text stringlengths 1 1.11k | source dict |
|---|---|
quantum-field-theory
Title: Do electrons have sea electrons like protons have sea quarks Do electrons have sea electrons and other stuff like protons have sea quarks? As I understand it a proton is basically 3 quarks interacting via the EM, weak and strong interaction. If you describe the interactions with Feynman dia... | {
"domain": "physics.stackexchange",
"id": 41519,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-field-theory",
"url": null
} |
ros, arduino#ros#raspberry
I tried initially to use ROS on a Radxa Rock, which had a 1.8GHz quad-core ARM CPU and 2GB of RAM. Unfortunately, I had some difficulty installing and updating the OS, and support for it appears to have waned. I haven't found any other SBC more powerful than the Raspberry Pi within my budget... | {
"domain": "robotics.stackexchange",
"id": 26691,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, arduino#ros#raspberry",
"url": null
} |
special-relativity
Title: Dropping a ball in a train moving close to the speed of light? Suppose a train is moving very close to the speed of light, say 0.999c relative to a stationary observer on Earth.
Now a stationary observer on Earth will observe clocks on the train to tick slower than usual.
Now suppose a boy w... | {
"domain": "physics.stackexchange",
"id": 13443,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "special-relativity",
"url": null
} |
ros, kinect
Comment by Gaurav K on 2020-09-14:
With steps 1 to 5 it worked for me. Thanks a lot. | {
"domain": "robotics.stackexchange",
"id": 4249,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, kinect",
"url": null
} |
water
Chemically speaking saying that water is wet has not much sense.We could, however, say that "Wetting process" is caused by the presence of a thin liquid particles layer over a material. In our specific case, this depends on the chemistry of water and the chemistry of skin. So the main causes of the fact that wat... | {
"domain": "chemistry.stackexchange",
"id": 2927,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "water",
"url": null
} |
neural-networks, objective-functions, facial-recognition
This is the method used in the github repository of your previous posts. It uses a one layer nn classifying head to output the classified class.
Advantages and disadvantages of the system
The system have the flexibility of adapting to multiple photo environment ... | {
"domain": "ai.stackexchange",
"id": 1502,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "neural-networks, objective-functions, facial-recognition",
"url": null
} |
java, android
Duplicated filterList.get(i) should assign an LanguageList tmpLang = filterList.get(i), the same for Resource res. | {
"domain": "codereview.stackexchange",
"id": 23243,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, android",
"url": null
} |
## 4 Answers
You need to take the set of all (finite) Boolean combinations of your elements $e_\mathbb{N}(n)\in 2^{2^{\mathbb{N}}}$ (here I mean "Boolean combination" in the usual sense when you think of elements of $2^{2^{\mathbb{N}}}$ as subsets of $2^{\mathbb{N}}$). These Boolean combinations will still form a coun... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9715639694252315,
"lm_q1q2_score": 0.823854921274176,
"lm_q2_score": 0.8479677583778258,
"openwebmath_perplexity": 289.99836342887994,
"openwebmath_score": 0.9999847412109375,
"tag... |
c#, meta-programming, rubberduck
Here, we have a method that listens for any ArgLists and determines whether they have a single ByRef parameter. If so, it adds the ArgListContext to a list exposed through the parser state class.
Here is the inspection:
public class ProcedureShouldBeFunctionInspection : IInspection
{
... | {
"domain": "codereview.stackexchange",
"id": 17685,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, meta-programming, rubberduck",
"url": null
} |
3. Originally Posted by mr fantastic
Draw the graph of y = 9 - x^2. For what values of x is $y \geq 0$ ....?
Yeah, in the graph I can see that, but if I'm actually writing out the problem, and I find the square root of 9, how does the inequality flip from x <= + and -3 to x >= -3?
4. Originally Posted by jonjon1324
Ye... | {
"domain": "mathhelpforum.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9857180656553328,
"lm_q1q2_score": 0.8358571347390824,
"lm_q2_score": 0.8479677545357569,
"openwebmath_perplexity": 272.50361983417446,
"openwebmath_score": 0.8143748641014099,
"ta... |
computer-vision
Title: Open cv and computer vision I'm new to computer vision, and I'm looking for a good place to start from, what's better between open cv in python or open cv in c++ Depends on your programming skills. Here is the summary:
OpenCV is a great tool originally developed in C++ and after a while a Python... | {
"domain": "datascience.stackexchange",
"id": 593,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "computer-vision",
"url": null
} |
denoising, speech-processing
Particularly, last year one of my teachers showed us a demo of the ICA algorithm, and we got to play round with it in MATLAB. It seemed really effective, and there's a research group that even created this MATLAB toolbox for the ICA algorithm. Here you can check a simple demo (called cockt... | {
"domain": "dsp.stackexchange",
"id": 726,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "denoising, speech-processing",
"url": null
} |
python, pyqt
def select_format(self, format_choice):
match format_choice:
case FormatChoice.Degrees:
self.actionDegrees.setChecked(True)
self.actionDMS.setChecked(False)
self.menuFormat.setTitle('Degrees')
self.dlg_class_proj_proj = Di... | {
"domain": "codereview.stackexchange",
"id": 43853,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, pyqt",
"url": null
} |
samtools
This looks fine... however when I try to call the genotype with bcftools I get a very long indel.
samtools mpileup -ugf ref.fa sample.bam -r Chromosome:198940-198940 -t AD | bcftools call -mv produces:
Chromosome 198940 . CAAAAGACGTCATCGACGTACGGTCGGTGACCACCGAGATCAACACGTTGTTCCAGACGCTCACCTCGATCGCCGA ... | {
"domain": "bioinformatics.stackexchange",
"id": 1813,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "samtools",
"url": null
} |
quantum-mechanics, optics, particle-physics, solid-state-physics, large-hadron-collider
What I don't understand is that since nucleus is much bigger than the neutron, classically, the neutron can even bounce back after the collision and thus the scattering angle would be quite large.
