text
large_stringlengths
148
17k
id
large_stringlengths
47
47
score
float64
2.69
5.31
tokens
int64
36
7.79k
format
large_stringclasses
13 values
topic
large_stringclasses
2 values
fr_ease
float64
20
157
Part I: Producing X-rays from adhesive tape A Collaboration with Johnny Lu Building our X-Ray source: While we could have purchased a standard X-Ray tube as an X-Ray source… it seemed kind of scary and we decided it might be more fun to attempt our own X-Ray source using scotch tape in a vacuum. Inspired by research done in 2010 at UCSD by Moses Marsh and the Shpyrko Group. The X-Ray producing effect is related to: - triboluminescence: the emission of light when a material is crushed, rubbed, scratched, or pulled apart. - Diffuse mechanical energy somehow concentrates huge charge densities over short time scales, resulting in high energy radiation during discharge. - At 1atm, it takes 50mW to peel tape at 3 cm/s. - In vacuum, it takes an extra 3mW. Of this, at least 0.2mW goes into accelerating electrons to 30 keV, generating an average X-ray power of 2 nW. The power going into visible triboluminescence is 10 nW. –Shpyrko Group We fabricated a winding mechanism from laser-cut acrylic and a high torque 24v gearhead DC motor. Our motor pulls approximately 9cm of tape per second, just slightly slower than the build at UCLA. Initial testing revealed clear signs of triboluminescence seen here, though no confirmation yet of X-Rays. We used an X-Ray phosphor (Gadolinium Oxysulfide: Terbium) as a visual indicator, but so far we have not seen any phosphorescence. We have only recently acquired a detector capable of reading X-Ray radiation, hopefully this will lead us in the right direction. We have so far only been able to bring our current vacuum chamber down to about -98 kPa against standard atmospheric pressure, which is about 3 magnitudes weaker than where UCLA was at (.0001 Torr). We believe we can’t go any lower with our current air-driven pump. We need to move to a multi stage oil-diffusion pump if we plan on getting a better vacuum… possible complications: vessel integrity. |pressure (Torr)||pressure (Pa)| |Atmospheric pressure||760||101.3 kPa| |Low vacuum||760 to 25||100 kPa to 3 kPa| |Medium vacuum||25 to 1×10−3||3 kPa to 100 mPa| |High vacuum||1×10−3 to 1×10−9||100 mPa to 100 nPa| |Ultra high vacuum||1×10−9 to 1×10−12||100 nPa to 100 pPa| |Extremely high vacuum||<1×10−12||<100 pPa| |Outer Space||1×10−6 to <3×10−17||100 µPa to <3fPa| |Perfect vacuum||0||0 Pa| Part II: The Effects of Ionizing Radiation On Plant Growth and Mutation Our Exposure Candidate: Pumpkin Seeds Using a standard dental X-ray device we will expose pumpkin and sunflower seeds to varying levels of radiation (most dental X-ray devices deliver around .005 mSv per exposure – equivalent to about 3 days of background radiation or a long airplane flight). We chose pumpkin seeds on the recommendation of Dave Jackson from Cold Spring Harbor genetics lab. Pumpkin and squash are fast growers and we concluded that if we are to get any growth in the amount of time we have… it had better be fast! Powerful ionizing radiation such as hard X-Ray and Gamma radiation has a destructive effect on DNA… essentially tearing it apart and causing it to form mutations. This is how cancer growth happens when exposed to radioactive material. We speculate that if our X-Ray source has any effect at all it will probably be totally inhibitory or sterilizing… that is: nothing will grow. Part III: The Effects of Aqueous Ferro Fluid and Magnetic Fields On Plant Growth As a bonus (and possible plan B) we have finally acquired all the necessary chemicals and equipment to synthesize aqueous (water based) ferro fluid, with the goal in mind to inject it into living plants to see if it, in addition to a magnetic field, has and effect on the growth of the plant. Aqueous Ferro Fluid Synthesis We are preparing the ferro fluid by iron oxide co-precipitation from auto-catalytic reaction of ferrous (Iron(II) Chloride Tetrahydrate) and ferric (Iron(III) Chloride Hexahydrate) salts. We have yet to make a decision on what to use as a surfactant, the substance that coats the magnetite nano-particles, helping to keep them in suspension. tetramethylammonium hydroxide has been used, but its potential toxicity here with plants makes it a bad candidate. We are considering citric acid, oleic acid, and linoleic acid as non-toxic substitutes. If synthesis is successful we plan to begin injections immediately into pumpkin and sunflower seeds in two groups; one with magnetic field exposure, and one without. Again pumpkins and sunflowers were chosen because they are fast growers. We will maintain a non-injected control group and log growth from germination.
<urn:uuid:2155e050-bdd5-48f2-852a-cecede6dfd75>
3.140625
1,142
Personal Blog
Science & Tech.
