text
stringlengths
1
1.11k
source
dict
a and x are related by ~ to each other”.. (Well, there may be some ambiguity about whether $(x,y) \in R$ is read as "$x$ is related to $y$ by $R$" or "$y$ is related to $x$ by $R$", but it doesn't matter in this case because your relation $R$ is symmetric.). The short answer to "what does this mean": To say that $x$ is...
{ "domain": "brandhome.com", "id": null, "lm_label": "1. YES\n2. YES\n\n", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9702399026119352, "lm_q1q2_score": 0.8412326828177606, "lm_q2_score": 0.8670357512127872, "openwebmath_perplexity": 449.1873379878951, "openwebmath_score": 0.5408604741096497, "tag...
blast, pdb Title: How to find a homolog that has a PDB structure available I tried to find a homolog that has a PDB structure available so I can use this PDB file for comparative modeling. I ran a BLAST search but none of the search results seemed to have a known structure. Is there any way to find the results I want?...
{ "domain": "bioinformatics.stackexchange", "id": 1278, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "blast, pdb", "url": null }
- Is there any general method for solving such problems? –  Norbert Jan 6 '12 at 15:33 @Norbert I think that having look at these questions could help math.stackexchange.com/questions/30687/… and math.stackexchange.com/questions/93459/… Perhaps someone who has better knowledge of field theory and Galois theory than me ...
{ "domain": "stackexchange.com", "id": null, "lm_label": "1. YES\n2. YES", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9793540722737479, "lm_q1q2_score": 0.8096435537572182, "lm_q2_score": 0.8267117855317474, "openwebmath_perplexity": 426.22503597245486, "openwebmath_score": 0.9249665141105652, "ta...
ros, callback, boost, action-server, action-client Please if someone knows how to solve this problem would be fantastic... I'm sure the solution is just changing a couple of characters, but I need to know which character. Originally posted by Canni on ROS Answers with karma: 5 on 2017-08-02 Post score: 0 First, chan...
{ "domain": "robotics.stackexchange", "id": 28515, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "ros, callback, boost, action-server, action-client", "url": null }
To help you understand, you could alternatively allow the angle $$\theta$$ to range from $$0$$ to $$2\pi$$. Then the area of the inscribed rectangle is $$|4 \cos \theta \sin \theta|$$, since it must be positive (and in quadrants II and IV, exactly one of $$\cos \theta$$ and $$\sin \theta$$ is negative). But if we recal...
{ "domain": "stackexchange.com", "id": null, "lm_label": "1. YES\n2. YES", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9915543715614326, "lm_q1q2_score": 0.8174988336996953, "lm_q2_score": 0.824461932846258, "openwebmath_perplexity": 74.75352397040051, "openwebmath_score": 0.9555150270462036, "tags...
fluid-dynamics $$\frac {\partial}{\partial t} (\rho\,\mathbf{u}) + \nabla \cdot (\rho\,\mathbf{u} \otimes \mathbf{u}) = \mathbf{f}$$ where $\mathbf{f}$ are all the interactions of a fluid element with its surroundings, e.g. pressure, gravity, etc. If you integrate this over a fixed volume $V$ (Euler picture of flu...
{ "domain": "physics.stackexchange", "id": 77903, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "fluid-dynamics", "url": null }
• Far better than my answer, which I shall now delete so as to avoid taking away well-deserved upvotes. But a counterexample to the $> 1/2$ exists, namely, $x, y \sim \text{U}(-1,1)$ and $x=1/4 \implies y \in [-3/4, 1/4]$, which evidently has probability equal to $1/2$. Mar 23 '18 at 20:05 • I'm not sure I follow you'r...
{ "domain": "stackexchange.com", "id": null, "lm_label": "1. YES\n2. YES", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9728307661011976, "lm_q1q2_score": 0.804250670047401, "lm_q2_score": 0.8267117962054048, "openwebmath_perplexity": 265.27622693231837, "openwebmath_score": 0.9112862944602966, "tag...
python, algorithm traverse_tree(config) ``` This approach will work, but be slow. You will be comparing something like N**2.5 lines in the worst case, which is quite bad. You should be running in something more like linear time. The biggest problem I see here is that your problem is not well-defined, so first clarify ...
{ "domain": "codereview.stackexchange", "id": 41957, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "python, algorithm", "url": null }
, is section modulus (Z), must be selected such that the f c does not exceed an allowable value. The shear force intensityvari es from zero at the top and bottom, y= ± h/2, to a maximum value at the neutral axis at y = 0 From Eq. 3- Determine the maximum shear stress in the beam section shown in the figure. But usually...
{ "domain": "laquintacolonna.it", "id": null, "lm_label": "1. YES\n2. YES", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9865717452580315, "lm_q1q2_score": 0.8133908373489247, "lm_q2_score": 0.8244619220634456, "openwebmath_perplexity": 1143.035002803819, "openwebmath_score": 0.7363621592521667, "ta...
ros Originally posted by DelWilson on ROS Answers with karma: 1 on 2014-01-02 Post score: 0 Original comments Comment by DelWilson on 2014-01-02: Clarification: one file is named ros-latest.list and starts with dep and the other ross-latest.list which starts with deb. dep is a typo; it should be deb You should only ...
{ "domain": "robotics.stackexchange", "id": 16559, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "ros", "url": null }
python, classification, scikit-learn, class-imbalance, metric Title: How to compute G-mean score? I would greatly appreciate if you could let me know how to fix the following issue: I used sklearn.metrics.fowlkes_mallows_score to compute G-mean score for my binary classification problem, but it produces nan: AUC: 0.9...
{ "domain": "datascience.stackexchange", "id": 10224, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "python, classification, scikit-learn, class-imbalance, metric", "url": null ...
physical-chemistry, thermodynamics My Questions How is bond formation enthalpy different from bond enthalpy? Why does the equation gets reversed when we are using bond formation enthalpy? Bond formation enthalpy and enthalpy of formation of a substance are different, right? This "enthalpy of bond formation" you are r...
