text stringlengths 1 18.8k | meta dict |
|---|---|
Introduction {#Sec1}
============
Bone is one of the most common sites of metastasis for various primary tumors including prostate, breast, lung, and kidney cancers^[@CR1],[@CR2]^. Although bone metastasis is associated with increased morbidity and mortality, promising therapy to prevent bone metastasis is currently unavailable. This deficiency emphasizes the need for new therapeutic approaches targeting molecular mechanisms that regulate bone metastasis and for new models to study this disease phenomenon.
Murine models of bone metastasis using intracardiac (IC) and intratibial injections have been instrumental in revealing molecular mechanisms underlying metastatic processes and translational studies for drug development^[@CR3],[@CR4]^. During the past two decades, IC injection has been the gold standard to develop bone metastasis in mice^[@CR5]--[@CR9]^ by injecting cancer cells into the left ventricle to disseminate them to the whole body including bone marrow tissue via the arterial bloodstream, which eventually develop into metastatic colonies in the bone and other organs^[@CR10]^. Unlike intratibial injection that severely damages the tibia, IC injection recapitulates the bone metastasis process, including survival of cancer cells in the bloodstream, extravasation, micro-colony formation, and metastatic progression in the intact bone marrow, and thus provides more relevant information for drug development. IC injection, however, is insufficient for rapid studies in this field, mainly owing to its requirement for high technical proficiency to exactly insert a syringe needle into the left ventricle of a mouse, causing severe cardiac stresses^[@CR3],[@CR4]^. This limits the number of cancer cells that can be injected at one time, leading to limited delivery of cancer cells to the bone. Thereby analysis with IC model may bias toward cancer cell lines with relatively high metastatic ability. Furthermore, cancer cells are preferably delivered to organs other than bone, such as the lungs and liver, and often develop into lethal cancers in other organs, hampering or even terminating studies of bone metastasis with cell lines with relatively slow metastasis development. New models overcoming such limitations would accelerate basic studies and drug development for bone metastasis.
Here, we present the establishment of a new murine model that predominantly develops bone metastasis in the hind limbs at high frequency. In this model, cancer cells are injected via the caudal artery (CA) in the tail, and the technique is as easy as tail vein injection. CA injection rarely causes acute death and facilitates the injection of a large number of cancer cells, thereby greatly increasing the frequency of bone metastasis for various types of cancer cells. Therefore, CA injection provides an easy-to-use murine model to develop overt bone metastasis in a short time and could greatly facilitate studies to understand bone metastasis and to prevent them.
Results {#Sec2}
=======
CA as a new route for injection {#Sec3}
-------------------------------
To develop a novel murine bone metastasis model, we searched for an alternative arterial route to deliver cancer cells to bone marrow in mice. The CA was the most easily accessible route to inject cancer cells without any surgical procedures (Fig. [1a](#Fig1){ref-type="fig"}). Although cell distribution after IC injection has been well studied, no study has assessed CA-injection route. Therefore, to examine whether this route could be practically used for injection, we injected fluorescent nanoparticles emitting near-infrared II (NIR-II) fluorescence (maximum emission at 1530 nm)^[@CR11],[@CR12]^. Because the nanoparticles injected via CA were thought to eventually travel to the tail vein, we compared their distributions after CA and intravenous (IV) injection by video-rate fluorescence imaging. Surprisingly, CA-injection exhibited totally different routes from IV injection: Injecting nanoparticles into the CA quickly illuminated the capillary bed in the lower body of mice, whereas nanoparticles injected via the tail vein resulted in slow and modest illumination (Fig. [1b](#Fig1){ref-type="fig"} and Supplementary Movies [1](#MOESM3){ref-type="media"} and [2](#MOESM4){ref-type="media"}). This result implied that the CA can be a practical injection rout and may be suitable for delivery of cancer cells to the bone of hind limbs. To track the fate of cancer cells after CA injection, we used murine lung carcinoma LLC cells constitutively expressing firefly luciferase (LLC/luc). In vivo bioluminescence (BL) imaging revealed predominant delivery of LLC/luc cells to the lower body by CA injection that is technically as easy as tail vein injection (Fig. [1c](#Fig1){ref-type="fig"} and Supplementary Movie [3](#MOESM5){ref-type="media"}). CA injection delivered cancer cells three-fold more efficiently to hind-limb bone marrow than IC injection, as revealed by luciferase activity in the bone marrow 30 min after injection of LLC/luc cells (Fig. [1d](#Fig1){ref-type="fig"}). This result was well correlated to the one of ex vivo bone imaging acquired just after dissection (Supplementary Fig. [1](#MOESM1){ref-type="media"}). In addition, ex vivo BL imaging of representative organs confirmed dominant delivery of cancer cells to organs of the lower body after CA injection; in contrast, IC injection resulted in dissemination of cancer cells to various tissues (Fig. [1e](#Fig1){ref-type="fig"} and Supplementary Fig. [2](#MOESM1){ref-type="media"}). These results indicated that CA injection provide a preferable model to study bone metastasis.Fig. 1CA injection efficiently delivered cancer cells to bone marrow of a hind limb. **a** Location of caudal artery in a mouse (left) and a schematic of cross section of mouse tail (right). A yellow arrow indicates the caudal artery along the tail. **b** Comparison of fluorescence images after intra-caudal artery (CA) or tail vein (IV) injection of near-infrared II nanoparticles. **c** Representative BL images at 30 min after injecting LLC/luc cells through caudal artery (CA) or left ventricle (IC). **d** BL intensity of LLC/luc cells harvested from bone marrow of hind limbs at 30 min after CA or IC injection. *n* = 8, \**P* \< 0.05 (two-side student's *t*-test). Error bars indicate s.e.m. **e** Biodistribution of LLC/luc cells after CA or IC injection. Major organs were removed at 30 min after injecting LLC/luc cells and ex vivo BL imaging was performed. BL intensity of each organ was quantitatively analyzed and its relative BL intensity to the one in hind limb is shown. B brain, H heart, Lv liver, S spleen, K kidney, P pancreas, T testis, Lg lung, SI stomach and intestine, V vesicular gland. *n* = 3, \**P* \< 0.05 (two-side student's *t*-test)
Cancer cell distribution after CA injection {#Sec4}
-------------------------------------------
We next compared the efficacy of bone metastasis development in mice, between CA and IC injections, by comparing luciferase activity over time after transplanting LLC/luc cells. BL intensities in the hind limbs were significantly higher after CA injection than after IC injection (Fig. [2a](#Fig2){ref-type="fig"}). Over time, growth rates were similar between these models throughout the development of bone metastasis (Fig. [2a](#Fig2){ref-type="fig"} and Supplementary Fig. [3](#MOESM1){ref-type="media"}), indicating that differences in stress between the methods, during injection and dissemination, did not affect cell proliferation in the bone marrow. Histological analysis confirmed an increase in the number of bone metastatic lesions in CA-injected mice 7 days after the injection of LLC/luc cells (Fig. [2b](#Fig2){ref-type="fig"} and Supplementary Fig. [4](#MOESM1){ref-type="media"}). In addition, significantly larger tumors were observed in the hind-limb bones of CA-injected mice at 14 days after LLC/mKO2-Rluc cell injection (Fig. [2c](#Fig2){ref-type="fig"} and Supplementary Fig. [5](#MOESM1){ref-type="media"}). X-ray micro-computed tomography (CT) imaging revealed a decrease in bone mass in CA-injected mice compared to that in IC-injected animals (Fig. [2d](#Fig2){ref-type="fig"} and Supplementary Fig. [6](#MOESM1){ref-type="media"}), confirming enhanced bone metastasis in CA-injected mice. CA injection enabled observation for more than 32 days after cancer cell injection. In contrast, IC-injected mice became weak and could not be observed after day 25 due to death (Fig. [2e](#Fig2){ref-type="fig"}). Ex vivo BL imaging of representative organs at 32 days after CA injection of LLC/luc cells revealed the development of metastasis predominantly in the hind-limb bones and some nonlethal micrometastases in vesicular glands (Fig. [2f](#Fig2){ref-type="fig"}). Most importantly, we obtained essentially similar BL imaging results in all CA-injected mice without failure.Fig. 2CA injection accelerated development of bone metastasis in a hind limb. **a** Representative BL images (left) and BL intensity in region of interest (ROI) (right) at indicated days after LLC/luc cells injection by CA (*n* = 16) or IC injection (*n* = 12). Red circles in the images of 0.5 h indicate ROI. \**P* \< 0.05 (two-side student's *t*-test). Error bars indicate s.e.m. **b** Metastatic lesions | {
"pile_set_name": "PubMed Central"
} |
{#sp1 .14}
{#sp2 .15}
| {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
Bladder cancer, the fourth most common tumor in men and the eighth in women, remains a huge concern for the medical community because of its incidence and prevalence rates, as well as high percentage of recurrence and progression \[[@B1]--[@B4]\]. Mortality rates in muscle-invasive disease are still very high, despite the growing efforts on earlier diagnosis and aggressive and multidisciplinary treatments \[[@B4], [@B5]\].
In this context, preventive strategies are crucial for the management of bladder cancer, but they still demand a better elucidation of the carcinogenetic process. Exogenous factors, such as cigarette smoking, which accounts for a huge percentage of cases, as well as occupational carcinogens, such as aromatic amines and polycyclic aromatic hydrocarbons, are important determinants of the disease appearance \[[@B6], [@B7]\]. However, apart from the genetic features already characterized \[[@B8], [@B9]\], the cellular and molecular mechanisms might involve inflammatory, proliferative, and oxidative stress phenomena that deserve further elucidation. In fact, the identification of promising drugs depends on continuous research concerning the molecular/cellular mechanisms underlying cancer appearance and progression.
The experimental model of rat bladder cancer induced by *N*-butyl-*N*-(4-hydroxybutyl) nitrosamine (BBN) is an appropriate and validated model to study human cancer development. In fact, due to the histological similarities with the human bladder cancer, it has been the most used model for the study of tumor pathophysiology, as well as for the evaluation the efficacy of therapeutic strategies \[[@B10]--[@B12]\]. The urothelial carcinogenesis is a continuous and slow process that goes through molecular and morphological changes, from benign to aggressive lesions, including initial dysplastic and proliferative epithelial abnormalities, preneoplastic changes, and malignant lesions (papilloma and carcinoma) \[[@B12]--[@B14]\]. Thus, an early treatment targeting these pathways could hypothetically prevent bladder cancer development and growth. Previous reports have demonstrated beneficial effects of preventive strategies, including our own studies using anti-inflammatory and anti-proliferative agents \[[@B15]--[@B19]\].
Polyunsaturated fatty acids (PUFAs) have many physiological roles in the body, including acting as sources of cellular energy, regulators of protein synthesis, building blocks of phospholipids and glycolipids required for cell membrane structure, and components of membranes that regulate the fluidity, permeability, and dynamics of cell membranes, as well as precursors for many hormones, inter- and intracellular messengers as well as their receptors \[[@B20], [@B21]\]. PUFAs nomenclature is based on the position of the first carbon-carbon double bond within the long hydrocarbon chain; two of the four families cannot be synthesized from the body\'s carbohydrate stores and are required from the diet and are, thus, named as essential fatty acids (EFAs) and include the omega-3 (*ω*-3) and omega-6 (*ω*-6) oils. Considering their various biological activities, such as antioxidant and anti-inflammatory properties, *ω*-3 fatty acids have been viewed as useful weapons against several conditions, including those of cardiovascular/atherogenic, neuronal/degenerative, and inflammatory and neoplastic nature \[[@B22]--[@B26]\].
There is a wide range of chronic inflammatory, oxidative, and proliferative conditions that make cells susceptible to neoplastic transformation. The omega-3 fatty acids, due to their antioxidant and anti-inflammatory properties have been tested as chemopreventive and/or therapeutic agents, *per se* and in combination with drugs and/or radiotherapy, in several cancer types \[[@B27]--[@B30]\], but the putative efficacy on bladder cancer remains to be elucidated. The purpose of this study was, thus, to evaluate the chemopreventive efficacy of *ω*-3 fatty acids, in particular eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), in a rat model of bladder cancer induced by a nitrosamine.
2. Material and Methods {#sec2}
=======================
2.1. Animals and Groups {#sec2.1}
-----------------------
Forty-four male Wistar rats obtained from Charles River Lab. Inc. (Barcelona, Spain), weighting around 250 g, were maintained in an air-conditioned room, subjected to 12 hours dark/light cycles, and given standard laboratory rat chow (SAFE A-04, Augy, France) and free access to tap water. Animal experiments were conducted according to the European Communities Council Directives on Animal Care. The animals were divided in four groups: control group (*n* = 8)---vehicle (orange juice); carcinogen (BBN) group (*n* = 20)---0.05% of *N*-butyl-*N*-(4-hydroxybutyl) nitrosamine (Tokyo Chemical Industry Co., Ltd., Tokyo, Japan); *ω*-3 group (*n* = 8)---600 mg/kg BW/day of DHA + EPA (240 + 360, resp.); and *ω*-3 + BBN group (*n* = 8)---in the same conditions described for the previous treatments. The animals underwent a two-phase protocol: a first period of 8 weeks for tumor induction and pharmacological treatment (orange juice, BBN and/or *ω*-3) and a second one of 12 weeks for cancer expression and putative prevention. BBN was given in drinking water and *ω*-3 and vehicle were administered by gavage, using an esophageal cannula. All the animals completed the 20-week study protocol. Body weight (BW) was measured weekly and drink beverage was monitored during the experimental period at intervals of two days.
2.2. Sample Collection and Preparation {#sec2.2}
--------------------------------------
Blood: at the end of treatment, animals were subjected to a blood collection procedure: first, the rats were injected with intraperitoneal anesthesia with 2 mg/Kg BW of a 2 : 1 (v : v) 50 mg/mL Ketamine (Ketalar, Parke-Davis, Pfizer Lab., Seixal, Portugal) solution in 2.5% chlorpromazine (Largactil, Rhône-Poulenc Rorer, Vitória lab., Amadora, Portugal). Blood samples were immediately collected by venipuncture from the jugular vein in needles with no anticoagulant (for serum samples collection). Tissues: the rats were sacrificed by cervical dislocation, and the lungs, stomach, liver, kidneys, and intestines were immediately removed, weighted, and placed in formaldehyde for histological evaluation. Before removal, bladders were intraluminally injected with a buffered formaldehyde solution as prefixation for histological analysis.
2.3. Tumor Chemoprevention Analysis {#sec2.3}
-----------------------------------
### 2.3.1. Quantitative Analysis (Number and Tumor Volume) {#sec2.3.1}
Each bladder pre-fixated in formaldehyde was carefully open; the lumen was inspected for grossly visible lesions and the number of tumors per rat and the tumor volume were reported in order to calculate the % of tumor per group and the mean volume per rat and per tumor.
### 2.3.2. Qualitative Analysis (Bladder Histology) {#sec2.3.2}
The bladder was immersion fixed in 4% buffered formaldehyde and processed for paraffin sectioning. Three slices from each bladder were embedded. Three micrometer thick sections were stained with haematoxylin & eosin (H&E) and examined histologically by clinical personnel with expertise.
2.4. Proliferation, Inflammation, and Redox Status Markers {#sec2.4}
----------------------------------------------------------
Serum levels of transforming growth factor beta-1 (TGF-β1) were measured through an ultrasensitive Quantikine ELISA kits (R&D Systems, Minneapolis, USA). Serum C-reactive protein (CRP) was measured by using an ELISA kit from Helica Biosystems, Inc. (Fullerton, CA, USA). Serum redox status was assessed by the thiobarbituric acid reactive species (TBARs) assay, measuring lipid peroxidation via malondialdehyde (MDA) content, and by the total antioxidant status (TAS) quantification, through ferric reducing antioxidant potential (FRAP) assay, as previously described \[[@B16]\].
2.5. Bladder Cancer CD31 Immunohistochemistry {#sec2.5}
---------------------------------------------
Immunohistochemical (IHC) staining of CD31 in bladder cancer tissue was performed in paraffin-embedded tissue, which was cut into 4 mm sections and mounted on polisinated slides, using standard staining procedures, as described previously \[[@B18]\]. Representative slides were selected for staining and histologic evaluation. Briefly, slides were deparaffinized and hydrated with water. Antigen enhancement was performed by pretreating with microwave heating in a citrate buffer, pH 6.00 (for three pulses of 5 min each at 250 W). The slides were washed three times, 2 min each, and then incubated with blocking serum for 10 min to block the nonspecific binding, and the excess of blocking serum was removed. Staining was performed using a primary monoclonal antibody. A negative control was obtained by omitting the primary antibody. Diaminobenzidine was used as chromogen. Standard procedures were used for visualization and the intensity and/or percentage of positive staining in the dominant pattern within the tumor was graded on a semiquantitative scale (0--3), in which 0 is very low intensity and \<25% of staining; 1 is mild and between 25 and 50%; 2 is moderate and between 50 and 75%; and 3 is severe and \>75% of staining. All slides were reviewed by expert investigators in a blinded data manner.
2 | {
"pile_set_name": "PubMed Central"
} |
{#sp1 .70}
{#sp2 .71}
{#sp3 .72}
{#sp4 .73}
| {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Calcitonin (CT) is a 32-amino acid peptide secreted from the parafollicular cells (C-cells) of the thyroid gland and belongs to a family of peptides including CT gene-related peptide, amylin, adrenomedullin, intermedin and CT receptor (CTR)-stimulating peptide \[[@b1]--[@b4]\]. CT is a hypocalcaemic hormone that induces Ca^2+^ deposition in bones and stimulates calcium excretion into urine \[[@b5]--[@b7]\]. Clinically, CT has been used for treatment of osteoporosis, Paget's disease and hypercalcemia. CT functions by binding to its receptor, CTR, which is a class II G-protein-coupled receptor predominantly expressed in osteoclasts. CTR in osteoclasts has been previously shown to be coupled to Gα and Gα~q~ proteins that links the receptor to both adenylate cyclase--cAMP--protein kinase A (PKA) and Ca^2+^-protein kinase C (PKC)-dependent pathways \[[@b8]\].
High levels of CT lead to diarrhoea. For example, diarrhoea has been reported to occur in 28--39% of patients with medullary thyroid carcinoma (MTC) associated with elevated levels of CT \[[@b9]--[@b11]\]. The diarrhoea in patients with MTC is usually severe, watery and lacks specific treatment and therefore, the mortality is high. Diarrhoea is also observed in other cases such as infusion of CT for hypercalcemia, CT-secreting pancreatic micro-tumours and small cell lung tumours \[[@b12]--[@b16]\]. Previous perfusion studies have shown that CT infusion in healthy humans and rabbits inhibited active sodium absorption and induced active chloride secretion \[[@b17], [@b18]\]. However, the detailed molecular mechanisms of CT-induced chloride secretion in intestinal epithelial cells are poorly understood.
Intestinal chloride secretion plays an important role in body fluid homeostasis and diarrhoea. Several transport processes present on the basolateral and the apical membranes of intestinal cells are involved in driving chloride secretion into the intestinal epithelial lumen. The main chloride channel expressed in small intestine and colon is the cystic fibrosis transmembrane conductance regulator (CFTR). CFTR is expressed in many epithelial tissues, where it has been found to have multiple putative functions, the major one being that of a chloride channel. Activation of CFTR as a Cl^−^ channel requires cyclic AMP, PKA and ATP \[[@b19]\]. Mutations in the gene encoding CFTR leading to a decrease in chloride channel function, is the primary defect in cystic fibrosis, a disease that affects approximately 30,000 patients in the United States alone \[[@b20]\]. On the other hand, activation of CFTR by cholera toxin leads to a massive secretory diarrhoea and life-threatening dehydration \[[@b21]\]. Whether the activation of CTR by CT also stimulates chloride secretion *via* CFTR is not known.
Therefore, current studies were undertaken to investigate the expression of CTR in intestinal epithelial cells and to examine the effect of CT on electrolyte secretion in colonic T84 cell line. Our data showed that CT induced chloride secretion *via* CFTR in a Ca^2+^- and cAMP-dependent manner. Our current studies provide novel insights into the molecular basis of CT-induced chloride secretion that may unravel potential targets for better therapy of diarrhoea associated with high levels of CT.
Materials and methods
=====================
Cell culture
------------
Experiments were performed with the human intestinal T84 cell lines as previously described \[[@b22]\]. DMEM/F12 with 6% calf serum was used for T84 cells. For simultaneous measurements of \[Ca^2+^\] and increased short circuit current (*I*~SC~), cells were seeded onto Snapwell membranes (Costar, Corning, NY, USA) with 0.4 μm pore diameter (culture area 0.1 cm^2^). Cells reached confluency after 7 to 8 days, with a resistance greater than 500 -Ω- cm^2^, and then mounted in Ussing chambers (Physiologic Instruments, San Diego, CA, USA) for electrical measurements.
Real time quantitative RT-PCR analysis
--------------------------------------
RNA was extracted from T84 cells using Qiagen RNeasy kits (Qiagen, Valencia, CA, USA). Equal amounts of RNA from T84 cells were reverse transcribed and amplified in one-step reaction for β-actin and CTR by using Brilliant SYBR Green quantitative RT-PCR (QRT-PCR) Master Mix kit (Stratagene, Santa Clara, CA, USA). Real-time QRT-PCR was performed by using Mx3000P (Stratagene). Human CTR was amplified with gene-specific primers (sense primer: 5′-GCAGGAAGATGTATGCTTTGA-3′; antisense primer: 5′-CTTTACAACAGCTAGGTCCTG-3′) \[[@b23]\]. Human β-actin was amplified as an internal control by using gene-specific primers (sense primer: 5′-CATGTTTGAGACCTTCAACAC-3′; antisense primer: 5′-CCAGGAAGGAAGGCTGGAA-3′) \[[@b24]\].
Immunoblotting
--------------
For immunoblotting studies, briefly, cell lysates were prepared from T84 cells using radio immunoprecipitation assay (RIPA) buffer. A total of 100 μg protein from each of the T84 cells lysates was solubilized in Laemmli sample buffer (2% SDS, 100 mM dithiothreitol, 60 mM Tris, pH 6.8, 0.01% bromophenol blue) and was separated on 8% Tris/glycine SDS-PAGE. For CFTR, 75 μg protein from T84 cell lysate was used. The blot was then probed with primary rabbit anti-CTR antibodies (1:500, Abcam, Cambridge, MA, USA) or rabbit anti-CTR antibody (1:1000) from SantaCruz (Santa Cruz, CA, USA) or rabbit anti-actin antibody (1:5000) from Sigma (Saint Louis, MO, USA) for loading control. Goat anti-rabbit antibody (1:2000, SantaCruz) was used as secondary antibody. The bands were visualized by enhanced chemiluminescence according to the manufacturer's instructions (Amersham, Piscataway, NJ, USA).
Measurement of intracellular Ca^2+^ and cAMP levels in T84 cells
----------------------------------------------------------------
Fluo calcium indicator, Fluo-4,AM (Invitrogen, Carlsbad, CA, USA) was used for measuring intracellular \[Ca^2+^\] changes after CT treatment according to company's suggested protocol. Briefly, transwell cultured T84 cells were incubated with Fluo-4,AM (5 μM) in cell culture incubator for 45 min. After washing with 1 × phosphate-buffered saline (PBS), cells were incubated in 1 × PBS for 30 min. to allow complete de-esterification of intracellular AM esters. The cells were then mounted on a Carl Zeiss LSM 510 laser (Carl Zeiss, Jena, Germany) scanning confocal microscope for live calcium imaging. Beam of 488 from a UV laser was used for excitation. CT was added to basolateral side at a concentration of 10 nM. Images were captured every 5 sec. for 5 min. Intracellular cAMP levels were determined using the Amersham Direct Biotrak EIA kit. On the day of assay, cells were harvested and assayed according to company's suggested protocol. Each assay point was performed at least in triplicate.
Measurements of short-circuit current
-------------------------------------
Agonist-induced anion secretion was measured in T84 monolayer as described \[[@b25], [@b26]\]. Briefly, cells grown on a Snapwell membrane were incubated with bicarbonate-buffered Krebs-Henseleit. The bicarbonate-buffered Krebs-Henseleit solution contained (in mM or mmoles/l) NaCl, 117; NaHCO~3~, 25; KCl, 4.7; MgSO~4~, 1.2; KH~2~PO~4~, 1.2; CaCl~2~, 2.5 and D-glucose, 11, pH 7.4, when bubbled with 5% CO~2~, 95% O~2~. Cl^−^-free solution was prepared by isosmotically replacing NaCl and KCl with sodium gluconate and potassium gluconate, respectively; CaCl~2~ was replaced with 11 mM calcium gluconate to counteract the chelating effect of gluconate anion. The potential difference was clamped to 0 mV, and *I*~SC~ was simultaneously measured using a voltage-clamp amplifier. Both signals were digitized and recorded. For antagonist experiments, cells were pre-incubated with the antagonist 45 min. before CT was added.
*I*~SC~ in nystatin-permeabilized T84 monolayers
------------------------------------------------
T84 cell monolayers were mounted in the Ussing chamber and bathed in normal Krebs-Henseleit solution while the *I*~SC~ was measured as described above. Apical membrane Cl^−^ currents, defined as *I*~(ap)~, were measured in cells permeabilized basolaterally with 300 μg/ml nystatin in the presence of asymmetrical buffers that imposed an apical to basolateral Cl^−^ gradient. Basolateral NaCl was replaced by equimolar sodium gluconate. Nystatin was added to the basolateral membrane 30 min. before the addition of drugs. Under these asymmetrical conditions, activation of the apical membrane Cl^−^ conductance would cause a rapid downward current deflection. Basolateral membrane K^+^ currents, defined as *I*~(bl)~, were measured in cells permeabilized apically with 300 μg/ml n | {
"pile_set_name": "PubMed Central"
} |
According to a 2010 orthopaedic residency program directors\' forum, the top concerns among programs include potential compromises to resident learning experience caused by work-hour restrictions and the need to identify a body of core knowledge with specific goals and expectations that all residents should meet.^[@R1]^ Similar challenges in Canada and Europe have resulted in some programs transitioning from a time-based structure to a competency-based medical education model, where residents progress at an independent pace by demonstrating the required knowledge and skills.^[@R2][@R3][@R4]^ It remains unclear whether US programs will eventually transition to a competency-based medical education. Canadian and European examples demonstrate the challenge in the lack of reliable evaluation tools or standardized curriculum to cover the breadth of orthopaedic education.^[@R5]^
The Accreditation Council for Graduate Medical Education (ACGME) provides guidelines indicating graduating resident case log minimums for certain core competency procedures. National summative case log data are available publicly (Figure [1](#F1){ref-type="fig"}), and individual programs also receive their specific data with which they can compare with national averages. By way of comparison, the ACGME provides much less guidance about the amount of time residents do and should spend on different rotations throughout residency. Currently, the ACGME and American Board of Orthopaedic Surgery (ABOS) provide only broad guidelines indicating the number of months postgraduate year (PGY) 2 to 5 residents should spend on general orthopaedic services^[@R6],[@R7]^ (Table [1](#T1){ref-type="table"}). However, there are no guidelines outlining the amount of time residents should spend on subspecialty services such as hand, arthroplasty, foot and ankle, sport, spine, and oncology. Furthermore, orthopaedic residency programs are increasingly offering elective and research rotations, but little is known about how variable these practices currently are.^[@R8]^
{#F1}
######
ACGME and ABOS Requirements for Curriculum Organization in Orthopaedic Surgery Residency Programs: Postgraduate Years 2 to 5
The purpose of this study is to summarize the subspecialty rotation exposure across ACGME-accredited orthopaedic residency programs and to examine associations between rotation schedule structure and available program-specific factors. Characterizing variation in resident rotation exposure is useful to residency program administrators because they compare their practices with other ACGME-accredited programs and work toward developing new and potentially more standardized orthopaedic residency training structure. Applicants to orthopaedic surgery residencies may also benefit from knowledge of this variability as they compare programs.
Methods {#s1}
=======
The ACGME Accreditation Data System website was used to generate a list of the 165 ACGME-accredited US orthopaedic surgery residency programs (updated August 2017) and their program coordinators\' contact information. Programs for D.O. medical graduates only were excluded (n = 3). Programs were included if the rotation schedules for PGY 2 to 5 showing the number of weeks spent on distinct rotations could be obtained from the residency program coordinator, from the program\'s website, or from faculty and residents at the program. Regardless of the method of collection, programs were excluded if the obtained schedule did not clearly outline the amount of time residents spend on each rotation throughout PGY 2 to 5. PGY-1 schedules were excluded from the analysis, given the time spent on nonorthopaedic specialty services during the intern year.
Schedules were reviewed to categorize the number of months that PGY-2, PGY-3, PGY-4, and PGY-5 residents spent on each of the following rotations: general orthopaedics, trauma, pediatrics, hand, sport, foot and ankle, arthroplasty, oncology, spine, research, and elective. The percentage of residency spent in each category was then calculated as number of months divided by 48 months. Rotations that were unable to be placed into one of the aforementioned 11 categories were noted. These included rotations that were listed by hospital name in their program schedules for which it was not possible to determine the types of cases residents were specifically involved with at these locations. Programs were excluded from analysis if \>3 months of the rotation schedule across the 4 years could not adequately be categorized with the rotation schedule information.
A total of 115 rotation schedules were obtained, representing 70.1% of all ACGME-accredited orthopaedic surgery residency programs. Forty-eight (42%) schedules were obtained from program coordinators, 53 (46%) were obtained from the program website, and 14 (12%) were obtained from program faculty or residents. Of the 115 programs, 9 programs were excluded because of the inability to accurately categorize \>3 months of time in their rotation schedules. Therefore, a total of 106 rotation schedules (65.4% of accredited programs) were included in the analysis. Of the 106 included programs, 15 (14.2%) had between 1 and 3 months of time in their rotation schedules across the 4 years that were unable to be adequately categorized.
The total percent of time spent on subspecialty rotations (including hand, pediatrics, arthroplasty, sport, foot and ankle, spine, and oncology) was then compared for the following program-specific variables: program size and presence of orthopaedic subspecialty fellowships at the program\'s institution.
Programs were divided into three groups based on size: group 1, 1 to 3 residents/yr; group 2, 4 to 5 residents/yr; and group 3, ≥6 residents/yr based on the interquartile range. A Kruskal--Wallis test was performed to compare the percentage of residency spent on subspecialty rotations between the three groups. A Mann--Whitney *U* test was performed to compare the percentage of residency spent on subspecialty rotations in programs with orthopaedic subspecialty fellowships at their institution with programs without any subspecialty fellowships.
Results {#s2}
=======
Subspecialty Rotation Exposure {#s2-1}
------------------------------
The average percentage of residency and the number of months spent on each rotation are presented in Figures [2](#F2){ref-type="fig"} and [3](#F3){ref-type="fig"}. The greatest percentage of residency spent was in the following categories: trauma (16.6%; mean 8.0 months), general orthopaedics (13.7%, mean 6.6 months); and pediatrics (12.5%, mean 6.0 months). Rotations with the highest variation between programs included the following: general orthopaedics (SD 5.8 months; range 0 to 30 months), sport (SD 2.5 months, range 0 to 15 months), and arthroplasty (SD 2.3 months, range 0 to 11.8 months). Sixty-seven programs (63.2%) had dedicated blocks for research (mean 1.65 months, range 0 to 6.25 months), and 25 programs (23.6%) had dedicated blocks for electives (mean 0.60 months, range 0 to 5 months).
{#F2}
{#F3}
Relationship Between Subspecialty Rotation Exposure and Program-specific Factors {#s2-2}
--------------------------------------------------------------------------------
Of the 106 programs, 45.3% (n = 48) had 4 to 5 residents/yr, 30.1% (n = 32) had ≥6 residents/yr, and 24.5% (n = 26) had 1 to 3 residents/yr (Figure [4](#F4){ref-type="fig"}). There were no significant differences in the percentage of residency spent on subspecialty rotations based on program size (1 to 3 residents, mean 62.3%; 4 to 5 residents, mean 63.9%; and ≥6 residents, mean 62.9%; *P* = 0.80). Programs with subspecialty fellowships at their institution spent an average percentage of time on subspecialty rotations of 63.9% compared with programs without sub | {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
Despite improvement in the treatments and techniques for peritoneal dialysis (PD) patients, long-term PD leads to the decline of residual kidney function (RKF) and peritoneal membrane function (PMF), as a result of membrane or ultrafiltration (UF) failure^[@CR1],[@CR2]^. Existing epidemiological studies have illustrated that RKF deteriorations over time in PD patients compromising patient survival as well as overall health-related quality of life (HRQOL)^[@CR3]--[@CR5]^. The CANUSA (Canada-United States Peritoneal Dialysis) study, the landmark multicenter prospective cohort of incident PD patients, showed 12% and 36% reductions in the risk of death for each 5 L/week/1.73 m^2^ increment in estimated glomerular filtration rate (eGFR) and each 250 mL increase in urine volume, respectively^[@CR3]^. Likewise, the risk of UF failure has increased 3--5% in the first year and 30--50% after three years of PD^[@CR6]--[@CR8]^. There is increasing evidence on the inter-relationship between the RKF and PMF^[@CR9]^. Alterations in RKF and peritoneal characteristics over time are important determinants of patients' technique survival and mortality^[@CR9],[@CR10]^. Subsequently, treatment strategies for maintaining RKF in conjunction with PMF are crucial.
Blockade of the renin-angiotensin aldosterone systems (RAAS) with angiotensin-converting enzyme inhibitors (ACEIs), angiotensin II receptor blockers (ARBs), and mineralocorticoid receptor antagonists (MRAs) in PD patients are likely to preserve residual glomerular filtration rate (rGFR) along with residual urine volume until the PD patients reach anuria that may improve survival in these population^[@CR11]--[@CR15]^. Several studies revealed that blockade of RAAS positively effects the peritoneal membrane by reducing morphologic changes and preserving peritoneal membrane integrity^[@CR16]--[@CR18]^. Therefore, inhibitions of RAAS could potentially improve technique survival and allow patients to be sustained on PD programs for longer periods.
However, the role of RAAS blockade in PD patients has not been fully elucidated. Some studies have revealed the protective properties^[@CR11]--[@CR15],[@CR19]^, whereas others have not^[@CR20]--[@CR26]^. Previous systematic reviews have shown that ACEIs/ARBs substantially benefit in preserving rGFR in PD patients, while a lack of evidence exist regarding the relative efficacy of MRAs and direct renin inhibitors (DRIs)^[@CR27]--[@CR29]^. Moreover, existing pairwise meta-analyses have focused mainly on RKF rather than other clinically relevant and related outcomes such as PMF and adverse events^[@CR27]--[@CR29]^. Recently, treatment with an ACEIs or ARBs has been recommended by the International Society for Peritoneal Dialysis (ISPD)^[@CR30]^ for PD patients with significant RKF, although the comparative effectiveness of specific RAAS blockade classes remains unknown.
To address this knowledge gap, we conducted a systematic review and network meta-analysis (NMA) of randomised controlled trials (RCTs) and non-randomised studies in PD patients to evaluate the effects of specific RAAS blockade classes on RKF and PMF as determined by five key parameters: rGFR, urine volume, incidence of anuria, dialysate-to-plasma creatinine ratio (D/P Cr), and acceptability of treatment.
Results {#Sec2}
=======
Search strategy and characteristics of included studies {#Sec3}
-------------------------------------------------------
The systematic search details are described in Fig. [1](#Fig1){ref-type="fig"}. After screening of titles/abstracts, 101 full-text articles of potentially relevant studies were acquired. After appraising these articles against study inclusion/exclusion criteria (Supplementary, Table [S1](#MOESM1){ref-type="media"}), we included 10 RCTs^[@CR12]--[@CR14],[@CR25],[@CR31]--[@CR36]^ and 10 non-randomised studies^[@CR11],[@CR20]--[@CR24],[@CR26],[@CR37]--[@CR39]^ that compared RAAS blockade classes with active control (Table [1](#Tab1){ref-type="table"}). Four RAAS blockade classes were compared with active control---ACEIs, ARBs MRAs, and mixed ACEIs/ARBs, however, no data for DRIs in any outcome of interest. Two studies provided direct comparisons of ACEIs and ARBs^[@CR31],[@CR36]^. Network diagrams presenting the available evidence for primary and secondary outcomes are illustrated in Figs. [2](#Fig2){ref-type="fig"} and [S1](#MOESM1){ref-type="media"}. Detailed methods of measurement and definition of outcomes are described in Supplementary Table [S2](#MOESM1){ref-type="media"}. A total of 3,789 PD participants were enrolled in the set of included studies; the majority of these patients received continuous ambulatory peritoneal dialysis (CAPD). The baseline mean age and rGFR ranged from 40.2--66.8 years and 0.6--8.4 mL/min/1.73 m^2^, respectively. The follow-up periods ranged from 7 days to 66.3 months, and 12 (60%) studies encompassed participants from Asia. The study- and participant-characteristics are illustrated in Table [1](#Tab1){ref-type="table"} and Supplementary, Table [S3](#MOESM1){ref-type="media"}.Figure 1Selection of studies. Abbreviations: RCTs, randomised-controlled trials.Table 1Description of included studies: RCTs and non-randomised studies.Author, YearDesignCountry EnrollmentSample SizeInterventionControlMean Age ± SD, YearFemale, N (%)Mean rGFR ± SD, mL/minMean Urine Volume ± SD, mL/dayPD ModalityFollow-Up Period, Mean ± SDRisk of Bias^a^Favazza et al., 1992^[@CR32]^RCT: open label, crossover studyItaly9Enalapril (40 mg/day)Nifedipine (60 mg/day), Clonidine (0.45 mg/day)64.0 ± 5.43 (33.3)3.9 ± 0.8NRCAPD14 days1/8Moist et al., 2000^[@CR11]^Non-randomised studies: prospective cohort studyUSA1,032ACEI userNon-ACEI users55.5 ± 14.6490 (47.5)7.5 ± 2.7^b^NRCAPD, APD11.9 ± 1.7 months7/9Johnson et al., 2003^[@CR37]^Non-randomised studies: prospective cohort studyAustralia146ACEI usersNon-ACEI users54.8 ± 16.383 (56.8)4.9 ± 2.3^b^NRCAPD, APD20.5 ± 14.8 months7/9Li et al., 2003^[@CR12]^RCT: open-label, parallel studyHong Kong60Ramipril (5 mg/day)Active control^c^58.6 ± 12.122 (36.7)3.6 ± 2.0^b^NRCAPD12 months3/8Phakdee-kitcharoen et al., 2004^d [@CR31]^RCT: open label, crossover studyThailand21Candesartan (8 mg/day)Enalapril (10 mg/day)44.8 ± 10.17 (33.3)2.0 ± 2.4NRCAPD1 months1/8Suzuki et al., 2004^[@CR13]^RCT: open-label, parallel studyJapan34Valsartan (40--80 mg/day)Active control^c^63.5 ± 3.516 (47.0)4.3 ± 1.7^b^1045.0 ± 220.6CAPD24 months3/8Rojas-Campos et al., 2005^[@CR20]^Non-randomised studies: quasi experimental (crossover) studyMexico20Losartan (50--200 mg/day)Prazosin (2--6 mg/day), verapamil (80--240 mg/day)42.9 ± 16.64 (20.0)NRNRCAPD7 days1/8Wang et al., 2005^[@CR33]^RCT: open-label, parallel studyChina32Valsartan (40--80 mg/day)Active control^c^42.0 ± 11.512 (35.3)4.9 ± 2.2^b^1085 ± 696.3CAPD28 ± 13 months1/8Furuya et al., 2006^[@CR21]^Non-randomised studies: quasi experimental (crossover) studyJapan8Candesartan (8 mg/day)Active control^c^66.8 ± 8.84 (50.0)NR1035 ± 383.5CAPD, APD3 months1/8Jearnsujitwimol et al., 2006^[@CR39]^Non-randomised studies: quasi experimental (crossover) studyThailand7Candesartan (8--16 mg/day)Active control^c^62.0 ± 3.62 (28.6)0.6 ± 0.416. | {
"pile_set_name": "PubMed Central"
} |
Pulmonary arterial hypertension (PAH) is a progressive disease characterized by an elevation of pulmonary artery pressure and pulmonary vascular resistance, leading to right ventricular failure and death. Idiopathic PAH (IPAH; formerly termed primary pulmonary hypertension) occurs in the absence of known causes. Estimates of the incidence of IPAH and familial PAH (FPAH) range from 1-2 cases per million people in the general population, with at least 6% of these patients having FPAH. Although the incidence of PAH in patients with other illnesses is not known with certainty, from various reports it appears that 2-4% of patients with portal hypertension and 0.1-0.6% of HIV patients have PAH. The incidence of PAH that occurs in patients with connective tissue disease is extremely variable; prevalence ranges from 2 to 35% in patients with the scleroderma spectrum of disease and may reach as high as 50% of patients with limited scleroderma. PAH has also been reported to occur in 10-45% of patients with mixed connective tissue disease and in 1-14% of cases with systemic lupus erythematosus. The incidence of PAH associated with anorexigens is cyclical in nature and varies depending on the availability of specific appetite suppressants. The link was first identified in the 1960s when an epidemic of PAH occurred in Switzerland, Austria and Germany that was linked to the anorexigen aminorex fumarate. Use of the anorexigens fenfluramine and dexfenfluramine have also been linked with an increased risk for PAH.
Prior to the development of disease-specific targeted PAH therapies, the median survival for subjects diagnosed with IPAH was approximately 2.8 years. However, 2.8 years likely underestimates current survival as the course of the disease has been favorably altered by therapeutic advances since that report from the 1980s. Prognosis is also dependent on the underlying etiology of the disease. The prognosis for patients with PAH associated with connective tissue disease appears to be worse than for those with IPAH. Estimates for 2-year survival in scleroderma patients with associated PAH are 40% compared with 48% for 3-year survival in patients with IPAH. Survival in patients with HIV-associated PAH is similar to patients with IPAH. With current HIV therapies, most of the deaths in patients with HIV and associated PAH are now attributed to PAH.
Although Ernst von Romberg, a German physician, described an autopsy in 1891 as 'pulmonary vascular sclerosis,' it is only since 1995 with the introduction of intravenous epoprostenol that disease-specific targeted medical therapies for PAH have become available. In addition, significant advances in the treatment of PAH have occurred during the past decade, with six medical therapies now having received regulatory approval worldwide targeting the prostacyclin pathway, the nitric oxide pathway and the endothelin pathway \[[Figure 1](#F0001){ref-type="fig"}\]. Furthermore, ongoing clinical trials are evaluating novel therapeutic approaches based on scientific insights gleaned over the past decade in the pathobiology of PAH \[[Figure 2](#F0002){ref-type="fig"}\].
{#F0001}
{#F0002}
From a therapeutic standpoint, why had it taken from 1891 until 1995 to develop a safe and efficacious therapeutic modality for the treatment of PAH? \[[Figure 3](#F0003){ref-type="fig"}\] Although several reports of young women dying of right heart failure without a diagnosis were published in 1940, it was not until pulmonary artery pressures could be recorded directly with the introduction of right heart catheterization that the physiology of the pulmonary circulation could be studied. In 1951, Dresdale tested the acute effects of tolzoline in a young woman with IPAH; the tolzoline caused a sudden decrease in pulmonary artery pressure and pulmonary vascular resistance without significant systemic effects. Unfortunately, no drugs were available at that time for chronic treatment. However, despite this, there remained little interest in PAH until the epidemic of the aminorex-induced PAH became apparent in the late 1960s. Prompted by the aminorex-induced PAH epidemic in 1973, the World Health Organization (WHO) held its first meeting in Geneva to assess what was known about IPAH and what remained unknown. In 1981, the National Heart, Lung and Blood Institute of the National Institutes of Health supported a national registry of patients with IPAH, which resulted in several reports over the next decade describing clinical features of IPAH and its natural history. Interestingly, despite the fact that IPAH was an orphan disease, significant interest from the scientific community rapidly ensued. Advances in the understanding of the mechanisms involved in the pathobiology of IPAH and PAH associated with other conditions have focused on molecular biology, developmental biology and genetics. Together with epidemiological and natural history studies, collaborative efforts between the scientific community and industry have led to a surge in clinical trials over the past decade: since the approval of intravenous epoprostenol for the treatment of IPAH in 1995, the prostacyclin analogue treprostinil has been approved for continuous subcutaneous infusion in 2002 and for continuous intravenous infusion in 2004. In addition, the prostacyclin analogue iloprost was approved in 2004 via inhalation. In 2001, bosentan, an endothelin ET ~A~/ET~B~ receptor antagonist, was the first oral therapy approved for the treatment of PAH; and sildenafil citrate, an oral phosphodiesterase type 5 inhibitor, was approved in 2005. In 2007, the oral ET~A~ selective ERA ambrisentan was approved, and the oral ET~A~ selective ERA sitaxsentan was approved in the EU.
{#F0003}
Prompted by the scientific insights from the 1990s, in 1998 the second WHO meeting was held on the 25^th^ anniversary of the original meeting; and with the dramatic advances over the next 5 years, the 3^rd^ WHO Symposium on PAH was held in 2003 and the 4^th^ World Symposium on PAH in 2008. Based on the clinical trials to date, current consensus evidence-based guidelines for the treatment of PAH are shown in \[[Figure 4](#F0004){ref-type="fig"}\]. What have we been able to achieve? The disease-specific PAH therapies, currently available in conjunction with anticoagulant, diuretic, digitalis and oxygen therapy, have improved exercise capacity, functional capacity, time to clinical worsening, hemodynamic parameters, overall quality of life and survival. However, PAH remains a devastating, life-threatening disorder. In more than 50% of patients, exercise capacity remains significantly limited, approximately 50% of patients remain WHO functional class III or IV, PAH patients continue to have frequent hospitalizations for PAH, right heart function remains significantly impaired in most patients, quality of life is suboptimal and despite an increase in survival for functional class III and IV patients with IPAH from a predicted survival of 33% (based on the NIH Registry) to 63% with our current therapeutic modalities, the outlook is far from ideal; we need to continue to aggressively pursue furthering our understanding of PAH if we ever hope to give these patients a near-normal life.
{#F0004}
We believe that future developments in vascular biology will improve our understanding of the pathobiology of PAH and provide rationale and 'proof of concept' for more disease-specific targeted therapies. With the advent of genomic technologies and methods, the necessary tools are now becoming available to begin pinpointing the genes that contribute to disease susceptibility and progression. Candidate gene discovery, that is, gene analysis using microarrays, can identify genes | {
"pile_set_name": "PubMed Central"
} |
{#sp1 .280}
{#sp2 .281}
| {
"pile_set_name": "PubMed Central"
} |
1. Introduction
===============
The National Institute of Standards and Technology (NIST), Systems and Software Division, sponsored a Users' Forum on the Application Portability Profile (APP) and Open System Environment (OSE) at NIST in May. This forum was the fifteenth in a continuing semiannual series on the NIST APP and its application to OSE. The APP Users' Forums are designed to provide users and providers with the opportunity to exchange information and respond to NIST proposals regarding the evaluation and adoption of an integrated set of standards to support the APP and OSE.
The forum offered the customary presentation of standards and activities in the APP, OSE, Institute of Electrical and Electronic Engineers (IEEE), and Joint Technical Committee 1 (JTC1-international activities). A workshop on Automated Testing Technologies was featured on the second day with extensive discussions concerning participants' case studies, current activities, plans and lessons learned. A tutorial for beginners with little or no experience with the APP and OSE was held on the morning of the first day. The tutorial presented basic OSE concepts and the reference model.
The next APP/OSE Users' Forums will be held May 7 and 8, 1996 at NIST.
The APP/OSE Users' Forum has been developed to assist federal agencies with information technology (IT) issues. Central to this assistance is publication and maintenance of a technical guidance document, the Application Portability Profile (APP), facilitating the migration to open systems. An Open System Environment encompasses the functionality needed to provide interoperability, portability, and scalability of computerized applications across networks of heterogeneous, multi-vendor hardware/software/communications platforms. The APP integrates industry, federal, national, international, and other specifications into a Federal application profile to provide the functionality necessary to accommodate a broad range of Federal information technology requirements. The Application Portability Profile (APP), The U.S. Government's Open System Environment Profile OSE/1 Version 3.0 provides recommendations on a variety of specifications that will generally fit the requirements of U.S. Government systems. A specific organization will not necessarily require all of the recommended specifications in the APP. As the U.S. Government's OSE profile, this guidance is provided to assist Federal agencies in making informed choices regarding the selection and use of OSE specifications, and in the development of more selective application profiles based on the APP. It is directed toward managers and project leaders who have the responsibilities of acquiring, developing, and maintaining information systems supported by heterogeneous application platform environments.
2. Standards Status
===================
Fritz Schulz, NIST, presented the following updates on the OSE standards activities of IEEE, JTC1 and the Computer Systems Laboratory (CSL) of NIST.
The IEEE Portable Application Steering Committee (PASC), which sponsors the Portable Operating System Interface (POSIX) projects has reorganized. Previously each standard activity had been individually numbered, and now activities are grouped into seven areas. These areas are system services, shells and utilities, system administration, language bindings, security, profiles, and test methods. In addition to lowering overhead and increasing efficiency, this reorganization will make it easier to progress approved standards to the international arena.
The OSE guide developed by P1003.0 has been approved and will be published very soon as a technical guide. The POSIX OSE guide describes an OSE Reference Model (OSE/RM) that is closely aligned with the APP and that provides a framework for describing open system concepts and defining a lexicon of terms that can be agreed upon generally by all interested parties. The same document is in ballot as a draft technical report (DTR) 14252 within working group (WG)15 of subcommittee (SC)22 of JTC1. The DTR is also expected to be approved very soon. The status of individual programs within the POSIX project were distributed in a handout.
Technical Report 10000-3: "Information Technology---Framework and Taxonomy of International Standardized Profiles---Part 3: Principles and Taxonomy for Open System Environment Profiles," produced by the JTC1 Special Group on Functional Standardization (SGFS) has been approved and will be published very soon. TR 10000, part 3 provides a context for functional standardization in support of Open System Environments (OSE). It outlines the basic OSE objectives and concepts, and defines an approach to the taxonomy and format for OSE Profiles specified by International Standardized Profiles. The technical report gives guidance on the nature and content of International Standardized Profiles (ISPs) documents to organizations proposing Draft OSE ISPs.
2.1 Application Portability Profile (APP) Version 3
---------------------------------------------------
Gary Fisher, NIST, made the presentation on the new version of the APP.
A selected suite of specifications that defines the interfaces, services, protocols, and data formats for a particular class or domain of applications is called a profile. The Application Portability Profile (APP) integrates industry, Federal, national, international, and other specifications into a Federal application profile to provide the functionality necessary to accommodate a broad range of Federal information technology requirements.
The APP is *not* a standard and is not designed to cover every case. In some instances, the selection of one specification recommended in the APP will obviate the need for other specifications that are also recommended (i.e., select one or the other, but not both.) There is some overlap in functionality covered in different specifications. There are also gaps in functionality. In areas where the APP does not meet all of a user's requirements, the user must augment the recommended specifications to ensure that proposed systems built on these specifications meet organizational requirements. The APP is designed to help users determine which specifications to use.
Not only is the U.S. Government involved in the development of profiles, but industry, national, and international organizations are preparing specifications that encompass numerous types of profiles. Corporations such as American Airlines, Boeing, DuPont, General Electric, Kodak, McDonnell Douglas, Merck, Motorola, Northrop, and Unilever are developing profiles for use within their own organizations and in many cases have based these profiles on the APP. The Institute of Electrical and Electronics Engineers, the International Organization for Standardization, and other standards-making organizations are in the process of developing profiles for specific types of application domains. U.S. Government organizations that are engaging the concepts of organizational profiles include the U.S. Army Sustaining Base Information Services, the U.S. Bureau of the Census, the Internal Revenue Service, the Defense Information Systems Agency, and many others.
Many specifications were reviewed and evaluated before the final recommended specifications were selected. If there are other specifications that should be considered in the APP and that meet a broad range of U.S. Government application requirements, users, vendors, and other interested parties should formally recommend them for evaluation using the same evaluation criteria applied to the selected specifications. This is one of the ways in which the APP will continue to evolve as technology evolves.
The initial version of the APP was published by the National Institute of Standards and Technology (NIST) in April 1991 as Special Publication 500-187. Version 2 of the APP Guide, NIST Special Publication 500-210, was published in June 1993. The changes in this third revision reflect the evolutionary developments that have occurred in the standards arena. Examples of the types of changes in this version include the following: The introductory material incorporates work done by the Institute of Electrical and Electronics Engineers (IEEE) POSIX Working Group 1003.0 on the Open System Environment Reference Model (OSE/RM).The evaluation criterion, *de facto usage*, has been removed and others have been reworded to provide more usable definitions.A new *bindings* information item has been added to individual specifications where appropriate.All of the recommended specifications have been updated and many new ones have been added. Areas that have seen the most change are those that encompass data interchange and communications where numerous new specifications have been added.
Specific changes between Version 2 and Version 3 recommended specifications include the following: Operating System ServicesIEEE 1003.2-1992 POSIX Shells and Utilities is now FIPS 189.IEEE 1003.4 Realtime is now IEEE 1003.1b.IEEE 1003.6 Security is now IEEE 1003.1e and IEEE 1003.2c.IEEE P1387.2, .3, and .4 are new.Human/computer Interface ServicesProposed FIPS 158-1 X Window System is now officially FIPS 158-1.IEEE P1295 X Window Toolkit is now IEEE 1295.1.Software Engineering ServicesFIPS 119 Ada is now FIPS 119-1 Ada.FIPS 21-3 COBOL is now FIPS 21-4 COBOL.FIPS 119 Pascal has been deleted due to very limited interest in this specification.ECMA PCTE has been replaced by ISEE Repository ISO/IEC 13719-1.Data Management ServicesFIPS 127-1 SQL is now FIPS 127-2.FIPS 193 SQL Environments is new.Data Interchange ServicesODA/ODIF/ODL ISO 8613 has been deleted due to lack of implementations.Draft Portable Document Delivery Format (PDDF) is new.SPDL ISO 10180 has been deleted and replaced by PDDF.Standard Data Elements ISO 11179 Parts 3, 4, and 5 are new.FIPS 194 Raster is new.JPEG is new.MPEG is new.STEP ISO 10303 has been replaced by the planned FIPS on STEP.FIPS 173 SDTS is now FIPS 173-1.Graphics ServicesFIPS 153 PHIGS is now FIPS 153-1.Network ServicesPII API P1003.12 has been renamed P1003.1g.IEEE 1238 | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION {#sec1-1}
============
Periodontitis is an immuno-inflammatory disease process resulting from the interaction of a bacterial attack and host inflammatory response, causing inflammation of the supporting tissues of the teeth leading to tissue destruction and tooth loss. Arrays of molecules are considered to mediate the inflammatory response at one time or another, among these is free radicals (FRs) and reactive oxygen species (ROS) like superoxide anion radicals, hydrogen peroxide, hydroxyl radicals and hypochlorous acid. All these molecules are capable of damaging either cell membranes or associated bio-molecules. Periodontal pathogens can induce ROS overproduction and thus may cause collagen and periodontal cell breakdown. When ROS are scavenged by antioxidants, there is a reduction of collagen degradation.\[[@ref1]\] Oxidative stress arises within tissues when the normal balance between ROS generation and antioxidant defense shifts in favor of the former, a situation arising from either an excess of ROS and/or a depletion of antioxidants.
There has been a tremendous expansion in dental research concerned with free radicals, ROS and anti-oxidant defense mechanisms. These are essential to many normal biological processes and low doses of certain radicals or radical-derived species can stimulate the growth of fibroblasts and epithelial cells in culture. A low FR/ROS often behaves as an inductor stimulus, whereas higher levels may result in injury. It may be necessary to deliver anti-oxidants selectively to specific cell types and to define the concentrations suitable for blocking inappropriate cell responses but leaving the unimpaired physiological levels of FR/ROS activity necessary for normal cell function.\[[@ref2]\]
Coenzyme Q10 was discovered in beef heart mitochondria at the University of Wisconsin.\[[@ref3]\] coenzyme Q10 is also known as ubiquinone because of its ubiquitous presence in nature and its quinone structure (similar to that of vitamin K).\[[@ref4]\] It is also called as "coenzyme" because of its unique ability to participate in chemical reactions but remain at steady-state levels in the cell, and plays a central role in energy metabolism. It has a positive inotropic effect.\[[@ref5]\]
The effects and mechanisms of action of CoQ10 include stabilization of calcium-dependent channels, inhibition of intracellular phospholipases, prostaglandin metabolism, free-radical scavenging and direct membrane stabilization.\[[@ref6]\]
CoQ10 is also known to play a crucial role in the generation of adenosine triphosphate (ATP) and cellular respiration. It exists in two molecular forms, ubiquinone, the oxidized form, and ubiquinole, the reduced form, which are the basis for its antioxidant properties.\[[@ref7]\] Co-Q10 functions as an intercellular antioxidant by acting as a primary scavenger of FRs and ROS. It serves as an endogenous antioxidant, and its increased concentration in the diseased gingiva effectively suppresses advanced periodontal inflammation.
A deficiency of coenzyme Q10 in the gingival tissue may exist independently of and/or because of periodontal disease. If a deficiency of coenzyme Q10 existed in the gingival tissue for nutritional causes and independently of periodontal disease, then the advent of periodontal disease could enhance the gingival deficiency of coenzyme Q10. In such patients, oral dental treatment and oral hygiene procedures can remove the local factors only but cannot correct the deficiency of CoQ10 due to systemic cause. Thus, mechanical periodontal therapy along with the adjunctive use of CoQ10 can be included for an overall improvement of the gingival health in periodontal disease.\[[@ref8]\] The present study was designed with the aim to evaluate the efficacy of coenzyme Q-10 gel application in the treatment of chronic periodontitis.
MATERIALS AND METHODS {#sec1-2}
=====================
This was a randomized, controlled, clinical trial with a split-mouth design. A total of 18 patients were selected from the Outpatient Department of Periodontology. Ethical clearance was obtained from the institutional ethical committee. Systemically, healthy patients in the age group of 20-55 years of both the genders (mean age 33.8 years) who were diagnosed with chronic periodontitis by their clinical and radiographic findings were included in the study. Written and verbal consent was obtained from the sample recruited for the study.
Patients suffering from chronic periodontitis and having a probing pocket depth of ≥5 mm in different quadrants (having a minimum of six permanent teeth in each quadrant) of the mouth with radiographic evidence of bone loss were included in the study \[Figures [1](#F1){ref-type="fig"}--[3](#F3){ref-type="fig"}\].
{#F1}
{#F2}
{#F3}
Patients with a history of any systemic diseases, any apparent oral infection like herpes or candida, patients who had taken antibiotic therapy in the past 3 months or undergone any periodontal therapy in the past 6 months, smokers, pregnant women and lactating mothers were excluded from the study.
Perio Q gel (Perio Q™) is a mixture of CoQ10 in a vegetable oil base in ratio of 1:9 and is supplied as a pack of gel \[[Figure 4](#F4){ref-type="fig"}\], and was stored at a temperature between 4 and 8°C to maintain its shelf-life.
{#F4}
In this study, three quadrants were assigned randomly in each patient: Group I: Scaling and root planning only (Control group); Group II: Scaling and root planing and topical application of Perio Q gel (Test group A); Group III: Scaling and root planing and intrapocket Perio Q gel application (Test Group B) \[Figures [5](#F5){ref-type="fig"} and [6](#F6){ref-type="fig"}\].
{#F5}
{#F6}
All the clinical parameters, i.e. plaque index,\[[@ref9]\] gingival index,\[[@ref10]\] modified sulcular bleeding index and probing pocket depth were recorded at baseline and at the 2^nd^ week and 4^th^ week after treatment.
At the baseline, scaling and root planing were performed in all the groups and in Group II, the topical application of gel was performed with the tip of the applicator completely soaked in gel. Intrapocket application was performed in Group III using special needles designed to deliver gel in the pocket. Patients were recalled every alternate day for the application of gel for 1 week. Eating, spitting and drinking were restricted for 1 h after application. Patients were recalled at the 2^nd^ and 4^th^ weeks after treatment to record all the clinical parameters \[[Figure 7](#F7){ref-type="fig"}\].
{#F7}
RESULTS {#sec1-3}
=======
The ANOVA test was employed for plaque index, gingival index, gingival bleeding index and probing pocket depth. A comparison of the mean plaque index, gingival index, gingival bleeding index and probing pocket depth among all the three groups at the observational period of 2^nd^ and 4^th^ weeks showed statistically significant results (*P* \< 0.01) \[Tables [1](#T1){ref-type="table"}--[4](#T4){ref-type="table"}\].
######
Plaque index (Silness and Loe 1964)
######
Gingival index (Loe and Silness 1963)
######
Gingival bleeding index (Ainamo and Bay 1975)
######
Probing pocket depth
Plaque index {#sec2-1}
------------
There was a statistically significant improvement in the plaque index from baseline to the 4^th^ week revaluation in Groups I-III \[[Table 1](#T1){ref-type="table"}\]. For Group I, the plaque index was reduced from the baseline value of 1.72 ± 0.492 to 0.96 ± 0.274 (*P* \< 0.0001\*), and for Groups II and III, it was reduced from 1.93 ± 0.468 to 0.61 ± 0.230 and 1.69 ± 0.424 to 0.48 ± 0.148 (*P* \< 0.0001\*), respectively.
Gingival index {#sec2-2}
--------------
The gingival index scores were significantly improved from baseline to the 4^th^ week revaluation \[[Table 2](#T2){ref-type="table"}\]. For Group I, the gingival index scores was reduced from 1.64 ± 0.422 to 0.63 ± 0.366 (*P* \< 0.0001\*), and for Groups II and III, it was reduced from 1.82 ± 0.391 to 0.5 ± 0.227 and 1.96 ± 0.57 to 0.57 ± 0.397 (*P* \< 0.0001\*), respectively.
Gingival bleeding index {#sec2-3}
-----------------------
Similarly, | {
"pile_set_name": "PubMed Central"
} |
Since the discovery of graphene, two-dimensional (2D) materials with atomic thickness have drawn increased attentions in recent years that hold promise for developing next-generation high-performance electronics, optoelectronics and spintronics[@b1][@b2][@b3][@b4][@b5][@b6][@b7][@b8]. Many exotic physical and chemical phenomena emerge with reducing dimensions owing to the change of electronic behaviors governed by quantum confinement effects within the 2D layer. Although excellent electrical and thermal transport properties make graphene a promising candidate for applications in transparent conductor and high mobility devices, its zero bandgap nature limits its technological applications in digital electronic devices, which inspires researches for materials with finite bandgap, such as transition metal dichalcogenides (TMDCs), (MX~2~, M a transition metal atom, such as Mo, W, Re, Pt, Sn etc. and X a chalcogen atom, such S, Se, or Te)[@b9][@b10][@b11] and black phosphorus[@b12] (BP) that were recently extensively studied. More recently, layered tin (II) oxide (SnO) was found to show excellent semiconducting performances in which bipolar conductivity can be easily realized[@b13][@b14][@b15][@b16]. It is a rare example of layered oxide semiconductors that holds promise for a wide variety of technological applications[@b14][@b17][@b18], which makes it quickly become the subject of significant theoretical and experimental investigations[@b1][@b13][@b14][@b18][@b19]. Compared to other TMDC-based layered structure, oxide-based materials are expected to be more stable in air since they are reluctant to oxidation.
Bulk SnO has a tetragonal unit cell (litharge crystal structure with space group: *P4/nmm*) with lattice constants of *a = b* = 3.8 Å and *c* = 4.84 Å[@b20][@b21]. A lone pair model was suggested for the electronic interaction of SnO[@b22], in which the lone pair states result from the crystal structure of SnO. In SnO, each Sn atom loses two 5*p* electrons to adjacent O atoms leaving an electronic configuration of 4*d*^*10*^5 *s*^*2*^5*p*^*0*^ in which the two Sn 5*s* electrons constitute a lone pair pointing towards the interlayer spacing. The inter-layer lone-pair interaction was found to be crucial for understanding the electronic structure of SnO[@b14]. In analogy with other TMDCs-based layered structure, Sn--O--Sn slabs in SnO are stacked along \[001\] direction with weak dipole-dipole van der Waals interlayer interaction[@b1][@b14][@b15]. In its monolayer counterpart, the lack of dipole-dipole lone pair interaction shows great impact on the electronic structure and widens the band gap which bring additional potential applications. To design a SnO-based material with required electronic structure, it is essential to explore the relationship between the engineering methods and their effects on the electronic and magnetic modifications. The unique lone pair electronic states around Sn atoms could also be modified by adatoms which needs to be understood.
In order to explore the potential applications of 2D materials, many strategies could be used to tune their electronic and magnetic properties, such as strain[@b15], defects and substitutional doping[@b23]. It is well-known that the exfoliation or growth processes can introduce defects and impurities in 2D materials which can dramatically alter their electronic, thermal and mechanical properties. Vice versa, a deliberate introduction of defects can be a feasible approach to modify the properties of the pristine materials. For instance, vacancies and Stone-Wales (SW) defects introduced in graphene by ion or electron irradiation brought new functionalities for graphene-based devices[@b24][@b25]. Defects in MoS~2~ formed during the growth process also play significant roles on their electronic behaviors as well as device performance[@b26][@b27][@b28]. Besides intrinsic defects, extrinsic defects such as adatoms are also shown to be important for 2D materials based devices with dedicated properties[@b29]. For real applications, modifications and engineering are generally applied to enhance the materials/devices functionalities. Especially for new materials, great efforts are needed to explore its function enhancement in all manner of possibilities. Adsorption of foreign atoms is another effective and promising strategy for tuning the electronic and magnetic properties of 2D materials[@b23][@b30]. Considering that the scientific investigations on the properties of SnO has just started[@b14][@b15][@b16][@b18][@b19][@b31][@b32][@b33][@b34], the role of extrinsic point-defects and the effects of adatoms on SnO need to be explored to widen the range of its applications.
In this work, we systematically investigate the stable crystal structures and electronic and magnetic properties of nonmetal atoms (B, C, N, O, and F) adsorbed SnO monolayers. We will calculate their geometric structure and electronic properties to gain insights in the adsorption mechanism. Compared with the magnetic moment from *d*-electrons of transitional-metal atoms, the magnetism from *sp* electrons of nonmetal elements could have stronger long-range exchange coupling interactions and avoid cluster formation of magnetic ions[@b35]. We will show that the electronic behavior of C and O is totally different from that of B, N and F adatoms, and the adsorption mechanism is dominated by the electronegativity of the adatom.
Results and Discussion
======================
Band structure property
-----------------------
SnO possesses a layered structure with each Sn atom bonded with four adjacent O atoms and vice versa, see the ball-and-stick model in [Fig. 1(a)](#f1){ref-type="fig"}. In [Fig. 1](#f1){ref-type="fig"}, the band structure at the valence band maximum (VBM) and conduction band minimum (CBM) for both bulk and monolayer (ML) SnO are given. It is found that both bulk and ML SnO are indirect band gap semiconductor, in which VBM is situated among Γ-M line. However, the CBM is located at M point for bulk and shifted to Γ point for ML which is in excellent agreement with previous theoretical reports[@b13][@b14][@b15]. The involvement of spin-orbital coupling (SOC) is found to have no effect on the band structure, *i.e.* no band splitting at CBM and VBM ([Fig. S1](#S1){ref-type="supplementary-material"}). The evolution of band structure implies indirect-direct-indirect band bap conversion may occur during the layer-thinning process, which is in strong contrast to other 2D layered materials, such as TMDCs. For the bulk SnO, the band gap is 0.38 eV while it increases dramatically to 2.94 eV for ML SnO at GGA level, see [Fig. 1(b,c)](#f1){ref-type="fig"}. The huge change of the band gap highlights the importance of interlay coupling which affects significantly the lone pair states that could also be modified by adsorption of foreign atoms. As is well known, the band gap is underestimated by the standard DFT calculation due to the poor description of the correlation interaction between electrons. To overcome this drawback, GGA+U and HSE06 methods were used to correct this. The results show that the correction of band gap do not have noticeable effect on the band structure behaviour ([Figs S2--S3](#S1){ref-type="supplementary-material"}). Although interaction in the \[001\] direction is governed by weak van der Waals, the calculated band structure for bulk SnO \[see [Fig. 1(b)](#f1){ref-type="fig"}\] exhibits significant band dispersion along the Γ-Z direction at VBM. However, [Fig. 1(c)](#f1){ref-type="fig"} shows that the band dispersion along *z* directions become flat for ML SnO which implies the band dispersion is originated from the strong inter-layer interaction. This is a very different behavior from the transition-metal dichalcogenides[@b9]. The orbital contributions to the electronic structure of pristine bulk SnO is obtained from partial density of states (PDOSs) which shows the VBM is derived from the in-layer hybridization of Sn 5*sp* orbitals and the O 2*p* orbitals consistent with lone pair model[@b22], while the CBM is contributed primarily from the hybridization of Sn 5*p* and O 2*s* antibonding orbitals and associated with the interlayer Sn^2+^--Sn^2+^ bonds. Since the band gap evolution is dominated by the orbitals at CBM, it is the interlayer lone pair interaction between Sn atoms that dominates the electronic structure and the band gap of SnO. Our calculated results are in excellent agreement with the previous theoretical reports[@b14][@b36].
Geometry stabilization
----------------------
In SnO, each Sn atom shares its two 5*p* electrons with the neighboring O atoms while the remaining 5*s* electrons do not participate in the bonding process and constitute a lone pair. As mentioned above, the band structure of SnO is determined by the lone pair interaction, the above model gives a strategy for the electronic structure design by adatoms which bond with Sn atoms via the lone pair electrons. To do so, the adsorption of a series of adatoms of B, C, N, O and F were studied, which provides an interesting variation in the number of valence electrons with a | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
Most protein sequences do not have an experimentally determined structure and at least 40% do not even have a sequence homolog with a known structure [@pcbi.1002175-Bork1]. Nevertheless, the current Protein Data Bank (PDB) [@pcbi.1002175-Berman1] is thought to represent structure space nearly exhaustively [@pcbi.1002175-Kihara1]--[@pcbi.1002175-Zhang2]. Therefore, for most proteins, a structural homolog that can serve as a "template" for modeling at least part of its structure is likely to exist. However, the degree of sequence similarity will generally be too low to allow a template to be detected or for an accurate sequence alignment to be found [@pcbi.1002175-Rost1]. A central problem is that current alignment methods based on dynamic programming (DP) [@pcbi.1002175-Waterman1] generate the unique "optimal" alignment (the alignment producing the highest score based on a residue-residue similarity score and a gap penalty), while the "correct" alignment (producing the most accurate model) is not guaranteed to be optimal in terms of this score at low sequence identity ranges.
Numerous variations of both the residue-residue similarity score and gap penalty have been developed to address these issues. Individual residue-based scoring functions have been replaced with more complex profile-profile [@pcbi.1002175-Edgar1]--[@pcbi.1002175-Tang1] and environment-dependent methods [@pcbi.1002175-Bowie1]--[@pcbi.1002175-Shi1]. Recognizing that affine gap penalties typically over-penalize long gaps, several studies have described the probability of a gap as a function of its length or location in the structure with the goal of penalizing it appropriately [@pcbi.1002175-Barton1]--[@pcbi.1002175-Goonesekere1]. Threading methods [@pcbi.1002175-Jones1], [@pcbi.1002175-Panchenko1] incorporate an energy term into the alignment procedure, but they face the drawback of not being compatible with the traditional DP algorithm [@pcbi.1002175-Madej1].
Even with these more sophisticated approaches, there are still many issues that will confound the generation of an accurate alignment. Moreover, it is generally necessary to consider an ensemble of alternative alignments in order to produce an accurate model at low sequence identity ranges. Such ensembles are frequently called "suboptimal" since by necessity they have lower scores than the optimal alignment produced by DP. A variety of suboptimal sequence alignment schemes have been reported. Waterman [@pcbi.1002175-Waterman2] produced an ensemble of alternative alignments by changing the dynamic programming algorithm to return all alignments with scores within a small difference, δ, from that of the optimal alignment. However, the difference between the DP scores of the correct alignment and the optimal sequence alignment can be significant, especially for remote homologues. Increasing δ until it encompasses the correct alignment often produces an unmanageably large ensemble. Keeping δ small returns a more reasonable number, but the alignments tend to deviate negligibly from the optimal alignment.
Saqi and Sternberg [@pcbi.1002175-Saqi1] adapted this approach to return a more diverse ensemble by penalizing an alignment that is similar to one previously determined. John and Sali [@pcbi.1002175-John1] used genetic algorithm operators to splice and re-combine alignments in order to achieve the same goal. Chivian and Baker [@pcbi.1002175-Chivian1] produced alternative alignments by systematically varying the parameters in their optimal alignment method. Each alignment in their returned ensemble was therefore "optimal" (*ie.* highest-scoring) under a different set of conditions. One problem faced by all suboptimal methods is how to adequately sample the gigantic space of possibilities. Jaroszewski *et al* [@pcbi.1002175-Jaroszewski1] sought to explore the size of alignment space by examining pairs of small and medium-sized proteins (seven or fewer template secondary structures). Even though only "significantly different" alignments were enumerated by disallowing gaps in template secondary structures and ignoring alignment variations in loop regions, tens of millions of alternative alignments were required in some cases to generate the correct one.
We describe here a new method to generate suboptimal alignments, S4 (**S**ampling **S**hifts in **S**econdary **S**tructures), that takes an approach that is fundamentally different from the standard dynamic programming algorithm. In validation tests that we describe below, we show that S4 is highly effective at producing an accurate alignment within a set of 100 top-ranked alternatives and can almost always produce such an alignment within a set of 1000 alternative alignments. The utility of the S4 approach is most evident when the query/template sequence identities are low, but S4 also improves accuracy when the homology is clear. Our results are shown to constitute a significant improvement over DP-based alternative alignment methods, which we show is due to unique features of the algorithm, in particular to the effective use of the 3-dimensional structure of the template. The ability to generate a small set of alignments likely to contain the correct one suggests that S4 offers the possibility of significantly improving the accuracy of homology models, extending the number of sequences that can currently be modeled based on existing structures in the PDB.
Results {#s2}
=======
A flowchart for the S4 algorithm is shown in [Figure 1](#pcbi-1002175-g001){ref-type="fig"}. The method starts by searching the DP matrix for a set of short, ungapped alignments bounded by individual template secondary structure elements (SSEs). The rationale is that whatever sequence similarity may exist between query and template will more likely be in SSEs than loop regions. To generate a global alignment, pairs from a high-scoring set of "primary" fragments are connected with lower-scoring "secondary" fragments. This is a crucial feature of S4. In particular, we find that correctly aligned fragments can generally be identified within a very small set of primary fragments, significantly reducing the combinatorial complexity of the alignment problem. This characteristic, combined with the requirement that alignments containing the fragments be structurally plausible (see [Materials and Methods](#s4){ref-type="sec"}), improves accuracy in regions where the relationship between the query and template is less clear. The constraints also allow S4 to remove many alignments from consideration through the application of filters that identify geometrically or energetically unreasonable alignments based on knowledge of the template structure. Filters are also applied to check for redundancy in order to ensure that the alignments represent unique regions of alignment space. (A detailed description of each step of the S4 algorithm and the filters applied is provided in the [Materials and Methods](#s4){ref-type="sec"}.)
{ref-type="sec"}); or simply being high-scoring (Score). (3) Starting at the N-terminus, the algorithm enumerates all connections to downstream primary and secondary fragments, resulting in a large ensemble of "fragment alignments". Alignment rules are tested (see [Materials and Methods](#s4){ref-type="sec"}) whenever any fragment is added to an alignment. (4) The number of fragment alignments is reduced by filtering with thresholds based on statistical energies, core contacts and a redundancy measure (see [Materials and Methods](#s4){ref-type="sec"}). (5) To generate a final global alignment from a set of fragments (e.g. the green line, a boundary is defined around each remaining fragment alignment (dashed lines) within which the traditional a DP-based suboptimal algorithm is used to find an ensemble of full alignments. DFIRE then selects the alignment with the lowest/best energy to represent the set of fragments. (6) The process continues until it has returned the top N alignments, ranked by their residue similarity score.](pcbi.1002175.g001){#pcbi-1002175-g001}
Improvement in alignment accuracy {#s2a}
---------------------------------
S4 was tested on a set of target sequences from the CASP [@pcbi.1002175-Moult1] experiments (T0129--T0359). Potential templates for each target/query sequence were identified by structurally aligning the native structure to other proteins in the PDB using the ska program [@pcbi.1002175-Petrey1], [@pcbi.1002175-Yang1]. Templates were then selected based on a set of criteria (see [Materials and Methods](#s4){ref-type="sec"}) to ensure that an alignment existed between the template and query structure that would produce a model with a TM-score [@pcbi.1002175-Zhang3] \>0.5, and also that S4 would not be run on sequences longer than 350 residues. The resulting test set contained 3,342 query sequence/template pairs and was heavily populated by those with low sequence identity: over 90% of all pairs had less than 20% identity and more than 60% had less than 10 | {
"pile_set_name": "PubMed Central"
} |
All relevant data are within the manuscript and its Supporting Information files.
Introduction {#sec001}
============
Effective humoral immunity is contingent upon the phenomenal diversity of antibodies. In mammals, this is derived via genetic recombination of numerous variable (V), diversity (D) and joining (J) gene segments localised to heavy, kappa and lambda immunoglobulin loci. In recent years, the capacity to clone and express antibodies from single B cells has proved a powerful tool to study antibody repertoires in a variety of infectious disease settings in humans \[[@pone.0233794.ref001]--[@pone.0233794.ref004]\], and important animal models such as mice \[[@pone.0233794.ref005], [@pone.0233794.ref006]\] and non-human primates \[[@pone.0233794.ref007], [@pone.0233794.ref008]\]. These approaches have subsequently been extended using next-generation sequencing platforms (reviewed in \[[@pone.0233794.ref009], [@pone.0233794.ref010]\]), allowing unprecedented depth in the characterisation of anti-pathogen antibody responses.
The domestic ferret *(Mustela putorius furo)* is a critical mammalian model to study pathogenesis and evaluate vaccines against a variety of human respiratory pathogens (reviewed in \[[@pone.0233794.ref011]\]), most critically influenza. However, the majority of influenza research using ferrets is focused upon viral transmission and/or pathogenesis, with in-depth immunological studies limited by a limited understanding of the ferret immune system (reviewed in \[[@pone.0233794.ref012]\]). A key knowledge gap surrounds the immunogenetics of ferret immunoglobulins. While the ferret genome was recently sequenced \[[@pone.0233794.ref013]\] accurate annotation of germline immunoglobulin genes is currently incomplete. This has hindered the ability to sequence ferret B cell receptors and/or allow the recovery of ferret monoclonal antibodies, limiting detailed interrogation of ferret serological responses that informs current influenza vaccine strain selection efforts.