For a small percentage of elastic... | {
"domain": "physics.stackexchange",
"id": 44026,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-mechanics, optics, particle-physics, solid-state-physics, large-hadron-col... |
\begin{align*} Li_2(1) &= \zeta(2)= \frac{\pi^2}{6}, \\ Li_4(1) &=\zeta(4), \\ Li_4(-1) &=-\eta(4)=-\frac{7}{8}\zeta(4),\\ \left(Li_2 \left(\frac{1}{2} \right) \right)^2 &= \left(\frac{\zeta(2)}{2} - \frac{\log^2(2)}{2} \right)^2 = \frac{\pi^4}{144} - \frac{\pi^2}{12}\log^2(2) + \frac{\log^4(2)}{4}. \end{align*} Using ... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9912886147702209,
"lm_q1q2_score": 0.8172797166530668,
"lm_q2_score": 0.8244619220634456,
"openwebmath_perplexity": 1417.0931327500082,
"openwebmath_score": 0.9997186064720154,
"ta... |
homework-and-exercises, fluid-dynamics, pressure
Title: Pressure in an enclosed tank I'm trying to solve this task:
Where I have to find v1, the velocity at the exit point of the hole.
I know I can use Bernoulli's equation. My question is what should I consider to be the pressures. I was thikning of writing the equa... | {
"domain": "physics.stackexchange",
"id": 61292,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "homework-and-exercises, fluid-dynamics, pressure",
"url": null
} |
Here is a proof of @cardinal's comment with a small twist. If $X$ and $f(X)$ are independent then $$\begin{array}{lcl} P(X \in A \cap f^{-1}(B)) & = & P(X \in A, f(X) \in B) \\ & = & P(X \in A) P(f(X) \in B) \\ & = & P(X \in A) P(X \in f^{-1}(B)) \end{array}$$ Taking $A = f^{-1}(B)$ yields the equation $$P(f(X) \in B) ... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9669140235181256,
"lm_q1q2_score": 0.8119505435496254,
"lm_q2_score": 0.8397339616560072,
"openwebmath_perplexity": 118.30469945063945,
"openwebmath_score": 0.9341435432434082,
"ta... |
complexity-theory, time-complexity
Title: AND operator of many functions Suppose we have a set of functions $f_i: \mathbb Z \rightarrow \{0,1\}, i=1, \dots,n $, with the following property:
For each $i =1,\dots ,n$, there exists an $x\in \mathbb Z$ such that $f_i(x)=0$ and $f_j(x)=1$ for each $j\in \{1,\dots,i-1,i+1,\... | {
"domain": "cs.stackexchange",
"id": 5541,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "complexity-theory, time-complexity",
"url": null
} |
python, image-processing, spectrogram
I would like to know the similarity between the two spectra. I tried cross correlation and Root mean square error but the results were not satisfying.
The goal is to predict a genetic distance of species from the spectra. For instance if the genetic distance of species 1 and speci... | {
"domain": "dsp.stackexchange",
"id": 8205,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, image-processing, spectrogram",
"url": null
} |
1.) we know triangle area = 1/2(base)(height) so 1/2(x)(y)=25. from this we can determine that (x)(y) = 50. x= 50/y. using equation above we have 2 equations 2 unknowns. sufficient.
2.) x^2 + x^2 = 10^2. sufficient.
Manager
Joined: 13 Oct 2013
Posts: 131
Concentration: Strategy, Entrepreneurship
The hypotenuse of a ri... | {
"domain": "gmatclub.com",
"id": null,
"lm_label": "1. Yes\n2. Yes\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9588471131345144,
"lm_q1q2_score": 0.8206303997797177,
"lm_q2_score": 0.8558511451289038,
"openwebmath_perplexity": 1056.1023628640028,
"openwebmath_score": 0.7589067816734314,
"tags"... |
Assuming that the word independent in the opening statement is used in the way that probabilists use the word and not in the sense of independent versus dependent variable as is common in regression analysis, the joint distribution of the five random variables $Y_{11}, Y_{12}, Y_{13}, Y_{21},Y_{22}$ is the product of t... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9904405986777259,
"lm_q1q2_score": 0.8003425724740437,
"lm_q2_score": 0.8080672112416737,
"openwebmath_perplexity": 419.4714558531591,
"openwebmath_score": 0.994788408279419,
"tags... |
haskell, vigenere-cipher
-- gets the index of the cth letter on the kth row in the table,
-- then uses that index to find the cth letter in the base
decryptLetter :: Crypt Char -- base[table[k, c]]
decryptLetter k c e = (base !!) <$> tableIndex
where tableIndex = getRow k e >>= L.elemIndex c -- gets index from table... | {
"domain": "codereview.stackexchange",
"id": 17594,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "haskell, vigenere-cipher",
"url": null
} |
python, algorithm, graph, heap
startTime = time()
print('Good prims: ' + str(prims(graph)) + ', ' + 'Time: ' + str(time() - startTime)) 1. Review
There is no docstring. What does prims do? What argument does it take? What does it return? The text in the post would be a good starting point for a docstring.
The cod... | {
"domain": "codereview.stackexchange",
"id": 29228,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, algorithm, graph, heap",
"url": null
} |
c++, game, snake-game, sfml
8) Use std::this_thread::sleep_for instead of _sleep.
9) Call sf::display only once per frame.
You have multiple display calls per frame. You only want to call display once per frame, after you've sent all data to be displayed by using sf::draw.
10) playAgain
playAgain can be consolidated i... | {
"domain": "codereview.stackexchange",
"id": 39056,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c++, game, snake-game, sfml",
"url": null
} |
context-free, probability-theory, pushdown-automata, nondeterminism
Thanks. In general when constructed in a natural way, you have to guess the correct position of $\beta$, so you have to have two positions right.
But there is a catch. In fact $L$ can alternatively be defined as $\{\omega \mid \omega = \alpha\beta\bet... | {
"domain": "cs.stackexchange",
"id": 2056,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "context-free, probability-theory, pushdown-automata, nondeterminism",
"url": null
} |
quantum-mechanics, operators, hilbert-space, many-body
Title: Doubt about definition of creation operator I am a past physics student and wanted to revise the rudiments of many body theory, in particular as related to materials physics.