{ "domain": "chemistry.stackexchange", "id": 15506, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "physical-chemistry, thermodynamics", "url": null }
(2) When the ball starts pure rolling, V = ωR (3). The conservation of angular momentum equation can then be used to find the omega of the ball, which can also be measured experimentally. We have found that a = gsinθ/(1 + c) and f. The ball can be any size and radius. Heavier objects have a greater moment of inertia an...
{ "domain": "motorfalke.de", "id": null, "lm_label": "1. YES\n2. YES\n\n", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.984336354045338, "lm_q1q2_score": 0.8137624648166316, "lm_q2_score": 0.8267117855317473, "openwebmath_perplexity": 338.2680287069021, "openwebmath_score": 0.5416763424873352, "tags...
php, mysql, symfony2, doctrine, symfony3 /** * @ORM\Column(type="datetime",nullable=true) */ private $createdAt I have done is put a renewal button on the contract I want to renew, and when I renew that contract I keep both the current contract and the new contract that has been created. My intention is...
{ "domain": "codereview.stackexchange", "id": 31206, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "php, mysql, symfony2, doctrine, symfony3", "url": null }
organic-chemistry, stereochemistry, isomers Title: number of optical isomers of a cyclic molecule What is the number of optical isomers for this compound? Also, there seems to be no clear-cut boundary between geometrical isomers and optical isomers. Referring to a post in StackExchange, is (RS)- and (RR)-form of 1,2-...
{ "domain": "chemistry.stackexchange", "id": 11212, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "organic-chemistry, stereochemistry, isomers", "url": null }
ros sensor_msgs::Image_<std::allocator<void> > >&; T2 = const boost::shared_ptr<const message_filters::NullType>&; T3 = const boost::shared_ptr<const message_filters::NullType>&; T4 = const boost::shared_ptr<const message_filters::NullType>&; T5 = const boost::shared_ptr<const message_filters::NullType>&; T6 = const b...
{ "domain": "robotics.stackexchange", "id": 28895, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "ros", "url": null }
reinforcement-learning, monte-carlo-methods, model-free-methods Title: Why are state-values alone not sufficient in determining a policy (without a model)? "If a model is not available, then it is particularly useful to estimate action values (the values of state-action pairs) rather than state values. With a model, ...
{ "domain": "ai.stackexchange", "id": 2222, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "reinforcement-learning, monte-carlo-methods, model-free-methods", "url": null }
where $$g_n(x)$$ is some ($$n$$-1)th order polynomial function of $$x$$ and is finite in value. This can be proven inductively by considering the ($$n$$+1)th derivative: \begin{align} \\ f^{(n+1)}(x) &= \tfrac{d}{dx} \Big( f^{(n)}(x) \Big) \\ &= \tfrac{d}{dx} \Big(K \big(1 - x^2 \big)^{N-n+1} \, g_n(x)\Big) \\ &= K(N-...
{ "domain": "stackexchange.com", "id": null, "lm_label": "1. YES\n2. YES", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9766692339078751, "lm_q1q2_score": 0.8007645919746638, "lm_q2_score": 0.8198933315126791, "openwebmath_perplexity": 1126.2977873774507, "openwebmath_score": 0.9993211030960083, "ta...
newtonian-gravity, pressure, fluid-statics $$\Delta P = \rho g \Delta h$$ Where $\rho$ is the density of water (1000 kg/m$^3$), $g$ is the gravitational acceleration (9.8 m/s$^2$), and $\Delta h$ is the height difference (100 ft). Now if you have a small container at the top, then when water starts to flow the water l...
{ "domain": "physics.stackexchange", "id": 49785, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "newtonian-gravity, pressure, fluid-statics", "url": null }
machine-learning, python, data-cleaning the Y (target) variable is either 0 or 1 My first question is should I normalize the X values? Since the classifiers target value is 0 or 1 and the independent variable are much larger or smaller. My second question is when you normalize your X variables should you normalize th...
{ "domain": "datascience.stackexchange", "id": 8821, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "machine-learning, python, data-cleaning", "url": null }
performance, file, go, search, bioinformatics Title: Locate substrings within a file Here, I am reading in a newline delimited file that can be millions of repeating lines that looks like this: TGATAGTTAGTCATATGAAAGCATCATTAGTAAACCACATTGCTTATTATATTGAACAGT TACATCTGGCTTATTATACAAAGAGAAAACCATACTATTCATACTATTCTCTTTTTGATC TTC...
{ "domain": "codereview.stackexchange", "id": 33412, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "performance, file, go, search, bioinformatics", "url": null }
There was a typo on the sheet: the 1 should have been a -1 (this was corrected at some point though). Therefore, the question goes as follows: \begin{align*} 16&=\int\limits_{-1}^k3x^2-12x+9\mathrm{d}x &\text{NOTE: Do not omit the dx (as in the OP). You'll drop a mark.}\\ &=\left[x^3-6x^2+9x\right]_{-1}^k\\ &=k^3-6k^2...
{ "domain": "stackexchange.com", "id": null, "lm_label": "1. YES\n2. YES", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9702399026119352, "lm_q1q2_score": 0.8106194716347812, "lm_q2_score": 0.8354835432479661, "openwebmath_perplexity": 191.7684568815697, "openwebmath_score": 0.9615248441696167, "tag...
python, beginner weight = int(input("Please enter the weight of the package: ")) print('The shipping charge is: ${:,.2f}'.format(shipping_charge(weight))) if __name__ == '__main__': main() Added: shipping_charge_no_list As commented upon, your teacher is not fond of lists, so here is a version of the functio...
{ "domain": "codereview.stackexchange", "id": 16467, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "python, beginner", "url": null }
estimation, climate-science, solar-cells The minor point: Generating electricity by burning fossil fuels also adds heat to the planet. For example, only about 1/3 of the energy liberated by burning coal in a coal power plant is turned into electricity; the rest is waste heat. The major point: Fossil-fuel power plants ...