Here we sought to increase the utility of ferrets for studying humoral immunity. Ferret heavy, kappa and lambda immunoglobulin loci were annotated using available genomic sequences, allowing the design of a novel set of multiplex PCR primers flanking recombined ferret immunoglobulin genes. Recombined B cell receptor sequences were recovered from single sorted ferret B cells, partially confirming our initial gene segment annotation and allowing identification of potential novel germlines. Ferret immunoglobulin constant gene sequences were confirmed using *de-novo* assembly of RNA-seq transcripts, allowing the design of expression plasmids and the recombinant production of ferret IgG monoclonal antibodies. In summary, we present a single-cell, RT-PCR based approach for recovery of B cell receptor immunoglobulins from ferret B cells and the recombinant production of ferret monoclonal antibodies in vitro, analogous to methodologies in widespread use in rodents and primates.
Materials and methods {#sec002}
=====================
Annotation of ferret immunoglobulin loci {#sec003}
----------------------------------------
Ferret genomic contigs containing potential immunoglobulin genes were retrieved from *e*!*Ensembl* ([http://www.ensembl.org](http://www.ensembl.org/)). (Immunoglobulin heavy loci---GL897360.1, GL897427.1, GL897453.1, GL897498.1, GL897556.1, GL897558.1, GL897564.1, GL897795.1, GL898421.1; kappa loci---GL896905.1; lambda loci---GL897406.1, AEYP01111698.1, GL896906.1, AEYP011112098.1, GL897285.1, GL897406.1, GL897344.1, GL897565.1, GL897418.1, AEYP01110728.1, AEYP01108526.1, GL897638.1 GL897285.1, GL897484.1, GL897019.1, GL897400.1). Iterative BLAST searches using human, and then ferret immunoglobulin gene segments were used to identify and annotate putative germline genes. Ferret immunoglobulin gene sequences were analysed with reference to human, mouse or canine databases using IMGT/V-Quest \[[@pone.0233794.ref014]\] and assigned to mammalian clans based upon phylogenetic analyses. Sequences with nonsense mutations and/or non-functional regulatory elements were considered pseudogenes. Phylogenetic relationships of functional V genes were determined based on the Jukes-Cantor model. Consensus phylogenetic trees were built using the Neighbour-Joining method with no outgroups and resampled by bootstrapping using Geneious tree builder (10.1.3). Ferret V, D, J and constant gene sequences have been uploaded to Genbank.
Flow cytometric sorting of single ferret B-lymphocytes {#sec004}
------------------------------------------------------
Ferret studies and related experimental procedures were approved and conducted in accordance to the University of Melbourne Animal Care and Use Standards by the relevant ethics committee (\#CT-FER-17-05). Single cell suspensions were prepared from the spleen of immunologically naïve ferrets. PBMCs were purified using 95% Ficoll-Paque Plus and cryopreserved in heat-inactivated fetal calf serum (FCS) containing 10% dimethylsulfoxide (DMSO). Cryopreserved ferret PBMCs were thawed, stained with Live/Dead Fixable Aqua (Thermo Fisher), surface stains anti-CD11b-BV510 (Biolegend: clone M1/70), anti-CD8-BV450 (Thermo Fisher: clone OKT8) and anti-ferret IgA/IgM/IgG-FITC (Rockland Immunochemicals cat.618-102-130). Stained cells were resuspended in OptiMEM (Thermo Fisher) before single, live, surface Immunoglobulin positive B cells were sorted into 96-well PCR plates and stored at -20°C.
For the recovery of antigen-specific ferret B cells, a single ferret was infected with 1000 TCID~50~ of H1N1 A/California/04/2009 and a single cell suspension of parapharyngeal lymph node cells (pLN) was prepared at 28 days post-infection and cryopreserved in heat-inactivated FCS containing 10% DMSO. Cells were subsequently thawed and stained with Live/Dead Fixable Aqua (Thermo Fisher), surface stains anti-CD11b-BV510 (Biolegend: clone M1/70), anti-ferret IgA/IgM/IgG-FITC (Rockland Immunochemicals cat.618-102-130), anti-CD8 eFluor450 (eBioscience Clone OKT8) and a prototype IgD Mab conjugated to APC-Cy7,. Biotinylated recombinant full length A/California/04/2009 hemagglutinin (HA) probes \[[@pone.0233794.ref015]\] conjugated to streptavidin-PE or streptavidin-APC (Invitrogen) were used to sort single HA-specific B cells into 96-well plates and stored at -20°C.
Ferret B cell receptor (BCR) sequencing {#sec005}
---------------------------------------
A B cell receptor (BCR) sequencing protocol was developed based upon the multiplex nested RT-PCR approaches previous described for humans \[[@pone.0233794.ref001]\] and mice \[[@pone.0233794.ref005]\]. Reverse transcription of total cellular RNA from single sorted ferret B cells was performed in 25μL reaction volumes in the sort plate using 450 ng random hexamers (Bioline), 50 U Superscript III (Thermo Fisher), 1X First Strand buffer (Thermo Fisher), 8 U RNAsin (Promega), 0.125pmol Dithiothreitol (DTT) (Thermo Fisher), 0.8% v/v IGEPAL CA-630 (Sigma Aldrich) and 0.8mM deoxynucleotide triphosphate (dNTP) (Bioline). Cycling conditions for cDNA synthesis were: 42°C for 10 min, 25°C for 10mins, 50°C for 60 mins and 94°C for 5min. 3μL of cDNA was used as template in multiplex nested PCR reactions to amplify paired recombined ferret heavy and light chain (IgK, IgL) sequences. Primary reactions were carried out in 50μL volumes using Hotstart Taq plus polymerase (Qiagen), 1X reaction buffer, 2.0 mM MgCl~2,~ 0.1mM dNTP (Bioline) and 5 nmol each of primary forward and reverse primer pools ([S1 Table](#pone.0233794.s001){ref-type="supplementary-material"}). 4μL of primary PCR product was used as template in a secondary, nested PCR (50 μL volume) containing 1 X reaction buffer, 1.5mM MgCl~2~, 1 x solution Q and 5 nmol secondary forward and reverse primer pools ([S1 Table](#pone.0233794.s001){ref-type="supplementary-material"}). For recovery of antigen-specific B cells from an infected ferret, the protocol was amended by substituting primary and secondary heavy chain reverse primer pools with 5 nmol reverse primer binding in the heavy chain joining gene (IGHJ) ([S1 Table](#pone.0233794.s001){ref-type="supplementary-material"}). Cycling conditions for both heavy and light chain amplification are as follows: Primary PCR: 95°C for 5 mins, 50 cycles of 95°C for 30s, 55°C for 30s and 72°C for 55s. Final extension for 7 | {
"pile_set_name": "PubMed Central"
} |
Coronavirus disease 2019 (COVID-19), caused by the newly identified strain of the coronavirus family severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has rapidly evolved into a worldwide pandemic and caused a public health emergency of major international concern.[@bib1], [@bib2] As a result, a profound reorganisation of hospital wards and clinical activities is happening worldwide to deal with the increasing number of COVID-19-positive patients who require hospitalisation and intensive care support.[@bib3] This comprehensive reallocation of health resources is of particular concern in patients such as those with underlying chronic diseases, including cancer.
The prioritisation of health support towards patients with COVID-19 is raising apprehension within the medical oncology community, in which physicians are increasingly being forced to select which patients should receive anticancer therapy on the basis of who is most likely to have a positive outcome.[@bib4] In this context, the threat of COVID-19 infection might also factor into decision making---a role which could possibly be lessened by knowledge of the COVID-19 status of patients suitable for anticancer therapy.[@bib4] This already dismal scenario seems to be even more severe for patients with lung cancer because of the high risk of interference of COVID-19 with their effective diagnostic and therapeutic management by treating physicians.
Clinical manifestations of COVID-19 range from asymptomatic, to mild symptoms (such as cold, fever, cough, or other non-specific signs), to severe pneumonia leading to acute respiratory distress syndrome, which occurs in 17--29% of infected individuals.[@bib2] Mortality due to COVID-19 has been reported in about 3% of COVID-19-positive patients in the Chinese population,[@bib5] while higher mortality rates are being reported in Italy,[@bib6] which is, after the USA, currently the country with the second highest number of confirmed COVID-19 cases worldwide.[@bib7]
In the early phase of COVID-19-induced pneumonia, the main CT findings include multifocal peripheral and basal ground-glass opacities, crazy paving patterns, traction bronchiectasis, and air bronchogram signs. A progressive transition to consolidation, together with pleural effusion, extensive small lung nodules, irregular interlobular or septal thickening, and adenopathies, characterise the more advanced phase of the disease.[@bib8], [@bib9] These radiological manifestations can overlap with CT findings that are often found in patients with lung cancer upon disease progression or onset of concomitant pneumonia due to overlapping opportunistic infections. Regarding clinical manifestations, the worsening of pulmonary symptoms during lung cancer progression can be similar to that typical of COVID-19, adding further complexity to the thorough assessment of the course of disease in lung cancer patients. Together, these similarities can pose a major challenge to clinicians in distinguishing lung cancer evolution from a potential COVID-19 super-infection on the basis of radiological and clinical evidence, and, importantly, these specific conditions require very different therapeutic approaches.
Adding further complexity to this scenario, pneumonitis can also be induced by immune checkpoint inhibitor therapy, an effective and widely used standard-of-care treatment for lung cancer in various treatment lines and settings.[@bib10] Immune checkpoint inhibitor-related pneumonitis has been reported in about 2% of cancer patients,[@bib11] with a seemingly higher incidence in patients with lung cancer.[@bib12] Similar to COVID-19 infection, the clinical symptoms of immune checkpoint inhibitor-induced pneumonitis are often not specific, consisting mainly of cough (or its worsening), chest pain, dyspnoea, and fever. Additionally, CT assessment of immune checkpoint inhibitor-related pneumonitis shows radiological findings similar to those typical of COVID-19-induced pneumonia ([figure](#fig1){ref-type="fig"} ), thus hindering discrimination between the two clinical entities. Similarly, tyrosine kinase inhibitors can induce radiological patterns of interstitial-like pneumonitis, which develops in 4% of patients with epidermal growth factor receptor-mutant lung cancer treated with osimertinib.[@bib13] FigureCT scans of pneumonia due to COVID-19 and immune checkpoint inhibitor therapy(A) Axial lung image (without intravenous contrast) of 49-year-old man with COVID-19, showing two sub-solid areas in the upper right lobe (arrows). (B) Axial lung image (without intravenous contrast) of an immune checkpoint inhibitor-treated 76-year-old man with metastatic melanoma, showing a sub-solid area and ground-glass opacities with a rounded morphology in the upper right lobe (arrows). COVID-19=coronavirus disease 2019.
In this scenario, standard chemotherapy does not seem to represent a suitable or potentially safer alternative to immune checkpoint inhibitor therapy---neither for treating physicians who want to avoid the overlapping immune checkpoint inhibitor-related and COVID-19-related radiological and clinical changes, or for patients who are unsuitable for immune checkpoint inhibitor therapy. First, combinations of chemotherapies and immunotherapies have shown the best efficacy and represent the standard of care in a large group of patients without oncogene-driven lung cancer and without high PD-L1 expression in tumour cells. Second, the development of chemotherapy-associated pneumonitis is known to occur in up to 16% of treated patients,[@bib14] and cytotoxic chemotherapy has immunosuppressive activity.[@bib15] Notably, administration of chemotherapy within the month preceding COVID-19 diagnosis has been shown to be associated with a higher risk of severe infection-related complications.[@bib16]
The clinical and biological aggressiveness of lung malignancies clearly does not allow for anticancer therapy to be withheld or postponed. Thus, while awaiting specific evidence-based guidelines, the comprehensive management of patients with lung cancer during the COVID-19 pandemic should involve specific and careful attention to their clinical and radiological pulmonary signs, more so than for patients with other types of tumour. From a practical viewpoint, it seems reasonable to suggest that patients with lung cancer undergo systematic testing for SARS-CoV-2 at the beginning of treatment and whenever it is deemed necessary by the treating physician in the course of therapy. This strategy might become more feasible with the increasing availability and progressive use of real-time PCR assays that can provide COVID-19 status results within an hour.[@bib17] Furthermore, the availability of laboratory IgM or IgG testing to evaluate the exposure and immunity to SARS-CoV-2 infection will be helpful when the COVID-19 pandemic begins to decline. Allocating resources for these methodological approaches to patients with lung cancer should facilitate the most appropriate clinical management by multidisciplinary lung cancer care teams.
© 2020 Dr P Marazzi/SPL2020Since January 2020 Elsevier has created a COVID-19 resource centre with free information in English and Mandarin on the novel coronavirus COVID-19. The COVID-19 resource centre is hosted on Elsevier Connect, the company\'s public news and information website. Elsevier hereby grants permission to make all its COVID-19-related research that is available on the COVID-19 resource centre - including this research content - immediately available in PubMed Central and other publicly funded repositories, such as the WHO COVID database with rights for unrestricted research re-use and analyses in any form or by any means with acknowledgement of the original source. These permissions are granted for free by Elsevier for as long as the COVID-19 resource centre remains active.
LC has served as consultant or advisor to Bristol-Myers Squibb and Merck Sharp and Dohme. SP has received education grants, provided consultation, attended advisory boards, or provided lectures for AbbVie, Amgen, AstraZeneca, Bayer, Biocartis, Bioinvent, Blueprint Medicines, Boehringer-Ingelheim, Bristol-Myers Squibb, Clovis, Daiichi Sankyo, Debiopharm, Eli Lilly, F Hoffmann-La Roche, Foundation Medicine, Illumina, Janssen, Merck Sharp and Dohme, Merck Serono, Merrimack, Novartis, Pharma Mar, Pfizer, Regeneron, Sanofi, Seattle Genetics, Takeda, and Vaccibody, from whom she has received honoraria (all fees to institution). J-CS was employee for AstraZeneca from September, 2017, to December, 2019, and has shares in Gritstone. AMDG has served as a consultant or advisor to Incyte, Pierre Fabre, GlaxoSmithKline and Bristol-Myers Squibb, Merck Sharp Dohme, and Sanofi. FB has served as a consultant, advisor, or lecturer for AstraZeneca, Bayer, Bristol-Myers Squibb, Boehringer-Ingelheim, Eli Lilly Oncology, F Hoffmann-La Roche, Novartis, Merck, Merck Sharp and Dohme, Pierre Fabre, Pfizer, and Takeda. CG has received honoraria as consultant or advisor or speaker bureau member for AstraZeneca, Bristol-Myers Squibb, F Hoffmann-La Roche, and Merck Sharp and Dohme, and has received funds (to organisation) from Merck Sharp and Dohme. MR has served as a consultant and provided lectures for Amgen, AbbVie, AstraZeneca, Bristol-Myers Squibb, Boehringer-Ingelheim, Celgene, Merck, Merck Sharp and Dohme, Novartis, Pfizer, Roche, Samsung. MM has served as a consultant or advisor to Roche, Bristol-Myers Squibb, Merck Sharp and Dohme, Incyte, AstraZeneca, Amgen, Pierre Fabre, Eli Lilly, GlaxoSmithKline, Sciclone, Sanofi, Alfasigma, and Merck Serono. AC, MA, and VV declare no competing interests. We thanks Nicholas | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
From an architectural point of view, bacterial cells are among the simplest forms of life on the planet. Their cytoplasm is typically devoid of membrane bound organelles, and their cellular morphology relies upon a semi-rigid peptidoglycan (PG) cell wall that imposes its shape on the malleable cell membrane(s). Bacterial cells are inflated by their high internal turgor pressure, which pushes the membranes against the cell wall, causing the PG to stretch and the cell to adopt its appropriate shape. Despite the apparent simplicity, studies in the past few decades have demonstrated that bacterial cellular architecture is far more complex than previously thought, in terms of both its ultrastructure and dynamic capabilities ([@bib17]; [@bib52]; [@bib53]).
Endospore formation in *Bacillus subtilis* represents a striking example of the dynamic capabilities of bacterial cells, as it entails dramatic changes in cellular architecture. First, the division site shifts to polar position, generating a sporangium comprised of two cells: a larger mother cell and a smaller forespore ([Figure 1A](#fig1){ref-type="fig"}; [@bib13]; [@bib18]; [@bib46]). The polar septum traps the forespore chromosome, which is subsequently transported to the forespore by SpoIIIE, a membrane-anchored ATPase that assembles a translocation complex at septal midpoint ([@bib3]; [@bib58]; [@bib55]; [@bib56]). Chromosome translocation increases the turgor pressure in the forespore, causing it to inflate and expand into the mother cell ([@bib25]). Simultaneously, the mother cell engulfs the forespore in a process that resembles eukaryotic phagocytosis ([Figure 1A](#fig1){ref-type="fig"}). After engulfment, the forespore is fully enclosed within the cytoplasm of the mother cell, where it matures in a process that involves the synthesis of protective layers of cortex and coat, and the partial dehydration of the forespore cytoplasm. Finally, the mother cell lyses and the mature spore is released to the environment, where it remains dormant until the conditions are appropriate for germination.
![Visualizing the 3D architecture of engulfment during sporulation in *B. subtilis*.\
(**A**) Schematic illustrating the process of polar septation, chromosome translocation, engulfment and spore maturation. Membranes (red), PG (gray), chromosomes (blue), SpoIIIE (orange) and coat proteins (shades of brown) are highlighted. Outward arrows in the stage II~ii~ forespore indicate increased turgor pressure due to chromosome translocation. (**B**) Revised engulfment model ([@bib38]): new PG (purple) is synthesized ahead of the leading edge of the engulfing membrane by forespore-associated PG biosynthetic enzymes (blue) and is subsequently degraded by DMP (yellow pacman), making room for the engulfing membrane to advance. The coordinated synthesis and degradation of PG at the leading edge of the engulfing membrane can move the junction between the septum (pink) and the lateral cell wall (gray) around the forespore. (**C**) Schematic illustrating cryo-FIB-ET methodology for bacterial samples (see Materials and methods). (**D--I**) Slices through cryo-electron tomograms representing different stages of engulfment: (**D**) flat polar septum (Stage II~i~), (**F**) curved septum (Stage II~ii~) and (**H**) engulfing septum (Stage II~iii~). Scale bar for (D,F,I): 200 nm. The corresponding forespore membrane (green) and the mother cell membrane (yellow) are annotated in (**E,G,I**) respectively. n indicates the number of tomograms acquired for each cell type. Scale bars have been omitted for (E,G,I) as cells are shown in perspective views . (**J--N**) Zoomed-in slices through cryo-electron tomograms showing (**J**) a large ellipsoidal complex adjacent to the forespore membrane (black arrow), (**K**) a putative SpoIIIE channel (brown arrow) and (**L**) another putative channel (brown arrow), (**L,M**) coat filaments (green arrows), (**M**) basement coat layer (maroon arrow) and (**N**) amorphous coat proteins (purple arrow). Scale bar for (J-N): 50 nm.](elife-45257-fig1){#fig1}
Engulfment represents a major rearrangement of the sporangium, from two cells that lie side by side to a cell within a cell. Such rearrangement likely involves a profound remodeling of the PG cell wall around the forespore, which would otherwise constrain the movement of the engulfing membrane. At the onset of engulfment, the engulfing mother cell membrane must circumvent the physical barrier posed by the septal PG in order to migrate around the forespore. This has led to the logical proposal that engulfment must entail the complete dissolution of the septal PG, a process often referred to as 'septal thinning' ([@bib9]; [@bib20]; [@bib39]). This proposal was supported by early electron microscopy studies of fixed and stained sporangia showing that engulfment-defective mutants had thicker septa than wild type sporangia ([@bib19]; [@bib20]; [@bib42]). Further studies showed that engulfment requires three mother cell proteins: SpoIID, SpoIIM and SpoIIP, which form a complex (DMP) with PG degradation activity ([@bib1]; [@bib2]; [@bib9]; [@bib35]). In principle, DMP could mediate the complete dissolution of the septal PG to remove the steric block to the movement of the mother cell membrane around the forespore.
The idea that septal PG is completely degraded has been more recently challenged by cryo-electron tomography (cryo-ET) images showing that a thin PG layer is present between the forespore and the mother cell membranes throughout engulfment ([@bib48]). It has also been shown that DMP-mediated PG degradation is required and rate-limiting for membrane migration even after the septal barrier has been bypassed, suggesting that DMP plays a role separate from the dissolution of septal PG ([@bib1]; [@bib16]). In addition, the movement of the mother cell membrane also requires PG synthesis at the leading edge of the engulfing membrane ([@bib34]; [@bib38]). Based on these observations, we proposed a revised model for engulfment membrane migration in which coordinated PG synthesis and degradation at the leading edge of the engulfing mother cell membrane moves the junction between the septum and the lateral cell wall around the forespore, making room for the engulfing membrane to advance ([Figure 1B](#fig1){ref-type="fig"}; [@bib38]). This model eliminates the need for complete dissolution of the septal PG and predicts that PG synthesis happens ahead of the leading edge of the engulfing membrane. Then, the mother cell DMP degrades this new PG to mediate membrane migration. However, due to the limited resolution of optical microscopy, conclusive evidence that PG synthesis occurs ahead of PG degradation is lacking.
Cryo-ET allows the visualization of three-dimensional (3D) architecture of bacterial membranes and cell wall in a hydrated near-native state that cannot be achieved by methods reliant on chemical fixation and staining ([@bib5]; [@bib31]; [@bib37]). However, a limitation of cryo-ET is that the samples must be less than \~500 nm thick to obtain high-resolution tomograms, constraining its application to only a handful of bacteria that are either naturally slender, or, as in the case of *B. subtilis*, for which slender mutant strains are available ([@bib48]). But the latter typically contain mutations in genes involved in PG metabolism and may not be ideal to study cell wall remodeling. Recent application of cryo-focused ion beam (cryo-FIB) milling has produced artifact-free thin sample sections of \~100--300 nm, which allows the acquisition of high-resolution tomograms of sections of wild type cells ([Figure 1C](#fig1){ref-type="fig"}; [@bib27]; [@bib41]; [@bib51]). Cryo-FIB milling coupled with cryo-ET (or cryo-FIB-ET) is therefore becoming the method of choice for studies of cellular architecture of both eukaryotic and prokaryotic cells ([@bib8]; [@bib12]; [@bib25]; [@bib26]).
Here, we have used cryo-FIB-ET to study sporulation in *B. subtilis*, revealing the different stages of engulfment with a resolution that has not been achieved previously. We have analyzed wild type sporangia, engulfment mutants, and sporangia treated with PG synthesis inhibitors to obtain new mechanistic insights into the PG transformations that occur during engulfment. First, we provide evidence that septal PG is not degraded completely at the onset of engulfment. Second, we show that during membrane migration, the newly synthesized PG deforms the forespore membrane ahead of the leading edge of the engulfing mother cell membrane, indicating that PG synthesis precedes PG degradation. Third, we observe that the mother cell membrane migrates around the forespore by forming tiny finger-like projections, the formation of which depends on DMP complexes tethering to and degrading the PG ahead of the engulfing membrane. The methodology, images and analyses presented here will provide valuable resources for future studies of spore assembly and other fundamental cell biological processes.
Results {#s2}
=======
Visualizing sporulation in wild type *B. subtilis* at molecular resolution {#s2- | {
"pile_set_name": "PubMed Central"
} |
{.253}
{.254}
| {
"pile_set_name": "PubMed Central"
} |
{#sp1 .362}
| {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-antioxidants-09-00293}
===============
The family Lamiaceae has 236 genera and about 6900 to 7200 species. *Salvia* (\~900 species) is one of the largest genera of Lamiaceae \[[@B1-antioxidants-09-00293]\]. The name derives from the Latin word "salveo", that means "to save, to heal" \[[@B2-antioxidants-09-00293]\]. *Salvia* species have been used as tea since ancient times to prevent colds, coughs, nervous exhaustion, stomach and abdominal pain, pharyngitis, inflammation of the mouth, inflammation of the gums, excessive sweating, and increased lactation \[[@B3-antioxidants-09-00293],[@B4-antioxidants-09-00293],[@B5-antioxidants-09-00293]\]. Many studies on *Salvia* species have shown that plants, extracts, and essential oils possess biological activities such as antiseptic, antifungal, antibacterial, antiviral, analgesic, antispasmodic, antioxidant, astringent, hallucinogenic, central nervous system depressant, anticancer, cardiovascular, antidiabetic, and insecticidal activities \[[@B6-antioxidants-09-00293]\]. As a result of the phytochemical studies, it has been learned that these plants are rich in flavonoids, phenolic compounds, as well as diterpenes and triterpenes \[[@B7-antioxidants-09-00293],[@B8-antioxidants-09-00293],[@B9-antioxidants-09-00293]\]. These compounds show a natural antioxidant property by stopping or inhibiting the reactions caused by free radicals \[[@B10-antioxidants-09-00293],[@B11-antioxidants-09-00293]\].
*Salvia aramiensis* Rech. f. grown in *Pinus brutia* woodlands, rocky places, and limestones in Hatay (Turkey) province, are perennial, evergreen, and subshrub with woody stems \[[@B12-antioxidants-09-00293]\]. Its flowers and leafy branches are used as stomachic herbal tea \[[@B13-antioxidants-09-00293]\]. The literature has focused on *S. aramiensis* essential oil composition and its antioxidant and antimicrobial activity \[[@B14-antioxidants-09-00293]\]. According to literature, *S. aramiensis* essential oil is a potent antimicrobial and antioxidant agent \[[@B2-antioxidants-09-00293],[@B6-antioxidants-09-00293],[@B15-antioxidants-09-00293]\]. To date, the biological activity and chemical composition of *S. aramiensis* have not been investigated.
Despite extensive research into the discovery of new collagenase, elastase, and hyaluronidase enzyme-inhibiting compounds of both synthetic and natural origin, it is still a major basis for recent inhibitors of these enzymes due to the side effects or low efficacy of existing enzymes. Also, the current number of these enzyme inhibitors is very limited, and recent inhibitors are in demand mainly in the cosmetic and pharmaceutical industry (wound healing) \[[@B16-antioxidants-09-00293]\]. The dermis, the middle layer of the skin, consists of elastin and collagen, the main component of the connective tissue. These proteins are responsible for the resistance and elasticity of the skin and are destroyed as a result of the formation of free radicals and the induction of elastase and collagenase enzymes \[[@B17-antioxidants-09-00293]\]. Collagen and elastin also play an important role in the wound-healing process. Inhibition of collagenase activity retards the progression of formation of pre-collagen fibers \[[@B18-antioxidants-09-00293]\]. Overproduced elastase enzyme accelerates the degradation of the surrounding healthy tissue around the wound by catalyzing this protein \[[@B18-antioxidants-09-00293],[@B19-antioxidants-09-00293]\]. Reactive oxygen species (ROS) are one of the factors that trigger skin aging and that delay the wound healing process by causing oxidative damage of skin lipids, proteins, and DNA \[[@B20-antioxidants-09-00293],[@B21-antioxidants-09-00293]\]. To increase the antiaging effect, to prevent loss of skin elasticity, and to accelerate wound healing, it is essential to find inhibitors of elastase and collagenase enzymes, which have a radical scavenging feature.
Encapsulation technologies have been used to increase the effectiveness of the active compounds using drug delivery systems in situations where water solubility is low and to improve long-term stability \[[@B22-antioxidants-09-00293]\]. Of them, nanoliposomes (LPs) are spherical, single or multi-layered vesicles that can be micro- or nanosized but can trap both hydrophobic and hydrophilic compounds \[[@B23-antioxidants-09-00293]\]. LPs are known as systems that provide and enhance the passage of active compounds both in the epidermis and in the deeper layers of the skin due to the similarity to cell membrane structure. Also, LPs are biologically compatible, biodegradable, non-immunogenic, and nontoxic systems that are widely used in cosmeceuticals \[[@B24-antioxidants-09-00293],[@B25-antioxidants-09-00293]\].
For hundreds of years, natural ingredients have been used mainly for antioxidant, antimicrobial, and enzyme inhibitory activities for skin care and wound healing \[[@B26-antioxidants-09-00293]\]. For this purpose, we studied (1) the antioxidant activities with radical scavenging assays and inhibition of β-carotene/linoleic acid co-oxidation of *S. aramiensis* extracts, (2) inhibitory effects of the most antioxidant active extracts (70% methanol) on elastase and collagenase enzymes, (3) the chemical composition of the 70% methanol extract, (4) the preparation and characterization of novel liposomal formulation containing 70% methanol extract, and (5) toxicity of 70% methanol extract and liposomal formulation on L929 fibroblast cell line.
2. Materials and Methods {#sec2-antioxidants-09-00293}
========================
2.1. Plant Sample and Reagents {#sec2dot1-antioxidants-09-00293}
------------------------------
*Salvia aramiensis* which was used for experimental studies was collected on 01.06.2016 from Hatay (Belen), Turkey. Herbarium sample of the plant is stored in Mustafa Kemal University Science and Literature Faculty Herbarium (Plant Collector no: 1864). All reagents and chromatographic standards were obtained from Sigma Chemical Company (St. Louis, MO, USA).
2.2. Extraction Procedure {#sec2dot2-antioxidants-09-00293}
-------------------------
The dried whole aerial part of the plant material (stem, leaves, and flower) was powdered and divided into three parts. The first part (50 g) was extracted with 70% methanol (MeOH) and the second part (50 g) was extracted with 70% ethanol (EtOH) three times in a shaking water bath at 37 °C for 24 h. The resulting extracts were combined separately and concentrated under vacuum with a rotary evaporator (37--38 °C). Since traditional use is in the form of tea, 2 g of aerial plant material is brewed with 100 mL of boiling water and left to rest for 10 min. This 2% form of infusion was then lyophilized. Until the analysis time, lyophilized extracts were stored at −20 °C.
2.3. Total Phenolic (TFC) and Flavonoid Content (TPC) {#sec2dot3-antioxidants-09-00293}
-----------------------------------------------------
TFC was calculated as gallic acid equivalents (GAE) in mg/g dry weight of plant material \[[@B27-antioxidants-09-00293]\]. TPC content was calculated as catechin (CA) equivalents in mg/g dry weight of plant material through the aluminum chloride colorimetric assay \[[@B28-antioxidants-09-00293]\].
2.4. Antioxidant Activity {#sec2dot4-antioxidants-09-00293}
-------------------------
### 2.4.1. 1,1-Diphenyl-2-Picrylhydrazyl Radical (DPPH^●^) Scavenging Activity {#sec2dot4dot1-antioxidants-09-00293}
The determination of DPPH^●^ radical scavenging was carried out by the method of Braca et al. \[[@B29-antioxidants-09-00293]\]: 500 µL of sample (0.025, 0.05, 0.1, 0.15, 0.2, 0.3, 0.4, 0.6, 0.8, 1, 1.5, and 2 mg/mL) and standard rosmarinic acid (5, 10, 15, 20, 25, 30, 40, 50, 75, and 100 µg/mL) were added to 1.5 mL of a 0.1 mmol/L MeOH solution of DPPH. Percent inhibition was calculated using Equation (1) after reading the absorbance at 517 nm.
### 2.4.2. 2,2'-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABTS^+●^) Radical Scavenging Activity {#sec2dot4dot2-antioxidants-09-00293}
The determination of ABTS^+●^ radical scavenging was performed as declared by Huang et al. \[[@B30-antioxidants-09-00293]\]. The ABTS^●+^ radical (7 mM) and potassium persulfate (2.45 mM) were dissolved in water to a final concentration and left for 16 h | {
"pile_set_name": "PubMed Central"
} |
###### Strengths and limitations of this study
- Health workers from health facilities of all three levels in China were sampled to draw a whole picture of prevalence, correlates and reasons for workplace violence (WPV) against health workers in this study.
- This study achieved a larger sample size (4862) and a higher valid response rate (79.8%) than past studies related to WPV against health workers.
- The convenience sampling strategy of this study may compromise the representativeness of the sample.
- A single Yi Nao incident usually affects a larger number of health workers in the facility, and thus, there might be potential impacts of Yi Nao at organisational level that could not be identified in the current study.
Introduction {#s1}
============
Workplace violence (WPV) against health workers has become a major global health problem.[@R1] It finds its expression in verbal abuse, bullying, threats, sexual harassment, physical assault and homicide.[@R2] WPV has threatened health workers' well-being, safety, health and even their lives, and has also resulted in a tendency to defensive medicine, poorer health service quality and productivity, resignation of health personnel and difficulties in recruitment.[@R2] This study focused on client-initiated WPV (ie, assaults by patients, caregivers or relatives of the patient) because it is the most common type of WPV in the health sector.[@R4]
China is known to have a high prevalence of WPV in the health sector.[@R5] A survey organised by the Chinese Hospital Association which drew data from 316 hospitals showed that the proportion of hospitals experiencing WPV increased from 90% in 2008 to 96% in 2012.[@R8] A study conducted by the Chinese Medical Doctor Association in 2014 revealed that nearly three quarters of physicians ever experienced physical injuries or verbal abuse at work.[@R9] China issued an Amendment of Criminal Law which included regulations against WPV in the health sector in 2015.[@R10] This amendment might explain the results of a widely circulated study conducted from 2013 to 2017 which showed that WPV in the health sector reached a peak in 2015 and then began to decrease.[@R11] Nevertheless, a 2016 survey with 1024 Chinese nurses showed 75.4% of physicians had experienced at least one form of WPV,[@R12] and a 2017 study indicated that 66% of participants had experienced WPV in the past year.[@R13] The WPV against health workers remains widespread even after the law legislations, and medical professions are considered by many to be unsafe working environments.[@R7]
The prominent problem of WPV in China is believed to be related to systemic and historical factors.[@R14] Insufficient public funding into the public health sector, commercialisation of public health facilities, and high out-of-pocket payment contributed to patient dissatisfaction with public health services over time, leading to a distrust of healthcare professionals and poor doctor-patient relationships.[@R16] Legal channels for reporting malpractice or resolving medical disputes are perceived to be time-consuming, unaffordable, ineffective and unfair.[@R8] Biassed media reports may also exacerbate the tension.[@R15] The Chinese government started a massive healthcare reform in 2009, rolled out universal health insurance coverage and zero-profit drug policy aiming to improve accessibility and affordability of health services.[@R19] However, with health resources remaining insufficient and the structural imbalance among the three tiers of healthcare facilities,[@R22] namely tertiary hospitals, secondary hospitals and primary care facilities, patients in China still flood into major hospitals and deal with long waiting times[@R15] and inadequate communication from physicians.[@R24] The accumulation of these patients' poor experiences can instigate more tension between health providers and patients.[@R25] Previous researches conducted in tertiary hospitals and/or together with secondary hospitals found that there is a high prevalence of WPV against health workers.[@R6] Seldom have these studies compared rates of WPV within the three-tier health system structure in China, and WPV in a rapidly changing health system merits more research.
Former studies have identified different kinds of WPV. One large sample survey of WPV in China from 2016 recognised seven types of WPV,[@R27] which include some special types such as 'smear reputation' and 'mobbing behaviour'.[@R28] Most Chinese studies only described WPV in the most general terms or divided into physical violence, verbal violence and sexual harassment.[@R13] In all these types of WPV, the prevalence of physical violence and its correlates have been frequently studied. However, little is known about specific forms of physical violence in China. On the other hand, threats of physical violence are a form of psychological violence.[@R2] Threats are associated with a higher risk of actual physical violence.[@R30] The self-rated degree of seriousness of the threat incident outcomes was similar to that of actual physical violence, and threats can cause consequences comparable to actual physical violence.[@R31] Specific data about threats and their associated factors in healthcare settings are needed. In addition, Yi Nao is a unique form of WPV in China, and has been defined as an extreme and organised form of WPV in which patients, relatives and even hired gangs attack health workers, damage hospital facilities and disturb the running of hospitals in order to gain monetary compensation from the hospital.[@R18] Many health workers have had individual exposure to Yi Nao by either witnessing or falling victim to it, but little is known about its correlates in the Chinese setting.
Furthermore, how employees perceive organisational policies and practices to prevent aggression is important because it affects victims' willingness to report violent cases to relevant parties.[@R31] It would be useful to conduct more research on the relationship between physicians' perception of organisational policies to report WPV and the rates at which they experienced incidents of WPV. In this study, we aimed to (1) Examine the magnitude of physical violence, threats, Yi Nao and their correlates, at the three levels of healthcare facilities in China. (2) Examine specific forms of physical violence and the aftermath. (3) Perception of organisational policies to report WPV and its association with physical violence, threats and Yi Nao.
Methods {#s2}
=======
Study population and design {#s2-1}
---------------------------
The study was a cross-sectional survey conducted from July 2016 to July 2017 in Zhejiang Province, which has a population of 56 million people including half a million health sector workers.[@R32] The target population was all health workers who had patient contact. The sampling strategy was divided into two steps:
First, we stratified the sampling by facility type which has been built according to political administration levels. Specifically, primary care facilities provide primary healthcare to the population of a district or a town, while tertiary and secondary hospitals are usually located in cities and counties, aiming to provide referral care to the population residing in their administrative areas. We purposefully sampled tertiary and secondary hospitals across different cities and counties. We included general hospitals and specialty hospitals. The latter included women and children hospitals, and traditional Chinese medicine hospitals.
The selected health facilities included tertiary hospitals (mostly in the developed capital city of Hangzhou and prefecture-level cities), secondary hospitals (mostly in counties) and primary care facilities including urban community health centres and rural township health centres. Specifically, the selected health facilities at each tier included: (1) Five tertiary hospitals: one general hospital was selected in Hangzhou, a developed prefecture-level city Jiaxing, and a less developed city Quzhou, respectively; one women and children hospital and one traditional Chinese medicine hospital in Hangzhou were selected. (2) Eight secondary hospitals: one general hospital and one traditional Chinese medicine hospital were sampled from the developed counties Ninghai and Shenzhou, and the less developed counties Jiangshan and Kaihua, respectively. (3) Thirty-two primary care facilities including 16 urban community health centres in Hangzhou and Ningbo (8 in each city) and 16 rural township health centres in Ninghai and Jiangshan (8 in each county). A total of 46 health facilities were selected for the study.
Second, we used convenience sampling to recruit participants. We first obtained permission from hospital managers or primary care facility directors to conduct the survey. Afterwards, an administrator was designated to help us contact each unit or contact health workers. We invited health workers on duty on surveying days to fill in the questionnaire, including doctors, nurses, laboratory technicians (who need to dispense sample containers and collect biological samples from patients) and administrative staff who had patient contact in their daily practices. The purpose of the survey was fully explained, and verbal consent was obtained. The front page of the questionnaire also included a statement of consent. Anonymity and confidentiality were assured. We informed participants that the survey was fully voluntary.
Questionnaire {#s2-2}
-------------
The questionnaire was designed based on WHO's instrumental survey tools which have previously been used in China.[@R2] The original questionnaire was developed by the joint programme on WPV in the health sector among the International Labour Office, International Council of Nurses, WHO and Public Services International in 2003. It consists of five sections: personal and workplace data, physical WPV, psychological WPV, health sector employer, and opinions on WPV. In this study, we adapted our questionnaire based on the former two and the last sections with a focus on physical violence. To fit the study aims and reflect the Chinese setting, additional items were added, including two items about experience of threats and Yi Nao, four items about specific forms of physical violence and how victims respond, and six items about the aftermath.
The final questionnaire comprised five sections: (1) Sociodemographic information and professional background. (2) Experience of physical violence, threats of physical violence (defined in the | {
"pile_set_name": "PubMed Central"
} |
Background
==========
Surgical resection is the standard treatment for localized non-metastatic pancreatic cancer. Data from the Surveillance Epidemiology and End Results (SEER) registry indicate that only about 10% of cases are able to undergo surgery with curative intent, and only a very small number of those are cured because of the high incidence of local relapse and early metastases \[[@B1]\]. Many clinical trials have been carried out using chemotherapy with or without radiation therapy following curative surgical resection, with the aim of preventing local and distant recurrence. With the exception of gemcitabine, neither chemotherapy nor radiation improved survival \[[@B2]\]. For those with locally advanced unresectable or metastatic disease, systemic chemotherapy remains the principal means of improving survival or alleviating cancer-related symptoms
The radiation-sensitive structures in the upper abdomen (small intestine, stomach, kidneys, liver, and spinal cord), prevent conventional radiation therapy to the pancreas or to the pancreatic bed from delivering adequate doses, and irradiation is usually accompanied by severe gastrointestinal intolerance \[[@B3]\]. This may explain in part the absence of survival benefit in patients with locally advanced pancreatic cancer who receive radiation therapy alone. However, 5-FU-based concurrent chemoradiation yields modest survival benefits in patients with locally advanced unresectable pancreatic cancer \[[@B4],[@B5]\]. Despite these findings, survival from pancreatic cancer is still poor, with approximately 23% of patients alive 12 months following diagnosis, and 5% alive at 5 years \[[@B1]\]. New radiation techniques including intensity modulated radiation therapy (IMRT), image guided radiation therapy (IGRT) and stereotactic radiosurgery make it possible to deliver optimally high doses to the target volume with minimal effect on adjacent radiosensitive tissues \[[@B6],[@B7]\]. Helical tomotherapy is a sophisticated image-guided IMRT based on the ring gantry concept, employing a combination of a megavoltage CT scanner and a linear accelerator \[[@B8],[@B9]\]. Capecitabine, a prodrug of 5-FU, is absorbed inert from the gastrointestinal tract and selectively metabolized to 5-FU in tumor cells. This selective conversion achieves higher levels of 5-FU in the tumor cells than can be obtained by intravenous administration of 5-FU. Additionally, radiation can magnify the tumor selectivity of capecitabine by upregulating thymidine phosphorylase in the tumor cells \[[@B10]\]. Capecitabine also acts as a radiation sensitizer by disturbing tumor cell DNA synthesis \[[@B11]\].
In this paper, we report our experience of concurrent administration of capecitabine with helical tomotherapy in patients with inoperable or recurrent pancreatic cancer. We achieved a highly conformal distribution of radiation doses and minimal treatment-related toxicities with excellent target volume responses.
Methods
=======
Patient population
------------------
Between October 2005 and February 2008, nineteen patients with pancreatic cancer were treated with concurrent chemoradiation using helical tomotherapy and capecitabine. They included patients with locally advanced and unresectable disease, and those with local relapse following curative resection or with metastatic disease. Patients who were older than 18 years, who understood the written informed consent document and who were willing to sign it, were eligible for inclusion. The medical records of these patients were reviewed retrospectively. This review was approved by the hospital institutional ethical committee, and written informed consent was obtained from each patient.
Radiotherapy
------------
Radiotherapy was provided by helical tomotherapy (Tomotherapy Incorporated, Madison, WI, USA). Two planning target volumes (PTV) were entered for each patient \[[@B3]\]. PTV1 consisted of the gross tumor volume (GTV) as determined by CT scan, or the tumor bed (in post-surgical cases). PTV2 consisted of the draining lymph nodes, comprising the nodes in the porta hepatis, celiac axis, superior mesenteric and retroperitoneal areas. PTV2 extended 2 cm below the target volume and did not have to include the inferior mesenteric nodes. Both targets were treated simultaneously in 25 daily fractions, 5 days a week. Helical tomotherapy delivered 55 Gy to PTV1 and 50 Gy to PTV2. In some patients with distant metastases (liver or lung), the metastatic lesions were also targeted as another PTV. The distribution of isodoses in the helical tomotherpy treatment planning is shown in Figure [1](#F1){ref-type="fig"}. The dose and volume constraints for the normal structures are listed in Table [1](#T1){ref-type="table"}. Figure [2](#F2){ref-type="fig"} is an average delivered dose-volume histogram for GTV and organ at risk. Capecitabine (Xeloda; Roche Pharmaceuticals, Nutley, NJ) was given at 1600 mg/m^2^/day in two doses on each day of radiation and continued for the duration of the radiation therapy \[[@B3]\].
{#F1}
{#F2}
######
Dose and volume constraints for organs at risk.
Structure Maximum dose constraint (Gy) Volume above limit (%) Maximum dose (Gy) Minimum dose (Gy)
-------------- ------------------------------ ------------------------ ------------------- -------------------
Liver 45.00 10.00 52.83 0.30
Right kidney 1.00 1.00 20.60 0.38
Left kidney 15.00 20.00 20.57 0.54
Small bowel 45.00 10.00 53.34 0.18
Stomach 50.00 10.00 52.95 0.44
Duodenum 10.00 1.00 14.07 0.60
Toxicity assessment
-------------------
Acute toxicity (occurring within 90 days of radiotherapy) was scored using the National Cancer Institute Common Toxicity Criteria (NCI CTC), version 2, morbidity scales \[[@B12]\]. Late toxicity was scored using the Radiation Therapy Oncology Group (RTOG) scale for late toxicity \[[@B13]\]. Patients were evaluated on a weekly basis.
Response assessment
-------------------
The response of each targeted lesion (defined as the in-field tumor response) was evaluated by comparing, by the RECIST criteria, tumor size in pre- and post-treatment CT images 8 weeks after completion of concurrent chemoradiation therapy (CCRT). Two different radiologist evaluated the response rate.
Statistical methods
-------------------
All statistics are descriptive. Survival was compared using the Kaplan-Meier method. Statistical analyses were performed using SPSS software, version 15.0, Chicago.
Results
=======
Patient and tumor characteristics
---------------------------------
The patient characteristics are shown in Table [2](#T2){ref-type="table"}. Twelve were male and seven were female. Median age was 64.0 (range, 46 - 83). Median duration from diagnosis to CCRT was 1.5 months (range, 0.2 - 63.3). The patients were classified with respect to disease status as follows: 1) eight had primarily unresectable disease without metastasis, and no history of previous treatment, 2) three had local relapse following complete resection, and 3) eight had metastatic disease in the liver, lung or peritoneum (three had metastases on first diagnosis and five had metastases that developed during the course of disease). Eight patients had previously received systemic chemotherapy.
######
Patient and tumor characteristics
Patient Sex Age Primary tumor site Previous operation Previous chemotherapy TNM (stage) Duration of follow-up after diagnosis (months) Site of metastasis Site of tomotherapy
--------- ----- ----- -------------------- -------------------- ----------------------------------------- ------------- ------------------------------------------------ -------------------- ---------------------
1 F 53 Head No No T4N1M0(IVA) 2.9 Pancreas
2 M 61 Body Yes Gemcitabine \#6, Cisplatin/Capecitabine T3N0M0 (II) 4.9 Pancreas
3 M 67 Tail No No T4N1M0(IVA) 1.5 Pancreas
4 F 76 Body No Gemcitabine \#5 T4N1M0(IVA) 7.6 Pancreas
5 M 57 Body No Gemcitabine/Capecitabine T4N1M1(IVB) 1.2 Liver Pancreas
6 F 64 Body, tail No No T4N1M0(IVA) 0.2 Pancreas
7 M 67 Body No No T4N1M0(IVA) 1 Pancreas
8 F 71 Body No Gemcitabine/Cisplatin \#3 T3N1M1(IVB) | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
Neural stem cells give rise to new neurons in the subgranular zone of the hippocampal dentate gyrus (DG) and the subventricular zone (SVZ) of the lateral ventricle throughout life. The generation of a mature neuron involves a stereotypic sequence of developmental steps including proliferation, cell cycle exit, neuronal fate determination, maturation and functional integration into the pre-existing neural circuit. These developmental stages can be distinguished on the basis of the expression of stage-specific marker proteins [@pone.0062693-Kempermann1].
Doublecortin (DCX) is a microtubule binding protein. The doublecortin (DCX) superfamily consists of 11 conserved members [@pone.0062693-Reiner1], all containing a DCX domain, which is necessary for microtubule binding [@pone.0062693-Kim1]. DCX is highly expressed in migrating neurons of the developing central nervous system [@pone.0062693-desPortes1], [@pone.0062693-Francis1], [@pone.0062693-Gleeson1]. In the adult mouse brain, DCX is almost exclusively expressed by immature newborn neurons in the DG and the SVZ/OB-system and is commonly used to distinguish immature neurons from non-neuronally committed precursors and mature neurons, and to estimate neurogenic activity [@pone.0062693-CouillardDespres1], [@pone.0062693-CouillardDespres2], [@pone.0062693-Ming1].
Mutations in the X-linked *Dcx* gene are associated with abnormal neuronal migration, and are causally linked to epilepsy, mental retardation, lissencephaly in male and subcortical laminar heterotopia in female human subjects [@pone.0062693-desPortes1], [@pone.0062693-desPortes2], [@pone.0062693-Dijkmans1]. Interestingly, there are species specific requirements for DCX function in the development of distinct forebrain regions. In humans, DCX is required for the lamination of the hippocampus and the neocortex [@pone.0062693-Corbo1]; in mice, only the lamination of the hippocampus is dependent on DCX function. RNAi-mediated knockdown of DCX causes heterotopia formation in the rat neocortex [@pone.0062693-Bai1] but not in the murine neocortex [@pone.0062693-Ramos1]. Short-hairpin (sh) RNA-mediated DCX knockdown in the early postnatal SVZ/OB system of mice causes abnormal neuronal migration and changes the fate of developing neurons [@pone.0062693-Belvindrah1]. Despite the widespread use of DCX as a marker for immature neurons in the adult neurogenic lineage, little is known about the specific function of DCX in adult neurogenesis. Analysis of DCX null mutant mice suggested that DCX is required for the migration of adult-born neurons in the SVZ/OB-system [@pone.0062693-Koizumi1]. DCX null mutant mice, however, lack DCX function already during embryonic development and thus do not allow to distinguish whether the observed migratory defects result from a direct function of DCX in adult-born neurons or result from defective CNS development. Here, we employ a MMLV-retrovirus based approach to overexpress or knockdown DCX specifically in the neurogenic lineage of the DG and the SVZ/OB-system during adulthood. Our results provide strong evidence that DCX is dispensable for the development of adult born neurons in wildtype mice.
Materials and Methods {#s2}
=====================
Animals {#s2a}
-------
All animal experiments were performed in accordance with the European Communities Council Directive (86/609/EEC). Stereotactic injections of retroviruses into the brain of adult mice were approved by the Government of Upper Bavaria. For all experiments, seven weeks old female C57BL/6-J mice were ordered from Charles River and retrovirally injected at an age of eight weeks. Mice were grouped housed in big rat cages under a 12 h light/dark cycle and had *ad libitum* access to food and water. Cages were containing a house and a running wheel.
Vector Construction {#s2b}
-------------------
For mouse moloney retrovirus (MMLV) -mediated expression of DCX, the cDNA of the murine DCX (oligos \# 796, \# 795; [Table 1](#pone-0062693-t001){ref-type="table"}) was tagged with FLAG (3x) and cloned into CAG-IRES-GFP [@pone.0062693-Jagasia1] or CAG-IRES-RFP to generate CAG-DCX-3xFLAG-IRES-GFP or CAG-DCX-3xFLAG-IRES-RFP. The CAG-RFP retrovirus has been described previously [@pone.0062693-Jagasia1], [@pone.0062693-Zhao1]. pcDNA^TM^6.2-GW/EmGFP-miR from Invitrogen was filled with a linker (\# 1015, \# 1016) to generate two BsmBI restriction sites and restriction sites (BglII, AvrII, XhoI, MfeI, HindIII) unique in the CAG-vectors. The generated vector was named pcDNA6.2-GW-EmGFP-filled. EmGFP-miR-flanking cassette was PCR amplified (\# 1025, \# 1027) from pcDNA6.2-GW-EmGFP-filled and cloned into pKSSP (pBluescript KS modified with a SfiI site near the KpnI site and a PmeI site next to the SacII site; from Fred Gage, Salk Institute, La Jolla, USA) to generate pKSSP-EmGFP-miR. Three different miRNAs against DCX were constructed using BLOCK-iT™ RNAi Express from Invitrogen miDCX(1) (\# 1072, \# 1073), miDCX(2) (\# 1074, \# 1075) and miDCX(3) (\# 1076, \# 1077) and cloned into BsmBI sites of pKSSP-EmGFP-miR to generate pKSSP-EmGFP-miDCX. EmGFP-miDCX was subcloned into CAG-GFP by replacing GFP to generate CAG-EmGFP-miDCX. For construction of the internal control vector CAG-RFP-miCtr-IRES-RFP, EmGFP was replaced in pcDNA6.2-GW-EmGFP-filled by PCR amplified (\# 1220, \# 1221) RFP from CAG-RFP. RFP-miR-flanking cassette was PCR amplified (\# 1222, \# 1027) from pcDNA6.2-GW-RFP-filled and cloned into pKSSP to generate pKSSP-RFP-miR. As a control miRNA, the sequence (\# 1170, \# 1171) of pcDNA™6.2-GW/miR-neg control plasmid from Invitrogen was used and cloned into pKSSP-RFP-miR to generate pKSSP-RFP-miCtr. RFP-miCtr was subcloned into CAG-IRES-RFP to generate CAG-RFP-miCtr-IRES-RFP.
10.1371/journal.pone.0062693.t001
###### Oligos used in this study.
{#pone-0062693-t001-1}
oligo name \# sequence 5′ --3′
------------------ ------ ------------------------------------------------------------------
DCX+1-for 796 GGGGCCGCCTGGGCCATGGAACTTGATTTTGGACA
DCX+1098-rev 795 GGGAATTCCATGGAATCGCCAAGTGA
miR_linker_for 1015 TGCTAGAGACGAGATCTCCTAGGCTCGAGCAATTGAAGCTTCGTCTCA
miR_linker_rev 1016 CCTGTGAGACGAAGCTTCAATTGCTCGAGCCTAGGAGATCTCGTCTCT
EmGFPmiRNA-for 1025 CAGGGCCGCCTCGGCCAATGGTGAGCAAGGGCGAGGAGCTG
miRNA-rev 1027 GTAGTTTAAACGGCCATTTGTTCCATGTGAGTGCT
miDCX(1)-for 1072 TGCTGATTACTTAATGCCTGCAAGGTGTTTTGGCCACTGACTGACACCTTGCACATTAAGTAAT
miDCX(1)-rev 1073 CCTGATTACTTAATGTGCAAGGTGTCAGTCAGTGGCCAAAACACCTTGCAGGCATTAAGTAATC
miDCX(2)-for 1074 TGCTGTGGAGTAGCACACTTTGAAGTGTTTTGGCCACTGACTGACACTTCAAAGTGCTACTCCA
miDCX(2)-rev 1075 CCTGTGGAGTAGCACTTTGAAGTGTCAGTCAGTGGCCAAAACACTTCAAAGTGTGCTACTCCAC
miDCX(3)-for 1076 TGCTGATTTCTAGATGCTTTGTCTCGGTTTTGGCCACTGACTGACCGAGACAACATCTAGAAAT | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
Opioid overdose deaths continue to increase in the United States, killing more than 42,000 people in 2016. The opioids detected in these cases, in increasing order, were methadone, natural and semi-synthetic opioids (e.g., oxycodone, hydrocodone), heroin and synthetic opioids (e.g., fentanyl, fentanyl-analogs). Synthetic opioids (excluding methadone) and heroin deaths specifically experienced a sharp increase from 2015 to 2016 (20 and 100%, respectively) (Seth et al., [@B102]). Fentanyl and its derivatives have been increasingly present as adulterants mainly in heroin, but also in other drugs such as cocaine and synthetic cannabinoids (Coopman and Cordonnier, [@B18]; Armenian et al., [@B5]), due to their ease of manufacturing and readily available precursors shipped from China (Armenian et al., [@B5]). In addition to being present in other drugs supply, fentanyl analogs have been also marketed as "research chemicals" and can easily be acquired over the internet. Due to their high potency and the increased use of heroin as an initiating opioid of abuse (8.7% in 2005 vs. 33.3% users in 2015) (Cicero et al., [@B17]; O\'Donnell et al., [@B78]), the number of opioid-related deaths have drastically increased in the recent years. Given that opioid novices have limited tolerance to opioids, a slight imprecision in dosing inherent in heroin use and/or the presence of potent fentanyl and analogs, can be fatal.
Fentanyl, its analogs (e.g., acetyl fentanyl, 3-methylfentanyl, alphamethylfentanyl, furanyl fentanyl) and the new generation synthetic opioids (e.g., AH-7921, U-47700, MT-45) have a chemical core structure totally different from morphine, a naturally occurring opioid from *Papaver somniferum* and reference compound of the opioids group; but all of them act on the opioid receptor (mu-receptor) reducing the intensity of pain and showing a high addiction potential. These opioid receptor agonists also induce dose-dependent respiratory depression (Pattinson, [@B87]), which is the main reason for their life-threatening risk (Ujváry et al., [@B112]). Fentanyl is approximately 200 times more potent than morphine, and the potencies of its analogs are variable, from 7 times more potent than morphine for butyrfentanyl and furanyl fentanyl, to more than 4,000 and 10,000 times for sufentanil and carfentanil, respectively (UNODC, [@B113]). The new generation opioids AH-7921 and MT-45 show similar potency to morphine (Brittain et al., [@B9]; EMCDDA, [@B30]), and U-47700 about 7.5 times more potent (Cheney et al., [@B15]).
Synthetic opioids are widely regulated by the United States Controlled Substances Act of 1970 (CSA) in order to control their use and distribution. As new compounds arise and threaten public safety, compounds can be emergency scheduled by the DEA to slow production and use of these harmful substances and aid in prosecution of drug diverters for a temporary period until the formal procedures have gone through (US Drug Enforcement Administration, [@B114]). Substances are classified into schedules in the CSA based on their safety, medicinal use and potential for abuse. A Schedule I substance is classified as having no currently accepted medical use and a high abuse potential. Examples of synthetic opioids in Schedule I include furanyl fentanyl, U-47700, acetyl fentanyl and 3-methyl fentanyl. Schedule II classified opioids have a high potential for abuse but have current medicinal uses like fentanyl which is used as an anesthetic and analgesic, as well as carfentanil, remifentanil and sufentanil (US Drug Enforcement Administration, [@B114]). Most recently, the DEA issued a temporary scheduling order for all fentanyl --related substances (to include all analog modifications) in February of 2018, which cover all substances that were not already classified into Schedule I of the CSA in an aggressive attempt to regulate the manufacture and subsequent trafficking of new synthetic opioids into the United States (Drug Enforcement Administration, [@B24]).
The expansion of these new synthetic opioids constitutes an important challenge in forensic toxicology. First of all, most of these substances are not detected in the routine screening and confirmation methods in the laboratory. Also, due to the low doses employed of these highly potent drugs, the concentrations expected in the biological samples are in the low ng to pg/mL or ng to pg/g range, requiring extremely sensitive methods of analysis. Recently, Marchei et al. ([@B62]) and Liu et al. ([@B59]) reviewed the currently available screening and confirmation methods of new synthetic opioids in biological and non-biological samples. As indicated by Marchei et al. ([@B62]), gas chromatography combined with mass spectrometry (GC-MS) and more frequently liquid chromatography tandem mass spectrometry (LC-MSMS) are the most common techniques due to their sensitivity and specificity. However, given the continued development of new derivatives, the major disadvantage of these target techniques, which employ quadrupole mass spectrometers, is that are limited by the reference standards available. High resolution mass spectrometry (time-of-flight, orbitrap) offers potential advantages to identify unknown compounds without the availability of a reference standard, but this technology is not readily available in most forensic laboratories (Marchei et al., [@B62]).
Regarding biological samples, most of these methods have been developed in blood or urine, and the target analytes are the parent compounds and rarely the metabolites (Marchei et al., [@B62]). In postmortem toxicology, other biological specimens such as vitreous humor, liver and brain are commonly analyzed. Unfortunately, fully validated methods for the determination of synthetic opioids in these specimens are lacking in the literature. This is in part due to the constant changes in illicit synthetic opioids being identified and laboratories being unable to justify the extensive time and cost associated with fully validating a method for a drug that may only be present in cases for a short time. Analytical methods in forensic toxicology are commonly validated in the corresponding biological sample following the guidelines published by the Scientific Working Group in Forensic Toxicology (SWGTOX) (Scientific Working Group for Forensic Toxicology, [@B100]) to guarantee the analytical quality of the measured concentrations. The analysis of metabolites in the different biological matrices may improve the interpretation of the results, extending the detection window and indicating if it was an acute or a delayed-death evaluating the metabolite-to-parent ratios. Recent publications about the identification of new metabolites of the synthetic opioids are available (Wohlfarth et al., [@B121]; Steuer et al., [@B108]; Watanabe et al., [@B119]; Krotulski et al., [@B56]); however, its application to authentic samples is still scarce (Poklis et al., [@B93]; Staeheli et al., [@B106]; Martucci et al., [@B65]; Allibe et al., [@B2]).
Besides the analytical challenges associated with synthetic opioids, due to the scarcity of available postmortem data, the interpretation of the results is extremely difficult. Conducting postmortem toxicology interpretation provides a number of very significant challenges to the forensic toxicologist. The range of postmortem specimens (blood, urine, vitreous humor, tissues, hair), the lack of reference databases, the presence of other substances (e.g., benzodiazepines, alcohol), opioid tolerance, and postmortem phenomena (postmortem redistribution and drug instability) complicates the interpretation of the analytical findings. Pichini et al. ([@B90]) and Zawilska ([@B123]) discussed non-fatal and lethal intoxications involving the new synthetic opioids, and Drummer ([@B25]) focused his review on fatalities due to these compounds.
The present review is focused on fentanyl derivatives and new generation opioids due to the limited knowledge concerning these substances and their high prevalence in opioid-overdose related cases. This work complements the previously published literature reviewing the current knowledge of postmortem toxicology of synthetic opioids and the chemical and pharmacological factors that may affect drug concentrations in the different matrices and therefore, their interpretation in postmortem samples. These factors include key chemical properties, essential pharmacokinetics parameters, postmortem redistribution and stability data in postmortem samples. All of these data are critically compared to postmortem data of natural opioids (morphine), semi-synthetic (oxycodone, hydrocodone, hydromorphone, and oxymorphone), and synthetic opioids (methadone and buprenorphine). The interpretation of drug intoxication in death investigation is based on the available published literature. This review serves to facilitate the evaluation of cases where synthetic opioids may be implicated in a fatality through the review of peer reviewed published case reports and research articles.
Methods {#s2}
=======
PubMed, Scopus and Google Scholar were searched for appropriate articles. Forensic case-reports and research articles of natural, semi-synthetic and synthetic opioids were reviewed up to May 2018. All articles were manually reviewed for content and references in each manuscript were further queried. Included articles were limited to peer-reviewed journals indexed by the Institute for Scientific Information (ISI) and published in English. Chemical properties were retrieved from the public databases PubChem (<https://pubchem.ncbi.nlm.nih.gov/>) and DrugBank (<https://www. | {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
Localized surface plasmon resonance (LSPR) biosensing is a label-free technique that enables biomolecule detection with nanoscale spatial resolution. Since its introduction, the technique has found a broad range of applications including studies of DNA-protein interactions \[[@CR1]\], toxins \[[@CR2]\], proteins \[[@CR3], [@CR4]\], and vesicles \[[@CR5]\]. The small size of the individual sensors, typically 40 to 150 nm in diameter, has the potential to enable sensor miniaturization to a scale unapproachable by the closely related planar technique of surface plasmon resonance (SPR) biosensing. Also unique to LSPR is that the nanoplasmonic resonance condition is satisfied in a simple reflected or transmitted light geometry, common to both microscopy and spectroscopy applications, whereas SPR excitation requires incident light that is totally internally reflected. As a result, LSPR spectroscopy and imaging (LSPRi) are increasingly being integrated into live-cell microscopy experiments for the detection of secreted proteins while simultaneously imaging the cells with more traditional techniques such as fluorescence and bright field \[[@CR6]--[@CR9]\].
Continued progress in the field of nanoplasmonic biosensing is highly dependent upon meeting two design challenges related to surface functionalization. First, the reduced sensor area limits the number of conjugated ligands, making orientation critical for maximizing the probability of analyte capture. The most common ligands in biosensing are full antibodies, surface conjugated via their lysine residues or N-terminal amino groups. The typical antibody will have 60--80 of such residues resulting in a range of surface orientations, many of which are not optimal for analyte detection \[[@CR10]\]. Second, experimental evidence and theoretical models show the nanostructures can exhibit a wide range of electromagnetic field decay lengths into the solution with some as short as 5 to 15 nm \[[@CR11], [@CR12]\]. Such nanoscale distances are largely filled when using intact IgG antibodies that have typical dimensions of 14.5 nm × 8.5 nm × 4.0 nm \[[@CR13]\]. As a result, LSPR optimization requires at a minimum highly oriented full antibodies as ligands \[[@CR14]\] and preferably lower molecular weight molecules which can be modified to enhance preferential orientation.
There are a number of classes of biomolecules which have been engineered with the goal of meeting these criteria including single chain antibodies (ScFvs), Fab fragments, and aptamers. Orientated ScFvs, which are roughly one fifth the size of full antibodies, were recently shown to enhance LSPR sensitivity relative to whole antibody counterparts \[[@CR15]\]. In general, however, attempts to orient ScFvs and Fab fragments for improved biosensor sensitivity have produced decidedly mixed results \[[@CR16]--[@CR22], [@CR10]\]. In addition, ScFvs and Fab fragments with molecular weights of approximately 27 and 50 kDa, respectively, are still relatively large ligands for many LSPR biosensing applications, leaving room for improved sensitivity if the size can be further reduced.
Single domain antibodies (sdAb), also called nanobodies, are the recombinant variable domain derived from heavy chain-only antibodies found in camelids, i.e., camels, llamas, and alpacas. Consisting of only a single domain endows sdAb with a number of attractive properties for biosensor applications. First, their small size (∼ 15 kDa or ∼ 1/10 the size of a full IgG) allows for facile production in yeast or bacteria, alone or as fusions with effector proteins. Second, both their small size and being a single domain provides them with remarkable thermostability, being able to refold and recover their binding ability following heat or chemical denaturation. Finally, sdAb are derived from true antibodies; thus, they possess the high affinity and specificity for which antibodies are renowned. SdAb, which recognize a plethora of targets, have been developed, and orientated sdAb have recently been demonstrated to improve SPR biosensor sensitivity \[[@CR23], [@CR24]\]. Our primary focus has been on the development of robust reagents for the detection of bio-threat agents \[[@CR25], [@CR26]\]. Of those reagents, the sdAb which bind ricin have been the most studied, and thus make well defined tools for testing the utility of sdAb in novel sensor applications \[[@CR27], [@CR28]\].
Here, we compare the sensitivity of LSPRi for orientated versus randomly surface-conjugated sdAb. Using anti-ricin sdAb, we first demonstrate the ability to modify the carboxyl terminus with positively charged peptide tails and rhizavidin fusion proteins for preferential surface orientation. The positively charged tail was designed to aid in surface orientation by means of an electrostatic interaction with a negatively charged surface. The rhizavidin fusion construct was designed to assist in orientation by binding to a biotinylated surface, preferentially directing the sdAb into the solution. Using SPR imaging (SPRi), we show that these modified sdAb have enhanced surface conjugation efficiencies and improved sensitivity to ricin relative to the non-orientated sdAb. We then measured the sdAb sensitivity to ricin on an LSPRi platform and compared the results to the biotin-neutravidin binding pair, a commonly used standard for biosensing applications and an apt comparison since biotin is readily orientated and ricin and neutravidin have similar molecular weights \[[@CR3], [@CR29]\]. Despite the fact that the sdAb ligands were 62-fold greater in mass than biotin, the measured sensitivities were statistically equivalent. We conclude that the relatively small size and the ability to readily modify sdAb for orientated surface conjugation make them optimal ligand candidates for LSPR imaging and spectroscopy applications. The current sensitivity study lays the groundwork for future work in determining the LSPRi limit of detection of each construct and multiplexed toxin-sensing applications.
Experimental {#Sec2}
============
The sequence and binding characteristics of the ricin-binding sdAb C8 and D12 have been previously described \[[@CR27], [@CR28]\]; both have sub-nM affinity for the toxin ricin. The clone D12f is a version of D12 in which an unpaired cysteine was mutated to a serine causing no change in sdAb affinity. The C8 sdAb, lacking the upper hinge region, was cloned into pET22b for protein expression. Protein was purified using immobilized metal affinity chromatography followed by size exclusion chromatography on an FPLC as previously described \[[@CR26], [@CR30]\]. Protein sequences of all sdAb constructs are detailed in the [Supplementary Material](#Sec5){ref-type="sec"}.
The construct referred to herein as C8-zip is a genetic fusion of the C8 sdAb with a positively charged leucine zipper described by Oshea et al. \[[@CR31]\]. DNA including a glycine-serine linker followed by the zipper sequences was synthesized by GenScript (Piscataway, NJ) and included flanking Not I and Xho I restriction endonuclease sites. We cloned the linker-zipper sequence into pET22b and then mobilized the C8 sdAb into the modified pET22b through the Nco I and Not I sites; DNA sequencing was used to confirm the constructs. Protein was produced from the periplasmic space in a protocol identical to that used to purify C8. This C8-Zip construct had initially been prepared to facilitate sdAb heterodimer formation \[[@CR32]\].
The D12f-rhiz construct is a genetic fusion of the D12f sdAb with the biotin binding protein rhizavidin (rhiz). Unlike our previously described sdAb-rhiz fusion construct, the D12f-rhiz does not include the upper hinge sequence between the D12f and rhiz. Protein production was as described for our previous sdAb-rhiz fusions \[[@CR33]\].
Details of the LSPR chip fabrication and the LSPRi measurement setup have been published previously \[[@CR34], [@CR29]\]. In short, square arrays of gold nanostructures were patterned on No. 1.5 glass coverslips using electron-beam nanolithography (Raith GmbH) to expose a bilayer resist structure consisting of polymethyl methacrylate and ethyl lactate methyl methacrylate copolymer purchased from Microchem Corp. Each array measured 6 μm × 6 μm and consisted of 400 evenly spaced nanostructures separated by a pitch of 300 nm. The bases of the nanostructures were circular in cross section with diameters of 70 ± 5 nm and the heights were 75 ± 2 nm, giving a plasmonic resonance peak centered at ∼ 635 nm in 10 mM phosphate buffered saline (Thermo Scientific). Protein binding to the Au surface creates a perturbation in the local index of refraction which induces a redshift in the resonance peak as well as enhanced scattering. In the LSPRi measurement, this response is manifested as an increase in the nanoplasmonic array's brightness as imaged by the camera. We have shown, using analytes such as neutravidin and IgG proteins, that this response can be calibrated to the fractional occupancy of surface-bound receptors. Commercial SPRi has sensors that are orders of magnitude larger in surface area but operates on a similar physical principle. When using the same functionalization chemistries, results from the two techniques can be correlated \[[@CR8], [@CR34]\].
The chip was loaded onto a custom-built microfluidic assembly consisting of a 300-μL chamber to which the analyte solution was introduced using a peristaltic pump from Instech Laboratories (P720). All imagery was acquired using Zeiss Zen software, an inverted Zeiss Axio Observer microscope, a 40X/1.4 NA objective, and a thermoelectrically cooled 16-bit sCMOS camera from Hamamatsu (Flash 4.0) operated in 2 × 2 bin | {
"pile_set_name": "PubMed Central"
} |
The content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus.
Introduction
============
Mentorship is an essential component of professional development and its benefits are well described in the medical, business, and education literature \[[@REF1]-[@REF10]\]. Mentorship relationships are beneficial for both mentors and mentees, who experience increased career satisfaction, scholarship, and efficiency of academic promotion \[[@REF11]-[@REF12]\]. Models include one-on-one mentor-protege models \[[@REF13]\], institutional group programs \[[@REF14]-[@REF15]\], and "speed-mentoring" sessions with many mentors in serial succession \[[@REF16]\].
Recently, a collaborative, network-based model for mentorship has gained popularity in the business world: the Mastermind group \[[@REF17]-[@REF20]\]. Initially described by Napoleon Hill \[[@REF21]\], the Mastermind group is composed of multiple colleagues, including near-peers and those at different stages of their academic careers, who provide mentorship and career advice for each other through regularly scheduled meetings. The group benefits from the combined intelligence and accumulated experience of the participants.
Advances in technology now mean that the world can literally be right at our fingertips. Geographic bounding of the mentor-mentee relationship is no longer necessary \[[@REF22]\]. In fact, for effective mentorship through Mastermind Groups, it may be advantageous to connect academic physicians from different centers in mentorship opportunities, since these relationships may be less influenced by personal gains and local politics.
We describe the curriculum design, implementation, and program evaluation of a Mastermind group for the purpose of professional development of academic emergency physicians. Our outcome measures reflect participant experience, impact, and feasibility of the program.
Materials and methods
=====================
Participants
Academic Life in Emergency Medicine (ALiEM; [www.aliem.com](www.aliem.com)) conducted two Mastermind group sessions in 2017 for volunteer faculty within the organization. ALiEM is a digital health professions education organization with a globally distributed team of faculty who lead various online educational initiatives. The Mastermind group was intended as a career development exercise for the volunteer faculty in the organization. Participants were recruited from within ALiEM via the organizational Slack Channel (Slack Technologies Inc, San Francisco, CA) through a general message to all volunteer faculty at ALiEM, asking for voluntary participation in this faculty development session. Only voluntary faculty within the ALiEM organization were included and there were no exclusion criteria. Groups were limited to 6-8 participants to facilitate small group discussion. Based on the number of recruited participants, two separate groups were formed. One group held its meetings in January of 2017 and the second group met in October of 2017. Because of the innate geographic diversity of volunteer faculty within the ALiEM team, each group was formed of physicians from varying locations across the United States and Canada. While the volunteer faculty at ALiEM come from different specialties and health professions, all of the volunteers for this faculty development program were Emergency Medicine physicians. Demographics of the group are described in Table [1](#TAB1){ref-type="table"}.
###### Participant Demographics
-------------------------- ------------------------- ------------------------------- ------------------------------ -----------------------------------------------
Participant Demographics
Sex Female 57% (n=8) Male 43% (n=6)
Academic Rank Instructor 14% (n=2) Assistant Professor 65% (n=9) Associate Professor 7% (n=1) Full Professor 14% (n=2)
Geographic Location US West Coast 29% (n=4) US Midwest 36% (n=5) US East Coast 14% (n=2) Canada 21% (n=3)
-------------------------- ------------------------- ------------------------------- ------------------------------ -----------------------------------------------
Procedures of the Mastermind group
Each Mastermind group completed two homework assignments and two 90-minute videoconference meetings, using a structured, moderator-facilitated format. Meetings were conducted using participants' personal computers on Google Hangouts on Air© (Google Inc., Mountain View, CA). As pre-work, participants completed selected questions from a free self-assessment tool created as supplementary, online material for \"Stand Out\", a book authored by Dorie Clark, adjunct professor at Duke University's Fuqua School of Business and proponent of the Mastermind group model \[[@REF23]-[@REF24]\]. The self-assessment survey summarized participants professional strengths, weaknesses and current career trajectory. Example questions can be found in Figure [1](#FIG1){ref-type="fig"}. Given 6-8 participants per group and the selected questions for each participant to discuss, 90 minutes was thought to be the optimal length of time per session.
{#FIG1}
In the initial group meeting, the moderator encouraged participants to discuss their self-assessments, current projects, and career challenges. The moderator then facilitated comments from all of the other participants and kept track of time so that all participants could discuss their self-assessments during the 90-minute session. Prior to the second meeting, participants each contributed to a shared, digital document (Google Docs©, Google Inc.) with their suggestions for professional development resources personalized for each of the other participants in the group. The second meeting allowed discussion of these suggested resources, actionable 'next steps', and an accountability timeline for each participant. The free, cloud-based platforms and voluntary basis for the Mastermind groups resulted in a zero-cost innovation.
{#FIG2}
Data collection
In addition to collecting the Mastermind group session notes compiled by the facilitator and participants through the shared, digital document, we also surveyed the participants via anonymous online survey software (SurveyMonkey, San Mateo, CA) to understand participant reactions and obtain program evaluation information.
The post-intervention survey of this program was administered to participants. This survey consisted of three phases: demographic data, participant reactions to the experience, and perceived value. Respondents were asked to rate their Mastermind Group experiences using a Likert Scale ranging from 1 (not valuable, would not recommend to others) to 10 (very valuable, would highly recommend this to others). They were also asked to compare these sessions to prior mentorship experiences using a comparison scale (better than, same as, worse than other mentorship experiences). Finally, qualitative data was gathered about the participants' experiences via a required free-text box. See Appendix 1 for a listing of all the questions.
Analysis
We describe the demographic composition of the groups, themes discovered in the Mastermind shared digital document notes compiled by the facilitator and participants, and we perform descriptive statistics on our program evaluation survey data.
Results
=======
Participant demographics
The two groups included two full professors, one associate professor, nine assistant professors, and two instructors, representing 14 different academic medical centers across North America. 57% of participants were female (n=8), and 43% were male (n=6). Compiled summary data of the groups is provided in Table [1](#TAB1){ref-type="table"}.
Description of themes from the Mastermind session notes
A majority of participants received specific resource recommendations during the sessions, including readings (e.g., books, journal articles, blog posts), training courses, or conferences. Many also received introductory email referrals to specific individuals for additional mentorship. This was made possible given the breadth of networks among the participants. All participants had at least one identifiable 'next step' related to their reason for participating in the Mastermind group with the goal of being accountable to the group.
Survey results
A post-intervention survey was sent to a convenience sample comprised of the 14 participants, with a final response rate of 100%. The participants rated the Mastermind group experience as 9.4/10 on the Likert scale. When asked to compare Mastermind groups with prior mentorship experiences, 3/14 (21.4%) respondents noted that this was not applicable as this was their first formal mentorship experience, while the remainder of the participants, 11/14 (78.6%) rated these sessions as "much better than prior experiences", 10/10 on a Likert scale. Participants cited one of two reasons for participating in the Mastermind groups: need for career advice or assistance with a project. Overall, the participants described a synergy of energy, commitment to one another's longitudinal success, and benefit from the diverse range of talent and expertise in the group as reasons for preferring this model to other models of | {
"pile_set_name": "PubMed Central"
} |
Introduction {#sec1}
============
In the United States, the prevalence of hip and knee osteoarthritis has increased substantially over the last 20 years and is the greatest cause of chronic disability in older adults [@bib1], [@bib2]. Although there are measures to slow the progression of the disease, elective total joint arthroplasty (TJA) is the recommended treatment after non-surgical measures have failed [@bib3], [@bib4]. TJA is a major surgical procedure, and recovery time can vary between patients with the most improvement in health-related quality of life quantified by the Quality of Wellbeing Index between 3 and 6 months postoperatively [@bib5]. Physical therapists play an important role in treating patients before and after TJA [@bib6]. The main goals of rehabilitation post-TJA are to maximize functional independence and to minimize complications [@bib7].
