progressive functional and structural changes in the atrial myocardium that facilitate long-term perpetuation of the arrhythmia.[@euz331-B6] Concomitant genetic and cardiovascular conditions also establish an underlying substrate favouring AF initiation and perpetuation,[@euz331-B2] although they do not provide information about individualized progression of AF remodelling as the arrhythmia persists.
Initially, AF provokes ion channel changes leading to shortening of the action potential duration and progressively faster AAR until reaching a complete electrically remodelled state.[@euz331-B6]^,^[@euz331-B7] As AF evolves other mechanical and structural changes also progressively develop,[@euz331-B6] which further decrease the probability of achieving a successful rhythm control strategy.[@euz331-B8] Interestingly, in translational animal models of persistent AF, the time-course of atrial electrical remodelling (AER) has been shown to present distinct progression from animal to animal,[@euz331-B6] whose remodelling slopes are sensitive to the effect of pharmacological treatment.[@euz331-B7] Although monitoring AER may have diagnostic and therapeutic implications in the clinic, it has not been demonstrated that AER also follows patient-specific patterns.
We tested the hypothesis that AAR changes during AF progression show patient-specific patterns that can be estimated using clinical variables and remote-monitoring tracings from implantable devices. We aimed to study AARs and the time-course of AER progression using bipolar AF recordings obtained from two populations of patients with implantable cardioverter-defibrillator+/−resynchronization therapy (ICD/CRT-D) and pacemaker devices. We also aimed to study the effect of the underlying clinical conditions on the AER process of AF.
Methods
=======
Study design
------------
The ICD/CRT-D data were obtained from an observational multicentre registry from 51 Spanish centres included in the UMBRELLA study (NCT01561144 at clinicaltrials.gov). This database is supported by the scientific co-operation platform, which is a cloud-based big-data tool that enables automatic and non-invasive data transmission with digitally structured storage. The database consisted of 4618 patients undergoing a Medtronic (Tolochenaz, Switzerland) ICD/CRT-D implantation from August 2011 to November 2017. A total of 2074 patients with dual-chamber ICD/CRT-D devices and remote-monitoring transmissions were considered for the study. Pacemaker data were obtained from a retrospective observational study in two Spanish centres. All patients undergoing a dual-chamber Microport (Clamart, France) pacemaker implantation from December 2009 to December 2018 were considered for the study. Atrial leads were routinely implanted in the right atrial appendage. *Figure [1](#euz331-F1){ref-type="fig"}* shows the study flow chart.
{#euz331-F1}
We obtained ethics committee approval for both ICD/CRT-D and pacemaker series in accordance with the Helsinki Declaration. All patients signed an informed consent. In patients with ICD/CRT-D devices, clinical baseline and demographic data were retrospectively collected at the time of device implantation using the official data collection sheet from the Spanish Society of Cardiology (see also [Supplementary material online](#sup1){ref-type="supplementary-material"}). In cases with device replacement during follow-up, the baseline data were selected using the data collection that was closest to the initiation of AF history. In pacemaker patients, clinical data and pharmacological history were obtained from electronic medical records during the follow-up period. In these patients, left atrial (LA) diameter was also measured using transthoracic echocardiography and a parasternal long-axis view.
Data selection and rhythm classification
----------------------------------------
The UMBRELLA scientific committee initially reviewed and classified 27461 ICD/CRT-D stored episodes registered in a digital two-channel electrogram format. Three independent investigators used a custom-made Java-based software tool (Standard Edition 8, Oracle, Redwood, CA, USA) to further review and classify 31 672 tracings obtained from remote-monitoring transmissions. Stored pacemaker tracings obtained at the time of regular device interrogations were reviewed using the same software tool. Poor signal quality tracings were excluded from the study during the review process. Then, all AF tracings with a bipolar lead configuration (tip-ring; *Figure [2](#euz331-F2){ref-type="fig"}A*), overt irregular and fast activation rates \>3 Hz, and ≥3-s long recordings were included in the study. Manual selection of AF segments was performed in tracings with documented AF termination at the end of the tracing. Signal artefacts were manually excluded if necessary.
{#euz331-F2}
Selected AF tracings were further classified as paroxysmal or persistent AF based on the recorded episode duration. In pacemaker patients, further confirmation of AF classification was obtained from clinical records. Atrial fibrillation episodes lasting \<7 days were classified as paroxysmal AF and episodes lasting ≥7 days as persistent AF.[@euz331-B3] In ICD/CRT-D patients, AF tracings without episode duration were classified using subsequent recordings in a way that two or more consecutive remote transmissions documenting AF, at least 7 days apart, were considered as persistent AF.
Computation of atrial activation rates
--------------------------------------
Atrial signals from stored episodes (ICD/CRT-Ds and pacemakers) were obtained at 128 Hz and data from remote transmissions (ICD/CRT-Ds only) were obtained at 256 Hz. Signals were high-pass filtered with cut-off frequency of 0.5 Hz. The median duration of AF tracings per patient was 9.6 \[5.03, 10.00\] s in ICD/CRT-D devices and 14.6 \[10.6, 19.7\] s in pacemakers. Local right AAR was computed using spectral analysis and the fast Fourier transform to convert the tracing into the frequency domain as reported elsewhere.[@euz331-B6] Specifically, we used the non-parametric Welch method for power spectrum estimation with a median spectral resolution per patient of 0.10 \[0.06, 0.24\] Hz and 0.07 \[0.05, 0.09\] Hz in ICD/CRT-Ds and pacemakers, respectively. Spectral information below 10 Hz was normalized to the amplitude of the highest spectral peak within this band. The dominant frequency (DF) was defined as the frequency with the highest power within this band. The DF value for each AF tracing was reviewed to detect potential harmonic peaks, and if needed, it was manually corrected to the estimated average local AAR using a custom-made Java tool. Thus, the DF peak provided a robust and rapid calculation of the reciprocal average local activation intervals \[estimated average cycle length (ms) = \[(1/DF) × 1000\]; *Figure [2](#euz331-F2){ref-type="fig"}B--D*\].
Time-course analysis of atrial electrical remodelling
-----------------------------------------------------
The DF-derived AARs were ordered by date to depict any changes during the follow-up period (*Figure [2](#euz331-F2){ref-type="fig"}B*). Then, patients with progression of | {
"pile_set_name": "PubMed Central"
} |
All relevant data are within the paper and its Supporting Information files.
Introduction {#sec001}
============
Classification of *Croton* and uses in ethnomedicine {#sec002}
----------------------------------------------------
*Croton* (Euphorbiaceae) is one of the largest genera of flowering plants, with between 1,200 and 1,300 species. It is widespread in tropical areas, with habits ranging from large woody trees through climbing lianas to simple and prostrate weeds \[[@pone.0138888.ref001],[@pone.0138888.ref002]\]. In Southeast Asia and Thailand there are at least 80 species and 30 species of *Croton*, respectively \[[@pone.0138888.ref003]\]. The complex subgeneric taxonomy of *Croton* relies on a provisional revision of the sections of the genus from the early 1990s \[[@pone.0138888.ref001]\]. Several studies, based on both classical taxonomy and phylogenetic analyses, have demonstrated the complex taxonomy of the *Croton* genus (e.g. \[[@pone.0138888.ref001],[@pone.0138888.ref004]\]). An example of this complexity is highlighted by *C*. *acutifolius* Esser in Thailand. This species is superficially similar to *C*. *robustus* Kurz, *C*. *laccifer* L. and *C*. *caudatus* Geiseler which can however be distinguished by their fruit size, and *C*. *argyratus* Blume which is characterized by silvery pubescent mature leaves \[[@pone.0138888.ref003]\]. Additionally, *C*. *griffithii* Hook.f. has been confused with *C*. *oblongus* Burm.f. by several authors, as the two species show similarity in their indumentum and floral characters \[[@pone.0138888.ref003]\].
Many species of *Croton* are used in traditional herbal medicine around the world. In Asia, and Thailand in particular, there has been a resurgence of interest in traditional medicine, aided by government programs to promote research into medicinal plants as a potential source of new remedies. Among the most popular remedies are those based on *Croton* species. Many *Croton* species from this region have been used in traditional medicine and have had their biological activities assessed. These include *Croton caudatus* Geiseler, *Croton crassifolius* Geiseler, *C*. *kongensis* Gagnep., *C*. *oblongifolius* Roxb., *C*. *sublyratus* Kurz., *C*. *tiglium* L., and *C*. *tonkinensis* Gagnep. \[[@pone.0138888.ref005]--[@pone.0138888.ref010]\]. At the same time, it is widely known from scientific and folk literature that many species of *Croton* are toxic and cause irritation \[[@pone.0138888.ref011]\], and therefor the correct identification of the species is important to avoid negative health effects.
In Thailand, *C*. *stellatopilosus* H.Ohba, known locally as '*Plao Noi*', is a popular natural remedy used for stomach disorders. Commercial products containing '*Plao Noi*' are sold as tea bags, capsules, and in powder form in herbal markets and are claimed to have anti-ulcer, anti-cancer, and anti-inflammatory effects. However, confusion has arisen because the same vernacular name is used for a number of species. At least six *Croton* species, *C*. *columnaris* Airy Shaw, *C*. *delpyi* Gagnep., *C*. *longissimus* Airy Shaw, *C*. *kongensis* Gagnep., *C*. *stellatopilosus* and *C*. *thorelii* Gagnep., share the same Thai common name '*Plao Noi*' \[[@pone.0138888.ref003]\]. The different species vary in their secondary metabolite spectra, which results in variation in their potential efficacy and safety.
Identification of plant products in trade through DNA barcoding {#sec003}
---------------------------------------------------------------
Medicinal plant products are commonly sold in processed or modified forms such as powders, dried material, tablets, capsules and tea bags, making it almost impossible to accurately identify the constituent species using morphology \[[@pone.0138888.ref012],[@pone.0138888.ref013]\]. Incorrect identification of the constituent plants may lead to the inclusion of undesirable, unrelated species, with potential health risks to end users. Substitution of the product's ingredients either intentionally or inadvertently can have negative effects on both consumers and producers. Herbal products are often perceived to be safe due to their natural origin. However, counterfeited, substituted and adulterated products can put consumers in danger \[[@pone.0138888.ref014]--[@pone.0138888.ref016]\]. There is an urgent need to find an approach that could help with the quality control of these herbal products in order to ensure consumer safety and which can also produce reliable species identifications even when morphology-based identification is impossible.
Molecular identification through DNA barcoding is a powerful method for the identification of plant species, including medicinal plants and products. Many studies have shown the potential for DNA barcoding to effectively distinguish among medicinal plants, as well as to identify constituent species in processed herbal medicines \[[@pone.0138888.ref012],[@pone.0138888.ref017]--[@pone.0138888.ref020]\]. Several reviews have highlighted the increasing and diverse applications of medicinal plant barcoding \[[@pone.0138888.ref021]--[@pone.0138888.ref023]\]. However, DNA barcoding in plants does have limitations. These include the inability to amplify marker regions due to degraded DNA in some processed samples \[[@pone.0138888.ref024]\], limited binding site universality \[[@pone.0138888.ref012],[@pone.0138888.ref025],[@pone.0138888.ref026]\], low rates of marker discrimination \[[@pone.0138888.ref012],[@pone.0138888.ref027]\], overlapping intraspecific and infraspecific genetic variation in some groups of plants \[[@pone.0138888.ref028]\], and low applicability of chloroplast markers for the identification of species of hybrid origin \[[@pone.0138888.ref028]\]. Another limitation of DNA barcoding is the associated costs, as it requires a molecular laboratory, costly equipment, chemicals and disposables, and DNA sequencing facilities. The lack of access to DNA sequencing facilities and the high costs of sequencing often impedes the wider implementation of DNA barcoding in developing countries \[[@pone.0138888.ref029]\].
Bar-HRM for species discrimination {#sec004}
----------------------------------
Developing and validating sequencing-free methods that are reliable, yet faster and more economical than DNA barcoding is challenging, but will be beneficial for the advancement of herbal product identification routines in developing countries. High resolution melting (HRM) is an emerging method for monitoring DNA dissociation ("melting") kinetics, and is a powerful technique for the detection of point mutations, indels, and methylated DNA \[[@pone.0138888.ref030],[@pone.0138888.ref031]\]. In addition to standard PCR equipment and reagents, HRM requires a generic DNA intercalation fluorescent dye. This dye is added to previously amplified PCR products and as the double-stranded DNA samples dissociate with increasing temperature the dye is progressively released and fluorescence diminishes. These denaturation thermodynamics are based on the binding affinities of individual nucleotide pairs, which vary due to indels, mutations and methylations. These differences are inferred by fluorescent measurements collected at standard temperature increments, which are plotted as a melting curve. The curve's shape and peak are characteristic for each sample, allowing for comparison and discrimination among samples. By using HRM, single base changes between samples can be readily detected and identified \[[@pone.0138888.ref032],[@pone.0138888.ref033]\].
The first study reporting the use of Bar-HRM to evaluate herbal medicine substitution came from a recent investigation of species substitution among three medicinal species of Acanthaceae \[[@pone.0138888.ref029]\]. Bar-HRM has also been used in a number of comparable applications \[[@pone.0138888.ref034]\], such as for authentication of an EU Protected Designation of Origin product made from *Lathyrus clymenum* \[[@pone.0138888.ref035]\], for the identification of olive oil and adulterants \[[@pone.0138888.ref036]\], for subspecies cultivar identification in eggplants \[[@pone.0138888.ref037]\], for the identification of closely related species of *Sideritis* and *Helleborus* \[[@pone.0138888.ref038],[@pone.0138888.ref039]\], for species distinction in Mediterranean pines \[[@pone.0138888.ref040]\], for the detection of allergenic hazelnut contamination \[[@pone.0138888.ref041]\], and for the identification of processed bean crops \[[@pone.0138888.ref042]--[@pone.0138888.ref044]\].
Research questions and hypothesis {#sec005}
---------------------------------
The use of Bar-HRM has been reported for species identification and detection in food and herbal and agricultural products. However, all previous studies have looked at species discrimination in complexes of limited species diversity \[[@pone.0138888.ref029],[@pone.0138888.ref035]--[@pone.0138888.ref037],[@pone.0138888.ref040]--[@ | {
"pile_set_name": "PubMed Central"
} |
All relevant data are within the paper and its Supporting Information files.
Introduction {#sec001}
============
The formation of amyloid is one of key characteristics in many neurodegenerative diseases such as Alzheimer's, Parkinson's and Huntington's diseases. In these diseases, under particular conditions, structure of proteins undergo gradual conformational conversion to β-rich amyloid fibrils \[[@pone.0217801.ref001], [@pone.0217801.ref002]\]. Parkinson's disease is the second common neurodegenerative disorder after Alzheimer's which is characterized by filamentous α-synuclein within Lewy bodies followed by loss of dopaminergic neurons in the substantia nigra \[[@pone.0217801.ref003], [@pone.0217801.ref004]\]. α-synuclein (α-syn) is considered as an extremely heat-resistant, small acidic protein (14 kDa) which have little or no ordered secondary structure under physiological condition \[[@pone.0217801.ref005]--[@pone.0217801.ref008]\]. Its monomers at high concentration and under oxidative stress in the presence of metal ion are prone to form β-sheet-rich oligomer species and eventually stable fibrils. These proteinaceous deposits cause neurodegeneration and the onset of Parkinson symptoms \[[@pone.0217801.ref009]\]. So, inhibiting the amyloid fibril growth has been considered as one therapeutic approach for this disease \[[@pone.0217801.ref010]\]. Recent studies have identified that flavonoids which belong to a class of polyphenols have anti-amyloidogenic properties against protein misfolding and amyloid formation. Flavonoids are secondary metabolites of plants found abundantly in a variety of herbal extracts, fruits, vegetables and beverages \[[@pone.0217801.ref011]--[@pone.0217801.ref013]\]. Small molecules that are capable of binding to α-syn could probably inhibit fibrillation; therefore, using surface plasmon resonance (SPR) with the ability to study molecular interactions between a wide variety of label free molecules could be a useful technique to screen fibril formation inhibitors. To date, several methods such as TEM, Congo red binding, Thioflavin-T assay, light scattering and atomic force microscopy (AFM) have been used to study amyloid fibril formation \[[@pone.0217801.ref014]\]. In the current study, several herbal extracts (*Berberis*, *Quercus robur*, *Stigma maydis*, *Salix aegyptica*) were first chosen and their anti-fibrillation effect on α-syn aggregation were first investigated using conventional methods such as ThT assay, TEM and CD spectroscopy. Then their interaction with α-syn was evaluated using surface plasmon resonance (SPR). The results of this study could be helpful in designing a new and effective SPR based approach for screening anti-amyloidogenic compounds.
Materials & methods {#sec002}
===================
Materials {#sec003}
---------
All chemicals were purchased from Sigma--Aldrich Chemical (USA). The carboxymethyldextran (CMD 500 D) sensor chip, N-hydroxysuccinimide(NHS), N-ethyl-N-(3-diethylaminopropyl) carbodiimide (EDC), and ethanolamine hydrochloride were obtained from Xantec Bio-analytics (Germany). All the reagents used in this study were of analytical grade.
Expression and purification of α-syn {#sec004}
------------------------------------
α-syn was expressed in *E*.*coli* BL21 (DE3). The cells were cultured at 37°C and180 rpm in LB medium containing kanamycin (50 μg/mL). After reaching 0.5 at 600 nm (OD600), expression was induced with 1mM IPTG for 4 h. The cells were harvested, suspended in lysis buffer (40 mM Tris, 5 mM imidazole, 400 mM NaCl) and disrupted using sonication. Disrupted cells were removed by centrifugation (1800 xg, for 20 min at 4°C). To obtain purified protein, the supernatant was loaded on Ni-agarose column. α-syn was eluted at 100 mM imidazole. The purity of elution fractions was confirmed by %12 SDS-PAGE \[[@pone.0217801.ref015]\].
Herbal extraction {#sec005}
-----------------
Powdered seeds of *Berberis*, *Quercus robur*, *Stigma maydis* and *Salix aegyptica* were extracted in 2000 mL methanol/water (80:20,v/v) for 24 h at room temperature (25 ºC), followed by 2 h sonication in ultrasonic bath. Then the extracts were concentrated by rotary evaporator and kept in -20 ºC.
α-syn fibril formation {#sec006}
----------------------
Purified protein from previous stage was dialyzed by a 3-kDa dialysis membrane against 30 mM Tris and 200 mM NaCl buffer, pH 7.5. To gain a suitable concentration for fibrillation, protein was concentrated using centricon (MWCO 3kDa). Protein concentration was quantified using absorbance at 280 nm (ε = 5960 cm^-1^ M^-1^) \[[@pone.0217801.ref016]\]. Final concentration of α-syn was 2.2 mg/mL.
Fibril formation was carried out in a mixture (final volume of 525 μL) containing 500 μL of α-syn (2.2 mg/mL) in 50 mM Tris buffer (pH 7.5) and 200 mM NaCl at 37°C while stirred using micro stir-bars. To analyse the effect of extracts on α-syn fibrillation 25 μl of each extract (1 mg/mL) was added into 500 μL of protein solution and incubated under noted condition. Fibril formation was monitored with fluorescence using 10 μL of each sample at regular time intervals and mixed with 1000 μL of 25 μM ThT.
ThT assay {#sec007}
---------
A 1 mM aqueous solution of Thioflavin T was prepared in 25 mM phosphate buffer (pH 6) and filtered through 0.2 μm polyether sulfone filter. Subsequently, aliquots (10 μL) were taken out at regular time intervals from each incubated samples and mixed with 1000 μL of ThT (25 μM) to monitor fibril formation by ThT assay. The molar ratio of final protein concentration and ThT concentration was about 1 to 15.The samples were excited at 440 nm and the resulting ThT fluorescence spectra of samples were measured between 450--520 nm using LS55 PerkinElmer fluorescence spectrometer. The excitation and emission slit were both set to 5 nm. The plots of ThT fluorescence at 485 nm versus time were obtained. Percent changes in fluorescent intensity was calculated using [Eq 1](#pone.0217801.e001){ref-type="disp-formula"}.
{#pone.0217801.e001g}
\%
Fluorescence
intensity
(
FI
)
=
\[
F
e
−
F
s
\]
/
F
s
×
100
Fe and Fs were intensities obtained from α-syn fibrils formed in the presence and absence of extract, respectively. A reduction in the amyloid fibril formation was associated with a decrease in the emission intensity \[[@pone.0217801.ref016]\].
The percent inhibition was determined using changes in the intensity in the presence and absence of each extract ([Eq 2](#pone.0217801.e002){ref-type="disp-formula"}) \[[@pone.0217801.ref016]\].
{#pone.0217801.e002g}
(
\%
)
i
n
h
i
b
i
t
i
o
n
=
(
p
e
r
c
e
n
t
F
I
i
n
t
h
e
p
r
e
s
e
n
c
e
o
f
e
x
t
r
a
c
t
/
p
e
r
c
e
n
t
F
I
f
o
r
α
‐
s
y
n
a
l
o
n
e
)
×
100
‐
100
Transmission electron microscopy (TEM) {#sec008}
--------------------------------------
20 *μ*L drop of the sample was placed on a Carbon film coated on 300 mesh copper grid (Agar) for 2 min. Excess liquid was absorbed with filter paper then negatively stained with a 20 *μ*L drop of 2%
uranyl acetate for 1--2 min and excess liquid was absorbed with filter paper. The grid was allowed to dry and examined on a Zeiss EM10C transmission electron microscope operating at an accelerating voltage of 100 kV.
CD spectroscopy {#sec009}
---------------
Far UV spectra were conducted using a JASCO J-715 spectropolarimeter (Japan). The CD spectra were taken at protein concentration of 0.25 mg/mL in 30 mM Tris buffer (pH 7.5) containing 200 mM NaCl using 1 mm path length cell. All spectra were collected from 200 to 245 nm and were corrected by subtracting a blank spectrum. Noise in the data was | {
"pile_set_name": "PubMed Central"
} |
Background
==========
The Children with HIV Early Antiretroviral Therapy (CHER) study recently found that more infants randomized to deferring antiretroviral therapy (ART) until their CD4 fell below 25% died compared to those who started ART before the age of three months \[[@B1]\] but there is currently no randomized trial to guide when to start ART in children older than one year of age. Although, ART has significantly reduced HIV-related morbidity and mortality, it is associated with side effects, interference with daily activities and resistance \[[@B2]-[@B6]\]. Deferring the start of ART could possibly reduce these problems but the risk of HIV disease progression may increase. This randomized pilot study was conducted to explore the feasibility and HIV disease outcome of the immediate versus deferred ART strategy as a ground work for a larger study.
Recommendations of when to initiate ART differ between guidelines based on expert advice, published data of outcome in ART-untreated children and local resources \[[@B7],[@B8]\]. Regular CD4 monitoring allows for opportunity to start ART prior to clinical progression as CD4 is the most important determinant for both short and long term HIV disease progression and death risks \[[@B7]-[@B9]\]. All guidelines recommend ART in children with severe HIV-related clinical events. Infants have a more rapid HIV disease progression, in fact, the efficacy and safety of immediate versus deferred ART strategy in older children is not known. Currently, in children age one year and up, the World Health Organization (WHO) guidelines for resource-limited countries and the Thai Ministry of Public Health guidelines recommend starting ART when CD4 is in the severe immune deficiency range according to age groups: 12--59 months (\< 20%) and = \> 5 years (\< 15% or \< 200 cells/mm^3^) \[[@B10]-[@B12]\]. The United States Guidelines recommend to start ART when CD4 is \< 25% \[[@B13]\] while the Pediatric European Network for Treatment of AIDS recommend starting ART at CD4 \< 20% in children ages 1 to 3 years and CD4 \< 15% in older children \[[@B14]\].
We planned to enroll 43 children within one year and expected that many children would not be eligible as CD4 monitoring was not performed routinely and many children would have lower than required CD4. We also expected that more children would decline immediate ART as the Thai guidelines at that time recommended starting ART when CD4 was below 15%. Regarding the safety of the two treatment arms, we hypothesized that with close follow up and CD4 monitoring, ART can be deferred until CD4 \< 15% in children ages 1 to 12 years old with Center for Disease Control and Prevention (CDC) clinical class A or B and CD4 15--24% without affecting HIV disease progression.
Results
=======
Enrollment and retention rates
------------------------------
Between December 2001 and March 2003, 69 children were screened and 43 were enrolled at two sites (Figure [1](#F1){ref-type="fig"}). The recruitment began at the Bangkok site in December 2001, and in October 2002, the Khon Kaen site was included to increase recruitment. The overall recruitment rate was 4 children/month. The recruitment was more rapid towards the end of the study due to the inclusion of two sites. Twenty six (37.7%) failed screening due to the following reasons: 24 (92.3%) from CD4 \< 15% and 2 (7.7%) from CD4 \> 24% The children who were not eligible had a median age of 6.2 years (IQR 3.7 to 9.7) and median CD4 of 6.5% (IQR 3.3 -- 10.8). All children accepted the randomized arm; however, three in the immediate arm stopped ART (one due to family\'s preference after the child had a mild nevirapine rash and two due to physician\'s recommendation after ART adherence cannot be ensured), and one deferred arm child was lost to follow up after the parents refused for the child to begin ART when the CD4 fell below 15%. Another deferred arm child was lost to follow up for unknown reason. The study ended when the last child reached week 108 of follow up with a median follow up time of 134 weeks, IQR 123 to 154, all in the immediate arm and 17 of 19 in the deferred arm completed the study. The median time spent on ART was 124 weeks (IQR 112--134) in the immediate arm children and 99 weeks (IQR 85--107) in the deferred arm children who initiated ART.
{#F1}
Baseline characteristics
------------------------
For the children who were enrolled, baseline characteristics are shown in Table [1](#T1){ref-type="table"}. Forty-three children were randomized to immediate (n = 24) and deferred ART (n = 19). Overall, the median age was 4.8 years (IQR 2.7--6.6) with 17 males and 26 females. Most (84%) had CDC A clinical disease with a median CD4 of 19% (IQR 17--22) and CD4 count of 615 (541--824), and median viral load of 4.8 log~10~copies/ml (IQR 4.3--5.3). Ninety and 77% of children had weight and height respectively in the normal ranges according to growth charts for Thai children (-1.5 to +2 standard deviation).
######
Baseline characteristics
------------------------------------------------------------------------------------------------------------------------
Characteristics Study arms
---------------------------------------------------------------------------- --------------------- ---------------------
Arm 1: Immediate\ Arm2: Deferred\
(n = 24) (n = 19)
Gender \[M : F\], n (%) 10: 14 (42 : 58) 7: 12 (37 : 63)
Median age, years (IQR) 5.2 (2.4 -- 8.0) 4.4 (2.7 -- 5.8)
Age group, n (%)
○ 1 -- 4 yrs 12 (50) 10 (53)
○ 5 -- 12 yrs 12 (50) 9 (47)
Median weight for age z-scores (WAZ) (IQR) -1.0 (-1.5 to 0.4) -0.1 (-1.5 to 0.3)
Median height for age z-scores (WAZ) (IQR) -1.7 (-2.0 to -0.9) -0.8 (-1.7 to 0.1)
HIV transmission, n (%)
○ Blood product or transfusion recipient 2 (8) 0
○ Mother to child transmission 21 (88) 19 (100)
○ Unclear 1 (4)\* 0
Exposed to AZT as prophylaxis against vertical HIV transmission, n (%)\*\* 5/13 (39) 4/11 (37)
CDC categories, n (%)
○ A 20 (83) 16 (84)
○ B 4 (17) 3 (16)
Median percent CD4+ count, % (IQR) 19 (16 -- 22) 20 (17 -- 22)
Median CD4+ count, cells/mm^3^(IQR) 649 (509 -- 834) 615 (544 -- 818)
Median plasma viral load, log~10~copies/ml (IQR) 4.8 (4.3 -- 5.3) 4.8 (4.1 -- 5.1)
Median hemoglobin, g/dl (IQR) 10.8 (10.2 -- 11.7) 11.2 (10.6 -- 11.8)
Median alanine transferase, IU/L (IQR) 20 (11 -- 30) 17 (15 -- 23)
Median glucose (mg/dL) at week 48 83 (74 -- 90) 81.5 (70.5 -- 88)
Median cholesterol (mg/dL) at week 48 173 (153 -- 195) 165 (150 -- 186)
Median triglyceride (mg/dL) at week 48 69 (54 -- 88) 98 (70 -- 148)
------------------------------------------------------------------------------------------------------------------------
\*This child had no blood transfusion and his parents were not HIV-infected
\*\*Information available in 24 patients
**Note:**all characters and baseline data did not differ between the two arms except median triglyceride was higher in the deferred arm (p 0.016).
Initiation of ART in the deferred arm
-------------------------------------
Ten of 19 (53%) of deferred arm children started ART at a median time of 29 weeks (IQR 20 -- 79), and a median CD4% and count of 12% (IQR 11--13, range 6 to 14) and 274 cells/mm^3^(IQR 220 to 394, range 137 to 555). The lowest CD4 drop to 6 | {
"pile_set_name": "PubMed Central"
} |
The elderly population has been growing for many years and is estimated to increase even more worldwide because of an increasing life expectancy. Therefore, organizations such as the World Health Organization (WHO) and the European Union have been articulating strategies focusing on promoting health globally among the elderly (Organization for Economic Co-operation and Development, [@CIT0025]; Swedish National Institute of Public Health, [@CIT0032]). Aging may be a time of self-development and self-realization where health promotion and knowledge about healthy aging are needed. It is known that healthy lifestyle behaviors, leisure activities, and social networks enhance life expectancy (Rizzuto, Orsini, Qiu, Wang, & Fratiglioni, [@CIT0027]).
Being old is associated with health risks and even seniors themselves think that advanced age is equivalent to risk (Alftberg, [@CIT0001]; Lundin, [@CIT0020]). Even though seniors are highly heterogeneous, they are often regarded as a homogeneous group in the Western world today (Swedish Institute of Public Health, [@CIT0032]). One of the major health determinants identified among the elderly is injuries, and the second most prevalent cause of injury-related hospitalizations is falls (Doran et al., [@CIT0007]; Gyllensvärd, [@CIT0013]; Hartholt et al., [@CIT0014]). Falls and fall-related injuries are frequent among those living independently, in hospital settings, and in nursing and residential care (Gyllensvärd, [@CIT0013]; McLure, Turner, Peel, & Spinks, [@CIT0023]; Organization for Economic Co-operation and Development, 2007). Even if as many as 30--60% of community-dwelling elderly fall each year (Gyllensvärd, [@CIT0013]; McLure et al., [@CIT0023]; WHO, [@CIT0039]), a fall does not always lead to injuries that require health care, but it may be a threat to an individual\'s quality of life (Gyllensvärd, [@CIT0013]; Roe et al., [@CIT0028]). Deterioration in quality of life caused by accidental falls is estimated to cost almost twice as much as direct costs such as healthcare (Gyllensvärd, [@CIT0013]). Many elderly people consider falls an unavoidable and unpredictable result of the aging process and accept the constantly present risk of falling (Roe et al., [@CIT0028]; Yardley, Donovan-Hall, Francis, & Todd, [@CIT0041]). In an Australian interview study of 333 elderly living in the community, the majority perceived themselves as having a low risk of falls (Hill et al., [@CIT0015]).
According to the National Institute for Clinical Excellence (NICE, [@CIT0024]), visual impairment is one of the strongest predictive risk factors of falling, both as an independent factor and in combination with other factors. Increasing age is an independent predictor of visual impairment and ocular diseases (Gunnlaugsdottir, Arnarsson, & Jonasson, [@CIT0012]). A natural decline in visual ability occurs around the age of 65 years and is perceived as impaired accommodation and/or a decline in ability to adapt when illumination suddenly changes, often caused by opacities in the lens (Laitinen et al., [@CIT0019]; Rosenbloom & Morgan, [@CIT0029]; Whiteside, Wallhagen, & Pettengill, [@CIT0036]).
For efficient fall prevention, it is important to get the individual\'s perspective, since "top-down" approaches limit and restrict the lives of individuals (Yardley et al., [@CIT0041]). A major issue in fall prevention is psychological attitude barriers. The elderly may either perceive fall prevention advice as authoritarian and patronizing, or as common sense and therefore of no importance (Yardley et al., [@CIT0041]). Others consider themselves as non-fallers even if they actually have fallen several times. Other barriers are unfamiliarity with fall prevention if they have not experienced a fall or if they see a fall as a natural part of aging, as well as a social stigma targeting seniors as a vulnerable group (McInnes & Askie, [@CIT0022]; Roe et al., [@CIT0028]). Therefore, it is vital to get a deeper understanding of senior citizens' personal main concerns when resolving daily life activities influenced by reduced visual ability and risk of falling.
Purpose {#S0002}
=======
The purpose of this study was to generate a grounded theory to explain how seniors living independently in the community resolve issues influenced by visual impairment and risk of falling. The research question according to grounded theory was, *what is going on in the lives of the studied group of people?*
Methods {#S0003}
=======
We used classic grounded theory (CGT) methodology according to Glaser in this study (Glaser, [@CIT0008], [@CIT0009]). The aim of CGT is to generate conceptual theories answering the question *what is going on?* in a particular field of study. The goal is to unravel an ongoing core behavioral pattern of individuals trying to resolve a main concern. This pattern is eventually identified, named, and explained in a rich conceptual way (Glaser, [@CIT0009]). The CGT researcher should trust the data and the emergence of the main concern (Glaser, [@CIT0011]). The behavioral patterns are named and used in the development and write-up of a theoretical model emerging from the data by constantly and systematically comparing the data without any preconceptions (Glaser, [@CIT0009]).
The theory generation has four basic steps: sampling data, coding data, writing memos, and sorting memos (Glaser, [@CIT0008], [@CIT0009]). There is constant movement back and forth between the steps, and the characteristics of the steps may change depending on where the researcher stands in the theory-generating process.
Sample {#S0003-S20001}
------
Thirteen senior citizens living independently in the community and six visual instructors participated as data informants. The seniors were between 73 and 85 years of age, including seven women (75 to 85 years) and six men (73 to 84 years), and had participated in two previous studies of falling and visual impairment (Källstrand-Eriksson, Baigi, Buer & Hildingh, [@CIT0002]; Källstrand-Eriksson, [@CIT0003]). Two men and two women were living with their spouse, whereas nine were widows or widowers. Of the married couples, only one spouse in each couple was interviewed. Inclusion criteria were having a performance-based visual ability with mild vision loss or worse in best eye and/or visual field defects in the lower quadrants and having reported at least one fall according to data in the previous studies. Twenty-eight individuals met the inclusion criteria, and one participant at a time was randomly selected to be invited for an interview. First an invitation by letter was sent, followed by an invitation by telephone. All the seniors invited agreed to participate and were able to choose the venue for the interview.
The six visual instructors, five women and one man, came from the same county as the seniors and were invited by e-mail followed by a telephone call. Their job was to guide and support the visually impaired in the community, usually by visiting seniors in their homes. Since they meet a large number of visually impaired who also are at risk of falling because of the impairment, their knowledge about how seniors solve issues in daily life was considered valuable theoretical sampling. Their experience as visual instructors ranged between 6 months and 23 years.
Data collection {#S0003-S20002}
---------------
We collected interview and observation data during December 2009 and January 2013. Twelve of the interviews and observations with the seniors took place in their own homes on one occasion. We wrote detailed field notes and collected audio recordings of what the participants said; we observed how they moved in familiar surroundings, noticing lighting and furnishing.
The formal interviews with the seniors lasted between 30 to 90 min and started with the question, "How do you perceive your daily life in relation to your vision and risk of falling?" Thereafter the participants talked openly. If something appeared to be of importance, clarifying questions were asked.
After the formal interviews the participants were often relaxed and continued talking about their daily life. All participants agreed to our use of this informal conversation as data in addition to the formal interview data. Directly after each interview further field notes of observations and informal talk were recorded in field notes. We interviewed one man over the telephone since he was too tired to manage a visit.
We interviewed two visual instructors at their offices and four by telephone for between 30 and 120 min. The visual instructors were initially asked, "What is your experience of working with visually impaired elderly people?" If needed, supplementary questions (mainly pertaining to the core variable) were asked, such as, "Can you elaborate on that?", "Can you give me an example?", or "Can you tell me about a case?"
Generating the theory {#S0003-S20003}
---------------------
We performed open coding immediately after the first occasion of data collection, comparing incidents to other incidents and later concepts to incidents and concepts to concepts (Glaser, [@CIT0008], [@CIT0009]). This process finally led to the emergence of a tentative core category, after which we did selective coding of the data, analyzing incidents and concepts only related to the core. We wrote memos during the entire research process, starting with our first contact with the seniors by telephone. We eventually discovered the core category *self-preservation---*a concept that was enduring, had "grab" according to Glaser, and was connected to and explained most other concepts (Glaser, [@CIT0008], [@CIT0009]). Thereafter, we interviewed the visual instructors as a further theoretical sampling of data associated with self-preservation | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s0001}
============
The impact of visual impairment (VI) on the communication development in young children has been underestimated and undertreated (House & Davidson, [@CIT0022]; James & Stojanovik, [@CIT0023]). Underestimation and undertreatment may be because communication difficulties in children with VI are ascribed to intellectual disability and autism spectrum disorder (ASD; House & Davidson, [@CIT0022]) or multiple disabilities (Chen, [@CIT0008]) rather than VI. Another reason may be that speech-language therapists are not trained to treat this population as their main focus of training with regard to sensory impairment is on communication delay associated with hearing impairment (James & Stojanovik, [@CIT0023]).
Early research on children with VI focused more on general development (Carvill, [@CIT0006]; Davidson & Harrison, [@CIT0011]; Good, Jan, Burden, Skoczenski & Candy, [@CIT0018]; Prechtl, Cioni, Einspieler, Bos & Ferrari, [@CIT0030]) than on communication difficulties. Communication-related studies were predominantly descriptive and mostly relied on expert opinion (Chen, [@CIT0007]; Goldware & Silver, [@CIT0017]; Tedder, Warden & Sikka, [@CIT0033]), whereas the current trend in research is towards a high level of evidence. There is a need to review recent research to examine the strength of the evidence and to describe language and communication development in young children with VI.
Since the visual system is complex and the causes and effects of VI are numerous and intricate (Holte *et al.*, [@CIT0021]), children with VI form part of a heterogeneous population. Approximately 70% of children with VI present with multiple disabilities (Chen, [@CIT0008]), and there are more than 80 known genetic and chromosomal syndromes that may result in deafblindness (Holte *et al.*, [@CIT0021]). The Joint Commission on Infant Hearing therefore endorses the ophthalmological assessment of all infants with confirmed hearing loss (Blumsack, [@CIT0005]). Multiple disabilities affect clinical decision-making during assessment and diagnosis as the characteristics of disorders may mask or mimic each other (House & Davidson, [@CIT0022]). For example, the social communication difficulties of children with VI may be mislabelled as autistic tendencies (*ibid*). Information is needed to help identify and improve the understanding of language and communication characteristics in young children with isolated VI and those with VI as part of multiple disabilities.
VI may affect the play, motor, cognitive, social and communication skills of young children (Chen, [@CIT0008]) as typical development occurs through unrestricted interaction with the environment (Glass, [@CIT0016]; Owens, [@CIT0026]). Despite complexity and diversity within the population, children with VI are unified by a significant absence of visual experiences that shape development. Developmental difficulties of young children with VI and the nature of the development of the visual system suggest the need for intervention within the first 12 months of life (Davidson & Harrison, [@CIT0011]). Increased information about language and communication development in young children with VI may improve early identification of communication difficulties, assist in goal setting and draw attention to the need for early communication intervention for this population.
Children with VI, and especially those with additional impairments, may require direct language instruction in order to develop language skills (Chen, [@CIT0008]), highlighting the need to include speech-language therapists in the early intervention team for children with VI. Early intervention, as an evidence-based strategy (ASHA, [@CIT0003]; SASLHA, [@CIT0032]), is known to augment young children's development and promote better long-term functional outcomes for both the child and the family (Fazzi, Signorini, Bova, Ondei & Bianchi, [@CIT0013]). There is a need to review recent research to examine the strength of the evidence and to describe language and communication developmental characteristics in young children with VI. This will assist speech-language therapists to build a knowledge base for participation in early intervention for young children with VI and their families.
The research questions posed in this systematic review were twofold: What is the strength of recent research evidence regarding early language and communication development skills of children with VI, and what are the children's characteristics in these developmental areas?
Method {#s0002}
======
Study design {#s20003}
------------
A systematic review was conducted to answer the research questions posed. The PRISMA (Preferred Reporting Items for Systematic Reviews and Meta-Analyses) statement (Moher, Liberati, Tetzlaff & Altman, [@CIT0025]) was used to structure the systematic review. The PRISMA checklist helps ensure the transparent and complete reporting of systematic reviews (*ibid*). This research project received ethical clearance from the Research Committee of the Department of Speech-Language Pathology and Audiology, and the Research Ethics Committee of the Faculty of Humanities of the University of Pretoria.
Study inclusion criteria {#s20004}
------------------------
The inclusion criteria comprised of articles pertaining to communication, language and speech development and characteristics thereof in young children (birth to five years) with any form of VI. VI is defined as the loss of any aspect of vision that diminishes the ability to see. The International Classification of Diseases (ICD-10, Update and Revision 2006) identifies the following ranges of vision: normal (equal to or better than 20/70), moderate (20/70--20/200) and severe VI (20/200--20/400). Moderate and severe VI are grouped as low vision. Blindness is categorised over three ranges: blind (20/200--20/1200), blind with light perception and blind with no light perception (WHO, [@CIT0035]).
No limit was placed on the type of study selected. Based on relevance to the subject field, the following electronic databases were searched: MEDLINE, Scopus, PsycINFO and PubMed. Since the concepts communication, language and speech are used interchangeably in databases, these three concepts were coupled with development or characteristics in separate searches of each database. The main search phrases were 'communication development' and 'communication characteristics', for example, 'communication development in children with VI' and 'communication characteristics in children with VI'. These phrases were used in two respective searches in each of the four databases. For the related search phrases, 'language' and 'speech' replaced 'communication' as the main phrases. A total of 24 searches were conducted across four databases. This electronic search strategy, limited to 2003--2013, resulted in the retrieval of a total of 1661 articles from the initial search. An age limitation of birth to five years was then applied. The last search was run in November 2013.
Study selection {#s20005}
---------------
All the English language article titles were reviewed and duplicate articles were removed (162 articles remained). The abstracts of the selected articles were then reviewed. The remaining nine articles meeting the inclusion criteria and discussing communication development and/or characteristics thereof were selected (see [Figure 1](#F0001){ref-type="fig"}). The full articles were reviewed to identify the communication, speech and/or language development or characteristics of children (birth to five years) with VI. To avoid bias, consensus was reached between the three authors regarding the final inclusion of articles.
{#F0001}
Data collection process and data items {#s20006}
--------------------------------------
Data collection took place by studying each article and extracting information to form summaries of the articles, displayed as mind maps. In terms of data items, information was collected from each article on:
1. Characteristics such as title, authors, year of publication, country where study was conducted, participant age range and number, method, level of evidence and visual status of participants.
2. The developmental communication characteristics of participants detailed in the article, including communication, language and speech development.
As it is widely accepted in the field of speech-language therapy, the ASHA level of evidence rating scale (ASHA, 2004) was used to categorise the articles in the final selection according to the level of evidence. These ratings are discussed within the results section of this article.
Risk of bias in selected studies {#s20007}
--------------------------------
The criteria for the assessment of risk of bias were modified from the Cochrane Collaboration's tool for assessing risk of bias (Higgins, Altman & Sterne, [@CIT0019]). The following criteria were included: steps taken to avoid selection bias, blinding of participants, personnel or outcome assessors (when information about the study that might lead to bias in the results is concealed), the presence of control groups or tools, the involvement of more than one clinician in evaluations, inter-rater agreement and the use of validity, internal item consistency and/or reliability testing. None of the selected articles specifically described an assessment of risk of bias other than providing statements pertaining to possible bias. Decisions on the risk of bias were made by consensus between the authors.
Data analysis {#s20008}
-------------
Thematic analysis (De Vos, Strydom, Fouché & Delport, [@CIT0012]) was used to organise the information extracted from the selected studies and to synthesise results. Main themes were identified within the data and sub-themes were assigned from the study outcomes.
Results and discussion {#s0009}
======================
Study characteristics {#s20010}
---------------------
The characteristics of the nine selected articles are presented in [Table 1](#T0001){ref-type="table"}.
######
Summary of articles selected for review.
Title Authors, year and country where study was conducted Participant age range Number of | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION {#sec1-1}
============
With modernization and advances in motorized technology, the pattern and problems associated with trauma are also changing. The 'floating knee' is one such injury, the incidence of which appears to be increasing. It is described as an ipsilateral concurrent break in the femur and tibia. Most of the patients are in their third decade with a preponderance of males.\[[@ref1]\]
Road traffic accident (RTA) accounts for majority of the cases and this is followed by fall from height (FFH). The word floating knee was introduced for the first time by McBryde in 1965. This injury is defined as the simultaneous ipsilateral disruption of skeletal integrity above and below the knee, which is usually associated with high-energy impact and likely a part of polytrauma. Ipsilateral fractures of the femur and tibia in the adult, or floating knee injuries, are serious injuries with a high rate of complications. Besides being caused by high-energy trauma with extensive skeletal and soft tissue damage, they are also associated with potentially life-threatening injuries of the head, chest, and abdomen.\[[@ref2][@ref3]\]
Some other complications attributable to floating knee injuries include infection, excessive blood loss, fat embolism, malunion, delayed or nonunion, knee stiffness, prolonged hospitalization, and inability to bear weight.\[[@ref1][@ref2]\]
It requires an immense force to fracture two of the strongest bones in the body, hence it is not surprising that these injuries are associated with other injuries (bony and soft tissue).\[[@ref3]\]
Frequently, multiple produced fractures in the same extremity, will add new dimensions to their management. These fractures range can change from simple diaphyseal to complex articular types.
According to the classification by Letts and Vincent the types of fractures are as shown in [Figure 1](#F1){ref-type="fig"}.\[[@ref4]\]
{#F1}
Although the exact incidence of a floating knee is unknown, it is not a common injury. The largest series of reported patients in the literature was of 222 cases over a period of 11 years. These may also be associated with life-threatening injuries to the head, chest, or abdomen and a high incidence of fat embolism and their management is varied. Many of these fractures are open with associated vascular injuries.\[[@ref5]\]
The floating knee is a complex injury with more than just ipsilateral fractures of the femur and tibia. The prognostic indicators of the initial and final outcome in patients include injuries and the type of fracture (open, intraarticular, comminution).\[[@ref6]\]
Management of associated life-threatening injuries should take precedence over the orthopedic injury. The reported rate of associated injuries may be as high as 89%, highlighting the violence involved. In the largest series reported till date by Kao *et al*., 110 (26%) patients had head injury, 37 (8.8%) had pelvis fracture, and 230 (55%) had contralateral serious extremity injury. Surprisingly, the incidence of vascular injury is reportedly low. Paul *et al*. reported 6 (29%) vascular injuries in their series of 21 patients. This high rate was, however, not shared in larger studies. Kao *et al*. in fact, did not comment on vascular insult in their report on 419 patients.\[[@ref7][@ref8]\] Fraser *et al*. reported an incidence of 7% (22 out of 222 patients).\[[@ref9]\]
The purpose of this retrospective study was to review the long-term outcomes of treatments for floating knee injuries performed at our institutions, and also to calculate the distribution of fracture types, mechanism of injury, associated injuries, method and results of treatment within patients' age and sex groups.
MATERIALS AND METHODS {#sec1-2}
=====================
This retrospective descriptive study was conducted over a 5-year period (2006-2011) in two tertiary care teaching hospitals of Isfahan University of Medical Sciences (Kashani and Alzahra hospitals) after approval of the Hospitals Research and Ethics Committees in Isfahan, Iran.
In the medical record ward, throughout the 254,620 trauma files, 19,833 cases had lower limb long bone fractures and 238 cases of floating knee injuries were found (12 cases had bilateral floating knees), because there were no separate medical code for "floating knee," all the femoral or tibia fractures were selected, and after documenting "floating knee" cases: All of them invited in outpatient ward, repeating physical exam, antroposterior and lateral radiographies and in the presence of "knee problem," more laboratory tests (including: Stability tests, joint aspiration, computed tomography \[CT\] scan, magnetic resonance imaging \[MRI\], etc.) were requested. A total of 18 cases decayed during 6 months after injury with 21 floating knees found: (3 cases had bilateral floating knee), hence, 220 cases with 229 floating knees were followed for 5 years. The kinds of fractures were classified by "Letts and Vincent classification." Reviewing the patients' files, information such as age, sex, type of injury according to the applied classification, mechanism of injury, treatment methods, early complications during the first 3 months and late ones after 3 months postinjury, and cause of possible death were registered and then analyzed with SPSS "version 20" using chi-square and *t*-test as standard tests of significance (*P* \< 0.05 : Significant).
RESULTS {#sec1-3}
=======
Most of the patients were in the third decade age group (aged between 20 and 29 years) (44.5%). The injury was observed more in males (85.5%). The most common type of injury was (D) according to "the classification of Letts and Vincent" (38.9%) \[[Figure 2](#F2){ref-type="fig"}\].
{#F2}
This study shows that 17.3% of frequent mechanism of injury was car to pedestrian accident, 48.2% was car to motorcycles accident, 26.8% was car to car accident, 4.5% was motorcycles to pedestrian accident, and 3.2% was other causes.
As seen from [Figure 3](#F3){ref-type="fig"}, the most frequent associated injury was pelvic fractures with a frequency of 86.7% and then head trauma with a frequency of 61.8%.
{#F3}
Open reduction and internal fixation (ORIF) was the common type of treatment, which was used in 70% patients. Fixation with plate and screws were used for 79 (35.9%) patients and distal femoral nailing with proximal tibial nailing (through knee joint) was used for 75 (34.1%) patients. External fixation devices were used in 26 (11.8%) patients. Hybrid fixation (one fracture fixed with internal and the other with external fixation device) were used in 11 (5%) cases. Transient skin or skeletal traction and then casting were applied for 27 (12.3%) patients (most in children). Two (0.9%) patients needed amputation (one above and one below the knee).
As shown in [Table 1](#T1){ref-type="table"}, the most common early complication during 3 months after injury was knee hemarthrosis in 31 (14%) cases and the most common late complication was knee osteoarthritis in 30 (13.6%) cases after the first 3 months.
######
Frequency of early and late complications
The most common cause of death among the 18 decayed cases was circulatory disruption, followed by deep vein thrombosis (61.11%). (Hazard mortality ratio: 95% and *P* \< 0.001.)
This study showed that there was a significant relation between the age and the outcomes as it worsens with age (*P*-value \< 0.05).
DISCUSSION {#sec1-4}
==========
An expanding population, increasing number of motor vehicles on limited infrastructure of most cities in developing countries, various modes of treatment and their effectiveness made floating knee injury a target of concern from both medical and socio-economic standpoints. Men aged 21-30 years were most commonly involved in RTAs, as they are less risk-averse in their driving habits. Male preponderance, a younger age group, and high-energy RTAs leading to this injury have been observed.\[[@ref10]\]
In a study by Rethnam *et al*., 29 patients with floating knee injuries were managed over a 3 year period. The mechanism of injury was RTA in 27 patients. There were 38 associated injuries. Twenty patients had intramedullary (IM) nailing for both fractures. The complications were knee stiffness, foot drop, delayed union of tibia, and superficial infection. The mean age of the study group was 28 years (18-56). The right side was involved in 19 and left side in 10 patients. There were 20 Type 1, 3 Type 2A, and 6 Type 2B floating knee injuries according to the Fraser classification.\[[@ref11]\] Results of this study showed that the frequency of injured men was higher than in females and the most common cause of injury was vehicle accidents. It was also shown that almost half of the patients were in the age group of 20-29 years.
Dwyer showed that the middle third of the shaft of both femur and tibia was most commonly (75%) involved, as in other reports. Concomitant injuries | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION
============
Transfer RNA (tRNA) is an essential molecule used in protein biosynthesis by all living organisms. Maturation of tRNA involves many ribonucleases to correctly process the precursor tRNA into a functional form. In most Eukaryotes, precursor tRNAs are often interrupted by a short intron inserted strictly between the first and second nucleotide downstream of the anticodon known as canonical position (37/38), while in Archaea, tRNA introns are also located at various non-canonical positions, with one to a maximum of three in a single tRNA gene ([@gkr692-B1],[@gkr692-B2]). Excision of tRNA introns is performed by an enzyme known as tRNA splicing endonuclease, which is evolutionarily conserved throughout Archaea and Eukaryotes ([@gkr692-B3]). Currently, a single type of eukaryotic splicing endonuclease comprised of four subunits (αβγδ) is known ([@gkr692-B4]), in contrast three types of endonucleases with different architecture; homotetrameric α~4~, homodimeric α~2~ and heterotetrameric (αβ)~2~ have been identified in Archaea ([@gkr692-B5]).
Despite the common evolutionary origin of the eukaryotic α- and β-subunits (SEN2 and SEN34) and archaeal endonucleases ([@gkr692-B6]), the recognition of exon--intron boundaries is somewhat different between the two domains. The eukaryotic endonuclease uses a 'ruler system' to locate the canonical position by measuring five base pairs from the mature domain of pre-tRNA ([@gkr692-B7]). The archaeal endonuclease recognize a pseudosymmetric RNA secondary structure known as bulge--helix--bulge (BHB) motif formed at the exon--intron boundary ([@gkr692-B8]). The substrate specificity of archaeal endonucleases generally depends on their architecture. The α~4~ and α~2~ type requires strict 3-4-3 nt hBHBh′ motif, whereas the (αβ)~2~ endonucleases recognize broader substrates with relaxed BHB motifs with various bulge lengths (1--4 nt) or even lacking either upper or the lower bulge (HBh′/hBH) ([@gkr692-B9]). Archaea possessing (αβ)~2~ endonucleases encode many disrupted tRNA genes with introns located at non-canonical positions, tRNAs that are separated into two or three pieces known as split/tri-split tRNA and even permuted tRNA where 3′ half is encoded upstream of the 5′ half ([@gkr692-B10],[@gkr692-B11],[@gkr692-B12]). In many cases, these tRNAs form a relaxed HBh′/hBH motif at the splice junction. Hence, the correlation between the tRNA gene variation and the architecture of splicing endonucleases further suggest an underlying coevolutionary scenario of the two molecules ([@gkr692-B13],[@gkr692-B14]).
Recently, five groups of uncultured Archaea referred to as ARMAN (Archaeal Richmond Mine Acidophilic Nanoorganisms) were discovered in an acid mine drainage (AMD) site at Iron Mountain in northern California, USA ([@gkr692-B15]). Phylogeny of 16S rRNA genes of the ARMAN revealed that they belong to phyla only represented by uncultured cloned sequences. They are common to acidic environments throughout the world. The near-complete genomes (each ∼1 Mb) of three ARMAN lineages, formally named *Candidatus* Micrarchaeum acidiphilum ARMAN-2, *Candidatus* Parvarchaeum acidiphilum ARMAN-4, and *Candidatus* Paravarchaeum acidophilus ARMAN-5, were reconstructed from shotgun genomic sequence from DNA extracted from AMD biofilms ([@gkr692-B15]). The genomes have characteristics similar to those seen in host-associated microbes and other deeply branched Archaea. Surprisingly, they were found to occasionally be physically connected to *Thermoplasmatales* Archaea in the community. Phylogenetic analyses of rRNA genes and several conserved proteins suggest that the ARMAN lineages share a common ancestor with the Euryarchaeota, but are very deeply branched in that group. However, many genes were found to have homologies to other groups, including Crenarchaeota. tRNA genes were predicted in all three ARMAN genomes, however some tRNAs were not identified.
Since it has been shown that the sequence diversity of the cryptic tRNA can make it impossible to locate these genes using common search tools ([@gkr692-B16]), we employed more sophisticated search strategies to identify tRNA genes that were missing. ARMAN-2 and ARMAN-4/5 possess different types of tRNA as well as tRNA splicing endonucleases. We identified a putative homodimeric endonuclease consisting of three units in ARMAN-2 and its close relative ARMAN-1, and demonstrate its ability to excise both strict and relaxed BHB motif in a way similar to (αβ)~2~ endonuclease. This reveals a new aspect of the coevolutionary history of tRNA gene architecture and its splicing enzyme in the domain Archaea.
MATERIALS AND METHODS
=====================
Prediction of tRNA genes in ARMAN lineages
------------------------------------------
tRNA genes are predicted by scanning the genomic fragments of ARMAN-2, 4 and 5 by using tRNAscan-SE ([@gkr692-B17]) and ARAGORN ([@gkr692-B18]) with a default parameter and SPLITS ([@gkr692-B19]) with a given parameter: --p 0.55, --f 0, --h 3. Missing ARMAN tRNA genes were further explored and identified through nucleotide BLAST search using the exon sequences of synonymous tRNA as a query.
Phylogenetic analysis
---------------------
Amino acid sequences of the tRNA splicing endonuclease from four ARMAN lineages with NCBI Protein ID: JF433956 (ARMAN-1), EET89679 (ARMAN-2), EEZ93328 (ARMAN-4) and EFD92272 (ARMAN-5), are aligned with the seed sequence alignment data of 51 archaeal tRNA splicing endonuclease C-terminal domains (Pfam family: PF01974) collected from 36 archaeal species registered in the Pfam database ([@gkr692-B20]). The phylogenetic tree was generated based on Bayesian credibility analysis using Mrbayes ver. 3.1.2 ([@gkr692-B21]). Posterior probabilities of trees were calculated by Bayesian Markov chain Monte Carlo (MCMC) simulation using the JTT model with approximation to a gamma distribution. Simulation was continued until the average standard deviation of split frequencies (ASDSF) was \<0.01. The tree was visualized by iToL ([@gkr692-B22]).
Cloning, expression and purification of the WT ARMAN-2 endonuclease
-------------------------------------------------------------------
PCR amplification of the ARMAN-2 tRNA splicing endonuclease gene (UNLARM2_0797) was carried out using KOD FX enzyme (TOYOBO Biochemicals, Japan) against DNA extracted from an acid mine drainage biofilm. PCR was performed for 32 cycles at 98°C (10 s), 50°C (30 s) and 68°C (1 min) with a specific primer containing NdeI and XhoI recognition sites. The PCR product was further purified by using illustra GFX™ PCR DNA and Gel Band Purification Kit (GE Healthcare, Buckinghamshire, UK) and subcloned into the pET-23b vector (Novagen, Madison, WI, USA) after NdeI/XhoI digestion. The resulting vector encoded a full-length tRNA splicing endonuclease with a six-histidine tag at its C-terminal end. The inserted nucleotide sequence was determined using a ABI3100 DNA Sequencer (Applied Biosystems, Foster city, CA, USA). The primer sequences used in the PCR and sequencing analysis are summarized in [Supplementary Table S1](http://nar.oxfordjournals.org/cgi/content/full/gkr692/DC1). For recombinant protein production, the plasmid was first transformed into *Escherichia coli* strain HMS174(DE3)pLysS. Five colonies were then pre-cultured in Luria--Bertani (LB) medium containing 50 µg/ml ampicillin and 50 µg/ml chroramphenicol at 30°C for 4 h and supplemented with 0.4 mM isopropylthio-β-galactoside (IPTG). After 14 h of culture at 30°C, the cells were recovered by centrifugation (8000 rpm for 5 min at 4°C), and the recombinant protein extracted by sonication (0.5 min) in 1× phosphate buffered saline (PBS) with 10 mM imidazole. The extract was heat-treated at 50°C for 15 min to partially denature the endogenous *E. coli* proteins and then centrifuged at 14 000 rpm for 10 min at 4°C to remove debris. The recombinant ARMAN-2 tRNA splicing endonuclease was purified using a PROTEUS IMAC protein purification kit (Pro-Chem, Littleton, MA, USA). The eluted protein solution was pooled and gel filtrated using a HiTrap column (GE Healthcare) with buffer A that contained 50 mM Tris·HCl (pH 8.0), 1 mM EDTA, 0.02% Tween 20, 7 mM 2-mercaptoethanol and 10% glycerol to remove | {
"pile_set_name": "PubMed Central"
} |
Introduction {#S1}
============
Crustaceans face a range of variable environmental stressors during their complex life cycle. Temperature and salinity are commonly considered as the most important abiotic factors for the survival, growth, and reproduction of crustaceans ([@B80]; [@B51]). However, ongoing ocean acidification (OA) may entail a new challenge for them. According to [@B60], the OA is a consequence of the absorption by oceans of atmospheric carbon dioxide (CO~2~) due to anthropogenic activities such as cement production and fossil fuels utilization. A substantial rise in oceanic CO~2~ partial pressure (*p*CO~2~) has already led to a reduction of 0.1 units in the current pH of surface seawater compared to preindustrial levels. It is predicted that by 2100, there will be a further decrease of 0.3--0.5 pH units ([@B1]; [@B44]).
The impacts of OA are raising increasing concerns with regard to crustaceans because of the sensitivity of calcifying animals ([@B22]). Among them, crabs present species-specific responses to OA, such as different impacts on calcification ([@B71]; [@B34]; [@B74]), and survival was shown to be reduced in crabs following a longer term exposure (months) to OA, although shorter term exposure (less than 1 month) did not have any apparent effects ([@B4]; [@B34]; [@B52]; [@B53]). In addition, OA can also induce negative effects on crab fertilization, embryonic development, and behavior ([@B8], [@B7]; [@B4]; [@B35]; [@B11]).
In general, such morphological and behavioral changes in crabs are associated with physiological changes. When exposed to OA, crabs sense the decreasing extracellular pH in tissues caused by OA ([@B75]; [@B45]). There is evidence that efficient acid--base, metabolic, and ionic regulation contributes to the compensation of extracellular pH changes, as shown in the velvet swimming crab, *Necora puber* ([@B68]; [@B66]), the dungeness crab, *Metacarcinus magister* ([@B19]), and the shore crab, *Carcinus maenas* ([@B39]). However, such osmoregulatory changes result in a rising energy cost and the reallocation of energy thereby compromises growth and behavior ([@B1]; [@B11]; [@B52]). Extracellular anisosmotic regulation and intracellular isosmotic regulation have been observed in crustaceans in response to environmental osmolality changes ([@B52]). However, OA has a depressing effect on oxygen consumption, which subsequently affects ATP production ([@B50]; [@B3]; [@B39]). The activity of energy-dependent osmoregulating enzymes such as Na^+^/K^+^-ATPase and V-type ATPase therefore decreases under acidified conditions ([@B76]; [@B26]). In this case, free amino acids are probably used as osmotic effectors. In addition, lactate has been shown to vary in spider crabs, *Hyas araneus*, exposed to elevated *p*CO~2~ ([@B83]). Overall, the underlying metabolic effects of OA have not been thoroughly evaluated in crabs.
The swimming crab, *Portunus trituberculatus* (Crustacea, Decapoda, Brachyura), is a widely cultured and consumed species in China with a yield of 617,540 tons in 2017 ([@B5]). Our previous studies have shown that elevated *p*CO~2~ (750 and 1500 μatm) has significant effects on the carapace of juvenile swimming crabs (e.g., a simplified arrangement of spinules, a reduced thickness, and an increased chitin content) ([@B56]) and their behavior (e.g., an increase in shoal average speed, a preference for dark environments and fast exploration) ([@B55]). Furthermore, previous studies have reported that OA can induce oxidative stress ([@B72]; [@B41]) and suppress immunity ([@B24]) in other crustaceans. Therefore, a holistic study is needed to advance our understanding of how OA exposure affects the swimming crab.
In this study, we subjected swimming crabs to increasing CO~2~ levels for 4 weeks to simulate OA. Our aim was to extensively explore the effects of OA exposure on the survival, growth, digestion, antioxidant capacity, immune function, tissue metabolites, and gut bacteria of swimming crabs as well as on seawater bacteria using biochemical assays, real-time quantitative polymerase chain reaction (RT-qPCR), 16S rRNA gene sequencing, and nuclear magnetic resonance (NMR)-based metabolomics analysis. This study provides new evidence that OA has a positive effect on the survival but a negative effect on the growth of swimming crabs through changes in crab digestion, antioxidant capacity, immune function, gut bacteria, and metabolites and the modulation of the seawater bacteria.
Materials and Methods {#S2}
=====================
Crabs and OA Exposure {#S2.SS1}
---------------------
Four hundred and twenty male juvenile stage VII swimming crabs (93.3 ± 10.0 mm carapace length \[CL\]) were purchased from a local aquaculture farm in Fenghua, Ningbo in Eastern China in late July 2018. Each crab was kept in a plastic box (210 × 170 × 80 mm) with small holes. These crabs were cultured in three tanks (1.5 × 1.2 × 0.6 m) containing 500 L of aerated and filtered local seawater per tank at ambient salinity (27.0 ± 0.4%) for a 1-week acclimatization. To avoid heat stress to the crabs, a chiller (Guangli Cooling Equipment Company, Guangzhou, China) was used to maintain the seawater temperature at 28°C via the heat exchange between seawater and tap water. The crabs were fed with fresh clams (*Ruditapes philippinarum*) once daily between 5:00 and 6:00 p.m., and waste food was removed before feeding.
Three experimental OA groups were designed with seawater *p*CO~2~ at current or predicted future levels: the ambient *p*CO~2~ was 380 μatm (designated the 380 group), 750 μatm (designated the 750 group) was used to represent the scenario at the end of this century and 1500 μatm (designated the 1500 group) was used to represent the scenario in c. 2200 ([@B57]; [@B16]). To build the experimental systems, a simulated ocean acidification system (CN: ZL201520071087.1) ([@B55]) and an incubation system that was partially derived from the experimental system of [@B73] were used. For each group, the incubation system per group consisted of a mixing tank (500 L) and three individual culture tanks (300 L), and seawater was recirculated and purified by using a water purification header tank connected to the culture tanks (200 L). The CO~2~ gas was first mixed with air in the mixing tank using a gas flow adjustment system (AK Biotechnology Co., Ltd., Qingdao, Shandong, China), followed by bubbling into seawater via a nano-aeration pipe. Both the mixing tank and the header tank were continuously bubbled with the respective and stable air--CO~2~ mixture. Each incubation system was stocked with 130 crabs with strong vitality and intact limbs with 43 crabs for two of the culture tanks and 44 crabs for the third culture tank. The flowing CO~2~ was adjusted to maintain the designed *p*CO~2~ level, and this gradually changed the pH from to the required level within 12 h. Three seawater inputs with different *p*CO~2~ levels for the three incubation systems were obtained: 380 μatm (pH = 8.1) for the control group, 750 μatm (pH = 7.9), and 1500 μatm (pH = 7.6) ([Figures 1A,B](#F1){ref-type="fig"}). The *p*CO~2~ levels were read daily from the gas flow adjustment system. Measurements of free CO~2~ concentrations in the seawater were determined daily by a base titration method following the protocol outlined in the Water Quality Analytical Methods (SL80-1994). The swimming crabs were checked daily for death or molting. The dead crabs and exuviae were removed from the tanks. Partial water exchange (25%) was performed every 2 days in each culture tank.
{#F1}
Water Quality, Sample Collection, Growth Performance, and Survival Rate {#S2.SS2}
-----------------------------------------------------------------------
Water temperature, dissolved oxygen (DO), pH, and salinity were measured daily by using a handheld multiparameter water quality analyzer (YSI, Yellow Springs, OH, United States). The planktonic microbial biomass in the water was collected once a week during the experiment. For each group, approximately 500 mL of water sampled from the three culture tanks was filtered through a sterilized 100-μm pore nylon net, followed by a 0.22-μm pore polycarbonate filter (MilliporeSigma, Burlington, MA, United States). The filters were stored in sterilized tubes, immediately snap-frozen in liquid nitrogen, and stored at −80°C until further analysis. For each group, 20 crabs were randomly collected (6--7 crabs | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s01}
============
To reach the cell surface, secreted proteins are transported along intracellular routes from the endoplasmic reticulum (ER) through the Golgi complex. Cargos exit the Golgi complex in transport carriers that use microtubules to be addressed rapidly to the plasma membrane before exocytosis. Transmembrane proteins are then exposed at the plasma membrane while soluble cargos are released in the extracellular space. Whether delivery of cargos occurs randomly or at specific sites of the plasma membrane is still unclear, and the mechanisms that direct exocytosis are still unknown. Microtubules were described to be captured and stabilized by focal adhesions ([@bib22]). Their targeting to focal adhesions is driven by microtubule plus-end tracking proteins, such as adenomatous polyposis coli, end-binding protein, and cytoplasmic linker-associated protein (CLASP), which ensure their physical contacts ([@bib24]; [@bib1]; [@bib23]; [@bib37]). Additionally, microtubules are linked to the actin network, which is a structural component of focal adhesions (FAs; [@bib32]). Notably, microtubules are involved in the regulation of the distribution and dynamics of adhesion sites ([@bib35]; [@bib36]; [@bib12]).
CLASPs interact at the plasma membrane with a protein complex made of LL5β, a phosphatidylinositol 3-phosphate--binding protein, and ELKS (also named ERC1 for ELKS/Rab6-interacting/CAST family member 1; also known as RAB6IP2). ELKS is an effector of the Golgi-associated Ras-related protein 6 (RAB6) GTPase ([@bib30]), which regulates several anterograde and retrograde trafficking pathways to and from the Golgi complex, as well as Golgi homeostasis ([@bib14]; [@bib41]; [@bib26]; [@bib15]). In particular, RAB6 was shown to be involved in the targeting of post-Golgi vesicles containing the secretory markers vesicular stomatitis virus glycoprotein (VSV-G; a type I transmembrane protein), and neuropeptide Y (NPY; a soluble protein) to ELKS-enriched regions of the plasma membrane ([@bib28]; [@bib16]). RAB6 has been also shown to regulate the secretion of TNFα in macrophages ([@bib27]) and the trafficking of herpes simplex virus 1 ([@bib20]). Herpes virus particles were shown to be associated with the RAB6 machinery in infected cells, and their exocytosis was observed to occur in close proximity to LL5β patches ([@bib19]). However, thus far, no systematic study has been performed to characterize the cargos present in RAB6-positive vesicles.
The aim of this study was to investigate the spatial organization of post-Golgi trafficking of a variety of anterograde cargos in nonpolarized cells. To this end, we combined the retention using selective hooks (RUSH) assay ([@bib5]) to synchronize anterograde transport of cargos and a selective protein immobilization (SPI) assay to map precisely the sites of arrival of the cargos at the plasma membrane. We show that cargos are transported along microtubules to hotspots of secretion, which are juxtaposed to FAs. Moreover, we found that RAB6-dependent post-Golgi machinery plays a key role in this process and that RAB6 could be a general regulator of post-Golgi secretion.
Results {#s02}
=======
Exocytosis takes place in restricted areas, close to the adhesion sites {#s03}
-----------------------------------------------------------------------
Secretion of newly synthesized proteins along the secretory pathway occurs continuously in cells. The RUSH system offers the possibility to synchronize the intracellular transport of cargos fused to the streptavidin-binding peptide (SBP) upon addition of biotin in the culture medium ([@bib5]). With this system, it is possible to monitor a wave of secretion of a selected cargo and analyze its transport to the cell surface. Using the RUSH assay, we studied the synchronous secretion of diverse cargos: collagen type X (ColX), VSV-G, secretory soluble EGFP (ssEGFP), gp135 (podocalyxin), the glycosylphosphatidylinositol-anchored proteins (GPI-APs) cluster of differentiation 59 (CD59) and placenta alkaline phosphatase (PLAP), and TNFα. [Fig. 1 A](#fig1){ref-type="fig"} illustrates RUSH-based transport monitoring using ColX as a cargo. As expected, before biotin addition, ColX was retained in the ER ([Fig. 1 A](#fig1){ref-type="fig"}, 0 min). Upon biotin addition, ColX left the ER, reached the Golgi apparatus within 10 min postrelease, and was then exocytosed at the plasma membrane. About 35 min after biotin addition, most of ColX had been secreted into the medium, and almost no signal remained in cells. Time-lapse imaging and temporal projection after Golgi exit suggested that exocytosis did not occur randomly at the cell surface but in preferred domains ([Fig. 1 A](#fig1){ref-type="fig"} and Video 1). However, because ColX is a soluble secretory protein, a significant fraction of released proteins diffuses out, which may lead to underestimate levels of exocytosis at these preferred sites. To prevent its diffusion after release, we set up an assay that we named SPI. In this assay, a GFP moiety is fused to soluble secretory factors or to the luminal part of membrane-bound cargos, and before seeding the cells, coverslips are coated with anti-GFP antibodies ([Fig. 1 B](#fig1){ref-type="fig"}). The interaction between the coated anti-GFP antibodies and the GFP moiety fused to the cargos reduces the diffusion speed of the cargos and eventually immobilizes them. This enables the local accumulation of secreted proteins that were released over an extended period of time.
{#fig1}
We showed that the coated antibodies are homogeneously distributed, enabling the SPI assay to quantitatively immobilize GFP-fused proteins (Fig. S1). In combination with the RUSH assay, a complete overview and localized history of the secretion of a selected cargo is obtained. As shown in [Fig. 1 C](#fig1){ref-type="fig"} and Video 2, the use of the SPI enables a strong accumulation of secreted ColX (see the differences between [Fig. 1 A](#fig1){ref-type="fig"}, without SPI, and [Fig. 1 C](#fig1){ref-type="fig"}). The presence of hotspots of ColX secretion confirmed that some domains of the plasma membrane seemed unable to support exocytosis, while others were very active. The localization of the active domains was reminiscent of FA sites. We used cells expressing paxillin-mCherry, which localizes to FAs ([@bib39]; [@bib38]), to monitor the synchronized transport of ColX combined with SPI and found that secreted ColX was clearly enriched on FAs ([Fig. 1 D](#fig1){ref-type="fig"}). A similar result was obtained for another soluble cargo, ssEGFP, although it appeared more diffuse when secreted, likely due to more rapid diffusion than ColX and/or less efficient capture by the antibody ([Fig. 1 D](#fig1){ref-type="fig"}).
Similar experiments were performed with membrane-bound cargos such as VSV-G, gp135, TNFα, and E-cadherin adapted to the RUSH assay. Although no particular enrichment was observed in normal conditions (Fig. S1), probably due to a rapid diffusion of secreted cargos in the plane of the plasma membrane, topologically restricted secretion was observed using SPI. As for secreted cargos, exocytosis of VSV-G and gp135 also occurred on hotspots localized to FAs ([Fig. 1 D](#fig1){ref-type="fig"}). The same results were obtained when monitoring E-cadherin and TNFα secretion (data not shown). The combination of the RUSH and SPI assays thus demonstrated the existence of secretion hotspots close to FAs for soluble and membrane-bound proteins.
Exocytosis is directed between FAs {#s04}
----------------------------------
| {
"pile_set_name": "PubMed Central"
} |
Introduction
============
The complement system is part of innate immunity and is one of the major pathogenic event that drives various inflammatory responses in numerous diseases.^([@B1],[@B2])^ The complement system consists of three major pathways: the classical, mannose-binding lectin, and alternative pathways. All pathways of complement activation lead to cleavage of the C5 molecule generating the anaphylatoxin C5a and C5b subsequently forms the terminal complement complex (C5b-9).^([@B3])^ C5a exerts a predominantly pro-inflammatory activity through interactions with the classical G-protein coupled receptor C5aR (CD88), which is expressed on various immune and non-immune cells.^([@B1])^ C5b-9 causes cytolysis through the formation of the membrane attack complex (MAC), and sub-lytic MAC and soluble C5b-9 also possess a multitude of non-cytolytic immune functions. These two complement effectors, C5a and C5b-9, both generated from C5 cleavage, are key components of the complement system responsible for propagating and/or initiating pathology in different diseases, including paroxysmal nocturnal hemoglobinuria (PNH), rheumatoid arthritis, ischemia--reperfusion injuries and neurodegenerative diseases.
We have previously demonstrated that intestinal epithelial cells are the local sites of complement biosynthesis.^([@B4],[@B5])^ Complement components are also supplied into the gut lumen from the exocrine pancreas and bile system.^([@B6],[@B7])^ Furthermore, previous studies have reported the deposition of complement components at the inflamed mucosa of inflammatory bowel disease (IBD) patients, suggesting that complement-mediated tissue injury is involved in the pathophysiology of IBD.^([@B8],[@B9])^ The regulatory mechanisms of complement activation are finely balanced, since overactivation of the complement system leads to tissue injury. The regulation of complement activation is mediated by complement-activation regulatory proteins such as decay-accelerating factor (DAF or CD55), membrane cofactor protein (MCP or CD46), and CD59.^([@B10])^ DAF prevents the assembly of C3 convertases (C4b2a and C3bBb), and also dissociates deposited-C3 convertases.^([@B9])^ Lin *et al.*^([@B11])^ reported that dextran sulfate sodium (DSS)-induced experimental colitis was exacerbated in DAF-knock out mice, indicating that complement activation plays an important role in the development of DSS-colitis.
In this study, to investigate the role of the complement system, we evaluated the effects of neutralizing anti-C5 antibodies on the development of DSS-colitis in mice. Since C5 is a central component of the complement cascade, complement activation leading to the formation of C5a and MAC does not occur in this model.
Materials and Methods
=====================
Induction of colitis
--------------------
Six to eight week-old male BALB/c mice were purchased from Charles River Japan (Kanagawa, Japan). They were acclimatized for one week before the experiment, and were housed individually in a room maintained at 22°C under a 12-h day/night cycle throughout the experiments.
Experimental colitis was induced by the oral administration of DSS (molecular weight 5000; Wako Pure Chem. Ind. Ltd., Osaka, Japan). Half of the mice were randomized to receive 3.5% (w/v) DSS in their drinking water for 14 days, and the other half of the mice were given regular drinking water. Neutralizing anti-C5 monoclonal antibodies (Eculizumab; Alexion Pharmaceuticals, Inc., Cheshire, CT) (1 µg/body) were administered intraperitoneally every 48 h for the duration of the experiment. The mice were weighed every other day, and were inspected visually for any sign of sickness. Immediately before sacrifice, the stool was tested for blood by the guaiac test. On day 14, all of the mice were sacrificed and their colons were collected for histological analysis and a myeloperoxidase activity assay. This study protocol was approved by the Animal Care and Use Committee of the Shiga University of Medical Science (Otsu, Japan).
Assessment of inflammation in DSS-induced colitis
-------------------------------------------------
Daily clinical assessment of the DSS-induced colitis were performed, including a measurement of food intake and body weight, an evaluation of stool consistency, and the presence of blood in the stools by the guaiac paper test. The stool consistency was assessed using the following four point-scale: 0, normal; 1, soft; 2, very soft but formed; and 3, liquid. The intensity of the guaiac paper test was scored by the following scale: 0, negative; 1, faintly blue; 2, moderately blue; 3, dark blue; and 4, blood visible. A validated clinical disease activity index ranging from 0 to 4 was calculated using the following parameters: stool consistency, presence of fecal blood, and changes in body weight.^([@B12])^
Histology
---------
A histological examination was performed on three samples of the distal colon from each animal. The samples were fixed in 10% buffered formalin, dehydrated in ethanol, and then embedded in paraffin. Five-micrometer-thick sections were then prepared and stained with hematoxylin and eosin. All of the histological evaluations were performed in a blinded fashion using a validated scoring system.^([@B12])^
Tissue myeloperoxidase activity
-------------------------------
The samples were washed with cold PBS, blotted dry, and were immediately thawed for the myeloperoxidase activity determination using the *O*-dianisidine method previously described.^([@B13])^ The activity was expressed as the amount of enzyme necessary to generate a change in absorbance of 1.0 per min per gram wet weight of the tissue.
Real-time polymerase chain reaction (PCR)
-----------------------------------------
The mRNA expression of Notch ligands in the samples was assessed by real-time PCR analysis. The oligonucleotide primers used in this study are described in Table [1](#T1){ref-type="table"}. Real-time PCR was performed using a LightCycler 2.0 system (Roche Applied Science, Tokyo, Japan). The PCR was performed using a SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA). The data were normalized versus β-actin for each gene.
Statistical analysis
--------------------
Statistical analyses were performed using the one-way ANOVA with Scheffe's post hoc test or the Kruskal-Wallis test when appropriate. A two-way ANOVA for repeated measures was used to test for group and time effects on the clinical data (e.g., disease activity index) over 7 successive days of clinical observation. A *p* value less than 0.05 was considered to be statistically significant.
Results
=======
To evaluate the role of complement activation in DSS-colitis, the administration of an anti-C5 antibody was started at the same time as the DSS exposure. The administration of the mAb was repeated every 48 h. As shown in Fig. [1](#F1){ref-type="fig"}, on days 6 after the initiation of DSS-induced colitis, a significant decrease in body weight was observed in the DSS-treated mice as compared with the control mice or the anti-C5 Ab-treated mice. After this time point, the body weight loss progressed in the DSS mice, but was completely blocked by the administration of anti-C5 antibody. The administration of the mAb did not affect the changes in body weight of control mice.
As shown in Fig. [2](#F2){ref-type="fig"}, the disease activity index was significantly lower in the anti-C5 antibody-treated mice than in the DSS mice. The total colonic length was significantly shorter in the DSS mice than in the anti-C5-treated mice (Fig. [2](#F2){ref-type="fig"}). The colonic weight/length ratio was significantly lower in the anti-C5 Ab-treated mice than in the DSS mice (Fig. [2](#F2){ref-type="fig"}), indicating that a blockade of the complement cascade by the anti-C5 antibody inhibited the progression of the edematous changes of the colon in DSS-colitis.
DSS-colitis is characterized by histological findings such as edema, the infiltration of inflammatory cells into both the mucosa and submucosa, ulceration and mucosal thickening. Our histological analysis indicated that the administration of the anti-C5 antibody markedly ameliorated the severity of the colitis as compared to the DSS mice (Fig. [3](#F3){ref-type="fig"}). The myeloperoxidase activity was significantly elevated in the DSS mice, but was significantly reduced in the anti-C5-treated mice.
To characterize the regulation of various inflammatory genes during the process of DSS-colitis, total RNA was isolated from the colons of the differently-treated mice, and the mRNA expression of cytokines was evaluated by real-time PCR. As shown in Fig. [4](#F4){ref-type="fig"}, the mice treated with DSS showed an increased expression of tumor necrosis factor (TNF)-α, interleukin (IL)-1β and IL-6. The administration of the anti-C5 antibody significantly reduced the expression of mRNAs for TNF-α, IL-1β and IL-6.
Discussion
==========
The complement system is a potent effector for both normal immune and inflammatory responses. Activation of the complement system also induces tissue injury. Previous studies have demonstrated local complement activation in the inflamed mucosa of IBD patients,^([@B9])^ suggesting the involvement of complement activation in the | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
Plantarflexion is achieved through the combined action of the soleus and gastrocnemius muscles, located in the calf \[[@B1], [@B2]\]. The gastrocnemius and soleus muscles share the Achilles tendon, the thickest and strongest human tendon, and are also known as the triceps surae \[[@B2]\]. The triceps surae is responsible for 80% of plantarflexion force \[[@B1]--[@B3]\]. Combined, the triceps surae stabilises the foot in weight bearing and produces a plantarflexion moment at toe-off, essential for forward momentum during gait \[[@B1], [@B2]\]. Therefore, sufficient plantarflexion strength and endurance are essential for basic mobility, such as walking and running \[[@B2], [@B4]\].