{ "domain": "physics.stackexchange", "id": 52519, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "estimation, climate-science, solar-cells", "url": null }
rotational-dynamics, reference-frames, angular-momentum This can be given a precise mathematical meaning, but intuitively it means something like the following: if an object has angular momentum, this causes the object to rotate. If an object has linear momentum, this causes the object to move (“translate”). Technical...
{ "domain": "physics.stackexchange", "id": 91869, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "rotational-dynamics, reference-frames, angular-momentum", "url": null }
java private HashMapHandler hash; public FileKeyCounter() { hash = new HashMapHandler(); } public void countKeys(String fileName) { FileReader fileReader = null; BufferedReader reader = null; try { fileReader = new FileReader(f...
{ "domain": "codereview.stackexchange", "id": 13835, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "java", "url": null }
human-anatomy, biophysics, health, temperature, bone-biology Teeth on the other hand, can crack from cold, but it needs to be very very cold, much colder than you will ever experience unless you are visiting Antarctica in the depths of winter, or perhaps parts of the Arctic (Yukon, Siberia) in winter. As far as I know...
{ "domain": "biology.stackexchange", "id": 12363, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "human-anatomy, biophysics, health, temperature, bone-biology", "url": null }
ros2 3: Test command: /usr/bin/python3.10 "-u" "/opt/ros/humble/share/ament_cmake_test/cmake/run_test.py" "/home/jishnu/testros/workspace/build/test_package/test_results/test_package/lint_cmake.xunit.xml" "--package-name" "test_package" "--output-file" "/home/jishnu/testros/workspace/build/test_package/ament_lint_cmak...
{ "domain": "robotics.stackexchange", "id": 2685, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "ros2", "url": null }
javascript, beginner, dom, video if (button) button.addEventListener('click', playVideo, false) querySelector can return null. So while you are checking button, you aren't checking for iframe. You will possibly get Assigning property src to undefined or something like that. classList is one of the newer properties. ...
{ "domain": "codereview.stackexchange", "id": 19354, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "javascript, beginner, dom, video", "url": null }
c#, sql, mvc the magic number 999999 if (c == 999999) continue; should be extracted to a meaningful named constant. Adding braces {} to such single line if statements should als be done to make the code less error prone. In addition you are sometimes adding braces and sometimes don't. If you decide to use one ...
{ "domain": "codereview.stackexchange", "id": 16089, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "c#, sql, mvc", "url": null }
# using (kg, cm) A_kg_cm = [a1/1000, a2] B_kg_cm = [b1/1000, b2] C_kg_cm = [c1/1000, c2] print('[kg, cm] A-B:', euclidian_distance(A_kg_cm, B_kg_cm)) print('[kg, cm] A-C:', euclidian_distance(A_kg_cm, C_kg_cm)) # using (grams, m) A_g_m = [a1, a2/100] B_g_m = [b1, b2/100] C_g_m = [c1, c2/100] print('[g, m] A-B:', euc...
{ "domain": "stackexchange.com", "id": null, "lm_label": "1. YES\n2. YES", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9433475778774728, "lm_q1q2_score": 0.8324361817210539, "lm_q2_score": 0.8824278571786139, "openwebmath_perplexity": 1993.6192671869928, "openwebmath_score": 0.7240191698074341, "ta...
3,977 views Consider the number given by the decimal expression: $$16^3*9 + 16^2*7 + 16*5+3$$ The number of $1’s$ in the unsigned binary representation of the number is ______ ### 1 comment $16^3=2^{12}$ and multiplying a number in binary with $2^x$ means that we are shifting that number to the left by $x$ bits. So,...
{ "domain": "gateoverflow.in", "id": null, "lm_label": "1. Yes\n2. Yes", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9728307716151472, "lm_q1q2_score": 0.8864236656502853, "lm_q2_score": 0.9111797154386841, "openwebmath_perplexity": 737.5600028960262, "openwebmath_score": 0.7348429560661316, "tags"...
electromagnetic-radiation, double-slit-experiment, interference Title: Why does interference pattern remain constant? In the double slit experiment we have something like this Light waves from two sources interfere at screen to give us this pattern. To reach the middle (that is a point on the perpendicular bisector...
{ "domain": "physics.stackexchange", "id": 99705, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "electromagnetic-radiation, double-slit-experiment, interference", "url": null }
javascript, playing-cards get length() { return this.cards.length; } get HCPs() { return this.calcHCPs(); } get sortedCards() { return this.cards.sort((x, y) => { if ( !isNaN(x) && isNaN(y) ) { return 1; } else if ( isNaN(x) && isNaN(y) ) { if ( x === "J" ) { return 1...
{ "domain": "codereview.stackexchange", "id": 41623, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "javascript, playing-cards", "url": null }
than to differentiate the itself... ( where u is a nonprofit with the mission of providing a free world-class! A Differential calculus Math mission on Khan Academy: Solving logarithms ln chain derivative differentiation situations! The method of logarithmic differentiation exercise appears under the Differential calcul...
{ "domain": "cmccintl.com", "id": null, "lm_label": "1. YES\n2. YES\n\n", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9808759638081522, "lm_q1q2_score": 0.8173880676218309, "lm_q2_score": 0.8333245973817158, "openwebmath_perplexity": 1750.0349962657733, "openwebmath_score": 0.4318494498729706, "tag...
terminology, machine-translation Title: Do full-text translators such as DeepL or Google Translate fall under the term "Generative AI"? My question relates to full-text translators that are not specifically based on LLMs. My current understanding is that the term Generative AI goes beyond LLMs and that the full-text t...
{ "domain": "ai.stackexchange", "id": 4112, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "terminology, machine-translation", "url": null }
c#, json Title: Convert Json response to object array I'm looking for the best solution. Here is a response from server and i need to get Organizations list: Content-Type:application/json;charset=UTF-8 { "code": 0, "message": "success", "organizations": [ { "organization_id": "10234695", "...
{ "domain": "codereview.stackexchange", "id": 30833, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "c#, json", "url": null }
So I think it is safe to say that the hypothesis $$\displaystyle \lim_{x \to \infty} f'(x) < 1 \tag 1$$ gives us two important facts concerning the function $$f(x)$$: first, that $$\lim_{x \to \infty} f'(x)$$ actually exists, that is, there is some $$L \in \Bbb R$$ such that, given any $$\epsilon > 0$$, there also e...
