text stringlengths 1 1.11k | source dict |
|---|---|
with the output:
including the intended solution of 30 feet masts.
Yes, you are right – thanks – i’ll modify my comment.
My empirical solution for this problem is as follows.
Let $$x$$ be the height of the masts, $$y$$ and $$y+2$$ be the lengths of the guy ropes with the anchor point on the left side of the mast ho... | {
"domain": "a2hosted.com",
"id": null,
"lm_label": "1. Yes\n2. Yes",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9916842234886746,
"lm_q1q2_score": 0.8389077671325836,
"lm_q2_score": 0.8459424353665381,
"openwebmath_perplexity": 291.45337703142053,
"openwebmath_score": 0.7549818158149719,
"tags": ... |
physical-chemistry, thermodynamics, entropy
However, in various answers on the Chemistry stack exchange, and in physical chemistry by peter atkins, it is claimed that the "surrounding" is an infinite reservoir: so the temperature can be assumed to be constant.
1.Is this not contradictory to the "thermal equilibrium" I... | {
"domain": "chemistry.stackexchange",
"id": 14248,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "physical-chemistry, thermodynamics, entropy",
"url": null
} |
python, performance, google-bigquery, apache-beam
Thank you for the example in the comment; that's helpful.
Directly returning the strptime expression would have been fine --
no need to name it result.
The .find() call should be .index().
Or we should assert '.' in s.
Or we should document that "dot is optional",
and ... | {
"domain": "codereview.stackexchange",
"id": 45420,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, performance, google-bigquery, apache-beam",
"url": null
} |
python, pandas
This does exactly what I want but seems inelegant to me because of the for-loop inside iterrows. Is there a better or more pythonic way to do this? You are correct in thinking that iterrows is a very bad sign for Pandas code. Even worse is building up a DataFrame one row at a time like this with pd.conc... | {
"domain": "codereview.stackexchange",
"id": 31494,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, pandas",
"url": null
} |
newtonian-gravity, potential-energy, variational-principle
Intuitively, things move downhill spontaneously - any matter under the force of gravity will try to minimize its distance to that center of gravity, unless something else prevents it. A sphere is the only possible shape that has all points on the surface equid... | {
"domain": "physics.stackexchange",
"id": 61407,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "newtonian-gravity, potential-energy, variational-principle",
"url": null
} |
So, those probabilities which stay almost constant at some point, are distributed among more and more possible values of the measured discrete variable, and so is not surprising that the probability at each individual point decreases. | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.984810951192016,
"lm_q1q2_score": 0.875259400053826,
"lm_q2_score": 0.8887588008585925,
"openwebmath_perplexity": 346.0749264444496,
"openwebmath_score": 0.8854819536209106,
"tags"... |
coronavirus, mrna, covid, vaccine
4284 * 320.5 + 159 = 1373181 g/mol.
The Pfizer vaccine has 30 ug/shot (PDF, see page 27 under "Description") or 30x10-6 grams
number of moles = mass/molar mass.
n= 30 x 10-6 grams/1373181 g/mol
n= 2.185 x 10-11
number of molecules = n (above) x Avogadro constant (6.022 x 1023)
Number ... | {
"domain": "biology.stackexchange",
"id": 11338,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "coronavirus, mrna, covid, vaccine",
"url": null
} |
filter-design, convolution, finite-impulse-response, reverse-engineering
No hard engineering constraints, but being able to reproduce what I already have ({0.3, 0.2, 0.75, -0.14, -0.11} but upscaled to 28 taps) is a good starting point.
This is just about poking things and watching the ripples propagate and distort. S... | {
"domain": "dsp.stackexchange",
"id": 11699,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "filter-design, convolution, finite-impulse-response, reverse-engineering",
"url": nu... |
ros, communication, ros-industrial, abb, rostopic
Originally posted by gvdhoorn with karma: 86574 on 2017-02-09
This answer was ACCEPTED on the original site
Post score: 1
Original comments
Comment by gvdhoorn on 2017-02-09:
If you would be interested in option 1, I would be willing to provide my support. Please open... | {
"domain": "robotics.stackexchange",
"id": 26964,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, communication, ros-industrial, abb, rostopic",
"url": null
} |
quantum-mechanics, quantum-entanglement, tensor-calculus
Title: Does the entanglement depend on the basis? Let's say, we have a composite system $A\otimes B$. We take the basis for $A$ as $|i\rangle,|j\rangle...,$ the basis for $B$ as $|\alpha\rangle,|\beta\rangle....$
Then an entangled state is a state which can not ... | {
"domain": "physics.stackexchange",
"id": 32094,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-mechanics, quantum-entanglement, tensor-calculus",
"url": null
} |
And in general, one can come up with infinitely many examples with the following format:
$$X = \{ a_1,a_2,\ldots,a_i \} \text{ where } a_i \in \Bbb{N} \ \forall i$$
$$Y = \{b_1,b_2,\ldots,b_n \} \text{ where } a_n \in \Bbb{N} \ \forall n$$
If $i = n$, then $X \mathcal{R}Y \text{ and } Y \mathcal{R}X$
$\overline{X} ... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9828232889752296,
"lm_q1q2_score": 0.8168667439050077,
"lm_q2_score": 0.8311430478583168,
"openwebmath_perplexity": 181.02126034866632,
"openwebmath_score": 0.9396858215332031,
... |
c#, dependency-injection, singleton, polly
and the IServiceProvider extension method BuildPolicyRegistryWithPolicySources():
public static PolicyRegistry BuildPolicyRegistryWithPolicySources(this IServiceProvider serviceProvider)
{
var policySourcesByName = new Dictionary<string, IPolicySource>();
foreach (var... | {