I have a doubt about the definition of creation and annihilation operators. Let's ... | {
"domain": "physics.stackexchange",
"id": 93132,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-mechanics, operators, hilbert-space, many-body",
"url": null
} |
• I should be very much interested in an explanation of the downvote with which all four answers seem to have been ‘graced’. – Brian M. Scott May 10 '13 at 15:05
$$\frac{1}{6}n(n+1)(n+2)+(1+2+3+\cdots+n+1)=$$
$$=\frac{1}{6}n(n+1)(n+2)+\frac{(n+1)(n+2)}{2}=$$ $$=\frac{1}{6}n(n+1)(n+2)+\frac{3(n+1)(n+2)}{6}=$$
$$=\fra... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9740426382811476,
"lm_q1q2_score": 0.8317474289363901,
"lm_q2_score": 0.8539127510928476,
"openwebmath_perplexity": 172.55928831029772,
"openwebmath_score": 0.8722524642944336,
"ta... |
Sum of taylor series program c programs studytonight. Find the taylor series expansion for sinx at x 0, and determine its radius of convergence. This will work for a much wider variety of function than the method discussed in the previous section at the expense of some often unpleasant work. Find the maclaurin series e... | {
"domain": "web.app",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9937100963729104,
"lm_q1q2_score": 0.8302284343142107,
"lm_q2_score": 0.8354835452961425,
"openwebmath_perplexity": 285.6080923274776,
"openwebmath_score": 0.9059241414070129,
"tags": null,
... |
discrete-signals, convolution, impulse-response, linear-systems
$$u[n]-u[n-3]=\delta[n]+\delta[n-1]+\delta[n-2]$$ you get
$$h[n]=\delta[n]+\delta[n-1]+4\delta[n-2] \tag{2}$$
Plugging (2) into (1) gives the desired result. | {
"domain": "dsp.stackexchange",
"id": 1576,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "discrete-signals, convolution, impulse-response, linear-systems",
"url": null
} |
Yes, see above answers. There are even bijective maps between $(0,1)$ and $\mathbb{R}^n$. To see this, note that a bijection $\phi$ between $(0,1)$ and $(0,1)^2$ can be made in this way: Let $x= 0.b_1b_2\ldots$, with $b_j$ being the digits in a decimal expansion. Define $$\phi(x) = (0.b_1b_3b_5\ldots,0.b_2b_4b_6\ldots)... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9825575116884779,
"lm_q1q2_score": 0.801012799569138,
"lm_q2_score": 0.8152324826183822,
"openwebmath_perplexity": 231.61522538609447,
"openwebmath_score": 0.9460605978965759,
"tag... |
homework-and-exercises, quantum-field-theory, particle-physics, feynman-diagrams, baryons
Title: $\Omega^0_c \to \Sigma^+ K^-K^- \pi^+$ Feynman diagram How can I work out the Feynman diagram for the decay process, $\Omega^0_c \to \Sigma^+ K^-K^- \pi^+$? Start by identifying the constituents of each particle. The charm... | {
"domain": "physics.stackexchange",
"id": 38293,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "homework-and-exercises, quantum-field-theory, particle-physics, feynman-diagrams, ... |
milky-way, active-galaxy
A "Seyfert flare", is not really a common term, but the authors refer to an energetic outburst from the type of active galaxies called Seyfert galaxies (after Carl Seyfert).
Like a quasar, a Seyfert galaxy is powered by gas accretion onto a central, supermassive black hole, although they're le... | {
"domain": "astronomy.stackexchange",
"id": 3992,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "milky-way, active-galaxy",
"url": null
} |
macos-mountain-lion, ros-groovy, image-view, osx
(process:591): GLib-GObject-CRITICAL **: gtype.c:2720: You forgot to call g_type_init()
(process:591): GLib-GObject-CRITICAL **: void g_type_interface_add_prerequisite(GType, GType): assertion `G_TYPE_IS_INTERFACE (interface_type)' failed
(process:591): GLib-CRITICAL ... | {
"domain": "robotics.stackexchange",
"id": 12561,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "macos-mountain-lion, ros-groovy, image-view, osx",
"url": null
} |
homework-and-exercises, electric-circuits
To be clear, the current is changing in time and so is not constant. But, the amplitude of the current is constant, i.e.,
$$i_C = A \cos(\omega t + \phi)$$
where $A$ is a constant. This is called AC or sinusoidal steady state. | {
"domain": "physics.stackexchange",
"id": 26012,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "homework-and-exercises, electric-circuits",
"url": null
} |
"ordinary" distance between two points that one would measure with a ruler, and is given by the Pythagorean formula.By using this formula as distance, Euclidean space (or even any inner product space) becomes a metric space.The associated norm is called the Euclidean norm. [30] Euclidean distance is the distance betwee... | {
"domain": "lemar.tv",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9648551525886194,
"lm_q1q2_score": 0.8081819394887328,
"lm_q2_score": 0.8376199653600372,
"openwebmath_perplexity": 608.1770943084895,
"openwebmath_score": 0.8368810415267944,
"tags": n... |
ros, opencv3
[ 1%] Built target topic_tools_generate_messages_cpp
[ 4%] Built target ecto
[ 4%] Built target geometry_msgs_generate_messages_py
[ 4%] Built target geometry_msgs_generate_messages_cpp
[ 4%] [ 4%] Built target topic_tools_generate_messages_lisp
Building CXX object ecto_opencv/cells/cv_bp/opencv/CMa... | {
"domain": "robotics.stackexchange",
"id": 23179,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, opencv3",
"url": null
} |
Matsumura's 2 books and the Wikipedia page on total ring of fractions just say the obvious definition without discussing what it means or any serious examples. In your treatment, I think Q(R) should be a subring of the Cartesian product
A slightly more complicated example would be k[x,y]/(x^n,y^m), where the total rin... | {
"domain": "columbia.edu",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.986777180969715,
"lm_q1q2_score": 0.802118924871582,
"lm_q2_score": 0.8128673223709251,
"openwebmath_perplexity": 247.8725097079258,
"openwebmath_score": 0.9583593606948853,
"tags": nul... |
differential-geometry, metric-tensor, coordinate-systems, tensor-calculus, differentiation
Title: Is the contracted Christoffel symbol a tensor? The coordinate transformation law (from coordinates x to coordinates y) for the Christoffel symbol is:
$$\Gamma^i_{kl}(y)=\frac{\partial y^i}{\partial x^m} \frac{\partial x^n... | {
"domain": "physics.stackexchange",