{ "domain": "stackexchange.com", "id": null, "lm_label": "1. YES\n2. YES", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9835969641180276, "lm_q1q2_score": 0.8109382456937072, "lm_q2_score": 0.8244619242200081, "openwebmath_perplexity": 3548.3187075129154, "openwebmath_score": 0.9987109899520874, "ta...
usb Title: ROS Answers SE migration: Is ROS for me? I am building a hobby robot from a old powered wheelchair. For the brains I have built a mini PC (intel core i3). For the motor controllers I am using two 25amp pololu simple motor controllers that can controlled over USB. I have a USB video camera that I'll use as ...
{ "domain": "robotics.stackexchange", "id": 11914, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "usb", "url": null }
audio Template: Cross-correlation: from scikits.audiolab import wavread from scipy.signal import fftconvolve from matplotlib.pyplot import plot template, fs, enc = wavread('clang.wav') recording, fs, enc = wavread('Volvo EC360B NLC clangs.wav') # Cross-correlation is convolution with one reversed c = fftconvolve(...
{ "domain": "dsp.stackexchange", "id": 479, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "audio", "url": null }
search, state-spaces, norvig-russell, depth-first-search, state-space-search If the nodes are at the same depth, let's assume that you expand them alphabetically; so, in the search space above, you expand first $B$ and then $C$, because $B$ comes before $C$ (in the English alphabet). Now, note that we can go directly ...
{ "domain": "ai.stackexchange", "id": 3084, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "search, state-spaces, norvig-russell, depth-first-search, state-space-search", "url": ...
electric-current, charge, si-units, discrete, metrology In addition, if you look at the SI base units and how they relate to the fundamental constants, you see that linking the mole to the Ampère, does not really simplify things. One still need a link to the electric charge of the electron and the hyperfine splitting ...
{ "domain": "physics.stackexchange", "id": 85380, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "electric-current, charge, si-units, discrete, metrology", "url": null }
electromagnetism, optics, speed-of-light There is actually an oscillating electromagnetic field everywhere in space (if this is a plane wave), and this animation shows only the field along an axis parallel to the $y$-axis. The vectors shown don't actually "span" any amount of space. Importantly, those vectors represe...
{ "domain": "physics.stackexchange", "id": 97852, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "electromagnetism, optics, speed-of-light", "url": null }
c#, beginner, console break; } } } else { if (i == 9) { teamIntro = ($"{Team2} time for your final question."); } else ...
{ "domain": "codereview.stackexchange", "id": 25650, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "c#, beginner, console", "url": null }
reference-frames, vectors, coriolis-effect In this case, the Earth rotates once each day. Rotational motion is accelerated motion. But we who live on the surface of the Earth think of it as inertial, as stationary. The acceleration we experience from traveling in a circle once per day is small, so we usually don't not...
{ "domain": "physics.stackexchange", "id": 71372, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "reference-frames, vectors, coriolis-effect", "url": null }
by a.... Definition & Examples, Working Scholars® Bringing Tuition-Free College to the Community Leg rule to this video our... To Q you are still not convinced, let ’ s consider these! Class of quadrilaterals can not be proven congruent because they have two angles an! if I have a dog. once students understand triangle...
{ "domain": "com.mx", "id": null, "lm_label": "1. Yes\n2. Yes\n\n", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9748211597623863, "lm_q1q2_score": 0.8014873660066589, "lm_q2_score": 0.822189134878876, "openwebmath_perplexity": 2011.2985900795904, "openwebmath_score": 0.3094938099384308, "tags": nul...
So, we can write the recurrence as: $T(n) = \begin {cases} \Theta(1) & \text { if } n = 1, \\ T(n - 1) + \Theta(n) & \text { if } n > 1 \end {cases}$ Although it has not been asked in the problem statement, let us try to solve the recurrence for practice the same way it was done for $$\textsc {Insertion-Sort}$$ in th...
{ "domain": "github.io", "id": null, "lm_label": "1. YES\n2. YES", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9843363489908259, "lm_q1q2_score": 0.8047682771121817, "lm_q2_score": 0.817574478416099, "openwebmath_perplexity": 565.6393993600861, "openwebmath_score": 0.9997324347496033, "tags": null,...
quantum-field-theory, particle-physics, quantum-electrodynamics, pair-production (a) gamma matrices (b) spinors (representing both particles and anti-particles) The reason is because each and every component of four-vectors is simply a scalar quantity. On the other hand, each component of the gamma matrices is a matri...
{ "domain": "physics.stackexchange", "id": 88936, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "quantum-field-theory, particle-physics, quantum-electrodynamics, pair-production",...
# Interpolate on log scale I have data in Mathematica that comes from y-log scale Data = {{5.0, 23.87548081003781}, {6.94392523364486, 0.511639358262082}, {8.925233644859812, 0.23397526329810545}, {10.962616822429906, 0.16190746961888203}, {12.906542056074766, 0.17751810380557045}, {14.925233644859812, 0.256534458699...
{ "domain": "stackexchange.com", "id": null, "lm_label": "1. YES\n2. YES", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.953966096291997, "lm_q1q2_score": 0.8448624027113336, "lm_q2_score": 0.8856314768368161, "openwebmath_perplexity": 4253.633085613474, "openwebmath_score": 0.22834773361682892, "tag...
proofs, st.statistics, embeddings $$ for $k \ll d$. Of course, in this case $\|f(y) - f(x)\|_2 = 0$ is a very bad approximation for $\|x - y\|_2 = 1$. So you almost certainly get infinite error. This is why the Fast J-L Transform of Ailon and Chazelle uses a Walsh matrix rather than a Haar matrix: $WDx$, for $D$ picke...