"domain": "codereview.stackexchange",
"id": 41876,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, dependency-injection, singleton, polly",
"url": null
} |
reinforcement-learning, python, q-learning, game-ai, combinatorial-games
Keep track of two different tables of $Q$-values for the two different players, and update each of them only on half of the actions (each of them pretending that actions selected by the opponent are just stochastic state transitions created by "t... | {
"domain": "ai.stackexchange",
"id": 2132,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "reinforcement-learning, python, q-learning, game-ai, combinatorial-games",
"url": null... |
have and the most number of times a function will cross the x-axis when graphed. In this unit we will explore polynomials, their terms, coefficients, zeroes, degree, and much more. (i) Since the term with highest exponent (power) is 8x 7 and its power is 7. â´ The degree of given polynomial is 7. Term: A term consists... | {
"domain": "brian-walker.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9787126457229185,
"lm_q1q2_score": 0.8069113111511725,
"lm_q2_score": 0.8244619242200082,
"openwebmath_perplexity": 802.8392468650438,
"openwebmath_score": 0.7237367630004883,
"tags... |
reinforcement-learning, long-short-term-memory, deep-rl, comparison, experience-replay
Not really, the state at any time step is still a single state representation, is separate conceptually from an observation, and is separate conceptually from a trajectory or sequence of states used to train a RNN (other RL approach... | {
"domain": "ai.stackexchange",
"id": 670,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "reinforcement-learning, long-short-term-memory, deep-rl, comparison, experience-replay",
... |
electrostatics, electric-circuits, conservation-laws, capacitance
Title: Why does charge on a capacitor remain constant when dielectric is fully inserted between the plates of the capacitor? We have a capacitor let's say of capacitance C and is charged by Voltage say V. Then the voltage is disconnected and a dielectri... | {
"domain": "physics.stackexchange",
"id": 65283,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "electrostatics, electric-circuits, conservation-laws, capacitance",
"url": null
... |
ros, gazebo, spawn
Title: how to use spawn_urdf_model service
Hi everyone
Currently I am trying to spawn a robot by calling spawn_urdf_model service. But, now matter what I did with it, it always failed to call the service. I think the problem is that I do not know how to assign value to model_xml field of gazebo_msg... | {
"domain": "robotics.stackexchange",
"id": 27688,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, gazebo, spawn",
"url": null
} |
power-spectral-density, correlation
Therefore the autocovariance function, as computed in the time domain, indicates the "time memory" in the waveform, and how similar or correlated subsequent samples are to previous samples. "White noise" which is completely independent from sample to sample results in an autocovaria... | {
"domain": "dsp.stackexchange",
"id": 11803,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "power-spectral-density, correlation",
"url": null
} |
general-relativity, spacetime, computational-physics, causality, closed-timelike-curve
My question is whether some alternative to the slicing approach exists which could in principle do this. For example, can the field equations be somehow solved self-consistently "at once" over some compact volume using Monte Carlo o... | {
"domain": "physics.stackexchange",
"id": 26544,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "general-relativity, spacetime, computational-physics, causality, closed-timelike-c... |
quantum-mechanics, quantum-field-theory, mathematical-physics, hilbert-space, linear-algebra
The Hilbert space of a particle in QM is not continuous: it is a separable Hilbert space, $L^2(\mathbb R)$ which, just in view of being separable, admits discrete countable orthogonal bases.
Moreover, a well known theorem pro... | {
"domain": "physics.stackexchange",
"id": 11778,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-mechanics, quantum-field-theory, mathematical-physics, hilbert-space, line... |
It's just a convention that we use pure real wavefunctions, the answer you got is perfectly correct, but not "standard", because it is pure imaginary. Wavefunctions don't have any meaning in real life (at least in the Copenhagen interpretation), they are just tools that we can use to get, for example, the probability d... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9553191271831559,
"lm_q1q2_score": 0.8430002191833991,
"lm_q2_score": 0.8824278664544912,
"openwebmath_perplexity": 183.0052529497422,
"openwebmath_score": 0.8999718427658081,
"tag... |
general-relativity, gravity, speed-of-light, acceleration, faster-than-light
Note that such a body with $v_e \gt c$ would necessarily trap light. In the Newtonian context, where the speed $c$ isn't a speed limit, an object falling from a great distance would impact the surface of the body with speed greater than the s... | {
"domain": "physics.stackexchange",
"id": 60422,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "general-relativity, gravity, speed-of-light, acceleration, faster-than-light",
"... |
c, hash-map
slot = sm->ht + POSITION(hash, sm->capacity);
htEnd = sm->ht + sm->capacity;
while (slot->key) {
if (hash == slot->hash) {
if (!strcmp(key, slot->key)) {
return slot;
}
}
if (++slot == htEnd) {
slot = sm->ht;
}
... | {
"domain": "codereview.stackexchange",
"id": 42288,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c, hash-map",
"url": null
} |
newtonian-mechanics, forces, spring, free-body-diagram
Title: Confusion regarding mass-spring system
The force equation for above system is
$$
\Sigma F=ma
$$
which is
$$
m\frac{d^2x}{dt^2}=-kx
$$
This should be always true; but confusion came as I think more on this.