"id": 91687,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "differential-geometry, metric-tensor, coordinate-systems, tensor-calculus, differe... |
java, algorithm, strings, combinatorics
private static Set<String> getPermutations(List<String> subStrings) {
assert subStrings != null;
final Set<String> set = new HashSet<String>();
int factorial = getFactorial(subStrings.size());
int counter = 0;
while (counter < factorial)... | {
"domain": "codereview.stackexchange",
"id": 5420,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, algorithm, strings, combinatorics",
"url": null
} |
sub-intervals, and construct different low degree polynomial approximations (with small oscillations) on the sub-intervals. Each macro triangle of the triangulated domain is split into three mini triangles and the interpolating surface on each mini triangle is a cubic Bézier triangle. Cubic Interpolation - If you need ... | {
"domain": "100per100sicily.it",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9873750514614408,
"lm_q1q2_score": 0.8206499013913631,
"lm_q2_score": 0.8311430394931457,
"openwebmath_perplexity": 858.9108399567517,
"openwebmath_score": 0.5121351480484009,
... |
c#, wpf, wrapper, properties, databinding
IMO, yes. You pollute your code with a new layer of complexity and obfuscate a quite simple and well established workflow, just because it's irritating to write the same code again and again.
If you are using Visual Studio, you have the opportunity to write and use code snippe... | {
"domain": "codereview.stackexchange",
"id": 37294,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, wpf, wrapper, properties, databinding",
"url": null
} |
database-theory, databases
System is available, but it may take 10 minutes to process some
huge query.
Actually system is not available, but there is some
wrapper (user calls it instead of the original system) that each time when original system is not available simply waits
until it becomes, so to the outside user it... | {
"domain": "cs.stackexchange",
"id": 8032,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "database-theory, databases",
"url": null
} |
forces
The question is "How to calculate the direction vector [u] using these values?".
I have already used u = 2Δ - gt² / 2Vo*t where Δ = endPoint - startPoint but it doesn't give me the correct vector which later will be multiplied with velocity.
I can see that because, by finding the angle of the vector θ = atan2(u... | {
"domain": "physics.stackexchange",
"id": 16066,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "forces",
"url": null
} |
ros
Edit: I'd also suggest adding the architecture_independent tag to the export section of your package.xml, as ackerman_vehicle_description does not contain any artefacts that will need to be rebuild for different processor architectures (ie: x86 vs x64, etc). That saves the buildfarm some effort, and results in you... | {
"domain": "robotics.stackexchange",
"id": 22312,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros",
"url": null
} |
This does not effect the internal precision used for computations.
## Applications¶
### Reflections¶
[27]:
from IPython.display import Image
Image(url='_static/reflection_on_vector.svg')
[27]:
Reflecting a vector $$c$$ about a normalized vector $$n$$ is pretty simple,
$c \rightarrow ncn$
[28]:
c = e1+e2+e3 ... | {
"domain": "readthedocs.io",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9719924818279465,
"lm_q1q2_score": 0.8099852355304259,
"lm_q2_score": 0.8333245891029457,
"openwebmath_perplexity": 5905.601107897232,
"openwebmath_score": 0.6071215271949768,
"tags":... |
star, terminology, star-evolution
Wikipedia has a good collection of articles on the various stellar nuclear fusion processes, including:
The triple-alpha process, which burns helium to carbon.
The carbon-burning process, which converts carbon to oxygen, neon, sodium, and magnesium.
The neon-burning process
The oxyge... | {
"domain": "astronomy.stackexchange",
"id": 5527,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "star, terminology, star-evolution",
"url": null
} |
newtonian-mechanics, forces, energy, work, free-body-diagram
So why is the normal force not considered here? Is the question/solution wrong?
If it is correct, why? And what is the mathematical proof of not considering the normal force when applying the work-energy theorem? You could indeed use the work-energy theorem ... | {
"domain": "physics.stackexchange",
"id": 98036,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "newtonian-mechanics, forces, energy, work, free-body-diagram",
"url": null
} |
loops will compute Aufor all interior nodes. Finite Difference Scheme for heat equation. FD1D_HEAT_IMPLICIT, a C program which uses the finite difference method and implicit time stepping to solve the time dependent heat equation in 1D. Magnetic Flux and Faraday's Law of Induction. Bottom wall is initialized at 100 arb... | {
"domain": "leplec.de",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9814534376578002,
"lm_q1q2_score": 0.8024112845639997,
"lm_q2_score": 0.8175744806385542,
"openwebmath_perplexity": 783.3088336727461,
"openwebmath_score": 0.4634234607219696,
"tags": null... |
api, perl, meta-programming, rest
Title: Perl wrapper library (written using Moose) for a REST API I wrote a wrapper library for a REST API in Perl using the Moose library. I would like to gather some feedback on it (mainly on the OOP part since I am new to moose), before pushing it out.
Base class:
has 'debug' ... | {
"domain": "codereview.stackexchange",
"id": 2476,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "api, perl, meta-programming, rest",
"url": null
} |
ros, gazebo, care-o-bot
and I am getting about 1.4Xreal-time. Taking a closer look, the current code was using gazebo_ros_block_laser plugin with 160X160 configuration. A better way to implement this is to use the gazebo_ros_openni_kinect plugin, for example, update your kinect.gazebo.xacro file to look something li... | {
"domain": "robotics.stackexchange",
"id": 6714,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, gazebo, care-o-bot",
"url": null
} |
ros-melodic, android
So, it seems related to rosjava but I'm not sure either. I'm wondering why it hasn't been fixed yet, github issues about that are not recent (??).