{ "domain": "cstheory.stackexchange", "id": 2466, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "proofs, st.statistics, embeddings", "url": null }
newtonian-mechanics, reference-frames, acceleration Title: Pendulum in an accelerating train A bob is hung from ceiling of a train.The train is moving with acceleration "a". The bob will make angle theta=tan^-1(a/g) with the vertical. This situation is synonymous to a one in which the train is on an incline of theta=t...
{ "domain": "physics.stackexchange", "id": 46784, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "newtonian-mechanics, reference-frames, acceleration", "url": null }
# How using law of cosines determines angle between two vectors My textbook says (derived from the law of cosines. Assume $|v-w| = c$. The equation below is basically $a^2 = b^2 + c^2 - 2bc \cos\theta$ rearranged: $$|v|^2 + |w|^2 = |v-w|^2 + 2|v||w|\cos\theta$$ The $|v|$ signify norm / magnitude. The book then says ...
{ "domain": "stackexchange.com", "id": null, "lm_label": "1. YES\n2. YES", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9883127395946486, "lm_q1q2_score": 0.8148262272800683, "lm_q2_score": 0.8244619285331332, "openwebmath_perplexity": 370.6931354763439, "openwebmath_score": 0.8999505043029785, "tag...
c++, c++11, library, audio m_opened{ false }, m_cacheSize{ cacheSize }, // 1MB == 1048576u m_cacheExtensionThreshold{ cacheExtensionThreshold } { if (m_cacheExtensionThreshold < 0.0) m_cacheExtensionThreshold = 0.0; else if (m_cacheExtensionThreshold > 1.0) m...
{ "domain": "codereview.stackexchange", "id": 39562, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "c++, c++11, library, audio", "url": null }
discrete-signals, sampling, computer-vision, nyquist, electrical-signal Title: Nyquist frequency , sampling distance I have few questions I tried to solve regarding nyquist theorem, and I would like to see your opinion if I'm doing it correctly?(one I know the answer second one not sure). 1.Let $f(x)$ and $g(x)$ be fu...
{ "domain": "dsp.stackexchange", "id": 7236, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "discrete-signals, sampling, computer-vision, nyquist, electrical-signal", "url": null...
algorithms, graphs Title: Kosaraju with connections between SSCs (strongly connected components) First of all I did find similar questions here on Computer Science but nothing what would provide real answer for this problem. I have a graph which i condense into SSC (strongly connected components) by Kosaraju's algorit...
{ "domain": "cs.stackexchange", "id": 12427, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "algorithms, graphs", "url": null }
ros, pcl, packages Comment by anonymous28046 on 2016-09-24: Regarding the PCL 1.7 that could be the issue I guess. I am using ROS indigo/jade and according to http://www.ros.org/reps/rep-0003.html I should be using C++03. What is the easiest way to turn of C++11 in gcc? A few are here: http://stackoverflow.com/questio...
{ "domain": "robotics.stackexchange", "id": 25823, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "ros, pcl, packages", "url": null }
design recall some information regarding this subject in this robotics handbook: https://www.cs.cmu.edu/~mmv/planning/readings/handbook.pdf but I'm unaware of any specific papers on this topic - most focus on some specific aspect of robotics or AI, and the controller architecture is just a means to that end.
{ "domain": "robotics.stackexchange", "id": 850, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "design", "url": null }
- @Ace: Thank you for taking the time to check my answer, find that it was off by one, and do the hard work in extending it! Have an upvote! –  drvitek Nov 1 '10 at 1:55 From Andreescu and Andrica, Complex Numbers from A to Z p. 48. $$\prod_{1 \le k \le n} \sin{\frac{(2k-1)\pi}{2n}} = \frac{1}{2^{n-1}}.$$ Ibid., p. ...
{ "domain": "mathoverflow.net", "id": null, "lm_label": "1. YES\n2. YES", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9702399060540359, "lm_q1q2_score": 0.8085247810842515, "lm_q2_score": 0.8333245994514084, "openwebmath_perplexity": 332.9126468684274, "openwebmath_score": 0.9165408611297607, "tags...
winforms, powershell, active-directory $details = new-object Windows.Forms.DataGridView -pr @{ AllowUserToAddRows = $false AllowUserToDeleteRows = $false AutoSizeRowsMode = [Windows.Forms.DataGridViewAutoSizeRowsMode]::AllCells AutoSizeColumnsMode = [Windows.Forms.DataGridViewAutoSizeCo...
{ "domain": "codereview.stackexchange", "id": 8151, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "winforms, powershell, active-directory", "url": null }
homework-and-exercises, kinematics, projectile Title: Projectile Motion, get velocity and angle knowing distance and max height I have been trying to figure out how to solve it. I know how to get the velocity by the distance and how to get the max height. Distance: $d = V_0^2 \cdot \sin(2\cdot\alpha)/g$ Max height: $h...
{ "domain": "physics.stackexchange", "id": 76891, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "homework-and-exercises, kinematics, projectile", "url": null }
ros, multiple All of these look like they're doing custom audio capture using ALSA or another OS-level API. Originally posted by ahendrix with karma: 47576 on 2015-07-10 This answer was ACCEPTED on the original site Post score: 3
{ "domain": "robotics.stackexchange", "id": 22145, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "ros, multiple", "url": null }
rust, computational-geometry, graphics, opengl // The second triangle of the radial segment. inds.push(c); inds.push(b); inds.push(d); } println!("{:.1?}", verts); println!("{:?}", inds); } for the sake of completeness here are the constants and the struct used within the function...
{ "domain": "codereview.stackexchange", "id": 43250, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "rust, computational-geometry, graphics, opengl", "url": null }
With V=W X R you end up with three equations corresponding to the three components of V. With v=W o R you end up with one equation because v is a scalar, and three unknowns for W. #### jbriggs444 Homework Helper Solving v=wxr makes sense, since this can be seen as solving 3 equations with 3 unknowns (each components)...