When I set $a=\frac{d^2x}{dt^2}=g$
$$
mg=-kx
$$
d... | {
"domain": "physics.stackexchange",
"id": 33579,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "newtonian-mechanics, forces, spring, free-body-diagram",
"url": null
} |
python, python-3.x, rest, wrapper
# Both are pretty much used interchangeably though.
request_method: RequestMethod = RequestMethod.GET,
# COMMENT: Try to annotate all of your parameters, even those with
# default values. Especially for `data`, which has a default value of
# `None`, a t... | {
"domain": "codereview.stackexchange",
"id": 36439,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, python-3.x, rest, wrapper",
"url": null
} |
kinect, turtlebot, openni-kinect
namespace pointcloud_to_laserscan
{
typedef pcl::PointCloud<pcl::PointXYZ> PointCloud;
class CloudToScanHoriz : public nodelet::Nodelet
{
public:
//Constructor
CloudToScanHoriz(): min_height_(0.10), max_height_(0.75), baseFrame("/base_footprint"), laserFrame("/camera_tower")
{
... | {
"domain": "robotics.stackexchange",
"id": 5261,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "kinect, turtlebot, openni-kinect",
"url": null
} |
newtonian-mechanics, electromagnetism, electrostatics, simulations, many-body
Title: Simulating electrostatics in discrete time steps I am trying to simulate the motion of several charged particles that are free to move around but have repulsive forces between each other. These may be 10 electrons moving around causin... | {
"domain": "physics.stackexchange",
"id": 52717,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "newtonian-mechanics, electromagnetism, electrostatics, simulations, many-body",
... |
kinematics, acceleration, velocity, differentiation, singularities
P.S. Many things might seem too "disgusting" to people who are passionate about mathematics as I have written this answer not using the appropriate mathematical rigour. I have used some vague, yet intuitive vocabulary in this answer. And that's intenti... | {
"domain": "physics.stackexchange",
"id": 62363,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "kinematics, acceleration, velocity, differentiation, singularities",
"url": null... |
javascript, jquery, html, formatting, dom
Consistent spacing
You switch between tabs of two spaces and four spaces. It's not clear to me why.
Use braces for multi-line for loops
Your second for loop is missing curly braces. It makes things easier to read to include curly braces if the for loop has code that spans mult... | {
"domain": "codereview.stackexchange",
"id": 33046,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "javascript, jquery, html, formatting, dom",
"url": null
} |
Let's say that the numbers $$a_1,\ldots,a_n$$ are non-negative, and sum to $$A$$. They induce a probability distribution on $$\{1,\ldots,n\}$$, in which the probability of $$i$$ is $$a_i/A$$.
Given a partition $$S_1,S_2,S_3,S_4$$, let $$I$$ be a random variable distributed as above, and let $$X$$ be the index of the se... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9780517475646369,
"lm_q1q2_score": 0.8018981078547008,
"lm_q2_score": 0.8198933337131076,
"openwebmath_perplexity": 197.88933262885044,
"openwebmath_score": 0.8611894845962524,
"ta... |
OK, you must really sketch your region before deciding which method to use. Sometimes it doesn't matter and sometimes one is much easier than the other.
In this case, without changing the coordinate plane (you could simply switch the $x$ and $y$ coordinate in this problem, then revolve around $x = 3$ and this this wou... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.980280871316566,
"lm_q1q2_score": 0.816892160381995,
"lm_q2_score": 0.8333245953120233,
"openwebmath_perplexity": 240.830330713254,
"openwebmath_score": 0.9036709070205688,
"tags":... |
c, thread-safety, queue, embedded, variant-type
void queue_destroy(queue_t* queue)
{
pthread_mutex_destroy(&queue->mutex);
queue->array = NULL;
queue->capacity = 0;
queue->sizeof_element = 0;
queue->in = 0;
queue->out = 0;
}
static void* index_to_address(queue_t const * queue, size_t index)
{
vo... | {
"domain": "codereview.stackexchange",
"id": 40490,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c, thread-safety, queue, embedded, variant-type",
"url": null
} |
c++, performance, c++11, queue, collections
//Indexes to the raw memory pointig to the head and tail end of the ring.
//..The indexes are each guaranteed to have one extra "parity bit" of storage,
//..which is used for distinguishing between an empty ring and a full ring.
MinUint<BufSize> ringFront_;
M... | {
"domain": "codereview.stackexchange",
"id": 13038,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c++, performance, c++11, queue, collections",
"url": null
} |
beginner, c, checksum
secDig = (cardNumber / 10) % 10;
cardNumber /= 100;
// multiply every other digit
multDig = secDig * 2;
// add those products (separate /10, return modulus of 10) digits together.
if (multDig > 10)
{
checkSum += (multDig % 10) + 1;
... | {
"domain": "codereview.stackexchange",
"id": 31512,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "beginner, c, checksum",
"url": null
} |
c++, ros-melodic, collision, mesh, stl
std::string packagePath = ros::package::getPath("moveit_tutorials");
ROS_INFO("PackagePath: %s", packagePath.c_str());
shapes::Mesh *meshObject = shapes::createMeshFromResource(
"file:///home/dvdv/ws_robotplatform/src/moveit_tutorials/markerTool.stl", vectorScale);
sh... | {
"domain": "robotics.stackexchange",
"id": 34862,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c++, ros-melodic, collision, mesh, stl",
"url": null
} |
c#, linked-list, interview-questions
list.Root.Next.Next.Next.Next = new ArbNode(5);
//5->2
list.Root.Next.Next.Next.Next.Arb = list.Root.Next;
//3->5
list.Root.Next.Next.Arb = list.Root.Next.Next.Next.Next;
//var res = list.DeepCopyLinkedListWithAuxArray(l... | {
"domain": "codereview.stackexchange",
"id": 11499,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, linked-list, interview-questions",
"url": null
} |
### Show Tags
16 Nov 2005, 03:01
2
1
24
00:00
Difficulty:
5% (low)
Question Stats:
80% (01:35) correct 20% (02:17) wrong based on 498 sessions
### HideShow timer Statistics
Of the 12 temporary employees in a certain company, 4 will be hired as permanent employees. If 5 of the 12 temporary employees are women, ho... | {
"domain": "gmatclub.com",
"id": null,
"lm_label": "1. Yes\n2. Yes",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9241418116217418,
"lm_q1q2_score": 0.8124562834814252,
"lm_q2_score": 0.8791467643431002,
"openwebmath_perplexity": 1620.918906944238,
"openwebmath_score": 0.5549290776252747,
"tags": n... |
mobile-robot, control, matlab
Title: How do I apply a disturbance observer to a mobile robot? I have to design a observer to estimate disturbances which are applied to a unicycle model. So, the unicycle model with disturbances is:
$\dot{x}=v cos\theta + d_x$
$\dot{y}=v sin\theta + d_y$
$\dot{\theta}=\omega$
where $d_x... | {
"domain": "robotics.stackexchange",
"id": 2256,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "mobile-robot, control, matlab",
"url": null
} |
Zonotope.