The heel rise test, also commonly described as heel raise test or calf rise test, was first developed in the 1940s \[[@B4], [@B5]\] to assess the function of the calf muscle-tendon unit and is now widely used by clinicians and researchers across disciplines. The test has commonly been used in neurology, cardiology, gerontology, orthopaedics, and sports medicine \[[@B5]\]. Plantarflexion strength and endurance are often impaired after lower limb injury, especially after injury to the Achilles tendon \[[@B1], [@B6]\]. The heel rise test is commonly used not only during the initial assessment of these injuries, but also during rehabilitation to quantify treatment outcomes \[[@B5]\]. The test is often described as a test of calf muscle endurance, strength, fatigue, function, and performance \[[@B5], [@B7], [@B8]\]. It involves standing on one leg and rising and lowering the body by lifting the heel off the ground and then lowering it while maintaining a straight knee. The task is repeated without a break until the participant cannot complete it correctly or complains of pain or fatigue in the calf muscles \[[@B1], [@B4], [@B9]\]. The number of heel rises a participant can achieve is then recorded. The research literature commonly recommends 25 heel rises as the target norm of clinical performance for healthy subjects; however, much higher and lower values ranging from 7 to 48 have also been suggested in both research literature and musculoskeletal textbooks \[[@B5]\].
A systematic review by Hébert-Losier et al. \[[@B5]\] investigated the test variables and concluded that although this test is widely used in various health professions as a recommended assessment and rehabilitation tool, there is no uniform description of the test. The wide range of reported normative values in the literature may reflect the lack of standardization of the test. This further emphasises the need that the development of a standardized, reliable heel rise test is important for researchers and clinicians alike \[[@B1]\].
Research studies using the heel rise test commonly use customised devices developed to standardize the test and monitor test variables; however, these devices were often extremely complex, prohibiting use in everyday clinical practice or inadequately controlled confounding variables. In one study \[[@B10]\], a device was constructed that consisted of a box with an incline, a weight belt attached to the waist of the participant, and a linear encoder attached to the heel of the shoe to measure plantarflexion endurance. The linear encoder, connected to a computer measuring system, measured the time and length of the heel displacement of the heel rise. A second study \[[@B11]\] used a device with a light beam attached to vertical rods at a fixed height of 5 cm above the heel. The device emitted an audible click when the participant\'s heel passed the 5 cm height when rising onto the toes to raise the body. However, no feedback was provided to participants about the actual height of each heel rise and therefore a maximum or standardized heel rise was not necessarily achieved. A further disadvantage of this device was that the height was not adjustable and therefore could not allow individualized testing. Additionally, the device required an electrical current to function. A third study \[[@B12]\] used a simple, portable device that positioned a rod horizontally across the foot for participants to touch with the anterior aspect of the arch of the foot when the heel was raised. Some adjustability was allowed by four preset holes in the device in which the rod was placed to enable selection of four different heights. Although the device allowed for some ability to individualize the test, adjustability was incomplete. Furthermore, the safety of placing the rod at the front of the foot is questionable: in the event that an individual lost balance during the test, the rod could prevent stepping off the device with ease.
Clinically, the heel rise test is often employed for assessment and rehabilitation purposes without using a device at all. This may possibly be due to the complexity of devices currently available. However, a standardized device and protocol that is suitable for all individuals is essential to monitor and replicate the heel rise test with consistent outcomes \[[@B1], [@B5]\]. When the aim is to use the device in clinical settings, it should be simple, cheap, reliable, and clinically accessible \[[@B5]\]. A universally accepted standardization of the heel rise test and consequently a device that allows for standardized, reliable, and individualized evaluation protocols is not currently available. The Ankle Measure for Endurance and Strength (AMES) device (IP Australia; innovation patent application number AU2012101251) and measurement protocol was created to provide the platform for such results. This paper aims to document the construction and reliability of the device.
2. Methods {#sec2}
==========
2.1. Construction of the Device {#sec2.1}
-------------------------------
The construction of the AMES device is shown in Figures [1](#fig1){ref-type="fig"} and [2](#fig2){ref-type="fig"}. We used a 44.5 cm × 40.5 cm (*L* × *W*) wooden platform as the base. To the bottom we glued two small wooden blocks each of 31 cm × 4.2 cm (*L* × *W*) to lift the platform slightly off the ground and to allow fixation of the other parts to the platform.
On top of the platform, two medium sized "L"-brackets were placed parallel to each other on both sides, spaced 23.1 cm apart and 12.5 cm from the back of the platform. The setting of the brackets as illustrated in Figures [1](#fig1){ref-type="fig"} and [2](#fig2){ref-type="fig"} has proven to fit the foot length and width of all tested individuals. However, the brackets can be moved forwards, backwards, or wider apart to accommodate individuals\' foot length and width. The L-brackets were secured onto the platform with two small "G"-clamps of 12 × 8 cm (*L* × *W*).
A 12 mm thick elastic band, on which the participant stands, was placed horizontally between the L-shape brackets and was held in place by two small spring clamps. The elastic band was 30 cm long and cut from a 4-meter strip. The L-shape brackets, the elastic band, the G-clamps, and the spring clamps are adjustable so that the device is able to fit the needs of a wide variety of individuals. The spring clamp facilitates the sliding of the elastic band up and down the L-brackets to cater for each individual\'s maximum heel rise height. Adjustment of the spring clamps and the elastic band was performed while the individual was standing on the platform and performing a heel rise. The platform, the small wooden blocks, the L-shape brackets, the G-clamps, the spring clamps, and the elastic band were all constructed from compact and lightweight materials and attached to each other but all were removable to facilitate easy repeated assembly and disassembly of the device. The total price of the current device and all its components was approximately \$25.00 USD.
2.2. Testing Set-Up Protocol {#sec2.2}
----------------------------
Before performing the test, the device was adjusted to the individual\'s maximum heel rise as follows.The participant placed the heel, barefoot, on the elastic band between the L-brackets with the individual\'s foot pointing to the front of the platform ([Figure 3](#fig3){ref-type="fig"}).The participant performed a maximum heel rise, with extended knee, with the nontesting leg flexed and suspended in the air and the fingertips of one hand on the wall for balance ([Figure 4](#fig4){ref-type="fig"}).The examiner adjusted the elastic band by sliding the spring clamps up or down until the elastic band was just clear of the heel and in a horizontal position. The participant lowered their heel back onto the platform.The participant performed another heel rise to confirm their maximum heel rise; for example, the participant cleared the elastic band on each heel rise during the test.Lastly, the test was conducted with the participant rising and lowering their heel to the beat of a metronome until the participant can no longer perform a heel rise or fails to perform a technically correct heel rise (maximum heel raise with extended knee, clearing the elastic band, and only fingertips of one hand on the wall for balance) on two consecutive occasions.
2.3. Reliability of the Device {#sec2.3}
------------------------------
Following the design of the device, we tested it for reliability.
### 2.3.1. Participants {#sec2.3.1}
The study was performed at the University of Sydney in the Arthritis and Musculoskeletal Research Lab. We recruited participants through advertisements on university noticeboards. A total of 40 participants who met the inclusion criteria for the study were enrolled. Inclusion criteria were as follows: (1) healthy adults over 18 years and ( | {
"pile_set_name": "PubMed Central"
} |
Aims and Scope
==============
*Annals of Clinical and Translational Neurology* is a peer-reviewed journal for rapid dissemination of high-quality research related to all areas of neurology. The journal publishes original research and scholarly reviews focused on the mechanisms and treatments of diseases of the nervous system; high-impact topics in neurologic education; and other topics of interest to the clinical neuroscience community.
All areas of clinical and basic neuroscience, including new technologies, cellular and molecular neurobiology, population sciences, and studies of behavior, addiction, and psychiatric diseases are of interest to the journal. *Annals of Clinical and Translational Neurology* is particularly interested in clinical trials and other large-scale studies that inform the practice of medicine. Trials reporting negative data will be considered.
In addition to manuscripts from established investigators, *Annals of Clinical and Translational Neurology* will welcome scholarly work, points-of-view, and case studies from residents, fellows and medical students.
*Annals of Clinical and Translational Neurology* publishes papers submitted directly to the journal and those referred from *Annals of Neurology.*
Open Access and Copyright
=========================
All articles published by *Annals of Clinical and Translational Neurology* are fully open access: immediately freely available to read, download and share. All *Annals of Clinical and Translational Neurology* articles are published under a Creative Commons License. All Research Councils UK (RCUK) and Wellcome Trust funded authors will be directed to the Creative Commons Attribution license (CC BY) in accordance with funder mandates effective on 1 April 2013. All other authors (non-RCUK and Wellcome Trust authors) will use the Attribution-Non-Commercial-NoDerivs (CC BY NC ND).
Copyright on any research article in a journal published by *Annals of Clinical and Translational Neurology* is retained by the author(s). Authors grant Wiley a license to publish the article and identify itself as the original publisher. Authors also grant any third party the right to use the article freely as long as its integrity is maintained and its original authors, citation details and publisher are identified. Further information about open access license and copyright can be found at <http://www.wileyopenaccess.com/details/content/12f25db4c87/Copyright--License.html>.
Purchasing Print Reprints
=========================
Print reprints of Wiley Open Access articles can be purchased from corporatesales\@wiley.com.
Disclaimer
==========
The Publisher, American Neurological Association and Editors cannot be held responsible for errors or any consequences arising from the use of information contained in this journal; the views and opinions expressed do not necessarily reflect those of the Publisher, American Neurological Association and Editors, neither does the publication of advertisements constitute any endorsements by the Publisher, American Neurological Association and Editors of the products advertised.
Wiley Open Access articles posted to repositories or websites are without warranty from Wiley of any kind, either express or implied, including, but not limited to, warranties of merchantability, fitness for a particular purpose, or non-infringement. To the fullest extent permitted by law Wiley disclaims all liability for any loss or damage arising out of, or in connection with, the use of or inability to use the content.
Editor-in-Chief
===============
John Kessler, MD
Northwestern University, Chicago
*Address correspondence to the Editorial Office:* <ACTNedoffice@wiley.com>
Associate Editors
=================
Flint Beal
Cornell University Medical College
New York
Andrew J. Cole
MGH/Harvard
Boston
Anne Cross
Washington University
St. Louis
Leon Epstein
Northwestern University
Chicago
Ahmet Hoke
Johns Hopkins
Baltimore
Steven Warach
University of Texas Southwestern
Dallas
Editorial Board
===============
Susan Bressman
Mt. Sinai
New York
Sydney Cash
MGH/Harvard
Boston
Merit Cudkowicz
MGH/Harvard
Boston
David Holtzman
Washington University
St. Louis
Michael Racke
Ohio State
Columbus
Sean Savitz
University of Texas
Houston
Tanya Simuni
Northwestern
Chicago
Gordon Smith
University of Utah
Salt Lake City
Kevin Staley
MGH/Harvard
Boston
Charlotte Sumner
Johns Hopkins
Baltimore
Emmanuelle Waubant
University of California
San Francisco
| {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
The current therapeutic challenges in cancer, including chronic lymphocytic leukemia (CLL) the most prevalent leukemia of adults in the western world, involve the targeting of tumor-specific pathways in a more profound fashion than accomplished by conventional cytostatics \[[@CR1]\]. In CLL, chemo-immunotherapies with nucleosides like fludarabine in combination with antibodies, have significantly improved response rates \[[@CR2]\], but the majority of patients eventually relapse due to incomplete clonal eradication and finally develop refractory disease. A major underlying reason for such treatment failures are resistances of the leukemic (sub)clones towards drug-induced triggering of classical apoptosis \[[@CR3]\]. Mediators of such protection in CLL are a marked pro-survival impact by micro-environmental niches \[[@CR4]\] and genetic deficiencies to evoke an adequate p53 mediated apoptotic response. The latter is particularly found in the clinically high-risk subsets of 11q23/ATM or 17p/TP53 deleted/mutated CLL \[[@CR5], [@CR6]\].
A key to overcome such high thresholds for classical apoptosis would be to exploit independent forms of (programmed) cell death. Such therapeutic strategies would bypass major modes of resistance to most currently used substances. We previously identified organochalcogens (organoselenium, -tellurium compounds) to act as 'sensor/effector' catalysts of reactive oxygen species (ROS), particularly in a specific tumor-to-normal cell fashion across various cancer cell types, including CLL \[[@CR7], [@CR8]\]. These substances exploited the aberrant redox equilibrium of enhanced radical production and reduced glutathione (GSH) buffer levels in CLL cells as their selective vulnerability by increasing the elevated ROS levels towards a cytotoxic threshold. The therapeutic potential of modulating ROS in CLL had been demonstrated by others as well \[[@CR9], [@CR10]\] and this can be particularly efficient when mitochondrial respiration is simultaneously inhibited \[[@CR11]\]. Encouragingly, ROS-mediated induction of CLL cell apoptosis was shown to be independent of p53-functional status \[[@CR12]\].
Elevated levels of ROS, the byproduct of normal cell respiration, are a hallmark of the rewired metabolic cancer phenotype \[[@CR13]\]. Due to their genotoxic effects and messenger function in milieu-derived growth signaling, especially via the B-cell receptor (BCR) \[[@CR14], [@CR15]\], ROS are implicated in transformation, clonal sustenance, and drug resistance in CLL particularly in advanced disease and after previous therapy \[[@CR16]\]. Protective stromal cells provide cystine for anti-oxidant GSH synthesis to CLL cells and thereby relieve their ROS stress \[[@CR17]\].
A central oncogenic mechanism in CLL is overexpression of the adapter molecule T-cell leukemia 1 (TCL1). Mice transgenic (tg) for human TCL1 driven by the Eμ immunoglobulin (IG) gene enhancer (Eμ-TCL1) model human CLL with most fidelity to its aggressive IGHV gene unmutated subset \[[@CR18]\]. Through a physical interaction with the AKT growth kinase, TCL1 enhances proximal milieu-derived signaling, particularly acting as a sensitizer for BCR-triggered cellular fates \[[@CR19]\]. High-level TCL1 is associated with high-risk disease features and poorer therapeutic outcome \[[@CR19], [@CR20]\].
These data provide strong rationales to therapeutically exploit ROS as mediators of non-classical cell death pathways in CLL in the context of their notorious resistance to apoptosis, especially linked to high TCL1 expression. We therefore designed novel metal-containing nucleoside analogues (MCNA) and present here their efficient and selective cell death induction in CLL. This action was indiscriminate of cytogenetic risk subsets and irrespective of protective stromal cell contact. Their non-autophagic and non-necrotic cytotoxic activity involved an early ROS induction and was independent of p53 or caspase activation. We link the oncogenic impact of TCL1 to elevated ROS and altered mitochondrial energetic flux, which results in an enhanced sensitivity to redox active agents, e.g. MCNA, representing a potent vulnerability.
Results {#Sec2}
=======
Chemistry and selection of the novel organometallic nucleoside analogues {#Sec3}
------------------------------------------------------------------------
We have been extensively studying butadiene Fe(CO)~3~-complexes like Me-N69 and could show that their iron-fragment is crucial for the cell death inducing activity in BJAB lymphoma cells \[[@CR21]\]. We found cytosine to be the nucleobase most effective for cell death induction as well as a non-polar protecting group at O5' to be essential for this substance efficacy \[[@CR21]\]. There was no significant difference in activity between furanoid compounds (partially hydrated furanes) like Me-N69 and its carbocyclic congeners \[[@CR21]\]. Given these observations, we designed optimized MCNA. They were synthesized according to our established protocols \[[@CR21]--[@CR23]\]. Based on chemical properties and extrapolated activity indices, 4 compounds were further selected for this study (Fig. [1](#Fig1){ref-type="fig"}). Huni132 is a ferrocene-based nucleoside analogue, which contains Fe(II). Huni218 is the corresponding ruthenium congener. Me-N69 is a butadiene Fe(CO)~3~-complex, which contains Fe(O) and can donate up to three electrons upon oxidation. Huni132, Me-N69, and Huni218 resemble natural nucleosides with respect to the relative position of the cytosine unit and the 5'-side chain. Dia-Me-N69 is formed as a diastereomeric byproduct during the synthesis of Me-N69. It features a stereochemically inverse, hence 'atypical', configuration at C1 and was added as a control.Fig. 1Chemical structure of the selected novel metal-containing nucleoside analogues. A panel of metal-containing nucleosides was designed and synthesized, with the 4 illustrated compounds selected for this study. Huni132 is a ferrocene based nucleoside analogue, Huni218 is the corresponding ruthenium congener. Me-N69 is a butadiene Fe(CO)~3~-complex and Dia-Me-N69 is formed as a diastereomeric byproduct during the synthesis of Me-N69
The novel organometallic nucleoside analogues induce marked in-vitro CLL cell death irrespective of the presence of high-risk disease determinants or stromal cell protection {#Sec4}
-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Flow cytometry with AnnexinV (early-apoptotic surface expression of the neoepitope phosphatidyl-serine) combined with 7AAD or Hoechst stain (uptake upon late-apoptotic or necrosis-associated membrane disintegration) assayed the ability of our MCNA to trigger death of primary tumor cells from CLL patients and of healthy-donor derived PBMC. Initial estimations of effective compound dosages were performed by LD50 titrations (Additional file [1](#MOESM1){ref-type="media"} Fig. S1). Next, already after 24 h all 4 tested MCNA, with the highest efficacy noted for Huni132, induced pronounced cell death in 25 CLL samples whereas normal PBMC were significantly less sensitive towards MCNA treatment (Fig. [2a](#Fig2){ref-type="fig"}). Solvent (Dmso) induced cell death was negligible (mean/SEM: PBMC 3.7 %/0.9 and CLL 5.4 %/1.3). This overall selectivity by the MCNA was greater than observed for bendamustine at this time point and for fludarabine, compared to which the MCNA also proved to be more B-cell specific (Fig.[2a](#Fig2){ref-type="fig"}, Additional file [1](#MOESM1){ref-type="media"} Fig. S2).Fig. 2The novel organometallic nucleoside analogues (MCNA) induce marked in-vitro cell death across all cytogenetic and clinical risk subsets of CLL and can overcome stromal cell protection. Incubation (24 h) of primary CLL suspension cultures (n = 25) or healthy-donor derived PBMC (n = 9) with MCNA (10 μM) or bendamustine. Cytotoxicity as per AnnexinV/7AAD flow cytometry ((apoptotic) cell death); means/SEM. **(a)** Significantly (\*\*\* P\<0.0001; \*\* P = 0.0012) higher CLL cell death induction by the MCNA (highest efficacy for Huni132) than in PBMC; a less pronounced selectivity for bendamustine. Solvent associated cell death corresponded to spontaneous death rates. **(b)** CLL with low-risk karyotypes (normal or isolated del13q14; n = 12) vs 9 CLL carrying the high-risk aberrations del11q or del17p (including 4 clinically fludarabine refractory patients) show no significant differences in MCNA sensitivity. **(c)** Immunoblot-based detection of PARP cleavage induced by MCNA in 2 CLL representing the clinical/cytogenetic profile of investigated samples (β-actin corrected densitometric values). **(d)** Increased in vitro cell death upon combination of MCNA (5 μM) with 25 μM bendamustine (data from 5 CLL) including a synergism for Huni132 and bendamustine (dashed lines; \* P = 0.006). Bottom: corresponding levels of cleaved PARP (immunoblot, β-actin corrected densitometric values) of 2 exemplary CLL. **(e)** CLL B-cells from clinically fludarabine refractory patients (n = 9, including the | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
The palliative care, or comfort care, movement in the USA is on the rise ([@b1]). Over the last several years, hospitals have developed comfort and pain management programs that support minimizing pain and maximizing comfort for their patients. Accrediting institutions, such as the Joint Commission on Acceditation of Healthcare Organization (JCAHO), have mandated standards for pain assessment and management for hospitals, nursing homes and other facilities ([@b2]).
The philosophical underpinnings of the palliative care movement come from the hospice movement, which arose in the UK in the 1960s and spread to the USA in the 1970s. Patient demand for these services then moved the trend for palliative services forward. This latter response can be viewed as a reflection of the patient empowerment processes emanating from the consumer rights and civil rights movements of the 1960s and 1970s.
However, our human actions do not currently include the integration of palliative services in an organized way throughout healthcare. In this commentary, I propose that we accept the argument that palliative care is ethically desirable and, as such, it needs to be integrated across a wide range of healthcare services. I consider basic ethical questions regarding palliative care, and I utilize well-known ethical frameworks to argue for the proposed concept of 'integrated palliative healthcare services' throughout the healthcare system in the USA. I also look at complementary and alternative medicine (CAM) therapies that are useful and necessary components of palliative care. I have chosen to focus on the USA because it is in a state of transition regarding palliative care services. However, it is important to acknowledge that internationally other countries have already embraced a more integrative approach to palliative care.
Defining Palliative Care
========================
The World Health Organization has defined palliative care as 'the active, total care of patients whose disease is not responsive to curative treatment' ([@b3]). Eileen Chrystal-Frances has written 'Palliative care of the terminally and chronically ill is a specialized field of medicine that is slowly emerging in step with certain changes in our society and our mindset toward death and dying' ([@b4]). She describes the interdisciplinary approach of palliative care and its emphasis on pain management and attention to psychological, social and spiritual issues. The goal of palliative care is to attain the optimal quality of life for patients. Thus, palliative care encompasses multiple concepts of pain management, quality of life and comfort care. The latter is a state linked to outcomes such as ease, well-being and satisfaction ([@b5]).
Palliative care embraces the hospice philosophy of care and strives to expand this concept to include patients who experience pain or discomfort, but who do not necessarily qualify for hospice services. Thomas Hoyer argues that today\'s end of life efforts are 'a repudiation of the notion that 'hospice' care is a choice to be made at the end-of-life' ([@b6]). He contends that it is instead a movement dedicated 'to making the healthcare system so responsive to quality of life concerns as to make hospice care unnecessary as an alternative (even if useful as an adjunct) to that system' ([@b6]). Thomas Hoyer is suggesting a notion of palliative care as an aspect of healthcare for all patients and not simply for those nearing the end of life. As such, it implies that all patients are entitled to palliative services regardless of a terminal diagnosis.
Ethical Frameworks
==================
Why might such an integrated palliative healthcare system be ethically meaningful? Four moral principles are frequently utilized as a framework for principles of bioethics: respect for autonomy, beneficence, non-maleficence and justice. In their description of beneficence, Beauchamp and Walters write that many medical codes assert the health professional\'s 'primary commitment is to protect the patient from harm and to promote the patient\'s welfare' ([@b7]). Palliative care can protect patients from the harm of experiencing symptoms of pain, and it can promote patient welfare by enhancing well-being. Historically, beneficence includes the active promotion of good, kindness and charity; however, modern notions have tended to focus more on removing possible harms ([@b7]). Palliative care harks back to an earlier concept of healing that includes caring and the promotion of holism as a central element.
An article on philosophies and practices analogous to bioethics among Aboriginal cultures describes a different way of perceiving health ([@b8]). The Aboriginal view is maintaining quality of life is paramount to extending life, and that achieving balance and wellness within all domains of life is commonly accepted. Palliative care encompasses ancient and modern philosophies of care by encouraging kindness and removing the possible harm of unnecessary human suffering.
Respect for autonomy is another concept that is integrally related to palliative care. In 2001, Institute of Medicine (IOM) and the National Research Council issued a report describing ways to improve care for people at the end of life ([@b2]). Although the report focused on cancer, many of the findings were applicable to individuals suffering from other terminal conditions as well. The report noted problems regarding the separation of palliative care from life-prolonging treatments. It stated that the lack of integration of these approaches caused individuals to choose between curative therapy and comfort care. Thus, an ethical dilemma is created. An individual with a terminal illness can choose either to seek a cure for their disease or to receive palliative care services. This can be perceived as an affront to autonomy. An individual\'s treatment options are being limited not by their free choice, but by policies that force them to choose between curative measures or palliative care. Additionally, Patrick Hill makes the argument that untreated or undertreated pain can compromise or destroy patient autonomy ([@b9]). Lisson agrees with this concept and suggests 'pain is an ultimate disvalue... The more severe the pain, the more it overshadows the patient\'s self-defining human qualities of intelligence, autonomy, and sense of self-esteem' ([@b10]). Lisson contends that pain management is essentially a clinical--ethical issue. Patients who are suffering from pain cannot make rational autonomous decisions about their healthcare. Therefore, since individuals who are suffering are less able to actualize the concept of patient autonomy, palliative care should never be excluded from healthcare.
Financial Considerations
========================
In 1983, Medicare established the hospice benefit, specifying a payment system and eligibility criteria. To obtain this coverage, a patient must have a terminal illness with a prognosis of 6 months or less to live if the illness runs its normal course, and the patient must be willing to forgo curative treatment ([@b11]). Medicare pays a fixed daily amount for hospice care based on four broad categories of care ([@b12]). Medicare pays approximately two-thirds of hospice services, while private insurance, Medicaid, and a variety of other sources contribute the remainder ([@b13]). Currently, there are not state and federal regulations that define the requirements of palliative care and its reimbursement structure ([@b11]). Little reimbursement is available for long-term care and palliative services outside of a hospice ([@b14]). Monies for palliative care programs depend upon how the care is provided, and often revolve around creative programs whose funding is determined by current reimbursement options. Hospital-based comfort and pain management programs are not uniformly funded and often obtain funding through other departments such as anesthesiology and mental health services. In 2001, the Centers for Medicare and Medicaid Services (CMS) issued a program memorandum that added a new specialty code for physicians who provide pain management services ([@b11]).
Thus, the system does not currently encourage palliative care coordination and management across a variety of providers and settings. A major problem with this approach is that the ethical concept of distributive justice is not achieved because of the disparities inherent in a system that does not offer palliative care in a uniform and organized way. Patients are likely to receive very different palliative services, or none at all, depending on the facility they happen to be in and their medical plan. Unfortunately, the ethical principle of justice is not served, as some patients are more likely to suffer than others.
It is similarly unjust that a patient must forgo life-saving treatment to enhance their comfort level. It can be argued that a system which only provides comprehensive palliative care in the last 6 months of life, and only once the patient has forgone curative treatment, is encouraging the hastening of death. Ironically, what frequently occurs is just the opposite. Patients continue curative treatments to the end of their life, and consequently are denied palliative services for the majority of their disease process.
Given this dilemma, how might the idea of integrated palliative care impact the system of healthcare? There is some evidence to suggest that coordinated care decreases costs. A conference sponsored by the NIH found that the use of palliative care networks promoting pain management may reduce costs by 10--15% ([@b15]). One program at Mount Sinai Hospital found that patients who receive palliative care have shorter lengths of in-patient stays and lower pharmacy costs ([@b16]). Miller *et al*. claim that quality palliative and hospice care reduces needless uses of the medical system ([@b17]). Anne Reb argues, 'the integration of palliative care throughout the course of illness may facilitate improved symptom management, quality of life, and continuity of care' ([@b18]). She also says that the incorporation of innovative models that encourage coordinated care should support a more cost-effective, integrated approach in delivering palliative care services. The American Academy of Nursing\'s Palliative and End-of-life Care Expert Panel (2001) recognized the need to integrate palliative care skills throughout the nursing care of people with acute and chronic illnesses ([@b19]). Given these claims and the fact that research estimates that Medicare benefits in the last year of life account for over a quarter of total Medicare expenditures, while Medicare spends ∼1.3% of its total budget on hospice services, an argument for change can be supported. In terms of cost reduction, providing palliative | {
"pile_set_name": "PubMed Central"
} |
All software, data, and documentation are freely available under Apache v2.0 and Creative Commons licenses. All input, output, example, and evaluation data as well as reports and figures are publicly accessible from the Mindboggle Open Science Framework website (<https://osf.io/ydyxu/>). The Mindboggle-101 manually edited label data are available on the Mindboggle101 Open Science Framework website (<https://osf.io/nhtur/>), the Mindboggle-101 Harvard Dataverse website (<https://dataverse.harvard.edu/dataverse/mindboggle101>), and the Mindboggle data website (<http://www.mindboggle.info/data.html>). The Mindboggle software is available through its GitHub repository (<https://github.com/nipy/mindboggle>) and all documentation is available on the Mindboggle website (<http://mindboggle.info/>).
> This is a *PLOS Computational Biology* Software Paper
Introduction {#sec001}
============
This article summarizes years of work on the Mindboggle project (<http://mindboggle.info>), including development and application of software that automates the extraction, identification, and shape analysis of features from human brain magnetic resonance imaging (MRI) data. The principal original contributions of the Mindboggle software include (1) a hybrid approach to combine different software packages' gray/white matter segmentations, (2) new algorithms for volume and surface shape measures devoted to brain images, including travel depth and cortical thickness, and (3) new shape-based feature extraction algorithms for brain structures such as folds, sulci, and fundi. Further contributions described in this article include (1) evaluations of Mindboggle volume and surface shape measurement algorithms against other software algorithms, (2) evaluation of Mindboggle's fundus extraction algorithm against other software algorithms, (3) Python implementations of algorithms for general-purpose shape measures such as Laplace-Beltrami spectra and Zernike moments, and (4) application of Mindboggle to provide the most detailed shape measures computed on human brain image data. This Introduction provides background and motivation for the project as well as a history of the project, the Design and Implementation section outlines the software's processing steps, the Results section describes evaluations and applications of the software, and the Availability and Future Directions section provides commentary and future directions.
The promise of brain imaging for finding biological markers of mental illness {#sec002}
-----------------------------------------------------------------------------
Brain images have been used to derive biological markers of mental illness and disease for years, most notably to predict prognoses among patients with behavioral disorders, often more accurately than current behavioral instruments such as widely used scales and structured interviews. For example, brain images have been used to predict relapse in methamphetamine dependence \[[@pcbi.1005350.ref001]\], onset of psychosis in at-risk individuals \[[@pcbi.1005350.ref002],[@pcbi.1005350.ref003]\], recovery from depression eight months later \[[@pcbi.1005350.ref004]\], response to drug treatment for depression \[[@pcbi.1005350.ref005],[@pcbi.1005350.ref006]\], anxiety \[[@pcbi.1005350.ref007]\], and for cognitive behavioral therapy in schizophrenia \[[@pcbi.1005350.ref008]\] and social anxiety disorder \[[@pcbi.1005350.ref009],[@pcbi.1005350.ref010]\] (see \[[@pcbi.1005350.ref011]\] for a more extensive review). Despite the above promising experimental results, there is still a dearth of reliable biomarkers \[[@pcbi.1005350.ref012]\]. The importance of identifying new biomarkers is reflected in the National Institute of Mental Health's Strategic Objectives: "Currently, very few biomarkers have been identified for mental disorders due in part to their complexity and an incomplete understanding of the neurobiological basis of mental disorders..."
Variation in human brains and the "correspondence problem" {#sec003}
----------------------------------------------------------
A significant impediment to our understanding of mental health is variation in human brain anatomy, physiology, function, connectivity, response to treatment, and so on. The normal range of variation must first be established to determine what is outside of this range, and only then can we hope to address neuropsychiatric assessment, diagnosis, prognosis, treatment, or prevention. An effective biomarker traditionally consists of one or more measures that maximize the separability between groups while minimizing the variance within each group. Brain images provide many ways of measuring different aspects of the brain, but it is not always clear how to compare these measures over time or across individuals. Comparing brains presumes that a brain-to-brain correspondence or mapping has been solved. To do this, scientists ubiquitously co-register images to each other, either individually or in groups, commonly with the use of a standard template brain or labeled atlas. However, registration alone does not guarantee correspondence \[[@pcbi.1005350.ref013]\] and templates are often not representative of the group being studied \[[@pcbi.1005350.ref014],[@pcbi.1005350.ref015]\]. Additional factors that affect the quality of registration are often ignored. For example, we have empirically demonstrated that registration algorithms vary widely in their accuracy \[[@pcbi.1005350.ref016]\], that even the best require removal of non-brain matter to perform adequately \[[@pcbi.1005350.ref017],[@pcbi.1005350.ref018]\], and conventional registration is less robust to missing regions than feature-based registration methods \[[@pcbi.1005350.ref019]\]. Despite this, many brain imaging studies co-register brains based on image similarity, assume alignment of corresponding anatomy \[[@pcbi.1005350.ref020]\], and compare the brains at the level of a small extent such as a sphere or rectilinear volume, which can be on the order of 1/100,000th the volume of the image.
Anatomical feature-based correspondence {#sec004}
---------------------------------------
Neuroanatomists rely instead on high-level "features" such as distinctive cortical folding patterns and relative positions of subcortical structures to consistently identify anatomical structures or label brain regions (\[[@pcbi.1005350.ref021],[@pcbi.1005350.ref022]\] and communications with neuroanatomists \[[@pcbi.1005350.ref023]\]). Such morphological features may also be identified by using multimodal imaging data and classifiers trained on such data \[[@pcbi.1005350.ref024]\]. In addition to whole (gyrus and sulcus) folds, components such as sulcal pits and sulcal fundi hold promise for establishing correspondence across brains. Sulcal pits, points of maximal depth or curvature in sulci, are interesting because they may be well conserved structures formed early in development \[[@pcbi.1005350.ref025]--[@pcbi.1005350.ref027]\] and have been used to characterize conditions such as polymicrogyria \[[@pcbi.1005350.ref028]\]. Sulcal fundi are defined as curves that run along the depths of sulci. They form branching skeletons that simplify the complex pattern of folds of the brain, may be measured for morphometry studies, and are used to help define the boundaries between gyri \[[@pcbi.1005350.ref022]\]. Like pits, fundi are thought to characterize early stages of morphological development, and therefore may exhibit abnormalities in neurodevelopmental and heritable disorders.
Shape measures as biomarkers {#sec005}
----------------------------
To compare features across individuals we need to quantify them. One quantification method is to characterize the quantities and distributions of grayscale values within a volume, but this does not work well for features of limited extent, such as a point, line, or surface patch. Another method is to coregister a given brain or brain feature with a reference and to define similarity with the reference based on the registration itself (deformation-based morphometry). Yet another method is to directly measure shape, where shape is defined as the geometrical information that remains when location, scale and rotation are removed from an object \[[@pcbi.1005350.ref029]\]. Publicly available brain image datasets that include any shape measures usually provide only a few shape measures per anatomical region: volume (such as the Internet Brain Volume Database, <http://www.nitrc.org/projects/ibvd>), surface area, and/or cortical thickness. These measures are useful for studies of neurogenesis or atrophy in morphological development, degeneration, injury, and disease progression. Volume measurement is almost ubiquitous in such studies, and cortical thickness measures derived from structural MRI data have been reported to help characterize a variety of disorders \[[@pcbi.1005350.ref030]\] such as mild cognitive impairment and Alzheimer's disease \[[@pcbi.1005350.ref031]--[@pcbi.1005350.ref033]\], multiple sclerosis \[[@pcbi.1005350.ref034]\], schizophrenia \[[@pcbi.1005350.ref035]\], autism spectrum disorder \[[@pcbi.1005350.ref036]\], and alcohol dependence \[[@pcbi.1005350.ref037]\], and to predict onset or progression of, for example, Alzheimer's disease \[[@pcbi.1005350.ref038]--[@pcbi.1005350.ref044]\], major depressive disorder \[[@pcbi.1005350.ref045]\], and attention-deficit/hyperactivity disorder \[[@pcbi.1005350.ref046]\].
More subtle shape measures may provide more sensitive and specific biomarkers, and combining shape measures in a multivariate analysis can improve results over any single measure \[[@pcbi.1005350.ref047]\]. The lack of shape measures may be attributable to the paucity of software programs such as BrainVISA \[[@pcbi.1005350.ref048],[@pcbi.1005350.ref049]\] (<https://www.nitrc.org/projects/brainvisa_ext>) that compute more nuanced measures. Sulcal width has been | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
Otitis media (OM), inflammation of the middle ear, remains the most common cause of hearing impairment in children \[[@pgen-0020149-b001],[@pgen-0020149-b002]\]. Acute episodes of OM in infants and children are most often associated with middle ear infections involving the pathogens Streptococcus pneumoniae and Haemophilus influenzae \[[@pgen-0020149-b003]\]. Prolonged stimulation of the inflammatory response, along with poor mucociliary clearance, can also lead to the persistence of middle ear fluid giving rise to the clinical presentation of otitis media with effusion \[[@pgen-0020149-b002]\]. In a substantial portion of children, recurrent episodes of OM or a chronic suppurative OM will develop. The high prevalence of the disease, coupled with its recurrent and chronic nature, accounts for the large number of tympanostomies undertaken in affected children. OM is still the most common cause of surgery in children in the developed world. There is still considerable debate over the etiology of OM and the underlying pathological mechanisms \[[@pgen-0020149-b002]\]. However, risk factors for OM include craniofacial abnormalities, impaired mucocilliary function, and the presence of an inflammatory stimulus, such as bacteria. There is evidence from studies of the human population and mouse models that there is a significant genetic component predisposing to recurrent or chronic OM \[[@pgen-0020149-b004]--[@pgen-0020149-b007]\], yet little is known about the underlying genetic pathways involved. While several inbred strains are predisposed to the development of OM, their genetic analysis and utility is compounded by the complex genetic bases and the low penetrance of the phenotype \[[@pgen-0020149-b006]\]. In addition, there are several mouse mutants that demonstrate an OM phenotype, but the OM develops as part of a complex syndrome with a wide spectrum of phenotypes \[[@pgen-0020149-b006]\]. It will be important to identify and characterize the genes underlying highly penetrant mouse mutants that develop OM in the absence of other diverse pathology and represent appropriate models for OM in the human population.
Large-scale phenotype-driven mouse ENU (*N*-ethyl-*N*-nitrosourea) mutagenesis programs provide a rich source of novel mutant phenotypes that are the basis for systematic efforts to identify the genetic basis for diverse disease states \[[@pgen-0020149-b008]--[@pgen-0020149-b010]\]. One such screen at MRC Harwell, recovered a large number of mutant phenotypes representing ENU-induced mutations at a number of novel loci in the mammalian genome \[[@pgen-0020149-b009]\]. Mouse models have and continue to play an important role in studying the genetic causes of hearing impairment. A number of mutations have been cloned and have provided us with several profound insights into the critical proteins involved with the development and function of the auditory apparatus at the level of both the middle and inner ears \[[@pgen-0020149-b011],[@pgen-0020149-b012]\]. Nevertheless, it is clear that we do not possess mouse mutants for all loci and pathways potentially involved in hearing impairment.
We report the characterization of a new mutant, *Junbo,* identified in the Harwell mutagenesis program as having a deafness phenotype. *Junbo* is a model of OM that shares many features with the human condition. Acute OM arises spontaneously in the postnatal period and develops into chronic suppurative OM with otorrhea. The underlying molecular basis of this phenotype has been identified as a mutation in the *Evi1* transcription factor causing a nonconservative Asn763Ile change in the second of the two zinc-finger domains in this protein. The *Junbo* mouse highlights a new role for the transcription factor *Evi1* and provides the first evidence for the genetic pathways involved in the etiology of this complex childhood disease.
Results {#s2}
=======
Identification, Mapping, and Cloning of the *Junbo* Mutation {#s2a}
------------------------------------------------------------
An ENU mutagenesis screen \[[@pgen-0020149-b009]\] identified a new dominant mutant, *Junbo (Jbo),* with hearing loss. Preliminary phenotyping using a click-box test (see [Materials and Methods](#s4){ref-type="sec"}) of an age-matched cohort derived from the founder mouse indicated that mice demonstrated a hearing loss at \~40 d after birth (DAB). We used a pooling strategy employing DNA from affected mice and genome-wide fluorescent simple sequence length polymorphism-based screening \[[@pgen-0020149-b009],[@pgen-0020149-b013]\] to provide an initial map position for the *Jbo* mutation on Chromosome 3. This map position was further refined using additional affected animals to an approximately 1.5-Mb region delineated by the *Eif5a2* locus and microsatellite marker *D3Mit178.* Direct sequence analysis of coding regions within this interval identified an A2288T transversion in the *Evi1* locus, causing a nonconservative Asn763Ile change in the second of the two zinc-finger domains in this protein ([Figure 1](#pgen-0020149-g001){ref-type="fig"}A and [1](#pgen-0020149-g001){ref-type="fig"}B). No other sequence changes were identified in any other coding sequences within the minimal nonrecombinant region containing the mutation.
{#pgen-0020149-g001}
A knockout allele of *Evi1* has been produced, *Evi1^tm1Mmor^* \[[@pgen-0020149-b014]\]. *Evi1^tm1Mmor^* mice carry a targeted deletion resulting in an isoform-specific null for the longest *Evi1* transcripts, while the Δ324 (shorter) isoform \[[@pgen-0020149-b015],[@pgen-0020149-b016]\] remains unaltered. This isoform lacks the final two zinc-finger motifs from the first (N-terminal) DNA-binding domain and consequently is predicted to exhibit altered binding abilities. Characterization of heterozygote mice carrying this targeted mutant failed to uncover any phenotype, while homozygotes show prenatal lethality from presumptive cardiac failure \[[@pgen-0020149-b014]\]. In addition, these embryos displayed widespread hypocellularity, most markedly of the cortical mesenchyme, retarded development of the first and second branchial arches, and severely reduced vasculature of the yolk sac. To confirm that the A2318T alteration identified in *Evi1* is responsible for the *Junbo* phenotype, we undertook a complementation screen between *Jbo*/+ and *Evi1^tm1Mmor^*/+ animals. 81 live births were produced from crosses of *Jbo*/+ and *Evi1^tm1Mmor^*/+ mice and all were genotyped. None of the progeny coinherited the *Evi1^tm1Mmor^* and the *Jbo* mutations. However, the other expected genotypes were recovered---*Jbo*/+ (38%), *Evi1^tm1Mmor^*/+ (28%), +/+ (33%)---confirming the allelism of the knockout and *Junbo* mutant. We established intercrosses between *Jbo/+* animals using in vitro fertilization and implantation into wild-type females as *Jbo/+* females undergo repeated spontaneous abortion. At 10.5 days postcoitum (dpc), 17% of homozygote mice had small hind limbs, a large pericardial sac, and a malformed forebrain, features demonstrated by the knockout \[[@pgen-0020149-b014]\]. However, many homozygotes were scored as normal in appearance at this and later stages and proceeded to die between E18. | {
"pile_set_name": "PubMed Central"
} |
Background
==========
A randomized, double-blind, placebo-controlled study was performed to evaluate the effect of adding protein (PRO) to a recovery mixture on exogenous and endogenous substrate oxidation during post-recovery exercise. Many studies have shown that carbohydrates (CHO) effectively restore glycogen post-exercise \[[@B1]\]. Some have also suggested that the addition of PRO to a CHO drink may produce further improvements \[[@B2]\]. CHO and PRO ingestion during recovery may result in higher CHO oxidation during subsequent exercise, which may be more beneficial to endurance performance because of preservation of endogenous substrates \[[@B3]\].
Methods
=======
With institutional ethics approval six well-conditioned men \[age: 34.0 yrs ± 8.2; body mass (BM): 75.6 kg ± 7.1; max: 62.5 ml•kg BM-1•min-1 ± 6.5\] completed a depletion protocol, followed by a 4-hour recovery period, and a subsequent 60 min cycle at 65% max on 3 occasions. During recovery subjects ingested either a placebo (PL), MD+13C-GAL+PRO (highly naturally enriched maltodextrin, 13C-labelled galactose, whey protein hydrolysate, L-leucine, L-phenylalanine; 0.5 +0.3 +0.2 +0.1 +0.1 g•kg BM-1•h-1) or MD+13C-GAL (0.9 +0.3g•kg BM-1•h-1) drink. O2 consumption (L/min) and CO2 production (L/min) were analyzed using breath-by-breath methodology (Metalyzer 3B, Cortex, Leipzig, Germany). Samples of expired air for determination of the 13C enrichment were collected every 15 min of the post-ingestion exercise. Data expressed as means ± s. Statistical significance set at p ≤ 0.05.
Results
=======
The mean rate of exogenous CHO oxidation (g·min^-1^) after MD+^13^C-GAL vs. MD+^13^C-GAL+PRO was: 1.80 ± 0.26 vs. 1.60 ± 0.18 (at 15 min), 1.85 ± 0.17 vs. 1.61 ± 0.17 (at 30 min), 1.88 ± 0.13 vs. 1.59 ± 0.20 (at 45 min), and 1.81 ± 0.12 vs. 1.47 ± 0.22 (at 60 min), respectively. The mean rate of endogenous CHO oxidation (g·min^-1^) after MD+^13^C-GAL vs. MD+^13^C-GAL+PRO was: 1.33 ± 0.21 vs. 1.66 ± 0.31 (at 15 min), 0.95 ± 0.31 vs. 1.27 ± 0.40 (at 30 min), 0.72 ± 0.25 vs. 1.47 ± 0.20 (at 45 min), and 0.78 ± 0.26 vs. 1.64 ± 0.22 (at 60 min), respectively. Differences between conditions were statistically significant at 45 and 60 min (p \< 0.02). 38.8% of the total ingested CHO dose was oxidized after MD+^13^C-GAL+PRO, which was 8.5% higher than in the MD+^13^C-GAL trial (30.3%). The contribution of exogenous CHO, endogenous CHO and fat towards the total energy expenditure was: 0, 38.6, 61.4% (PL), 40.7, 20.7, 38.6% (MD+^13^C-GAL), 34.2, 33.1, 32.7% (MD+^13^C-GAL+PRO), respectively.
Conclusion
==========
These results suggest that the inclusion of PRO in the mixture results in a higher amount of total CHO oxidized. However, at the same time adding PRO to the drink seems to increase endogenous CHO oxidation and decrease exogenous CHO and fat oxidation. On the other hand, MD+^13^C-GAL seems to promote higher contribution of exogenous CHO and fat but lower endogenous CHO to total energy expenditure, which is believed to be more beneficial to endurance performance.
| {
"pile_set_name": "PubMed Central"
} |
The authors confirm that all data underlying the findings are fully available without restriction. All data are included within the manuscript and Supporting Information files.
Introduction {#s1}
============
The Japanese traditional medicine (Kampo) daikenchuto (TU-100) has been established to have anti-inflammatory, prokinetic, and blood flow effects in the gastrointestinal tract in both animal models as well as humans [@pone.0097456-Jin1]--[@pone.0097456-Kaneko1]. TU-100 is an extract from a mixture of ginseng radix, processed ginger, and Japanese green pepper (30%, 50%, 20% by weight). All three plant extracts contribute a number of active phytochemicals. Ginger contains several gingerols and shogaols (6-, 8-, and 10- isomers) that have anti-inflammatory and blood flow effects and are believed to act by modulating mitogen activated protein kinase (MAPK), protein kinase B (Akt), and NF-κB activities [@pone.0097456-Kim1]--[@pone.0097456-Li1]. Japanese pepper contains hydroxy-sanshools (alpha and beta) that alter intestinal blood flow, motility, and barrier function by inducing adrenomedullin and calcitonin gene related peptides [@pone.0097456-Kono1], [@pone.0097456-Kono3], [@pone.0097456-Kono4]. These compounds have been shown to activate intestinal epithelial TRPA1 channels [@pone.0097456-Kono5]. Ginseng contains diverse compounds including protopanadiols and protopanaxatriols that exert anti-inflammatory effects. These and other ginseng-containing compounds modulate cell growth and act as anti-cancer agents [@pone.0097456-Jin2]--[@pone.0097456-Zhang1]. In addition to these effects of individual extract constituents, TU-100 has been shown to activate nicotinic acetylcholine receptors, contributing to its effects on motility [@pone.0097456-Endo1].
TU-100 has been shown to decrease intestinal inflammation in models of experimental colitis, including the trinitrobenzene sulfonic acid-induced colitis in the mouse and the adoptive transfer model of CD4^+^ CD45RB^high^ cells in the SCID knockout mouse [@pone.0097456-Kono3], [@pone.0097456-Iwasa1]. The anti-inflammatory actions of TU-100 were proposed to be multifactorial. Induction of adrenomedullin and CGRPs by the ginger shogaols and Japanese pepper sanshools appear to play a role since neutralization of adrenomedullin decreases the anti-inflammatory effects of TU-100 in TNBS colitis [@pone.0097456-Kono3], [@pone.0097456-Iwasa1]. Activation of TRPA1 channels may contribute to this effect of TU-100. The TU-100-induced blood flow effect is blocked by a CGRP antagonist (inhibits both adrenomedullin (a CGRP family member) and CGRP) and also blocked by antibody to adrenomedullin. The effect of TU-100 directly on intestinal epithelial cells is mediated by TRPA1. TU-100 effects CGRP also, but appears to be mediated via activation of TRPV1 on intestinal sensory nerves. Gingerols, shogaols and hydoroxysanshools are TRPV1 agonists \[24. 25\]. It has not been determined whether adrenomedullin neutralization blocks the effect of TU-100\'s effect on CGRP. Different components of TU-100 affect adrenomedullin differentially. Ginger compounds, especially shogaols, strongly stimulate TRPA1-mediated adrenomedullin release in normal rats [@pone.0097456-Kono5] while hydroxysanshools, from Japanese pepper, have a similar but weaker effect in normal rodents. In the ischemic intestine, the effect of hydroxysanshools is greater in the diseased (ischemic) portions of intestine [@pone.0097456-Kono4] while shogaols are not as effective in the ischemic intestine.
To extend our understanding of TU-100\'s anti-inflammatory effects, we investigated the actions of TU-100 in a model of T-cell mediated inflammation. In contrast to the TNBS- and CD4^+^ CD45RB^high^ adoptive transfer models, activation of CD3^+^ T cells in mice with anti-CD3 monoclonal antibody results predominantly in small bowel inflammation [@pone.0097456-Radojevic1]--[@pone.0097456-Tang1]. This was originally observed in humans treated with an anti-CD3 antibody to suppress organ transplant rejection. These patients developed a systemic cytokine response [@pone.0097456-Abramowicz1], [@pone.0097456-Charpentier1]. Intraperitoneal injection of anti-CD3 antibody in mice appears to selectively activate small intestinal CD3^+^ T-lymphocytes and cause rapid pooling of intestinal contents (an effect called "enteropooling") within 1--3 hours. This is followed by apoptosis of villus epithelial cells within 1.5--3 hours and induction of crypt epithelial cell apoptosis within 24 hours [@pone.0097456-Radojevic1], [@pone.0097456-Miura1]. Anti-CD3 antibody also increases TNFα levels in the small intestinal mucosa, an effect that appears essential to the development of enteritis, as anti-CD3 antibody treatment does not increase enteropooling or cause diarrhea in the TNFα receptor knockout mouse [@pone.0097456-Musch1].
The present studies show TU-100 pre-treatment blocks jejunal enteropooling stimulated by anti-CD3 antibody, villus shortening, and subsequent development of enterocyte apoptosis. TU-100 also inhibits the induction of TNFα by anti-CD3 antibody. Notably, enteritis induced by anti-CD3 antibody is comparable in germ-free (GF) mice and their specific pathogen free (SPF) counterparts. Treatment with either TU-100 or the ginger component block anti-CD3 antibody-induced enteritis in GF mice, indicating that their effects in this model are independent of gut microbes.
Materials and Methods {#s2}
=====================
Mouse studies and ethic statement {#s2a}
---------------------------------
All animal work was approved by the University of Chicago Institutional Animal Care and Use Committee (Institutional Animal Care and Use Committee protocol 72101). C57Bl6/J mice were bred in house for all studies. Either specific pathogen free mice (SPF) or germ free (GF) were used. Mice were from 8--14 weeks of age and both genders were used. Mice were sacrificed using CO~2~ followed by cervical dislocation as approved by the University of Chicago Institutional Animal Care and Use Committee. TU-100 was included in diet AIN-76A at 15 gm/kg and mice were fed this diet for 3 days prior to treatment with anti-CD3 antibody (monoclonal 145 2C11 obtained from Fitch Monoclonal Antibody Core, Cancer Research Center, University of Chicago). Three days plus gavage one hour prior to anti-CD3 antibody injection was selected as preliminary experiments demonstrated maximal inhibition of enteropooling within this time. Mice were injected with 200µg antibody and sacrificed after 3 or 24 hours (these times points were selected on the basis of previous reports that defined the optimal times for different enteritis-associated changes (e.g. enteropooling, villus and crypt cell apoptosis) [@pone.0097456-Musch1], [@pone.0097456-Miura1]. A laparotomy was performed and a ligature placed around the intestine at the ligament of Treitz, and a second ligature carefully placed 3--4 cm distal to the first. This segment was then removed and the weight and length determined. Sections were fixed in formalin for determination of apoptosis by TUNEL staining (In Situ Death Kit, Roche, Indianapolis, IN) or stained with hematoxylin and eosin for histological examination for villus height and crypt depth using NIH Image J software. The imaging station included an embedded scale to calibrate length in microns. At least 20 villi and crypts in each section and 3 sections from each mouse were analyzed to determine villus height and crypt depth. Histological measurements were performed by two authors (NU, MWM) who were blinded to the treatment conditions for a given mouse. From adjacent sections, RNA was extracted using Trizol reagent according to the manufacturer\'s directions (Invitrogen, Carlsbad, CA) and protein was extracted as previously described [@pone.0097456-Calixto1].
Epithelial immune cell coculture experiments {#s2b}
--------------------------------------------
Human colonic adenocarcinoma Caco2BBE cells were grown as monolayers on permeable supports. Caco2BBE cells were a gift of Dr. Mark Mooseker, Yale University [@pone.0097456-Petersen1]. Cells were allowed to grow for 7 days to mature and then treated overnight with human IFNγ (100 U/ml) to increase expression of TNFα receptors. Human Jurkat-1 cells were seeded on the serosal/bottom side of the permeable support. After one day, the human anti-CD3 antibody UCHT1 (BD Biosciences) was added (200 ng/ml) and Jurkat-1 and Caco2BBE cells were harvested separately. The Jurkat cells were pelleted from the medium by centrifugation and the media analyzed for secreted human TNFα. Jurkat and Caco2BBE cells were extracted and cell lysates analyzed | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
Glaucoma is a blinding optic neuropathy affecting nearly 60 million people world-wide. Among all forms of glaucoma, primary open angle glaucoma is the most frequent etiology \[[@CR1]\]. The therapeutic arsenal for primary open angle glaucoma includes pressure lowering medications, laser treatments and surgery. Trabeculectomy and shunt surgery come with a range of complications like hypotony, leakage, shallowing of the anterior chamber and choroidal effusion as well as valve-related complications such as encapsulation, tube blockage, erosion and endothelial cell loss \[[@CR2]\]. A novel technique of creating an alternative route through an ab interno approach via implantation of a collagen implant XEN has been described in an attempt to overcome the different complications which are seen in both trabeculectomy and shunt operations \[[@CR3]\]. As with every new method, there is a lack of practitioner experience and knowledge about long-term outcomes in terms of effectiveness, technique and complications.
In this case report, we aimed to present a hypertrophic bleb complication after the third month of XEN gel implantation and to evaluate complication management. Similar studies have not yet been published. For that reason, this study contains novel methods and results. However, by this minimal invasive method, hypertrophic bleb complication of XEN gel implant has been successfully treated.
Case presentation {#Sec2}
=================
A 75-year-old male patient who recently was accepted for a decrease in vision and who was treated for glaucoma appealed to the clinic. He had a longstanding history of pseudoexfoliation glaucoma which had been previously treated with topical medications.
His best corrected visual acuity was 6/38 (Snellen chart) in the right and left eyes. Intraocular pressure was 19 mmHg in the right eye and 23 mmHg in the left eye (Goldman applanation tonometry). Deep anterior chamber and presence of pseudoexfoliation materials with corticonuclear cataract was seen in both eyes by slit-lamp examination. Gonioscopic examination of both eyes has revealed open iridocorneal angle in all quadrants (Shaffer-Kanski classification system, Grade 4). On posterior segment examination we observed bilateral glaucomatous neuroretinal rim loss and vertical cup / disc ratio of each eye was 0.8.
Combinated cataract glaucoma surgery was planned for the patient, and XEN45 (Allergan, Irvine, California, USA) gel implantation was performed from the upper-nasal quadrant after phacoemulsification and intraocular lens implantation. After subconjunctival/sub-Tenon 0.1 ml (mL) lidocaine \[20 mg (mg) / mL\] injection to create an area for XEN implantation, 0.1 mL 0.2 mg / mL mitomycin C was applied to the implantation site in the upper nasal quadrant towards the posterior region with gentle massage. Stent placed to anterior trabecular meshwork as ab interno approach and by using intraoperative gonioscopy its placement was confirmed. At the end of surgery, the recommended placement of the XEN gel implant 1--2-3 mm (anterior chamber, sclera and subconjunctival/sub-Tenon's area, respectively) was confirmed and surgery completed uneventfully.
In the first 3 months, the intraocular pressure ranged from 9 to 13 mmHg without drug use, and no complications were determined. At the third month control, a bleb was seen that extended through the nasal 180 degrees of the eye which caused ectropion of the lower eyelid, and the value of the IOP was 12 mmHg (Fig. [1](#Fig1){ref-type="fig"}). Considering that the large bleb was linked to overfiltration, topical/systemic carbonic anhydrase treatment and tight closure were performed. Although the IOP was 7 mmHg after treatment, there was not any change in the size of the bleb. The clinic personnel thought this was a hypertrophic bleb, and the bleb was drilled by suture needle. In order to avoid a recurrence, a "Drainage Channel with Sutures," extending from both sides of the XEN gel implant to the globe equator, was created (Fig. [2](#Fig2){ref-type="fig"} and [3](#Fig3){ref-type="fig"}). This procedure was carried out with topical proparacain eye drops. A conjunctiva/scleral suture was made with 8/0 polyglactin to create scar tissue. While the nasal conjunctiva and the lower eyelid were observed quiet at the one-year follow-up appointment with the patient (Fig. [4](#Fig4){ref-type="fig"}), the IOP was measured at around 13 mmHg. Fig. 1Hypertrophic filtration bleb caused ectropion of the lower eyelid Fig. 2The "Drainage Channel with Sutures" extending from both sides of the XEN gel implant to the globe equator Fig. 3Schematic diagram of "Drainage Channel with Sutures" technique application Fig. 4Image of XEN gel and the "Drainage Channel with Sutures" after l year
Discussion and conclusion {#Sec3}
=========================
XEN gel implant is promising glaucoma drainage surgery in terms of short operation time, rapid healing process, fewer complications and easy applicability. The implant utilizes subconjunctival filtration, creating a nonphysiologic route for aqueous outflow which is the basis of the traditional trabeculectomy and aqueous shunt glaucoma surgeries \[[@CR2]\].
Several articles in the literatures have reported on relatively frequent complications such as hypotonia, choroidal effusion or choroidal folds, hyphema, the Seidel sign and a flat anterior chamber \[[@CR4]\]. The filtration blebs normally produced are usually diffuse and not very large (approximately 3 h quadrant). In the present case, at the third month control, the patient presented a significant bleb that produced mechanical ectropion, a complication which is rarely described in the literature. When medical and conservative treatment do not resolve the situation, surgical treatment is indicated which comprises bleb resection and conjunctival stitches or autologous injection of platelet concentrates \[[@CR5]\].
A similar case using fibrin adhesive has been previously described \[[@CR6]\]. However, this method comprises the adhesion of all of the bleb and the likelihood of increased IOP. Therefore, instead of using fibrin adhesive, we preferred to use direct liquid drainage towards the back of the globe.
In conclusion, as with every new method, there is a lack of knowledge about long-term outcomes in terms of effectiveness, technique and complications. This case report shows that hypertrophic bleb complication of XEN gel implant can be successfully treated by "Drainage Channel with Sutures" method but stronger evidence is needed.
IOP
: Intraocular pressure
mg
: milligrams
MIGS
: Minimally invasive glaucoma surgery
mL
: milliliters
mmHg
: millimeters of mercury
**Publisher's Note**
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
None relevant.
KY and AM have equally contributed to paper preparation and writing. KY has critically reviewed the paper. All authors read and approved the final manuscript.
The authors received no grants and funds in support of the study.
Not applicable.
Not applicable.
Consent for the publication of this case report, any additional related information and images was taken from the patient involved in the study. The informed consent obtained from the patient had been in writing.
The authors declare that they have no competing interests.
| {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION {#s1}
============
Preterm premature rupture of membranes (PPROM), which is defined as spontaneous rupture of fetal membranes before labor begins before 37 weeks' gestation, affects approximately 3% of all pregnancies ([@ref1]). It is closely related with significant maternal and fetal morbidity and mortality. PPROM is one of the most common causes of preterm delivery, and is associated with maternal and neonatal infections ([@ref2], [@ref3]). The risk of chorioamnionitis is approximately 6-10% and increases to 40% if it prolongs over 24 hours ([@ref4]). Moreover, neonatal infection risk is two times greater in patients without chorioamnionitis ([@ref5]). Infection risk increases with PPROM, and neonatal hypoxia and jaundice are also more common in this condition ([@ref6]). Early diagnosis is very important to provide maternal and fetal well-being because of these serious complications ([@ref7]). Even though the pathophysiologic mechanism of PPROM has not been clearly defined and is multifactorial; inflammation plays a crucial role in the rupture of membranes ([@ref8]). The role of inflammation in PPROM has been evaluated in many studies, and a significant association between various inflammatory markers and PPROM has been reported ([@ref9], [@ref10], [@ref11]). Many inflammatory markers were recently evaluated for their ability to diagnose membrane rupture at early stages.
In chronic inflammatory processes, megakaryocytic series proliferate increasingly and lymphocyte counts tend to decrease due to severe apoptosis. As a consequence, markers obtained from total blood counts such as the platelet-to-lymphocyte ratio (PLR) can be affected in severe chronic inflammatory diseases ([@ref12]).
PLR is a widely available, effective, and simple marker. It has been proposed as a predictive and prognostic parameter for many kinds of diseases such as cardiovascular diseases and malignancies ([@ref13], [@ref14]). Also, it has been shown to be related with gestational diabetes mellitus, acute appendicitis, preeclampsia, recurrent pregnancy loss, and preterm labor in pregnant women ([@ref15], [@ref16], [@ref17], [@ref18]). There are scant data about the relation between PLR and presence of PPROM in the literature. Therefore, we investigated the role of PLR for predicting PPROM at early stages.
MATERIAL AND METHODS {#s2}
====================
Study population and data collection {#s2a}
------------------------------------
This is a prospective case-control study, in which 121 pregnant women with PPROM and 96 age- matched pregnant women with spontaneous preterm labor between January 2014 and December 2015 were enrolled. It was conducted at a university-affiliated research and training hospital.
Age, gestational week, gravida, parity, delivery mode, birth weight, APGAR score, neonatal intensive care unit (NICU) admission rate, presence of neonatal sepsis, and development of respiratory distress syndrome (RDS) were recorded from medical records. In addition, results of a complete series of routine laboratory investigations including complete blood cell counts were recorded. Blood samples were taken from all study participants on admission and complete blood counts were analyzed using a Coulter LH 780 Hematology Analyzer (Beckman Coulter Ireland INC, Mervue, Galway, Ireland). The neutrophil-to-lymphocyte ratio (NLR) was calculated by dividing the neutrophil count by the lymphocyte count, and PLR was calculated as the number of platelets divided by the lymphocyte count, both of which were obtained from the same blood samples.
Inclusion criteria {#s2b}
------------------
The inclusion criteria included PPROM diagnosed as defined between 24-37 gestational weeks of pregnancy, and eligible for recording complete blood samples and other clinical perinatal findings.
Exclusion criteria {#s2c}
------------------
We excluded patients with multiple gestations, hematologic disorders, malignancies, hepatic disease, history of autoimmune disease, any inflammatory disease of pregnancy such as gestational diabetes mellitus and preeclampsia, any acute or chronic infectious or inflammatory diseases, pregnancies with fetal chromosomal anomalies, intrauterine growth restriction, any fetal infection, and women who underwent any invasive procedures such as amniocentesis.
Diagnosis of preterm premature rupture of membranes {#s2d}
---------------------------------------------------
PPROM was diagnosed if 1 and one of the other following were present; 1) all patients were asked for risk factors and any fluid leakage before 37 weeks' gestation and regular uterine contractions, 2) examination in dorsolithotomy position with a sterile speculum to verify the pooling of amniotic fluid in the fornices or active flowing of amniotic fluid from the cervix, 3) positive nitrazine test, 4) when necessary, confirming the presence of insulin-like growth factor binding proteins (ACTIM PROM test; MedixBiochemica, Kauniainen, Finland) in the vaginal fluid.
All participants gave informed consent and the local ethics committee approved the study.
Statistical analysis {#s2e}
--------------------
SPSS version 17.0 (SPSS Inc., Chicago, IL, USA) was used for statistical analyses. The Shapiro-Wilk test was used to determine whether the variables were distributed normally. Categorical variables were presented as frequencies and/or percentages, and continuous, normally distributed variables were stated as mean ± SD. Student's t-test or the Mann-Whitney U test were performed to compare normally distributed continuous numeric variables, and the Chi-square test was used to compare categorical variables between the two groups. In order to determine the sensitivity and specificity of PLR values to predict PPROM, receiver-operator curve (ROC) analysis was performed. The area under the curve (AUC) value, specificity, sensitivity were reported. A p value of ≤0.05 was considered statistically significant.
RESULTS {#s3}
=======
Baseline demographic and clinical features of the patients were shown in [Table 1](#t1){ref-type="table"}. There was no difference between the two study groups in terms of age, gravida, parity, gestational age and lymphocyte count (p\>0.05). The neutrophil count was significantly higher in patients with PPROM as compared with controls (9948.4±3393.2 vs. 7466.1±1698.5/mm³, p\<0.001). Similarly, the platelet count was found to be significantly higher in the PPROM group (244.5±60 vs. 210.6±64.8 x1000/mm³, p\<0.001). NLR and PLR were both higher in the PPROM group (p\<0.001). Correlation analysis revealed that PLR levels were positively correlated with NLR (r= 0.10, p=0.031).
The neonatal outcomes of pregnancies were presented in [Table 2](#t2){ref-type="table"}. The groups did not significantly differ with regard to birth weight, RDS, APGAR score, and NICU admissions (p\>0.05). Sepsis was more common in the PPROM group (34.7% vs. 19.8%, p=0.02).
The ability of the PLR to diagnose PPROM was evaluated using ROC curve analysis. The AUC for PLR was 0.62 (p\<0.001) ([Figure 1](#f1){ref-type="fig"}). The sensitivity and specificity of the PLR was 57.8% and 73.7%, respectively, at a threshold \>117.14. PLR values \>117.14 were significantly related with increased risk of PPROM.
DISCUSSION {#s4}
==========
The main findings of our study are as follows: ([@ref1]) NLR and PLR were both significantly higher in the PPROM group as compared with controls ([@ref2]). With the exception of sepsis, a similar relation was found between the two groups according to the neonatal outcomes of pregnancies; sepsis was more common in the PPROM group ([@ref3]). PLR values \>117.14 were significantly related with an increased risk of PPROM.
PPROM, the exact pathophysiology of which is still controversial, leads to common and serious pregnancy complications such as RDS, intraventricular hemorrhage, necrotizing enterocolitis, sepsis, and sudden intrauterine death due to umbilical cord compression. Recent studies demonstrated that the major etiologic mechanism of PPROM was inflammation ([@ref19], [@ref20]). However, many inflammatory markers have been studied for their ability to diagnose PPROM accurately; a reliable marker for diagnosing PPROM that can demonstrate intraamniotic or placental inflammation is not evident.
Cytokines that participate in inflammatory reactions have been reported to be associated with PPROM. Satar et al. ([@ref21]) reported that interleukin (IL)-8 levels were increased in PPROM in maternal serum and in the umbilical cord. Similarly, IL-6 was found elevated only in the umbilical cord, especially in PPROM with microbial invasion and histologic chorioamnionitis ([@ref21]). In the study of Flídrová and Krejsek ([@ref22]), cytokines such as tumor necrosis factor (TNF)-α, IL-8, IL-6, and IL-1, were reported to be increased in preterm birth and PPROM.
A study by Popowski et al. ([@ref23]) demonstrated that C-reactive protein was elevated in patients with PPROM with clinical and histopathologic chorioamnionitis. Also, procalcitonin, proadrenomedullin, and serum amyloid A levels were reported to be related with chorioamnionitis before any clinical signs appear ([@ref24]).
Another marker that can play a role in inflammatory processes is NLR. In systemic inflammatory conditions, leukocyte subtypes differentiate as an immune response. Neutrophil counts increase and lymphocyte counts decrease. As such, the NLR tends to alter in various systemic | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#s0005}
===============
Pathology diagnosis has been performed by a human pathologist observing the stained specimen on the slide glass using a microscope. In recent years, attempts have been made to capture the entire slide with a scanner and save it as a digital image (whole slide image, WSI) \[[@bb0005]\]. As a large number of WSIs are being accumulated, attempts have been made to analyze WSIs using digital image analysis based on machine learning algorithms to assist tasks including diagnosis.
Digital pathological image analysis often uses general image recognition technology (e.g. facial recognition) as a basis. However, since digital pathological images and tasks have some unique characteristics, special processing techniques are often required. In this review, we describe the application of digital pathological image analysis using machine learning algorithms, and its problems specific to digital pathological image analysis and the possible solutions. Several reviews that have been published recently discuss histopathological image analysis including its history and details of general machine learning algorithms \[[@bb0010], [@bb0015], [@bb0020], [@bb0025], [@bb0030], [@bb0035]\]; in this review, we provide more pathology-oriented point of view.
Since the overwhelming victory of the team using deep learning at ImageNet Large Scale Visual Recognition Competition (ILSVRC) 2012 \[[@bb0040]\], most of the image recognition techniques have been replaced by deep learning. This is also true for pathological image analysis \[[@bb0045], [@bb0050], [@bb0055]\]. Therefore, even though many techniques introduced in this review are related to deep learning, most of them are also applicable for other machine learning algorithms.
2. Machine Learning Methods {#s0010}
===========================
[Fig. 1](#f0005){ref-type="fig"} shows typical steps for histopathological image analysis using machine learning. Prior to applying machine learning algorithms, some pre-processing should be performed. For example, when cancer regions are detected in WSI, local mini patches around 256 × 256 are sampled from large WSI. Then feature extraction and classification between cancer and non-cancer are performed in each local patch. The goal of feature extraction is to extract useful information for machine learning tasks. Various local features such as gray level co-occurrence Matrix (GLCM) and local binary pattern (LBP) have been used for histopathological image analysis, but deep learning algorithms such as convolutional neural network \[[@bb0045],[@bb0050],[@bb0060], [@bb0065], [@bb0070]\] starts the analysis from feature extraction. Features and classifiers are simultaneously optimized in deep learning and features learned in deep learning often outperforms other traditional features in histopathological image analysis.Fig. 1Typical steps for machine learning in digital pathological image analysis. After preprocessing whole slide images, various types of machine learning algorithms could be applied including (a) supervised learning (see [Section 2](#s0010){ref-type="sec"}), (b) unsupervised learning (see [Section 2](#s0010){ref-type="sec"}), (c) semi-supervised learning (see [Section 4.2.2](#s0055){ref-type="sec"}), and (d) multiple instance learning (see [Section 4.2.2](#s0055){ref-type="sec"}). The histopathological images are adopted from The Cancer Genome Atlas (TCGA) \[[@bb0170]\].Fig. 1
Machine learning techniques often used in digital pathology image analysis are divided into supervised learning and unsupervised learning. The goal of supervised learning is to infer a function that can map the input images to their appropriate labels (e.g. cancer) well using training data. Labels are associated with a WSI or an object in WSIs. The algorithms for supervised learning include support vector machines, random forest and convolutional neural networks. On the other hand, the goal of unsupervised learning is to infer a function that can describe hidden structures from unlabeled images. The tasks include clustering, anomaly detection and dimensionality reduction. The algorithms for unsupervised learning include k-means, autoencoders and principal component analysis. There are derivatives from these two learning such as semi-supervised learning and multiple instance learning, which are described in [Section 4.2.2](#s0055){ref-type="sec"}.
3. Machine Learning Application in Digital Pathology {#s0015}
====================================================
3.1. Computer-assisted Diagnosis {#s0020}
--------------------------------
The most actively researched task in digital pathological image analysis is computer-assisted diagnosis (CAD), which is the basic task of the pathologist. Diagnostic process contains the task to map a WSI or multiple WSIs to one of the disease categories, meaning that it is essentially a supervised learning task. Since the errors made by a machine learning system reportedly differ from those made by a human pathologist \[[@bb0070]\], classification accuracy could be improved using CAD system. CAD may also lead to the reduce variability in interpretations and prevent overlooking by investigating all pixels within WSIs.
Other diagnosis-related tasks include detection or segmentation of Region of Interest (ROI) such as tumor region in WSI \[[@bb0075],[@bb0080]\], scoring of immunostaining \[[@bb0055],[@bb0085]\], cancer staging \[[@bb0070],[@bb0090]\], mitosis detection \[[@bb0095],[@bb0100]\], gland segmentation [@bb0105], [@bb0110], [@bb0115], and detection and quantification of vascular invasion \[[@bb0120]\].
3.2. Content Based Image Retrieval {#s0025}
----------------------------------
Content Based Image Retrieval (CBIR) retrieves similar images to a query image. In digital pathology, CBIR systems are useful in many situations, particularly in diagnosis, education, and research [@bb0125], [@bb0130], [@bb0135], [@bb0140], [@bb0145], [@bb0150], [@bb0160], [@bb0165]. For example, CBIR systems can be used for educational purposes by students and beginner pathologists to retrieve relevant cases or histopathological images of tissues. In addition, such systems are also helpful to professional pathologists, particularly when diagnosing of rare cases.
Since CBIR does not necessarily require label information, unsupervised learning can be used \[[@bb0145]\]. When label information is available, supervised learning approaches could learn better similarity measure than unsupervised learning approaches \[[@bb0135],[@bb0140]\] since the similarity between histopathological images may differ by definition. However, preparing sufficient number of labeled data can be a serious problem as will be described later.
In CBIR, not only accuracy but also high-speed search of similar images from numerous images are required. Therefore, various techniques for dimensionality reduction of image features such as principal component analysis, and fast approximate nearest neighbor search such as kd-tree and hashing \[[@bb0160]\] are utilized for high speed search.
3.3. Discovering New Clinicopathological Relationships {#s0030}
------------------------------------------------------
Historically, many important discoveries concerning diseases such as tumor and infectious diseases have been made by pathologists and researchers who have carefully and closely observed pathological specimens. For example, *H*. *pylori* was discovered by a pathologist who was examining the gastric mucosa of patients with gastritis \[[@bb0165]\]. Attempts have also been made to correlate the morphological features of cancers with their clinical behavior. For example, tumor grading is important in planning treatment and determining a patient\'s prognosis for certain types of cancer, such as soft tissue sarcoma, primary brain tumors, and breast and prostate cancer.
Meanwhile, thanks to the progress in digitization of medical information and advance in genome analysis technology in recent years, large amount of digital information such as genome information, digital pathological images, MRI and CT images has become available \[[@bb0170]\]. By analyzing the relationship between these data, new clinicopathological relationships, for example, the relationship between the morphological characteristic and the somatic mutation of the cancer, can be found \[[@bb0175],[@bb0180]\]. However, since the amount of data is enormous, it is not realistic for pathologists and researchers to analyze all the relationships manually by looking at the specimens. This is where the machine learning technology comes in. For example, Beck et al. extracted texture information from pathological images of breast cancer and analyzed with L1 - regularized logistic regression, and indicated that the histology of stroma correlates with prognosis in breast cancer \[[@bb0185]\]. Other researches include prognosis predictions from histopathological image of cancer \[[@bb0190]\], prediction of somatic mutation \[[@bb0065]\], and discovery of new gene variants related to autoimmune thyroiditis based on image QTL \[[@bb0195]\].
4. Problems Specific to Histopathological Image Analysis {#s0035}
========================================================
In this section, we describe unique characteristics of pathological image analysis and computational methods to treat them. [Table 1](#t0005){ref-type="table"} presents an overview of papers dealing with the problems and the solutions.Table 1Overview of papers dealing with problems and solutions for histopathological image analysis.Table 1SolutionReference*Very large image size*Case level classification summarizing patch or object level classificationMarkov Random Field \[[@bb0085]\], Bag of Words of local structure \[[@bb0090]\] and random forest \[[@bb0070],[@bb0200],[@bb0205]\]
*Insufficient labeled images*GUI toolsWeb server \[[@bb0210],[@bb0215]\]Tracking pathologists\' behaviorEye tracking \[[@bb0220]\], mouse tracking \[[@bb0225]\] and viewport tracking \[[@bb0230]\]Active learningUncertainly sampling \[[@bb0215]\], Query-by-Committee \[[@bb0235]\], variance reduction \[[@bb0240]\] and hypothesis space reduction \[[@bb0245]\]Multiple instance learningBoosting-based \[[@bb0250],[@bb0255]\], deep weak supervision \[[@bb0260]\] and structured support vector machines (SVM) \[[@bb0265]\]Semi-supervised learningManifold learning \[[@bb0150]\] and SVM \[[@bb | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION {#s1}
============
Short-chain fatty acids (SCFA, mainly acetate, propionate and *n*-butyrate) are produced during bacterial fermentation in the large intestine. Among these, *n*-butyrate (butyrate) in particular has attracted much attention because it is the major energy substrate for colonocytes and may play an essential role in maintenance of the colonic mucosa \[[@r1], [@r2], [@r3]\].
Compared with non-starchy polysaccharides, starches have been shown to yield high proportions of butyrate by *in vitro* fermentation in human fecal inocula \[[@r4]\]. With respect to substrate supply to the large bowel microflora, resistant starch (RS) may be a good answer. RS is defined as the sum of starch and degradation products of starch that reach the large intestine \[[@r5]\]. Previous studies with rat experiments showed that both of raw potato starch (PS) and high-amylose cornstarch (HACS) had a major impact on the cecal production of butyrate \[[@r6], [@r7], [@r8]\]. At the same time, however, these studies consistently reported that PS unlike HACS enhanced the molar proportion of butyrate in the total SCFA even when the adaptation period of PS ingestion and dietary dosage of PS differed. However, the reason for this potential difference in butyrate production between the two starches is still unclear.
*In vitro* RS assays repeatedly confirmed that PS is much more resistant to α-amylase digestion than HACS \[[@r9], [@r10]\], but *in vivo* data is relatively scarce except for data from human subjects with ileorectostomy \[[@r11]\]. The difference in molar proportion of cecal butyrate between rats fed PS and HACS may be due to the different amounts of starch entering the large intestine when the rats consume the same amount of the respective starches. Also, starches from different sources have been suggested to affect the digestibility of protein in the diet differently \[[@r12], [@r13]\], implicating the possibility that the ratio of starch to nitrogen in the ileal digesta as a fermentation substrate in the large intestine may differ between in rats fed the diets including PS and HACS. Previous studies clearly indicated that the ratio of carbohydrate to nitrogen (C/N ratio) of fermentation substrate profoundly affected the production of butyrate *in vitro* \[[@r14]\] and *in vivo* \[[@r15], [@r16]\]. Accordingly, these findings may partly explain the difference in molar proportion of cecal butyrate between rats fed PS and HACS.
The aim of this study was to examine whether there is an intrinsic difference in the molar proportion of butyrate between PS and HACS. For this purpose, *in vivo* RS contents of PS and HACS in the small intestine were directly measured using ileorectostomized rats. The ratio of starch to nitrogen of the ileal digesta was also measured in the ileorectostomized rats. Then, we evaluated the cecal fermentation profile of PS and HACS in intact rats under the condition in which the *in vivo* RS contents were similarly set up in the diets. In the present study, we used two special kinds of PS with different phosphorus contents, since it has been suggested that besides the C/N ratio, phosphorus and sulfur are other important factors that act as fermentation substrates to increase cecal butyrate production \[[@r17]\].
MATERIALS AND METHODS {#s2}
=====================
Materials
---------
Normal potato starch (PS) was provided by Matsutani Chemical Co., Ltd. (Osaka, Japan). Additionally, two other kinds of PS, derived from different cultivars (Benimaru and Hokkaikogane) with different phosphorus contents, were provided by Jinno Potato Starch Factory Co., Ltd. (Obihiro, Japan). The phosphorus contents, as determined by the molybdovanadate method \[[@r18]\], were 550 mg/kg (normal PS), 419 mg/kg (Benimaru) and 708 mg/kg (Hokkaikogane), respectively. The latter two were referred to as low-phosphorus (LPPS) and high-phosphorus potato starches (HPPS). HACS was obtained from the National Starch and Chemical Company (Sydney, NSW, Australia), and its amylose content was determined to be 68% by an iodine-colorimetric method \[[@r19]\]. The phosphorus content of HACS was 159 mg/kg. The RS contents of LPPS, HPPS and HACS *in vitro,* as determined by the method of McClearly and Monaghan \[[@r10]\], were 75% (LPPS), 76% (HPPS) and 46% (HACS), respectively.
Care of animals
---------------
Male Wistar rats were purchased at 5 and 8 week-old from Shizuoka Laboratory Animal Center (Hamamatsu, Japan). They were housed in individual screen-bottomed stainless steel cages in a room with controlled temperature (23 ± 2°C) and lighting (light on from 8:00 to 20:00). Rats were fed a control diet for at least 5 days for adaptation. The diet was formulated from 250 g/kg casein, 652.25 g/kg sucrose (except in the preliminary experiment in which normal cornstarch (CS) was used as a carbohydrate source), and 50 g/kg corn oil \[[@r15]\]. The remainder of the diet consisted of vitamins and minerals (AIN-76 \[[@r20]\]). Body weight and food intake were recorded every morning before replenishing the diet. The study was approved by the Animal Use Committee of Shizuoka University, and the animals were maintained in accordance with the guidelines of Shizuoka University for the care and use of laboratory animals.
Preliminary study
-----------------
Twenty-four 8-week-old Wistar rats were used in this study. Rats weighing 185--193 g were divided into 3 groups of 8 rats after acclimation and were allowed free access to the control diet or a diet either containing 200 g HACS or 200 g normal PS/kg. Supplementation of HACS and PS was performed by replacement of an equal amount of CS in the control diet. After feeding the respective diets for 15 days, rats were euthanized by decapitation under anesthesia with diethyl ether, the cecum was excised, and the contents were removed and weighed. The cecal contents were homogenized and then used for measurements of pH and organic acids.
Comparison of starch digestibility between LPPS, HPPS and HACS in ileorectostomized rats (experiment 1)
-------------------------------------------------------------------------------------------------------
Five-week-old Wistar rats were used in this study. After overnight fasting, 24 rats weighing 104--120 g were subjected to an ileorectostomy in which the terminal ileum was connected to the rectum according to the method of Lambert \[[@r21]\], with some modifications \[[@r22]\]. To shorten the recovery period, we did not dissect the cecum and the colon, but the ileocecal valve was ligatured (closed), and then the colonic terminal was anastomosed to the stoma in the abdominal wall to allow the cecal and colonic contents to be excreted naturally. The surgery was performed for 2 consecutive days (12 rats/day were operated on). Postoperatively, the rats were not allowed food and water for the first 24 hr and then were fed the control diet for 14 days. The rats received a daily intramuscular injection of antibiotics \[[@r22]\] at surgery and for 5 days thereafter. The rats lost about 13 g of body weight during the immediate postoperative recovery period. However, they then gained weight, and constant growth rates (3--4 g of body weight gain/d) were achieved 4--5 days after surgery. Rats weighing 121--149 g were divided into four groups (six rats per each) and were freely fed one of the diets containing 200 g of CS, LPPS, HPPS or HACS per kilogram of the diet for 7 days. Thus there were four groups: CS, LPPS, HPPS and HACS (initial body weights 132 ± 5, 132 ± 5, 133 ± 6, and 132 ± 5 g, respectively). Supplementation of each starch was performed by replacement of an equal amount of sucrose in the control diet. Feces (ileal excreta) were collected for the last 3 days of the experimental period, freeze-dried, and stored at -40°C. After the digestibility study was performed, to measure the small intestinal transit time in ileorectostomized rats, all rats further consumed the respective diets at 0800--0900 and 1900--2000 hr for 5 days. After adaptation to meal feeding, rats weighing 165--190 g were fed 3 g of the respective diets including 5% carmine (a water-insoluble and unabsorbable dye) at 1900 hr. Their feces were monitored every 30 min for the first appearance of the red dye.