{ "domain": "physicsforums.com", "id": null, "lm_label": "1. YES\n2. YES\n\n", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9504109742068041, "lm_q1q2_score": 0.80008033917396, "lm_q2_score": 0.8418256532040707, "openwebmath_perplexity": 1447.615235060041, "openwebmath_score": 0.7856002449989319, "t...
c# string result = char1 + char2 + char3 + char4; string path = @"C:\Users\Username\Desktop\passwords.txt"; using (StreamWriter sw = File.AppendText(path)) { sw.WriteLin...
{ "domain": "codereview.stackexchange", "id": 41317, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "c#", "url": null }
python, python-3.x, tree elif search_type == 2: print("_____TREE_MAX____") found_node = self.tree_max(root) if found_node is not None: print(found_node.value) else: print("Not Found") elif search_type ==...
{ "domain": "codereview.stackexchange", "id": 27523, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "python, python-3.x, tree", "url": null }
Suppose that $w := \sqrt 2 = p/q$ for integers $p,q>0.\,$ Then $w^2 = 2\,\Rightarrow\, w = 2/w = 2q/\color{#c00}p.\,$ Therefore if $w =\sqrt 2$ is a fraction $p/q$ then its numerator $\color{#c00}p$ can also serve as a denominator for $w$. This peculiar property easily leads to contradictions, e.g. if we choose $q$ as ...
{ "domain": "stackexchange.com", "id": null, "lm_label": "1. YES\n2. YES", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9643214491222695, "lm_q1q2_score": 0.8412232956887594, "lm_q2_score": 0.8723473862936942, "openwebmath_perplexity": 202.39386786748088, "openwebmath_score": 0.9427694082260132, "ta...
Tough 700+ Level RCs: Passage1 | Passage2 | Passage3 | Passage4 | Passage5 | Passage6 | Passage7 VOTE GMAT Practice Tests: Vote Here PowerScore CR Bible - Official Guide 13 Questions Set Mapped: Click here
{ "domain": "gmatclub.com", "id": null, "lm_label": "1. Yes\n2. Yes", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9284087965937711, "lm_q1q2_score": 0.8015803688683482, "lm_q2_score": 0.8633916134888614, "openwebmath_perplexity": 3135.2848151299554, "openwebmath_score": 0.5189012885093689, "tags": ...
# derivative of an array Hi I am trying to take a derivative of an array but am having trouble. The array is two dimensional, $x$ and $y$ directions. I would like to take a derivative along $x$ and along $y$ using central difference discretization. The array has random values of numbers, no values are NaN. I will prov...
{ "domain": "stackexchange.com", "id": null, "lm_label": "1. YES\n2. YES\n\n", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9553191284552529, "lm_q1q2_score": 0.8001943752844698, "lm_q2_score": 0.8376199653600371, "openwebmath_perplexity": 595.1819945856529, "openwebmath_score": 0.5927183628082275, ...
classification, scikit-learn, pipelines Where I have entered xxxxxxxxxxx below replace with one of the following ce.OneHotEncoder ce.TargetEncoder OneHotEncoder OrdinalEncoder from sklearn.pipeline import FeatureUnion from sklearn.compose import ColumnTransformer from sklearn.preprocessing import Imputer from sklear...
{ "domain": "datascience.stackexchange", "id": 6141, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "classification, scikit-learn, pipelines", "url": null }
c, linked-list /* * Append an element to the list. */ void list_append(List * list, void * elem) { Node * new; new = (Node*) malloc(sizeof(Node)); new->data = elem; new->next = NULL; if (list->tail) { new->prev = list->tail; list->tail->next = new; list->tail = new; ...
{ "domain": "codereview.stackexchange", "id": 13281, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "c, linked-list", "url": null }
algorithms, complexity-theory, time-complexity Proof: Let's consider $\phi \in O(f)$, then we have $\phi \leqslant C f \leqslant C (k+\varepsilon)g$ for appropriate $C, \varepsilon$ and $n \gt N.$ So $O(f) \subset O(g)$. Using, that we have also $\lim\limits_{n \to \infty}\frac{g(n)}{f(n)}=\frac{1}{k} \gt 0$, we obta...
{ "domain": "cs.stackexchange", "id": 17707, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "algorithms, complexity-theory, time-complexity", "url": null }
The same idea would work for any closed nowhere dense subset $E\subset[0,1]$ of positive measure, and you can appeal to the definition to see this. Because every subinterval of $[0,1]$ has nonempty intersection with $[0,1]\setminus E$, the lower Riemann sums of $\chi_E$ are all $0$. However, the upper Riemann sums are ...
{ "domain": "stackexchange.com", "id": null, "lm_label": "1. YES\n2. YES", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9787126488274565, "lm_q1q2_score": 0.8197892530246804, "lm_q2_score": 0.8376199633332891, "openwebmath_perplexity": 223.85372312138747, "openwebmath_score": 0.9354121685028076, "ta...
bash, installer #part 3 : SCRIPT - a 'case' to watch options like "-update" - the list of 7 functions that I need to run everytime with or without the susmentionned 'options' Total = 409 lines (~150 without all the simple text to write somewhere or to display) Here's the full code. You can also watch what it does...
{ "domain": "codereview.stackexchange", "id": 7843, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "bash, installer", "url": null }
works for every problem. ) sin2 t+cos2 t =1 tan2 t+1 = sec2 t 1+cot2 t = csc2 t Table 6. Detailed Description for All Pythagorean Theorem Worksheets. If cost = 3/5 and t is in quadrant IV, use the trigonometric identities to find the values of all the tirgonometirc functions at t. Trigonometric Identities. The longest ...
{ "domain": "hhdy87.com", "id": null, "lm_label": "1. YES\n2. YES\n\n", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9901401441145626, "lm_q1q2_score": 0.837601566789277, "lm_q2_score": 0.8459424373085146, "openwebmath_perplexity": 945.3422094831918, "openwebmath_score": 0.7557592391967773, "tags": ...
Now, the map which takes $i \sqrt{3}$ to $- i \sqrt{3}$ and fixes $\alpha_1$ interchanges $\omega$ and $\omega^2$ (as you can see from their explicit formulas). Thus, it maps $\alpha_2 = \omega \alpha_1$ to $\omega^2 \alpha_1 = \alpha_3$ and similarly it maps $\alpha_3$ to $\alpha_2$. Thus it is the transposition $(23)...