(I have nothing more to say, but say more to satisfy the computer.)
• Minkowski sum of line segments, projection of a cube... Yeah, that's a zonotope! Apr 25 '15 at 14:38
If the points are linearly dependent, $\setA$ is a projection of a parallelipiped.[3]
In any case, $\setA$ is the image of the cube $[... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9871787830929849,
"lm_q1q2_score": 0.8000875782646697,
"lm_q2_score": 0.8104789040926008,
"openwebmath_perplexity": 157.19257678248002,
"openwebmath_score": 0.7993727326393127,
"ta... |
python, pandas
check_2 = df['BUS ID'].isna()
df.loc[check_2, 'check_2'] = 'Invalid BUS ID'
check_3 = df.duplicated(subset=['Balloon ID', 'BUS ID'], keep=False)
df.loc[check_3, 'check_3'] = 'Duplicated entry'
check_3_additional = ~df.duplicated(
subset=['Balloon ID'... | {
"domain": "codereview.stackexchange",
"id": 40972,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, pandas",
"url": null
} |
c, array, stack
void push(int *arr, int *length, int *status, int data)
{
*status = START;
if (*length == MAX_SIZE) {
*status = PUSH;
return;
}
arr[(*length)++] = data;
}
int pop(int *arr, int *length, int *status)
{
*status = 0;
if (*length == 0) {
*status = 1;
... | {
"domain": "codereview.stackexchange",
"id": 4233,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c, array, stack",
"url": null
} |
quantum-interpretations, error-analysis, wavefunction-collapse, thought-experiment, quantum-measurements
In other words, the $\tilde P_i$'s which define our POVM do not uniquely define our post-measurement states. They uniquely define our measurement probabilities, but in order to know the post-measurement state we n... | {
"domain": "physics.stackexchange",
"id": 76884,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-interpretations, error-analysis, wavefunction-collapse, thought-experiment... |
growth and decay formulas, y = final amount, a = original amount, r = rate of growth or decay, and t = time. Unit 6 – Exponents, Exponents, Exponents and More Exponents This unit begins with a fundamental treament of exponent rules and the development of negative and zero exponents. (Lessons 11-7, 11-8) growth an incre... | {
"domain": "residencemaiori.it",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9914225143328517,
"lm_q1q2_score": 0.8386863801025874,
"lm_q2_score": 0.8459424392504911,
"openwebmath_perplexity": 826.3457215131704,
"openwebmath_score": 0.48758867383003235,
... |
By the way, the first person to study seriously the boundary between convergence and divergence is Paul du Bois-Reymond. He proved a version of the result I just showed above, that no "decreasing" sequence of divergent series "exhausts" the divergent series in that we can always find one diverging and with terms going ... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9896718471760708,
"lm_q1q2_score": 0.8684140810487613,
"lm_q2_score": 0.8774767954920548,
"openwebmath_perplexity": 146.43397397440762,
"openwebmath_score": 0.9720413684844971,
"ta... |
# unwrap
Shift phase angles
## Description
example
Q = unwrap(P) unwraps the radian phase angles in a vector P. Whenever the jump between consecutive angles is greater than or equal to π radians, unwrap shifts the angles by adding multiples of ±2π until the jump is less than π. If P is a matrix, unwrap operates col... | {
"domain": "mathworks.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9773708019443872,
"lm_q1q2_score": 0.8186652972685694,
"lm_q2_score": 0.8376199653600372,
"openwebmath_perplexity": 2505.252058144994,
"openwebmath_score": 0.7687689661979675,
"tags": ... |
motion-planning, path-planning
Title: Construct Configuration-Space with Obstacles for arbitrary Object/Robot in Motion Planning I found that a configuration-space approach is a elegant way to describe problems in motion planning.
However, I was not able to find a known general way to construct configuration-spaces.
B... | {
"domain": "robotics.stackexchange",
"id": 2058,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "motion-planning, path-planning",
"url": null
} |
# Math Help - Some integral problems I'm having trouble with
1. ## Some integral problems I'm having trouble with
1. The integral: (sinˆ2 (3x) cos(3x) ) dx
2. The integral: (x+2)(x-3)ˆ20 dx
3. The integral from 0 to pi/4: sqrt(tan(x)) secˆ2 (x) ) dx
4. The integral from 0 to 1: ( eˆ(cubed root of x) ) / 6xˆ(2/3) d... | {
"domain": "mathhelpforum.com",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9790357549000774,
"lm_q1q2_score": 0.8221295809185967,
"lm_q2_score": 0.8397339696776499,
"openwebmath_perplexity": 8064.7125877284725,
"openwebmath_score": 0.9325185418128967,
... |
algorithms
Of course you can iterate through these integers by starting at 0 and incrementing until you reach MAX^SIZE - 1. Now by expressing that integer in base MAX, you can convert the integer to an array, and thereby iterate through all possible values of the array.