Comparison of cecal fermentation between LPPS, HPPS and HACS in intact rats (experiment 2)
------------------------------------------------------------------------------------------
Eight-week-old Wistar rats were used in this study. Thirty-two rats weighing 185--193 g were divided into 4 groups of 8 rats after acclimation and were allowed free access to diets either containing 200 g CS, 109 g LPPS, 106 g HPPS, or 200 g HACS per kilogram. Thus there were four groups: 20-CS, 10-LPPS, 10-HPPS and 20-HACS. *In vivo* RS contents were similarly set up at 72 g/kg diet among the 10-LPPS, 10-HPPS and 20-HACS diets according to the findings obtained in | {
"pile_set_name": "PubMed Central"
} |
Introduction {#ece32120-sec-0001}
============
Seasonal polyphenism is a phenomenon observed in species that respond to seasonally changing environmental parameters by expressing distinct phenotypes (Shapiro [1976](#ece32120-bib-0038){ref-type="ref"}; Simpson et al. 2011). The ability of environmental stimuli to determine which of several phenotypes is expressed by the same genome has led many researchers to investigate the underlying mechanisms (Fric et al. [2004](#ece32120-bib-0018){ref-type="ref"}; Suzuki and Nijhout [2008](#ece32120-bib-0043){ref-type="ref"}; Daniels et al. [2014](#ece32120-bib-0013){ref-type="ref"}).
The European map butterfly *Araschnia levana* (Linnaeus, 1758) (Lepidoptera: Nymphalidae) is a textbook example of seasonal polyphenism, because it produces imagoes with two strikingly distinct phenotypes (Fig. [1](#ece32120-fig-0001){ref-type="fig"}). The spring generation (April to June) is reddish with dorsal black spots (*A. levana levana*), whereas the summer generation (July to August) is dark brown with a white band (*A. levana prorsa*). The summer generation also has a larger body size, wing area, and greater mobility than the spring generation (Morehouse et al. [2013](#ece32120-bib-0026){ref-type="ref"}). The caterpillars developing into either the spring or the summer phenotype of the imagoes are exposed to distinct biotic and abiotic environments. Caterpillars encountering long‐day (LD) conditions develop rapidly into adult butterflies of the summer generation (Reinhardt [1984](#ece32120-bib-0034){ref-type="ref"}). Their offspring are exposed to short‐day (SD) conditions, and the resulting pupae enter a dormant state known as diapause characterized by enhanced stress tolerance, which is necessary to survive winter temperatures and prolonged exposure to pathogens (MacRae [2010](#ece32120-bib-0024){ref-type="ref"}). Both the day length during larval development and the temperature during early pupal development are known to influence the imago phenotype (Reinhardt [1984](#ece32120-bib-0034){ref-type="ref"}; Koch [1992](#ece32120-bib-0022){ref-type="ref"}; Windig and Lammar [1999](#ece32120-bib-0046){ref-type="ref"}). However, little is known about the underlying molecular mechanisms (Fric et al. [2004](#ece32120-bib-0018){ref-type="ref"}; Beldade et al. [2011](#ece32120-bib-0009){ref-type="ref"}).
{#ece32120-fig-0001}
We investigated the molecular basis of seasonal polyphenism in *A. levana* by screening for genes that are differentially expressed in prepupae developing from larvae exposed either to LD (18‐h photoperiod) or SD (8‐h photoperiod) conditions. Differentially expressed genes at the onset of metamorphosis were identified by suppression subtractive hybridization (SSH), which has been used successfully for this purpose in several insect species that lack a sequenced genome (Altincicek and Vilcinskas [2007a](#ece32120-bib-0001){ref-type="ref"},[b](#ece32120-bib-0002){ref-type="ref"}; Vogel et al. [2011](#ece32120-bib-0045){ref-type="ref"}; Dobson et al. [2012](#ece32120-bib-0015){ref-type="ref"}). Because both the identity of the differentially expressed genes and the direction of differential expression were unknown, we prepared separate cDNA libraries representing prepupae derived from larvae reared under SD or LD conditions and created LD -- SD and SD -- LD subtracted libraries to identify genes preferentially expressed in the rapidly developing spring phenotype and the overwintering summer phenotype, respectively. We then used a combination of SSH, direct cDNA sequencing, and quantitative real‐time RT‐PCR to identify differentially expressed sequences representing genes with putative diverse roles in the development of *A. levana* seasonal phenotypes.
Materials and Methods {#ece32120-sec-0002}
=====================
Biological specimens {#ece32120-sec-0003}
--------------------
*Araschnia levana* caterpillars were collected in the vicinity of Albach (Germany) either in June (LD) or August (SD). They were fed with stinging nettle cultivars and kept in a climate chamber at 20°C under LD or SD conditions. One day after the onset of pupation, three biological replicates each consisting of five individuals from each group were transferred to vials containing RNAlater (Qiagen, Hilden, Germany) for RNA isolation. The remaining 10 caterpillars under LD conditions developed into the summer generation of butterflies which hatched in August, whereas the remaining 15 caterpillars under SD conditions were allowed to overwinter at 5°C to ensure that the early pupae from both groups were primed appropriately by the light regime to produce distinct phenotypes.
Suppression subtractive hybridization and sequencing {#ece32120-sec-0004}
----------------------------------------------------
Total RNA was extracted from whole prepupae developing from caterpillars collected in either June (LD) or August (SD). The RNA samples were extracted using TRI Reagent (Molecular Research Centre, Cincinnati, OH). The integrity of the RNA was verified using an Agilent 2100 Bioanalyzer and a RNA 6000 Nano Kit (Agilent Technologies, Palo Alto, CA). The quantity of RNA was determined using a Nanodrop ND‐1000 UV/Vis spectrophotometer (Thermo Fisher Scientific, Waltham, MA). Poly(A)+ mRNA was isolated using the MN‐NucleoTrap mRNA kit according to the manufacturer\'s instructions (Macherey & Nagel, Düren, Germany). SSH was carried out on prepupal mRNA from the LD and SD samples using the SMART PCR cDNA synthesis kit (Clontech, Mountain View, CA) and the PCR‐Select cDNA subtraction kit (Clontech) as previously described (Altincicek and Vilcinskas [2009](#ece32120-bib-0003){ref-type="ref"}; Vogel et al. [2011](#ece32120-bib-0045){ref-type="ref"}). The RNA was pooled from all 15 prepupae in each treatment group for analysis. SSH was carried out in both directions, using either LD or SD mRNA as the driver. The subtraction efficiency of the cDNA library was confirmed using 1 ng of nonsubtracted and subtracted cDNA to amplify the housekeeping gene *α‐tubulin*. Fractions of the resulting SD -- LD and LD -- SD subtracted cDNA pools were cloned in the pCRII‐TOPO vector and introduced into *Escherichia coli* ELECTROMAX DH5α‐E electrocompetent cells (Invitrogen, Carlsbad, CA) to create a pair of bidirectional subtracted libraries. We then transferred 500 bacterial colonies from each library into 96‐deep‐well plates and isolated plasmid DNA using the 96‐well robot plasmid isolation kit (NextTec Biotechnologie GmbH, Hilgertshausen, Germany) on a Tecan Evo Freedom 150 robotic platform (Tecan, Männedorf, Switzerland). Nonsubtracted cDNA produced from the LD and SD mRNA pools was resolved by agarose gel electrophoresis and extracted from the gel as three different size fractions (150--700, 700--1300, and \>1300 bp) in order to improve cloning efficiency for larger cDNAs. Each size fraction of the LD and SD pools was purified, cloned in the pCRII‐TOPO vector, and introduced into *E. coli* cells as above to create six size‐fractionated nonsubtracted libraries. We then transferred 800 colonies from each library into microtiter plates for plasmid preparation as described above. The 5′ and 3′ termini of the subtracted and nonsubtracted cDNA library clones were sequenced on an ABI 3730 xl automatic DNA sequencer (PE Applied Biosystems, Foster City, CA). Vector clipping, quality trimming, and sequence assembly under stringent conditions (e.g., high‐quality sequence trimming parameters, 95% sequence identity cutoff, 25‐bp overlap) with the individual sequence trace files were carried out using the Lasergene software package (DNAStar Inc., Madison, WI).
The resulting sequences were used to search the National Center for Biotechnology Information (NCBI) database with the blastall program. Homology searches (BLASTx and BLASTn), and functional annotation according to gene ontology (GO) terms (<http://www.geneontology.org>), InterPro terms (InterProScan, EBI), enzyme classification (EC) | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
Chronic lymphocytic leukemia (CLL) is the most frequent leukemia in Western countries and is characterized by a marked clinical, molecular, and prognostic heterogeneity \[[@B1]\]. While some patients without treatment have a life expectancy equal to that of the healthy population, others require treatment from the beginning of the disease and may even die within a short period of time \[[@B2]--[@B4]\]. For this reason, more than 35 years ago, the Rai \[[@B5]\] and Binet \[[@B6]\] classifications appeared. Although these classifications are widely used, they have shown certain limitations in the ability to predict which patients will have a more aggressive progression and which ones will respond worse to treatment \[[@B1]\].
In recent years, many studies have been carried out to identify characteristics and biomarkers related to the tumor process and to the patient. From these results, it has been possible to establish new PIs that solve most of the limitations of classical staging systems. The advances in the identification of cytogenetic alterations analyzed by fluorescence in situ hybridization (FISH) are worth mentioning, which distinguish groups with favorable prognosis (13q deletion \[13q-\]) and unfavorable prognosis (11q deletion \[11q-\] or 17p deletion \[17p-\]) \[[@B7]\]. Likewise, the study of somatic mutations in the variable region of the immunoglobulin heavy chain gene*(IGHV)* has shown that patients with mutated pattern have favorable outcome \[[@B8]--[@B10]\].
In 2007, the MD Anderson Cancer Center (MDACC) \[[@B11]\] designed a nomogram out of a retrospective study of 1.674 patients diagnosed with CLL. Prognostic factors included were sex, age, absolute lymphocyte count, *β*2-microglobulin, Rai stage, and the number of nodal regions affected. Although this prognostic index (PI) has been validated extensively by other groups \[[@B12]--[@B18]\] and is very useful because of its simple application, its main limitation is that the parameters included are closely related to the tumor burden and not to genetic factors \[[@B19]\].
Recently, the chronic lymphocytic leukemia international prognostic index (CLL-IPI) \[[@B20]\], which combines genetic, biochemical, and clinical parameters in a prognostic model, has been published, based on the results of a meta-analysis and subsequently validated in other publications \[[@B13], [@B21], [@B22]\]. The CLL-IPI includes five variables (mutation or chromosomal status of the*TP53*/17p- gene, serum *β*2-microglobulin, mutation status of*IGHV*, Rai/Binet clinical stage, and age) and assigns a score according to their greater or lower prognostic impact.
With the aim to facilitate the use of the CLL-IPI in routine clinical practice, a simplified version of this PI, performed by Hospital Clinic Barcelona, University of Brno Hospital, Azienda Ospedaliera Pugliese-Ciaccio, and Azienda Ospedaliera di Cosenza groups, which only includes*IGHV*mutation status and FISH cytogenetics, has been proposed recently. It has shown a similar discriminatory value to the CLL-IPI and has been applied independently of age, separating patients with different risks among the same clinical stage groups \[[@B23]\].
The objective of this work is the evaluation of the validity and reproducibility of the CLL-IPI, the Barcelona-Brno biomarkers only prognostic model, and its comparison with the MDACC in a cohort of Spanish patients.
2. Materials and Methods {#sec2}
========================
2.1. Patients {#sec2.1}
-------------
A total of 696 unselected CLL patients newly diagnosed and previously untreated from different institutions of the central region of Spain were included in this study. The data collection period began in 2004 and ended in 2014. This study was approved by the local ethics committee, and the ethical norms of the Declaration of Helsinki were followed.
The database contains information about demographic (age and sex), clinical (nodal regions affected, hepatomegaly, and splenomegaly), analytical (blood counts, LDH, and *β*2-microglobulin), and genetic abnormalities determined by FISH (11q-, trisomy 12, 13q-, and 17p-), immunophenotypic (CD38 and ZAP70 expression) and molecular (somatic mutations of the*IGHV* gene) variables, and Rai and Binet clinical stages. A review of the patients\' medical records was carried out, and 107 cases were excluded of the analysis due to incomplete data. Finally, 483 patients were included to assess the MDACC PI and 258 for the CLL-IPI and the Barcelona-Brno biomarkers only prognostic model, as the remaining cases did not have information about the mutation status of the*IGHV* gene.
2.2. MDACC Prognostic Index {#sec2.2}
---------------------------
The classification in the three groups of risk proposed by the MDACC, low risk (1--3 points), intermediate risk (4--7 points), and high risk (≥8 points), was determined from the sum of the points assigned to six prognostic factors \[[@B11]\]. The index was calculated after assigning 1 point for age \< 50 years, male sex, level of *β*2-microglobulin 1-2x upper limit of normality, absolute lymphocyte count of 20--50 × 10^9^/L, Rai stage III or IV, and ≥3 nodal regions affected; 2 points for age 50--65 years, *β*2-microglobulin \>2x upper limits of normality, and absolute lymphocyte count \>50 × 10^9^/L; and 3 points for age \> 65 years.
2.3. CLL-IPI {#sec2.3}
------------
In order to stratify patients according to the CLL-IPI, 4 points were assigned for 17p- mutation, 2 points for unmutated*IGHV* status and serum *β*2-microglobulin \>3.5 mg/L, and 1 point for age \> 65 years and advanced clinical stage (Rai I--IV or Binet B-C). As*TP53* mutational status was not available in the database, only 17p- was used to assess*TP53* status. The sum of these scores identified patients in 4 subgroups: low risk (0-1 points), intermediate risk (2-3), high risk (4--6), and very high risk (7--10) \[[@B20]\].
2.4. Barcelona-Brno Biomarkers Only (*IGHV* Mutational Status and FISH Cytogenetics Prognostic Model) {#sec2.4}
-----------------------------------------------------------------------------------------------------
The simplified version of the CLL-IPI defined high-risk patients as those with adverse FISH cytogenetics (11q- and/or 17p-) and an unmutated*IGHV* status, low-risk patients as those without adverse cytogenetics and mutated*IGHV*status, and intermediate-risk patients as those not included in the previous groups \[[@B23]\].
2.5. Statistical Analysis {#sec2.5}
-------------------------
Statistical analysis was performed using the SPSS software package version 21.0. Overall survival (OS) was calculated from the time of diagnosis to death or last follow-up and time to first therapy (TTFT) from the date of diagnosis to first treatment or last follow-up. Both variables were estimated by the Kaplan-Meier method and assessed by the log-rank test. Cox regression was used for univariate and multivariate analyses of the impact of variables on OS. These data were expressed as the hazard ratio (HR) with a 95% confidence interval (95% CI). On the other hand, the area under the ROC (receiver\'s operating characteristic) curve was used to find the discrimination of models. In the same way, a 95% CI was established, in which 0.5 implies that the model offers random results and 1 implies that the model is a perfect predictor of survival. The value of *p* \< 0.05 was considered significant for all analyses.
3. Results {#sec3}
==========
3.1. Patients Characteristics {#sec3.1}
-----------------------------
A total of 483 patients with CLL were included in the analysis of the MDACC prognostic index. The principal characteristics of these patients are shown in [Table 1](#tab1){ref-type="table"}. Of note, most of the patients presented with early clinical Rai or Binet stages. The median age at diagnosis was 67 years (range: 25--90) and most patients were older than 50 (92.3%). After a median follow-up period of 46 months (range: 1--277), 92 individuals had died and 186 had required treatment. The median time to treatment was 32 months (range: 0--264).
The analysis for the validation of CLL-IPI and the Barcelona-Brno biomarkers only prognostic model included 258 patients. [Table 2](#tab2){ref-type="table"} illustrates the main characteristics of this subgroup of patients. Analogously to the previous cohort, the majority of the patients presented with early Rai or Binet stages. In this cohort, the median follow-up period was 68 months (range: 3--277), during which 47 patients died and 113 were treated. The median period to the treatment was 31 months (range: 0--264).
3.2. Application of the MDACC Prognostic Index {#sec3.2}
----------------------------------------------
The distribution of patients in the three prognostic groups proposed by the index was 160 (33.1%) patients at | {
"pile_set_name": "PubMed Central"
} |
{#sp1 .201}
{#sp2 .202}
{#sp3 .203}
{#sp4 .204}
{#sp5 .205}
{#sp6 .206}
{#sp7 .207}
| {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION
============
Attention deficit hyperactivity disorder (ADHD) is a clinical disorder characterized by persistent hyperactivity, inattention, and impulsivity.[@B1] Symptoms appear to be developmentally inappropriate and lead to functional impairments at home or in school.[@B2] Children with ADHD are more likely to have comorbid learning difficulties and behavioral problems, and to have poor peer relationships and low self-esteem.[@B3] About 30-50% of children with ADHD have significant behavior and psychiatric problems in adulthood.[@B4]-[@B6] Persistence of ADHD symptoms into adolescence and adulthood is associated with antisocial behavior, substance use and abuse,[@B7] fewer years of education, and lower rates of employment.[@B8]
Symptom control is strongly related to functional improvement.[@B9]-[@B11] Methylphenidate (MPH) is recommended for the treatment of ADHD.[@B12] Studies indicate that MPH is an effective remedy for both core symptoms (e.g., inattention, hyperactivity, and impulsivity) and aggressive behavior.[@B13] MPH increases child compliance with parental commands and decreases hostile and negative responses, which facilitates the social interactions in young children.[@B14]-[@B16] However, about 30% of children with ADHD do not tolerate or respond to stimulant medication.[@B17],[@B18] A study reported that the electroencephalogram (EEG) patterns of children who respond to MPH treatment are different from those who do not respond.[@B19] However, little else is known regarding predictive factors for responsiveness to MPH. Further research into these predictive factors is warranted.
Studies have consistently shown that great response time (RT) variability is found in children with ADHD, making it a potential marker for differentiating children with ADHD from those without ADHD.[@B20]-[@B26] Homozygosity for the DAT 10-repeat allele is correlated with poor response to MPH treatment among Korean children with ADHD.[@B27] Furthermore, ADHD patients who have two copies of the 10-repeat allele at the dopamine transporter gene (DAT) show greater variability in RT on attention tests compared to those with fewer than two copies.[@B28] These data suggest the possible relationship between greater RT and poor response to MPH treatment. We performed this study to examine whether great RT variability would be predictive of poor response to MPH treatment in children with ADHD.
MATERIALS AND METHODS
=====================
Participants
------------
Participants were recruited from seven sites in Korea for a prospective 12-week, open-labeled study to examine optimal dosage of OROS methylphenidate. Diagnoses were made with the Kiddie-Schedule for Affective Disorders and Schizophrenia-Present and Lifetime Version (K-SADS-PL).[@B29] Exclusion criteria were as follows: use of MPH hydrochloride other than OROS-MPH within the past 24 hours; use of OROS-MPH within the past three months; use of psychotropic medication within the past four months (clonidine or other α-adrenaline agonist, tricyclic antidepressant, selective serotonin reuptake inhibitor, theophylline, coumarin, or anticonvulsant, antipsychotics, benzodiazepine, modafinil); history of hypersensitivity reaction to MPH hydrochloride or another component of OROS MPH; other medical problems, such as gastrointestinal disorders, glaucoma, cardiovascular disease, or hyperthyroidism; neurological illnesses, such as a seizure disorder; comorbid psychiatric disorders, such as pervasive development disorder, psychotic disorder, or Tourette syndrome; an intelligence quotient (IQ) less than 70 \[as assessed by the Korean Wechsler Intelligence Scale for Children (K-WISC-III)[@B30]\]; history of substance use or abuse; and possible pregnancy. After an initial assessment, 144 subjects (ages 6-18 years) with ADHD were included.
Baseline MPH dosages were either 18 mg or 27 mg depending on clinical judgment. Dosage was titrated for nine weeks, at which point it was maintained for the remainder of the 12-week treatment trial. Of the 144 subjects enrolled in the study, 28 dropped out due to adverse events (n = 8, 28.6%), medication noncompliance (n = 12, 42.9%), or follow-up loss (n = 6, 21.4%). Data from an additional 24 subjects with comorbid disorders, such as oppositional defiant disorder (n = 12), tic disorder (n = 9), depressive disorder (n = 3), and anxiety disorder (n = 6), were excluded. Since the ADHD diagnostics system was standardized for children of 6-15 years, we excluded 2 subjects who were older than 15. Thus, data from 88 participants were included in the final statistical analyses.
This study was approved by the Institutional Review Boards of all seven sites.
Measures
--------
### Symptom severity and treatment effectiveness
The attention deficit hyperactivity disorder rating scale (ARS; Korean version, K-ARS) is an 18-item measure used to assess inattention and hyperactivity. Items are rated on a 4-point scale (0 = never or rarely, 3 = very often). The K-ARS has good reliability and validity among Korean children.[@B31] The IOWA Conners Parent Rating Scale (CPRS) is a 10-item measure administered to parents to assess inattention/overactivity (5 items) and oppositional/defiant behavior (5 items) in children.[@B32] The CPRS has a 4-point rating scale (0 = never, 3 = very often) and it has good reliability and validity.[@B32] The Clinical Global Impression Severity (CGI-S) and Clinical Global Impression Improvement (CGI-I) scales are clinical outcome measures. Both are clinician-administered and consist of 7-point scales (1 = much improved, 7 = much worse). Generally, the CGI-I is more sensitive to treatment effect.[@B33] We defined \'responders\' as subjects who received a score of less than 18 on the K-ARS and a score of 1 or 2 on the CGI-I, and ultimately were in remission state.[@B34] Clinical assessment was done at baseline as well as weeks 1, 3, 6, 9, and 12. Body weights and vital signs were measured at every visit. ECG and laboratory measures were assessed at baseline and week 12.
### ADHD diagnostic system
The ADHD diagnostic system (ADS) is a computerized continuous performance test that consists of auditory and visual modalities.[@B35] In each modality, the targets and non-targets are presented in the form of auditory or visual stimuli. The test can be used to assess children over five years of age. It consists of three sessions: the early, middle, and late phases. The ADS generates four broadband scores. The omission errors score indicates the number of times when the subject failed to respond to the target, with high scores reflecting inattention. The commission errors score indicates the number of times when the subject made an incorrect response to the non-target, with high scores reflecting impulsivity. The response time (RT) score measures the amount of time between presentation of the target stimulus and a correct response. RT is related to speed of information processing and motor response. The standard deviation of the RT reflects variability or consistency of attention.[@B35] Scores are reported as T-scores and produced in a printable report. In our study, each subject performed the ADS at baseline and at the end of the study. We used scores derived from the visual modality of the ADS in light of research suggesting that the auditory modality is more difficult than the visual modality and is less sensitive in differentiating subjects with ADHD from healthy controls.[@B35]
Statistical analyses
--------------------
To examine the effect of the RT variability on the MPH treatment response, we carried out analysis in two phases. At the first phase, we conducted T-tests, chi-square tests, Mann-Whitney U tests and univariate analysis of variance (ANOVA) to determine whether the responders differed significantly from the non-responders on the focal variables and extract the predictor variables. The RT variability was entered as an independent variable and commission error score was entered as a covariate for univariate ANOVA. Secondly, to examine the effect of the baseline RT variability on the MPH response, we conducted a binary logistic regression analysis, with baseline RT variability entered as the predictor variable, and \"responder/non-responder\" as the dependent variable. We ran a series of paired T-tests to compare the baseline and 12 week ADS scores. We then computed correlations to examine the relationship between the ADS scores and the behavior rating scale scores.
RESULTS
=======
The mean age of the participants at baseline was 9.43 years (± 2.2). Slightly more than 87.5% (n = 77) of the children were boys and 11 (12.5%) were girls. The average IQ was 109.7 (± 16.1). The mean K-ARS and CPRS scores were 28.2 (± 8.5) and 11.7 (± 5.3), respectively.
Characteristics of the responders (n = 59) and non-responders (n = 29) are shown in [Table 1](#T1){ref-type="table"}. There were no significant differences between the responders and non-responders for age or gender. Nor were there any significant differences between the responders and non-responders for baseline IQ, K-ARS, and CPRS scores.
At week 12, the mean dosage of MPH across subjects was 0.99 mg/kg (± 0.29). There was no statistically significant difference in week 12 MPH dosage between the responders and non-responders. At week 12, the responders scored significantly lower on the K-ARS and | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION
============
The breast is the most common site of primary malignancies in adult women, but is an uncommon site for metastasis from extramammary malignancies. The incidence of metastasis to the breast varies from 1.7 to 6.6% in autopsy series, due to the inclusion or exclusion of patients with leukemia or lymphoma in different reports ([@B1]-[@B3]). The clinically observed rate of breast metastases from extramammary malignancies is rarer, ranging from 0.5 to 1.3%, due to the late appearance of extramammary malignancies in the course of malignant disease ([@B4]). This rare occurrence of metastases to the breast is suggested to be due to the presence of large areas of fibrous tissue with a relatively poor blood supply ([@B1], [@B5], [@B6]). The most common sources of extramammary metastases to the breast are lymphomas/leukemias and melanomas. Some of the less common sources include carcinomas of the lung, ovary, and stomach, and infrequently, carcinoid tumors, hypernephromas, carcinomas of the liver, tonsil, pleura, pancreas, cervix, perineum, endometrium and bladder ([@B1], [@B2], [@B7]).
No clear predisposing factors correlating with the development of breast metastasis have been identified ([@B1], [@B8]). However, hormones are considered to function as predisposing factors for several types of extramammary malignancies ([@B1], [@B7]). Estrogen may increase the vascularity and stroma of the breast, and may have a role as a predisposing factor in the development of a metastasis ([@B1], [@B7]). In accordance with this hypothesis, most reported cases have occurred in younger women. There have been some rare cases of the development of breast metastases in male patients with prostatic carcinomas who have been treated with estrogens ([@B1], [@B9]).
Breast metastases from extramammary malignancies have both hematogenous and lymphatic routes. There are common radiological features of metastatic diseases of the breast, but the features are not specific for metastatic disease. It is difficult to differentiate metastatic lesions in the breast from primary breast cancers or benign lesions. In order to avoid unnecessary surgery, it is important to be able to recognize the findings of metastatic lesions. In this review, we demonstrate various ultrasound (US) appearances of breast metastases from extramammary malignancies as typical and atypical features. This review is based on the results of US and other imaging studies performed at our institution.
Typical US Features of Hematogenous Breast Metastases
=====================================================
Hematogenous breast metastases from extramammary malignancies are commonly located in the upper outer quadrant and are located superficially in subcutaneous tissue or immediately adjacent to the breast parenchyma that is relatively rich in blood supply ([@B1], [@B10]). Metastatic breast masses tend to grow rapidly. Typical US features include single or multiple, round to oval shaped, well-circumscribed or occasionally microlobulated hypoechoic masses without spiculations, calcifications, architectural distortion, retrotumoral acoustic shadowing, or secondary skin or nipple changes ([Fig. 1](#F1){ref-type="fig"}) ([@B4], [@B6], [@B7], [@B11]-[@B13]). The lack of significant desmoplastic response near the lesion, which is typical of primary tumors, explains the same size seen on clinical examinations and mammography, and the rareness of spiculation seen on mammography ([@B1], [@B4], [@B11]). These features could pose difficulty in making the diagnosis of benign breast lesions such as fibroadenomas or of well-circumscribed primary breast cancer ([@B8]). Rare tumoral calcifications found in metastases may be helpful to differentiate metastases from primary breast cancers, except for rare instances of metastasis from ovarian, thyroid, or mucin-producing gastrointestinal tract carcinomas that could contain intratumoral calcifications ([@B1], [@B2], [@B4], [@B14], [@B15]). Axillary lymph node involvement is less common in metastases than in primary breast cancers ([@B16]).
Lymphoma or leukemia can also show single or multiple solid masses with a circumscribed or ill-defined margin ([Fig. 2](#F2){ref-type="fig"}) ([@B17], [@B18]). Primary involvement of the breast by lymphoreticular malignancies is rare, due to the relatively small amount of lymphoid tissue within the breast as compared with the gut or lung ([@B14], [@B19]). Metastatic involvement of lymphoma or leukemia occurs more frequently than primary breast lymphoma or leukemia ([@B20]).
Typical US Features of Lymphatic Breast Metastases
==================================================
The appearance of lymphatic metastasis that makes it different from extramammary malignancies include diffusely and heterogeneously increased density in subcutaneous fat and glandular tissue and a thick trabecular pattern with secondary skin thickening, lymphedema, and lymph node enlargement, which are indistinguishable from those of inflammatory breast cancer ([Fig. 3](#F3){ref-type="fig"}) ([@B1], [@B14]). Malignant-type microcalcifications, as is often reported in primary inflammatory breast cancer, are not common ([@B1], [@B2]). US shows diffuse skin thickening and obliteration of subcutaneous fat, lymphatic dilatation, without evidence of primary breast mass, that is secondary to retrograde edema from mechanical obstruction of draining lymphatics by the tumor. Typically lesions are hypoechoic, and abnormal enlargement of axillay or internal mammary lymph nodes are associated ([@B1], [@B2], [@B21]). These features of lymphatic metastases are common for metastases originating from the contralateral breast cancer, and have been reported for metastases from the stomach and ovarian carcinomas ([@B1], [@B3], [@B14], [@B22], [@B23]).
Bilateral diffuse parenchymal breast involvement with or without lymph node enlargement is one of the US features of lymphoreticular malignancies ([Fig. 4](#F4){ref-type="fig"}) ([@B17], [@B18]).
Sabaté et al. ([@B19]) suggested a more diffuse infiltrative parenchymal pattern when the lesions are presented as high-grade lymphomas.
Atypical Mass Lesions of Breast Metastases
==========================================
Ultrasound features of breast metastases from extramammary malignancies can vary in addition to the above-mentioned typical appearances.
Findings observed for primary breast cancer including spiculation, calcification, and surrounding parenchymal distortion may appear for breast metastases from extramammary malignancies and lesions are often indistinguishable from each other ([Fig. 5](#F5){ref-type="fig"}). Therefore, it is important to recognize the possibility of the presence of a metastastic tumor as well as the presence of primary breast cancer in patients with a known malignancy. Breast metastases from extramammary malignancies are mostly seen in patients with disseminated malignant disease ([@B9], [@B24]). However, the breast may be the first metastatic site and a breast lesion the first sign of extramammary malignant disease ([@B1], [@B7], [@B24]). Pre-surgical pathological confirmation with the use of core needle biopsy is necessary in patients with breast lesions that are indistinguishable from primary breast cancer.
In unusual cases, breast metastases can be seen as heterogeneous hyperechoic masses with ill-defined margins ([Fig. 6](#F6){ref-type="fig"}). This finding can be considered for one type of hematogenous breast metastasis.
There are few reports describing extramammary metastatic lesions with intratumoral cystic lesions, and little is known about their imaging features. At our institution, rapid growing, well defined or microlobulated breast masses with some cystic portions have been seen in patients with synovial sarcoma from the thigh, hepatocellular carcinoma, and insular carcinoma of the thyroid gland. These were primarily cancers that were considered as other tumors such as phyllodes tumors that have cleft-like cystic space seen on US ([Fig. 7](#F7){ref-type="fig"}), or benign masses with multifocal cystic changes such as resolving state of hematoma ([Fig. 8](#F8){ref-type="fig"}). In one case that was considered as a hematoma, a follow-up US after 4 months showed a markedly enlarged solid hypoechoic mass with multiple cystic foci ([Fig. 8](#F8){ref-type="fig"}). All three cases were considered as hematogeneous metastases; these tumors are known to undergo frequent intratumoral hemorrhagic changes or necrosis with poor differentiation ([@B25]-[@B27]).
Sometimes cyst-like marked hypoechoic areas within the tumor can be caused by high cellularity. In mass-forming cases of lymphoreticular malignancy, focal hypoechoic masses or almost anechoic masses with pseudocystic configuration representing compact cellularity can be noted in this series ([Figs. 9](#F9){ref-type="fig"}, [10](#F10){ref-type="fig"}) ([@B23], [@B28], [@B29]).
Atypical Non-Mass Lesions of Breast Metastases
==============================================
One patient with lung cancer showed multiple small Hypoechoic masses with segmental, ductal distribution from the nipple, and axillary lymph node enlargement. Histopathological examination with the use of core needle biopsy confirmed the diagnosis of breast metastasis from lung cancer ([Fig. 11](#F11){ref-type="fig"}). These features with segmental distribution may mimic those of ductal carcinoma *in situ* (DCIS) or papillary lesions; however, no associated microcalcifications can help to distinguish breast metastasis from DCIS or papillary lesions. These findings may correspond to thoseof one type of lymphangitic or hemato-lymphang | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
Intra-abdominal hemangiomas are rarely found outside of the liver \[[@R01]\]. Gastric haemangioma accounts for only 0.05% of all gastrointestinal (GI) neoplasms \[[@R02]\]. Isolated gastric hemangiomas generally manifest in routine clinical practice as epigastric pain and upper gastrointestinal bleeding of occasional recurrence. Endoscopic investigations hold a crucial position in the establishment of a diagnosis. However, with regard to the submucosal localization of gastric hemangiomas, their dense vascular nature and requirement for biopsy to confirm the diagnosis are among the challenges encountered. Endoscopic ultrasonography (EUS) and contrast-enhanced computed tomography (CT) play crucial roles in establishing a diagnosis. Total excision is the curative treatment for cavernous hemangioma. Here, we report the case of a 25-year-old male patient who was admitted due to hematemesis and epigastric pain.
Case Report {#s2}
===========
A 25-year-old male with a history of intermittent abdominal pain for the last six months was admitted to our emergency department complaining of intractable postprandial abdominal pain, along with bloody vomiting. Having been subject to a preliminary evaluation in our emergency department, the patient was transferred to the gastroenterology clinic for further investigation and treatment, where oral intake was stopped and replaced with parenteral replacement therapy. The patient's medical background revealed nothing remarkable other than recurrent epigastric pain. He also had a history of receiving proton pump inhibitor drugs on an irregular basis. Upon physical examination, his general clinical status was good, with stable vital parameters. A palpable mass of 5 × 5 cm, along with tenderness in the epigastric region on palpation, was detected during abdominal examination. The laboratory test results, including liver and renal function tests, complete blood count, coagulation profiles and tumor markers were within normal limits. Upper GIS endoscopy revealed a submucosally located mass lesion of dense vascularity at the antrum-corpus junction on the greater gastric curvature. The appearance of the mass evoked the impression of a gastrointestinal stromal tumor of mesenchymal origin ([Fig. 1](#F1){ref-type="fig"}). Accordingly, a biopsy was taken from this area. No definite focus of active bleeding was evident. In abdominal computed tomographic evaluation, an isodense and smooth contoured mass lesion of 52 × 25 × 32 mm that contained focal calcifications and was located on the greater gastric curvature in the left upper abdominal quadrant was detected ([Fig. 2](#F2){ref-type="fig"}). Since the biopsy report indicated that the material was insufficient for a definitive diagnosis to be made, a deeper biopsy sampling was recommended. As such, Positron Emission Tomography (PET) was performed in an attempt to identify whether or not the mass was malignant. PET showed a smooth contoured mass of 5 × 5 cm, projecting from the gastric corpus into the lumen and containing scattered calcifications, which displayed no evidence of malignant transformation. A 6 × 4 × 5 cm mass was detected at the the greater gastric curvature on the anterior gastric surface during intraoperative exploration. The mass was not invading into adjacent tissues, and contained dense vascular structures ([Fig. 3](#F3){ref-type="fig"}). No pathology associated with other intraabdominal organs was identified. Unluckily, no preoperative histopathological evaluation could be implemented due to the device for frozen sectioning in our hospital being out of order. The lesion appeared macroscopically to be benign. A wedge resection was first undertaken, since the lesion was consistent with a gastric hemangioma. The patient suffered no complications during the post-operative follow-up, and was discharged from the hospital on the seventh postoperative day. The pathology report was consistent with varicous dilatations of the submucosal veins and gastric cavernous hemangioma ([Fig. 4](#F4){ref-type="fig"}).
{#F1}
{#F2}
{#F3}
{#F4}
Discussion {#s3}
==========
Hemangiomas are congenital malformations that generally stem from the mesenchymal tissues. They may involve the skin, internal viscera, or both, with a predilection for the head and neck region (60%), the truncal region (25%), and the extremities (15%) \[[@R03]\]. The liver is the most frequent site of involvement among the internal viscera (0.4% - 20%) \[[@R04]\].
Hemangiomas of the gastrointestinal tract can be classified as capillary-, cavernous- or mixed-type, with a predilection towards the cavernous type in the gastrointestinal system. Gastric cavernous hemangiomas, on the other hand, are rare (0.05%). First defined by Lambers in 1893, gastric hemangiomas are most commonly encountered in adulthood, although they can occur in any age group \[[@R05]\]. Epigastric pain, dyspepsia and upper gastrointestinal system (GIS) bleeding are among the most frequent symptoms. Endoscopic assessment is of pivotal importance for preoperative diagnosis. Gastric hemangiomas provide a limited contribution to the final diagnosis due to their submucosal localization. Accordingly, USG, endoscopic USG, CT, abdominal magnetic resonance imaging (MRI) and angiography are important components of the imaging modality. Ultrasound reveals a solid mass with a heterogeneous multinodular appearance \[[@R06]\]. CT seems to be the most useful imaging method for establishment of a diagnosis, which typically shows phelobolitis and marked vascular enhancement with the 'filling pattern' characteristic of parenchymal haemangiomas \[[@R07]\]; moreover, it provides information regarding the extent and degree of invasion of the hemangioma \[[@R08]\]. MRI is also useful but is unlikely to contribute to the specific diagnosis. Angiography delineates the arterial supply of the tumor and is useful for confirming the diagnosis \[[@R09]\]. Angiography-directed embolization may also be beneficial in cases of acute bleeding. Endoscopic USG may prove helpful in characterizing the extent of vascularity of cavernous hemangiomas \[[@R10]\]. Positron Emission Tomography is eligible for benign/malignant differentiation of the mass in the preoperative period. The mass lesion and all abdominal cavities were evaluated by abdominal CT in our patient, revealing no additional intraabdominal pathology other than the aforementioned mass lesion in the upper abdominal region and bilateral millimetric nephrolithiasis.
The role of endoscopic biopsy in the preoperative histopathological diagnosis of hemangiomas is limited owing to the submucosal localization and dense vascular nature of such lesions \[[@R11]\]. As such, we were unable to establish a definitive diagnosis by means of endoscopic biopsy.
Other gastric submucosal masses, especially those of gastrointestinal stromal tumors, leiomyomas, lipomas, varicous vessels and carcinomas should be kept in mind in the differential diagnosis of cavernous hemangiomas due to their frequent submucosal localization. Biopsy may yield equivocal results for especially small lesions covered by normal mucosa. Assessment of such lesions by endoscopic USG becomes increasingly significant. Boyce et al. evaluated 91 patients with gastric submucosal tumors by EUS, reporting that endoscopic ultrasound was useful for the evaluation of upper gastrointestinal submucosal mass lesions \[[@R12]\]. Due to the lack of such a facility in our hospital, the submucosal lesion in our patient could not be evaluated. As for larger lesions, probable mucosal ulcerations and polypoid formations are likely to facilitate the establishment of a definitive diagnosis by endoscopic biopsy. Cavernous hemangiomas should be considered upon observation of dense vascular varicous dilatations in the submucosal area.
Surgery is the curative treatment. Accordingly, wedge resection, partial or total gastrectomy constitute the standard treatment modalities for isolated gastric hemangiomas \[[@R13]\]. A surgeon should meticulously evaluate the lesion and determine the appropriate procedure according to lesion localization. For this reason, we performed a wedge resection in our patient owing to the lesion being located on the greater curvature and its smooth contours.
Endoscopic resection may be preferred for submucosal lesions less than 2 cm in diameter, which can easily be removed from the muscularis propria \[[@R14]\]. Arafa et al. reported a case from whom they extracted a hemangioma around 14 mm in diameter, which was located on the posterior antral wall \[[@R15]\]. In parallel with the advent of new endoscopic instruments and techniques, endoscopic resection is becoming increasingly widespread.
In conclusion, gastric hemangiomas are rare and benign tumors of the stomach. Use of endoscopy in conjunction with CT is beneficial for diagnosis. The role of endoscopic biopsy, however, remains limited. Endoscopic resection can be undertaken in selected cases. Surgery is the curative treatment. Moreover, surgical treatment along with histopathological studies occupy an important place in the establishment of a definitive treatment.
Author Contributions {#s4}
====================
Basbug M, Yavuz R and Dablan M performed the surgical procedure, Baysal B performed endoscopic examination and Gencoglu M performed histopathologic examination. Basbug M contributed writing the article and | {
"pile_set_name": "PubMed Central"
} |
1 Introduction
==============
Since its introduction more than a century ago, random walks ([@btaa291-B63]) have been successfully applied to a wide range of sciences including Physics, Chemistry, Biology, Computer Science and Engineering. With its effective algorithmic layout, easy realization and efficiently produced outcomes, the method is still deemed a suitable choice for extracting sub-networks of interest in graph-structures consisting of nodes demonstrating multiple strong connections. The methodology has known weaknesses, such as simply recreating the degree distribution of a graph or getting trapped in highly connected cliques without being able to explore distant neighborhoods. Moreover, random walks entail a finite number of steps and in this respect, if additional neighborhoods are to be explored during the same time period, multiple walkers have to be simultaneously deployed ([@btaa291-B17]; [@btaa291-B48]). To prevent walker entrapment in strongly connected network regions, restart strategies are used ([@btaa291-B11]; [@btaa291-B75]). Such strategies allow a walker to discontinue its current course and proceed by following up a different node in the graph. Converging strategies have also been studied, mostly in the context of computer networks where random walks converge according to application-induced probability distributions for visiting nodes ([@btaa291-B89]).
The output from methodologies such as the random walk, heavily depends on the quality of the contained data. In random walks specifically, these data can be integrated in a graph. There is a vast number of online databases offering biological content and an even greater need of parsing and integrating this information ([@btaa291-B6]; [@btaa291-B57]; [@btaa291-B64]). The potential knowledge gain could provide researchers the means and tools to extract results that would benefit the health care system by enhancing prevention, diagnosis as well as treatment of maladies.
Computational applications, which allow for fast screening and integration of such biological information, are the prerequisite for speeding up the process of generating quality results. In this respect, tools, such as the PREDICT ([@btaa291-B27]), integrate drug information from online databases including DrugBank ([@btaa291-B82]), OMIM ([@btaa291-B3]) and SIDER ([@btaa291-B41]) to suggest new drug-target indications based on substance similarities. Other models including MutPred ([@btaa291-B45]) parse protein sequences and provide insights on the mechanisms of diseases. Similar software tools are especially needed in the case of rare diseases as *in vivo* experiments might not be given the appropriate consideration. The latter could be attributed to the lack of targeted individuals especially if a disease under examination is simply infrequent.
The integration of biological data from different 'omes' (e.g. genome, transcriptome and proteome) is essential for bioinformatics applications that yield sophisticated results revolving around pathway analysis, drug repurposing, interaction networks and disease associations. [@btaa291-B88] examined the importance of studying disease mechanisms from a multi-omics perspective and proposed a multi-level network for the *Alzheimer's disease* (*AD*). This network was formed by integrating multi-source biological information, such as differentially expressed genes, pathways, single-nucleotide polymorphisms, drugs and microRNAs. Here, genes act as intermediaries between the different layers of the proposed network. Through this methodology, clusters of potential key biological pathways of *AD* were proposed for further examination.
Community detection algorithms are regularly used to identify meaningful clusters in a graph and have been successfully proposed in the context of social networks for more than a decade now ([@btaa291-B13]; [@btaa291-B47]; [@btaa291-B84]). We have only recently seen the adoption of such techniques in biological settings. In particular, a benchmarking study ([@btaa291-B65]) considered the Louvain method ([@btaa291-B7]) as the best choice in finding protein communities in the protein--protein interaction (PPI) networks of Human and Yeast. While addressing the DREAM challenge, [@btaa291-B76] applied their community detection framework in six heterogeneous biological networks (two human PPI, a pathway signaling, a co-expression, a cancer and a homology network) in order to extract core disease communities. More specifically, they showed that overlapping community detection algorithms yield better results for disease module identification, which is justified since a node (e.g. a gene) can participate in multiple diseases at the same time. [@btaa291-B81] applied community detection algorithms in a gene interaction network and while deploying the Louvain algorithm they sought to identify communities of up to 10 genes that characterize functional and disease pathways.
In this work, we propose a random walk-based methodology on a pathway-to-pathway network and we term this as PathWalks. PathWalks exploits a map that we construct in the form of a synthetic gene network, containing integrated information regarding a disease of interest, as the latter has been presented in [@btaa291-B88]. We create multi-source integrated information maps regarding *AD* and *idiopathic pulmonary fibrosis* (*IPF*). We use the produced maps to drive random walks on respective pathway-to-pathway networks. Our methodology highlights the most frequently walked candidate pathways and trajectories, identifying pathway communities that are expected to be strongly related to these diseases. The novelty of our approach lies with the exploitation of multi-omics disease-related information that helps drive walks on a functional connectivity network of biological pathways. The approach ultimately highlights key pathways and their functional communities related to the disease of interest.
2 Materials and methods
=======================
2.1 The general concept of PathWalks
------------------------------------
Our proposed PathWalks methodology integrates random walks and shortest paths computations to walk on a pathway-to-pathway network under the guidance of a synthetic gene network that we construct by integrating *a-priori* molecular information related to a disease ([@btaa291-B88]). The PathWalks methodology exploits two main network components related to a disease of interest, which need to be constructed before the execution of the algorithm.
The first component is the multi-source information map; this is a synthetic gene-to-gene network, which represents integrated information (e.g. gene co-expression, physical interactions and miRNA targets) from biological databases in the form of weighted connections. Mathematically, the gene network is represented as a graph (G~g~) and described as G~g~ = (V~g~, E~g~), where V~g~ is the set of nodes (genes) and E~g~ is the set of connections among nodes. The walker performs random walks on the gene network and the visited nodes indicate the walker's new destination on the PathWalks' second component; the functional connectivity network of biological pathways.
We construct the pathway-to-pathway network \[G~p~ = (V~p~, E~p~)\], by parsing the biological pathways' functional connectivity information from KEGG ([@btaa291-B35]). Pathways that contain genes already associated with the studied disease, receive higher numeric-value edge scores (i.e. visitation probability). The walker moves on the pathway-to-pathway network according to the instructions given by the map (gene-to-gene network) in order to explore biological pathway relations regarding the disease under examination.
A sorted list of the most visited pathways is generated after a set number of iterations. In order for the algorithm to converge, the two last sorted pathway-visitation lists must have a similarity index above a selected threshold. Finally, the algorithm highlights the most frequently visited edges (i.e. pathway-to-pathway connections) and nodes (pathways), revealing interesting pathway communities, according to the multi-source map. In this study, we explore two use-case scenarios from different disease settings; *AD* as a neurodegenerative disease and *IPF* as a fibrotic disease. We show a descriptive diagram of the PathWalks methodology in [Figure 1](#btaa291-F1){ref-type="fig"}.
{#btaa291-F1}
2.2 Multi-source integrated gene map per disease
------------------------------------------------
The first component needed for the execution of PathWalks is the gene map. Here, we create gene maps for the PathWalks algorithm by integrating biological information as described ([@btaa291-B88]). For both *AD* and *IPF* maps, we download genes, drugs, biological pathways and single-nucleotide polymorphisms from Malacards ([@btaa291-B20]). For the *AD* map, we further include copy-number variations' information from Malacards, which was missing in the case of *IPF*. We link drugs of both cases to their gene targets via the DrugBank database. We then extract additional genetic and physical interaction information for each disease's genes through GeneMANIA's ([@btaa291-B22]) default dataset choices for these two categories. Finally, we map the genes of each disease to miRNAs through MirTarBase ([@btaa291-B12]). In the *AD* use case, we explore additional miRNAs through miRBase ([@btaa291-B28]) and TargetScan ([@btaa291-B44]). Following the multi-source integration, we generate gene-to-gene networks to act | {
"pile_set_name": "PubMed Central"
} |
Introduction {#sec1}
============
The Centers for Disease Control (CDC) projects that the proportion of adults older than 65 years of age in the US population will grow from 12.4 to 19.6% reflecting the aging baby boom generation and declining birth rates in the United States. Furthermore, the population of persons older than 80 years is expected to more than double from 9.3 million in 2000 to 19.5 million in 2030 ([@ref22]). This aging phenomenon is not unique to the United States since the number of individuals aged 65 years and older is expected to nearly double from 6.9% of the world population in 2000 to 12.0% by 2030 ([@ref13]). Revisions to such predictions even suggest that by 2050, the population of those over the age 65 in the United States will be up to 108 million, 25.8% of the predicted population ([@ref117]).
Since the aged population is increasing globally, the prevalence of sarcopenia, the age-related loss of skeletal muscle mass and function, is likely to increase as well. Global prevalence of sarcopenia is difficult to measure in part due to changing consensus of what constitutes the diagnosis of sarcopenia. In 1998, Baumgartner et al. defined sarcopenia as the age-associated loss of skeletal muscle mass two standard deviations below a healthy population ([@ref12]). Based strictly on skeletal muscle mass loss, Baumgartner and colleagues estimated that 24% of individuals less than 70 years of age have sarcopenia while 50% of those over 80 years of age had sarcopenia ([@ref12]). More recent analyses find widely discrepant disease incidence with NHANES data collected between 1999 and 2004 reporting that 27.8 and 19.3% of men and women at least 60 years of age were sarcopenic ([@ref72]). Other estimates are as high as 35.4 and 52.5% for women over 60 and 80 years of age, respectively, and 75.5 and 88.1% for men over 60 and 80 years of age ([@ref9]). Surprisingly, there is a paucity of data that detail the economic burden of sarcopenia, although an analysis over a decade old found that the healthcare cost of sarcopenia in the United States was an estimated \$18.5 billion per year ([@ref73]).
Skeletal muscle is the largest organ in the human body and plays a key role in posture and capacity for locomotion, as well as serving as a bona fide endocrine organ ([@ref123]). As such, skeletal muscle dysfunction has detrimental effects on many aspects of human health for older adults. Epidemiological studies have found that sarcopenia increases the overall risk for mortality ([@ref86]; [@ref9]). In part, this is because sarcopenia increases the risk of developing mobility disabilities, leading to impairment in activities of daily living by twofold ([@ref72]), and risk of falls by three times ([@ref86]). The loss of muscle mass and function is not exclusive to postural/locomotor muscle groups, as myopathy of key inspiratory muscles also occurs with aging, resulting in respiratory failure ([@ref78]). The increased risk of disability from respiratory failure has led to greater hospitalization of older adults ([@ref186]; [@ref78]). The combined effect of sarcopenia and hospitalization further exacerbates muscle dysfunction, as older adults do not adequately recover from bed rest ([@ref172], [@ref171]; [@ref67]), which contributes to reduced functionality and ambulation upon discharge, and leads to loss of independence, nursing home placement, and increased risks of falls ([@ref45]; [@ref108]). In addition to physical disability, sarcopenia contributes to the development of cardiovascular and metabolic diseases because of its involvement in substrate metabolism ([@ref10]) and as an endocrine organ ([@ref123]).
The current consensus is that to diagnose sarcopenia, one should assess walking speed or grip strength and then examine appendicular lean mass if either is below a certain cutoff value ([@ref29]; [@ref42]; [@ref110]). If muscle mass is lower than a healthy population cutoff value, sarcopenia is diagnosed. As such, low muscle mass continues to be an important component in the definition of sarcopenia. In 2016, the World Health Organization established an ICD-10 code for sarcopenia, which will spur the development of effective therapeutic strategies and increase the recognition of the importance of maintaining muscle mass and function with age for overall human health ([@ref3]).
Resistance exercise continues to be the most effective intervention against sarcopenia ([@ref87]). In addition, maintenance of physical activity can delay the progression of sarcopenia ([@ref129]; [@ref92]). Despite the strong support for maintaining an active lifestyle, adherence to physical activity guidelines remains low. The traditional therapeutic focus of sarcopenia treatment is to target growth-related pathways to increase muscle mass. Here, we discuss the positives of these strategies, but also build a case for targeting mitochondrial bioenergetics as a way to maintain muscle mass and function with age as summarized in Figure [1](#fig1){ref-type="fig"}. This review will cover the etiology of muscle loss, three basic characteristics of aging that may contribute to sarcopenia, current treatments targeting mass, and how targeting mitochondria rather than mass could mitigate basic mechanisms of aging to slow sarcopenia.
{#fig1}
Mechanisms Leading to Loss of Strength and Function {#sec2}
===================================================
Etiology of Muscle Loss {#sec3}
-----------------------
The etiology of sarcopenia is characterized by both slow, gradual loss of muscle mass over time that is propagated by acute periods of accelerated loss and poor nutrition ([@ref35]). Acute periods of muscle loss in older individuals is often met with an incomplete regain of muscle mass and strength, thus accelerating gradual sarcopenic progression ([@ref172]; [@ref192]; [@ref6]). The inability to completely regain muscle mass and strength is common in both aging humans ([@ref172]) and animals ([@ref192]; [@ref6]). This public health problem is particularly troublesome for older adults who comprise the majority of hospital patients in the United States ([@ref31]; [@ref44]) and who may lose more muscle mass during bed rest ([@ref118]; [@ref83]). Older adults do not adequately recover following bed rest without adequate rehabilitation ([@ref172], [@ref171]; [@ref67]), which likely contributes to their reduced functional status and ambulation upon discharge ([@ref28]; [@ref26]). It is important to target both the gradual and accelerated periods of muscle loss to mitigate the progression of sarcopenia.
The vast majority of adults fail to meet physical activity guidelines. While 60% of adults, both European and American, self-report that they meet guidelines, objectively measured physical activity reveals that fewer than 10% of adults in the United States meet physical activity guidelines ([@ref181]; [@ref101]). Moreover, sedentary behavior alone increases the risk for sarcopenia. While there are few trials in humans on the effects of lifelong sedentary behavior, studies in mice reveal lifelong sedentary behavior impairs mitochondrial function ([@ref43]). Moreover, a cross-sectional study in men revealed that sedentary behavior increased inflammation independent of physical activity ([@ref120]). Other lifestyle behaviors such as diet, combined with a sedentary lifestyle, also predispose individuals to increased risk for sarcopenia. An analysis of four prospective studies revealed that obesity increased the risk of developing sarcopenia by 20--162% ([@ref169]). Indeed, sarcopenia and obesity often occur together, and evidence suggests that risk of metabolic disease and mortality increase when both are present ([@ref189]). Obesity is characterized by inflammation and insulin resistance, both of which contribute to vascular dysfunction, as indicated by reduced endothelium-mediated vasodilation, impaired skeletal muscle perfusion, and decreased myofiber capillary density. Greater adipose infiltration into skeletal muscle is associated with the loss of skeletal muscle strength and torque ([@ref53]). Lifestyle factors contribute to changes in the basic processes that lead to muscle loss.
Muscle mass is controlled by a dynamic balance of protein synthesis and degradation. A loss of muscle mass occurs when protein synthesis and degradation tip toward net degradation. Strategies to maintain muscle mass have focused on increasing protein synthesis since this is thought to be the more dynamic regulator of mass. Signaling through the mechanistic target of rapamycin (mTOR) pathway is the major regulator of protein synthesis in skeletal muscle ([@ref17]; [@ref50]). The activation of mTOR results in activation of p70 S6K causing an increase in protein translation, and the inhibition of 4e-binding protein (4e-BP1), which is a negative regulator of the eukaryotic translation initiation factor-4e (EIF-4e). The activation of these pathways stimulates growth processes, primarily of the myofibrillar proteins. However, a focus purely on growth may not maintain protein quality as discussed later in the review.
Mechanisms of Muscle Loss---Basic Processes {#sec4}
-------------------------------------------
### Loss of Proteostasis {#sec5}
Proteostasis is the maintenance of protein homeostasis that refers to the | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION
============
Traumatic cervical spinal injury is a common cause of severe disability. It is reported that about 11000 patients are admitted to hospitals due to cervical spinal injury annually[@B15] and around 75% of them require intubation and mechanical ventilation due to respiratory problems[@B21]. Tracheostomy is required in 11-35% of patients with cervical spinal cord injury to maintain airway and to manage pulmonary complications and pulmonary hygiene[@B1],[@B2],[@B13] and in 10% of ICU patients for long-term mechanical ventilation (longer than 24 hours)[@B8]. Patients with cervical spinal cord injury tend to require mechanical ventilation more often and for a longer period of time to manage frequently occurred respiratory problems and to effectively provide oxygen. This tendency is more prominent in patients with the upper spinal cord injury or severe spinal cord injury. The American Consensus Conference on Artificial Airways states that tracheostomy is preferred if mechanical ventilation is required longer than 21 days[@B18]. Tracheostomy has some advantages over endotracheal or nasotracheal intubation. It improves pulmonary toilet and reduces the length of the breathing pathway and airway resistance. Consequently, it reduces effort to breath and weaning of mechanical ventilation becomes easier and less problematic, reducing the length of time on mechanical ventilation. However, the optimal time to perform tracheotomy remains controversial[@B11]. This study aimed to determine the optimal timing of tracheostomy and to evaluate the subsequent beneficial effects by comparing early tracheostomy (1-10 days) and late tracheostomy (\>10 days) in patients with spinal cord injury.
MATERIALS AND METHODS
=====================
This is a retrospective study conducted at neurosurgery department between August, 2003 and March, 2012. Among a total of 254 patients with spinal cord injury, 21 patients who required tracheostomy and mechanical ventilation were selected. Their medical records and imaging studies were retrospectively analyzed. Patients with traumatic cervical spinal cord injury were only included in this study and patients with degenerative spinal disease, spinal tumors, inflammatory disease such as myelitis were excluded from this study. Spinal surgery was performed if required and the subjects were classified into two groups according the timing of tracheostomy. In most previous studies, early tracheostomy was defined as performed within 7 days and late tracheostomy as any time after the first week[@B14]. In this study, we defined early tracheostomy as performed within 10 days and late tracheostomy as more than 10 days. Tracheostomy was performed according to the standard surgical technique. There were 10 patients in the early tracheostomy group and 11 patients in the late tracheostomy group. The severity of spinal cord injury was determined according to the classification of American Spinal Injury Association (ASIA). The location of the injury, the total period of ICU stay, the length of time on mechanical ventilation, the period of ICU stay after tracheotomy, the period of hospital stay and tracheostomy complications of each group were compared to analyze the advantages and disadvantages of early tracheostomy and late tracheostomy ([Table 1](#T1){ref-type="table"}). Variables are expressed as the mean±SD. Data was analyzed using Fisher\'s exact, Mann-Whitney U-test and binary logistic regression analysis. Significance was determined when *p* value was less than 0.05. The statistical package SPSS, version 18.0 for Windows (SPSS Inc., Chicago, IL, USA), was used for the analysis.
RESULTS
=======
There were 10 patients in the early tracheostomy group and 11 patients in the late tracheostomy group. Early tracheostomy was performed after 6.7±3.97 days and late tracheostomy was performed after 24±5.66 days. The mean age of the subjects was 50 years (18-88 years). There were 19 male and 2 female patients and the majority of them were between 40 years and 70 years old. There was no statistically significant difference in the demographic characteristics between the groups (*p*=0.328). The injury occurred at the cervical 1-2nd level in a patient, cervical 3-5th level in 16 patients and cervical 6-7th level in 4 patients. The severity of the injury was determined according to ASIA classification; 8 patients were grade A; 3 patients were grade B; 9 patients were grade C; 1 patient was grade D. There were no statistically significant differences in the location and the severity of the injury between the groups (*p*=0.781, 0.301) ([Table 2](#T2){ref-type="table"}). Among dependent variables, the total ICU stay was significantly reduced in the early tracheostomy group comparing with the late tracheostomy group and the reduction was statistically significant (20.8 day vs. 38.0 day, *p*=0.010). The total length of time on mechanical ventilation was also significantly reduced in the early tracheostomy group comparing with the late tracheostomy group and the reduction was statistically significant (5.2 day vs. 29.2 day, *p*=0.009). This shows that there were correlation between early tracheostomy (within 10 days) and the length of time on mechanical ventilation and ICU stay \[odds ratio (OR 1.134\]. The length of ICU stay after tracheostomy was shorter in the early tracheostomy group comparing with the late tracheostomy group (6 days vs. 15 days) but without statistical significance (*p*=0.597), and there was no statistically significant difference in the total length of hospital stay (*p*=0.291) ([Table 3](#T3){ref-type="table"}). With respect to post-tracheostomy complications, the incidence of pneumonia was 40% in the early tracheostomy group and 82% in the late tracheostomy group but the difference was statistically not significant (*p*=0.283) ([Table 4](#T4){ref-type="table"}). Tracheal stenosis was reported in a case of late tracheostomy but the difference between the group was statistically not significant (*p*=0.999) ([Fig. 1](#F1){ref-type="fig"}). Anterior approach spine surgery performed when surgery was required. There was no infection related to cervical spinal surgery and tracheostomy in both groups.
DISCUSSION
==========
Endotracheal or nasotracheal intubation is often performed when patients with cervical spinal cord injury present with respiratory problems. However, the optimal time to perform tracheostomy after intubation remains controversial. Previous studies, both animal experiments and clinical trials, reported that prolonged endotracheal intubation (longer than 7 days) resulted in severe laryngeal trauma[@B4],[@B19],[@B22]. The long-term intubation repeatedly injured posterior endolarynx, inducing tracheal stenosis. In addition, activity is restricted in endotracheally or nasotracheally intubated patients due to ventilator tubing, which may compromise the emotional recovery of the patients.
Tracheostomy is required in 11-35% of patients with cervical spinal cord injury for the management of pulmonary complications and pulmonary hygiene[@B21]. In case of cervical spinal cord injury, motor innervation to the chest muscle involved in inspiration and expiration is damaged. The diaphragm is innervated by the phrenic nerve which is formed from the cervical nerves C3, C4, and C5[@B17]. Therefore, injuries at these levels reduce motor impulses via the phrenic nerve and impair diaphragmatic function. Spinal cord injury above the level of C5 also reduces the tidal volume and compromises the ability to clear respiratory secretions. In these patients, tracheostomy is necessary. Spinal cord injury above the level of C5 is reported to the independent predictor for immediate mechanical ventilation[@B5]. Tracheostomy reduces the length of breathing circuits, improves pulmonary toilet and reduces airway resistance. As a result, breathing and weaning of mechanical ventilation become easier and the length of time on mechanical ventilation becomes shorter[@B6],[@B7]. It is reported that early tracheostomy reduces the incidence of pneumonia in traumatic spinal cord injury[@B12]. However, tracheostomy is an invasive procedure causing fractures of cartilaginous rings, posterior tracheal wall injury, hemorrhage, pneumothorax, subcutaneous emphysema, mediastinitis, wound infection[@B10] and the colonization around the tracheostomy. In a study analyzing 152 patients who underwent early tracheostomy within 7 days after spinal cord injury, Javier Romero et al.[@B20] reported that early tracheostomy was advantageous reducing the length of time on mechanical ventilation, the length of ICU stay and complications such as tracheal granulomas and concentric tracheal stenosis. Nonetheless, early tracheostomy failed to reduce the risk of pneumonia related to mechanical ventilation and mortality. We retrospectively analyzed cases of prolonged intubation related to the use of steroids or anti-inflammatory agents due to various factors (medication, severe wound, hemorrhage) and cases of prolonged intubation due to pulmonary complications although extubation was attempted several times. The results showed that early tracheostomy performed within 10 days after intubation was still advantageous. Although the 10-day-period is not absolutely long enough, we retrospectively reviewed the patients with spinal cord injury. In case of the patients whose tracheostomy was delayed due to the patient\'s condition or situation, we reviewed the dates that fit into 10 days and checked statistically. Statistically, there were some beneficial effects from tracheostomy performed within 10 days, even if we have small number of patients. Although several previous studies reported that beneficial effects came out within 7 days, comparable advantages are still expected even if tracheostomy is slightly delayed due to the unavoidable reasons according to the results (\<10 days) of this study. This study demonstrated that early tracheostomy performed within 10 days after intubation significantly reduced the total ICU stay (20.8 day vs. 38.0 day, *p*=0.010) and the length of time on mechanical ventilation (5.2 day vs. 29.2 day, *p*=0.009). The ICU | {
"pile_set_name": "PubMed Central"
} |
Background
==========
Reactive oxygen species (ROS) are generated in the normal metabolism of living organisms, and besides of their useful role in signal transduction; they are also involved in the dispersion of several degenerative diseases like malignant tumors, rheumatic joint inflammation, cataracts, Parkinson's and Alzheimer's disease, hypertension, diabetes, oxidative stress, tissue damages and atherosclerosis \[[@B1]\]. To protect the body from such effects; in addition to antioxidant enzymatic system, there are non-enzymatic biomolecules and proteins in living organisms, which act as antioxidant and free radical scavengers. However, food supplementation containing ascorbates, carotenoids, tocopherols, flavonoids and phenols play a significant role in this matter \[[@B2],[@B3]\]. These bioactive natural compounds scavenge the reactive oxygen species and prevent free radicals to cause deterioration. They have the aptitude to scavenge oxygen-nitrogen derived free radicals by donating hydrogen atom or an electron, chelating metal catalysts, activating antioxidant enzymes and inhibiting oxidizes \[[@B4]-[@B6]\]. Based on such a type of incredible results, interest in exploration of bioactive compounds extracted from medicinal plants was increased in recent years to replace the use of synthetic drugs, which were restricted due to side effects. On the other hand, polyphenol, used as natural antioxidants, are gaining importance, due to their health benefits for humans, decreasing the risk of cardiovascular and degenerative diseases by reduction of oxidative stress and counteraction of macromolecular oxidation \[[@B7],[@B8]\].
Medicinal plants are also in high demand for application of functional food or biopharmaceuticals because of consumer preferences. *Launaea procumbens* (LP) is one of the important medicinal plants widely distributed in waste places, vacant lots and in cultivated fields throughout Pakistan. Ayurvedic and herbal medicine prepared from this plant promote self healing, good health and longevity, as well as used as a food ingredient \[[@B9]\]. Traditionally, it has been used in the treatment of kidney disorders like painful urination, gonorrhea, and sexual diseases \[[@B10]\]. Chemical characterization showed that LP is composed of salicylic acid, vanillic acid, synergic acid, 2-methylresercinol and gallic acid \[[@B11]\]. These compounds have spasmogenic, cardiovascular, anticarcinogenic, antiinflammatory, and antioxidant properties to scavenge reactive oxygen species \[[@B12]\]. The present study was arranged to screen the various fractions of LP for the determination of total flavonoids and phenoilc consents, and to evaluate its antioxidant potential through scavenging of various free radicals.
Results
=======
Phytochemical characterization
------------------------------
### Total phenolics and flavonoids contents
Table [1](#T1){ref-type="table"} shows the presence of phenolics and flavonoids contents in various fractions of LP. The LPME possessed the highest total phenolics contents (432.8 ± 2.93) mg GAE/g while n-hexane comprised of lowest total phenolics content (188.3 ± 2.1) mg GAE/g extract. Maximum total flavonoid contents were recorded in LPME (13.98 ± 0.87) while the lowest concentration was present in LPHE (4.43 ± 0.45) mg equivalent rutin/g of dry fraction. The extraction yield of these samples varied from 4.43 ± 0.45% to be 16.28 ± 0.27% with a descending order of methanol \> chloroform \> ethyl acetate \> n-hexane fraction. Methanol and chloroform fractions resulted in the highest amount of total extractable compounds, whereas the extraction yield with ethyl acetate and n-hexane was significantly less (*P* \< 0.01) as compared to methanol and chloroform fraction.
######
**Total phenolic content in different extracts of*Launaea procumbens***
**Sample** **Total flavonoids compounds as rutin equivalent (mg/g dry extract)** **Total phenolic compounds as mg Gallic acid equivalent (GAE mg/g extract)** **% yield extraction**
------------ ----------------------------------------------------------------------- ------------------------------------------------------------------------------ ------------------------
LPME 13.98 ± 0.87^c^ 432.8 ± 2.93^c^ 16.28 ± 0.27^d^
LPCE 7.3 ± 0.54^b^ 267.4 ± 1.3^b^ 10.3 ± 0.54^c^
LPEE 8.6 ± 0.37^b^ 322 ± 3.6^b^ 8.6 ± 0.37b^b^
LPHE 4.43 ± 0.45^a^ 188.3 ± 2.1^a^ 4.43 ± 0.45^a^
Each value in the table is represented as Mean ± SD (n = 3) Means not sharing the same letter are significantly different (LSD) at P \< 0.01 probability level in each column.
HPLC quantification of flavonoids
---------------------------------
The HPLC-UV chromatogram revealed the presence of six polyphenolic compounds, including kaempferol, orientin, rutin, hyperuside, myricetin and quercetin. The investigated compounds in the methanolic extracts were quantified by integration of the peak-areas at 220 nm using an external calibration method. Calibration curves were constructed for each standard compound. Least-squares linear regression was used to determine the calibration parameters for each of standards. The linearity of all calibration curves was determined by calculating the correlation coefficients. There were some small peaks, which could not be identified; however, based on their chromatographic behaviors and UV spectra, their chemical class may correspond to unknown flavonoids compounds as presented in Figure [1](#F1){ref-type="fig"}. The Table [2](#T2){ref-type="table"} revealed that LPME possessed highest quantity of myricetin (1.237 ± 0.04) while hyperuside (0.335 ± 0.06) are in low concentration.
{#F1}
######
**HPLC quantification of methanolic extract of*Launaea procumbens***
**Samples** **Retention time** **Concentration (μg/mg dry weight)** **Compound**
------------- -------------------- -------------------------------------- --------------
LPME 18.5 0.607 ± 0.03 kaempferol
26.0 0.725 ± 0.02 orientin
27.5 0.608 ± 0.07 rutin
33.0 0.335 ± 0.06 hyperuside
35.0 0.897 ± 0.05 quercetin
45.5 1.237 ± 0.04 myricetin
Mean ± SEM.
*In vitro* antioxidant assays
-----------------------------
### DPPH (1, 1-diphenyl-2-picryl-hydrazyl) radical scavenging activity
DPPH is a stable free radical, which has been widely used in phytomedicine for the assessment of scavenging activities of bioactive fractions. The scavenging activities of various fractions of LP extracts were determined using free radicals of 1, 1-diphenyl 1-2-picryl-hydrazyl (DPPH) (Figure [2](#F2){ref-type="fig"} and Table [3](#T3){ref-type="table"}). Results showed that LPME (IC50 2.6 ± 0.004 μg/ml) possessed the highest antioxidant activity as compared to other fractions while LPHE had the lowest scavenging effect (IC50 19 ± 0.04 μg/ml). The DPPH radical scavenging activities of the LPME were even less (*P* \< 0.01) than those of ascorbic acid.
{#F2}
######
**IC**~**50**~**of different extracts of*Launaea procumbens*for various antioxidant systems**
**DPPH activity** **ABTS radical Inhibition assay** **Phosphomolybdenum assay** **β-carotene bleachingInhibition** **Chelating activity | {
"pile_set_name": "PubMed Central"
} |
Since Jacobs *et al*.[@b1] reported the first laparoscopic colectomy in 1991, the enthusiasm for mini-invasive surgery for colon cancer has been increasing every year[@b2]. A series of randomized, prospective clinical trials have confirmed that the oncologic outcomes of laparoscopic colectomy are equivalent to those of open surgery ([**Table 1**](#cjc-33-06-277-t01){ref-type="table"})[@b3]--[@b6]. Meanwhile, laparoscopic colectomy significantly improves the short-term outcomes of patients, such as lower pain scores, less estimated blood loss, and shorter length of hospital stay[@b7]--[@b10]. However, mini-invasive surgery for rectal cancer remains controversial because total mesorectal excision (TME) is limited by the confines of the bony pelvis and the goal of preserving the autonomic nerves. The main concern is that oncologic outcomes may be compromised by laparoscopic rectal cancer surgery. Substantial evidence is lacking, but some multicenter, prospective, randomized clinical trials are undergoing ([**Table 1**](#cjc-33-06-277-t01){ref-type="table"})[@b10]--[@b14].
As mini-invasive surgery for colorectal cancer gains popularity around the globe, several technologic innovations have been made ([**Table 2**](#cjc-33-06-277-t02){ref-type="table"}). Robotic surgery is an emerging technology that provides 3-dimensional imaging, tremor filtration, and motion scaling[@b15],[@b16]. With these advantages, robotic rectal cancer resection may overcome the limitations of conventional laparoscopic surgery. With the development of laparoscopic techniques and the invention of new surgical equipments, scarless surgery is becoming increasingly popular. In single-incision laparoscopic surgery (SILS), also termed single-port laparoscopic surgery, the surgeon operates through a single entry point with a single incision of only 25-30 mm. Several studies have found that colorectal SILS is feasible and safe and requires a significantly shorter total skin incision[@b17]--[@b20]. Another innovation is natural orifice specimen extraction (NOSE). For this procedure, the specimen is extracted from a natural orifice such as the vagina or anus; therefore, an additional incision in the abdominal wall is not needed. Several studies confirm that NOSE is a safe and effective approach with acceptable complication rates[@b21]--[@b25]. The final innovation is natural orifice transluminal endoscopic surgery (NOTES). NOTES is the only type of surgery that lacks scarring of the abdominal wall, thus, NOTES may represent the next step in the evolution of mini-invasive surgery[@b26],[@b27].
In this article, we review the published data and highlight the current status and latest advances of mini-invasive surgery for colorectal cancer.
###### Characteristics of multicenter, randomized, controlled trials of laparoscopic colorectal surgery compared with open surgery for colorectal cancer
Trial Type of cancer Reference(s) Surgery pattern Cases (n) Conversion rate (%) Follow-up (months) DFS OS
----------- ---------------- --------------------- ----------------- ----------- --------------------- -------------------- ---------------------- ----------------------
COST Colon [@b6],[@b7] LR 435 21 84 69.2% (5-year) 76.4% (5-year)
OR 428 68.4% (5-year) 74.6% (5-year)
COLOR Colon [@b5],[@b9] LR 534 19 53 74.2% (3-year) 81.8% (3-year)
OR 542 76.2% (3-year) 84.2% (3-year)
Barcelona Colon [@b3],[@b8] LR 111 11 95 NA 62% (7-year)
OR 108 NA 50% (7-year)
CLASICC Colorectal [@b4],[@b10],[@b38] LR 526 29 62.9 89.5 months (median) 82.7 months (median)
OR 268 77.0 months (median) 78.3 months (median)
COREAN Rectal [@b11] LR 170 1.2 UN NA NA
OR 170 UN NA NA
COLOR II Rectal [@b12] LR 699 17 UN NA NA
OR 345 UN NA NA
COST, the Clinical Outcomes of Surgical Therapies trial; COLOR, the COlon cancer Laparoscopic or Open Resection trial; CLASICC, the Conventional versus Laparoscopic-Assisted Surgery In Colorectal Cancer trial; COREAN, the Comparison of Open versus laparoscopic surgery for mid and low REctal cancer After Neoadjuvant chemoradiotherapy trial; COLOR II, the COlorectal cancer Laparoscopic or Open Resection II trial; LR, laparoscopic resection; OR, open resection; Conversion rate, the percent of patient in the laparoscopic group converted to open procedure; DFS, disease-free survival; OS, overall survival; UN, unknown; NA, not available.
###### Advantages and disadvantages of different mini-invasive surgical techniques for colorectal cancer
Surgery pattern Advantages Disadvantages
------------------------------------- -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Conventional laparoscopic surgery Relatively cheaper, a mature technology, shorter operation time[@b47]--[@b52] Steep learning curve, requires an abdominal wall incision, tremor, 2-dimensional vision, poor ergonomics, requires a skilled assistant, and limited degrees of freedom of the instruments[@b47]--[@b52]
Robot-assisted laparoscopic surgery Three-dimensional vision, 7 degrees of freedom of the instruments, enhanced ergonomics, tremor filtration, superior dexterity, less steep learning curve[@b15],[@b16],[@b47]--[@b60] Lack of tactile sensation and tensile feedback, expensive, limited intracorporeal range of motion, long operation time[@b15],[@b16],[@b47]--[@b60]
SILS Smaller abdominal wall incision, better short-term outcomes[@b17]--[@b20],[@b63]--[@b65] High cost, requires specific articulated instruments, steep learning curve[@b17]--[@b20],[@b63]--[@b65]
NOSE No need of an abdominal wall incision or specific devices, better short-term outcomes[@b21]--[@b25] Not suitable for every patient, risk of intraabdominal contamination and extraction site tumor implantation, highly variable in operative steps and devices[@b21]--[@b25]
NOTES No scar on the abdominal wall, avoidance of incision-related complications, less impairment of the peritoneal immune system[@b26],[@b27],[@b66]--[@b70] Risk of abdominal infection, hernia, and extraction site tumor implantation, difficulty in achieving a stable operating field, unavailability of adequate instrumentation[@b26],[@b27],[@b67]--[@b70]
SILS, single-incision laparoscopic surgery; NOSE, natural orifice specimen extraction; NOTES, natural orifice transluminal endoscopic surgery
Mini-invasive Surgery for Colon Cancer {#s2}
======================================
The benefits of mini-invasive surgery have been well estab-lished for some surgical procedures, such as laparoscopic cholecystectomy[@b28],[@b29]. Thus, there has been great enthusiasm for laparoscopic colectomy since Jacobs *et al*.[@b1] reported the first laparoscopic colectomy in 1991. Early studies demonstrated the feasibility of laparoscopic colectomy[@b1],[@b30],[@b31]. However, several reports showed that laparoscopic colectomy was associated with a high rate of trocar site and wound recurrences[@b32]--[@b34]. Berends *et al*.[@b32] reported that 21.4% of patients developed abdominal wall metastases after laparoscopic colectomy. Moreover, some reports documented that patients who converted from laparoscopic to open surgery had a significantly shorter cancer-specific survival than patients who did not convert to open surgery[@b35]--[@b37], and Chan *et al*.[@b35] demonstrated that patients in the conversion group had a 7% higher risk of local recurrence (9.8% vs. 2.8%). Moloo *et al*.[@b36] found a significantly lower 2-year survival rate after converted procedures compared to laparoscopic surgery (75.7% vs. 87.2%).
To determine whether laparoscopic colectomy has worse oncologic outcomes than open surgery, a series of multicenter, prospective, randomized trials have been performed, including the Clinical Outcomes of Surgical Therapies (COST) trial[@b6],[@b7], the Barcelona trial[@b3],[@b8], the COlon cancer Laparoscopic or Open Resection (COLOR) trial[@b5],[@b9], and the Conventional versus Laparoscopic-Assisted Surgery In Colorectal Cancer (CLASICC) trial[@b4],[@b10],[@b38]. The CLASICC trial is the only trial that includes patients with either colon or rectal cancer[@b4],[@b10],[@b38]. To date, the results of long-term follow-up have been published, and all of the trials found similar short- and long-term oncologic outcomes[@b3]--[@b10],[@ | {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
Malnutrition is responsible for about 24,000 deaths per day worldwide^[@CR1]^. Rice is staple food for more than half of the world population. It has a significant contribution in daily calorie-intake as millions of poor families depend mainly of rice for their nutrition. Rice supplies abundant carbohydrate as its kernel constitutes mainly of starch (\>80%) but protein (7--8%) is the source of concern. However, the protein quality measured by protein digestibility index and amino acid composition is the best among cereals^[@CR2]^, which makes it preferable for the food and feed industries. Efforts were made during past three decades by rice breeders to improve the protein content in rice grain, but significant and stable improvement could not be achieved due to the involvement of many small effect genes/quantitative trait loci (QTLs) substantially affected by environment. The QTLs for grain protein content (GPC) in rice have been identified in almost all chromosomes, though majority of them are present on chromosomes 1, 2, 6, 7, 10 and 11^[@CR3]--[@CR13]^. But multi-environmental stable and robust QTL for this trait was rare. This was due to the lack of high throughput genotyping platform leading to low density linkage map, low population size, lack of high throughput phenotyping procedure and lack of validation in different cropping season and environments. Moreover, this trait is not only governed by additive gene effect but also significantly influenced by the complex gene interaction including dominance, epistatic and genotype × environment interaction (G EI) component effects as realized by many researchers^[@CR12],[@CR14],[@CR15]^. But, in spite of quite high probability of getting epistasis and GEI-QTLs, no notable epistatic or multi-environment trial QTL (MET-QTL) was detected in rice for this trait. With the recent advancements in rice genomics research, more robust and reproducible markers such as single nucleotide polymorphic (SNPs) markers have been utilized to make SNP chips of various magnitude, i.e. on medium density Illumina's rice platform^[@CR16]--[@CR18]^, high density 50 K Illumina Infinium array platform (RiceSNP50)^[@CR19]^ and Affymetrix custom array such as 44 K and 50 K SNP chips platform in rice^[@CR20],[@CR21]^. In addition, Near Infrared (NIR) spectroscopy has been used by researchers to screen large number of germplasm for protein content in several cereals^[@CR22]--[@CR24]^ and in high throughput phenotyping of breeding lines^[@CR25]^.
In bi-parental mapping, population for detection of robust QTL for a particular trait required significant differences of two parents for that trait. For detecting QTLs for GPC, rarely very high protein genotype and low protein counterpart had been used which restricted trait variability and availability of robust QTL. Several rice germplasm with high GPC have been identified over the environments^[@CR26]^. They however were low yielder and had many undesirable features. Backcross breeding could be an effective approach for minimizing the undesirable effects coming from un-adapted donor parents^[@CR4],[@CR27]^. Backcross population is not only useful for detecting robust QTLs but also to generate introgression lines for use as pre-breeding lines or as high yielding elite cultivars. The advanced backcross QTL (AB-QTL) analysis has been successfully employed in detecting and transferring QTLs from un-adapted germplasm into advanced breeding lines in many plant species^[@CR28]--[@CR32]^. In rice, AB-QTL analysis has helped to detect many QTLs for several grain quality traits^[@CR33]^. But the use of two diverse parents (with regard to origin, nature, type and adaptability) often poses many problems such as lack of proper chromosomal pairing, pollen sterility in backcross lines leading to segregation distortion (SD) etc., Zhan and Xu^[@CR34]^ suggested that being the potential evolutionary force, the SD loci should be effectively utilized in mapping genes using appropriate packages. Among the statistical packages utilized for mapping QTLs, a SAS-based programme Proc QTL, QTL IciMapping V4 and DistortedMap handle SD markers safely and effectively to identify regions influencing trait expression^[@CR35]--[@CR38]^. Inside the putative or multi-environment QTLs region, functional genes which ultimately governed the phenotype were found using bioinformatics tool in previous studies on rice^[@CR39]^. In the present study high genetic variability governed by high protein donor followed by high throughput SNP-array based genotyping were exercised with the aim of detection of robust QTLs for grain protein content with plausible influence of epistasis and genotype × environment interaction. This investigation also explored the scope of high throughput phenotyping using NIR spectroscopy to validate stable QTLs in advanced near isogenic line (NIL) population. Finally it focused on the delineation of QTLs loci to find functional genes inside QTLs and tried to associate them with higher protein and protein fraction content in the selected stable high protein introgressed (NILs) over the environments.