There are 2 common ways of assessing outcomes after TJA: the patient\'s assessment of his/her own function (patient-reported outcome measures or PROMs) and observed physical performance (performance-based outcome measures or PBOMs). Common PROMs include the Knee Injury and Osteoarthritis Outcome Score (KOOS), Hip Injury and Osteoarthritis Outcome Score (HOOS), and the Lower Extremity Function Scale (LEFS) [@bib8], [@bib9]. Examples of PBOMs include the Timed Up and Go (TUG), 6-Minute Walk Test, and the Stair Climbing Test [@bib10], [@bib11]. Currently, there is no absolute consensus in the literature on the appropriate PROMs and PBOMs following total hip or knee arthroplasty (THA or TKA) [@bib12], [@bib13], [@bib14]. However, the American Joint Replacement Registry (AJRR) 2016 guide recommends collection of PROMs including Veterans RAND 12 Item Health Survey or Patient Reported Outcome Measure Information System Global and HOOS or KOOS Jr [@bib15]. Also in a recent American Academy of Hip and Knee Surgeon symposium, the HOOS Jr and KOOS Jr were recommended for quality assessment in TJA [@bib16].
Both PROMs and PBOMs are useful and provide different clinical data. PROMs do not require a clinical visit, and therefore might be easier to collect than PBOMs especially when following a large number of patients [@bib17]. To utilize a more patient centered approach to medicine, the Center for Medicaid and Medicare Services has recently highly valued the use of PROMs based on goals stated by the National Quality Strategy and Institute of Medicine due to the Affordable Care Act [@bib18], [@bib19]. PROMs provide useful information about patients\' perceptions of physical function but are highly influenced by pain [@bib20]. However, patient perception may not correlate well with actual functional performance and may overstate functional improvement especially in the early postoperative period [@bib10], [@bib11]. PBOMs on the other hand can be harder to collect, but may provide important objective information about functional performance and progress through rehabilitation [@bib11], [@bib20]. Recent studies have recommended the use of both PROMs and PBOMs for evaluating patient progress after THA/TKA [@bib10]. McAuley et al [@bib21] found that physical therapists use a wide range of outcome measures when evaluating THA and TKA patients in Canada.
The aim of this study is to assess current and anticipated use of PROMs and PBOMs of physical therapists practicing in New England. There is very little known about outcome measures that therapists use pre-TJA and post-TJA. This information is important because orthopaedic surgeons and physical therapists work toward the same goal of optimizing patient recovery. The motivation for this study is to establish a foundation of current practice from which to develop standardized sets of outcome measures for orthopaedic surgeons and physical therapists to collect pre-TJA and post-TJA.
Material and methods {#sec2}
====================
The study was cross-sectional in design. It was executed as an online questionnaire requiring 10-15 minutes to complete distributed via email to licensed physical therapists practicing in New England (Maine, Vermont, New Hampshire, Massachusetts, Rhode Island, and Connecticut). A cover letter of instructions was developed, and reminder emails were sent 12, 21, and 36 days after the initial correspondence on July 15, 2015. Physical therapists who treated patients undergoing THA and/or TKA in the last 5 years were invited to complete the survey and those who had not were asked to decline. The online survey platform LimeSurvey was used and anonymity was ensured by assigning each response a random numeric code. The study was approved by the Committee on Human Subjects.
The survey had 4 sections consisting of a modified version of the survey developed by McAuley et al [@bib21] obtained with permission from the lead author. The first section documented location of practice, education background, and demographic characteristics of the therapist. The second and third sections evaluated the use of PROMs and PBOMs ([Table 1](#tbl1){ref-type="table"}). These measures were queried specifically in terms of clinical decision making (day-to-day thinking and reasoning that clinicians execute to plan, administer, modify, and evaluate a therapeutic intervention for a given patient after THA or TKA). These specific PROMs and PBOMs were chosen based on the work of McAuley et al and the Osteoarthritis Research Society International (OARSI) advisory group recommendations [@bib21], [@bib22]. Responders were asked to rate their current use of each measure on a 4-point scale (0 = not familiar, 1 = familiar no experience, 2 = some experience, 3 = considerable experience). The third section asked about anticipated future use of specific measures using a modified scale (0 = unable to rate, 1 = unlikely to use, 2 = likely to use, 3 = will use and recommend) ([Fig. 1](#fig1){ref-type="fig"}). The fourth section asked for their opinions about most valuable measures outright, other modalities used, and number of postoperative treatment sessions patient receive.Figure 1Example from Section 2 of questionnaire. ^∗^*P* \< .05.Table 1Outcome measures used in cross-sectional survey of New England physical therapists.PROMsPBOMsNumeric Pain Rating ScaleSit to Stand TestLEFSWalking SpeedOKS6-Minute walk testOHSTUGEQ-5DTimed Stair ClimbKOOSTinetti Mobility TestHOOSSingle Leg BalanceWOMACFunctional Reach Test[^1]
Initially, the survey was sent to 14 physical therapists in various practices throughout New England for feedback on language clarity and organization. Based on their comments the survey was modified.
Data were exported into an Excel spreadsheet and converted into SPSS. Analyses of responses were reported in frequencies and percentages and visualized with graphs for comparison ([Figs. 2](#fig2){ref-type="fig"} and [3](#fig3){ref-type="fig"}). Following the approach used by McAuley et al [@bib21] variables were dichotomized from the ordinal 4-point scales to used/familiar (3, 2) and not used/unfamiliar (1, 0). Paired sample t-tests were used to compare the use of each outcome measure for current and future use. Significance was set at *P* \< .05.Figure 2Comparison of responders\' current and future use of PROMs (a) and PBOMs (b) for clinical decision making (t-test, *P* \< .05). ^∗^*P* \< .05. EQ-5D, Euro-Quality of Life; OHS, Oxford Hip Score; OKS, Oxford Knee Score; WOMAC, Western Ontario and McMaster Universities Osteoarthritis Index.Figure 3Physical therapists\' overall rating of most valuable PROMs (a) and PBOMs (b). EQ-5D, Euro-Quality of Life; OHS, Oxford Hip Score; OKS, Oxford Knee Score; WOMAC, Western Ontario and McMaster Universities Osteoarthritis Index.
Results {#sec3}
=======
Seven hundred twenty-four emails were sent. Of the 724 emails, 95 failed to be transmitted. Therefore 629 surveys were successfully sent. Of those, 168 responses were received, and of those, 19 responses were not interested in completing the survey and 27 of them did not treat patients who had undergone TJA. Therefore, this produced 122 complete responses.
[Table 2](#tbl2){ref-type="table"} shows the demographic data of the physical therapists who completed the survey ([Table 2](#tbl2){ref-type="table"}). Physical therapists reported treating patients on average for 13.5 ± 0.5 sessions post-TKA and 11.2 ± 0.4 sessions post-THA.Table 2Demographics of responding physical therapists in percentages.Population setting Rural21.3 Mixed62.3 Urban16.4Years since graduation (y) \<513.4 5-912.3 10-1417.2 15-1913.9 20-249.8 \>2532.8Working status Full time88.5 Part time8.2 Per diem4.9Clinical setting Private practice clinic53.3 Private practice clinic associated with large organization10.7 Home/community care (eg, VNA)15.6 Outpatient clinic associated with academic hospital/medical center18.0 Inpatient acute care hospital5.7 Non-hospital inpatient rehabilitation facility2.5 Other8. | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#s0005}
===============
Gastrointestinal parasites account for huge losses experienced by the livestock industry worldwide ([@bb0165]). While presently the major way of control and treatment of these gastrointestinal parasites depends profoundly on the utilization of conventional anthelmintics, there are challenges associated with the use of these synthetic anthelmintics ([@bb0020]; [@bb0075]). The challenges include unavailability and inconsistent supply; high cost to resource-limited farmers, environmental pollution and the build-up of residues in animal products ([@bb0065]). The rapidly increasing resistance to anthelmintics may perhaps be as a result of the increased rate of dosing, under-dosing, prophylactic mass treatments and repeated chronic use of the same anthelmintic drugs ([@bb0135]). Regular use of these anthelmintics has also led to poor development of natural immunity against gastrointestinal parasites ([@bb0080]).
One practical way of developing cheaper and effective anthelmintics is to explore potential indigenous herbal remedies used as anthelmintics ([@bb0145]). Plant-derived anthelmintics is a promising area of research in trying to mitigate the challenges around the use of synthetic anthelmintic drugs in controlling gastrointestinal parasites. Alternative ethnoveterinary medicines, for example, plant extracts with anthelmintic properties are considered to be of immense potential in overcoming anthelmintic resistance ([@bb0090]). There have been many reports, mainly from Africa and Asia have indicated the effectiveness of medicinal plants against helminth infections in livestock ([@bb0005]; [@bb0025]). Hence, there is a need to investigate the potential active compounds from these plants.
Worldwide research has shown that some plants can be utilized to diminish the level of parasitism in livestock; thus are considered alternative options to the conventional chemical anthelmintics ([@bb0030]). *Elephantorrhiza elephantina* is a medicinal plant commonly utilized in ethnoveterinary medicine. Root decoctions infusions of *E*. *elephantina* are used to control gastrointestinal worms ([@bb0160]; [@bb0015]; [@bb0105]). The anthelmintic effects of this plant are due to the activity of secondary metabolites, such as tannins, alkaloids, saponins and glycosides ([@bb0125]; [@bb0025]; [@bb0040]). Phytochemicals are beneficial in the treatment of diseases and control of parasites that nourish on the walls of the gastrointestinal tract ([@bb0110]). Plants produce them as a defense mechanism. Research demonstrates the ability of these phytochemicals to protect humans and animals against infections ([@bb0085]).
However, reports on the phytochemical analysis of crude extracts from *E*. *elephantina* are limited. This study sought to quantify the phytochemical constituents of *E*. *elephantina* in ethanol, methanol and water extracts of the root. Furthermore, the study evaluated the *in vitro* anthelmintic potential of *E*. *elephantina* root extracts against adult *Paramphistomum cervi* in goats.
2. Materials and methodology {#s0010}
============================
2.1. Plant collection {#s0015}
---------------------
Roots of *E*. *elephantina* were collected from a characteristic populace in Mt. Frere, Alfred Nzo District Municipality, Eastern Cape, South Africa. Mt. Frere lies along latitude 30°55′0″ S and longitude 28°58′60″ E. Immediately after harvesting, the roots were rinsed in distilled water and air-dried in the shade for 10 weeks and after that were ground into powder using a grinder with 1 mm pore size sieve (IKA- Universal Mill M20, Laboratory and Scientific Equipment Co. Pty. Ltd). The root powder was kept in airtight containers at 4 °C until further analyses.
2.2. Extraction procedure {#s0020}
-------------------------
Three samples of 20 g of *E*. *elephantina* root powder were soaked in 200 mL each of ethanol, methanol, and distilled water. The mixtures were left on an orbital shaker for 24 h and then filtered under pressure using a Buchner funnel and Whatman filter paper (12.5 cm; 111^v^). Then the ethanol and methanol extracts were condensed in a rotary evaporator (Laborator 4000-efficient, Heidolph, Germany) while the water extract was freeze-dried (Vir Tis benchtop K, Vir Tis Co, Gardiner, NY). The dried extracts were used for the quantitative analysis of phytochemicals. The percentage yield was calculated for each extract using the formula:$$\text{Yield}\ \left( \% \right) = \frac{\text{Final weight}}{\text{Initial weight}} \times 100$$
2.3. Quantitative determination of phytochemicals {#s0025}
-------------------------------------------------
### 2.3.1. Alkaloids {#s0030}
The gravimetric analysis for total alkaloid content was used to determine alkaloids with a few modifications ([@bb0115]). A 0.5 mL of plant extract (1 mg/mL) was combined with 100 mL of 10% acetic acid in ethanol. The mixture was covered and left standing for 4 h. Afterwards, the mixture was filtered, and the filtrate was concentrated in a water bath at 60 °C to a quarter of its initial volume. Concentrated ammonium hydroxide (25%) was added to the mixture drop-wise until the formation of a precipitate was completed. The entire mixture was left to stand, then the accumulated precipitates were rinsed with 20 mL of 0.1 M dilute ammonium hydroxide and then filtered. The collected residue was oven-dried at 80 °C and weighed. The alkaloid content was calculated using the formula:$$\text{Alkaloid}\left( \% \right) = \frac{\text{Weight of residue}}{\text{Weight of sample taken}} \times 100$$
### 2.3.2. Condensed tannins {#s0035}
Determination of total condensed tannin was performed by applying the technique described by [@bb0150] with a few modifications. A 0.5 mL of plant extract (I m/mL) was added to 3 mL of 4% vanillin-methanol. A 1.5 mL of 37% hydrochloric acid was added to the mixture, thoroughly mixed and left standing for 15 min at room temperature. The absorbance of catechin standard (0.02 to I mg/mL) solution and plant extracts were recorded at 500 nm using the UV 3000 PC Spectrophotometer. Distilled water was used as the blank. Readings were taken in triplicates. The calibration curve was plotted using standard catechin. The readings were expressed as mg of catechin equivalent per g dry weight extract (mg CE/g).
### 2.3.3. Flavonoids {#s0040}
Flavonoid content was determined as described by [@bb0070] using the aluminium chloride colorimetric assay technique with some modifications. Briefly, 2 mL of distilled water and 0.15 mL of 5% sodium nitrite were put into a test-tube with 0.5 mL of the plant extract (1 mg/mL). The mixture was left standing for about 5--6 min at room temperature. After 6 min 0.15 mL of 10% aluminium chloride was added to the mixture and then was left standing for an additional 6 min. Afterwards, 1 mL of 4% sodium hydroxide was added to the mixture. A 1.2 mL of distilled water was poured to make up the volume of the mixture to 5 mL. The mixture was incubated for 15 min to develop colour. The absorbance was taken at 420 nm using a UV 3000 PC Spectrophotometer. Each assay was done in triplicates. The calibration curve was plotted using standard quercetin (0.2 to 1 mg/mL). The results were calculated as mg of quercetin equivalent for each g dry weight (mg QE/g).
### 2.3.4. Phenols {#s0045}
Phenol content was quantified through Folin-Ciocalteu\'s technique with a few modifications ([@bb0140]). A 2.5 mL of Folin-Ciocalteu reagent was added to 0.5 mL of each plant extract (I mg/mL) and vortexed for about 1 min. The mixture was held at room temperature for about 3--8 min. A 2.5 mL of 7.5% anhydrous sodium carbonate was then added and incubated in a water bath at 40 °C for 30 min to develop colour. Absorbance was then read at 765 nm using the UV 3000 PC Spectrophotometer. The blank was performed using distilled water. Each assay was done in triplicates. Standard gallic acid (0.02 to 1 mg/mL) was used to plot the calibration curve. The readings were expressed as mg of gallic acid equivalent for each g dry weight (mg GAE/g).
### 2.3.5. Saponins {#s0050}
The saponin content was determined following the technique of [@bb0115] with some modifications. A 20 mL of 20% ethanol was added to 0.5 mL (1 mg/mL) of the plant extract and put on a shaker for 30 min. The resulting mixture was then left in a water bath at 55 °C for 4 h. The mixture was filtered and extraction was repeated with 20 mL of 20% ethanol. The collected filtr | {
"pile_set_name": "PubMed Central"
} |
1.. Introduction {#sec1}
==================
Many recent advances in synchrotron X-ray imaging can be attributed to X-ray focusing optics (Ice *et al.*, 2011[@bb6]). These optics may operate *via* three possible principles: (i) diffraction, such as in Fresnel zone plates (Kirz, 1974[@bb10]) and multilayer Laue lenses (Kang *et al.*, 2006[@bb8]); (ii) total reflection, such as in Kirkpatrick--Baez (Kirkpatrick & Baez, 1948[@bb9]) and Wolter (Wolter, 1952[@bb27]) mirrors, and lobster-eye (Inneman *et al.*, 1999[@bb7]) and Kumakhov (Kumakhov & Komarov, 1990[@bb12]) lenses; and (iii) refraction, such as in prisms (Cederstrom *et al.*, 2000[@bb2]) and compound refractive lenses (CRLs) (Snigirev *et al.*, 1996[@bb24]). In the hard X-ray regime (*E* \> 15 keV), CRLs (linear arrays of refractive lenslets) are widely used due to their relatively low cost, ease-of-use and efficiency. Furthermore, their focal length can be actively varied by adjusting the number of lenslets (Vaughan *et al.*, 2011[@bb25]). However, the spatial resolution of CRL-based imaging systems is typically 50--100 nm (Schroer *et al.*, 2005[@bb20]), worse than that of other optics at comparable energies: 7 nm (Yamauchi *et al.*, 2011[@bb28]), 8 nm (Morgan *et al.*, 2015[@bb14]) and 20 nm (Vila-Comamala *et al.*, 2012[@bb26]) have been reported from microscopes based on mirrors, multilayer Laue lenses and Fresnel zone plates, respectively. Nonetheless, the advantages of CRLs make them uniquely suitable for *in situ* experiments where efficiency, large working distances and high X-ray energies are required. Under such circumstances, improving the spatial resolution of CRLs could facilitate new opportunities for multi-scale characterization.
One route to improving spatial resolution is by optimizing the CRL geometry (Chen *et al.*, 2014[@bb3]). Numerical optimization requires concise analytical expressions for parameters such as focal length, transmission and aberration. Furthermore, these expressions are essential for imaging techniques that involve sampling data in grids such as ptychography (Schroer *et al.*, 2008[@bb19]), scanning X-ray microscopy (Schroer *et al.*, 2005[@bb20]) or dark-field X-ray microscopy (Simons *et al.*, 2015[@bb22]). The optical theory of CRLs and CRL-based imaging systems has been addressed by various approaches such as ray-transfer matrices (RTMs) (Protopopov & Valiev, 1998[@bb17]; Pantell *et al.*, 2003[@bb15]) \[including Gaussian beam variants (Poulsen & Poulsen, 2014[@bb16])\], Monte Carlo ray tracing (Sanchez\~del Rio & Alianelli, 2012[@bb18]), wavefront propagation methods (Kohn, 2003[@bb11]) and others (Lengeler *et al.*, 1999[@bb13]). While these have greatly furthered the design and implementation of CRLs, no single formalism fulfills the core requirements for optimization: (i) simple, closed expressions, (ii) broad applicability to both condensing and full-field imaging systems, and (iii) consideration of both the thin-lens (where the focal length of the CRL far exceeds its length) and thick-lens conditions (where this approximation is no longer valid).
We present a formalism for CRL-based imaging systems utilizing an RTM approach to model archetypal X-ray imaging systems in a lens-by-lens manner, thus accounting for both thin- and thick-lens conditions. Attenuation by the lens material is calculated using RTMs to trace the ray position through the CRL. We provide exact analytical expressions for focal length, numerical aperture, spatial resolution, vignetting and chromatic aberration among other key optical parameters. These expressions form the basis of an efficient parametric optimization of the CRL and imaging geometry, which ultimately provides suggestions for future lens development routes.
2.. RTM formalism for CRLs {#sec2}
============================
2.1.. Assumed CRL and lenslet geometry {#sec2.1}
----------------------------------------
This formalism assumes a one-dimensional (1D) focusing geometry valid for both axisymmetric two-dimensional and planar 1D CRLs. The CRL is comprised of *N* identical parabolic and non-kinofirm lenslets (Fig. 1[▸](#fig1){ref-type="fig"}), each with radius of curvature *R*, aperture 2*Y* and center-to-center distance between successive lenslets *T* such that . For manufacturing reasons, lenslets have a small distance between the parabolic apices (*i.e.* a web thickness) that affects attenuation. There may also be a gap between adjacent lenslets, implying that the physical lenslet thickness is less than *T*. Such geometries limit *Y* and necessitate defining the physical aperture such that = .
2.2.. Background to the RTM approach and focusing behavior {#sec2.2}
------------------------------------------------------------
RTM analysis is a paraxial ray-tracing approach that assumes all rays propagate nearly parallel to the optical axis. It does not intrinsically consider diffraction and total reflection; however, these may be introduced *ad hoc*. The approach treats each photon as a ray with transverse position *y* and angle to the longitudinal optical axis α, within an optical system defined by a matrix (*i.e.* an RTM) that transforms an incident ray into an exit ray ,RTMs of compound systems may then be determined by multiplying the RTMs for the individual optical components. Previous RTM analyses of CRLs (Protopopov & Valiev, 1998[@bb17]; Pantell *et al.*, 2003[@bb15]; Poulsen & Poulsen, 2014[@bb16]) show that a single refractive X-ray lenslet can be described by three such components: a free-space propagation by *T*/2, a refracting thin lens with focal length *f* = (where δ is the refractive decrement) and a final free-space propagation by *T*/2. Because *f* is many times larger than *T*, each lenslet behaves like an ideal thin lens with the following transfer matrix,As the CRL is a linear array (*i.e.* a stack) of identical lenslets, its transfer matrix is = . This can be calculated through the matrix eigendecomposition theorem (Poulsen & Poulsen, 2014[@bb16]) (see §S1 of the [supporting information](http://scripts.iucr.org/cgi-bin/sendsup?ie5162) for derivation),Within this paraxial treatment, the parameter φ can be expressed as = = . Thus, is the refractive power of the CRL per unit length (Lengeler *et al.*, 1999[@bb13]) while is the critical angle for total external reflection (Schroer & Lengeler, 2005[@bb21]).
The trigonometric terms in equation (3)[](#fd3){ref-type="disp-formula"} imply periodicity with respect to . While attenuation by the lens means that CRLs practically operate within the first half-period (*i.e.* ), optical behavior differs markedly between the thin-lens limit (*i.e.* and correspondingly ) and the general thick lens case (*i.e.* all values of ). This formalism provides both cases in order to give straightforward access to the most common and important optical parameters for the vast majority of CRL geometries.
From equation (3)[](#fd3){ref-type="disp-formula"}, the focal length of the CRL as measured from its exit surface is given by the following two expressions (derived in §S2 of the [supporting information](http://scripts.iucr.org/cgi-bin/sendsup?ie5162)), which are identical to those given in the literature (Poulsen & Poulsen, 2014[@bb16]; Lengeler *et al.*, 1999[@bb13]),
2.3.. Ray transfer path {#sec2.3}
-------------------------
In order to predict the attenuation of the rays as they traverse the CRL, the RTM approach must be extended. Specifically, we require an expression for the position and angle of a given ray at the *center* of the *n*th lenslet as a function of its incident state . To this end, we compute the RTM of the CRL *after* the *n*th lenslet and back-propagate by *T*/2,Inserting from equation (3)[](#fd3){ref-type="disp-formula"} and simplifying (see §S3 of the [supporting information](http://scripts.iucr.org/cgi-bin/sendsup?ie5162)), are then Within the CRL, all rays have a sinusoidal trajectory that varies with distance *nT* with a period of . The physical aperture of the lenslets bounds this trajectory however, imposing the following criteria for participation in the focusing process,Rays may be excluded due to total reflection by the parabolic lenslet surfaces. In this case, the criteria for participation is \> . However, we note that, | {
"pile_set_name": "PubMed Central"
} |
Roy Choudhury S, Johns SM, Pandey S. A convenient, soil‐free method for the production of root nodules in soybean to study the effects of exogenous additives. Plant Direct. 2019;3:1--11. 10.1002/pld3.135
This manuscript was previously deposited as a preprint at preprints.org; <https://www.preprints.org/manuscript/201809.0527/v1> (<https://doi.org/10.20944/preprints201809.0527.v1>).
1. INTRODUCTION {#pld3135-sec-0001}
===============
Nitrogen is an essential element for plant growth, development and productivity. Improving the nitrogen availability to plants results in significant increases in crop yields. Although present in huge quantities in the atmosphere (78% of earth\'s atmosphere), this nitrogen is not available to plants, unless fixed by biological nitrogen fixation (BNF). BNF happens by the activity of specialized groups of bacteria called rhizobia, which exists as symbionts with the roots of leguminous plants in specialized structures called root nodules. Root nodule formation is a sophisticated process that requires strict synchronization of bacterial infection and growth as well as plant organogenesis and nodule development. The successful interactions between the host plant and the soil bacteria of *Rhizobium* spp. begin with the secretion of flavonoids from plant roots. In response, the rhizobia produce lipochito‐oligosaccharides, known as nodulation factors or nod factors (NFs). The secreted NF from symbiotically compatible rhizobia directly bind with and activate the nod factor receptors (NFRs) of plants, which are LysM (Lysine motif)‐containing receptor like kinases (Limpens et al., [2003](#pld3135-bib-0036){ref-type="ref"}; Madsen et al., [2003](#pld3135-bib-0038){ref-type="ref"}; Radutoiu et al., [2003](#pld3135-bib-0056){ref-type="ref"}). NFR activation induces root hair deformation, curling, and consequently entrapment of bacteria in those root hairs. The entrapped bacteria form infection threads, which enters in the root hair cells and elongates from the root hair tips to the inner cells to initiate early infection. Additionally, active NFRs stimulate downstream signaling pathways through nuclear Ca^2+^ oscillations and Ca^2+^ spiking to begin nodule organogenesis from the cortical cells (Gleason et al., [2006](#pld3135-bib-0019){ref-type="ref"}; Tirichine et al., [2006](#pld3135-bib-0072){ref-type="ref"}). All these signaling and organogenesis events are considerably affected by the hormonal balance in plants (Ryu, Cho, Choi, & Hwang, [2012](#pld3135-bib-0059){ref-type="ref"}).
Phytohormones both positively and negatively regulate nodulation and nitrogen fixation in legumes. The positive effects of plant hormones auxins and cytokinins in nodule development have been established for a long time. Auxins are a prerequisite during the development and differentiation of nodule primordia and the formation of the vasculature within the nodules (Kohlen, Ng, Deinum, & Mathesius, [2018](#pld3135-bib-0028){ref-type="ref"}; Takanashi, Sugiyama, & Yazaki, [2011](#pld3135-bib-0068){ref-type="ref"}; Thimann, [1936](#pld3135-bib-0070){ref-type="ref"}). Similarly, cytokinins are responsible for the cortical cell division, differentiation, and nodule organogenesis (Frugier, Kosuta, Murray, Crespi, & Szczyglowski, [2008](#pld3135-bib-0016){ref-type="ref"}; Gonzalez‐Rizzo, Crespi, & Frugier, [2006](#pld3135-bib-0021){ref-type="ref"}; Reid et al., [2017](#pld3135-bib-0057){ref-type="ref"}). In addition to auxins and cytokinins, gibberellins (gibberellic acid, GA) are also involved during regulation of nodulation likely via their cross talk with cytokinin signaling pathways (Maekawa et al., [2009](#pld3135-bib-0039){ref-type="ref"}). Conversely, stress‐related hormones such as jasmonic acid (JA), salicylic acid (SA), and abscisic acid (ABA) typically reduce nodulation by disrupting NF‐induced Ca^2+^ spiking and downstream signaling pathways (Martinez‐Abarca et al., [1998](#pld3135-bib-0040){ref-type="ref"}; Nakagawa & Kawaguchi, [2006](#pld3135-bib-0046){ref-type="ref"}; Phillips, [1971](#pld3135-bib-0055){ref-type="ref"}).
Nodulation is an energy‐demanding process, therefore to control the number of nodules, legumes have evolved a systemic auto‐regulation of nodulation (AON) as well as local hormonal inhibition of nodulation, which are considered the negative feedback systems. The molecular mechanism of AON has been actively investigated using different supernodulation mutants, such as *hyper nodulation and aberrant root 1 (har1), super numeric nodules 1 (sunn)*, and *nodule autoregulation receptor kinase (nark)* in *Lotus japonicus, Medicago truncatula*, and *Glycine max*, respectively (Ferguson et al., [2010](#pld3135-bib-0014){ref-type="ref"}; Krusell et al., [2002](#pld3135-bib-0030){ref-type="ref"}; Nishimura et al., [2002](#pld3135-bib-0048){ref-type="ref"}; Oka‐Kira & Kawaguchi, [2006](#pld3135-bib-0050){ref-type="ref"}; Oka‐Kira et al., [2005](#pld3135-bib-0051){ref-type="ref"}; Searle et al., [2003](#pld3135-bib-0061){ref-type="ref"}). Numerous studies suggest that auxin, JA, and brassinosteroids (BRs) modulate AON signaling pathways (Kinkema & Gresshoff, [2008](#pld3135-bib-0027){ref-type="ref"}; Nakagawa & Kawaguchi, [2006](#pld3135-bib-0046){ref-type="ref"}; Oka‐Kira et al., [2005](#pld3135-bib-0051){ref-type="ref"}; Terakado, Yoneyama, & Fujihara, [2006](#pld3135-bib-0069){ref-type="ref"}) whereas ABA, JA, ethylene, and SA appear to act as during local inhibitory regulation of nodulation (Biswas, Chan, & Gresshoff, [2009](#pld3135-bib-0005){ref-type="ref"}; Ding et al., [2008](#pld3135-bib-0012){ref-type="ref"}; Oldroyd, Engstrom, & Long, [2001](#pld3135-bib-0052){ref-type="ref"}; Penmetsa & Cook, [1997](#pld3135-bib-0054){ref-type="ref"}; Sun et al., [2006](#pld3135-bib-0065){ref-type="ref"}). Coordinated action of the hormone levels and signaling controls nodule organogenesis and mature nodule development.
Previous studies on the hormonal control of nodulation are based on physiological approaches using a variety of leguminous species and exogenous application of phytohormones to study their effect on nodule formation. For example, exogenous application of cytokinins and auxins to pea root cortical explants induced cell proliferation required for root nodule formation (Libbenga, van Iren, Bogers, & Schraag‐Lamers, [1973](#pld3135-bib-0034){ref-type="ref"}). On the other hand, exogenous ABA reduced the number of root nodules by inhibiting the cortical cell divisions during nodule organogenesis (Phillips, [1971](#pld3135-bib-0055){ref-type="ref"}). GA, an important growth regulator, also modulates root nodule formation in legumes by exogenous application (Maekawa et al., [2009](#pld3135-bib-0039){ref-type="ref"}). SA, a key molecule in plant disease resistance, was shown to inhibit the indeterminate nodules of *Vicia sativa*, but not the determinate nodules of *Lotus japonicus* after exogenous application (van Spronsen et al., [2003](#pld3135-bib-0063){ref-type="ref"}). Although each hormone had a characteristic physiological effect, it was evident that different hormones may also follow additive, synergistic, or antagonistic interactions to regulate nodule formation.
The availability of excellent mutant populations in plants such as *L. japonicus* and *M. truncatula* provided genetic evidence for the effect of hormones on | {
"pile_set_name": "PubMed Central"
} |
**Citation:** Morita T, Rahman A, Hasegawa T, Ozaki A, Tanimoto T. The potential possibility of symptom checker. Int J Health Policy Manag. 2017;6(10):615--616. doi:10.15171/ijhpm.2017.41
Dear Editor, {#s1}
============
The access to medical care is unacceptably low worldwide in spite of the increasing demand for medical care due to population aging and increasing burden of non-infectious diseases. The probability of patients receiving at least one medicine for secondary prevention of cardiovascular disease was 19.8% in low-income countries, 30.7% in low- and middle-income countries, and 54.9% for upper-middle-income countries.^[@R1]^ Especially, low- to middle-income countries are seriously in short of professional medical staff. For example, in Bangladesh, the doctor-population and the doctors-nurse ratio is 1:12 690 and 2.5:1, respectively, which is among the lowest group in the world.^[@R2]^ In such resource-limited countries, patients cannot access to medical care in a timely manner. Thus, the tool to help patients with self-diagnosis and self-triage is urgently needed to mitigate the shortage of medical care resources.
Symptom checkers are algorithm-based tools for self-diagnosis and self-triage. The increasing access to the Internet enabled these kinds of web-based healthcare service including symptom checkers. Generally, symptom checkers make a diagnosis of a disease based on the data on the prevalence of disease and its sensitivity and specificity of symptoms. We would like to introduce the possible benefit of symptom checkers on public health.
One of the main functions of symptom checkers is to assist with triage, which is the same function of community health workers (CHWs) in resource-limited countries. In Bangladesh, community health workers trained by NGOs contribute to promote public health, which has been proved effective such as in reducing mortality among infants in rural areas.^[@R3]^ However, quality control or education cost for health workers are now becoming social issues.^[@R4]^ It is sometimes difficult or impossible for the doctors or health workers to maintain the quality of the treatment since they do not analyze the patient's symptoms with the medical database or due to lack of their up to date knowledge. They just do some specific tests to assess the health condition of the patients and using their sport observation they draw the conclusion and suggests medicine for the patient's remedy from diseases or illness. Symptom checkers could help CHWs to triage patients. In the future, symptom checkers would help keeping up the quality of primary care delivered by CHWs in resource-limited countries.
Though, prior researches suggest that symptom checkers may be less effective than physicians in diagnostic accuracy for now,^[@R5]^ to conclude the superiority of doctors to symptom checkers might be overhasty. This is because diagnostic accuracy of symptom checkers can be improved after appropriate feedback. One reason of low diagnostic accuracy is because there is no accurate database of these information for all diseases. However, with the feedback of the data of diagnoses along with patients' symptoms reported by doctors, the symptom checkers can update their incorporated database, making the diagnosis closer to doctors' diagnosis than before. After doctors' feedback, the updated database of symptom checkers can provide useful information for clinical education (eg, sensitivity and specificity of symptoms for diseases, prevalence of diseases). Therefore, symptom checkers could be more useful and helpful tools for medical staff.
Symptom checkers can not only be the beneficial tools for doctors but also provide the access to health care in low resource settings such as in rural areas or developing countries. We doctors should concern that our active cooperation with symptom checkers can contribute to improve public health.
Ethical issues {#s2}
==============
Not applicable.
Competing interests {#s3}
===================
Authors declare that they have no competing interests.
Authors' contributions {#s4}
======================
TM and TH developed the concept of the letter. TM and AR collected data. TM drafted the manuscript and all authors contributed substantially to its revision.
Authors' affiliations {#s5}
=====================
^1^Department of Internal Medicine, Soma Central Hospital, Soma, Japan. ^2^Department of Medicine, Shaheed Suhrawardy Medical College & Hospital, Dhaka, Bangladesh. ^3^Health Intelligence Center, The Institute of Medical Science, The University of Tokyo, Minato-ku, Japan. ^4^Department of Surgery, Minamisoma Municipal General Hospital, Fukushima, Japan. ^5^Department of Internal Medicine, Jyoban Hospital of Tokiwa Foundation, Fukushima, Japan.
| {
"pile_set_name": "PubMed Central"
} |
All relevant data are within the paper and its Supporting Information files.
Introduction {#sec001}
============
The regulation of cell growth is fundamentally important for a wide range of biological processes \[reviewed in [@pgen.1006154.ref001], [@pgen.1006154.ref002], [@pgen.1006154.ref003]\]. A key signal transduction network regulating cell growth and proliferation in response to nutrients involves two related kinases, Target-of-Rapamycin (TOR) and Class I phosphatidylinositol 3-kinase (PI3K) \[[@pgen.1006154.ref004]--[@pgen.1006154.ref007]\]. A variety of nutritional and growth factor stimuli are known to activate PI3K, which converts the membrane phospholipid phosphatidylinositol-4,5-bisphosphate (PIP2) into phosphatidylinositol-3,4,5-trisphosphate (PIP3) \[[@pgen.1006154.ref008]\]. Levels of PIP3 are kept in check by Phosphatase and Tensin Homologue (PTEN), which hydrolyzes PIP3 back to PIP2. PIP3 is a signaling lipid that stimulates plasma membrane recruitment of proteins with PIP3-specific pleckstrin homology (PH) domains such as Akt (also known as protein kinase B) and phosphoinositide-dependent kinase 1 (PDK1). The colocalization of Akt and PDK1 at the membrane surface increases the rate at which PDK1 phosphorylates Akt at a regulatory site essential for its activation \[[@pgen.1006154.ref009]\]. Activated Akt is then able to phosphorylate numerous targets in the TOR/PI3K network, including Forkhead box subgroup O (FoxO) transcription factors and Tuberous Sclerosis Complex 2 (TSC2), an inhibitor of TOR \[reviewed in [@pgen.1006154.ref010]\]. Akt phosphorylation of both of these negative growth regulators attenuates their activities, thus promoting an increase in cell growth and biomass.
*Drosophila melanogaster* provide a useful genetic system for studying cell growth and PI3K signaling in the context of an intact organism. Tissue growth in *Drosophila*, as in mammals, depends upon the Insulin-like receptor (InR)/PI3K pathway and the interconnected amino-acid/TOR pathway \[reviewed in [@pgen.1006154.ref011], [@pgen.1006154.ref012]--[@pgen.1006154.ref015]\]. Class I PI3K is required for the growth of most if not all *Drosophila* tissues but the ways in which it is differentially regulated as a function of cell type and developmental stage are not yet fully clear. Nevertheless, some insights have been gained by experiments showing that there is selective tissue growth in larvae subjected to nutrient restriction (NR). At early larval stages, NR shuts down the growth of developing tissues, and prevents the stem cells of the central nervous system (neuroblasts) from re-entering the cell cycle after a period of quiescence \[[@pgen.1006154.ref016]--[@pgen.1006154.ref018]\]. At late larval stages, however, growth in neuroblast lineages is almost completely spared during NR, whereas it is approximately halved for the epithelial progenitors of adult structures (imaginal discs) and reduced to near zero in many other larval tissues \[[@pgen.1006154.ref019], [@pgen.1006154.ref020]\].
Among the larval tissues that are not spared during NR are two major organs of the *Drosophila* adipose axis: fat body cells (adipocytes) and oenocytes. The fat body provides the major storage depot in *Drosophila* for neutral lipids such as triglycerides, in the form of intracellular lipid droplets \[[@pgen.1006154.ref021]\]. This tissue is important for the maintenance of energy homeostasis during starvation and acts as a nutrient sensor. Depending upon amino acid levels, the fat body can either store or release lipid nutrients into the hemolymph, in the form of lipoproteins \[[@pgen.1006154.ref022]--[@pgen.1006154.ref024]\]. Oenocytes are endocrine cells specialized for lipid metabolism \[reviewed in [@pgen.1006154.ref025], [@pgen.1006154.ref026]\]. There are two morphologically distinct populations of *Drosophila* oenocytes, larval and adult (imaginal), each deriving from a separate pool of ectodermal progenitors \[[@pgen.1006154.ref027]--[@pgen.1006154.ref029]\]. Adult oenocytes synthesize species and sex-specific mixes of cuticular hydrocarbons that function in desiccation resistance and pheromonal communication \[[@pgen.1006154.ref030]--[@pgen.1006154.ref032]\]. These cuticular hydrocarbons are synthesized from very-long chain (VLC) fatty acids via a pathway requiring the cytochrome P450 enzyme Cyp4g1, a VLC fatty aldehyde decarbonylase \[[@pgen.1006154.ref033], [@pgen.1006154.ref034]\]. Larval oenocytes, on the other hand, are known to be essential for molting and synthesize VLC fatty acids required for waterproofing the tracheal system \[[@pgen.1006154.ref035], [@pgen.1006154.ref036]\]. Unlike most other cell types, larval oenocytes accumulate numerous lipid droplets during NR \[[@pgen.1006154.ref035]\]. This oenocyte NR response resembles, at least superficially, the fasting-induced build up of neutral lipids (steatosis) observed in mammalian hepatocytes. In mammals, this steatosis is thought to be a physiological response to elevated lipolysis in adipose tissue. Similarly, in *Drosophila*, fat-body specific overexpression of an ortholog of Adipose Triglyceride Lipase (ATGL) is sufficient to induce steatosis in the oenocytes of fed larvae \[[@pgen.1006154.ref035]\]. Hence, during NR, neutral lipid in the form of lipid droplets is lost from the fat body but gained by the oenocytes. The induction of lipid droplets during starvation requires the activity of the Lipophorin receptor (Lpr2) in oenocytes and so presumably involves the uptake of lipids released into the hemolymph \[[@pgen.1006154.ref036]\]. It nevertheless remains unclear which tissue-specific signaling mechanisms allow neutral lipid content in the fat body and in oenocytes to be simultaneously regulated in opposite directions during starvation.
Here, we characterize novel regulatory interactions between PI3K signaling, lipid metabolism and cell growth in the context of the *Drosophila* adipose axis. Tissue-specific and clonal genetic analyses reveal that oenocytes respond to nutrition and PI3K signaling very differently from the fat body. PI3K signaling stimulates neutral lipid storage in fat body cells but it inhibits this process in oenocytes. We identify two lipid oxidoreductases that regulate the balance between lipid storage and cell size in oenocytes and show that one of these is part of an oenocyte-specific regulatory circuit that modulates PI3K-dependent cell growth.
Results {#sec002}
=======
PI3K signaling inhibits lipid droplets in oenocytes but promotes them in fat body {#sec003}
---------------------------------------------------------------------------------
When raised on an optimal diet, *Drosophila* larvae grow (increase mass) by more than two orders of magnitude as they develop through three instars (L1-L3) over a four-day (\~96 hr) period. Fat body and oenocytes ([Fig 1A](#pgen.1006154.g001){ref-type="fig"}), in common with many other larval tissues, grow via an increase in cell size and ploidy rather than by cell division \[[@pgen.1006154.ref037], [@pgen.1006154.ref038]\]. We first compared how oenocytes and fat body respond to PI3K signaling. To assess the cell-autonomous effects of class I PI3K signaling upon fat body cell size and intracellular lipid droplets, genetic mosaic larvae were generated via Flp/FRT mediated activation of the GAL4/UAS system (Flp-out clones). A previous study found that overexpressing PI3K (UAS-Dp110) in Flp-out clones in the fat body is sufficient to increase cell size in well-fed larvae \[[@pgen.1006154.ref039]\]. During starvation it is known that neutral lipids, stored in intracellular lipid droplets, decrease in the fat body yet increase in oenocytes and neither tissue is able to grow significantly \[[@pgen.1006154.ref019], [@pgen.1006154.ref035]\]. To investigate the role of PI3K signaling in the regulation of lipid droplets during nutrient restriction (NR), larvae at the early-L3 stage (48hr after larval hatching) were switched from fed (yeast/cornmeal/agar) to NR (PBS/agarose) medium for 18 hr. Tissues were analyzed either at the early L3 stage (Fed~48~ control group) or 18 hr later (NR~66~ experimental and Fed~66~ control groups) ([Fig 1B](#pgen.1006154.g001){ref-type="fig"}). NR applied at early L3 induces developmental arrest such that, for NR~66~ larvae, their chronologically matched control is Fed~66~ but their developmentally matched control is Fed~48~. Figures therefore show comparisons between Fed~48~ and NR~66~ larvae, although in most cases the Fed~66~ time point was also analyzed. Following 18 hr of NR, the size of fat body cells is decreased but they are only partially depleted of stored neutral fat and so still contain numerous lipid droplets \[[@pgen.1006154.ref023], [@pgen.1006154.ref035] and [Fig 1C](#pgen.1006154.g001){ref-type="fig"}\]. Overexpression of PI3K resulted in increases in fat body cell size, lipid droplet diameter and neutral lipid content following NR (Figs [ | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec0005}
===============
Ileorectal intussusception is a rare condition in adults in which the distal ileum, caecum, variable lengths of ascending and transverse colon, and associated mesentery invaginate into the rectum. Case reports on this rare condition in the adult population are limited [@bib0005; @bib0010; @bib0015; @bib0020].
2. Presentation of case {#sec0010}
=======================
We present the case of a 56-year-old man who presented to our hospital for investigation of rectal bleeding. The patient was an otherwise healthy male who had experienced two days of bright red rectal bleeding and colicky abdominal pain. On further questioning, he described an unintentional weight loss of 5 kg, anorexia, borborygmi, and altered bowel habit over a three-month period. Abdominal examination revealed a soft but slightly distended abdomen with a palpable mass in the right upper quadrant. A digital rectal exam demonstrated a mass in the rectum and rigid sigmoidoscopy revealed a large tumour in the rectum.
The patient had work up for a suspected rectal carcinoma with a staging CT scan. The CT revealed an extensive ileorectal intussusception ([Fig. 1](#fig0005){ref-type="fig"} red arrows). The intussusceptum consisted of distal ileum, caecum, ascending, and proximal transverse colon. The splenic flexure, descending colon, sigmoid colon, and rectum acted as the intussuscipiens. There was extensive involvement of the ileo-colic mesentery in the intussusceptum. A large soft tissue mass was demonstrated in the rectum and thought to represent the lead point ([Fig. 2](#fig0010){ref-type="fig"}b arrow). Also noted were extensive liver lesions, which were suspicious for colorectal metastases ([Fig. 1](#fig0005){ref-type="fig"} blue arrows). The CT revealed signs concerning for possible ischaemia in the distal portion of the intussusceptum ([Fig. 2](#fig0010){ref-type="fig"}a arrow) and a decision was made to immediately proceed to exploratory laparotomy.
A large caecal tumour, chronically intussuscepted into the rectum, was discovered during the laparotomy ([Fig. 3](#fig0015){ref-type="fig"}). The colon at the hepatic flexure was completely mobile due to a long mesentery and lack of posterior peritoneal attachment. There was no evidence of bowel ischaemia. A decision was made to carefully reduce the intussusceptum and avoid a total colectomy given the extent of the intussusception. The caecal mass was carefully milked back from the rectum to the transverse colon and an extended right hemicolectomy with a primary anastomosis was performed. Histology of the tumour revealed a mucinous caecal adenocarcinoma with clear surgical margins (Dukes Stage D AJPP stage pT3 N1a M1). The final histology was consistent with the mass originally biopsied with a rigid sigmoidoscope. The patient recovered well and was discharged home six days post operatively. The patient was considered for adjuvant chemotherapy and possible down staging of the liver metastasis before possible resection in a subsequent multidisciplinary meeting.
3. Discussion {#sec0015}
=============
Intussusception in adults is a rare diagnosis, accounting for only 5% of intussusception cases [@bib0025]. When cases occur in adults, they are generally secondary to a pathological solid lesion creating the lead point although cases of diverticulum, including Meckel's diverticulum, have been reported in the literature [@bib0030]. Adult intussusception is a difficult diagnosis to make since it may not present with the classical triad of crampy abdominal pain, vomiting and bloody stools. Adults can have a wide variety of symptoms such as abdominal pain, haematochezia, abdominal mass, altered bowel habits, and bowel obstruction [@bib0035]. Due to the varied clinical presentations, radiological imaging plays a key role in diagnosis. CT scanning of the abdomen is the most sensitive radiological investigation for adult intussusception and can be useful in establishing a diagnosis, locating a causative lesion and planning the operative strategy [@bib0025; @bib0040]. Due to the high rate of malignant cause of adult intussusception, laparotomy and bowel resection without preoperative reduction is the advocated management strategy and intraoperative reduction is often discouraged for fear of tumour rupture and potentially upstaging the cancer. However, no high level evidence is available to provide an answer to this question and the topic is debated [@bib0045; @bib0050; @bib0055].
What is unique in this case is the extent of the intussusception; there have only been a few case reports of adult ileo-rectal or ileo-anal intussusception [@bib0005; @bib0010; @bib0015; @bib0020]. The failure in the embryologic development of the mesenteries of the ascending and descending colon to blend with the posterior abdominal wall peritoneum by the process of zygosis contributes to this rare phenomenon. The colon is thus straighter and allows the intussusceptum to migrate large distances freely without obstruction.
4. Conclusion {#sec0020}
=============
Intussusceptions are a rare diagnosis in the adult population. Presentations are varied and radiological imaging plays a key role in diagnosis. In cases with extensive ileorectal or ileoanal intussusception, a balance needs to be reached between extensive resection that increases the morbidity of the procedure verses the risk of upstaging the malignancy. The decision to reduce the intussusception ultimately requires the application of surgical judgement specific to each patient. In our patient, the intussusception was reduced due to pre-existing distal metastasis.
Conflicts of interest {#sec0025}
=====================
None of the authors have any conflicts of interest to declare.
Funding {#sec0030}
=======
The article was funded entirely by the authors.
Ethical approval {#sec0035}
================
N/A.
Author contribution {#sec0040}
===================
Dr. Robertson -- article conception, image creation, literature review, writing the article and editing the article.
Dr. Due -- article conception, writing the article and editing the article.
Dr. Shimokawa -- image creation, writing the article and editing the article.
Dr. Yeow -- writing the article and editing the article.
Consent {#sec0045}
=======
Written informed consent was obtained from the patient prior to the writing of the case report.
Guarantor {#sec0050}
=========
Dr. Robertson will act as the guarantor for this article.
{#fig0005}
{#fig0010}
{#fig0015}
| {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
Due to advances in operation techniques and novel treatments (targeted therapy and PD-L1 immunotherapy) for patients with non-small cell lung carcinoma (NSCLC), the prognosis of NSCLC is improved. However, the 5-years survival rate of NSCLC patients is still \<20% and NSCLC remains a major health problem worldwide. Therefore, it is urgent to discover novel targets to regulates the carcinogenesis and metastasis of NSCLC and to develop new therapeutic agents for the treatment of NSCLC ([@B1], [@B2]). Recently, accumulating evidence indicates that abnormal regulation of acetylation processes plays a vital role in lung carcinogenesis. For example, histone deacetylases (HDACs) and histone acetyltransferases (HATs) can significantly change the nucleosome conformation of tumor cells through post-translational modifications of the N-terminal tails of core histones ([@B3], [@B4]). However, the expression level and clinical characteristics of HDAC10 in NSCLC tissue is not clear. Tumor-associated PD-L1 (B7 homolog 1, B7-H1) can block tumor-specific T cell-mediated immunity through inducing apoptosis of T cells, suppressing the secretion of cytokines and disturbing the function of activated T cells ([@B5], [@B6]). Moreover, recent findings suggested that activation of HDACs could induce PD-L1 expression in various types of cancer, especially in myeloma and B-cell lymphomas ([@B7]--[@B9]). Thus, we hypothesized that high-level expression of HDAC10 is closely associated with PD-L1 expression and poor prognosis of patients with NSCLC.
Herein, we evaluated HDAC10 and PD-L1 expression in patients with NSCLC. Furthermore, the correlation of HDAC10 and PD-L1 was analyzed. HDAC10 expression and poor prognosis in patients with NSCLC receiving pulmonary resection was also investigated.
Materials and Methods {#s2}
=====================
Patients
--------
From April 2004 and August 2009, a total of 180 pulmonary squamous carcinoma and adenocarcinoma patients from the 1st Affiliated Hospital of Jinzhou Medical University (Jinzhou, China) who were receiving complete pulmonary resection and systematic lymph node dissection were enrolled. During the enrollment period, all patients were pathologically diagnosed for the first time as having NSCLC. Based on the International Association for the Study of Lung Cancer TNM classification system, all of the patients with NSCLC were classified into TNM stages ([@B10]). The enrolled patient were required to have integrated clinicopathological information and follow-up data. Strictly based on the National Comprehensive Cancer Network Clinical Practice Guidelines on NSCLC, all of the patients received postoperative treatment ([@B11]). Exclusion criteria were as follows: patients receiving preoperative anticancer treatment (including neo-adjuvant chemotherapy, radiotherapy, or biotherapy), patients with previous or simultaneous cancers, patients who died within 1 month after surgery or died from non-cancer diseases.
Until August 30, 2014, all of the patients were followed up. In the retrospective study, patients who were still alive after the last follow-up were censored. Overall survival (OS) means the period between the time of surgery and the last follow-up or death.
Immunohistochemistry (IHC) and Scoring
--------------------------------------
Monoclonal mouse anti-HDAC10 antibody (Abcam, No. ab108934) and polyclonal rabbit anti-PD-L1 antibody (Abcam, No. ab213524) for IHC of NSCLC tissues were purchased from Abcam Inc. 180 samples of normal lung tissue were taken from tissue that was 10 cm from the cancer, and were used as para-cancer samples. In line with the viewpoints of two pathologists who were blinded to identity of the NSCLC tissues. Positive staining of HDAC10 and PD-L1 is taken to show the nuclear or cytoplasmic staining of tumor cells. Considering both the staining intensity and the proportion of cells stained, the IHC score was determined by a semi-quantitative method ([@B12]). The expression of analyzed makers were assessed using a semi-quantitative method, based on the intensity of color reaction (on a scale of + to +++), and the rate of immunopositive cells (within the ranges of 1--20%, 21--40%, 41--60%, 61--80%, 81--100%) ([@B13]). Based on these two variables, a numerical ratio of the markers expression was estimated and used for further analyses. The expression level was further classified into low expression (≤1), moderate expression (1.5-6) and strong positive expression (≥7.5) for both HDAC10 and PD-L1.
Database for HDAC10 and PD-L1 Expression in Patients With NSCLC
---------------------------------------------------------------
To provide evidence for our findings, we also searched HDAC10 expression in the Oncomine database ([@B14]). A total of 226 patients with NSCLC and 20 normal lung tissues were analyzed. Based on the Protein Atlas database ([@B15]), the expression of CD274 (PD-L1) in various types of cancer was also investigated. To verify the correlation of HDAC10 and CD274 in patients with NSCLC, an R2 database was used to analyze the relationship of HDAC10 and PD-L1 ([@B16]).
Statistical Analysis
--------------------
SPSS22.0.0 software was used to perform statistical analysis. The correlation of HDAC10 and PD-L1 expression was analyzed by Spearman\'s correlation method. OS (Overall Survival) was calculated by the Kaplan-Meier method and analyzed by log-rank test. Based on Cox\'s proportional hazard model, multivariable analysis of as an independent factor for survival was investigated. *P* \< 0.05 was considered statistically different.
Results {#s3}
=======
Expression Level of HDAC10 and Clinicopathological Features of all Patients With NSCLC
--------------------------------------------------------------------------------------
The clinicopathological features of all examined cases are shown in [Table 1](#T1){ref-type="table"}. Out of 180 NSCLC cases, 64 (35.6%) patients were classified in the high-level of the HDAC10 group. No significant differences were observed between HDAC10 expression and patient characteristics (gender, age, tumor size, and stages). Positive immunostaining of HDAC10 was mainly located in the nucleus and cytoplasm of carcinoma cells ([Figure 1A](#F1){ref-type="fig"}). Noticeably, we observed that the expression score of HDAC10 in NSCLC tissue of 180 patients was significantly higher than that in the corresponding para-cancer tissues (*P* \< 0.001). Meanwhile, we searched for HDAC10 expression in patients with NSCLC as compared to normal lung tissue in the Oncomine database. As shown in [Figure 1B](#F1){ref-type="fig"}, the expression level of HDAC10 in NSCLC tissues is 1.55-fold higher than that in normal lung tissues (*p* = 0.020, data were obtained from <https://www.oncomine.org/resource/login.html>). This result is consistent with our findings.
######
The clinicopathological features and analysis of all examined cases.
**Clinicopathological features** **OS**
---------------------------------- ------------ -------------------- --------- --------- ---------- -----------
**N (%)** **Median, months** **UVA** **MVA**
***P*** ***P*** ***HR*** **95%CI**
Gender 0.79 0.34 1.2 0.36--3.8
Male 100 (55.6) 54
Female 80 (44.4) 51.5
Age 0.13 0.12 1.7 0.85--3.6
\>60 98 (54.4) 52.5
≤60 82 (45.6) 56.5
Size 0.9 0.32 1.0 0.52--2.1
\>5 55 (30.6) 53
≤5 125 (69.4) 56
T 0.19 0.92 1.6 0.78--3.4
T1 36 (20) 66
T2 102 (56.7) 54
T3 32 (17.8) 49.5
T4 10 (6) 14
N 0.04 0.53 2.0 1--3.8
N0 74 (41.1) 63.5
N1 68 (37.8) 56
N2 32 (17.8) 43.5
N3 6 (3) 24
M 0.08 0.77 6.1 0.8--46
M0 178 (98.9) 54
M1 2 (1.1) 14
TNM 0.00 0.02 2.4 1.5--3.8
I 54 (30) 81
II 78 (43.3) 64
III | {
"pile_set_name": "PubMed Central"
} |
Many factors, including professional and personal relationships and activities, can influence the design, conduct, and reporting of the clinical science that informs health care decision. The potential for conflict of interest exists when these relationships and activities may bias judgement.[@B1] Many stakeholders---editors, peer reviewers, clinicians, educators, policymakers, patients, and the public---rely on the disclosure of authors\' relationships and activities to inform their assessments. Trust in the transparency, consistency, and completeness of these disclosures is essential.
Ten years ago, the International Committee of Medical Journal Editors (ICMJE) adopted the "ICMJE Form for the Disclosure of Potential Conflicts of Interest" as a uniform mechanism for collecting and reporting authors\' relationships and activities that readers might consider relevant to a published work.[@B2] The goal was to avoid the confusion (and often ensuing controversy) created when journals vary in how they collect and report this information. We believe a uniform disclosure form has been helpful, but problems remain. First, the software supporting the current form is increasingly problematic, making its use difficult or impossible for an increasing number of authors. More important, however, is that many authors and readers misunderstand, misapply, or misinterpret the disclosures.
Although some individuals violate the public trust by purposefully hiding relevant relationships and activities, we believe most authors are committed to transparent reporting and consider it as vital to the advancement of clinical science. Nonetheless, disagreement, confusion, and controversy regarding authors\' disclosures arise when opinions differ over which relationships and activities to report. An author might not report an item that others deem important because of a difference in opinion regarding what is "relevant," confusion over definitions, or a simple oversight. Some authors may be concerned that readers will interpret the listing of any item as a "potential conflict of interest" as indicative of problematic influence and wrongdoing, a concern often raised regarding the requirement to report publicly funded grants. For their part, some readers fail to recognize that their own relationships and activities influence how they assess the work of others and what they deem to be a "conflict" for others or themselves.
We propose several changes to the ICMJE disclosure form to help address these issues. First, words matter. Despite including the word "potential," a form entitled "... for the Disclosure of Potential Conflicts of Interest" may imply that any relationship or activity listed represents a problematic influence or wrongdoing. The proposed new title, "The ICMJE Disclosure Form," aims to dispel that interpretation and potential stigma. Second, we no longer ask authors to decide what might be interpreted as a potential conflict of interest. Authors disclose their relationships and activities so that readers can decide whether these relationships or activities should influence their assessments of the work. Further, to avoid omissions--inadvertent or purposeful--we now provide a checklist of relationships and activities for authors to complete.
We welcome feedback about the proposed new form, which is available with a link to provide comments, at [www.icmje.org](http://www.icmje.org). We will consider comments received by 30 April 2020, before finalizing and adopting a revised version. In the interim, the extant "ICMJE Form for the Disclosure of Potential Conflicts of Interest" will remain in use and available as a downloadable PDF at our website ([Supplementary Data](#S1){ref-type="supplementary-material"}).
In a further step to avoid inconsistencies and omissions, and to help ease the disclosure process for authors, some journals will change the mechanism by which disclosures are collected. Authors are required to provide disclosures to multiple entities (e.g., to academic institutions, continuing education providers, guideline and other committees as well as medical journals). Disclosing information repeatedly, with varying reporting requirements, formats, and definitions, is frustrating for authors and contributes to problematic and controversial discrepancies across disclosures. The ICMJE will therefore accept disclosures from web-based repositories. These enable authors to maintain an inventory of their relationships and activities and create electronic disclosures tailored to the requirements of entities such as ICMJE, without having to reenter information repeatedly.
ICMJE will accept disclosures from repositories that meet the following criteria: collection and reporting of relationships and activities consistent with ICMJE requirements; no fees for individuals to enter, store, or export their data; provision of disclosures to journals electronically as well as an option for journals without a digital interface; and compliant with the General Data Protection Regulation (GDPR).
One currently available repository that is consistent with these criteria is Convey ([www.convey.org](http://www.convey.org)), but we encourage the development of other repositories as necessary to meet regional, linguistic, and regulatory needs. A template that enables authors to create disclosures that emulate the extant "ICMJE Form for the Disclosure of Potential Conflicts of Interest" is already available at the Convey platform, and some of our journals have begun to collect author disclosures electronically in this way. This template will be updated to conform to the new ICMJE Disclosure Form when it is finalized, and all ICMJE journals can begin accepting disclosures in this manner. Ultimately, the currently employed PDF-based ICMJE form will be unavailable.
While no approach to disclosure will be perfect or foolproof, we hope the changes we propose will help promote transparency and trust. We look forward to your feedback.
This article is being published simultaneously in *Annals of Internal Medicine*, *BMJ (British Medical Journal)*, *Bulletin of the World Health Organization*, *Deutsches Ärzteblatt (German Medical Journal)*, *Ethiopian Journal of Health Sciences*, *JAMA (Journal of the American Medical Association)*, *Journal of Korean Medical Science*, *The Lancet*, *New England Journal of Medicine*, *New Zealand Medical Journal*, *Revista Medica de Chile (Medical Journal of Chile)*, *and Ugeskrift for Laeger (Danish Medical Journal)*.
**Disclaimer:** Dr. Sahni\'s affiliation as representative and past president of the World Association of Medical Editors (WAME) does not imply endorsement by WAME member journals that are not part of the ICMJE.
SUPPLEMENTARY MATERIAL
======================
###### Supplementary Data
ICMJE Form for Disclosure of Potential Conflicts of Interest.
| {
"pile_set_name": "PubMed Central"
} |
{#sp1 .44}
| {
"pile_set_name": "PubMed Central"
} |
Introduction
============
As the second leading cause of death after heart disease,[@b1-ott-11-5397] cancer includes a group of diseases characterized by irregular cell division and proliferation. Lung cancer is the most deadly type.[@b2-ott-11-5397] The main reason behind the dismal survival statistics is that most lung cancer patients are terminally ill and cannot be cured with existing therapies.[@b3-ott-11-5397] As far as we know, there is little information about quercetin (QCT) regulating the ultrastructural changes of lung cancer.
QCT, or 3, 3′, 4′, 5, 7-pentahydroxyflavone, 1 of the 6 subclasses of flavonoids, has a wide range of biological activities.[@b4-ott-11-5397] The antitumor, antiallergic, and anti-inflammatory effects of QCT have been extensively reviewed.[@b5-ott-11-5397],[@b6-ott-11-5397] Their biological activities mainly include electron transfer of free radicals, the activation of antioxidant enzymes, and the ability to inhibit oxidative stress.[@b7-ott-11-5397] There is evidence that QCT is capable of targeting different types of cancer cells including those of leukemia, breast cancer, esophageal cancer, colon cancer, prostate cancer, nasopharyngeal carcinoma, endometrial cancer, and lung cancer.[@b8-ott-11-5397],[@b9-ott-11-5397] The proliferation of these malignant cells may be inhibited by QCT; however, the exact molecular mechanisms underlying the effects of QCT are unknown. For the treatment of these pulmonary diseases, the required therapeutic agents must be taken for extended periods of time. Moreover, the long-term use of QCT may generate many undesirable side effects such as tubule adenoma, renal failure, and liver cancer.[@b10-ott-11-5397],[@b11-ott-11-5397] In addition, QCT has low water solubility, poor absorption, and rapid metabolism (bioavailability of about 1%--5%),[@b12-ott-11-5397] all of which can produce in vivo results that differ from the powerful in vitro efficacy of QCT. Therefore, the loading of QCT in nanoscale droplets can improve its pharmacokinetic profile, and, with the use of ultrasound-triggered rupturing, enable effective drug delivery to provide anticarcinogenic effects.[@b13-ott-11-5397],[@b14-ott-11-5397]
RGD is a short peptide containing arginine--glycine--aspartic acid and widely exists in the human body. The extracellular matrix and adhesion proteins in blood, including fibrinogen, fibronectin, and collagen, usually contain RGD sequences.[@b15-ott-11-5397] RGD peptide acts as a recognition site for integrins and their ligands, and allows for adhesion between mediated cells, extracellular matrix, and cells. In recent years, targeting angiogenesis has become an important topic in cancer research. It is generally believed that tumor growth, invasion, and metastasis are caused by angiogenesis. If the blood vessels feeding the tumor were insufficient, the tumor would be necrotic or apoptotic.[@b16-ott-11-5397] At the same time, molecular biological studies have shown that integrins exist on the cell surface and play an important role in tumor angiogenesis.[@b17-ott-11-5397] Integrin receptors, especially ανβ3, are highly expressed in some types of tumor cells and vascular endothelial tumor cells, but not in the normal vessels.[@b18-ott-11-5397] It is also indicated that exogenous RGD peptides can competitively inhibit the ligand binding of integrins, thus inhibiting angiogenesis and migration of tumor cells. At the same time, tumors can be target-marked and anticancer drugs can be target-delivered.[@b19-ott-11-5397]--[@b21-ott-11-5397] In the present work, we encapsulated QCT in nanoscale liposome using the lipid carriers. The surface morphology and particle size distribution were characterized. The drug loading (DL%), encapsulation ratio (ER%), and in vitro release of the drug were also studied. In addition, pharmacokinetics and antitumor studies of RGD-QCT liposomes were evaluated.
Materials and methods
=====================
Materials
---------
QCT was purchased by Natural-Standard Biopharma Co., Ltd (Shanghai, People's Republic of China). Distearoyl-L-a-phosphatidylethanolamine (DSPE)-PEG2000-RGD was provided by the HuiJia Biopharma Co., Ltd (Xiamen, People's Republic of China). Soybean phosphatidylcholine, DSPE-PEG2000, and cholesterol were obtained from Sinopharm Chemical Reagent (Shanghai, People's Republic of China). A549 cell line was purchased from Kobai Biomedical Ltd., Co. (Nanjing, People's Republic of China). All other reagents were obtained from Sinopharm Chemical Reagent. Methanol and acetonitrile (chromatographic grade) were obtained from Sigma (Aldrich, St Louis, MO, USA). Deionized water used throughout the research was produced using a Milli-Q System (Millipore Corporation, Burlington, MA, USA).
Animals
-------
Experiments were carried out on rats weighing 220±20 g and C57BL/6 mice weighing 20±2 g. The animals were kept in cages in a room at a temperature of 25°C±2°C, with a 12:12 light--dark cycle. There was a free supply of food and water. All experiments were carried out in strict accordance with the rules of experimental animal care used by Chinese national health institutions.
Preparation of liposomes
------------------------
RGD-modified liposomes containing QCT were prepared by the thin-film hydration method as described previously.[@b22-ott-11-5397] Briefly, QCT, soybean phosphatidylcholine, (DSPE)-PEG2000-RGD, and cholesterol (molar ratio: 2, 55, 5, and 38, respectively) were dissolved in 5 mL of chloroform to form a mixed solution; then the organic solvent was removed under reduced pressure at 40°C by rotary evaporation to form a thin solid film on the inner walls of the round-bottomed flask. This film was then flushed with nitrogen for 30 minutes and stored overnight in a desiccator to remove any traces of chloroform. Glucose and mannitol (1:1, w/w) were dissolved in PBS (pH =7.4). The lipid film was then hydrated with 5 mL of PBS (pH =7.4) at 55°C by rotation (180 rpm ×0.5 hour) to form (DSPE)-PEG2000-RGD-LPs/QCT ([Figure 1A](#f1-ott-11-5397){ref-type="fig"}, appearance morphology). For the preparation of different QCT LPs distearoyl-L-a-phosphati-dylethanolamine-polyethylene glycol 2000-RGD-liposomes (\[DSPE\]-PEG2000-LPs/QCT; \[DSPE\]-PEG2000-RGD-LPs/QCT), a similar procedure was carried out.
Characteristics
---------------
Nanoliposome morphology was observed with an optical microscope. In addition, high-resolution images were obtained of the lyophilized particles using a transmission electron microscope (Philips CM120, Philips, Amsterdam, the Netherlands). In practice, the LPs solution containing 0.1% (w/v) phosphotungstic acid was applied to the copper mesh carbon film and observed by electron microscopy at 80 kV. Particle size distribution and average diameter of (DSPE)-PEG2000-RGD-LPs/QCT were determined by dynamic light scattering using a NICOMP 380 Submicron Particle Sizer (Particle Sizing Systems, Santa Barbara, CA, USA) equipped with a 5 mW heliumneon laser at 632.8 nm. Zeta potential was measured on the same samples prepared for size analysis.
The QCT loading was determined as previously described.[@b23-ott-11-5397] Briefly, QCT was extracted from the LPs with methanol; then, the QCT concentration was determined at 254 nm using high-performance liquid chromatography method with a QCT calibration curve (1.0--10 µg/mL concentration range). The calibration curve was A =0.0654C +0.0031, *r*=0.997. Then, DL% and ER% were calculated according to [Eq (1)](#fd1-ott-11-5397){ref-type="disp-formula"} and [Eq (2)](#fd2-ott-11-5397){ref-type="disp-formula"}: $$\text{DL}\% = \frac{W_{M}}{W_{P} + W_{M}\ } \times 100$$ $$\text{ER}\% = \frac{W_{M}}{W_{F}} \times 100$$where W~P~ is the weight of the initial feeding polymer, W~M~ is the weight of drug incorporated in microspheres, and W~F~ is the weight of the initial feeding drug.
Stability
---------
The liposomes were stored for 6 months at 4°C and 20°C, respectively. The morphology and drug content of liposomes were detected regularly.
In vitro release
----------------
The in vitro drug release from different formulations was determined in PBS (pH=7.4) containing 10% alcohol at the temperature of 37°C±0.5°C | {
"pile_set_name": "PubMed Central"
} |
Gravity is a relentless fact of life on Earth. With each change in posture, the vector of all hydrostatic pressure gradients is altered, and regional pressures affected. Due to the elongated shape of the human body, our cardiovascular system is particularly sensitive and when upright gravity reduces cardiac output by remarkable 2 L/min. In response to the gravitational stress, an intricate system of baroreceptors and compensating blood pressure reflexes have evolved. The most important baroreceptors are located just below the brain and thus at an advantageous position to monitor and safeguard blood pressure and flow to the brain.
The cerebral perfusion pressure is defined as the pressure gradient across the brain and calculated by the difference between the arterial blood pressure at brain level and the intracranial pressure (ICP) (Petersen et al. [2016](#phy214039-bib-0009){ref-type="ref"}). To maintain perfusion pressure to the brain, elevations in ICP are counterbalanced by equal elevation in arterial blood pressure (Guild et al. [2018](#phy214039-bib-0003){ref-type="ref"}). The role of ICP is thus well‐recognized in pathology and any physician will cringe at the thought of what elevated ICP will do to cerebral perfusion, especially in the case of head‐trauma where cerebral autoregulation may be temporarily impaired or knocked out. Despite this, the role of ICP in normal everyday regulation of cerebral perfusion is largely unrecognized -- this is in part because the pressure range of ICP has been believed to be very small compared to arterial blood pressure and therefore ignored, and perhaps moreover because of the invasive nature of ICP‐recordings and the limited available data on ICP variability in healthy humans. With this well‐written article, Stok et al. ([2019](#phy214039-bib-0010){ref-type="ref"}) open up this important question of role of intracranial pressures and cerebrospinal fluid movement for cerebral autoregulation.
Cerebral autoregulation is a broad term that indicates the ability of the human brain to maintain appropriate blood flow despite changes in arterial blood pressure. A broad array of intrinsic mechanisms and systemic neural reflexes contribute to cerebral autoregulation. The term "static" cerebral autoregulation refers to the brains ability to maintain relatively constant flow within mean arterial blood pressure range of some 60--150 mmHg (Lassen [1974](#phy214039-bib-0005){ref-type="ref"}). The more recently coined term "dynamic" cerebral autoregulation describes the brain\'s ability to compensate for rapid changes in perfusion pressure. The buffering capacity of the cerebral vascular bed depends on the frequency of the fluctuation in perfusion pressure; high‐frequency fluctuations in arterial blood pressure are translated more directly to cerebral blood flow velocity, while slower changes are better dampened indicating more efficient autoregulation. Furthermore, a rise or fall in arterial partial pressure of CO~2~, which is a potent cerebral vasodialator, can increase or decrease cerebral blood flow independently of the autoregulation (Lennox and Gibbs [1932](#phy214039-bib-0007){ref-type="ref"}). Conversely, low arterial blood pressure alters the CO~2~ reactivity of the cerebral vasculature (Harper and Glass [1965](#phy214039-bib-0004){ref-type="ref"}) and a decrease or increase in CO~2~ partial pressures can improve or attenuate dynamic cerebral autoregulation (Aaslid et al. [1989](#phy214039-bib-0001){ref-type="ref"}). Thus, both direct and indirect effects of CO~2~ on the cerebral vasculature interfere with cerebral autoregulation adding to the complexity of the integrated physiology.
Daily fluctuates in ICP are determined by the sum of the volumes of intracranial arterial and venous pressure and the cerebrospinal fluid (CSF) pressure. The overall brain pressure is, so to say, the resultant balance of these three fluid columns. Within the rigid confinements of the skull, the second to second arterial inflow is, of course, perfectly matched by venous outflow and each pulse wave is furthermore buffered by CSF movements to and from the spinal cavity. The three fluid systems are thus synchronized and interact in a compensatory fashion.
Because of the eccentric placement of our brain at the very top of these fluid columns, the daily postural fluctuations in ICP are quite significant (Petersen et al. [2016](#phy214039-bib-0009){ref-type="ref"}). Traditionally, cerebral autoregulation is assessed by transfer function from systemic blood pressure to changes in cerebral perfusion. If the gravitational vector is kept constant, that is, body position is maintained, changes in blood pressure and ICP/cerebral perfusion pressure are congruent and this assessment holds true. However, during a change in posture, the arterial blood pressure at heart level is affected less than ICP and cerebral perfusion pressure because the hydrostatic indifference point is located close to heart level (Petersen et al. [2014](#phy214039-bib-0008){ref-type="ref"}). As dynamic changes in the gravitational vector affect regional arterial pressure and ICP/cerebral perfusion pressure differently, it is possible that dynamic cerebral autoregulation is over‐ or underestimated. Furthermore, compliance of the brain‐tissue and thus pressure‐wave propagation within the brain is affected by posture, which may in itself also affect cerebral autoregulation. In other words, ICP may affect cerebral autoregulation differently in upright versus supine postures and could be considered an independent modifying factor in dynamic regulation of cerebral blood flow.
Dr. Stok and colleagues (Stok et al. [2019](#phy214039-bib-0010){ref-type="ref"}) illustrate the complex interaction of gravitational fluid‐shifts, regional pressures, and respiration for cerebral autoregulation. Using both static and dynamic manipulation of the gravitational vector by whole‐body head‐up tilt and sinusoidal oscillations, responses in cerebral blood flow velocity and arterial blood pressure are reported. Further attempts to interpret data are done by mathematic modeling of CSF movements to and from the spinal canal. Despite the fact that no final conclusions can be drawn from the results, Stok et al. deserves much credit for the truly integrative approach to unravel the complex physiology behind cerebral autoregulation. The article raises the important question of the role of normal gravitational ICP fluctuations for cerebral autoregulation.
Changes in posture, whether static or dynamic, may be used to manipulate the magnitude and direction of the gravitational vector and the resultant hydrostatic pressure gradients. However, the only way to eliminate hydrostatic gradients altogether is by weightlessness which thus constitutes an important tool for investigating effects of gravitational stress. The indications of impaired intracranial pressure regulation in some astronauts during and following long‐term spaceflight (Lee et al. [2017](#phy214039-bib-0006){ref-type="ref"}) along with indications of possible impaired cerebral autoregulation (Blaber et al. [2011](#phy214039-bib-0002){ref-type="ref"}) begs further investigation of effects of gravity and weightlessness on cerebral perfusion and function.
| {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
Public health ethics is seen from the view of communities and populations. The ethical considerations related to forced quarantine *i*mpinges on the rights of individuals to protect the wellbeing of the greater public, in an effort to curb an epidemic, a pandemic or to ensure that neither starts. In these situations, ethical conflicts are bound to occur because public health and the safety of the community often trumps individual rights. This chapter will examine the ethical questions pertaining to public health ethics that arose from the Ebola outbreak of 2014/2015. During the outbreak, it is said that the United States of America went through extraordinary lengths to give two tow of it citizens, experimental drugs, outfit a plane with an incubation pod and monitors; airlift them out of the "red zone" to a special, ward at Emory University hospital which houses the most sophisticated infectious disease unit in the United States. Many people were outraged that the individual rights of these two citizens appeared to be more important than that of the public. The fear of Ebola Virus Disease spreading in the country turned to hate mail hurled at doctors at Emory. (Usborne [@CR23]). The practice of forced quarantine will be a focus of the discussions as the risks of emerging and re-emerging infectious diseases increase with modern travel that transports people, to different continents within a few hours via airplanes, ships and trains that cross borders at exceedingly increasing speeds. With this "speed travel" comes the speed of rapid transport of communicable, infectious diseases, bio-hazards and toxic, biological agents; across borders. In the United States of America, rules and regulations that govern the use of quarantine are in place to safeguard the public against the transmission of infectious diseases to the general public.
This chapter attempts to explain differences between medical and public ethics, using quarantine, as an example. It also explains the differences between quarantine and isolation. There are existing laws, regulations, as well as, ethical considerations that affect health practice and practitioners when a forced quarantine occurs. Examples from the countries around the world are used for discussion purposes in an effort to express a global experience and to outline historical perspective.
International Law {#Sec2}
=================
Historically, international law played a key role in global communicable disease by providing guidelines for the control of diseases as well as playing a major role in the surveillance of global communicable diseases. During the nineteenth century, in lieu of a world global health body which could harmonize the different laws within European nations, international law dominated the field. There were inconsistent regulations on quarantine until the exchange of information and the establishment of international health organizations (Aginam [@CR2]). Communicable diseases shape global health since pandemics and epidemics know no borders. International law has been of importance since it reduces cross-border vulnerability to these diseases.
Quarantine and Isolation {#Sec3}
------------------------
In 1377, the first known record of modern day quarantine was introduced in Dubrovnik, on Croatia. In 1424, the first *lazeretto* was opened in Venice because of the Plague. It was on the island of Santa Maria di Nazareth. In 1467, the system in Venice was adopted by Genoa (Tognotti [@CR22]). The origin of the word "quarantine" is said to be from Venetian Italian and a variant of the term "*quaranta giorni*" which was used as a designated period of 40 days that ships were isolated before crew and passengers could come ashore during the Plague and Black Death (CDC [@CR7]). Quarantine is government enforced and can apply to humans, animals and can be used at borders or within countries. Clearly, this is the historical perspective of quarantine from a global north perspective. Isolation is when a sick person is kept separate from others. This differs from quarantine where people who have been exposed but are not ill, are separated from the general public.