Depth-first search
You can view this as a compl... | {
"domain": "cs.stackexchange",
"id": 6040,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "algorithms",
"url": null
} |
algorithm, sorting, vba, quick-sort
While l < r
While arr(l) < p And l < r
l = l + 1
Wend
While arr(r) >= p And l < r ' Right claims values which equal pivot
r = r - 1
Wend
If l <> r Then Call swap(arr(l), arr(r))
Wend
' Don't swap the same thing
... | {
"domain": "codereview.stackexchange",
"id": 34902,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "algorithm, sorting, vba, quick-sort",
"url": null
} |
c#
if (viewcount != null)
{
foreach (var v in viewcount)
{
output.AppendLine(v.InnerHtml); | {
"domain": "codereview.stackexchange",
"id": 1139,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#",
"url": null
} |
@EliLansey OK I get your point. It seems I overlooked your title... But please allow me update the answer after 20 hours. It's too late here and I get some stuff to busy with tomorrow. (And yes, the only thing you need to do is doing the some coordinate transformation on arguments of f.) – Silvia Jun 21 '13 at 17:38
I... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9724147185726375,
"lm_q1q2_score": 0.8341063233432482,
"lm_q2_score": 0.8577680977182186,
"openwebmath_perplexity": 2606.6402416528435,
"openwebmath_score": 0.6156749129295349,
"ta... |
same as its reciprocal … 12.2.1. One-One and onto for indicating the inverse of a matrix A−1 for which the of! Information and translations of left inverse of a given function inverses ; pseudoinverse Although pseudoinverses will appear. Tabular data as well as algebraically functions that are inverses first two exampl... | {
"domain": "momon.bio",
"id": null,
"lm_label": "1. Yes\n2. Yes\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.978051746285132,
"lm_q1q2_score": 0.8480058272049631,
"lm_q2_score": 0.8670357477770337,
"openwebmath_perplexity": 458.23095543335194,
"openwebmath_score": 0.7499845623970032,
"tags": ... |
definite nor negative definite, then M can only be indefinite. To subscribe to this RSS feed, copy and paste this URL into your RSS reader. Can a matrix be positive semidefinite, even though it has negative leading principle minors? the matrix is indefinite. EDIT 3: Proof of the "if" direction. We will now go into the ... | {
"domain": "jabeplastic.ir",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9811668728630677,
"lm_q1q2_score": 0.8239191491302249,
"lm_q2_score": 0.8397339656668287,
"openwebmath_perplexity": 591.2567837159927,
"openwebmath_score": 0.6519129872322083,
"tags":... |
c#, design-patterns, .net, winforms
Obviously I am open to other suggestions in a more general sense, but I am specifically focused on my question regarding further decoupling.
Is decoupling necessary for very small applications?
YES!!
However I'd correct your statement here:
Is following those patterns just addi... | {
"domain": "codereview.stackexchange",
"id": 8511,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, design-patterns, .net, winforms",
"url": null
} |
c#, interface
There are several possible ways to implement this data structure: a linked-list/queue, an ordered array/circular buffer, an unordered array/circular buffer, a minheap plus keeping track of the maxes, a maxheap plus keeping track of the min, a MinMax heap, or Cartesian trees (and I'm sure there are others... | {
"domain": "codereview.stackexchange",
"id": 14165,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, interface",
"url": null
} |
c++, stream, sdl
/*
* Like streamSeekThorRead but uses write stream.
*/
Sint64 streamSeekThorWrite(SDL_RWops* input, Sint64 dist, int dir)
{
ThorSDLStreamWrite* data = reinterpret_cast<ThorSDLStreamWrite*>(input);
data->stream.clear();
std::ios_base::seekdir direction = convertSDLDirectionThor(dir);
... | {
"domain": "codereview.stackexchange",
"id": 44266,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c++, stream, sdl",
"url": null
} |
electromagnetism
$$
\mathbf D=\varepsilon_0\mathbf E+\mathbf P,
$$
and it can change if either of $\mathbf E$ or $\mathbf P$ changes. In this case, $\mathbf P$ is zero inside the cavity, so that $\mathbf D=\varepsilon_0\mathbf E$, but the electric field inside the cavity is also different from the field $\mathbf E_0$ ... | {
"domain": "physics.stackexchange",
"id": 80238,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "electromagnetism",
"url": null
} |
quantum-field-theory, qft-in-curved-spacetime, unruh-effect
One class of states it would map to are the following: $$U_R|0\rangle$$
where $U_R$ denotes an unitary operator in the right Rindler wedge. But it's not clear that they correspond to nice Minkowski states. Are there other states in Minkowski space field theor... | {
"domain": "physics.stackexchange",
"id": 53107,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-field-theory, qft-in-curved-spacetime, unruh-effect",
"url": null
} |
cr.crypto-security, obfuscation
Do you mean relation between code obfuscation and code maintenance?
Obviously good obfuscation means poor maintainability, so an alternate question is: how can a small part of the source code be reobfuscated without having to obfuscate the whole source code again? This leads to: "how ca... | {
"domain": "cstheory.stackexchange",
"id": 809,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "cr.crypto-security, obfuscation",
"url": null
} |
quantum-mechanics, atomic-physics, pauli-exclusion-principle
That angular momentum and the principal quantum number are discretized follow from the analysis of the quantum mechanical operators associated to them (and is experimentally supported e.g. by the observation of discrete spectral lines): It is an axiom of qua... | {
"domain": "physics.stackexchange",
"id": 23100,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-mechanics, atomic-physics, pauli-exclusion-principle",
"url": null
} |
electromagnetism, classical-electrodynamics, maxwell-equations, integration
Title: Integration constants in Maxwell's equations (ambiguousness?) In classical electrodynamics, if the electric field (or magnetic field, either of the two) is fully known (for simplicity: in a vacuum with $\rho = 0, \vec{j} = 0$), is it po... | {
"domain": "physics.stackexchange",
"id": 14484,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "electromagnetism, classical-electrodynamics, maxwell-equations, integration",
"u... |
$$E + O + E + O + E + E \\= (E + O) + (E + O) + (E + E) \\= O + O + E \\= (O+O) + E \\= E + E \\= E.$$
So, for a five-digit number, what numbers of odd digits can we have to make the sum even?