Results and Discussion {#Sec2}
======================
Phenotypic analysis {#Sec3}
-------------------
ANOVA for plant height (cm) (PH), maturity duration (MD), number of panicles/plant (PN), panicle length (cm) (PL), grains/panicle (GRAIN), 100 grain weight (g) (GWT), plant yield (g) (PY), grain protein content (%) (GPC), single grain protein content (mg/g) (SGPC) in both *kharif* 2013 (*Env*.1) and *rabi season* 2014 (*Env*.2) individually and over the seasons (*Env*.1 + *Env*.2) revealed the significant variation in population for all the traits (Supplementary Table [1](#MOESM1){ref-type="media"}). High heritability (*h*^2^ = 0.75--0.78) of GPC in individual environment was observed. But this was moderate to low (*h*^2^ = 0.45) across environments calculated from pooled data. In contrary, SGPC revealed relatively higher heritability (*h*^2^ = 0.55) over the environments (Supplementary Table [1](#MOESM1){ref-type="media"}). Moreover, higher phenotypic variance of SGPC also indicated its suitability for QTL analysis. These facts indicated that SGPC was environmentally more stable than the percent protein content and therefore, transfer of this trait could be more feasible. Except PY and GWT all other traits followed normal distribution and both absolute values of skewness and kurtosis were less than 1.0, indicating suitability of data for QTL analysis (Supplementary Table [2](#MOESM1){ref-type="media"}). Transgressive segregation was observed for all traits, suggesting possible existence of multiple QTLs and QTL × QTL interaction or epistatic interaction. Transgressive segregation was observed in both directions of normal distribution for GPC and SGPC (Fig. [1](#Fig1){ref-type="fig"}). This indicated that both the parents may contribute to the QTL analysis of these traits. GPC and SGPC were not significantly (*p* \< 0.01) correlated with PY in two seasons and over the seasons (Supplementary Table [3](#MOESM1){ref-type="media"}). But both these traits were significantly (*p* \< 0.01) negatively associated with GRAIN which was positively associated with PY in both the seasons and over the environments. Path coefficient analysis (Supplementary Table [4](#MOESM1){ref-type="media"}) also revealed most significant direct effect of PN and GRAIN on PY, while no significant effect of GPC and SGPC was observed on PY.Figure 1Distribution of backcross derived mapping population (BC~3~F~4~) from ARC10075/Naveen for grain protein content (GPC) and single grain protein content (SGPC) in individual environments (Env.1 and Env.2) and distribution for GPC, SGPC, panicle length, panicle number/plant and plant yield over the environments (*Env*.1 + *Env*.2) (Note: P1: Naveen, P2: ARC10075, E1: *Env*.1 (*Kharif season* 2013), E2: *Env*.2 (*Rabi season* 2014)).
Analysis of variance revealed significant differences (*p* \< 0.001) of genotypes, environment and genotype × environment interaction for grain protein content (GPC) with nearly similar trend for single grain protein content (SGPC) in genotype (G) and environment (E) (*p* \< 0.001) as well as G x E (*p* \< 0.01). The significantly higher (*p* \< 0.001) mean GPC of mapping population was observed in *rabi season* 2014 (*Env*.2) as compared to both the *kharif seasons* (*Env*.1 and *Env*.3). Comparative lower (*p* \< 0.001) average SGPC was also found in *Env*.1 than in the *Env*. 2. Better water and nutrient management and higher light intensity in *rabi season* might have contributed to better grain filling and protein content in rice. ARC10075 had higher GPC and SGPC values than the control. Hence, ARC10075 and environment *Env*.2 were considered as reference combinations for identifying the best genotype in any specific environment. Lines, PLN-32, PLN-64, PLN-58 and PLN-56 in *Env*.2 were found superior in GPC while PLN-64 was also found superior in SGPC in *Env*. 2. | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-pharmaceutics-07-00542}
===============
The field of genetics is the study of genes, inheritance and genetic variation, while genomics is the study of the complete DNA sequence in the genome. In recent years, genomics gave birth to a series of other omics that refer to the complete collection of gene derivatives such as proteins, transcripts, or metabolites. Therefore, the broader and more inclusive term "genomics" sometimes refers to all large-scale approaches that are included in "omics".
Personalized medicine refers to the use of individual unique genomic information to optimize patient care. Because, in each individual, the nature of the disease, the onset, the prognosis, and the drug response are different, the effective application of genomic findings to clinical practice becomes our predominant goal.
In this review, we describe the important roles of genomic information applied in personal healthcare in general ([Figure 1](#pharmaceutics-07-00542-f001){ref-type="fig"}). First, disease susceptibility and risk can be identified at birth using DNA-based technologies, such as SNP genotyping, haplotype mapping or gene sequencing. Second, dynamic testing, including the profiles of mRNAs and microRNAs, and proteins and metabolites, combined with molecular imaging modalities may provide more precise means to access the risk of individuals during early initiating events of the disease. That information can also improve disease diagnosis and predict the disease progression. Third, when the decision is made to treat a condition, the selection of a therapy can be directed by the patient's genetic makeup as well as by the understanding of the disease's mechanism.
{#pharmaceutics-07-00542-f001}
1.1. DNA-Based Technologies {#sec1dot1-pharmaceutics-07-00542}
---------------------------
Human genome variation is represented by single-nucleotide polymorphisms (SNPs), copy-number variations (CNVs), insertions and deletions. During the drug discovery phase, information about genetic variations is used to identify signaling pathways as therapeutic targets. This early-stage research tries to understand the disparity between patients and control populations. Genome-wide association study (GWAS) is an efficient method that detects human genome variations and reveals novel genes contributing to disease pathogenesis. Some known drug targets and associated pathways have been identified on the list of GWAS hits. In the NIH policy white paper (2011) \[[@B1-pharmaceutics-07-00542]\], 44 genetic variants have been found to be strongly linked to type 2 diabetes susceptibility. Among them, six genetic variants are the primary drug targets while there are eight genetic variants associated with cellular, pharmacokinetic, pharmacodynamic, or clinical variations which respond to one or multiple drugs currently on the market. The other 30 variants on the list will further provide new insights into the underlying biology, disease mechanisms, and potentially novel therapeutic approaches.
As we understand, in reality, sometimes the contributions of genetic variants to the phenotypes are very small. The inconsistency in genotypic measurements diminishes the accuracy of genotypes and causes Type II errors in GWAS \[[@B2-pharmaceutics-07-00542],[@B3-pharmaceutics-07-00542]\]. There are diverse sources of genotype inconsistency from SNP microarray technologies that affect the findings of GWAS, including genotyping technologies \[[@B4-pharmaceutics-07-00542]\], the batch effect \[[@B5-pharmaceutics-07-00542],[@B6-pharmaceutics-07-00542]\] and genotype calling algorithms \[[@B7-pharmaceutics-07-00542],[@B8-pharmaceutics-07-00542],[@B9-pharmaceutics-07-00542],[@B10-pharmaceutics-07-00542]\]. Currently, next-generation sequencing (NGS) technologies have emerged as the most promising tools in genetic studies \[[@B11-pharmaceutics-07-00542]\].
Advances in sequencing technology have reduced the costs to the point where a human genome can now be sequenced at the \$1000 level \[[@B12-pharmaceutics-07-00542]\]. Therefore, sequencing a patient's genome will be part of standard medical testing in the future. NGS has now been used to sequence hundreds of human genomes and is being applied to identify the disease-related genes, which further helps to make a definitive diagnosis and even guide the treatment. Nicholas Volker's case is a promising example \[[@B13-pharmaceutics-07-00542]\]. He is the first patient diagnosed with an *XIAP* mutation and was saved by sequencing technology. In responding to President Obama's announcement of a new initiative for precision medicine, the NIH is going to sequence one million human personal genomes. With the development of quality control metrics and standardization for NGS technologies and data analysis \[[@B14-pharmaceutics-07-00542],[@B15-pharmaceutics-07-00542]\], NGS will accelerate the implementation of personalized medicine to improve public healthcare.
1.2. Dynamic Testing {#sec1dot2-pharmaceutics-07-00542}
--------------------
Dynamic testing is a method to look at an individual's molecular profile and study the genetic characteristics such as the messenger RNAs (mRNA), MicroRNAs, proteins and metabolites.
The unique pattern of molecular profiling can be used to explain disease heterogeneity and further classify the diseases. [Figure 2](#pharmaceutics-07-00542-f002){ref-type="fig"} demonstrates the utilization of gene expression profiles of bone marrow samples to diagnose patients with hematologic malignancies \[[@B16-pharmaceutics-07-00542]\]. Each column represents a bone marrow sample and each row corresponds to a gene. Shades of red indicate elevated expression while shades of blue indicate decreased expression. *FLT3* is the gene that is found to correlate most highly with the mixed-lineage leukemia (MLL) subtype. Several hundred studies have identified gene or protein expression profiles that predict clinical outcome and disease recurrence risks. Some are being routinely used for disease diagnosis and approved by the US FDA \[[@B17-pharmaceutics-07-00542]\].
{#pharmaceutics-07-00542-f002}
1.3. Pharmacogenomics {#sec1dot3-pharmaceutics-07-00542}
---------------------
Pharmacogenomics refers to the use of complex molecular information from the genome to optimize drug dose or predict drug response, which is a valuable tool in the development of new drugs as well as in improving overall outcomes with current drugs. Hundreds of drug labels have included exposure information and clinical response variability in individuals with certain genotypes \[[@B18-pharmaceutics-07-00542]\]. Among those drugs, Trastuzumab, a monoclonal antibody that interferes with *HER2*, is an example of a biologic therapy for which the diagnostic assay was developed to identify certain cancer patients who will most likely benefit. Trastuzumab was approved for about 10% of *HER2*-overexpressing patients. Due to the small sample size of the subgroup of patients, without a sensitive and accurate diagnostic assay, the drug might fail at the clinical trial stage. Clopidogrel is an antiplatelet agent used to prevent heart attack and inhibit blood clots in coronary artery disease. *CYP2C19* is an important drug-metabolizing enzyme. In 2010, the FDA put a black box warning on Clopidogrel to make patients and healthcare providers aware that patients with low activity of *CYP2C19*, representing up to 14% of patients, are at high risk of treatment failure and it is recommended that genetic testing is used to screen out those patients. Tetrabenazine is approved to treat Huntington\'s disease (HD) and is primarily metabolized by *CYP2D6*. Due to safety concerns caused by high exposure, patients with low activity of *CYP2D6* should be treated with lower doses compared with extensive and intermediate metabolizers.
1.4. Challenges of Using Genomics in Drug Development {#sec1dot4-pharmaceutics-07-00542}
-----------------------------------------------------
It generally takes 10--15 years for an experimental drug to go from the lab to US patient use. Only five in 5000 compounds at preclinical testing can enter the phase I stage. Additionally, only one of those five is approved for the market. On average, it costs a company \$1.2 billion. Based on the awareness of the drug development and approval process, researchers who are interested in translating genomic discoveries into personalized drug therapy should understand the challenges involved. (1) Drug development is extremely risky. Every year, about 10% of drug candidates can pass preclinical development to get approval. In recent years, almost half of the potential therapeutics failed with late-stage failures. Moreover, pharmaceutical product candidates receive extensive government regulations. Those factors lead to a conservative attitude toward using genomic approaches in pharmaceutical development. (2) Since the cost for the development of an innovative drug is very high and the time to create a successful drug is extremely long, pharmaceutical companies are reluctant to use genomic approaches to limit the indicated patient population unless "one-size-fits-all" development fails. (3) Even after drug approval, the manufacturer might not be able to make much profit by continuing genomic post-marketing studies due to patents' limited lifespans.
There are additional challenges for genomics to be applied in neurological drug development. (1) There is structural and functional heterogeneity of the individual brain. (2) There are difficulties for acquiring quality data from specimens for reliable analysis. Additionally, developing a human brain model is not easy and animal models cannot display the full range of human phenotypes. (3) Neurological evaluations for disease severity or progression are always subjective due to patients' or investigators' reports. Better | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#s0005}
===============
The Lambert-Eaton myasthenic syndrome (LEMS) is a rare autoimmune disease of the neuromuscular transmission involving the presynaptic voltage-gated calcium channels (VGCCs) ([@b0040]). In most cases (60%), LEMS represents a paraneoplastic syndrome associated with small cell lung cancer, in the remaining an idiopathic, autoimmune disease, with frequent overlap with other dysimmune syndromes, including myasthenia gravis (MG) ([@b0030]).
The typical clinical triad in LEMS consists of weakness (predominantly affecting proximal muscles), autonomic dysfunctions (including xerostomia, pupillomotor dysfunction, constipation, impaired sweating) and hypo/areflexia ([@b0020]). Strength and deep tendon reflexes should be tested at baseline and soon after exercise, in order to detect the well-known phenomenon of the "post-exercise facilitation", a short-lasting improvement of both reflexes and muscle strength immediately after muscle contraction ([@b0035]). LEMS patients typically present a proximal lower \> upper limb weakness that progressively involves axial, oculomotor and pharyngo-laryngeal muscles, thus leading to gait and upright alteration, ocular and bulbar symptoms in severely affected patients ([@b0015]).
Diagnosis is confirmed by detection of circulating VGCC antibodies and neurophysiological study, showing: *1*) significant increase of compound muscle action potential (CMAP) amplitude (\>60%) following brief isometric exercise compared to the rest (baseline), *2*) decremental response of CMAP amplitude at low-frequency (LF) (3 Hz) repetitive stimulation test (RST), *3*) incremental response of CMAP amplitude at high-frequency (HF) RST (10, 20, and 50 Hz), and *4*) increased neuromuscular jitter at single-fiber electromyography (SFEMG).
SFEMG is a neurophysiological test to study the neuromuscular junction ([@b0045]). Stimulated SFEMG (sSFEMG), in particular, has the following advantages compared to voluntary SFEMG (vSFEMG): *1*) allows the study of the neuromuscular junction without the voluntary activation; *2*) allows stimulation rate control ([@b0050]); *3*) requires only a limited patient cooperation; *4*) is far more comfortable.
2. Case report {#s0010}
==============
We report the case of a 60-year-old woman presenting with proximal and axial weakness, waddling gait and bilateral ptosis. After consultation with her general practitioner, a needle electromyography (EMG) was performed and showed early recruitment, polyphasic motor unit potentials (MUPs) with small amplitudes and short durations (SASD MUPs), absence of resting activity, suggesting a diagnosis of non-inflammatory myopathy. At this point, the patient was referred to our Division of Neurology for further diagnostic procedures. A more detailed medical history revealed that patient was also complaining of xerostomia, xerophthalmia and constipation, symptoms compatible with an autonomic dysfunction. At neurological evaluation, deep tendon reflexes were absent at rest but showed the post-exercise facilitation phenomenon. All these clinical findings were suggestive of a pre-synaptic myasthenic syndrome. Extended neurophysiological testing revealed an increase of the median nerve CMAP basal amplitude after brief (10 s) isometric contraction (4.4 → 12.7 mV, increase of 288%) ([Fig. 1](#f0005){ref-type="fig"}A), a decremental response of CMAP amplitude at LF-RST (3 Hz) (−22.7%) and incremental response at HF-RST (30 Hz) (227%) ([Fig. 1](#f0005){ref-type="fig"}B−C), recording from right abductor pollicis brevis (APB). At rest, needle EMG in the right biceps showed early recruitment with a reduced firing rate (2:1), normal activation, SASD and polyphasic MUPs. This pattern is called pseudomyopathic because of its normalization after brief muscle contraction, showing normal recruitment, firing rate (5:1) and MUPs parameters. To better characterize the neurophysiology of this syndrome, we performed both vSFEMG and sSFEMG in the right extensor digitorum communis (EDC) muscle using a concentric needle EMG with the smallest recording area (0.03 mm^2^). We used a Synergy EMG machine (Synopo) with automatic jitter, MCD and percentage of blocking analysis. For sSFEMG, three different rates of intramuscular axonal stimulation were used (10, 20 and 50 Hz). Inter-potential intervals represent the difference in latency between the artifact stimuli and the action potential, therefore representing the variability of the end-plate ([@b0005]). Blocking was expressed as a percentage of the number of stimulations that failed to evoke a potential over the total number of stimulations.Fig. 1Neurophysiological tests in LEMS. Representative neurophysiological diagnostic approach in patients with LEMS. (A) the baseline low amplitude of the median nerve compound muscle action potential (CMAP) from right abductor pollicis brevis (APB) was significantly increased after brief isometric exercise; (B) in the same muscle, low- (LF) and C) high-frequency (HF) repetitive stimulation test (RST) showed significant decremental (B) and incremental response (C), respectively.
vSFEMG showed a non-specific increased duration of the neuromuscular jitter (mean jitter and MCD 97.9 μs, n.v. \<30) with blocks in the 20% of the analyzed fibers, as also typically observed in MG. In contrast, sSFEMG showed the typical rate-dependent reduction of the neuromuscular jitter and blocking: neuromuscular jitter and the percentage of blocks were significantly reduced at the increase of the stimulation rate (jitter: 166.5 → 90.5 → 50.3 μs; percentage of blocks: 24 → 13 → 2% at 10, 20, and 50 Hz, respectively) ([Fig. 2](#f0010){ref-type="fig"}). Diagnosis was confirmed by serological demonstration of circulating VGCC antibodies (265.39 pmol/L, n.v. \<80).Fig. 2Frequency-dependent neuromuscular jitter in LEMS. Stimulated single-fiber electromyography (sSFEMG) demonstrated a frequency-dependent reduction of the neuromuscular jitter values at the increase of the stimulation rate.
3. Discussion {#s0015}
=============
This case report highlights the importance of the correct execution and interpretation of the neurophysiological evaluation, suggesting that pseudomyopathic pattern at EMG should be correlated with other clinical (e.g. weakness and deep tendon reflexes at rest and after exercise) and neurophysiological findings (fibrillations, complex repetitive discharges) ([@b0025]) to differentiate myasthenic from myopathic syndrome. Recently, SASD MUPs and marked type II fiber atrophy mimicking myopathy have been also reported in LEMS patients ([@b0010]), thus making differential diagnosis even more complex. sSFEMG represents, therefore, a very helpful approach in the differential diagnosis of LEMS thanks to the peculiar rate-dependence of neuromuscular jitter that is not observed in myopathies.
In conclusion, sSFEMG findings in LEMS underlie the stimulation rate-dependency of both neuromuscular jitter and blocks, reflect the basic pathophysiology of this neuromuscular syndrome, thus making this technique very specific and, therefore, clinically useful for an early and accurate diagnosis.
Acknowledgments {#s0020}
===============
The authors thank Dr. Silvana D'Amico, a neurophysiology technician, for her assistance.
This research did not receive any financial support from commercial or non-profit companies.
Conflict of interest {#s0025}
====================
The authors declare that they have no conflicts of interest and nothing to disclose.
[^1]: These authors equally contributed to this work.
| {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-sensors-18-00223}
===============
Just as the personal computer has revolutionized research in the sciences over recent decades, smartphones are now finding increasing application in a wide variety of research domains. This is expedited by the integrated data capture and processing capability (e.g., lab in a phone) operability of these units, their compact form factor, relatively low cost, and very widespread circulation. Indeed, whilst smartphones can be interfaced with external hardware for data acquisition, they are also host to an increasingly sophisticated array of onboard sensors, e.g., proximity sensors, accelerometers, moisture sensors, gyroscopes and electro-magnetic compasses, in addition to the sensors associated with the touchscreen and the cameras themselves. Furthermore, in view of their intrinsic networking capacity, smartphones are also obvious candidates for deployment as nodes within Internet of Things networks, to enable capture of spatially resolved big data within a variety of environments.
Over the last decade smartphone imaging has been increasingly applied in a variety of scientific domains. For example, in an early seminal work on this theme, a smartphone-based microscope assembly was reported and used to identify *P. falciparum*-infected and sickle red blood cells and *M. tuberculosis*-infected sputum samples, via a combination of bright-field and fluorescence approaches \[[@B1-sensors-18-00223]\]. The point was made, that owing to the wide spread use of smartphone technology and the availability of cell phone networks in many parts of the developing world, that this approach could be a highly cost-effective means of diagnosis and screening concerning hematologic and infectious diseases, in contexts where standard microscopy laboratory equipment is scarce. The authors go on to anticipate telemedicine for global healthcare, mediated via mobile phones. A more recent review of the field has tracked how the Moore's law type, doubling every two years or so, of the Megapixel count of phone cameras, has expedited the uptake of smartphone imaging in microscopy (fluorescence, dark-field and bright-field), enabling imaging and detection of individual viruses and single DNA molecules \[[@B2-sensors-18-00223]\]. In terms of point of care applications, eye health has featured too, in particular involving an adapter attached to a smartphone camera, to enable imaging of the optic nerve and retina, which is of importance in the diagnosis and monitoring of a variety of conditions including glaucoma, macular degeneration, hypertension and malaria. In an exciting recent development, this technology has been applied in a Kenyan context, with a view to expanding the reach of eye care in the developing world \[[@B3-sensors-18-00223],[@B4-sensors-18-00223]\] ([Figure 1](#sensors-18-00223-f001){ref-type="fig"}).
The individual colour (RGB) outputs of smartphones have also been exploited in an imaging capacity in a number of ways, e.g., colourimetric determination of water quality. For instance, chlorine contamination has been characterised via reaction of this pollutant with an indicator chemical, prompting a change in colouration, which is captured by the smartphone \[[@B5-sensors-18-00223]\]. This capacity, combined with the GPS functionality of the phone, can be used to obtain spatio-temporal maps of species concentrations \[[@B6-sensors-18-00223]\], which would be very useful, for instance in monitoring dispersal of effluent following pollutant events. Smartphone-based colourimetry has also been realised in bioanalytical \[[@B7-sensors-18-00223]\] applications as well as for monitoring air quality \[[@B8-sensors-18-00223]\]. This capacity, has in addition, been applied to characterizing the colour of soils, in order to achieve objective Munsell type soil classifications \[[@B9-sensors-18-00223]\]. Smartphone imaging has also been applied in fluorescence measurements in the visible \[[@B10-sensors-18-00223],[@B11-sensors-18-00223]\], particularly in terms of point of care diagnostics \[[@B12-sensors-18-00223]\], and in the infrared \[[@B13-sensors-18-00223]\], as well as in flame emission diagnostics \[[@B14-sensors-18-00223]\], in profiling laser beams \[[@B15-sensors-18-00223]\] and for characterizing food volumes via an image based segmentation algorithm as a potential aid in diet monitoring \[[@B16-sensors-18-00223]\].
Smartphone imaging has furthermore been useful in remote sensing, for example in aerial photography and grass roots mapping applications. This methodology has been applied from drones and kites \[[@B17-sensors-18-00223]\], using the positional information available from the smartphone, along with open source geospatial toolkits, to deliver products, which can be readily fed into geographical information systems, with potential application in a variety of areas e.g., in providing rapid data to inform responses to humanitarian or natural disasters. Smartphones have additionally been applied quantitatively in this context, for example in determining 'leaf area index', which is a measure of foliage cover \[[@B18-sensors-18-00223]\], and these units could be powerful tools in tracking longer term trends in sky \[[@B19-sensors-18-00223]\], land cover and vegetation conditions. Ultraviolet characterisation with these devices has been performed too, with a view to potential future use in determining personal UV exposure levels \[[@B20-sensors-18-00223],[@B21-sensors-18-00223],[@B22-sensors-18-00223],[@B23-sensors-18-00223]\]. Finally, there has also been considerable use of array sensors, developed for the smartphone market, but instead housed within camera modules, which are interfaced with low cost computer, e.g., Raspberry Pi, boards, for application in a number of scientific domains, e.g., volcanology \[[@B24-sensors-18-00223],[@B25-sensors-18-00223]\]. This alternate configuration has the advantage of a potentially greater degree of user control of the sensor than available via the phone itself, e.g., by using the Python programming language.
Building on the initial application of smartphone sensor arrays in imaging, a number of workers have begun to pioneer methods of using these sensors to capture spectral information, e.g., by dispersing spectra across one dimension of the sensors' 2D arrays. This interest has spanned the maker, academic research and citizen science communities, expedited by the advent of 3D printing, which has been used to great effect to generate open source optical hardware at a fraction of the cost of commercially available units, therefore opening optical science to everyone \[[@B26-sensors-18-00223]\].
This article provides a review of the exciting and potentially highly disruptive advent of spectral acquisition with smartphones. Such a piece is timely, as this technology is now beginning to gain traction within the sciences as units are being developed which are of sufficient quality to be useful in a wide variety of applications, including agriculture, food inspection, atmospheric spectroscopy and analytic chemistry. Indeed, [Figure 2](#sensors-18-00223-f002){ref-type="fig"} reveals the sharp uptake in interest in this field since 2014, as manifested as research articles per year within the Science Citation Index Expanded (Clivariate Analytics; data accessed November 2017), using the search term: 'smartphone and spectrometer'. For reference, [Figure 2](#sensors-18-00223-f002){ref-type="fig"} also details the earlier escalation in interest in smartphone imaging, via a 'smartphone and imaging' search, in line with the now widespread reach of that approach within the sciences.
2. Transmission Grating Configurations {#sec2-sensors-18-00223}
======================================
Smartphones have been used to acquire spectra via two dominant approaches, namely using transmissive, and reflective diffraction gratings, respectively to disperse incoming radiation, before detection using the smartphone camera sensor. These modalities will be covered in this and the next section, respectively, with other formats used to acquire spectra with smartphones treated in the discussion section. In terms of transmission grating approaches, some of the case study optical configurations are shown in [Figure 3](#sensors-18-00223-f003){ref-type="fig"}.
The initial designs of smartphone spectrometers were focused on affixing transmissive diffraction gratings directly to the windows of smartphone cameras. In, what to our knowledge is the first report of a smartphone spectrometer, a system is described in which a slit shaped aperture was formed over the grating, using two parallel strips of tape, separated by ≈1 mm \[[@B27-sensors-18-00223]\]. A tube containing darkened foil was mounted over the camera, at an angular inclination of around 45° in order for the sensor to be illuminated by the first order diffracted output from the grating. Furthermore, another slit located at the non-spectrometer end of a tube ensured that only quasi-collimated light could pass to the grating such that the system effectively captured diffracted images of this slit, constituting a spectral analogue of a pinhole camera. The authors reported on proof of concept functionality by collecting spectra of light transmitted through human tissue, as well as fluorescence from a rhodamine 6 G solution, demonstrating favourable performance in comparison to contemporaneously obtained spectra from a commercially available spectrometer. System spectral resolutions of 5--10 nm were reported, with an applied grating of 1000 lines/mm. This dual aperture approach was also adopted by Oliviera et al. \[[@B28-sensors-18-00223]\], who built an inexpensive medium density fibre-board (MDF) unit, using a DVD for the diffraction grating. A modularized design enabled both fluorescence and absorption based spectroscopic observations, with demonstrated applications in measurements of Fe^2+^ and Na^+^ in medicine and saline samples, respectively.
This approach has been elaborated | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
Many carnivore species are currently threatened and are the focus of intense conservation concern [@pone.0024601-Baillie1]. Feline carnivores are often subject to illegal wildlife trade, thus the ability to estimate the geographic provenance of illegal tissue samples would constitute important information in wildlife crime investigations [@pone.0024601-Nowell1]. Probabilistic provenance determination based on O and H isotopes has strong potential to be applied to animal tissues as an investigative tool in wildlife forensic science [@pone.0024601-Bowen1]--[@pone.0024601-Hnaux1]. Validation of isotopic methods has relevance and practical application in various fields like wildlife forensics and conservation biology.
Measurements of the stable isotopes of hydrogen (δD) and oxygen (δ18O) of animal keratinous tissues have been used to track the geographic origin and migratory patterns in a wide variety of animals (e.g. [@pone.0024601-Bowen1], [@pone.0024601-Hobson1], [@pone.0024601-Cryan1]--[@pone.0024601-Hobson2]). To date, this approach is based on strong empirical correlations between δD values in animal tissues (δD~t~) with the isotopic composition of the amount-weighted mean annual or mean-growing season precipitation (δD~p~). The latter correlates inversely with latitude and elevation across the continents, especially in North America [@pone.0024601-Bowen2]--[@pone.0024601-Rozanski1]. Few studies have coupled δD and δ^18^O measurements of the organic or inorganic fractions of animal tissues despite the strong covariance between these isotopes in environmental waters (hairs and nails: human [@pone.0024601-Ehleringer1], [@pone.0024601-Bowen3]--[@pone.0024601-Thompson1]; CO~2~, body water, hair and enamel: woodrat [@pone.0024601-Podlesak1]; chitin: brine shrimp [@pone.0024601-Nielson1]; chitin: chironomids [@pone.0024601-Wang1]; plasma, blood and feathers: birds [@pone.0024601-Hobson3], [@pone.0024601-Wolf1]; fat, blood, muscle, hair and collagen: pig [@pone.0024601-Tuross1]; carbonate and phosphate tooth enamel, bone collagen, subcutaneous fat and hair: laboratory rat [@pone.0024601-Kirsanow1]). Strong correlations between δD~p~ and δD~t~ have been found for many species [@pone.0024601-Hobson1]. The hydrogen and oxygen isotopic composition of animal tissues (hair, feathers, teeth) is related to the isotopic composition of body water (e.g. [@pone.0024601-Hobson4]--[@pone.0024601-Sharp1]) and ultimately to that of ingested water. Influences on isotopic composition of body water (δD~bw~, δ^18^O~bw~) of animals include abiotic (climate, drinking water) and biotic (diet and physiology) factors [@pone.0024601-Bryant1]--[@pone.0024601-Tatner1]. The incorporation of H and O isotopes from the hydrosphere via diet and drinking water into animal tissues is a complex process and our understanding of how these mechanisms affect the nature and variability of the empirically observed relationships is still poor (e.g. [@pone.0024601-Bowen3]). However, to reliably track the geographic origin of an animal requires a detailed understanding of the metabolic routing of dietary nutrients and mechanisms of H and O isotopic incorporation into animal tissues [@pone.0024601-Hobson5].
Hydrogen and oxygen in animal tissues can be derived from two potential sources: dietary nutrients and body water, whereas oxygen is also derived from inhaled air. The body-water pool, in turn, is derived from ingested drinking-, food-, and metabolic-water produced during the catabolism of food macromolecules [@pone.0024601-Bryant1], [@pone.0024601-Kohn1], [@pone.0024601-Luz2], [@pone.0024601-Tatner1], [@pone.0024601-Ayliffe1]--[@pone.0024601-Luz4]. The relative contributions of all these sources to protein synthesis (i.e. keratin and collagen) are likely to vary among animals [@pone.0024601-Karasov1]--[@pone.0024601-Reynard1]. Controlled experiments are key to understand and model the incorporation of H and O isotopes into proteinaceous tissues like keratins (hair and feathers), collagen, and chitin, and have so far been developed for only a small number of species like woodrat (*Neotoma cinerea* and *Neotoma stephensi*; [@pone.0024601-Podlesak1]), rat (*Rattus norvegicus*; [@pone.0024601-Kirsanow1]), Japanese quail (*Coturnix japonica*; [@pone.0024601-Hobson4]), house sparrow (*Passer domesticus*; [@pone.0024601-Wolf1]), humans (*Homo sapiens*; [@pone.0024601-Ehleringer1], [@pone.0024601-Bowen3]--[@pone.0024601-Thompson1], [@pone.0024601-Sharp1]), pig (*Sus scrofa domesticus*; [@pone.0024601-Tuross1]), brine shrimp (*Artemia franciscana*; [@pone.0024601-Nielson1]) and chironomids (*Chironomus dilutus*; [@pone.0024601-Wang1]). These studies revealed that keratin δD and δ^18^O reflect both biological (diet, physiology) and environmental signals (water, geographic movement, climate; [@pone.0024601-Bowen3]). Deviations from a strong coupling between δD~t~ and δD~p~, and δ^18^O~t~ and δ^18^O~p~ have been shown (e.g. [@pone.0024601-Bowen3], [@pone.0024601-Lott1]) and may be linked to: 1) climatic factors like relative humidity [@pone.0024601-Ayliffe1], [@pone.0024601-DelgadoHuertas1]; 2) isotopic disequilibrium of food and water contributions to δD~t~ [@pone.0024601-Sharp1]; 3) possible trophic-level effects on δD~t~ [@pone.0024601-Birchall1]; 4) impacts of metabolic rate and drinking water flux on δD~bw~ and δ^18^O~bw~ [@pone.0024601-OGrady1], [@pone.0024601-Bryant1], [@pone.0024601-Kohn1], [@pone.0024601-Luz2] (δ^18^O of phosphate in urinary stone [@pone.0024601-Levinson1], bone [@pone.0024601-Luz1] and tooth [@pone.0024601-Levin1]); and 5) dietary and physiological controls on δ^18^O~h~ and δD~h~ of hair [@pone.0024601-Bowen3].
Previous studies that successfully applied combined δD~t~ and δ^18^O~t~ analysis to track the geographic origin and migration of animals focused on herbivores and omnivores (e.g. [@pone.0024601-Bowen1], [@pone.0024601-Hobson2], [@pone.0024601-Podlesak1], [@pone.0024601-Wolf1], [@pone.0024601-Tuross1], [@pone.0024601-Hobson4]). The fact that this method performs particularly well in omnivorous modern humans [@pone.0024601-Ehleringer1], [@pone.0024601-Bowen3]--[@pone.0024601-Thompson1], [@pone.0024601-Daux1] is not surprising, because humans are well-hydrated and typically consume a constant local water source (e.g. tap water: [@pone.0024601-Bowen4]--[@pone.0024601-Kennedy1]) and consistent homogenous diet across regions (e.g. fast food: [@pone.0024601-Chesson2]). But even for humans, hydrogen isotopic incorporation during keratin synthesis likely varies between different keratinous tissues like nail and hair [@pone.0024601-Fraser2]. Free-ranging carnivores, however, differ significantly in their nutritional, physiological and metabolic characteristics from herbivores and omnivores [@pone.0024601-MacDonald1], [@pone.0024601-Zoran1]. The house cat, *Felis catus*, is the most thoroughly studied mammalian carnivore [@pone.0024601-MacDonald1]. Felids are strict carnivores and thus obtain much of their body water from the consumption of prey [@pone.0024601-MacDonald1]. Owing to the lack of empirical H/O isotope studies on strict carnivores (other than raptors) it is unclear whether carnivore hairs track the spatially predictable meteoric water | {
"pile_set_name": "PubMed Central"
} |
Background
==========
Choledocholithiasis is the presence of gallstones in the common bile duct (CBD) and constitutes the dominating etiology of nonmalignant biliary obstruction \[[@b1-medscimonit-23-4500]\]. Choledocholithiasis develops in 8--20% of patients suffering from this common disorder, of which 5% are asymptomatic \[[@b2-medscimonit-23-4500]\]. Although CBD stones may be asymptomatic, they are responsible for considerable morbidity and mortality because of complications such as cholangitis, acute pancreatitis, and hepatic dysfunction \[[@b3-medscimonit-23-4500]\]. Therefore, paying attention to the detection and management of CBD stones is mandatory.
The management of CBD stones remains debatable, although both endoscopic and laparoscopic techniques have evolved significantly with considerable refinement of equipment and technique \[[@b4-medscimonit-23-4500]\]. T tube drainage after choledochotomy is a traditional surgical treatment for choledocholithiasis \[[@b5-medscimonit-23-4500]\]. The T tube has been proven to be an effective method for postoperative biliary decompression, which is essential in avoiding spasm or edema of Oddi's sphincter \[[@b6-medscimonit-23-4500],[@b7-medscimonit-23-4500]\]. However, T tube usage is not exempt from complications, such as bile leakage after T tube removal, tract infection, electrolyte and nutritional disturbances, cholangitis, or acute renal failure from dehydration due to inadequate water ingestion, particularly in elderly patients \[[@b7-medscimonit-23-4500],[@b8-medscimonit-23-4500]\]. In addition, the patients have to carry bile drainage equipment for several weeks before removal, causing significant discomfort in patients and affecting their work \[[@b9-medscimonit-23-4500]\]. The disadvantage of T tube drainage led several authors to perform primary closure of the duct immediately after exploration \[[@b10-medscimonit-23-4500],[@b11-medscimonit-23-4500]\]. On the other hand, laparoscopic CBD exploration (LCBDE) has all the advantages of minimal access surgical procedures and is currently considered to be as effective as endoscopic retrograde cholangiopancreatography (ERCP) \[[@b11-medscimonit-23-4500]\]. LCBDE is now an accepted treatment modality for single-stage management of CBD stones in qualified patients \[[@b12-medscimonit-23-4500]\].
The internal double J (D-J) stent, also known as the retrograde ureteric stent, has become an integral part of the urological armamentarium \[[@b13-medscimonit-23-4500]\]. The D-J stent is a thin, hollow, flexible tube, and has 2 "J-shaped" (curled) ends, with one anchored in the renal pelvis and the other inside the bladder. Additionally, the D-J tube has multiple side-holes that allow urine to drain freely from the upper collecting system of the kidney, down through and around the stent, and into the bladder \[[@b14-medscimonit-23-4500]\]. The D-J stent, as a main option for temporary urinary diversion, allows good urinary drainage from the kidney to the bladder, and is generally safe and well tolerated. The usage of D-J stenting is associated with decreased incidence of urinary fistula and ureterostenosis \[[@b15-medscimonit-23-4500]\]. In this context, we suggested that the D-J stent drainage may be used as an alternative to T tube drainage. However, few studies have investigated whether the D-J tube could be an alternative to the placement of a T tube and be used in the primary closure after LCBDE.
In the present study, we conducted a retrospective study to assess the short-term clinical results of primary closure following LCBDE combined with intraoperative choledochoscopy and D-J tube drainage. In particular, the D-J stents used in this study were 4.7F×14 cm, a size commonly used in pediatric urology.
Material and Methods
====================
Patients and data collection
----------------------------
Patients who underwent LCBDE with primary duct closure for choledocholithiasis in our hospital between April 2010 and April 2015 were enrolled in this study. Choledocholithiasis was diagnosed and confirmed preoperatively by B-type ultrasonography (US), computed tomography (CT), and/or magnetic resonance cholangiopancreatography (MRCP). Patients were included in the study if they met all of the following criteria: 1) inner diameter of CBD ≥0.7 cm, 2) 1--3 stones with diameter of 0.3--1.2 cm, 3) sphincter of Oddi in good condition, and 4) no history of upper abdominal surgery. Patients were excluded from recruitment into the study if they had confirmed intrahepatic multiple stones or primary sediment calculus; suppurative cholangitis; stenosis of the bile duct; or biliary pancreatitis. Thus, a total of 25 patients met the eligibility criteria and were included in the study. A total of 17 patients had a CBD diameter \>10 mm and 8 patients had a CBD diameter \<10 mm. The range of CBD diameters was 0.7--2.0 cm. None of the patients had acute suppurative obstructive cholangitis at the time of admission. Only 3 had already undergone a previous cholecystectomy and 1 patients had previously undergone partial intestinal resection. Symptoms such as fever and abdominal pain were identified in 5 cases preoperatively. Nine patients had jaundice and they were given an anti-inflammatory agent and liver-protective drugs for treatment. Ethics approval was obtained from the local Ethics Committee and all patients signed written informed consent prior to participation into the study.
Operative technique
-------------------
The operations were performed under general anesthesia. The procedure was initiated with the standard 4-trocars technique as a laparoscopic cholecystectomy \[[@b16-medscimonit-23-4500]\]. An operating laparoscope (Olympus CHF-P60, Japan) was employed. The cystic artery was clipped and cut off. The gallbladder bed was isolated and the gallbladder was left *in situ*. We used needle aspiration of bile to identify the CBD. A 0.6-cm to 1-cm longitudinal incision was made at the anterior surface of the CBD, through which a choledochoscope (Olympus, HF-10) was inserted into the CBD and maneuvered proximally and distally in the biliary tree. Any stone encountered during the choledochoscopy was retrieved with a stone basket. Biliary lithotripsy was used, if necessary, to fragment large stones ([Figure 1](#f1-medscimonit-23-4500){ref-type="fig"}). The stones were all retrieved and the intrahepatic/extrahepatic bile duct clearance was confirmed with choledochoscopy. Then, a guide wire was advanced through the working channel of the choledochoscope into the duodenum. We used the guide wire to support the circle head at both ends of the D-J stent (4.7F×14 cm, Bard Medical, Covington, GA, USA) into a straight tube, and then pushed the D-J tube into the CBD from the side of the choledochoscope. Then, the D-J tube and the guide wire were advanced into the duodenum ([Figure 2](#f2-medscimonit-23-4500){ref-type="fig"}) through the duodenal papilla using the choledochoscopy grasping forceps. After the tube had been positioned in place using the grasping forceps, the guide wire was withdrawn from the CBD. Two ends of the D-J tube were spiral in the duodenum and CBD ([Figure 3](#f3-medscimonit-23-4500){ref-type="fig"}). The choledochotomy was primarily closed with interrupted Vicryl (polyglactin, absorbable) 4-0 sutures. To reduce the risk of bile leak from the choledochotomy, suture closure should be carried out delicately and steadily. After cholecystectomy was completed, a peritoneal drain was placed in the subhepatic space. The D-J tube was removed using a duodenoscope (OLYMPUS, JF-240) if there was no bile leakage. Bile leak was noted intraoperatively and postoperatively. After primary suture closure, the location at the biliary suture was repeatedly wiped with gauze. If the gauze was dyed yellow, the corresponding suture position was reinforced using 0--5 PDS absorbable sutures. Bile fistula was assessed by observing the nature and amount of drainage fluid.
Discharge and follow-up
-----------------------
Patients could drink water on the first day postoperatively. Before discharge, we examined the blood amylase. After discharge or D-J tube removal, all patients were routinely assessed for complications. B-ultrasonography (US) examinations were carried out at 1 to 12 months in the outpatient clinic to check residual or recurrent common bile duct stones, with MRCP used when indicated. Magnetic resonance imaging was used to check for stenosis of the bile duct or other severe complications in every patient.
Statistical analysis
--------------------
Data were analyzed using the SPSS statistical software package version 20.0 (SPSS, Chicago, Illinois). The results of continuous variables are expressed as median (range). The cost of treatment was calculated and reported in Renminbi yuan (CNY; USD 1=CNY 6.9). Differences were considered statistically significant at P values less than 0.05.
Results
=======
During the study period, 25 patients (14 women and 11 men) with the median age of 45.5±6.3 years (1 patient was \>65 years old) underwent a primary closure following LCBDE combined with intraoperative choledochoscopy and D-J | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
Sharks are an important component of coral reefs, both in terms of the ecological role they play in reef ecosystems [@pone.0086682-Friedlander1]--[@pone.0086682-Sandin1], and increasingly because of their value for shark-diving tourism [@pone.0086682-Stoeckl1], [@pone.0086682-Vianna1]. Watching sharks in their natural habitats, and hence diving with sharks, has become an important product of today's recreational dive industry [@pone.0086682-Gallagher1]. However, in order to guarantee shark sightings to paying customers, dive operators are often required to use food to reliably attract them to specific dive sites [@pone.0086682-Dobson1]. Whereas the effects of baiting (i.e. chumming) and supplemental food provisioning (i.e. actual feeding) on, for example, the behaviour and abundance of individual shark species are starting to become known [@pone.0086682-Clua1]--[@pone.0086682-Brunnschweiler2], there is an almost complete lack of equivalent data from multi-species shark diving sites.
In the only two studies on multiple species available to date, Meyer et al. [@pone.0086682-Meyer1] suggest that increasing numbers of larger Galapagos sharks *Carcharhinus galapagensis* and tiger sharks *Galeocerdo cuvier* gradually excluded smaller sandbar sharks *Carcharhinus plumbeus* at a baited dive site in Hawaii. In a more recent study, Clarke et al. [@pone.0086682-Clarke2] found that, at a reef in the Red Sea where sharks have been baited for more than 12 years, initially grey reef sharks *Carcharhinus amblyrhynchos* outnumbered silky sharks *Carcharhinus falciformis*, but over a six-year period *C. falciformis* sightings increased almost 20-fold, while *C. amblyrhynchos* sightings decreased by more than 90%. Subsequently, the number of *C. falciformis* also declined considerably, leading the authors to suggest that declines were related to local fishing pressure rather than competitive exclusion [@pone.0086682-Clarke2].
In the present study, we evaluate data from the Shark Reef Marine Reserve, a multi-species shark feeding site in Fiji [@pone.0086682-Brunnschweiler3], [@pone.0086682-Brunnschweiler4]. Up to eight different species of sharks can be encountered at Shark Reef, namely bull sharks *Carcharhinus leucas*, whitetip reef sharks *Triaenodon obesus*, blacktip reef sharks *Carcharhinus melanopterus*, tawny nurse sharks *Nebrius ferrugineus*, silvertip sharks *Carcharhinus albimarginatus*, sicklefin lemon sharks *Negaprion acutidens*, *C. amblyrhynchos* and *G. cuvier*. Since 2003, parts of Shark Reef have been declared as a no-take zone that is visited 3 to 4 times per week by a single dive operator [@pone.0086682-Brunnschweiler4]. Previous research from this site has shown that the number of *C. leucas*, the numerically dominant species at the Shark Reef Marine Reserve, increased over the years, but decreased over the course of a calendar year [@pone.0086682-Brunnschweiler1], [@pone.0086682-Brunnschweiler3]. In 2006, a competitor dive operator started to conduct shark feeding dives on the neighbouring Lake Reef ([Fig. 1A](#pone-0086682-g001){ref-type="fig"}), mostly on the same days and times when dives on Shark Reef take place.
{#pone-0086682-g001}
In order to determine changes in species composition and relative abundances at the Shark Reef Marine Reserve, we asked the following questions: 1) Did species composition and/or encounter rates change over time at the Shark Reef Marine Reserve? 2) Are there seasonal and/or long-term changes in relative abundance of the different shark species at the feeding site? 3) Does the presence of a competitor operator conducting shark feeds at a nearby reef have an effect on shark abundance at the Shark Reef feeding site? In answering these questions, our results provide baseline data on the long-term trends in relative abundance and seasonal cycles, and help elucidate whether the numbers of the eight species of sharks visiting the Shark Reef Marine Reserve changed over the years. Additionally, our data provide important fisheries-independent information on shark populations that can supplement long-term monitoring and serve for conservation purposes.
Materials and Methods {#s2}
=====================
Ethics Statement {#s2a}
----------------
Field work was carried out in the Shark Reef Marine Reserve. No animals were caught or handled. All research methods were approved and conducted under a permit provided by the Fijian Ministry of Fisheries and with the knowledge and permission of the traditional owners of Shark Reef.
Study Site and Data Collection Protocol {#s2b}
---------------------------------------
A single dive operator has exclusive access to the Shark Reef Marine Reserve, located on the southern coast of Viti Levu [@pone.0086682-Brunnschweiler4], where it hand-feeds sharks at three feeding sites about 10--30 m from one another at different depths ([Fig. 1](#pone-0086682-g001){ref-type="fig"}). The main attraction of the shark dive is *C. leucas*, the most abundant species at this shark provisioning site in Fiji [@pone.0086682-Brunnschweiler1]. Since its establishment in 2003, up to eight species of sharks can be encountered at the marine reserve [@pone.0086682-Brunnschweiler3].
The dive procedure starts with a first dive to 30 m to attract sharks with fish scraps dispersed out of a bin and/or whole fish heads ([Fig. 1B](#pone-0086682-g001){ref-type="fig"}). Here, only *C. leucas* and *N. ferrugineus* turn up regularly. Whereas the former species will only approach if whole fish heads are offered, *N. ferrugineus*, if present, persistently approach the person feeding sharks and/or the bin to feed on fish scraps and/or whole fish heads. A notable observation is that *C. leucas* will not approach the feeder if *N. ferrugineus* beleaguer the person and/or the bin. After 17 min, the divers ascend up the reef slope to the shallow water feeding site where the feeder hand-feeds *T. obesus*, *C. melanopterus* and *C. amblyrhynchos* with fish scraps for the remainder of the dive (∼20 min). After a one hour surface interval, a second dive is conducted at 16 m where the feeder hand-feeds the larger shark species that include *C. leucas*, *C. albimarginatus*, *N. acutidens* and *G. cuvier* with whole fish heads (mainly tuna) for ∼35 min ([Fig. 1B](#pone-0086682-g001){ref-type="fig"}).
Food amounts introduced daily were measured for the years 2009 and 2010. In 2009 (n = 169 sampling days) and 2010 (n = 164 sampling days), between 100 and 250 kg and 100 and 300 kg of fish, respectively, were each introduced on the first (mean~2009~±SD = 147.3±19.2 kg; mean~2010~±SD = 132.1±42.8 kg) and second dive of the day (mean~2009~±SD = 170.2±29.5 kg; mean~2010~±SD = 140.5±49.9 kg). Whole fish heads fed to sharks present at the 30 m and 16 m feeding sites were mainly *Thunnus* spp. (73 heads weighted; mean±SD = 2.42±0.85 kg; range = 1.5--6 kg). It is important to note that not all food introduced was consumed by sharks, but also other predatory fish such as giant trevally *Caranx ignobilis* and twinspot snapper *Lutjanus bohar* took bait, especially at the 30 m feeding site.
Data on species composition and relative abundances, measured as the number of individuals sight | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION
============
The chemistry of ancient organic materials carries information of their original nature. Because this information is difficult to decode and limited by degradation, the depiction of chemical signatures preserved in the fossil record constitutes one of the essential challenges for paleontologists.
In some rare cases, organic structures can be preserved in rocks. Emblematic cases of organic preservation include mammoths entombed in the permafrost ([@R1], [@R2]), insects trapped in amber ([@R3]--[@R6]), colored dinosaur feathers ([@R7]), and charcolified or lignitic fossil plants from the Carboniferous used as the main source for coal. Although fascinating, the search for ancient biomolecules imposes stringent interpretational and analytical challenges as (i) taphonomic and diagenetic processes may strongly affect original chemistry, (ii) contaminants are likely present at the surface of the samples, and (iii) carbon-based compounds can be preserved as traces.
Most fossil biogenic organic compounds have been detected in their native form using invasive analysis such as gas chromatography/mass spectrometry \[GC/MS; e.g., ([@R8], [@R9])\] or amplified by polymerase chain reaction \[e.g., ([@R1], [@R2], [@R4])\]. However, these measurements are performed on extracts and therefore only represent averaged information over the sampling volume and do not yield the spatial complexity of the chemistry of these specimens for which imaging is a requisite. The development of new analytical tools and/or technical improvements toward higher sensitivity or resolution have recently pushed forward the search for traces of ancient biomolecules in the fossil record ([@R10]).
For instance, fourier transform infrared (FTIR) mapping revealed the preservation of amide and thiol groups of the β-keratin molecule in ca. 50-million-year-old reptile skin from Utah, USA ([@R11]). Time-of-flight secondary ion mass spectrometry (ToF-SIMS) data provided identification of hemoglobin-derived porphyrin molecules in a ca. 46-million-year-old blood-engorged mosquito from Montana, USA ([@R12]). In conjunction with immunohistochemical staining and FTIR imaging, ToF-SIMS identified endogenous proteinaceous and lipid constituents, keratinocytes, and branched melanophores, which give evidence for homeothermy and crypsis in a ca. 180-million-year-old ichthyosaur from Germany ([@R13]). One of the most promising experimental approaches is scanning transmission x-ray microscopy (STXM), a synchrotron-based soft x-ray technique that can probe speciation of light elements in micrometric samples at a spatial resolution of a few tens of nanometers ([@R14]). Carbon K-edge spectra obtained on carbonaceous systems consist of spectral features that can differentiate organic compounds ([@R15]). Applied to paleontology, STXM identified partially degraded sporopollenin molecules within a ca. 230-million-year-old lycophyte megaspore from France ([@R16]) and partially preserved chitin-protein complexes within the cuticles of a ca. 310-million-year-old scorpion from Illinois, USA, and of a ca. 420-million-year-old eurypterid from Canada ([@R17]). This technique even allowed documenting the chemical nature of ancient (several billion years old) organic microfossils ([@R18]).
However, these techniques present some limitations, the main one being the lack of bulk sensitivity. STXM-based x-ray absorption near-edge structure (XANES) spectroscopy only allows probing thin samples (i.e., samples transparent to x-rays at the transition energy of the element of interest). FTIR, Raman, and ToF-SIMS imaging also only provide surface sensitivity. Thus, any contamination of the surface by exogenous organic matter, and sample roughness as well, can compromise data acquisition and interpretation. This "black and white" situation where organic compounds absorb either too much or too little (hard x-rays) to allow meaningful imaging, depending on the nature of the probe, still poses numerous challenges to the depiction of the three-dimensional (3D) chemical speciation of primarily organic systems. A method providing spatially resolved information of organic carbon speciation in 3D and over large areas appears critically required to overcome these limitations.
Here, we report the unprecedented use of a hard x-ray probe for the element-specific chemical bulk imaging of ancient materials. Taking advantage of the capability of nonresonant x-ray Raman scattering (XRS) for direct tomography with chemical bond contrast ([@R19]), we develop 2D and 3D XRS spectral imaging for cultural heritage and geosciences. The large penetrative power of hard x-rays enables the measurement to be done in a noninvasive way, with no particular preparation nor specific experimental conditions, in air, and provides information that is not compromised by surface contamination by ensuring that the dominant signal contribution is from the bulk of the probed material ([@R20]). XRS 2D and 3D imaging are demonstrated against a fragment of *Lepidodendron* trunk from the Upper Carboniferous \[ca. 305 million years (Ma) old\] of Pas-de-Calais (France) and an Eocene ant (ca. 53 Ma old) entrapped in amber from Oise (France), respectively. The present results reveal local "pockets" of preservation in the chemical composition of the plant fossil, likely inherited from its geological history, while they acquaint the exceptional preservation of the insect cuticle by showing chemical signatures of polysaccharides such as chitin.
RESULTS AND DISCUSSION
======================
We collected XRS carbon K-edge intensities using mapping (or raster scanning) by sequentially moving objects across the photon beam at a given incident energy while measuring the scattered intensity. Several of these maps are acquired at different energy losses through the carbon K-edge to produce a hyperspectral data cube.
Illuminating a sample with an incident energy *E* and setting a fixed analyzer energy *E*~f~, the energy loss Δ*E* = *E* − *E*~f~ can create electronic excitations. If Δ*E* is tuned to a transition involving a bound electron, then the resulting spectroscopy is called XRS spectroscopy. Beside a *q*-dependent background that is dominated by Compton scattering and collective valence electron excitations such as plasmons at high and low momentum transfers (*q*), respectively, the XRS spectrum generally contains nondispersive features that are generated when a fraction of incident photon energy is transferred to the sample inner shell electrons, promoting them into unoccupied states ([@R21]). XRS therefore enables the measurement of the near-edge excitation spectrum in the energy loss domain. It combines the chemical sensitivity of x-ray absorption spectroscopy (XAS) for the study of the speciation of light elements such as carbon with the benefit of high photon energy (range, 6 to 13 keV), discarding the substantial experimental constraints of XAS at the low energy of the carbon K-edge (range, 280 to 350 eV). XRS has demonstrated a great potential to probe carbon speciation in homogeneous liquid and solid carbon--based samples that are poor in heavier elements (absorption of x-ray from the latter represents the main limitation of this technique). XRS has been shown to be a promising means to identify the chemical speciation of light elements in a range of systems from oil cuts to artists' pigments ([@R20]--[@R22]). The proof of concept of imaging has been established on a model object ([@R19]), yet XRS imaging (XRI) of real-life materials has never been studied.
Microscale 2D imaging of carbon on centimetric Carboniferous plants
-------------------------------------------------------------------
We used XRI to study a fragment of *Lepidodendron* trunk collected on an Upper Carboniferous (ca. 305 Ma old) coal slag heap in Noyelles-lez-Lens, France ([Fig. 1, A to C](#F1){ref-type="fig"}). The fossil fragment, easily recognizable by its characteristic diamond-shaped pattern, is ca. 6 cm long and 2.5 cm wide and lies on a black shale, yellowish in places, which also includes other plant fragments. Most of the *Lepidodendron* trunk has the same appearance and color as the shale, but it also contains a thicker, vitreous black to very shiny material (extremely similar to vitrinite) distributed along the edges of most diamond-shaped leaf scars. A few beige patches are irregularly distributed over the fossil.
{ref-type="fig"}. a.u., arbitrary units. (**E**) Normalized background-corrected carbon K-edge XRS spectra from the locations indicated by asterisks in (D) (sum of four spectra; 500 ms per energy step; beam size, 15 μm by 15 μm), and pure graphite (denoted as "G") for energy calibration and reference; spectra were vertically shifted for an increased readability. Scale bars, 1 cm. (Photo credit: Rafaella Georgiou, CN | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
The bone extracellular matrix (ECM) has historically been described as a static and protective scaffold [@pone.0109078-Allori1]. Yet in reality, bone ECM is subjected to periodical remodeling to maintain its strength and integrity [@pone.0109078-Boyle1], [@pone.0109078-Rodan1]. The task of skeletal remodeling falls in the domain of osteoclasts, which degrade the inorganic and organic phases of bone [@pone.0109078-Allori1] and osteoblasts, which produce and secrete new matrix and regulate matrix mineralization [@pone.0109078-Manolagas1]. Under normal circumstances bone destruction and formation are in steady state equilibrium. However, imbalances in bone remodeling result in perturbations of skeletal structure, integrity and function leading to diseases such as osteoporosis [@pone.0109078-Sambrook1], osteopetrosis [@pone.0109078-Tolar1], inflammatory osteolysis such as rheumatic arthritis, periodontal disease [@pone.0109078-Rodan1], [@pone.0109078-Novack1] and Paget\'s bone disease [@pone.0109078-Rodan1]. Even though bone remodeling requires the collaborative action of osteoblasts and osteoclasts, the common thread to all the aforementioned disorders is abnormal bone resorption. Therefore, a thorough understanding of osteoclast formation or osteoclastogenesis (OCG) is crucial for development of novel drugs for treating bone-related diseases.
Osteoclasts are tissue specific multinuclear cells derived from hematopoietic stems cells [@pone.0109078-Walker1] of the macrophage/monocyte lineage [@pone.0109078-Takahashi1]. The intricate process of OCG, which involves coordinated cellular migration [@pone.0109078-Parent1], [@pone.0109078-Fuller1], adhesion and membrane fusion [@pone.0109078-Helming1]-- is regulated by the critical hematopoietic cytokines, Macrophage Colony Stimulating Factor (M-CSF) and Receptor Activator of NF-κB Ligand (RANKL) [@pone.0109078-Arai1]. OCG also requires dynamic regulation of cellular actin cytoskeleton. Cells organize their actin cytoskeleton through interactions with actin binding proteins [@pone.0109078-Schafer1]--[@pone.0109078-Carlier1] that control the length, flexibility and the viscosity of the actin network leading to changes in cell morphology and function. One such group of actin binding proteins is the Gelsolin superfamily, consisting of seven highly conserved members [@pone.0109078-Silacci1]. Adseverin (Ads), also known as Scinderin, is the closest homologue to the founding member of the Gelsolin superfamily. Like Gelsolin, Ads can promote F-actin depolymerization and nucleation depending on the intracellular conditions [@pone.0109078-Sakurai1]. However, unlike Gelsolin, Ads\'s F-actin severing activity is inhibited by a wider range of membrane lipids [@pone.0109078-Maekawa1]--[@pone.0109078-Chumnarnsilpa1], and its activation requires lower intracellular calcium concentrations [@pone.0109078-Lueck1]. Ads has been heavily implicated in regulating exocytosis through a rapid depolymerization of cortical actin in a number of biological systems, including chromaffin cells [@pone.0109078-Trifar1], airway goblet cells [@pone.0109078-Ehre1], murine pancreatic β-cell [@pone.0109078-Bruun1] and platelets [@pone.0109078-Marcu1]. In addition, Ads has been identified as a member of a multi-protein complex required for the trafficking of the water channel aquaporin-2 in rat renal collecting ducts [@pone.0109078-Noda1] and has been shown to play a role in the differentiation of platelets [@pone.0109078-Zunino1] and chondrocytes [@pone.0109078-Nurminsky1]. A report by Robbens et al. [@pone.0109078-Robbens1] noted that Interleukin-9 stimulated T-helper lymphocytes express a splice variant of Ads, Ads D5, that is missing most of the fifth and a portion of the sixth Gelsolin like domains. Ads D5 has most of the typical characteristic common to all members of the Gelsolin family of actin binding proteins, with the exception of nucleation of filament assembly *in vitro*.
Surprisingly very little is known about the role of Ads during OCG. Unlike Gelsolin, which regulates osteoclast function and motility [@pone.0109078-Beaulieu1]--[@pone.0109078-Wang1], a microarray analysis published by Yang et al. [@pone.0109078-Yang1] is the only existing publication identifying Ads as a gene of interest in osteoclasts. A similar microarray performed in our lab also identified Ads as a gene of interest, which led us to test the hypothesis that Ads is a RANKL induced regulator of OCG with a potential functional role during osteoclast formation and function. The present study focused on investigating the role of Ads in OCG using two established *in vitro* model systems. It was shown for the first time that Ads is expressed during OCG in response to soluble RANKL (sRANKL) at both transcript and protein levels. Several Ads knockdown (KD) clonal cell lines with varying degrees of Ads expression reduction were generated. The clonal KD cell line with the greatest reduction in Ads expression failed to undergo OCG upon treatment with sRANKL, a phenotype most likely caused by a defect in osteoclast precursor fusion. The attenuation of Ads led to distinct morphological changes characterized by altered F-actin remodeling. The reintroduction of Ads was capable of rescuing the pre-osteoclast differentiation in the KD cells, in the form of TRAcP expression. Therefore, we concluded that Ads is a novel RANKL induced regulator of OCG with a functional role during the early stages of OCG.
Materials and Methods {#s2}
=====================
2.1 Cell cultures {#s2a}
-----------------
All procedures described were performed in accordance with the Guide for the Humane Use and Care of Laboratory Animals and were approved by the University of Toronto Animal Care Committee. Bone marrow monocytes (BMMs) were isolated from 6--12-week-old wild-type (WT) mice (SV129/BL6) as previously described [@pone.0109078-Wang2]. OCG was induced by seeding 3×10^6^ cells onto 60-mm^2^ culture dishes in the Minimum Essential Medium -- Alpha (α-MEM) (Gibco Life Technologies, Cat. No. 11095) containing 10% Fetal Bovine Serum (FBS) and 164 IU/mL of penicillin G, 50 µg/mL of gentamicin, and 0.25 µg/mL of fungizone (complete media), supplemented with 20 ng/ml M-CSF (Sigma, Cat No. M9170) for two days (unstimulated cells) or with 20 ng/ml M-CSF plus 30 ng/ml of sRANKL (Peprotech, Cat. No. 315-11) for up to 6 days. Fresh culture media supplemented with cytokines was added to the cells every two days. Cells were cultured at 37°C (5% CO~2~). Murine RAW264.7 (RAW) macrophages (ATCC, provided by Keyin Li and Morris F Manolson at the University of Toronto) were cultured in the complete Dulbecco\'s Modified Eagle\'s Medium (DMEM) (Gibco Life Technologies, Cat. No. 11995). For osteoclast differentiation, 2.5×10^5^ cells were seeded in 6-well culture dishes and cultured with 30 ng/ml sRANKL for up to 4 days. Unstimulated RAW cells were used as controls. Cells were cultured at 37°C (constant high humidity and 5% CO~2~). All RAW cells used were between passage 5 and 12 to minimize the effects of passage on cell differentiation.
2.2 Microarray analysis {#s2b}
-----------------------
Total bone marrow cells from three mice were harvested, mixed and stimulated for 48 hours in complete α-MEM supplemented with 10 ng/ml M-CSF. Non-adherent cells were collected and centrifuged at 350×g for 30 minutes at 22°C over Ficoll-Paque PLUS (GE Healthcare, Cat No. 17-1440-02). A layer of mononuclear osteoclast precursors was obtained and split into two dishes, each containing 8×10^5^ cells/cm^2^. One dish was stimulated with 20 ng/ml M-CSF plus 200 ng/ml of purified sRANKL (as previously described [@pone.0109078-Wang2]), and the other with 20 ng/ml M-CSF. After two days, the cells were washed with α-MEM and the total RNA was extracted (RNeasy Mini Kit, Qiagen, Cat. No. 74104). The quality of total RNA was determined using Agilent Technologies BioAnalyser. Microarray was performed using Affymetrix GeneChip Mouse Gene 1.0 ST array. Three independent experiments were performed making cells from three mice a single biological repeat. Gene expression profiles of cytoskeleton-associated genes were filtered. Gene normalization was performed prior to subsequent clustering computation using MultiExperiment Viewer 4.9.0 (MeV -TM4) [@pone.0109078-Saeed1]. MeV-HCL was run | {
"pile_set_name": "PubMed Central"
} |
{
"pile_set_name": "PubMed Central"
} | |
{#sp1 .196}
{#sp2 .197}
| {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
Osteoporotic hip fractures cause high mortality and morbidity in elderly adults \[[@CR1]--[@CR4]\]. One-year mortality rates after hip fracture were up to 30 % in the elderly \[[@CR1]--[@CR4]\]. After surgery for hip fractures in elderly patients, the short-term readmission or reoperation rates were 5 % to 30 % within 12 months, and the long-term reoperation rates were 20 % to 40 % \[[@CR5]--[@CR14]\].
Compared to the general population, subjects with end-stage renal disease (ESRD) and dialysis often develop mineral bone disorders and had a higher risk for hip fractures \[[@CR15]--[@CR23]\]. Studies reported that one-year mortality rates after hip fracture were up to 30 % and 64 %, with short-term readmission rates up to 40 % in hemodialysis subjects \[[@CR19], [@CR23]--[@CR30]\]. However, few previous studies have reported long-term mortality, surgical and medical complications simultaneously using a large sample size. Therefore, in this study, the short-term and long-term mortalities and complications after surgery for hip fracture were investigated using competing risk analysis in hemodialysis subjects aged greater than 60 years from a nationwide population database in Taiwan.
Methods {#Sec2}
=======
Data source and subjects {#Sec3}
------------------------
Data were obtained from the National Health Insurance Research Database (NHIRD) released by the National Health Research Institutes in Taiwan. Taiwan began its National Health Insurance program in 1995 to finance health care for all residents. The coverage rate was more than 99 % of the total population of about 23 million residents in 2012. The database includes comprehensive information on insured subjects, such as demographic data, dates of clinical visits, diagnostic codes, details of prescriptions, and expenditure amounts. This study was approved by the Institutional Review Board of China Medical University Hospital.
This study selected subjects aged 60 years old and above, who were admitted to hospitals from January 1997 to December 2007. Subjects were identified both with (i) a first discharge diagnosis code of hip fracture (based on International Classification of Diseases, Ninth Revision, Clinical Modification (ICD-9-CM) codes 820, 820.0, 820.00, 820.01, 820.02, 820.09, 820.8, 820.03, 820.2, 820.20, and 820.21) and (ii) medical code with surgery of internal fixation or hemiarthroplasty (based on ICD-9-CM codes 79.15, 79.35, and 81.52). The first admission date of hip fracture was defined as the index day of surgery. The exclusion criteria were inpatients with pathological fractures (ICD-9-CM codes 733.14 and 733.15) or open hip fractures (ICD-9-CM codes 820.1, 820.10, 820.11, 820.12, 820.19, and 820.9). Subjects who underwent operations on their pelvis, femur, or hip region before the index day were also excluded to avoid confounding effects.
Owing to certain covariate differences, we used a matched cohort design to explore the outcomes of hemodialysis and non-hemodialysis subjects after hip fractures. For each hemodialysis subject, we randomly matched one non-hemodialysis subject, who had the same age, gender, fracture type, operation type, and comorbidities, including hypertension, diabetes, chronic heart disease, and chronic pulmonary disease, to serve as a control. In addition, the non-hemodialysis control had the operation in the same calendar year as the hemodialysis subject. Subjects with chronic renal disease or ESRD without hemodialysis were excluded. In total, 2680 subjects received hemodialysis before the index day of surgery for hip fracture and 2680 matched non-hemodialysis controls were identified. This cohort was followed until death, exiting the NHI program or the end of 2009.
Ethical approval {#Sec4}
----------------
All patients' data were encrypted using the same encryption algorithm to cross-link the data while protecting the privacy of the patients. This study protocol was approved by the Institutional Review Board (IRB) of China Medical University Hospital (protocol \# CMUH102-REC2-012).
Outcomes of interest {#Sec5}
--------------------
This study analyzed three outcomes: (a) overall mortality; (b) cumulative incidence of the first medical complication within 90 days after the index day; and (c) cumulative incidence of the first surgical complication after the index day of surgery. Overall survival time was defined as the duration from the index day to the death day. Subjects who survived at the end of the study or were lost to follow-up were treated as censored. The first surgical complication time was defined as the duration from the index day to the day of the first postoperative unplanned reoperation caused by surgery-related complications. These included converting to arthroplasty or revision arthroplasty, implant failure, surgical site infection, mechanical complications (e.g., loss reduction, screw loosening or cutting out, skin irritation, implant broken/failure), dislocation, avascular necrosis of femoral head, second hip fracture at the same site, and malunion/nonunion during follow-up. The first medical complication time was defined as the duration from the index day to the day of the first medical complication within 90 days after the index surgery, which required extra days of hospital stay or hospital readmission for treatment. The medical complications included stroke, acute myocardial infarction, pulmonary embolism, deep vein thrombosis, acute renal failure, acute respiratory failure, pneumonia, and acute exacerbation of chronic obstructive pulmonary disease (COPD). The comorbidities of a subject were retrieved before or at the time of the index day and included hypertension, diabetes, chronic heart disease, chronic pulmonary disease, cerebrovascular disease, chronic liver disease, and cancer.
Statistical analysis {#Sec6}
--------------------
We estimated overall survival using the Kaplan--Meier method and explored the risk factors for survival using the log-rank test and the multiple Cox proportional hazards model. We estimated the cumulative incidence of the first complication using competing risk analysis, in which death was considered a competing risk \[[@CR31]--[@CR34]\]. We explored the effects of risk factors on complication-free time using the Gray's test as well as the Fine and Gray's model with proportional subdistribution hazards. The risk factors included age, gender, fracture type, operation type, and comorbidities. All analyses were performed using the SAS System (version 9.3; SAS Institute, Cary, NC) and R 3.0.0 \[R Development Core Team (2013), R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria, the R libraries survival, cmprsk, and mstate\] \[[@CR35]\].
Results {#Sec7}
=======
Between 1997 and 2007, 2680 hip fracture subjects with hemodialysis and 2680 matched controls without hemodialysis were identified, of which 63.4 % were female, 36.6 % were male, 56.8 % had cervical fractures, 43.2 % had trochanteric fracture, 53.3 % received internal fixation, and 46.7 % received hemiarthroplasty (Table [1](#Tab1){ref-type="table"}). The death incidence rate was 354.30 per 1000 person-year (PY) (95 % CI: 339.49--369.75) for hemodialysis patients, and 152.04 per 1000 PY (95 % CI: 144.52--159.95) for non-hemodialysis patients. The median survival time was 1.89 years (95 % CI: 1.76--2.03) for hemodialysis, and 4.68 years (95 % CI: 4.42--4.98) for non-hemodialysis subjects. The one-month to ten-year mortality rates and cumulative incidence rates of the first complication are shown in Table [2](#Tab2){ref-type="table"} and Fig. [1](#Fig1){ref-type="fig"}. The two-year and five-year mortality rates were 51.5 % and 80.5 % for hemodialysis and 25.9 % and 52.3 % for non-hemodialysis subjects, respectively. Hemodialysis subjects after surgery for hip fracture had significantly higher overall mortality and complication rates than non-hemodialysis subjects after surgery for hip fracture.Table 1Baseline characteristics of hip fracture subjects stratified by hemodialysis groupsNon-hemodialysis (N = 2680)Hemodialysis (N = 2680)*p*-valueN%N%Age (years), mean ± SD74.90 ± 7.0474.88 ± 7.050.912GenderFemale1700(63.4 %)1700(63.4 %)0.999Male980(36.6 %)980(36.6 %)Fracture typeCervical1521(56.8 %)1521(56.8 %)0.999Trochanteric1159(43.2 %)1159(43.2 %)Operation typeFixation1429(53.3 %)1429(53.3 %)0.999Hemiarthroplasty1251(46.7 %)1251(46.7 %)HypertensionNo651(24.3 %)651(24.3 %)0.999Yes2029(75.7 %)2029(75.7 %)Diabetes mellitusNo1536(57.3 %)1536(57.3 %)0.999Yes1144(42.7 %)1144 | {
"pile_set_name": "PubMed Central"
} |
Introduction {#gcbb12419-sec-0001}
============
*Miscanthus* is a bioenergy grass predominantly used for heat and power (Jensen *et al*., [2016](#gcbb12419-bib-0020){ref-type="ref"}). It is a perennial species that produces high annual yields and requires very low chemical inputs (Lewandowski *et al*., [2000](#gcbb12419-bib-0025){ref-type="ref"}). There are two main subspecies of *Miscanthus: M. sinensis* and *M. sacchariflorus*. The commercially grown genotype, *M. x giganteus,* is a hybrid between the two species. *M. x giganteus* genotypes are the progeny of a tetraploid, Japanese *M. sacchariflorus,* and a diploid, Japanese *M. sinensis*; this combination has proved to produce high‐yielding plants from multiple, independent crossing events with different parents (Wang *et al*., [2008a](#gcbb12419-bib-0042){ref-type="ref"}; Jezowski *et al*., [2011](#gcbb12419-bib-0021){ref-type="ref"}; Purdy *et al*., [2013](#gcbb12419-bib-0037){ref-type="ref"}). As a member of the subtropical Poaceae, *Miscanthus* is related to two other major food and bioenergy crops: maize and sugarcane (Hodkinson *et al*., [2002](#gcbb12419-bib-0017){ref-type="ref"}).
The soluble sugar content of actively growing *M. x giganteus* clones has been reported to be approximately 6% DW (Purdy *et al*., [2013](#gcbb12419-bib-0037){ref-type="ref"}; de Souza *et al*., [2013](#gcbb12419-bib-0041){ref-type="ref"}). In a study of four genotypes of *Miscanthus* representing both species and an *M. x giganteus*, peak‐soluble sugar contents were 6--8% (Purdy *et al*., [2014](#gcbb12419-bib-0038){ref-type="ref"}). This is comparable to sugarcane progenitors (Wang *et al*., [2008b](#gcbb12419-bib-0043){ref-type="ref"}; Lingle *et al*., [2009](#gcbb12419-bib-0026){ref-type="ref"}; de Souza *et al*., [2013](#gcbb12419-bib-0041){ref-type="ref"}), which has led to the proposition that *Miscanthus* could be bred to produce a temperate sugarcane (de Souza *et al*., [2013](#gcbb12419-bib-0041){ref-type="ref"}). However, unlike sugarcane, *Miscanthus* also accumulates starch to concentrations ranging between 2% and 7% DW in the shoots depending upon genotype (de Souza *et al*., [2013](#gcbb12419-bib-0041){ref-type="ref"}; Purdy *et al*., [2014](#gcbb12419-bib-0038){ref-type="ref"}). This then raises the possibility that instead of breeding for soluble sugars, with potential problems of feedback inhibition of photosynthesis, the focus could switch to increasing starch content. Elevated levels of nonstructural carbohydrates (NSC) would broaden the potential uses of *Miscanthus* from being burnt for fuel, to being a feedstock for anaerobic digestion (AD). Anaerobic digestion is the decomposition of organic matter in an anaerobic environment to produce biogas that is usually around 60% methane and 40% carbon dioxide (DECC & DEFRA, [2011](#gcbb12419-bib-0013){ref-type="ref"}, Whittaker *et al*., [2016](#gcbb12419-bib-0047){ref-type="ref"}). Biogas can be produced from a variety of organic wastes, animal manures or energy crops (Amon *et al*., [2007](#gcbb12419-bib-0003){ref-type="ref"}). Forage maize is the most commonly used crop for AD (Mayer *et al*., [2014a](#gcbb12419-bib-0027){ref-type="ref"}) and plant breeders have bred tailored varieties specifically for AD. New varieties of forage maize for AD are early maturing, have a high dry matter (DM) yield (\>30%), high starch yield of \~6 t ha^−1^, high digestibility and high metabolizable energy (ME; BSPB, [2016](#gcbb12419-bib-0005){ref-type="ref"}). The use of forage maize for AD has increased rapidly across Europe, particularly in Germany, but this has raised concerns about the negative effects on soil and waterway health and competition between land for fuel and food (Weiland, [2006](#gcbb12419-bib-0044){ref-type="ref"}; Klimiuk *et al*., [2010](#gcbb12419-bib-0024){ref-type="ref"}; Mayer *et al*., [2014b](#gcbb12419-bib-0028){ref-type="ref"}; Kiesel & Lewandowski, [2016](#gcbb12419-bib-0023){ref-type="ref"}). In a study into soil health and land use in south‐west England, soils under maize and potatoes had the most degraded soils, with 75% of sites exhibiting erosion (Palmer & Smith, [2013](#gcbb12419-bib-0035){ref-type="ref"}). This is linked to increased overland flow of water across fields and into waterways which, in turn, causes water pollution and localized flooding (Palmer & Smith, [2013](#gcbb12419-bib-0035){ref-type="ref"}). *Miscanthus* has been identified as being the most promising alternative to maize for biogas yield compared to 13 other possible AD substrates (Mayer *et al*., [2014b](#gcbb12419-bib-0028){ref-type="ref"}). The higher yields of *Miscanthus* in continental Europe mean that *Miscanthus* can already compete with the biogas yields of maize, with methane yields of 6153 m^3^ ha^−1^ and 6008 m^3^ ha^−1^ for Miscanthus and maize, respectively (Kiesel & Lewandowski, [2016](#gcbb12419-bib-0023){ref-type="ref"}). In a recent study, forage maize had sugar and starch contents of \~8% and \~18%, whereas *M. x giganteus* has sugar and starch contents of \~5% and 4%, respectively, and a BMP of less than half that of maize (Whittaker *et al*., [2016](#gcbb12419-bib-0047){ref-type="ref"}). The study concluded that to compete with maize for AD, *Miscanthus* yields would have to be increased from \~14 to 19--26.5 t ha^−1^ (Whittaker *et al*., [2016](#gcbb12419-bib-0047){ref-type="ref"}), but another possible scenario would be to also increase the concentration of starch and/or soluble sugars in *Miscanthus* through breeding.
A major difference between Miscanthus and maize is the concentration of starch and cellulose. Miscanthus predominantly accumulates cellulose (\~35% DW) rather than starch (\~4% DW) whereas maize accumulates a higher proportion of starch (\~18% DW) compared to cellulose (13% DW; Whittaker *et al*., [2016](#gcbb12419-bib-0047){ref-type="ref"}). Although starch and cellulose are both polymers of glucose, starch is the preferred substrate for AD because it is easier to breakdown (Montgomery & Bochmann, [2014](#gcbb12419-bib-0031){ref-type="ref"}). The limiting factor for cellulose is its physical and chemical association with lignin which is not digestible in anaerobic conditions and impedes the breakdown of the cell wall polysaccharides (Weng *et al*., [2008](#gcbb12419-bib-0046){ref-type="ref"}). When using lignocellulosic materials, such as straw, in an AD system, the high levels of recalcitrance mean that only 40--50% of the feedstock is converted to biogas and the rest is unused (Ahring *et al*., [2015](#gcbb12419-bib-0001){ref-type="ref"}). Conversely, a reactor fed on late‐harvested maize achieved 84% of the theoretical biogas potential (Bruni *et al*., [2010](#gcbb12419-bib-0004){ref-type="ref"}). Therefore, a higher abundance of starch, rather than lignocellulose, and high digestibility are desirable for maximizing biogas outputs.
At present, the concentration of starch in *M. x giganteus* at peak yield in west Wales is approximately 5% DW. With peak autumn yields of 16 t ha^−1^, this equates to approximately 0.8 t ha^−1^ which is 7.5‐fold less than the yield of starch from | {
"pile_set_name": "PubMed Central"
} |
Please see related commentary by Balmelli *et al.*, <http://ccforum.com/content/15/2/131>
Introduction
============
N-terminal pro-brain natriuretic peptide (NT-proBNP) is the inactive polypeptide of the pre-prohormone brain natriuretic peptide (BNP). It is synthesized in the cardiac myocytes in response to hemodynamic stress \[[@B1]\] or inflammatory status \[[@B2]\]. Over the last decade, some studies have indicated that NT-proBNP testing greatly increased the accuracy of the diagnosis of heart failure in patients with dyspnea \[[@B3],[@B4]\]. NT-proBNP can also serve as a novel, independent predictor of prognosis in cardiovascular patients \[[@B5]-[@B7]\] as well as in the general population \[[@B8]\]. During the past few years, several studies \[[@B9]-[@B16]\] have focused on the potential value of NT-proBNP for prognosis of intensive care unit (ICU) patients, but the performance of NT-proBNP to predict adverse outcome in those patients is unimpressive \[[@B17]\]. First, the results of those studies have been conflicting. Several studies have shown that NT-proBNP could serve as an independent predictor of greater mortality in patients with cardiogenic shock \[[@B9]\], septic shock \[[@B10]\], severe sepsis \[[@B11]\], as well as in noncardiac \[[@B12]-[@B14]\] or unselected ICU patients \[[@B15]\], while another study \[[@B16]\] demonstrated that NT-proBNP failed to predict short-term mortality of ICU patients with hypoxic respiratory failure. Second, most of these studies were rather small and confounded by some factors, such as cardiovascular disease, renal insufficiency, or inflammation \[[@B17]\], although the prevalence of these conditions among patients admitted to ICU is generally high.
C-reactive protein (CRP) is an extremely sensitive objective marker of inflammation, tissue damage, and infection. Its ability to provide predictive value of long-term outcomes in ICU patients was just investigated in limited studies \[[@B18]-[@B20]\]. There were less data about the predictive value of CRP for short-term mortality \[[@B21],[@B22]\]. In addition, although NT-proBNP and CRP have been shown to be predictors of adverse outcomes in ICU patients, the predictive value of the combination of both for outcomes has not been investigated.
Currently, the Acute Physiology and Chronic Health Evaluation II (APACHE-II) score is one of the most common models used to evaluate ICU patients\' condition and predict their outcomes \[[@B23]\]. The additive ability of NT-proBNP and CRP to APACHE-II score to predict ICU mortality has rarely been assessed. Traditionally, predictive models have been evaluated by C-statistic, but this method has been criticized as being insensitive in comparing models \[[@B24]\] and for having little direct clinical relevance \[[@B25]\]. Several new methods have recently been proposed to evaluate and compare predictive risk models \[[@B26]\]. Calculation of net reclassification improvement (NRI) and integrated discrimination improvement (IDI) indices is now frequently being used \[[@B27]\]. We hypothesized that the higher plasma level of NT-proBNP and CRP would be independently associated with worse clinical outcomes in unselected ICU patients. We, therefore, undertook a prospective, observational study to assess the prognostic value of NT-proBNP, CRP or combination of both in a large population of unselected medical ICU patients. We also evaluated the ability of NT-proBNP and CRP additive to APACHE-II score to predict ICU mortality by calculation of C-index, NRI and IDI indices.
Materials and methods
=====================
Participants
------------
The prospective, observational trial was undertaken between January 2009 and March 2010 at Xinhua Hospital Affiliated to Shanghai Jiaotong University School of Medicine. Medical patients were eligible for enrollment if they needed to be transferred to ICU from emergency department or other departments of our hospital (trauma and surgical patients were not included). The decision to transfer the patients into or out of ICU was made by at least one critical care expert and one medical expert. Exclusion criteria were age \< 18 years and known pregnancy. Patients who died within four hours of admission or were discharged from the ICU within four hours of admission were also excluded because data collection for those patients was difficult. Patients were classified as cardiac or noncardiac subgroups according to their primary diagnosis. Noncardiac was defined as a patient with a primary noncardiac diagnosis. Noncardiac did not preclude a secondary cardiac disease, nor was a preexisting cardiac disease *a priori*excluded. The study was approved by Shanghai Jiaotong University Xinhua Hospital Ethics Committee (XHEC2011-002) and in accordance with the Declaration of Helsinki. Because this was an observational study and all laboratory indices (including CRP and NT-pro-BNP) observed were commonly measured for all patients in our ICU department, the need for written informed consent was waived by the review ethical review board.