When right clicking of the imu topic in the rqt_bag window, I encountered the same python error in the console from where I launch the rqt_bag plot eit... | {
"domain": "robotics.stackexchange",
"id": 32525,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros-melodic, android",
"url": null
} |
thermodynamics, energy
From my understanding
$K.E = \frac{mv^2}{2}$
and temperature is directly proportional to kinetic energy.
I know that the $v$ in the above equation is really the mean speed of the particles and therefore some are moving backwards and some moving forwards, it is the speed that is used. But surely ... | {
"domain": "physics.stackexchange",
"id": 62758,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "thermodynamics, energy",
"url": null
} |
machine-learning
Title: Does L1 regularization always generate a sparse solution? Following is a plot in Bishop's Pattern Recognition and Machine Learning explaining why $L_1$ regularization would lead to sparse solution, and I understand that in this case $w_1$ would be automatically constrained to be 0. However, it... | {
"domain": "datascience.stackexchange",
"id": 2914,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "machine-learning",
"url": null
} |
$$\langle f,g\rangle=\int_{\mathbb C} \frac{f(z)\overline{g(z)}}{\left(1+|z|^2\right)^{N+2}}\frac{i}{2\pi}dz\wedge d\overline{z}.$$
The $SU(2)-$invariance of the inner product shows immediately that the covariance kernel of $p_n$ is $SU(2)-$invariant and hence so is the average distribution of zeros. There are also mo... | {
"domain": "mathoverflow.net",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9828232914907946,
"lm_q1q2_score": 0.8211326799223712,
"lm_q2_score": 0.8354835371034368,
"openwebmath_perplexity": 265.6323066576666,
"openwebmath_score": 0.8915950655937195,
"tags... |
algorithms, computational-geometry, randomized-algorithms
Is there a more efficient algorithm? Here's an approach that I think achieves $O(n^2)$ running time, as long as the points are not too dense (as long as $n$ is not too large compared to the size of the region).
Store the set of all slopes of lines between any p... | {
"domain": "cs.stackexchange",
"id": 2458,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "algorithms, computational-geometry, randomized-algorithms",
"url": null
} |
xhlzazrap8k7 nmthyrasyspf1ea 23cbaf5vnnytcd v1d71hzhyug xxqc3g6sxmorf1k pt9z7kem42l xhicp6f2o4o37 phckt1hx6dg9v7z 7bc2ko4gj8u8166 tbfkwh1g9ylg q6ac5okt4jj 9s52qkpmahxp8 live4tpl0c0ge dvkgvdm6xscp wwhrj5c2plrokwa p754eziusl6 zocrsfoomz9uu6 gb6e62f8ht 4f45y7myi5xd0e 561r4bwupk7 6ens4e2t3q7kqd qal8zy9gljk 71cczt1hqvzr j0a... | {
"domain": "casandrea.it",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9896718453483273,
"lm_q1q2_score": 0.8351792253683175,
"lm_q2_score": 0.8438951045175643,
"openwebmath_perplexity": 379.3981477732795,
"openwebmath_score": 0.89300936460495,
"tags":... |
python, python-3.x, numpy, coordinate-system, geospatial
def get_latitude(azimuth: float, sigma: np.ndarray, cos_u1: float, sin_alpha: float) -> np.ndarray:
# φ2 = atan(sin U1 · cos σ + cos U1 · sin σ · cos α1 /
latitude = np.arctan2(
(np.sin(cos_u1) * np.cos(sigma) + np.cos(cos_u1) * np.sin(sigma) * n... | {
"domain": "codereview.stackexchange",
"id": 42999,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, python-3.x, numpy, coordinate-system, geospatial",
"url": null
} |
quantum-mechanics, general-relativity, quantum-field-theory, quantum-gravity
as the comment pointed out, I've used "QM" improperly, when I really meant quantum theories like QED, QCD, or the Standard Model, because that's what is usually meant in the infamous "QM vs GR debate"
with "complex" I mean where both the gra... | {
"domain": "physics.stackexchange",
"id": 84697,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-mechanics, general-relativity, quantum-field-theory, quantum-gravity",
"... |
c#, game
/// <summary>
/// The interpolator
/// </summary>
private IInterpolator<T> interpolator;
/// <summary>
/// Gets or sets the interpolator.
/// </summary>
/// <value>
/// The interpolator.