### Patrick Sawyer: Ebola Virus Disease in Lagos[1](#Fn1){ref-type="fn"},[2](#Fn2){ref-type="fn"} {#Sec4}
On July 20th 2017, a Liberian national, by the name of Patrick Sawyer, flew to Lagos, the former administrative and current commercial capital of Nigeria from Monrovia with a brief stopover in Lomé in Togo. Although there are no accurate statistics on the population of Lagos, in 2016, the National Population Commission of Nigeria, stated that the population of Lagos was over 21 million. Lagos became the largest city on the continent of Africa, surpassing Cairo back in 2012 (World Population Review [@CR27]). Patrick Sawyer arrived in Lagos with the intention to proceed to Calabar, Nigeria, for a government conference. Some reports state that he was seeking the healing ministry of one of the Nigerian pastors, in Calabar, because he knew he was sick and possibly had Ebola Virus Disease (EVD). Mr. Sawyer's actions were reported to have been deliberate; as he reportedly evaded health warnings and the health protocols for the spread of infectious disease and lied to the staff at the hospital about not having contact with anyone who had EVD. Patrick Sawyer had nursed his sick sister who was confirmed to have EVD. She later succumbed to the disease. According to Patrick Sawyer's wife, he evaded contact with people at the Monrovia airport. In an interview with Mrs. Sawyer, she stated that her husband travelled to Nigeria because of the better health system. He knew he was ill and wanted to be treated (Mai-Duc [@CR16]). Patrick Sawyer was the index case, (the first known case) of EVD in Nigeria. Professionally, Patrick Sawyer was a lawyer and the National Public Health Officer for Arcelor-Mittal, headquartered in Luxembourg. Patrick Sawyer was a naturalized American citizen with his family residence in the state of Minnesota, although he was consulting for the government of Liberia, at the time (Mai-Duc [@CR16]). Information regarding Mr. Sawyer's education and social status is worthy of note, as it rules out the case of a person who may not know or understand the lethal and highly infectious nature of EVD. Against this backdrop, one can only assume that Patrick Sawyer, as the public health officer knew he was not supposed to travel and therefore should have quarantined himself to avoid exposing others to risk of contracting EVD.
Patrick Sawyer underscored the tension that might arise in balancing self-determination and autonomy of individuals and protecting the greater good of the society at large. Considering the social, health and psychological impact the Sawyer case had in Lagos and Nigeria at large, there is no doubt that the potential benefits for self-quarantine would certainly have outweighed by far, the individual rights of Mr. Sawyer. However, the debate on whether or not one should self-quarantine themselves is more complex than what many can imagine. For example, in the event that a person does not self-quarantine, important questions may arise about the ethical considerations for having that person under mandatory quarantine in an effort to protect the public from the spread of an outbreak? In the event that mandatory quarantine is considered, questions may equally arise regarding infringing and violating their individual rights? At face value, these questions and considerations may sound simple, yet too complex to resolve!
### West Point: Government of Liberia {#Sec5}
On August 20, 2014, the Liberian government, led by President Ellen Johnson-Sirleaf, imposed a 21 day quarantine in an effort to contain the EVD outbreak, on a sprawling area known as West Point. The Liberian government were at a loss as to how to contain the outbreak and the decision to cordon off this community, a week after the government had declared the outbreak a public health emergency, did not go well with the international community. West Point, a lower socio-economic slum of about 800,000 people, came under strict military enforced quarantine after a holding center for suspected Ebola disease victims was ransacked. Seventeen suspected EVD patients escaped; mattresses and infected materials were stolen. The government of Liberia felt the need for barbed wire and wooden checkpoints to go up around West Point. In a Time magazine interview, President Johnson-Sir leaf cited the attack on the holding center as the reason for the quarantine. She further went on to say that the attack "put the entire community at risk, hence the government had to protect them from themselves." (MacDougal [@CR15]). President Johnson-Sirleaf was making reference to the residents of West Point.
West Point residents struggle to eke out a living by trade and barter such as, selling their catch of fish for the day, to people in wealthier neighborhoods. Contrary to international advice, President Johnson Sirleaf, imposed mandatory quarantine enforced by the military. The Liberian government got caught up in the fear and the turmoil of the Ebola epidemic which led to violent clashes. There were many scuffles with the police and West Point residents threw bottles and stones at the authorities, attempting to escape the makeshift checkpoints. Liberian security forces opened fire on the rioting crowd and killed a 15-year-old, Shakie Kamara,[3](#Fn3){ref-type="fn"} wounding two other teenagers in the resulting melee. There was no autopsy performed on Shakie Kamara and the Ministry of Defence forces took possession of his body (MacDougall [@CR15]). The quarantine imposed area was cordoned off for a total of 10 days (Butty [@CR6]). On Friday, August 30th, the quarantine was lifted amongst much jubilation | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
Approximately 20% of human breast cancers possess an amplification of human epidermal growth factor receptor 2 (HER2), and this overexpression was previously correlated with aggressive tumor behavior and poor patient outcomes \[[@CR1]\]. HER2 (ErbB2, or HER2/neu) is a member of the HER tyrosine kinase receptor (TKR) family, which includes three other members: the epidermal growth factor receptor (EGFR or HER1), HER3, and HER4. Homo- and hetero-dimerization of ligand-bound HER receptors results in activation of multiple pathways, including the p44/42 mitogen-activated protein kinase (MAPK) and phosphatidylinositol 3-kinase (PI3K)/AKT pathways, which regulate cell proliferation and apoptosis \[[@CR2]--[@CR4]\]. HER2 is the preferred heterodimerization partner of the other HER receptors, although it does not have a known natural ligand. Its activation is mediated by homodimerization, or by ligand-mediated stimulation of another HER receptor through heterodimerization. Targeted therapies such as monoclonal antibodies or tyrosine kinase inhibitors (TKI) have provided a significant improvement in patient outcome by targeting HER2 or its dimerization partners. The monoclonal antibody trastuzumab and the TKI lapatinib have both been approved by the FDA and the EMA in combination with chemotherapy \[[@CR5], [@CR6]\], and both have proven efficacy in the clinical setting \[[@CR7], [@CR8]\]. However, resistance still occurs in patients because of the complexity, robustness and redundancy of the HER biological network \[[@CR9], [@CR10]\].
Obesity has been described as a risk factor not only for cancer development but also for a decreased sensitivity to cancer treatment \[[@CR11]--[@CR14]\]. Epidemiological studies have demonstrated that trastuzumab and lapatinib were less efficient in overweight and obese patients than in other patients in terms of free relapse survival and overall survival \[[@CR10], [@CR15]\]. Indeed, with a 10-year follow-up the overall survival of lean women treated with trastuzumab was 38% higher than for obese women. Moreover, several in vitro studies have demonstrated a decrease of efficacy of targeted therapies on breast tumor cells when cells are cultured in the presence of adipocytes or adipocyte-conditioned medium (CM) \[[@CR16]--[@CR19]\]. The main mechanisms identified for obesity-mediated resistance of cancer cells to anticancer agents have been described in vitro or in mice and include alterations of the intracellular signaling pathway PI3K/AKT/mTOR \[[@CR16]\], inhibition of cell cycle blockade and inhibition of apoptosis \[[@CR20]--[@CR22]\]. In a previous study, our team showed that adipocyte-secreted factors decreased the efficacy of trastuzumab on BT-474 and SKBR-3 breast cancer cell lines \[[@CR16]\]. More recently we have shown that MVP could be involved in adipocyte-induced resistance of breast cancer cells to doxorubicin \[[@CR23]\].
Several mechanisms of resistance have been described specifically for anti-HER2 targeted therapies. These include i) the expression of a truncated form of HER2 called p95HER2 unable to bind trastuzumab \[[@CR24]\] ii) an alteration in ADCC mechanisms \[[@CR25]\] iii) a defect in cell cycle arrest and/or apoptosis \[[@CR26]\] iv) an alteration in phosphorylation of intracellular signaling pathways \[[@CR27]\] v) the action of alternative tyrosine kinase protein activation in case of HER2 blockade \[[@CR17], [@CR28]\] vi) drug efflux through efflux pumps such as P-gp \[[@CR29]\] and vii) an upregulation of estrogen receptors (ER) \[[@CR30]\].
In this study, we analyzed the role of proximal adipose tissue in the resistance of breast cancer cells to small molecule targeted therapies such as the TKI lapatinib. Lapatinib is a small molecule that binds to the intracellular domain of the TKR and inhibits the activation of downstream signalization pathways. Lapatinib shares some of the mechanisms of resistance described for anti-HER2 targeted therapies. However, since it binds to the intracellular domain of HER2, the truncation of HER2 into p95HER2 and alterations in ADCC mechanism should not modify its activity, we did not study these mechanisms as a potential mechanism of resistance and focused our analyses on cell cycle arrest. Indeed, the cytotoxic effect of lapatinib has been described to modify the activation of the PTEN/AKT/mTor pathway and to block the cell cycle in G1 phase \[[@CR31]\]. Several proteins are required for cell cycle progression, such as P27, AKT, cyclin D1 and E2F3. Phosphorylated AKT is involved in cell cycle progression by phosphorylating P27, thereby preventing cell cycle blockade. The non-phosphorylated form of P27 inhibits the action of cyclins, while E2F3 is implicated in cyclin D1 gene transcription.
After demonstrating the reduction of cell cycle blockade induced by lapatinib in the presence of adipocyte-conditioned medium, we reproduced the protective effect of adipocyte-secreted factors on tumor cells against lapatinib, according to studies carried on other compounds \[[@CR16], [@CR20], [@CR32]--[@CR34]\] and investigated the effect of adipocyte-conditioned medium on cell proliferation. In order to investigate whether the protective effect of adipocyte-secreted factors is dependent on HER2 expression, we explored the lapatinib-induced cytotoxic effect on different breast cancer cell lines in the presence or absence of adipocyte-conditioned medium. We reproduced these results in vivo in SCID mice using patient derived normal human adipose tissue. To understand the mechanisms of resistance to lapatinib induced by the proximity of adipocytes and to identify the different agents involved in these mechanisms, we performed different physical and chemical treatments on the adipocyte-conditioned media. In parallel, we investigated alterations occurring on breast tumor cells following the contact with adipocyte-conditioned media and the exposure to lapatinib, both at transcriptional and protein levels. Finally, we used pharmacological agents to modify the metabolism of adipocytes in order to determine the possibility to overcome adipocyte-induced resistance of tumor cells to lapatinib.
Methods {#Sec2}
=======
Cell culture {#Sec3}
------------
The preadipocyte cell line 3T3, the fibroblast cell line NIH3T3 and the tumor cell lines MDA-MB-453, MDA-MB-361, MDA-MB-231, and MCF-7 were cultured in complete DMEM medium (Life technologies), supplemented with 10% fetal calf serum (FCS), 2 mM L-glutamine, 100 U/mL penicillin and 100 μg/mL streptomycin). The tumor cell linesBT-474 and SKBR3 were cultured in complete RPMI medium with the same supplementation as DMEM. All cells were cultivated at 37 °C in presence of 5% CO~2~.
To induce the differentiation of 3T3 cells, confluent cells were incubated in differentiation medium (DMEM supplemented with 10% FCS plus 50 nM insulin (Sigma, 259,278)) up to 14 days. During the two-week incubation, pre-adipocytes differentiated into adipocytes (80--90% of the cells are differentiated after 14 days) and accumulate lipid droplets in their cytoplasm. The CM from pre-adipocytes (3T3-CM) and adipocytes (\#3T3-CM) were harvested, centrifuged at 300 g for 5 min and either directly used or stored at − 20 °C before use. The control medium for these CM is complete DMEM (medium) for 3T3-CM and differentiation medium (\#medium) for \#3T3-CM.
\#3T3 cells were incubated with 5 μM salbutamol, 18 μM terbutaline, 0,1 μM isoprenaline, 29,6 μM dobutamine, 45 μM propranolol, 45 μM atenolol, 15 μM insulin, 100 μM acipimox and 20 μM etomoxir.
Protein denaturation, exosome isolation and lipid sequestration {#Sec4}
---------------------------------------------------------------
The \#3T3-CM was heated at 96 °C during 1 h in order to denature the proteins.
Exosomes were isolated from the CM by differential centrifugation. In brief, the CM was centrifuged at 3000 g for 30 min to remove cell debris then at 10,000 g for 60 min at 4 °C to separate vesicles from exosomes. The exosomes and the soluble factors were separated by ultracentrifugation at 100,000 g for 90 min. We evaluated the purification using the Nanosight® device that detects and quantifies the exosomes with a laser at 405 nm.
Cytotoxicity MTT assay {#Sec5}
----------------------
BT-474, SKBR3 and MCF-7 cells were seeded in 96 wells plates at 20,000; 8000; 3000, cells per well respectively, in 50 μL media. The 3T3-CM, \#3T3-CM, human adipocyte line hMAD-CM (hMADs-CM) and human fibroblast NIH3T3-CM (NIH3T3-CM) were added to the wells. The next day, drugs were added to the wells at a range of concentrations and cells were incubated for 72 h at 37 °C, 5% CO~2~. MTT was then added in each well and incubated for an additional 4 h. The supernatant was discarded, and a solution composed of isopropanol/H~2~O/HCl (90/9/1, v/v/v) was added. The optical density was determined at 540 nm using Multiskan device.
Cell cycle analysis {#Sec6}
-------------------
BT-474 cells seeded in 6 well | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION
============
Colorectal cancer is one of the most common malignant tumors in the world. In Korea, the incidence of colorectal cancer has been increasing since 2000, as the lifestyle has become westernized. Accordingly, the number of colorectal cancer surgeries has also increased precipitously \[[@B1]\].
Postoperative ileus is one of the most common complications after abdominal surgery \[[@B2]\]. Postoperative ileus increases abdominal discomfort, pain, the number of nosocomial infections and the length of hospital stay and, as a result, can lead to an overall increase in the medical costs. The incidence of postoperative ileus in laparoscopic surgery is lower than that in conventional open surgery. However, the surgical extent and dissection area are wide in laparoscopic colorectal cancer surgery, which could be a risk for postoperative ileus \[[@B3]\]. Thus far, various treatments have been attempted to prevent and shorten the duration of ileus. Choi and O\'Connell \[[@B4]\] reported that it was safe to start early feeding as soon as possible after conventional open colorectal surgery and that the early-feeding group had a shorter hospital stay than the late-feeding group. Stewart et al. \[[@B5]\] also reported that early feeding after surgery could decrease postoperative ileus and shorten hospital stay. However, approximately 20% of the patients showed difficulties with or did not tolerate early feeding \[[@B5]\]. Thus, as an alternative to early feeding, \"sham feeding\" by gum chewing was introduced and was found to lead to an early recovery of intestinal motility and shortened hospital stay \[[@B6]\].
Gum chewing promotes the cephalic-vagal reflex, which is activated when eating food, and it is thought to promote the secretion of hormones related to intestinal motility \[[@B7]\]. However, few studies have reported on the relationship between gum chewing and recovery from postoperative ileus after laparoscopic surgery. In this study, we aimed to examine the effect of gum chewing after laparoscopic colorectal cancer surgery.
METHODS
=======
We reviewed the medical records of patients who underwent laparoscopic colorectal cancer surgery from January 2012 to November 2012 at Incheon St. Mary\'s Hospital, The Catholic University of Korea School of Medicine.
In this study, patients who needed to have a stoma (temporary or permanent) made or had postoperative complications such as leakage were excluded. We divided the patients into 2 groups: group A consisted of 67 patients who did not chew gum; group B consisted of 65 patients who chewed gum. Patients in the gum-chewing group were asked to chew gum, starting at the first postoperative day, 3 times a day, approximately 10-20 minutes at a time, until normal feeding was resumed. Postoperative care of both groups was the same and was in accordance with the institution\'s clinical pathway program with the exception of gum chewing. We analyzed the short-term clinical outcomes between the two groups to evaluate the effect of gum chewing. In this study, P \< 0.05 was considered statistically significant.
Patients were considered appropriate for discharge if they passed flatus, passed urine freely, ambulated independently, and tolerated a diet and if pain was managed with oral medication, the patient was willing to leave the hospital and had adequate home support, and there was no evidence of postoperative complication. These factors all contributed to the length of the postoperative hospital stay, and as mentioned above, patients who had postoperative complications were excluded in this study.
RESULTS
=======
No significant differences were observed between the 2 groups in terms of patient\'s demographics, American Society of Anesthesiologists physical status score, body mass index (BMI) or prior history of abdominal surgery ([Table 1](#T1){ref-type="table"}). The types of surgical procedures for colorectal cancer were not significantly different between the 2 groups. The first passage of gas was slightly earlier in group B, but did not show a significant difference. However, the length of hospital stay was 6.7 days in group B, which was significantly shorter than that in group A, 7.3 days (P = 0.018) ([Table 2](#T2){ref-type="table"}).
DISCUSSION
==========
Normal gastrointestinal motility is maintained through complex mechanisms involving the central nervous system, gastrointestinal system, hormones, neurotransmitters and inflammatory reactions \[[@B8]\]. Postoperative gastrointestinal motility is normally recovered within several hours for the small intestine, 24-48 hours for the stomach, and 3-5 days for the large intestine \[[@B9]\]. Postoperative ileus is one of the most common complications after abdominal surgery \[[@B2]\]. Although its pathogenic mechanism is still controversial, factors such as overstimulation of the sympathetic nervous system, increased blood catecholamine levels, electrolyte imbalance, irritation of the peritoneum or retroperitoneum, use of narcotic analgesics and type of surgical procedure are thought to contribute to postoperative ileus \[[@B10], [@B11]\].
Recently, the importance of neurohormonal factors has been highlighted, and the splanchnic nerve is known to play an important role in the pathogenic mechanism of ileus \[[@B12]\]. After surgery, vasoactive intestinal polypeptide levels increase, which directly suppresses the contraction of the smooth muscles of the small intestine \[[@B13]\], but the secretion of hormones that promote intestinal motility, such as gastrin, neurotensin and pancreatic polypeptide, decreases \[[@B11]\]. Pain increases the secretion of substance P, which suppresses intestinal motility \[[@B14], [@B15]\], and the use of analgesics affect the enteric nervous system, increasing enteric input and decreasing gastrointestinal motility and peristalsis.
In addition a large surgical site has been shown to lead to severe tissue damage, which, in turn, activates local inflammatory factors, thereby causing ileus \[[@B16]\]. For this reason, the incidence of postoperative ileus in laparoscopic surgery is lower than that in conventional open surgery \[[@B3]\]. Rapid recovery of intestinal motility after abdominal surgery could decrease the length of postoperative hospital stay and the medical costs.
Gum chewing is a type of \"sham feeding\" that activates the cephalic-vagal reflex in a manner similar to that when eating food and stimulates the motility of the duodenum, stomach and rectum. Gum chewing increases the serum concentrations of gastrin, neurotensin and pancreatic polypeptide, stimulates the motility of the duodenum, stomach and rectum, and promotes intestinal motility \[[@B17]-[@B19]\]. Several studies reported that the first passage of gas was faster and the length of postoperative hospital stay were significantly less in the gum-chewing group; also, rapid recovery of intestinal motility was shown in the gum-chewing group \[[@B6], [@B20]\].
Although we used feeding protocols that commenced with sips of water on the second postoperative day, with the diet being escalated only after passage of flatus, there has been a move toward early postoperative feeding regimes as part of enhanced recovery after surgery (ERAS) program. The ERAS program features a push toward earlier gastrointestinal recovery and discharge, and some patients feel discomfort with ERAS feeding protocol. In this case, we think that gum chewing would lead to improved gut and functional recovery and make patients feel more comfortable.
This study had some limitations. First, although the data were collected prospectively, this study was a retrospective study. Second, the study volume was too small to evaluate the exact effect of sham feeding. A larger scale prospective randomized study is needed to evaluate the exact effect of sham feeding on the recovery from laparoscopic colorectal cancer surgery. Third, the use of analgesics could affect the recovery of intestinal motility, so the effect of analgesics must be taken into consideration \[[@B21], [@B22]\]. However, all patients in this study used patient-controlled analgesia; unfortunately we were not able to determine the correlation between the use of analgesics and recovery of intestinal motility. Fourth, we recommend patients for discharge according to the criteria discussed above, but some refused to be discharged from the hospital for the reasons other than medical reasons; thus, the length of postoperative hospital stay might have been influenced by that decision.
Gum chewing is extremely easy and very cost-effective. We also think that gum chewing can help prevent dehydration of the mouth. In addition, the process of chewing, the sweet taste, and the smell of gum satisfied the patient\'s appetite, leading to increased patient comfort.
In conclusion, this study showed that the length of the postoperative hospital stay was shorter in the gum-chewing group, and we think that gum chewing is an easy and cost-effective method to reduce the length of the postoperative hospital stay for laparoscopic colorectal cancer surgery. In future studies, we expect to elucidate the effect of gum chewing on the postoperative recovery more clearly.
No potential conflict of interest relevant to this article was reported.
######
Demographics of patients
Values are presented as mean ± standard deviation or number (%).
ASA, American Society of Anesthesiologists.
######
Short-term clinical outcomes between the two groups
Rt, right; Lt, left.
| {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-materials-10-00304}
===============
Controlled drug-delivery systems were designed to deliver drugs at desirable times and/or to specific sites for achieving a therapeutic purpose \[[@B1-materials-10-00304]\]. For developing drug-delivery carriers, the major challenges were preparation of a suitable biomaterial that could ensure an excellent drug-releasing rate at the required dose to a target location, while also being nontoxic with good biocompatibility \[[@B2-materials-10-00304]\]. In recent years, considerable attention has been paid to the synthesis of intelligent hydrogels for the purpose of drug delivery because of their responsiveness to external stimuli such as pH, solvent composition, ionic strength, temperature and light, and other factors \[[@B3-materials-10-00304],[@B4-materials-10-00304]\].
Temperature- and pH-sensitive hydrogels represent the most investigated class of intelligent hydrogels, and have been used extensively \[[@B5-materials-10-00304],[@B6-materials-10-00304],[@B7-materials-10-00304],[@B8-materials-10-00304],[@B9-materials-10-00304]\]. Variations in pH occur at several body sites, such as the gastrointestinal tract, blood vessels, and vagina, and therefore suitable pH- and temperature-responsive hydrogels are needed for drug release. Temperature- and pH-sensitive hydrogels can protect a drug from enzymatic hydrolysis or being destroyed by stomach acid, and therefore they can be considered as the ideal candidate for a drug-delivery system \[[@B10-materials-10-00304]\]. Nevertheless, it should be noted that most traditional temperature- and pH-sensitive hydrogels generally have several limitations. Firstly, the traditional hydrogels usually suffer from poor biodegradability and biocompatibility. Secondly, the drug-loading and encapsulation efficiency are limited. Finally, another serious limitation of the normal hydrogel as a potential drug carrier is its poor sustained release capability \[[@B11-materials-10-00304]\]. Therefore, for the preparation of hydrogels possessing nontoxicity, biocompatibility, high drug-loading and encapsulation efficiency, and controlled drug delivery, it is very necessary to change their structure.
In recent years, natural polymer-based hydrogels have aroused broad interests because of their unique adjustable structure, and properties such as the low cost and good biodegradability and biocompatibility \[[@B3-materials-10-00304],[@B12-materials-10-00304],[@B13-materials-10-00304],[@B14-materials-10-00304],[@B15-materials-10-00304]\]. Hemicellulose, a renewable plant polysaccharide, ranks second to cellulose in terms of lignocellulosic biomass content, and accounts for 1/4 to 1/3 of agriculture residues \[[@B16-materials-10-00304]\]. Due to the low cost and good biodegradability and biocompatibility, the high value-added utilization of hemicellulose has attracted much attention \[[@B17-materials-10-00304]\]. Xylan, as the most common hemicellulose, has unique physiological properties, such as inhibition of cell mutation; promotion of cell adhesion, proliferation, and innate immunological defense; and anticancer effects. These properties make xylan suitable for preparation of hydrogels used in drug release and biomedical engineering \[[@B8-materials-10-00304],[@B18-materials-10-00304]\]. Moreover, hydroxyl and carboxylic groups on the xylan chains provide more opportunities for chemical or enzymatic modifications, while maintaining their native structure. Especially, the introduction of carboxyl groups and unsaturated double bonds can improve the pH response performance and the reaction efficiency of hemicellulose-based hydrogels, thereby extending their application in drug release. Maleic anhydride (MAH), as a small molecule of multifunctional groups, can react chemically with carbohydrate hydroxyls to form polymeric intermediates--MAH derivative, which contains both carboxyl groups and unsaturated double bonds. The carboxyl groups and double bonds in these derivatives can improve the pH response and adjust the cross-linking density of hydrogels and thus can be used as functional groups in drug delivery \[[@B19-materials-10-00304],[@B20-materials-10-00304]\]. Therefore, MAH-modified xylan (MAHX) can also be imparted with potential applications in the preparation of hydrogels for drug delivery.
In this work, new pH- and thermoresponsive hydrogels were prepared by the cross-linking polymerization of MAHX with *N*-isopropylacrylamide (NIPAm) and acrylic acid (AA) using *N*, *N*'-methylene-bis-acrylamide (MBA) as the cross-linker under UV irradiation to form MAHX-*g*-P(NIPAm-co-AA) hydrogels, and their application in the drug-release system was studied. The aim of this study was to improve the encapsulation efficiency and regulate the drug controlled release behaviors of hydrogels by changing the degree of substitution (DS) of MAHX and the hydrogels' structure. The physical and chemical properties of hydrogels were characterized by the swelling ability, the lower critical solution temperature (LCST), scanning electron microscopy (SEM) and Fourier-transform infrared spectroscopy (FTIR). Acetylsalicylic acid is widely used as a model compound because of its prevention of and therapy for thrombotic diseases, and it represents structures which form parts of many drug substances (benzene ring and carboxyl group) \[[@B21-materials-10-00304]\]. Theophylline, belonging to alkaloids, is a bronchodilator widely used in asthma therapy, and can exist either as the anhydrate or the monohydrate depending on the conditions under which it is stored \[[@B22-materials-10-00304]\]. The two compounds were applied as drug models for the study of drug-delivery performance of prepared hydrogels. Moreover, the cytocompatibility of MAHX-based hydrogels was studied by MTT methods.
2. Experimental Section {#sec2-materials-10-00304}
=======================
2.1. Materials {#sec2dot1-materials-10-00304}
--------------
Beech wood xylan (*M*~w~ of 130,000 g·mol^−1^) was obtained from Sigma Aldrich, Germany. 1-Butyl-3-methylimidazoliumchloride (\[BMIM\]Cl) ionic liquids (ILS) were bought from Lanzhou Greenchem ILS, LICP. CAS (Lanzhou, China). MBA (98%) and acetylsalicylic acid (99%) were supplied by Aladdin Reagent Company Limited (Shanghai, China). LiOH, maleic anhydride (A. P.), and theophylline were purchased from Shanghai Macklin Biochemical Co., Ltd. (Shanghai, China). NIPAm (98%), AA (98%), 2,2-dimethoxy-2-phenylacetophenone (DMPA, 99%) *N*-methyl pyrrolidone (NMP, 99%) were obtained from Guangzhou Chemical Reagent Factory. The NIH3T3 cells were supplied by School of Chemical Engineering, Jinan University (Guangzhou, China), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide (MTT) was supplied by Sigma-Aldrich (St. Louis, MO, USA), and fetal bovine serum (FBS) was supplied by SiJiqing Bio-engineering Material Company (Hangzhou, China). All chemical reagents were analytical reagent grade.
2.2. Preparation of MAHX or MAHX-Based Hydrogels {#sec2dot2-materials-10-00304}
------------------------------------------------
### 2.2.1. Preparation of MAHX {#sec2dot2dot1-materials-10-00304}
MAHX was synthesized according to our previous work \[[@B23-materials-10-00304]\]. Dry xylan (0.33 g) was dissolved into \[BMIM\]Cl ionic liquids (2.5%, *w*/*w*) to form the mixed solution. The mixture was stirred at 90 °C for 4 h under the protection of nitrogen to guarantee complete dissolution of xylan. Then, 0.0025 g of LiOH and the required amount of MAH ([Table 1](#materials-10-00304-t001){ref-type="table"}) were added and stirred for 80 min at 80 °C. After the required time, the mixture was cooled to room temperature, precipitated with 95% (*w*/*w*) ethanol, and centrifuged at 4000 rpm for 30 min. The precipitate was washed by 95% (*w*/*w*) ethanol. In the end, obtained MAHX was dried at 45 °C in a vacuum oven for 16 h. The DS of MAHX was determined according to the method in our previous work \[[@B23-materials-10-00304]\].
### 2.2.2. Preparation of MAHX-Based Hydrogels {#sec2dot2dot2-materials-10-00304}
MAHX-based hydrogels were synthesized by the cross-linking polymerization under UV irradiation. The detailed synthesis conditions are summarized in [Table 1](#materials-10-00304-t001){ref-type="table"}. Briefly, MAHX with different DS (in [Table 1](#materials-10-00304-t001){ref-type="table"}) was dissolved in distilled water at a concentration of 5% (*w*/*w*) and stirred until MAHX was completely dissolved. Under nitrogen atmosphere, a certain amount of N | {
"pile_set_name": "PubMed Central"
} |
We seek to define the gene regulatory networks that govern heart development and disease. Recently, we discovered that the hearts of neonatal mice can fully regenerate after partial surgical resection or myocardial infarction, but this capacity is lost early in life. We are currently exploring the molecular underpinnings of the neonatal regenerative response of the heart, with the long-term goal of discovering combinations of genes and drugs that promote cardiac repair and regeneration. Promotion of cardiomyocyte proliferation through activation of the Yap pathway and modulation of epicardial signaling systems have shown efficacy in enhancing these processes. We are also optimizing strategies for reprogramming of cardiac fibroblasts toward a cardiac cell fate as a means of replacing cardiomyocytes in injured hearts. We have shown that four transcription factors can cooperatively reprogram fibroblasts into cardiac-like myocytes in vitro, albeit relatively inefficiently. Forced expression of these factors in dividing non-cardiomyocytes in mice also allows reprogramming into functional cardiac-like myocytes, improves cardiac function and reduces adverse ventricular remodeling following myocardial infarction. Screens for small molecules and microRNAs that enhance cardiac reprogramming have revealed new insights into the mechanistic basis of this process and have allowed further optimization in human cells. Opportunities and obstacles in the path toward mammalian cardiac regeneration will be discussed.
| {
"pile_set_name": "PubMed Central"
} |
**Purpose:** Currently, the outcomes of aesthetic facial treatments are limited to patient-reported satisfaction and patient, clinician, or observer rating scales. These assessments are highly subjective and incapable of evaluating skin function and structure below the superficial epidermis. The purpose of this study was to determine the practicality of non-invasive 3D imaging and 0.33mm microbiopsy methods for the objective assessment of facial skin following laser treatment. In addition, we evaluatedskin repair following microbiopsy extraction.
**Methods:** Twelve patients received a single facial treatment with a 1470nm/2940nm laser. Assessments were performed before treatment, seven days, three weeks, and three months post-treatment. VISIA imaging was used to assess skin texture. High-resolution, non-invasive 3D skin imaging- ultrasonography and optical coherence tomography (OCT)- were used to measure epidermal/dermal thickness, blood flow, surface roughness, wrinkle depth and attenuation coefficient. 0.33mm diameter microbiopsies were collected for histological and gene expression evaluation. In order to assess scar formation following microbiopsy, fifteen subjects were randomized to receive no biopsy, biopsy on the left nasolabial fold, or biopsy on the right nasolabial fold. Six blinded raters assessed subject facial photos at baseline, one month, and three months post-biopsy to evaluate for a visualized scar.
**Results:** The non-invasive measurements were able to detect significant changes after treatment in a variety of parameters, including improvements in skin surface, a decrease in attenuation coefficient at 3 weeks (p\<0.05), and an increase in blood flow 0.5mm to 0.7mm deep during the 5 day- to 3 week-period following treatment. (p\<0.05). Microbiopsy analysis revealed an increase in epidermal hyaluronic acid expression assessed by immunostaining and increased expression of inflammatory genes IL-1 beta at seven days post-treatment compared to untreated or three months post-treatment. No subjects exhibited scar formation post-biopsy. There was no visible evidence at the biopsy site seven days after the procedure, and OCT imaging showed a complete closing of the column created by the biopsy punch approximately 48 hours post-biopsy. At both one-month and three-months post-biopsy, six blinded photography reviewers were unable to determine whether a scar was present based on statistical analysis.
**Conclusions:** Non-invasive imaging successfully provides objective measurements of skin structure, texture, and blood flow to assess the effectiveness of facial skin rejuvenation treatments. Furthermore, microbiopsies can objectively evaluate the effects of these treatments at molecular level without scarring or pain. A single treatment with the 1470nm/2940nm laser significantly improved skin appearance at three weeks following treatments without significant changes in the tissue at the molecular level, as assessed by microbiopsy.
| {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-nutrients-12-01872}
===============
Cerebrovascular diseases, such as stroke, and heart diseases, including angina pectoris and myocardial infarction, are the leading causes of death worldwide. Even for patients who recover, a major economic burden is placed on both the patient and society, as patients must undergo long-term treatments and extended bed rest. Hence, there is a need to improve the vascular function of patients in an effort to prevent vascular diseases. Accordingly, our laboratory has been studying the effects of food materials on vascular function and attempting to elucidate the mechanisms through which functional foods may prevent vascular disease \[[@B1-nutrients-12-01872],[@B2-nutrients-12-01872],[@B3-nutrients-12-01872]\].
Blood vessels consist of three layers: the outermost tunica adventitia, the tunica media, and the innermost tunica intima, which contains vascular endothelial cells (VECs). Nitric oxide (NO) is released from VECs to protect blood vessels by regulating their contraction and relaxation and by preventing thrombus formation caused by attachment of white blood cells, and other blood components, to the vascular endothelium \[[@B4-nutrients-12-01872],[@B5-nutrients-12-01872]\]. Meanwhile, if VECs become damaged by oxidative stress induced by reactive oxygen species, or oxidised low-density lipoprotein (LDL), the production of NO is suppressed, thereby increasing the risk of cardiovascular diseases \[[@B6-nutrients-12-01872]\]. Accordingly, improving NO production by VECs is critical for protecting blood vessels. In our previous research, *Raphanus sativus* cv. Sakurajima Daikon (Sakurajima radish; [Figure 1](#nutrients-12-01872-f001){ref-type="fig"}A) extracts were found to induce NO production, and its active ingredient was identified as trigonelline ([Figure 1](#nutrients-12-01872-f001){ref-type="fig"}B) \[[@B1-nutrients-12-01872]\]. Sakurajima radish, produced in Kagoshima, Japan, is famously known as the world's largest radish cultivar \[[@B7-nutrients-12-01872],[@B8-nutrients-12-01872]\]. However, no studies have yet evaluated the concentration of trigonelline that becomes absorbed and subsequently transferred into the blood following human consumption of Sakurajima radish. Moreover, although the bioregulatory functions of trigonelline, including improved hypertension, diabetes, and central nervous system disease, have been reported \[[@B9-nutrients-12-01872],[@B10-nutrients-12-01872]\], the effects of Sakurajima radish on human endothelial function have not been characterised.
Therefore, in this study, we evaluated trigonelline contents in various plants, including several varieties of Sakurajima radish, including 'Sakurajima Ogojo', which is a smaller F1 variety with a high germination rate cultivated in Kagoshima Prefecture; the 'Native farm species', which is a larger variety with a germination rate of approximately 75% \[[@B11-nutrients-12-01872],[@B12-nutrients-12-01872]\]; and 'Others', which represents other varieties obtained from the markets. Furthermore, we assessed the effects of cooking and processing Sakurajima radish on trigonelline and conducted the first trial of Sakurajima radish in humans.
2. Materials and Methods {#sec2-nutrients-12-01872}
========================
2.1. Materials {#sec2dot1-nutrients-12-01872}
--------------
Sakurajima radish, Aokubi radish (*Raphanus sativus var. Longipinnatus*), coffee cherry (*Coffea arabica*), and squash (*Cucurbita maxima*), cultivated in Kagoshima, Japan, were used in this study. Different varieties of Sakurajima radish were obtained, including 'Sakurajima Ogojo', an F1 variety with lower occurrence of hollow cavity and pores; 'Native farm species', are the largest varieties and have been inherited for many years; and 'Others' which represented a mixture that do not classified other varieties. Seeds of Sakurajima radish were obtained from the Japan Agricultural Cooperative (Kagoshima, Japan). Porcine VECs were purchased from Cosmo Bio Co., Ltd. (Tokyo, Japan). Trigonelline and methanol for high-performance liquid chromatography (HPLC) were purchased from FUJIFILM Wako Chemical Corporation (Osaka, Japan).
2.2. Quantification of Trigonelline {#sec2dot2-nutrients-12-01872}
-----------------------------------
The roots and leaves were separated and cut into small pieces. The roots were processed using a homogeniser and lyophilised to generate powdered raw material. One mL of methanol/H~2~O/acetic acid solvent (95.0%/9.5%/0.5%, *v*/*v*/*v*) was added to 25 mg raw material and mixed in a vortexer, followed by 5 min of ultrasonic treatment. The sample was centrifuged twice at 1600× *g* for 10 min at 4 °C (cooling centrifuge 3500; KUBOTA Corporation Co., Ltd., Tokyo, Japan); the supernatant was then collected and concentrated by drying. The dry sample material was weighed and dissolved in an appropriate solvent prior to use in experiments.
After filtration through a 0.45-μm filter (Toyo Roshi Kaisha, Tokyo, Japan), the samples were analysed by HPLC with an ultraviolet-visible adsorption detector and a photodiode array detector (Extrema, Jasco, Tokyo, Japan). The conditions for HPLC analysis were as follows: the C18 reversed-phase column (COSMOSIL 5C~18~-AR-300, 5 μm, 4.6 mm I.D., 250 mm; NACALAI TESQUE, INC., Kyoto, Japan) was maintained at 40 °C, and detection was conducted at 265 nm. The mobile phase consisted of 10 mM phosphoric acid solution (A) and methanol (B). We used a gradient of 0 min with 10% solution B, and 0--10 min with a direct increase in solution B of up to 40%. The flow rate was 0.7 mL/min, and the injection volume was 10 μL.
2.3. Cooking and Processing {#sec2dot3-nutrients-12-01872}
---------------------------
After harvesting Sakurajima radish, 1 g of the washed product was weighed to obtain a raw sample. The samples used for analysis of the effects of boiling were sliced thinly and boiled at 100 °C for 1, 10, 20, and 30 min; whereas the samples used for analysis of the effects of high-temperature cooking were baked in an oven or fried in oil for 1, 5, 10, 15, and 20 min at 180 °C. The samples used for analysis of the effects of freezing were stored in a deep freezer at −80 °C after initial freezing in liquid nitrogen. In addition, salted samples were immersed in 5% salt for 24 h, and pickled samples were boiled with vinegar (1 mL), water (1 mL), sugar (0.2 g), and salt (0.06 g; pH 3.8) for 24 h.
2.4. First Trial of Sakurajima Radish Examining the Vasodilator Property in Humans {#sec2dot4-nutrients-12-01872}
----------------------------------------------------------------------------------
Fourteen healthy volunteers (seven men and seven women, age 33.9 ± 6.7 years) participated in this study. Sakurajima radish (native species) was consumed at 170 g/day (trigonelline content: 61.2 mg), which was assumed to be sufficient for promoting NO production from VECs \[[@B1-nutrients-12-01872]\]. Other lifestyle factors were not altered. The intake period was ten consecutive days, and participants were permitted to either eat the entire 170-g portion, which was packaged using a vacuum packer (MINI JUMBO, RO18765-1; Nichiwa Electric Corporation, Tokyo, Japan), at once or divide it into multiple servings. Additionally, there were no limitations to the method used to cook the radish. Blood pressure (BP), pulse, and weight were measured before consumption and then again after ten days of consumption of Sakurajima radish. Blood samples were collected before consumption and then again after ten days of consumption of Sakurajima radish, and general biochemical tests (white blood cell \[WBC\]; haemoglobin \[Hb\]; platelet \[Plt\]; LDL cholesterol \[LDL-C\]; high-density lipoprotein cholesterol \[HDL-C\]; triglyceride \[TG\]; fasting plasma glucose \[FPG\]; uric acid \[UA\]; blood urea nitrogen \[BUN\]; creatinine \[Cr\]; sodium \[Na\]; potassium \[K\]; chloride \[Cl\]; aspartate transaminase \[AST\]; and alanine transaminase \[ALT\]) were performed. For analysis of vascular endothelial function, flow-mediated dilation (FMD) values were determined using an ultrasonic diagnostic imaging device (UNEXEF18VG; UNEX Co., Nagoya, Japan), which is an automated edge detection system for measurement of brachial artery diameter. FMD represents endothelium-dependent, largely NO-mediated, dilatation of conduit arteries in response to an imposed increase in blood flow and shear stress and is a tool for examining the pathophysiology of cardiovascular diseases to potentially identify individuals who are | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
Nonalcoholic fatty liver disease (NAFLD) is characterized by the excessive accumulation of hepatic lipid and hepatic steatosis in the absence of alcoholism \[[@B1]\]. It is emerging as the most common cause of liver diseases, with a global prevalence of 25% approximately. More importantly, NAFLD is considered to be a dangerous complication of nonalcoholic steatohepatitis (NASH), advanced fibrosis, cirrhosis, and hepatocellular carcinoma, with evidence of NAFLD at markedly increased risk of adverse outcomes, including liver-specific morbidity and mortality \[[@B2]\]. Recently, increases in high-fat diet (HFD) intake and thus induced obesity have demonstrated parallelism with a global increase in NAFLD. Furthermore, studies evidence that NAFLD contributed to the characteristics of a series of diseases, such as metabolic syndromes, like type II diabetes mellitus, hypertension, and cardiovascular events, making NAFLD a major public health concern worldwide \[[@B3], [@B4]\].
Although the presence of steatosis is a requisite and typical for NAFLD, the development of NAFLD is a complex process that is affected by numerous mechanisms including genetic, metabolic, lifestyle, and gut microbiome \[[@B5]\]. They lead to increased metabolic substrate (mainly lipids and carbohydrates) delivery to the liver and increased visceral adipose tissue, featured with the excessive accumulation of free fatty acids (FFA), triglycerides (TG), and proinflammatory mediators. These changes alter lipid and glucose metabolism, produce insulin resistance, and create a proinflammatory milieu that induce oxidative stress and modify cell-cell crosstalk, triggering cell injury, apoptosis, or cell death \[[@B6]\]. Variable activation of these processes and the consequent metabolic response determines the development of disease phenotype and its progression to fibrosis and cirrhosis. Lifestyle intervention is recommended for the majority of NAFLD patients, and its benefit is also witnessed by a wide range of clinical studies \[[@B7], [@B8]\]. However, confined to the difficulties of long-term exercise, pharmaceutical treatment aimed at alleviating hepatic steatosis or protecting the liver from additional injury is necessary.
To expand the range of pharmaceutical options for NAFLD treatment, recent studies also focus on identifying active agents or herbal extracts that can ameliorate NAFLD. With a multi-ingredient and multipath pharmacological action, traditional Chinese medicine (TCM) is compatible with the complex pathogenesis of NAFLD, which can be used to mitigate NAFLD and associated diseases \[[@B9]\]. Kangtaizhi granule (KTZG) is a Chinese medicine compound prescription that is composed of eight kinds of TCM, Radix Puerariae, Rhizoma Dioscoreae, Sophora japonica oyster, mulberry leaves, Polygonatum odoratum, mulberry, and papaya. Some of these eight TCM are partly consumed as a part of the human diet with abundant bioactivities. Our previous study demonstrated that KTZG has the efficacy to protect life from NAFLD, with the ability to ameliorate abnormal liver function and lipid metabolism \[[@B10]\]. Although the effect of KTZG in the clinic has been confirmed, the clear mechanisms under this efficacy are rather elusive. In this study, with network pharmacology and experiment validation in high-fat diet rats and FFA-treated HepG2 cells, we aimed to provide basic data for a better understanding of the pharmacological effects and potential mechanisms of KTZG in preventing of NAFLD.
2. Materials and Methods {#sec2}
========================
2.1. KTZG Bioactive Compounds and NAFLD-Related Target Screening {#sec2.1}
----------------------------------------------------------------
For the eight herbs that make up KTZG, the Traditional Chinese Medicine Systems Pharmacology (TCMSP) database, TCM-Mesh database, and Traditional Chinese Medicine Integrative Database (TCMID) database were used to obtain the related chemical information of these eight herbs, including the bioactive compound name; molecular weight; structural formula; absorption, distribution, metabolism, and elimination (ADME) parameters; and CAS ID. Based on the screened compounds in KTZG, compound-related targets were predicted using the SwissTargetPrediction and STITCH online databases. Canonical SMILES of each compound was searched from PubChem and submitted to these two databases, then predicted targets were obtained. The keyword "NAFLD" was inputted in the following databases including the Therapeutic Target Database (TTD), DrugBank, Online Mendelian Inheritance in Man (OMIM), and DisGeNET to screen the disease-related targets. Then, the coexistent targets between compounds and disease were identified as KTZG-related targets for NAFLD treatment.
2.2. Network Construction and Analysis {#sec2.2}
--------------------------------------
Based on the identified compounds and predicted targets of KTZG, the interaction network between compounds and targets was visualized with Cytoscape 3.2.1 software. The protein-protein interactions of the targets were also analyzed with the STRING online tool and visualized with Cytoscape 3.2.1 software. The protein\'s topological attribute was analyzed with the software plugin tool "Network analyzer".
2.3. KEGG Pathway Enrichment Analysis {#sec2.3}
-------------------------------------
For the predicted targets, the underlying biological information was also explored. These target-enriched KEGG pathway networks were analyzed with the Cytoscape 3.2.1 software plugin tool ClueGO; *P* value of the KEGG pathway term less than 0.05 was set up as the criterion.
2.4. High-Performance Liquid Chromatography (HPLC) Analysis of KTZG {#sec2.4}
-------------------------------------------------------------------
HPLC analysis of KTZG was performed on a Waters e2695 HPLC system equipped with a 2998 PDA detector. An Agilent ZORBAX SB-C18 column (4.6 mm × 150 mm, 5 *μ*m) was used for the chromatographic separation, and solvent A (acetonitrile) and solvent B (0.01% glacial acetic acid in distilled water) composed the solvent system. The chromatographic separation was conducted according to the following solvent gradient: 0-30 min, 10%-15% A; 30-60 min, 15%-35% A; and 60-70 min, 35%-90% A. the injection volume was 10 *μ*L, flow rate was 0.8 mL/min, detection wavelength was 254 nm, and column temperature was 30°C \[[@B11]\].
2.5. Animal Diets and Tissue Sample Preparation {#sec2.5}
-----------------------------------------------
4-week male SD rats were purchased from the Shanghai SLAC Laboratory Animal Co. Ltd., China, and maintained under specific pathogen-free conditions at 22\~25°C temperature, 60% humidity, 12 h dark-light cycle, and free access to water and normal diet. After a week of acclimatization, the rats were randomly divided into five groups (*n* = 12 per group): control group: rats were fed with normal diet; NAFLD group: rats were fed with HFD; KTZG 0.75 group: rats were fed HFD and KTZG 0.75 mg/kg/d, i.g.; KTZG 1.5 group: rats were fed with HFD and KTZG 1.5 mg/kg/d, i.g.; and KTZG 3 group: rats were fed with HFD and KTZG 3.0 mg/kg/d, i.g. Rats were fed with normal or HFD for 10 weeks; at the same time, KTZG was administrated from the week of 5 to 10 for a total of 6 weeks. The same volume of saline was given to the control and NAFLD groups. After last administration and overnight fasting, body weight was recorded, and all rats were euthanized using CO~2~. Blood was collected from a cardiac puncture and centrifugated at 3000 rpm for 15 min to obtain the serum samples. Liver tissues were also removed and weighted and then stored immediately at -80°C for further analysis. All experiments were performed with the approval from the Zhejiang Chinese Medical University using guidelines for the care and use of laboratory animals.
2.6. Biochemical Analysis {#sec2.6}
-------------------------
Serum content of total TG, total cholesterol (TC), total bilirubin, high-density lipoprotein (HDL), low-density lipoprotein (LDL), alanine aminotransferase (ALT), and aspartate aminotransferase (AST) was detected using an automatic analyzer (Roche, Basel, Switzerland) according to the manufacturer\'s introduction.
2.7. Liver Histopathological Examination {#sec2.7}
----------------------------------------
The liver tissues were fixed in 10% paraformaldehyde for 48 h and embedded in paraffin, then the tissues were cut into 3\~5 *μ*m sections and stained with hematoxylin and eosin (HE). All the specimens were examined under a light microscope (Olympus, Tokyo, Japan). The tissue sections were also stained with oil red O solution to assess the lipid droplet accumulation in liver tissues. The specimens were examined under a light microscope, and the oil red O-positive areas were quantified using Image-Pro Plus 6.0 software (IPP, Media Cybernetics, Inc., USA).
2.8. Immunohistochemical Assay {#sec2.8}
------------------------------
Liver tissue sections were incubated with the primary antibody at 4°C overnight, then washed with PBS for three times and further incubated with the horseradish peroxidase anti-rabbit secondary antibody for 15 min at room temperature. Then, the sections were washed with PBS for 3 times and stained with DBA solution. After terminating the reaction with water, the sections were further | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
There is a growing appreciation for the neurodevelopmental underpinnings of many psychiatric disorders. While the importance of the growth and structuring of the brain has long been recognized for disorders that begin in childhood such as autism, language disorders or mental retardation, there is consensus building that adult-onset mental disorders also have origins early in neurodevelopment. In order to expand our understanding of these origins, the National Institute of Mental Health (NIMH) is investing in studies of developmental neurobiology, choosing one of its strategies to be the support of "research to improve our basic understanding of the development, structure, and function of neural circuits, with a focus on those most relevant to mental disorders" (NAMHC, [@B110]). Forwarding this agenda requires a better understanding of the neurobiology of neural stem cells (NSCs) and the factors that regulate them in the developing brain.
Neural stem cells can be defined as self-renewing, multipotent cells that are present in both the embryonic and adult brain. Several recent research findings demonstrate that psychiatric illness may begin with abnormal specification, growth, expansion and differentiation of embryonic NSCs. For example, candidate susceptibility genes for schizophrenia, autism and major depression include those specifying the signaling molecule Disrupted In Schizophrenia-1 (DISC-1), the homeodomain gene engrailed-2 (EN-2), and several receptor tyrosine kinases (RTKs), including brain-derived neurotrophic factor (BDNF) and fibroblast growth factors (FGF), all of which have been shown to play important roles in NSCs or neuronal precursors. Hypotheses about how some of these factors relate to psychiatric disorders are now the focus of much neurodevelopmental work (see several reviews: Arnold et al., [@B2]; Buckley et al., [@B14]; Eisch et al., [@B42]; Thomas and Peterson, [@B152]; Jaaro-Peled et al., [@B72]; Vaccarino et al., [@B159]).
This review will lay out some aspects of the new frontier represented by stem cells for understanding the origins of mental illness. In section I, we will review embryonic central nervous system (CNS) development, focusing on forebrain NSCs and the role of the RTKs, such as FGF receptors (FGFRs), in the earliest developmental processes. RTKs are transmembrane proteins that, upon binding a ligand presented or secreted by nearby cells, phosphorylate intracellular signaling molecules and transduce cell-to-cell signaling in the brain. FGF receptors (FGFRs) are among the earliest RTKs expressed in the developing brain, but also continue to be expressed in the mature brain.
Following this review of NSCs and FGFs in embryonic development, in section II we will describe neurobiological findings in clinical populations that support disrupted embryonic stem cell activity. In section III, adult NSC functioning and connections with mental illness will be reviewed. In section IV, we will discuss how new research with inducible pluripotent stem cells derived from patients with neuropsychiatric disorders may further our understanding of developmental aspect of psychopathology and reveal potential targets for psychiatric treatment.
Embryonic CNS Development
=========================
An introduction to neurogenic stem cells (NSCs)
-----------------------------------------------
Perturbations in early development of the CNS may increase an individual\'s susceptibility to neuropsychiatric disorders. These perturbations may occur at the earliest stages of development, when the primordium of the brain is a sheet of neuroepithelial stem cells. The functioning of NSCs is tightly regulated by both intrinsic and extrinsic factors (Johnson et al., [@B73]). Intrinsic factors that shape the development of NSCs include transcription factors, non-coding RNAs and covalent modifications of chromatin in the nucleus (epigenetic modifications). All of these factors, a description of which is outside the scope of this review, can influence stem cells and their proliferation, or the migration and terminal differentiation of their progeny into defined neural cell types with specific connectivity (Figure [1](#F1){ref-type="fig"}).
{#F1}
The specific "mix" of intrinsic factors that characterizes distinct neural stem cell function and identity acts in conjunction with a local "mix" of extracellular signaling molecules bathing NSCs. There are four major classes of secreted extracellular signaling molecules that are expressed in the developing brain during embryogenesis and that participate in the patterning of the nervous system -- FGFs, WNTs, Sonic Hedgehog (SHH) and Bone Morphogenetic Proteins (BMP). FGFs diffuse from the anterior neural ridge, a region corresponding later in development to the commissural plate, which is the foremost rostral boundary of the telencephalon; WNTs and BMPs emanate from the cortical hem, comprising the medial margin of each hemisphere; BMPs are secreted from the roof plate, the dorsal region in between the cerebral hemispheres; and SHH diffuses from the ventral portion of the neural tube or floor plate (Figure [2](#F2){ref-type="fig"}). In addition to these long-range signals, the balance between Notch ligands and Notch receptors, which are membrane bound, strongly influences neural stem cell fate (Johnson et al., [@B73]). Extracellular signals shape CNS morphogenesis and regulate cell fate by influencing the specific "mix" of intrinsic factors present at specific locations and times in the developing CNS (Figure [1](#F1){ref-type="fig"}).
{#F2}
One mechanism by which changes in embryonic NSCs could lead to behavioral symptoms include an imbalance between production of specific types of excitatory and inhibitory neurons, resulting in abnormal levels of activation in cortical circuits (Rubenstein and Merzenich, [@B135]). A second mechanism may involve impairments in the relative size of cortical areas receiving specific thalamic inputs or sending projections to subcortical stations that play an important role in emotional/behavioral regulation (Figure [1](#F1){ref-type="fig"}).
WNT, SHH, and BMP decrease in expression with age, indicating that their primary function is in establishing early identities of NSCs. Continued expression of WNT and SHH in the adult NSC niches regulates stem cell proliferation (Lai et al., [@B84]; Lie et al., [@B90]; Palma et al., [@B118]). In contrast, FGFs continue to be widely expressed and play a role not only in adult NSC niches (Zheng et al., [@B175]) but also in the maturation of the postnatal cerebral cortex.
FGF ligands, stem cell amplification and cortical neurogenesis
--------------------------------------------------------------
Fibroblast growth factor ligands are peptides that act both intracellularly and through secretion into the extracellular space. There are 22 known FGFs which act upon the four membrane bound FGFRs. Amongst the FGF ligands, 13 are known to be expressed in the CNS during embryonic development (Fgf1,2, 3,7,8, 9,10,13,15,16,17,18,22) in specific regions of the neuroepithelium (Figure [2](#F2){ref-type="fig"}). Three of the receptors, FGFR1, FGFR2 and FGFR3 are present in the embryonic brain. Indeed, FGFRs are among the earliest RTKs expressed in brain development.
Two FGF ligand molecules must bind a receptor dimer in order to cause receptor activation. FGF receptors, akin to other members of the RTK family of proteins, cross-phosphorylate their partner upon ligand binding, triggering the activation of three main intracellular pathways, the Ras/MAP Kinase, PI3 kinase, and PLCγ/Protein Kinase C (Schlessinger, [@B139]). The cascades eventually impinge upon the transcriptional machinery in the cell nucleus. Although RAS/MAPK and PI3K pathways are known to be important mediators of FGF signaling in the developing CNS, the relative role of each of these signaling pathways and of the other putative nuclear functions of FGF signaling for transcriptional regulation in stem/progenitor cells and biological functions are still unclear.
Concurrently with patterning in the developing dorsal telencephalon, NSCs expand in number. Through a developmental switch not yet fully understood, after the majority of this expansion has occurred, stem cells then begin to generate neuronal precursors in a neurogenic phase that lasts for approximately 6 days in rodents and 10--12 weeks in primates (Caviness et al., [@B22]; Rakic, [@B132]) (Figure [1](#F1){ref-type="fig | {
"pile_set_name": "PubMed Central"
} |
I[NTRODUCTION]{.smallcaps} {#sec1-1}
==========================
Diabetes, a global escalating public health problem, primarily because of the increasing prevalence, is estimated to affect 285 million individuals worldwide\[[@ref1]\] (Approximately 90% have type 2 diabetes mellitus) and causes hundreds of billions of dollars of economic damage each year. Global estimates for the year 2030 predict a further growth of almost 50%.\[[@ref2]\] In 2000, it is estimated that 2.8% of world\'s population had diabetes mellitus and that by 2030 this number will be 4.4% of the world\'s population. According to WHO\[[@ref2]\] the 'top' three countries in terms of the number of type 2 diabetes mellitus (T2DM) individuals with diabetes are India (31.7 million in 2000; 79.4 million in 2030), China (20.8 million in 2000; 42.3 million in 2030) and the US (17.7 million in 2000; 30.3 million in 2030). This increase is a warning sign for Indian health care system to be vigilant for adequate diabetes mellitus management.
Type 2 diabetes mellitus is a complex and pleomorphic metabolic disorder, characterized by defects in insulin secretion and insulin action which lead to hyperglycemia.\[[@ref3]\] With the onset of this chronic condition and the associated co-morbidities (hypertension, abdominal obesity, dyslipidemia and insulin resistance; together termed as metabolic syndrome), a life-long reduction in quality of life and premature mortality due to micro and macro-vascular complications can be expected.\[[@ref4]\] Genetic background and environment factors are likely to be important in determining susceptibility to associated micro and macro-vascular complications, but exposure of tissues to chronic hyperglycemia is the main initiating factor. Thus, the primary therapeutic goal is to reduce plasma hyperglycemia. For many years, it is generally accepted that exercise is a cornerstone of diabetes management, along with dietary and pharmacological interventions. Based on a number of large randomized controlled trials, current guidelines from the American Diabetes Association (ADA)\[[@ref5]\] acknowledge the therapeutic strength of exercise intervention. Although, there are guidelines on treatment patterns for T2DM patients, it appears that most patients with T2DM are treated pharmacologically.\[[@ref6]\] It is not known whether this is a reflection of poor adherence to lifestyle modifications in T2DM patients or because clinician\'s perceptions of and experiences with lifestyle recommendations and interventions are less effective (for whatsoever reasons) for managing T2DM patients.
Presently available literature regarding the effects of lifestyle modification, in terms of increasing the quantity and quality of physical activity, on overall glycemic control independently or in combination with hypoglycemic drugs are scarce and less conclusive. The majority of studies which supplement weight reduction and exercise programs with appropriate drug therapy have been done on western population. There is a paucity of such studies in Indian population more so specifically in Gujarat population. In India, considering the economic/time constraint and other factors (such as availability of suitable training center, awareness etc), structured exercise training may be available only to a subset of patients with type 2 diabetes, increased physical activity (unstructured activity) is more feasible and can be easily followed.
Therefore, with the hypothesis that short-term six month regular physical activity (structured exercise/unstructured activity) undertaken by T2DM patients, with minimal diet modification may boost glycemic control, an attempt has been made in this study to assess the effect of structured exercise training and unstructured activity interventions on glycemic control along with other biochemical and anthropometric parameters in T2DM patients.
Primary outcome for the result was change in hemoglobin A1c value from baseline to the end of the intervention and secondary outcomes were measures of anthropometry, plasma lipid levels and blood pressure. In addition, we assessed the proportion of T2DM patients in whom cardiovascular risk factors (CVRFs)/profile were not under control as established by the NCEP-ATP III (National Cholesterol Education Program-Adult Treatment Panel III) guidelines.\[[@ref7]\]
M[ATERIALS AND]{.smallcaps} M[ETHODS]{.smallcaps} {#sec1-2}
=================================================
This was a randomized six month exercise intervention study conducted from October 2011 to July 2012 (Box 1 shows the flow of participants from enrollment to follow--up) \[[Figure 1](#F1){ref-type="fig"}\]. Before randomization, all enrolled T2DM participants (*n*: 300) entered a one-month run-in phase to reduce dropout and maintain adherence. Participants performed 15 min of aerobic exercise\[[@ref8]\] and one set of nine resistance exercises\[[@ref8]\] {four upper body exercises (bench press, seated row, shoulder press, and pull down), 3 leg exercises (leg press, extension and flexion), abdominal crunches and back extensions}, at moderate intensity\[[@ref8]\] under professional trainer and physiotherapist. Only persons who attended \>75% of the scheduled 24 run-in sessions were eligible for randomization. The study protocol was approved by the human research ethical committee and informed consent was obtained (after providing a detailed study overview) from all the patients before enrolling into the study.
{#F1}
Inclusion criteria for enrollment includes sedentary, 30 to 60 year old adults of either sex with type 2 diabetes mellitus (for more than a year) of HbA1c levels of 6.5% or higher, residing in and around Ahmedabad (Gujarat), and attending the diabetic clinics at B. J. Medical College and Civil Hospital, Ahmedabad (Gujarat). Sedentary was defined as not exercising more than 20 min on three or more days a week. The history of diabetes mellitus was based on patient self report of a prior physician diagnosis. Patients with overt albuminuria, congestive cardiac failure, preexisting macro-vascular condition, any severe illness (such as malignancy, severe infection, respiratory disease, kidney disease, liver disease), impairment of speech, hearing, vision or cognition, suffering from a serious diabetes complication, using insulin, changes during the previous three months in oral hypoglycemic agents, continuous or periodic use of corticosteroids, pregnant females or who had given birth within the preceding six weeks, orthopedic constraints or any musculoskeletal injury or joint or peripheral vascular disease sufficient to impede exercise or who had participated in regular physical exercise (more than two 30 min sessions/week of moderate/vigorous aerobic exercise or one 30 min session/week of resistance training) during the preceding six months, serious exertion hypertension or any medical condition that prevented participants from adhering to the protocol or exercising safely, lack of approval by physician and patients showing disinterest were excluded from the study.
After one-month run-in phase, participants were randomly allocated (randomization sequence was computer generated) in equal numbers to the structured exercise training, unstructured activity and control groups, stratified by sex and age. Structured exercise training was defined as an intervention in which patients were engaged in planned, individualized and supervised exercise programs (combination of aerobic and resistance exercise). Unstructured activity was defined as an intervention in which patients were not engaged in supervised exercise training, but received advice to increase the "physical activity" which refers to any bodily movement produced by skeletal muscles that results in an expenditure of energy and includes a walk for 45 min/day, broad range of occupational, leisure and daily activities and control group in which patients reverted to pre-study physical activity levels. Later two groups were asked to maintain the said activity during the six-month study period.
Participants, physiotherapist and trainers could not feasibly be blinded to group assignment after randomization, but the main study outcomes were measured by blinded objective methods. Dietician recommended (based on standard guidelines)\[[@ref6][@ref9]\] a diet (which was not greatly different from individual\'s routine diet) to all participants that would not cause weight loss to minimize dietary variability among groups. Physicians were requested not to alter the medications (antihypertensive, lipid-altering, or hypoglycemic) during the six month intervention unless it was medically necessary and if any change occurs throughout the study, it was well documented.
Structured exercise training group participants followed an exercise plan consists of a combination of aerobic and resistance exercise, conducted under supervision of professional trainer and physiotherapist. Participants exercised six-times weekly,\[[@ref6][@ref10]\] Each session lasted for 45 min and training progressed gradually in intensity. Each exercise session had a five minute warm-ups and cool-down period, consisting of very light exercises and stretching, to allow a gradual warming/cooling of the muscles. During 12^th^ week the exercise dose was reduced by one-third to provide a recuperation week.
Nine resistance exercises were performed on three non-consecutive days/week using weight-stacked machines (Multi Station Gym Khare Enterprises Pvt. Ltd, Sangli.). {The weight loading was set at 70-85% one repetition maximum, determined for each exercise at week 0 to assess the muscle strength.\[[@ref11]\] One repetition maximum is defined and determined as: Following a low-intensity warm-up, participants performed four trials (separated by a one-minute resting interval) using varying moderate-heavy weights to determine the highest weight that could be lifted with only one repetition through the full range of motion with correct technique}. Each session consisting of two sets of four upper body exercises, three sets of three leg exercises and two sets each of abdominal crunches and back extensions (with one-min rest between sets). Each set consisted of 12 repetitions. Weight or resistance was increased by 5 to 10 pounds when the participant was able to complete 12 repetitions for each set of exercises on 2 consecutive exercise sessions while maintaining proper form. On other three days of week, aerobic activities were performed on a bicycle ergometer or treadmill. At week 0, participants self-selected a | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Visual categorization allows us to effortlessly interpret a wide range of sensory information into a limited number of meaningful categories. This process enables the efficient response to novel stimuli and is the foundation for visual perception and memory. Though initial category learning and well-practiced categorization have been well-studied at both the behavioral (Fabre-Thorpe, [@B11]; Ashby and Maddox, [@B2]) and neural levels (Reber et al., [@B51]; Kanwisher, [@B31]; Haxby et al., [@B23]; Seger, [@B55]), few studies have directly compared these time points in learning nor the large scale network changes in the transition from initially learned to well-practiced categorization.
Initial visual category learning relies on representations in early visual cortex and inferior temporal cortex (ITC), though other mechanisms employed and brain regions involved depend on the strategy that subjects use. According to COVIS (COmpetition between Verbal and Implicit Systems), a prominent theory of the neural basis of category learning, when the rule that separates categories is verbalizable, brain regions supporting working memory such as prefrontal cortex (PFC) and parts of the basal ganglia (BG) that include the head of the caudate nucleus are implicated (Ashby and Maddox, [@B2]). In contrast, when the category rule is not verbalizable, a procedural system that depends on the tail of the caudate nucleus is involved. Studies demonstrating initial category learning deficits in patients with damage to the PFC (Barcelo and Knight, [@B3]) and BG (Maddox et al., [@B41]) support this theory. The involvement of the medial temporal lobe (MTL) in initial category learning is unclear: some studies have demonstrated that MTL damage significantly impairs visual category learning (Hopkins et al., [@B27]) while others have shown that forms of category learning can occur without an intact MTL (Knowlton and Squire, [@B35]; Knowlton et al., [@B36]). Studies have also implicated the premotor cortex (PMC) in learning new visual categories, especially for categories that require a stereotyped motor response (Halsband and Freund, [@B20]; Boettiger and D\'Esposito, [@B5]).
Though PFC, PMC, BG, and MTL have shown to be important to initially learning visual categories, damage to these regions does not consistently produce deficits in the automatic recognition of well-established categories (Freedman et al., [@B14]; Zgaljardic et al., [@B66]; Squire et al., [@B56]). There are some reports, however, of patients with MTL damage that present with object discrimination difficulties, suggesting that the MTL may facilitate higher-level object processing (Lee et al., [@B37]). Additionally, lateral frontal regions have feedback connections to object recognition regions in ITC and studies have shown that lateral frontal regions modulate ITC to help facilitate successful recognition (Fuster et al., [@B16]; Barcelo et al., [@B4]; Gazzaley et al., [@B19]). A goal of the current study is to further characterize the supporting roles that the PFC, PMC, BG, and MTL play in well-established categorization and how the interactions between these regions and ITC change with category learning.
In contrast to patients with PFC, PMC, BG, and MTL lesions, patients with ITC lesions present with severe deficits in recognizing well-established categories (Warrington, [@B63]). These patients can often describe an object in their visual field in great detail, including color, texture, and shape but are unable to integrate this information to identify the object. Thus, ITC has a crucial role in organizing perceptual features into an integrated percept, essentially linking perception with recognition. In addition to this role in representing and recognizing well-established categories, ITC has also been shown to be modified with learning. Studies have generally demonstrated increases in ITC activity and enhanced neural tuning after extensive training with novel categories (Gauthier et al., [@B17]; Op de Beeck et al., [@B47]; Jiang et al., [@B29]) and when comparing category experts with category novices (Gauthier et al., [@B18]). These training-related changes have been demonstrated in the regions that preferentially respond to stimuli before training, such as the lateral occipital cortex for shapes, as well as in changes in the overall pattern of activity across ITC (Op de Beeck et al., [@B47]). Though these studies clearly demonstrate ITC changes with learning, the interpretation of these changes and overall organization of ITC are intensely debated (Tarr and Gauthier, [@B59]; Haxby et al., [@B23]; Kanwisher and Yovel, [@B33]). Current models suggest that extensive category learning is accompanied by changes in activity in regions representing that object or process, such as in the fusiform face area for faces, which may reflect the recruitment of new processes or modifications in object representations (Tarr and Gauthier, [@B59]; Kanwisher and Yovel, [@B33]). An alternative model suggests that changes distributed across all of ITC may be more important to category learning and representation than any specific region(s) (Haxby et al., [@B23]).
A goal of the current study is to compare the regional and network changes that occur during extensive category learning to better characterize the mechanisms of category learning in ITC.
In addition to characterizing changes within PFC, PMC, BG, MTL, and ITC we also seek to explore the overall changes in involvement of these regions in initial categorization as compared to later in learning. Though there are many variations of how this could occur, we propose two general possibilities: (1) there could be a shift from the network including PFC, PMC, BG, MTL, and ITC regions to a new network more focused on visual regions or (2) the same network could be utilized for visual categorization both early and late in learning and with practice there could be a redistribution of activity within the same network (for a review of these mechanisms see Kelly and Garavan, [@B34]). Several studies demonstrate a shift from the initial network of regions engaged to a new network when training involves recruiting different strategies at the beginning and end of practice. For example, Poldrack et al. ([@B49]) showed that during classification learning, initially MTL structures were recruited and later, when learning was more associative, activation shifted to more basal ganglia involvement. Additionally, Fletcher et al. ([@B12]) demonstrated a decrease in right fronto-parietal activity and increase in left fronto-parietal connectivity during the acquisition of artificial grammar rules. As far as category learning is accompanied by salient shifts in cognitive and neural strategies, we might expect to see a shift in the network from PFC, PMC, BG, MTL, and ITC early in learning to a network more focused around ITC regions since damage to these regions are the only lesions that consistently impair the retrieval of well-established categories.
An alternative to shifting to a new network is that the same network of PFC, PMC, BG, and MTL may serve as a permanent scaffold throughout all stages of learning: these regions initially facilitate category learning, retrieval, and decision-making and could continue to be involved in further updating, retrieving, and making decisions as categories become more well-established. This model suggests that a similar network including PFC, PMC, BG, MTL, and ITC is recruited throughout category learning, though parts of this network such as the PFC and BG may be less active late in learning when updating visual representations and retrieval demands are less pronounced (Wagner et al., [@B61]). Thus, another goal of the current study is evaluate the overall network changes that accompany visual category learning and decide between these two models.
Standard univariate analyses of regional activation changes could be useful to determine whether the same network or a different network is recruited with category learning. However, univariate analyses cannot assess if regions that change with learning are functionally connected. One approach to this issue is to measure the activity covariance between a region known to be involved in the task and the rest of the brain. By comparing this covariance map before and after training, it could help characterize the changes in task-related functional networks that accompany categorization training. A functional MRI method that is well-suited for this approach is coherence analysis. In coherence analysis, a reference or seed region is identified and the time series in this region is correlated, in the frequency domain, with the time series of every other voxel in the brain (Sun et al., [@B57], [@B58]). In this way, coherence analysis provides a task-related network with the seed region and we can measure how this network differs between initially learned and well-practiced categorization. The main advantage of coherence over simply correlating activity with a seed region is that coherence does not depend on the estimate of the hemodynamic response function or a model of neural activity. Thus, coherence is not affected by regional differences in hemodynamic responses whereas correlating activity is biased to produce high correlations between regions with similar hemodynamic responses (Muller et al., [@B45]). Also, by using partial coherence, we can measure the task-induced relationship between two regions while factoring out the stimulus-locked response (see Sun et al., [@B57] for further details).
In the current study, by using two categorization tasks, a novel task (100 training trials) and a well-practiced task (4250 training trials) with similar stimuli, we assess initially learned and well-practiced categorization in a single fMRI session. We chose to use faces as stimuli because faces have been shown | {
"pile_set_name": "PubMed Central"
} |
All relevant data are within the paper.
Introduction {#sec001}
============
Obligate intracellular bacteria exclusively replicate inside the cells of their host and they are predominantly transmitted through mother-offspring relationships \[[@pone.0128660.ref001]\]. As a consequence, some endosymbionts have adopted a strategy consisting of manipulating their host reproduction to maximise their transmission \[[@pone.0128660.ref002]\]\[[@pone.0128660.ref003]\]\[[@pone.0128660.ref004]\]. Indeed, reproductive parasite endosymbionts either favour the fitness of the infected females through cytoplasmic incompatibility (CI) \[[@pone.0128660.ref005]\]\[[@pone.0128660.ref006]\], or induce sex-ratio biases towards females in host progenies \[[@pone.0128660.ref007]\] through male-killing (death of male progeny) \[[@pone.0128660.ref008]\]\[[@pone.0128660.ref009]\], thelytokous parthenogenesis \[[@pone.0128660.ref010]\]\[[@pone.0128660.ref011]\], or feminization of genetic males \[[@pone.0128660.ref012]\]\[[@pone.0128660.ref013]\]. The alphaproteobacterium *Wolbachia* that infects many arthropod species and filarial nematodes is the only endosymbiont known to induce all four of these effects \[[@pone.0128660.ref014]\]\[[@pone.0128660.ref015]\]\[[@pone.0128660.ref016]\]. Considered the most widespread endosymbiont on the planet, *Wolbachia* infects at least 40% of insect species \[[@pone.0128660.ref016]\], some chelicerate species (mites, spiders and scorpions \[[@pone.0128660.ref017]\]\[[@pone.0128660.ref018]\]\[[@pone.0128660.ref019]\]), and crustaceans, in which at least 61% of terrestrial isopod species are infected \[[@pone.0128660.ref012]\]\[[@pone.0128660.ref020]\].
In feminization induced by *Wolbachia*, host genetic sex determination is manipulated by the endosymbiont which converts genetic males into functional phenotypic females. *Wolbachia-*induced feminization is the most common phenotype observed in terrestrial isopod crustaceans \[[@pone.0128660.ref012]\]\[[@pone.0128660.ref021]\]\[[@pone.0128660.ref022]\]\[[@pone.0128660.ref023]\], even if CI strains have been described in three species \[[@pone.0128660.ref024]\]\[[@pone.0128660.ref025]\]\[[@pone.0128660.ref026]\]. Despite extensive studies carried out since the discovery of *Wolbachia* as the feminizing agent of the isopod *Armadillidium vulgare* in the 1970s \[[@pone.0128660.ref022]\]\[[@pone.0128660.ref027]\]\[[@pone.0128660.ref028]\], no underlying molecular mechanism has been described to date \[[@pone.0128660.ref002]\].
In *A*. *vulgare*, embryos that inherited *Wolbachia* developed into functional females, in which bacteria prevented the development of the androgenic gland. This gland secretes the androgenic hormone responsible for the differentiation of primary and secondary male sexual characters \[[@pone.0128660.ref002]\]\[[@pone.0128660.ref029]\]. *A*. *vulgare* gonad differentiation has been described in detail by Suzuki and Yamasaki \[[@pone.0128660.ref030]\] and it occurs within a period of ten to fifteen weeks after the release of juveniles from the female ventral pouch. Eight post-embryonic stages were defined, each corresponding to an intermolt stage. Gonads differentiate during stages 4 to 8 and androgenic glands progressively develop at the top of each testis from stage 6 to 8 \[[@pone.0128660.ref030]\]. *Wolbachia* is thought to act before or during sexual differentiation in order to inhibit male gonad differentiation, and convert genetic males into phenotypic females. When incomplete feminization occurs, this leads to intersexes ranging from sterile intersex males (iM) exhibiting female genital apertures and hypertrophied androgenic glands, to functional intersex females harboring typical male brushes on forelegs \[[@pone.0128660.ref031]\]\[[@pone.0128660.ref032]\]\[[@pone.0128660.ref033]\]. It has been hypothesized that this incomplete feminization is linked with low density of *Wolbachia* \[[@pone.0128660.ref034]\].
All these intersex phenotypes regularly observed in natural isopod populations can be experimentally produced by injection of *Wolbachia* in adult males. *Wolbachia*-induced iM may be obtained when the donor of the feminizing *Wolbachia* strain and the recipient belong to the same species \[[@pone.0128660.ref012]\]\[[@pone.0128660.ref035]\]\[[@pone.0128660.ref036]\]. In the case of interspecific transfers of *Wolbachia* in terrestrial isopod hosts, the efficiency of the feminizing strains decreases with phylogenetic distance of the recipient, leading to *Wolbachia* elimination, an absence of effect, death of the recipient or conservation of the effect \[[@pone.0128660.ref012]\]\[[@pone.0128660.ref034]\]\[[@pone.0128660.ref035]\]\[[@pone.0128660.ref036]\]. It has been shown that the feminizing strain of *A*. *vulgare*, *w*VulC, is able to induce the development of female secondary sexual characters in *Cylisticus convexus* adult males \[[@pone.0128660.ref035]\], whereas the CI-inducing strain of *C*. *convexus*, *w*Con, is able to induce CI when transinfected to *A*. *vulgare* \[[@pone.0128660.ref025]\]. These observations showed that the *Wolbachia*-induced phenotypes are due to the injected strains and do not depend on the genetic background of the hosts. *C*. *convexus* may therefore be a suitable model to uncover the mechanisms of feminization. Hence, it would be relevant to compare feminization induced by the same strain of *Wolbachia*, *w*VulC, in two distinct host species. However, induction of female secondary sexual characters by *w*VulC in *C*. *convexus* adult males does not necessarily mean that there is feminization of *C*. *convexus*, as feminization is the conversion of the male genetic sex into a fully functional female. Moreover, since feminization is supposed to take place before or during sexual differentiation, it is essential to distinguish between the feminizing action of the bacteria linked to sexual differentiation and an alternative action of the bacteria unrelated to sexual differentiation (*i*.*e*., without any link to feminization) but fortuitously happening during sexual differentiation. Such a confounding effect may be uncovered by analyzing a feminizing *Wolbachia* strain in two distinct genetic backgrounds having different timings of sexual differentiation.