Laboratory methods
------------------
The NT-proBNP level was determined using the Elecsys Electro-chemo luminescent assay (Cobase 411 analyzer; Roche Diagnostics; Mannheim, Germany). The analytical range for NT-proBNP in the laboratory of our hospital is 5 to 35,000 pg/mL. Readings \> 35,000 pg/mL were taken as 350,000 pg/mL. Reported total coefficient of variation is 4.4% at mean concentration 248.9 ng/L and 3.91% at MC 5,449 ng/L, respectively, based on multicenter calibrations of the automated Roche NT-proBNP assay \[[@B28]\]. Serum creatinine (SCr) and albumin were measured by the Hitachi 7600-120 (Hitachi, Tokyo, Japan) analyzer. We calculated the estimated glomerular filtration rate (eGFR) using the abbreviated Modification of Diet in Renal Disease (MDRD) study equation: eGFR (expressed in mL/minute/1.73 m2) = 186 \* (SCr) -1.154 \* (age) -0.203 \*0.742 (if female), where SCr is serum creatinine in mg/dL \[[@B29]\]. Serum CRP levels were measured using Quick Read CRP test kit (Orion Corporation, Orion Diagnostica, Espoo, Finland). Blood samples were obtained from patients when they were admitted to ICU for measurement of the indicators mentioned previously.
Study outcomes
--------------
At baseline, demographic and clinical characteristics, including the APACHE-II score (which can range from 0 to 71, with higher scores indicating more severe illness), were collected. Then the patients were followed up during the ICU stay. The primary outcome of this analysis was death in the ICU from any cause.
Statistical analysis
--------------------
Continuous variables and categorical variables were presented as mean value ± SD and %, respectively. But CRP, NT-proBNP and eGFR values were reported as median (95% confidence interval) and then logarithmically normalized (presented as log-CRP, log-NT-proBNP and log-eGFR, respectively) for statistical calculations because they were skewed. Baseline characteristics between survivals and non-survivals were compared with unpaired Student\'s *t*-test or Mann-Whitney test for continuous variables and chi-square or Fisher\'s exact tests for categorical variables. Univariate logistic regression analyses were performed to examine the association between mortality and each of the predictors separately. We also conducted a forward stepwise multivariate logistic regression to determine the independent predictors of ICU mortality. A criterion of *P*\< 0.05 for entry and a *P*≥ 0.10 for removal was imposed in this procedure. Cox & Snell R Square and Nagelkerke R Square were calculated for assessing the goodness of fit of the models \[[@B30]\]. Odds ratios (ORs) for continuous variables were described using standardized ORs, which were associated with a one standard deviation change in the variable. The receiver operating characteristic (ROC) curve was used to examine the performance of variables to predict ICU mortality. The curve represented a plot of sensitivity vs 1-specificity. The area under the curve (AUC, that is, C-index) was calculated from the ROC curve. A statistically derived value, based on the Youden index, maximizing the sum of the sensitivity and specificity was used to define the optimal cut-off value \[[@B31]\]. ROC curve was also constructed for the combination of two or three variables for predicting ICU mortality according to the Mackinnon and Mulligan\'s weighted sum rule \[[@B32]\]. The differences between AUC (C-index) were tested by Hanley-McNeil methods in order to examine whether the addition of one or both of the biomarkers improved the discrimination of the model \[[@B33]\]. The increased discriminative value of the biomarkers was further examined by calculation of NRI and IDI indices described by Pencina *et al*. \[[@B27]\]. NRI is the net increase versus decrease in risk categories among case patients minus that among control participants. It requires that there exist *a priori*meaningful risk categories (we used \< 10%, 10% to 30%, and 30% to 50%, and \> 50% for the risk of ICU death) \[[@B26]\]. IDI is the difference in Yates slopes between models, in which the Yates slope is the mean difference in predicted probabilities between case patients and control participants \[[@B26]\]. A two-sided *P-*value of less than 0.05 was considered to indicate statistical significance. All analyses were performed with SPSS 13.0 software (SPSS Inc., Chicago, Illinois, USA).
Results
=======
Baseline characteristics
------------------------
In all, 576 consecutive patients (55.7% male; mean age 71 | {
"pile_set_name": "PubMed Central"
} |
IN the course of this review, we will touch on many of the genes and processes conserved between mitosis and meiosis. Indeed, early studies in yeast and other fungi showed that mitotic recombination exhibited many of the same properties of meiotic recombination. For example, gene conversion, the nonreciprocal transfer of genetic information (see below), is sometimes associated with exchange (*i.e.*, crossover). Heteroduplex DNA, which is detected by the failure to repair mismatches between genetically distinct DNA molecules, is indicative of strand exchange and is often found at or near sites of crossovers. Importantly, the unrepaired mismatched sequences segregate after the next round of DNA replication and can be seen as sectored colonies, similar to postmeiotic segregation observed by tetrad analysis.
For simplicity, homologous recombination (HR) is minimally defined as the repair of DNA lesions using homologous sequences. During S phase and G2, in both haploid and diploid cells, repair of the damage uses the unbroken sister chromosome as the homologous sequence ([Figure 1A](#fig1){ref-type="fig"}). Such repair is the main role of mitotic recombination and it can lead to genetic consequences. When sister chromatid repair is accompanied by a crossover, it results in sister-chromatid exchange (SCE). If the repair event occurs between misaligned repetitive sequences in a tandem array, it results in an unequal SCE (USCE) ([Figure 1B](#fig1){ref-type="fig"}). In diploids, repair can also be templated from the unbroken homologous chromosome and if associated with a crossover, the exchange can lead to loss of heterozygosity (LOH) ([Figure 1C](#fig1){ref-type="fig"}). Mitotic gene conversion results when there is a nonreciprocal transfer of genetic information from one chromosome to the other during the repair event ([Figure 1D](#fig1){ref-type="fig"}). DNA repair from homologous sequences at nonallelic positions, called ectopic recombination, can lead to deletions, inversions, translocations, and acentric or dicentric chromosomes if repair is associated with a crossover ([Figure 1, E and F](#fig1){ref-type="fig"}).
{#fig1}
Most of our attention focuses on the repair of double-strand breaks (DSBs); however, the exact nature of the initiating spontaneous lesion is unknown. Indeed nicks can be processed into single-stranded DNA (ssDNA) gaps or DSBs as the result of ligation failure from the previous round of DNA replication or during the repair of damaged or misincorporated nucleotides via processes such as nucleotide excision repair (NER), mismatch repair (MMR), base excision repair (BER), or transcription-coupled repair (TCR). Nicks can also be formed after the failed catalysis of [Top1](http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000005366) covalently attached to DNA. Upon subsequent replication, these protein-bound nicks can also become DSBs. Reactive oxygen species (ROS), cellular metabolism, and exogenous damage from ultraviolet light or gamma-irradiation can also produce nicks. Similarly, collapsed and stalled replication forks can lead to structures that can be processed into DSBs. Finally, DNA ends are produced when gamma-irradiation breaks both strands or when telomeres are uncapped due to problems in assembling the shelterin complex. In some cases, simple ligation of the ends, so-called nonhomologous end joining (NHEJ), results in repair that may or may not be error-free. For example, in a G1 cell, NHEJ is likely the preferred repair choice. However, given the many different sources of DNA lesions, it is clear that one of the central questions in the regulation of recombination is how the cell "determines" how to repair a DSB---NHEJ or HR. Among some of the issues the cell must confront are the necessity to interpret whether it is haploid or diploid (controlled by the *MAT* locus), where it is in the cell cycle (controlled by CDK), what kind of processing the DNA ends need \[controlled in part by the [Mre11](http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000004837)--[Rad50](http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000005194)--[Xrs2](http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000002777) (MRX) complex\] and the chromatin environment of the DNA lesion. All of this information must be integrated for the appropriate repair decision to be made. Understanding this integration will clarify how all of the pathways that impact recombination are intertwined to lead to repair of a DNA lesion and a viable cell.
Many of the genes described in this chapter that affect genetic recombination were originally identified by their requirement to repair radiation-induced DNA damage. For example, most of the genes of the *[RAD52](http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000004494)* epistasis group are ionizing radiation (IR) sensitive, while *[RAD1](http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000005943)* and *[RAD10](http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000004560)* are ultraviolet light sensitive ([@bib135]; [@bib136]). In addition, genes have been identified that are sensitive to other types of DNA damaging agents, such as methyl methanesulfonate (MMS), camptothecin (CPT), 4-nitroquinoline 1-oxide (4-NQO), etc. Over the years, genes involved in many pathways have been shown to affect genetic recombination. Some of these genes were discovered in mutation analyses that looked for effects on recombination and repair assays, while others were identified when the yeast gene disruption library was systematically tested for gross chromosomal rearrangements ([@bib174]; [@bib409]), mitotic crossing over ([@bib17]), sensitivity of polyploidy ([@bib418]), [Rad52](http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000004494) foci ([@bib16]), doxorubicin sensitivity ([@bib485]), sensitivity to R-loops ([@bib146]), fragility of triplex structure-forming GAA/TTC ([@bib499]), stability of quasipalindromes ([@bib500]), and many more. Bioinformatic analyses have also revealed many genes involved in genome stability ([@bib348]). Furthermore, screens for hyperrecombination (hyper-rec) uncovered genes involved in a multitude of pathways ([@bib4]; [@bib203]; [@bib381]).
Finally, it is worth mentioning that most assays that have been constructed to identify genes that affect recombination were applied without knowing the precise recombination pathway being assayed. By isolating mutations that affect that pathway, we can start to understand the mechanism of the assay. At the same time, the precise function of the gene is refined by understanding its role in the assay. This "yin--yang" situation makes the study of homologous recombination so challenging.
II. Mechanisms of Recombination {#s1}
===============================
A. Models for DSB-initiated homologous recombination {#s2}
----------------------------------------------------
### DSB repair and synthesis-dependent strand annealing models: {#s3}
The DSB repair (DSBR) model was first proposed to explain the mechanism of plasmid gap repair and is currently the most accepted model to rationalize the association of crossing over with gene conversion during homologous recombination ([@bib319]; [@bib440]). In this model, the 5′ ends at the DSB are degraded to yield 3′ ssDNA tails, one of which invades a homologous double-stranded DNA (dsDNA) to form a displacement loop (D-loop) and is used to prime DNA synthesis, templated by the donor duplex ([Figure 2](#fig2){ref-type="fig"}). The 3′-terminated strand at the other side of the break anneals to the displaced strand | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
The industrial interest of carbon materials in any of their allotropic forms has considerably grown in the past century due to their interesting intrinsic physicochemical properties such as good electronic conductivity, high chemical stability, tailorable surface properties, ease of processing, and nonhazardous nature.^[@ref1]^ Carbon materials find applications in fields as diverse as thermal^[@ref2]^ and energy storage systems,^[@ref3]^ removal of metal contaminants,^[@ref4]^ and organics in water purification,^[@ref5]^ catalyst supports,^[@ref6]^ gas adsorption and storage,^[@ref7]^ or biosensing.^[@ref8]^ In the field of energy storage, carbon materials dominate the composition of commercial electrodes in electrochemical double-layer capacitors (EDLCs or "supercapacitors")^[@ref9]−[@ref13]^ and of anodes for lithium-ion (LIBs)^[@ref14]−[@ref16]^ and sodium-ion batteries (SIBs).^[@ref17],[@ref18]^
The working principle of EDLCs relies on physical charge separation,^[@ref19]^ which allows the devices to withstand thousands of cycles without remarkable capacitance loss^[@ref20],[@ref21]^ while delivering high power densities. For this application, mesoporous materials of different compositions,^[@ref22],[@ref23]^ metal--organic framework (MOF)-derived nanoporous materials,^[@ref24],[@ref25]^ and two-dimensional (2D) layered materials^[@ref26]^ have shown promising electrochemical properties as electrodes for supercapacitor applications. Notwithstanding that, carbon-based electrodes are still receiving the most attention and dominate the commercial market. Since the capacitance is predominantly related to the surface area accessible to the electrolyte, intensive research efforts have been devoted to design advanced carbon materials with tailored pore characteristics.^[@ref27],[@ref28]^ However, aside from either increasing the specific surface area and storage active sites by chemical and physical activation processes^[@ref29]^ or attempting to control the final surface properties by template methods,^[@ref30]^ there is currently a new focus toward the development of three-dimensional (3D) nanostructured materials with hierarchical and interconnected porosity due to their improved storage performance at high charge/discharge rates.^[@ref31]^ This interest has aroused not only for EDLC applications but also for the application of carbonaceous materials in LIBs^[@ref32]^ and SIBs.^[@ref33]^
In the case of LIBs, one of the essential and desired requirements for their implementation in automotive applications is a higher power density, which enables charging the device in a short period of time without compromising energy density. However, state-of-the-art graphite anodes deliver extremely poor rate capabilities that cannot satisfy such a demand whilst also arising safety concerns related to lithium-metal plating on the anode surface.^[@ref34]^ As for EDLCs, nanostructured amorphous carbon anodes have shown promise in supplying better rate capabilities^[@ref35]−[@ref37]^ when compared to graphite anodes due to shorter lithium diffusion length paths and smaller charge transfer resistance.
Dimensionality has proven to have a decisive effect on electronic and ionic transport properties of carbon materials,^[@ref38]^ positioning layered carbon structures amongst the most promising electrode materials.^[@ref39]^ Nevertheless, the main limitation of sheet-like morphologies when evaluated for EDLC and LIB applications is that isolated sheets suffer from agglomeration during electrode preparation as a result of strong van der Waals intersheet interaction, limiting the area accessible by the electrolyte only to the electrode edges rather than across the whole volume.^[@ref40]^ For instance, in high-loaded anodes for LIBs, the diffusion of lithium ions across the electrode is extremely poor at high charging rates due to the high ion path tortuosity.^[@ref41]^
This fact usually leads to a reduction in the achievable capacitance (EDLCs)/capacity (LIBs) compared to what is expected in relation to the material properties. One of the main approaches to overcome the above shortcomings and endow such materials with better electrochemical performance is the introduction of porosity or holes onto the sheets in order to facilitate the ionic access to the whole electrode area.^[@ref42]^ A variety of procedures have been addressed to produce porous nanosheets: high-energy bombardment with electrons or ions, nanolithography and etching, liquid-phase oxidation, acid etching with nitric acid (HNO~3~), guided etching with catalysts or reactive nanoparticles,^[@ref42]^ or chemical activation^[@ref43]^ and oxidation.^[@ref44]^
Another novel strategy for shortening ionic diffusion lengths is the development of graphene-like nanosheets arranged into a porous hierarchical 3D network.^[@ref45]−[@ref47]^ Some attempts already reported to design such microstructures include template-directed deposition or assembly of graphene,^[@ref48]^ development of graphene aerogels by self-assembly in freeze-drying processes,^[@ref49],[@ref50]^ and taking advantage of the naturally developed hierarchical structure of some biomass precursors.^[@ref44]^
The use of biomass resources as sustainable starting precursors to obtain carbon materials is currently of high interest. Most biomass, especially that coming from agricultural waste, can be seen as a renewable resource, and thus there is interest in exploring ways to turn a waste biomass into a high-value product.^[@ref51]^ Porous carbon nanosheet networks have been previously obtained from various biomass precursors, including, for example, from cellulose via ball milling treatment followed by KOH activation,^[@ref52]^ from peanut skins and rice husk via a sulfuric acid-assisted hydrothermal process followed by activation,^[@ref53],[@ref54]^ from sugarcane bagasse pith/chitosan by carbonization and activation with KOH treatments,^[@ref43]^ and from soybean milk using NaCl as a template.^[@ref36]^
Herein, a one-step process for the synthesis of a three-dimensional porous graphene-like carbon material is presented. A recycled cellulose precursor was first impregnated with a saturated nickel nitrate solution and then carbonized in a nitrogen atmosphere. Upon heat treatment, a fast thermal decomposition causes the breakage of the original cell wall structure of the biomass source, while nickel acts as catalyst promoting graphitization. A subsequent acid etching process removes the nickel particles and introduces pores into the structure. The resulting microstructure of the carbon material, consisting of holey graphene-like sheets, would be interesting for electrochemical energy storage applications. The thermal behavior during pyrolysis and the resulting microstructural features and surface properties are evaluated with a view to their electrochemical behavior as electrodes for supercapacitor devices and as a negative electrode (anode) for LIBs.
2. Results and Discussion {#sec2}
=========================
2.1. Synthesis and Microstructural Characterization {#sec2.1}
---------------------------------------------------
Thermogravimetric (TGA) and differential scanning calorimetry (DSC) analysis were performed to study the thermal behavior of samples while heating under an inert atmosphere. [Figure [1](#fig1){ref-type="fig"}](#fig1){ref-type="fig"} shows the TGA and DSC analysis under nitrogen of raw MDF precursor and MDF impregnated with an aqueous nickel nitrate solution in comparison with that of MDF impregnated with the nickel nitrate isopropanol-based solution previously reported in ref ([@ref55]). In that paper, focused on the graphitization of MDF wood by means of a nickel catalyst, the authors decided to use isopropanol as a solvent instead of water to avoid the swelling of the wood fibers and ensure the consistency of the monolithic carbon scaffold.
![TGA/DSC analysis using a heating rate of 10 °C·min^--1^ from room temperature to 1000 °C under a constant nitrogen flow rate of 100 mL·min^--1^. Comparison between the thermal behavior of raw MDF, MDF impregnated with Ni(NO~3~)~2~ isopropanol-based solution^[@ref55]^ and MDF impregnated with Ni(NO~3~)~2~ water-based solution: (a) Weight curve (left; solid lines) and derivative weight loss (right; dashed lines) versus temperature during pyrolysis; (b) heat flow curve versus temperature (black arrows point to the exothermic reactions).](ao9b03142_0008){#fig1}
The raw MDF precursor exhibits a smooth and continuous weight loss at temperatures between 200 and 500 °C attributed to the decomposition of the main polysaccharide chains of cellulosic precursors and breakdown of C--O, C--C, and C--H bonds, leaving a solid carbon template with ≈20--25% of the initial weight at temperatures above 600 °C ([Figure [1](#fig1){ref-type="fig"}](#fig1){ref-type="fig"}a). No further weight loss is observed for untreated samples, whereas samples impregnated with an isopropanol-based nickel nitrate solution^[@ref55]^ exhibit a fairly similar behavior except for a more progressive weight loss arising from the decomposition of a nickel nitrate component (TGA/DSC analysis of a hexahydrate nickel nitrate powder in an inert atmosphere shown in [Figure S1](http://pubs.acs.org/doi/suppl/10.1021/acsomega.9b03142/suppl_file/ao9b03142_si_001.pdf), Supporting Information).
In contrast, samples impregnated with an aqueous nickel nitrate solution undergo an abrupt thermal decomposition with a large weight loss of ≈67% at 150 °C (pointed out by arrows in [Figure [1](#fig1){ref-type="fig"}](#fig1){ref-type="fig"}). At this temperature, the sample weight abruptly decays from 89 to 22%. A highly exothermic reaction can be confirmed by the DSC analysis (enthalpy of ≈360 J·g^--1^) shown in [Figure [1](#fig1){ref-type | {
"pile_set_name": "PubMed Central"
} |
**Pregnant women have long been orphaned from drug studies. The application of physiologically based pharmacokinetic modeling to quantitatively describe drug disposition and effects during pregnancy is an attractive approach that is now actively pursued as it allows optimal use of available information for both efficient study designs and prediction of maternal--fetal exposure.**
Pregnant women have long been orphaned from drug studies, similar to the situation for children before the Best Pharmaceuticals Act for Children and the Pediatric Research Equity Act.^[@bib1]^ Yet drugs are being prescribed for pregnancy-related conditions (gestational diabetes, preeclampsia, premature labor) as well as part of chronic disease management (e.g., asthma, depression, diabetes, epilepsy, and hypertension). For many of these drugs, good dosing guidelines during pregnancy are lacking while pharmacokinetics are likely altered as a result of significant physiological changes such as increased plasma volume, higher glomerular filtration, and increased activity of phase I and II drug metabolizing enzymes. Following the success of the Pediatric Pharmacology Research Units network as an infrastructure for high quality pediatric labeling and translational studies, the National Institute of Child Health and Development now supports an active network of Obstetric-Fetal Pharmacology Research Units (<http://opru.rti.org>) to carry out pharmacology research to enhance understanding of obstetrical pharmacokinetics and pharmacodynamics, and improve appropriate therapeutics during pregnancy. Ongoing research within the Obstetric-Fetal Pharmacology Research Unit network focuses on systems approaches to understanding pharmacokinetics and pharmacodynamics of oral hypoglycemics for treatment of gestational diabetes, agents thought to alter uterine activity, and several other drugs used during pregnancy (such as antibiotics and antidepressants). The application of physiologically based pharmacokinetic modeling to quantitatively describe drug disposition and effects during pregnancy is a highly attractive approach that is now actively pursued as it allows optimal use of available information for both efficient study designs and prediction of maternal--fetal exposure. These scientific activities are in line with what has been advocated by the US Food and Drug Administration\'s (FDA) Critical Path Initiative as the "systems pharmacology" approach and apply innovative computational techniques to integrate the effects of pregnancy-induced changes in physiology to describe and predict drug disposition as associated with response to therapy and adverse events. Physiologically based pharmacokinetics (PBPK) is a modeling technique that attempts to mathematically represent an organism, all of the organism\'s components, and time-dependent changes that are important for describing the absorption, distribution, metabolism, and excretion of a drug in humans.^[@bib2]^ The physiological representation through organ-specific models has the advantage to incorporate elements that reflect true clearance mechanisms as well as changes over time. This can be represented as disease progression or as physiological changes such as the one that occur during pregnancy from prepregnancy, through the continuum of first, second, and third trimester and postpartum.^[@bib3]^ PBPK modeling is increasingly used in pharmaceutical research and drug development.^[@bib2],[@bib4]^ Earlier this year, the FDA\'s Pharmaceutical Science and Clinical Pharmacology Advisory Committee voted in support of extending the use PBPK modeling for pediatric drug development although several members of the committee emphasized the need for more data and prospective evaluation and validation of the models with observed data (<http://www.fda.gov>). In addition, a recent FDA guidance on drug--drug interaction studies posted for comments also includes an in-depth discussion on PBPK.^[@bib5]^ Therefore mechanistic PBPK models that use organs and tissues with physiologic volumes has seen a tremendous increase in application, initially for environmental toxins and chemicals but now also for drugs. This is evidenced by more than 800 PBPK-related publications and over 40 publications of pregnancy physiologically based pharmacokinetic models developed for theoretical assessment of the kinetics of drugs during pregnancy, all trying to take into account relevant dynamic changes of the maternal and embryonic/fetal physiological functions.^[@bib6]^
Increasing Interest in PBPK---Advantages of Bottom--Up Over Top--Down Compartmental Analysis
============================================================================================
Most of the early pharmacokinetic data in pregnant women have been obtained from small parallel studies. In recent years, for some drugs, our knowledge base has been supplemented with data derived from population pharmacokinetic analyses. These data, typically collected in the third trimester have been our primary sources for the identification of factors that would explain pregnancy-induced changes in drug disposition. For instance, nifedipine is a calcium channel blocker and one of the few therapeutic options available for the treatment of chronic and gestational hypertensive disorders that are a major complication during pregnancy. Current recommendations for acute and maintenance doses of nifedipine are based on expert opinion rather than on evidence-based data from well-designed pharmacokinetic--pharmacodynamic studies. Clearance during the 3rd trimester has been reported to be increased by a factor of 2--3 as compared with that in patients and healthy subjects.^[@bib7]^ **[Figure 1](#fig1){ref-type="fig"}** shows a simulation of anticipated effects of gestation and trimester on maternal nifedipine clearance. These changes may markedly alter the pharmacodynamics of nifedipine. In addition, pharmokinetics/pharmacodynamics changes may be different in subjects with chronic hypertension or patients with preeclampsia. A comprehensive evaluation of these changes is an important first step in optimizing drug therapy during pregnancy, with special consideration to the disease state. Of note, nifedipine belongs to the Pregnancy Category C drug classification by the US FDA, which implies that "Animal reproduction studies have shown an adverse effect on the fetus and there are no adequate and well-controlled studies in humans, but potential benefits may warrant use of the drug in pregnant women despite potential risks." Despite FDA Category C, nifedipine remains one of most commonly used drugs in pregnancy. Beside ethical constraints, there are challenges for performing informative pharmokinetics/pharmacodynamics studies during pregnancy including unfriendly designs burdened by intense sampling schedules and long waiting times (at least one dosing interval) that further complicate enrollment. These barriers are somewhat mitigated by population pharmokinetics/pharmacodynamics analysis and modeling. Such "top--down" population analysis identifies important covariates or patient characteristics such as age, body weight, weeks of pregnancy, and organ function, and their association with pharmacokinetic behavior of the drug. Despite the level of sophistication of some of the top--down modeling, analysis is based primarily on pharmacostatistical considerations, and there is an unmet clinical need to improve our understanding of key sources of variability in a mechanism-based fashion. Fundamental to the PBPK approach is the separation of information on the system (i.e., human body) from that of the drug (e.g., physicochemical characteristics determining permeability through membranes, partitioning to tissues, binding to plasma proteins, or affinities toward certain metabolizing enzymes and transporter proteins) and the study design (e.g., dose, route and frequency of administration, concomitant drugs, and food intake). This paradigm or "bottom--up" approach includes physiologically based *in vitro*--*in vivo* extrapolation and has in recent years gained momentum due to our increased understanding of the contributing factors (physical chemistry, systems biology, physiology, and pharmacogenetics) and advances in quantitative modeling using mechanistic models.
Recent Advances
===============
In the September issue of CPT-PSP, two studies described the applications of physiologically based pharmacokinetic modeling of CYP3A substrates in pregnant women.^[@bib8],[@bib9]^ The studies are noteworthy as they highlight several important developments in the analysis of pharmacokinetic data in pregnant women that will aid in the design of more informative studies and the development of evidence-based dosing algorithms. These two research teams developed PBPK models using distinct approaches to predict the disposition of the CYP3A substrates midazolam, nifedipine, and indinavir. The semimechanistic pregnancy compartment model developed by Quinney *et al.* incorporated the intestinal lumen, intestinal wall, liver, portal circulation, and systemic circulation as elements to represent the key organs involved in the absorption, metabolism, and distribution of the investigated drugs midazolam and nifedipine. Physiological changes associated with pregnancy were modeled through the addition of placental and fetal compartments with metabolic capability, increased volume of distribution, decreased plasma protein binding, and increased CYP3A activity. Physiological compartments, not considered key determinants of drug clearance, were collapsed into the central and peripheral compartment.
The model used by Ke and colleagues represents a time-varying full-PBPK model based on the 13-compartment Simcyp model extended with a lumped compartment to represent placental--fetal organs including the fetus, placenta, and the amniotic fluid. Systemic clearance was considered to occur in the maternal liver and kidney, and presystemic metabolism was considered to occur in both maternal small intestine and the liver. Both studies used sensitivity analyses to interrogate known and potential pregnancy-related effects on absorption and bioavailability, such as hepatic blood flow, protein binding, CYP3A activity in the gut and liver, and fetal and maternal drug metabolism on pharmacokinetic parameters to predict mean area under the curve, peak plasma concentration, and trough plasma concentration and compare the results with published data in pregnant and nonpregnant women. Sensitivity analysis is the technique used to quantify the influences associated with specific input parameters, interactions between parameters and any nonlinear processes on model predictions. Of note, both studies conclude that PBPK modeling successfully predicted the disposition of CYP3A substrates midazolam, nifedipine, and indinavir during the third trimester. In addition, the models indicate that the two- to threefold increase in clearance can be attributed to increased CYP3A activity in the liver but not in the gut.
Future Directions
=================
Despite the promise of PBPK as a powerful tool, there still are significant knowledge gaps, and a great amount of work will need to go into developing fully predictive | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
At a global level, amongst the most important groups of emerging infectious diseases are those caused by arboviruses. These include West Nile virus (North America, 1999), Rift Valley Fever virus (Arabia, 2000), and Chikungunya virus (Indian Ocean rim, 2005/2006; Italy, 2007) \[[@CR1], [@CR2]\]. Many arboviral diseases are zoonoses maintained in a transmission cycle between a non-human vertebrate host and an arthropod vector \[[@CR1]\].
In Australia, Murray Valley encephalitis virus (MVEV) is an important pathogenic arbovirus largely endemic to the Kimberley region of Western Australia (WA) and the Top End of the Northern Territory (NT) \[[@CR3]\]. A number of MVE epidemics have occurred in the past century \[[@CR3], [@CR4]\], with the last major event in 1974, when 58 cases were reported across the country \[[@CR4]\]. There are fears that with increased economic activity and development in northern Australia where the virus is endemic, the risk of MVEV epidemics in that region might increase, which could lead to its spread to, or emergence in, other parts of the country \[[@CR5]\].
MVEV is maintained in an arthropod vector-vertebrate host transmission cycle. The virus's major vector is the common banded mosquito, *Culex annulirostris* Skuse, a freshwater species, and the major hosts are waterbirds of the order *Ciconiiformes*, in particular the Rufous night heron, *Nycticorax caledonicus* \[[@CR3]\]. Evidence also suggests that other species of mosquito may transmit the virus, such as *Cx. australicus*, *Aedes normanensis*, and *Ae. sagax* \[[@CR6]\]. Although non-avian vertebrates such as kangaroos, rabbits, cattle, horses, pigs and mice can become infected with MVEV, their roles in transmitting the virus on to humans are uncertain \[[@CR3], [@CR7]\].
Cases of MVEV infection in humans are typically reported after the annual wet season in Australia, particularly during late summer and autumn \[[@CR3]\]. In the majority of cases, infections are typically asymptomatic, and only about 0.10--0.67 % of all infected persons will display symptoms \[[@CR8]\]. Although this is a small percentage, such infections can be lethal \[[@CR8]\]. In about 40 % of symptomatic cases, permanent neurological sequelae may result \[[@CR8]\]. Death can occur in about 15--30 % of encephalitic cases \[[@CR8]\]. Currently, treatment of symptomatic infections is limited and no antiviral therapy has so far proven effective \[[@CR8]\]. Preventive measures and education form the mainstay of public health efforts to control the virus.
As mentioned above, there is the prospect of increased incidence of MVEV infections due to greater human activity in northern Australia. For example, large parts of the Kimberley and Pilbara regions in WA are being developed to support mining, agriculture and other industries, and have driven increased immigration to those regions \[[@CR5]\]. The increase in population and frequent travel-related exposure of those regions put communities there at greater risk of experiencing an outbreak. Compounding these processes are other factors such as climate change, which could possibly lead to changes in the geographical ranges of *Cx. annulirostris* or *Ciconiiformes*, and the emergence of MVEV in other parts of the country.
The factors that drive MVEV epidemics in the past have been identified and various models developed in an attempt to predict when and where the next outbreak will occur. According to Forbes, two preceding seasons of excessive rainfall is predictive of an MVEV epidemic in the Murray Valley region \[[@CR9]\], while according to Nicholls, summer epidemics in that same region are most likely to occur if the Southern Oscillation Index is below average during the preceding three seasons \[[@CR10]\]. Kay et al. (1987) developed a mathematical model of MVEV amplification specific to southern parts of Australia calibrated with data from the 1951 and 1974 epidemics \[[@CR11]\], while Schuster et al. \[[@CR12]\] devised a separate model to predict MVEV epidemics in the Kimberley and Pilbara regions of WA based on remotely sensed rainfall data. It predicted higher risk of MVEV with elevations in the monthly rainfall and the number of days with above average rainfall \[[@CR12]\].
Here, we present a new approach for assessing MVEV risk in Western Australia. Our model differs from previous attempts by being a Bayesian Belief Network (BBN), incorporating a range of abiotic, biotic and anthropogenic factors that might affect features such as the population densities of *Ciconiiformes* and *Cx. annulirostris*, which would in turn affect MVEV risk. These include (i) climatic factors such as rainfall, temperature and humidity; (ii) geographical factors such as the presence of rivers and waterbodies; (iii) ecological factors that influence the timing of waterbird breeding and migration; and (iv) anthropogenic factors such as the seroprevalence of MVEV among members of the community. Risk maps encompassing all of Western Australia were then produced based on the model.
BBNs are acyclic graphical networks consisting of a set of vertices and edges (nodes and arrows, respectively) that represent conditional probability relationships between random variables, with each node having one or several states whose probabilities are assigned based on a prior distribution model (input or 'parentless' nodes) or calculated using Bayes' Theorem from prior probabilities ('child' nodes) \[[@CR13], [@CR14]\]. BBNs are widely used in diverse fields such as artificial intelligence, medical diagnosis, speech recognition, and most relevantly, in ecology and environmental health as well \[[@CR13]--[@CR17]\]. For example, BBNs have been used in conjunction with Geographic Information Systems (GIS) to identify suitable habitats for wildlife \[[@CR18], [@CR19]\]; support conservation and land-management efforts \[[@CR20]\]; evaluate forest management techniques \[[@CR14]\]; analyse risk factors contributing to the outbreak of wildfires \[[@CR21]\]; and also to assess environmental factors affecting the distribution of birth defects \[[@CR22]\].
We chose a BBN as the modelling tool because it is best suited to modelling large and complex systems with multiple interacting variables \[[@CR17]\], which is often the case in ecological processes including those that drive the emergence and distribution of MVEV. BBNs are generally robust to imperfect knowledge and approximate probabilities (even educated guesses) very often give good results \[[@CR15], [@CR23]\]. Because arboviruses are maintained in such complex ecological networks involving at least three different species---the viruses themselves, their vertebrate hosts, and arthropod vectors, each governed by its own ecological parameters and inhabiting its own niche in space and time---they are intrinsically well suited to risk modelling and mapping \[[@CR24]\]. The factors that drive their emergence in new locations are complex and multifaceted, with landscape factors and ecological processes playing a dominant role. This extends to MVEV, whose emergence can only happen when viruses, vectors, hosts, and humans, are present in sufficient numbers simultaneously \[[@CR1], [@CR24]\].
The model that we present is an 'expert system' \[[@CR23]\] designed after a comprehensive review of the literature. It was subsequently tested and refined using climatic data and historical reports during the main MVEV season of 4 years in the first decade of this century (2000, 2003, 2009 and 2011), containing a mix of epidemic and non-epidemic years. In such BBNs, where all or the majority of conditional probability tables (CPTs) are essentially determined by expert-opinion, there inevitably arises a sense of arbitrariness to the entire construction, although guidelines have been suggested by some authors to streamline and rationalise the whole process \[[@CR16]\]. Here we present a unique way of populating expert-derived CPTs. As described further in the "[Methods](#Sec16){ref-type="sec"}" and the Additional file [1](#MOESM1){ref-type="media"}, for every CPT that was to be populated by subjective opinion, we first assigned a numerical score/weight to every possible combination of parent node states. We then derived the probability distribution for that combination of states from a probability distribution table containing the distributions for all possible scores. These pre-defined probability distribution tables were carefully constructed to be symmetrically balanced around the middle score. The main advantage of using this method is that a consistent way of populating opinion-based CPTs was achieved.
The risk maps are presented in order to demonstrate the model's capacity to predict MVEV outbreaks during the four selected years. Because rainfall has been consistently identified as a major factor affecting MVEV risk, we also included maps showing the risk distributions at different states of the rainfall node in order to test the model's sensitivity to this particular node. Our results show significant differences in risk distributions across WA between 'high' and 'low' states of rainfall.
Finally, it is our hope that the model and maps presented here will add to the range of surveillance measures available to combat this infectious disease in Western Australia.
Results {#Sec2}
=======
Risk model {#Sec3}
----------
The MVEV risk model is shown in Fig. [1](#Fig1){ref-type="fig"}. All node states and prior distributions are listed in Table [1](#Tab1){ref-type="table"}, and the Conditional Probability Tables (CPTs) are provided in the Additional file [1](#MOESM1){ref-type="media"}. Prior distributions of parentless nodes are uniform while those of all other nodes are determined by their CPTs.Fig. 1The infectious | {
"pile_set_name": "PubMed Central"
} |
1. Introduction
===============
Prostate cancer is an androgen-dependent disease that is well known for its high sensitivity to androgen deprivation. In fact, for over 50 years, the exclusive treatment of advanced metastatic prostate cancer was androgen deprivation achieved through castration, as it was believed that 95% of androgens were of testicular origin \[[@B1-molecules-18-00914],[@B2-molecules-18-00914]\]. However, it is now well known that peripheral tissues represent another important source of androgens \[[@B3-molecules-18-00914],[@B4-molecules-18-00914]\]. In fact, the prostatic tissues efficiently convert the hormone precursor dehydroepiandrosterone (DHEA) into the active androgens testosterone (T) and dihydrotestosterone (DHT) \[[@B5-molecules-18-00914],[@B6-molecules-18-00914],[@B7-molecules-18-00914],[@B8-molecules-18-00914],[@B9-molecules-18-00914],[@B10-molecules-18-00914]\]. Both type 3 and type 5 17β-hydroxysteroid dehydrogenases (17β-HSD3 and 17β-HSD5, respectively) catalyse the reduction of 4-androstene-3,17-dione (4-dione) to testosterone (T) ([Figure 1](#molecules-18-00914-f001){ref-type="fig"}). However, whereas type 3 is located mainly in the testis, type 5 is expressed in the peripheral tissues \[[@B10-molecules-18-00914]\]. In order to control the peripheral formation of active androgens, which could enhance the efficacy of endocrine therapy (such as the use of a pure antiandrogen with an LHRH agonist), we focused on the development of inhibitors of 17β-HSD3 and 17β-HSD5.
{#molecules-18-00914-f001}
Our group has previously demonstrated that a spiro-δ-lactone at position 17 and an estrane backbone are two important requirements for the inhibition of 17β-HSD5 \[[@B11-molecules-18-00914]\]. We also reported that introducing a hydrophobic group at position 3 of androsterone (ADT) provides potent inhibitors of 17β-HSD3 \[[@B12-molecules-18-00914],[@B13-molecules-18-00914],[@B14-molecules-18-00914],[@B15-molecules-18-00914],[@B16-molecules-18-00914]\]. For example, we recently published the inhibitory potency of 3-spiro-carbamate and 3-spiro-morpholinone ADT derivatives and their respective stereoisomers on 17β-HSD3 \[[@B17-molecules-18-00914]\]. In our pursuit of the optimization of new 17β-HSD inhibitors, we synthesized steroid derivatives **4**, **5**, **12**, **13**, **16** and **17** ([Figure 2](#molecules-18-00914-f002){ref-type="fig"}). The monospiro derivatives **4**, **5**, **12** and **13** were designed to inhibit 17β-HSD5 whereas dispiro derivatives **16** and **17** were designed to inhibit 17β-HSD3. In this article, we report the synthesis, NMR characterization and biological activity of these new spiro derivatives (compounds **4**, **5**, **12**, **13**, **16** and **17**) ([Figure 2](#molecules-18-00914-f002){ref-type="fig"}).
{#molecules-18-00914-f002}
2. Results and Discussion
=========================
2.1. Synthesis of Spiro-δ-Lactones ***4*** and ***5*** ([Scheme 1](#molecules-18-00914-f003){ref-type="fig"})
-------------------------------------------------------------------------------------------------------------
The natural C19-steroid *epi*-androsterone (epi-ADT) was the starting material used in the synthesis of spiro-δ-lactones **4** and **5**. After protecting the 3β-OH as a tetrahydropyranyl (THP) ether using dihydropyran in the presence of a catalytic amount of *p*-toluenesulfonic acid (*p*-TSA), the carbonyl group at position 17 was alkylated with the lithium acetylide generated from 2-(3-butynyloxy)-tetrahydro-2*H*-pyran and *n*-BuLi. As reported in the literature, the acetylide attacks the carbonyl group by the less hindered alpha face of the steroid, providing the alkyne derivative **2** \[[@B18-molecules-18-00914],[@B19-molecules-18-00914],[@B20-molecules-18-00914]\]. The triple bond of the alkylated steroid **2** was hydrogenated using a mixture of Pd/C and Pd/CaCO~3~, under a hydrogen atmosphere to yield the corresponding alkane **3**. Without purification, the di-THP derivative **3** was treated with Jones' reagent leading to the spiro-δ-lactone **4**. Under these conditions, both deprotection and oxidation of secondary and primary alcohols occurred followed by lactonization between the 17β-OH and the carboxylic acid at the end of the side chain. Formation of the spiro-δ-lactone ring was confirmed by the presence of characteristic signals in ^13^C-NMR (93.21 and 171.98 ppm for C-17 and COO, respectively), which are identical to those of the corresponding spiro-δ-lactone with an estrane nucleus \[[@B20-molecules-18-00914]\]. The carbonyl group of ketone **4** was reduced with NaBH~4~ in MeOH to yield **5** as an epimeric mixture of 3β- and 3α-alcohols (3β-OH/3α-OH: 85/15). The major 3β-OH product was identified by the 3α-CH signal at 3.55 ppm in ^1^H NMR whereas the 3β-CH of the minor 3α-OH product appears at 4.01 ppm. These two signals are similar to those obtained from commercially available samples of *epi*-ADT (3α-CH: 3.60 ppm) and ADT (3β-CH: 4.07 ppm).
{#molecules-18-00914-f003}
2.2. Synthesis of Methylated Spiro-δ-Lactones ***12*** and ***13*** ([Scheme 2](#molecules-18-00914-f004){ref-type="fig"})
--------------------------------------------------------------------------------------------------------------------------
The monomethylated and dimethylated spiro-δ-lactones **12** and **13** were obtained from androsterone (ADT) through the sequence of reactions depicted in [Scheme 2](#molecules-18-00914-f004){ref-type="fig"}. ADT was first protected as a silylated ether using *tert*-butyldimethylsilyl-chloride (TBDMS-Cl) and imidazole in DMF. The anion resulting from the reaction between *n*-BuLi and 2-(3-butynyloxy)tetrahydro-2*H*-pyran was used for the alkylation of the carbonyl of TBDMS-ADT (**6**). The alkyne **7** was submitted to hydrogenation conditions (H~2~, Pd/C and Pd/CaCO~3~) to yield the corresponding alkane, which was treated *insitu* with *p*-TSA in MeOH at room temperature to selectively hydrolyze the THP group. The diol **8** was then treated with Jones\' reagent to yield the spiro-δ-lactone **9**. Alkylation in α-position of the lactone carbonyl was performed with lithium diisopropylamide (LDA) and methyl iodide. A mixture of three α-methylated lactones was obtained: the dimethylated lactone **11** and the two possible monomethylated spiro-δ-lactones **10A** and **10B**. Methylated spiro-lactones **10A**, **10B** and **11** were oxidized with Jones' reagent leading to compounds **12** and **13**. Unfortunately, epimerisation at position α of the lactone occurred when submitting each of the monomethylated compounds **10A** and **10B** to hydrolysis and oxidative conditions. The same mixture of the two possible monomethylated compounds was thus obtained, and this time, it was not possible to separate them by column chromatography.
{#molecules-18-00914-f004}
2.3. Synthesis of Spiro-Carbamate ***16*** and Spi | {
"pile_set_name": "PubMed Central"
} |
{
"pile_set_name": "PubMed Central"
} | |
Introduction
============
Cell migration is a fundamental aspect in numerous normal and pathological processes, including embryonic development, wound healing, inflammation, and metastasis of tumor cells (for reviews see [Hay 1995](#Hay1995){ref-type="bib"}; [Viebahn 1995](#Viebahn1995){ref-type="bib"}; [Birchmeier et al. 1996](#Birchmeieretal1996){ref-type="bib"}; [Gumbiner 1996](#Gumbiner1996){ref-type="bib"}). Various factors in the cellular microenvironment participate in the regulation of cell migration. These include soluble growth factors and extracellular matrix (ECM) proteins whose pivotal role has been clearly established using in vivo and in vitro model systems ([Schor 1994](#Schor1994){ref-type="bib"}; [Boyer et al. 1996](#Boyeretal1996){ref-type="bib"}; [Brand-Saberi et al. 1996](#Brand-Saberietal1996){ref-type="bib"}). Cell motility is also governed by the cell interpretation of external signals, which are transduced via multiple intracellular pathways. The motile process is finally executed by different biochemical events that modify the actin cytoskeleton and cell adhesion molecules ([Ingber 1993](#Ingber1993){ref-type="bib"}). Because of its wide implications for normal physiology and pathological conditions, considerable effort was directed towards the identification of intracellular signaling molecules that may control the dynamics of cell movement.
Induction of motility by the ECM is primarily associated with integrin-mediated cell adhesion. Integrins constitute a large family of α/β heterodimeric transmembrane receptors that mediate interaction of cells with many different ECM proteins ([Hynes 1992](#Hynes1992){ref-type="bib"}). The cytoplasmic tails of integrins interact with cytoskeletal-associated molecules providing a physical link between the ECM and the actin cytoskeleton. Ligation of integrins by the ECM initiates a cascade of intracellular signaling events involving the activation of tyrosine kinases and subsequent phosphorylation of multiple cytoskeleton-associated substrates ([Clark and Brugge 1995](#ClarkandBrugge1995){ref-type="bib"}; [Giancotti 1997](#Giancotti1997){ref-type="bib"}; [Schoenwaelder and Burridge 1999](#SchoenwaelderandBurridge1999){ref-type="bib"}). These biochemical modifications ultimately bring about diverse biological responses, including cell survival, proliferation, and migration.
The interactions of cells with the ECM organize integrins into specialized adhesive structures, termed focal adhesions, which are sites where signaling molecules are highly enriched ([Jockusch et al. 1995](#Jockuschetal1995){ref-type="bib"}; [Miyamoto et al. 1995](#Miyamotoetal1995){ref-type="bib"}; [Burridge and Chrzanowska-Wodnicka 1996](#BurridgeandChrzanowska-Wodnicka1996){ref-type="bib"}). Integrin clustering at these adhesive structures is dependent on the proper assembly of the actin cytoskeleton that is regulated by the Rho family of GTPases ([Keely et al. 1998](#Keelyetal1998){ref-type="bib"}; [Mackay and Hall 1998](#MackayandHall1998){ref-type="bib"}). Several signaling molecules that localize at focal adhesions after integrin stimulation have been implicated in cell motility; these include the nonreceptor focal adhesion kinase (FAK) and c-Src family kinases. FAK-deficient fibroblasts ([Ilic et al. 1995](#Ilicetal1995){ref-type="bib"}) and Src kinase--inactivated epithelial cells ([Rodier et al. 1995](#Rodieretal1995){ref-type="bib"}) show defective cell locomotion, whereas the overexpression of these kinases facilitates cell movement ([Rodier et al. 1995](#Rodieretal1995){ref-type="bib"}; [Cary et al. 1996](#Caryetal1996){ref-type="bib"}; [Gilmore and Romer 1996](#GilmoreandRomer1996){ref-type="bib"}). In addition, the protein tyrosine phosphatases Shp-2 ([Yu et al. 1998](#Yuetal1998){ref-type="bib"}) and PTP-PEST ([Angers-Loustau et al. 1999](#Angers-Loustauetal1999){ref-type="bib"}) also have been implicated in the regulation of cell locomotion. A role for these tyrosine kinases and phosphatases in cell migration is also outlined by their substrates, including the adaptor protein p130Cas (Crk-associated substrate) that was recently shown to play a role in cell motility ([Cary et al. 1998](#Caryetal1998){ref-type="bib"}; [Klemke et al. 1998](#Klemkeetal1998){ref-type="bib"}). However, the involvement of other direct effectors of these kinases and phosphatases in cell motility remains to be determined.
Paxillin is a focal adhesion protein ([Turner et al. 1990](#Turneretal1990){ref-type="bib"}) that was originally identified as a major tyrosine-phosphorylated protein in cells transformed by the v-Src and v-Crk oncogenes ([Glenney and Zokas 1989](#GlenneyandZokas1989){ref-type="bib"}; [Birge et al. 1993](#Birgeetal1993){ref-type="bib"}). Paxillin becomes phosphorylated on tyrosine in response to various physiological stimulants including bombesin, PDGF, NGF, and angiotensin II ([Zachary et al. 1993](#Zacharyetal1993){ref-type="bib"}; [Rankin and Rozengurt 1994](#RankinandRozengurt1994){ref-type="bib"}; [Melamed et al. 1995](#Melamedetal1995){ref-type="bib"}; [Turner et al. 1995](#Turneretal1995){ref-type="bib"}), and in response to adhesion-mediated events that are associated with remodeling of the actin cytoskeleton ([Burridge et al. 1992](#Burridgeetal1992){ref-type="bib"}; [Turner 1998](#Turner1998){ref-type="bib"}). Evidence from in vitro and in vivo studies has identified paxillin as a potential substrate for FAK ([Bellis et al. 1995](#Bellisetal1995){ref-type="bib"}; [Schaller and Parsons 1995](#SchallerandParsons1995){ref-type="bib"}). These two proteins are coordinately phosphorylated on tyrosine upon cell stimulation, are localized in focal adhesions, and paxillin exhibits enhanced phosphorylation in FAK-overexpressing cells (for review see [Hanks and Polte 1997](#HanksandPolte1997){ref-type="bib"}). Paxillin can also serve as a substrate for the protooncogene c-Abl in an integrin-dependent manner ([Lewis and Schwartz 1998](#LewisandSchwartz1998){ref-type="bib"}). Several structural features identify paxillin as an adaptor protein capable of recruiting multiple signaling molecules (for review see [Turner 1998](#Turner1998){ref-type="bib"}). It contains a proline-rich region that provides a potential binding site for the Src homology (SH) 3 domain of Src family members ([Weng et al. 1993](#Wengetal1993){ref-type="bib"}) and two pYXXP motifs that conform to consensus binding sites for the SH2 domain of Crk and the protein tyrosine kinase Csk ([Birge et al. 1993](#Birgeetal1993){ref-type="bib"}; [Sabe et al. 1994](#Sabeetal1994){ref-type="bib"}). The tyrosines at positions 31 and 118, in particular, have been shown to be involved in the binding of Crk ([Schaller and Parsons 1995](#SchallerandParsons1995){ref-type="bib"}). Paxillin also contains leucine rich motifs (LD repeats) that can selectively bind to vinculin, FAK ([Brown et al. 1996](#Brownetal1996){ref-type="bib"}), the FAK-related kinase Pyk2 ([Salgia et al. 1996](#Salgiaetal1996){ref-type="bib"}), the papillomavirus oncoprotein E6 ([Tong et al. 1997](#Tongetal1997){ref-type="bib"}), or to the recently identified p95PKL, or paxillin-kinase linker that links paxillin to the p21 GTPase--activated kinase PAK, and the guanine nucleotide exchange factor PIX ([Turner et al. 1999](#Turneretal1999){ref-type="bib"}). In the later case, it was proposed that a protein complex composed of paxillin in association with p95PKL/PAK/PIX is important for remodeling of the cytoskeleton. The ability of paxillin to interact with numerous proteins suggests that paxillin may mediate diverse signaling pathways. The functional significance of these different associations of paxillin is yet to be determined.
We have used the rat bladder carcinoma cell line Nara Bladder Tumor II (NBT-II) to study the factors that control ECM-mediated cell migration. NBT-II epithelial cells are converted to motile cells during a process known as the epithelium--mesenchymal transition ([Boyer et al. 1996](#Boyeretal1996){ref-type="bib"}). The induction of cell dispersion is specific for collagens, whereas other ECM components such as fibronectin (FN) and laminin (LN) only allow cell adhesion and spreading ([Tucker et al. 1990](#Tuckeretal1990){ref-type="bib"}). Moreover, NBT-II cells can be induced to scatter after stimulation | {
"pile_set_name": "PubMed Central"
} |
I.. INTRODUCTION {#acm20070-sec-0001}
================
Historically, it was expected that every inversely‐planned radiotherapy course would receive some level of experimental dosimetric quality assurance (QA) prior to first treatment.[^(1)^](#acm20070-bib-0001){ref-type="ref"} In the United States, such "patient‐specific end‐to‐end tests"[^(2)^](#acm20070-bib-0002){ref-type="ref"} are currently codified as an essential element of an IMRT safety and QA program[^(3)^](#acm20070-bib-0003){ref-type="ref"} and are a requirement for the facility accreditation in Radiation Oncology by the American College of Radiology.[^(2)^](#acm20070-bib-0002){ref-type="ref"} Electronic arrays, either planar[^4^](#acm20070-bib-0004){ref-type="ref"}, [^5^](#acm20070-bib-0005){ref-type="ref"}, [^6^](#acm20070-bib-0006){ref-type="ref"} or quasi‐three‐dimensional,[^7^](#acm20070-bib-0007){ref-type="ref"}, [^8^](#acm20070-bib-0008){ref-type="ref"}, [^9^](#acm20070-bib-0009){ref-type="ref"}, [^10^](#acm20070-bib-0010){ref-type="ref"} are a popular practical choice for these tests because of the ease of setup and nearly instantaneous availability of results. Various combinations of dose error and distance to agreement (DTA) thresholds are used to create comparison metrics between the measured and treatment planning system (TPS) calculated dose on the phantom, either sequentially in the composite analysis approach,[^(11)^](#acm20070-bib-0011){ref-type="ref"} or often combined in the gamma analysis formalism introduced by Low et al.[^(12)^](#acm20070-bib-0012){ref-type="ref"} The analysis passing rates are presumed to reflect the TPS ability to accurately calculate the phantom dose, and the method is commonly used during commissioning of a TPS or delivery system. It can catch certain (but not all) types of the larger deviations during the pretreatment QA. However, regarding the ability to identify the potentially clinically significant but modest dosimetric imperfections in the IMRT process on a per‐patient basis[^13^](#acm20070-bib-0013){ref-type="ref"}, [^14^](#acm20070-bib-0014){ref-type="ref"} in terms of sensitivity to systematic errors,[^13^](#acm20070-bib-0013){ref-type="ref"}, [^14^](#acm20070-bib-0014){ref-type="ref"}, [^15^](#acm20070-bib-0015){ref-type="ref"}, [^16^](#acm20070-bib-0016){ref-type="ref"} the value of this metric is less clear. One way to circumvent limitations in the sensitivity of conventional passing rate metrics is to reconstruct full, high‐resolution volumetric (3D) patient dose from relatively sparse array measurements, and generate delivered patient‐based dose‐volume histograms (DVHs) for direct comparison with the plan.[^(13)^](#acm20070-bib-0013){ref-type="ref"} It was recently demonstrated with independent dosimeters that, on a homogeneous "patient", this measurement‐guided dose reconstruction is sufficiently accurate for fixed gantry step‐and‐shoot IMRT with a planar diode array,[^(17)^](#acm20070-bib-0017){ref-type="ref"} and for VMAT with a helical one.[^(18)^](#acm20070-bib-0018){ref-type="ref"} The goal of this paper is to demonstrate that the latter approach is also valid for a heterogeneous "patient" dataset. To that end, we devised a novel thoracic phantom insert accommodating an ion chamber or an array of optically stimulated luminescent dosimeters (OSLDs) in and around a unit‐density spherical target suspended inside the lung‐density material. In the process, we also illustrate how this phantom can be used, with a modest effort, for end‐to‐end hidden target tests.
II.. MATERIALS AND METHODS {#acm20070-sec-0002}
==========================
A.. Phantoms {#acm20070-sec-0003}
------------
The anthropomorphic phantom used in this work is a modification of the commercial IMRT Thorax Phantom (Model 002LFC; CIRS Inc., Norfolk, VA).[^(19)^](#acm20070-bib-0019){ref-type="ref"} The conceptual design of the new dosimetric insert was provided by the authors, while the detailed design and manufacturing were performed by the vendor. The phantom is based on a Plastic Water cylinder (1 in [Fig. 1](#acm20070-fig-0001){ref-type="fig"}) with an approximately elliptical cross section flattened on the bottom to provide stability on the table. The overall dimensions are $30\text{cm} \times 30\text{cm} \times 20\text{cm}$. The phantom contains two cylindrical "lungs"(2) made out of epoxy resin $0.21 g/\text{cm}^{3}$ in density. The right lung (appearing with a cavity in [Fig. 1](#acm20070-fig-0001){ref-type="fig"}) can accommodate an 8.5 cm diameter cylindrical lung density insert. One version of the insert contains a 4 cm diameter spherical Plastic Water target with a cavity for an A1SL 0.05 cm^3^ ion chamber (Standard Imaging Inc., Middleton, WI) in the center. The other version(5) is overall geometrically equivalent, but has a removable two‐piece (3 and 4 in [Fig. 1](#acm20070-fig-0001){ref-type="fig"}, and [Fig. 2](#acm20070-fig-0002){ref-type="fig"}) target insert designed to accommodate optically stimulated luminescent dosimeters (OSLD)(6) known as InLight nanoDots (Landauer Inc., Glenwood, IL). The nanoDot slots are placed such that the lines drawn through the centers of the active volumes form two orthogonal profiles through the target center. The first array (IEC X‐direction on the transverse cut in [Fig. 2](#acm20070-fig-0002){ref-type="fig"}) has 14 slots offset symmetrically from the target center. The two central nanoDots are offset $\pm 2.5\text{mm}$, while the remaining detectors are separated by 5 mm in the target and 4.1 mm in the lung. The orthogonal (IEC Z) set contains 12 detectors positioned asymmetrically with respect to the target center. The innermost dosimeters are shifted $+ 6.5$ and $- 8.5\text{mm}$ from the center, with the remaining ones following the same spacing pattern as described above. The reduced distance between the outer detectors (4.1 mm) is an attempt to balance the desire for higher detector density in the penumbra region with the mechanical strength of the low‐density epoxy material. Each detector set covers about 60 mm in length. The "rounded cube" target insert is symmetrical on the outside, and the detector plane can be positioned in the cylinder to coincide with any of the cardinal anatomical planes. In addition, the cylinder can be rotated to place the detector plane in any number of intermediate orientations, although only the three cardinal positions were used in this work. The phantom also has a 4 cm diameter "spine" bone density ($1.6 g/\text{cm}^{3}$) insert (7 in [Fig. 1](#acm20070-fig-0001){ref-type="fig"}) drilled for an ion chamber.
{#acm20070-fig-0001}
{#acm20070-fig-0002}
In addition, for the OSLD sensitivity measurements described below, a $20 \times 20 \times 20\text{cm}^{3}$ Plastic Water Cube phantom (CIRS Inc.) was used. The phantom could interchangeably accommodate either a Semiflex 0.125 cc ion chamber (PTW, Freiburg, Germany) or a single nanoDot.
B.. OSL dosimeters {#acm20070-sec-0004}
------------------
The OSL Carbon‐doped Aluminum Oxide ($\text{Al}_{2}O_{3}:C$) dosimeters were originally proposed for radiation protection application in the late 1990s by Akselrod\'s group[^(20)^](#acm20070-bib-0020){ref-type="ref"} and were later characterized for radiotherapy applications by the same[^(21)^](#acm20070-bib-0021){ref-type="ref"} and other[^22^](#acm20070-bib-0022){ref-type="ref"}, [^23^](#acm20070-bib-0023){ref-type | {
"pile_set_name": "PubMed Central"
} |
Neurodegenerative diseases such as Alzheimer\'s disease, Parkinson\'s disease, and amyotrophic lateral sclerosis (ALS) are untreatable conditions that collectively represent a major healthcare burden. Improved understanding of the biology of these diseases is required in order to develop neuroprotective and ultimately reparative treatments. Until recently, neurodegenerative diseases have been largely regarded as exclusively neuronal disorders. However, recent findings have challenged this concept, implicating non-cell-autonomous mechanisms of neurodegeneration mediated by astrocytes in acute and chronic disorders.^[@bib1],\ [@bib2]^
The role of astrocytes in influencing neuronal viability has primarily been characterised in rodent systems. Advances in human stem cell biology now allow the modelling of human astrocyte--neuronal interaction under physiological and injury paradigms. Although there are robust platforms for the generation of neural stem cells and functional neurons, the generation of enriched and functional human astrocytes is comparatively understudied.^[@bib3],\ [@bib4]^ While our understanding of astrogliogenesis remains incomplete, it is well established that neurogenesis precedes gliogenesis and this in turn is reflected in differential temporal phenotypic potential of neural precursor cells (NPCs); young precursors are neuron restricted while aged precursors are glial competent.^[@bib5],\ [@bib6],\ [@bib7]^ In addition to poorly understood epigenetic changes that control temporal competence to astrogliogenesis, extrinsic signals are important determinants of astrocyte fate, including the JAK-STAT pathway activated by cytokines such as LIF, CNTF, and cardiotrophin 1 as well as BMP signalling acting through the Smad transcription factor family.^[@bib8],\ [@bib9]^ Synergistic interaction between these two signalling pathways raises the possibility that dual activation of STAT and BMP signalling will promote astrogliogenesis from human ES-derived neural precursors.^[@bib10]^
While the underlying cause of individual neurodegenerative diseases is unknown, multiple lines of evidence implicate oxidative stress in disease pathogenesis.^[@bib11]^ The support of neuronal antioxidant defences by astrocytes represents a key neuroprotective role and its manipulation represents an emerging therapeutic strategy for a range of acute and chronic neurological disorders associated with oxidative stress.^[@bib12]^ One attractive target is the transcription factor nuclear factor-erythroid 2-related factor 2 (Nrf2), a master regulator of antioxidant defences and drug-metabolising enzymes. The binding of Nrf2 to a *cis*-acting DNA promoter sequence called the antioxidant response element (ARE), allows *trans*-activation of a group of genes that includes key components of the glutathione antioxidant system.^[@bib13]^ Under normal conditions, Nrf2 is bound in the cytoplasm by Kelch-like ECH-associated protein 1 (Keap1) and targeted for proteasomal degradation.^[@bib14]^ However, the Keap1-dependent turnover of Nrf2 can be inhibited by oxidative stress and a variety of small molecules, leading to an accumulation of Nrf2 whereupon it accumulates in the nucleus and activates ARE-driven genes. Activation of Nrf2 by mild oxidative stress in astrocytes contributes to neuroprotective ischaemic preconditioning,^[@bib15]^ although other mechanisms exist.^[@bib16]^ Furthermore, pharmacological activation of astrocytic Nrf2, or overexpression of Nrf2 in astrocytes, confers a neuroprotective response in rodent models of Parkinson\'s disease, and ALS.^[@bib17],\ [@bib18],\ [@bib19]^ The mechanism behind this non-cell-autonomous neuroprotection is thought to be through the upregulation of astrocytic glutathione biosynthesis and secretion, breakdown products of which are used by the neurons to support their own glutathione levels.^[@bib18]^ Noting inter-species functional differences, the relevance of these rodent-based astrocyte-mediated neuroprotective effects to human experimental systems is unknown.^[@bib20]^
Here, we describe a novel protocol for generating highly enriched, functional astrocytes derived from human embryonic stem cells (HESCs), using a combination of developmental cues. By generating a separate population of neurons derived from the same HESC line, we establish a human-centred platform for assessing the neuroprotective properties of compounds when administered either directly to neurons, or in triggering a non-cell-autonomous neuroprotective response in astrocytes. As proof-of-concept, we demonstrate a key capacity for human astrocytes to mediate neuroprotective responses, including those triggered by a small molecule activator of Nrf2 that can only act in this non-cell-autonomous manner.
Results
=======
Generation of enriched and functional astrocytes from human ES cells
--------------------------------------------------------------------
In order to establish a platform to study astrocyte--neuronal interactions, we first generated a stable human neural precursor cell (hNPC) population. Using established protocols, HESC neural aggregates were first derived.^[@bib21]^ At day 8, neural aggregates were mechanically dissociated and plated as an adherent monolayer in defined conditions on gelatin, selecting for neural rosette-like structures at each passage.^[@bib22]^ By day 30, a near homogeneous population of hNPCs were obtained that were both nestin and 3CB2 positive (93.9±1.0% and 82.7±2.1%, respectively; [Figures 1a and b](#fig1){ref-type="fig"}) and had a bipolar morphology consistent with a radial glial identity.
In order to generate astroglia, hNPCs were further propagated until day 55 when they expressed, along with nestin, and key receptors and downstream signalling effectors for astrogliogenesis. These included BMP and LIF receptors and, SMAD1 and STAT3, by RT-PCR ([Figure 1c](#fig1){ref-type="fig"}). Having previously shown that BMP4 promotes astrogliogenesis,^[@bib5]^ we sought to refine this process in order to obtain more enriched astroglial populations for further enrichment. We systematically tested the efficacy of BMP4 alone and in combination with LIF and BMP2, which have been shown previously to promote astroglial commitment.^[@bib9],\ [@bib10]^ Astroglial specification was screened by measuring differential gene expression of brain lipid binding protein (BLBP), a neural precursor marker, and glutamine synthetase (GS), an astrocyte-expressed enzyme required for production of glutathione and glutamate recycling in neurotransmission. Gene expression analysis revealed downregulation of BLBP and upregulation of GS with all treatment groups relative to control (*P*\<0.05). The combination of BMP4 and LIF resulted in the greatest change in gene expression ([Figure 1d](#fig1){ref-type="fig"}). Quantitative immunohistochemistry was next undertaken with astrocyte differentiation determined by downregulation of nestin and concomitant upregulation of GFAP staining, along with a change in morphology from bipolar to stellate. Although all treatment groups increased the numbers of cells with GFAP staining, the combination of BMP4 and LIF resulted in the greatest upregulation (88.4±2.0% *versus* control 35.8±3.6% [Figures 1e--h](#fig1){ref-type="fig"}). Prolonged exposure (12 days) to BMP4 and LIF increased GFAP-positive staining to 95.7±3.1%. Furthermore, GFAP-positive astrocytes derived by BMP4/LIF co-treatment also stained positive for other markers of astrocyte differentiation; aquaporin 4 (79.4±1.0%) ([Figure 1i](#fig1){ref-type="fig"}), S100*β* (90.1±2.0%) ([Figure 1j](#fig1){ref-type="fig"}), and EAAT1 (89.5±3.2%) ([Figure 1k](#fig1){ref-type="fig"}). A defining physiological role of astrocytes is glutamate uptake mediated by Na^+^-dependent channels that include members of the excitatory amino-acid transporter family EAAT1 and EAAT2.^[@bib23]^ Radiolabelled glutamate uptake assays revealed negligible hNPC uptake in contrast to robust Na^+^-dependent glutamate uptake by BMP4/LIF-derived astrocytes consistent with astrocyte function ([Figure 1l](#fig1){ref-type="fig"}). Combined BMP4/LIF treatment was therefore used for subsequent functional and neuroprotection experiments.
Human astrocytes attenuate oxidative neuronal injury
----------------------------------------------------
Having established functional hNPC-derived astrocytes, we next generated an enriched population of neurons from HESCs in order to examine human astrocyte--neuronal interaction in the context of oxidative stress. Neural stem cells were generated from H9 HESCs as described by Koch *et al.*^[@bib22]^; following differentiation for 10 days 95.5±1.4% were TuJ1 positive upon immunostaining ([Figure 2a](#fig2){ref-type="fig"}). Studies predominantly based in rodent systems have shown that astrocytes can release soluble factors that support the growth, development, and survival of neurons, and so astrocyte-conditioned medium (ACM) can be neuroprotective.^[@bib24]^ We therefore sought to determine whether medium conditioned by HESC-derived astrocytes could exert a neuroprotective effect on HESC-derived neurons, using H~2~O~2~ to model an oxidative insult ([Figures 2b and c](#fig2){ref-type="fig"}). Cell death in response to H~2~O~2~ treatment was quantified with the CellTiter-glo assay and confirmed by quantitative immunohistochemistry determining activated caspase-3/TuJ1 positive co-staining ([Figures 2d--f](#fig2){ref-type="fig"}). Addition of ACM resulted in a significant neuroprotective effect against H~2~O~2~-induced injury, compared with unconditioned medium (31.0±1.8% loss of viability compared with control: 41.4±1.4% loss of viability; [Figure 2c](#fig2){ref-type="fig"}, *P*\<0.05). Immunofluorescent analysis of | {
"pile_set_name": "PubMed Central"
} |
a**aambeeld (van het oor)**anvil, incus**aambeien**hemorrhoids, piles, varicose veins of anus**aambeien, extirpatie van \~**hemorrhoidectomy**aanbiedingsbrief**cover(ing) letter, transmission letter**aanbod van zuurstof**oxygen supply**aanbrengen op de huid**application on the skin N *(met name van zalf)***aandachtsconcentratiestoornis**mental concentration disorder**aandachtsgebied**subspecialty**aandachtsgerichte cognitieve therapie**mindfulness training, mindfulness based cognitive therapy**aandachtsproblematiek**concentration difficulty**aandachtstekortstoornis met hyperactiviteit**attention-deficit/hyperactivity disorder**aandachtsvermogen, gestoord \~**defective concentration**aandeel**share, portion, moiety**aandoening**disorder, illness, affection**aandoening met ettervorming**suppurating lesion E *(cf. gleet)***aandoening van de nieren**renal disease**aandoening van slagaderen (elk type)**arteriopathy**aandoening van vestibulum labyrinthi**vestibulopathy**aandoening waarbij een nier betrokken is**(with) kidney involvement**aandrang (tot plassen)**urinary urgency, urgency (of micturition/urination)**aandrang tot urineren, frequente \~**(urinary) frequency, frequent urination**aandrangincontinentie**urge incontinence**aaneengegroeide tweelingen**conjoined twins**aaneengroeiing van de benen, congenitale \~**sirenomelia**aangeboren**congenital, inborn, innate, connatal**aangemelde instantie**notified body**aangetast**affected, impaired**aangevoerd door de lucht**air borne**aangevoerd door het bloed**blood borne**aangevreten als door motten**moth-eaten**aangezichtsligging**face presentation**aangezichtspijn**trigeminal neuralgia, facial (nerve) neuralgia**aangezichtsskelet**maxillofacial skeleton**aangifteplichtige ziekte**notifiable disease**aangrenzende gebieden**contiguous sites**aanhalingstekens openen en sluiten**to quote and unquote**aanhangsel**appendix, tag E *(cf. (anal) skin tag)***aanhangsels van peritoneum bij colon**epiploic appendages (of intestine)**aanhankelijk (gedrag)**clinging N *(als psychische afwijking)***aanhechting**attachment, insertion**aanhechting aan wervelkolom, ziekte van \~**spinal enthesopathy**aanhechting van pees, ziekte m.b.t. \~**enthesopathy**aanleg hebben voor een ziekte**being predisposed to a disease**aanleggen van een ontlastend stoma**palliative colostomy**aanleiding om door te verwijzen**reason for referral**aanmaak boven de fysiologische grens**overproduction**aanmaak van complexe verbinding in het lichaam**biosynthesis**aanmaakstoornis van bot en kraakbeen**(familial) osteochondrodystrophy E *(cf. lipochondrodystrophy)***aanmaken (van een product)**to synthesize**aanmelden**to report (1); to apply (2) N *(cf. rapport)***aanmeldingsformulier**application form**aanpassen**to adjust, to modify N *(verwijst naar een incidenteel proces)***aanpassing van de osmotische druk**osmoregulation**aanpassingsreactie**adjustment reaction**aanrander**assailant**aanranding**(criminal) violation/assault, outrage N *(cf. ontvoering, verkrachting, mishandeling, zedendelict, omvang van ongeregistreerde criminaliteit)***aanslag (op weefsel)**plaque**aansluiting (tech.)**connector, (point of) junction, terminal, link E *(cf. bayonet, mains, power line, BNC, USB, VGA, HDMI)***aanspannen van de buikspieren**abdominal straining**aanspanningswarmte**maintenance heat E *(cf. recovery heat)***aanspreekbaar**susceptible E *(cf. accessible)***aansteken**to affect**aanstotelijk**offensive, shocking, obnoxious E *(cf. noxious)***aantal**number, count**aantal baringen van een vrouw**parity E *(cf. nullipara, multipara)***aantal cycli per seconde**cycles per second, cps (abbr.) N *(cf. Hz)***aantal nieuwe gevallen van een ziekte**incidence N *(gerelateerd aan een bepaalde populatiegrootte en tijdsduur)***aantal ziektegevallen van een bepaalde soort**prevalence N *(binnen een bepaalde populatie en tijdsbestek; cf. incidentie)***aantasten**to affect, to impair**aantastend (middel)**corrosive**aantasting**impairment, interference**aantasting van bloedplaatje**platelet destruction**aanval**attack, fit, bout, paroxysm, seizure, spell, syncope, crisis E *(cf. hypertensive crisis, laryngeal syncope, convulsive seizure, terrors)***aanval van adem inhouden**apneic spell, breath-holding spell**aanval van een ziekte**attack of a disease**aanval van epilepsie**epileptic fit**aanval van slapte**fit of weakness**aanvallen (van ziekteverschijnselen)**bouts**aanvallend (met lichamelijk geweld)**assaultive**aanvalsgewijs**paroxysmal E *(cf. episodic, transient)***aanvalskracht van micro-organisme**virulence**aanvalsvrij**attack-free**aanvangsdosis**initial dose N *(cf. onderhoudsdosering, inleidende dosis)***aanvankelijk**initial, original**aanvoerende darmlis-syndroom**afferent loop syndrome**aanvoerende slagader**supplying artery**aanvoerende vaten, obstructie van \~**devascularization N *(leidend tot verminderde bloeddoorstroming)***aanvraagformulier**application form**aanvreten**to eat, to gnaw**aanvullend onderzoek**ancillary investigations**aanvullende diagnostiek**additional diagnostics**aanwenden**to apply, to utilize, to employ**aanwending**application**aanwensel**(acquired) habit**aanwezigheid op een abnormale plaats**malposition**aanwezigheid van abnormale cellen**cellular atypia**aanwezigheid van lucht vereisend**aerobic**aanwijzen met vinger gaat doel voorbij**past-pointing N *(als teken van cerebellaire ataxie)***aanwijzing dat iets volgt**indication, omen N *(cf. voorteken)***aanwijzingen**pointers, hints, clue, evidence**aanwijzingen voor gebruik**directions for use, instructions**aanzetten tot activiteit**excitation, stimulation**aanzien (van het gelaat)**complexion**aapachtig**pithecoid**aard van een complicatie**nature of a complication**aard van een ziekte, onzekerheid over \~**acrisia**aardbeigalblaas**strawberry gallbladder**aardbeihemangioom**strawberry hemangioma**aardbeinaevus**strawberry mark**aarde**soil (1); ground (2)**aars**arse, ass hole (sl.), anus**aarsmade**pinworm, threadworm, seatworm**aarsmade-infectie**enterobiasis N *(door Enterobius vermicularis)***aarzelend**hesitant, tremulous**abarognosis**baragnosis**abces**abscess, apostema**abces (slechts met microscoop zichtbaar)**microabscess**abces in de buurt van een nier**perinephric/perirenal abscess**abces in het ovarium**pyo-ovarium**abces van vetkussentje van distale falanx**felon | {
"pile_set_name": "PubMed Central"
} |
Background
==========
Influenza A virus still is a major cause of disease in humans, accounting for three to five million cases of severe illness and 250,000 - 500,000 deaths each year \[[@B1]\]. Efficient influenza A vaccines are available, which induce antibodies predominantly against the two major components of the virus membrane, hemagglutinin (HA) and neuramidase (NA). Protection is mediated primarily by neutralizing antibodies against HA \[[@B2],[@B3]\]. Since HA undergoes continuous change due to mutations (antigenic drift), new antigenic variants of influenza A arise every year requiring constant update of the vaccines. Effective vaccination is further complicated by the occasional reassortment of the segmented viral genome leading to the replacement of HA or NA from one subtype by another subtype, a processs called antigenic shift \[[@B4]\]. Passive immunization with monoclonal antibodies (mAbs) targeting HA is very efficient \[[@B5]-[@B7]\], however, suffers the same disadvantages as the current vaccines due to antigenic shift and drift.
An ideal target for active and passive immunization strategies would therefore be a conserved viral protein. The matrix protein 2 (M2) fits the bill and has received considerable attention as a potential target against influenza infection over the past decades \[[@B8]-[@B23]\]. M2 is a tetrameric ion channel \[[@B24]-[@B26]\] which is involved in virus uncoating in the endosome and in virus maturation in the trans-Golgi network \[[@B27]-[@B29]\]. Its 23 amino acid extracellular domain has remained remarkably conserved in human influenza A virus isolates over the last hundred years \[[@B30]\], at least in part due to the fact that the M2 protein is co-transcribed with the matrix protein 1 (M1) \[[@B31],[@B32]\]. Whereas M2 is abundantly expressed on infected cells, only very few M2 molecules are present in Influenza A virus membranes \[[@B23],[@B26]\]. In accordance with this, current seasonal influenza vaccines do not induce a significant humoral resonse against M2, and M2 specific antibodies (administered intravenously or induced by active immunization) mediate protection not by neutralizing virions, but by eliminating infected cells by ADCC \[[@B15],[@B22]\].
Passive immunization with monoclonal antibodies has several advantages over vaccination. In particular, it allows treating people which poorly respond to vaccines, such as the elderly, young children or immune compromised individuals. In addition, passive immunisation is the treatment option of choice in situations where rapid protection is crucial, such as for post-exposure treatment or prophylaxis for the acutely exposed. A number of M2 ectodomain (M2e)-specific mAbs have been reported to protect mice from a lethal challenge in a prophylactic setting \[[@B12],[@B17],[@B21]-[@B23]\]. While these mAbs include fully human antibodies derived from transchromosomic mice \[[@B22]\], no natural human M2e-specific antibodies have been reported to date. However, for application in human subjects, natural human antibodies are the preferred choice. In contrast to humanized and fully human antibodies derived from phage display or transchromosomic mice, natural human antibodies combine the advantage of minimal immunogenicity with the smallest possible off-target reactivity and toxicity. Furthermore, human derived antibodies have the advantage of having gone through the affinity maturation process, resulting in high affinity antibodies.
We recently described a novel method for the efficient isolation of antibodies from humans by mammalian cell display \[[@B33]\]. Here, we used this method for the isolation of natural human antibodies directed against M2e. We demonstrate that the antibodies bind M2 with high affinity and efficiently recognize M2 from a recently isolated H5N1 influenza A strain. The antibodies not only have potent prophylactic activities in a mouse model of Influenzy A infection, but also show efficacy in a therapeutic setting. Thus, the natural human antibodies described here have potential as immunotherapeutics against influenza infection.
Results and Discussion
======================
Isolation of M2e-specific human monoclonal antibodies
-----------------------------------------------------
Human mAbs were isolated by Sindbis-mediated mammalian cell display \[[@B33]\]. First, 334 M2e-specific B cells were isolated by FACS from the peripheral blood mononuclear cells (PBMCs) of an individual with high M2e titers, using the M2e consensus peptide (M2e-cons) (Table [1](#T1){ref-type="table"}) conjugated to the virus-like particle Qβ as a bait. The immunoglobulin variable regions (VRs) of the heavy chains (HCs) and light chains (LCs) were then amplified by RT-PCR and assembled to single-chain antibody (scFv) coding regions. Two separate libraries, one encoding scFv antibodies with κ, the other with λ LCVRs, were cloned in the Sindbis cell surface display vector pDel-SP-TM \[[@B33]\]. The resulting scFv-κ and scFv-λ sublibraries consisted of 1.0 × 10^6^and 1.1 × 10^6^independent transformants, respectively. Since the library was derived from 334 cells, it may be expected that every possible combination of heavy and light chain is covered multiple times by the 2 million clones and, accordingly, that screening is likely to yield antibodies containing the natural heavy and light chain pairs. Recombinant Sindbis virus libraries were then generated with titers of 3.4 × 10^7^pfu/ml and 5.7 × 10^7^pfu/ml, respectively, and used to infect BHK cells at a low multiplicity of infection (MOI), to ascertain expression of a single antibody species per infected cell.
######
M2e variants used in this study
M2 variant Abbreviation Subtype M2e (2-24) Sequence^(2)^
---------------- -------------- --------- ---------------------------
Consensus^(1)^ M2e-cons n/a `SLLTEVETPIRNEWGCRCNDSSD`
A/VN/1203/04 M2e-VN H5N1 `SLLTEVETPTRNEWECRCSDSSD`
A/PR/8/34 M2e-PR H1N1 `SLLTEVETPIRNEWGCRCNGSSD`
\(1\) M2e consensus sequence derived from H1, H2, and H3 subtypes of human Influenza A viruses.
\(2\) Variations from M2e consensus sequence are shown in bold \[[@B38]\].
Cells were stained for cell surface expression of M2-specific scFv using RNAse-M2e-cons or Qβ-M2e-cons conjugates and subjected to FACS. No M2e-specific antibodies could be found on the surface of BHK cells infected with the scFv-λ sublibrary. In contrast, BHK cells infected with the scFv-κ sublibrary contained a substantial fraction of M2e-reactive cells (typically about 0.3% of infected cells). Three sorts were carried out with the scFv-κ library, two using Qβ-M2e-cons (not shown) and one using RNase-M2e-cons as bait (Figure [1A](#F1){ref-type="fig"}), leading to the isolation of 255 BHK cells each displaying an M2e-specific antibody. Single cells were sorted into wells containing BHK feeder cells and incubated for 2 to 3 days to allow for amplification of the corresponding Sindbis virus clone. In total, 201 of the 255 wells showed signs of viral infection and were reanalyzed for M2e binding, using RNase-M2e-cons as a bait (Figure [1B](#F1){ref-type="fig"}). 130 cells showing varying degrees of M2e binding were identified. Supernatants from wells containing infected BHK cells displaying highly M2e-reactive scFv were used to clone the corresponding scFv coding region by RT-PCR. The large number of specific antibodies isolated in a single screen not only illustrates the utility of mammalian cell display \[[@B33]\], but also makes it an attractive alternative to other methods, typically based on cloning of antibodies from single or amplified B cell clones \[[@B34],[@B35]\], or from EBV-immortalized memory B cells \[[@B36]\].
{#F1}
Since the protective potential of M2e-specific antibodies depends on ADCC \[[@B15]\], the scFv antibodies were fused to the Fc region of mouse IgG2c (msFc-γ2c), allowing *in vivo*efficacy testing in a mouse model of influenza. All scFv-msFc-γ | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION: THE PRIMARY CILIUM AS A COMPARTMENTALIZED ORGANELLE
=================================================================
The primary cilium is a tiny, antenna-like projection from the apical membrane of most vertebrate cells ([@B83]). Most cilia are a few micrometers in length and are ∼200 nm in diameter. Long believed to be vestigial, the primary cilium has now been implicated in multiple cellular pathways, including vertebrate hedgehog signaling ([@B34]). Defects in primary cilia result in diseases (ciliopathies) affecting multiple tissues, including the neural tube, brain, and kidney ([@B39]).
The membrane of the primary cilium envelops the microtubular axoneme that templates from the basal body and is continuous with the rest of the plasma membrane. However, the ciliary membrane is believed to be partitioned from the rest of the plasma membrane by the transition zone ([@B80]; [Figure 1](#F1){ref-type="fig"}). At least 25 rhodopsin-family G protein--coupled receptors (GPCRs) have been reported to localize to cilia, particularly in neurons in the brain and in other cell types ([@B40]). Proteins linked to polycystic kidney disease, such as the TRP-channel family proteins polycystin-1 and 2 (PC1/2; [@B76]; [@B102]), and the single-pass transmembrane protein fibrocystin ([@B94]), also localize to cilia. In addition, sonic hedgehog (Shh) pathway components such as the Shh receptor Patched (Ptch1), the pathway activator Smoothened (Smo), and the orphan GPCR, Gpr161, a negative regulator of the pathway localize to ciliary membrane in a dynamic manner ([@B20]; [@B81]; [@B70]). Other cilia and ciliary pocket-coordinated signaling pathways involve transforming growth factor β, receptor tyrosine kinase, Wnt, and Notch signaling ([@B27]; [@B90]; [@B77]). Signaling mediated by cilia is an ancient phenomenon; for example, interactions between receptors (agglutinins) on plus and minus gamete cilia during fertilization in the green alga *Chlamydomonas* stimulate a signaling pathway involved in gamete activation that ultimately leads to cell--cell fusion ([@B93]). Thus the ciliary membrane serves as a compartment for subcellular localization of factors associated with sensory perception and multiple signaling pathways.