{ "domain": "stackexchange.com", "id": null, "lm_label": "1. YES\n2. YES", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9907319879873276, "lm_q1q2_score": 0.8190498192322087, "lm_q2_score": 0.8267117940706735, "openwebmath_perplexity": 92.97965961086115, "openwebmath_score": 0.9551321864128113, "tag...
is 1. We can define these as the parent functions for the sine and cosine families of functions. Since we have the coordinates of a high point, we will use a cosine function. This standard works in conjunction with the content standards. We can relate sides and angles in an arbitrary triangle using two basic formulas k...
{ "domain": "marcodoriaxgenova.it", "id": null, "lm_label": "1. YES\n2. YES\n\n", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9902915223724212, "lm_q1q2_score": 0.820891080723575, "lm_q2_score": 0.8289388146603365, "openwebmath_perplexity": 518.6406767028611, "openwebmath_score": 0.7474116683006287, ...
proteins, food, nutrition, temperature Why do we cook then instead of digesting by ourself Digestion takes much energy and require the organism to have the right organs and to have the right matter (enzymes and stuff). We can save up energy (and the other stuff) by digesting the food outside our body. One could say t...
{ "domain": "biology.stackexchange", "id": 4156, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "proteins, food, nutrition, temperature", "url": null }
complexity-theory, reductions, polynomial-time Title: If A is poly-time reducible to B, is B poly-time reducible to A? Basically, is the following statement true?
{ "domain": "cs.stackexchange", "id": 1280, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "complexity-theory, reductions, polynomial-time", "url": null }
virology, mutations, coronavirus If you are interested in this question, I recommend looking into genotype-phenotype maps. I know Jesse Bloom has done some work on influenza in this field, here is one example of such a paper. It is generally extremely laborious to do this kind of work, so relatively little is known ab...
{ "domain": "biology.stackexchange", "id": 10398, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "virology, mutations, coronavirus", "url": null }
that are nested i.e... Two-Dimensional area, a double integral in which the integrand involves a function of more than variable! Central points and many useful things Theorem of Calculus Thanks to all of you support... To integrate over a region in [ latex ] R^2 [ /latex are... X and y i.e some Properties of integrals ...
{ "domain": "kabero.com", "id": null, "lm_label": "1. YES\n2. YES\n\n", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9773707993078212, "lm_q1q2_score": 0.8345893935251338, "lm_q2_score": 0.8539127566694177, "openwebmath_perplexity": 693.7423234955559, "openwebmath_score": 0.9358883500099182, "tags":...
How to Find a Basis for the Nullspace, Row Space, and Range of a Matrix, Prove that $\{ 1 , 1 + x , (1 + x)^2 \}$ is a Basis for the Vector Space of Polynomials of Degree $2$ or Less, Basis of Span in Vector Space of Polynomials of Degree 2 or Less, The Intersection of Two Subspaces is also a Subspace, Rank of the Prod...
{ "domain": "evirtualservices.com", "id": null, "lm_label": "1. YES\n2. YES\n\n", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9748211597623863, "lm_q1q2_score": 0.838018409020435, "lm_q2_score": 0.8596637451167997, "openwebmath_perplexity": 264.9882352193398, "openwebmath_score": 0.8475714325904846, ...
special-relativity, coordinate-systems, inertial-frames, time-dilation, observers To re-emphasize the point that we are dealing with two different pairs of events when we consider length-contraction, I will quote here a part of the discussion from the comments (now deleted): The length of a rod in its rest frame is t...
{ "domain": "physics.stackexchange", "id": 85742, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "special-relativity, coordinate-systems, inertial-frames, time-dilation, observers"...
special-relativity, time-dilation Title: Length contraction experienced by a person "at rest"? If a person was riding a train going .999C tword a person standing on the train track, and the train track and everything on it were the only things in the universe, the person on the train would see the person on the track ...
{ "domain": "physics.stackexchange", "id": 91851, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "special-relativity, time-dilation", "url": null }
Edit: Following the answer I was able to reveal the higher pole for the third case: • I think the last plot shows a pole very close to the origin but it is not. Should you zoom out, you should see the second real pole at a higher frequency but it does not appear in the plot. When $Q$ is low ($R=100\;\Omega$), as expl...
{ "domain": "stackexchange.com", "id": null, "lm_label": "1. YES\n2. YES", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9643214480969029, "lm_q1q2_score": 0.8395356169619232, "lm_q2_score": 0.8705972667296309, "openwebmath_perplexity": 494.53591770624087, "openwebmath_score": 0.9045380353927612, "ta...
theoretical-biology, synthetic-biology, central-nervous-system Title: In theory how fast could nerve signals travel if the nerve fibre was perfectly insulated? My question is purely theoretical and my main aim is to find out the maximum speed that a nerve signal can travel within a nervous system and and whether this ...
{ "domain": "biology.stackexchange", "id": 5344, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "theoretical-biology, synthetic-biology, central-nervous-system", "url": null }
c++, algorithm, image, error-handling, c++20 [&](auto&& element) { return TinyDIP::normalDistribution1D( TinyDIP::recursive_reduce( TinyDIP::recursive_transform<1>( [&](auto&& each_plane_x, auto&& each_plane_input) { return TinyDIP::manhat...
{ "domain": "codereview.stackexchange", "id": 42578, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "c++, algorithm, image, error-handling, c++20", "url": null }
python, converting, numbers-to-words subThousand: You can use implicit evaluation of integers as boolean : 0 is False, anything else is True. subThousand: As explained in Janne Karila's comment, it might be worth returning an empty string when the input is 0. After taking into account the comments (except the last),...
{ "domain": "codereview.stackexchange", "id": 39585, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "python, converting, numbers-to-words", "url": null }
optics, waves, diffraction The secondary source at $P_1$ has the following properties: It has a complex amplitude that is proportional to the amplitude of the excitation U(P1) at the corresponding point. It has an amplitude that is inversely proportional to $A$, or equivalently directly proportional to the optical fr...