Next, let's count the number of five-digit numbers that have three odd digits. (Is the sum of digits of these numbers even or... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9787126475856414,
"lm_q1q2_score": 0.8571438053168258,
"lm_q2_score": 0.8757869916479466,
"openwebmath_perplexity": 185.39753959843088,
"openwebmath_score": 0.7157057523727417,
"ta... |
python, python-3.x, game, game-of-life
def advance_state(self):
''' update the board configuration with the config for the next state '''
self.board_ = self.next_board_state()
if __name__ == '__main__':
arr = np.random.choice([0, 1], (20, 100), p=[0.90, 0.1])
board = Board(arr.shape[0], arr.s... | {
"domain": "codereview.stackexchange",
"id": 30425,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, python-3.x, game, game-of-life",
"url": null
} |
mechanical-engineering, mechanisms, pulleys
Title: Would the reduction ratio of a pulley drive also be applied to a compound pulley? So, a pulley drive with the drive pulley having 1cm of diameter and the driven pulley 10cm of diameter would have something around a 10:1 reduction ratio. | {
"domain": "engineering.stackexchange",
"id": 5195,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "mechanical-engineering, mechanisms, pulleys",
"url": null
} |
python, python-3.x, genetic-algorithm
L1_WIDTH = 12
L1_HEIGHT = 5
# DATATYPES
Point = namedtuple("Point", "x y")
@dataclass
class Level:
"""Class for representing a level with a start and end point."""
map: list
width: int
height: int
start: Point
end: Point
__move_dict = {N: Point(0, 1)... | {
"domain": "codereview.stackexchange",
"id": 39507,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, python-3.x, genetic-algorithm",
"url": null
} |
python, algorithm, pathfinding, breadth-first-search, sliding-tile-puzzle
In Puzzle.actions(), you generate the list of all possible moves. To do so, you must find up to four neighbours of the hole. You accomplish that by searching all width * width locations for the hole. If it were a linear list, we could just ca... | {
"domain": "codereview.stackexchange",
"id": 11524,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, algorithm, pathfinding, breadth-first-search, sliding-tile-puzzle",
"... |
python, algorithm, reinventing-the-wheel
return list(unique_perms(nums, set()))
Using modules
from itertools import permutations
def permute_unqiue(nums, r):
return list(set(permutations(nums, r)))
This works by making a set() of the permutations. That removes all duplicate values, since they will hash to the s... | {
"domain": "codereview.stackexchange",
"id": 28857,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, algorithm, reinventing-the-wheel",
"url": null
} |
c#, .net, asp.net, asp.net-mvc-4
Other than that, I agree with your naming (except maybe vm could be called viewModel, but vm is pretty descriptive in this specific context) and naming conventions, and there's nothing much left to say as far as I'm concerned - good job! :) | {
"domain": "codereview.stackexchange",
"id": 5400,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, .net, asp.net, asp.net-mvc-4",
"url": null
} |
python, beginner, adventure-game
print ("The Zombies have dealt more damage than you!")
time.sleep(3)
print ("You can't make it out alive... You die a heroic death....")
time.sleep(3)
playAgain = input ("Do you want to try to climb the wall again? God seems to give you a... | {
"domain": "codereview.stackexchange",
"id": 31824,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, beginner, adventure-game",
"url": null
} |
thermodynamics, cooling
Thank you for help.
I get this Your boundary conditions (BC) are better formulated as:
$$T(0,y,z,t)=T(a,y,z,t)=20$$
$$T(x,0,z,t)=T(x,a,z,t)=20$$
$$T(x,y,0,t)=T(x,y,a,t)=20$$
Such BC are called 'non-homogeneous' and very difficult to handle.
But there's a 'cheap-and-easy' remedy: transform the d... | {
"domain": "physics.stackexchange",
"id": 78235,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "thermodynamics, cooling",
"url": null
} |
statistical-mechanics, phase-transition, ising-model, percolation
There is another, substantially more relevant, type of percolation that has been investigated: the percolation of Fortuin-Kasteleyn clusters (keywords: random cluster model, FK-percolation; this is the representation on which the Swendsen-Wang algorithm... | {
"domain": "physics.stackexchange",
"id": 95974,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "statistical-mechanics, phase-transition, ising-model, percolation",
"url": null
... |
java, linked-list, unit-testing
assertTrue(spliterator3.tryAdvance(
i -> assertEquals(list.get(4), Integer.valueOf(4))));
assertTrue(spliterator3.tryAdvance(
i -> assertEquals(list.get(5), Integer.valueOf(5))));
////
MyIntegerConsumer consumer = new MyInteger... | {
"domain": "codereview.stackexchange",
"id": 42089,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, linked-list, unit-testing",
"url": null
} |
ros, ros2, use-sim-time
Driver nodes (what you describe as "nodes involving interacting with the physical component of the robot" can typically not be used with simulated hardware (ie: a robot in Gazebo), so they are typically not started in such situations.