{#F1}
The lipid composition of the ciliary membrane is different from the rest of the plasma membrane ([@B55]). In particular, phosphoinositide 5-phosphatases Inpp5e and Ocrl localize to cilia ([@B8]; [@B47]; [@B60]), and the ciliary compartment lacks phosphoinositide 4,5-bisphosphate (PI(4,5)P~2~), similar to endosomes ([@B16]; [@B32]). The ciliary pocket flanking the primary cilium is rich in coated vesicles and actin microfilaments ([@B82]; [@B4]; [@B77]). In addition, there are distinct lipid barriers between cilia and rest of the plasma membrane ([@B88]), and proteins such as septins that localize to the cilia and transition zone restrict ciliary membrane components from diffusing into the rest of the plasma membrane ([@B43]; [@B18]; [@B33]). Certain membrane proteins are prevented from trafficking to cilia by being immobilized by the apical actin network outside cilia ([@B30]). Thus factors that affect ciliary pools include trafficking into cilia, removal from cilia, retention inside cilia, restriction outside cilia, and recycling of membrane components in the endosomal compartment ([Figure 1](#F1){ref-type="fig"}; [@B9]). Finally, loss of proteins in extracellular vesicles might also regulate ciliary content ([@B92]; [@B13]; [@B99]).
Localization of endogenous proteins in the ciliary membrane of vertebrate cells has been mostly determined by immunolabeling techniques. However, it is important to realize that these proteins are not exclusive to cilia; rather, they are enriched in cilia. The ciliary membrane is ∼1/1000--1/5000 of the total cellular surface, and the ciliary volume (∼0.5 fl) is about ∼1/30,000 of the total cellular volume ([@B22]). The small size of the cilium enables enrichment of proteins with respect to the rest of the plasma membrane and establishing an effective signaling compartment by local concentration of second messengers and effectors. However, the absolute amounts of cilia-localized proteins are likely to be minute in comparison to total cellular levels. Thus, to understand the role of compartmentalization in ciliary signaling, it is imperative to determine mechanisms underlying ciliary trafficking, and identify functional consequences upon disruption of ciliary localization. Unfortunately, we are lacking in understanding of signaling *inside* cilia, mostly due to the difficulty of working with such a tiny compartment. We are also extremely limited in the availability of tools that allow us to address the role of ciliary compartmentalization while maintaining the architecture of cilia and/or retaining the functionality of the studied proteins.
ITINERARY FOR MEMBRANE PROTEIN TRAFFICKING TO CILIA
===================================================
Membrane biogenesis has to be closely coordinated with axonemal growth during ciliogenesis. Key players in this process have been identified and include a Rab cascade consisting of Rab11 and Rab8 ([@B68]; [@B71]; [@B97]; [@B59]). Because disruption of these factors affects ciliogenesis per se, it is important to distinguish between factors that affect biogenesis of the ciliary membrane and those that affect trafficking. An increasing number of pathways linked to the secretory pathway have been implicated in trafficking of membrane proteins to cilia. These include the small G protein ARF4 for rhodopsin and fibrocystin trafficking ([@B64]; [@B29]) and the GGA1 adapters for PC1/2 trafficking ([@B51]). The BBSome proteins regulate membrane composition ([@B56], [@B55]) in addition to regulating ciliary GPCR pools and removal of GPCRs, polycystins, and membrane-associated proteins from cilia ([@B7]; [@B56], [@B55]; [@B50]; [@B24]; [@B58]; [@B25]; [@B57]; [@B101]). Thus the BBSome proteins have multiple effects on ciliary trafficking and in maintaining membrane composition.
Irrespective of the role of factors in the secretory pathway and in ciliary membrane biogenesis, the final critical step in ciliary trafficking is the targeting of GPCRs into cilia from the plasma membrane or juxtaciliary vesicles. A ciliary targeting sequence needs to be carefully considered because lack of ciliary localization in mutants might result from defective transit or recycling through the secretory pathway, both of which are steps distinct from direct trafficking into the compartment. Multiple sequences that target proteins to ciliary membrane have been determined ([@B23]; [@B48]; [@B6], [@B7]; [@B28]; [@B58]; [@B70]). The lack of a consensus sequence that could exclusively predict ciliary localization ([@B58]) and the multiplicity of pathways implicated in trafficking argue for multiple ways for finally targeting proteins to cilia ([@B75]). Alternatively, binding of these motifs with a few adapters that is dictated by structural elements in these varied sequences could determine trafficking into cilia.
The tubby-family proteins Tulp3 and tubby (Tub) have been implicated as adapters in trafficking of multiple GPCRs into the ciliary membrane ([@B70]; [@B86]; [@B58]). These tubby-family proteins have an N-terminal intraflagellar complex A (IFT-A) core-binding conserved helix and a C-terminal tubby domain that binds to PI(4,5)P~2~ ([@B84]; [@B69]). Disrupting either of these domains prevents trafficking of these GPCRs to cilia, suggesting that Tulp3 "bridges" the GPCRs with IFT-A core in targeting them into cilia ([@B69]). The generality of this model in targeting all cilia-localized rhodopsin-family GPCRs, the parallels between Tulp3 and Tub in ciliary trafficking, and the role of Tulp3/Tub as adapters in ciliary trafficking of other integral membrane proteins are important future directions to pursue.
In contrast to transmembrane protein trafficking to cilia, lipidated membrane-associated protein trafficking to cilia is mediated by a set of proteins that serve as carriers for the lipid modifications (Unc-119 and Pde6δ for myristolylated and prenylated proteins, respectively; [@B100]; [@B45]). The lipid-binding carriers release the lipidated cargo into cilia in an Arl3-GTP--dependent cycle in which Arl13b functions as a guanine nucleotide exchange factor for Arl3 ([@B35]). Disruption of trafficking of lipidated cargo to cilia causes profound defects in ciliary function, including disrupted Shh signaling, photodegeneration, and ciliopathies ([@B14]; [@B | {
"pile_set_name": "PubMed Central"
} |
Introduction {#section5-2042018820931664}
============
Laboratory glycated hemoglobin A1c (HbA1c) is a standard metric for the assessment of glycemic control in patients with diabetes mellitus. However, there are several limitations in the use of laboratory HbA1c for assessing glycemic control. Laboratory HbA1c could not assess hypoglycemia or glycemic variability (GV) and is easily affected by certain conditions such as renal failure, hemoglobinopathy and chronic liver disease.^[@bibr1-2042018820931664]^ Thus, estimating glycemic control by laboratory HbA1c alone may not reveal a thorough characterization of glycemic exposure for some patients, especially those with large blood glucose fluctuations in the short term and those with frequent exposure to hypoglycemia such as patients with type 1 diabetes mellitus (T1D).^[@bibr2-2042018820931664]^
Continuous glucose monitoring (CGM) has become a useful tool for assessing blood glucose levels in the last few years. It can provide more detailed and comprehensive blood glucose information *via* numerous data. The glucose metrics derived from CGM data partially compensate for the limitations of laboratory HbA1c.^[@bibr3-2042018820931664],[@bibr4-2042018820931664]^ Recently, 15 of these metrics have been recommended as key metrics by international guidelines and consensuses.^[@bibr5-2042018820931664][@bibr6-2042018820931664]--[@bibr7-2042018820931664]^ The glucose monitoring index (GMI), derived from CGM mean glucose and previously named as estimated A1C, is one of them.^[@bibr5-2042018820931664],[@bibr8-2042018820931664]^
The GMI formula was conceived using data derived from specific types of CGM sensors including Dexcom G4 and G5 (Dexcom, Inc., San Diego, CA), and mainly based on Caucasian populations.^[@bibr8-2042018820931664]^ It was well known that the accuracy of measurement varied among different types of sensors. Although GMI formula has been validated by using Guardian Sensor 3 (Medtronic Inc., CA) and Freestyle Navigator II (Abbott Diabetes Care, CA) glucose sensors,^[@bibr9-2042018820931664]^ the validation of the GMI formula for the retrospective CGM system with SOF sensor (Medtronic Minimed Inc., Northridge, CA, USA) in Asian populations is still lacking.
Moreover, previous studies have reported the discordance between GMI and laboratory HbA1c.^[@bibr8-2042018820931664][@bibr9-2042018820931664][@bibr10-2042018820931664][@bibr11-2042018820931664]--[@bibr12-2042018820931664]^ Therefore, the assessment of glycemic control based on laboratory HbA1c or GMI alone might mislead clinical decisions. The exact reasons for such a discrepancy remain unclear. Several studies have evaluated the effect of glycemic variability (GV) on the relationship between mean glucose and laboratory HbA1c, but the results were inconsistent. Most of these studies used self-monitoring of blood glucose (SMBG) data to calculate GV and mean glucose, and the results showed that GV had no or minimal effect on the relationship between mean glucose and laboratory HbA1c.^[@bibr13-2042018820931664][@bibr14-2042018820931664]--[@bibr15-2042018820931664]^ On the contrary, a study by Kuenen JC *et al*. used CGM data instead of SMBG data and found that GV influenced the association between mean glucose and laboratory HbA1c in patients with T1D, with high GV leading to a higher HbA1c level for the same mean glucose.^[@bibr16-2042018820931664]^ Given that the GMI was calculated from CGM derived mean glucose, we speculated that GV assessed by CGM data may have an impact on the relationship between GMI and laboratory HbA1c.
Therefore, the aim of this study was to validate the GMI formula using the iPro^™^2 system with SOF sensor in Chinese adult patients with T1D and to further explore the impacts of GV on the relationship between GMI and laboratory HbA1c.
Methods {#section6-2042018820931664}
=======
Study design and participants {#section7-2042018820931664}
-----------------------------
All data analyzed in the current study was extracted from an ongoing study registered on [www.clinicaltrials.gov](http://www.clinicaltrials.gov) (identifier: NCT03522870). This multicenter and randomized study was designed to evaluate the effect of a novel flash glucose monitoring system and conventional SMBG in adult patients with T1D who have inadequate glycemic control. The protocol of study design was summarized herein.
Briefly, patients with T1D aged 18 years and older were recruited. Other main inclusion criteria were duration of diabetes ⩾ 1 year, HbA1c 7--10%, treated with continuous subcutaneous insulin infusion or multiple daily injections at a stable regimen, and SMBG at least three times per day for at least 3 months prior to study entry. Key exclusion criteria included having used CGM 3 months prior to study entry, severe chronic diabetic complications or critical illness, being pregnant or planning pregnancy, or any condition that could affect impact reliability of the HbA1c measurement (hemoglobinopathy, hemolytic anemia, or chronic liver disease).
After a 2-week screening, eligible patients were randomly assigned to an intervention group of flash glucose monitoring (FGM) system (Freestyle Libre^®^; Abbott Diabetes Care, Witney, Oxon, UK) or control group of conventional SMBG (Bayer^®^; Bayer Consumer Care AG). All patients received general diabetes management education including dietary, exercise, SMBG, and insulin titration algorithms at enrollment, with reinforcement at 3- and 6-month visits. This trial was reviewed by the Ethics Committee of the Third Affiliated Hospital of Sun Yat-sen University \[Ethics Approval Number: (2017) 2-5\] and conformed to the Declaration of Helsinki. All patients gave written informed consent before the screening.
Data collection {#section8-2042018820931664}
---------------
The 14 consecutive days of subcutaneous interstitial glucose data for all subjects was obtained *via* the professional retrospective CGM (iPro^™^2, Medtronic Minimed Inc., Northridge, CA, USA) at baseline, 3 months and 6 months. During the 14 days, SMBG was performed at least four times per day using the Bayer^®^ blood glucose meter (Bayer^®^; Bayer Consumer Care AG). The SMBG data were downloaded from the respective meters and were used to calibrate CGM data. Records which contained at least 80% of glucose data during the wearing time (presented as the percentage of data collected per week) were included in the analysis.
Laboratory HbA1c was measured centrally at baseline, 3 months and 6 months by an automated analyzer (Bio-Rad D10; Bio-Rad Laboratories, Hercules, CA) using the high-performance liquid chromatography technique, with a reference range of 4.3--6.1% and intra-batch and inter-batch coefficients of variation of 0.46% and 0.99%, respectively.
Demographic and clinical characteristics including age, sex, duration of diabetes, body mass index (BMI), treatment method, and blood routine were collected at each visit by trained physicians.
For the purpose of the current analysis, CGM data and corresponding HbA1c, as well as demographic and clinical characteristics, at 3 months and 6 months were included.
CGM parameter {#section9-2042018820931664}
-------------
CGM data from iPro^™^2 sensor was downloaded *via* Carelink iPro and was calculated using Glyculator 2.0 software, which was allowed for calculation of every index of CGM recommended by the International Consensus.^[@bibr5-2042018820931664],[@bibr17-2042018820931664]^
GMI was calculated by applying CGM-derived mean glucose to the equation \[GMI (%) = 3.31 + 0.02392 × mean glucose in mg/dl\].^[@bibr8-2042018820931664]^ Hemoglobin glycation index (HGI) was calculated by subtracting the GMI from laboratory HbA1c \[HGI = laboratory HbA1c (%) -- GMI (%)\].^[@bibr18-2042018820931664]^ Absolute value of HGI was used to describe the discrepancies between the GMI and laboratory-measured HbA1c. HGI groups were determined by HGI value tertile (low HGI, \<0.07; moderate HGI, 0.07--0.45; high HGI, \>0.45), and the differences of GMI and laboratory HbA1c were compared among different HGI groups.
GV was assessed by the standard deviation (SD), glucose coefficient of variation (CV), and mean amplitude of glycemic excursions (MAGE). CV was calculated by dividing the SD by the mean of the corresponding glucose readings. MAGE algorithm was adapted from the P. Baguhrst version.^[@bibr19-2042018820931664]^ SD and MAGE were stratified according to their quartiles.
Statistical analysis {#section10-2042018820931664}
==================== | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
Diabetes Mellitus has emerged as a global burden, as World Health Organization (WHO) has estimated a prevalence of more than 300 million people by the year 2025. Diabetes is associated with a 2--4 fold increased risk for developing unstable angina and myocardial infarction (MI) with subsequent increased mortality and morbidity \[[@B1], [@B2]\]. Endothelial inflammation, dyslipidemia, fluid retention, edema are among the important factors that play a role in increasing cardiovascular risk in patients with diabetes mellitus.
PPAR agonists have several metabolic activities which can significantly affect cardiovascular risk. Rosiglitazone and pioglitazone are PPAR*γ* agonists that improve glycemic control and have been shown to exert possible cardiovascular benefits. However, recent studies have shown that rosiglitazone is associated with an increased risk of heart failure, acute MI (AMI) and death as a result of cardiovascular complications \[[@B3], [@B4]\]. PPARs belong to the nuclear receptor superfamily. They are ligand-activated transcription factors and regulate transcription of target genes by forming heterodimers with the retinoid X receptor (RXR) and binding to specific PPAR response elements (PPREs) in the promoter region of target genes \[[@B5]\]. Three receptor isoforms have been identified, PPAR*α*, PPAR*γ*, and PPAR*δ*. They mediate distinct effects on blood vessel wall, liver, adipose tissue and skeletal muscle ([Table 1](#tab1){ref-type="table"}) \[[@B6]--[@B8]\].
TZDs decrease insulin resistance, increase peripheral glucose use, reduce hepatic glucose output and as a result improve overall blood glucose control. In addition, PPAR*γ* ligands have beneficial effects on plasma lipids. Both pioglitazone and rosiglitazone increase serum levels of high-density lipoprotein (HDL) and reverse cholesterol transport. Pioglitazone also reduces plasma triglyceride levels markedly \[[@B6]--[@B9]\]. Pioglitazone has more favorable effects on triglycerides than rosiglitazone, although the clinical impact of this finding remains unclear and seems insignificant in clinical practice \[[@B10], [@B11]\]. The mechanisms underlying differential effects of pioglitazone and rosiglitazone on serum lipids may derive from different degrees of selectivity for PPAR*γ*. Rosiglitazone acts more selectively as a PPAR*γ* agonist while pioglitazone has some additional PPAR*α* agonist activity \[[@B12]--[@B14]\]. The differences between pioglitazone and rosiglitazone remain unknown, probably due to mechanisms related both to kinetic properties and pleiotropism of these molecules. Further studies are needed to better understand the mechanisms underlying differential effects of these drugs on lipid metabolism and the meaning of these effects in terms of cardiovascular prevention. PPAR "off-target" signalling remains a possibility and requires further elucidation.
2. Effects of PPAR Agonists on Cardiovascular Events {#sec2}
====================================================
Pioglitazone Effect on Regression of Intravascular Sonographic Coronary Obstruction Prospective Evaluation (PERISCOPE) was designed to compare the effects of Glimepride with pioglitazone on atherosclerosis in patients with type 2 diabetes. It showed that pioglitazone significantly lowered the rate of progression of atherosclerosis in these patients \[[@B15]\]. Similarly, the PROactive study (PROspective pioglitAzone Clinical Trial In macroVascular Events) is a large-scale prospective clinical trial examining the effects of TZDs on cardiovascular outcomes. In this placebo-controlled study of 5238 patients with type 2 diabetes and significant macrovascular disease at baseline, patients were randomized to pioglitazone-treated or placebo groups. In this study, pioglitazone significantly reduced a secondary end point (all-cause mortality, nonfatal myocardial infarction (MI), and stroke; hazard ratio, 0.84; *P* = .03) \[[@B16]\]. The pioglitazone-treated group also showed significant changes in lipid profile (increased HDL cholesterol and LDL cholesterol and decreased triglycerides). However, in PROactive study, pioglitazone increased the incidence of heart failure with a relative risk of 1.5% (*P* = .007). Hence, potential unwanted cardiac effects require caution and further rigorous clinical evaluation, because they may have masked any benefit from actions on lipid profile and inflammation. Similarly, the results of an interim analysis of the Rosiglitazone Evaluated for Cardiac Outcomes and Regulation of Glycemia in Diabetes (RECORD) study which was designed to evaluate the effect of rosiglitazone on cardiovascular morbidity and death in approximately 4500 patients showed a significant risk of heart failure (hazard ratio 2.15; with a 95% confidence interval from 1.30 to 3.57, *P* = .003) in those assigned to rosiglitazone group compared with metformin and sulfonylurea. It did not show any increase in AMI \[[@B17], [@B18]\].
Patients on TZD monotherapy as well as or in combination with other agents were at increased risk of chronic heart failure (CHF). This increased risk was identified only with rosiglitazone. A significant association with CHF risk remained for patients treated with rosiglitazone even among patients with no history of CHF. In addition, TZDs treatment, appeared to be limited to rosiglitazone, was associated with an increased risk of AMI versus users of other oral hypoglycemic agent combinations. Both rosiglitazone monotherapy and combination therapy were associated with an increased risk of death compared with other oral hypoglycemic agent combination therapies ([Figure 1](#fig1){ref-type="fig"}) \[[@B19]\]. Similarly, results from the Diabetes Outcome Progression Trial (ADOPT) showed differences in the adverse events among patients receiving monotherapy with rosiglitazone; metformin; glyburide although there was no significant difference in the overall mortality between the three groups. Rosiglitazone group was also significantly associated with edema and the use of loop diuretics than was either metformin or glyburide and higher levels of LDL cholesterol although the death rates were similar, there were other statistically significant differences in adverse outcomes within the three drugs. Rosiglitazone was significantly associated with CHF, edema and raised LDL compared to metformin and glyburide ([Figure 2](#fig2){ref-type="fig"}). Various studies compared the differences in the treatment outcomes of pioglitazone and rosiglitazone ([Table 2](#tab2){ref-type="table"}) \[[@B19]--[@B23]\]. Broadly, pioglitazone has a better overall clinical and laboratory outcome as compared to rosiglitazone. However, a common limitation was a high drop-out rate of patients in these studies.
The adverse effects of full PPAR*γ* agonists have reinforced the need to identify additional therapies that improve insulin sensitivity and treat hyperlipidemia in addition to lowering blood pressure. In this regard, several lines of clinical evidence support the use of two Angiotensin receptor blockers (ARBs), telmisartan and irbesartan, in treating hyperlipidemia and insulin resistance \[[@B24]\]. In the Ongoing Telmisartan Alone and in Combination with Ramipril Global Endpoint Trial (ONTARGET), subjects with increased risk for cardiovascular events were randomized to receive telmisartan, ramipril, or a combination of telmisartan and ramipril, while in the companion Telmisartan Randomized Assessment Study in ACE-Intolerant Subjects with Cardiovascular Disease (TRANSCEND) trial, subjects intolerant to ACE inhibitors were randomized to telmisartan or placebo \[[@B25]\]. This study included 5926 participants who were randomly assigned to telmisartan 80 mg/day (*n* = 2954) or placebo (*n* = 2972). The primary endpoint was the composite of cardiovascular death, MI, stroke or hospitalization due to heart failure. The secondary outcome excluded heart failure. Median follow-up was 56 months \[[@B26]\]. There was no difference in the primary composite endpoint of cardiovascular death, myocardial infarction, stroke, or admission to hospital for heart failure. These studies indicate that Angiotensin converting enzyme inhibitors (ACEi) will probably remain the first choice due to the greater body of supportive evidence.
3. PPAR*α* and Cardiovascular Events {#sec3}
====================================
PPAR*α* by regulating the expression of proteins involved in the transport and *β*-oxidation of free fatty acids (FFAs) plays a pivotal role in the regulation of lipid and glucose metabolism \[[@B27]\]. Fibrates, widely used to treat hypertriglyceridemia, are weak activators of PPAR*α*. They lower circulating triglyceride levels by increasing the activity of lipoprotein lipase (LPL) which hydrolyzes triglycerides \[[@B28]\]. PPAR*α* agonists increase the gene expresson of LPL and up regulate Apo A-I and A-II synthesis which are major apoproteins of the HDL fraction in the liver and resulting in increased serum HDL levels \[[@B29], [@B30]\]. Data from large clinical trials suggested that fibrates reduce cardiovascular risk, particularly in high-risk populations. In the Veterans Affairs High-Density Lipoprotein InterventionTrial (VA-HIT), gemfibrozil significantly decreased coronary heart disease (CHD) mortality by 41% as compared to those patients with diabetes mellitus receiving the standard treatment \[[@B31]\]. In the Helsinki Heart Study (HHS), gemfibrozil reduced coronary risk by 34% in the overall study population. Coronary artery disease (CAD) events occurred in 3.4% and 10.5% of gemfibrozil and placebo treated patients with diabetes, respectively, although this difference did not achieve statistical significance \[[@B32], [@B33 | {
"pile_set_name": "PubMed Central"
} |
{#sp1 .425}
{#sp2 .426}
{#sp3 .427}
{#sp4 .428}
{#sp5 .429}
{#sp6 .430}
{#sp7 .431}
{#sp8 .432}
{#sp9 .433}
{#sp10 .436}
{#sp11 .437}
{#sp12 .438}
{#sp13 .439}
{#sp14 .440}
{#sp15 .441}
{#sp16 .442}
{#sp17 .443}
{#sp18 .444}
{#sp19 .445}
{#sp20 .446}
{#sp21 .447}
{#sp22 .448}
{#sp23 .449}
{#sp24 .450}
{#sp25 .451}
{#sp26 .452}
| {
"pile_set_name": "PubMed Central"
} |
(J Am Heart Assoc. 2019;8:e011721 DOI: 10.1161/JAHA.118.011721.)30879373
Clinical PerspectiveWhat Is New?This is the first study to systematically survey known dual certified physicians in both cardiovascular disease and critical care medicine.Dual certified physicians outlined which critical care skills were most relevant to cardiovascular intensive care unit patient care, including ventilator management, multiorgan dysfunction management, and end‐of‐life care.Dual certified physicians agreed that general cardiology fellowship alone is currently insufficient to practice effectively in the modern cardiovascular intensive care units.What Are the Clinical Implications?This study has important implications regarding training guidelines and standards for future cardiovascular intensive care unit providers.Forthcoming iterations of training guidelines should incorporate the specific skills that dual certified physicians have identified as relevant to cardiovascular intensive care unit care.Many of the highlighted areas are not currently adequately covered in general cardiology fellowships and will be important educational milestones to include in all future critical care cardiology training paradigms.
Introduction {#jah33925-sec-0008}
============
There is growing evidence that cardiac intensive care units (CICUs) have evolved from coronary care observation wards into units that comprehensively care for critically ill patients with primary cardiac problems and complex multisystem illnesses. The American Heart Association released a scientific statement in 2012 detailing the need for CICUs with dedicated critical care cardiologists as well as potential shifts in training strategies for aspiring CICU physicians.[1](#jah33925-bib-0001){ref-type="ref"} The American Heart Association statement outlines the existing Accreditation Council for Graduate Medical Education training paradigm, which includes 4 years of fellowship with a minimum of 30 months of clinical training, 6 of which must be dedicated to critical care medicine (CCM). The American College of Cardiology Core Cardiovascular Training Statement Task Force has also recognized the need for advanced training opportunities, describing 3 levels of critical care cardiology proficiency.[2](#jah33925-bib-0002){ref-type="ref"} The Task Force specifies that level I should be obtained during a general cardiology fellowship and should be sufficient to care for the majority of CICU patients. Level II can be achieved with an extra 3 to 6 months of critical care time and level III with an extra 12 months of critical care time. The Task Force only highlights endotracheal intubation and intra‐aortic balloon pump placement as patient care milestones and no evaluation processes are specified, indicating that competencies for the practice of advanced critical care cardiology need to be further delineated.
There have been numerous publications, aiming to characterize the added value of critical care cardiology training. CICU providers are exposed to an increasing amount of noncardiac pathology, including sepsis, renal failure, and respiratory failure requiring prolonged mechanical ventilation.[3](#jah33925-bib-0003){ref-type="ref"}, [4](#jah33925-bib-0004){ref-type="ref"}, [5](#jah33925-bib-0005){ref-type="ref"}, [6](#jah33925-bib-0006){ref-type="ref"}, [7](#jah33925-bib-0007){ref-type="ref"}, [8](#jah33925-bib-0008){ref-type="ref"} Moreover, patients with these noncardiac complications have longer CICU lengths of stay and a higher risk of mortality.[6](#jah33925-bib-0006){ref-type="ref"} Transitioning to a high‐intensity staffing model, which incorporates dedicated critical care cardiologists or regular consultation with CICU‐based noncardiology critical care physicians may be associated with reduced mortality, length of stay, and costs.[9](#jah33925-bib-0009){ref-type="ref"}, [10](#jah33925-bib-0010){ref-type="ref"} However, dual trained critical care cardiologists remain few in number, with a recent survey identifying only 8.7% of hospitals utilizing them as unit leaders and only 14.7% of hospitals with at least 1 critical care cardiology attending.[11](#jah33925-bib-0011){ref-type="ref"} Similarly, an investigation of the Doximity physician database reported that only 0.47% of CICU admissions were treated by dual certified physicians and that only 3.4% of the identified dual certified physicians were female.[12](#jah33925-bib-0012){ref-type="ref"} Despite these data, the perceived priority of fostering critical care trained cardiologists remains a topic of debate, prompting numerous letters and editorials.[13](#jah33925-bib-0013){ref-type="ref"}, [14](#jah33925-bib-0014){ref-type="ref"}, [15](#jah33925-bib-0015){ref-type="ref"}
Though numerous studies have described the current organizational structure and staffing of modern‐day CICUs, no previous study has systematically surveyed practitioners with American Board of Internal Medicine certification in both cardiovascular disease (CVD) and CCM. Thus, we sought to better understand how these American Board of Internal Medicine dual certified critical care cardiologists have utilized their training, and how they fit into the evolving critical care landscape.
Methods {#jah33925-sec-0009}
=======
This research activity was designated exempt from institutional review board review by the Office for Human Research Protections at the National Institutes of Health. The original survey is available within [Data S1](#jah33925-sup-0001){ref-type="supplementary-material"}. The data that support the findings of this study are available from the corresponding author upon reasonable request.
Through 2014, the American Board of Internal Medicine granted initial certification in both CVD and CCM to 563 physicians. After excluding 5 deceased physicians, 4 physicians under disciplinary action, 21 physicians retired or without valid medical licenses, and 136 physicians without registered e‐mails, the analysis sample of 397 physicians remained (Figure [1](#jah33925-fig-0001){ref-type="fig"}). A questionnaire to delineate the role of additional critical care training in the setting of cardiology training was provided to these dual certified physicians by e‐mail invitation, using REDCap (Research Electronic Data Capture) data capture tools hosted at University of California San Francisco.[16](#jah33925-bib-0016){ref-type="ref"} REDCap is a secure, web‐based application designed to support data capture for research studies, incorporating data entry, auditing, and import/export procedures.
{#jah33925-fig-0001}
Survey data were augmented with key American Board of Internal Medicine administrative data. Variables derived from the administrative data included practice location, age, gender, an indicator variable for passing both CVD and CCM initial certification exams on the first attempt, and an indicator variable for obtaining CCM certification through the practice pathway. CCM certification through the practice pathway was possible during the first 3 years of exam administration: 1987, 1989, and 1991. No fellowship training in critical care medicine was required as long as applicants documented that they were currently providing critical care, and they had previously certified in internal medicine. Because these practice pathway physicians and those having completed fellowship training in CCM potentially represent distinct groups with divergent training and unique insight, they were separated for a subgroup analysis. We used chi‐square tests to examine whether responders differed from nonresponders in regard to demographic variables (Table [1](#jah33925-tbl-0001){ref-type="table"}). To adjust for possible nonresponse bias, we used propensity score weighting with poststratification.[17](#jah33925-bib-0017){ref-type="ref"} Subjects were assigned a poststratification weight after being divided into quintiles based on estimated propensity scores. Estimated propensity scores were computed with a logistic regression model containing an indicator variable for survey response as the outcome, along with practice location, age, gender, an indicator variable for passing both CVD and CCM initial certification exams on the first attempt, and an indicator variable for obtaining CCM certification through the practice pathway as predictors. Descriptive statistics of survey results were reported based on the calculated propensity score weights. Analyses were conducted using SAS software (version 9.4; SAS Institute Inc, Cary, NC).
######
Demographic Data of Survey Responders Compared to Non‐Responders
Characteristics Nonresponder (N=277) Responder (N=120) *P* Value (Responder vs Nonresponder)
-------------------------------------------------------------------------------------------------- ---------------------- ------------------- ---------------------------------------
Certified CCM through practice pathway, N (%)[a](#jah33925-note-0004){ref-type="fn"} 196 (70.8) 77 (64.2) 0.193
Age (y), N (%)[a](#jah33925-note-0004){ref-type="fn"} 0.030
\<50 17 (6.1) 17 (14.2)
50 to 59 41 (14.8) 20 (16.7)
60 to 69 180 (65. | {
"pile_set_name": "PubMed Central"
} |
**Suggested citation:** EFSA FEEDAP Panel (EFSA Panel on Additives and Products or Substances used in Animal Feed) , Bampidis V, Azimonti G, Bastos ML, Christensen H, Dusemund B, Kos Durjava M, Kouba M, López‐Alonso M, López Puente S, Marcon F, Mayo B, Pechová A, Petkova M, Ramos F, Sanz Y, Villa RE, Woutersen R, Gropp J, Rychen G, Holczknecht O and Vettori MV, 2020 Scientific Opinion on the efficacy of Cygro^®^ 10G (maduramicin ammonium‐α) for turkeys. EFSA Journal 2020;18(4):6079, 7 pp. 10.2903/j.efsa.2020.6079
**Requestor:** European Commission
**Question number:** EFSA‐Q‐2019‐00035
**Panel members:** Giovanna Azimonti, Vasileios Bampidis, Maria de Lourdes Bastos, Henrik Christensen, Birgit Dusemund, Maryline Kouba, Mojca Kos Durjava, Marta López‐Alonso, Secundino López Puente, Francesca Marcon, Baltasar Mayo, Alena Pechová, Mariana Petkova, Fernando Ramos, Yolanda Sanz, Roberto Edoardo Villa and Ruud Woutersen.
**Acknowledgments:** The Panel wishes to acknowledge the contribution of Montserrat Anguita and Jaume Galobart to this opinion.
Adopted: 19 March 2020
1. Introduction {#efs26079-sec-0002}
===============
1.1. Background and Terms of Reference as provided by the requestor {#efs26079-sec-0003}
-------------------------------------------------------------------
Regulation (EC) No 1831/2003 establishes rules governing the Community authorisation of additives for animal nutrition and, in particular, Article 9 defines the terms of the authorisation by the Commission.
The applicant, Zoetis Belgium SA, is seeking a Community authorisation of maduramicin ammonium to be used as a coccidiostats and histomonostats in turkeys (Table [1](#efs26079-tbl-0001){ref-type="table"}).
######
Description of the substances
---------------------------------- ----------------------------------
**Category of additive** Coccidiostats and histomonostats
**Functional group of additive** Coccidiostats and histomonostats
**Description** Maduramicin ammonium
**Target animal category** turkeys
**Applicant** Zoetis Belgium S.A.
**Type of request** New opinion
---------------------------------- ----------------------------------
John Wiley & Sons, Ltd
On 28 January 2015, the Panel on Additives and Products or Substances used in Animal Feed of the European Food Safety Authority ('Authority'), in its opinion on the safety and efficacy of the product (EFSA FEEDAP Panel, [2015](#efs26079-bib-0001){ref-type="ref"}), considered that based on the recent studies (floor pen studies, field studies and sensitivity studies), the efficacy of maduramicin ammonium in turkeys for fattening has not been sufficiently demonstrated.
The Commission gave the possibility to the applicant to submit complementary information in order to complete the assessment and to allow a revision of Authority\'s opinion. The new data have been sent to EFSA and Commission on 19 December 2018.
In view of the above, the Commission asks the Authority to deliver a new opinion of maduramicin ammonium as a coccidiostat and histomonostat in turkeys based on the additional data submitted by the applicant.
1.2. Additional information {#efs26079-sec-0004}
---------------------------
The FEEDAP Panel issued an opinion on the safety and efficacy of Cygro^®^ 10G (maduramicin ammonium‐α) when used as a coccidiostat in turkeys (EFSA FEEDAP Panel, [2015](#efs26079-bib-0001){ref-type="ref"}). In this opinion, the FEEDAP Panel was not able to conclude on the efficacy of the additive for turkeys for fattening based on the available studies.
2. Data and methodologies {#efs26079-sec-0005}
=========================
2.1. Data {#efs26079-sec-0006}
---------
The present assessment is based on data submitted by the applicant in the form of additional information[1](#efs26079-note-1005){ref-type="fn"} to a previous application of the same product.[2](#efs26079-note-1006){ref-type="fn"}
2.2. Methodologies {#efs26079-sec-0007}
------------------
The approach followed by the FEEDAP Panel to assess the efficacy of Cygro^®^ 10G (maduramicin ammonium‐α) is in line with the principles laid down in Regulation (EC) No 429/2008[3](#efs26079-note-1007){ref-type="fn"} and the relevant guidance document: Guidance on the assessment of the efficacy of feed additives (EFSA FEEDAP Panel, [2018](#efs26079-bib-0002){ref-type="ref"}).
3. Assessment {#efs26079-sec-0008}
=============
The additive Cygro^®^ 10G is a preparation of the polyether ionophore maduramicin ammonium‐α (Maα) produced by fermentation of *Actinomadura yumaensis* NRRL 12515. The additive is intended for the control of coccidiosis in turkeys for fattening (up to 16 weeks of age) at a concentration of 5 mg/kg complete feed with a withdrawal period of four days.
In the previous opinion, the FEEDAP Panel could not conclude on the efficacy of the additive because of a series of limitations in the floor pen trials, field studies and anticoccidial sensitivity tests (EFSA FEEDAP Panel, [2015](#efs26079-bib-0001){ref-type="ref"}). The applicant submitted additional data to address the limitations identified by the Panel.
3.1. Efficacy {#efs26079-sec-0009}
-------------
### 3.1.1. Floor pen studies {#efs26079-sec-0010}
The applicant re‐submitted the four studies[4](#efs26079-note-1008){ref-type="fn"} assessed by the FEEDAP Panel in 2015 (EFSA FEEDAP Panel, [2015](#efs26079-bib-0001){ref-type="ref"}). Two out of the four studies assessed (trial 1 and trial 3) did not show improvement in any of the specific endpoints (e.g. lesion/faecal score, oocyst excretion, morbidity, coccidiosis‐related mortality); therefore, these studies cannot be considered as positive for the demonstration of the coccidiostatic efficacy of Cygro^®^ 10G. The remaining trials (2 and 4) were re‐considered in light of the current requirements with regard the specific endpoints (Guidance on the assessment of the efficacy of feed additives, EFSA FEEDAP Panel, [2018](#efs26079-bib-0002){ref-type="ref"}). Both trials were described in detail in the former opinion (EFSA FEEDAP Panel, [2015](#efs26079-bib-0001){ref-type="ref"}).
With regard to the specific endpoints, in trial 2, the oocyst excretion showed a significant improvement in the infected treated (IT) group with respect to the infected untreated control (IUC) group (88,833 vs. 250,066) during the period of days 15--28. In absence of the raw data and the statistical output, this result could not be verified by the Panel.[5](#efs26079-note-1009){ref-type="fn"} Considering this limitation and also the fact that the study was conducted in 2009, Trial 2 cannot be used for the demonstration of efficacy.
In trial 4, the Panel also noted significant improvement by the treatment on the oocyst excretion (47,895 of IT vs. 121,127 of IUC) on day 21 and also at days 35, 42, 49, 56, 98 and 105. The results could be verified by checking the raw data and the statistical output which was made available.[6](#efs26079-note-1010){ref-type="fn"} However, the Panel noted a high mortality rate in the untreated uninfected (UUC) group (6 birds, corresponding to 10%) similar to the level of the IUC group (7 birds, corresponding to 11.9%) and the highest being in the IT group (11 birds corresponding to 18.3%). This high mortality was mainly due to non‐coccidiosis related causes therefore the Panel considers that Trial 4 cannot be used for the demonstration of efficacy.
### 3.1.2. Anticoccidial sensitivity tests {#efs26079-sec-0011}
The applicant submitted in total six anticoccidial sensitivity tests (ASTs), three of them performed in 2012[7](#efs26079-note-1011){ref-type="fn"} and three in 2018.[8](#efs26079-note-1012){ref-type | {
"pile_set_name": "PubMed Central"
} |
1. Introduction
===============
Recently, there has been a growing movement away from the use of synthetic antioxidants and toward the use of natural antioxidants. This trend is thought to be due to the adverse effects of synthetic antioxidants like butylated hydroxyanisole (BHA) and butylated hydroxytoluene (BHT) on human health \[[@B1-molecules-18-07004],[@B2-molecules-18-07004]\]. As a result, it is interesting and meaningful to discover effective antioxidants from natural sources for food industrial, pharmaceutical and cosmetic use although they may not be comparable in efficiency to synthetic agents.
*Morinda citrifolia* (Rubiaceae), also known as noni, originated in tropical Asia or Polynesia \[[@B3-molecules-18-07004]\]. The roots, stems, bark, leaves, flowers and fruits of *M. citrifolia* have been traditionally used as a folk remedy to treat diseases such as diabetes, hypertension and cancer \[[@B4-molecules-18-07004]\]. With the profound nutritional and functional properties of *M. citrifolia*, its fruits are now commercialized as "noni juice". These beneficial effects were currently believed to be linked to the fact that *M. citrifolia* is rich in phytochemicals and particularly in phenolic compounds. Recently, several novel bioactive compounds such as flavonol glycosides, iridoid glycosides and anthraquinones have been identified in the fruits of *M. citrifolia* \[[@B4-molecules-18-07004],[@B5-molecules-18-07004]\].
Extraction is a very important stage in the recovery of bioactive compounds from natural samples, where extraction procedures must be versatile, relatively simple, inexpensive and able to both preserve and extract most of the bioactive compounds present in a plant matrix. However, there is no generalised extraction procedure that is applicable to all phenolic compounds; plant materials have diverse structures and extraction procedures can interact with other components of the plant matrix \[[@B6-molecules-18-07004],[@B7-molecules-18-07004]\]. In addition, the extractability of phenolic compounds and their antioxidant capacities also affected by other factors including solvent composition, extraction time, extraction temperature, pH, solvent to solid ratio and the number of extraction steps \[[@B8-molecules-18-07004],[@B9-molecules-18-07004],[@B10-molecules-18-07004]\]. Thus, extraction procedures for phenolic compounds from *M. citrifolia* must be optimised.
To the best of our knowledge and the literature search, it was revealed that only a few scientific studies has been undertaken to evaluate *M. citrifolia* to its value for the phenolics extraction. Therefore, current study was designed and undertaken to optimise extraction conditions for phenolic compounds from *M. citrifolia* to confirm and provide scientific basis on the effects of ethanol concentration, extraction time and extraction temperature as well as optimised conditions prior its incorporation into food materials.
2. Results and Discussion
=========================
2.1. Model Fitting
------------------
The responses consisting of TPC, TFC, ABTS and DPPH radical-scavenging capacities for *M. citrifolia* extract by using solvent extraction were optimised based on the central composite rotatable design (CCRD). A second-order regression equation (Equation 1) was employed to fit the experimental data, while the regression coefficients for the intercept, linear, quadratic and interaction terms of the model were statistically analysed for analysis of variance (ANOVA); the results of these analyses are shown in [Table 1](#molecules-18-07004-t001){ref-type="table"} and [Table 2](#molecules-18-07004-t002){ref-type="table"}: where *X~1~*, *X~2~*,..., *X~k~* corresponds to the independent variables affecting *Y* (namely ethanol concentration, extraction time and extraction temperature) and *β~0~*, *β~i~* (*i*= 1, 2,..., *k*;), *β~ii~* (*i*= 1, 2,..., *k*; *j*= 1,2,..., *k*) values represent the regression coefficients for intercept, linear, quadratic and interaction terms, respectively. Lastly, *k* is the number of variables. Using the determined regression coefficients, four full second-order regression equations for the concentrations of TPC (*Y~1~*), TFC (*Y~2~*), ABTS (*Y~3~*) and DPPH (*Y~4~*) were established:
In Equations (2--5), *X~1~*, *X~2~* and *X~3~* correspond to the coded values of the three independent variables of ethanol concentration, extraction time and extraction temperature, respectively. Reduced second-order regression models for the four responses using significant terms for ethanol concentration (*X~1~*), extraction time (*X~2~*) and extraction temperature (*X~3~*) were as follows:
molecules-18-07004-t001_Table 1
######
Estimated regression coefficients of the second-order polynomial model for three dependent variables of mengkudu (*Morinda citrifolia*) crude extract.
Independent Variables Regression coefficients
-------------------------------- ------------------------- ----------- -- ----------- -----------
Intercept, *X*~0~ 930.00 923.18 513.97 513.77
Linear
*X*~1~, Ethanol concentration −32.05 \* −32.05 \* 75.63 \* 75.63 \*
*X*~2~, Extraction time −8.52 \- −8.45 −8.45
*X*~3~, Extraction temperature 46.87\* 46.87\* 43.96 \* 43.96 \*
Quadratic
*X*~1~^2^ −56.47 \* −55.64 \* −57.54 \* −57.51 \*
*X*~2~^2^ 0.79 \- 19.75 \* 19.78 \*
*X*~3~^2^ −9.89 \- −0.24 \-
Interaction
*X*~12~ −11.71 \- 4.08 \-
*X*~13~ −11.12 \- −21.17 −21.17 \*
*X*~23~ 25.55 \- −8.15 \-
Model
F value 6.02 17.05 23.87 43.14
*p* value 0.0067 \<0.0001 \<0.0001 \<0.0001
Lack of fit
F value 0.99 0.93 2.27 1.61
*p* value 0.5177 0.5840 0.2239 0.3391
Mean 879.62 879.62 480.49 480.49
Standard deviation 42.79 41.82 27.89 25.35
R^2^ 0.8576 0.7732 0.9598 0.9557
Adjusted R^2^ 0.7151 0.7279 0.9196 0.9335
CV 4.86 4.75 5.80 5.28
^a^ Total phenolic content (TPC) (mg GAE/100g dry weight, DW). ^b^ Total flavonoid content (TFC) (mg CE/100 g dry weight, DW). \* Significant at 0.05 level.
For the fitted model, the model coefficients, *F*-values and *p*-values demonstrate the significance of the experimental variables. The *p-*values were used to verify the significance of the coefficients in order to understand the mutual interactions pattern between the independent variables \[[@B11-molecules-18-07004]\]. The high *F*-value (*F*~model~ = 6.02 − 43.14) with a low probability value for the models (*p* \< 0.01) justifies the significance of each independent variables in the fitted models. [Table 1](#molecules-18-07004-t001){ref-type="table"} and [Table 2](#molecules-18-07004-t002){ref-type="table"} show that both the full and reduced second-oder regression models were highly significant (*p* \< 0.01) and the lack-of-fits were insignificant (*p* \> 0.05). These findings suggest that the models contain one or more important terms and do not suffer from lack-of-fits, that give excellent agreement between experimental and predicted values \[[@B12-molecules-18-07004]\]. However, this is not conclusive evidence that the models accurately represent the data in the experimental region. Coefficients of determination (R^2^), or the ratios of the explained variation to the total variation, serve as a good measurement of the models' overall performance. The R^2^ in the present study were observed to be 0.8596, 0.9598, 0.9583 and 0.9497 for TPC, TFC, ABTS and DPPH, respectively, in the full model; the R^2^ were 0.7732, 0.9557, 0. | {
"pile_set_name": "PubMed Central"
} |
**Session:** 250. HAI: *C. difficile* - Diagnostic Testing
*Saturday, October 5, 2019: 12:15 PM*
| {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION
============
Chronic kidney disease (CKD) is a well-known risk factor for cardiovascular disease and mortality.[@B1] CKD caused by nephrectomy may increase mortality by inducing cardiovascular disease; thus, to preserve kidney function, partial nephrectomy (PN) has become the standard surgical care for small renal masses.[@B2][@B3][@B4][@B5] However, the benefits of partial versus radical nephrectomy (RN) are still under debate, particularly as they relate to the survival advantage of PN.[@B6][@B7][@B8][@B9][@B10][@B11][@B12][@B13][@B14][@B15]
PN is the preferred treatment modality for renal cell carcinoma (RCC) in patients with pre-existing CKD, when technically feasible. However, little is known about differences in overall survival (OS) and postoperative renal function between patients undergoing RN and PN for the treatment of RCC in patients with pre-existing CKD. To address this gap in the literature, we evaluated the impact of PN over RN on survival rate and kidney function in patients with stage III CKD.
METHODS
=======
Study population
----------------
We retrospectively collected data from 5,916 patients who underwent RN or PN for localized RCC from January 1988 through December 2014 at eight institutions in Korea.[@B16] After excluding 1,584 patients with solitary kidney, bilateral RCC, stage pT3 or greater, lymph node or distant metastases, preoperative hemodialysis, or pre-existing stage IV CKD (estimated glomerular filtration rate \[eGFR\] \< 30 mL/min/1.73 m^2^) and those with missing preoperative kidney function records, we finally analyzed 4,332 patients who underwent PN or RN for pathological T1a-T2N0M0 RCC in this study. To evaluate the effects of PN on survival rate according to CKD stage, we divided patients into two subgroups: CKD I--II (eGFR ≥ 60 mL/min/1.73 m^2^) and CKD III (30 ≤ eGFR \< 60 mL/min/1.73 m^2^). Data included age, sex, body mass index (BMI), preoperative nutritional status (albumin and hemoglobin levels), comorbidities (diabetes and hypertension), American Society of Anesthesiologists (ASA) score, tumor size, pathologic stage, Fuhrman grade, tumor histology, and preoperative kidney function (eGFR).
Primary outcomes
----------------
The primary outcome was difference in postoperative kidney function and OS between the PN and RN arm according to baseline kidney function. OS was calculated by death from any cause after surgery. Cancer-specific survival (CSS) was assessed by the cancer-related death rate. Data regarding death and the cause were obtained from the database of every participating center and updated by the office for Korean National Statistics. The follow-up period was calculated from the date of surgery to the date of the last known contact with the patient or the date of death. To assess the longitudinal change in kidney function after nephrectomy, serial serum creatinine data were collected annually for each patient. The eGFR was calculated using the Modification of Diet in Renal Disease equation.[@B17]
Statistical analysis
--------------------
Differences between groups of patients receiving PN and RN in baseline clinical and pathological characteristics were compared using the Mann-Whitney test for continuous variables and the χ^2^ test for categorical variables. To reduce the impact of treatment selection bias, we performed rigorous adjustment for significant differences in characteristics of patients by use of the propensity score. Patients were pair-matched by age, sex, BMI, preoperative nutritional status (albumin and hemoglobin levels), comorbidities (diabetes and hypertension), ASA score, tumor size, pathologic stage, Fuhrman grade, tumor histology, and preoperative kidney function (eGFR). OS and CSS were estimated by the Kaplan-Meier method and compared by the log-rank test. OS represents the time from surgery to death from any cause. CSS represents the time from surgery to death by cancer. Cox proportional hazards regression models were used to assess the relation of surgery type with survival rate or new onset of stage IV CKD. In the descriptive analyses of kidney function, the mean eGFR in each group was evaluated separately and plotted against each follow-up point. Probabilities of freedom from new onset of stage IV CKD after nephrectomy were also compared using Kaplan-Meier plots. To study the relationship between nephrectomy type and repeated longitudinal measurements of eGFR, and to obtain the slope of the kidney function decline over time and reliable confidence intervals (CIs) of nephrectomy type effects on the renal function trajectory, linear mixed models (with random intercepts and slopes specific to each participant) were used. We calculated a separate regression line with time slopes to compare the differences in the slopes of eGFR decline according to the nephrectomy type. Two-sided tests were performed, and *P* values \< 0.05 were considered statistically significant. All statistical analyses were conducted using the Statistical Package for the Social Sciences (SPSS version 24.0; IBM, Chicago, IL, USA).
Ethics statement
----------------
This study was approved by the Institutional Review Board (IRB) of Seoul National University Bundang Hospital (B-1202/145-102) and each participating institution.
RESULTS
=======
Patient demographic and clinical characteristics
------------------------------------------------
[Table 1](#T1){ref-type="table"} shows the baseline characteristics of patients. Before propensity matching analysis, there were significant differences in tumor size, diabetes distribution ratio, Fuhrman grade, pathologic stage, and tumor histology type between RN and PN arms. These differences were eliminated by matching. In the CKD I--II group, 878 RN patients were matched with 878 PN patients. The median pre-eGFRs were 77.1 and 78.7 mL/min/1.73 m^2^ in each arm (RN vs. PN), respectively. The median follow-up durations in the RN and PN arms were 52 (interquartile range \[IQR\], 18--81) and 43 (IQR, 12--62) months, respectively. In the CKD III group, 138 RN patients were matched with 138 PN patients. The median pre-eGFRs were 54.1 and 53.8 mL/min/1.73 m^2^ in each arm (RN vs. PN), respectively. The median follow-up durations in the RN and PN arms were 56 (IQR, 18--78) and 52 (IQR, 20--72) months, respectively.
###### Baseline characteristics of patients who underwent PN or RN after propensity score matching
Variables CKD I--II CKD III
---------------------------- ------------------- ------------------- ------------ ------------------- ------------------- -------
No. of patients 878 878 138 138
Age, yr 54 (45--63) 54 (45--62) 0.753 66 (55--71) 65 (56--71) 0.878
BMI, kg/m^2^ 24.2 (22.2--26.4) 24.3 (22.2--26.4) 0.119 24.8 (23.1--26.8) 24.7 (22.8--26.6) 0.535
Sex 0.715 0.097
Male 612 (69.7) 619 (70.5) 99 (71.7) 85 (61.6)
Female 266 (30.3) 259 (29.5) 39 (28.3) 53 (38.4)
Diabetes 0.471 0.778
No 773 (88.0) 763 (86.9) 106 (76.8) 104 (75.4)
Yes 105 (12.0) 115 (13.1) 32 (23.2) 34 (24.6)
Hypertension 0.505 0.715
No 606 (69.0) 593 (67.5) 57 (41.3) 60 (43.5)
Yes 272 (31.0) 285 (32.5) 81 (58.7) 78 (56.5)
Tumor size, mm 32.0 (25.0--40.0) 33.0 (25.0--40.0) 0.892 30.0 (22.0--36.5) 30.0 (22.0--36.5) 0.938
ASA score 0.774 0.483
1 427 (48.6) 413 (47.0) 37 (26.8) 42 (30.4)
2 42.4 (48.3) 439 (50.0) 87 (63.0) 77 (55.8)
3 27 (3.1) 26 (3.0) 12 (8.7) 18 (13.0)
4 0 (0.0) 0 (0.0) 2 (1.4) 1 (0.7)
Fuhrman grade 0.841 0.895
Grade I 85 (9.7) 81 (9.2) 19 (6.5) 7 (5.1 | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Although atherosclerosis is a systemic disease and the circulatory system is uniformly exposed to risk factors such as hyperglycemia and hypercholesterolemia, plaque development varies between vascular sites. For decades, clinicians have noted such heterogeneity of presentation,^[@b1]^ and researchers have shown distinct risk factor profiles for arterial beds.^[@b2]^ We have previously demonstrated variable disease development of atherosclerosis in diabetic/hypercholesterolemic (DM/HC) pigs with severe, high‐risk lesion development in the coronary arteries (CORs), less severe disease in the thoracic aorta, and minimal disease in the carotid arteries.^[@b3]^ Extensive atherosclerosis in the distal abdominal aortas (AAs) extending into the proximal iliac vessels has also been reported in these animals.^[@b4]^ The cause of such variable site‐specific disease development, observed in both humans and DM/HC pigs, is unclear but clinically important.
Lipoprotein‐associated phospholipase A~2~ (Lp‐PLA~2~) is a potential target for atherosclerosis treatment.^[@b5]^ An enzyme secreted by inflammatory cells, it generates the proinflammatory mediators lysophosphatidylcholine and oxidized nonesterified fatty acids from oxidized low‐density lipoprotein within the arterial wall.^[@b6]^ We previously showed that selective inhibition of Lp‐PLA~2~ with darapladib reduced the development of high‐risk COR atherosclerotic plaques in a DM/HC pig model,^[@b7]^ and The Stabilization of Atherosclerotic Plaque by Initiation of Darapladib Therapy Trial (STABILITY) has shown that darapladib significantly reduced the risk of the secondary end points of major coronary events and total coronary events in patients with stable coronary heart disease, although it failed to demonstrate significant reductions in the risk of the primary end point of cardiovascular death, myocardial infarction, and stroke.^[@b8]^ In the current study, we addressed the question of whether the mechanism of atherosclerosis in 2 areas of extensive lesion development―the CORs and the distal AAs―differed with regard to inflammatory pathways, specifically those using Lp‐PLA~2~. We assessed differences in plaque development by comparing plaque severity, macrophage infiltration, and inflammatory gene expression profiles caused by DM/HC induction between the CORs and AAs. In addition, we assessed for differences in the role of Lp‐PLA~2~ in plaque development and gene expression by analyzing differences in response to darapladib treatment between the CORs and AAs.
Methods
=======
Animals and Experimental Protocol
---------------------------------
The DM/HC porcine model has been previously described.^[@b3],[@b7]^ Briefly, 37 male Yorkshire domestic pigs weighing 20 to 25 kg (Archer Farms) were made DM/HC with 3 healthy pigs serving as controls (non‐DM/HC control). DM was induced by 125 mg/kg of intravenous streptozotocin (Sicor Pharmaceuticals), and exogenous insulin was administered via a sliding scale for blood glucose levels \>350 mg/dL to avoid ketoacidosis. Hypercholesterolemia was induced with a hyperlipidemic diet containing 0.5% cholesterol, 10% lard, and 1.5% sodium cholate (Animal Specialties) to achieve a target cholesterol level of 400 to 800 mg/dL. Four weeks after DM/HC induction, pigs were randomly assigned into a control group (DM/HC control, n=17) or a treatment group (DM/HC darapladib, n=20) receiving 10 mg/kg/d orally of the selective Lp‐PLA~2~ inhibitor darapladib (SB480848; GlaxoSmithKline). Twenty‐eight weeks after DM/HC induction (24 weeks from treatment), pigs were killed (Eutasol; Virbac AH) and tissue was harvested for analysis. A distal section of AA including the proximal iliac and the right CORs were processed for gene expression. Following fixation with formaldehyde, the remaining distal AA underwent magnetic resonance imaging (MRI). Then, the tissue was processed for histologic and immunohistochemical analyses. The left anterior descending coronary artery was used for the analyses. Glucose and cholesterol levels for each animal were measured monthly for the duration of the study and were plotted over time. The cumulative total plasma glucose or cholesterol level was determined by calculating the area under the curve for the respective levels for each animal. All studies were approved by the University of Pennsylvania Animal Care and Use Committee. These experiments are a further analysis derived from the 40 pigs from which only the coronary data were published.^[@b7]^ In the current experiment, the magnitude of effect of DM/HC induction and darapladib treatment on the AAs is compared with the magnitude of effect of DM/HC induction and darapladib treatment on the CORs. Further details of the methods have been previously published.^[@b7]^
Histologic and Immunohistochemical Evaluation
---------------------------------------------
Arteries were cut into 5‐mm sections and embedded in paraffin. Histologic sections were stained with Movat\'s pentachrome and analyzed with the use of Image Pro 6.2 software (MediaCybernetics). Morphometric analysis of all arterial sections was performed to determine lesion area, area of calcification, necrotic core area, presence of intraplaque hemorrhage, medial destruction, and lesion classification as previously described.^[@b7]^ The normalized plaque area, defined as the ratio of the lesion area to medial area, was used to adjust to compare arteries of different sizes. The normalized calcification area was defined as the ratio of the calcification area to lesion area of the most severe lesion, and the normalized necrotic core area was defined as the ratio of the necrotic core area to lesion area of the most severe lesion. Each section was classified by using the modified American Heart Association (AHA)/Virmani score (0=no disease, 1=intimal thickening, 2=intimal xanthoma, 3=pathologic intimal thickening, 4=fibrous cap atheroma, and 5=thin fibrous cap atheroma)^[@b9]^ with the maximum AHA score of the artery used for analysis. The maximum medial destruction score was determined using the following scale from 0 to 4: 0=normal, 1=internal elastic lamina disrupted, 2=destruction of \<50% of the medial thickness, 3=destruction of \>50% of the medial thickness, and 4=destruction of \>50% of the medial thickness along with disruption of the external elastic lamina.^[@b7]^ Intraplaque hemorrhage was identified by the presence of extravasated red blood cells outside of the vasa vasorum.^[@b9]^ Adjacent sections of the AAs and CORs were stained with a goat polyclonal cathepsin S antibody (Santa Cruz Biotechnology Inc) for inflammatory cells with augmented protease activity, mostly macrophages, as previously described.^[@b7]^ The normalized macrophage area was defined by the ratio of cathepsin S staining area divided by the lesion area of the most severe lesion.
Gene Expression Using Quantitative Real‐Time Polymerase Chain Reaction
----------------------------------------------------------------------
The details for the gene expression analysis have been previously published.^[@b7]^ Briefly, a Taqman plate was constructed using 87 genes shown to be expressed in human atherosclerotic plaque^[@b10]^ that have pig orthologs (see Table S1 for sequences). The effect of DM/HC induction on gene expression was analyzed by comparing the non‐DM/HC control group (n=3) with the DM/HC control group (n=17). The effect of darapladib treatment on gene expression was analyzed by comparing the DM/HC control group (n=17) with the DM/HC darapladib group (n=20). Whole minced arteries were homogenized on ice in Trizol reagent (Sigma). Total RNA was extracted, purified, and, after on‐column DNase treatment, eluted with RNase‐free water. Genomic DNA contamination was removed with DNase I (Ambion). Quantification of the RNA was performed and converted to cDNA via reverse transcription. TaqMan gene expression data were analyzed on the basis of normalized expression values, by using scaled geometric mean of selected reference genes for the normalization factor calculations.
Ex Vivo MRI
-----------
The distal AAs were placed in 0.2% gadopentetate dimeglumine--doped water solution, and imaging was performed with a 9.4‐T μ‐imaging system (Bruker). A gradient echo coronal scout image to properly orient the axial high‐resolution T2‐weighted images had the following parameters: TE/TR=4.2/137 ms, 256×256 matrix, excitations=1, field of view=4 cm, slice width=50 kHz, flip angle=30°, 10 slices, 1‐mm slice thickness. Once the scout image was acquired, a T2‐weighted spin echo image was acquired in the axial plane with the following parameters: TE/TR=40/2000 ms, slice width=50 kHz, 256×256 matrix, excitations=16, field of view=1.6 cm, 20 slices, 1‐mm slice thickness.
Statistical Analysis
--------------------
To assess for site‐specific effects of DM/HC induction on plaque severity and macrophage infiltration, the effect size of DM/HC induction on the CORs was compared with the effect size on the AAs among the 17 DM/HC pigs. As appropriate for the data type and sample distributions, paired‐response or mixed‐model analysis methods were used to allow each animal to serve as its own control. The paired analysis approach was used for all the categorical responses (fibroatheroma, intraplaque hemorrhage, AHA score, and medial destruction score) with a signed rank comparison for the paired difference of the artery responses. The paired analysis approach was also used for the continuous response values that did not have normal distributions (normalized calcification area | {
"pile_set_name": "PubMed Central"
} |
AbbreviationsATCCAmerican Type Culture CollectionBAYBAY 61‐3606Bsdblasticidine resistanceC+THP‐1 cells transduced with control (anti‐GFP) lentiviral particlesCD13cluster of differentiation 13CM‐H~2~DCFDA5‐(and 6‐)‐chloromethyl‐2′, 7′‐dichlorodihydrofluorescein diacetate acetyl esterCONACYTConsejo Nacional de Ciencia y TecnologíaCRcomplement receptorDiI1,1′‐dioctadecyl‐3,3,3′,3′‐tetramethylindocarbocyanine perchlorateEBS‐FabSRBCs labeled with CFSE and coated with biotin, streptavidin, and bivalent antigen‐binding fragments of biotinylated anti‐IgG (Ec)EFab452/32.2EBS‐Fab coated with Fab452/32.2F(ab)′~2~bivalent antigen‐binding fragment (disulfide bond joined)FAKfocal adhesion kinasehCD13human cluster of differentiation 13HCoV‐229Ehuman coronavirus 229EHEKhuman embryonic kidneyhMDMhuman monocyte‐derived macrophageIMSSInstituto Mexicano del Seguro SocialL2THP‐1 cells transduced with clone TRCN0000050239 onlyLYLY294002MDMmonocyte‐derived‐macrophagePIphagocytic indexpSykphosphorylated spleen tyrosine kinaseRFPred fluorescent proteinROSreactive oxygen speciesRsvrespiratory syncytial virus promotershRNAshort hairpin RNAsiC+anti‐GFP small interfering RNAsiL2anti‐CD13 small interfering RNASrcnon‐receptor tyrosine kinase of the proto oncogen tyrosine kinase familysiRNAsmall interfering RNAsuCMVsuper strong CMV promoterSykspleen tyrosine kinaseUNAMUniversidad Nacional Autónoma de México
Introduction {#s1}
============
Phagocytosis plays a critical role in innate and adaptive immunity by facilitating the removal and killing of pathogens while priming the adaptive immune response. Phagocytosis is a receptor‐mediated event. Direct or indirect (opsonin‐mediated) recognition of the target particle by receptors on the surface of professional phagocytes triggers signaling events that mediate actin‐dependent particle internalization. Receptors able to mediate phagocytosis are structurally diverse and include a variety of receptor families \[[1](#B1){ref-type="ref"}, [2](#B2){ref-type="ref"}\], such as FcγRs (FcγRI, ‐IIa, ‐IIc, and ‐IIIa), integrins (such as CR3, CR4, α~5~β~1~, α~v~β~3~, and LFA‐1) \[[3](#B3){ref-type="ref"}, [4](#B4){ref-type="ref"}, [5](#B5){ref-type="ref"}--[6](#B6){ref-type="ref"}\], scavenger receptors (such as scavenger receptor I, CD36, MARCO) \[[7](#B7){ref-type="ref"}, [8](#B8){ref-type="ref"}--[9](#B9){ref-type="ref"}\], C‐type lectin receptors (such as Dectin‐1, dendritic cell‐cell‐specific intercellular adhesion molecule‐3‐grabbing nonintegrin, mannose receptor), glycoproteins (such as CD44) \[[10](#B10){ref-type="ref"}\], and adhesion molecules (such as carcinoembryonic antigen‐related cell adhesion molecule 3) \[[11](#B11){ref-type="ref"}\]. This list has expanded in the last years, and it is expected to continue growing, as the receptors involved in certain phagocytic processes have not been defined yet.
Membrane peptidases are a multifunctional group of ectoenzymes involved in several processes, including growth, differentiation, activation, cell--cell interactions, and trafficking. Interestingly, their participation in such processes is not always dependent on their peptidase activity \[[12](#B12){ref-type="ref"}\]. Aminopeptidase N/CD13 is a transmembrane ectoenzyme expressed in several tissues. Among hematopoietic cells, CD13 expression is restricted to stem cells and most developmental stages of myeloid cells, to such an extent that CD13 has been considered a myelomonocytic marker \[[13](#B13){ref-type="ref"}\]. CD13 cleaves N‐terminal neutral amino acids of small peptides, and its substrates and functions vary according to the tissue where it is expressed. However, additional functions, independent of its enzymatic activity, have been attributed to CD13 \[[14](#B14){ref-type="ref"}\]. Inhibition of CD13 enzymatic activity by pharmacological inhibitors, active‐site mutations or inhibitory antibodies, is evidence that at least 3 types of functions of CD13 do not require its enzymatic activity: 1) as a viral receptor \[[15](#B15){ref-type="ref"}, [16](#B16){ref-type="ref"}--[17](#B17){ref-type="ref"}\], 2) as an adhesion molecule \[[18](#B18){ref-type="ref"}, [19](#B19){ref-type="ref"}--[20](#B20){ref-type="ref"}\], and 3) as a signaling molecule \[[20](#B20){ref-type="ref"}, [21](#B21){ref-type="ref"}, [22](#B22){ref-type="ref"}--[23](#B23){ref-type="ref"}\]. Interestingly, all of these functions rely on CD13 cross‐linking on the plasma membrane by antibodies or viral ligands, which presumably leads to signal transduction.
Structurally, CD13 is a heavily glycosylated type II membrane protein with a large extracellular domain, a single transmembrane region, and a short cytoplasmic domain of 8 aa. Despite having a very short cytoplasmic region, CD13 cross‐linking by antibodies or viral ligands induces intracellular signals, such as intracellular Ca^2+^ increases; activation of Src, PI3K, FAK, and the Ras/MAPK pathway; cytokine secretion \[[20](#B20){ref-type="ref"}, [23](#B23){ref-type="ref"}, [24](#B24){ref-type="ref"}\]; and CD13 association to actin fibers \[[20](#B20){ref-type="ref"}, [25](#B25){ref-type="ref"}\]. Given that the short intracellular domain of CD13 contains no classic signaling motifs, it has been proposed that CD13 might require an auxiliary protein to transduce signals. In line with this, CD13 coimmunoprecipitates with the adaptor molecules Grb2/Sos in U‐937 monocytes \[[18](#B18){ref-type="ref"}\], providing a possible link between CD13 aggregation and MAPK signaling. Furthermore, a recent report showed that CD13 is constitutively associated to the scaffolding protein IQGAP1 and that upon CD13 aggregation, α‐actinin is recruited into the complex, linking membrane‐bound CD13 to the cytoskeleton \[[20](#B20){ref-type="ref"}\]. However, that same study showed that upon aggregation, CD13 is phosphorylated on the Tyr6 of its cytoplasmic domain in a Src‐dependent manner and that this phosphorylation is required for ERK and FAK activation, as well as for CD13‐mediated adhesion \[[20](#B20){ref-type="ref"}\]. This observation emphasizes that despite being very short, the cytoplasmic region of CD13 participates directly in cellular signaling.
We \[[18](#B18){ref-type="ref"}, [19](#B19){ref-type="ref"}\] and others \[[20](#B20){ref-type="ref"}, [26](#B26){ref-type="ref"}\] have shown that antibody‐induced CD13 aggregation mediates monocyte‐monocyte and monocyte‐endothelial cell adhesion in vitro and in vivo in a tyrosine kinase‐dependent manner. Phagocytosis shares biochemical mechanisms with adhesion, spreading, and migration, as all of these processes require coordinated cytoskeletal reorganization. Indeed, there are several examples of membrane molecules that work as cell adhesion molecules and phagocytic receptors, including CR3 \[[27](#B27){ref-type="ref"}, [28](#B28){ref-type="ref"}\], CD44 \[[10](#B10){ref-type="ref"}, [29](#B29){ref-type="ref"}\], CD36 \[[30](#B30){ref-type="ref"}\], and α~V~β~3~ integrin \[[5](#B5){ref-type="ref"}\], among others \[[31](#B31){ref-type="ref"}\]. The first suggestion that CD13 was possibly involved in phagocytosis dates back to 1996, when a positive correlation between CD13 expression and phagocytosis of microspheres was observed in hMDMs \[[32](#B32){ref-type="ref"}\]. We have reported previously that CD13 cross‐linking by antibodies during phagocytosis of zymosan particles or heat‐killed *Escherichia coli* led to a more efficient uptake in macrophages and dendritic cells \[[33](#B33){ref-type="ref"}\]. Furthermore, an increase in FcγRI‐mediated phagocytosis was also observed in monocytes and macrophages when particles interacted simultaneously with CD13 and FcγRI compared with the phagocytosis of particles interacting with FcγRI alone. Likewise, the cocross‐linking of CD13 with FcγRI by specifc mAb increases the pSyk level and duration compared with cross‐linking FcγRI alone \[[34](#B34){ref-type="ref"}\]. These results suggest that CD13 aggregation can trigger signaling pathways required for phagocytosis. Finally, some data in our previous works also | {
"pile_set_name": "PubMed Central"
} |
In the article titled "Topography Prediction of Helical Transmembrane Proteins by a New Modification of the Sliding Window Method" \[[@B1]\], the error occurred in formula (1): the summation index *i* of the function *f*~*n*~(*k* + *i*) was accidentally lost. It should be corrected as follows:$$\begin{matrix}
{f_{n}\left( { k} \right)\operatorname{} = \frac{1}{2n + 1}{\sum\limits_{i = - n}^{n}{f_{n - 1}\left( { k + i} \right)}},\mspace{1800mu} n = 1,2,\ldots,5,} \\
\\
{f_{0}\left( { k} \right)\operatorname{} = f\left( { k} \right).} \\
\\
\end{matrix}$$
| {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
Autoimmune sialadenitis (AS) is characterized by chronic inflammation and swelling of the major or minor salivary glands (SGs), along with focal lymphocyte infiltration. In humans, AS is seen in primary Sjögren's syndrome (SS), and secondary SS associated with other autoimmune diseases such as systemic lupus erythematosus (SLE), scleroderma, and rheumatoid arthritis, and in IgG4-related diseases^[@CR1]--[@CR3]^. Under AS conditions, the parenchyma and ducts of the SGs are targeted for destruction by autoantibodies and infiltrating lymphocytes, ultimately causing insufficient saliva secretion and xerostomia^[@CR3],[@CR4]^. The development of AS is thought to have multiple causative factors, including immune factors, genetic background, hormonal abnormalities, and microbial infections^[@CR2]--[@CR4]^. Studies using animal models have proved valuable for analyzing the mechanisms of AS progression and regulation, and for testing novel treatments. Various mouse models of spontaneous AS are currently available^[@CR5]--[@CR8]^. The lupus-prone strain MRL/*lpr* and its substrains develop AS that is similar to secondary SS in SLE, and the NOD strain and its substrains are regarded as models of primary SS or secondary SS with autoimmune diabetes^[@CR5],[@CR8]--[@CR10]^.
During AS development, lymphoid organ-like structures form in SG tissues. This includes compartmentalization of infiltrating T and B cells, germinal centers, and a highly organized vasculature with high endothelial venules (HEVs) and lymphatic vessels^[@CR11],[@CR12]^. Such ectopic lymphoid organ-like structures are called tertiary lymphoid organs (TLOs) because their development closely resembles lymphoid neogenesis of secondary lymphoid organs (SLOs), particularly peripheral lymph nodes (LNs), in terms of cellular composition, organization, and vasculature^[@CR11],[@CR13]^. TLOs are thought to function as local sites of antigen presentation by dendritic cells (DCs), and areas of lymphocyte activation for somatic hypermutation and class switching in B cells, suggesting that they can exacerbate autoimmunity^[@CR11],[@CR14]^. However, the regulatory mechanisms that underlie the initiation and progression of TLO formation in AS are not fully understood.
Increasing evidence suggests that the development of autoimmunity involves innate immune detection of nucleic acids^[@CR15]--[@CR17]^. In particular, endosomal Toll-like receptors (TLRs) play a key role in recognizing chromatin- or small nuclear ribonucleoprotein-derived antigens, which contain dsDNA or RNA. TLR ligation activates downstream signaling via the adaptor protein MyD88. This in turn activates transcription factors involved in the production of type I IFNs, proinflammatory cytokines, and other proinflammatory mediators^[@CR18],[@CR19]^, which contribute to the development and progression of autoimmunity^[@CR19],[@CR20]^. Previous reports have shown that deletion of MyD88 can prevent lupus manifestations in mice. *Myd88*-deficient MRL/*lpr* mice show no apparent development of autoimmune nephritis^[@CR21]^. In this model, B cell-intrinsic MyD88-mediated signaling was shown to cause nephritis, whereas in DCs, it is critical for the development of dermatitis^[@CR22]^. In addition, germinal center formation and anti-nuclear antibody production requires MyD88-mediated signaling in B cells and DCs in lupus-prone *Lyn*-deficient mice^[@CR23]^. More recently, AS manifestations in NOD mice were found to be prevented by *Myd88* deficiency^[@CR24],[@CR25]^. *Myd88*^−/−^ NOD mice show impaired lymphocyte infiltration in SGs and decreased production of anti-nuclear antibody compared with *Myd88*^+/+^ NOD mice^[@CR24],[@CR25]^. As is thought to occur in lupus, it is possible that MyD88-mediated signaling is important for B cells and DCs in AS development. The detailed mechanism, or the existence of an alternative mechanism, has not been unveiled yet.
In the present study, we sought to investigate the role of MyD88-mediated signaling in AS development using two AS animal models, B6/*lpr* and NOD mice, and comparing *Myd88*^+/+^ mice with *Myd88*^−/−^ mice. We found that *Myd88* deficiency was able to suppress TLO formation, especially HEV formation-associated gene expression in SGs. Furthermore, we found evidence to suggest that activation of lymphotoxin (LT) β receptor (LTβR) signaling, which is important for lymphoid neogenesis in TLOs^[@CR26]^, is upregulated by MyD88. Our findings highlight a previously unknown role for MyD88 in AS development, and suggest that MyD88-mediated signaling-dependent HEV formation occurs during ectopic lymphoid neogenesis.
Results {#Sec2}
=======
*Myd88* deficiency suppresses AS development in lupus-prone B6/*lpr* mice {#Sec3}
-------------------------------------------------------------------------
To determine whether MyD88-mediated signaling affects the development of AS, we compared female *Myd88*^+/+^ B6/*lpr* mice, which spontaneously develop AS along with abnormal lymphoproliferation similar to secondary SS with SLE^[@CR5],[@CR27]^, with *Myd88*^−/−^ B6/*lpr* mice. In 24-week-old female *Myd88*^+/+^ B6/*lpr* mice, severe hyperplasia in the spleen and SG-associated LNs (SGALNs), and swelling of SGs were found (Fig. [1a](#Fig1){ref-type="fig"}). In contrast, female *Myd88*^−/−^ B6/*lpr* mice at the same age looked almost normal. The spleen, SGALNs, and SGs of these mice were considerably smaller than those of *Myd88*^+/+^ B6/*lpr* mice (Fig. [1a](#Fig1){ref-type="fig"}), and were almost the same as *Myd88*^+/+^ B6 mice (Supplementary Fig. [1](#MOESM1){ref-type="media"}). SG histology in *Myd88*^−/−^ B6/*lpr* mice seemed normal, compared with the AS symptoms seen in *Myd88*^+/+^ B6/*lpr* mice, such as severe tissue destruction due to diffuse lymphocyte infiltration (Fig. [1b and c](#Fig1){ref-type="fig"}). Large numbers of T and B lymphocytes (CD3^+^ and B220^+^ cells, respectively) could be collected from the spleen and SGALNs of *Myd88*^+/+^ B6/*lpr* mice, whereas the numbers were considerably reduced in *Myd88*^−/−^ B6/*lpr* mice (Fig. [1d](#Fig1){ref-type="fig"}). Analysis of T cell subsets revealed an increase in CD3^+^CD4^−^CD8^−^ double-negative T cells in the spleen and SGALNs of *Myd88*^+/+^ B6/*lpr* mice (Fig. [1e](#Fig1){ref-type="fig"}). However, in *Myd88*^−/−^ B6/*lpr* mice, the number of double-negative T cells was reduced, and they were shifted towards CD3^+^CD4^−^CD8^+^ T cells (Fig. [1e](#Fig1){ref-type="fig"}). Thus, in a lupus-prone AS model that has severe lymphoproliferation, *Myd88* deficiency shows a remarkable suppressive effect on AS development, which is due to a reduction in lymphoproliferation and regulation of lymphocyte differentiation.Figure 1MyD88-dependent AS manifestation and lymphocyte abnormalities in B6/*lpr* mice. (**a**) SLOs and SGs extracted from 24-week-old female *Myd88*^+/+^ and *Myd88*^−/−^ B6/*lpr* mice. Representative spleen (left picture) and SMGs with SGALNs (right picture) for each genotype are shown. (**b**) Representative areas of H&E-stained sections of SGs from *Myd88*^+/+^ (left) and *Myd88*^−/−^ (right) B6/*lpr* mice. Original magnification: ×20. (**c**) Pathological scores of SG sections evaluated from eight mice per genotype. Results are expressed as mean ± SD calculated from mean scores of four sections per animal. \*p \< 0.01. (**d**) Total number of CD3^+^, B220^+^, and CD3^−^B220^−^ cells collected from spleen (left graph) and SGALN (right graph) from *Myd88*^+/+^ and *Myd88*^−/−^ B6/*lpr* mice was calculated using flow cytometry. Similar results were obtained from all four animals for each strain, therefore a representative result is shown. (**e**) Flow cytometric analysis of CD3^+^ T cells from spleen (upper) and SGALN (lower) of *Myd88*^+/+^ and *Myd88*^−/−^ B6/*lpr* mice. Representative plots for CD4/CD8 expression from three separate experiments are shown.
*Myd88* deficiency suppresses AS development in NOD mice {#Sec4}
--------------------------------------------------------
Next, we investigated the effect of *Myd88*-deficiency on spontaneous AS development in NOD mice. Two groups previously reported that *Myd88* deficiency has a suppressive effect on AS in NOD mice and their substrain^[@CR24],[@CR25]^. As NOD mice do not show severe lymphoproliferation-associated symptoms, including organ hyperplasia, the size | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-sensors-19-04575}
===============
Flexible systems such as endoscopes are widely used for performing minimally invasive surgical interventions, as in intraluminal procedures or single port laparoscopy. Surgical platforms have been developed by companies and by laboratories to improve the capabilities of these flexible systems, for instance by providing additional degrees of freedom (DoF) to the instruments or triangulation configurations \[[@B1-sensors-19-04575],[@B2-sensors-19-04575]\]. In classic intraluminal procedures, the high number of DoF to be controlled represents a constraint, where several expert technicians, including the surgeon, have to work together in a complex environment. Robot assistance has been identified as a solution to this problem relative to the use of flexible systems in minimally invasive surgery \[[@B3-sensors-19-04575]\], which explains the motivation for developing the new, teleoperated robotic system put to work in this study here. The goal of *STRAS* is to optimally assist the expert surgeon in minimally invasive procedures \[[@B4-sensors-19-04575]\], and the design is based on the Anubis^®^ platform developed by Karl Storz and the IRCAD \[[@B5-sensors-19-04575]\]. Previous studies on *STRAS* were focused on the system architecture and the control theory of the application \[[@B4-sensors-19-04575],[@B5-sensors-19-04575],[@B6-sensors-19-04575]\]. In minimally invasive surgical systems for endoscopic surgery, surgeons need to operate master interfaces to control the endoscope and surgical instruments. They need to be able to have optimal skills in controlling the system and the user interface for targeted manipulation of the remote-controlled slave system as well as to cope with the overall complexity of the design. Such expertise can only be achieved by learning to optimally master the control mechanisms through practice in a simulator task and in vivo. Human control of endoscopic surgical systems may benefit from robotic surgical assistance \[[@B7-sensors-19-04575]\]. Previous studies were focused on tool-tip pressures and tactile feedback effects, rather than on the grip forces applied during manipulation of the handles \[[@B8-sensors-19-04575]\]. The system described here was designed without force feedback, and maneuver control is therefore based solely on visual feedback from the 2D images provided by an endoscopic fisheye camera and displayed on a screen. Anthropometric data from the literature suggest that, with or without force feed-back, dynamic changes in perceptual hand and body schema representations and cognitive motor programming occur inevitably after repeated tool use \[[@B9-sensors-19-04575],[@B10-sensors-19-04575]\]. These cognitive changes reflect the processes which highly trained surgeons go through in order to adapt to the visual and tactile constraints of laparoscopic surgical interventions. Experts perform tool-mediated image-guided tasks significantly quicker than trainees, with significantly fewer tool movements, shorter tool trajectories, and fewer grasp attempts \[[@B11-sensors-19-04575]\]. Additionally, an expert tends to focus attention mainly on target locations, while novices split their attention between trying to focus on the targets and, at the same time, trying to track the surgical tools. This reflects a common strategy for controlling goal-directed hand movements in non-trained operators in various goal-directed manual tasks \[[@B12-sensors-19-04575]\], often considerably affecting task execution times. Such strategy variables are also likely to influence grip forces while manipulating the control sticks of a robotic device \[[@B13-sensors-19-04575]\]. This work here is focused on the analysis of expertise and sensor specific force profiles during execution of a four-step pick-and-drop task with the telemanipulation system of *STRAS*. Pre-clinical testing of the *STRAS* robotic system has permitted to demonstrate that an expert surgeon on his own can successfully perform all the steps of a complex endoscopic surgery task (colorectal endoscopic submucosal dissection) with the telemanipulation system \[[@B14-sensors-19-04575],[@B15-sensors-19-04575]\]. Previously \[[@B16-sensors-19-04575]\], we had shown that proficiency (expertise) in the control of the *STRAS* master/slave system is reflected by a lesser grip force during task execution as well as by a shorter task execution time. In the meantime, pre-clinical testing of the *STRAS* robotic system has permitted to demonstrate major advantages of the system for expert endoscopic surgeons in comparison with classic procedures \[[@B14-sensors-19-04575],[@B15-sensors-19-04575]\], and benchmark measures permitting to establish objective criteria for expertise in using the system need to be found to ensure effective training of future surgeons on the system. Experimental studies of grip force strength and control for lifting and manipulating objects strategically have provided an overview of the contributions of each finger to overall grip strength and fine grip force control \[[@B17-sensors-19-04575]\]. While the middle finger is the most important contributor to the gross total grip force and, therefore, most important for getting a good grip of heavy objects to lift or carry, the ring finger and the small (pinky) finger are most important for the fine control of subtle grip force modulations \[[@B17-sensors-19-04575]\], as those required for effectively manipulating the control handles of *STRAS*. Moreover, it is well-documented in the literature that grip force is systematically stronger in the dominant hand compared with the non-dominant hand \[[@B16-sensors-19-04575],[@B18-sensors-19-04575]\]. In this study here, the grip force profiles correspond to measurements collected from specific sensor positions on these anatomically relevant parts of the finger and hand regions of the dominant and non-dominant hands. The grip force profiles of an expert in controlling the master/slave system are compared to those of an absolute beginner, who manipulated the robotic device for the first time. The wireless sensor glove hardware-software system described in \[[@B16-sensors-19-04575]\], was improved and employed in this study here to collect force data from a novice trainee and an expert in various anatomical locations in the palm and on the phalanges of fingers of the right and left hands for detailed analyses in terms of sensor-specific grip force profiles.