In this study, we first described the developmental stages of *C*. *convexus* by comparison with those of *A*. *vulgare* and identified a one-stage shift of sex differentiation timing between the two species. *w*VulC from *A*. *vulgare* was also injected into uninfected *C*. *convexus* adult females and males to test whether: (i) *w*VulC can be vertically transmitted from mother to offspring, and (ii) *w*VulC induces feminization in its new host (feminization being assessed by the appearance of female secondary sexual characters in adult males, as well as the presence of intersexes and female bias in transinfected female progenies). Altogether, our results provide formal demonstration of a feminizing effect of *w*VulC in *C*. *convexus*.
Materials & Methods {#sec002}
===================
Transinfection of the *w*VulC Feminizing *Wolbachia* Strain in *C*. *convexus* {#sec003}
------------------------------------------------------------------------------
Isopods were reared at 20°C with food *ad libitum* (dead lime tree leaves and carrots) under natural photoperiod, except those in cross-breeding and juveniles which were reared under a 18L:6D photoperiod. Uninfected 10 month-old *C*. *convexus* males and females (from our laboratory line AW, derived from individuals caught in Villedaigne, France, in 1997) were infected by *w*VulC. The solution containing *Wolbachia* was prepared using ovaries from five *A*. *vulgare* females naturally harbouring the *w*VulC strain (from our laboratory line ZN, derived from individuals caught in Celles sur Belle, France, in 1991). The presence of *w*VulC was specifically checked by PCR and sequencing of the *wsp* sequence as described in Cordaux *et al*. \[[@pone.0128660.ref021]\]. Ovaries were crushed in 500 μL of Ringer solution (NaCl 394 mM; KCl 2 mM; CaCl~2~, 2H~2~O 2 mM; NaHCO~3~ 2 mM), and the resulting suspension was filtered through a 5 μm pore membrane (Sartorius Stedim Biotech). One microliter | {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
Multiple sclerosis (MS) treatment has evolved tremendously over the last two decades. Whereas a patient diagnosed with MS 30 years ago had very little hope of a future without severe neurological disability, most patients who receive the diagnosis now have access to a variety of pharmacological and non-pharmacological treatments that can modify their disease evolution \[[@CR1]\]. In the present scenario, MS management aims to reach a state of no (or minimal) evidence of disease activity in patients \[[@CR2]\]. Therefore, while individuals with MS might not have considered parenthood in the past due to the potential disability, patients nowadays seem to have a different attitude towards having children. Family planning for patients with MS includes advice from neurologists regarding disease control at conception and during pregnancy and the puerperium. Since reactivation of well-controlled MS may lead to relapses and accumulated neurological disability, simple withdrawal of drugs for patients who intend to conceive is not an option. On the other hand, not all treatments presently recommended for MS are considered safe during conception, pregnancy and/or breastfeeding \[[@CR3]\]. The objective of the present study was to summarize the practical and evidence-based recommendations for neurologists, obstetricians and urologists who discuss family planning with women and men with MS.
A panel of neurologists with experience in MS reviewed several aspects of the disease with regard to human reproduction. Their recommendations were established based on published evidence and the specialists' expert opinion. The review of the literature was not limited by date and included specific words for each individual subject reviewed by the specialists. The authors used PubMed, Medline, SciELO, LILACS, the Cochrane Library and Google Scholar to identify relevant papers. Only papers with a title and abstract in English were reviewed; from the articles selected, the lists of references were further searched for potentially relevant citations. After 2 months of reviews, the panel met for a full day of discussions and elaboration of the material below. All recommendations presented here are evidence-based and were included with the approval of at least 80% of the authors.
This paper is a comprehensive review of medical literature on previously conducted studies and does not contain any studies with human participants or animals performed by any of the authors. All statements regarding the literature are cited in the references.
Level of Evidence {#Sec2}
=================
For obvious ethical reasons, there are no double-blind or placebo-controlled randomized studies on men or women with MS who intend to conceive, or on pregnant and/or breastfeeding women. The papers selected for this article typically come from anecdotal reports, case series, observational studies and national or international databases, using retrospective, prospective or cross-sectional cohorts of patients. Therefore, there is no evidence coming from Class I or II studies in this population of patients with MS, and all recommendations in the literature are, at best, Level C \[[@CR4]\].
General Recommendations for Patients with MS Who Want to Have Children {#Sec3}
======================================================================
Although both men and women with MS should have the disease under control before conceiving a child, this recommendation is particularly important for women. The risk of relapses in the post-natal period showed an independent correlation with the 12-month \[[@CR5]\] and 24-month \[[@CR6]\] annualized relapse rate preceding pregnancy. In addition, a higher number of postnatal relapses increased the risk of disability progression in women with MS \[[@CR5]\]. Therefore, it is of essence that women with MS who intend to become pregnant have their disease under control for at least 1 year before conceiving. Should the patient have a new diagnosis of MS, the recommendation is to wait for at least 1 year in order to attempt to control disease activity before conceiving.
Antenatal Care for Women with MS {#Sec4}
================================
Pregnancy in a woman with MS does not constitute a case of "high-risk" pregnancy. Antenatal care follows the general recommendations, with the same scheme of dietary supplementation of folic acid, vitamins, minerals and iron that pregnant women need to have. Likewise, cessation of alcohol and tobacco use is important \[[@CR7]\]. One aspect of antenatal care that may give rise to greater controversy is supplementation of vitamin D among pregnant women with MS. The plasma levels of vitamin D have not been found to be associated with the postnatal relapse rate in MS \[[@CR8], [@CR9]\], and general obstetric and neonatal outcomes seem to have little relationship to vitamin D supplementation during pregnancy \[[@CR10]\]. Therefore, there is no particular reason to aim for high plasma levels of vitamin D in pregnant women with MS.
In summary, antenatal care for women with MS should follow the general recommendations of the gynecology and obstetrics societies of each country.
Vaccines {#Sec5}
========
Obstetricians and gynecologists have very good opportunities to incorporate vaccination into the standard clinical care for women \[[@CR11]\]. They specifically care for pregnant women who, along with their fetuses, can be particularly vulnerable to vaccine-preventable diseases and their related complications \[[@CR12]\]. In patients with MS, vaccination can have peculiarities related to the disease itself and its treatment \[[@CR13], [@CR14]\].
Vaccination should be discussed with the patient before conception and should follow the recommendations and immunization calendar of each country. In general, if the woman has not been previously exposed or vaccinated against a certain disease, the risk/benefit of immunization during pregnancy should be assessed individually \[[@CR15]\]. Inactivated vaccines, such as seasonal influenza and tetanus, can be used safely even during pregnancy. Vaccines with bacteria and those with attenuated viruses can be used before the woman conceives and may be used in the final trimester of pregnancy. These include Bacillus Calmette--Guérin (BCG) against tuberculosis, oral typhoid, measles-mumps-rubella (MMR), varicella/zoster and rotavirus \[[@CR16]\]. Other vaccines that may be used during pregnancy on an exception basis include pneumococcal polysaccharide vaccine and hepatitis B. The healthcare staff need to be aware that patients with MS should not receive live-virus vaccine (for example, yellow fever). These patients should be immunized only in some very specific situations, through case-by-case indication.
The Effect of Pregnancy on MS Relapses (Short-Term Outcomes) {#Sec6}
============================================================
Acute demyelinating relapses of MS can be worrisome during pregnancy and the puerperium. While pregnancy status typically reduces the number of clinical relapses, this number is not zero, and some patients may require treatment while pregnant. Reactivation of MS inflammatory activity is a characteristic feature of the postnatal period, and treatment of relapses may be necessary in the puerperium.
The mechanism underlying the changes in relapse rate during gestation and after delivery are ultimately a function of cytokine and hormone levels in the woman. Pregnancy is associated with downregulation of cell-mediated immunity, ultimately resulting in a shift towards a T-helper 2 (Th2) cytokine profile \[[@CR17]\]. This shift leads to reduced levels of Th1 cytokines (interferon gamma and tumor necrosis factor alpha) and increased levels of Th2 cytokines (interleukins IL-4 and IL-10), which are essential for tolerance of the fetus during pregnancy \[[@CR18]\]. In addition, the beneficial immunomodulatory effects of high levels of estrogen during pregnancy \[[@CR19]\] may explain the overall reduction in MS activity during gestation.
Management of Relapses During Pregnancy {#Sec7}
=======================================
Fortunately, most women with MS will not develop neurological symptoms during or after pregnancy \[[@CR20]\]. Relapses occurring during pregnancy, particularly in the first trimester, should be treated with corticosteroids only when they significantly affect the mother's activities of daily living \[[@CR21]\]. Although conflicting data have been published, corticosteroids used during pregnancy have been associated with orofacial cleft \[[@CR22], [@CR23]\]. There are no reports of other therapies (including immunoglobulin) for treatment of relapses during the gestational period in women diagnosed with MS.
Summarizing the recommendations regarding therapy for MS relapses during pregnancy, intravenous 3-day pulse of methylprednisolone (1 g/day) can be used if necessary. Prolonged oral administration of prednisone should be avoided, as well as the use of corticosteroids with placental effects, such as dexamethasone or betamethasone \[[@CR24]\].
Management of Relapses After Delivery {#Sec8}
=====================================
Studies from various countries show that relapses occur in 12--39% of women with MS during the puerperium \[[@CR20], [@CR25]--[@CR28]\]. A low relapse rate preceding pregnancy \[[@CR6], [@CR21]\] and exposure to immunomodulatory drugs at the time of conception \[[@CR6], [@CR29]\] appear to be the only factors associated with lower numbers of postnatal relapses.
Following studies with conflicting results regarding the role of breastfeeding in preventing postnatal relapse \[[@CR30], [@CR31]\], a meta-analysis concluded that this protective effect, if present, is modest \[[@CR32]\]. The recommendation is to encourage breastfeeding for its beneficial effect as a whole \[[@CR33]\], with the important exception of (re)starting MS therapy with drugs that are detectable in breast milk. These drugs will be discussed later in this paper.
The use of intravenous immunoglobulin (IVIG) has generated conflicting results in published papers. Although IVIG has a good safety profile, a recent meta-analysis demonstrated an ineffective cost--benefit profile from prescribing IVIG for prevention of relapses during the puerperium \[[@CR34]\]. Different therapeutic schemes have been used; there are some uncontrolled studies and some studies controlled with 30-year-old historical patient data \[[@CR34]\]. Briefly, using the present information on IVIG, approximately six women must be treated to | {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
Overuse injuries of the lower limb associated with intensive weight bearing exercise are a significant problem for athletes and military recruits, with estimated incidence of running-related injuries reported to range from 20% to 79% \[[@CR1]\]. Lower limb overuse injuries are generally recognised as having multifactorial aetiologies \[[@CR2]\]. Some of the most common injuries, such as Achilles tendinopathy, medial tibial stress syndrome, patellofemoral pain and lower limb stress fractures, are reported to be more prevalent in those with altered foot function \[[@CR3],[@CR4]\].
The potential mechanisms linking variations in dynamic foot function with lower limb overuse injury may be related to altered lower limb biomechanics and subsequent changes in tissue stress \[[@CR5]\]. This is supported by laboratory-based research using uninjured participants, which suggests that variations in foot posture (flat- and normal-arched feet) are associated with systematic differences in lower limb kinematics \[[@CR6]-[@CR8]\], kinetics \[[@CR4],[@CR9],[@CR10]\], muscle function \[[@CR11]-[@CR16]\] and tendon morphometry \[[@CR17]\].
While laboratory-based research is important for understanding potential mechanisms linking foot function and lower limb overuse injury, field-based prospective studies are required to determine whether foot function is a risk factor for lower limb overuse injury. Our accompanying systematic review \[[@CR18]\] found that static measures indicating greater foot pronation were associated with an increased risk of patellofemoral pain and medial tibial stress syndrome. However, the small effects suggest that static measures may not adequately represent dynamic foot function. A substantial number of prospective studies have utilised a variety of measurement techniques in order to quantify dynamic foot function and its relationship with lower limb overuse injury \[[@CR19]-[@CR46]\]. However, it is unclear if there are consistent findings across different measures, or whether particular foot function characteristics are risk factors for specific overuse injuries. Enhanced knowledge regarding this may lead to the development of targeted preventative strategies.
Therefore, the aim of this systematic review was to: (i) identify and appraise the current evidence for the prospective link between dynamic foot posture and lower limb overuse injury; and (ii) provide guidance for future research in this area. This review represents the second component of a two-part systematic review on foot posture-related risk factors for lower limb overuse injury.
Methods {#Sec2}
=======
The systematic review protocol was developed in consultation with guidelines provided by the Preferred Reporting of Systematic Reviews and Meta-Analysis (PRISMA) Statement \[[@CR47]\].
Search strategy {#Sec3}
---------------
MEDLINE, CINAHL, Embase and SPORTDiscus were searched from inception until April 2014. Medical Subject Headings (MeSH) were exploded to include relevant subheadings, in addition to keywords specific to the research question (Additional file [1](#MOESM1){ref-type="media"}). The search was limited to adult human participants and English language publications. To ensure identification of all relevant studies, reference lists of appropriate narrative and systematic reviews were hand searched, and discussion with field experts (e.g. physiotherapists, podiatrists) was conducted regarding known important publications. A cited reference search for each included paper was also completed in Google Scholar.
Eligibility criteria {#Sec4}
--------------------
All studies identified by the search strategy were exported to Endnote version X5 (Thomson Reuters, Philadelphia), by a single investigator (GJD). Abstracts and then full text versions were reviewed by two authors (GJD, MMFS) to determine eligibility. Discrepancies were resolved in consultation with a third reviewer (GSM). Initial eligibility criteria were: (i) prospective cohort study design; (ii) quantitative measurement of foot posture or function at baseline (static or dynamic); and (iii) prospective collection of specific or non-specific lower limb overuse injury surveillance data over a specified time period. Specific lower limb overuse injuries were defined as injuries with a single diagnosis, while non-specific lower limb overuse injuries included injuries without a specific diagnosis or where multiple overuse types of injuries were pooled by the study reviewed. After retrieval of studies that fulfilled the initial eligibility criteria, suitable studies were separated into those that investigated dynamic measures of foot function (i.e. measured during walking or running), and those that investigated static measures of foot posture. This review focused on dynamic measures as risk factors, while static measures are addressed in the accompanying review \[[@CR18]\].
Quality assessment {#Sec5}
------------------
Assessment of the methodological quality of the included studies was performed using the Epidemiological Appraisal Instrument (EAI) \[[@CR48]\]. This instrument is designed to assess the quality of cohort (prospective and retrospective) studies. The EAI consists of 43 items separated into five domains --- (i) reporting, (ii) subject/record selection, (iii) measurement quality, (iv) data analysis and (v) generalisability of results \[[@CR48]\]. Items on the EAI were scored as "Yes" (score of 2), "Partial" (score of 1), "No" (score of 0), "Unable to determine" (score of 0) or "Not Applicable" (item excluded). The EAI has demonstrated good/excellent validity, and good to excellent intra-rater (Kappa coefficient range 52 to 60), and inter-rater reliability (Kappa coefficient = 90% \[95% CI; 87 to 92%\]) \[[@CR48]\]. For the purpose of this review, the wording of all 43 items was modified slightly to improve clarity and rater interpretation. No items were removed or modified, in order to maintain validity (Additional file [2](#MOESM2){ref-type="media"}).
Two raters (GJD, NJC) independently evaluated each study while blind to author and publication details. For any discrepancies in assessment of items between the two raters, a meeting occurred and consensus was achieved. To evaluate the overall quality of the studies, average scores across the 43 items were calculated, with a maximum possible score of two (i.e. as individual items are scored '0', '1' or '2', the maximum 'average' score across 43 items is two). A ranking system was used to evaluate the quality of evidence, whereby studies were classified as being high (EAI ≥ 1.4), moderate (EAI 1.1 to \<1.4), or low quality (EAI \< 1.1) \[[@CR47]\].
Data management {#Sec6}
---------------
Two investigators (GJD, GSM) extracted data regarding study characteristics, including publication details (year, author, country), participant characteristics (number of injured and uninjured, age, sex, inclusion and exclusion criteria, population \[i.e. military\]) and study methods (dynamic foot function measurement, examiner details, injury outcome, duration of study and covariates investigated). To facilitate calculation of effects, means and standard deviations (SD) were extracted for injured and uninjured participants for continuous foot function variables, while raw counts were extracted for nominal variables.
Where appropriate data was not provided in the publication, authors were contacted with a request to provide additional data. Where studies described specific variables but did not publish data, it was recorded as 'not reported' (NR) and, for the purpose of the analysis, assumed that the variable investigated was not significantly different between the injured and the uninjured population.
Statistical methods {#Sec7}
-------------------
Inter-rater reliability of the raters' EAI scores was evaluated using a descriptive analysis. Differences between rater scores for "Yes", "Partial", "No", and "Unable to determine" were calculated, with a difference of zero indicating perfect agreement and a difference of 1 indicating near perfect. The rating "not applicable" was excluded from analysis because no interpretation was required for this rating.
For continuous foot function variables, standardised mean differences (SMD) were calculated as the difference between injured and uninjured group means, divided by the pooled standard deviation \[[@CR49]\]. SMDs and 95% confidence intervals (CI) were calculated using the 'Effect Size Calculator' from the Centre for Evaluation and Monitoring \[[@CR50]\]. Interpretation of the SMD was based on previous recommendations, where \> 1.2 was considered large, 0.6 to 1.2 moderate, and \< 0.6 small \[[@CR51]\]. For nominal scaled foot function variables, risk ratios (RR) and 95% CI were calculated using the 'Confidence Interval Calculator' from the Physiotherapy Evidence Database (PEDro) \[[@CR52]\]. This was represented as the number of participants with lower limb overuse injury in the group with the associated factor (e.g. delayed time to peak force), divided by participants with lower limb overuse injury in the group without the associated factor. A RR \> 1.0 indicated that the lower limb overuse injury was more likely to be found in participants with the risk factor present. A small effect was indicated by a RR ≥ 2.0, and a large effect ≥ 4.0 \[[@CR53]\]. Effects were considered statistically significant if the associated 95% CI did not contain zero for the SMD, or one for RR.
Evidence-based recommendations {#Sec8}
------------------------------
In order to provide recommendations based on statistical findings, while incorporating the methodological quality of included papers, a scale regarding levels of evidence was utilised, based on previous work by van Tulder et al. \[[@CR54]\].
***Strong evidence:*** pooled results derived from three or more studies, including a minimum of two high quality studies that are statistically homogenous; may be associated with a statistically significant or non-significant | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
At present, lung transplantation is still the best treatment for end-stage lung disease. Chronic rejection, the pathological manifestation of which appears as bronchiolitis obliterans (BO), also known as bronchiolitis obliterans syndrome (BOS), is the main factor affecting the long-term survival of patients who have undergone lung transplantation \[[@CR1], [@CR2]\]. Based on "The Registry of the International Society for Heart and Lung Transplantation: Thirty-second Official Adult Lung and Heart-Lung Transplantation Report," it was estimated that 5 years after lung transplantation 50% of the recipients would have developed BOS and 76% would have developed BOS 10 years after transplantation \[[@CR3]\]. In recent years, the study of lung transplantation and BOS has been facilitated by the establishment of several relatively mature experimental models of orthotopic left-lung transplantation in rats and mice, based on the cuff technique or other anastomotic methods \[[@CR4]--[@CR6]\].
Hypoxia-inducible factor-1 (HIF-1) is a transcription factor that becomes activated under hypoxia. It is involved in the immune/inflammatory reaction in various pathophysiological statuses, encoding or regulating more than 50 kinds of proteins including erythropoietin, glycolytic enzymes, induced-NOS, and vascular endothelial growth factor (VEGF) \[[@CR7]--[@CR10]\]. HIF-1, as a heterologous dimer, is composed of a functional alpha subunit and a structural beta subunit, and its biological effect is achieved by HIF-1 alpha (HIF-1α), which mediates the recruitment of bone marrow-derived angiogenic cells to increase arterial remodeling and angiogenesis during transplantation. Among the numerous target proteins associated with HIF-1, the protein of most concern is the VEGF, which is well-known for its pro-angiogenic and pro-fibrogenic effects. It has six isoforms, from VEGF-A to VEGF-F, where VEGF-A specifically promotes the division and proliferation of vascular endothelial cells and the migration of inflammatory cells. It is confirmed that HIF-1α signaling inhibition can downregulate VEGF induced fibrinogenesis and angiogenesis in vitro \[[@CR11]\]. Recent studies have found that VEGF-A can bind to VEGF receptor-2 (VEGFR-2) to enhance vascular permeability, promote the expression of cytokines, and induce the inflammatory cells' chemotaxis, which may play a role in the inflammatory response of transplanted organs \[[@CR8], [@CR12], [@CR13]\].
The oxygen concentration in the graft is different from normal after transplantation due to the change in anatomic structures and the involvement of immune, inflammation, and other internal environmental factors \[[@CR7], [@CR14]--[@CR16]\]. At present, it is not clear whether this change would affect the expression of HIF-1 and its downstream proteins, and relate to the rejection of the allograft. Thus, we studied the expression of HIF-1α and VEGF-A, and the relationship between these proteins and BO, in rats after orthotopic left-lung transplantation.
Material and methods {#Sec2}
====================
Animals {#Sec3}
-------
Fischer 344 (F344) and Lewis (LEW) male rats were purchased from the experimental animal center at Zhejiang Academy of Medical Sciences. They were reared in the SPF laboratory of the Key Laboratory of Multiorgan Transplantation at the Chinese Ministry of Health (The First Affiliated Hospital, Zhejiang University, Hangzhou). Animals weighing 250--300 g were used as both donors and recipients. All experimental animal protocols were reviewed and approved by the ethics committees at The First Affiliated Hospital and the Experimental Animal Center, Zhejiang University, China.
Orthotopic lung transplantation {#Sec4}
-------------------------------
The orthotopic left-lung transplantation was performed in the F344-to-Lewis rat strain combination as the allogeneic group (*n* = 24). As described in previous studies \[[@CR4]\], the F344 rats (RT1^1v1^) were used as donors and the Lewis rats (RT1^1^) as recipients. In the control group (*n* = 12), both the donors and the recipients were the Lewis rats. We had two trained laboratory technicians who dealt with donors and recipients, respectively. To reduce the time of cold ischemia and anesthesia of the recipient as much as possible, when one technician separates the donor lung hilar, the other one can start recipient surgery, so that pulmonary hilar anastomosis can be performed as soon as possible. Recipient operation time is from cutting the recipient rat skin, to the end of the skin suture. Warm ischemia time is composed of two parts, the first part is from donor rats superior vena cava disconnection to lung lavage completion, the second part starts with anastomosis, ends of the recipient pulmonary artery opening. Cold ischemia time is the transition time between the first and the second part of the warm ischemia time. Recipients of all groups received the same drug treatment, and specifically, with ciclosporin (Sandimmune, 50 mg/ml; Novartis, Nürnberg, Germany) on the first 10 days and lipopolysaccharide (LPS; L2654, from *Escherichia coli*, 026:B6, Sigma-Aldrich, Steinheim, Germany) once on the 28th day after transplantation.
Histology {#Sec5}
---------
The recipients were sacrificed 90 days after transplantation. The lungs were immediately fixed in situ by an intratracheal instillation of 4% formaldehyde for 24 h with subsequent paraffin embedding. The tissue sections were prepared and stained with hematoxylin-eosin (HE) and Masson's trichrome staining. The staging of the lung allograft rejection was completed according to the International Society for Heart and Lung Transplantation guidelines \[[@CR2]\]. The severity of fibrosis (SF) was measured on an arbitrary scale of 0 to 4 for reference \[[@CR17], [@CR18]\].We conducted the histopathologic analysis in a blinded fashion.
Immunohistochemistry {#Sec6}
--------------------
Immunohistochemistry staining was performed by the streptavidin peroxidase complex method to detect HIF-1α, VEGF-A, and VEGFR-2. The immunohistochemistry score was the product of the staining intensity and percentage of positive cells. The staining intensity was graded from 0 to 3+ (0 for colorless, 1+ for pale yellow, 2+ for brown-yellow, and 3+ for saddle-brown). The score for the percentage of positive cells was from 0 to 4+ (0 for negative, 1+ for fewer than 10% positive cells, 2+ for 10--50% positive cells, 3+ for 51--75% positive cells, and 4+ for over 75% positive cells). The immunohistochemistry score ≥ 3 was considered positive immune response.
Statistical analysis {#Sec7}
--------------------
All numerical data of the experimental results were presented as mean ± standard deviation and categorical data as count and percentage. The statistical analyses were accomplished using the GraphPad Prism 5.0 (GraphPad Software, San Diego, CA). Tests were performed with the Pearson's chi-square test for count data and the student T test for measurement data. All *p*-values were two-tailed and differences were considered statistically significant at *p* \< 0.05.
Results {#Sec8}
=======
Animal model of lung transplantation {#Sec9}
------------------------------------
We have successfully completed a total of 35 rat lung transplantations, with an average operation time for the recipient of about 27 min and a 97.2% success rate (35/36). Cold ischemia time is about 10 min, and warm ischemia time is about 12.5 min. There were two deaths in the allogeneic group: one was caused by a pleural hemorrhage on the third day after surgery and the other by a digestive obstruction on the fiftieth day after the operation. In the isogeneic group, one rat's pulmonary vein was torn during the operation, eventually leading to death by hemorrhagic shock and another died 3 days after the surgery due to a pulmonary embolism. So finally, we have 22 allogeneic recipients in the allogeneic group and 10 isogenic recipients in the control group.
Each recipients received the chest computed tomography scan at specific points \[[@CR19]\]. We selected a typical example from each group (Fig. [1](#Fig1){ref-type="fig"}). On day 27, the computed tomography images of the two groups were similar for clear lung fields and unobstructed bronchus (Fig. [1](#Fig1){ref-type="fig"}a and e). On day 30 after surgery, the diffuse infiltration of bilateral lung parenchyma was seen in every model and the surrounding of the bronchus was more serious as the LPS was applied intratracheally (Fig. [1](#Fig1){ref-type="fig"}b and f). Sixty days after transplantation, lung fields appeared clearer than the previous scan (Fig. [1](#Fig1){ref-type="fig"}c) while the allogenic left lungs still had an increased lung field density and emphysema appeared in the right native lungs (Fig. [1](#Fig1){ref-type="fig"}g). Ninety days postoperatively, the lung fields of the isografts and the right native lungs of the allogenic recipients were clear (Fig. [1](#Fig1){ref-type="fig"}d and h). However, the allogenic left lungs showed disseminated high density shadows with local atelectasis and mediastinum shifted to the left (Fig. [1](#Fig1){ref-type="fig"}h).Fig. 1High-resolution computed tomography imaging of lung isografts (**a**- | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-ijms-21-03165}
===============
Diabetes is a serious, long-term condition with a major impact on the lives and well-being of individuals, families, and societies worldwide. The global diabetes prevalence in 2019 is estimated to be 9.3% (463 million people), rising to 10.2% (578 million) by 2030 and 10.9% (700 million) by 2045 \[[@B1-ijms-21-03165]\]. Population aging is also increasing dramatically throughout the world, especially in developing countries, creating pressures on the health system as well as social security services and policies. In Vietnam, diabetes is projected to be one of the top seven diseases leading to death and disability by 2030 \[[@B2-ijms-21-03165],[@B3-ijms-21-03165]\]. With the increasing prevalence of diabetes, there are approximately 5.76 million people with diabetes currently living in Vietnam. The age-adjusted comparative prevalence of diabetes in the population of Vietnam was approximately 6% in 2017 \[[@B2-ijms-21-03165]\]. Nowadays, many people are familiar with type 1 or type 2 diabetes mellitus, however, there is another form of diabetes that has just recently been identified, known as type 3 diabetes (T3DM). This lesser-known type manifests as insulin resistance within the brain and has major potential to impact neurocognition and contributes to the etiology of Alzheimer's disease \[AD\]. AD has already been identified as the sixth leading cause of death in the United States, and the fifth leading cause of mortality in people 65 and older \[[@B4-ijms-21-03165]\]. It has no current cure, but treatments for symptoms are available and research continues. Neurotransmitter deficits, degenerated neurons, synaptic dysfunction, extracellular buildup of β-amyloid (Aβ) and intracellular neurofibrillary tangles (NFT) are the major crude disfigurements present in AD \[[@B5-ijms-21-03165]\]. To produce Aβ peptides of different lengths such as Aβ38, Aβ40, and Aβ42 due to the active enzymatic component of the γ-secretase complex, presenilin 1 (PSEN1), and PSEN2, the amyloid precursor protein (APP) cleaves at several sites within the membrane. Unfortunately, diabetes is following right behind AD as the seventh leading cause of mortality and is projected to affect almost half a billion people by the year 2045 \[[@B1-ijms-21-03165]\]. Both diseases have been recognized to have multifactorial interactions involving both the environment and to a lesser degree, genetics. Yet, insulin insensitivity has been linked to memory deficits, cognitive decline, and many of the characteristic symptoms that have been displayed in AD. At the same time, type 2 diabetes has remained one of the most adjustable risk factors for the development of AD. DM may be classified into four clinical categories: type 1, type 2, type 3, and type 4. Type 1 diabetes (T1D) is mainly due to β-cell destruction, mostly leading to absolute insulin deficiency. The type 2 diabetes (T2D) is due to a progression of insulin secretary defect concomitantly with insulin resistance. Insulin resistance is a common phenomenon, closely associated with obesity, and defined as the inability of target tissues to respond normally to insulin. Insulin resistance typically precedes the onset of type 2 diabetes by several years. T2D is a risk factor for dementia and for AD, the most common type of dementia. T1D is mainly observed in children and young adults, while T2DM is more common among adults and is responsible for 90% of the incidences globally \[[@B6-ijms-21-03165]\]. Some epidemiological studies suggest that insulin resistance increases the risk for dementia and AD, even in nondiabetic populations.
A recently discovered form has been suggested to be termed type 3 diabetes mellitus (T3DM) by scientists. These scientists have tried to define it as a metabolic syndrome that may lead to abnormalities linked to progressive brain insulin resistance with consequent impairment of central insulin signaling processes, accumulation of neurotoxins, neuronal stress, and resulting in a course of neurodegeneration \[[@B7-ijms-21-03165],[@B8-ijms-21-03165]\]. In vitro and animal studies indicated that insulin resistance can contribute to the pathogenesis of AD through multiple different pathways \[[@B7-ijms-21-03165]\]. Endocrine abnormalities---especially diabetes---are common in AD, which is also regarded as a type of diabetes. Diabetes having an influence on memory processing (recognition and retrieval), morphology of brain (brain atrophy) and synaptic communication is a well demonstrated hazardous aspect that influences the pathology of AD \[[@B9-ijms-21-03165]\]. In addition, the hyperinsulinemia impairment of insulin signaling and insulin resistance are the vital factors that make the sense of keeping insulin at the center stage of both pathologies irrespective of genotype \[[@B10-ijms-21-03165]\]. Many recent studies have indicated that impaired hippocampus insulin signaling impairs the memory and other executive functions, attributing to the decline of insulin signaling and concurrent development of insulin resistance \[[@B11-ijms-21-03165],[@B12-ijms-21-03165],[@B13-ijms-21-03165]\]. This deliberation advocates a strong link between hyperinsulinemia and insulin resistance and the resultant pathologies like T3D and AD \[[@B14-ijms-21-03165]\]. Peripheral insulin resistance leads to decrease insulin signaling in CNS, followed by alteration in brain metabolism. Increased Aβ toxicity, Tau hyperphosphorylation, oxidative stress and neuroinflammation are attributed to central insulin resistance, which leads to neurodegeneration. The work provides the relationship between T3DM and AD based on the fact that both the processing of amyloid-β (Aβ) precursor protein toxicity and the clearance of Aβ are attributed to impaired insulin signaling in the brain. Furthermore, insulin-related therapeutic strategies are suggested to succeed in the development of therapies in AD by slowing down their progressive nature or even halting their future complications. [Figure 1](#ijms-21-03165-f001){ref-type="fig"} reveals the concept of T3D regarding AD and its approaches for treatment and prevention.
2. Insulin and Glucagon Signaling in the Central Nervous System (CNS) {#sec2-ijms-21-03165}
=====================================================================
Insulin is a hormone that regulates glucose levels in the blood, is produced by the beta cells of the islets of Langerhans in the pancreas, and consists of two polypeptide chains connected by disulfide linkages. Insulin initiates its action by binding to transmembrane glycoprotein receptors formed by two α and two β-subunits \[[@B14-ijms-21-03165]\]. Insulin binding to α-subunits of the receptors fabricate confirmative alterations that lead to its activation and autophosphorylation of several Tyr residues at β-subunit cytosolic region \[[@B15-ijms-21-03165],[@B16-ijms-21-03165]\]. Autophosphorylated remnants are then acknowledged by the insulin receptor substrates (IRS), out of which IRS-1 and IRS-2 are the two major players and the common intermediaries in insulin signal propagation. IRS is ideal and suitable for the configuration of molecular complexes which mediates intracellular signaling pathways. Insulin and insulin-like growth factors (IGF-1) connect to tyrosine kinase receptors, the insulin receptor (IR) and IGF-1. Insulin binding is highest in the olfactory bulb, cerebral cortex and hippocampus. Furthermore, insulin receptors are also expressive on endothelial cells of the blood--brain barrier and are responsible for transport of insulin and IGF-1 through the blood--brain barrier (BBB) into CNS \[[@B17-ijms-21-03165]\]. While the exact mechanism of how insulin gets into the brain still remains controversial, insulin circulating in the blood can cross the BBB through a receptor-mediated active transport system \[[@B17-ijms-21-03165]\]. This pathway is consistent with studies showing that insulin levels in the cerebrospinal fluid (CSF) increase proportionally with blood insulin after peripheral insulin infusion \[[@B15-ijms-21-03165],[@B16-ijms-21-03165],[@B17-ijms-21-03165]\]. However, the amount of insulin produced in the brain and whether this pool of insulin is physiologically relevant still remains elusive. It is possible that both the centrally and peripherally derived pools of insulin are important for signaling in the brain.
Insulin and IGF-1 are conferred with functions which are important for neuronal survival and the maintenance of CNS integrity. Insulin receptors and insulin signaling affect glucose homeostasis, neuronal integrity and cognition through influencing several receptor-mediated mechanisms including calcium influx, neurotransmitter build-up and synaptic connections, apoptosis, and neurogenesis \[[@B17-ijms-21-03165]\]. Insulin also regulates expression and levels of GABA, NMDA and AMPA-mediated mechanisms which have a strong influence over long-term potentiation (LTP) and long-term depression (LTD). Furthermore, insulin is crucially involved in expansion and preservation of excitatory synapses \[[@B18-ijms-21-03165]\] and dendritic spine formation through the activation of AKT--mTOR and Ras-related pathways \[[@B19-ijms-21-03165],[@B20-ijms-21-03165]\] which are integral to insulin signaling \[[@B21-ijms-21-03165]\]. Insulin also influences cell survival by modulating apoptotic pathways and the intermediates involved in the apoptotic cascade \[[@B22-ijms-21-03165],[@B23-ijms-21-03165]\].
The presence of insulin in the brain was first reported by Havrankova et al. \[[@B24-ijms-21-03165]\] who used radioimmunoassay to determine high levels of insulin in brain extracts. Also, high insulin concentrations had then | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
*Nocardia* is a genus belonging to the aerobic actinomycetes group of bacteria which are Gram-positive bacilli and showing branching filamentous forms \[[@B1]\]. They are saprophytic ubiquitous bacteria which can be found in several environments such as fresh water and saltwater, soil, dust, decaying vegetation, and decaying fecal deposits from animals \[[@B1]\]. Nevertheless, these environmental bacteria can be opportunistic pathogens and lead to human infectious diseases called "nocardiosis" \[[@B2]\]. Nocardiosis can be discriminated into two groups: invasive infection, mainly caused by*N. asteroides,*presenting commonly as pneumonia in patients who are immunocompromised, have underlying chronic lung disease, and are with a possible dissemination to other organs \[[@B3]\], and cutaneous infection via a cut or abraded skin, which can be manifest clinically as (i) abscess and cellulitis, (ii) lymphangitis, (iii) skin infection secondary to dissemination, and (iv) actinomycetoma. This latter group is the most amazing infection due to their severity characterized by the presence of tumefaction, subcutaneous nodules, destructive granulomata, fistulas, and pus \[[@B2], [@B4]\].
*N. brasiliensis* is the species isolated from the majority (approximately 80%) of cases of cutaneous nocardiosis, especially in actinomycetoma \[[@B2]\]. This species is more commonly isolated in areas with tropical or subtropical climates such as South America, Asia, and Africa. Due to false diagnosis, rural lifestyles, and poor access to care in these countries,*N. brasiliensis* nocardiosis constitutes a real public health problem that can lead, in the absence of treatment, to amputations and death in young populations. On the basis of epidemiological surveys conducted in France, the number of cases of nocardiosis between 2000 and 2007 according to the French Nocardiosis Observatory (OFN) was 607 with*N. farcinica* and*N. nova* being the most frequent species \[[@B5]\]. However, no data currently exists on the phylogenetic relationships between the indigenous*N. brasiliensis* strains of tropical origin and native strains isolated in France. Routine genus/species identification of*Nocardia*was based on macroscopic, microscopic, and biochemical characteristics. The methods described by Boiron et al. \[[@B6]\] were used to determine the decomposition of adenine, casein, hypoxanthine, tyrosine, and xanthine. In addition to the phenotype-based methods, species-level identification is mainly genetically based, nowadays. Classically, 16S rRNA*(rrs)* gene sequencing is generally used for the species-level identification \[[@B7], [@B8]\], but it fails to discriminate among some species of*Nocardia* because it does not have enough polymorphism to differentiate them at the species level. Multilocus sequence analysis (MLSA) using concatenated sequences of several housekeeping genes such as superoxide dismutase A*(sodA)* and heat shock protein 65*(hsp65)* has been increasingly used to provide higher accuracy and discriminatory power in the molecular identification of*Nocardia* spp. \[[@B9], [@B10]\]. Indeed, a recent study seeking to identify new molecular targets shows that the polymorphism observed in the*sodA* gene sequence contains variable regions that allow the discrimination of closely related*Nocardia* species \[[@B9]\].
The aim of the present study was to perform a genetic characterization and assess the phylogenetic relationships of*Nocardia brasiliensis* focusing on using housekeeping*rrs*,*hsp65,* and*sodA* genes, for 36 autochthonous*N. brasiliensis*strains isolated in France and analyzed by the OFN between 2002 and 2012. Phenotypic characterization was also conducted by assessing antimicrobial resistance profiles, metabolic profiles, and culture condition.
2. Materials and Methods {#sec2}
========================
2.1. Bacterial Strains and Culture Media {#sec2.1}
----------------------------------------
A collection of 36 human clinical strains of*N. brasiliensis* was studied ([Table 1](#tab1){ref-type="table"}). All strains were identified as such, at species level by the French Nocardiosis Observatory (OFN) by genetic approach. Moreover, six*Nocardia* reference strains belonging to*N. brasiliensis* clade \[[@B9]\] were also used:*N. brasiliensis* ATCC 19296^T^ (unknown),*N. altamirensis* DSM 44997^T^ (karstic cave),*N. boironii* DSM 101696^T^ (pus sample),*N. iowensis* DSM 45197^T^ (garden soil),*N. tenerifensis* DSM 44704^T^ (rhizosphere), and*N. vulneris* DSM 45737^T^ (human leg wound). Prior to the assays, strains were cultured 72 hours in Bennett medium (made in the laboratory) aerobically at 37°C.
2.2. Growth Test on Culture Media {#sec2.2}
---------------------------------
From 0.5 McF bacterial suspension, bacterial growth was evaluated on three culture media: (i) bromocresol purple (BCP) (Biomérieux, Marcy l\'étoile), (ii) Bennett (made in the laboratory), and (iii) Middlebrook (Biomérieux, Marcy l\'étoile). One hundred microliters from bacterial suspension standardized was inoculated on the different plate of culture media. The plates were incubated at 37°C and the observations were performed at 48, 72, and 96 hours.
2.3. Antimicrobial Susceptibility {#sec2.3}
---------------------------------
The susceptibility of the isolates to different antimicrobials was determined by disk diffusion method with a panel of 31 antibiotics (Biorad, Marnes-la-Coquette France) on Muller Hinton E medium (Biomérieux, Marcy l\'étoile, France). Susceptibility testing was done with amikacin 30 *μ*g, gentamycin 15 *μ*g, tobramycin 10 *μ*g, ciprofloxacin 5 *μ*g, levofloxacin 5 *μ*g, moxifloxacin 5 *μ*g, minocycline 30 *μ*g, doxycycline 30 *μ*g, tigecycline 15 *μ*g, cefotaxime 30 *μ*g, ceftriaxone 30 *μ*g, cefepime 30 *μ*g, cefuroxime 30 *μ*g, amoxicillin 25 *μ*g, amoxicillin + clavulanic acid 20/10 *μ*g, ampicillin 10 *μ*g, ertapenem 10 *μ*g, meropenem 10 *μ*g, imipenem 10 *μ*g, vancomycin 30 *μ*g, pristinamycin 15 *μ*g, erythromycin 15 *μ*g, trimethoprim + sulfamethoxazole 1.25/23.75 *μ*g, rifampicin 30 *μ*g, and linezolid 30 *μ*g.
From visible colonies, bacterial suspension was done in sterile water, using a cotton swab to obtain a concentration of 0.5 McFarland according to the Clinical and Laboratory Standards Institute standard M24-A2 \[[@B12]\]. Seeding was done according to the swab method. In this latter, the bacterial inoculum was spread on the agar using a sterile cotton swab in three different directions. The disks were dispensed with a dispenser and the plates were incubated at 37°C for 72 hours and read manually according to the thresholds defined in the recommendations of the SFM 2013 \[[@B11]\].
2.4. Substrate Degradation {#sec2.4}
--------------------------
The methods of Boiron et al. \[[@B6]\], Goodfellow et al. \[[@B13], [@B14]\], and Goodfellow and Lechevalier \[[@B15]\] were used to determine the decomposition of adenine, casein, and uric acid \[[@B9]\]. Clinical strains of*N. brasiliensis* and the strains of species belonging to the*N. brasiliensis* clade (*N. brasiliensis, N. altamirensis, N. iowensis, N. tenerifensis*,*N. boironii,* and*N. vulneris*) were tested \[[@B9]\]. Strains*N. boironii* DSM 101696^T^,*N. brasiliensis* ATCC 19296^T^, and*N. vulneris* DSM 45737^T^ were incubated at 37°C, and*N. altamirensis* DSM 44997^T^,*N. tenerifensis* DSM 44704^T^, and*N. iowensis* DSM 45197^T^ were incubated at 28°C \[[@B9]\]. The readings were performed at 3, 7, 10, 14, 17, and 21 days.
2.5. Methods of DNA Extraction {#sec2.5}
------------------------------
DNA extraction from*Nocardia* strains was performed with achromopeptidase according to the method reported by Rodríguez-Nava et al. \[[@B10]\]. Colonies were picked off with a loop, and one loopful | {
"pile_set_name": "PubMed Central"
} |
[^1]: Chun-yang Xu, Sheng-dong Lu. These authors contributed equally to this work
| {
"pile_set_name": "PubMed Central"
} |
Rajendran K, Krishnasamy N, Rangarajan J, Rathinam J, Natarajan M, Ramachandran A. Convalescent plasma transfusion for the treatment of COVID‐19: Systematic review. J Med Virol. 2020;1--9. 10.1002/jmv.25961 31502247
1. INTRODUCTION {#jmv25961-sec-0010}
===============
The recent coronavirus disease 2019 (COVID‐19) epidemic developed into an unprecedented global public health crisis with significant humanitarian consequences. As of 19 April 2020, the World Health Organization has been informed of 2 241 359 confirmed cases of COVID‐19, with 152 551 deaths (6.8%) documented worldwide.[^1^](#jmv25961-bib-0001){ref-type="ref"}
The current treatment of COVID‐19 caused by novel coronavirus SARS‐CoV‐2 has been limited to general supportive care, with provision of critical care as no approved therapies or vaccines are available.[^2^](#jmv25961-bib-0002){ref-type="ref"}
The clinical data for the studies involving COVID‐19 are still scarce and limited to data from China, Spain, Italy, United States of America, Germany, France, The United Kingdom, and other international registries. This will be a problem when predicting treatment outcomes.
Passive immunization therapy has been successfully used to treat infectious diseases back to the 1890s. An individual who is sick with infectious diseases and recovers has blood drawn and screened for particular microorganism neutralizing antibodies. Following identification of those with high titers of neutralizing antibody, convalescent plasma containing these neutralizing antibodies can be administered in individuals with specified clinical disease to reduce symptoms and mortality. Hence, convalescent plasma transfusion (CPT) has been the subject of increasing attention, especially in the wake of large‐scale epidemics.[^3^](#jmv25961-bib-0003){ref-type="ref"} It has recently been suggested by Food and Drug Administration that administration and study of investigational CPT may provide a clinical effect for treatment of COVID‐19 during the public health emergency.[^4^](#jmv25961-bib-0004){ref-type="ref"}
We conducted a systematic review to evaluate available data for the clinical effectiveness of convalescent plasma for the treatment of COVID‐19. This will help to provide clinicians and scientists with an overview of scientific evidence on a potential treatment option and better clinical management of critically ill COVID‐19 patients.
2. METHODS {#jmv25961-sec-0020}
==========
2.1. Protocol and registration {#jmv25961-sec-0030}
------------------------------
This systematic search was carried out in major electronic databases (PubMed, Embase, and Medline) to identify available evidence providing Information on the CPT for treatment of COVID‐19 in accordance with the preferred reporting items for systematic reviews and meta‐analyses guidelines.[^5^](#jmv25961-bib-0005){ref-type="ref"} Due to the urgency of the matter and anticipated long waiting period, we were not able to wait for registration of this systematic review protocol (PROSPERO Submission id number: 179739).
2.2. Eligibility criteria {#jmv25961-sec-0040}
-------------------------
### 2.2.1. Study designs {#jmv25961-sec-0050}
Study designs from the selected publication reported CPT in COVID‐19 patients included clinical trials such as randomized controlled trials, controlled clinical trials, prospective and retrospective comparative cohort studies, case‐control studies; cross‐sectional studies, case series, and case reports.
2.3. Intervention {#jmv25961-sec-0060}
-----------------
We included clinical studies involving assessment of CPT treatment for the COVID‐19 patients.
Study population, timing, and setting:
Published literatures were identified between 1 December 2019 and 19 April 2020 using "convalescent plasma and COVID‐19" as search term without restrictions on the study type of setting.
2.4. Comparators {#jmv25961-sec-0070}
----------------
There were no restrictions on the type of comparator in the studies.
2.5. Outcomes {#jmv25961-sec-0080}
-------------
The outcome of interest was clinical effects, survival benefits, viral load & antibody titer status and adverse events.
2.6. Languages {#jmv25961-sec-0090}
--------------
We included articles without considering any restriction of language to identify potential published studies.
2.7. Publication status {#jmv25961-sec-0100}
-----------------------
We included articles published in scientific journals.
2.8. Information sources {#jmv25961-sec-0110}
------------------------
This systematic search was carried out in major electronic databases (PubMed, Embase, and Medline) to identify available evidence providing information on the CPT for treatment of COVID‐19. In addition, we also searched the reference lists of selected studies.
2.9. Search strategy {#jmv25961-sec-0120}
--------------------
The results of our database searches and records identified from other sources were documented. Removal of duplicates were also done manually and depicted in a PRISMA flow diagram.
2.10. Study selection {#jmv25961-sec-0130}
---------------------
A study screen was done minimum of two authors from the search results spreadsheet, authors independently screened the titles and abstracts of studies using the inclusion criteria. Studies selected at title and abstract levels were further screened with the full text of the article for eligibility to include in our review. The studies exploring preclinical trials such as in vitro trials and studies on animal models and in silico drug screens were excluded.
2.11. Data extraction and data items {#jmv25961-sec-0140}
------------------------------------
A pre‐conceived data extraction sheet was used to extract data from selected eligible studies. Any consensus in case of disagreement was resolved by opinion of a third reviewer. The extracted information included mortality, viral load, viral antibody titers, clinical benefits, and adverse events. Outcomes were extracted in all data forms (eg, dichotomous and continuous) as reported in the included studies. The results of our databases search were documented and described in a PRISMA flow diagram (Figure [1](#jmv25961-fig-0001){ref-type="fig"}).
{#jmv25961-fig-0001}
2.12. Risk of bias in individual studies {#jmv25961-sec-0150}
----------------------------------------
To reduce risk of bias two authors independently assessed the included studies. Overall risk of bias was judged as low risk, unclear risk, and high risk.
3. RESULTS {#jmv25961-sec-0160}
==========
The search identified 110 sources. Following screening of titles and abstracts and removing duplicates, we evaluated eight articles in full text. Among these, we found five relevant articles (one pilot study, one preliminary communication, one novel report, one case report, one descriptive study).[^6^](#jmv25961-bib-0006){ref-type="ref"}, [^7^](#jmv25961-bib-0007){ref-type="ref"}, [^8^](#jmv25961-bib-0008){ref-type="ref"}, [^9^](#jmv25961-bib-0009){ref-type="ref"}, [^10^](#jmv25961-bib-0010){ref-type="ref"} Extracted details for five studies are presented in Table [1](#jmv25961-tbl-0001){ref-type="table"}, including the country of study, number of patients, dosage of CPT, mortality, length of hospital stay during transfusion, critical care interventions, clinical outcome, viral load, and adverse events. The five studies include a total of 27 patients who received CPT therapies for COVID‐19.
######
The efficacy and safety of convalescent plasma transfusion (CPT) in patients with COVID‐19
<table><thead><tr class="header"><th>Author</th><th>Country</th><th>Study period</th><th>Study population</th><th>CPT dosage</th><th>Antiviral (antimicrobial drugs)</th><th>Administrated day</th><th>Status during CPT</th><th>Outcome</th><th>Viral load</th><th>Severe adverse events & treatment complications</th></tr></thead><tbody><tr class="odd"><td>Duan et al<a href="#jmv25961-bib-0006" data-ref-type="ref"><sup>6</sup></a></td><td>China</td><td>23 January 2020 to 19 February 2020</td><td>10, 6 M:4 F, Age (x̃‐52.5 y), Cardiovascular and/or cerebrovascular diseases and HTN (n = 4)</td><td>200 mL within 4 h, antibody titer >1:640</td><td><p>arbidol or/and remdesivir/ribavirin/peramivir (n = 9)</p><p>ribavirin (n = 1)</p><p>Antibacterial/antifungal for coninfecion (n = 8)</p | {
"pile_set_name": "PubMed Central"
} |
All sequence files are available from the GenBank database (accession numbers KT804429-42).
Introduction {#sec001}
============
*Leptospira* spp. are helical-shaped bacteria and form a particular group of causative agents for the zoonotic disease Leptospirosis. *Leptospira* spp. are transmitted through infected urine of small mammals or contaminated water via the direct contact to skin lesions or conjunctivae \[[@pntd.0004501.ref001]\]. Small mammals are described as the most important maintenance reservoirs in nature and thus as an essential vector for several pathogenic *Leptospira* spp. \[[@pntd.0004501.ref002], [@pntd.0004501.ref003], [@pntd.0004501.ref004], [@pntd.0004501.ref005]\]. Leptospirosis is considered the most widespread zoonotic disease worldwide, which is of emerging concern \[[@pntd.0004501.ref006]\]. In the past, Leptospirosis was described to be a disease of occupational risk for harvesters, miners, veterinarians and rodent control workers in Europe \[[@pntd.0004501.ref002], [@pntd.0004501.ref007]\]. Nowadays, it is increasingly linked to recreational outdoor activities, such as water sports and adventure travels \[[@pntd.0004501.ref005], [@pntd.0004501.ref008]\]. However, partially due to the broad variety of clinical symptoms, which are nonspecific, the awareness for this disease is not yet present especially in temperate regions \[[@pntd.0004501.ref005], [@pntd.0004501.ref009]\]. The estimated incidence of clinical cases per year is 0.2 / 100,000 in Germany \[[@pntd.0004501.ref010]\]. Severe cases associated with rats have also been reported \[[@pntd.0004501.ref008], [@pntd.0004501.ref011]\]. Recently, human cases, which were linked to contaminated water or soil, occurred in Austria \[[@pntd.0004501.ref012], [@pntd.0004501.ref013], [@pntd.0004501.ref014]\]. Furthermore leptospirosis outbreaks were reported among triathletes and strawberry harvesters in Germany \[[@pntd.0004501.ref015], [@pntd.0004501.ref016]\]. The clinical severity of *Leptospira* spp. infection depends on the virulence of the infecting *Leptospira* serovar as well as on the health status of the patient \[[@pntd.0004501.ref003]\]. The taxonomy of *Leptospira* spp. is complex. To date, ten different pathogenic *Leptospira* species with more than 300 serovars, grouped in 20 serogroups are known \[[@pntd.0004501.ref017]\]. The term serogroup is of taxonomic importance and defines groups with antigenetically related serovars. However identical serovars may belong to different *Leptospira* species \[[@pntd.0004501.ref002]\]. Duplex PCR \[[@pntd.0004501.ref018]\] and detailed sequence typing are used for the characterisation of *Leptospira* spp. strains and genotypes while the microscopic agglutination test (MAT) which is important for the categorisation of serovars, is still the gold standard in routine diagnostics \[[@pntd.0004501.ref019]\]. Most commonly, human clinical cases in Europe are caused by *L*. *interrogans* and/or *Leptospira* spp. serovar Grippotyphosa \[[@pntd.0004501.ref012], [@pntd.0004501.ref013], [@pntd.0004501.ref016], [@pntd.0004501.ref020]\]. A recent study from Poland reported also antibody titres in humans against the serovars Australis, Autumnalis, Hebdomadis, Hardjo, Sejroe, Zanoni, Bataviae, Bratislava, Canicola and Grippotyphosa, belonging to 3 species, *L*. *interrogans*, *L*. *borgpetersenii* and *L*. *kirschneri*\[[@pntd.0004501.ref021]\]. Studies from Germany and France reported high prevalences for *Leptospira* spp. in small mammals which are likely responsible for simultaneous human leptospirosis cases \[[@pntd.0004501.ref016], [@pntd.0004501.ref020]\]. So far there are only a few studies reporting moderate to high prevalences in small mammals, beavers (*Castor fiber*) and wild boars (*Sus scrofa*) from Germany \[[@pntd.0004501.ref005], [@pntd.0004501.ref008], [@pntd.0004501.ref022]\]. Little is known about the prevalence and the geographic distribution of pathogenic *Leptospira* spp. in rodent maintenance hosts in Germany. Possible host-pathogen associations were not further determined thus far.
Therefore, this study's objectives were:
1. Detection of prevalence rates for different pathogenic *Leptospira* spp. in captured small mammals from three selected sites in Germany;
2. Comparison of the detected *Leptospira* spp. and their sequence types (ST) in relation to captured small mammal species and the various study sites.
Materials and Methods {#sec002}
=====================
Study sites {#sec003}
-----------
### Bavarian Site 1 "Angelberger Forst", Bavaria (B1) {#sec004}
The site B1, located near Tussenhausen, Bavaria, is a large mixed forest (641 ha). The anthropogenic influence is low thus interaction between wild and domestic animals and humans is limited \[[@pntd.0004501.ref023]\]. Details of this study area have been described before \[[@pntd.0004501.ref024], [@pntd.0004501.ref025]\].
### Bavarian Site 2 "Bavarian Forest National Park" (B2) {#sec005}
The second study site B2 was divided in three transects in the "Bavarian Forest National Park" (242,000 ha) from 629 to 1420 m a. s. l. It is also situated in Bavaria and is part of the Bohemian Massif. This National Park and the adjacent Czech Sumava National Park form one of the most homogenous and extensively forested landscapes in Central Europe. The study site is located in a forested montane area and is often frequented by visitors for recreational activities. Further characteristics, GPS coordinates of trapping sites along the transects as well as ecologic properties have been described in detail before \[[@pntd.0004501.ref026]\].
### Renaturalised area in the city centre of Leipzig, Saxony (S) {#sec006}
The third site (S) is divided in five areas located around the city centre of Leipzig formerly consecutively named from E to I \[[@pntd.0004501.ref027]\]. The study site belongs to a renaturalised location ([www.neuseenland.de](http://www.neuseenland.de/)), which was created out of a former brown coal mining area. Today, the surroundings of this site are the largest recreational area near Leipzig thus many visitors frequent this site. Detailed descriptions about the areas around Leipzig have been published elsewhere \[[@pntd.0004501.ref027]\].
Sampling of small mammals {#sec007}
-------------------------
Small mammals were trapped with Sherman live animal traps (H. B. Sherman Traps, Inc., Tallahassee, Fla., U.S.A.) in 2012 at site B1, in 2010 at site B2 and from 2010 to 2012 at site S. Traps, baited with apple slices, were placed for at least two consecutive nights per month and site and were checked twice a day. For site B1, 50 traps were set up between July and October in 2012. At site B2 in plot sizes of 18 x 18 m, 16 traps were laid out in a grid. The traps were checked twice on two successive days once a month, from May to October 2010. At site S, small mammals were captured with at least 20 traps per subdivided area per month in August and October in 2010 and from March to June in 2011 (site E, H, I) and further in November 2011 and from March to October in 2012 (site E, F, G, H, I). Collected animals were euthanized in accordance with the German Animal Protection Act and stored at −80°C. Detailed trapping procedures were published elsewhere \[[@pntd.0004501.ref026], [@pntd.0004501.ref027], [@pntd.0004501.ref028]\]. Necropsy was carried out with collection of biometric data of all small mammals and kidneys were collected. All small mammals were morphologically identified with taxonomic keys \[[@pntd.0004501.ref029]\]. Further, a conventional PCR targeting the partial mitochondrial *cytochrome b* gene \[[@pntd.0004501.ref030]\] yielding an amplicon of 354 bp was performed with 37 small mammal DNA samples from site B1 (17.1%) and 36 DNA samples from site S (6.7%) including all bycaught small mammal species, which were not rodents, in order to verify morphological identification and to verify successful DNA extraction.
DNA extraction {#sec008}
--------------
Depending on the initial kidney size of the small mammals, kidney samples weighed 0.01--0.05g and were homogenized either by cutting the samples into small pieces | {
"pile_set_name": "PubMed Central"
} |
All relevant data are within the paper.
Introduction {#sec006}
============
Parkinson's disease (PD) is a neurodegenerative process that leads to the selective loss of dopaminergic neurons, mainly in the basal ganglia of the brain. Clinical manifestations include movement alterations as well as non-motor symptoms, such as dementia, depression, and autonomic dysfunction \[[@pone.0177163.ref001]\]. Neurons and neural circuits outside the basal ganglia can be affected simultaneously or upstream of the substantia nigra \[[@pone.0177163.ref002]\].
Vision is one of the non-motor systems altered in PD, especially the visual field corresponding to the fovea \[[@pone.0177163.ref003],[@pone.0177163.ref004]\]. Recent studies demonstrated retinal thinning in different macular sectors and retinal nerve fiber layers (RNFL) in PD patients compared with healthy subjects, \[[@pone.0177163.ref005],[@pone.0177163.ref006]\], and alterations in multifocal electroretinograms \[[@pone.0177163.ref007],[@pone.0177163.ref008]\].
Several mechanisms have been proposed for the axonal loss in PD disease, leading to tissue degeneration and ultrastructural changes of the retinal ganglion cells \[[@pone.0177163.ref009]\], but the changes of the choroidal layer have not been thoroughly evaluated. Mechanobiologic response of tissues \[[@pone.0177163.ref010]\] and cells \[[@pone.0177163.ref011]\] depends on the mode of deformation, and the magnitude and temporal profile of the stimulus, as well as the type of tissue or cell and its biologic state. Understanding the particular deformations observed in each tissue and ocular layer in patients with PD might facilitate diagnosis and treatment.
Before the development of OCT, choroidal studies were limited to histopathologic analysis. OCT is a useful tool for choroidal studies; nevertheless, the role of choroidal analysis for ocular pathologies is not yet established. Spectral domain-optical coherence tomography (SD-OCT), mostly with enhanced depth imaging (EDI), has been used to evaluate the macular and peripapillary choroid (mainly in healthy eyes and glaucoma patients) \[[@pone.0177163.ref012],[@pone.0177163.ref013]\], but the relation of OCT measurements with changes in the peripapillary choroid remain unclear. Some studies report a reduction in the mean or regional peripapillary choroidal thickness (PPCT) in primary open-angle glaucoma \[[@pone.0177163.ref014]--[@pone.0177163.ref016]\], but in these studies, choroidal thickness was measured manually using SD-OCT at only a few points and beneath the circumpapillary ring, an area typically used for RNFL evaluation. The automated segmental measurement software used in the present study, however, is better suited for a broader and more objective evaluation of choroidal thickness. Swept-source (SS) OCT, as compared with SD-OCT with EDI, provides better visualization of the choroid \[[@pone.0177163.ref017]\], more accurately measures the deep tissues, detects the posterior limit of the sclera, \[[@pone.0177163.ref018]\], and is applicable for evaluating a broader area of the posterior segment.
Based on the improved ability of this new SS-OCT technology to reveal and automatically measure a wide area of the peripapillary choroid, our first objective was to measure the PPCT in a 26×26 cube-grid centered on the optic disc, which is automatically performed by the Deep Range Imaging (DRI)-OCT Triton (Topcon Corporation, Tokyo, Japan), in a sample of healthy subjects to determine the pattern or distribution of PPCT and to establish objective zones with similar choroidal thicknesses. Our second objective was to study the PPCT differences within these zones in a sample of PD patients compared with age- and sex-matched healthy controls. The third objective was to evaluate the relationship between PPCT alterations and PD severity. The main advantage of the present study is that PPCT was evaluated in a wide area of the peripapillary choroid using an automatic and accurate new method.
Material and methods {#sec007}
====================
Study population and design {#sec008}
---------------------------
This was a prospective, observational, cross-sectional case-control study. The study included patients with definite PD, and age- and sex-matched healthy controls. Based on our preliminary studies, we calculated the necessary sample size to detect differences in choroidal thickness of at least 20 μm as measured by OCT, applying a two-tailed test with an alpha of 5% and a beta of 10%, and a risk ratio of 0.5. Based on this calculation, at least 70 eyes were needed (35 from PD patients and 35 from healthy controls). A total of 40 eyes of 40 PD patients and 80 eyes of 80 healthy controls were evaluated. PD diagnosis was based on the UK Brain Bank Criteria, which included, in the first stage, bradykinesia and one additional symptom, i.e., rigidity, 4--6 Hz resting tremor, or postural instability \[[@pone.0177163.ref019],[@pone.0177163.ref020]\].
Patients with a visual acuity less than 0.1 (Snellen scale), intraocular pressure (IOP) \>20 mmHg, optic neuritis antecedent, no transparent ocular media (nuclear color/opalescence, cortical or posterior subcapsular lens opacity ≥1 according to the Lens Opacities Classification System III system) \[[@pone.0177163.ref021]\] and systemic disease that could affect the eye (e.g., diabetes, neurologic pathologies, hypertension, and endocrine disorders) were excluded from the study. Subjects with refractive errors greater than 5 diopters (D) of spherical equivalent refraction or 3 D of astigmatism were also excluded from the study.
Standard protocol approvals, registrations, and patient consent {#sec009}
---------------------------------------------------------------
The study procedures were performed in accordance with the tenets of the Declaration of Helsinki, and the study protocol was reviewed and approved by the Aragon Ethics Committee For Clinical Research before the study began. Written informed consent to participate in the study was obtained from all subjects.
Main outcome measures {#sec010}
---------------------
All subjects underwent a complete neuro-ophthalmic examination, including assessment of best-corrected visual acuity using the Snellen chart, pupillary reflexes, and ocular motility; examination of the anterior segment, IOP with the Goldmann applanation tonometer, and papillary morphology by funduscopic exam; as well as OCT.
In the PD group, disease severity was assessed using the Unified Parkinson Disease Rating (UPDRS) and the Hoehn and Yahr scales, and disease duration since the PD diagnosis was recorded. The Hoehn and Yahr scale is a commonly used diagnostic tool for quantifying the progression of PD symptoms \[[@pone.0177163.ref022]\]. Stages range from 0 (no signs of disease) to 5 (requiring a wheelchair, or bedridden unless assisted). Clinicians and researchers most commonly use the UPDRS, and the motor section in particular, to follow the longitudinal course of PD in clinical studies \[[@pone.0177163.ref023]\]. The scale includes three sections that evaluate the key areas of disability, and a fourth section that evaluates treatment complications. Treatment for PD was registered using three different categories for clearer classification: "drugs that enhance dopamine levels" (carbidopa, levodopa, and rasagiline), "dopaminergic drugs" (pramipexole, ropirinole, rotigotine), and "other" (amitriptyline, propranolol, clonazepam).
OCT {#sec011}
---
An optic disc 6.0×6.0 mm three-dimensional scan was obtained using the DRI OCT Triton (Topcon Corporation). This scan combines morphometric optic disc parameters and various peripapillary parameters, including RNFL and choroidal thickness. The subjects were seated and properly positioned. All DRI-OCT images were obtained by a single well-trained technician blinded to the presence or absence of PD. The DRI-OCT Triton includes the new SMARTTrack tool that enhances tracking, corrects for motion, and guides the operator to reduce potential errors while acquiring images. Only eyes with good quality scans were included in the analysis. Good-quality SS-OCT images were defined as those with a signal strength ≥40 (maximum = 100), and without motion artifact, involuntary saccade, or overt misalignment of decentration. A total of three eyes (two in the PD group and one in the control group) were excluded due to poor DRI-OCT image quality. These eyes were substituted with two new patients in the PD group and one new healthy subject in the control group. The same investigator performed all of the OCT scans and checked the accuracy of segmentation in each scan and the lack of artifacts. A total of 15 scans in the PD group and 10 in the control group were excluded and repeated.
A 26×26 cube-grid centered on the optic disc was generated to automatically measure choroidal thickness. This grid comprised 676 cubes (200 μm x 200 μm) around the optic nerve head with the 88 central cubes corresponding to the optic nerve head area not analyzed; therefore the DRI-OCT Triton displays choroidal thickness for a total of 588 peripapillary cubes ([Fig 1](#pone.0177163.g001){ref-type="fig"}). The Bruch membrane and choroidal-scleral interface were delineated with the segmentation algorithm implemented by Topcon ([Fig 1](#pone.0177163.g001){ref-type="fig"}).
{ref-type="fig"} shows a decrease in the frequency of her pancreatitis attacks as her serum calcium levels dropped with an increase in cinacalcet dose. She has not had an episode of pancreatitis for more than 2 years and her latest calcium levels remain at 2.10 mmol/l. She is being followed up annually with a repeat serum calcium level as well as 24 h urine calcium level before analysis in the clinic.
{#fig1}
Discussion
==========
FHH is usually a benign inherited condition, which is usually associated with minimal sequelae from hypercalcaemia. Pancreatitis has been reported rarely [@bib1] [@bib2]. Other complications include chondrocalcinosis, gallstones and osteoporosis [@bib3]. It is well established that FHH is caused by inactivating mutations in the *CASR* gene, which reduce sensitivity to extracellular calcium. However, the mechanism of pancreatitis in this condition is poorly understood. Although the link between FHH and pancreatitis had previously been questioned [@bib4], more recent papers have associated it with variant mutations of the *CASR* [@bib1] possibly due to a combination of *CASR* mutation and a coexisting SPINK1 mutation, which predisposes to chronic pancreatitis [@bib5]. Theoretically, improving the sensitivity of mutant *CASR* to extracellular calcium would improve calcium homoeostasis and may offer effective treatment for patients with symptomatic FHH.
Calcimimetic agents such as cinacalcet are allosteric activators of CASR, which lower its activation threshold to extracellular calcium [@bib6]. Although commonly used in the management of secondary hyperparathyroidism, inoperable parathyroid adenomas and carcinomas [@bib6], it has also been a successful treatment for patients with symptomatic FHH [@bib3] [@bib7]. Mutations of the *CASR* in FHH also have various degrees of responsiveness to calcimimetics [@bib8]. Therefore, the response to cinacalcet and the dose required are likely to be unpredictable.
Whether or not cinacalcet can be used as a long-term therapy in these patients remains yet to be determined. One long-term case series [@bib9] in which patients with FHH were treated with cinacalcet for up to 3 years showed that not only was it well tolerated but there was also a sustained improvement in serum calcium levels as well as PTH levels.
Our patient responded well to a moderate dose of cinacalcet. This case highlights the effective use of cinacalcet and the potential strategy in managing FHH patients presenting with recurrent pancreatitis. It also draws attention to getting the right diagnosis in order to avoid unnecessary surgical intervention in these patients.
Patient consent
===============
Written informed consent was obtained from the patient for publication.
Author contribution statement
=============================
Dr M Druce is the patient\'s main physician and is a co-author.
Declaration of interest
=======================
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
=======
This research did not receive any specific grant from any funding agency in the public, commercial or not-for-profit sector.
| {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
Severe, acute salicylate toxicity remains a common presentation to the Emergency Department (ED) and is associated with a significant degree of mortality \[[@B1]\]. In its unionized form, salicylate can move across cell membranes into tissues to exert toxic effects. In the presence of acidemia, salicylate will shift to this unionized form, which allows it to cross the blood-brain barrier, and cause central nervous system toxicity (cerebral edema, seizures, and coma). Therefore, the presence of acidemia is seen as a poor prognostic indicator. Classically, salicylate toxicity is initially associated with a respiratory alkalosis, secondary to direct stimulation of the medulla, and subsequent tachypnea and hyperpnea as a response to metabolic acidosis. For this reason, intubation and mechanical ventilation have been commonly recommended against in severe salicylate poisoning, as it is believed that this intervention may take away this protective respiratory drive \[[@B2], [@B3]\]. Other sources suggest that intubation may be safely performed, as long as apneic time during induction is minimized, and the patient is hyperventilated adequately on the ventilator \[[@B3]\]. Unfortunately, very little evidence exists on this topic, and there are multiple reasons that a patient with salicylate toxicity may require intubation, including decreased or altered level of consciousness, failure to protect airway, and respiratory distress from pulmonary edema. Taken together, there is very little understanding regarding the approach to intubation of patients with severe salicylate overdose. We present a case of a patient with unknown severe salicylate toxicity, who was intubated upon arrival, but immediately hyperventilated several minutes later once initial blood gas levels revealed the diagnosis. To our knowledge, we are the first to publish pre- and postintubation blood gas data in the context of ventilator settings that should have resulted in hyperventilation and improving acidemia.
2. Case Report {#sec2}
==============
The patient was a 59-year-old male farmer who had been found by his daughter to be confused and tachypneic on the morning of presentation, and she brought him to the local community ED. His vital signs were blood pressure of 116/75 mmHg, heart rate (HR) of 107 beats/minute, respiratory rate (RR) of 20 breaths/minute, initial temperature of 36.3 degrees\' Celsius, and 100% oxygen saturation. Glasgow Coma Scale (GCS) was 15 on initial physician assessment. His weight was estimated at 65 kg. He was treated for presumed pneumonia with moxifloxacin and transferred to our tertiary care hospital for computed tomography (CT) scan of the head, in order to rule out intracranial pathology. During transfer, paramedics assessed the patient and found him to be significantly obtunded, with a GCS of 7.
Upon arrival at our ED, the patient had a HR of 130 beats/min, a RR of 15--20 breaths/min, and a stable blood pressure. He had a temperature of 39 degrees\' Celsius and was diaphoretic and mottled to the chest. GCS remained at 7. Pupils were equal and reactive and the physical exam was otherwise unremarkable. Bedside glucose was obtained and was 5.3 mmol/L. A venous blood gas (VBG) and standard sepsis bloodwork (including blood cultures) were sent upon presentation. At this point, there was concern regarding the rapid decline in level of consciousness without a clear etiology. It was decided that an urgent CT scan of the head was indicated and since the patient would not obey commands and was not lying still, the decision was made to intubate him in order to facilitate the scan. The patient was induced for rapid sequence intubation (RSI) with propofol (50 mg) and rocuronium (50 mg). Following administration of propofol, the patient was ventilated using bag mask ventilation, in order to facilitate gas exchange during induction. He was successfully intubated using a GlideScope® on the first attempt. Nursing notes suggest that the longest possible apnea time was approximately 4 minutes, which reflects the time from rocuronium administration to detection of end-tidal carbon dioxide. A postintubation chest X-ray revealed a possible small consolidation in the left lower lung, but no evidence of pulmonary edema to suggest acute respiratory distress syndrome (ARDS).
Several minutes following intubation, the patient\'s preintubation bloodwork returned. VBG revealed a pH of 7.37, pCO2 of 19, HCO~3~ of 11, and venous base excess of −11.1 mmol/L. This mixed respiratory alkalosis and metabolic acidosis were suggestive for salicylate poisoning, and ventilator settings were adjusted to increase the respiratory rate (increased to 25, as compared to the patient\'s initial 20 breaths/minute) and tidal volume (increased to 620 mL, approximately 10 mL/kg of total body weight, as ideal body weight was unknown), which were the maximal tolerated settings. At this time, a toxicologic work-up was added to the bloodwork, and collateral history of ingestion was obtained, revealing access to 240 mg acetylsalicylic acid (ASA) boluses used for cattle. It was later confirmed that the patient had in fact intentionally overdosed on this ASA, though his family was not aware of this.
The patient was given two bolus ampules of IV NaHCO~3~ and started on a NaHCO~3~ infusion. The serum salicylate level was found to be critically elevated at 7.2 mmol/L. VBG performed twenty minutes following intubation revealed a pH of 6.89, pCO2 of 121, HCO~3~ of 23, and venous base excess of −13.2 mmol/L. A 50 g/L dextrose infusion was started to counter possible neuroglycopenia (which was presumed to be contributing to the decreased level of consciousness), and Nephrology and Critical Care were consulted for urgent hemodialysis. Despite the above interventions, a repeat VBG twenty minutes after the previous showed a pH of 7.03 and pCO2 \>120 (HCO~3~ and venous base excess were not reported). Soon after, the patient suddenly became very bradycardic and arrested. Initial rhythm was consistent with pulseless electrical activity (PEA). Chest compressions were started and the patient received bolus doses of 1 mg epinephrine and 50 mEq NaHCO~3~. Return of spontaneous circulation was briefly achieved, but subsequently lost again several minutes later. The patient again received multiple doses of epinephrine, NaHCO~3~, and 1 g calcium chloride. Bedside ultrasound confirmed absence of cardiac activity. The resuscitation was terminated after thirty minutes, at which point the patient\'s family requested to cease resuscitative efforts. CT of the head was ultimately not completed. The remainder of the toxicologic work-up (acetaminophen, ethanol, ECG) did not reveal any obvious coingestion.
3. Discussion {#sec3}
=============
Acute salicylate poisoning remains an important consideration in the undifferentiated patient with altered mental status, due to its subtle signs and significant mortality. While intubation of these patients may sometimes be necessary, it is commonly recommended against by several sources, due to the belief that it may stifle respiratory compensation and worsen acidemia. That being said, there are no experimental trials to support this belief, and only a few case reports exist (with varying results). In our literature review, we found one case report supporting the notion of worsening acidemia with intubation in severe salicylate overdose \[[@B4]\]. However, we also noted a case report of successful intubation in a patient with an intentional ASA overdose, though the serum concentration of salicylate was unknown \[[@B5]\]. The most comprehensive literature on this topic was a case-series published by the New York City Poison Control Centre, which was a retrospective review of 3,144 cases of salicylate poisoning from 2001 to 2007 \[[@B6]\]. In this 8-year time period, these authors found only 7 cases with available blood gas data of intubation in severe salicylate poisoning. In all of these cases, intubation resulted in acidemia, though the preintubation pH was not always known. Two of these 7 cases resulted in death. Furthermore, full blood gas values are not provided. Therefore, it is unclear how much of this acidemia is secondary to metabolic acidosis from salicylate metabolism and how much is secondary to respiratory acidosis from intubation and reduced respiratory drive. Finally, the time periods at which these pH values were collected are unknown, and evidence demonstrates that peak concentration of serum salicylate in acute overdose may not reach peak values until 6 hours following ingestion, due to bezoar formation \[[@B7], [@B8]\]. In our case, acidemia can be attributed to both respiratory acidosis (evidenced by hypercarbia) and likely metabolic acidosis from salicylate metabolism.
Several sources on management of acute salicylate toxicity also recommend that, if proceeding with intubation, the clinician should try to minimize the time of apnea and try to match the patient\'s minute ventilation with the ventilator \[[@B3], [@B6]\]. However, again there is no data available regarding either of these factors in intubation of these patients. In our case, the time from induction to airway security was less than four minutes, which should have minimized time of apnea. Further to that, the ventilator settings were adjusted in an attempt to maintain the patient\'s respiratory alkalosis. The patient\'s initial respiratory rate was 20, and this was increased | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
Growth hormone (**GH**) deficiency (**GHD**) can be congenital or acquired. The incidence of congenital GHD has been assessed at from 1/4000 to 1/10 000 [@pone.0016367-Sizonenko1], [@pone.0016367-Vimpani1], [@pone.0016367-Bao1], [@pone.0016367-Lindsay1]. The pituitary stalk interruption syndrome (**PSIS**) is a sign of congenital and permanent GHD [@pone.0016367-Tauber1], [@pone.0016367-Marcu1], [@pone.0016367-Argyropoulou1]. It is diagnosed by magnetic resonance imaging (MRI) and includes the absence of both a visible pituitary stalk and normal posterior lobe hyperintense signals in the sella turcica, together with the presence of a hyperintense nodule in the region of the infundibular recess of the third ventricle. Familial forms of PSIS and associated malformations suggest that its origin is antenatal [@pone.0016367-Pinto1]. It is important to diagnose GHD and start treatment as soon as possible because this deficiency is associated with excess mortality and substantial morbidity [@pone.0016367-Taback1], [@pone.0016367-Mills1]. Moreover, because insufficient height at the onset of puberty leads to short final height, early diagnosis and treatment of GHD are necessary to allow catch-up growth to optimal height before puberty [@pone.0016367-Grumbach1]. Signs of congenital GHD in neonates include hypoglycemia, prolonged jaundice, and microphallus [@pone.0016367-Sizonenko1], [@pone.0016367-Pinto1], [@pone.0016367-Pinto2], [@pone.0016367-Rottembourg1]. In older children, the diagnosis is based on short stature or growth failure. Height for age is the most common criterion for referral for GH evaluation [@pone.0016367-Grote1]. However, the mean ages reported for diagnosis of symptomatic PSIS in various studies range from 4 to 9 years and suggest important diagnostic delay [@pone.0016367-Tauber1], [@pone.0016367-Argyropoulou1], [@pone.0016367-Pinto2], [@pone.0016367-Rottembourg1], [@pone.0016367-Maghnie1].