I've always considered Gazebo sensor and actuator plugins th... | {
"domain": "robotics.stackexchange",
"id": 38373,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, ros2, use-sim-time",
"url": null
} |
2016 MCQ Pattern) questions for your exams. In this post questions are from different paper from May 2013 to May 2020. As always with conditional probability the important step is to deduce which two probabilities need to be calculated. This video shows examples of using probability trees to work out the overall probab... | {
"domain": "satoevyemekleri.com",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9669140197044659,
"lm_q1q2_score": 0.8383490433651055,
"lm_q2_score": 0.867035771827307,
"openwebmath_perplexity": 2543.047379232255,
"openwebmath_score": 0.5019693970680237,
... |
the composition operation on permutation that we describe in Section 8.1.2 below does not correspond to matrix multiplication. Sometimes, we have to swap the rows of a matrix. •Find the inverse of a simple matrix by understanding how the corresponding linear transformation is related to the matrix-vector multiplication... | {
"domain": "southernglowtans.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9908743615328861,
"lm_q1q2_score": 0.8880725174237823,
"lm_q2_score": 0.8962513835254866,
"openwebmath_perplexity": 401.4975871929007,
"openwebmath_score": 0.8973594307899475,
"... |
thermodynamics, thermal-radiation, atmospheric-science, geophysics, climate-science
I think there may also be an argument that can be made regarding treating the atmosphere as a multi-layered insulator, with each layer at its own temperature (with lapse rate mostly controlled mostly by convection and gravity); as carb... | {
"domain": "physics.stackexchange",
"id": 96353,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "thermodynamics, thermal-radiation, atmospheric-science, geophysics, climate-scienc... |
2. Then transformation matrix can be found by the function cv2. add 5 to each x-coordinate B. Now let's say we have some alternate. Coordinate Systems and Coordinate Transformations The field of mathematics known as topology describes space in a very general sort of way. Transformation Matrices. As the jacobian matrix ... | {
"domain": "eyuc.pw",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9857180685922241,
"lm_q1q2_score": 0.8546528264059812,
"lm_q2_score": 0.8670357718273068,
"openwebmath_perplexity": 549.3513566036629,
"openwebmath_score": 0.7963940501213074,
"tags": nu... |
organic-chemistry, synthesis, heterocyclic-compounds, chemical-engineering
3-Methylpyridine is produced industrially by the reaction of acrolein with ammonia:
:$$\ce{2 C3H3O + NH3 -> 3-CH3C5H4N + 2 H2O}$$ This reaction also affords substantial amounts of pyridine.
Wikipedia Nicotinonitrile article
A colorless solid,... | {
"domain": "chemistry.stackexchange",
"id": 15246,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "organic-chemistry, synthesis, heterocyclic-compounds, chemical-engineering",
"... |
java, object-oriented, queue, serialization
It is additionally syntaxically more pleasing to send a Message rather than an address and a location.
By the way, why would the message body not be sent as well? This is confusing. I would have expected sendToDatabase(Message message, Address address) at least. Maybe the Lo... | {
"domain": "codereview.stackexchange",
"id": 24308,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, object-oriented, queue, serialization",
"url": null
} |
supermassive-black-hole, quasars, brightness
500 trillion times more luminous than the Sun
To put it in terms easier to understand at a human level, how bright would the quasar be if it were within our galaxy? I'm considering that it is either in place of the current black hole in the galactic center of the Milky Way... | {
"domain": "astronomy.stackexchange",
"id": 7242,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "supermassive-black-hole, quasars, brightness",
"url": null
} |
quantum-field-theory, particle-physics, quantum-chromodynamics, quantum-anomalies
either in the QCD there are massless spin $1/2$ bound states
reproducing $(1)$, or there is the SSB with the Goldstone bosons reproducing $(1)$.
For the QCD it was found that, assuming first existence of massless bound fermions, it is... | {
"domain": "physics.stackexchange",
"id": 43645,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-field-theory, particle-physics, quantum-chromodynamics, quantum-anomalies"... |
java, file, file-system, io, stream
note:
you could write the corresponding information directly inside the loop.
for (Path path : pathSet) {
attr = getBasicFileAttributes(path);
if (attr.creationTime().toMillis() > fileTime) {
fileTime = attr.creationTime().toMillis();
pathToRetu... | {
"domain": "codereview.stackexchange",
"id": 36486,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, file, file-system, io, stream",
"url": null
} |
# Strong law of large numbers for Poisson process
My question regards the strong law of large numbers as stated, e.g., in Ethier and Kurtz (1986, p. 456 Eq. (2.5)), as follows:
If $Y$ is a unit Poisson process, then for each $u_0>0$, \begin{eqnarray*} \lim_{n \to \infty} \sup_{u \geq u_0} \vert Y(nu)/n - u \vert = 0 ... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9732407137099625,
"lm_q1q2_score": 0.8131265999235788,
"lm_q2_score": 0.8354835432479661,
"openwebmath_perplexity": 286.964729726222,
"openwebmath_score": 0.9893971681594849,
"tags... |
strings, parsing, search, smalltalk
You can actually run do: and at:put: on it directly, but there's also doWithIndex: for example, which looks like it will make your second bit even simpler:
string := 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'.