/// </value>
/// <exception cref="System.ArgumentNullException">Interpolator</exce... | {
"domain": "codereview.stackexchange",
"id": 11654,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, game",
"url": null
} |
ros, ros-melodic, tf2-ros
Title: need to get tf2_ros to work in python3 environment for Melodic
I need tf2 to work in python3 environment in ROS melodic. I saw a similar question here for ROS kinetic, I need the same thing for melodic. Please help. | {
"domain": "robotics.stackexchange",
"id": 37584,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, ros-melodic, tf2-ros",
"url": null
} |
performance, sql, sql-server, t-sql, stackexchange
select round(sum([20K])/@target_20k, 2) [20K],
round(sum([10K])/@target_10k,2) [10K],
round(sum([3K])/@target_3k,2) [3K],
round(sum([2K])/@target_2k,2) [2K],
sum(Reputation) [TotalSiteRep],
count(*) [UsersCount],
sum(AvidRep) ... | {
"domain": "codereview.stackexchange",
"id": 6574,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "performance, sql, sql-server, t-sql, stackexchange",
"url": null
} |
Option 1
There are these possible derangements with the probability of choosing that derangement using option 1 given next to each:
BADC $$\frac{1}3\frac{1}3$$
BCDA $$\frac{1}3\frac{1}3\frac{1}2$$
BDAC $$\frac{1}3\frac{1}3$$
CADB $$\frac{1}3\frac{1}2\frac{1}2$$
CDAB $$\frac{1}3\frac{1}2\frac{1}2$$
CDBA $$\frac{1}3\frac... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9830850882200038,
"lm_q1q2_score": 0.8275862484965917,
"lm_q2_score": 0.8418256551882382,
"openwebmath_perplexity": 1291.761582705253,
"openwebmath_score": 0.6644536256790161,
"tag... |
noise, snr, derivative
Their average energy $E$ thus differ by a factor of $|h\|^2=\sqrt{2}^2 = 2$. As said by Olli, a similar question was answered in 2nd order edge detectors more susceptible to noise?. The part "can be magnified twice" is important, since this does not happen for all noises or all difference filte... | {
"domain": "dsp.stackexchange",
"id": 4434,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "noise, snr, derivative",
"url": null
} |
• @PeterK. The sum starts from 0 in that case and the a^-n remains intact. That solves it, you can add the answer – John Katsantas Jul 15 '17 at 14:36
• I am late in the party! Unfortunately, the image was not loaded when I left the answer. Hence is the change of notation (will fix it). DilipSarwate I didn't see that e... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.973240718366854,
"lm_q1q2_score": 0.8067570095186262,
"lm_q2_score": 0.8289388167733099,
"openwebmath_perplexity": 1226.1339428541066,
"openwebmath_score": 0.8565137386322021,
"tag... |
php, authentication, session
$_SESSION['userid'] = $query[0]->userid;
$_SESSION['cookie_hash'] = $_COOKIE['cookie_hash'];
$_SESSION['username'] = $query[0]->username;
$_SESSION['HTTP_USER_AGENT'] = md5($_SERVER['HTTP_USER_AGENT']);
$_SESSION['type'] ... | {
"domain": "codereview.stackexchange",
"id": 27645,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "php, authentication, session",
"url": null
} |
gravity, gravitational-waves
Please keep in mind that I have no experience with the math side of general relativity or special relativity. I tried searching for answers online but I couldn't find anything that a physics enthusiast with no university level physics courses could understand. Part 1: no, the amplitude dec... | {
"domain": "physics.stackexchange",
"id": 30715,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "gravity, gravitational-waves",
"url": null
} |
machine-learning, data-mining, unsupervised-learning, supervised-learning
Title: What is the best method to *classify* series of data? I'm working on a project for CCG (such as HearthStone, Yu-Gi-Oh!, etc.) which does classify (or give labels) deck type when user uploads their own deck.
let's assume every cards are ha... | {
"domain": "datascience.stackexchange",
"id": 9666,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "machine-learning, data-mining, unsupervised-learning, supervised-learning",
"... |
c++, parsing, boost, math-expression-eval
and parser.h:
#include <sstream>
#include <string>
#include <iterator>
#include <exception>
#include <cmath>
#include <boost/variant.hpp>
#include "lexer.h"
#include "tree.h"
class parse_error : public std::exception
{
std::string msg;
public:
parse_error(std::stri... | {
"domain": "codereview.stackexchange",
"id": 8707,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c++, parsing, boost, math-expression-eval",
"url": null
} |
string-theory, metric-tensor, gauge-theory, gauge, diffeomorphism-invariance
Title: Gauge fixing of Polyakov Action In the Gauge fixing of Polyakov action we do general coordinate transformation where we take the transformation stated below
$$h_{\alpha\beta} = e^{\phi(\sigma)}\eta_{\alpha\beta}.$$
But here the left si... | {
"domain": "physics.stackexchange",
"id": 60851,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "string-theory, metric-tensor, gauge-theory, gauge, diffeomorphism-invariance",
"... |
discrete-signals, filtering, denoising, smoothing
Title: A Simple Algorithm to Filter / Smooth / Denoise a Noisy Staircase Graph Is there a way to remove the noise and smooth the graph into a staircase graph. Assuming you meant to produce something similar to the green line:
What about
$$\text{output}[n] = \max\{\text... | {
"domain": "dsp.stackexchange",
"id": 9193,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "discrete-signals, filtering, denoising, smoothing",
"url": null
} |
In practice, systems of many linear equations are solved indirectly, by either stationary iterative methods, such as the Richardson method, the Jacobi method, the Gauss-Seidel method, and the successive over-relaxation method, or Krylov subspace methods, such as conjugate gradients, generalized minimal residual, or bic... | {
"domain": "actruce.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9902915258107348,
"lm_q1q2_score": 0.8164576611799372,
"lm_q2_score": 0.824461928533133,
"openwebmath_perplexity": 344.1789283553058,
"openwebmath_score": 0.9217903017997742,
"tags": nul... |
java, object-oriented, unit-testing, android, classes
@org.junit.jupiter.api.Test
void getPersonalID() {
Assertions.assertThrows(NoSuchAlgorithmException.class, () -> {
User User1 = new User(
"Mike",
"M12345678",
"1990/10/13",
... | {
"domain": "codereview.stackexchange",
"id": 41309,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, object-oriented, unit-testing, android, classes",
"url": null
} |
thermodynamics, fluid-dynamics, statistical-mechanics, weather, meteorology
Okay, so that gives us a time scale of the heat diffusion alone. We can also come up with a velocity scale, which is the distance divided by the time, and so the diffusion velocity would be something like:
$$V_{diff} = \frac{\nu}{L}$$
Now let'... | {
"domain": "physics.stackexchange",
"id": 61422,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "thermodynamics, fluid-dynamics, statistical-mechanics, weather, meteorology",
"u... |
calibration, camera-calibration
Title: where is the calibration info of usb_cam?
i have used camera_calibration to generate my desired calibration info .
but ,how can i apply this data to my application.
i can see the original calibration info by
" rostopic echo /usb_cam/camera_info".
and how can i find the location ... | {
"domain": "robotics.stackexchange",
"id": 11270,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "calibration, camera-calibration",
"url": null
} |
homework-and-exercises, special-relativity
(2) In the primed coordinate system, twin A is at rest at the spatial origin.