In 2000, the GH Research Society (**GHRS**) published guidelines based on height for age but also five other auxological criteria (see below), to ensure that children and adolescents with GHD are appropriately identified and treated [@pone.0016367-Consensus1]. A survey has shown that these criteria are not currently applied, probably because the concomitant use of six auxological criteria might be difficult in day-to-day routine practice [@pone.0016367-Grote1]. Moreover the performance (notably sensitivity for early diagnosis) of these guidelines has never been tested.
The objective of this study was therefore to study the diagnostic delay for PSIS with GHD and the sensitivity of the auxological criteria of the GHRS to identify the most useful ones and simplify their routine use.
Results {#s2}
=======
Characteristics of the population {#s2a}
---------------------------------
During the study period, 67 patients seen for growth failure had PSIS and/or GHD: 38 (57%) had GHD with a normal MRI or an isolated hypoplastic anterior pituitary gland, 2 (3%) had GHD and PSIS but had been adopted, six (9%) patients had GHD and PSIS diagnosed in the neonatal period. The study thus included 21 (31%) patients with GHD and PSIS ([Table 1](#pone-0016367-t001){ref-type="table"}), 76% of them boys. One patient was born preterm, and nine were delivered by cesareans (43%) (confidence interval, **CI** = 22--64), including three in breech presentation. One patient had midline abnormalities, including bilateral optic nerve hypoplasia.
10.1371/journal.pone.0016367.t001
###### Patient characteristics.
{#pone-0016367-t001-1}
Isolated GHD (n = 16) MPD (n = 5) TOTAL (n = 21)
----------------------- ----------------------- ------------------------------------- ---------------- ------------------------------------ ----- ------------------------------------
**Neonatal symptoms** n\' Percentage n\' Percentage n\' Percentage
Breech delivery 2 12.5% (CI 0--29) 1 20% (CI 0--55) 3 14% (CI 0--29)
Cesarean delivery 5 31% (CI 8--54) 4 80% (CI 45--100) 9 43% (CI 22--64)
**At diagnosis** Median (range) Median (range) Median (range)
Age (yr) 16 3.2 (1; 13.6) (IQR 2.6; 4.9) 5 5.1 (1; 10.5) (IQR 5; 5.6) 21 3.6 (1; 13.6) (IQR 2.6; 5.5)
Bone age (yr) 12 1.5 (0.5; 9.5) (IQR 1.2; 2.3) 4 2.2 (0.5; 4) (IQR 1.6; 2.9) 16 1.7 (0.5; 9.5) (IQR 1.2; 2.5)
Bone age delay (yr) 12 1.3 (0.5; 4.1) (IQR 1; 1.7) 4 2.8 (0.5; 6.4) (IQR 2; 3.9) 16 1.4 (0.5; 6.4) (IQR 1; 2.6)
Target height (SDS) 16 −0.2 (−1.6; 1.5) (IQR --0.7; 0.3) 5 −0.3 (−1.5; 0.6) (IQR --0.6; 0.4) 21 −0.3 (−1.6; 1.5) (IQR --0.6; 0.4)
Height (SDS) 16 −2.7 (−4.3; −1.3) (IQR --3.7; −2.3) 5 −2.2 (−2.4; −2) (IQR --2.2; −2) 21 −2.5 (−4.3; −1.3) (IQR --3.5; −2)
Height velocity (SDS) 16 −3 (−4.1; 0.3) (IQR --3.3; −1.6) 5 −3.3 (−4.2; 0) (IQR --3.4; −3.2) 21 −3.1 (−4.2; 0.3) (IQR --3.4; −1.6)
Weight (SDS) 16 −2.5 (−4; −0.4) (IQR --3; −1.9) 5 −0.7 (−1.3; 1.1) (IQR --1.2; −0.3) 21 −2.4 (−4; 1.1) (IQR --2.8; −1)
BMI (SDS) 16 −0.9 (−3.7; 2.2) (IQR --1.5; 0.2) 5 1.3 (−0.2; 4) (IQR --0.1; 1.7) 21 −0.23 (−3.7; 4) (IQR --1.1; 0.5)
GH peak (ng/mL) 16 3.2 (1.5; 23) (IQR 2; 6.7) 5 2.1 (0.5; 4.1) (IQR 0.9; 3.1) 21 3 (0.5; 23) (IQR 2; 5.5)
IGF-1 (ZS) 16 −2.9 (−5.1; −2) (IQR --4; −2.4) 5 −4.8 (−5; −4.1) (IQR --4.9; −4.4) 21 −3.1 (−5; −2) (IQR --4.4; −2.7)
CI: confidence interval 95%.
IQR: interquartile range.
GHD: growth hormone deficiency.
MPD: multiple pituitary deficiencies.
SDS: standard deviation score.
ZS: Z-score.
Median age at diagnosis was 3.6 years (range 1--13.6; interquartile range **IQR**: 2.6--5.5), and all patients were prepubertal ([Table 1](#pone-0016367-t001){ref-type="table"}). Sixteen patients (76%) (95%) (CI 58--94) had isolated GHD and five (24%) (CI 6--42) had multiple | {
"pile_set_name": "PubMed Central"
} |
HTLV-1 infection of humanized NOG mice has been demonstrated to recapitulate the development of ATL-like symptoms within several months of infection. Infected human T-cells in these mice start to proliferate vigorously in a couple weeks after infection and the mice die of ALT-like lymphoproliferative disorder. Thus, this mouse model should provide a potent tool to analyze the *in vivo* effect of various candidates for ATL treatment.
Treatment of ATL with the combination of anti-viral agents, zidovudine (AZT) and interferon-alpha (IFN), has been reported to be highly effective, especially to indolent type, but the mechanism of action is totally unknown. We, therefore, examined the efficacy and the *in vivo* mechanism of AZT/IFN treatment in the humanized mouse system.
HTLV-1 infected humanized mice were inoculated daily with AZT and IFN from two to four weeks post infection and the number of infected cells and proviral loads (PVL) were analyzed. Treatment with either AZT or IFN alone attenuated the onset of lymphoproliferative disorder, whereas the combined treatment suppressed the growth of infected T-cells in PBL almost completely and the PVL remained low throughout lifetime. The suppressive effect is infected-cell specific because the number of uninfected human lymphocytes in PBL stayed constant on the administration of drugs.
It is suggested that infected cells expressing higher level of viral gene, most provably Tax, should have been selectively eliminated, since a similar suppressive effect has been obtained in HTLV-1 infected humanized mice treated with an Hsp90 inhibitor, 17-DMAG, which enhances the degradation of Tax.
| {
"pile_set_name": "PubMed Central"
} |
Tse G, Gong M, Li CKH, et al. T~peak~‐T~end~, T~peak~‐T~end~/QT ratio and T~peak~‐T~end~ dispersion for risk stratification in Brugada Syndrome: A systematic review and meta‐analysis. J Arrhythmia. 2018;34:587--597. 10.1002/joa3.12118
1. INTRODUCTION {#joa312118-sec-0005}
===============
Brugada syndrome is a used to describe the combination of specific ECG changes, the Brugada pattern, in addition to life threatening arrhythmias and sudden cardiac death (SCD).[1](#joa312118-bib-0001){ref-type="ref"} Traditionally, it has been considered a congenital ion channelopathy linked to abnormalities in the cardiac sodium channel.[2](#joa312118-bib-0002){ref-type="ref"}, [3](#joa312118-bib-0003){ref-type="ref"} Recently, pathogenic mutations in other ion channels have been described. Mechanisms of arrhythmogenesis can be broadly divided into triggered activity and re‐entry. Of these, re‐entry is thought to be the predominant mechanism underlying increased arrhythmogenicity in Brugada syndrome requiring an increased spatial dispersion of repolarization. Such re‐entrant activity may involve direct electrotonic activation during phase 2 of the cardiac action potential, as shown in pre‐clinical studies using arterially perfused, canine wedge preparations,[4](#joa312118-bib-0004){ref-type="ref"} or circus‐type/spiral wave activity around an anatomical or functional obstacle. Regardless of the precise underlying mechanism for re‐entry, this transmural dispersion of repolarization can be quantified electrocardiographically by the interval from the peak to the end of the T‐wave (T~peak~‐T~end~ interval), (T~peak~‐T~end~)/QT ratio and T~peak~‐T~end~ dispersion.[5](#joa312118-bib-0005){ref-type="ref"}, [6](#joa312118-bib-0006){ref-type="ref"}
However, not all studies have shown an association between higher T~peak~‐T~end~ intervals, (T~peak~‐T~end~)/QT ratio or T~peak~‐T~end~ dispersion with an arrhythmogenic phenotype in Brugada Syndrome. Recently, Mugnai and colleagues conducted one of the largest retrospective studies to date, including a total of 448 patients with spontaneous or drug induced type 1 Brugada pattern.[7](#joa312118-bib-0007){ref-type="ref"} They found no statistically significant difference in all three indices between asymptomatic subjects and patients with syncope and malignant arrhythmias. Morita and colleagues also found in 471 patients no difference in T~peak~‐T~end~ intervals between patients with syncope or VT/VF and those who were asymptomatic.[8](#joa312118-bib-0008){ref-type="ref"} These findings contrast with a meta‐analysis published previously by some members of our group, which extracted and pooled odds or hazard ratios for the relationship between T~peak~‐T~end~ and arrhythmic and/or mortality outcomes in various clinical conditions, including Brugada Syndrome.[9](#joa312118-bib-0009){ref-type="ref"} This demonstrated prolonged T~peak~‐T~end~ interval was associated with an increased risk of ventricular arrhythmias and SCD in Brugada Syndrome.
However, our previous study did not determine the absolute mean values for T~peak~‐T~end~, nor was it possible to include the largest dataset from Mugnai and colleagues. Moreover, it did not investigate the utility of other indices such as (T~peak~‐T~end~)/QT ratio or T~peak~‐T~end~ dispersion. Therefore, we conducted a systematic review with meta‐analysis into the relationships between T~peak~‐T~end~ interval, (T~peak~‐T~end~)/QT ratio and T~peak~‐T~end~ dispersion and arrhythmic and/or mortality endpoints in Brugada Syndrome.
2. METHODS {#joa312118-sec-0006}
==========
2.1. Search strategy, inclusion and exclusion criteria {#joa312118-sec-0007}
------------------------------------------------------
This study was conducted according to the Preferred Reporting Items for Systematic Reviews and Meta‐Analyses (PRISM) statement. PubMed and Embase were searched for studies that investigated the association between T~peak~‐T~end~ or T~peak~‐T~end~ /QT with arrhythmic or mortality endpoints in Brugada syndrome. The following search terms were used for both databases: \["Tpeak‐Tend" or "Tpeak‐end" or "Tp‐e" AND Brugada\]. The databases were searched until 1 May 2018 without language restrictions. The following inclusion criteria were used: (a) the study was a case‐control, prospective or retrospective cohort study in human subjects with a Brugada phenotype, (b) T~peak~‐T~end~ intervals or (T~peak~‐T~end~) /QT ratios were provided; (c) predefined adverse events (appropriate implantable cardioverter‐defibrillator therapy \[ICD\], syncope, ventricular tachycardia/fibrillation \[VT/VF\], SCD, cardiovascular death \[CVD\], major adverse cardiac events \[MACE\]) or all‐cause mortality were reported. In cases of incomplete data from the published studies, the original authors were contacted, but no replies were received.
The Newcastle‐Ottawa Quality Assessment Scale (NOS) was used for quality assessment of the included studies.[10](#joa312118-bib-0010){ref-type="ref"} The NOS system evaluated the categories of study participant selection, results comparability, and quality of the outcomes. Specifically, the following characteristics were assessed: (a) representativeness of the exposed cohort; (b) selection of the non‐exposed cohort; (c) ascertainment of exposure; (d) demonstration that outcome of interest was not present at the start of study; (e) comparability of cohorts based on study design or analysis; (f) assessment of outcomes; (g) follow‐up periods that were sufficiently long for outcomes to occur; and (h) adequacy of follow‐up of cohorts. This scale varied from zero to nine stars, which indicated that studies were graded as poor quality if the score was \<5, fair if the score was 5‐7, and good if the score was \>8. Studies with a score equal to or higher than six were included. The details of the NOS quality assessment are shown in Tables [S1](#joa312118-sup-0001){ref-type="supplementary-material"} and [S2](#joa312118-sup-0001){ref-type="supplementary-material"}.
2.2. Data extraction and statistical analysis {#joa312118-sec-0008}
---------------------------------------------
Data from the different studies were entered in pre‐specified spreadsheets in Microsoft Excel. All potentially relevant studies were retrieved as complete manuscripts, which were assessed fully to determine their compliance with the inclusion criteria. We extracted the following data from the included studies: (a) publication details: last name of first author, publication year and locations; (b) study design; (c) endpoint(s); (d) quality score; and (e) characteristics of the population including sample size, gender, age and number of subjects. Two reviewers (GT and MG) reviewed each included study independently. Disagreements were resolved by adjudication with input from a third reviewer (TL).
Adverse events were defined as ventricular arrhythmias (VT/VF), SCD, cardiovascular death, MACE or all‐cause mortality. If more than one mortality endpoint was described, then SCD was preferentially used for analysis, followed by cardiovascular and all‐cause mortality in this order. Mean differences between event‐positive and event‐negative groups, with 95% confidence intervals (CIs) for T~peak~‐T~end~ interval, (T~peak~‐T~end~)/QT ratio and T~peak~‐T~end~ dispersion were extracted and subsequently combined to generate a pooled estimate.
Heterogeneity between studies was quantified using The Cochran\'s Q value and the *I* ^2^ statistic from the standard chi‐square test, which describes the percentage of the variability in effect estimates resulting from heterogeneity. *I* ^2^ \> 50% was considered to reflect significant statistical heterogeneity. A fixed effects model was used if *I* ^2^ \< 50%. The random‐effect model using the inverse variance heterogeneity method was used when *I* ^2^ \> 50%. To locate the origin of the heterogeneity, sensitivity analysis by excluding one study at a time, and subgroup analyses based on different disease conditions and different endpoints were performed. Funnel plots, Begg and Mazumdar rank correlation test and Egger\'s test were used to detect publication bias.
3. RESULTS {#joa312118-sec-0009}
==========
Figure [1](#joa312118-fig-0001){ref-type="fig"} shows a flow diagram detailing the above search terms with inclusion and exclusion criteria. A total of 29 and 57 entries were retrieved from PubMed and Embase, respectively. Nine studies met the inclusion criteria and were included in our final meta‐analysis.[6](#joa312118-bib-0006){ref-type | {
"pile_set_name": "PubMed Central"
} |
Studies using magnetic resonance imaging (MRI),^[@bibr6-2325967114550274],[@bibr7-2325967114550274],[@bibr11-2325967114550274],[@bibr26-2325967114550274]^ computed tomography,^[@bibr21-2325967114550274]^ and ultrasonography^[@bibr25-2325967114550274]^ have shown that the semitendinosus (ST) tendon can regenerate after harvest. With increasing numbers of anterior cruciate ligament (ACL) reconstructions, the amount of revision procedures after failed primary reconstructions will increase as well. If total regeneration of the ST tendon really occurs, this might be a potential source for future graft material in conjunction with ACL revision surgery. Studies concerning the histology of the ST tendon appear important since open biopsy specimens obtained in the short term have shown that real tendinous tissue regenerates. However, focal areas of scar tissue^[@bibr7-2325967114550274]^ and histological changes^[@bibr23-2325967114550274]^ compared with the healthy ST tendon can also be found. The literature does not provide evidence that the ST tendon returns to normal, and furthermore, there are no studies where the regenerated tendon is compared with the contralateral nonharvested tendon from the same patients. The purpose of the present medium- to long-term study was to investigate whether the regenerated ST tendon has histology similar to that of the contralateral nonharvested tendon from the same patient, in terms of fiber structure, cellularity, vascularity, and content of glycosaminoglycans (GAGs). The hypothesis of the study was that this would be the case.
Materials and Methods {#section1-2325967114550274}
=====================
Eighteen patients (8 females, 10 males) who underwent ACL reconstruction using ipsilateral ST and gracilis (G) tendon autografts were included in the study. The patients were a subgroup from a previously published study focusing on tendon regeneration as seen on MRI,^[@bibr1-2325967114550274]^ who agreed to undergo a bilateral biopsy procedure.
The median age at reconstruction was 23 years (range, 17-40 years). Percutaneous specimens were obtained from the regenerated tendon and the contralateral nonharvested healthy ST tendon under ultrasonographic guidance at a median of 8.4 years (100.5 months; range, 77-129 months) after the harvesting procedure. Specimens from the nonharvested side served as controls. In all, 36 biopsies were obtained.
Surgical Technique {#section2-2325967114550274}
------------------
At the index operation, the ST/G autograft was harvested through a 3-cm oblique incision over the pes anserinus. The sartorius fascia was incised parallel to the fibers of the fascia just above the thicker and more distally inserted ST tendon. After the vinculae had been cut under visual control, the full lengths of the tendons were harvested with a semiblunt, semicircular open tendon stripper (Acufex; Microsurgical Inc). The femoral bone tunnels were prepared using a standard transtibial or medial portal approach. No harvest site drain was used.
Rehabilitation {#section3-2325967114550274}
--------------
All patients were rehabilitated according to the same accelerated protocol used for all patients at the clinic, permitting immediate full weightbearing and full range of motion.^[@bibr27-2325967114550274]^ No rehabilitation brace was used.^[@bibr4-2325967114550274]^ Closed-chain exercises were started immediately postoperatively. Terminal extension with an external load other than the weight of the operated leg was not permitted during the first 6 weeks postoperative. Running was permitted after 3 months, and contact sports after 6 months at the earliest. During the rehabilitation period, no sprains or ruptures were registered in the posterior part of the thigh.
Biopsy Procedure {#section4-2325967114550274}
----------------
Specimens were obtained from the ST tendon on the operated and nonoperated side of each patient. The biopsy specimens were obtained under ultrasonographic guidance with a free-hand technique using a 1.2-mm Tru-cut Monopty instrument (Bard Inc). This is a metal handle with a preattached disposable biopsy needle. The gun needle moves in 2 stages when fired. During the first stage, the inner stylet punctures the target and, in the second stage, an outer cannula follows the path of the stylet, covering the sample notch and thus capturing the sample. Local anesthesia with adrenaline (5-10 mL) was given subcutaneously. Under ultrasonographic guidance, the ST and G tendons were identified proximally on the thigh and followed to a position approximately 4 cm above the medial joint line with the knee in slight flexion. In this position, the specimens were obtained from the central part of the ST tendon through a small incision. Each specimen was placed separately in a coded tube. The specimens had a depth of approximately 5 mm and a maximum diameter of 1.2 mm.
Clinical Assessment {#section5-2325967114550274}
-------------------
The Tegner activity level and the Lysholm score were used to assess patient function at follow-up.
Evaluation of Histology Using the Light Microscope {#section6-2325967114550274}
--------------------------------------------------
The specimens were fixed in 10% neutral-buffered formalin, embedded in paraffin, and sectioned at 4 to 5 µm, according to routine procedures. The sections were stained with hematoxylin and eosin to evaluate fiber structure, cellularity, and vascularity, and Alcian blue (pH, 2.5)/periodic acid--Schiff (AB/PAS) for the detection of GAG-rich areas. A pathologist and an orthopaedic surgeon, both with a specific interest in and knowledge of tendon pathology, simultaneously examined the tendon specimens using a light microscope (Leica DMRBE). Both examiners were blinded for whether the specimens came from regenerated or nonharvested ST tendon. The specimens were evaluated using a semiquantitative (nonparametric) grading system for the tendon alterations used in multiple previous studies.^[@bibr13-2325967114550274],[@bibr17-2325967114550274],[@bibr18-2325967114550274],[@bibr28-2325967114550274]^ Grading was based on a 4-point scoring system ([Table 1](#table1-2325967114550274){ref-type="table"}). Fiber structure, cellularity, vascularity, and level of GAGs were graded after examining the entire section. The number of cells was estimated in a high-power field (HPF) representative of the section.
######
Semiquantitative Scoring System*^a^*
Grade 0 Grade 1 Grade 2 Grade 3
-------------------- ----------------------------------------------------------------- ------------------------------------------------------------------------------- ------------------------------------------------------- ---------------------------------------------------------
Fiber structure Straight, parallel, packed fibers, with slight waviness Slight separation of fibers, increased waviness Separation of fibers, deterioration of fibers Complete loss of fiber structure and hyalinization
Cellularity \<100 cells/HPF 100-199 cells/HPF 200-299 cells/HPF \>300 cells/HPF
Vascularity Vessels run parallel to the collagen fiber bundles in the septa Slight increase in vessels, including transverse vessels in the tendon tissue Moderate increase in vessels within the tendon tissue Markedly increased vascularity with clusters of vessels
Glycosaminoglycans No alcianophilia Slight alcianophilia between the collagen fibers Moderate increase in alcianophilia Markedly increased alcianophilia
*^a^*A semiquantitative, 4-point scoring system^[@bibr13-2325967114550274]^ was used to evaluate the biopsies. HPF, high-power field.
Statistical Analyses {#section7-2325967114550274}
--------------------
Median (range) values are presented. The Wilcoxon signed-rank test was used for comparisons between the regenerated and nonoperated ST tendon specimens. A value of *P* \< .05 was considered significant. When planning the study, a difference of 1 unit in the classification of fiber structure between regenerated and nonharvested tendons was expected. The required sample size would then be 10 paired specimens to reach a power of 80%, if the standard deviation is 1 unit for the difference between pairs. To allow for lost and nongradable samples, 18 paired specimens were obtained.
Ethics {#section8-2325967114550274}
------
The Ethics Committee at the University of Gothenburg approved the study. All patients gave their informed consent.
Results {#section9-2325967114550274}
=======
The patients had a median Tegner activity level of 6 (range, 5-7) and a median Lysholm score of 87 (range, 47-100) at the time for biopsy procedure.
Bilateral biopsy specimens were obtained in all patients (n = 36 specimens). The patients experienced no pain or discomfort during or after the biopsy procedures. One patient had undergone ACL reconstruction on the contralateral side and was therefore excluded. Also, the regenerated ST tendon in 1 patient and the nonharvested tendon specimen in 4 patients contained insufficient amounts of tissue for evaluation. This left 16 specimens from regenerated | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
Complementary feeding practice is a noteworthy factor that determines the nutritional status of children. The transition period from exclusive breastfeeding to 2 years is a critical window for optimal growth and development of the child. During this period, appropriate, safe, adequately nourished and frequent feeding is essential. Innocently, the food provided to a child might be too high or too low in some nutrients, the diversity of food might be adequate or inadequate and micronutrient content including iron could be lower than required \[[@CR1]\].
Suboptimal (inadequate) infant feeding practices are the major reasons for childhood under nutrition in developing countries \[[@CR2], [@CR3]\]. Poor nutritional status of children in most developing countries is due to the presence of overwhelming of poverty, low maternal education, high burden of disease and mal-feeding practices \[[@CR4], [@CR5]\]. Many survey reports \[[@CR4]--[@CR9]\] consistently indicated that underprivileged child feeding practices are correlated with cultural factors such as selection of low-quality complementary foods, taboos, restrictive traditional beliefs and social factors including caregivers' poor knowledge on nutrition and lack of knowledge on food diversity in their surroundings. Ultimately, all of these factors lead to low dietary diversity, low feeding frequency and low food and energy intake for children \[[@CR2], [@CR10]\].
Several studies have shown that dietary diversity score (DDS) is positively associated with overall dietary quality and micronutrient intake of young children and found to be proxy indicator for household food security and in the long run for childhood stunting \[[@CR6], [@CR11]\]. A higher DDS has also been associated with better nutritional status of children in developing countries \[[@CR12], [@CR13]\].
As per the recommendation of World Health Organization/Pan American Health Organization (WHO/PAHO) 2003, breastfed children 6--23 months should receive animal-source foods and vitamin A-rich fruits and vegetables daily. Therefore, four food groups (grain- or tuber-based staple, animal-source food, vitamin A-rich fruit or vegetable) are considered the minimum acceptable number of food groups for breastfed infants. Non-breastfed children should be fed meals four or five times per day, with one to two snacks as desired. Meal frequency is considered a proxy for energy intake from foods other than breast milk. Therefore, for non-breastfed children feeding frequency indicators include both milk feeds and solid or semi-solid feeds \[[@CR14], [@CR15]\].
Updated knowledge of feeding practices will assist the national nutrition programme to monitor the changes in the feeding practices and design interventions to increase the recommended feeding practices and thereby contribute in reducing undernutrition in the country. In general speaking, Ethiopia is known to have low minimum dietary diversity (MDD) as compared to the rest of the world. Some surveys including national demographic health survey of 2011 conducted in Ethiopia revealed that MDD is below 5%. Five years back, the magnitude of MDD, minimum meal frequency (MMF) and minimum acceptable diet in Southern Ethiopia were 3.8, 49.8 and 3.1%, respectively \[[@CR16]\]. Even though there are limited studies done in Ethiopia which were primarily focusing on measuring complementary feeding levels in the rural communities, the current study was unique because it was designed to be conducted in urban area of Ethiopia. The existing surveys are found mostly in Northern and Western parts of Ethiopia \[[@CR17]\]. No survey was investigated on dietary diversity and meal frequency in Southern Ethiopia particularly in the urban areas. There should be an urgent measure to identify reasons why complementary feeding indicators are still low. This study was aimed to measure the proportions of minimum dietary diversity and minimum meal frequency and to investigate factors associated with them among young children aged 6--23 months.
Methods {#Sec2}
=======
Study area, study design and participants {#Sec3}
-----------------------------------------
Community-based cross-sectional study design was carried out in Wolaita Sodo town on March 02--20, 2015. The town is found in Wolaita zone, Southern Ethiopia, and 315 km far away from Addis Ababa. The town is administratively structured by 11 kebeles and has a total population of 110,660, of which 54,275 are males and 56,385 are females. Out of all female population, 25,784 of them are women in the reproductive age group. About 14% of the total population are children 6--59 months of age.
Mothers or caregivers of children 6--23 months of age who reside in Wolaita Sodo town were the source population, whereas mothers/caregivers of children 6--23 months that were drawn from the selected kebeles were considered as the study population. Mothers/caregivers of children 6--23 months of age who have been residents of the town and have ever breastfed in the selected kebeles were included in the study. However, mothers or caregivers who are seriously ill, mental problem or unable to communicate were excluded.
Sample size and sampling procedure {#Sec4}
----------------------------------
The sample size was determined using single proportion population formula by assuming the proportion of introduction of complementary foods as 42.9% in western Ethiopia \[[@CR17]\], 1.5 as design effect, 5% as level of significance and 5% as degree of precision and which was 566. Adding 10% as non-response rate, 623 mothers/caregivers with 6--23 months of children were included in the study. To ensure the adequacy of sample size, Epi-info was used to calculate sample size for factors associated with minimum dietary diversity and minimum meal frequency. Then, the maximum sample size was taken.
Two stage sampling was used to select the participants. Seven administrative units were randomly drawn from 11 administrative units. A census was conducted in these selected kebeles to identify the study participants. The sample size was allocated to the population size proportionately, and sampling interval was calculated. Finally, 623 participants were selected using a systematic sampling method after randomly identified the first household and proceed to the second participant based on the interval.
Data collection and measurements {#Sec5}
--------------------------------
Data were collected using interviewer-administered validated questionnaire in a face-to-face manner from mothers/caregivers of children 6--23 months of age. The questionnaire consists of three parts: socio-demographic characteristics of households, maternal and child health related features and child feeding practices. Twenty-four-hour recall method and food frequency questionnaire were used to assess dietary diversity and meal frequency. Ten first degree in nursing holders as data collector and three second degree holders who had previous experiences as supervisor were involved in the survey.
Structured questionnaire partly adopted from WHO assessment tool for infant and young child feeding (IYCF) practices were used and translated into local language by fluent speakers and back translated to English to validate the consistency. Training was given for data collectors and supervisors on how to interview and maintaining the quality of data. Pre-test was done on 5% of the participants out of the selected areas. Then, the questionnaire was rechecked for its precision and consistency, and necessary modifications were incorporated before commencing the actual data collection. The supervisors and the investigatory were regularly monitored and checked the completeness of the data in daily bases.
### Minimum dietary diversity {#Sec6}
Proportion of children 6--23 months of age who receive foods from four or more food groups during the previous day. The seven food groups used for tabulation of this indicator were as follows: cereals, roots and tubers; legumes and nuts; dairy products (milk, yoghurt and cheese); flesh foods (meat, fish, poultry and liver/organ meats); eggs; vitamin A-rich fruits and vegetables and other fruits and vegetables \[[@CR14]\].
### Minimum meal frequency {#Sec7}
Proportion of breastfed and non-breastfed children 6--23 months of age, who receive solid, semi-solid or soft foods (but also including milk feeds for non-breastfed children) the minimum number of times or more. Breastfed infants of age 6--8 and 9--23 months should obtain a minimum of two or three meals with one to two snacks and three or four meals with one to two snacks per day, respectively. But non-breastfed infants of age 6--23 months should receive milk products at least twice a day \[[@CR8]\].
Statistical analysis {#Sec8}
--------------------
Data were entered to Epi-Data 3.02 and exported, cleaned and analysed by SPSS version 21. Missed data were explored, and normality for continuous variables was checked. Dietary diversity score (DDS) was computed out of seven from seven food groups. Reliability of the tool was done, and Cronbach's Alpha value was 0.76. Household economic status was measured by constructing a wealth index through principal component analysis. The indicator variables used for wealth index construction that fulfil the requirement of factor analysis were telephone, table, chair, refrigerator and electric mitad. Varimax rotation was used. The communality of each variable was greater than 0.53; Kaiser-Meyer-Olkin measure of sampling adequacy was 0.58. The cumulative proportion of variance criteria was met with two components which was 66.80%. Split sample validation was done, and none of communality's of the variable in each split was below 0.5 and finally categorized into poor, medium and rich.
The data were presented in tables and figures by computing the percentages of minimum dietary diversity, meal frequency and acceptable diet. Binary logistic regression was done for the two outcome variables of MDD (1 = met 4 and above food groups, 0 = met less than four food groups) and MMF (1 = met the minimum requirement for | {
"pile_set_name": "PubMed Central"
} |
{#sp1 .325}
{#sp2 .326}
| {
"pile_set_name": "PubMed Central"
} |
{#sp1 .649}
| {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
Myotonic dystrophy type 1 (DM1, OMIM no. 160900) is an autosomal dominant repeat expansion disorder, affecting skeletal and smooth muscle as well as the heart, the endocrine system, the eye and the central nervous system ([@DDW042C1]). The multisystemic manifestation and progression of DM1 are caused by expansion of a (CTG·CAG)*~n~* repeat, located in the 3′-untranslated region (3′ UTR) of the dystrophia myotonica protein kinase (*DMPK*) gene ([@DDW042C2]) and in an overlapping antisense transcription unit in the DM1 locus ([@DDW042C3]). In DM1 families the expanded repeat is unstable, both somatically and intergenerationally, with a bias toward expansion, causing progression of disease symptoms during ageing and over successive generations ([@DDW042C4]).
Several mechanisms may contribute to the molecular pathogenesis of DM1 ([@DDW042C5]). Expanded *DMPK* transcripts are retained in the nucleus, where they form focal complexes in insoluble or diffuse-soluble state by abnormal association with transcription factors and RNA-binding proteins, like members of the muscleblind-like family (MBNL1--3), DEAD-box helicases and hnRNP proteins ([@DDW042C1],[@DDW042C6],[@DDW042C7]). In turn, abnormal phase transitions in RNP complexes lead to sequestering of factors needed for processing of other transcripts with *in trans* consequences for faithful alternative splicing and polyadenylation and expression of miRNAs ([@DDW042C7],[@DDW042C8]). Production of proteins by ribosomes that decode the normally untranslated (CUG)*~n~* repeat tract in *DMPK* mRNA by a newly discovered process, coined repeat-associated non-ATG (RAN) translation, is also possible ([@DDW042C9],[@DDW042C10]). Similar toxic events may occur with antisense transcripts originating from the complementary strand of the DM1 locus, overlapping the 3′ end of the *DMPK* gene. Abnormal RNAs are thus formed with an expanded (CAG)*~n~* repeat, potentially leading to the production of homopolymeric peptides by RAN translation of the (CAG)*~n~* repeat, which may evoke an imbalance in proteostasis ([@DDW042C9],[@DDW042C10]). Finally, it cannot be excluded that problems with DNA replication across the repeat tract or abnormal epigenetic modification of the chromatin region containing the DM1 locus also contribute to pathology ([@DDW042C3],[@DDW042C11]).
Together, alterations in the transcriptome, proteome and replisome may compromise the physiological integrity of cells and tissues in which the mutant *DMPK* and the *DM1-antisense* gene are expressed. Throughout development, growth and adulthood this imbalance may lead to the loss of function and ultimately to cell degeneration, causing the muscle wasting and CNS white matter loss in patients ([@DDW042C4],[@DDW042C12]).
For study of biological mechanisms underlying DM1 pathology and for testing of possible therapeutic strategies in preclinical studies, several animal models are available, including *Drosophila*, zebra fish and mouse ([@DDW042C13],[@DDW042C14]). Predominant focus is thereby oriented toward mechanisms involved in RNA-based disease etiology. Notably, DM1 animal models differ profoundly in nature, structural organization and chromatin context of their transgenic insert and in the length of the (CTG·CAG)*~n~* segment therein. Comparison of pathobiological findings between models and extrapolation to the situation in patients remain therefore difficult. Work of others has already demonstrated that the timing of *DMPK* expression, i.e. the onset of potential RNA toxicity, influences phenotypic severity ([@DDW042C15]). Expression of RNA with an abnormal repeat tract in satellite cells or neuronal progenitor cells may affect proper muscle and brain development ([@DDW042C16]--[@DDW042C19]) and have serious consequences for tissue regenerative capacity in adulthood. The absolute number of expanded RNAs and their structure at any given moment may also be crucial, as these ultimately will influence the extent of toxicity caused by abnormal RNP binding or abnormal properties of RAN translation products ([@DDW042C20]--[@DDW042C22]). The type of gene promoters, whether from endogenous or ectopic origin, that drive transcription during development and ageing, and the structure of the transcripts that entail the repeat segment are therefore critical parameters in animal models and patients.
Here, we report on comparison of expression and measurement of absolute numbers of (CUG)*~n~*-repeat containing RNAs in muscle cells and tissues of four commonly used mouse DM1 models and in cells and biopsies from patients. DM1 mouse models express transgenes with different promoters, different structural organization and different repeat lengths: DM500, DMSXL, Tg26 and *HSA*^LR^ (Table [1](#DDW042TB1){ref-type="table"}). DM500 and DMSXL mice are both descendants of the DM300-328 line, which was subject to intergenerational repeat expansion. These mice carry a complete human DM1 locus ([@DDW042C23],[@DDW042C24]). The *DMPK* transgene in Tg26 mice carries a tandem insert of ∼25 copies of the complete human *DMPK* gene, with a normal-sized (CTG)11 repeat ([@DDW042C25],[@DDW042C26]). In *HSA*^LR^ mice, the transgene is under control of the *ACTA1* promoter and the repeat is embedded in the context of the *ACTA1* gene ([@DDW042C27]). The rationale for quantification of repeat RNA expression in these models is that knowledge about toxic RNA concentration will provide us with more insight in pathophysiological cascades *per se*, especially as more and more anatomical, physiological and behavioral phenotype data become available, enabling relatively easy cross comparisons. Furthermore, some of the DM1 models have already been extensively used for preclinical translational studies in the past decade, but translation of findings in these models has been difficult. Table 1.Characteristics of DM1 mouse models used in this study.Mouse modelTransgeneTransgene copy numberPromoterExpression(CTG)*~n~*Genetic backgroundReferencesDM500 (DM300-328 line)Human DM1 locus (43 kb transgene)1Human *DMPK* (∼11.5 kb region upstream of main TSS)All DM1-related tissues (e.g. skeletal muscle, heart and CNS)500--600\>90% C57BL/6([@DDW042C23])DMSXL (DM300-328 line)Human DM1 locus (43 kb transgene)1Human *DMPK* (∼11.5 kb region upstream of main TSS)All DM1-related tissues (e.g. skeletal muscle, heart and CNS)∼1300\>90% C57BL/6([@DDW042C24])Tg26Human *DMPK* gene (14 kb transgene)∼25Human *DMPK* (∼1.9 kb region upstream of main TSS)All DM1-related tissues (e.g. skeletal muscle, heart and CNS)11FVB/*n*([@DDW042C25])*HSA*^LR^ (LR20b line)Human α-actin gene; CTG repeat inserted in 3′ UTR (7.1 kb transgene)2Human α-actin (∼2.1 kb region upstream of TSS)Skeletal muscle only220--250FVB/*n*([@DDW042C27])WTNo transgenen.a.n.a.n.a.n.a.\>90% C57BL/6n.a.[^3]
We demonstrate that, in comparison with expression of normal and mutant *DMPK* transcripts in patient cells, considerable variation exists in level and developmental timing of transgene expression in DM1 cell and animal models. A remarkable low level of expression with absolute numbers of, at most, a few dozen RNA molecules per cell was observed for *DMPK* transcripts in human samples. Our findings highlight the hitherto unrecognized involvement of low-abundance RNA molecules in DM1 pathophysiology, altering our current view on the RNA gain-of-function theory, which explains the role of repeat RNA in DM1 manifestation. We discuss the possible implications of our findings for future interpretation of data from fundamental and translational studies in which these DM1 models and patient cells will be used.
Results {#s2}
=======
Derivation of myogenic cell lines from DM1 mouse models {#s2a}
-------------------------------------------------------
Characteristics of mouse models included in this study are listed in Table [1](#DDW042TB1){ref-type="table"}. For profiling of transgene expression at the cellular level, we established conditionally immortalized myoblast populations from each model by pooling clones of individual cells derived from the calf muscle complex from double hemizygous mice carrying one transgenic DM1 allele and one H-2K^b^-tsA58 allele ([@DDW042C28]). As there is strong evidence that satellite cells from different inbred mice behave intrinsically differently ([@DDW042C29],[@DDW042C30]), it is important to note that crossings included different genetic backgrounds to generate the double hemizygous animals. The cell populations have therefore distinct mixed genetic backgrounds with contributions of C57BL6, FVB/*n*, CBA/Ca and C57BL/10. We do believe, however, that these differences have no major impact on transcriptome composition and therefore should not overtly confound our comparison.
An important feature of the immortalized myoblasts is that during | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-nutrients-12-01609}
===============
Cardiovascular (CV) disease is the most common cause of morbidity and mortality in patients with chronic kidney disease (CKD) \[[@B1-nutrients-12-01609],[@B2-nutrients-12-01609]\].
The high CV risk may be due, at least in part, to the excess of vascular calcifications (VC) observed even in very young dialysis patients, who lack the typical CV risk factors such as hypertension, dyslipidemia, and smoking \[[@B3-nutrients-12-01609],[@B4-nutrients-12-01609],[@B5-nutrients-12-01609]\]. The presence of abdominal aortic calcifications is significantly associated with all-cause and cardiovascular mortality in maintenance hemodialysis (HD) patients \[[@B2-nutrients-12-01609]\].
Although arterial medial calcification is the most represented, both intimal and medial calcifications coexist in CKD patients \[[@B3-nutrients-12-01609]\]. Medial and intima calcification are active processes that share some triggering factors: mineral bone disorders, inflammatory status, humoral factors, and phenotypic switch of resident or circulating precursor \[[@B3-nutrients-12-01609],[@B6-nutrients-12-01609],[@B7-nutrients-12-01609],[@B8-nutrients-12-01609],[@B9-nutrients-12-01609],[@B10-nutrients-12-01609]\]. Chronic kidney disease--mineral bone disorder (CKD-MBD) is considered one of the main factors associated with increased cardiovascular morbidity and mortality in CKD patients \[[@B11-nutrients-12-01609]\]. These patients frequently show both impaired bone mineralization and ectopic vessel mineralization, a feature which is the result of at least two factors: the "bone--vessel axis" and the "calcification paradox".
Albeit some pathways involved in the crosstalk between vasculature and bone (the "bone-vascular axis") are still unknown, it is clear that osteotropic hormones, including parathyroid hormone and calcitriol, physiologically regulate both vascular and skeletal mineralization as well as stem cell renewal \[[@B9-nutrients-12-01609],[@B12-nutrients-12-01609]\]. Cellular, endocrine and metabolic signals that flow bidirectionally between vasculature and bone are necessary for the health of both. Diabetes and CKD in particular are associated with an important derangement of the bone--vascular axis which usually determines simultaneous alterations in both.
VC is frequently associated with and evolves in parallel with decreased bone mineral density and deranged bone turnover. Bone and vessel mineralization share common pathways, and this parallel is known as the "calcification paradox" \[[@B13-nutrients-12-01609]\]. Moreover, treatments targeting bone disorders might have adverse consequences for cardiovascular health.
This creates the need to identify treatments that have a positive impact on the factors or pathways involved in the crosstalk between vasculature and bone. Over the last decade, as a growing body of evidence has seemed to point to an involvement of vitamin K deficiency in VC, the hypothesis that vitamin K supplementation could be a tool to prevent the rapid progression of VC in CKD patients is gaining momentum \[[@B14-nutrients-12-01609]\].
2. Vitamin K and Gla Proteins {#sec2-nutrients-12-01609}
=============================
There are two main natural forms of Vitamin K: K1 (or phylloquinone, PK) contained in green vegetables, and K2 (including several different vitamers called menaquinones, MKs) mostly derived from fermented foods and intestinal bacteria (e.g., cheeses and the Japanese soybean product known as "natto") \[[@B15-nutrients-12-01609]\]. There are up to 12 different types of MKs, from MK-4 to MK-15; the most common MKs in humans are the short-chain MK-4 and MK-7 to MK-10, which are respectively produced by systemic conversion of phylloquinone to menaquinones and synthesized by bacteria \[[@B16-nutrients-12-01609]\]. The pivotal biological role of vitamin K is to act as a cofactor for the carboxylation (and thereby activation) of vitamin-K-dependent proteins (VKDPs). Vitamin-K-dependent carboxylase is an enzyme that catalyzes the addition of carbon dioxide to the specific glutamic acid residues of a limited number of proteins leading to the formation of g-carboxyglutamic (Gla) residues.
Seventeen members of the Gla protein family, involved in various biological processes, have currently been identified. In particular, the Gla family includes (i) seven proteins belonging to the coagulative cascade: prothrombin, factor VII, factor IX, factor X, protein C, protein S and protein Z; (ii) four proteins that regulate bone and vascular mineralization: matrix Gla protein (MGP), osteocalcin (OC), growth arrest-specific protein 6 (Gas6), Gla-rich protein (GRP); (iii) two proline-rich Gla proteins, two transmembrane Gla proteins, periostin and periostin-like factor \[[@B17-nutrients-12-01609],[@B18-nutrients-12-01609],[@B19-nutrients-12-01609],[@B20-nutrients-12-01609]\].
Measuring Vitamin K plasma levels is difficult due its low circulating concentration, the non-polar nature of the molecule and the interference of lipids. Moreover analytical variability, diet, inflammation, and the coexistence of chronic disease may further influence plasma levels of vitamin K subtypes \[[@B21-nutrients-12-01609]\]. Functional tests can be performed to estimate vitamin K blood levels indirectly. In particular, the measurement of undercarboxylated proteins, OC and MGP, has proved to be more sensitive than prothrombin time in detecting subclinical vitamin K deficiency. Vitamin K deficiency status does not allow VKDPs to acquire their carboxylated form: the gamma-carboxyglutamate (Gla) domain is responsible for the high-affinity binding of calcium ions, thus allowing coagulation factors OC and MGP to interact with negatively charged phospholipid membranes. Moreover, adequate calcium binding is a critical physiologic step in bone mineralization counteracting VC \[[@B22-nutrients-12-01609]\].
Since some Gla-proteins are involved in bone metabolism and vascular health, their reduced carboxylation leads to bone metabolism impairment and an increase in the VC formation process \[[@B23-nutrients-12-01609]\]. Mild vitamin K deficiency does not usually induce clinically evident changes in coagulation, which is consistent with the observation that functional tests (e.g., prothrombin time) are altered only when the activity of vitamin K-dependent coagulation is reduced by 50% \[[@B24-nutrients-12-01609],[@B25-nutrients-12-01609]\]. On the other hand, due to differences between hepatic and extra-hepatic vitamin K metabolism, extra-hepatic VKDP carboxylation is most affected by subclinical deficient states \[[@B25-nutrients-12-01609]\]. The current understanding is that vitamin K2 is mainly transported to the extra-hepatic tissues and controls the carboxylation of VKDPs in bone and blood vessels, while vitamin K1 is central for the carboxylation of vitamin-K-dependent coagulation factors in the liver \[[@B25-nutrients-12-01609]\].
Considering that each Gla-protein has specific biological functions, no single biomarker is considered a gold standard in the assessment of vitamin K deficiency.
OC is synthesized by the osteoblasts under the control of vitamin D, and its active carboxylated form (cOC) is mainly involved in bone mineralization, since it binds and incorporates calcium ions in the hydroxyapatite crystals in bone matrix. Thus, a high undercarboxylated OC (ucOC) level is an expression of poor vitamin K levels and intake. Moreover ucOC can be released during osteoclastic resorption, and is thought to be responsible for functions related to energy metabolism \[[@B17-nutrients-12-01609],[@B26-nutrients-12-01609]\].
Low levels of ucOC are associated with higher bone mineral density and reduced fracture risk \[[@B27-nutrients-12-01609]\]. It is a fact that ucOC mirrors total OC, and expressing ucOC as a percentage of the total OC (%ucOC) may therefore be considered a more reliable index of vitamin K storage than the absolute value of ucOC. As showed by Booth et al., a value of %ucOC \>20% is congruent with subclinical vitamin K deficiency in vitamin K depletion and repletion studies \[[@B28-nutrients-12-01609]\].
As OC distribution seems to change with age and gender, reflecting the degree of bone formation, the differences in its distribution in bone matrix may be responsible, at least in part, for the altered remodeling of bone associated with gender and aging \[[@B29-nutrients-12-01609],[@B30-nutrients-12-01609],[@B31-nutrients-12-01609]\]. In addition, glutamic acid carboxylation at position 17 is probably fundamental for the spatial and structural conformation of the osteocalcin, allowing a correct interaction with hydroxyapatite crystals \[[@B18-nutrients-12-01609]\].
It has been observed that mice knocked out for the OC gene are affected by hyperostosis, suggesting that osteocalcin is crucial for bone formation. Vitamin K2 seems not to be involved only in OC carboxylation, but also in the reduction of bone resorption through the increase in osteoprotegerin (OPG) production and the inhibition of RANK ligand (RANKL) expression \[[@ | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION
============
The World Health Organization describes the healthcare waste as discarded, untreated materials from healthcare activities, which have the potential of transmitting infectious agents to humans \[[@R1]\]. Dental instruments and materials are exposed to blood and saliva during various dental procedures. Hence, biomedical waste (BMW) management in dental practice is equally critical as in the medical fraternities. Proper BMW disposal is essential for the safety of the dental personnel and the general public at large. Justifiably, the majority of countries control the dental waste under medical waste management regulations. Dental laboratories are an integral part of dental practice. The well-equipped, efficient laboratory is vital across the dental specialties including Prosthodontics, Restorative dentistry, pedodontics, and orthodontics. Most of the restorative dental procedures require the dental laboratories support to complete the planned treatment. During the process of indirect restoration fabrication, the dental laboratories generate various hazardous wastes potentially detrimental to the health and environment. The dental laboratory solid waste classified as infectious waste, non-infectious toxic waste, and domestic waste. The waste suspected to contain the pathogen in sufficient concentration causing disease in susceptible hosts is considered as infectious waste \[[@R2],[@R3]\]. The Dental prosthesis, occlusal bite blocks, occlusal records, and orthodontic appliances routinely come in contact with human saliva and blood \[[@R4]\]. The researchers demonstrated the presence of bacteria and fungi over the dental impression on their arrival to the laboratory \[[@R5]\]. Some studies even indicate the existence of bacteria on the denture polishing pastes and wheels. The other infectious waste includes silicones used for maxillofacial prosthesis, gloves and plastic containers used for transporting the dentures and appliances from clinics. The non-infectious toxic wastes are devoid of human fluids contamination but potentially toxic in nature. It includes the acrylic resin scraps, wasted metal alloys, metal dust, porcelain, and gypsum waste. Other non-infectious toxic wastes are amalgam alloys and acids used in electrolytic polishing of metal frameworks. Domestic type wastes are comprised of Paper cups, plastics, sand papers, and household wastes.
The Dental laboratories broadly belong to two categories. The first group operates as an integral part of dental clinics or hospital. The second group is independent of dental hospitals; work as separate establishments to serve the dental fabrication need of clinics. The laboratories of later categories are routinely ignored by regulating bodies from the government. The dental laboratory solid waste is frequently disposed of through the municipal solid waste. The reason for improper disposal is multifactorial; it includes a lack of knowledge, improper attitude of the dental technician and inadequate facilities. The existing dental literature regarding the waste management are conducted predominantly in dental clinics and critically deficient on waste disposal practices at dental laboratories. The knowledge and attitude of personnel, disposal practices and disposal facilities at different categories of dental laboratories need to be explored further. The result of the study will help to identify and initiate the corrective measures for acceptable dental solid waste disposal. Hence, this study was designed to assess the knowledge, attitude and practices about dental solid waste management among dental staff at different categories dental laboratories in Abha city, Kingdom of Saudi Arabia.
MATERIAL AND METHODS
====================
The study was conducted in the Abha- Khamis Mushiath city Kingdom of Saudi Arabia during the first semester of 2014. The Abha City is the largest city in the southern part of the Kingdom of Saudi Arabia. The city has several dental treatment facilities; it includes the College of Dentistry dental clinics, three government dental specialty treatment hospitals, twelve private specialty dental clinics and four private, independent dental laboratories. The approval for the research proposal was obtained from institution research ethics committee. The study population included the dental technicians across all the laboratories. The study was a cross-sectional study, with stratified sampling. Total of 90 dental technicians were working in all the dental laboratories, out of which 80 consented to participate in the study. The participation rate was at 88.9%. The exclusion criteria were the subjects not willing to participate in the study. The study group comprised of four groups with twenty subjects from each group. The Group I consisted of the dental technicians working in a dental teaching hospital; Group II included the laboratory technicians working at government dental hospital. The technician at private dental clinics laboratories considered as Group III and Group IV were technicians at independent dental laboratories. A written consent was obtained from all the study participants. The data collection was done through the anonymous, pre-designed, pre-tested and structured questionnaire. The pretesting was carried out on 20 subjects among target populations to determine the variation in the language, terminology, interpretation of question and response options in the questionnaire. According to the participant's feedback, the required modification was incorporated in the questionnaire. The internal consistency of the survey instrument was ascertained by Cronbach\'s alpha coefficient (0.891) analysis. The question consisted 29 closed-ended questions to assess the knowledge, practice, disposal facilities and education regarding biomedical waste management among the dental technicians. The questionnaire was self-administered, the purpose of the study was explained to all members and collected back immediately after the completion. The resultant data was analysed using SPSS software version 19 for proportions to interpret the results.
RESULTS
=======
Table **[1](#T1){ref-type="table"}** indicates the improper BMW disposal risk was recognized by only 45% (9) in Group IV, and 55% (11) among Group III. The risk awareness among Group II was at 85% (17) and Group I was 75% (15). The knowledge regarding the different BMW categories, was at 40% (8), 11% (55), 25% (5), 15% (3) for Group I, II, III, IV respectively. The information regarding BMW colour coding and segregation at source among Group I was at 65% (13) and 55% (11) respectively. The Group IV subjects had the least information on colour coding and segregation at 5% (1) and 10% (2). The knowledge of disinfection methods, disposal options was also at lowest among the Group IV at 10% (2) and 5% (1). The Group III was slightly better at 15% (3) and 5% (1). The information on national and institutional BMW disposal regulations was surprisingly less among all the studied groups. Only 5-25% of the participants across the groups were aware of BMW regulation applicable to dental practice.
The positive attitude towards BMW disposal was relatively high and uniform among all groups (Table **[2](#T2){ref-type="table"}**). It was at an average of 75-90%. The majority of respondents agree that good BMW management and handling is the integral part of their work.
The third segment of the questionnaire (Table **[3](#T3){ref-type="table"}**) was about the BMW disposal practice at dental laboratories.
The result indicated color specific bags for BMW disposal was utilized by 20% of Group IV, followed by Group III (25%), Group I (45%) and Group II (65%). The 20% (4) subjects from Group IV practiced proper disposal of heavy metals and amalgam and 35% (7) of subjects from Group III. The favorable heavy metal and amalgam disposal was practiced by 65% (13) for Group II and 55% (11) from Group I. Only 25% (5) amongst Group IV and 35% (7) from Group III dental technicians were utilizing puncture-proof container to dispose of sharp objects. 20% (4) and 25% (5) practiced the disinfection of solid waste prior disposal among Group IV and Group III respectively. Though the solid waste disinfection practice was better at Group I (45%) and Group II (86%), still at inadequate proportion.
The results of the study revealed (Table **[4](#T4){ref-type="table"}**) inadequate disposal facilities at Group III and Group IV working place. The 15% (3) of Group IV respondents had coloured container while only 5% (1) had puncture proof containers for waste disposal at the working place. The availability of these containers was also insufficient at Group III respondents working area with corresponding values of 25% (5) and 30% (6). The disposal facilities at Group I and Group II was significantly better at 65-85%. The monitoring agency visits for these facilities was only 5% at Group IV, followed by group III (45%), Group I (45%) and Group II (65%).
Though 25% of the study respondents had learned about BMW disposal in their curriculum, there were very few reorientation programs to update the knowledge (Table **[5](#T5){ref-type="table"}**). The Dental Technician at Group IV had no reorientation programs conducted or attended. The Group II subjects had better exposure to reorientation program with 55% (11) respondents attended these reorientation scientific activities.
DISCUSSION
==========
The dental practice generates the infectious, non-infectious toxic and domestic waste. The potentially infectious dental solid wastes are blood/saliva soaked paper towels, gauze, cotton roll, latex gloves, syringes, dental floss, and surgical blades. The dental laboratories handle the potentially infectious objects like dental bridges and prosthesis, matrix bands, dental impressions, wax, interocclusal records. Toxic wastes produced at laboratories include dental amalgam and heavy metal waste. Proper handling and disposal of the potentially infectious and toxic waste is critical for the safety of patients, professionals, public, and the environment. The study reports from Nabizadeh R *et al.* \[[@R6]\] suggests, the dental waste constituted of 71.15% domestic waste, 21.40% potentially infectious waste, 7.26% chemical and 0.18% toxic waste. They observed highest dental solid waste was produced by denture maker (37.96%), followed by a general dentist (34.95), practical dentist (20.69) and specialist dentist (6.40%). A | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
Liver X receptors (LXRs) were originally identified as ligand-dependent transcriptional activators that induce target genes involved in lipid metabolism. The subfamily consists of two isoforms: LXR*α* and LXR*β*. Gene transcription is modulated by LXRs, which heterodimerize with the retinoid X receptor and bind to LXR-response elements in the transcriptional regulatory regions of their target genes \[[@B1]\]. Recently, LXRs have been reported to regulate macrophage inflammatory responses, phagocytosis, and apoptosis \[[@B2], [@B3]\]. LXRs inhibit the transcription of proinflammatory cytokines such as interleukin-1*β* (IL-1*β*), IL-6, and tumor necrosis factor-*α* (TNF-*α*) via their promoters or enhancers \[[@B3]\]. One study showed that LXRs mediate the regulation of Th17 cell differentiation and autoimmunity \[[@B4]\]. Furthermore, LXR has been demonstrated to be involved in the upregulation of various genes, including apoptotic inhibitor of macrophage and arginase II \[[@B5]\]. Therefore, LXRs have emerged as important regulators of inflammatory gene expression in several inflammatory diseases \[[@B6]--[@B8]\].
Systemic lupus erythematosus (SLE) is a chronic autoimmune disease with various clinical manifestations and autoimmune serologic markers. The pathogenesis of SLE is unclear, but several causes, such as genetic background, environmental factors, and disturbance in both innate and adaptive immunity, have been proposed as contributing factors for the development of the disease \[[@B9]\]. Disturbances in apoptotic cell clearance, hyperactive immune cells, and an abnormal production of autoantibodies are observed as major pathological features of SLE \[[@B9], [@B10]\]. In particular, uncleared apoptotic cells and their accumulation in tissues have been suggested to contribute most to the inflammation in SLE \[[@B11]\]. Some molecules, such as growth arrest-specific 6 and protein S, enhance the recognition and susceptibility of apoptotic cells to phagocytosis \[[@B12], [@B13]\]. These interact with receptor tyrosine kinases of the TAM (Tyro-3, Axl, and Mer) family \[[@B14]\]. The loss of regulation of inflammation and delayed clearance of apoptotic materials are associated with the development of a lupus-like syndrome in TAM knockout mice \[[@B15]\]. In particular, Mer signaling has been reported to increase the transcriptional activity of LXR to promote the resolution of acute sterile inflammation \[[@B16]\]. Therefore, LXRs might play an important role in the regulation of inflammatory gene expression in SLE. However, the association between LXR activation or expression and pathogenesis of SLE has not been well addressed.
We had previously reported that LXR*α* gene (*NR1H3*) promoter polymorphisms are associated with SLE in Koreans \[[@B17]\]. Specifically, the -1830 T \> C polymorphism within *NR1H3* promoter region was associated with clinical manifestations of SLE; increased B cell proliferation and decreased *NR1H3* mRNA expression were observed in patients with -1830 TC genotype compared to those with the -1830 TT genotype. Therefore, in this study, we assessed cytokine expression in different LXR*α* polymorphism in monocyte-derived macrophages from patients with SLE. Furthermore, we evaluated the effect of LXR activation on proinflammatory cytokine secretion induced by several Toll-like receptor (TLR) agonists.
2. Materials and Methods {#sec2}
========================
2.1. Cell Culture {#sec2.1}
-----------------
U937 cells (human myelomonocytic leukemia cell line) were cultured in RPMI 1640 medium supplemented with 10% heat-inactivated fetal bovine serum (FBS) at 37°C in a 5% CO~2~ incubator. THP-1 cells (human acute monocytic leukemia cell line) were cultured in RPMI 1640 medium supplemented with 10% heat-inactivated FBS and 0.05 mM 2-mercaptoethanol at 37°C in a 5% CO~2~ incubator. Macrophages were obtained after 72 h of culture of human monocytes (U937 or THP-1) in RPMI 1640 medium (Gibco by Life Technologies, Grand Island, NY) supplemented with PMA (40 nM or 80 nM). Cells were cultured at a density of 1 × 10^6^ cells/mL in 24-well plates (Corning, NY), and the cells were transfected with 1 *μ*g control pGL3 or LXR*α* promoter constructs, using FuGENE HD (Promega, Madison, WI), Lipofectamine 2000 (Thermo scientific, Fremont, CA), and ultra TRAX transfection agent (GeneDireX, Taoyuan, Taiwan) according to the manufacturer\'s instructions. After incubation for 6 h, the medium was replenished with 500 *μ*L of fresh medium with 20% FBS, and the cells were incubated for another 18 h at 37°C in a 5% CO~2~ incubator. Twenty-four hours after transfection, cells were preincubated with LXR agonist (3 *μ*M GW3965 or 5 *μ*M T0901317) at the indicated concentrations for 24 h prior to the addition of TLR ligands: 100 ng/mL ultrapure lipopolysaccharide (LPS; Calbiochem, San Diego, CA), 1 *μ*g/mL CL097 (tlrl-c97, InvivoGen, San Diego, CA), and 1 *μ*M ODN TTAGGG (tlrl-ttag151, InvivoGen) for 24 h.
2.2. Ex Vivo Cell Culture {#sec2.2}
-------------------------
Twelve patients with SLE, who were involved in the previous study, were enrolled again \[[@B17]\]. Among them, 6 patients had LXR*α* -1830 TT and 6 patients had TC genotype. All patients satisfied at least four of the criteria laid out by 1982 revised American College of Rheumatology criteria for SLE \[[@B18]\]. Supplementary [Table 1](#supplementary-material-1){ref-type="supplementary-material"} shows the clinical characteristics and laboratory findings of enrolled 12 SLE patients. This study was approved by the Institutional Review Board of Ajou University Hospital (IRB No. AJIRB-BMR-EXP-14-186). Informed consent was obtained from all subjects. All experiments were performed in accordance with relevant guidelines and regulations.
PBMCs from buffy coats of patients were isolated using Ficoll-Paque PLUS gradient (GE Healthcare Life Sciences, Pittsburgh, PA). The purity of CD14^+^ cells was \>90%, as assessed by flow cytometry. CD14^+^ cells were cultured for 5 days at 1 × 10^6^ cells/mL in 6-well plates containing serum-free DMEM media (Gibco, Carlsbad, CA) in the presence of M-CSF (100 ng/mL; R&D Systems, Minneapolis, MN).
LXR agonist, on day 2, was coincubated with either activators or inhibitors of TLR7 and TLR9 for 24 h. Cells were then harvested by centrifugation. Supernatants were collected and immediately stored at -20°C before being tested by enzyme-linked immunosorbent assay (ELISA). Pellets were resuspended in phosphate-buffered saline (PBS), and proteins were extracted for western blot analysis.
2.3. Preparation of Plasmid DNA and Transfection {#sec2.3}
------------------------------------------------
Structures, composed of the LXR*α* -1830 T \> C sequence, were assembled carrying each allele. A 500 bp fragment (from -2121 to -1622) of the LXR*α* gene was PCR-amplified using either -1830 T homozygous or -1830 C homozygous genomic DNA as a template and the following primers: forward primer: 5′-CGGCGG**GGTACC**ACATCTATGCCAGCCCTGTTTCAG-3′ (the bold characters represent the KpnI site); reverse primer: 5′-CCGCCG**CTCGAG**ACTGAGCCCCAGCGGCTTTC-3′ (the bold characters denote the XhoI site). Each PCR product was subcloned separately into the KpnI-XhoI site of the pGL3-Basic luciferase reporter vector (Promega, Madison, WI).
2.4. RNA Extraction and Quantitative Real-Time PCR {#sec2.4}
--------------------------------------------------
Total RNA was extracted from cells, using an RNeasy Mini kit according to the manufacturer\'s instruction (Qiagen, Valencia, CA); cDNA was synthesized from total RNA using GoScript Reverse Transcription System kit (Promega, Madison, WI) and 18-residue oligo (dT) (Bioneer, Seoul, Korea). After annealing at 25°C for 5 min and extension at 70°C for 15 min, the product was stored at -20°C until use. The real-time PCR amplification was performed using a Rotor-Gene SYBR Green PCR kit (Qiagen, Valencia, CA). The following PCR conditions were used: heating to 95°C for 5 min, then 40 cycles of 95°C for 5 s, 58°C for 10 s, and 72°C for 30 s. The primers used were as follows: human LXR*α* (F): 5′-AGGGCTGCAAGGGATTCTTCC-3′, (R): 5′-TCTGACAGCACACACTCCTCCC-3′, TNF-*α* (F): 5′-TGCCTATGTCTCAGCCTCTTC-3′, (R): 5′-GGGCCAT | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
In July 2014, the University of Hawai'i hosted the First Island Biology Symposium, where nearly 450 island biologists from all over the world and from very different island biology subdisciplines (Island Biogeography, Phylogeography, Ecology, Palaeoecology, Conservation Biology, etc.) joined together for the first time ([@PLV148C17]). The aim of the event was to launch a regular series of International Island Biology conferences, bringing together researchers who, by the very nature of the islands they study, face geographical barriers to communication and collaboration. This event was broadly recognized as a big success and the Second Symposium, following the agreed policy of rotating the ocean of the archipelago hosting the next event, will be held in Angra do Heroismo, Azores, in summer 2016 (<http://www.islandbiology2016.uac.pt/>).
The year of the first Island Biology conference coincided with the 40th anniversary of the publication of an outstanding book that inspired a generation of island biologists: Sherwin Carlquist\'s *Island Biology*, published in 1974 by Columbia University Press. Unfortunately, unforeseen circumstances at the last minute prevented Sherwin Carlquist from attending the conference and presenting a keynote address.
This special issue brings together some of the most interesting botanical contributions presented at the Symposium. The 18 contributions that we compiled deal with very different themes and come from very different archipelagos across the world and disciplines within plant science. Indeed, the broad coverage of themes relevant to island biology and of different islands, archipelagos and ocean regions was a key feature of the conference. It was a strong indication that island biology is flourishing, and given the importance of Sherwin Carlquist\'s work across many research fields, it showed that his legacy lives on and grows. We will first provide a short overview of the life and work of the inspiring scientist to whom we dedicate the special issue, Sherwin Carlquist, before summarizing the main findings of each contribution in the special issue.
Sherwin Carlquist\'s life and work {#s1a}
----------------------------------
Sherwin John Carlquist was born in 1930 in California. From a young age, he was fascinated with islands, very likely due to reading some books about the Galápagos archipelago borrowed from Los Angeles School Library where Sherwin\'s mother worked. He received his undergraduate degree (1952) and a Ph.D. in Botany (1956) from the University of California, Berkeley. Following a postdoctoral stay at Harvard University, he began his teaching career at the Claremont Graduate School. In 1977, he also began teaching at Pomona College and continued working at both institutions until 1992. From 1984 to 1992, Carlquist was the resident Plant Anatomist at Rancho Santa Ana Botanic Garden. His last post was as an adjunct professor at University of California at Santa Barbara from 1993 to 1998.
Although trained as a wood anatomist, the early opportunity of doing research in Revillagigedo (Mexico) and Hawai'i strengthened the allure of oceanic island floras to the young Carlquist. During his life, he has worked in many other island groups around the world, including Guadalupe, Society Islands, Samoa, Fiji, New Caledonia, Vanuatu, New Guinea, New Zealand, Australia, Taiwan, Japan, Borneo, Ryukyu Islands, Ogasawara (Bonin) Islands and the Subantarctic islands of New Zealand.
His scientific production includes \>300 scientific articles, the majority being related to wood anatomy, as well as \>10 books, 4 of them dealing with islands: *Island Life* ([@PLV148C5]), *Hawaii: A Natural History* ([@PLV148C6]), *Island Biology* ([@PLV148C7]) and *Tarweeds and Silverswords: Evolution of the Madiinae (Asteraceae)* ([@PLV148C8]). While all of these are very important contributions to our knowledge of island biology in general, and for Hawaiian natural history in particular, one of them, *Island Biology* ([@PLV148C7]), became a major milestone in the field, comparable with classic books such as Darwin\'s *On the Origin of Species*, ([@PLV148C9]), Wallace\'s *Island Life* ([@PLV148C35]) or MacArthur and Wilson\'s *The Theory of Island Biogeography* ([@PLV148C19]). In that book, Carlquist displayed, in an outstandingly organized structure, his encyclopaedic knowledge about the evolutionary trends and phenomena occurring among insular plants (and animals) and the selection pressures that drive them. The resulting set of evolutionary innovations is characteristic of island taxa and is known as the *island syndrome* ([@PLV148C1]). Four of Carlquist\'s most important contributions to the development of the biology of island plants were as follows: *Long-distance dispersal to islands and secondary loss of dispersability on islands*. Following the classic ideas of Darwin, Wallace and Hooker, Carlquist was convinced of the importance of long-distance dispersal as a way to colonize oceanic islands and of the role of these as stepping stones between continents. In *Island Biology*, he formulated his famous 24 principles of dispersal and evolution ([@PLV148C23]), addressing the evidence for and implications of long-distance dispersal. He also focussed his attention on the several ways island plant (and animal) lineages, after arriving on an island via long-distance dispersal, lost or shifted their dispersal abilities when the ancestral trait was no longer adaptive. The increases in fruit size and weight, making the original fruit design no longer functional for dispersal (e.g. the Polynesian genus *Fitchia* of the Asteraceae---a subject on which Carlquist wrote his Ph.D. dissertation) or the flightlessness achieved by both birds and insects, are outstanding examples of this phenomenon.*Adaptive radiation*. Using his outstanding knowledge of island plants, Carlquist provided a comprehensive synthesis of information on the most important adaptive radiations of vascular plants on islands worldwide. He dedicated at least seven chapters of *Island Biology* to this subject, including a general introduction to the theme and detailed examples of evolutionary processes in Hawaii, Macaronesia, Galápagos, Juan Fernández, New Caledonia, New Zealand, islands off the coast of Western Australia and other islands.*Reproductive biology on islands*. In his book, Carlquist displayed his profound knowledge of floristic sexual systems providing plentiful examples of different reproductive systems among island plants (especially on Hawai'i). He emphasized a general insular rule promoting outcrossing, i.e. self-compatible continental ancestors evolve different types of outcrossing on islands (dichogamy, herkogamy), via anemophily, heterostyly and all the possible stages in the transition from hermaphroditism to dioecy. He also elaborated upon hybridization in insular floras and its significance.*Insular woodiness*. Carlquist proposed that insular secondary woodiness is a result of evolution from continental herbaceous ancestors. He hypothesized that a release from seasonality occurred on islands---due to the buffer effect of the surrounding ocean---leading recurrently in different archipelagos (Hawai'i, Galápagos, Macaronesia, etc.) and across many plant families to the *in situ* evolution of a woody habit from herbaceous plants. His view was in contrast to the traditional explanation by European island biologists for whom insular woodiness was not a derived feature but instead a basal characteristic of insular palaeoendemic species that became extinct on continents due to climatic or geological events after establishing on the islands. Only the emergence of phylogenetic analyses, a couple of decades after Carlquist\'s claims, made definitively clear that his interpretation was correct.
Long-distance dispersal {#s1b}
-----------------------
The topics of more than a third of the papers covered in this special issue are related to the first three themes indicated above. Three papers advance our knowledge of different aspects of long-distance dispersal and its importance to island plant biology. **[Alsos, Ehrich, Eidesen, Solstad, Westergaard, Schönswetter, Tribsch, Birkeland, Elven and Brochmann (2015)](Alsos, Ehrich, Eidesen, Solstad, Westergaard, Schönswetter, Tribsch, Birkeland, Elven and Brochmann (2015))** present the first comprehensive study of long-distance dispersal to oceanic islands based on combined population genetic and floristic similarity analyses. The authors studied 25 representative vascular plant species of five Arctic Ocean islands (Greenland, Iceland and Jan Mayen) or island groups (Svalbard and Faroe), with the aim of shedding light on the origin and timing of their present floras\' composition. They were able to detect that most plant species colonized those islands after the Last Glaciation through multiple long-distance dispersal events from several source regions, including Europe, Asia and North America, some of them travelling as far as 3000 km. The authors also found that the relative intensity of the founder effect was similar at the species and gene level, broadly corresponding with the predictions of the Island Equilibrium Theory ([@PLV148C19]), and indicating that species and genetic diversities on islands are shaped by similar processes. They report that insect-pollinated species show a strong founder effect that increases with island isolation and decreases with island size, whereas only a weak founder effect was found for wind-pollinated outcrossing species. Finally, they found that colonization patterns among the study islands were largely congruent, indicating that despite the | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
*Erysipelothrix* are gram-positive, rod-shaped, facultative anaerobic bacteria. Based on phylogenetic relatedness, *Erysipelothrix* spp. can be categorized into *Erysipelothrix rhusiopathiae* (serovars 1a, 1b, 2, 4, 5, 6, 8, 9, 11, 12, 15, 16, 17, 19, 21, and N), *Erysipelothrix tonsilarium* (serovars 2, 7, 10, 14, 20, 22, and 23), *Erysipelothrix* sp. strain 1 (serovar 13), *Erysipelothrix* sp. strain 2 (serovar 18), and *Erysipelothrix inopinata*, a novel species that was recently isolated from sterile-filtered vegetable broth.^[@bib1],[@bib2],[@bib3],[@bib4]^ These *Erysipelothrix* species are ubiquitous in nature and can cause diseases in a variety of animals including swine, humans, poultry, sheep, cattle, and wild animals. The diseases caused by these species are called erysipelas in animals and erysipeloid in humans.^[@bib5]^ Humans can be infected with pathogens from the pigs.^[@bib6]^
Swine erysipelas is caused by *E. rhusiopathiae*, which enters the bloodstream through the tonsils and other lymphoid tissues of the alimentary canal. It is estimated that 30%--50% of healthy pigs carry *E. rhusiopathiae* in the tonsils. The carriers serve as a reservoir for acute erysipelas outbreaks and may not have clinical signs.^[@bib7]^ The clinical presentation of swine erysipelas are usually manifested as acute septicemia or chronic disease characterized as endocarditis and polyarthritis.^[@bib8]^
Swine erysipelas appears worldwide and causes economic loss to the swine industry.^[@bib9]^ Within the Chinese swine industry, the occurrence of erysipelas has significantly decreased since the 1990s due to intensification and improved management of the industry. It only occasionally occurs in small farms. However, since 2010, we have observed an increase in the number of cases of erysipelas submitted to the Huazhong Agricultural University Clinical Microbiology Laboratory. In addition, other research groups have reported similar trends in China.^[@bib10]^ Whether this increased occurrence of swine erysipelas is due to the development of antimicrobial resistance or extension of a specific lineage is not clear, because information regarding the molecular characteristics and antibiogram of *E. rhusiopathiae* remains limited. To the best of our knowledge, molecular epidemiology of *E. rhusiopathiae* has not been conducted in China.
In the present study, 48 strains of *E. rhusiopathiae* isolated from diseased pigs in China in 2013--2014 were subject to antimicrobial susceptibility testing, virulence gene typing, and pulsed-field gel electrophoresis (PFGE) genotyping to improve our understanding of the virulence traits and molecular profile of *E. rhusiopathiae* in China.
Materials and methods
=====================
The 48 *E. rhusiopathiae* strains were collected from liver, spleen, and blood samples of pigs with a clinical history of acute septicemia by the Clinical Microbiology Laboratory at Huazhong Agricultural University during 2012--2013. These samples were from Southern and Central China, including Zhejiang, Hunan, Hubei, Anhui, Guangdong, Henan, and Jiangsu provinces. Each sample was collected from different pigs and strains with typical morphological characteristics of *E. rhusiopathiae* were picked from each plate. The strains were identified as *E. rhusiopathiae* on the basis of polymerase chain reaction and cellular morphology; growth in gelatin; positive reactions in triple sugar iron agar slants for glucose, lactose, and arabinose fermentation by arginine dihydrolase; and negative reaction for catalase, oxidase, urease, nitrate reduction, mannose, and sucrose fermentation, as described by Wang *et al.*^[@bib11]^
Pulsed-field gel electrophoresis (PFGE)
---------------------------------------
The total DNA of *E. rhusiopathiae* was purified using protocol described previously.^[@bib12]^ DNA was digested with a mixture of *XbaI*, 0.1% bovine serum albumin, and buffers (Takara Biotechnology, Dalian, China) at 37 °C for 8 h. Digested DNA plugs was loaded in 1% agarose gels and run in an contour-clamped homogeneous electric field (CHEF-DRIII; Bio-Rad, Shanghai, China) for 22 h at 14 °C and 6 V with pulse times from an initial 2.2 s to a final 64 s. The gel was subsequently stained by ethidium bromide for detecting PFGE patterns.
Antimicrobial susceptibility testing
------------------------------------
Susceptibility to ampicillin, erythromycin, cefotaxime, norfloxacin, cefazolin, sulfadiazine, amikacin, polymyxin, tetracycline, doxycycline, lincomycin, and levofloxac in was evaluated by microdilution technique, according to the protocol of the Manual of Antimicrobial Susceptibility Testing described by Stephen *et al.*^[@bib13]^ Quality control was performed with *Staphylococcus aureus* (ATCC29213) and *Streptococcus pneumonia* (ATCC49619). The breaking point of the minimum inhibitory concentration (MIC) was cited from the Clinical and Laboratory Standards Institute.^[@bib14]^
Detection of virulence-associated genes
---------------------------------------
The presence of capsule synthesis gene (cpsA-C), neuraminidase (nanH.1 and nanH.2), hyaluronidase (hylA-C), surface protective antigen (spa), adhesion, rhusiopathiae surface protein (rspA and rspB), and nine putative virulence genes, including patatin-like phospholipase A and B (locus tag: ERH_0072 and ERH_00334, respectively; GenBank assembly accession: GCA_000270085.1), phospholipase/carboxylesterase family protein A and B (locus tag: ERH_0083 and ERH_0347, respectively; GenBank assembly accession: GCA_000270085.1), lysophospholipase A, B, and C (locus tag: ERH_0148, ERH_1214, and ERH_1433, respectively; GenBank assembly accession: GCA_000270085.1), cardiolipin synthetase, and phospholipase D was investigated using primers described in [Supplementary Table S1](#xob1){ref-type="supplementary-material"}. Polymerase chain reaction (PCR) was carried out in a 25 μL mixture containing 1 μL DNA, 0.5 μL each primer, 2.5 μL 10× Ex Taq buffer, 2 μL dNTP mixture, 19.25 μL deionized distilled water, and 0.25 μL Ex Taq DNA polymerase (Takara, Dalian, China). Each PCR test was repeated for three times.
Data analysis
-------------
The PFGE patterns were analyzed with BioNumerics software version 6.5 (Applied Maths, Kortrijk, Belgium). A dendrogram was calculated using the unweighted pair group method using arithmetic averages (unweighted pair group method with arithmetic mean (UPGMA)), dice coefficient, and 1.5% optimization with 1.5% band position tolerance. Strains with similarities \>70% had eight band differences and were clustered in a clonal complex. Comparisons between different complexes were tested by Fisher\'s exact test (two-tailed), if a significant result between different complexes was found, comparisons between each complex and all other complexes combined were subsequently tested as well. A *P* value \< 0.05 was considered significant.