string doWithIndex: [ :char :i | (char = $T... | {
"domain": "codereview.stackexchange",
"id": 26688,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "strings, parsing, search, smalltalk",
"url": null
} |
python, tic-tac-toe
Title: Tic Tac Toe in Python practice I'm quite novice here so apologies for any silly mistake in advance
I've been writing a simple tic tac toe game which is a part of my course in udemy
Since this is my first project, I want to do my best in order to learn new things besides learning how to code ... | {
"domain": "codereview.stackexchange",
"id": 38867,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, tic-tac-toe",
"url": null
} |
javascript, html, css, dom
width: 100%;
}
.customizeField{
/*TEST 1*/
position: absolute;
top: 50%;
left: 50%;
transform: translate(-50%, -50%);
/*TEST 1*/
}
.textbutton{
border: none;
align-items: center;
background-color: rgb(204,204,204);
box-shadow: -2px -2px 4px 0 rgba(255, 255, 255, 0.3) inse... | {
"domain": "codereview.stackexchange",
"id": 38190,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "javascript, html, css, dom",
"url": null
} |
javascript, node.js, ecmascript-6, amazon-web-services, nosql
and then the function below basically polls my database every 1 minute looking for new rows that have a null value & performs actions on them until the lastUpdated can then be updated (once an action is performed elsewhere) | {
"domain": "codereview.stackexchange",
"id": 34107,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "javascript, node.js, ecmascript-6, amazon-web-services, nosql",
"url": null
} |
ros, ros-hydro, camera-info-manager
/usr/local/lib/libgtest.a(gtest-all.cc.o): In function `llvm::raw_os_ostream::raw_os_ostream(std::ostream&)':
gtest-all.cc:(.text._ZN4llvm14raw_os_ostreamC2ERSo[_ZN4llvm14raw_os_ostreamC5ERSo]+0x28): undefined reference to `vtable for llvm::raw_os_ostream'
/usr/local/lib/libgtest.a(... | {
"domain": "robotics.stackexchange",
"id": 21872,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, ros-hydro, camera-info-manager",
"url": null
} |
quantum-mechanics, special-relativity, wavefunction, hilbert-space, dirac-equation
Title: Dirac Equation in RQM (as opposed to QFT) is written in which representation? In introductory Quantum Mechanics treatments it is common to see the Schrödinger's equation being written, simply as:
$$-\dfrac{\hbar^2}{2m}\nabla^2\Ps... | {
"domain": "physics.stackexchange",
"id": 31001,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-mechanics, special-relativity, wavefunction, hilbert-space, dirac-equation... |
game, rust
fn main() {
env_logger::Builder::new()
.filter_level(log::LevelFilter::Info)
.init();
let deck = Deck::new(
[
(WHITE_SUITS.iter().copied(), Some('★')),
(BLACK_SUITS.iter().copied(), Some('☆')),
]
.iter()
.cloned(),
RANK... | {
"domain": "codereview.stackexchange",
"id": 38384,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "game, rust",
"url": null
} |
java, performance, linked-list, deque, heuristic
/**
* Removes the last occurrence of the specified element in this
* list (when traversing the list from head to tail). If the list
* does not contain the element, it is unchanged.
*
* @param o element to be removed from this list, if present
... | {
"domain": "codereview.stackexchange",
"id": 42034,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, performance, linked-list, deque, heuristic",
"url": null
} |
Uniform convergence in probability Statlect. This can happen only if convergence is not uniform. This theorem does not hold if uniform convergence is replaced by pointwise convergence. For example, let ƒ, By comparing the definition of uniform convergence with eqs. (6) and (7), it is clear that the sum given in eq. (... | {
"domain": "top85.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9458012686491108,
"lm_q1q2_score": 0.8057780444860065,
"lm_q2_score": 0.8519528057272543,
"openwebmath_perplexity": 479.3520617740006,
"openwebmath_score": 0.8387923836708069,
"tags": null... |
java, game, unit-testing, community-challenge
public void add(final Card card) {
Objects.requireNonNull(card);
ExceptionUtils.throwOnSuccess(this::isFull, IllegalStateException::new, "hand is full");
list.add(card);
}
I would wrap the longer lines. 180 character is could be much.
I like your finals, they ... | {
"domain": "codereview.stackexchange",
"id": 7096,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, game, unit-testing, community-challenge",
"url": null
} |
go
// Find and remove a struct element from a slice of struct pointers within a struct
func main() {
var d myData
details := make(detailSlicePtr, ARBITRARY)
for j := 0; j < ARBITRARY; j++ {
details[j] = &detail{
id: j,
name: strconv.Itoa(j),
}
}
d.de... | {
"domain": "codereview.stackexchange",
"id": 11789,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "go",
"url": null
} |
quantum-mechanics
Could you please show a step by step instruction on how this was done? Even one or two terms would suffice the example, no need to do the entire Hamiltonian. Edit: The question was flagged as a homework question. It is not one. The concepts may be clear but an example application often clarifies what... | {
"domain": "physics.stackexchange",
"id": 82125,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-mechanics",
"url": null
} |
homework-and-exercises, mass, nuclear-physics, mass-energy, binding-energy
I don't understand that, since that mass difference Δm would be tinier as the one I calculated earlier. And shouldn't it be bigger since neutrons are missing? Or am I overthinking this and ignore that neutrons decay - since they decay into a pr... | {
"domain": "physics.stackexchange",
"id": 78046,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "homework-and-exercises, mass, nuclear-physics, mass-energy, binding-energy",
"ur... |
There are other interpretations of system failure, which I trust you can take from here. | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9843363476123224,
"lm_q1q2_score": 0.8047682650469344,
"lm_q2_score": 0.8175744673038222,
"openwebmath_perplexity": 306.61734968844195,
"openwebmath_score": 0.7428539991378784,
"ta... |
beginner, c, io
I commend you on using long names in c, as many c-programmers use 1-2 letter names for things. I might suggest adding comments to complex code, such as mentioning the fact that you are using triangle inequality in your is_valid_triangle function
I would also suggest extending this program to work with ... | {
"domain": "codereview.stackexchange",
"id": 12701,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "beginner, c, io",
"url": null
} |
81 2.5 Inverse Matrices Suppose A is a square matrix. Matrices are array of numbers or values represented in rows and columns. inverse matrix 3x3 matlab, This Solver (Finding the Determinant of a 3x3 Matrix) was created by by jim_thompson5910(35256) : View Source, Show, Put on YOUR site About jim_thompson5910: If you n... | {
"domain": "tager.lt",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9425067179697694,
"lm_q1q2_score": 0.8084522031268212,
"lm_q2_score": 0.8577681068080748,
"openwebmath_perplexity": 385.722225238428,
"openwebmath_score": 0.7457876205444336,
"tags": nu... |
acid-base, solutions, titration
Remember that the volume of titrating solution added at the equivalence point can be calculated from the respective concentrations:
$$ V_\ce{NaOH} = V_\ce{HA} \cfrac{C_\ce{HA}}{C_\ce{NaOH}} $$
Since all three examples have the same concentration of acid, the first equivalence point will... | {
"domain": "chemistry.stackexchange",
"id": 10204,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "acid-base, solutions, titration",
"url": null
} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.