{ "domain": "physics.stackexchange", "id": 91094, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "optics, waves, diffraction", "url": null }
electromagnetism, mathematical-physics, boundary-conditions, differential-equations, greens-functions Where $G(x-x')=\frac{1}{|x-x'|}$ When we start to talk about boundary conditions there is an ambiguity in the definition of our Greens function such that we can have a form as follows: $G(x-x')=\frac{1}{|x-x'|}+F(x-x'...
{ "domain": "physics.stackexchange", "id": 6679, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "electromagnetism, mathematical-physics, boundary-conditions, differential-equations...
slam, navigation, eigen, rosdep, ros-fuerte Original comments Comment by allenh1 on 2012-07-24: How about you go to the root of the rgbdslam directory and do a git pull? Maybe code isnoutdated. If you just downloaded it, Check the cmake file. If it doesn't work, list the build log. Comment by jerdman on 2012-07-25: I...
{ "domain": "robotics.stackexchange", "id": 10227, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "slam, navigation, eigen, rosdep, ros-fuerte", "url": null }
blocks often a goal to find the minimizers of the equation by... No trendline, we 're often interested in the column space of, ^x, es... That exactly satis es additional constraints are a set of the equation by., but they ’ re what allow us to make all of wikiHow available for free, least problems! Squares minimizers i...
{ "domain": "strouden.com", "id": null, "lm_label": "1. YES\n2. YES\n\n", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.9603611563610179, "lm_q1q2_score": 0.864833828656533, "lm_q2_score": 0.9005297881200701, "openwebmath_perplexity": 1235.3437523865437, "openwebmath_score": 0.6542348265647888, "tags...
experimental-physics, speed-of-light, faster-than-light, refraction This effect is important in focusing X-ray telescopes, like Chandra or NuSTAR, since, as your video mentions, very high frequencies have phase velocities faster than $c$ in most materials and thus have indices of refraction less than $1$. Some familia...
{ "domain": "physics.stackexchange", "id": 13489, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "experimental-physics, speed-of-light, faster-than-light, refraction", "url": nul...
special-relativity, kinematics, vectors, inertial-frames, lorentz-symmetry \tag{07}\label{07} \end{equation} we simply divide equations \eqref{03a} and \eqref{03b} side by side and so we find that \begin{equation} \mathbf{w'} \boldsymbol{=}\dfrac{\mathbf{w}\boldsymbol{+}\dfrac{\gamma^2_{\mathrm u}\left(\mathbf{u}\bold...
{ "domain": "physics.stackexchange", "id": 56956, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "special-relativity, kinematics, vectors, inertial-frames, lorentz-symmetry", "ur...
functional-programming, scala println("Enter the length of sequence: ") val length = readInt(); val seq = populateSequence(length) Ok, where to from here? Well, in this case, instead of modifying substituteCount as we go, I'd rather just calculate it up front: val substituteCount = seq count (_ > z) To get our...
{ "domain": "codereview.stackexchange", "id": 3798, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "functional-programming, scala", "url": null }
c++, c++11, graph, dijkstra friend std::ostream& operator<<(std::ostream& stream, const Graph& g) { for (size_t i = 0; i < g.adjList.size(); i++) { stream << "node " << i << "\n"; for (const arc& p : g.adjList[i]) { stream << "connected with " << p.first << " cost: " << ...
{ "domain": "codereview.stackexchange", "id": 39890, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "c++, c++11, graph, dijkstra", "url": null }
hilbert-space, operators, mathematical-physics, commutator Title: Commutators and Hermiticity - Exam question I'm doing old exam questions, and here is one that on first glance seemed rather simple to me, but I just can't get it: Given two operators $A$ and $B$, and all we know about them is that $$[A,B] = B$$ and $$B...
{ "domain": "physics.stackexchange", "id": 1132, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "hilbert-space, operators, mathematical-physics, commutator", "url": null }
rotation, we have the matrix:. This property allows you to rotate, scale, move, skew, etc. Home / Mathematics / Space geometry; Calculates the new coordinates by rotation of points around the three principle axes (x,y,z). 7 Transformation Matrix and Stiffness Matrix in Three-Dimensional Space. This article might seem e...
{ "domain": "valledelchieseonline.it", "id": null, "lm_label": "1. YES\n2. YES", "lm_name": "Qwen/Qwen-72B", "lm_q1_score": 0.986777179414275, "lm_q1q2_score": 0.8537833831960149, "lm_q2_score": 0.8652240860523328, "openwebmath_perplexity": 608.277822995443, "openwebmath_score": 0.5945829749107361, ...
php, mysql, pdo, wrapper public function querySelect($tableName, $selectData, $sellectWhereKey = null, $selectWhereValue = null, $orderByKey = null, $orderByValue = null){ if(isset($selectWhereKey, $selectWhereValue)){ $prepare = parent::prepare("SELECT {$selectData} FROM {$tableName} WHERE...
{ "domain": "codereview.stackexchange", "id": 18068, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "php, mysql, pdo, wrapper", "url": null }
precipitation, terminology, mars, water-vapour Details are published in the Journal of Geophysical Research. In addition: Indirect evidence for water ice snow has also been found. According to an article published in Nature, mixing layers have been identified from orbiting spacecraft and water-ice precipitation sign...
{ "domain": "earthscience.stackexchange", "id": 2157, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "precipitation, terminology, mars, water-vapour", "url": null }
atmosphere, atmosphere-modelling, air-pollution, air-quality Typical air quality monitor sites are relatively sparse, and even large cities have just a few monitors. Generally, monitors are located in such a way that they are observing well mixed air, so that it represents air quality in the region. It is imperative...
{ "domain": "earthscience.stackexchange", "id": 712, "lm_label": null, "lm_name": null, "lm_q1_score": null, "lm_q1q2_score": null, "lm_q2_score": null, "openwebmath_perplexity": null, "openwebmath_score": null, "tags": "atmosphere, atmosphere-modelling, air-pollution, air-quality", "url": null }