2. Materials and Methods {#sec2-sensors-19-04575}
========================
2.1. Slave Robotic System {#sec2dot1-sensors-19-04575}
-------------------------
The slave robotic system is built on the Anubis^®^ platform of Karl Storz. This system consists of three flexible, cable-driven sub-systems (for more information, \[[@B4-sensors-19-04575]\]): One main endoscope and two lateral flexible instruments. The endoscope carries the camera providing the visual feedback at its tip, and has two lateral channels which are deviated from the main direction by two flaps at the distal extremity. The instruments have bending extremities (one direction) and can be inserted inside the channels of the endoscope. This system has a tree-like architecture and the motions of the endoscope act also upon the position and orientation of the instruments. Two kinds of instruments are available: Electrical instruments and mechanical instruments. Overall, the slave system has 10 motorized DoF. The main endoscope can be bent in two orthogonal directions. This allows moving the endoscopic view, respectively from left to right and from up to down, as well as forward/backward. Each instrument has three DoF: Translation (tz) and rotation ($\theta z$) in the endoscope channel, and deflection of the active extremity (angle $\beta$). The deflection is actuated by cables running through the instrument body from the proximal part up to the distal end. The mechanical instruments can be opened and closed.
2.2. Master/Slave Control {#sec2dot2-sensors-19-04575}
-------------------------
The slave robot is controlled at the joint level by a position loop running at 1000 Hz on a central controller. The master side consists of two specially designed interfaces, which are passive mobile mechanical systems. The user grasps two handles, each having three DoF: They can translate for controlling instrument insertion, rotate around a horizontal axis for controlling instrument rotation, and rotate around a final axis (moving with the previous DoF) for controlling instrument bending. These DoFs are similar to the possible motions of the instruments as demonstrated in preclinical trials \[[@B15-sensors-19-04575]\]. Each handle is also equipped with a trigger and with a small four-way joystick for controlling additional DoF. In the experiments here, the trigger is operated with the index finger of a given hand for controlling grasper opening and closing, the small joysticks for moving the endoscope are not used. Since there is no force measurement on the slave side, no force effects are reproduced on the master side.
A high-level controller running on a computer under a real-time Linux OS communicates with the master interfaces and provides reference joint positions to the slave central controller. The user sits in front of the master console and looks at the endoscopic camera view displayed on the screen in front of him/her at a distance of about 80 cm while holding the two master handles, which are about 50 cm away from each other. Seat and screen heights are adjustable to optimal individual comfort. The two master interfaces are identical and the two slave instruments they control are also identical. Therefore, for a given task the same movements need to be produced by the user whatever the hand he/she uses (left or right). The master interfaces are statically balanced and all joints exhibit low friction, and therefore only minimal forces are required to produce movements in any direction. A snapshot view of a user wearing the sensor gloves while manipulating the | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
Obesity in children has become a serious public health problem similar to that found in the adult population. It is well known that obesity increases the risk of complications such as diabetes mellitus and cardiovascular disease in adults. Although obese children have lower incidences of these complications than adults, it is obvious that preventing the development of obesity and its concomitant medical problems is a useful method for decreasing severe health problems in adulthood. For this reason, it is absolutely imperative to initiate aggressive medical interventions in obese children, especially those with a higher risk of developing metabolic abnormalities or complications such as diabetes mellitus or hypertension.
Lipoprotein lipase (LPL) is a key enzyme synthesized in adipose, cardiac and skeletal muscle cells. It hydrolyzes triglyceride (TG) in chylomicrons and very low-density lipoproteins and is regulated by insulin ([@r1], [@r2]). LPL is bound to heparan sulfate proteoglycan (HSPG) on vascular endothelial cells. So, the LPL levels have previously been measured after injection of heparin to cleave LPL from HSPG. However, the adequacy of this postheparin LPL measurement remains uncertain. One of the reason for this is that heparin also releases hepatic lipase (HL) from hepatic sinusoid capillaries, resulting in a significant contribution of HL to the total postheparin lipolytic activity ([@r3]). Recent reports demonstrated that in nonheparinized plasma, a small part of LPL is associated with circulating lipoproteins ([@r4]), and preheparin LPL had a positive correlation with postheparin lipolytic activity ([@r5]). Subsequently, the clinical significance of measuring preheparin LPL has been investigated, and it has become apparent that it is useful for obtaining pathophysiologic information about metabolic disorders or acute inflammation ([@r6]).
Several researchers have reported that LPL may be a marker of insulin resistance and thereby reflect the risk of developing diabetes mellitus and cardiovascular disease in adulthood ([@r7],[@r8],[@r9],[@r10],[@r11],[@r12]). However, the relationship between LPL and serious metabolic status has remained largely unstudied in children. The purpose of this study was therefore to determine whether preheparin LPL is a marker of deteriorating metabolic status in obese Japanese children.
Subjects {#s2}
========
We examined 102 obese children (55 boys and 47 girls; mean age 10.9 yr, range 6.8--14.7 yr) who lived in Niigata Prefecture, Japan and received regular medical examinations in conjunction with \"The Prevention of Cardio- and Cerebrovascular Diseases in Childhood\" program. The Division of Pediatrics, Niigata University Graduate School of Medical and Dental Sciences and the school health divisions of local governments in Niigata Prefecture undertake this program every year. All subjects were more than 20% overweight based on age- and sex-specified body weights for height (percent relative body weight \[%RBW\]) and had a body fat percentage \>25% for boys or \>30% for girls aged \<11 yr or \>35% for girls aged ≥11 yr. No subjects had known endocrine disorders or diabetes. The anthropometric measurements and blood examinations were performed after informed consent was obtained from the parents or guardians of all the subjects. The Ethics Committee of the Niigata University Graduate School of Medical and Dental Sciences approved this study.
Methods {#s3}
=======
Height was measured by a portable stadiometer to the nearest 1 mm, weight was measured by a digital scale to the nearest 0.1 kg and %RBW was calculated based on the standard body weight of Japanese children published in 1990 by the Ministry of Education, Science and Culture of Japan. Waist and hip circumferences were measured to the nearest 1 mm. Systolic (SBP) and diastolic blood pressures (DBP) were measured in triplicate in the right arm, with the subjects seated quietly, using an automated sphygmomanometer (Dinamap Model 8104; Critikon Inc., Tampa, FL, USA). The third measurement was used in the statistical analyses. Body composition was measured using an InBody 3.0 multi frequency bioelectrical impedance analyzer (Biospace, Seoul, Korea). Abdominal fat thickness was estimated by ultrasonography (Model SSA-250A; Toshiba Corp., Tokyo, Japan) ([@r13]) with the subjects in the supine position and the linear-array probe kept perpendicular to the skin on the upper medial aspect of the abdomen. A longitudinal scan was then performed from the xiphoid process to the navel along the linea alba. Scanning was performed at the optimal position, with the surface of the liver being kept almost parallel to the skin, by requesting that the subjects hold their breath. The probe was applied lightly to the skin in order to avoid compression of the fat layer. Maximum preperitoneal fat thickness (Pmax) and minimum subcutaneous fat thickness (Smin) were measured directly from the screen using electronic calipers ([@r14]).
Birth weight was obtained from maternal and child health handbooks, and then the current weight--to--birth weight ratio \[WBWR: current weight (kg)/birth weight (kg)\]) was calculated.
Blood samples were collected from the subjects after an overnight fast for measurement of the levels of serum liver enzymes, lipids, lipoproteins, uric acid, fasting blood glucose (FBG), hemoglobin A1c (HbA1c), fasting serum insulin, leptin, adiponectin and lipoprotein lipase (LPL) in preheparin serum. The homeostasis model assessment-insulin resistance index (HOMA-R) was calculated as FBG \[mg/dl\] × serum insulin \[µU/ml\]/405.
Statistical Analysis {#s4}
====================
Metabolic classification of the children
----------------------------------------
The children were divided into the two groups, those with metabolic syndrome (MS) and those without MS (MS group and non-MS group, respectively). We used the criteria of MS for Japanese children proposed by the study group of the Ministry of Health, Labour and Welfare of Japan ([@r15]): 1) waist circumference ≥80 cm; 2) serum triglyceride (TG) levels ≥120 mg/dl or high-density lipoprotein cholesterol (HDL-C) levels \<40 mg/dl; 3) FBG levels ≥100 mg/dl; and 4) SBP ≥125 mmHg or DBP ≥70 mmHg. A diagnosis of MS was made in children who complied with criterion 1 and had at least two of the other criteria (2 to 4).
Age, hip circumference, body fat percentage, SBP, DBP, birth weight, T-Chol (total cholesterol), LDL-C (low-density lipoprotein cholesterol) and HbA1c were normally distributed and were expressed as a range, median, mean and SD. The other parameters were not normally distributed and were expressed as a range, median and mean.
Stepwise multiple regression analysis was used to examine the influence of height, weight, %RBW, age and gender on LPL levels. LPL levels, height, weight and %RBW were log-transformed before analysis.
The relationships between anthropometric measurements, birth weight, WBWR, metabolism-related parameters and LPL levels were analyzed using Spearman's rank correlation coefficients.
Tukey-Kramer honestly significant difference test was used to examine differences in LPL levels between the MS and non-MS groups. LPL levels were log-transformed before analysis, and the results were expressed as means ± SD for the both original and log-transformed values.
We analyzed the relationship between LPL and total number of MS components (number of MS criteria) included in the definition criteria. Insulin and adiponectin levels were also analyzed for comparison. Each value was log-transformed before analysis by the Tukey-Kramer honestly significant difference test. The total number of MS criteria ranged from 0 in the G0 group to 4 in the G4 group. Because there was only one subject in G4 group, G3 and G4 were grouped together and analyzed as one group (G3-4).
All statistical analyses were carried out using JMP Ver. 8.0.2 (SAS Institute Inc., Cary, NC, USA). Probability (p) values \<0.05 were considered statistically significant in all the analyses.
Results {#s5}
=======
The clinical characteristics of the subjects are summarized in [Table 1](#tbl_001){ref-type="table"}. All anthropometric measurements and metabolism-related laboratory data are expressed independent of gender. The median LPL level was 59.0 ng/ml.Table 1Clinical characteristics of the subjects (n=102; boys 55, girls 47)RangeMedianMeanSDAge (yr)6.8 -- 14.711.010.92.0Height (cm)120.0 -- 186.1144.7144.3Weight (kg)31.5 -- 132.053.456.9%RBW (%)31.6 -- 93.347.150.1Waist circumference (cm)65.0 -- 125.082.084.0Hip circumference (cm)68.5 -- 118.087.588.79.8Body fat percentage (%)26.1 -- 49.238.638.14.1Smin (mm)3.8 -- 29.012.112.9Pmax (mm)2.4 -- 21.411.912.0SBP (mmHg)87 -- 148113.0113.911.6DBP (mmHg)37 -- 7357.555.87.8Birth weight (g)1,850 -- 4,6783215.53214.0506.2WBWR9.4 -- | {
"pile_set_name": "PubMed Central"
} |
Dr. Melissa Suh is not included in the author byline. She should be listed as the twelfth author and her affiliation is 1: Department of Surgery, University of Nebraska Medical Center, Omaha, Nebraska, United States of America. The contributions of this author are as follows: Data Curation, Methodology, Writing--Original Draft Preparation, and Writing--Review & Editing.
| {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION {#S1}
============
Many babies are born preterm and despite improvements in their care, their extrauterine growth frequently falters ([@R1]--[@R3]). Although premature infants may be initially provided parenteral nutrition, the goal is to initiate and advance enteral feeding ([@R4]). However, enteral feedings is often limited by concern for the preterm infant's ability to metabolize nutrients and clinical complications related to feeding intolerance and necrotizing enterocolitis ([@R5]--[@R7]). Thus, enteral feeding may not achieve the level of protein required to sustain optimal growth.
To identify strategies to optimize the nutrition of neonates, we have used the neonatal pig as a model of the human infant. We found that feeding stimulates PS in skeletal muscle of neonatal pigs ([@R8]), and this response is independently mediated by the rise in insulin and amino acids (AA) ([@R9]--[@R10]). Leucine is the most effective single AA to trigger the activation of translation initiation factors that regulate muscle PS ([@R11]--[@R16]), but the effects of leucine in visceral tissues are not well understood. We have shown that parenteral AA infusion in neonates stimulates the intracellular signaling proteins that regulate PS ([@R17]), however, less is known about the effects of enteral AA delivery on the activation of this pathway.
AA, especially leucine, serve as substrates for PS and also as nutrient signals to stimulate translation initiation ([@R11]--[@R17]). Unlike insulin, AA do not activate protein kinase B (PKB) but activate the mammalian target of rapamycin (mTOR) ([@R16], [@R18]), which functions in two distinct protein complexes (mTORC1 and mTORC2) ([@R19]). mTORC1, a major player for mRNA translation, consists of several components, including regulatory associated protein of mammalian target of rapamycin (raptor, an activator) and proline-rich Akt substrate of 40 kDa (PRAS40, an inhibitor) ([@R20]), whose association is crucial for mTORC1 activation. Activated mTORC1 promotes eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1) and ribosomal protein S6 kinase-1 (S6K1) phosphorylation. Phosphorylated 4EBP1 allows active eIF4E·eIF4G complex formation and activated S6K1 phosphorylates ribosomal protein S6. Both processes are crucial for translation initiation ([@R21]).
Other crucial steps for mRNA translation are the eukaryotic initiation factor (eIF2) pathway ([@R22]) and the peptide elongation process. Phosphorylation of eIF2α (an inhibitor) is a limiting step in the eIF2 pathway while elongation factor 2 (eEF2) phosphorylation regulates elongation ([@R23]). Insulin and AA modulate eIF2α and eEF2, resulting in PS progression.
Recently, we showed that enteral leucine supplementation of a low protein meal acutely stimulates PS ([@R24]). However, it is unclear whether the effects could be sustained by prolonged enteral leucine supplementation. Although prolonged intravenous leucine infusion alone can reduce circulating levels of essential AA, which can limit PS ([@R17]), whether this occurs with prolonged enteral leucine supplementation is unknown as a decline in other AA was not observed in our previous acute enteral leucine supplementation study ([@R24]). Therefore, the aims of this study were to determine whether feeding of a low protein diet supplemented with leucine for 24 h can sustain enhanced rates of muscle and visceral tissue PS in neonatal pigs to rates similar to those achieved with a high protein diet and to examine the mechanisms involved.
MATERIALS AND METHODS {#S2}
=====================
Animals {#S3}
-------
Sows and piglets were managed as previously described ([@R14], [@R15]). After birth, piglets suckled ad libitum and were not given supplemental creep feed. At 2 d of age, indwelling catheters were surgically inserted into the jugular vein and carotid artery ([@R25]). The Animal Care and Use Committee of Baylor College of Medicine approved all experimental procedures. This study was conducted in accordance with the National Research Council's *Guide for the Care and Use of Laboratory Animals.*
Treatments and infusion {#S4}
-----------------------
Overnight fasted 5-d-old piglets (2.3 + 0.1 kg) were randomly assigned to 1 of the 3 dietary treatment groups: low protein (LP), low protein supplemented with leucine (LP+L), or high protein (HP) diets ([Table 1](#T1){ref-type="table"} and [2](#T2){ref-type="table"}; n = 7--9 pigs). The LP+L diet provided an equivalent amount of leucine as the HP diet. All animals were gavage fed at a rate of 40 ml · kg^−1^ at time 0 min and every 4 h for 24 h; the feeding was administered over a 15 min period. Protein provided in the meal was 0.83 and 3.33 g · kgbody weight (wt)^−1^ for the LP and HP diets, respectively. Diets were isocaloric and contained the same lactose level. Blood samples were collected at intervals after feeding initiation for measurement of individual plasma AA, insulin, and glucose concentrations. At 25 h, piglets were injected with L\[4-^3^H\] phenylalanine to measure PS and killed 30 min later. Samples of longissimus dorsi, gastrocnemius, and masseter muscles, heart, liver, pancreas, kidney, and jejunum were obtained for measurements of PS rate and nutrient signaling activation.
Plasma hormones and substrate assays {#S5}
------------------------------------
Blood glucose concentrations were analyzed using a YSI 2300 STAT Plus (Yellow Springs Instruments, Yellow Spring, OH). Plasma total branched-chain AA (BCAA) were analyzed by rapid enzymatic kinetic assay ([@R26]). Individual AA were measured by HPLC (PICO-TAG reverse-phase column; Waters, Milford, MA) ([@R27]). Plasma radioimmunoreactive insulin concentrations were measured using a porcine insulin radioimmunoassay kit (Linco, St. Louis, MO).
Tissue PS in vivo {#S6}
-----------------
Fractional rates of PS were measured with a flooding dose of 1.5 mmol·kg body wt^−1^ of L\[4-^3^H\]phenylalanine (18.5 MBq·kg ^−1^ body weight; American Radiolabeled Chemicals Inc., St. Louis, MO) ([@R28]). Piglets were killed 90 min after the last meal because our previous meal feeding study ([@R29]) showed increased PS from 0.5 to 2 h after the meal. Tissue samples were immediately frozen in liquid nitrogen and stored at −70^o^C until analyzed.
Protein immunoblot analysis {#S7}
---------------------------
Proteins from tissue homogenates were separated on polyacrylamide gels (PAGE). Samples were run at the same time on triple-wide gels to eliminate inter-assay variation. Proteins were electrophoretically transferred to polyvinylidene difluoride transfer membranes (Pall Corporation, Pensacola, FA), incubated with primary antibodies, washed, and exposed to secondary antibody ([@R16]).
For normalization, immunoblotting performed with antiphospho-specific antibodies were stripped and reprobed with corresponding nonphospho-specific antibodies. Blots were visualized and analyzed using a ChemiDoc-It Imaging System (UVP, Upland, CA). Primary antibodies were PKB (total and Ser^473^, Cell Signaling Technology Inc., Danvers, MA), mTOR (total and Ser^2448^, Cell Signaling), PRAS40 (Total and Thr^246^, Cell Signaling), 4EBP1 (total, Bethyl Laboratories Inc., Montgomery, TX and Thr^70^, Cell Signaling), eIF4G (total and Ser^1180^, Cell Signaling), S6K1 (total and Thr^398^, Cell Signaling), eIF2α (Total and Ser^51^, Cell Signaling), and eEF2 (Total and Thr^56^, Cell Signaling).
Quantification of protein-protein interaction {#S8}
---------------------------------------------
eIF4E·eIF4G and eIF4E·4EBP1 complexes were immunoprecipitated using an anti-eIF4E monoclonal antibody (Dr. Leonard Jefferson, Penn State University College of Medicine, Hershey, PA) followed by immunoblotting with 4EBP1 (Bethyl Laboratories) or eIF4G antibodies ([@R16]). For analysis of protein-protein interaction of members of the mTOR complex 1 (mTORC1), homogenates were immunoprecipitated using an anti-raptor antibody (Cell Signaling) ([@R30]). Western blot analysis using mTOR, S6K1, 4EBP1, and PRAS40 were conducted to determine interaction with raptor. Protein-protein interaction was normalized by eIF4E or raptor abundance.
Calculations and statistics {#S9}
---------------------------
Fractional rates of PS (Ks, percentage of protein mass synthesized in a day) were calculated as Ks (%/day) = \[(S~b~/S~a~) x (1,440/t)\] x 100, where S~b~ (in dpm·nmol^−1^) is the specific radioactivity of the protein-bound phenylalanine, S~a~ (in ·nmol^−1^) is the specific radioactivity of the tissue free phenylalanine, *t* is labeling time in min, and 1,440 is the min-to-d conversion ([@R31]).
Statistical analysis was carried out in SPSS (Version 17.0). A protected post hoc least significant | {
"pile_set_name": "PubMed Central"
} |
{#F1}
{#F2}
Eye injuries often occur in the workplace in low and middle-income countries, particularly in the construction, agricultural, mining, and manufacturing industries. Even if there are safety regulations in these industries, their enforcement is often unsatisfactory, and owners are not required to provide safety equipment.
In 2005, Christian Medical College in Vellore, India, conducted a pilot study in stone quarries in the area. At the start, they found that between 10% and 20% of workers had sustained injuries sufficiently severe for them to seek treatment (often costly) and that, of these injuries, 10% were sight threatening.
Plastic protective eyewear was then given to all workers after a single educational session (a health talk). Posters showing eye trauma due to quarrying were also displayed around the mine.
Regular use of protective eyewear was monitored by a health worker during surprise checks, and at three months 188/218 workers (86%) were regularly using them. A repeat slit lamp examination showed that the incidence of new eye injuries had reduced to 6% (13/218), and none were sight threatening.
The next challenge was to encourage sustained use of the eyewear, particularly as workers expressed their dissatisfaction, including: fogging and staining with sweat, a feeling of heaviness, and the development of scratches within two weeks, leading to difficulty with vision and requiring frequent replacement.
In order to answer the question 'What is the evidence that educational interventions are effective in preventing ocular injuries?' a Cochrane systematic review in 2009 assessed all available evidence and concluded that it was insufficient to answer the question, particularly in low-and middle income settings.
The Vellore group then carried out a follow-up randomised control trial (RCT) to assess the effectiveness of an educational strategy to encourage sustained compliance with the wearing of protective eyewear and to see whether this would reduce the incidence of eye injuries at three months and at six months.
In one arm of the RCT, a standard, single education session was provided, while in the other an enhanced education programme was provided over 11 sessions in 6 months. This included a standard talk, pre-recorded street plays and messages on the regular use of suitable protective eyewear, group motivational sessions, and individual counseling. In both arms, workers were given shatterproof, impact-resistant, heat-toughened protective eyewear with side shields.
Compared to standard education, the enhanced education had increased sustained compliance by 25%. The cumulative reduction in eye injuries over 6 months was greater in the enhanced education group (12%) than in the standard education group (7%) The effect of the intervention was limited by the small sample size and was not as large as in the pilot (which is often the case), but it was nevertheless a real effect.
This study demonstrated that:
- Protective eyewear designed to suit the harsh working conditions are accepted and welcomed by quarry workers
- Their regular use reduces the incidence of ocular trauma and prevents sight-threatening injuries
- Continued compliance with protective eyewear is improved by an enhanced educational programme that is sustained over longer periods than just one educational session.
Unfortunately, however, the eyewear used in the study was not easily available locally, and use of the eyewear (which was provided to quarry owners free of charge) was not sustained long after the study.
We recommend that researchers and eye health workers engaged in prevention of occupational eye injuries take the following action to ensure that evidence-guided service provision is established.
- Disseminate and discuss research findings with business owners (focusing on the economic benefit) and workers\' unions (focusing on safety and rights in the workplace)
- Create links between the business (or quarry) owners and local protective eyewear providers -- and encourage the local eyewear providers to offer bulk discounts
- Submit the findings to a local public health and occupational health authority.
| {
"pile_set_name": "PubMed Central"
} |
All relevant data are within the paper and its Supporting Information files.
Introduction {#sec001}
============
Protein synthesis is an essential process undertaken by all organisms, but its necessity also presents cells with a myriad of challenges. An extensive network of molecular machines is active throughout translation, folding, and degradation in order to preserve protein homeostasis (proteostasis). Perturbations to that machinery can have ripple effects that impact many cellular systems.
Misfolded proteins are one such challenge to proteostasis. Improperly folded proteins are generally non-functional; thus, the correct folding and trafficking of polypeptides is essential to the maintenance of cellular viability \[[@pgen.1006431.ref001]\]. Protein misfolding can lead to the induction of cellular stress responses, apoptosis, and cell death. In humans, protein misfolding diseases include Alzheimer's disease, Parkinson's disease, Huntington's disease, and prion diseases such as Creutzfeldt-Jakob disease \[[@pgen.1006431.ref001]--[@pgen.1006431.ref003]\]. The complexity of protein folding is mirrored by the complexity of these incurable diseases; thus, increased understanding of the molecular basis of folding and misfolding will be crucial to improved treatment of various pathologies.
Prions are a subset of misfolded proteins that are self-templating and stably propagated from cell to cell. In yeast, the intrinsically disordered domain of the translation termination factor Sup35 misfolds and aggregates to form the \[*PSI*+\] prion, which is cytoplasmically inherited via amyloid seeds \[[@pgen.1006431.ref004]--[@pgen.1006431.ref006]\]. \[*PSI*+\] is toxic under certain circumstances, including Sup35 overexpression, due to severe disruption of proteostasis as a consequence of excessive aggregation of Sup35 \[[@pgen.1006431.ref007],[@pgen.1006431.ref008]\].
Nascent polypeptides begin to fold cotranslationally before protein synthesis has been completed by the ribosome \[[@pgen.1006431.ref009]\]. Sup35, not unlike other proteins, faces folding challenges immediately upon emergence from the ribosome exit tunnel. Proteins are protected from early misfolding by ribosome-bound protein chaperone families \[[@pgen.1006431.ref010]\]. First, the nascent polypeptide-associated complex (NAC) interacts with nascent chains \[[@pgen.1006431.ref011]\], followed by the ribosome-associated complex (RAC) and the Hsp70 Ssb \[[@pgen.1006431.ref012]--[@pgen.1006431.ref015]\]. Cotranslational chaperone factors are of keen interest in the area of protein aggregation, as they have a bias towards substrates that are intrinsically disordered and amyloidogenic \[[@pgen.1006431.ref016]\]. The NAC and Ssb-RAC systems are components of a larger molecular chaperone network within *Saccharomyces cerevisiae* \[[@pgen.1006431.ref010],[@pgen.1006431.ref017]\]. However, the interactions between cotranslational folding factors and other players in the chaperone network have yet to be fully elucidated.
Here, we describe a surprising mechanism for preventing aggregation-related cytotoxicity by manipulating cotranslational folding pathways. We utilized the \[*PSI*+\] prion as a model for protein misfolding and a reporter for the activities of the chaperone network. We screened for factors that, when disrupted, rescued the prion-dependent toxicity and restored viability. Surprisingly, disruption of β-NAC, a subunit of the NAC chaperone complex, was identified as one of the rescuing mutants in our screen. This counterintuitive result suggests that depletion of chaperones can, in some cases, rescue defects associated with misfolded proteins.
Indeed, we found that deletion of NAC subunits has significant impact on the localization and activity of other cytosolic chaperones, the Hsp70 family in particular. We propose that altered localization and activity of chaperones can aid cells in the ability to maintain proteostasis when faced with severe folding challenges. As such, inhibition of the NAC presents a novel avenue for investigation into therapeutics to treat protein conformational disorders that may slow further aggregation of amyloidogenic proteins and suspend disease progression.
Results {#sec002}
=======
Disruption of NAC subunits rescues toxicity associated with the \[*PSI*+\] prion {#sec003}
--------------------------------------------------------------------------------
We set out to identify factors that modulate the toxic misfolding environment associated with the \[*PSI*+\] prion. Though \[*PSI*+\] is generally well-tolerated by cells, the overexpression of Sup35 in \[*PSI*+\] cells is cytotoxic \[[@pgen.1006431.ref007]\]. To identify factors that could rescue this toxicity, we overexpressed Sup35 from a copper-inducible promoter and screened for colonies that overcame the toxicity phenotype while retaining the "strong" variant of \[*PSI*+\] ([S1A Fig](#pgen.1006431.s001){ref-type="supplementary-material"}). Upon sequencing, two toxicity-suppressing candidate colonies contained single gene disruptions of *EGD1*. The *EGD1* gene encodes Egd1, the β-NAC subunit ([Fig 1A](#pgen.1006431.g001){ref-type="fig"}). The NAC is comprised of three subunits: Egd1 (β subunit), Egd2 (α subunit), and Btt1 (β' subunit), which are together known to play an important role in cotranslational folding and protein homeostasis (proteostasis) \[[@pgen.1006431.ref018]\]. Our results indicate, for the first time, that deletion of NAC subunits may help to improve cellular health in the face of misfolding stress.
![Disruption of NAC subunits rescues toxicity associated with the \[*PSI*+\] prion.\
(A) The nascent-polypeptide associated complex consists of the proteins Egd1 (β), Btt1 (β'), and Egd2 (α) that share homology within their NAC domains. (B) Sup35 under control of the copper-inducible promoter CUP1 was induced in \[*psi*-\] WT, \[*PSI*+\] WT, and \[*PSI*+\] NAC deletion strains by growth on selective media containing 350μM CuSO4. The empty vector (EV) control contained the pCUP1 vector. Single horizontal white line separates non-contiguous spots from the same plates. Dashed black line separates spots from different plate of identical media. The "*egd1Δ*^t^" designation indicates the strain isolated from the transposon screen.](pgen.1006431.g001){#pgen.1006431.g001}
Intrigued by this result, we tested whether deletion of other NAC subunits also rescued the \[*PSI*+\]-dependent toxicity caused by Sup35 overexpression \[[@pgen.1006431.ref007],[@pgen.1006431.ref008]\]. We theorized that double- or triple-deletions, which would not be recovered by our screen, may exhibit stronger phenotypes. We created yeast strains containing combinatorial deletions of all NAC subunits, hereafter referred to as "NAC deletion strains," and tested them for growth in the presence of toxic Sup35 aggregates. We found that two double deletions, *egd1Δegd2Δ* and *egd1Δbtt1Δ*, strongly rescued the toxicity caused by the overexpression of Sup35 in \[*PSI*+\] cells ([Fig 1B](#pgen.1006431.g001){ref-type="fig"}). Interestingly, other deletion combinations and deletion of the whole NAC did not detectably overcome the toxicity, potentially due to individual subunit interactions that are not yet understood ([S1B Fig](#pgen.1006431.s001){ref-type="supplementary-material"}).
Nonsense suppression and prion status are not changed as a result of NAC subunit deletion {#sec004}
-----------------------------------------------------------------------------------------
It has been previously shown that impaired translation termination is responsible for the toxicity phenotype in \[*PSI*+\] cells overexpressing Sup35 \[[@pgen.1006431.ref007]\]. Therefore, we hypothesized that a decrease in stop codon readthrough may be responsible for the toxicity rescue in the NAC deletion strains.
To test this, we utilized a well-characterized genetic assay: the *ade1-14* allele, which contains a premature stop codon in the *ADE1* open reading frame. Yeast carrying the *ade1-14* allele are unable to complete adenine biosynthesis, resulting in accumulation of a red pigment in cells grown on rich media that have faithful translation termination. The nonsense suppression that occurs in *ade1-14* \[*PSI*+\] cells leads to completion of the adenine biosynthesis pathway, thus the colonies are white in color and are able to grow on media lacking adenine (SD-Ade) \[[@pgen.1006431.ref019]\]. We spotted \[*PSI*+\] NAC deletion strains onto rich media (YPD) and SD-Ade plates to assess their nonsense suppression phenotypes. All NAC deletion strains formed white colonies and grew strongly on SD-Ade ([Fig 2A](#pgen.1006431.g002){ref-type="fig"}), indicating similar levels of nonsense suppression in all strains in the context of endogenous Sup35.
![Nonsense suppression and prion status are not changed as a result of NAC subunit deletion.\
(A) \[*PSI*+\] NAC deletion strains were tested for growth on YPD and SD-Ade to monitor nonsense suppression of the *ade1-14* allele. (B) Stop codon readthrough is not significantly altered in NAC deletion strains relative to the WT. Expression of PGK(stop)LacZ fusion proteins was monitored by a β-galactosidase assay \[[@pgen.1006431.ref | {
"pile_set_name": "PubMed Central"
} |
1.. Introduction {#s2}
================
The log transformation, a widely used method to address skewed data, is one of the most popular transformations used in biomedical and psychosocial research. Due to its ease of use and popularity, the log transformation is included in most major statistical software packages including SAS, Splus and SPSS. Unfortunately, its popularity has also made it vulnerable to misuse -- even by statisticians -- leading to incorrect interpretation of experimental results.[@B1] Such misuse and misinterpretation is not unique to this particular transformation; it is a common problem in many popular statistical methods. For example, the two-sample t-test is widely used to compare the means of two independent samples with normally distributed (or approximately normal) data, but many researchers take this critical assumption for granted, using t-tests without bothering to check or even acknowledge this underlying assumption. Another example is the Cox regression model used in survival analysis; many studies apply this popular model without even being aware of the proportionality assumption (i.e., the relative hazard of groups of interest is constant over time) required for valid inference.
In this article we focus on the log-transformation and discuss major problems of using this method in practice. We use examples and simulated data to show that this method often does not resolve the original problem for which it is being used (i.e., non-normal distribution of primary data) and to show that using this transformation can introduce new problems that are even more difficult to deal with then the problem of non-normal distribution of data. We conclude with recommendations of alternative analytic methods that eliminate the need of transforming non-normal data distributions prior to analysis.
2.. Log-normal transformation {#s3}
=============================
2.1. Using the log transformation to make data conform to normality {#s3a}
-------------------------------------------------------------------
The normal distribution is widely used in basic and clinical research studies to model continuous outcomes. Unfortunately, the symmetric bell-shaped distribution often does not adequately describe the observed data from research projects. Quite often data arising in real studies are so skewed that standard statistical analyses of these data yield invalid results. Many methods have been developed to test the normality assumption of observed data. When the distribution of the continuous data is non-normal, transformations of data are applied to make the data as \"normal\" as possible and, thus, increase the validity of the associated statistical analyses. The log transformation is, arguably, the most popular among the different types of transformations used to transform skewed data to approximately conform to normality.
If the original data follows a log-normal distribution or approximately so, then the log-transformed data follows a normal or near normal distribution. In this case, the log-transformation does remove or reduce skewness. Unfortunately, data arising from many studies do not approximate the log-normal distribution so applying this transformation does not reduce the skewness of the distribution. In fact, in some cases applying the transformation can make the distribution more skewed than the original data.
To show how this can happen, we first simulated data u~i~ which is uniformly distributed between 0 and 1,and then constructed two variables as follows: x~i~=100(exp(μ~i~-1)+1, y~i~=log(x~i~).
Shown in the left panel in Figure 1 is the histogram of x~i~, while the right panel is the histogram of y~i~ (the log-transformed version of x~i~) based on a sample size of n=10,000. While the distribution of x~i~ is right-skewed, the log-transformed data y~i~ is clearly left-skewed. In fact, the log-transformed data y~i~ is more skewed than the original x~i~, since the skewness coefficient for y~i~ is 1.16 while that for x~i~ is 0.34. Thus, the log-transformation actually exacerbated the problem of skewness in this particular example.
{#sap-26-02-105-g002}
In general, for right-skewed data, the log-transformation may make it either right-or left-skewed. If the original data does follow a log-normal distribution, the log-transformed data will follow or approximately follow the normal distribution. However, in general there is no guarantee that the log-transformation will reduce skewness and make the data a better approximation of the normal distribution.
2.2. Using the log transformation to reduce variability of data {#s3b}
---------------------------------------------------------------
Another popular use of the log transformation is to reduce the variability of data, especially in data sets that include outlying observations. Again, contrary to this popular belief, log transformation can often increase -- not reduce -- the variability of data whether or not there are outliers.
For example, consider the following simple linear regression with only an intercept term: y~i~=β~0~+ε~i~, ε~i~\~U(-0.5, 0.5)
Unlike the ordinary regression analysis where the error term is assumed to have a normal distribution, the error term in this regression is uniformly distributed between -0.5 and 0.5. Thus y~i~ in the above model does not follow a log-normal distribution and the log-transformed y~i~ does not have a normal distribution. We then simulated data y~i~ for this model with a sample size of n=100 and a value of the β~0~ parameter ranging from 0.5 to 5.5. Note that β~0~ starts from 0.5, rather than from 0, to ensure y~i~\>0 and, thus, log(y~i~)is correctly estimated when performing the log transformation on the data simulated from the linear regression of the original data. We fit two different linear models on the same data. The first model used the data without transformation, the second model used the log-transformed data. The ordinary least square method was used to estimate the intercepts in both models.
Table 1 shows the original and log-transformed estimates of β~0~ and its standard errors averaged over 100,000 Monte Carlo (MC) simulations[@B1] from fitting the linear model to the original data. We use a large MC sample size to help reduce the sampling variability in the standard error estimates; thus the differences in the presented estimates from fitting the original and log-transformed data reflect true differences. The table shows that when β~0~=0.5, the standard errors from the model fit to the original y~i~ were much smaller than those from fitting the log-transformed data. As β~0~ increased towards 5.5, the standard errors from fitting the original data remained the same, while their counterparts from fitting the log-transformed data decreased. When β~0~ increased past the value 1, the standard errors from fitting the log-transformed data became smaller than those from fitting the original data. Table 2 presents the same estimates of β~0~ as those in Table 1, except that we introduced four outlying points (4, 6, 8 and 10) in the simulated data, thereby increasing the sample size to 104.As can be seen in Table 2, the estimates of β~0~ and of the standard error of β~0~ changed after introduction of the outliers, but the pattern of differences in these estimates between the model for the original data and for the log-transformed data remains the same. This example shows that the conventional wisdom about the ability of a log transformation of data to reduce variability especially if the data includes outliers, is not generally true. Whether the log transformation reduces such variability depends on the magnitude of the mean of the observations --- the larger the mean the smaller the variability.
######
Simulation results for simple linear regression without outliers (n=100; 100,000 simulations)
β~0~ Original data log-transformed data
------ --------------- ---------------------- --------- --------
0.50 0.5000 0.0288 -0.9999 0.0998
0.51 0.5100 0.0289 -0.9440 0.0887
0.55 0.5499 0.0289 -0.7993 0.0718
0.60 0.6001 0.0290 -0.6647 0.0608
0.70 0.7002 0.0289 -0.4591 0.0480
0.80 0.8000 0.0288 -0.2977 0.0401
0.90 0.8999 0.0288 -0.1626 0.0347
1.00 1.0001 0.0288 -0.0451 0.0307
1.50 1.5000 0.0289 0.3863 0.0198
5.50 5.5000 0.0289 1.7034 0.0053
######
Simulation results for simple linear regression with outliers (n=104; 100,000 simulations)
β~0~ Original data log-transformed data
------ --------------- ---------------------- --------- --------
0.50 0.7501 0.0277 -0.8886 0.0960
0.51 0 | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
The discoveries of Interleukin-1 (IL-1) and IL-2 led to a better understanding of the effects of ILs, and till now more than 40 cytokines are discovered with specific functions \[[@B1]\]. Interleukin-4 (IL-4) is one of the extensively studied cytokines which induces specific functions in wide range of immune cells defining its pleotropic character \[[@B2]\]. IL-4 was identified originally as a B cell growth factor-1 in mice \[[@B3]\] and was subsequently shown to modulate other cellular interactions of immune response \[[@B4]\]. It is the primary cytokine which promotes the development of Th2 effector cells and antagonises the activity of interferon gamma (IFN-*γ*) induced development of Th1 cells \[[@B5], [@B6]\]. Upon activation by IL-4, Th2 cells subsequently produce additional IL-4. These cytokines act synergistically with IL-5 to either activate IgE producing B cells or induce isotype switching and enhance IgE mediated responses in allergy and asthma \[[@B7]--[@B9]\]. IL-21 that was discovered recently is homologous to IL-4 in its ability to modulate both innate and adaptive immune responses \[[@B10]\]. Wide diversity of IL-4 activity reported to date suggests that it is a key regulator in humoral and adaptive immunity.
The gene encoding IL-4 is found in chromosomes 11, 5, and 7 in mouse \[[@B11]\], human \[[@B12]\], and cattle \[[@B13]\], respectively. In mouse and human, the gene comprises 4 exons spanning 6 kb and 10 kb, respectively \[[@B14], [@B15]\]. This cytokine was initially cloned and characterised in mouse and human \[[@B16]--[@B18]\]. Further exploration was carried out by characterising it in domestic animals like dog \[[@B19]\], cat \[[@B20]\], camel \[[@B21]\], horse \[[@B22]\], pig \[[@B23]\], and so forth. In addition, IL-4 of some ruminants like cow \[[@B24]\], African buffalo \[[@B25]\], sheep \[[@B26]\], and goat \[[@B6]\] was also previously cloned and identified. In addition, IL-4 has been identified and reported in chimpanzee \[[@B27]\] and bottle-nosed dolphin \[[@B28]\]. Wild animals are presumed to possess stronger immune system as compared to their domestic counterparts. Due to difference in habitat/environment, the immune function of wild animals could be different from that of laboratory bred/domestic animals \[[@B29]\]. A comparison of sequence encoding IL-4 among various wild and domestic species could explain the difference, if any, in structure and function with respect to this cytokine. Indian buffaloes are the centre of dairy industry and are fast replacing indigenous cattle in contribution towards total milk production of India. In India, nilgai is sympatric with one domestic ruminant, that is, Indian buffalo. The present study reports the characterisation of IL-4 of nilgai (*Boselephus tragocamelus*) and Indian buffalo (*Bubalus bubalis*) as a model for the comparison of wild versus domestic ruminants of Bovidae family and their phylogenetic lineage.
2. Materials and Methods {#sec2}
========================
2.1. Sample Collection and RNA Isolation {#sec2.1}
----------------------------------------
Total RNA was isolated from peripheral blood mononuclear cells (PBMs). Blood was obtained aseptically by jugular puncture from nilgai maintained in semicaptivity at Deer Park, Indian Veterinary Research Institute (IVRI), Izatnagar, and Indian buffalo from slaughter house, Bareilly. PBM cells were extracted using Histopaque 1077 (Sigma, USA) density gradient centrifugation following a method previously described \[[@B30]\] and stimulated with Concanavalin A (Con A) at the concentration of 10 *μ*g/mL for 20 h at 37°C in a humidified incubator with 5% CO~2~. Total RNA of both the samples was isolated using Trizol LS reagent (Life Technologies, New York, NY) following the manufacturer\'s instructions.
2.2. cDNA Synthesis and Amplification {#sec2.2}
-------------------------------------
Two respective first strands of cDNA were synthesized at 37°C from two RNA samples by using oligo dT primers (Promega, Madison, WI). Nilgai and Indian buffalo IL-4 genes were amplified from their respective cDNA using specific oligonucleotide primers (Forward 5′-TAATGGGTCTCACCTACCAG-3′ and Reverse 5′-TTCAGCTTCAACACTTGGAG-3′) designed based on the sequence of cattle (Accession NM_173921.2). The oligonucleotide primers were designed using OLIGO 4.0 software (USA). The IL-4 specific cDNAs were amplified using sequence specific primers (50 pmol/*μ*L) 1.0 *μ*L each; Template cDNA 1.0 *μ*L; dNTPs (10 mM) 1.0 *μ*L; 10X Taq polymerase buffer 5 *μ*L; 25 mM MgCl~2~ 3 *μ*L; Taq DNA polymerase (MBI Fermentas, 5 U/*μ*L) 1.0 *μ*L; and nuclease free water making final reaction mixture of volume 50 *μ*L. PCR amplification program followed was: 95°C for 5 min, 35 repeated cycles of 1 min denaturation at 94°C, 1 min annealing at 60°C and 1 min extension at 72°C, and one cycle of final extension at 72°C for 10 min. The PCR amplified product was analysed on 1% agarose gel containing ethidium bromide along with DNA molecular weight marker.
2.3. cDNA Cloning and Sequencing {#sec2.3}
--------------------------------
The amplified products were purified from the agarose gel using Gel extraction Kit (Qiagen, Germany). Nilgai IL-4 PCR product was cloned into pTZ57R/T vector (MBI Fermentas, MD) and buffalo amplified product using pGEMT-Easy (Promega, Madison, USA) vector following the manufacturers\' protocol and further screened by blue white screening. The recombinant plasmids were characterized by restriction enzymes *Not*I, *Pst*I, *Nco*I, and *Eco*RI (MBI Fermentas, MD) and by PCR using gene specific primers predicted from cattle IL-4 sequence.
2.4. Sequencing and Analysis {#sec2.4}
----------------------------
The characterized plasmids were sequenced using T7 and SP6 universal primer using ABI PRISM 377 Version 3.0 DNA sequencer (Applied Biosystem, Foster city, CA). The nucleotide sequences of both insert IL-4 were first BLAST analyzed (<http://www.ncbi.nlm.nih.gov/>) and further submitted to GenBank. Multiple sequence alignment was carried out with IL-4 gene sequences of nilgai and Indian buffalo with its homologues from other species like cattle (*Bos taurus*) (GenBank Accession no. NM_173921), African buffalo (*Syncerus caffer*) (EU000421), goat (*Capra hircus*) (U34273), sheep (*Ovis aries*) (M96845), pig (*Sus scrofa*) (JF906512), camel (*Camelus dromedarius*) (HM051106), red deer (*Cervus elaphus*) (L07081), giraffe (*Giraffa camelopardalis*) (EU000423), bison (*Bison bonasus*) (EU000422), llama (*Lama glama*) (AB107648), dog (*Canis lupus familiaris*) (NM_001003159), cat (*Felis catus*) (NM_001043339), and bottle-nosed dolphin (*Tursiops truncatus*) (AB020732).
Amino acid sequences were predicted using DNA Star software (Lasergene). Nucleotide and deduced amino acid sequence were aligned to predict phylograms using Mega 5.1 software \[[@B31]\]. Nilgai and Indian buffalo IL-4 protein structure was predicted using PHYRE2 software (Protein Homology/analog Y Recognition Engine; <http://www.sbg.bio.ic.ac.uk/phyre2>). The N-glycosylation sites were predicted using HIV sequence database (<http://www.hiv.lanl.gov>). Leader peptide cleavage site was predicted using SignalP 4.1 server (<http://www.cbs.dtu.dk>) \[[@B32]\].
3. Results {#sec3}
==========
The concentration of RNA was measured using UV spectrometer, and the purity and integrity were checked by analyzing the ratio of optical density (OD) at 260 and 280 nm. The ratios of OD~260~/OD~280~ in total RNA from nilgai and Indian buffalo were found to be 1.83 and 1.85, respectively. Amplification of cDNA through PCR was confirmed through agarose gel electrophoresis which gave a product size 417 bp in both the cases. Purified PCR product of respective species was cloned, and the recombinant plasmid was characterized by restriction analysis ([Figure 1](#fig1){ref-type="fig"}, Lanes 2--5) and sequencing. Recombinant plasmid was linearised by digesting with BamH1 ([Figure 1](#fig1){ref-type="fig"}, Lane 1); insert was released from vector using *Not*I enzyme ([Figure 1](#fig1){ref-type="fig"}, Lane 2). The | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-genes-10-00220}
===============
Microbial life is one of the most diverse and bioenergetically dominant forces in the earth's ecosphere \[[@B1-genes-10-00220]\], making microbiome research a critical component of modern ecology. The unparalleled taxonomic and functional diversity of microbial communities has allowed them to populate all locations on the planet \[[@B2-genes-10-00220],[@B3-genes-10-00220]\], including environments unfit for colonization by other life forms. In hypersaline environments, unique environmental pressures have forced microbiota to evolve with specific survival adaptations, resulting in highly resilient communities that push the boundaries of life's limit ([Figure 1](#genes-10-00220-f001){ref-type="fig"}). Halophiles have been found to play important roles in soil bioenergetic processes \[[@B4-genes-10-00220]\] and food storage and preservation \[[@B5-genes-10-00220],[@B6-genes-10-00220]\], and have also been detected in the human gut microbiota \[[@B7-genes-10-00220]\]. Additionally, studying halophilic life forms has revealed many fundamental aspects of life's survival limits and strategies, including the potential to endure the harsh environments we are most likely to find on other planets \[[@B8-genes-10-00220],[@B9-genes-10-00220]\]. Prior to the introduction of high-throughput sequencing, our understanding of halophile genomics was limited to studying cultured organisms \[[@B10-genes-10-00220],[@B11-genes-10-00220]\]. While next-generation sequencing technologies have become commonplace in microbiology, the halophile field lacks a critical analysis of prospects and potential applications of these technologies in halophilic microbiomes.
In this review, we discuss key aspects of halophile community composition and function that metagenomics has revealed and provide examples of studies in various hypersaline environments for a perspective on analytical progress. We then examine the advantages and limitations of applying shotgun metagenomic sequencing in uncovering the structure and function of halophilic microbiomes. We outline the factors and characteristics that make the deconvolution of halophilic metagenomes a major challenge and propose analytical adjustments to be made when investigating these complex communities. Both experimental design and computation analysis approaches that are appropriate in halophilic metagenomics are summarized. Finally, we discuss novel sequencing technologies that show promise in further propelling the halophile metagenomic field.
2. Shotgun Sequencing in Metagenomics {#sec2-genes-10-00220}
=====================================
Rapid developments in high-throughput DNA sequencing technologies since the early 2000s have propelled our understanding of not only single-organism genetics, but also microbiome community structure and function \[[@B12-genes-10-00220]\]. Marker gene (particularly the *16S rRNA* gene) amplicon sequencing has revealed the taxonomic composition of a given community through sequencing a small target of the community's DNA. In contrast, whole-metagenomic sequencing (WMGS) theoretically allows for reconstruction of the entire microbial community's DNA content. This has led to a number of important findings in microbiome research \[[@B12-genes-10-00220],[@B13-genes-10-00220],[@B14-genes-10-00220]\], as biologists have been able to thoroughly investigate microbial communities at the genetic level without the need for culturing \[[@B15-genes-10-00220]\].
However, while sequencing technologies are rapidly developing, producing complete genomes of all the microorganisms found in a community is currently unattainable due to low sequencing coverage of the less abundant organisms. Additionally, sequence repeats and regions of homology between organisms limits genome recovery from short-read data, resulting in incomplete assemblies. Instead, long contiguous pieces (contigs) of genomes are produced, ranging in length from 1 Kbp to 1 Mbp \[[@B16-genes-10-00220],[@B17-genes-10-00220]\]. These contigs then need to be grouped based on the genome they belong to, a process known as binning. It is only recently that binning has become reliable enough to produce reasonably high-quality metagenome-assembled genomes (MAGs). The ability to produce high-quality MAGs has in turn led to the discovery of thousands of novel organisms and has thus enabled many breakthroughs in characterizing the taxonomic and functional components of microbiomes \[[@B18-genes-10-00220],[@B19-genes-10-00220],[@B20-genes-10-00220]\].
Shotgun metagenomics offers tremendous advantages in recovering taxonomic and functional potential components of microbial communities, but sequencing costs deter some researchers from deploying this approach in their studies. The high average read coverage required for the assembly of a genome from shotgun reads \[[@B21-genes-10-00220]\] presents a major challenge for the assembly of less-abundant organisms in a metagenomic context. These highly diverse but underrepresented taxa often constitute significant proportions of microbial communities and play important roles in biome functioning \[[@B22-genes-10-00220]\]. Despite these challenges, WMGS carries tremendous benefits, empowering researchers to study previously unknown aspects of microbiomes. In particular, WMGS allows for the reconstruction of a given community's gene content, which has enabled ecologists to predict the functional potential of entire communities. This new angle of microbiome analysis has enabled the prediction of metabolic processes potentially present in communities and the study of community natural selection at the functional level \[[@B23-genes-10-00220],[@B24-genes-10-00220]\]. The possibility of studying the functional potential of any organism in a community means that our understanding of microbial genetics, dynamics, evolution, and function is no longer limited to cultured organisms. In many fields, such as human microbiome research, this has hailed a new era for research \[[@B25-genes-10-00220],[@B26-genes-10-00220]\].
2.1. Halophilic Microbiome Research Powered by Shotgun Metagenomics {#sec2dot1-genes-10-00220}
-------------------------------------------------------------------
Numerous breakthroughs in halophilic microbiome research have been enabled by WMGS \[[@B11-genes-10-00220]\] ([Table 1](#genes-10-00220-t001){ref-type="table"}). This sequencing approach reveals the taxonomic structure of microbiomes in high-salt environments with significantly less taxonomy-based biases than conventional ribosomal amplicon sequencing. Indeed, in conventional *16S rDNA* amplicon sequencing, primer choices can have a substantial impact on taxonomic distribution, and it is difficult to reliably amplify multiple domains of life, e.g., Bacteria and Archaea, with the same primer set \[[@B27-genes-10-00220]\]. While WMGS still has biases associated with G + C content, taxonomic annotation of shotgun reads usually results in more accurate and robust taxonomic profiles than amplicon sequencing \[[@B28-genes-10-00220]\]. This is particularly important in high-salt environments, where both Archaea and Bacteria are found in high abundance. For example, shotgun sequencing has provided more comprehensive taxonomic profiles of an endolithic halite community ([Figure 1](#genes-10-00220-f001){ref-type="fig"}B) and the discovery that a unique algae was present in this community, in addition to Halobacteria, Cyanobacteria, and other heterotrophic bacteria \[[@B29-genes-10-00220]\]. In the study of a hypersaline lake ([Figure 1](#genes-10-00220-f001){ref-type="fig"}D), the use of shotgun sequencing revealed the functional redundancy between taxonomically dissimilar communities constituted of both bacteria and archaea along a salinity gradient \[[@B30-genes-10-00220]\]. WMGS also provides DNA sequences that are not targeted by *16S rDNA* amplification, including eukaryotic genomes, DNA viruses, and extrachromosomal DNA, such as plasmids. For example, in a study investigating the community composition of saltern ponds ([Figure 1](#genes-10-00220-f001){ref-type="fig"}A) along a salinity gradient, the use of metagenomics allowed access to both the cellular and viral components of the community within the same sequencing datasets, revealing increased virus abundance at higher salt concentrations \[[@B31-genes-10-00220]\].
The reconstruction of viral genomes from hypersaline environments \[[@B32-genes-10-00220]\] using WMGS has resulted in improved characterization of this major component of halophilic microbiomes. Viruses take on the vital role of predators in many microbiomes and contribute to nutrient turnover with their lytic activity \[[@B33-genes-10-00220],[@B34-genes-10-00220]\]. While nonshotgun approaches have been used previously to characterize halophilic metaviromes \[[@B35-genes-10-00220],[@B36-genes-10-00220]\], high-throughput sequencing has empowered a more streamlined and unbiased recovery and annotation of viral sequences from various types of high-salt environments ([Table 1](#genes-10-00220-t001){ref-type="table"}). For example, an investigation of the metavirome in deep-sea haloclines ([Figure 1](#genes-10-00220-f001){ref-type="fig"}E) through nontargeted shotgun sequencing revealed the stratification of virus lineages along the salinity gradient of the haloclines, likely associated with their host specificity \[[@B37-genes-10-00220]\]. In WMGS from solar salterns ([Figure 1](#genes-10-00220-f001){ref-type="fig"}A), perfect alignments between the CRISPR | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION
============
Microtubules (MTs) are highly dynamic structures crucial for many cellular processes, such as cell division and cell polarity. MTs consist of α-β--tubulin heterodimer stacks ([@B51]) that generate a polarized structure. MT minus ends are usually stabilized at an MT-organizing center, whereas their plus ends are often highly dynamic, oscillating between phases of polymerization and depolymerization, a process known as dynamic instability ([@B32]; [@B11]). This instability triggers constant remodeling of the MT network in cells and is strictly regulated. An important mode of regulation involves MT-associated proteins (MAPs), which are distributed along the lattice ([@B3]) or restricted to growing MT plus ends ([@B1], [@B2]). A second important mode of regulation of MT dynamics involves factors controlling the accessibility of free tubulin heterodimers. For instance, OP18/stathmin prevents MT growth by sequestering soluble heterodimers, thereby decreasing the concentration of tubulin molecules available for polymerization ([@B7]; [@B20]).
Newly synthesized α- and β-tubulin monomers are labile molecules unable to fold and dimerize without the help of the cytosolic chaperonin and tubulin-binding cofactors (TBCs; [@B28]). In vitro, five TBCs (TBCA to TBCE) cooperate to trigger the release of functional α-β--tubulin dimers ([Figure 1A](#F1){ref-type="fig"}; [@B48], [@B46]). TBCs are thought to regulate MT dynamics by modulating the concentration of dimers available for polymerization ([@B28]). Although not essential in vitro, TBCB may enhance tubulin folding by transferring α-tubulin monomers to TBCE ([Figure 1A](#F1){ref-type="fig"}; [@B48], [@B46]).
{#F1}
Conversely, TBCB is also able to form a binary complex with TBCE that enhances the efficiency of TBCE to dissociate tubulin heterodimers in vitro. TBCB therefore has a potential role in the degradation or recycling of tubulin ([@B26]).
The function of TBCB in vivo is far less clear. In *Schizosaccharomyces pombe*, a knockout of TBCB results in a specific decrease of α-tubulin levels that correlates with an affected MT network and defects in cell division ([@B37]; [@B36]). In several mammalian cell types, however, TBCB knockdown does not affect tubulin levels nor does it destabilize the MT network ([@B50]; [@B27]). In fact, TBCB gene silencing, using RNA interference (RNAi), enhances MT density in amoeboid microglia and stimulates axonal growth in neuronal cells ([@B27]; [@B17]). These results are consistent with the implication of mammalian TBCB in tubulin heterodimer dissociation but raise the question of whether TBCB is required for tubulin dimerization and MT network formation in a metazoan organism. It is also unclear whether this protein is involved in cell division and polarity during development. Moreover, some studies have reported an association of TBCB with MTs and centrosomes ([@B18]; [@B50]). However, this distribution remains a matter of debate ([@B37]; [@B26]; [@B27]; [@B17]). A functional study of TBCB in a metazoan organism would therefore help to clarify the role of this protein in vivo.
*Drosophila* has been extensively used to study MT-dependent processes during development. During oogenesis, cyst divisions, oocyte differentiation, and establishment of the two main body axes of the future embryo all depend on MTs and polarized transport ([@B9]; [@B21]; [@B4]). MTs are also essential for the apico-basal polarity of follicle cells, the somatic epithelial cells surrounding the germ cells ([@B43]). However, molecules triggering MT network organization and remodeling during oogenesis remain largely unknown. TBCs, by modulating the concentration of tubulin dimers available for MT polymerization, are possible candidates for regulating specific cellular functions during oogenesis, as well as other developmental processes. Indeed, dTBCE, the only tubulin cofactor studied in flies, was shown to be required for the normal development of neuromuscular synapses ([@B24]).
The *Drosophila* genome contains a single TBCB orthologue, annotated as *CG11242* ([@B49]). Using mutant flies, we show that dTBCB is essential for viability, MT network integrity, and cell polarity but, surprisingly, not for cell proliferation. During oogenesis, loss of dTBCB causes delocalization of axis-determining mRNAs at midoogenesis and of PAR complex components in follicle epithelial cells. Throughout development, cell division can still occur, although probably with a considerable delay, as revealed in dividing neuroblasts. We therefore propose that dTBCB enhances tubulin dimer assembly in vivo, thereby regulating cell polarity and development of multicellular organisms.
RESULTS
=======
CG11242 encodes a *Drosophila* orthologue of human TBCB
-------------------------------------------------------
The *CG11242* gene encodes a protein that we named dTBCB on the basis of its high degree of sequence similarity to TBCB proteins from yeast, plants, and mammals ([@B46]; [@B18]; [@B37]; [@B12]). CG11242 and human TBCB share 61% similar residues, with 43% identical ([Figure 1, B--D](#F1){ref-type="fig"}). Similar to its human orthologue, dTBCB has three conserved structural motifs: a ubiquitin-like domain (Ubl), a coiled-coil, and a cytoskeleton-associated protein (CAP)-glycine rich (Gly) domain ([Figure 1, C and D](#F1){ref-type="fig"}). As a first step in investigating the in vivo function of dTBCB, we took advantage of genome-wide transgenic RNAi libraries in *Drosophila* combined with the Gal4/UAS system ([@B13]) to inactivate dTBCB. Ubiquitous overexpression of *UAS-RNAi-dTBCB* with *daughterless-Gal4* (*da-Gal4*) strongly reduced viability, especially at the pupal stage (43% lethality, *n* = 539; [Figure 2A](#F2){ref-type="fig"}). Western blot analysis with a polyclonal antibody that we raised against the full-length protein showed that this RNAi significantly reduces dTBCB levels at the larval stage ([Figure 2B](#F2){ref-type="fig"}). Most of the flies that reached adulthood harbored altered wings (91% of the flies, *n* = 305; [Figure 2, A and D](#F2){ref-type="fig"}). These particular effects of TBCB on pupal lethality and wing development were also obtained with *engrailed-Gal4* (*en-Gal4*) and *apterous-Gal4* (*ap-Gal4*) drivers ([Figure 2, A and D](#F2){ref-type="fig"}).
![*dTBCB* is an essential gene. (A) Pupal and adult phenotypes obtained with *UAS-RNAi-dTBCB* flies combined with various transgenic *Gal4* drivers: *da-Gal4* is expressed ubiquitously in wing disks, *en-Gal4* is expressed in the posterior compartment, and *ap-Gal4* is expressed in the dorsal compartment. (B) Western blot of *dTBCB* RNAi knockdown transgenic flies. Third-instar larval stage extracts showing dTBCB protein levels. *UAS-RNAi-dTBCB; da-Gal4*: larvae carrying one copy of *UAS-RNAi-dTBCB* and one copy of *da-Gal4*. (C) Western blot of stage 14 oocyte and second-instar larval stage extracts showing dTBCB protein levels. *dTBCB**^1^***/*dTBCB**^1^***: homozygous mutant larvae or germ-line clones. *dTBCB**^1^***/*Def*: larvae carrying one copy of *dTBCB**^1^*** over a deficiency removing the *dTBCB* locus. (B and C) Actin is used as | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
TEs and their abundant relics are found in the genome of almost all organisms and are classified into many distinct families based on sequence features and transposition mechanisms \[[@CR1]\]. DNA transposons generally exhibit cut-and-paste transposition, while retrotransposons use an RNA intermediate and thus transpose using a copy-and-paste mechanism. Retro-elements are further divided into two subclasses, depending on the presence or absence of Long Terminal Repeats (LTR). The biological role of TEs has been the subject of great controversy, and although they had been assimilated to "selfish" or "junk" DNA for some time \[[@CR2]\], they are now recognized as important factors in the evolution of genome structure and function \[[@CR3],[@CR4]\]. Indeed, it has been estimated that mobilization of LTR-retrotransposons is responsible for up to one tenth of spontaneous germ line mutations \[[@CR5]\] in laboratory mice. Similarly, mobilization of the human LINE1 (L1) non-LTR retrotransposon was found to account for 19% of the structural variation between individual genomes \[[@CR6]\], and has been linked to over a hundred human diseases \[[@CR7]\]. In plants, bursts of TE mobilization are responsible for the large differences in genome size that are sometimes observed between closely related species \[[@CR8],[@CR9]\].
With the advent of NGS technologies, it is now conceivable to re-sequence whole genomes in order to computationally characterize TE mobilization in a systematic way. However, this task is complicated by the inherently repetitive nature of TE sequences and by their frequent clustering in parts of the genome. Over the past years, several tools have been developed specifically for the detection of newly mobilized TEs in re-sequenced genomes \[[@CR10]-[@CR17]\]. However these tools have strong limitations. First, they all rely on prior annotation or knowledge of the TE sequence, making the detection of un- or mis-annotated TE impossible. In the same way, single transpositions involving several adjacent elements (composite events) and transposition of truncated TEs, as frequently observed in human genomes \[[@CR11]\], are difficult to identify using such methods. Moreover, many existing tools only deal with TEs that create target site duplication (TSD) during transposition events \[[@CR13],[@CR16],[@CR17]\], or are restricted to the analysis of the human genome (e.g. TEA \[[@CR11]\]) or only detect the presence/absence of a TE (e.g. T-lex \[[@CR12]\]). Finally, although several methods also attempt to identify the donor TE sequence, this identification is often limited to the subfamily level \[[@CR11],[@CR15]\]. Therefore, exhaustive and de-novo discovery of mobilization of un- or mis-annotated TEs can only be attempted using generic SV detection tools. Four broad types of such methods have been described over the past few years. They are based on the analysis of either (i) depth of coverage, (ii) split reads, (iii) discordant paired reads, or else on (iv) de novo assembly \[[@CR18]\]. Type (i) methods give a quantitative measure of the number of extra TE copies but do not provide information about their location. Type (ii) and (iii) methods identify one-sided events in the form of clusters of anomalously mapped reads, but they do not combine these one-sided events to produce *bona fide* TE insertions. Finally, the heavy computational burden of type (iv) methods, as well as their poor performance with repetitive sequences, preclude their use for large-scale detection of new TE insertions \[[@CR19]\]. More recently, several programs have attempted to adopt an integrative approach by combining results from several methods \[[@CR20],[@CR21]\], but their precision statistic is still typically low when considering specific types of structural variation (See [Methods](#Sec7){ref-type="sec"}). Major drawbacks of these general-purpose tools are the fact that they produce a high number of non-TE predictions, and that none of these tools can identify the donor TE and provide the complete sequence of transposed copies.
Here, we present TE-Tracker, a new method dedicated to the systematic and robust identification of newly mobilized TEs in genomes resequenced using Illumina paired-end fragments. TE-Tracker is able to detect transposition of composite, un- or mis-annotated TEs. Moreover TE-Tracker includes a donor-scoring feature, which makes it able to detect both the identity and destination of TEs. We use TE-Tracker to provide a comprehensive view of transposition events induced by loss of DNA methylation in Arabidopsis.
Results and discussion {#Sec2}
======================
The TE-Tracker pipeline {#Sec3}
-----------------------
TE-Tracker is divided into three independent modules: *Eris*, *Leto* and *Metis* (Figure [1](#Fig1){ref-type="fig"}). TE-Tracker starts with the *Eris* module detecting discordant read pairs (Figure [2](#Fig2){ref-type="fig"}a), i.e. pairs that map in unexpected orientation or location with respect to the preparation and insert size, which can constitute evidence of a transposition event. First, alignments are filtered based on mapping quality and then a random sample of the read pairs is used to estimate the insert size distribution. Median and median absolute deviation (MAD) thresholds are used to mark as discordant the pairs for which the read mates map with an unexpected insert size (see [Methods](#Sec7){ref-type="sec"}). Pairs mapping on different chromosomes or in an unexpected orientation with respect to the sequencing library are flagged discordant as well. When multiple mappings are available for either mate of one pair, the pair is considered discordant only if all combinations of mate mappings match the aforementioned discordance criteria; in which case all potential mappings are recorded as if they were unique mappings from separate read pairs (see [Methods](#Sec7){ref-type="sec"}).Figure 1**TE-Tracker overview, main steps of the TE-Tracker pipeline.**Figure 2**TE-Tracker main algorithms. a**. Discordant pairs around insertion breakpoint. Sequenced reads around a newly inserted TE-copy (top half) produce discordant read mappings when aligned onto the reference sequence where the newly inserted copy only exists at the locus of origin (bottom half). The thin black line represents the sequenced DNA fragment, the thick black line represents a transposon of interest. Yellow and orange arrows represent the left and right extremities of the insertion breakpoint, linked arrows represent paired-end reads. Grey reads will be normally mapped, while colored reads will be mapped discordantly, the color indicates a type of discordance (left mate on the acceptor and right on the donor and vice-versa). **b**. Clustering of discordant pairs. Discordant reads of the same type are isolated and sorted (left half). Both ends must be sufficiently close for two read pairs to be clustered together, but sorting of the left end, combined with a random insert size results in different thresholds for clustering both ends. Pairs are clustered according to the Single-Linkage method ([see Methods](#Sec7){ref-type="sec"}), which represent read pairs as edges on a graph (right half). A point is added to a cluster if its distance to any other point already in the graph meets both thresholds when projected on both axes. **c**. Cluster merging. Local drops in read coverage break clusters, corrupting insertion signals. A proximity threshold is applied to merge neighboring clusters of the same type and orientation. Local coverage is represented by a grey curve on top of the sequence, while linked colored arrows represent clusters of read pairs. **d**. Calling. The four types of transposition events detected by TE-Tracker along with their associated cluster signatures, with an emphasis on the overlap condition used to assemble clusters with compatible signatures into bona fide events.
Once discordant read pairs are extracted, they are clustered using the *Leto* module. The aim of this step is to regroup discordant pairs that might support the same transposition event while discarding lone pairs that are most certainly due to mapping errors. Clustering is done using single-linkage clustering in the mate-position space. Pairs are classified according to read orientation as well as the chromosome each mate maps on; hence for every such couple of chromosomes, each discordant pair can be represented in a two-coordinate system, making it easy to compute the respective distance between the right and left mates of any two read pairs. Clusters are built by adding pairs that are close enough to any pair already in a cluster. Because the read pairs are sorted by position, and because only the first encountered mate is ordered when sorting paired-end reads, the distance requirements for the clustering differ for both dimensions. Intuitively, the distance requirement on the ordered mate side is smaller than on the unordered mate side, since it is determined by the coverage distribution, whereas in the latter case distance is influenced by the insert size distribution, which typically has a larger variance (Figure [2](#Fig2){ref-type="fig"}b). These two values constitute the main parameters of the TE-Tracker software. In order to maximize the number of detected events, *Leto* will scan several values for both of these clustering parameters and merge clusters that are found more than once. Like discordant pairs, clusters are then classified into several types (deletion, insertion, duplication, inversion and translocation signatures*)*, according to their orientation and mapping chromosome for each mate (See [Methods](#Sec7){ref-type="sec"}).
Clustering algorithms are generally memory-intensive when run over a large number of points; in particular, it is known that the optimal performance of the single-linkage algorithm used in | {
"pile_set_name": "PubMed Central"
} |
As the adoption of electronic health records (EHRs) has made it easier to access and aggregate clinical data, there has been growing interest in conducting research with data collected during the course of clinical care.[@b1] [@b2] The Natonal Institutes of Health has called for increasing the reuse of electronic records for research, and the clinical research community has been actively seeking methods to enable secondary use of clinical data.[@b3] EHRs surpass many existing registries and data repositories in volume, and the reuse of these data may diminish the costs and inefficiencies associated with clinical research. Like other forms of retrospective research, studies that make use of EHR data do not require patient recruitment or data collection, both of which are expensive and time-consuming processes. The data from EHRs also offer a window into the medical care, status, and outcomes of a diverse population that is representative of actual patients. The secondary use of data collected in EHRs is a promising step towards decreasing research costs, increasing patient-centered research, and speeding the rate of new medical discoveries.
Despite these benefits, reuse of EHR data has been limited by a number of factors, including concerns about the quality of the data and their suitability for research. It is generally accepted that, as a result of differences in priorities between clinical and research settings, clinical data are not recorded with the same care as research data.[@b4] Moreover, Burnum[@b5] stated that the introduction of health information technology like EHRs has led not to improvements in the quality of the data being recorded, but rather to the recording of a greater quantity of bad data. Due to such concerns about data quality, van der Lei[@b6] warned specifically against the reuse of clinical data for research and proposed what he called the first law of informatics: '\[d\]ata shall be used only for the purpose for which they were collected'.
Although such concerns about data quality have existed since EHRs were first introduced, there remains no consensus as to the quality of electronic clinical data or even agreement as to what 'data quality' actually means in the context of EHRs. One of the most broadly adopted conceptualizations of quality comes from Juran,[@b7] who said that quality is defined through 'fitness for use'. In the context of data quality, this means that data are of sufficient quality when they serve the needs of a given user pursuing specific goals.
Past study of EHR data quality has revealed highly variable results. Hogan and Wagner,[@b8] in their 1997 literature review, found that the correctness of data ranged between 44% and 100%, and completeness between 1.1% and 100%, depending on the clinical concepts being studied. Similarly, Thiru *et al*,[@b9] in calculating the sensitivity of different types of EHR data in the literature, found values ranging between 0.26 and 1.00. In a 2010 review, Chan *et al* [@b10] looked at the quality of the same clinical concepts across multiple institutions, and still found a great deal of variability. The completeness of blood pressure recordings, for example, fell anywhere between 0.1% and 51%. Due to differences in measurement, recording, information systems, and clinical focus, the quality of EHR data is highly variable. Therefore, it is generally inadvisable to make assumptions about one EHR-derived dataset based on another. We need systematic methods that will allow us to assess the quality of an EHR-derived dataset for a given research task.
Our review primarily differs from those highlighted above in its focus. The previous reviews looked at data quality findings, while ours instead focuses on the methods that have been used to assess data quality. In fact, the earlier reviews were explicitly limited to studies that relied on the use of a reference standard, while we instead explore a range of data quality assessment methods. The contributions of this literature review are an empirically based conceptual model of the dimensions of EHR data quality studied by clinical researchers and a summary and critique of the methods that have been used to assess EHR data quality, specifically within the context of reusing clinical data for research. Our goal is to develop a systematic understanding of the approaches that may be used to determine the suitability of EHR data for a specific research goal.
Methods
=======
We identified articles in the literature by performing a search of the literature using standard electronic bibliographic tools. The literature search was performed by the first author on PubMed in February of 2012. As observed by Hogan and Wagner[@b8] in their literature review, there is no medical subheadings (MeSH) term for data quality, so a brief exploratory review was performed to identify relevant keywords. The final list included 'data quality', 'data accuracy', 'data reliability', 'data validity', 'data consistency', 'data completeness', and 'data error'. The MeSH heading for EHR was not introduced until 2010, so the older and more general MeSH heading 'medical record systems, computerized' was used instead. The phrases 'EHR', 'electronic medical record', and 'computerized medical record' were also included in order to capture articles that may not have been tagged correctly. We searched for articles including at least one of the quality terms and at least one of the EHR terms. Results were limited to English language articles. The full query is shown below."('data quality' OR 'data accuracy' OR 'data reliability' OR 'data validity' OR 'data consistency' OR 'data completeness' OR 'data errors' OR 'data error') AND (EHR OR electronic medical record OR computerized medical record OR medical records systems, computerized \[mh\]) AND English\[lang\]"
This search produced 230 articles, all of which were manually reviewed by the first author to determine if they met the selection criteria. In particular, the articles retained for further review: (1) included original research using data quality assessment methods; (2) focused on data derived from an EHR or related system; and (3) were published in a peer-reviewed journal. Articles dealing with data from purely administrative systems (eg, claims databases) were not included. These inclusion criteria resulted in 44 relevant articles. Next, we performed an in-depth ancestor search, reviewing the references of all of the articles in the original pool of 44. This allowed us to identify an additional 51 articles, resulting in a final pool of 95 articles meeting our inclusion criteria that were then used to derive results in this study.
From each article we abstracted the features of data quality examined, the methods of assessment used, and basic descriptive information including about the article and the type of data being studied. Through iterative review of the abstracted data, we derived broad dimensions of data quality and general categories of assessment strategies commonly described in the literature. Finally, we reviewed the 95 articles again, categorizing every article based on the dimension or dimensions being assessed, as well as the assessment strategies used for each of those dimensions.
Before beginning this analysis, we searched for preexisting models of EHR data quality, but were unable to find any. We decided that the potential benefits of adapting a data quality model from another field were outweighed by the risks of approaching our analysis through the lens of a model that had not been validated in the area of EHR data quality. Furthermore, using an existing model to guide analysis is a deductive approach, which has the potential to obscure information contained in the data.[@b11] By imposing an existing model from a different discipline, we would have run the risk of missing important findings. Therefore, we decided to use an inductive, data-driven coding approach. This approach provides advantages over the deductive approach by allowing us better coverage of the dimensions and methods of data quality assessment.
Results
=======
The majority of papers reviewed (73%) looked at structured data only, or at a combination of structured and unstructured data (22%). For our purposes, unstructured data types include free-entry text, while structured data types include coded data, values from pre-populated lists, or data entered into fields requiring specific alphanumeric formats.
Ignoring variations due to lexical categories and negation, the articles contained 27 unique terms describing dimensions of data quality. Features of data quality that were mentioned or described but not assessed were not included in our analysis. We grouped the terms together based on shared definitions. A few features of good data described in the literature, including sufficient granularity and the use of standards, were not included in our analyses. This decision was made due to the limited discussion of these features, the fact that they could be considered traits of good data practice instead of data quality, and because no assessment methods were described. Overall, we empirically derived five substantively different dimensions of data quality from the literature. The dimensions are defined below.
- Completeness: Is a truth about a patient present in the EHR?
- Correctness: Is an element that is present in the EHR true?
- Concordance: Is there agreement between elements in the EHR, or between the EHR and another data source?
- Plausibility: Does an element in the EHR makes sense in light of other knowledge about what that element is measuring?
- Currency: Is an element in the EHR a relevant representation of the patient state at a given point in time?
The list of data quality terms and their mappings to the five dimensions described above are shown in [table 1](#tbl1){ref-type="table"}. The terms chosen to denote each of the dimensions were the clearest and least ambiguous from each of the groups. There was a great deal of variability and overlap in the terms used to describe each of these dimensions. 'Accuracy', for example, was sometimes used as a synonym for correctness, but in other articles meant both correctness and completeness. The dimensions themselves, | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-nutrients-09-01140}
===============
Early nutrition is crucially important for children to survive, grow and develop into healthy adults who can lead rewarding lives and productively contribute to their communities, and improving nutrition among young children has widely been recognized as an international priority \[[@B1-nutrients-09-01140]\]. Nonetheless, almost half of all childhood deaths (those under age 5) continue to be linked to nutritional causes \[[@B2-nutrients-09-01140]\]. In addition to morbidity and mortality, the impacts of poor nutrition, both in the form of under- and overnutrition, include strong, negative intergenerational health consequences for descendants \[[@B3-nutrients-09-01140]\]. Alongside maternal nutrition and intrauterine exposures \[[@B4-nutrients-09-01140]\], nutritionally-based caring behaviors of families, including breastfeeding and complementary feeding, form the basis of child nutrition. As a result, the potential impact of improved dietary practices on child nutrition has been extensively studied and subsequently promoted for potential to greatly improve health \[[@B5-nutrients-09-01140],[@B6-nutrients-09-01140],[@B7-nutrients-09-01140],[@B8-nutrients-09-01140]\].
The United Nations Children's Fund (UNICEF) and the World Health Organization (WHO) concur that optimal nutrition practices for childhood include early initiation of breastfeeding, exclusive breastfeeding for the first 6 months of life, followed by the addition of nutritionally adequate, safe, and appropriate complementary foods with continuation of breastfeeding for 1 year and longer \[[@B9-nutrients-09-01140],[@B10-nutrients-09-01140]\]. Markers of appropriate infant and young child feeding include these practices, as well as the timely introduction of solid and semi-solid foods, adequately frequent provision of daily meals, dietary diversity, and consumption of iron rich foods. In response to the need for simple, practical indicators of appropriate feeding practices in children aged 6--23 months, WHO published a set of population-level indicators that could be obtained from large-scale survey data on feeding practices in varied international settings \[[@B11-nutrients-09-01140]\].
However, characterizing feeding practices through quantitative methods such as large-scale surveys can be challenging, particularly because these practices constitute multidimensional and often interrelated behaviors rooted in family systems and socioeconomic conditions, and feeding patterns also change rapidly within short intervals of age \[[@B12-nutrients-09-01140],[@B13-nutrients-09-01140]\]. Nonetheless, information on infant and young child feeding (IYCF) practices is required to improve nutrition and health during the first 2 years of life. Over the last decade, numerous studies on improvement of nutrition-related behaviors for infants and young children have relied on qualitative research methods, well-suited to exploring complex behaviors and their underlying psychosocial and cultural drivers, to investigate infant and young child feeding \[[@B14-nutrients-09-01140],[@B15-nutrients-09-01140],[@B16-nutrients-09-01140],[@B17-nutrients-09-01140],[@B18-nutrients-09-01140]\]. This body of research is likely to contain useful information to further the understanding of behavioral approaches to improve child nutrition. A comprehensive summary of qualitative data on feeding practices in this age group from lower-income settings, including a synthesis of barriers and facilitators to recommended practices, is currently lacking in the biomedical literature.
The primary objective of the proposed study was to systematically review qualitative literature related to family experiences (particularly parental ones) of infant and young child feeding in low-income countries, synthesizing information on the barriers and facilitators that may relate to interventions to impact nutrition, survival, growth and development. The results provide an overview of qualitative studies relating parental perspectives on infant and child dietary patterns, in the interest of providing insights for developing, improving, and scaling nutrition interventions.
2. Materials and Methods {#sec2-nutrients-09-01140}
========================
This systematic review was registered with the International Prospective Register of Systematic Reviews (PROSPERO): registration number CRD42016035677. The review followed guidelines from the Enhancing Transparency in Reporting the Synthesis of Qualitative Research (ENTREQ) statement. Due to the exclusive focus on qualitative research, the review employed the ENTREQ guidelines \[[@B19-nutrients-09-01140]\] in lieu of the Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines, which are more specific to the requirements of quantitative literature reviews \[[@B20-nutrients-09-01140]\]. The [Supplementary Material](#app1-nutrients-09-01140){ref-type="app"} to this article contains the full ENTREQ checklist.
Studies were only reviewed if their results were directly obtained from participants who were parents or close family members of an infant or young child (0--2 years of age) at the time of the study. Family members, for the purposes of this review, were defined to include mothers, fathers or other caregivers living in the child's household who routinely engage in infant or young child feeding. Infant and child feeding practices were defined as all actions taken to meet the physiological nutritional needs of children in this age group, including but not limited to: breast feeding; introduction of solid, semi-solid, and/or family foods (known as complementary feeding); and continued breastfeeding of children alongside provision of solid/semi-solid food.
2.1. Inclusion and Exclusion Criteria {#sec2dot1-nutrients-09-01140}
-------------------------------------
Included studies used widely accepted qualitative data collection methods, with well-described methodology, including for example: interviews, focus groups, direct observation, and participatory action research. Included studies also needed to have provided a clear description of recognized qualitative data analysis methods (e.g., Grounded Theory, narrative analysis, content analysis, thematic analysis).
Excluded studies were those for which it was difficult to extract qualitative data, e.g., mixed methods studies without clearly labeled data, or studies in settings where perceptions of parents or caregivers around infant and young child feeding could not be clearly identified, such as summaries or aggregated data. Commentaries, protocols, and systematic reviews were not included in the analysis. Additionally, as the focus was on research from resource limited settings, studies from countries other than those defined by the World Bank as low-income countries and lower-middle income countries (which have a Gross National Income per capita of less than \$4125) were excluded \[[@B21-nutrients-09-01140]\].
2.2. Search Strategy {#sec2dot2-nutrients-09-01140}
--------------------
The following electronic databases were considered to be the most relevant for the topic and were searched: MEDLINE (PubMed); Embase; Cumulative Index to Nursing and Allied Health Literature (CINAHL: EBSCOhost). A health sciences librarian was consulted in the development of the database searching strategy.
The initial search strategy was developed for MEDLINE and then adapted for the other databases. Medical Subject Headings were initially used followed by free-text terms using controlled vocabulary (see [Appendix A](#app2-nutrients-09-01140){ref-type="app"} for a detailed description of the search strategy). Results were restricted to English language publications from the last 10 years, due to potential difficulties in translating and interpreting foreign language qualitative data by native English-speaking reviewers, and to ensure that the review identifies literature relating to the most current infant and young child feeding practices. In addition, reference lists of included studies were manually searched to identify any additional studies that fit the inclusion criteria.
The included grey literature was initially identified through listing of relevant websites to search for organizations working in nutrition in lower-income countries (in consultation with experts working in the field who use and disseminate data through websites for related nutrition research). A custom search engine was created using Google Custom Search. Within the Custom Search Engine, the relevant websites were searched using search strategies adapted from those used in the databases to reflect relevant keywords related to qualitative studies of infant and young child feeding practices.
The review also included documents identified through a manual review of organizational reports and reports from relevant meetings related to nutrition of young children in low income countries. Results were similarly limited to publications in English from the last 10 years.