(3) In either system, we are considering the coordinates of twin A. Thus, $\Delta x$ is the displacement of twin A in the unprimed system and $\Delta x'$ is the displacement of twin A in the primed... | {
"domain": "physics.stackexchange",
"id": 8332,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "homework-and-exercises, special-relativity",
"url": null
} |
row vector and a column vector have compatible sizes. How to Add a row vector to a column vector like matrix multiplication matlab product vectorization addition or ask your a matrix by corresponding column of In MATLAB a vector is a matrix with either one row or one column. kastatic. Addition of two Vectors The additi... | {
"domain": "sportsradars.com",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9820137868795702,
"lm_q1q2_score": 0.8051465596377749,
"lm_q2_score": 0.819893335913536,
"openwebmath_perplexity": 559.1494305728536,
"openwebmath_score": 0.7407938241958618,
"t... |
navigation, move-base, ros-kinetic
Original comments
Comment by gvdhoorn on 2019-03-27:\
An inflation_radius of 2.5 is very high, the unit is meter you should have something equivalent to the size of your robot
Or the robot is just really big and clunky, and 2.5m is really needed to avoid it running into things .. ;... | {
"domain": "robotics.stackexchange",
"id": 32761,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "navigation, move-base, ros-kinetic",
"url": null
} |
evolution, neuroscience
Several types of molecules are used as neurotransmitters; their evolutionary deployment in different synapse types across animals is fascinating and still poorly understood. Many are used widely in eukaryotes for intercellular communication, but some of the biogenic amines may be present in ani... | {
"domain": "biology.stackexchange",
"id": 10621,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "evolution, neuroscience",
"url": null
} |
charge, gauge-theory, group-theory, lie-algebra, beyond-the-standard-model
\begin{equation}
Q = T_{3} -\frac{1}{\sqrt{3}}T_8 + X \tag{4}
\end{equation}
where $T_a (a = 1, 2, ..., 8)$ and $X$ stand for $SU(3)_L$ and $U(1)_X$ charges respectively. This paper just lists eq. (4) but does not derive it. I wonde... | {
"domain": "physics.stackexchange",
"id": 79278,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "charge, gauge-theory, group-theory, lie-algebra, beyond-the-standard-model",
"ur... |
quantum-mechanics, mathematical-physics, differential-geometry, supersymmetry, instantons
The bosonic zero mode corresponds to the instanton's collective coordinate (moduli space). Geometrically, this coordinate is the central time $t_0$ of the classical kink solution; and the solution satisfies the equations of motio... | {
"domain": "physics.stackexchange",
"id": 15268,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-mechanics, mathematical-physics, differential-geometry, supersymmetry, ins... |
java, game, community-challenge, rock-paper-scissors
public final void wonSet() {
sets++;
for (PlayerListener pl : listeners) {
pl.wonSet(this);
}
}
public String getName() {
return name;
}
public int getGames() {
return games;
}
public int... | {
"domain": "codereview.stackexchange",
"id": 5203,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, game, community-challenge, rock-paper-scissors",
"url": null
} |
condition is needed, while the second-order derivative in space leads to a demand for two boundary conditions. • Boundary conditions will be treated in more detail in this lecture. 5) is called the eigenvalue problem, a nontrivial solution is called an eigenfunc-tion associated with the eigenvalue λ. Finite difference ... | {
"domain": "muse-deutsch.de",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9924227578357059,
"lm_q1q2_score": 0.8270102868898517,
"lm_q2_score": 0.8333245891029456,
"openwebmath_perplexity": 492.8236940831988,
"openwebmath_score": 0.8473877906799316,
"t... |
\sqrt{t_{i+1}-t_{i-1}}\left(z_i - z_{i-1}\right)$$is that what you meant? Is it illegal for a police officer to buy lottery tickets? Just added specifics to my normality test in the problem description. Monte Carlo methods In option pricing there are two main approaches: Monte Carlo methods for estimating expected valu... | {
"domain": "nsadvocacy.ca",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.947381048137938,
"lm_q1q2_score": 0.8089807536266007,
"lm_q2_score": 0.853912747375134,
"openwebmath_perplexity": 1000.6160172732714,
"openwebmath_score": 0.8053338527679443,
"tags... |
javascript, statistics, heap, median
var MaxHeap = function(){
Heap.call(this);
};
MaxHeap.prototype = Object.create(Heap.prototype);
MaxHeap.prototype.constructor = MaxHeap;
MaxHeap.prototype.heapifyUp = function(){
var pos = this.size() - 1;
while(this.hasParent(pos)){
if(this._heap[pos] <= t... | {
"domain": "codereview.stackexchange",
"id": 23053,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "javascript, statistics, heap, median",
"url": null
} |
6
Your belief that there will be two different vertices in the set of optimal solutions as long as the feasible polyhedron contains more than a single point is incorrect. In practice, most LPs have unique solutions. As far as an upper bound on the number of optimal vertices, let's assume that you have $m$ constraints ... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9637799420543365,
"lm_q1q2_score": 0.8031415261928189,
"lm_q2_score": 0.8333245911726382,
"openwebmath_perplexity": 408.8839761093023,
"openwebmath_score": 0.756816029548645,
"tags... |
space-complexity, bloom-filters
Title: What is the point of Bloom's filter if its false positive rate is so high? This and this agree that there will be near 100% false positive rate with Bloom's filter should number of elements in the set ($n$) be greater than the number of bits in the filter ($m$).
E.g. if $n=100$, ... | {
"domain": "cs.stackexchange",
"id": 20494,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "space-complexity, bloom-filters",
"url": null
} |
Can someone please explain the flaw in my reasoning?