Results
=======
Molecular characterization of *E. rhusiopathiae*
------------------------------------------------
PFGE resulted in 32 distinct patterns from 48 *E. rhusiopathiae* strains ([Figure 1](#fig1){ref-type="fig"}). Dendrogram analysis showed that, at 30% divergence, four clonal groups (A--D) were identified. Twenty-five patterns were observed in clonal complexes A and B, suggesting a high diversity of genetic characterization in these two predominant clonal complexes. Clonal complex A accounted for 48% (23/48) of all strains, with a similarity of 78%--96%. Clonal complex B accounted for 35% (17/48) of strains, with a similarity of 84%--97.5%. Only two strains were classified into clonal group C and showed 83% similarity. Clonal group D included six strains, which showed five different PFGE patterns. Strains with similar PFGE patterns were recovered from different provinces and at different times. Strains 1231 and 13002 shared the same PFGE pattern, but strain 1231 was isolated from Hunan province in 2012 and strain 13002 from Hubei province in 2013. Similarly, strain 1210 isolated from Jiangsu province in 2012 also had the same PFGE pattern as that of strain 13007 isolated from Hubei province in 2013. PFGE pattern of strain 13001, 13005, and 13006 was isolated from samples from Hubei and Henan provinces during the same period.
Antimicrobial susceptibility
----------------------------
The MICs of 13 antibiotics for the 48 strains are shown in [Table 1](#tbl1){ref-type="table"}. All the stains were susceptible to ampicillin, erythromycin, and cefotaxime, whereas all were resistant to kanamycin, cef | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION
============
The PhD (doctor of philosophy) pathway is full of highs and lows, and should terminate with a valuable contribution to knowledge. During this pathway, one should demonstrate one's ability to conduct independently scholarly research, and the ability to solve research problems to reach the "Cinderella moment". To keep the research steps in the correct orbit, toolboxes are needed to navigate the PhD journey. Most biomedical students decide to go through the PhD journey either to improve their academic careers, seek the intellectual challenge or to satisfy their eager about a certain topic. The reason that spurred one to pursue the PhD will determine the shape and fate of your PhD thesis and contribution to knowledge. To better understand the PhD process and the pre-and PhD tools which are needed during the journey, the panacea toolboxes are discussed in this manuscript.
***Pre-PhD toolbox:*** Before one takes a step into the PhD world, one should make sure first it is really what one want. Second, you should have list of skills to make the way unclouded through the PhD journey. Communication skills such as academic writing, reading papers and how to evaluate a paper are very important skills that would give the biomedical student the ability to touch the strengths and weaknesses of each paper related to his topic, and how to find the gaps in the previous research and how to fill the gaps in his future research. Independent work and creativity are also needed. [Table-I](#T1){ref-type="table"} shows the top 10 skills that the biomedical student should have to make the way easier, as one have several tasks over a tight time through the PhD journey.
######
Top 10 skills of a pre-PhD student.
**No.** **Skill** **Description**
--------- ------------------------------- ------------------------------------------------------------------------------------------------------------------------------------------------
**1** **Creativity** Seven key questions (who, what, why, when, where, how and how much) cover the basics and help you to understand and figure out a situation.
**2** **Research methods** Qualitative, quantitative and cohort studies. Sampling techniques. All of those and many others should be familiar to the biomedical students.
**3** **Search medical databases** Skills of searching effectively the databases are needed to achieve highly sensitive and specific results.^1^
**4** **Reading a paper** How to read and interpret a paper in your field is highly-demanded.^2^
**5** **Writing a paper** Improve your writing skills as much as you can.^3^
**6** **Computer skills** Microsoft's word, PowerPoint and Excel skills are all desired during your PhD journey.
**7** **Presenting results** How to present your results to academics and non-academics is an art, which needs training and previous knowledge.^4^
**8** **Independent work** One should be used to organize the daily research without having to be alerted.
**9** **Documenting and reporting** Learn how to keep everything documented and reported would help you so much during the PhD degree.
**10** **Statistical knowledge** It is always preferred to have some knowledge about statistics and the corresponding softwares.
***PhD toolbox:***\"If we knew what it was we were doing, it would not be called research, would it?\" It is a transition time that you spend during the PhD period to go day by day to higher orbitals armed with more and more skills, which will enable you to "hit the nail on the head" in a specific area and topic of interest, and should terminate with a valuable contribution to knowledge. First of all and before you decide to go through the PhD journey, one should choose a supervisor who is interested and has done some work in that particular area and who is productive as well. To improve one's skills during the PhD period, start first with reading and evaluating the literature to enable you to identify the previous problems, how to analyze and solve them. The top 10 tips for improving the PhD skills and for passing successfully the journey are highlighted in [Table-II](#T2){ref-type="table"}.
######
Top 10 tips of a PhD student.
**No.** **Tip** **Description**
--------- ------------------------------------------------------ ------------------------------------------------------------------------------------------------------------------------------
**1** **Time management** Plan you days and weeks and try to stick to your plans.
**2** **Reading and analyzing the literature** This will help you a lot to define the problems and to solve the problems.
**3** **Patience** You should have a high patience threshold.
**4** **Attending seminars and conferences** To extend your knowledge and creativity. Be always active and feel free to ask questions.
**5** **Practice writing** To increase and improve your ability to write your first paper and the thesis.
**6** **Talk about your project** Talk about your projects and the problems you face to your colleagues and your supervisor. This will always open new vistas.
**7** **Take courses** Courses such as statistics, communication skills, English, or any course you feel that you need it to improve your career.
**8** **Join international and professional societies** This will keep you in the loop in your topic and field.
**9** **Talk to the sales representatives** You will always learn new diagnostic things from them.
**10** **Take some days off and enjoy the formal holidays** It will make your brain always fresh to re-think and evaluate the projects' troubles.
| {
"pile_set_name": "PubMed Central"
} |
{.779}
{.780}
{.781}
{.782}
{.783}
| {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Trust in the doctor and the healthcare system is important for patient satisfaction, compliance and partnership towards successful aging and better disease management. [@b53-cia-0102-175] defined trust as "one's willingness to rely on another's actions in a situation involving the risk of opportunism." Recent work on trust has increasingly focused on conceptualizations regarding distrust ([@b44-cia-0102-175]; [@b4-cia-0102-175]; [@b45-cia-0102-175]). Distrust entails "the belief that a person's values or motives will lead one to approach all situations in an unacceptable way" ([@b44-cia-0102-175]). Distrust is not mistrust or no-trust, the contradictory notion of trust. Distrust is a qualified conditional trust in doctors and/or the healthcare delivery system on the part of the patient. The latter may be burdened by cost, beset by anxiety, having to cope with difficulties of navigating the managed care system, and confused by the complexities of modern medicine. In the midst of such a multifaceted healthcare delivery system, positive and legitimate distrust can co-exist with positive trust during patient--physician encounters. This area of positive distrust has received minimal attention in the medical literature ([@b27-cia-0102-175]; [@b12-cia-0102-175]; [@b37-cia-0102-175]), when compared with the numerous studies relating to patient--physician trust ([@b50-cia-0102-175]; [@b19-cia-0102-175]; [@b20-cia-0102-175]; [@b42-cia-0102-175]; [@b51-cia-0102-175]; [@b21-cia-0102-175]; [@b49-cia-0102-175]; [@b15-cia-0102-175]), that followed the sentinel work of [@b1-cia-0102-175] patient--physician trust scale. When it comes to the elderly, however, there appears to be a paucity of research on trust or distrust ([@b32-cia-0102-175]; [@b34-cia-0102-175]; [@b48-cia-0102-175]), despite the fact that the elderly account for over 30% in medical resource utilization as a group in the US. Moreover, with increasing longevity and the growing numbers of the elderly worldwide, the issue of patient--doctor trust and distrust (PDTD) in this group of patients clearly merits research. In this exploratory study we will focus on the concept of trust and distrust as perceived by a convenient sample of older patients with chronic diseases who had interacted with their doctors and healthcare delivery systems over a long period of time. We will then review the literature as it relates to the dynamics of trust--distrust in the day-to-day patient--doctor encounter and define a set of hypothesized predictors of PDTD. We hope these predictors will serve as a basis to develop a PDTD scale (PDTDS).
Importance of patient trust--distrust determinants
==================================================
It is important to understand the concept of PDTD. We would therefore like to expound on the trust--distrust concept based on various theories of trust and distrust and accordingly, derive hypothesized predictors of trust--distrust. Traditionally, patients have relied on trust in medical professionals to minimize the stress and uncertainty associated with their illness. If in addition, patients have to worry about their physician's control, given the increasing strictures of managed care and the perceptions related to the trustworthiness of the Health Maintenance Organization (HMO), it may become a major factor in how patients trust their physicians ([@b14-cia-0102-175]). In the last four to five years, state regulators have reported a 50% rise in complaints about HMOs by patients and physicians, particularly regarding healthcare service denials or delays, and most of these complaints reflect the public's increasing distrust of managed care rather than a true decline in quality healthcare ([@b28-cia-0102-175]). Obviously, increasing trust of patients in the entire healthcare delivery system, inclusive of managed care, is critical.
This trust--distrust bi-dimensional but mutually complementing perspective may provide a better and more insightful framework to understand the dynamics of patient--doctor trust-relations than those expressed in existing trust scales ([@b1-cia-0102-175]; [@b50-cia-0102-175]; [@b42-cia-0102-175]; [@b21-cia-0102-175]; [@b49-cia-0102-175]; [@b15-cia-0102-175]). Distrust is not mistrust, nor the opposite of trust, but a complimentary dimension that can enable doctors, nurses, managed care executives, and even governments who subsidize healthcare, to understand the specific and even positive role of distrust in patient--doctor trust. High levels of patient--doctor trust can coexist with high levels of patient--doctor distrust. Given the current complex US healthcare delivery system, patients are bound to experience high levels of trust and distrust with healthcare providers. Moreover, the perceived complexity, ambiguity, and vulnerability of healthcare delivery inputs, its processes and outcomes, and patient--physician encounters are bound to be a mix of high trust and distrust states that need to be carefully studied, predicted, and managed.
Measuring PDTD in older populations is important, especially, to better understand patient perceptions and design interventions to influence both doctor and patient behaviors. In chronic disease management, trust and distrust are important if patients are to adhere to care plans in partnership with their doctors.
Methodology
===========
As an initial and experimental approach to the understanding of patient trust--distrust in doctors, we analyzed the results from an earlier study of patient trust in doctors where distrust was only a component of a scale that measured patient trust and satisfaction with doctors. This scale was administered to a convenient sample of 515 patients with chronic diseases. The scale (see [Table 6](#t6-cia-0102-175){ref-type="table"}) was designed to assess four major trust factors: Trust 1 (cooperation and caring attributes by doctors); Trust 2 (quality and hospital reputation); Trust 3 (patient's confidence in doctors); and Trust 4 (patient's distrust and fear in the healthcare delivery system).
Based on these preliminary results we undertook to investigate in depth the trust--distrust literature both in the management and the medical sociology fields and accordingly, derive a set of hypothesized predictors which we believe can be used as the basis for developing a PDTDS.
Results
=======
Our preliminary study involved a mixed population of 200 breast cancer survivors, 174 hospitalized patients, and 141 ambulatory care patients. The demographics of the study population are presented in [Table 1](#t1-cia-0102-175){ref-type="table"}. We then compared the age--trust relationship and patient satisfaction ([Figure 1](#f1-cia-0102-175){ref-type="fig"}). As observed in [Figure 1](#f1-cia-0102-175){ref-type="fig"}, whereas the first three constructs of the trust instrument (Trust 1, Trust 2, and Trust 3) moved in tandem with patient satisfaction, the fourth component that measured trust--distrust (Trust 4) significantly departed from the other three trust components and the satisfaction construct. Additionally, when the patient data was classified into age-groups, elderly (aged 65 years and above) and younger (aged less than 65), there were significant differences (p=0.005) in trust and distrust levels between the elderly and younger patients ([Table 2](#t2-cia-0102-175){ref-type="table"}). To further investigate and analyze this phenomenon, we chose the first sample of 200 female breast-cancer patients. In this sample, we studied two major groups: 101 African-American and 69 Caucasian patients. These results are provided in [Table 3](#t3-cia-0102-175){ref-type="table"}. As observed in [Table 3](#t3-cia-0102-175){ref-type="table"}, while the first trust components are statistically equivalent across both groups, the fourth component of trust--distrust shows significantly (p=0.028) higher levels of distrust among African-American patients. These results caused us to study the conceptual and theoretical foundations of patient trust--distrust and their determinants.
Conceptual and theoretical foundations of patient trust--distrust in doctors
============================================================================
While there is widespread agreement on the importance of trust--distrust in human conduct, there also appears a bewildering diversity in defining the construct of trust ([@b17-cia-0102-175]). Trust researchers have developed different trust constructs in response to disparate sets of questions regarding social phenomena ([@b5-cia-0102-175]). There has been remarkably little effort, however, to integrate these different perspectives ([@b22-cia-0102-175]; [@b5-cia-0102-175]). The formidable variety in approaches to trust is largely a function of the diverse theoretical perspectives and research interests of scholars engaged in trust research ([@b22-cia-0102-175]). For instance, personality theorists view trust as an individual attribute or difference; sociologists and economists study trust as an institutional phenomenon or arrangement, and social psychologists conceptualize trust as behavior in a situational context: eg, an expectation of another party in a transaction ([@b44-cia-0102-175]; [@b22-cia-0102-175]). Whereas earlier trust literature in the management field contrasts trust with distrust as polar opposites, later developments reveal a complimentary approach to trust and distrust. Trust and distrust are separate dimensions that can coexist and mutually | {
"pile_set_name": "PubMed Central"
} |
{.74}
{.75}
{.76}
{.77}
{.78}
{.79}
{.80}
| {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
The magnitude of linkage disequilibrium (LD) can be used to estimate effective population size [@pone.0069078-Sved1]--[@pone.0069078-Waples1]. In general, low populations sizes are expected to give rise to relatively high levels of LD, and similarly high population sizes to low LD levels. An important feature of this means of estimation is that measurement at a single point in time can provide information on effective size. Furthermore closely-linked loci give information on population sizes over historical periods of time, while loosely-linked loci estimate population sizes in the immediate past [@pone.0069078-Hill1], [@pone.0069078-Hayes1].
Much recent attention has been paid to the use of unlinked loci for estimating population size, for which the term 'Linkage Disequilibrium' will inappropriately be used. There are three major advantages of studying unlinked loci. First, the majority of pairs of loci are unlinked. Secondly, these are the only locus pairs for which it is easy to estimate the recombination frequency, 50%. Finally, in the study of pest populations, and in the area of conservation, it is usually the most recent population sizes that are of interest, for which unlinked loci are the most relevant.
The principal problem in studying unlinked loci comes from the sample sizes needed to obtain accurate LD estimates. The expected disequilibrium is a function of , where is the effective population size, assumed constant, and , where is the sample size [@pone.0069078-Weir1]. Unless sample sizes are large, the latter can overwhelm the former.
A second complication comes from the usual necessity to use diploid data. Most LD theory is based on haplotypes rather than diploid genotypes, which typically cannot be observed. Although the recognition of haplotypes may seem inappropriate for unlinked loci, the same distinction applies as for linked loci, because the information on population size comes from genes with the same parental origin rather than genes inherited from different parents. The passage from zygotic to to gametic parameters can be made using either the maximum likelihood estimator of Hill [@pone.0069078-Hill2], or, as will be used here, the Burrows estimator as elaborated by Weir [@pone.0069078-Weir2].
In preliminary investigations of the size of Queensland fruit fly populations, we found very low estimates for populations that are believed to be large. We traced this discrepancy to an excess of homozygous genotypes, believed to be due to the presence of null alleles at some of the microsatellite loci used in the study.
Because of these complications, the problem of finding an adequate estimator of is fraught with potential biases. Waples and Do [@pone.0069078-Waples2] have, however, shown that their LDNe program works well in estimating from simulated data. The program uses empirically derived correction factors rather than investigating the underlying reasons for the biases. The purpose of the present paper is to produce an analytical solution to account for the biases. We derive two sets of formulae that do this, depending on whether a 'within-locus disequilibrium factor' is used or not, and compare the application of these two sets to simulated and real data.
Materials and Methods {#s2}
=====================
Queensland Fruit Fly Samples {#s2a}
----------------------------
Two data sets are analysed in the paper.
1. East coast Australian populations. The data are from 55 samples from towns in the state of NSW in the years 2002--2004 [@pone.0069078-Gilchrist1]. Some of these sample come from areas where the flies are endemic, and in other cases the outbreaks appear to be only temporary.
2. NorthWest. These flies were collected during the years 1999--2003 from Northern West Australia and the Northern Territory [@pone.0069078-Cameron1].
The data in the two cited papers have previously been summarised only in terms of single locus statistics. The present paper involves a two-locus analysis, which requires additional information from the original data sets. The original data sets are provided in Supporting Information, [Data S1](#pone.0069078.s005){ref-type="supplementary-material"} and [Data S2](#pone.0069078.s006){ref-type="supplementary-material"}.
Computer Simulation {#s2b}
-------------------
All simulations reported in the paper are forward Monte-Carlo simulations under the Wright-Fisher model. Parents were chosen randomly in each case, thereby allowing selfing and not assuming permanent mate bonding, an important aspect of population structure [@pone.0069078-Weir1]. Most simulations involved a starting population with either 16 or 32 loci, each locus having the number of alleles chosen randomly between 2 and 8. Alleles were assigned randomly at different loci, assuming no systematic LD. Populations were simulated for 20 generations, followed by sampling without replacement of 32 individuals from the final population, and calculation of LD levels. Simulations were written in C, and are available on request.
Theory {#s2c}
------
Most of LD theory applies to gametes rather than genotypes. Fortunately a simple method, the 'Burrows composite LD coefficient', is available for handling genotypes. This coefficient has been defined by Cockerham and Weir [@pone.0069078-Cockerham1] in terms of sums of genotype frequencies. It is convenient to introduce here a slightly different but simpler way of relating genotype frequencies to gamete frequencies. See [Table 1](#pone-0069078-t001){ref-type="table"} for a listing of symbols used.
10.1371/journal.pone.0069078.t001
###### Symbols used in the text.
{#pone-0069078-t001-1}
------------- -----------------------------------------------------------------------------------------
N~e~ Effective population size
S Number of diploid individuals in a sample
n~11~ Number of genotypes in a sample with aa at first locus and bb at second locus
n~12~ Number of aa b-- genotypes where -- refers to non-b allele at the second locus
n~21~ Number of a-- bb genotypes
n~22~ Number of a-- b-- genotypes
n~a~, n~b~ Number of a and b alleles respectively
p~a~, p~b~ Allele frequencies in gametic and composite table, = n~a~/2S and n~b~/2S
p~ab~ Frequency of the ab haplotype
D Gametic disequilibrium coefficient = p~ab~ -- p~a~p~b~
r^2^ Gametic correlation = D^2^/\[p~a~(1-- p~a~)p~b~(1-- p~b~)\]
M Number of ab haplotypes in composite haplotype table = 4n~11~+2n~12~+2n~21~+ n~22~
p~ab~(comp) Frequency of ab in composite haplotype table = M/4S
D(comp) Disequilibrium coefficient from composite haplotype table = p~ab~(comp) -- p~a~p~b~
Δ Burrows' disequilibrium coefficient = 2D(comp)
r^2^(comp) r^2^ value from composite haplotype table = D^2^(comp)/\[p~a~(1-- p~a~)p~b~(1-- p~b~)\]
Composite r^2^ parameter = 4r^2^(comp)
Estimate of from sample
with single-locus disequilibrium =
?^2^(comp) ?^2^ calculated from composite haplotype table
p~n~ Frequency of null alleles at a locus
α Half the difference between coupling and repulsion heterozygote frequencies
------------- -----------------------------------------------------------------------------------------
[Figure 1](#pone-0069078-g001){ref-type="fig"} shows the principle for populating a 'composite haplotype table'. Each genotype in Part (i) contributes the four possible gametes to the composite haplotype table in Part (ii). In the case of double heterozygotes, where the phase is usually unknown, each of the four possible haplotypes is represented. For all other genotypes the haplotypes are known, but each genotype nevertheless contributes four haplotypes. Note the use of rather than for the diploid sample total to emphasise the distinction between number in a population () and number in a sample (). The normal haploid table cannot be written down from the genotypes in [Figure 1](#pone-0069078-g001){ref-type="fig"}, but the total would be , and, for example, the number of genes = . The marginal totals in the composite table are double these.
{#pone-0069078-g001}
[Figure 2](#pone-0069078-g002){ref-type="fig"} shows a numerical example of the composite haplotype table for one sample of size 32 from the Eastern Australia fruit fly data set, where one microsatellite, , has 3 alleles and a second, , has 4. Again the total in the haplotype table of Part (ii) of [Figure 2](#pone-0069078-g002){ref- | {
"pile_set_name": "PubMed Central"
} |
(J Am Heart Assoc. 2016;5:e003524 doi: [10.1161/JAHA.116.003524](10.1161/JAHA.116.003524))
Introduction {#jah31684-sec-0005}
============
Autonomic dysfunction is a typical phenomenon in patients with chronic heart failure (HF).[1](#jah31684-bib-0001){ref-type="ref"} Measures of more advanced autonomic dysfunction are indicators of the severity of HF and adverse prognosis.[2](#jah31684-bib-0002){ref-type="ref"}, [3](#jah31684-bib-0003){ref-type="ref"}, [4](#jah31684-bib-0004){ref-type="ref"}, [5](#jah31684-bib-0005){ref-type="ref"}, [6](#jah31684-bib-0006){ref-type="ref"} They may include heart rate variability,[4](#jah31684-bib-0004){ref-type="ref"}, [7](#jah31684-bib-0007){ref-type="ref"} heart rate recovery,[3](#jah31684-bib-0003){ref-type="ref"} baroreflex sensitivity,[5](#jah31684-bib-0005){ref-type="ref"} measurement of norepinephrine spillover,[2](#jah31684-bib-0002){ref-type="ref"}, [7](#jah31684-bib-0007){ref-type="ref"} and muscle nerve sympathetic activity.[8](#jah31684-bib-0008){ref-type="ref"} However, the techniques needed to identify these are complex, and their application requires considerable infrastructure and time and are, therefore, not well suited for serial testing in clinical practice. Less sophisticated tests of autonomic function are not available in HF patients yet. However, an easy and quick test for assessing autonomic function that provides prognostic information in HF patients would be highly desirable.
In contrast to the situation in HF, a battery of simple tests based on the heart rate (HR) and blood pressure response to a variety of maneuvers has been in clinical use for decades for the assessment of diabetic autonomic neuropathy.[9](#jah31684-bib-0009){ref-type="ref"} One of these tests assesses the HR response to standing using continuous ECG monitoring of HR and RR intervals, respectively. The normal response to standing is characterized by a rapid baroreceptor‐mediated rise in HR, which peaks around the 15th beat (shortest RR interval), followed by a relative bradycardia with a maximum RR interval around the 30th beat after getting up. The ratio of the longest (\~30th beat) and shortest (\~15th beat) RR intervals ("30/15 ratio") is used to describe this HR response. However, after the 30th beat, the HR remains elevated compared to the supine baseline in the presence of an intact sympathicovagal balance, and patients with diabetic neuropathy are characterized not only by a low 30/15 ratio but also by a lack of or a severely overall blunted rise in HR from the supine to the standing position.[10](#jah31684-bib-0010){ref-type="ref"} Thus, the change in HR following getting up from the supine to the upright position (∆HR) might be a simple test to assess the degree of autonomic dysfunction in patients with chronic HF, which may also predict prognosis, but this has not yet been investigated.
Therefore, we have prospectively measured ∆HR in patients with chronic HF included in the Trial of Intensified Medical Therapy in Elderly Patients with Congestive Heart Failure (TIME‐CHF)[11](#jah31684-bib-0011){ref-type="ref"}, [12](#jah31684-bib-0012){ref-type="ref"} to describe the association of ∆HR with clinical characteristics in an elderly HF cohort and to evaluate its prognostic value.
Methods {#jah31684-sec-0006}
=======
Study Population and Protocol {#jah31684-sec-0007}
-----------------------------
This is a post‐hoc analysis of TIME‐CHF (isrctn.org identifier ISRCTN43596477). Design[11](#jah31684-bib-0011){ref-type="ref"} and main results[12](#jah31684-bib-0012){ref-type="ref"} of TIME‐CHF have been published previously. In brief, TIME‐CHF was a randomized, controlled multicenter trial comparing an N‐terminal pro‐B‐type natriuretic peptide (NT‐proBNP)‐guided vs a symptom‐guided management strategy in patients with chronic HF aged ≥60 years with symptoms corresponding to New York Heart Association (NYHA) ≥II, HF‐related hospitalization within 12 months prior to inclusion, and an age‐adjusted elevated NT‐proBNP plasma concentration (\>400 ng/L in those \<75 years, \>800 ng/L in those ≥75 years). Patients with both reduced (n=499) and preserved (n=123) left ventricular ejection fraction (LVEF) were included between January 2003 and December 2006. The study was approved by the local ethics committees, and all participants provided written informed consent.
For the present analysis, patients in sinus rhythm and without any pacemaker (bradypacing, cardiac resynchronization; patients with defibrillators and pure VVI backup pacing were not excluded) throughout the trial were eligible (n=327). HR was measured in the supine position after at least 1 minute of supine rest. HR in the upright position was measured immediately after getting up by pulse palpation or an automated blood pressure monitor, and ΔHR was calculated as the difference between HR in the upright and supine positions. Thus, a positive value for ΔHR indicates a rise in HR upon standing, whereas a negative value indicates a fall in HR after getting up. This measurement of the HR at rest and after getting up was part of the study protocol, and data were collected in a prospective manner. The present analysis is based on the 321 patients with complete data on HR in the supine and upright positions. Patients were followed in the outpatient clinics after 1, 3, 6, 12, and 18 months. Medical treatment was prescribed in accordance with predefined escalation rules either to reduce symptoms to NYHA ≤II or also to reduce NT‐proBNP below the age‐specific target level (\<400 ng/L in patients \<75 years, \<800 ng/L in those ≥75 years) as described in the design paper of TIME‐CHF.[11](#jah31684-bib-0011){ref-type="ref"} The primary endpoint of TIME‐CHF was 18‐month survival free of any hospitalization. Secondary endpoints included survival and survival free of HF‐hospitalization at 18 months. For the present analysis, survival free of HF‐hospitalization was the primary endpoint, and the other two were secondary endpoints.
Statistical Analysis {#jah31684-sec-0008}
--------------------
Descriptive statistics are expressed as mean±standard deviation, or median (interquartile range) for continuous variables and as numbers and percentages for categorical variables. Distribution of continuous data was assessed using Kolmogorov‐Smirnov tests. First, the association between ΔHR and outcomes was examined using univariate Cox regression. Then, best cutoff for ΔHR to predict death or HF hospitalization based on log‐rank testing was performed. Characteristics of patients with ΔHR above and below this cutoff were compared by chi‐squared tests for categorical variables and by t tests or Mann‐Whitney U tests for continuous variables, as appropriate. Kaplan‐Meier curves were constructed for calculating the time‐dependent occurrence of events in patients with ΔHR above and below this cutoff, and for comparison between these groups the log‐rank test was used. To test the independence of the association between ΔHR (as a continuous and dichotomized variable) and outcomes, multivariate Cox regression was performed after testing the proportional hazard assumption. A stepwise backward model was used. To account for the number of events, the number of covariates was limited to those with the strongest association with the dependent variable based on Wald score in addition to the variable of interest ΔHR. For the model with death or HF hospitalization as the dependent variable, the following covariates were included in the model: age, ischemic HF etiology, NT‐proBNP (log~10~‐transformed), estimated glomerular filtration rate (eGFR), hemoglobin, peripheral arterial obstructive disease (PAOD), NYHA functional class, presence and extent of rales (4 categories), and β‐blocker use at baseline. For the model with death as the dependent variable, the following covariates were included in the model: ischemic HF etiology, NT‐proBNP (log~10~‐transformed), eGFR, hemoglobin, NYHA class, and presence and extent of rales. The results of these models are presented in the tables. We also tested whether adjustment of this final model for sex, body mass index, and diabetes changed the findings, and the results of these analyses are mentioned in the text. Interactions between ΔHR and patient characteristics were analyzed using Cox regression with ΔHR and a second covariate and the interaction term forced into a model. In particular, the interactions between ΔHR and age, resting heart rate, NT‐pro‐BNP‐guided therapy (ie, allocation to the NT‐proBNP‐guided arm), LVEF stratum (LVEF \<45% vs ≥45%), diabetes, and baseline β‐blocker use were tested 1 at a time. To illustrate the prognostic value of the multivariate model, we constructed a 5‐point score including the following items: ΔHR ≤3 bpm, ischemic HF etiology, eGFR \<47 mL | {
"pile_set_name": "PubMed Central"
} |
{#sp1 .389}
{#sp2 .390}
{#sp3 .391}
{#sp4 .392}
{#sp5 .393}
{#sp6 .394}
{#sp7 .395}
{#sp8 .396}
{#sp9 .397}
{#sp10 .398}
{#sp11 .399}
{#sp12 .400}
{#sp13 .401}
{#sp14 .402}
{#sp15 .403}
{#sp16 .404}
{#sp17 .405}
{#sp18 .406}
{#sp19 .407}
| {
"pile_set_name": "PubMed Central"
} |
1. Cachexia as an Energy-Wasting Syndrome {#sec1}
=========================================
Cachexia, from the Greek: "*kakos*" and "*hexis*," meaning "bad condition," is a multiorgan syndrome associated with cancer and other systemic diseases such as sepsis and renal failure and characterized by at least 5% body weight loss due to muscle and adipose tissue wasting and inflammation \[[@B1]\]. Abnormalities associated with cachexia include alterations in carbohydrate, lipid, and protein metabolism \[[@B2]\]. Cancer cachexia has been characterized as a syndrome associated with loss of muscle with or without loss of fat mass. Other disorders associated with cachexia are anorexia, inflammation, insulin resistance, and increased muscle protein \[[@B2]\]. Another defining characteristic is that cachexia cannot be fully reversed by conventional nutritional support and leads to progressive functional impairment \[[@B3]\]. Thus, it can be concluded that cachexia is caused by an energy imbalance which is the result of both decreased food intake, due to marked anorexia, and increased energy expenditure caused by a highly hypermetabolic state. Blum et al. \[[@B4]\] in a recent meta-analysis of cancer cachexia conclude that current data support a modular concept of cancer cachexia with a variable combination of reduced nutritional intake and catabolic/hypermetabolic changes.
Cachexia occurs in the majority of terminal cancer patients and is responsible for the deaths of 22% of cancer patients \[[@B5]\]. Importantly, survival of cancer patient suffering from different types of neoplasias is dependent on the amount of weight loss \[[@B6]\]. Therefore, cachexia represents an important factor in the treatment of a cancer patient, affecting not only survival, but also the efficacy of anticancer treatment, quality of life, and medical costs. Thus there is a strong pressure to better understand the mechanisms that drive cachexia in order to offer cancer patients more effective care.
Here we will discuss the impact of nonmuscle tissues, only the ones that have a certain role; that is, kidney and lung do not seem to have a role in cancer cachexia. Indeed recent developments suggest that tissues/organs such as adipose (both brown and white), brain, liver, gut, and heart are directly involved in the cachectic process and may be responsible for muscle wasting. This suggests that cachexia is indeed a multiorgan syndrome ([Figure 1](#fig1){ref-type="fig"}).
2. Brain {#sec2}
========
Although a recent study involving 1853 cancer patients \[[@B7]\] did not find common genetic causes in appetite loss in cancer patients, cytokines, neuroendocrine changes, and tumour mediators are the main signals involved in appetite depression in cachexia. Additional factors contributing to the anorectic state are altered taste perception, therapy-induced side effects \[[@B8]\], depressed motor activity, possible mechanical interference on the gastrointestinal tract, and, of course, psychological factors \[[@B9]\]. Indeed, patients with cachexia often experience psychological distress as a result of the uncertainties of the disease, its diagnosis, its treatment, and its anticipated and final outcome \[[@B9]\]. This psychological state, which often involves depression, is bound to affect food intake. Both the limbic system and the brain stem participate in the regulation of appetite and energy balance. Thus, morphologically defined regions of the hypothalamus, the arcuate nucleus (ARC), the paraventricular nucleus (PVN), the dorsomedial nucleus (DMH), the ventromedial nucleus (VMH), the lateral hypothalamic area (LHA), and the perifornical area (PFA), appear to play a major role in the regulation of body weight. There are two primary neuron types within the ARC that integrate signals of nutritional status and influence energy homeostasis: a subpopulation of neurons in the medial ARC expresses the orexigenic neuropeptides (neuropeptide Y (NPY) and agouti-related peptide (AgRP)). More laterally there is a second subpopulation that inhibits food intake via the expression of cocaine- and amphetamine-regulated transcript (CART) and proopiomelanocortin (POMC), which is processed to melanocyte stimulating hormone (MSH). Specific neuropeptides are involved in the signalling of the neuronal circuits within these regions of the hypothalamus, for instance, corticotrophin-releasing hormone (CRH), thyrotropin-releasing hormone (TRH), NPY, brain-derived neurotrophic factor (BDNF), orexin, and melanin-concentrating hormone (MCH). The brain stem also plays an important role in the regulation of energy balance. Reciprocal connections are present, in an extensive way, between the hypothalamus and brain stem, particularly at the level of the*nucleus tractus solitarii* (NTS). This nucleus is in close anatomical proximity to the area postrema, a circumventricular organ that has an incomplete blood brain barrier. Like the ARC, the NTS is therefore located in an ideal place to respond to peripheral circulating signals but in addition also receives vagal afferent signals from the gastrointestinal tract and afferents from the glossopharyngeal nerves.
Therefore, brain mediators involved in the control of food intake, appetite, satiation, taste, and smell of food, are responsible for the anorexia of the cancer patient, making the brain a main organ responsible for one of the components of the altered energy balance in cancer patients \[[@B10]\] ([Figure 1](#fig1){ref-type="fig"}). Although anorexia represents a very important factor in the development of cachexia, it has to be pointed out that in many cases the use of total parenteral nutrition does not stop the loss of body weight \[[@B11]\]. In addition to anorexia, the hypothalamus via the melanocortin system may contribute to muscle wasting via neuronal output, as suggested by different animal studies \[[@B12], [@B13]\].
3. Gut {#sec3}
======
Gut-barrier dysfunction is a syndrome characterized by both breakdown and leakage of the gut epithelial barrier, leading to systemic inflammation due to the entry of bacterial cell wall components (endotoxin or lipopolysaccharide), or intact bacteria into the circulation. Gut-barrier dysfunction is often observed during the course of cancer cachexia \[[@B14]\] ([Figure 1](#fig1){ref-type="fig"}) and is partially connected to radiochemotherapy treatment. Additionally, tumour growth or macrophage infiltration at the level of the intestinal wall may affect gastrointestinal permeability, either locally or throughout the intestine via alterations in epithelial tight junctions \[[@B15]\]. From this point of view, tight junction proteins, such as ZO-1 and occludin, show decreased expression in tumour-rich regions of the intestine and colon in humans \[[@B16]\]. Decreases in tight junction proteins would increase permeability and allow passage of large molecules such as lipopolysaccharide (LPS) into the lymphatic circulation. Changes in mucin secretion and profiles in gastrointestinal carcinomas may become a source of inflammation in the course of cancer cachexia \[[@B17]\]. Indeed, gut-barrier dysfunction may lead to endotoxemia and, therefore, increased inflammation in cancer patients \[[@B14]\].
In addition to the gut-barrier dysfunction syndrome, recent studies support a role for gut microbiota in cancer cachexia. Indeed, decreased levels of bacteria, which have immunomodulating properties, are decreased during experimental cancer cachexia \[[@B18]\]. The existence of a gut-microbiota-skeletal muscle axis has been reported \[[@B19]\]; in fact, gut microbiota generates metabolites that can reach skeletal muscle and influence energy expenditure in the muscle cells \[[@B20]\].
Other aspects related with the gut may be beneficial for cachectic patients. Ghrelin is the first identified circulating hunger hormone that influences body weight regulation via a vagal pathway \[[@B21]\]; it is a gastric hormone initially identified in the rat stomach, in 1999, as an endogenous ligand for the growth hormone secretagogue receptor (GHSR) \[[@B21]\]. Under fasting conditions, the stomach, through endocrine cells located in the*antrum*, secretes ghrelin into the bloodstream. The hormone acts as a "hunger" mediator that signals the gastrointestinal fuel status from the periphery to the central nervous system in order to stimulate food intake and to adjust energy balance through decreasing energy expenditure \[[@B22]\]. Ghrelin also binds to the GHSR1a splice-variant that is enriched in the hypothalamus, as well as other brain regions. In the hypothalamus, at the level of the ARC, ghrelin contributes to enhanced food intake by activating orexigenic mediators such as NPY, gamma-aminoisobutyrate (GABA), and AgRP, and inhibiting anorexigenic mediators such as POMC, MSH, and CART \[[@B23]\]. The GHSR1a receptor is also present on vagal afferents \[[@B24]\] and, therefore, there is also strong evidence that ghrelin has a peripheral effect on satiety by affecting the mechanosensitivity of upper gastrointestinal vagal afferents, making them less sensitive to distension which can result in overeating. Ghrelin also has potent effects on fat storage. Ghrelin activates white adipocytes \[[@B25]\] while doing the opposite to brown adipocytes, therefore contributing to decreased energy expenditure \[[@B26]\]. These effects are related with the capacity of the hormone to stimulate growth hormone (GH) release from the anterior pituitary \[[@B27]\]. In addition, ghrelin increases insulin-like growth factor 1 (IGF-1) by stimulating its own receptor. These two factors are major signals being related with the regulation of energy homeostasis. The effects of ghrelin on GH and IGF-1 may be linked to the capacity of the hormone to prevent increases in protein degradation, through different components of the proteasome such as MuRF1 and MAFbx, at the level of skeletal muscle. | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
Patients with psoriasis have increased prevalence of classical coronary risk factors, including hypertension, hypercholesterolemia, and diabetes mellitus and increased risk of cardiovascular disease, e.g., myocardial infarction and stroke [@pone.0036342-Wakkee1], [@pone.0036342-Azfar1], [@pone.0036342-Menter1], [@pone.0036342-Gelfand1], [@pone.0036342-Mehta1], [@pone.0036342-Ahlehoff1], [@pone.0036342-Ahlehoff2]. Screening practices, treatment, and clinical control aimed at coronary risk factors and disease may be inadequate in patients with other chronic diseases [@pone.0036342-Wenger1], [@pone.0036342-MacLean1] and very recent results from a highly selected population of patients participating in phase III randomized trials with ustekinumab, a therapeutic anti-interleukin (IL)-12/IL-23p40 monoclonal antibody, demonstrated marked undertreatment and underdiagnosis of coronary risk factors in patients with psoriasis [@pone.0036342-Parsi1], [@pone.0036342-Kimball1]. Undertreatment of coronary risk factors may contribute to the increased risk of cardiovascular disease in patients with psoriasis. To examine the current practice regarding the pharmacological treatment of coronary risk factors in patients with psoriasis in a real-world setting we examined the pharmacological management of these risk factors in patients with severe psoriasis treated with biologic agents between 2007 and 2009.
Methods {#s2}
=======
Ethics {#s2a}
------
The study was approved by The Danish Data Protection Agency and the DERMBIO steering committee. Data at the individual case level was made available by the national registers in anonymized form. Registry studies do not require ethical approval in Denmark. The corresponding author had full access to the data and take responsibility for its integrity.
Data sources {#s2b}
------------
In Denmark all citizens are provided with a unique social security number at birth enabling linkage across registries. Medical history of patients with severe psoriasis selected for treatment with biologic agents was retrieved from a nationwide Danish registry (DERMBIO), a nationwide Danish database of patients with psoriasis treated with biologic agents. [@pone.0036342-Gniadecki1] Registration of patients with psoriasis treated with biologic agents is mandatory. From DERMBIO information registered on the date of subject database entry, psoriasis activity and severity index score, baseline history of hypertension, hypercholesterolemia and diabetes mellitus, and previous systemic antipsoriatic treatment and biologic treatment were recorded. Patients with psoriasis identified with hypertension, hypercholesterolemia, and diabetes mellitus were age- and sex matched with 4 individuals with corresponding coronary risk factors (hypertension, hypercholesterolemia, and diabetes mellitus) from the general population. All medications dispensed from pharmacies were obtained from the National Prescription Registry (the Danish Registry of Medicinal Product Statistics), wherein all dispensed prescriptions from Danish pharmacies has been recorded since 1995. Comorbidity, including ischemic heart disease (International classification of diseases 10th revision \[ICD-10\] codes: I20--I25), cerebrovascular disease (ICD-10: I60--I69), peripheral arterial disease (ICD-10: I70--I74), hypertension (ICD-10: I10), hypercholesterolemia (ICD-10: E78), and type II diabetes mellitus (ICD-10: I11) was obtained from the Danish National Patient Register in which all hospital admissions, diagnoses, and invasive procedures have been recorded since 1978. Individual-level linkage with these nationwide administrative registries of hospitalizations and dispensed prescriptions were used to assess treatment of coronary risk factors. Results were summarized as means with standard deviations for continuous data and counts and percentages for categorical data. Differences in pharmacological treatment were assessed by chi-square test. A two-sided p-value \<0.05 was considered statistically significant.
Outcome measures {#s2c}
----------------
Prescriptions claimed up to 6 months prior to study inclusion and 6 months after inclusion for drugs with therapeutic indications aimed at coronary risk factors and cardiovascular diseases including platelet inhibitors (anatomical therapeutic chemical classification \[ATC\] code: B01AC), beta-blockers (C07), angiotensin-converting enzyme inhibitors (ACE-Is)/angiotensin II receptor blockers (ARBs) (C09), calcium antagonist (C08), loop diuretics (C03C), thiazide diuretics (C03A), cholesterol-lowering drugs (C10A), and glucose-lowering drugs (A10).
Results {#s3}
=======
A total of 693 patients (mean age 46.1±12.7 years, 65.7% male) with severe psoriasis treated with biologic agents were identified and baseline characteristics of the study population are presented in [Table 1](#pone-0036342-t001){ref-type="table"}. Coronary risk factors, including hypertension, hypercholesterolemia, and diabetes mellitus were identified in 16.6%, 9.2%, and 6.7%, respectively
10.1371/journal.pone.0036342.t001
###### Baseline characteristics of patients with psoriasis.
{#pone-0036342-t001-1}
Patients with psoriasis n = 693
------------------------------------------------------------------------ ---------------------------------
Age/years (mean, standard deviation) ±12.7
Female (%) 238 (34.3)
Male (%) 455 (65.7)
PASI[\*](#nt101){ref-type="table-fn"} score (mean, standard deviation) 13.0±8.1
Psoriatic arthritis 85 (12.3)
Established atherosclerotic disease[\*\*](#nt102){ref-type="table-fn"} 6 (0.9)
**Coronary risk factors**
Hypertension 94/565 (16.6)
Hypercholesterolemia 52/565 (9.2)
Diabetes mellitus 38/565 (6.7)
**Previous systemic psoriasis treatment**
Methotrexate 469 (67.7)
Psoralen+UVA[\*\*\*](#nt103){ref-type="table-fn"} 125 (18.0)
Cyclosporine 161 (23.2)
Retinoids 116 (16.7)
Climate therapy 60 (8.7)
**Biologic agents**
Adalimumab 279 (40.3)
Alefacept 2 (0.3)
Efalizumab 39 (5.6)
Etanercept 264 (38.1)
Infliximab 64 (9.2)
Tocilizumab 2 (0.3)
Ustekinumab 42 (6.1)
Information not recorded 1 (0.1)
PASI; psoriasis activity and severity index.,
Established atherosclerosis; ischemic heart disease, cerebrovascular disease, peripheral vascular disease.
UVA; ultraviolet A light.
Patients with psoriasis and coronary risk factors received significantly less evidence based pharmacotherapy compared to age, sex, and coronary risk factor matched individuals from the general population ([Tables 2](#pone-0036342-t002){ref-type="table"} and [3](#pone-0036342-t003){ref-type="table"}). In psoriatic patients with hypertension 27.7% received no pharmacotherapy. Along this line, patients with dyslipidemia only received cholesterol-lowering medication in 55.8% of cases. Patients with diabetes mellitus received ACE-Is)/ARBs and cholesterol-lowering medication in 42.1% and 23.7% of cases, respectively. Pharmacologic treatment in patents with \>1 cardiovascular risk factor and secondary prophylaxis in the small subset of patents with manifest atherosclerotic disease showed a similar pattern of infrequent use of evidence-based cardiovascular pharmacotherapy ([Tables 4](#pone-0036342-t004){ref-type="table"} and [5](#pone-0036342-t005){ref-type="table"}). Assessment of pharmacological treatment 6 months after the index date indicated similar patterns of drug use, however beta blocker use generally decreased, e.g., 12.8% and 2.1% for hypertension at baseline and after 6 months, respectively ([Tables 3](#pone-0036342-t003){ref-type="table"}, [4](#pone-0036342-t004){ref-type="table"}, [5](#pone-0036342-t005){ref-type="table"}).
10.1371/journal.pone.0036342.t002
###### Medical management of coronary risk factors in patients with psoriasis and age- and sex matched controls.
{#pone-0036342-t002-2}
Patients with psoriasis Controls P value
---------------------------------------------- ------------------------- ------------- ---------
**Hypertension** **n = 94** **n = 376**
ACE-Is/ARBs[\*](#nt104){ref-type="table-fn"} 50 (53.2) 235 (62.5) 0.09
Beta-block | {
"pile_set_name": "PubMed Central"
} |
{#sp1 .50}
| {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION {#sec1-1}
============
Robot-assisted minimally invasive surgery (RAS-MIS) allows less experienced laparoscopic surgeons to perform higher quality operative procedures.\[[@ref1][@ref2]\] These techniques result in a shorter hospital stay and recovery time, reduced blood loss, and fewer complications compared to open surgery.\[[@ref3]\] However, some limitations of RAS include lack of tactile feedback, a fixed-port system, longer operative times, and prohibitive costs.\[[@ref4][@ref5]\] Detailed surveys that assessed the practice patterns and opinions of urologic surgeons have led to interesting insights about RAS.\[[@ref6][@ref7][@ref8]\] Therefore, the present study aimed to evaluate the perceived utility of RAS in Saudi Arabia.
METHODS/PROCEDURES {#sec1-2}
==================
An Internet-based, 59-item questionnaire was sent to 238 practicing urologists in the KSA who attended the 2015 Saudi Urological Association Meeting in the first quarter of 2015. The survey was E-mailed to urology physicians and trainees, and the questionnaire was available on the study website for 3 months to give respondents the opportunity to complete it online. Reminder E-mails were sent after 2 months to encourage those who missed the first invitation to complete the survey. Only one response per computer was allowed to avoid duplicate responses.
The survey comprised five sections inquiring about demographics and individual and institutional surgical practice patterns of MIS with a focus on RAS. Perceptions of MIS, in general, were also assessed, specifically those regarding RAS oncology procedures for prostate, bladder, and kidney treatment. The first section covered baseline characteristics, including geographical region, age, gender, current level of training, and years of practice. The second section assessed training, the number of MIS procedures performed in general, and the number of laparoscopic and RAS procedures performed specifically. The third section assessed institutional aspects, including staff and MIS or RAS fellowship programs. The fourth section evaluated the importance of robotic surgery training for career goals and the importance of developing a robotic surgery program. The fifth and final section was specialty-specific and assessed perceptions of RAS subtypes, including robot-assisted radical prostatectomy (RARP), robot-assisted radical cystectomy (RARC), and robot-assisted radical nephrectomy (RARN) or robot-assisted partial nephrectomy (RAPN).
Data were analyzed using a commercially available Statistical Package for the Social Science (IBM SPSS Statistics V22.0, Chicago, IL, USA). Descriptive data were presented as number of responses and percentages. Fisher\'s exact test was used for comparing discrete variables, and a two-tailed *P* \< 0.05 indicated significant differences among groups.
RESULTS {#sec1-3}
=======
Demographics and practice patterns {#sec2-1}
----------------------------------
The survey response rate was 40%, with 95 surveys completed. Most respondents (93.7%) were males with different levels of training, and \>45% had been in urology practice for at least 10 years. Nearly 53% of respondents were formally trained in laparoscopic surgery, 46% were formally trained in MIS beyond residency training, and only 21% were formally trained in RAS. More than half (66.8%) of respondents had either performed or assisted in laparoscopic surgery, with 43% performing 2 or more laparoscopic operations. Forty percent of respondents had used the surgical robot console in their training courses, and 38% had participated as console surgeons, including 11.6% who had performed at least two RAS operations as console surgeons. Of those who had only been exposed to RAS, 58% stated that they would perform the procedure in the future.
A total of 66.8% of respondents cited at least two surgeons performing laparoscopic surgery at their institutions. Fellowship-trained staff at respondents\' institutions totaled 79% in laparoscopic surgery and 23% in RAS. Nearly 37% of respondents\' institutions offered MIS fellowship programs; most of them were genitourinary or multiple programs that included at least two MIS fellowships. These programs were incorporated with an endourology (42%) or urologic oncology (16%) fellowship. With respect to RAS, 33.7% of respondents had a dedicated RAS support team in place, and 25% of respondents planned to hire new faculty to establish an RAS program at their institution \[[Table 1](#T1){ref-type="table"}\].
######
Demographic characteristics and clinical practice of respondents (*n*=95)
Impact of robot-assisted surgery subtypes {#sec2-2}
-----------------------------------------
Almost 24.2% of respondents felt that RAS training should be included to meet their career goals, and 68.4% would pursue a separate RAS fellowship if given the opportunity. A total of 66.3% would take additional courses to integrate RAS into their practice, with almost 70% choosing an MIS fellowship \[[Figure 1](#F1){ref-type="fig"}\]. Respondents were asked about the usefulness of RAS programs to their departments or clinical practice. Nearly 29.5% stated that RAS programs would strengthen the department academically and/or financially, whereas about 28% stated that RAS programs would strengthen only MIS at their departments. About 45.3% of respondents cited the need for an institutional robot system and identified administrative disinterest with lack of institutional support as the main obstacles to the development of a robotic program. Another 16% stated lack of academic evidence or operation room allocation as the main obstacle to the development of a robotic program \[[Figure 2](#F2){ref-type="fig"}\].
{#F1}
{#F2}
Robot-assisted radical prostatectomy {#sec2-3}
------------------------------------
Twenty-two percent of respondents had performed RARP, including 48.1% who performed \<50 RARP surgeries/year, 3.7% who performed 50--100 surgeries/year, and 9.3% who performed \>100 operations/year. Less than one-third (28.4%) had upgraded their operative skills to RARP. The more traditional open radical prostatectomy (ORP) was still being performed (65.3%) at most respondents\' institutions with 89% having performed \<10 surgeries/year and 11% having performed \>10 surgeries/year. However, many institutions had witnessed a decrease in ORP case volume per year. Laparoscopic radical prostatectomy (LRP) was still being performed in 20% of respondents\' institutions.
Nearly 34% of respondents cited RARP as the gold standard for prostatectomy; 21% believed it to be as good as open or laparoscopic procedures, 12.6% described it to be better, while 14.7% believed it was too early to form judgments regarding RARP \[[Figure 3](#F3){ref-type="fig"}\]. Nevertheless, most of the respondents (73.7%) would recommend RARP over ORP (11.6%) or LRP (14.7%) for themselves or their family \[[Figure 4](#F4){ref-type="fig"}\].
{#F3}
{#F4}
Robot-assisted radical cystectomy {#sec2-4}
---------------------------------
Only 3.2% of respondents had personally performed RARC, and this procedure had not been performed at all in 65% of their institutions. The more traditional open radical cystectomy (ORC) was performed by 36% of respondents and laparoscopic radical cystectomy (LRC) by 7.4%. Nearly 42% believed that 100--200 RARC procedures should be performed to be comfortable with the technique while most of them (51.4%) cited that \<50 cases would be sufficient. Only 23% of respondents declared RARC to be the gold standard for cystectomy; 40% believed RARC to be as good as ORC or LRC, 11.6% described it to be better than open or laparoscopic approaches, while 11.6% believed it too early to form judgments regarding RARC \[[Figure 3](#F3){ref-type="fig"}\]. Nevertheless, 50% of respondents would recommend RARC over either ORP (40%) or LRP (9.5%) for themselves or their family \[[Figure 4](#F4){ref-type="fig"}\].
After RARC and pelvic lymph node dissection, most respondents (53.7%) believed that urinary diversion should be performed either open or laparoscopically while 46.3% reported that urinary diversion should be performed robotically as well. Only 6% of respondents believed proximal lymph node dissection to be challenging using the robot while most of them (78%) were not sure. Similarly, 73% were not sure if there was an advantage to an extended pelvic lymph node dissection with the robotic da Vinci^®^ Surgical System (Intuitive Surgical Inc., Sunnyvale, CA, USA) while only 16.8% believed that it was advantageous.
Robot-assisted radical nephrectomy {#sec2-5}
----------------------------------
RARN and RAPN were performed by 20% and 23.2% of respondents, respectively. Of 56 respondents, 37.5% had performed \<50 surgeries/year while 9% had performed 50--100 operations/year. The more traditional open radical nephrectomy (ORN) and laparoscopic radical nephrectomy (LRN) were still being performed in 75.8% and 65.3% of respondents\' institutions, respectively, at a volume of \>10 cases | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION
============
Proper sedation is an important component in the care of critically ill patients requiring mechanical ventilation. Deep sedation levels are associated with several negative outcomes, such as increased time on mechanical ventilation,^([@r1])^ delirium,^([@r2])^ memory disturbances,^([@r3])^ and higher mortality in the short^([@r4])^ and long term.^([@r5])^
The deleterious effects of deep sedation can be minimized by employing a strategy of sedation protocols that target lighter sedation levels^([@r6],[@r7])^ and the daily interruption of sedative infusion.^([@r8],[@r9])^ The effects of these strategies have been assessed in two systematic reviews in which the included study control groups consisted of patients who received \"usual\" care in relation to the sedation of patients on mechanical ventilation. The first systematic review that included observational and randomized studies showed that most of the studies suggested a reduction in the duration of mechanical ventilation and ICU and hospital length of stay.^([@r10])^ The second systematic review included only randomized studies and pooled their results into a meta-analysis, which indicated that there were reduced ICU and hospital length of stay and reduced mortality with the use of both sedation reduction strategies.^([@r11])^ Another meta-analysis also suggested that the two sedation minimization strategies were not associated with higher incidences of post-traumatic stress in the long term,^([@r12])^ which was a fear that had been raised when the first study on daily sedation interruption was published.^([@r13])^
Therefore, protocols targeting either a light sedation level or daily sedative infusion interruption should be adopted to reduce the deleterious effects of excessive sedation.^([@r14])^ However, the use of these strategies is still far from universal,^([@r15])^ and it is unclear whether one of the two is more effective than the other.
The objective of this study was to systematically review studies that compared a light target sedation protocol with daily sedation interruption.
METHODS
=======
Search strategy
---------------
Searches of the Medline (via PubMed), Scopus and Web of Science databases were performed. The studies were obtained by combining the following keywords: (\"sedation\" OR \"sedatives\") AND (\"critical care\" OR \"intensive care\" OR \"critically ill\") AND (\"daily interruption\"). Additional studies were sought based on the references of included studies and personal files. There was no language restriction. The searches were limited to randomized clinical studies performed on adults and published up to February 4, 2016. Titles and abstracts were assessed for eligibility. The full texts of potentially relevant articles were analyzed. The eligibility assessment was conducted by the authors, and disagreements were resolved by consensus. Preferred Reporting Items for Systematic Review and Meta-Analysis (PRISMA) guidelines were used as a guide.^([@r16])^ The systematic review was recorded in the PROSPERO database (CRD 42014014121). As the study is a literature review, there was no need for Ethics Committee approval.
Study selection
---------------
Studies that met the following criteria were included: those comparing a protocol with a predefined sedation scale target with daily sedative infusion interruption; and those assessing any of the following outcomes: mortality in intensive care, duration of mechanical ventilation, days free of mechanical ventilation in 28 days and ICU length of stay.
Data extraction
---------------
The authors extracted the following data independently using a specific form: country where the study was conducted, year of publication, study design, number of patients included in each study group, description of the sedation protocol and the manner in which daily sedation interruption was conducted, ICU and hospital mortality, duration of mechanical ventilation, days free of mechanical ventilation in 28 days, ICU and hospital length of ICU stay, delirium, accidental extubation rates and extubation failure (reintubation within 48 hours). Authors of included studies were contacted by e-mail to obtain information about missing data from the publications.
Evaluation of study quality
---------------------------
Study quality was assessed by the Cochrane risk of bias assessment tool for clinical studies. The risk of bias was assessed as \"low\", \"uncertain\" or \"high\" in the following areas: generation of random sequence, allocation concealment, blinding of participants and professionals, blinding of outcome assessors, incomplete outcomes, selective outcome reporting, and other sources of bias. Disagreements were resolved by consensus.
Outcomes
--------
The primary outcome was mortality in the ICU. Secondary outcomes were duration of mechanical ventilation, days free of mechanical ventilation in 28 days, hospital mortality, ICU and hospital length of stay, prevalence of delirium, and accidental extubation and extubation failure rates (reintubation within 48 hours after extubation).
Statistical analysis
--------------------
A random effects model was used due to the variability among studies regarding samples and how the interventions were applied. The differences between groups were expressed as odds ratios (OR) for categorical variables and as mean differences (MD) for continuous variables, both with 95% confidence intervals (95%CI). The reference group for the analysis was always \"sedation protocol.\" Heterogeneity was assessed using the I^2^ statistic and was classified as low (\< 25%), moderate (25 - 50%) or high (\> 50%). The analyses were performed using *R* software version 3.3.1, with *R* Studio version 0.99.902, and the meta package (version 4.4.0) developed by Guido Schwazer (<http://cran.rproject.org/web/packages/meta/meta.pdf>).
RESULTS
=======
Study characteristics
---------------------
A total of 279 references were identified by the search strategies, eight full-text articles were assessed for eligibility. In total, seven studies^([@r17]-[@r23])^ were included; one was excluded, as it did not report any of the outcomes of interest^([@r24])^ ([Figure 1](#f1){ref-type="fig"}).
Figure 1Study flowchart.
The characteristics of the included studies are described in [table 1](#t1){ref-type="table"}. In general, the studies were small, and only one was a multicenter study. The goal was light to moderate sedation in all studies. The Sedation-Agitation Scale (SAS), the Ramsay scale and the Richmond Agitation Sedation Scale (RASS) were used in three, three and two studies, respectively. Only one of the studies had a deeper sedation level as its lower target (Ramsay 5).^([@r19])^ Descriptions of the sedation protocols and daily sedation interruption can be found in [table 2](#t2){ref-type="table"}.
######
Study characteristics
Study Country Number of centers Number of patients (protocol/daily interruption) Sedation target
-------------------------------- -------------------------- ------------------- -------------------------------------------------- --------------------------
Mehta et al.^([@r17])^ Canada 1 33/32 SAS 3 - 4
de Wit et al.^([@r18])^ United States 1 38/36 RASS -2 - -3
Anifantaki et al.^([@r19])^ Greece 1 48/49 Ramsay 3 - 5
Strom et al.^([@r20])^ Denmark 1 70/70 Ramsay 3 - 4
Yiliaz et al.^([@r21])^ Turkey 1 25/25 Ramsay 3 - 4
Mehta et al.^([@r22])^ Canada and United States 16 209/214 SAS 3 - 4 or RASS -3 - 0
Nassar Junior e Park^([@r23])^ Brazil 1 30/30 SAS 3 - 4
SAS - Sedation Agitation Scale; RASS - Richmond Agitation Sedation Scale.
######
Sedation protocol and daily interruption performed in each study
Study Sedation protocol Daily sedation interruption
-------------------------------- ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Mehta et al.^([@r17])^ Midazolam and morphine (or fentanyl, if CrCl \< 10mL/min) reduced every 15 - 30 minutes if SAS 1-2. Boluses were administered if there was agitation, and sedative and analgesic doses were increased. SAS was reassessed every 1 - 2 hours The infusion of sedatives and opioids was maintained identically to the protocol, but sedatives and analgesics were turned off after 9 hours, and the patients were assessed for their ability to obey three out of four commands (open your eyes, follow the investigator with your eyes, shake hands and wiggle your toes). If the doctor felt that the patient needed to be sedated, sedation was reinitiated at half the dose. In this case, the protocol continued, targeting SAS 3-4. If it was decided that the patient would not receive any more sedatives, they were only resumed if the patient was at SAS 6 - 7
de Wit et al.^([@r18])^ Analgesia with morphine or fentanyl (if renal failure or hemodynamic instability) in bolus. If boluses were frequent, continuous infusion began. Sedation followed the same pattern, with the use | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Proteases are a large group of enzymes that can cleave proteins during a multitude of physiological reactions in all organisms ([@bib28]). A unique group of cysteine proteases called caspases functions to execute the apoptotic cell death program ([@bib69]; [@bib60]; [@bib57]). Caspases are synthesized as inactive zymogens (or proenzymes) and work in a controlled proteolytic cascade to activate themselves and one another ([@bib49]; [@bib52]). Initiator caspases are generally activated through dimerization, facilitated at multiprotein complexes such as the apoptosome (cytochrome c-Apaf-1--caspase-9; [@bib70]; [@bib50]; [@bib52]). Once activated, initiator caspases cleave and activate effector caspases, such as caspase-3 and -7 ([@bib8]; [@bib49]), which in turn cleave a variety of cellular protein substrates, ultimately leading to apoptosis ([@bib40]; [@bib15]; [@bib41]). Caspases are also regulated by inhibitory proteins, such as the inhibitor of apoptosis proteins, which can bind to and inhibit caspases in both insects and mammals ([@bib21]; [@bib61]; [@bib44]). In addition to the efforts invested in revealing and understanding these global pathways of caspase regulation during apoptosis, other studies imply that caspase activation is not necessarily an all-or-nothing process ([@bib26]; [@bib47]; [@bib48]). Indeed, low, transient, or subcellularly restricted levels of caspase activity have been recently reported to promote vital cellular processes ([@bib33]; [@bib32]; [@bib39]; [@bib53]). Furthermore, different cells, under varying physiological and pathological conditions, often display substantial differences in their sensitivity to apoptotic stimuli, which may reflect distinct apoptotic potentials. However, it is still poorly understood why restrictive levels of caspase activity fail to induce apoptosis and what factors determine the apoptotic potential of the cell.
The *Drosophila melanogaster* genome encodes seven distinct caspases, out of which the initiator caspase-9 ortholog Dronc and the effector caspase-3 ortholog Drice are the major apoptotic caspases ([@bib35]; [@bib10]; [@bib67]). Mutations in these caspases cause pleiotropic defects in developmental cell death and stress-induced apoptosis as well as the apoptosis-like process of spermatid individualization ([@bib9]; [@bib12]; [@bib62]; [@bib65], [@bib66]; [@bib5]; [@bib43]). In contrast, only minor physiological roles in apoptosis have been demonstrated for the initiator-like atypical caspase Strica/Dream and the effector-like caspases Dcp-1 and Decay ([@bib36]; [@bib38]; [@bib43]; [@bib66]; [@bib6]; [@bib13]). The caspase-8--like initiator Dredd appears not to be involved in cell death but rather in the innate immune response ([@bib37]; [@bib59]), whereas no role in apoptosis has been thus far demonstrated for the effector-like caspase Damm/Daydream ([@bib23]; [@bib38]). It is unclear why these caspases display different roles in apoptosis. For example, although Dcp-1 is highly homologous to Drice (67% identity; [@bib57]) and loss of *dcp-1* can aggravate *drice* mutant phenotypes ([@bib38]; [@bib43]; [@bib66]), *dcp-1* mutant flies are quite healthy, displaying only mild defects during starvation-induced autophagy and cell death in midoogenesis ([@bib36]; [@bib29]). Likewise, in mammals, knocking out caspase-3 causes decreased apoptosis and pleiotropic morphological defects, whereas caspase-7 knockout mice exhibit only mild antiapoptotic defects ([@bib34]; [@bib64]; [@bib30]). Whether these functional differences are the consequence of tissue specificity, distinct cellular levels of activity, or different execution efficiencies remains to be investigated.
Using a transgenic reporter of caspase-3--like (DEVDase) activity ([@bib63]), we set up an in vivo system for monitoring and comparing the activity levels and execution efficiencies of the two main effector caspases in *Drosophila*, Drice and Dcp-1, during apoptosis. We show that after irradiation-induced apoptosis, Drice and Dcp-1 are the only DEVDases that become activated in wing imaginal discs (WDs), although Drice is more efficient than Dcp-1 in processing this reporter and an endogenous protein substrate. The apoptosome components, Dronc and its adaptor protein Ark (the Apaf-1 homolog), constitute the initiator activity required for Drice and Dcp-1 activation, which can be blocked by expression of caspase inhibitory proteins. Importantly, in a series of genetic and transgenesis studies, we demonstrate that whereas both Drice and Dcp-1 can induce apoptosis, Drice can execute apoptosis more effectively than Dcp-1. Dcp-1, on the other hand, functions to fine tune the rate of cell death, at least in part through further activation of Drice in a positive amplification loop. Building on the differential efficiencies of these caspases to induce apoptosis, we show that the apoptotic potential of the cell is significantly affected by the total level of caspase activity, which in turn is directly proportional to the levels of the procaspases and their ratios. Finally, we demonstrate that the total level of caspase activity must reach a critical threshold in order for the cell to undergo apoptosis; short of that threshold, apoptosis cannot occur, and the cell will recover.
Results
=======
Detection of effector caspase--like DEVDase activity during apoptosis in vivo
-----------------------------------------------------------------------------
To monitor effector caspase activity in vivo, we took advantage of a genetic reporter previously designed for detection of caspase activity during the vital process of dendritic pruning in *Drosophila* sensory neurons ([@bib63]; [@bib53]). This reporter, dubbed *CD8::PARP::Venus* (*CPV*), encodes an artificial effector caspase substrate composed of a 40-aa-long fragment of the human poly(ADP-ribose) polymerase (PARP) protein (including the caspase-3 consensus site DEVD) flanked by the extracellular/transmembrane domain of the mouse CD8 protein at the N-terminal side and the YFP Venus at the C terminus ([Fig. 1 A](#fig1){ref-type="fig"}). The activity is detected by staining with the anticleaved human PARP antibody, whereas the fluorescence of the Venus protein indicates which cells express the reporter. The *CPV* reporter has not been characterized during apoptosis, and the exact caspases (or other proteases) that may cleave it have not been determined. Therefore, we established a genetic assay for monitoring the *CPV* reporter during irradiation-induced apoptosis in *Drosophila*. The *CPV* was expressed in the pouch region of the WD using the *spalt* (*sal*)-Gal4 driver. Transgenic larvae were then γ-irradiated and subsequently allowed a 4-h recovery before their WDs were removed and stained to visualize cleaved human PARP. Whereas nonirradiated animals displayed almost no reporter processing activity, strong activity was detected after apoptosis induction ([Fig. 1 B](#fig1){ref-type="fig"}, a and b, respectively). Furthermore, coexpression of the apoptosome components Ark and Dronc, using the *sal*-Gal4 driver, also induced a high level of *CPV* processing activity ([Fig. 1 B](#fig1){ref-type="fig"}, c), consistent with the idea that this combination is a strong inducer of apoptosis ([@bib56]).
{#fig1}
Apoptosis is associated with massive proteolytic activity ([@bib11]). To validate that *CPV* is cleaved only (immediately) after the DEVD consensus site, we introduced a point mutation to this reporter, which changes the invariably conserved aspartic acid residue to glycine (DEVD to DEVG). Transgenic flies expressing this modified construct (dubbed *CP^G^V*) were treated as described above for the visualization of *CPV* processing activity. However, this mutation completely abrogated processing of the reporter ([Fig. 1 B](#fig1){ref-type="fig"}, d). Therefore, the proteolytic cleavage of *CPV* during apoptosis reflects DEVDase activity only.
The effector caspases Drice and Dcp-1 are both activated during γ-irradiation--induced apoptosis
------------------------------------------------------------------------------------------------
Apoptosis is mainly mediated by caspases, but other proteases may also be involved in this process ([@bib54]). To test whether *CPV* | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
Immunoglobulins (Ig) are glycoproteins produced exclusively by activated B-lymphocytes and plasma cells that mediate humoral response against pathogens. Each B-cell clone presents an antigen-specific membrane-bound immunoglobulin that, together with CD79A and CD79B molecules, comprise the B-cell receptor (BCR). After stimulation by antigens, B-cells secrete immunoglobulins (antibodies) with the same antigen-binding sites than the membrane-bound molecules.
All Ig share a similar basic structure composed of four polypeptide chains: two identical heavy chains and two identical light chains. The heavy chain has one variable domain (V~H~) and three or four constant domains (C~H~1, C~H~2, C~H~3, and C~H~4). Each light chain exhibits one variable domain (V~L~) and one constant domain (C~L~). The variable region (V~H~ and V~L~) is responsible for antigen recognition and binding while the constant regions (C~H~ and C~L~) primarily mediate the Ig effector functions, which includes complement activation and Fc Receptor binding ([@B1], [@B2]).
In humans, the immunoglobulin heavy chain gene (*IGH*) is located in chromosome region 14q32 and consists of four groups of gene segments: the variable heavy (*IGHV*), diversity heavy (*IGHD*), joining heavy (*IGHJ*), and constant heavy (*IGHC*). The *IGHC* group includes *IGHM, IGHD, IGHG3, IGHG1, IGHEP1, IGHA1, IGHGP, IGHG2, IGHG4, IGHGE*, and *IGHA2* gene segments and pseudogenes. Immunoglobulin light chains are encoded by two different genes: lambda (*IGL*) at 22q11 and kappa (*IGK*) at 2p11.2 ([@B3], [@B4]).
During B-cell development, the *IGH* gene undergoes a somatic rearrangement, in which only one *IGHV*, one *IGHD*, and one *IGHJ* gene segment are combined to form the Ig variable region V~H~. In contrast, during clonal expansion after activation of the B-cell, *IGHC* gene segments go through a process called class-switch recombination, which determines the Ig class and subclass: IgM, IgD, IgG (IgG1, IgG2, IgG3, and IgG4), IgA (IgA1 and IgA2), and IgE. The human humoral immune response is mainly mediated by Ig gamma (IgG), which is subdivided into four subclasses, IgG1, IgG2, IgG3, and IgG4, ordered by decreasing abundance in peripheral blood ([@B5]). The constant regions of these four subclasses are encoded by the gene segments *IGHG1, IGHG2, IGHG3*, and *IGHG4*, respectively, the first three being the ones focused on this study. Each *IGHG* gene segment consists of three exons that encode the constant heavy domains (*CH1, CH2*, and *CH3*) and exon *H*, which encodes the hinge between the CH1 and CH2 domains ([@B5]).
Most of the human IgG diversity in populations has only been characterized by serological methods, which defined the immunoglobulin allotypes at the protein level. Ig allotypes are polymorphic epitopes (resulting from nucleotide variation) on the Ig constant domain that provide binding sites for antibodies ([@B6]). Certain IgG allotypes have been associated with susceptibility to cancer, autoimmune and infectious diseases ([@B7]--[@B9]).
Although the genetic variability of some *IGHG* gene segments has been characterized ([@B10], [@B11]), it has never been systematically sequenced at the nucleotide level across populations. Thus, the diversity of these gene segments is probably underestimated. Additionally, this genomic region is not well-covered in genome-wide studies and genomic databases for two reasons: first, DNA samples used are often extracted from B-cell lines, which are not suitable for analyzing this region due to the somatic rearrangement within this locus; second, the high sequence similarity of these segments imposes technical difficulties for sequencing and genotyping ([@B12]).
Here, we analyzed the diversity of *IGHG1, IGHG2*, and *IGHG3* in seven Brazilian populations: five Amerindian populations that have been genetically isolated for centuries and two urban populations. By analyzing deep sequencing data, we found 28 novel *IGHG* alleles, characterized the linkage disequilibrium of variants within these segments and analyzed the relationship among alleles. Additionally, we provided compelling evidence of the occurrence of gene conversion between different gene segments and evidence of purifying selection shaping *IGHG* diversity.
Methods {#s2}
=======
Characterization of the Study Populations
-----------------------------------------
This study was approved by the Brazilian National Human Research Ethics Committee (CONEP), protocol number CAAE 02727412.4.0000.0096, in accordance to the Brazilian Federal laws. We analyzed a total of 357 individuals from seven Brazilian populations, of which five are Amerindian: Guarani Kaiowa (GKW, *n* = 46), Guarani Ñandeva (GND, *n* = 48), Guarani Mbya (GRC, *n* = 51), Kaingang from Ivaí (KIV, *n* = 52), and Kaingang from Rio das Cobras (KRC, *n* = 52); and two are urban populations: Japanese-descendants (BrJAP, *n* = 57) and Euro-descendants from Curitiba (CTBA, *n* = 51). Their detailed geographic location and sample sizes are found in [Figure 1](#F1){ref-type="fig"} and [Table S1](#SM3){ref-type="supplementary-material"}.
{#F1}
The Amerindians samples were collected between late 1980s and early 1990s. According to public data from the Brazilian Institute of Geography and Statistics (IBGE), there are approximately 900,000 Amerindians individuals in Brazil, distributed across 693 official indigenous lands (<https://www.ibge.gov.br>). The Guarani speak a Tupi-Guarani language, which belongs to the Tupi language family. The Kaingang speak Jê, which belongs to the Macro-Jê language stock. Analyzing mtDNA segments and the proposed time of origin of Tupi-Guarani and Jê linguistic families, Marrero and colleagues ([@B13]) estimated the Guarani population split in three partialities (Guarani Kaiowa, Guarani Ñandeva and Guarani Mbya) 1,800 years ago, while the different Kaingang populations would have split more recently, around 200 years ago. Since then, they are believed to have remained isolated from each other and other urban populations due to strong cultural and language barriers ([@B14]). A former study from our group estimated that the gene flow of these Amerindian populations with non-Amerindians was low, being 0% in Guarani Kaiowa, 4% in Guarani Mbya, 14% in Guarani Ñandeva and 7% in Kaingang ([@B15]).
The two urban samples were from Curitiba, the capital of Paraná State and the 5th largest city in Brazil. As a result of the Brazilian history of European colonization 500 years ago, and especially the more recent European migrations since the 19^th^ Century, the population of Curitiba is of predominantly European ancestry. According to the public data from IBGE, 78.7% of the inhabitants of Curitiba self-declared themselves as white, 16.7% as admixed, 3% as black, 1.4% as Asian, and 0.2% as Amerindian (<https://www.ibge.gov.br>). The population here referred as CTBA only included Euro-descendant individuals. Therefore, we excluded all individuals with known miscegenation with Amerindian and/or other non-European ancestries. Paraná State also hosts the second largest Japanese community in Brazil, one of the largest outside Japan. The Japanese migration started in the twentieth century with the Treaty of Friendship, Commerce and Navigation between Brazil and Japan. All Japanese-descendent individuals of this study (BrJAP) were born in Brazil, with either both parents or all four grandparents born in Japan. They reported no history of admixture with non-Japanese ethnicities.
DNA Extraction
--------------
Genomic DNA was extracted from peripheral blood samples by standard salting-out ([@B16]) or by the phenol-chloroform-isoamyl method ([@B17]). High-quality DNA has been stored at −80°C since the extraction. DNA integrity was evaluated by 1% agarose gel electrophoresis and purity was accessed by spectrophotometry.
Sequencing and Allele Identification
------------------------------------
We aligned all previously known *IGHG* alleles and designed primers to amplify each segment specifically. To define the best set of primers we used the following approaches: (i) we ruled out unspecific amplification by verifying that all amplicons did | {
"pile_set_name": "PubMed Central"
} |
All relevant data are within the paper and its Supporting Information files.
Introduction {#sec001}
============
Primary open angle glaucoma (POAG) is a chronic and progressive eye disease characterized by loss of retinal ganglion cells, thinning of the retinal nerve fiber layer, and subsequent visual field loss. If left untreated, it can eventually lead to blindness. Previously, an elevated intraocular pressure (IOP) was deemed to be the key factor in the pathophysiology of glaucoma. However, there is a variant of POAG in which the patients have a normal IOP (normal tension glaucoma \[NTG\])\[[@pone.0204939.ref001]\]. One potential explanation for this is that the relationship between IOP and intracranial pressure (ICP) is the key factor, rather than IOP itself \[[@pone.0204939.ref002],[@pone.0204939.ref003]\].
Alterations in IOP, ICP, or both can lead to a change in the pressure gradient across the lamina cribrosa (LC)---known as the trans lamina cribrosa pressure difference (TLCPD)---and cause it to bulge, therefore damaging the nerve fibers. It has been shown with lumbar punctures (LPs) that patients with glaucoma have a lower ICP than the healthy population and that those with NTG have the lowest \[[@pone.0204939.ref004]--[@pone.0204939.ref006]\]. As further evidence, patients with normal pressure hydrocephalus who received shunts, which can significantly lower ICP, had a 40 fold increase in the rate of NTG when compared with the general population \[[@pone.0204939.ref007]\]. There is, however, controversy over this theory \[[@pone.0204939.ref008]\].
LPs are invasive and thus limit a researcher's ability to conduct experiments with a sufficient number of subjects. In addition, LP opening pressures are only a proxy of the actual ICP as they are measured at the lower part of the spine and typically only in the lateral decubitus position. They are especially not likely to be representative of the pressure behind the LC. This is important because it is possible that NTG is related to an inability to maintain a certain pressure in the upright position, rather than the lateral decubitus position. Interestingly, a recent study by Linden et al. \[[@pone.0204939.ref008]\] aimed to use LPs to estimate ICP at the LC as accurately as possible by accounting for the hydrostatic gradients between the auditory meatus and the LC. LPs were done and ICP was measured continuously using a pressure transducer in various body positions but no differences were found in ICP between a small group of NTG patients and controls. A noninvasive device that measures the pressure at the level of the brain rather than in the lower part of the spinal canal could potentially further this field tremendously.
Otoacoustic emissions are sounds that originate in the cochlea and can be easily used to measure cochlear function noninvasively \[[@pone.0204939.ref009],[@pone.0204939.ref010]\]. One particular type of emission is the distortion product otoacoustic emission (DPOAE), which is emitted by the inner ear in response to two tones at specified levels and frequencies. These emissions are thought to depend on ICP because there is a connection between the cranium and inner ear via the cochlear and endolymphatic aqueducts. When ICP fluctuates, the pressure on the stapes also changes, affecting the transmission of sound in the middle ear. Previous research has shown that DPOAE phase shifts can accurately represent changes in ICP \[[@pone.0204939.ref011]--[@pone.0204939.ref014]\]. As such, a DPOAE measurement potentially contains all the desired properties of an ideal ICP measurement. One limitation is that the recorded DPOAE phase has an unknown---subject specific---offset. As a result, if the relationship between ICP and the DPOAE phase would be linear, changes in phase would only convey changes in pressure. In case of a nonlinear relationship (e.g. the phase changes only for pressures above or below a certain value), however, an absolute pressure measurement should be feasible as well. In this study we explore the clinical value of the DPOAE phase shift for ICP assessment and apply the technique to glaucoma patients.