A flow diagram using PRISMA guidelines for reporting of systematic reviews is presented in [Figure 1](#nutrients-09-01140-f001){ref-type="fig"} in reporting of the selection process and results \[[@B20-nutrients-09-01140]\]. For organization of initial search results, Endnote reference management software (EndNoteX8, Clarivate Analytics, Boston, MA, USA) was used, and results of searches imported to the software. At the first stage, duplicates and irrelevant studies were removed. Two independent reviewers then screened study titles and abstracts for suitability against inclusion and exclusion criteria. The decision to include or exclude a study was required to be agreed on by both reviewers. If after consultation a decision was not reached by the two reviewers, a third reviewer made the final decision.
2.3. Data Extraction {#sec2dot3-nutrients-09-01140}
--------------------
For organization of extracted data, a unified matrix was utilized to record specific characteristics of included studies. Extracted data included: reference details (author, year, title, journal/publisher); country/region of study; objectives or aims of the study; study design including methodological approaches (e.g., interviews/focus groups) and conceptual basis underlying the study (e.g., Grounded Theory); analysis method(s); sampling methodology and sample size; and initial assessment of the methodological limitations of the study. The initial results of the selection process and data abstraction are | {
"pile_set_name": "PubMed Central"
} |
Duchenne muscular dystrophy (DMD) is the commonest form of muscular dystrophy in humans^(^[@ref1]^)^ and it is inherited from a recessive X-linked gene, affecting 1 in 3500 newborn males^(^[@ref2]^)^. The disease involves progressive muscle degeneration until death at about 20 years of age, usually caused by cardiorespiratory events^(^[@ref3]^)^. For researching new therapies to improve the quality of life or discover an effective treatment for those affected by this disease, the use of animal models has major importance^(^[@ref4]^)^.
There are many animal models for studying DMD, among them, the MDX mouse and the golden retriever muscular dystrophy (GRMD) dog; however, the GRMD dog is the most appropriate^(^[@ref5]^)^ because, like in humans, it is a spontaneously occurring disease that progressively causes degeneration of muscle fibres^(^[@ref6]^)^.
Additionally, adult GRMD dogs show phenotypic characteristics similar to boys affected by DMD, such as decreased body weight and muscle quantity^(^[@ref7]^)^, differently from the mice, where the phenotype is different from the human phenotype of the same disease^(^[@ref8]^)^.
Muscle atrophy is frequently observed in patients with insulin deficiency, which leads to decreased rate of protein synthesis in skeletal muscle^(^[@ref9]^,^[@ref10]^)^. Skeletal muscle is also responsible for approximately 40 % of the total body mass and plays a major role in energy balance, since it stimulates the uptake, disposal and storage of glucose^(^[@ref11]^)^.
Glucose is the main energy source for cells, which may be obtained directly from the food or converted from other metabolites through gluconeogenesis^(^[@ref12]^)^. In single-stomached animals like dogs, dietary starches are hydrolysed enzymically in the gastrointestinal tract and the resulting glucose is absorbed and transported to the liver where the processes of glycolysis (postprandial conditions) or gluconeogenesis (fasting conditions) occur. The metabolic activities of this tissue, along with the hormonal signalling of glucagon and insulin released by α and β cells of pancreas, respectively, effectively regulate blood glucose homeostasis^(^[@ref13]^)^.
The values of plasma glucose concentrations are used as indicators of carbohydrate metabolism and reflect the balance between glucose production and uptake^(^[@ref14]^)^. Fructosamine is a glycated plasma protein that can be used as a carbohydrate metabolism indicator since it reflects the glycaemic behaviour beyond that observed by plasma glucose at the time of collection^(^[@ref15]^)^.
Insulin is a multifunctional hormone. It is related to the anabolic and anticatabolic processes in mammals^(^[@ref16]^)^ and plays two other important functions: stimulation of carbohydrate and lipid metabolism for induction of cellular enzymes, especially in hepatocytes, and transportation of glucose across plasma membranes of insulin-sensitive cells, mainly in fat cells and skeletal muscle.
The homeostasis model assessment (HOMA) index, a widely used tool in human medicine as an indicator of insulin sensitivity, can properly reflect how animals metabolise their diet. Evaluating the results obtained by this index enables possible correction of food management for these animals. Previous studies in dogs have already used the same methodology^(^[@ref17]^--^[@ref20]^)^ and formed the basis for the interpretation of these results.
Considering the importance of body musculature on glucose metabolism and the existence of metabolic and endocrine alteration in some muscular dystrophies, the present study aimed to evaluate parameters related to carbohydrate metabolism in golden retriever dogs that are carriers or affected by GRMD, since information in the literature is currently unavailable.
Experimental methods {#sec1}
====================
All procedures were approved by the Ethics and Animal Welfare Committee (protocol no. 13.1.1505.74.7) of the College of Animal Science and Food Engineering, University of São Paulo.
Animals and experimental design {#sec1-1}
-------------------------------
The study was performed at a kennel located at the Department of Anatomy of Domestic and Wild Animals of the College of Veterinary Medicine and Animal Science at the University of São Paulo.
The dogs were chosen according to the kennel availability and randomised into three experimental groups: healthy/control (G1), carrier GRMD females (G2) and dogs affected by GRMD (G3), totalling six animals per experimental group.
The affected and carrier animals underwent a periodic clinical evaluation every 15 d and were weighed once per week. The groups of carrier females and controls presented ideal body condition score (4 or 5) whereas affected dog scores were under or equal to 4, according to Laflamme^(^[@ref21]^)^.
The classification of the GRMD carriers or affected animals was confirmed by performing biochemical, immunohistochemical and molecular diagnostic methods, which consisted of detecting a high concentration of the creatine kinase isoenzyme and a lack of dystrophin protein^(^[@ref22]^,^[@ref23]^)^ at the moment of birth by collecting blood samples from the umbilical cord. The tests were repeated for confirmation after 30 d.
Diet {#sec1-2}
----
During the study, all animals received the same commercial dry diet (Royal Canin Medium Junior; Royal Canin Brazil), and were allowed 7 d for adaptation to the diet before the start of data collection. The amount of food offered to each animal was calculated according to National Research Council^(^[@ref24]^)^ recommendations, using the equation: 95 × (body weight)^0·75^ = kcal/d (397 × (body weight)^0·75^ = kJ/d). The food was ground and hydrated with warm water and offered as a paste for all animals as a way to standardise the management employed for the affected animals due to their difficulty in seizing and swallowing.
Postprandial response test {#sec1-3}
--------------------------
These tests were performed after 12 h of fasting and each dog was aseptically catheterised using a peripheral intravenous catheter (Becton Dickson). Blood samples were taken before feeding (baseline sample, time 0) and 5, 10, 15, 30, 60, 120, 180, 240, 300 and 360 min after feeding according to Carciofi *et al.*^(^[@ref25]^)^ and Brunetto *et al.*^(^[@ref26]^)^. Samples destined for glucose analysis were collected in fluoridated EDTA tubes, and samples for fructosamine and insulin analysis were collected in tubes without anticoagulant. Fructosamine was analysed only at time 0. All samples were immediately centrifuged and frozen until use.
Laboratory analysis {#sec1-4}
-------------------
Plasma glucose concentrations were determined by the glucose oxidase test (Glucose assay; Randox Laboratories Ltd), using semi-automatic glucose equipment (Randox Laboratories Ltd). Plasma fructosamine concentrations were determined by the kinetic method of fixed time (Frutosamina test; Labtest Diagnóstica S.A.) in the Multiuser Laboratory of the College of Veterinary Clinics of Food Engineering and Animal Science at the University of São Paulo. Insulin analysis was performed using human insulin containing ^125^I as a tracer hormone and 100 % of specificity for canine insulin (Human Insulin Specific; Millipore Corporation) at Genese laboratory (São Paulo, Brazil).
Calculations and statistical analysis {#sec1-5}
-------------------------------------
The glucose increments were calculated by subtracting the baseline value for each animal from the values obtained during the 360 min of collections. The AUC were calculated for the glucose concentrations in the total range, which represents the 360 min of collections, and also for the following ranges: 0 to 60 min (AUC 0--60); from 0 to 120 min (AUC 0--120); from 0 to 240 min (AUC 0--240); from 60 to 120 min (AUC 60--120); from 60 to 240 min (AUC 60--240), and 60 to 360 min (AUC 60--360) after food consumption. Those areas were calculated using the mean blood glucose values at each time for all animals in each group, and AUC were obtained for G1, G2 and G3 by the trapezoidal numerical integration method. The results were analysed using GraphPad Prism (GraphPad Software)^(^[@ref27]^)^. Evaluation of insulin sensitivity was calculated by the HOMA (homeostasis model assessment) index which takes into account the paired basal insulin with basal glucose levels, according to the equation: HOMA score = (basal serum insulin (mU/l) × (basal plasma glucose (mg/dl))/405 ((basal serum insulin (mU/l) × (basal plasma glucose (mmol/l))/22·5)^(^[@ref19]^)^, and animals are considered insulin resistant for HOMA values higher than 2·4.
The obtained results were analysed by Statistical Analysis System software (SAS Institute Inc.)^(^[@ref28]^)^, and were previously checked for normality of residues by the Shapiro--Wilk test and the variances were compared by an *F* test. Basal, minimum, mean and maximum glucose, basal insulin and fructosamine, HOMA index and ages were analysed using PROC GLM and experimental groups were compared by a Tukey test. For assessing postprandial response, statistical analyses were conducted in PROC MIXED with the definition of the matrices used based on the value of the Akaike information criterion, considering effects of group, time and interaction between groups and time as fixed effects and animal within the group as a random effect. The significance level was set at *P | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
Treatment with immune checkpoint inhibitors (ICIs) has transformed the field of oncology, improving long-term survival in patients across several types of cancer.[@R1] The most commonly used ICIs target cytotoxic T-lymphocyte-associated antigen 4 (CTLA-4), programmed cell death protein 1 (PD-1), and PD-ligand 1 (PD-L1).[@R3] However, these agents are associated with a distinct spectrum of side effects resulting from activation of the immune system, termed immune-related adverse events (irAEs).[@R6]
irAEs can potentially affect any organ system, but most commonly involve the skin, gastrointestinal tract, lungs, liver, and endocrine glands.[@R7] The incidence of irAEs has been well characterized in the literature with the median time to onset of 2--3 months after initiation.[@R10] Nonetheless, delayed or latent irAEs have been reported months or even years after initiating therapy with onset extending beyond treatment discontinuation.[@R12] In clinical trials, the analysis of ICI safety in terms of irAEs is generally reported as incidence proportions. Incidence proportion is typically calculated by crude rates, that is, the ratio of the number of patients who developed the specific adverse event at any point in time to the total number of patients in the cohort. A simple descriptive listing of irAEs in clinical trials is inadequate for modern immunotherapy treatments because this method does not account for the toxicity profile of ICIs conditioned over time. To date, there are limited studies that investigate and quantify the risk of irAEs over time in patients with cancer treated with ICIs.[@R10] Accurate estimates of this risk will guide oncologists and patients to make decisions regarding treatment strategy and monitoring.
Here, we performed a retrospective study that evaluated, for the first time, the cumulative incidence of irAEs in patients with metastatic urothelial carcinoma (mUC) and metastatic renal cell carcinoma (mRCC) treated with ICIs. Additionally, we investigated the concept of conditional toxicity, how the incidence of irAE occurrence may be dynamic and may change over time, as well as the risk factors associated with the development of irAEs.
Methods {#s2}
=======
Data Collection {#s2-1}
---------------
We conducted a retrospective medical record review of patients with mUC and mRCC who received ICI-based therapy at the Dana Farber Cancer Institute (DFCI) between July 2013 and October 2018. All patients had a histologically confirmed UC or RCC. Patients treated with a CTLA-4 inhibitor and/or PD-1/PD-L1 inhibitor were eligible. Data regarding clinicopathological features and treatment history were extracted. irAEs were defined as adverse events with a potential immunological basis that medical oncologists could recognize objectively. The patients were divided into two groups based on the presence or absence of irAEs within 1 month of each dose of ICI.
Toxicities were graded using the Common Terminology Criteria for Adverse Events (CTCAE) V.5.0. We noted the irAEs and grade reported by the medical professional who encountered a patient experiencing acute irAE. If the grade was not reported, we assigned it based on a thorough review of the medical record describing the events.
Statistical analysis {#s2-2}
--------------------
Descriptive statistics were used to summarize patient characteristics and outcomes. Time to irAE was defined as the amount of time elapsed from the date of ICI initiation to the development of irAE. The monthly incidence of irAEs was calculated for each 30-day period and was defined as the ratio of the number of patients with an irAE to the number of patients alive without irAE at the start of each month. Similarly, the incidence of irAEs at landmark times was defined as the ratio of the number of patients with an irAE at any time following the landmark time to the number of patients alive at each landmark date who had not experienced a prior irAE. Cumulative incidence was calculated to evaluate the time to the first occurrence of an irAE accounting for the competing risk of death. We used the Fine and Gray method to identify variables associated with irAE development: age at the start of ICI, sex (female vs male), cancer type (mUC vs mRCC), ECOG PS (0 vs ≥1), lung metastases (yes vs no), lymph node metastases (yes vs no), bone metastases (yes vs no), liver metastases (yes vs no), brain metastases (yes vs no), other metastases (yes vs no), ICI type (ICI monotherapy vs dual ICI regimens vs ICI plus another class of agents), line of ICI (first line vs second or more), and type of ICI (PD-L1 inhibitors vs PD-1 inhibitors). A multivariable model was constructed using forward stepwise selection. All tests were two-sided and a p-value of \<0.05 was considered statistically significant. Statistical analyzes were performed using SAS V.9.2 or R V.3.50 ([www.r-project.org](www.r-project.org)).
Results {#s3}
=======
Patient characteristics {#s3-1}
-----------------------
A total of 470 patients received ICIs between July 2013 and October 2018: 271 mRCC (57.7%) and 199 mUC (42.3%). Baseline patient characteristics are reported in [table 1](#T1){ref-type="table"}. The median follow-up was 11.9 months (maximum=8.8 years). The cohort comprised 342 (72.8%) men and 128 (27.2%) women, with a median age of 65 years (range: 22--91). Overall, 341 (72.5%) patients received ICI monotherapy, 86 (18.3%) patients received ICI plus another class of agents (including investigational immunotherapy), and 43 (9.2%) patients received a dual ICI regimen. Most (n=312, 660.2%) were treated with anti-PD1-based therapy, whereas a third (n=159,330.8%) received an anti-PD-L1- based regimen. The median duration of therapy was 4.0 (95% CI: 3.6 to 5.0) months. Two hundred and seven (44%) patients received ICI as first-line therapy and 263 (56%) received as second or later line therapy. Three hundred and fifty patients (74.5%) discontinued ICI due to radiological progression (n=226, 64.6%), clinical and radiological progression (n=43, 12.3%), toxicity (n=55, 15.7%), clinician preference (n=19, 5.4%), patient preference (n=3, 0.9%), or unknown reasons (n=4, 1.1%).
######
Baseline patient characteristics (N=470)
Patients, n (%) mRCC cohort mUC cohort
----------------------------- ----------------- --------------- ---------------
Age at start of ICI (years)
Mean (SD) 64.8 (11.6) 61.7 (10.9) 69.0 (11.1)
Median (min, max) 65 (22 to 91) 62 (22 to 85) 69 (26 to 91)
Sex
Male 342 (72.8) 201 (74.2) 141 (70.9)
Female 128 (27.2) 70 (25.8) 58 (29.2)
Line of ICI
First 207 (44.0) 113 (41.7) 94 (47.2)
Second or more 263 (56.0) 158 (58.3) 105 (52.8)
ECOG PS
0 149 (32.4) 78 (28.8) 71 (37.6)
1 242 (52.6) 156 (57.6) 86 (45.5)
2 65 (14.1) 37 (13.7) 28 (14.8)
3 4 (0.9) \_ 4 (2.1)
Site of metastasis
Lung 257 (54.7) 176 (64.9) 81 (40.7)
Lymph nodes 393 (83.6) 211 (77.9) 182 (91.5)
Bone 119 (25.3) 81 (29.9) 38 (19.1)
Liver 112 (23.8) 67 (24.7) 45 (22.6)
Brain 14 (3.0) 12 (4.4) 2 (1.0)
Other 104 (63.8) 104 (38.4) 59 (29.7)
Type of ICI
PD-1 inhibitors\* 312 (66.2) 197 (72.7) 114 (57.3)
PD-L1 inhibitors† 159 (33.8) 74 (27.3) 85 (42.7)
ICI type
ICI monotherapy 341 (72.5) 157 (57.9) 184 (92.5)
ICI+ICI | {
"pile_set_name": "PubMed Central"
} |
{#sp1 .459}
{#sp2 .460}
| {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
Fetal infection following maternal varicella, especially during the first 20 weeks of gestation, can result in varicella embryopathy, also known as congenital varicella syndrome or fetal varicella syndrome. This constellation of malformations was first described by LaForet and Lynch in 1947 \[[@B1]\]. We report a 5-day-old boy and a 17-day-old boy with aplasia cutis congenita as the sole manifestation of congenital varicella syndrome. A perusal of the literature revealed only one case \[[@B2]\], to which we are adding two more, to alert readers of such as an association.
2. Case Reports {#sec2}
===============
2.1. Case 1 {#sec2.1}
-----------
A 5-day-old Malay infant boy from Malaysia was born to a 28-year-old primigravid woman at 37 weeks gestation, following an uncomplicated normal spontaneous vaginal delivery. The Apgar score was 6 and 9 at 1 minute and 5 minutes, respectively. The birth weight was 2.6 kg, length was 48 cm, and head circumference was 34 cm. At birth, a linear skin defect was noted on the right forearm extending to the elbow. The neonatal course was otherwise uneventful.
At around the 16^th^ week of gestation, the mother experienced constitutional symptoms of malaise and fever. Two days later, she developed an itchy rash, which started as rose-colored macules, progressing rapidly to become papules, vesicles, pustules, and crusts. New lesions appeared in crops every one to two days, and lesions at different stages of development were seen. The distribution of the lesions was typically central, with the greatest concentrations on the trunk. After the rash had subsided, she was left with hyperpigmented and hypopigmented scars in lesional areas consistent with prior varicella infection ([Figure 1](#fig1){ref-type="fig"}). The mother did not recall having varicella or varicella vaccination in the past. A diagnosis of maternal varicella was made on clinical grounds. Parents were nonconsanguineous. There was no history of maternal medications taken during pregnancy.
On physical examination, there was a linear skin defect involving two-thirds of the length of the right forearm extending to the elbow, along the distribution of the T1 dermatome ([Figure 2](#fig2){ref-type="fig"}). The lesion was depressed in comparison with the surrounding skin. There was a thin transparent membrane at the site of the skin defect, and the underlying subcutaneous structures were obvious to the naked eye. The skin surrounding the defect was erythematous and indurated. The rest of the physical examination was unremarkable. In particular, there were no dysmorphic features.
A clinical diagnosis of aplasia cutis congenita secondary to maternal varicella was made. The infant was seen by an ophthalmologist, a neurologist, and an orthopedic surgeon who did not detect any other anomalies. Cranial MRI was normal. The wound was cleaned daily with betadine solution. Fucidin acid cream was applied twice daily to the wound which was then covered with a nonadhesive sterile dressing. The wound healed in 34 days. The infant was referred to a plastic surgeon for reconstructive surgery. The parents were happy with the esthetic outcome. There was no functional impairment.
2.2. Case 2 {#sec2.2}
-----------
A 17-day-old Malay infant boy from Malaysia was referred because of an extensive scar on the left flank, which was noted at birth. There was no history of vesiculobullous lesions. The infant was born to a gravida 2 para 1 30-year-old mother at term following an uncomplicated normal spontaneous vaginal delivery. The Apgar score was 7 and 10 at 1 minute and 5 minutes, respectively. The infant\'s birth weight was 2.7 kg, length was 47 cm, and head circumference was 35 cm. The infant was breast-fed and thriving. The neonatal course was unremarkable.
At around 15^th^ week of gestation, the mother developed an intensely pruritic rash consisting of erythematous macules, papules, pustules, and crusts, which appeared in crops. The rash was extensive, with the greatest concentration on the trunk. The lesions were typical of varicella. The mother was tested for varicella, and her serum varicella-zoster specific IgM was positive. She was treated with acyclovir 800 mg orally four times a day for five days. The maternal health was otherwise unremarkable. She was not on any other medications. There was no history of consanguinity and no family history of similar skin lesions.
On physical examination, the infant was alert and not in distress. Vital signs were normal. There was an extensive irregular, depressed, white scar over the left flank corresponding to the distribution of the T8 and T9 dermatomes (Figures [3](#fig3){ref-type="fig"} and [4](#fig4){ref-type="fig"}). An area of erosion was noted on the posterior aspect of the scar. The rest of the physical examination was unremarkable.
A clinical diagnosis of aplasia cutis congenita secondary to maternal varicella was made. The infant\'s varicella-zoster specific IgM was negative. On the other hand, the varicella-zoster specific IgG was elevated at 3011 mIU/ml (\>100 mIU/ml is considered as positive).
The infant was seen in consultation by various specialists, including a neurologist, an ophthalmologist, and an orthopedic surgeon, who could not detect other anomalies. He was referred to a plastic surgeon for follow-up care. The parents were happy with the esthetic outcome. There was no functional impairment.
3. Discussion {#sec3}
=============
Humans are the only known reservoir for the varicella-zoster virus \[[@B3]\]. The virus is transmitted by direct contact with varicella or zoster lesions or by inhalation of infected airborne droplets \[[@B3]\]. The incidence of varicella has been estimated at 0.1--0.7 per 1000 pregnancies \[[@B4]\]. Up to 25% of the infants born to women who contract varicella may become infected \[[@B4], [@B5]\]. Approximately 2% of fetuses exposed to maternal varicella infection in the first 20 weeks (usually between 13 and 20 weeks) of pregnancy have features of congenital varicella syndrome \[[@B4], [@B6], [@B7]\].
Congenital varicella syndrome is characterized by a number of clinical manifestations: premature labor and small for gestational age; cutaneous lesions (e.g., scars in a dermatomal distribution and aplasia cutis congenita); CNS and peripheral nervous system abnormalities (e.g., microcephaly, hydrocephalus, cortical/cerebellar atrophy, mental retardation, facial nerve palsy, phrenic nerve palsy, recurrent laryngeal nerve palsy, bulbar palsy, brachial plexus palsy, and intracranial calcifications); ocular abnormalities (e.g., cataracts, nystagmus, microphthalmia, chorioretinitis, and optic atrophy); autonomic nervous system dysfunction (e.g., Horner syndrome, neurogenic bladder, dysphagia, and anal sphincter dysfunction); neuromuscular/orthopedic abnormalities (e.g., talipes equinovarus or calcaneovalgus deformity, hypoplasia/atrophy of the limb, rudimentary digit, hypoplasia of ribs, and scoliosis); gastrointestinal anomalies (e.g., duodenal stenosis, jejunoileal atresia, Meckel diverticulum, colonic atresia, colonic stricture, small left colon syndrome, and sigmoid atresia); and genitourinary anomalies (e.g., hydronephrosis, hydroureter, renal dysplasia, renal agenesis, and undescended testes) \[[@B6]--[@B18]\].
In the first case, varicella infection in the mother was diagnosed on clinical grounds following a classic presentation of varicella and the typical residual scars. Leung et al. examined 986 randomly selected children (519 boys, 467 girls) who had varicella at least one year previously for the presence of scars resulting from varicella \[[@B19]\]. The authors found that 96 (18.5%) boys and 88 (18.8%) girls had varicella scars, giving rise to an overall prevalence of 18.7%. The mean number of scars in the 184 children was 2.8 (standard deviation 1.9). The scars were hypopigmented in 160, hyperpigmented in 32, hypertrophic in 32, and depressed in 38 children. Two children had keloids. As varicella tends to be more severe in adults than in children, it is conceivable that adults have more scars from varicella infection. In the first case, the diagnosis of congenital varicella syndrome is based on evidence of maternal varicella infection during pregnancy and presence of aplasia cutis congenita in the infant.
In the second case, the diagnosis of maternal varicella was based on typical clinical features of varicella, positive varicella-zoster specific IgM in the mother, as well as a positive varicella-zoster specific IgG in the infant. In one study, only 4 of 16 (25%) infants with clinical manifestations of intrauterine varicella infection had positive varicella-zoster specific IgM \[[@B20]\].
| {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
Engaged patients are research *partners*, involved in the planning, conduct and governance of health research, rather than serving as passive study subjects \[[@CR1]--[@CR3]\]. Patient engagement could improve the relevance of health research, facilitate the adoption of research findings into practice, and ultimately improve patient outcomes \[[@CR1]--[@CR7]\]. A continuum of engagement ranges from informing and consulting, to collaboration with researchers, to empowering, patient-led projects \[[@CR8]--[@CR10]\]. Patients can be engaged at all levels, including identifying study topics, collecting data or disseminating findings \[[@CR1], [@CR3], [@CR9], [@CR11]\].
In line with international patient engagement movements \[[@CR11], [@CR12]\], the Canadian Institutes of Health Research (CIHR) announced Canada's Strategy for Patient-Oriented Research (SPOR) in 2011. Its vision is that "patients are active partners in health research that will lead to improved health outcomes and an enhanced health care system \[[@CR13]\]." A key goal was the creation of Support for People and Patient-Oriented Research and Trials (SUPPORT) Units across the country whose mandate is to facilitate patient-engaged research on jurisdictional priorities.
The methods and impact of patient engagement are under-described \[[@CR3]\]. Most studies provide little detail about engagement processes, few evaluate its impact over time, and uncertainty remains about best practices for supporting engagement \[[@CR3], [@CR9], [@CR14]\]. Systematic reviews \[[@CR3], [@CR9], [@CR15]\] reveal patient engagement is most common in the early stages of research, and a recent review highlighted how patient-identified priorities helped shaped research programs in Rheumatology, Venous Thromboembolism, and Paget's disease \[[@CR16]\]. However, research is often not aligned with the priorities of patients. For example, the James Lind Alliance analysed over 300 studies reporting research priorities and found that most described the priorities of researchers, not patients \[[@CR17]\].
This article describes a patient engagement exercise at Memorial University in Newfoundland and Labrador (NL), Canada. A broad view of 'patient' was adopted, referring to any member of the general public who had experience with the healthcare system as a patient at some point in their lives. Common methods of engagement for exploring research priorities include meetings, workshops and focus groups \[[@CR3], [@CR16], [@CR18]\]. This study used a town hall meeting format.
Objectives {#Sec2}
==========
To explore health research priorities and outcomes of the public and to contribute to the evidence base on patient-oriented research.
Methods {#Sec3}
=======
Approval was granted by the Newfoundland and Labrador Health Research Ethics Authority (Project Approval \# 15.057).
Planning sessions {#Sec4}
-----------------
The NL SUPPORT Unit partnered with a local SPOR research network, PRIIME (Primary Healthcare Research and Integration to Improve Health System Efficiency) to conduct town halls. Sessions were planned during monthly meetings in early 2015. The team was comprised of two clinicians, a pharmacist, and health researchers from a variety of areas (e.g., genetics, public health, primary care). All supported patient engagement in research and were committed to facilitating open, respectful discussion on patient-identified priorities and outcomes. Communication assistance was not offered for town halls, which could have precluded participation from some members of the public. No translation services were thought to be required as the population in this jurisdiction is largely homogenous (white, English-speaking, and middle class), and none was required.
Town hall sessions {#Sec5}
------------------
Town halls were a hybrid information-consultation session led by a team member with facilitation experience (HE). A 15--20 min presentation was developed, which introduced the idea of CIHR's SPOR and provided an overview of the research initiative at Memorial. Discussion was centered around two questions to gather data on public priorities (Table [1](#Tab1){ref-type="table"}). These were developed prior to sessions in order to facilitate discussion, but also to maintain consistency across town halls.Table 1Research questions used during town hall meetings1. We are interested in what kind of health research projects are of interest to you. If you could think about a worry or concern about healthcare in this province that needs to be our top priority, what would that be?2. We want to know what you would like to see happen as a result of health research. As a patient, what are the outcomes you might want to see as a result of health research?
At least two other team members attended each session. At the beginning of sessions, team members introduced themselves and explained their interest and endorsement of patient engagement with health research. In this way, an encouraging and supportive environment for conversation was created. Ground rules were explained following introductions, namely that no names were required or would be attached to any comments; we were interested only in summarizing participants' ideas. We also asked that participants respect others' views, acknowledging that everyone's experience and priorities could be different. Participants were encouraged to share their views, even if these were different from those expressed and to give each other time to speak before commenting. The facilitator made every effort to encourage all participants to share their thoughts and moved conversation back to the key question if it became sidetracked with any one participant's experience. This was generally done by asking if other participants had similar experiences or asking how this might be translated into a health research question or outcome.
Recruitment {#Sec6}
-----------
Sessions were planned in rural and urban settings. Posters were widely distributed to community organizations and posted in public locations (e.g., pharmacies, post office). Sessions were advertised on PRIIME and NL SUPPORT's websites, and research team members extended invitations to their networks. Local call-in radio programs were used, as well as promotion by community organizations through websites and word-of-mouth.
Data collection {#Sec7}
---------------
Audio recordings of sessions were taken with two digital recorders placed at opposite ends of the room. A survey booklet containing the two questions above, as well as standard demographic items and three evaluation questions about the usefulness of a town hall format, was developed and provided to participants during the introduction of the session. Participants were encouraged to complete the demographic items and record any thoughts in response to the questions and conversation as the session progressed. Detailed notes, including quotes from participants, were taken by all members; flip charts were used to record key ideas, in particular health research areas identified by participants which were outlined in bullet form. Debriefing meetings were held where researchers' observations and reflections about sessions were recorded. These meetings allowed researchers to review notes and discuss key areas of health research identified by participants as sessions progressed. This allowed a good understanding of issues raised in prior sessions and anticipatory reflection of what might be discussed at upcoming town halls (or easy identification of different ideas raised).
Data analysis {#Sec8}
-------------
Flip chart recordings, team members' detailed notes, and data from completed survey booklets comprise the data for analysis. No pre-existing framework was developed in advance of the analysis; rather, an inductive approach was used to allow categories to emerge from the data. No qualitative software was used to manage the data. Qualitative description \[[@CR19]\] was used to explore participant comments by HE and LB. This type of naturalistic inquiry made no *a priori* theoretical or philosophical assumptions about the data. The data are presented in the language of participants, resulting in a comprehensive summary of participants' ideas.
Results {#Sec9}
=======
Eight town halls sessions were held across the province with 68 members of the public (Table [2](#Tab2){ref-type="table"}). Sessions lasted an average 1.5 h. Most participants did not complete survey booklets, preferring to engage in discussion. Thus, demographic information was not consistently captured. Observation indicated that participants represented a broad range of ages and backgrounds, with more females than males in attendance.Table 2Town hall session informationTown hall locationDateAudienceNumber attendedChurch hall, St. John'sApril 2015General public, mixed ages21Municipal office, FerrylandJune 2015General public, mixed ages4 (3 male)Mall Walkers Club -- senior's group, St. John'sOctober 2015General public, most \>65 years of age15 (2 male)Seniors Bridging Cultures -- a senior's group, St. John'sNovember 2015General public, \>65 years of age12 (4 male)West Coast Tour, 4 communities\
Grand Falls-Windsor\
Deer Lake\
Corner Brook\
Port aux BasquesMay 2016General public, mixed ages16 (4 male)
Thematic analysis {#Sec10}
-----------------
All data elements were first read independently by HE and LB. Through an iterative process of reading the data, discussing, and rereading, these investigators consensually validated emerging categories. Data were compared between and within town hall sessions using constant comparative analysis \[[@CR19], [@CR20]\]. Constant comparison requires a constant shifting back and forth between data elements to establish analytical categories and themes, as well as their boundaries. For example, participants often talked about problems with accessing health services, making it a key theme. However, constant reading of the data revealed various foci of access, such as primary care and specialist services. Once HE and LB reached consensus, the summary of themes was presented to a subgroup of team members who had attended sessions for discussion. No new themes were identified.
The public's priorities for health research are described under: 1) Access and availability of healthcare services; 2) Disease prevention, health promotion and healthy aging; 3) Survivorship, follow-up | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s0001}
============
Anthrax is a severe infectious disease caused by a bacterium known as *Bacillus anthracis*. Anthrax can be found naturally in soil and commonly affects domesticated and wild herbivores. Although anthrax is perceived to be a weapon of bioterrorism in most countries in the world (Siamudaala et al. [@CIT0021]), it has ecologically emerged to be a significant public health threat in the Western Province of Zambia. In this region, the disease has reached endemic proportions with interminable outbreaks in both cattle and humans (Siziya [@CIT0023]). Between 1989 and 1995, the Western Province recorded 1626 suspected cases of cattle anthrax of which 51 were confirmed cases (Siamudaala et al. [@CIT0021]), and 1216 cases were recorded between 1999 and 2007 (Munang'andu et al. [@CIT0015]). Furthermore, Zambia is categorised under the countries where the problem of anthrax in Africa has reached a hyper-endemic state given the incessant and the long-drawn-out outbreak periods that seem unceasing in the recent years (World Anthrax Data Site [@CIT0028]). The disease has had a modifying effect across families, public health institutions and ecotourism in the affected areas of the Western Province as well as other parts of Zambia, such as the Luangwa Valley (Kamboyi [@CIT0012]). Despite the Western Province being the most sparsely populated place in Zambia, with a human population density of less than five people per square kilometre (IUCN [@CIT0011]), outbreaks and occurrence of anthrax in cattle are markedly more noticeable in this area than any other area in Zambia. The Western Province has recorded six outbreaks of anthrax in cattle and humans between 2011 and 2016 compared to Southern Province that has not recorded any outbreaks since 2011 (Office of the Auditor-General [@CIT0020]). The cattle population in the Western Province is estimated to be over 760 000 but is continuously under serious threat not only to anthrax but also to contagious bovine pleuralpneumonia among other diseases (National Livestock Epidemiology and Information Centre [@CIT0018]). The place has the highest incidence and prevalence of anthrax in Zambia, with cultural practices and beliefs of the local people being identified as significant risk factors coupled with the ecological set-up (Kamboyi [@CIT0012]; Munang'andu et al. [@CIT0015]; Siamudaala et al. [@CIT0021]). The disease endemicity is a result of appropriate mix of environmental and epidemiological factors. Ecological factors include the cyclical rainfall pattern, flooding, evaporation potential, temperature and the geology of the floodplains. Epidemiological factors include the increase in cattle and human populations on the floodplains during the dry season, leading to anthropogenic pressure, transhumance grazing system (Munang'andu et al. [@CIT0015]) and human behavioural factors (Sitali et al. [@CIT0022]). Notwithstanding that ecological and epidemiological factors have been researched to some extent, human practices and behavioural factors have not been scrutinised and are still poorly understood (Mumba et al. [@CIT0014]). Outbreak investigation reports and reviews of anthrax outbreaks in the Western Province have indicated that the disease has persisted in the province because of entrenched cultural beliefs and practices of local communities (Mwambi et al. [@CIT0017]). However, this phenomenon has been poorly explored thus far. It is crucial for programme implementers to consider local beliefs, practices and perceptions surrounding the disease if control measures are to yield the most significant results. Modifying factors such as demographics and socio-economic status, among others, are vital in predicting how a community responds to information leading to health behaviour. In this study, the overall objective was to assess and determine the perceptions, beliefs and cultural practices, and other anthropogenic factors, related to the contraction of anthrax by cattle in the Western Province. These factors have been partly discussed in a previous paper (Sitali et al. [@CIT0022]); in this article, we describe the observational and situational analysis data of anthrax in the Western Province as it relates to the endemicity in cattle, zoonotic implication and public health impact of the disease.
Materials and methods {#s0002}
=====================
Study area {#s20003}
----------
Three districts that are endemic to anthrax in the Western Province were conveniently selected for the study. These were Mongu, Nalolo and Limulunga ([Figure 1](#F0001){ref-type="fig"}). The Western Province lies in the upper Zambezi basin also called the Barotse floodplain located at coordinates 14°19'--16°32'S and 23°15'--23°33'E and covering about 5500 km^2^ in extent (IUCN [@CIT0011]). The maximum flooded area is estimated at 10 750 km^2^ (Welcomme [@CIT0027]) when floods of all tributaries of the Zambezi River are taken into account. The floodplain stretches from the confluence of the Lungwebungu River with the Zambezi River in the north extending southwards for a distance of 250 km until Ngonye falls. Soils are composed of the Kalahari sands stretching several metres deep underlain by calcareous rocks (Munang'andu et al. [@CIT0015]). Elsewhere, calcareous soils have been associated with prolonged survival of anthrax spores (Hugh-Jones & Hussaini [@CIT0010]; New et al. [@CIT0019]). The main human activities in the study area are traditional cattle farming, fishing and rice farming, and to a lesser extent, maize and cassava farming in the upper forest lands. The cattle population in the study area is estimated at over 760 000 (National Livestock Epidemiology and information Centre [@CIT0018]). The Zambezi floodplain alone contains a population of over 225 000 people in an estimated 28 000 sparsely spaced households (Central Statistical Office Zambia [@CIT0002]). Given the landmass of the floodplain to be 10 750 km^2^ at its maximum (Welcomme [@CIT0027]), this gives a human population density of 20.6 people/km^2^ in the floodplain during the dry season. However, it was estimated that another 200 000 people live on the plain margin (Turpie [@CIT0026]) and their livelihood is also dependent on the floodplain, thereby exerting more pressure on the natural resource utilisation of the floodplain.
{#F0001}
Study design {#s20004}
------------
The study was a mixed-methods design employing both quantitative and qualitative methods. A cross-sectional survey was concurrently conducted with five focus group discussions and five key informant interviews from August to December 2015. Quantitative data were reported in a paper by Sitali et al. ([@CIT0022]).
Data collection and analysis {#s20005}
----------------------------
Respondents for the focus group discussions were purposively sampled from the survey participants based on whether they had lost cattle because of anthrax, had a family member who suffered from anthrax or died from the same. Five key informant interviews with professional staff were held as follows: one with a senior veterinary officer, three with veterinary assistants and one officer working for the Ministry of Health. An unstructured topic guide with open-ended questions was used to guide the interviews. The interview guide focused on the experiences of key informants with communities in controlling for anthrax, and the challenges faced. All the interviews took place in the respondents' environments, either their office or home. The interviews lasted for a minimum of 30 min to 1 h. Also, five focus group discussions were held with community members as follows: one in Limulunga, two in Mongu and two in Nalolo District. Each focus group had an average of 11 participants. Two of the focus group discussions were held with female participants only; one was held with men only to identify gender differences in perceptions and practices. Two of the focus group discussions were held with both sexes. Field observations were supplemented with informal discussions with community members and professional staff from the health and livestock departments. A topic guide was used to guide the discussions, focusing on the beliefs, and perceptions, of respondents towards professional staff and control measures. Common cattle-rearing practices and cultural practices surrounding anthrax were also explored. Piloting of the tools was not performed as is the standard practice in qualitative research. However, at the end of each field day, recorded narratives were audio played to identify areas that needed further probing or clarification. The questions in the interview guide were then adjusted accordingly. This was repeated until saturation of data (no new themes emerge from data) was reached.
Interviews were audio-recorded. All the interviews were moderated by the principal investigator and a research assistant took field notes. Focus group discussions were either held at a village or crush-pen. Focus group discussions were held in the local language (*Lozi*) to facilitate understanding. The narratives were audio-taped and later translated into English and transcribed into computer files. Nvivo 12 for windows was used to help manage the data. Broad coding followed by fine coding was performed in NVivo software to facilitate the identification of themes. Framework matrices were formulated to help cross-check information from community members with that of professional staff to identify similar and contradicting views between professional and community members. Illustrative quotations that represented the themes were used to present results. Information was summarised through a logical risk chart of pathogen transmission and contamination based on the lay practices, beliefs and cultural understanding of the disease.
Ethical consideration {#s20006}
---------------------
| {
"pile_set_name": "PubMed Central"
} |
All relevant data are within the paper.
Introduction {#sec001}
============
Vascular smooth muscle cells (VSMCs) are essential regulators of vascular function \[[@pone.0170699.ref001],[@pone.0170699.ref002]\]. In healthy arteries, VSMCs are located in the medial vascular layer, where they express contractile proteins that regulate vessel tone and blood flow \[[@pone.0170699.ref003]\]. However, endoluminal vascular interventional procedures cause stretching of the vessel wall and cell necrosis \[[@pone.0170699.ref004]\], and subsequently release endogenous molecules activating vascular inflammatory processes \[[@pone.0170699.ref005]\]. During the vascular inflammatory processes, the recruitment of monocytes to the lesion tissues and subsequent transformation into macrophages concomitant with overproduction of inflammatory cytokines would be major steps \[[@pone.0170699.ref006]\]. This, in turn, stimulates VSMC proliferation resulting in the development of vascular wall remodeling including atherosclerosis and restenosis after vascular injury \[[@pone.0170699.ref007],[@pone.0170699.ref008]\].
Previous studies have demonstrated that OPN levels were elevated in human atherosclerotic plaque \[[@pone.0170699.ref009],[@pone.0170699.ref010]\] and neointima after experimental angioplasty \[[@pone.0170699.ref011]\]. Thus, OPN has been suggested to be implicated in vascular injury responses by increasing extracellular matrix invasion, migration and proliferation of VSMCs \[[@pone.0170699.ref012]--[@pone.0170699.ref014]\]. Furthermore, OPN was reported to be strongly expressed in a synthetic VSMC phenotype \[[@pone.0170699.ref015]\], and suggested to be a key factor of the development of vascular remodeling diseases \[[@pone.0170699.ref016],[@pone.0170699.ref017]\]. Although the vascular remodeling effects of OPN have aroused considerable research interest \[[@pone.0170699.ref018]\], little is known of its role in vascular wall remodeling.
*Schisandra chinensis* (SC) has a long history as a medicinal herb and is a traditional component in oriental medicines \[[@pone.0170699.ref019],[@pone.0170699.ref020]\]. Several authors have suggested SC may have beneficial regulating effects in patients with cardiovascular diseases, as its aqueous extract induced vasorelaxation in rat thoracic aorta \[[@pone.0170699.ref021],[@pone.0170699.ref022]\]. In the previous study, we demonstrated that gomisin A and gomisin J isolated from SC relaxed vascular smooth muscle, suggesting a potential therapeutic role in hypertensive patients \[[@pone.0170699.ref023],[@pone.0170699.ref024]\]. Also, Choi et al. \[[@pone.0170699.ref025]\] reported the antioxidant properties of α-iso-cubebene (ICB), a dibenzocyclooctadiene lignin found in SC, and suggested its potential use to ameliorate the symptoms of cardiovascular disease. However, little is known about the effect of ICB on VSMC proliferation, which is characteristic feature of many vascular diseases.
Under pathological conditions, VSMCs exhibit phenotypic changes characterized by loss of contractility, abnormal proliferation, migration, and matrix secretion \[[@pone.0170699.ref010]\]. This synthetic phenotype of VSMCs plays an active role in the development of several cardiovascular diseases, including vascular remodeling diseases \[[@pone.0170699.ref026]--[@pone.0170699.ref028]\]. In view of the known participation of OPN in the progression of vascular remodeling diseases \[[@pone.0170699.ref017],[@pone.0170699.ref029]\], we considered that the identification of molecular regulators of OPN expression in VSMCs might be of importance. Accordingly, we undertook this study to determine the relations between ICB and OPN and PDGF-stimulated VSMC proliferation, and to identify the ICB-targeted transcription factors underlying OPN expression in VSMCs.
Materials and Methods {#sec002}
=====================
Purification of α-iso-cubebene {#sec003}
------------------------------
α-Iso-cubebene (ICB) was purified from dried fruits of *Schisandra chinensis* (SC) as described previously \[[@pone.0170699.ref030]\]. Briefly, SC (2.5 kg) fruit was dried, and ground to a fine powder, and successively extracted at room temperature with *n*-hexane, chloroform (CHCl~3~), and methanol (MeOH). The hexane extract (308 g) was evaporated in vacuo and chromatographed on a 40 μm silica gel (J.T. Baker, Phillipsburg, NJ, USA) column (100 × 10 cm) using step gradient elution (0%, 5%, and 20% ethyl acetate in hexane and 5% methanol MeOH in CHCl~3~ to obtain 38 fractions). Fraction 1 (KH1PA, 3,689 mg) was separated on a silica gel column (100 × 3.0 cm) using 15% acetone in dichloromethane (CH~2~Cl~2~) to obtain nine fractions, and the second fraction (KH1PAIB, 999 mg) was separated on a silica gel column (100 × 3.0 cm) using 15% acetone in CH~2~Cl~2~ to yield ICB (316 mg). Pure ICB (purity \> 99%) was identified by high-performance liquid chromatography on a Phenomenex Luna C18 column (150 × 4.6 mm internal diameter; 5 μm particle size) using an acetonitrile-water-alcohol gradient at a flow rate of 1.0 ml/min.
Ethics statement and animals {#sec004}
----------------------------
All animal procedures conformed with the Guide for the Care and Use of Laboratory Animals published by the US National Institute of Health (NIH Publication No. 85--23, 2011 revision), and the experimental protocols were approved by the Pusan National University Institutional Animal Care and Use Committee. All genotyping, including that of OPN deficient mice was performed by PCR using a protocol provided by the Jackson Laboratory (Harlan Nossan, Italy). Wild-type (WT) control mice (C57BL/6J) were purchased from Jackson Laboratories.
Chemicals and antibodies {#sec005}
------------------------
Platelet derived growth factor (PDGF) was purchased from Sigma (St. Louis, MO), and OPN (sc-21742) and β-actin (sc-47778) antibodies were purchased from Santa Cruz Biotechnology Inc. (Beverly, MA). Horseradish peroxidase (HRP)-conjugated IgG antibody (Santa Cruz Biotechnology Inc.) was used as the secondary antibody. PCR primers were from Bioneer (Seoul). AP-1 (10024-2-AP) antibody was purchased from Proteintech (Proteintech Group, Chicago, USA), and C/EBPβ (ab15049) antibody from Abcam (Cambrige, MA). Restriction enzymes were supplied by Promega (Madison, WI).
AP-1 and C/EBPβ siRNA oligonucleotides were synthesized by Bioneer (Daejeon, Korea). siRNA molecules were transfected into cells using Lipofectamine 2000 siRNA transfection reagent (Invitrogen, Carlsbad, CA), according to the manufacturer\'s instructions. siRNA sequences against AP-1 and C/EBPβ were as follows: AP-1, `ACUGUAGAUUGCUUCUGUA` (sence) and `UACAGAAGCAAUCUACAGU` (antisense); C/EBPβ, `GACAAGCUGAGCGACGAGU` (sence) and `ACUCGUCGCUCAGCUUGUC` (antisense).
Cell culture and MTT assay {#sec006}
--------------------------
Sprague-Dawley rats (Charles River Breeding Laboratories, Kingston, NY, USA) were sacrificed by CO~2~ inhalation, and then primary VSMCs was cultured from thoracic aorta. Briefly, excised aortas were cut into \~1 mm^2^ segments, and placed as explants in a cell culture dish containing DMEM (Gibco BRL, Grand Island, NY) with 10% FBS (Gibco BRL). Cells were maintained in DMEM containing 10% FBS and antibiotic-antimycotic (Gibco BRL) at 37°C.
An MTT assay was used to determine the proliferation rates of VSMCs. Briefly, cells (a total of 1x10^5^ cells) were treated with MTT working solution (EZ-Cytox, Daeil Laboratories, Seoul, Republic of Korea), and incubated at 37°C for 1 hr. OD values of solution was obtained at a wavelength of 450 nm by ELISA. Relative proliferation rates were determined by comparing cells with control cells.
Western blot analysis {#sec007}
---------------------
VSMC lysates were prepared in ice-cold lysis buffer, and equal amounts of the protein obtained were separated on 8\~10% polyacrylamide gel under reducing conditions, and then transferred to nitrocellulose membranes (Amersham-Pharmacia Biotech, Piscataway, NJ). Membranes were blocked with 5% skim milk in TBST and incubated overnight with primary antibody in 5% skim milk. Blots were washed with TBST, and incubated with HRP-conjugated secondary antibody for 2 hrs. Blots were developed using ECL Western blot detection reagents (Amersham). Membranes were re-blotted with anti-β-actin antibody (Santa Cruz Biotechnology) as an internal control.
Measurement of mRNA expression {#sec008}
------------------------------
OPN mRNA levels in | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
Free water in the context of neuroimaging refers to extracellular non-flowing water in the cranium and brain tissue. Quantifying free water is of interest for estimating cerebral spinal fluid (CSF) contamination and as an index measured within brain tissue since it is sensitive to edema from pathologies. Free water is characterized by uninhibited movement, and is present in CSF and vasogenic edema. A conceptual approach to measuring free water is using diffusion tensor imaging (DTI) estimates of water diffusivity to classify free water regions based on high diffusivity. If DTI scans had sub-nanometer resolution, one could measure free water directly, since most voxels could be categorized as being either water or tissue. However, at the current practical voxel resolution of 1--3 mm in each dimension, a DTI voxel encompasses millions of cells and intercellular space, and will often include brain-CSF boundaries. As a consequence, many voxels will present with partial volume effects, and measures of diffusivity in a voxel reflect a contributions from tissue and free water. The aim of DTI studies is usually to assess tissue structure, but contamination from CSF and edema affect mean diffusivity and factional anisotropy values \[[@bib1], [@bib2]\]. Identifying and accounting for potential free-water contamination could lead to better measures of tissue structure and higher fraction of intracellular water. An estimate of free water from DTI requires further calculations than standard processing based on a voxel model comprising free water and tissue, termed a two-compartment model [@bib3]. Existing methods have been proposed to estimate the proportion of free water within a voxel, termed the free water fraction *f*, based on the ratio of the volume of free water *V*~*fw*~ to the volume of the voxel *V*~*vox*~ [(1)](#fd1){ref-type="disp-formula"}:$$f = \frac{V_{fw}}{V_{vox}}\text{.}$$
However, these methods may not have single solutions \[[@bib4], code no longer available\], leading to the need to solve an inverse problem with optimization, and approaches may require the addition of non-standard DTI scans with specific parameters \[[@bib5], [@bib6], [@bib7]\]. We therefore propose a method to provide an estimate related to free water content. Specifically, we present a calculation, based on any product DTI sequence, which provides an upper bound to the free water fraction.
As background, the motivation to measure free water in the context of assessing CSF contamination is present in several imaging modalities. For example, magnetic resonance spectroscopy (MRS) involves large voxels (X/Y/Z dimensions of 5--15 mm) with large partial volume effects, and MRS measures are highly influenced by the proportions of tissue and free water in the voxel [@bib8]. Neurochemical levels are usually presented as a ratio of creatine, which is used as a marker of tissue cell content \[[@bib9], [@bib10]\], but the free water fraction would provide additional information, especially in the context of diseases that alter creatine levels or chemicals in CSF. Theoretically, free water fraction could help with interpretation of structural measures such as T2 relaxometry, voxel-based morphometry, cerebral blood flow with arterial spin labelling, and functional MRI. DTI itself involves measuring a tensor based on the directionality of water diffusion properties, and even at ∼1 mm resolution, DTI voxels will have partial CSF components. Therefore, by extracting the free water fraction, improved estimates of the tissue-specific tensor are possible [@bib4]. A two-compartment model was shown to allow for better estimation of tissue tensors [@bib3].
Another motivation to measure free water fraction is its sensitivity to changes in intracellular water and space that occur in pathologies associated with edema, or inflammation, as well as atrophy [@bib11]. Initial studies have found changes in free water associated with aging [@bib12], and diseases such as schizophrenia [@bib13], multiple-sclerosis [@bib11], and Alzheimer\'s disease [@bib5]. An estimate related to free water would be another quantitative MRI measure with which to assess neural pathology, or provide a starting point for free water calculation by another method.
2. Theory {#sec2}
=========
2.1. Two-compartment model {#sec2.1}
--------------------------
Considering the underlying structure of the brain, two-compartment models have been proposed, whereby the characteristics of a voxel tensor reflect the combination of components from different types of material [@bib3]. [Fig. 1](#fig1){ref-type="fig"} illustrates this model in a hypothetical voxel, illustrating a brain-CSF boundary in an animal model ([Fig. 1](#fig1){ref-type="fig"}, left panel). A voxel may include CSF and brain tissue, and within brain tissue there may be edema, in addition to neurons and glial cells, vessels, and other intercellular material or ependymal cells ([Fig. 1](#fig1){ref-type="fig"}, middle panel). Free water exists both in CSF and throughout the tissue, but for the purposes of the model, we assume one compartment is free water and the other brain tissue ([Fig. 1](#fig1){ref-type="fig"}, right panel).Fig. 1Two-compartment model based on tissue and fluid in brain. Left panel shows image from animal brain of boundary between brain tissue and CSF. Middle panel illustrates various tissue and fluid components, which are simplified into the two-compartment model in the right panel. Note that the free water compartment includes CSF and water in the tissue.Fig. 1
Standard DTI measures are interpreted assuming a single compartment model. The conventional DTI-derived diffusion tensor ***D*** represents the directional diffusivity of water within a voxel [@bib14], and this tensor forms the basis of most DTI analyses, including calculation of structural indices and fiber or probabilistic tracking. The most common formulation is a 3×3 matrix that is assumed to be symmetric [(2)](#fd2){ref-type="disp-formula"}:$$\mathbf{D} = \begin{bmatrix}
D_{xx} & D_{xy} & D_{xz} \\
D_{xy} & D_{yy} & D_{yz} \\
D_{xz} & D_{yz} & D_{zz} \\
\end{bmatrix}$$
For a two compartment model, the diffusivity of a voxel ***D***~***vox***~ is the combination of diffusivities from tissue (***D***~***t***~) and free water (***D***~***fw***~) compartments [(3)](#fd3){ref-type="disp-formula"}:$$\mathbf{D}_{\mathbf{vox}} = \ \left( 1 - f \right)\mathbf{D}_{\mathbf{t}} + f\mathbf{D}_{\mathbf{fw}},$$assuming the voxel diffusivity is a linear function of compartment diffusivities [@bib15]. Assuming the free water diffusion is equal in all directions [@bib4], the tensor ***D***~***fw***~ water simplifies to [(4)](#fd4){ref-type="disp-formula"}:$$\mathbf{D}_{\mathbf{fw}} = \begin{bmatrix}
\text{D}_{\text{W}} & 0 & 0 \\
0 & \text{D}_{\text{W}} & 0 \\
0 & 0 & \text{D}_{\text{W}} \\
\end{bmatrix}$$where $\text{D}_{\text{W}}$ is the diffusivity of water.
While [(2)](#fd2){ref-type="disp-formula"} can be solved using any DTI series with 6 or more directions, for [Eq. (3)](#fd3){ref-type="disp-formula"}, even though only one additional variable is introduced, *f* does not have a single solution and is complex to solve for. Here, we propose using a characteristic of the diffusion tensor to obtain an estimate of an upper limit of the free water compartment fraction.
2.2. Third eigenvalue of the diffusion tensor and free water fraction {#sec2.2}
---------------------------------------------------------------------
The tensor ***D*** can be decomposed into eigenvectors, with the first eigenvector *v*~*1*~ being in the direction of greatest diffusivity. The second eigenvector *v*~*2*~ is the direction of greatest diffusivity in a plane perpendicular to the first eigenvector, and the third *v*~*3*~ is in the orthogonal direction of least diffusivity. The three eigenvalues, *λ*~*1*~, *λ*~*2*~, *λ*~*3*~, represent the magnitude of diffusivity along the three eigenvectors. The diffusion tensor can be visualized by an ellipsoid, as in [Fig. 2](#fig2){ref-type="fig"}. In fluid such as CSF, water can diffuse unimpeded by barriers equally in all directions, and so the mean and directional diffusivities will be equivalent in magnitude, and approximately equal to the diffusivity of water ([Fig. 2](#fig2){ref-type="fig"}A). In brain tissue with minimal directionality in structure, such as some gray matter regions, the diffusion eigenvectors will be of similar magnitude in all directions but the eigenvalues will be much lower than those in CSF \[[Fig. 2](#fig2){ref-type="fig"}B; [@bib14]\]. In tissue that is highly directional, such as large white matter tracks like the corpus callosum, one direction will dominate, and the eigenvalue *λ*~*1*~ in that direction will be moderate to large combined with much smaller values for *λ*~*2*~ and *λ*~*3*~ ([Fig. 2](#fig2){ref-type="fig"}C). Another scenario is tissue where water | {
"pile_set_name": "PubMed Central"
} |
Summary
=======
Neuroprolotherapy and acupuncture for clinical trial of acute and chronic migraine treatment.
Objectives
==========
Formulation of protocol for clinical trial of neuroprolotherapy and acupuncture treatment of migraine, partially based upon treatment sites used in OnabotulinumtoxinA treatment of migraine.
Background
==========
Studies thus far have demonstrated that acupuncture is both effective, and cost effective in the treatment and prevention of migraine. Neuroprolotherapy and acupuncture are less costly, and are associated with fewer risks, than OnabotulinumtoxinA. No studies have been published that examine the effects of neuroprolotherapy on migraine.
This protocol will serve as a template for use in a multi-center clinical trial to be conducted at a later date.
Methods
=======
Key muscles in the treatment of migraine, using either OnabotulinumtoxinA or acupuncture, are the frontalis, the corrugator supercilii, procerus, temporalis, occipitalis, trapezius, and splenius capitis. These muscle locations correspond to classical acupuncture point locations as follows: Frontalis:GB14, corrugator supercilii :BL2, procerus :GB24.5, or Yin Tang, temporalis :GB 4,5,6,7, occipitalis GB20, splenius capitus:BL10, trapezius GB21.
Neuroprolotherapy utilizes similar locations, with emphasis on "Chronic Constriction Injuries of the Peptidergic Sensory System". These locations are chosen for their location directly over sensory nerve exits, and often correspond to acupuncture points as well. These locations include the nerve exits and course of the infraorbital (ST1), subraorbital(BL2), subratrochlear(BL1), infratrochlear(ST2), zygomatico-facial (SI18), zygomatic-temoral (GB1), auriculo-temporal (SI17), mental(Jiachengjiang \[M-HN-18\]), buccal, lessor occipital (GB12,), greater auricular(SI16), greater occipital(GB20,19), auriculotemporal nerve (GB4, 5, 6, 7), posterior cutaneous branches of dorsal rami of C4, 5, 6 (BL10).
Clinical experience indicates that Neuroprolotherapy is able to abort chronic cycling migraine, theoretically by repair of the peptidergic sensory TRPV1 receptors via the antagonist effect of 5% dextrose. Acupuncture activates the default mode network, and regulates heart rate variability and autonomic tone.
A protocol will be formulated that utilizes these points, as well as the addition of secondary acupuncture points chosen to alleviate myofascial strain patterns disrupting structural tensegrity. Acupuncture points helpful in the alleviation of nausea will also be chosen.
Results
=======
To be determined.
Conclusion
==========
The protocol will create a reproducible template of neuroprolotherapy and acupuncture points that can be used to conduct a multicenter clinical trial examining the efficacy of the use of these methods in the treatment of migraine prophylaxis and acute treatment.
No conflict of interest.
| {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Lipopolysaccharide (LPS), a glycolipid constituent of the outer membrane of Gram-negative bacteria, initiates inflammatory signaling cascades in cells, including monocytes, macrophages, dendritic cells, and endothelial cells, leading to the upregulation of cytokines, chemokines, and other inflammatory mediators, such as inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2). As critical pattern recognition receptors for the first line of the host defense system against bacteria, viruses, fungi, and parasites, Toll-like receptors (TLRs) are widely found on the surface of those cells and play a key role in the innate immune system ([@B55]; [@B4]; [@B21]; [@B49]). Among these TLRs, TLR4 is activated by LPS, which is primarily associated with the accessory protein MD-2 and the co-receptor CD-14 to recognize LPS, resulting in transducing signals for activation of several transcription factors, such as nuclear factor-κB (NF-κB), in cooperation with myeloid differentiation factor 88 (MyD88) ([@B4]). MyD88 leads to activation of the serine/threonine kinase interleukin-1 receptor-associated kinase 4 (IRAK4), which engages with mitogen-activated protein kinase (MAPK) cascades (extracellular signal-regulated protein kinase \[ERK\], c-Jun N-terminal kinase \[JNK\], and p38) and results in NF-κB activation and subsequent upregulation of expression of pro-inflammatory mediators ([@B5]; [@B13]; [@B54]; [@B21]; [@B49]). Alternatively, the phosphoinositide 3-kinase (PI3K)/Akt pathway downstream of TLR4 signaling could also induce NF-κB activation ([@B26]; [@B45]). It should be also noted that the canonical NF-κB pathway responds to diverse stimuli, including TLR activation, is activated with the inducible degradation of IκBα (inhibitor of κBα) triggered through its site-specific phosphorylation by multi-subunit IκB kinase complex, and participates in the induction of type I interferons (IFNs) and pro-inflammatory cytokines ([@B52]; [@B27]).
G protein-coupled receptor kinases (GRKs) are serine/threonine kinases that were originally identified to phosphorylate activated G protein-coupled receptors (GPCRs) and cause desensitization of GPCR signaling ([@B41]; [@B44]). The seven mammalian GRKs can be divided into three subfamilies based on sequence and functional similarities: the rhodopsin kinase or visual GRK subfamily (GRK1 and GRK7), the β-adrenergic receptor kinase subfamily (GRK2/GRK3), and the GRK4 subfamily (GRK4, GRK5, and GRK6) ([@B44]). Among them, the ubiquitous isoform GRK2, also known as β-adrenergic receptor kinase-1 (βARK1), has been documented to regulate other pathways independently of its role in GPCR phosphorylation ([@B44]; [@B19]; [@B40]). Thus, GRK2 can restrain cellular signaling via direct interaction with downstream kinases such as Akt, MAPK kinases 1 and 2 (MEK1/2), PI3K, and p38 MAPK, leading to inhibition of their activities ([@B43]; [@B44]; [@B39]; [@B9]). Incoming evidence suggests a key role of GRK2 in the inflammatory signaling pathways. Intriguingly, GRK2 has been reported to be highly expressed in the immune system being a critical regulator of inflammatory responses ([@B57]). Furthermore, mice with GRK2 depletion in cells of myeloid lineage appear to display exaggerated inflammatory cytokine/chemokine production and organ injury as a result of macrophage hyperreaction to endotoxemia ([@B38]). Besides, it is of interest to note that GRK2 levels are altered in immune cells from human patients with some inflammatory disorders ([@B29], [@B28]; [@B12]; [@B58]; [@B3]; [@B7]).
Our recent work has shown that GRK2 plays a critical role in iNOS gene transcription in microglial cells stimulated with LPS ([@B22]). Based on this result, we postulated that GRK2 may function as TLR signaling to induce iNOS expression. To test this hypothesis, we attempted to delineate the role and mechanisms by which GRK2 regulates the TLR signaling pathway for iNOS induction using cultured mouse MG6 microglial cells.
Materials and Methods {#s1}
=====================
Cell Culture and Reagent
------------------------
Mouse microglial cell line MG6 cells (RCB2403) were obtained from RIKEN BRC (Tsukuba, Japan) and cultured as described previously ([@B22]). Cells were maintained until 70% confluency in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum, 10 μg/ml insulin, 10 μM 2-mercaptoethanol, 100 U/ml penicillin, and 100 μg/ml streptomycin at 37^°^C in a 5% CO~2~ incubator. Phosphorothioate-modified oligodeoxynucleotide (ODN) 1668 and control ODN were synthesized by Hokkaido system science (Hokkaido, Japan). The ODN1668 sequence was TCCATGACGTTCCTGATGCT and used as CpG-ODN. The control ODN (CTL-ODN) sequence was TCCATGAGCTTCCTGATGCT. GRK2 inhibitor (GRK2i), methyl 5-\[2-(5-nitro-2-furyl)vinyl\]-2-furoate was purchased from Calbiochem (San Diego, CA, United States). Stattic was obtained from Abcam (Cambridge, United Kingdom). BAY11-7082 and MG-132 were purchased from Sigma (Sigma, St. Louis, MO, United States).
siRNA Transfection
------------------
All small interfering RNAs (siRNAs) were purchased from Sigma-Aldrich (St. Louis, MO, United States). MISSION siRNA universal negative control (SIC-001) was employed as the negative control in this study. GRK2 siRNAs, signal transducers and activators of transcription 1 (STAT1) siRNAs, IFN regulatory factor 1 (IRF1) siRNAs, TIR-domain-containing adaptor-inducing interferon-β (TRIF) siRNAs, STAT3 siRNAs, interferon alpha and beta receptor subunit 1 (IFNAR1) siRNAs and IRF3 siRNAs were transfected at a final concentration of 60, 15, 50, 50, 40, 40, and 50 nM using lipofectamine RNAiMAX (Life Technologies, Carlsbad, CA, United States) according to the manufacturer's protocol, respectively.
Western Blot Analysis
---------------------
Cells were harvested and lysed in 300 μl of Radio-Immunoprecipitation Assay (RIPA) buffer (Thermo Fisher Scientific, Rockford, IL, United States) containing protease inhibitor cocktail (Nacalai Tesque, Kyoto, Japan) on ice. The lysates were centrifuged at 18,000 ×*g* for 10 min at 4°C and the resulting supernatants were reserved. The supernatant proteins were quantified using BCA Protein Assay Kit (Thermo Fisher Scientific). Samples (20 μg of protein) were run on 10% polyacrylamide gel and electrotransferred onto polyvinylidene fluoride filter membrane. The membrane was blocked for 60 min at room temperature in 1% bovine serum albumin in Tris-buffered saline containing Tween 20, followed by overnight incubation with primary antibody, anti-iNOS rabbit polyclonal antibody (1:1,000; Cell Signaling, Danvers, MA, United States), anti-STAT1 mouse monoclonal antibody (1:300; Santa Cruz Biotechnology, Santa Cruz, CA, United States), anti-phospho-STAT1 (Tyr-701) mouse monoclonal antibody (1:300; Santa Cruz Biotechnology), anti-GRK2 rabbit polyclonal antibody (1:500; Santa Cruz Biotechnology), anti-STAT3 mouse monoclonal antibody (1:1000; Cell Signaling), anti-phospho-STAT3 (Tyr-705) rabbit monoclonal antibody (1:1000; Cell Signaling), anti-IRF1 rabbit monoclonal antibody (1:1000; Cell Signaling), anti-lamin B1 rabbit polyclonal antibody (1:3000; Proteintech, Rosemont, IL, United States), or anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mouse monoclonal antibody (1:10000; Wako Pure Chemical, Osaka, Japan), at 4°C. Primary antibody detection was performed with horseradish peroxidase-conjugated secondary antibodies. Binding of the antibody was detected by an enhanced chemiluminescence (ECL) Plus chemiluminescent system (GE Healthcare, Tokyo, Japan) and levels of protein expression were quantified by a lumino image LAS-4000 analyzer (Fuji Film, Tokyo, Japan). Additional details are described by our laboratory ([@B48]; [@B1]; [@B36]; [@B22]).
RNA Extraction and Quantitative Reverse-Transcribed PCR
-------------------------------------------------------
Total RNA was isolated from cells with the use of Sepazol-RNA I Super G (Nacalai Tesque) according to the manufacturer's manual. ReverTra Ace qPCR RT Master Mix (Toyobo, Osaka, Japan) was used for the reverse transcription reaction, and quantitative PCR analyses were performed using PowerUp^TM^ SYBR^®^ Green Master Mix (Thermo Fisher Scientific), as described in the manufacturers' instructions. Values were normalized to the housekeeping gene GAPDH according to the manufacturer's protocol (MX3000P real-time PCR system; Agilent Technologies Inc., Santa Clara, CA, United States). The IFN-β primer sequences were 5′-CAGCT | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-children-07-00046}
===============
Anxiety may be defined as the bodily response to a perception of danger. If it is exaggerated or overplayed in case of the perception of danger that influences functionality, it may lead to a disorder in the long term \[[@B1-children-07-00046]\]. Contrary to some psychopathologies, anxiety refers to a feeling that has a part in both protection and adaptation of the individual throughout physical and mental developments. For example, the first day at school, sleeping alone or public speaking could make the individual tense or scared. However, if the feeling of anxiety persists and disturbs the quality of life and worsens family problems, the person may develop an anxiety disorder.
Even though anxiety disorder has been known since ancient times, comprehensive diagnostic and therapeutic studies started only in the first half of the 20th century \[[@B1-children-07-00046]\]. It generally develops among the children with various types such as, "generalized anxiety disorder, panic disorder, social anxiety disorder and separation anxiety disorder." This may trigger serious issues for the children---as well as their parents---and cause social problems in their mental developments that disturb the quality of life and raise in-house issues.
Anxiety disorders are common mental disorders in children and adolescents \[[@B2-children-07-00046]\]. Its prevalence in the general pediatric population ranges between 5%--18% in the US \[[@B3-children-07-00046],[@B4-children-07-00046]\]. The incidence of pre-adolescent children is lower (0.3%--12.9%) \[[@B5-children-07-00046]\]. Specific phobias, separation anxiety disorder and generalized anxiety disorder are the most common forms of anxiety disorder \[[@B6-children-07-00046]\]. Anxiety disorders are more common in girls \[[@B7-children-07-00046]\]. In terms of age, the age of separation anxiety is lower than other anxiety disorders \[[@B8-children-07-00046]\]. Some of the most common symptoms of anxiety in children include crying, unwillingness to go to school, fear, sadness, fear of separation, tension, restlessness, difficulty at focusing, difficulty at falling asleep, dry mouth and dizziness \[[@B9-children-07-00046]\].
Studies of anxiety disorder in children have increased in recent years \[[@B10-children-07-00046]\]. Some have been investigating its forms, upsetting factors and treatment methods \[[@B11-children-07-00046],[@B12-children-07-00046],[@B13-children-07-00046],[@B14-children-07-00046],[@B15-children-07-00046],[@B16-children-07-00046]\]. We briefly examine significant findings of the previous studies regarding its patterns and stimulating factors.
Separation anxiety disorder (SAD) has been identified as the most common form of anxiety disorder observed during early childhood and influences approximately 4% of all children under 12 around the world \[[@B11-children-07-00046]\]. In terms of treatment attempts, studies \[[@B12-children-07-00046],[@B13-children-07-00046]\] have been conducted to test certain methods such as cognitive-behavioral therapy and drugs to reduce symptoms of the separation anxiety disorder among children.
One study \[[@B14-children-07-00046]\] examined the prevalence of anxiety disorders and behavioral shyness among preschool children. Prevalence was found to be approximately 22.2%. Furthermore, in a recent study conducted in Turkey, the temperament levels of the mothers of the preschool children diagnosed with the anxiety disorder were investigated by observing the children and interviewing their mothers \[[@B15-children-07-00046]\]. They observed the children and interviewed their mothers. It was discovered that the mothers had high levels of depressive, cyclothymic, irritable and anxious temperament. Furthermore, the existing mental problems of the mothers were the triggering elements of the anxiety disorder for the children. Similarly, other studies that investigated potential reasons behind anxiety disorder in children state that children's mental health is disturbed by parents' temperament and character traits \[[@B15-children-07-00046]\].
Attachment is an important emotional concept for the individual, as it is based on relations of comfort, self-confidence and satisfaction \[[@B16-children-07-00046],[@B17-children-07-00046]\]. It may be described as a cluster of strong emotional ties that people develop for individuals they care about. It is shaped by the nature of the relations with the caregiver. Its nature is specific to any kind of relationship. Patterns of attachment formed in early years are transferred to later periods of life through such models without undergoing a substantial change \[[@B18-children-07-00046]\]. According to the attachment theory, attachment patterns are created based on the continuity and cognitive models of an individual's cognitive abilities \[[@B19-children-07-00046]\].
Bonding between the child and parent plays a crucial part in the healthy upbringing of a child and negative types of attachment influence an individual's quality of life adversely in later years \[[@B19-children-07-00046],[@B20-children-07-00046],[@B21-children-07-00046],[@B22-children-07-00046]\]. Children express their feelings of attachment for their parents through behavior, such as crying, calling, greeting, laughing.
Parental bonding instrument (PBI) is an important measurement scale regarding parental attachment perceptions. It measures attachment data from the retrospective perspective. It principally evaluates an individual's perceived relationship with parents. It consists of two subscales: care and overprotection (or control). Subscales are measured for mother and father separately. In addition, four typical types of bonding features may be obtained with PBI to determine te parenting styles, such as high care and low protection---accepted as optimal parenting \[[@B22-children-07-00046]\].
Parental attachment is defined as bonding between parent and child \[[@B22-children-07-00046]\]. Attachment theory is based on the idea that there are individual differences in the way infants are emotionally attached to their caregivers, and this has impacts on their cognitive and emotional development \[[@B18-children-07-00046]\]. Possible connections between attachment patterns of the caregiver and the anxiety disorder of a child may help us better understand this disorder and prevent possible psychopathologies that may develop in children in the future through changes in parental behavior.
[Table 1](#children-07-00046-t001){ref-type="table"} shows how children feel and perceived attachment in terms of four particular attachment styles and types of anxiety.
The securely attached child shows positive emotions to the family. It can be separated from parents without stress, seeks parents' comfort when scared and positively responds to parents' return. Children with an anxious attachment may be cautious around strangers and get very anxious as their parents leave. The avoidant child may neglect the family, does not want much care from their parents and does not care about strangers. Disorganized attachments display a mixture of indifferent and obsessive behaviors. They may be confused or worried. There is no clear-cut attachment behavior.
In light of the review of the literature, the following hypothesis were proposed: (1) A statistically significant difference exists between the patients' mothers' parental care in the experimental and the control group; (2) A statistically significant difference exists between the perceived care and protection scores of the mothers in the experimental group; (3) A statistically significant difference exists between the perceived care and protection scores of the mothers in the control group.
In relevant studies, the relationship between anxiety disorder and mother's temperament \[[@B23-children-07-00046]\], adolescent clinical characteristics \[[@B24-children-07-00046],[@B25-children-07-00046]\], familial traits \[[@B26-children-07-00046]\] and the incidence of mental disorder were investigated in Turkey. As no particular study previously focused on the relationship between the anxiety disorder of the children and the attachment patterns of their mothers to their parents, this study could be considered as the study of its kind in any country.
2. Materials and Methods {#sec2-children-07-00046}
========================
2.1. Ethics Approval {#sec2dot1-children-07-00046}
--------------------
All subjects gave their informed consent for inclusion before they participated in the study. The study was conducted by the Declaration of Helsinki, and the protocol was approved by the Çağ University Institute of Social Science Research Ethics Committee Ref Number: 23867972/2015 (date 21/12/2018).
2.2. Setting {#sec2dot2-children-07-00046}
------------
The sample of the study consisted of the mothers of children who were admitted to a city hospital and a private clinic in the city of Kayseri, Turkey, and diagnosed with an anxiety disorder by specialist child psychiatrists.
2.3. Participants {#sec2dot3-children-07-00046}
-----------------
The criteria to be included in the study were being a caregiver and parent of a child diagnosed with an anxiety disorder. The participants were 80 mothers (40 in the experimental group and 40 in the control group). [Table 2](#children-07-00046-t002){ref-type="table"} summarizes their sociodemographic characteristics. A purposive sampling method was utilized to select suitable patients. Two requirements included being at the age of between 20 and 65 years old, and that the parent had a child diagnosed with an anxiety disorder.
2.4. Data Collection {#sec2dot4-children-07-00046}
--------------------
A sociodem | {
"pile_set_name": "PubMed Central"
} |
All data are included within the paper.
Introduction {#sec001}
============
The majority of viral, bacterial, and parasitic infections occur at mucosal surfaces, thus developing effective mucosal vaccines would greatly decrease the burden of infectious diseases. This task has however been challenging, mainly due to the poor stability, uptake, and immunogenicity of mucosally-administered antigens. As a result, very few mucosal vaccines are currently licensed for use in humans \[[@pone.0118067.ref001]\]. Oral vaccines are especially convenient for mass-immunizations, since they are preferred over parenteral injections and eliminate the use of needles and syringes \[[@pone.0118067.ref002]\]. To be effective, oral vaccines must be efficiently internalized at mucosal surfaces and induce antigen-specific effector, as well as memory B and T cell responses. Especially important for protection against pathogens and their toxins are mucosal antibodies, which can neutralize mucosal antigens and limit their access to the internal milieu \[[@pone.0118067.ref003]\]. Secretory IgA, a predominant antibody in intestinal secretions, can bind to and neutralize microorganisms and toxins, preventing them from making contact with and crossing the epithelial cell barrier \[[@pone.0118067.ref004],[@pone.0118067.ref005]\]. Specifically, intestinal IgA was shown to neutralize cholera toxin \[[@pone.0118067.ref006],[@pone.0118067.ref007]\], reduce motility of *Salmonella* \[[@pone.0118067.ref008]\], as well as decrease the ability of *Shigella* to invade the intestinal epithelium \[[@pone.0118067.ref009]\]. In addition, oral transfer of specific IgA antibodies was shown to protect mice against bacterial infections such as *S*. *typhimurium* \[[@pone.0118067.ref010],[@pone.0118067.ref011]\], *V*. *cholera* \[[@pone.0118067.ref012]\], *S*. *flexneri* \[[@pone.0118067.ref013]\], and *H*. *felis* \[[@pone.0118067.ref014]\]. In addition to aiding in the "trapping" of antigens in the intestinal mucus, IgA is also important for expelling antigens from the internal milieu into the intestinal lumen via transcytosis, as well as transporting lumen antigens into underlying lymphoid tissues for the initiation of immune responses \[[@pone.0118067.ref015],[@pone.0118067.ref016],[@pone.0118067.ref017],[@pone.0118067.ref018]\]. Although parenteral vaccination induces systemic antibodies and protection against some mucosal pathogens such as HPV, polio and influenza viruses \[[@pone.0118067.ref019],[@pone.0118067.ref020]\], mucosal vaccination induces systemic, and most importantly, local mucosal antibodies that can offer protection against mucosal pathogens such as HIV, rotavirus, norovirus, *V*. *cholera*, and *Mycobacterium* spp. \[[@pone.0118067.ref021],[@pone.0118067.ref022],[@pone.0118067.ref023],[@pone.0118067.ref024],[@pone.0118067.ref025]\]. Therefore, the efficacy of an oral vaccine will in great part depend on the vaccine's ability to induce long-lasting production of antibodies at mucosal surfaces. In addition, to increase the efficacy of vaccine formulations, various prime-boost immunization strategies have been used \[[@pone.0118067.ref026]\]. Prime-boost immunization regimen influences localization and the strength of the immune response induced, thus vaccine efficacy \[[@pone.0118067.ref027]\]. The immunogenicity of many vaccine formulations depend on their co-administration with adjuvants. However, there are safety concerns associated with the use of most effective adjuvants. Similarly, live attenuated vaccine strains that have been developed for mucosal immunization raise concerns that attenuated strains might revert to virulence, trigger, exacerbate autoimmune diseases, or cause disease in immunocompromised individuals \[[@pone.0118067.ref028]\].
To overcome some of these challenges, nano-scale particles (such as liposomes, ISCOMs, virus-like particles, etc.) have become increasingly popular as vehicles for the delivery of antigens and drugs \[[@pone.0118067.ref029]\]. NPs of various sizes have been engineered of biodegradable materials and can be impregnated with or conjugated to multiple antigens, and thus potentially be safe while inducing immunity to multiple pathogens. NPs larger than 200 nm have been mainly used for antigen delivery due to their ability to carry larger amount of antigen cargo \[[@pone.0118067.ref030],[@pone.0118067.ref031],[@pone.0118067.ref032]\]. However, smaller NPs can penetrate the mucus barrier and are internalized at mucosal surfaces more efficiently than larger NPs \[[@pone.0118067.ref033],[@pone.0118067.ref034],[@pone.0118067.ref035]\]. We showed that intestinal epithelial cells efficiently internalize p.o. administered 20 and 40 nm NPs, which are then transported to the draining mesenteric lymph nodes (MLNs) \[[@pone.0118067.ref036]\]. Here we demonstrate that NP-conjugated antigen administered p.o. reaches the internal milieu in an immunogenic form and induces systemic and mucosal antibodies. In addition, we show that mucosal priming with NP-Ova is necessary for a mixed systemic Th1/Th2 immune response. Moreover, mucosal priming with NP-Ova, followed by s.c. boosting immunization was necessary for induction of long-lasting serum IgG1 and IgG2c, as well as intestinal IgA. These findings have implications for the development of mucosal vaccines and prime-boost immunization strategies. In addition, this work will aid in the understanding of fundamental mechanisms that govern immune responses to orally acquired antigens.
Materials and Methods {#sec002}
=====================
Ethics statement {#sec003}
----------------
This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Southern Illinois University Institutional Animal Care and Use Committee (Protocol Number: 13--057). Animals were housed in centralized AAALAC-accredited research animal facilities, staffed with trained husbandry, technical, and veterinary personnel.
Animals, reagents, and antibodies {#sec004}
---------------------------------
For these studies six to eight week-old male and female C57BL/6 mice (Jackson Laboratories) were used. Chicken Ova (Sigma) was used as a model protein antigen. Carboxylate-modified fluorescent polystyrene nanoparticles (20 nm, Invitrogen) were conjugated to Ova and every batch of conjugated NPs was analyzed by dot-blot as described previously \[[@pone.0118067.ref036]\]. Biotinylated rabbit anti-Ova antibodies (Thermo Scientific) in combination with streptavidin-FITC (eBioscience) were used to detect Ova and NP-Ova on dot blots. Goat anti-mouse IgG1, IgG2c, and IgA antibodies conjugated to alkaline phosphatase (AP) (Southern Biotechnology) were used for determination of antibody titers in sera and fecal extracts of immunized mice as described previously \[[@pone.0118067.ref037]\].
Administration of Ova and NP-Ova to the mice {#sec005}
--------------------------------------------
For p.o. immunizations mice were fasted for 4 h, then administered 200 μl PBS (control), Ova (25 mg/200 μl PBS), NP-Ova (0.25 mg/200 μl PBS), or an equivalent dose of Ova (0.25 mg/200 μl PBS) via a gastric gavage using a round-tip needle on days 0, 3, 6, and 8. In total, mice received 0 mg Ova (control), 100 mg, and 1mg Ova (either as NP-Ova or soluble Ova). For immunizations NPs were diluted 1:10 in PBS, from an original concentration of 2% (wt/wol). At day 28 after p.o. inoculation, mice were s.c. injected with 300 μg Ova in CFA (Sigma). In other experiments mice were primed either p.o. with NP-Ova as described above or s.c. with 200 μl of NP-Ova, then boosted p.o. with 200 μl of NP-Ova diluted in PBS at 10% from an original NP concentration of 2%.
Collection of fecal pellets and blood samples {#sec006}
---------------------------------------------
Before immunizations and every week thereafter, fecal pellets were collected from each mouse and diluted in PBS containing 0.02% sodium azide (Sigma) to a final concentration of 100 mg dry matter/ml of PBS. Diluted fecal pellets were homogenized and then centrifuged at 10,000 × g for 10 minutes. Supernatant devoid of fecal debris was collected and stored at -20°C until further analysis. Blood samples were collected via the tail vein using a 30 g needle, and serum was stored at -20°C until further analysis.
Determination of Ova-specific antibody titers in sera and fecal extracts using ELISA assay {#sec007}
------------------------------------------------------------------------------------------
Flat-bottomed 96-well plates were coated with 100 μl of 50 μg/ml Ova (Sigma) solution in coating buffer (0.02 M Na~2~CO~3~/0.07 M NaHCO~3~ in H~2~O, pH 9.6) and allowed to incubate overnight at 4°C. After the unbound antigen was removed, wells were then blocked for 1 h at 37°C with 200 μl of blocking buffer (0.2% porcine gelatin (Sigma) in PBS). Although bovine serum albumin (BSA) is often used for ELISA assays, to avoid experimental | {
"pile_set_name": "PubMed Central"
} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.