• So if there were instead $2000$ coins, the probability would be $1.953125$? – Chris Eagle Jan 9 '13 at 17:58
• Ack, of course that makes no sense. – user1332148 Jan 9 '13 at 18:03
• About $1-\exp(-1)$. Tossing $2^{10}$ coins would be even closer. – Henry Nov 16 '1... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9777138164089085,
"lm_q1q2_score": 0.8329660327630424,
"lm_q2_score": 0.851952809486198,
"openwebmath_perplexity": 255.53809236688198,
"openwebmath_score": 0.9265347719192505,
"tag... |
Suppose $G(A)$ converges. Then (by definition) the sequence of matrices $G_N(A)$ converges entrywise. Let $G_N(A) = [a_{i,j}^N]$, $P = [p_{i,j}]$, and $P^{-1} = [q_{i,j}]$. Now $G_N(P^{-1}AP) = P^{-1}G_N(A)P$ $= [\sum_\ell \sum_k q_{i,k} a_{k,\ell}^Np_{\ell,j}]$. That is, the $(i,j)$ entry of $G_N(P^{-1}AP)$ is $\sum_\... | {
"domain": "wordpress.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9805806557900713,
"lm_q1q2_score": 0.8106575848061016,
"lm_q2_score": 0.8267117855317474,
"openwebmath_perplexity": 46.50295748534041,
"openwebmath_score": 0.9932059049606323,
"tags": ... |
javascript, template, data-visualization, d3.js
Any other improvements / suggestions for making this code easier to scale and maintain. Here's the Computer Science 101 answer: put the parameters that change between charts into an array, and then loop over that array.
I want to include your code and data as a dc.js ex... | {
"domain": "codereview.stackexchange",
"id": 33909,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "javascript, template, data-visualization, d3.js",
"url": null
} |
python, keras, time-series, lstm, multiclass-classification
model.fit(X_train, Y_train, epochs=100, batch_size=128)
Y_test_predict = model.predict(X_test, batch_size=128)
This is what the above gives me:
ValueError: A target array with shape (390, 37) was passed for an output of shape (None, 1, 37) while using as los... | {
"domain": "datascience.stackexchange",
"id": 5907,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, keras, time-series, lstm, multiclass-classification",
"url": null
} |
word2vec, lstm, word-embeddings, word
use a pretrained word2vec
Train our own word2vec using a dataset related to the domain
Can any one help me on this
Thanks The entire philosophy of Distributed Word Representations makes use of the fact that a word is understood by the context it has . When we say context , we me... | {
"domain": "datascience.stackexchange",
"id": 3657,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "word2vec, lstm, word-embeddings, word",
"url": null
} |
ros, navigation, roslaunch, local-costmap
Title: local_costmap "ghost objects"; Restarting move_base
Hey all,
I am running the ROS naviagation stack with a 360 degree lidar. After running a couple paths. the local costmap from the lidar seems to fill up with "ghost objects" until the robot can no longer generate a pa... | {
"domain": "robotics.stackexchange",
"id": 28454,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, navigation, roslaunch, local-costmap",
"url": null
} |
javascript, strings, ecmascript-6, iterator, generator
A long sequence for test(alpha, "Stack"): http://lpaste.net/137336
Other tests
test("pen", "p", 10);
e n pp .. np
test("0123456789", "5", 10);
6 7 8 9 00 01 02 ..
It should
Use ES6 features
Expose a generator
Handle every kind of unique sequence
Be re... | {
"domain": "codereview.stackexchange",
"id": 34369,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "javascript, strings, ecmascript-6, iterator, generator",
"url": null
} |
newtonian-mechanics, energy, everyday-life, biophysics
Human gross muscle motion energy handling/metabolism is not efficient and doesn't behave like an ideal object. We have multiple energy pathways, and switch between them according to need. This happens less with walking, more with vigorous exercise like running. Th... | {
"domain": "physics.stackexchange",
"id": 80503,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "newtonian-mechanics, energy, everyday-life, biophysics",
"url": null
} |
comets, temperature
Title: Why is Rosetta's Comet so "warm"? Rosetta Comet AKA 67P/Churyumov–Gerasimenko has the surface temperature range of -43 to -93 degree Celsius.
Now, if we compare that with the Mercury (I chose Mercury cause it's closest to the Sun and has the thinnest atmosphere), the minimum surface tempera... | {
"domain": "astronomy.stackexchange",
"id": 1333,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "comets, temperature",
"url": null
} |
ros, marker, markerarray
printf("Value of point %u is erased\n", count);
printf("X after erased = %f\n", x[count]);
}
cout << "Sample 2 ="<< x.size() << endl;
Point = count;
if (check = true && count == x.size())
reaction = visualization_msgs::Marker::DELETE;
else
reaction = vis... | {
"domain": "robotics.stackexchange",
"id": 17547,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, marker, markerarray",
"url": null
} |
<p>Incidentally, the localization of $R$ at each $\mathfrak m_i$ is a dvr, but $R$ is not noetherian because ${\mathfrak m}_0$ is not finitely generated. Thus $R$ is an example of an "almost Dedekind domain" that isn't Dedekind. A <a href="http://mathoverflow.net/questions/114715" rel="nofollow">question</a> about such... | {
"domain": "mathoverflow.net",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9879462215484651,
"lm_q1q2_score": 0.8100105276363543,
"lm_q2_score": 0.8198933403143929,
"openwebmath_perplexity": 598.38865623681,
"openwebmath_score": 0.9509128332138062,
"tags":... |
np-hardness, optimization
That in turn is equivalent to choosing between $1$ and $k$ indices (the ones for which $x_j = 1$) such that for all $i =1, ..., |V|$, some one of the chosen indices $j$ has $R_{ij} = 1$.
But $R_{ij} = 1$ if and only if $i = j$ or $(v_i, v_j) \in E$. Thus solving the instance is equivalent to ... | {
"domain": "cstheory.stackexchange",
"id": 3248,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "np-hardness, optimization",
"url": null
} |
php, natural-language-processing
In addition to making them all visible, I've indented the different blocks as best I can. Possible bug: Do you have an parenthesis issue in the first if block after the in_array() where there seem to be missing an parenthesis? I've changed it here, but you need to reiterate it, to veri... | {
"domain": "codereview.stackexchange",
"id": 16956,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "php, natural-language-processing",
"url": null
} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.