The aim of this study was to (1) determine the relationship between DPOAEs and body position and to (2) compare this relationship between POAG, NTG, and controls. Finally, we aimed to (3) calibrate this relationship using published data regarding LP-based measurements of ICP versus body position.
Methods {#sec002}
=======
Study population {#sec003}
----------------
Subjects with healthy eyes who responded to our advertisement and glaucoma patients who were selected from the Groningen Longitudinal Glaucoma Study database \[[@pone.0204939.ref015]\], received an information letter and informed consent form. The ethics board of the University Medical Center Groningen (UMCG) approved the study protocol. All participants provided written informed consent. The study followed the tenets of the Declaration of Helsinki.
In order to be eligible to participate in this study, subjects in all groups had to meet the following inclusion criteria: 50 to 70 years of age and presence of detectable DPOAEs in at least one ear. Additionally, for healthy controls: IOP of 21 mmHg or lower, no eye disease, and no family history of glaucoma (determined by a questionnaire). To exclude eye disease, we performed optical coherence tomography (OCT-HS100; Canon, Tokyo, Japan; considered normal if the mean retinal nerve fiber layer and retinal ganglion cell layer thickness in macular area were above the 5th percentile), frequency doubling technology (FDT; Carl Zeiss, Jena, Germany; no reproducibly abnormal test locations allowed in C20-1 screening mode), and a measurement of visual acuity (visual acuity at least 0.8 in both eyes). For POAG: diagnosed glaucoma and IOP over 21 mmHg before the onset of IOP lowering treatment. For NTG: diagnosed glaucoma and IOP of 21 mmHg or lower before the onset of IOP lowering treatment and at any time during follow-up. Glaucoma was defined according to Heeg et al \[[@pone.0204939.ref015]\]. We required a reproducible (same hemifield and at least partially overlapping) visual field defect (Humphrey Field Analyzer 30--2 SITA fast; Carl Zeiss, Jena, Germany; criterion: \'glaucoma hemifield test\' outside normal limits) in at least one eye that had to be compatible with glaucoma and without any other explanation. Subjects taking acetazolamide were excluded in this study as this drug has been shown to change ICP \[[@pone.0204939.ref016]--[@pone.0204939.ref018]\].
DPOAE parameters {#sec004}
----------------
DPOAEs were measured using hardware (Elios) and software (Echosoft version 2.4.2) developed by Echodia (St. Beauzire, France). To ensure the highest magnitude responses at the 2*f*1-*f*2 emission, a fixed rate of *f*2/*f*1 = 1.20 with tones at frequencies *f*1 = 1000 Hz and *f*2 = 1200 Hz and levels L1 = L2 = 72 dB SPL were used. All DPOAE measurements were completed in a sound-isolated audiometric room in the otorhinolaryngology clinic.
Measurement protocol {#sec005}
--------------------
Blood pressure (Omron Model M6 Comfort, Omron Healthcare Co., Ltd.) and upright IOP (iCare Pro tonometer, Icare Finland Oy) were measured. Subjects were then secured onto the tilt table (Ironman iControl 400 Disk Brake Inversion System, Paradigm Health and Wellness Inc.). Body mass index (BMI) was determined using self-reported height and weight.
DPOAEs were measured at the following body positions (assuming 90° as upright): 45, 30, 20, 10, 0 (supine), -10, and -20°. At each position, 30 seconds were allowed for normalization of the emission, and presumably the ICP \[[@pone.0204939.ref012],[@pone.0204939.ref019]\]. This was followed by 5 DPOAE measurements that were performed over approximately 20 seconds. IOP was measured again at the supine position. The ear probe was then removed and subjects were allowed a short break before repeating the test. In this way we were able to determine test-retest variability with (between test) and without (within test) replacing the probe.
Data analysis {#sec006}
-------------
Groups were described with mean and standard deviation (SD) for normally distributed variables; means were compared using one-way analysis of variance (ANOVA). For variables with a skewed distribution, we used median and interquartile range (IQR) for descriptive statistics and the Kruskal-Wallis test for comparing medians of groups. Proportions were compared using a chi-square test.
The stimulus and data collection protocols are already described in detail by Avan et al \[[@pone.0204939.ref020]\]. At each body position, 5 DPOAE measurements were taken, which took approximately a total of 20 seconds of measurement time. For the within test test-retest variability, the first 2 and last 2 of these 5 measurements were averaged for each body position and compared. For the between test test-retest variability, the average phase over the full 20 seconds was compared for the first and second test, between which the ear probe had been removed and replaced. Test-retest variability was presented as the SD of differences of both measurements.
Due to the subject specific | {
"pile_set_name": "PubMed Central"
} |
Prostate cancer (CaP) is the second most common malignancy in men worldwide, with 910 000 new cases diagnosed in 2008 ([@bib7]). CaP has a predilection to metastasise to the bone marrow stroma (BMS), and development of CaP bone metastases almost invariably result in CaP-related mortality ([@bib9]). The metastatic process is a complex, multistep process, which can be modelled with modified *in vitro* invasion chambers utilising human primary BMS ([@bib16]; [@bib25]; [@bib13]). These *in vitro* models not only allow the determination of the mechanism of CaP metastasis to the BMS but enable the elucidation of how therapeutic agents may interfere with the metastatic process.
Recent evidence links lipid metabolism and statin use with the behaviour of CaP. Large scale epidemiological data showing lower rates of CaP progression in patients taking statins ([@bib23]) have been consolidated by reports showing that CaP incidence in screened ([@bib20]) and non-screened ([@bib2]) populations is reduced in men taking these drugs and that individuals with lower cholesterol levels had lower rates of high risk disease ([@bib22]). Further clinical data from histological analysis of large case after prostatectomy series showed less aggressive features in men taking statins ([@bib17]) and in patients undergoing radiotherapy for CaP indices of CaP treatment failure were reduced in men taking statins, especially in those with high risk features ([@bib10]).
The basis for these observations is poorly understood but the effects probably relate to the pleiotropic actions of 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) inhibitors on cellular behaviour, cell-cell interaction and cellular motility in relation to lipid metabolism ([@bib27]). To better understand this process, we have studied the effects of different statins in our in-house, well-categorised models of CaP behaviour, evaluating the differential effects of specific statins on cellular binding, migration and early cellular survival in human BMS.
Materials and methods
=====================
Cell culture
------------
PC-3 (ATCC-LGC, Teddington, UK) cells were cultured in HAM\'S-F12 media supplemented with 7% foetal calf serum (FCS) and 2 mℳ L-glutamine at 37 °C, 5% CO~2~ in air. PC3-GFP were cultured as for PC-3 except for addition of 0.15 mg ml^−1^ hygromycin B. Human BMS was obtained from volunteers undergoing surgery for benign disease and cultured according to [@bib6]. Briefly, 2 × 10^6^ cells ml^−1^ in long-term bone marrow culture medium (LTBCM) (Iscove\'s modified Dulbecco\'s medium at 350 mOsm, 10% foetal calf serum, 10% horse serum, 5 × 10^−7^ ℳ hydrocortisone) were grown at 33 °C in 5% CO~2~ in air for 4--5 weeks until haematopoietically active areas were observed. Bone marrow endothelial cells (BMEC) were cultured in LTBCM conditioned by BMS on fibronectin-(50 mg ml^−1^ in PBS) treated flasks. All cell lines were verified by the Paterson Institute for Cancer Research tissue typing service.
Statins and metabolites
-----------------------
Atorvastatin, rosuvastatin (Discovery Fine Chemicals Ltd, Dorset, UK), mevastatin, and simvastatin (Sigma-Aldrich, Poole, UK) were dissolved in dimethyl sulphoxide (DMSO) and pravastatin (Sigma-Aldrich) was dissolved in water at concentrations of 100 mℳ. Activated simvastatin was also assessed. Briefly, 4 mg of simvastatin was dissolved in 100 *μ*l of ethanol to which 150 *μ*l of 0.1 N NaOH was added and incubated at 50 °C for 2 h. The pH was brought to 7.0 by HCl and diluted to a final concentration of 100 mℳ before storing at 4 °C. All statins were used at final non-toxic concentrations as defined by trypan blue exclusion. All metabolites were purchased from Sigma-Aldrich. Geranylgeranyl pyrophosphate (GGPP) and farnesyl pyrophosphate (FPP) were dissolved in methanol at a final concentration of 1 mg ml^−1^. Cholesterol was dissolved in chloroform at 100 mℳ. Mevalonate was made up in water at a stock concentration of 10 mg ml^−1^ (40 mℳ).
Binding assay
-------------
Prostate epithelial cell (PEC) binding to BMS was determined as previously described ([@bib25]); 5 × 10^4^ PC3-GFP cells, treated with statin or DMSO vehicle control, were added to confluent BMS in a 96-well plate. Wells were washed and fluorescence was read using a FLUOstar OPTIMA spectrometer (BMG Labtech, Aylesbury, UK). Binding was expressed as percent of pre-washed total fluorescence.
Invasion assay
--------------
Prostate epithelial cell invasion towards BMS was measured as previously described ([@bib13]); invasion towards statin-pretreated BMS or in the presence of statins was assessed. The FluoroBlok (BD Biosciences, Oxford, UK) tumour cell invasion system used phenol red-free RPMI 1640 media and FluoroBlok cell culture inserts coated with 100 *μ*l of Matrigel (BD Biosciences) (1 : 25 dilution with RPMI 1640) above chemoattractant (BMS or tissue culture plastic (TCP)). 2 × 10^5^ PC3-GFP in RPMI 1640/0.1% BSA were added to each FluoroBlok insert and the co-cultures incubated at 37 °C, 5% CO~2~ for 18 h. Bone marrow stroma was pretreated daily with the different statins. PC-3 cells were treated with statins 30 min before addition. Final readings utilised the FLUOstar OPTIMA spectrometer. Recovery assays were conducted as above or in the presence of a confluent BMEC cell layer barrier ([@bib13]). PC3-GFP cells were treated with 10 *μ*ℳ GGPP, 100 *μ*ℳ mevalonate, 16 *μ*ℳ cholesterol or 10 *μ*ℳ FPP immediately before the additions of statins and adding to the invasion chamber.
Co-culture colony assay
-----------------------
Prostate epithelial cell growth in BMS co-culture was measured as previously described ([@bib16]); confluent primary human BMS, pretreated with statins for 60 min, was seeded with 500 PC-3 cells. Statins were refreshed daily for 8 days before 4% paraformaldehyde fixation. Co-cultures were permeabilised using ice-cold methanol and blocked with 10% rabbit serum, followed by 0.3% hydrogen peroxide. Co-cultures were incubated with mouse anti-human pan-cytokeratin at 1 : 200 (Sigma-Aldrich) followed by biotinylated rabbit anti-mouse 1 : 400 (DAKO Ltd., Cambridge, UK). A complex of avidin DH and biotinylated horseradish peroxidase H (Vector Laboratories, Peterborough, UK) was then added and developed with DAB substrate.
Clonogenic assay
----------------
Five hundred PC-3 cells were treated at day 1 and day 7 with statins, before methanol acetone fixation and staining with crystal violet on day 14; colonies (\>32 cells) were then counted using a standard microscope graticule.
Statistics
----------
Values are presented as mean±s.e. Assays were compared using the two-tailed Student\'s *t-*test with significance set at *P*\<0.05.
Results
=======
Reduction of BMS invasion by lipophilic statins
-----------------------------------------------
We have previously shown that BMS is the most potent chemoattractant for metastatic PECs and that the metastatic process can be modelled using primary human BMS co-cultures ([@bib13]; [@bib4]). We therefore addressed three different questions: do statins affect the BMS microenvironment ([Figure 1A](#fig1){ref-type="fig"}), the PECs directly ([Figure 1B](#fig1){ref-type="fig"}) or the interaction between BMS and PECs ([Figure 1C](#fig1){ref-type="fig"}). Statins did not affect the ability of BMS to induce PEC invasion; although atorvastatin and simvastatin treatment of BMS reduced invasion as compared with the controls (84±8.8% *P*=0.18806 and 80±10.57% *P*=0.14755), this did not reach significant levels ([Figure 1A](#fig1){ref-type="fig"}). All statins, except pravastatin, induced a similar and marked reduction in PEC invasion towards BMS (*P*\>0.05), averaging 66.68% of control (range 54--77% *P*\<0.05). Bone marrow stroma pretreatment ([Figure 1C](#fig1){ref-type="fig"}) did not provide additional benefit to treating PECs alone (58.86% *P*\>0.05 of PC-3\'s invading compared with controls), suggesting a direct effect on the PC-3 cells and not on the BMS 'soil\'.
The effect of statins was more significant in the presence of a confluent | {
"pile_set_name": "PubMed Central"
} |
Introduction {#S0001}
============
Low birth weight (LBW) is considered as birth weight less than 2500gm and in Bangladesh, 45% child born with LBW \[[@CIT0001], [@CIT0002]\]. It has been speculated that low birth weight predisposes children to a high risk of diabetes, heart diseases and other chronic conditions later in life \[[@CIT0003]--[@CIT0008]\]. Data cited in National Food and Nutrition policy (1997) document shows that LBW ranges from 30-50 percent, however from different other studies it has been revealed that LBW prevalence rate is about 30 percent \[[@CIT0009], [@CIT0010]\]. It is assumed that, under nutrition, both before and during pregnancy, causes intrauterine growth retardation and is one of the major reasons for the high LBW. Between 1990 and 2004, underweight levels among children fell from 67% to 48% and child stunting fell from 66% to 43% \[[@CIT0011], [@CIT0012]\], but the levels are still unacceptably high. Some studies, from Bangladesh, showed that mean birth weight increase with an increase in mother\'s age from 14 to 31 years, while after 32 years birth weight decrease and the highest mean birth weight occurred in women between 26 and 31 years of age \[[@CIT0002]\]. There are studies both in support and to deny the relationship between maternal socioeconomic and anthropometric characteristics and birth weight \[[@CIT0013]--[@CIT0015]\].
Breastfeeding is considered as the pivotal factor between life and death for the vast majority of children in developing countries, but pattern of breast feeding and exclusive breast feeding is more important, which is ignored often by most mothers. Breast milk is a natural resource that has a major impact on infant\'s health, growth and development and it is recommended for at least the first two years of a child\'s life \[[@CIT0016]\]. Breast milk contains all desirable nutrients in right quantity that a baby needs and are easily digestible \[[@CIT0017]\]. However it is important to ensure exclusive breastfeeding for the first six months of life, only 35.0% of infants worldwide were exclusively breastfed during the first six months of life and 27.0% under six months infant were bottle fed \[[@CIT0016]\]. It is evident that inappropriate breastfeeding practices are associated with severe malnutrition in the under five children, lack any advantage in terms of weight gain and are associated with growth faltering \[[@CIT0018]\]. A study conducted in Khulna, Bangladesh, stated that the prevalence of breastfeeding as 96% \[[@CIT0019]\], but the prevalence of exclusive breastfeeding and the effect of breastfeeding on infant nutritional status were not clearly stated. Early initiation of breastfeeding generally lengthens the duration of breastfeeding and also prevents postpartum hemorrhage \[[@CIT0019]\], however the pattern of initiation of breastfeeding was not clearly reported in Bangladesh.
In developed countries during the last two decades a large number of studies have been conducted to identify the effect of maternal status and breastfeeding practices on infant development. In Bangladesh, few studies have been conducted to find out the effect of maternal status and breastfeeding practices on infant nutritional status and most of them are weak due to inappropriate study design and lack of statistical validity. We think it is important to investigate the relationship between these in a view to prevent infant morbidity and mortality. The objectives of this analysis was to determine how maternal socioeconomic and anthropometric status effect on birth weight, particularly in determining low birth weight (\<2500 gm), and how breastfeeding practice, particularly the type and effective time of initiation and termination of breastfeeding effect on infant growth and development.
Methods {#S0002}
=======
Subjects {#S20003}
--------
A total of 510 mother-infant pairs were included and the study was continued for 6 months. Mothers and their infants attending the selected hospitals and maternal clinics in Kushtia during the study period were regarded as the study population. Infants' of up to 24 months of age was selected and infants above 24 months of age were excluded from the study. The mothers were selected beyond any ages. Some selection and exclusion criteria were followed as women whose health status was normal and who gave normal live birth were included and women with any severe health complication and caesarian cases were excluded from the study.
Study design {#S20004}
------------
The cross-sectional study was conducted during the period of September 2011 to February 2012. A detailed questionnaire was used to collect data on maternal and infant characteristics. Maternal variable as maternal age, maternal education level and maternal anthropometry like maternal height, weight and mid upper arm circumference (MUAC) was used as maternal variable. Family income was also used as a variable. Whenever mothers come to maternal clinic were interviewed and investigated. Maternal age, level of education and family income was collected from direct questionaries' and from hospital log book; maternal health card was used to collect maternal anthropometric measurement during pregnancy. Additionally maternal height and MUAC was also measured during the interview period according to standardized techniques \[[@CIT0020]\]. A non-stretchable tape made of fiberglass was used to measure maternal MUAC. All of the maternal variables were categorize into several category ([Table 1](#T0001){ref-type="table"}) to aid in data processing and evaluation of specific effect on infant birth weight. The entire maternal characteristics were used as independent variable. Infant birth weight was used as dependent variable. Birth weight of every infant was collected from maternal and infant health cards and from visited hospital\'s log book. Birth weight was categorized into three categories ([Table 1](#T0001){ref-type="table"}) as \< 2500 gm, 2500-2999 gm and = 3000 gm. According to WHO cutoff points \< 2500 gm of birth weight was considered as Low Birth Weight (LBW) \[[@CIT0021]\]. Details data on the pattern of breast feeding practice was also collected during the interview session. The women were asked about their current and previous infant feeding practices, including the time of initiation and duration of breastfeeding, use of formula, bottle feeding and introduction of complementary food. Use of any pre-lacteal feeding was also documented and categorize into another group. Exclusive breast feeding (EBF) up to six months was categorized into one category and EBF for less than six months was categorizing into other category. The other categories of breast feeding practice were as breast feeding on demand and continuing breast feeding for 24 months. Three infant variables were used as Stunting, Wasting and Stunting and Wasting. Infant anthropometric measurements were done during the period of interview. Infant age was collected from infant health card or from questionnaire. A research team consisting of students and teacher were directly involved in data collection in the maternal clinic. Data were collected with the help of health assistant working in the maternal clinic, Infant weight and height was measured using electronic scale and wooden measuring board following standard measuring procedure \[[@CIT0020]\]. Before measurement, the scales were calibrated and validated by the research team. Waterlow classification was used to classify infant into normal, wasting, stunting and wasting and stunting. In Waterlow classification% height for age and% weight for height was calculated using standard reference data for height of normal infant of the same age and weight of normal infant of the same height \[[@CIT0020]\].
######
Relative distribution of infant according to their birth weight and categories of maternal variables.
Variable Total Birth Weight (gm)
-------------------------------------------------- -------------- ------------------- --------------- ---------------
**Maternal Age (years)**
Up to 20 110(21.57) 34(30.9) 48(43.6) 28(25.5)
21-25 282(55.29) 80(28.4) 112(39.7) 90(31.9)
26-30 55(10.78) 13(23.6) 20(36.4) 22(40)
≥ 31 63(12.35) 23(36.5) 23(36.5) 17(27)
**Maternal Education**
Illiterate 58(11.37) 32(55.2) 15(25.9) 11(18.9)
Primary 75(14.71) 35(46.7) 32(42.6) 08(10.7)
class 6- S.S.C[\*](#TF0001){ref-type="table-fn"} 272(53.33) 69(25.3) 11542.3) 88(32.4)
H.S.C[\*](#TF0001){ref-type="table-fn"} 52(10.20) 11(21.2) 26(50) 15(28.8)
Graduation & above 53(10.39) 03(5.7) 1528.3) 35(66)
**Family Income (Tk)**
Up to 3999 81(15.88) 35(43.2) 28(34.6) 18(22.2)
4000-7999 135(26.47) 42(31.1) 62(45.9) 31(23.0)
8000-11999 119(23.33) 36(30.1) 46(38.7) 37(31.1)
12000-15999 87(17.05/ 25(28.7) 32(36.8) 30(34.5)
≥16000 88(17.25) 12(13.6) 3539.8) 41(46.6)
| {
"pile_set_name": "PubMed Central"
} |
*Bioscience Reports* (2019); <https://doi.org/10.1042/BSR20182466>
The authors are retracting their accepted manuscript "MicroRNA-367 promotes progression of hepatocellular carcinoma through PTEN/PI3K/AKT signaling pathway" at the request of the corresponding author and Hunan Provincial Tumor Hospital, in conjunction with the policies of their Institutional Review Board (IRB), as their study had not been granted at Hunan Provincial Tumor Hospital. They had also noticed an error in terms in the institutional review board within their Declarations.
All the named authors of the original accepted manuscript have agreed to this retraction, and apologise for any inconvenience caused to the readers and to the Editor of *Bioscience Reports*.
| {
"pile_set_name": "PubMed Central"
} |
Introduction
============
The term small for gestational age (SGA) is used to describe a neonate who is smaller than average after adjusting for sex and gestational age (GA). SGA infants usually have a birth weight below the 10th percentile for GA \[[@b1-apem-2019-24-4-226]\]. Some infants born SGA, particularly due to intrauterine growth restriction (IUGR), suffer acute and chronic consequences. In the neonatal period, some suffer from perinatal events, such as hypoglycemia, gastro-esophageal reflux, and hypothermia \[[@b2-apem-2019-24-4-226]\]. Such individuals can be and remain short in stature or suffer premature adrenarche and polycystic ovarian syndrome \[[@b3-apem-2019-24-4-226],[@b4-apem-2019-24-4-226]\]. Furthermore, SGA individuals demonstrate significantly increased risks for obesity, hypertension, dyslipidemia, insulin resistance, type 2 diabetes mellitus, and cardiovascular diseases (CVD) from childhood to adulthood \[[@b2-apem-2019-24-4-226]\]. For proper assessment and management of SGA individuals, up-to-date, ethnicity-specific birth length or birth weight references according to GA are needed \[[@b5-apem-2019-24-4-226]\]. Many countries, including the United States, have reported new birth weight or birth length references by sex and GA, as the old references no longer fit the contemporary population \[[@b6-apem-2019-24-4-226]-[@b11-apem-2019-24-4-226]\]. The new references and cutoffs can be used to identify children at risk for short adult stature and future metabolic disease. Previously, we reported Korean birth weight references according to GA and sex \[[@b12-apem-2019-24-4-226]\]. However, birth length references based on the Korean population remained absent at the time of this study. Thus, the objectives of this study were as follows: (1) to create sex-specific birth length reference data for Koreans; (2) to create a sex-specific birth length cutoff to define SGA; and (3) to compare Korean-specific birth length reference data and cutoffs to those of other countries.
Materials and methods
=====================
1. Study subjects
-----------------
This study was performed using data from the 4th Korean National Health and Nutrition Examination Survey (KNHANES-IV; 2007--2009), a cross-sectional and nationally representative survey with a multistage and stratified sampling design conducted by the Division of Chronic Disease Surveillance of the Korea Centers for Disease Control and Prevention. Written informed consent was secured from the respective caretakers of all participants before the study began, and the KNHANES-IV was conducted following ethical approval by the Institutional Review Board of Korea Centers for Disease Control and Prevention (No: 2007-02-04-P, 2008-04EXP-01-C, 2009-01CON-03-2C). In the KNHANESIV, the birth weight and birth length of children 1--3 years of age (n=895, representing 42,756 subjects) were available. Those without birth length were excluded (n=52). Thus, the final analytical sample consisted of 843 subjects (male, 459; female, 384).
2. Reference birth weights and lengths for 36-37 week and 38- to 41-week gestational ages
-----------------------------------------------------------------------------------------
In the KNHANES-IV, GA was identified using the closedended question \"Was your baby born between the expected birth date±2 weeks?\" If the answer was yes, the baby was defined as full-term (38--41 weeks). When the birth date was between 2--4 weeks earlier than expected, the baby was designated as GA 36--37 weeks. For reference, a GA of 38 weeks represented 38 weeks + 0--6 days. Multiple births (n=10) were excluded, as the negative impact on intrauterine growth is well known. Thus, we used data of singleton newborns. We further excluded \"extreme outliers,\" which were defined as value \> 2 times the interquartile range (25th to 75th percentiles) above the third quartile for each GA \[[@b13-apem-2019-24-4-226]\]. There were 6 extreme outliers based on the birth length and 3 based on birth weight. Those with a GA below 36 (n=6) or an unspecified GA (n=18) were also excluded. Thus, data of 67 (39 males) singleton newborns with GA of 36--37 weeks and data of 736 (399 males) with GA of 38--41 weeks were used for reference. The 3rd, 10th, 25th, 50th, 75th, 90th, and 97th percentiles for male and female birth lengths were calculated.
3. Small for gestational age definition
---------------------------------------
We used 2 identifiers to define SGA: a birth weight below the 10th percentile (SGAW) and a birth length below the 10th percentile (SGAL) \[[@b1-apem-2019-24-4-226],[@b6-apem-2019-24-4-226]\].
4. Statistical analysis
-----------------------
All statistical analyses were performed using SPSS ver. 17.0 (SPSS Inc., Chicago, IL, USA). The *P*-values of \<0.05 were considered significant. The data are presented as the mean±standard deviation concerning the percentile values for birth weight and length according to GA of 36--37 weeks and of 38--41 weeks.
Results
=======
1. Subject characteristics
--------------------------
The characteristics of the study subjects are presented in [Table 1](#t1-apem-2019-24-4-226){ref-type="table"}. The 843 subjects in this study were born between 2005 and 2009 in Korea. The mean birth length was 50.7±2.9 cm, and the mean birth weight was 3,283±438 g. Female infants had lower birth lengths and birth weights than male infants (50.2±3.2 cm vs. 51.1±2.7 cm, 3,225±464 g vs. 3,327±413 g, respectively; *P*\<0.001). There was no difference in birth weight concerning vaginal delivery and caesarean section. However, the birth lengths of infants born by caesarean section were shorter those born by vaginal delivery (50.4±3.4 cm vs. 50.9±2.6 cm, respectively; *P*=0.046). Full-term neonates comprised 91.3% of the participants (n=770), and preterm neonates younger than 37 weeks made up 8.7% (n=73).
2. Percentile distributions of birth length and birth weight by sex
-------------------------------------------------------------------
The mean and percentiles of birth length and weight according to GA of males are presented in [Table 2](#t2-apem-2019-24-4-226){ref-type="table"}, and the corresponding female data are presented in [Table 3](#t3-apem-2019-24-4-226){ref-type="table"}. In creating the percentiles, outliers and twins were excluded; therefore, data from 736 (399 males) singleton infants born between 38--41 weeks and from 67 infants born between 36--37 weeks were used. At full-term, the 10th percentile birth length was 48 cm in both males and females, the 10th percentile birth weight was 2,900 g for males and 2,828 g for females, and the 3rd percentile birth length was 47 cm for males and 46 cm for females.
3. Prevalence of SGA
--------------------
The prevalence (%) of SGA in full-term neonates when using the 10th percentile as the cutoff point for either birth length or weight is shown in [Fig. 1](#f1-apem-2019-24-4-226){ref-type="fig"}. In full-term neonates, a total of 745 subjects (including outliers) were divided based on birth length and weight. Of the subjects, 86.3% (n=643) possessed a greater than 10th percentile value for both birth length and weight (group I). The others fell into 3 groups: 3.9% (n=29) were of normal length and low weight (group II); 7.0% (n=52) were short and of normal weight (group III); and 2.8% (n=21) were short and of low weight (group IV). Considering SGA based only on birth weight, short newborn infants of normal weight (group III) were neglected from all SGA classifications, consisting of 51% of all individuals.
Discussion
==========
In this study, we introduced references for Korean birth length and weight based on the nation-wide survey data from the KNHANES-IV. This new Korean birth length data may be useful in assessing long-term health risks, such as short stature in childhood and metabolic risk in adulthood for children born with SGA. Furthermore, we showed that approximately half of infants classified as SGA, who are short but have a normal birth weight, might be misclassified as appropriate gestational age (AGA); this supports the need for updates and Korean-specific reference curves for birth length.
Contemporary ethnicity-specific birth weight references are needed to identify SGA neonates who might suffer from acute and chronic consequences \[[@b5-apem-2019-24-4-226]\]. Some SGA neonates are born following IUGR, and the suboptimal fetal growth occurring in IUGR fetuses is an important cause of perinatal mortality and morbidity \[[@b2-ap | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
The endoplasmic reticulum (ER) is the site of synthesis, maturation, folding, and oligomerization of newly synthesized proteins, such as secretory and membrane proteins. Moreover, the ER plays a key role in protein homeostasis. The folding process is regulated by a group of proteins, referred to as ER chaperones \[[@B1]\]. One of them is oxygen regulated protein 150/glucose regulated protein 170 (ORP150/GRP170) alternatively known as HSP12A \[[@B2]\]. It was originally identified in cultured astrocytes exposed to hypoxia. The ORP150 is a part of the ER machinery that assists in the assemble and folding of secretory and membrane proteins \[[@B2], [@B3]\]. Its expression is upregulated in hypoxia, serum starvation, glucose deprivation, ischemia, and treatment with tunicamycin or 2-deoxyglucose. The ORP150 plays a cytoprotective role for the maintenance of cellular viability \[[@B3]\].
Many stress conditions, such as hypoxia or nutrient deprivation, slow down the folding process and cause accumulation of unfolded/misfolded proteins in the cell \[[@B4]--[@B6]\]. Hypoxia is a factor inducing ER stress, although the underlying mechanism is unknown. Yoshida \[[@B7]\] suggested that during this process glycolytic enzymes are induced to sustain ATP production and then cells consume glucose. Perhaps a decrease in glucose concentration induced by hypoxia inhibits N-glycosylation, leading to ER stress \[[@B7]\].
The accumulation of unfolded proteins activates the so-called "unfolded protein response" (UPR), which involves at least four types of reaction: general translational attenuation (phosphorylation of the translation initiation factor 2); increased folding capacity (upregulation of ER chaperones); enhanced ER-associated degradation of misfolded and unfolded proteins; and, if the stress is severe and unsolvable, apoptosis \[[@B4]--[@B6]\].
Misfolded and unfolded proteins are returned from the ER to the cytosol and degraded in the proteasome \[[@B8]\]. The ubiquitin proteasome pathway is responsible for cell quality control by eliminating defective proteins from the cytosol and endoplasmic reticulum. Proteins are degraded by the ubiquitin proteasome pathway via two distinct steps: the covalent attachment of multiple monomers of ubiquitin molecules to a protein substrate and degradation of the tagged protein by the 26S proteasome \[[@B8], [@B9]\].
Bortezomib ((\[(1*R*)-3-methyl-1-({(2*S*)-3-phenyl-2-\[(pyrazin-2-ylcarbonyl) amino\]propanoyl}amino)-butyl\]boronic acid), velcade, formerly known as PS-341) is a competitive inhibitor of 20S proteasome activity in whole cells. It is used in the treatment of multiple myeloma and some forms of non-Hodgkin\'s lymphoma \[[@B8], [@B9]\]. Bortezomib inhibition of the proteolytic activity of the 20S proteasome has been shown to induce proapoptotic ER stress and inhibit proteasome degradation of I*κ*B, an inhibitor of nuclear factor-*κ*B (NF-*κ*B) in the cancer cell \[[@B8]--[@B10]\].
The inhibition of the proteasome results in many toxic effects, including the accumulation of unfolded and damaged proteins \[[@B11]--[@B13]\]. In response to proteasome inhibition, the cell induces specific protective mechanisms, including the unfolded protein response \[[@B11]\], autophagy \[[@B14], [@B15]\], and, if the damage is severe, apoptosis \[[@B11], [@B16]\].
It is known that apoptosis plays the major role in control of cancer development. An organelle that can induce apoptosis when stressed is the ER. In fact, cells encounter multiple apoptotic stimuli during cancer progression, including nutrient deprivation or hypoxia. Accordingly, it was suggested that the well-documented antiapoptotic potential of chaperons may play a critical role in suppression of apoptosis in cancer cells \[[@B1], [@B8]\]. Recently, the attention of the scientists has shifted towards a novel role of cell senescence in control of cancer development, and with this shift our view on the role of chaperons in cancer has also evolved towards appreciation of the major role of chaperons in regulation of the senescence program \[[@B17]\].
Senescence can be generally characterised as a cellular stress response. This is a signal transduction process that leads to an irreversible growth arrest of cells in the G1 cell cycle phase \[[@B18]\]. Our knowledge about cell senescence occurring *in vivo*and, most importantly, as a desired result for cancer treatment, is very limited and a rather new field of research. Senescence was originally applied to the irreversible growth arrest of cells after prolonged proliferation under *in vitro*cell culture conditions. Now it has been extended to the irreversible proliferation arrest of cells caused by various stresses, including oxidative damage, telomere dysfunction, DNA damage, and oncogene induced senescence as well \[[@B19]--[@B24]\]. Tumour cells are exposed to many different---external as well as internal---sources of stress; therefore the induction of senescence constitutes an important block to tumour progression \[[@B18]\]. Senescence is a potent anticarcinogenic program and the process of neoplastic transformation involves series of events that allow cells to bypass senescence by inactivation of senescence associated pathways. Still, many tumour cells have retained the capacity to senesce in response to external stress stimuli. Most conventional anticancer therapies activate DNA damage signaling pathways, which aim to induce primarily apoptotic cell death but often treated cells do not die by apoptosis but rather undergo growth arrest or senescence. It is not fully understood currently which specific signals cause cells to undergo either senescence or initiate apoptosis \[[@B18]\]. Senescence runs parallel with an accumulation of damaged proteins at the molecular-cellular level. The attenuation of molecular chaperone inducibility and the simultaneous accumulation of damaged proteins raise the possibility that preservation of protein homeostasis is a major determinant in the occurrence and duration of cellular senescence \[[@B25]\].
The cellular and molecular effects of the proteasome inhibitor---bortezomib---on human skin fibroblasts are as yet poorly characterised. Its participation in senescence process remains unclear. We decided to study the effect of bortezomib on apoptosis and senescence of human skin fibroblasts incubated in hypoxia in comparison to normoxic conditions. We investigated the effect of bortezomib on the activity of senescence marker SA-*β*-galactosidase and induction of ORP150 chaperon in normal fibroblasts incubated in hypoxic and normoxic conditions and its correlation with apoptosis of these cells.
2. Materials and Methods {#sec2}
========================
2.1. Reagents {#sec2.1}
-------------
Dulbecco\'s modified Eagle\'s medium (DMEM), containing glucose at 4.5 mg/mL (25 mM) with Glutamax, penicillin, streptomycin, and trypsin-EDTA were provided by Invitrogen (San Diego, USA), passive lysis buffer by Promega (Madison, USA), FBS Gold by Gibco (USA), BCA Protein Assay Kit by Thermo Scientific (USA), PE Annexin V Apoptosis Detection Kit I by BD Pharmingen (USA), Senescence Detection Kit by bioVision (USA), Sigma-Fast BCIP/NBT reagent, and alkaline phosphatase-labelled anti-mouse immunoglobulin G (IgG) by Sigma (St. Louis, USA). The monoclonal antihuman ORP150 antibody was purchased from IBL (Gunma, Japan) and anti-HIF-1*α* antibody from BD Transduction Laboratory (USA).
2.2. Cell Cultures {#sec2.2}
------------------
Normal human skin fibroblasts cell line (CRL1474) were obtained from American Type Culture Collection (ATCC). Cells were maintained in high glucose DMEM supplemented with 10% heat-inactivated foetal bovine serum GOLD (FBS GOLD), 2 mM L-glutamine, penicillin (100 U/mL), and streptomycin (100 *μ*g/mL). Cells were cultured in Falcon flasks (BD) in a 5% CO~2~ incubator (Galaxy S+; New Brunswick), at 37°C. Subconfluent cultures were detached with 0.05% trypsin 0.02% EDTA in calcium-free phosphate-buffered saline (PBS) and counted in cells counter Scepter (Millipore).
2.3. Cell Viability {#sec2.3}
-------------------
Cell viability was measured according to the method of Carmichael et al. \[[@B26]\] using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT). Briefly, cells were seeded in 24-well plate at a density of 5 × 10^4^ per well. Confluent cells, cultured for 12 h, 24 h, and 48 h in normoxic conditions with different concentrations of bortezomib, were washed three times with PBS and then incubated with 1 mL of MTT solution (0.25 mg/mL in PBS) for 4 h at 37°C in 5% CO~2~ in an incubator. The medium was removed and 1 mL of 0.1 mol/L HCl in absolute isopropanol was added. Absorbance of converted dye in living cells was measured at wavelength of 570 nm. The viability of fibroblasts cultured in hypoxic conditions was calculated as percentage of control cells, incubated in normoxia. All the experiments were done in triplicate in at least three cultures.
2.4. Induction of Hypoxia in Cell Cultures {#sec2.4}
------------------------------------------
The cells (2.5 × 10^5^ in 2 mL of medium) were seeded in six-well plates and incubated until they achieved confluence (about 48 h). The high glucose DMEM was removed and replaced with 2 mL of the same fresh | {
"pile_set_name": "PubMed Central"
} |
The melting temperatures of lower mantle minerals are fundamental properties for understanding the evolution of the Earth from an early magma-ocean state to now, and for understanding the likelihood of melting in the current deep Earth (i.e., in Ultra Low Velocity Zones, ULVZs). Orthorhombic MgSiO~3~ perovskite (now bridgmanite[@b1]) is the end-member of the most voluminous phase in the lower mantle and so its melting temperature is a key cornerstone to any comprehensive understanding of lower mantle melting. Despite this, considerable doubt remains as to its high-pressure melting temperature.
At low pressures (\~25 GPa) the melting temperature of bridgmanite is reasonably well constrained from multi-anvil experiments to be between about 2800 and 2900 K (Ito and Katsura)[@b2]. This agrees well with more recent experiments of Liebske and Frost[@b3]. At higher pressure, however, there is little agreement between different studies. First of all, there are currently no static experimental measurements on the high-pressure melting T of perovskite above 100 GPa. The early diamond anvil cell experiments of Heinz and Jeanloz[@b4] and Knittle and Jeanloz[@b5] produced extremely flat melting curves and, therefore, very low high-pressure melting temperatures (\<4000 K at 100 GPa). These low melting temperatures have not been reproduced by other experiments or by theoretical estimates, and are likely to underestimate the high pressure melting temperature of bridgmanite. Other than these, the highest pressure static experiments only reach about 60 GPa. The higher pressure melting curve is constrained by a single shock-wave measurement of Akins *et al*.[@b6], which produced a melting temperature of 5500 K at 110 GPa.
The lack of high-pressure data has driven many attempts to estimate the melting temperature of bridgmanite by extrapolating the lower pressure data with simple melting equations, or by using theoretical methods such as molecular dynamics. However, these produce widely varying melting curves. For instance, simple extrapolations of the low-pressure data with various different melting equations predict melting temperatures ranging from 6800 K to \~8000 K at 120 GPa (Zerr and Boehler[@b7]). Lower melting temperatures of around 6000 K at 120 GPa were found using molecular dynamics simulations (Belonoshko[@b8]) and a temperature near 5200 K was found by Stixrude and Karki[@b9]. In this study they used the low-pressure melting temperature of Ito and Katsura[@b2] to anchor the melting curve and then used the Clapeyron slope from enthalpies and volumes from *ab initio* molecular dynamics (AIMD) simulations to extrapolate the melting curve to higher pressures. An even lower melting temperature of 5000 K at 120 GPa was suggested by Mosenfelder *et al*.[@b10] using equations of state constrained from shock-experiments.
It is fair to say, therefore, that current estimates for the melting temperature of the MgSiO~3~ end-member of bridgmanite at 120 GPa range from somewhere between 5000 K and 8000 K.
In this study we estimate the melting temperature of bridgmanite at 25 GPa and 120 GPa using the so-called two-phase model (2P phase) and *ab initio* molecular dynamics. This method avoids overheating issues typical of melting a fully solid system and has been used in a number of studies to produce melting temperatures for a range of materials[@b11][@b12][@b13][@b14][@b15][@b16][@b17][@b18][@b19][@b20][@b21][@b22][@b23][@b24][@b25][@b26][@b27]. As described in Methods section, a system of coexisting solid and liquid is set up and allowed to evolve through time. If the system melts, we assume it is above its melting temperature, and if it solidifies then it is below the melting temperature. If solid and liquid coexist, we assume it is on the melting temperature. This is an elegant and simple method used many times in the past (Fe, Al[@b28][@b29][@b30][@b31][@b32][@b33][@b34][@b35][@b36][@b37][@b38][@b39]). However, as discussed below, diffusion is relatively slow in silicate melts even near the melting temperature, and the system takes a long time to melt and appears to coexist at hundreds of degrees above its melting temperature. This is particularly a problem when using *ab initio* forces since the calculations are restricted to 100 ps or so, and we would predict melting temperatures that are too high. We show, however, that we can use the results from much cheaper empirical potential simulations to extrapolate the *ab initio* simulations to much longer timescales and produce very accurate melting temperatures.
Results
=======
In order to account for the very long times it can take the two-phase system to melt, while at the same time keeping the accuracy of the *ab initio* forces and energies, we characterised the melting kinetics (time to melting) using a classical empirical potential model and extremely long simulation times. To do this we used the Matsui pair-potential[@b40]. This potential model was designed to describe the MgSiO~3~ perovskite solid crystal over a small range of pressures and temperatures, and produces melting temperatures that are somewhat higher than via first principles (FP) methods. However, as we show later, diffusion rates and coordination numbers are very similar to those obtained *ab initio*, and so we use the classical potential to correct the *ab initio* simulations to infinite time.
To minimise any differences between the classical and DFT results, simulations were run in an NVT ensemble at the *ab initio* volume of the liquid at the target pressure (found via a set of fully liquid NPT simulations at 25 GPa and 120 GPa), using the coexistence approach for the model and recording the time it takes the system to melt as a function of temperature. The detailed procedure can be found in the [Supplementary Information](#S1){ref-type="supplementary-material"}.
[Figure 1](#f1){ref-type="fig"} shows the time, *τ*, it took the two-phase system to melt at different temperatures using the classical potential model. The results are shown for two pressures (25 GPa and 120 GPa). At very high temperatures the two-phase system melts very quickly, while *τ* increases dramatically as the temperature of the system approaches the solid-liquid transition point. The error bars are the uncertainties obtained from 10 trials per temperature, and show that the time to melting for the same temperature can vary quite significantly for different starting conditions (i.e., initial atomic velocities). This is particularly pronounced near the melting temperature.
The T-*τ* profile cannot be fit via a single activation energy or rate constant, and suggests that the perovskite melting process is dominated by different kinetics at than at temperatures closer to the melting temperature. An explanation for this behaviour comes from an interpretation of the melting process of solids by Samanta *et al*.[@b41]. Metadynamics calculations showed that the melting of a solid proceeds through multiple barrier-crossing events and competitive pathways when the temperature is relatively close to the melting point. On the other hand, when the system is heated to temperatures much higher than T~*M*~, the solid melts via a single step process with a small activation energy. We have, therefore, adopted a similar multi-barrier formulation to interpolate (*R*^2^ = 0.99) our melting time T-*τ* curve with a '2-rate exponential decay' model:where *T*~*M*~ is the melting temperature at the desired pressure, *κ*~*s*~ and *κ*~*f*~ (in ps^−1^) represent the kinetic constants for the slow and fast processes respectively and the pre-exponential factors *A* and *B* (in Kelvin) define the percentage of the fast process that spans between the fastest point to the melting temperature *T*~*M*~ as follows: .
Using this kinetic model, we tentatively suggest three different behaviours of the two-phase system of MgSiO~3~ around the melting point: 1) close to the melting point the slow kinetics is dominated by very low diffusion coefficients associated to Mg, Si and O in the melt; 2) at higher temperatures faster melting rates are associated to a very low transition barrier due to the solid becoming vibrationally unstable; 3) for temperatures in between the kinetics derives from a balance between the stability of the solid and the diffusivity of the liquid phase. Regardless of the exact mechanisms, this provides a convenient way of parameterising T vs *τ*, and moreover, for obtaining the true melting temperature for a set of simulations well above the actual melting point.
By fitting the two-rate equation we find a melting point of T~*M*~ = 3016 ± 35 K (as standard error of the mean SEM) and T~*M*~ = 5463 ± 15 K at 25 and 120 GPa, respectively. The fit to this is shown in [Fig. 1](#f1){ref-type="fig"}. We also find that the kinetic constants are weakly dependent on the pressure and that the fast rate is one order of magnitude smaller than the slower one. Moreover, it has to be noticed that the statistical value of %~*fast*~ calculated at both pressures | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
It has long been known that cancer cells hijack cellular programs that regulate survival, growth and proliferation, leading to tumor formation and progression. The best-known causes of malignant transformation are the genetic and epigenetic changes that induce stem-cell-like properties, such as unlimited cell division and blocked differentiation. Traditionally, the proposed role of the cellular metabolism of cancer cells was to primarily support and sustain malignant growth. However, it is clear today that cellular metabolism actively regulates the malignant phenotype. For example, loss of the p53 tumor suppressor may contribute to malignant transformation independently of its well-described functions in cell cycle regulation, DNA repair and senescence (see [Box 1](#DMM034272B1){ref-type="boxed-text"} for a glossary of terms). Instead, through the induction of glycolysis and anabolic pathways ([Box 1](#DMM034272B1){ref-type="boxed-text"}), p53 dysfunction leads to an early-onset metabolic malignant transformation ([@DMM034272C63]). Another example of a key role of a mutation-driven metabolic reprogramming leading to malignant transformation are oncometabolites. For example, a consequence of loss-of-function mutations in succinate dehydrogenase (SDH; [Box 1](#DMM034272B1){ref-type="boxed-text"}) is that cancer cells can massively accumulate succinate, an intermediate metabolite in the tricarboxylic acid (TCA) cycle. Intriguingly, succinate, now in the role of an oncometabolite, can induce epigenetic alterations through the inhibition of α-ketoglutarate-dependent dioxygenases ([@DMM034272C117]), ultimately leading to a malignant phenotype ([@DMM034272C115]). Some features of metabolic reprogramming in cancer have, however, been puzzling, such as the Warburg effect, in which tumor cells increase glucose consumption and lactate excretion ([@DMM034272C111]). This phenotype is energetically inefficient compared to mitochondrial respiration, and could theoretically limit tumor growth in glucose-depleted tissues. However, anaerobic glycolysis can be beneficial if the malignant cell requires a high metabolic flux to synthesize building blocks such as nucleotides. Moreover, this phenotype can induce a unique metabolic milieu with low glucose and high lactate ([@DMM034272C22]; [@DMM034272C53]; [@DMM034272C100]). Intriguingly, evidence from murine *in vitro* and *in vivo* models suggests that glucose deprivation and lactate accumulation in the tumor microenvironment can have detrimental effects on the immune cells that were poised to infiltrate and destroy tumors ([@DMM034272C20]; [@DMM034272C22]).
Box 1. Glossary**^13^C-labeling:** method to interrogate intracellular metabolic pathways. Detection of labeled metabolites is performed using nuclear magnetic resonance spectroscopy.**Anabolic pathways:** synthesis of macro-molecules out of smaller biochemical components.**CD4+ T cells:** T cells expressing CD4. Often referred to as 'helper' T cells; can differentiate to inflammatory ('effector') and anti-inflammatory ('regulatory') subtypes.**CD4+ Treg cells:** CD4+ T cells with regulatory properties. Usually described by high CD25 and FOXP3 expression. Critical for maintenance of self-tolerance.**CD8+ T cells:** T cells expressing CD8. Often referred to as 'cytotoxic' T cells; capable of direct engagement with infected cells or tumor cells.**Chimeric antigen receptor (CAR)-transduced T cells:** engineered effector T cells, recognizing specific antigens expressed by tumor cells, such as CD22 in B-cell leukemia.**Costimulatory receptors:** in addition to T-cell receptor (TCR) stimulation, ligation of costimulatory receptors such as CD28, CD137 and ICOS increases or modulates T-cell activation.**Germinal center:** area in lymphoid follicles where B cells become activated, proliferate intensively after antigen contact, switch immunoglobulin class and increase affinity for the antigen.**Granzyme-B and perforin:** cytolytic molecules stored in the granules of cytotoxic T cells and natural killer (NK) cells.**Immune checkpoint inhibitors:** monoclonal antibodies that block immune inhibitory pathways such as CTLA-4, PD-1 and PD-L1, and induce immune-cell activation.**Interferon-ɣ (IFN-ɣ):** inflammatory cytokine, mainly produced by T cells and NK cells, with anti-tumoral, anti-viral and immunostimulatory properties.**L-kynurenine:** product of L-tryptophan degradation through tryptophan dioxygenase and indoleamine 2,3-dioxygenase.**Lymphoid/lymphatic organs:** spleen, bone marrow, thymus, appendix, lymph nodes, lymph vessels and tonsils. Critical for formation, maturation, differentiation and activation of immune cells.**Myeloid-derived suppressor cells (MDSCs):** heterogeneous population of immature myeloid cells consisting of precursors for granulocytes, macrophages or dendritic cells. Associated with resolution of inflammation and tumor progression.**Pentose phosphate pathway (PPP):** series of metabolic steps leading to degradation of glucose to pentoses via the formation of NADPH and carbon dioxide.**Plasma cells:** differentiated B cells capable of antibody production and secretion.**Programmed death 1 (PD-1) receptor:** surface protein on activated T cells repressing an immune response. Activated through PD-1 ligands (PD-L1, PD-L2), which are expressed in various tissues, including tumors.**Retinoic acid receptor-related orphan receptor gamma (RORɣt):** ligand-dependent transcription factor expressed only in cells of the lymphoid compartment, typically in CD4+ T cells secreting IL-17 (Th17 cells).**Senescence:** age-related alterations in all stages of immune-cell development.**Succinate dehydrogenase (SDH):** also known as respiratory complex II; catalyzes the oxidation of succinate to fumarate with the reduction of ubiquinone to ubiquinol.**Toll-like receptor (TLR) ligands:** ligands to the pattern recognition receptors and activator of innate immune cells; e.g. microbial cell wall components (e.g. lipopolysaccharide) and viral molecules.**Tumor-draining lymph nodes:** closest lymph nodes to the tumor. Typically a primary site of tumor dissemination.
Cancers are highly diverse and, in addition to the genetic and functional heterogeneity of malignant cells, a broad spectrum of immune populations can be found in human tumor tissue. Among adaptive immune cells, the tumor-infiltrating T cells are the best documented. T cells are highly heterogeneous, and various phenotypic sub-populations \[CD4+ and CD8+ T cells ([Box 1](#DMM034272B1){ref-type="boxed-text"})\] and functional (effector, memory) and differentiation \[CD4+ Th1, CD4+ Treg ([Box 1](#DMM034272B1){ref-type="boxed-text"})\] states have been identified. T cells can affect tumor growth either through direct engagement or through stimulation of other cells in the tumor microenvironment. This feature has been exploited in clinical approaches that aim to increase their anti-tumor potential, such as through blockade of the T-cell-inhibitory PD-1 receptor ([Box 1](#DMM034272B1){ref-type="boxed-text"}), or through employment of *ex vivo* engineered chimeric antigen receptor (CAR)-transduced T cells ([Box 1](#DMM034272B1){ref-type="boxed-text"}). The tumor infiltration with B cells is less well documented, but both their pro- and anti-tumorigenic functions ([@DMM034272C106]) are intriguing and require extensive elucidation in future studies.
The interaction of adaptive immune cells with cells of innate immunity is critical for an effective and well-regulated response, and innate immune cells are often found in tumors. Indeed, the first immune cells to be described in human tumors were macrophages ([@DMM034272C62]). Outside of the context of cancer, these innate immune cells are responsible for fast clearance of pathogen-infected cells during infections. Upon stimulation with interferon-γ (IFN-γ) and toll-like receptor (TLR) ligands ([Box 1](#DMM034272B1){ref-type="boxed-text"}), macrophages polarize to a pro-inflammatory (M1) phenotype, with an anti-tumor potential ([@DMM034272C119]). Additionally, macrophages can also polarize toward an anti-inflammatory phenotype with pro-tumoral characteristics through alternative activation (M2) when stimulated with IL-4 and IL-10. M1 and M2 macrophages participate in inflammatory responses and modulate tissue homeostasis and repair through their distinct functional specialties ([@DMM034272C71]). Hence, macrophages must be highly plastic to adapt their functions in response to infection and tissue damage. Emerging evidence reveals that macrophages engage distinct metabolic demands during M1 and M2 activation. For example, M1 macrophages enhance their anabolic metabolism, including anaerobic glycolysis, pentose phosphate pathway ([Box 1](#DMM034272B1){ref-type="boxed-text"}) activation and fatty acid synthesis. In contrast, M2 macrophages prefer catabolic metabolism and heavily utilize oxidative phosphorylation (OXPHOS) to support their metabolic demands ([@DMM034272C48]). These changes provide metabolic checkpoints to fine-tune macrophage behavior and contribute to their altered functions in diseases, especially in the tumor microenvironment. Also part of the innate immunity, natural killer (NK) cells are critical for direct engagement and killing of cells identified as non-self. Accordingly, they have the potential to destroy cancer cells ([@DMM034272C70]). Compared to T cells and macrophages, NK cell metabolism is | {
"pile_set_name": "PubMed Central"
} |
{.719}
{.720}
{.721}
{.722}
{.723}
| {
"pile_set_name": "PubMed Central"
} |
Background
==========
Ischemia is a condition of poor oxygen supply to the tissues; prolonged ischemia and subsequent reperfusion causes severe irreversible damage to the myocardium \[[@b1-medscimonit-22-1250],[@b2-medscimonit-22-1250]\]. Consequences of myocardial ischemia reperfusion (MI/R) injury include thrombolysis, angioplasty, coronary by-pass, and heart transplantation \[[@b3-medscimonit-22-1250]--[@b6-medscimonit-22-1250]\]. Mediation of reperfusion injury is multifactorial and includes increased production of oxygen free radicals, Ca^2+^ levels, loss of membrane phospholipids, and endothelial dysfunction \[[@b7-medscimonit-22-1250],[@b8-medscimonit-22-1250]\]. These factors lead to changes in myocardial functional status. Oxidative stress is one of the key mediators of MI/R injury. Increased reactive oxygen and nitrogen species target cellular protein and lipid moieties. These reactive species arise from the arachidonic acid pathway, mitochondrial electron transport chain, and through neutrophil activation \[[@b9-medscimonit-22-1250]\]. In recent years, antioxidants have gained much importance in preventing I/R injury because these compounds acts as redox balancers. Antioxidant molecules directly scavenge the free radicals and also induce antioxidant enzyme activities to mediate protective effects.
Plumbagin (5-hydroxy-2-methyl-1, 4-naphthoquinone) is a potent antioxidant. Plants rich is this compound were used in ancient times for protection against heart and liver diseases and for their neuroprotective properties \[[@b10-medscimonit-22-1250]\]. Plumbagin had been reported to mediate anti-inflammatory, analgesic, and anti-arthritic activities \[[@b11-medscimonit-22-1250],[@b12-medscimonit-22-1250]\]. Various studies have reported a potential role in anti-cancer effects, including cancers in the breasts \[[@b13-medscimonit-22-1250]\] and lungs \[[@b14-medscimonit-22-1250]\], as well as leukemia \[[@b15-medscimonit-22-1250]\], melanoma \[[@b16-medscimonit-22-1250]\], prostate cancer \[[@b17-medscimonit-22-1250]\], and osteosarcoma \[[@b18-medscimonit-22-1250]\]. Plumbagin modulates redox status through targeting oxidative stress and redox-sensitive transcription factor (NF-κB) \[[@b19-medscimonit-22-1250],[@b20-medscimonit-22-1250]\]. Further, inflammation-associated cytokine expression was significantly reduced by plumbagin and it effectively reduces inflammation and prevents endotoxemia \[[@b21-medscimonit-22-1250]\]. The potential role of plumbagin in prevention of oxidative stress-associated diseases and other important biological functions \[[@b22-medscimonit-22-1250]\], as well as antifungal \[[@b23-medscimonit-22-1250]\] and anti-atherosclerotic \[[@b24-medscimonit-22-1250]\] action have been reported. In the present study, we aimed at understanding the protective role of plumbagin against MI/R injury and its mechanism.
Material and Methods
====================
Animals and myocardial ischemia-reperfusion (I/R) treatment
-----------------------------------------------------------
Male C57BL6/J mice 8--12 weeks of age were used for the present study. All experimental procedures were approved and followed the guidelines of the Institute for Animal Care and Use Committee at the Chinese Ministry of Education and Chinese Ministry of Health, Qilu Hospital, China. The animals were maintained in separate cages with controlled conditions of temperature (22±1^o^C) and relative humidity (70--72%) with alternate dark and light cycles. The animals were acclimatized to their environment for 1 week and fed with standard rat pellets and water ad libitum. Surgical ligation of the left coronary artery (LCA) was performed as described previously \[[@b25-medscimonit-22-1250]\]. The rats were randomly divided into 4 groups with 10 animals in each (n=10): Group 1 (sham); Group 2 (plumbagin); Group 3 (MI/R injury); and Group 4 (plumbagin+ MI/R group) subjected to 45 min of myocardial ischemia followed by 4 h of reperfusion. Animals with MI/R injury received plumbagin (5 mg/kg) with i.p. injection 1 h before the reperfusion. A preliminary study was carried out with different plumbagin concentrations (2.5, 5, and 10 mg/kg) (data not shown); however, 5 mg/kg showed better cytoprotection. Therefore, further studies were performed with this dose. After the treatment, the hearts were removed and the LV was frozen in liquid nitrogen and stored at −80°C.
Oxidative stress parameters
---------------------------
### Lipid Peroxidation
The lipid peroxidation content was determined as described by Ohkawa et al. \[[@b26-medscimonit-22-1250]\]. Thiobarbituric acid reactive substance (TBARS) was measured spectrophotometrically at 532 nm.
### Reactive oxygen species
The tissue samples were incubated in 50 μl of a 30-μM c-H~2~DCFDA stock solution for 30 min. The reaction mixture was centrifuged and fluorescent intensity was measured using a 485/520-nm filter set. The results are expressed as percentage of ROS generation \[[@b27-medscimonit-22-1250]\].
Antioxidant status
------------------
### Non-enzymic antioxidant -- Glutathione
The total GSH content was determined using Cayman's GSH assay kit. The principle involves the reaction between the sulfhydryl group of GSH and DTNB (5, 5′-dithiobis-2-nitrobenzoic acid) in the presence of glutathione reductase. The formation of 5-thio-2-nitrobenzoic acid (TNB) in reaction with Ellman's reagent was measured at 412 nm.
#### Enzymic antioxidant activity -- GST
The principle involves measurement of the conjugation product of 1-chloro-2, 4-dinitro benzene (CDNB) with reduced glutathione, which is measured 340 nm. One unit of GST activity is the amount of enzyme producing 1 mmol of CDNB-GSH conjugate/min \[[@b28-medscimonit-22-1250]\].
#### GPx
The principle involves reduction of oxidized glutathione (GSSG) formed during GPx reaction, which is reduced by nicotinamide adenine dinucleotide phosphate (NADPH) and glutathione reductase. Thus, the rate of NADPH consumption is proportional to GSSG formation. The kinetic change was measured at 340 nm (37°C) for 3 min. GPx activity was expressed as mmol of NADPH oxidized/minute/mg protein (U/mg protein) \[[@b29-medscimonit-22-1250]\].
#### Catalase
The CAT activity was measured as described by Clairborne (1985) \[[@b30-medscimonit-22-1250]\]. The principle involves the measurement of CAT activity by the rate of H~2~O~2~ degradation, which was measured at 230 nm. The results are expressed as H~2~O~2~ consumed/min/mg protein.
#### SOD
The SOD activity was estimated as described by Kakkar et al. (1985) \[[@b31-medscimonit-22-1250]\]. Superoxide dismutase (SOD) activity is based on the inhibition of the formation of (NADH-PMS-NBT) complex. 1 U of SOD activity is calculated as a 50% reduction in NBT/1 min. The results are expressed as U/mg of protein.
### ELISA: MCP-1, TNF-α, IL-6, and IL-8 levels
The serum cytokines were measured using Cayman's EIA kit (Cayman Chemicals, Ann Arbor, MI). The protocol was performed as described in the manufacturer's instructions. The interleukin levels are expressed as pg/ml.
Western blot analysis
---------------------
The tissues (20 mg) were placed in pre-chilled glass petri dishes and minced on ice using sharp scissors followed by addition of 200 μL of cytoplasm isolation buffer (10 mM HEPES-KOH, pH 7.9, at 4°C, 1.5 mM MgCl~2~, 10 mM KCl, 0.5 mM DTT, and 0.2 mM PMSF) incubated on ice for 15 min and centrifuged at 13 000 rpm for 20 min. The supernatant containing the cytoplasm was discarded. Nuclear extract was isolated from the remaining pellets. We added 50 μL of nuclear fraction isolation buffer (20 mM HEPES-KOH, pH 7.9 at 4°C, 25% glycerol, 420 mM NaCl, 1.5 mM MgCl~2~, and 0.2 mM EDTA) incubated for 40 min in ice and vortexed at 10-min intervals. The mixture was centrifuged at 13 000 rpm for 5 min. The supernatant containing the nuclear extract was aliquoted in separate tubes and stored at −80°C for further analysis. Approximately 50 μg of protein was loaded on 12% SDS-PAGE gels and resolved at 100 V for 2 h. The proteins were transferred into PVDF membranes. Membranes were blocked with skimmed milk for 1 h. Later, the blots were washed and incubated with primary antibodies directed against NF-κB-p65 and COX-2 (1: 1000, Calbiochem, La Jolla, CA) and Nrf-2, HO-1, NQO1, and GST (1:1000, Santa Cruz Biotechnology, Santa Cruz, CA) proteins overnight at 4°C. After washing in TBST, we added secondary antibody (horseradish peroxidase-coupled rabbit IgG | {
"pile_set_name": "PubMed Central"
} |
######
Key Messages
CPRD data have been extensively used for observational research. For example, the data were used to show that there was no association between MMR vaccine and autism, and to show an association between oral corticosteroid use and increased risk of fractures.The CPRD has a large UK dataset bringing together longitudinal primary care medical records from participating practices. Over half of CPRD patients are eligible for linkage to additional datasets, including hospital data, national cancer registration data and national mortality records.Quality of some data is driven by the Quality and Outcomes Framework in the UK, and data are also monitored by CPRD internal processes. Analyses described in this paper show that active (alive, currently registered) CPRD patients are representative of the UK population in terms of age and sex.CPRD data originate from routine clinical practice, and their use for epidemiological studies typically requires extensive data processing and an understanding of the way the data are originally recorded and stored.
Data resource basics
====================
UK primary care data for research
---------------------------------
Over 98% of the UK population are registered with a primary care general practitioner (GP)[@dyv098-B1] and under the National Health Service (NHS), visits to the GP are free of charge. The GP is the gatekeeper of care in the UK National Health Service. GPs act as the first point of contact for any non-emergency health-related issues, which may then be managed within primary care and/or referred to secondary care as necessary. Secondary care teams also feed back information to GPs about their patients, including key diagnoses. Patient data are routinely recorded onto computers by practice staff, against a unique patient NHS number. These facets of UK primary care provide good capture of health information in a longitudinal electronic health record.
The Clinical Practice Research Datalink (CPRD)
----------------------------------------------
The CPRD harnesses general practice data and produces a primary care dataset, which is one of the largest databases of longitudinal medical records from primary care in the world ([Table 1](#dyv098-T1){ref-type="table"}). Established in London in 1987, the small Value Added Medical Products (VAMP) dataset grew to become the General Practice Research Database (GPRD) in 1993,[@dyv098-B2]^,^[@dyv098-B3] before expanding to become the CPRD in 2012. The CPRD collates routinely collected anonymised electronic health record data from general practices who have agreed at a practice level to provide data on a monthly basis. All patients registered with the participating practices are included in the dataset, unless they have individually requested to opt out of data sharing, by asking their GP to amend their registration details on the system to disable the extraction of their data. Table 1.Key details about the Clinical Practice Research DatalinkCounties participatingUK: England, Wales, Scotland and Nortdern IrelandWho is included?Patients registered at general practices that contribute data to CPRD, who have not dissented from secondary use of GP patient-identifiable dataWhat is recorded?Demographics, diagnoses, symptoms, signs, prescriptions, referrals, immunisations, behavioural factors, testsPeriod of data collection1987 to presentAverage duration of follow-up 5.1 yearsFunding sourceCPRD has received funding from the MHRA, Wellcome Trust, Medical Research Council, NIHR Health Technology Assessment programme, Innovative Medicines Initiative, UK Department of Health, Technology Strategy Board, Seventh Framework Programme EU, and various universities, contract research organizations and pharmaceutical companies
Data linkage
------------
A subset of English practices (currently 75%, representing 58% of all UK CPRD practices) have consented to participate in the CPRD linkage scheme and have provided patient-level information. Patient-level data from consenting practices are linked via a trusted third party (the Health and Social Care Information Centre[@dyv098-B4]) to other existing data sources. Established linkages include Hospital Episode Statistics[@dyv098-B5] (hospitalisation data), Office for National Statistics[@dyv098-B6] (mortality data including causes of death), Index of Multiple Deprivation and Townsend scores (deprivation data)and disease registries including the National Cancer Intelligence Network,[@dyv098-B7] and the Myocardial Ischaemia National Audit Project[@dyv098-B8] (details in [Supplementary Table 1](http://ije.oxfordjournals.org/lookup/suppl/doi:10.1093/ije/dyv098/-/DC1), available as [Supplementary data](http://ije.oxfordjournals.org/lookup/suppl/doi:10.1093/ije/dyv098/-/DC1) at *IJE* online). Other linkages are planned (see CPRD website[@dyv098-B9]) and researchers can make requests for bespoke linkage for individual studies.
Uses for observational research and interventional research
-----------------------------------------------------------
Subject to the appropriate data governance and approvals, the CPRD can supply primary care and linked patient data to researchers in the UK and internationally. Through the CPRD, researchers can approach practices and patients to take part in biosample collection studies or trials. The feasibility of this work has been tested: patients from the CPRD have been recruited to a pharmacogenetic study of statin-induced myopathy,[@dyv098-B10]^,^[@dyv098-B11] practices have been recruited to cluster randomised trials[@dyv098-B12]^,^[@dyv098-B13] and patients have been recruited to pragmatic point-of-care randomised trials.[@dyv098-B14] The electronic health record data can be used alongside the study data to provide a full clinical picture for the recruited patients.
Ethics
------
The CPRD has broad National Research Ethics Service Committee (NRES) ethics approval for purely observational research using the primary care data and established data linkages. Other uses of CPRD data may require separate ethical approval. This is likely if there is any specific patient involvement in the study; for example, if the researcher wishes to ask patients to complete a questionnaire for Patient Reported Outcomes, or to conduct an interventional trial among CPRD patients.
Data governance, practice and patient confidentiality
-----------------------------------------------------
The CPRD strives to operate within UK and European laws to protect confidentiality. Governance requirements to protect patient confidentiality where patient consent has not been obtained are respected by ensuring that patient identifiers are held separately from the clinical data and that there is separation between researchers with access to identifiable information from the primary study and those using CPRD data.
Funding sources
---------------
The CPRD is a joint venture from the Medicines and Healthcare Regulatory Agency (MHRA) and the National Institute for Health Research (NIHR).The CPRD is owned by the UK Department of Health and operates within the MHRA. The CPRD has received funding for studies from the MHRA, Wellcome Trust, Medical Research Council, NIHR Health Technology Assessment programme, Innovative Medicines Initiative, UK Department of Health, Technology Strategy Board, Seventh Framework Programme EU and various universities, contract research organizations and pharmaceutical companies.
Data resource area and population coverage
------------------------------------------
[Figure 1](#dyv098-F1){ref-type="fig"} describes the population coverage of CPRD primary care data across England, Wales, Scotland and Northern Ireland. At the mid-year date of 2 July 2013, the dataset held information on 11.3 million patients who were deemed acceptable for research based on data quality checks (Appendix 1, available as [Supplementary data](http://ije.oxfordjournals.org/lookup/suppl/doi:10.1093/ije/dyv098/-/DC1) at *IJE* online, and described below). The population of active patients (alive and currently registered) on 2 July 2013 was 4.4 million, representing 6.9% of the total UK population (based on the UK 2013 mid-year population of 64.1 million). The remaining 6.9 million records represent inactive patients who have died or are no longer registered with a participating practice. Patient numbers by age, sex, deprivation, ethnicity and region are described in [Table 2](#dyv098-T2){ref-type="table"}. Figure 1.Distribution of 674 CPRD practices by region in England, and in Wales, Scotland and Northern Ireland.Note: practices mapped are those contributing up to standard data to the dataset on 2 July 2013, based on the January 2014 dataset build Table 2.Demographic characteristics of acceptable CPRD patients (January 2014 dataset build), and the subset of those active on 2 July 2013All patientsActiveNo. patients112992214425016Men, *n* (%)5478715 (48.5)2183161 (49.3)Women, *n* (%)5820506 (51.5)2241855 (50.7)Age in 2013, *n* (%) (years) \<18-- 742765 (20.2) 18-64-- 4402926 (61.8) 65+-- 1728514 (18.1)Region, *n* (%) North East184753 (1.6)67639 (1.5) North West1257846 (11.1)523356 (11.8) Yorkshire & The Humber441933 (3.9)48480 (1.1) East Midlands446799 (4)29954 (0.7) West Midlands943011 (8.4)394115 (8.9) East of England1117235 (9.9)306538 (6.9) South West943295 (8.4)377821 (8 | {
"pile_set_name": "PubMed Central"
} |
The authors confirm that all data underlying the findings are fully available without restriction. The toolbox and the scripts to generate all simulated data are available at this address: <http://dx.doi.org/10.6084/m9.figshare.1005245>; the cardiovascular data are included in the toolbox package; the epilepsy data are available at this address: <http://math.bu.edu/people/kolaczyk/datasets.html>.
Introduction {#s1}
============
Since its first introduction by Schreiber [@pone.0109462-Schreiber1] transfer entropy (TE) has been recognized as a powerful tool to detect the transfer of information between joint processes. The most appealing features of TE are that it has a solid foundation in information theory and it naturally detects directional and dynamical information. Moreover, the formulation of TE does not assume any particular model as underlying the interaction between the considered processes, thus making it sensitive to all types of dynamical interactions. The popularity of this tool has grown even more with the recent elucidation of its close connection with the ubiquitous concept of Granger causality [@pone.0109462-Barnett1], which has led to formally bridge information-theoretic and predictive approaches to the evaluation of directional interactions between processes. Given all these advantages, TE has been increasingly used to assess the transfer of information in physiological systems with several applications in neurophysiology [@pone.0109462-Wibral1]--[@pone.0109462-Gourvitch1]. It is worth noting that speaking of the transfer of information as measured by TE we refer to the "predictive information transfer" intended as the amount of information added by the past (and present) states of a source process to the present state of a target process.
The estimation of TE from time series data which constitute realizations of the investigated physiological processes is complicated by a number of practical issues that need to be addressed and that are contributing to the development of several recipes to compute this measure.
In this study we discuss three different approaches (binning, nearest neighbor, linear) to evaluate the probability distribution function which constitutes the basis for TE in multivariate systems. In turn, each approach has to be paired with the choice of the time series\' past values which contribute information to the knowledge of the present state of a given target time series. The first choice is the classical uniform embedding (UE) that considers a fixed amount of past terms for each series; the second approach is quite recent and employs a non-uniform embedding (NUE) [@pone.0109462-Faes1], [@pone.0109462-Kugiumtzis1] iteratively selecting the most informative terms through an optimization criterion.
These recipes, some of them already established, some novel, are accordingly revisited or explained. Then, in order to contribute to the foundation of a common framework for the application of TE, we describe their implementation in a modular MATLAB toolbox. Several examples are presented allowing a critical comparison of UE and NUE approaches for all the three entropy estimators.
The paper is organized as follows. We first provide an overview of TE. We then distinguish between UE and NUE approaches to the representation of the history of the observed processes. We describe in detail the methods used to estimate the probabilities involved in the evaluation of the TE and their implementation in the toolbox. The approaches are then validated on synthetic time series and then tested on real data: the electroencephalogram of an epileptic patient and cardiovascular measurements in healthy subjects.
Materials and Methods {#s2}
=====================
Transfer entropy {#s2a}
----------------
Let us consider a composite system described by a set of *M* interacting dynamical subsystems and suppose that, within the composite system, we are interested in evaluating the information flow from the source system to the destination system , collecting the remaining systems in the vector . We develop our framework under the assumption of stationarity, which allows to perform estimations replacing ensemble averages with time averages (for non-stationary formulations see, e.g., [@pone.0109462-Ledberg1] and references therein). Accordingly, we denote *X*, *Y* and **Z** as the stationary stochastic processes describing the state visited by the systems , and over time, and , and as the stochastic variables obtained by sampling the processes at the present time *n*. Moreover, we denote , , and as the vector variables representing the whole past of the processes *X*, *Y* and **Z**. In some cases it can be desirable to take into account also the instantaneous influences of the candidate drivers. In this case, the vectors and defined above should contain also the present terms and . Then, the multivariate transfer entropy from *X* to *Y* conditioned to **Z** is defined as:where the sum extends over all the phase space points forming the trajectory of the composite system. (**a**) is then the probability associated with the vector variable **a** while is the probability of observing knowing the values of . The conditional probabilities used in (1) can be interpreted as transition probabilities, quantifying to which extent the transition of the target system towards its present state is affected by the past states visited by the source system . Specifically, the TE quantifies the information provided by the past of the process *X* about the present of the process *Y* that is not already provided by the past of *Y* or any other process included in **Z**.
The formulation presented in (1) is an extension of the original TE measure proposed for pairwise systems [@pone.0109462-Schreiber1] to the case of multiple interacting processes. The conditional TE formulation, also denoted as partial TE [@pone.0109462-Vakorin1], [@pone.0109462-Kugiumtzis1], rules out the information shared between *X* and *Y* that is mediated by their common interaction with **Z**. Note that the TE can be seen as a difference of two conditional entropies (CE), or equivalently as a sum of four Shannon entropies:
TE has a great potential in detecting information transfer because it does not assume any particular model that can describe the interactions governing the system dynamics, it is able to discover purely non-linear interactions and to deal with a range of interaction delays [@pone.0109462-Vicente1]. Recent research has proven that TE is equivalent to Granger Causality (GC) for data that can be assumed to be drawn from a Gaussian distribution, a case in which the data covariance is fully described by a linear parametric model [@pone.0109462-Barnett1], [@pone.0109462-HlavckovSchindler1]. This establishes a convenient joint framework for both measures. Here we evaluate GC in the TE framework and compare this model-based approach with two model-free approaches.
Reconstruction of the system\'s past states and TE evaluation {#s2b}
-------------------------------------------------------------
We will discuss here the crucial issue of how to approximate the infinite-dimensional variables representing the past of the processes. This problem can be seen in terms of performing suitable conditioned embedding of the considered set of time series [@pone.0109462-Vlachos1].
The main idea is to reconstruct the past of the whole system represented by the processes *X*, *Y*, with reference to the present of the destination process *Y*, in order to obtain a vector containing the most significant past variables to explain the present of the destination. Once *V* is computed it is easy to evaluate TE as the difference of two CEs or through the four entropies using the whole *V* or convenient subsets of it according to [equation (2](#pone.0109462.e024){ref-type="disp-formula"}).
### Uniform embedding {#s2b1}
The large majority of approaches applied so far to estimate TE implicitly follow uniform conditioned embedding schemes where the components to be included in the embedding vectors are selected a priori and separately for each time series. For instance the vector is approximated using the embedding vector , where *d* and *m* are respectively the embedding dimension and embedding delay (the same for and , approximated by and ). In this way it is possible to distinguish between a first phase during which the past states are collected and a second phase during which the estimate of the entropy, and consequently of the CE, is evaluated by means of the chosen estimator, according to the following pseudo-code:
1. build the vector ;
2. use *V* and to evaluate the last two entropies of (2) and, consequently, the lowest CE term (CE2);
3. use to evaluate the first two entropies of (2) and, consequently, the highest CE term (CE1);
4. compute TE as equal to the difference CE1--CE2.
The obvious arbitrariness and redundancy associated with this strategy are likely to cause problems such as overfitting and detection of false influences [@pone.0109462-Vlachos1]. Moreover one should assess which TE values are significant. The significance tests associated with TE estimation based on UE are different for model-based and model free estimators, and are described in the respective following subsections.
### Non-uniform embedding {#s2b2}
Non-uniform embedding constitutes the methodological advance, with respect to the state of art, that we implement as a convenient alternative to UE. This approach is based on the progressive selection, from a set of candidate variables including the past of *X*, *Y*, and considered up to a maximum lag (*candidate set*), of the lagged variables which are most informative for the target variable . At each step, selection is performed maximizing the amount of information that can be explained about | {
"pile_set_name": "PubMed Central"
} |
**To the Editor**I read the article of Yatsu et al. with great interest ([@B1]). Hypoalbuminemia is key to understanding cardiac cachexia and malnutrition, which are closely associated with a poor outcome in heart failure patients. However, I have two concerns regarding their article.
First, they used a serum albumin level of 3.4 g/dL of as the cut-off value for indicating hypoalbuminemia. The optimal cut-off might be calculated by a receiver operating characteristics analysis, despite the fact that the continuous serum albumin level was not found to be a significant predictor of the outcome in their study.
The second concern involves the observational duration. The authors showed survival durations of approximately six years; however, the number of patients at risk was very small, particularly after several years. The two curves cross also after several years. It might be better to confirm whether or not their data meet the proportional hazard before performing log-rank tests and Cox proportional hazard ratio analyses. Furthermore, generally speaking, acute diseases rarely affect long-term outcome. The short-term outcome might therefore be of more interest in patients with acute decompensated heart failure. Hypoalbuminemia with an optimal cut-off value might be useful for stratifying the short-term outcome in such populations.
**The author states that he has no Conflict of Interest (COI).**
[^1]: Correspondence to Dr. Teruhiko Imamura, <te.imamu@gmail.com>
| {
"pile_set_name": "PubMed Central"
} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.