49.994265
There are many errors that can occur when numbers are written, printed or transferred in any manner. Luckily, there are schemes in place to detect, and in some cases even correct, such errors almost immediately. Emily Dixon takes a break and discovers that codes are not just for sleuths. 'Of the myriad strategems I employ to avoid useful work, the one I most enjoy is to envision how scientists of earlier eras would have made use of modern computers.' John L. Casti tells us how today's mathematicians are using computers to carry on the work of turn-of-the-century polymath d'Arcy Wentworth Thompson, who showed how mathematical functions could be applied to the shape of one organism to continuously transform it into other, physically similar organisms. Actuarial science began as the place where two branches of mathematics meet: compound interest and observed mortality statistics. Financial planning for the future is therefore rooted firmly in the past. John Webb takes us through some of the mathematics involved, introducing us to some of the colourful characters who led the way. Solitaire is a game played with pegs in a rectangular grid. A peg may jump horizontally or vertically, but not diagonally, over a peg in an adjacent square into a vacant square immediately beyond. The peg which was jumped over is then removed. The German mathematician Adam Ries (1492-1559) was the author of the most successful textbook of commercial arithmetic of his day. The book, published in 1552, earned such a high reputation that the German phrase nach Adam Ries is used to this day to indicate a correct calculation. We've all seen a traditional sundial, where a triangular wedge is used to cast a shadow onto a marked-out dial - but did you know that there is another kind? In this article, Chris Sangwin and Chris Budd tell us about a different kind of sundial, the analemmatic design, where you can use your own shadow to tell the time.
<urn:uuid:4400a01f-dde5-414d-ae2f-4a02519827df>
2.796875
407
Content Listing
Science & Tech.
41.661664
ESA offers a new way of looking at the Sun 14 December 2010 ESA has released interactive, open-source software that gives both scientists and the public an unprecedented insight into the ever-changing face of the Sun. Read more SOHO (SOlar Heliospheric Observatory) is a space-based observatory, viewing and investigating the Sun from its deep core, through its outer atmosphere - the corona - and the domain of the solar wind, out to a distance ten times beyond the Earth's orbit. Europe maintains its presence on the final frontier 22 November 2010 ESA has decided to extend the productive lives of 11 of its operating space science missions. This will enable ESA's world-class science missions to continue returning pioneering results until at least 2014. Read more SOHO sheds new light on solar flares 12 October 2010 Data from the SOHO and GOES spacecraft have enabled a team of European scientists to shed new light on the role of solar flares in the total output of radiation from the Sun. Their surprising conclusion: X-rays account for only about 1% of the total energy emitted by these explosive events. Read more
<urn:uuid:35e6dda1-a029-4313-a22d-4458daafffa4>
2.71875
230
Content Listing
Science & Tech.
33.916403
Scott Baker, associate director of the Marine Mammal Institute at Oregon State University, writes from Samoa, where he studies the formation of local communities among dolphins and their genetic isolation from one another. Wednesday, Aug. 15 I often think that finding a needle in a haystack would be relatively comfortable work compared with finding dolphins in offshore waters. If the dolphins do not approach the boat to ride the bow, the only sighting cue is the dorsal fin or the occasional leap. Add wind, waves and sun glare to create discomfort as well as tedium. Even when you find the dolphins, it is easy to lose them in the waves and whitecaps. It can be frustrating work, but interrupted with moments of excitement and the occasional discovery. Today, we surveyed the offshore waters along the northwestern tip of Savai’i hoping to find rough-toothed dolphins. Previous studies in Hawaii and the Society Islands (French Polynesia) have found that this species prefers waters of 3,000 to 6,000 feet in depth. To improve our chances, we planned a series of surveys crossing this depth a few miles offshore of Asau, where we had anchored for the night. Although the morning began with calm seas, the wind and swell increased by late morning and the conditions for sighting the dolphins deteriorated. By early afternoon we had abandoned our survey track and were headed back to shore, feeling a little discouraged. Then our luck changed. Just as I started down the ladder from the flying bridge to the deck, I thought I saw a blow. As I called out to the others, the animal surfaced again and I could see it was too large for a dolphin. Before we had time to grab our cameras, the whale leapt fully into the air and dived. It was a beaked whale, one of the most elusive and poorly understood mammal groups. More than 20 species are currently described in the Ziphiidae family, some of which have never been seen alive. Beaked whales are primarily deep-diving species, spending much of their lives at great depths in pursuit of squid, their main prey. I have worked for many years on the molecular identification of beaked whales using DNA extracted from bones in museums, but this was my first encounter with a living beaked whale. It was over in an instant. I knew that it was unlikely we would see the whale again, given the nearly hourlong dives that are common with these species. I quickly sketched what I saw on the back of our sighting form and showed it to Renee, Nevé and Titi. We all agreed that whale was about 20 feet long and robust in girth. The back of the whale was dark, and appeared brown in color. As it leapt, I thought I saw the characteristic “tusks” of a mature male – actually two teeth that erupt from the lower jaw. Beaked whale species are difficult to identify at sea, but it is likely that this was a Cuvier’s beaked whale, one of the most widely distributed members of this family. A biopsy sample would have allowed us to confirm the species identification, but collecting a sample was not possible in these conditions. Encouraged by this sighting, we continued our offshore track despite the conditions. Remarkably, over the next hour we found a small but uncooperative pod of rough-toothed dolphins and sighted another beaked whale. This time, we had our cameras ready but got only a glimpse of the whale’s back before it dived. Based on the location and time, we think it unlikely that this was the same individual that we had seen an hour earlier. Back at anchor in Asau, the winds abated and we enjoyed a few of the pleasures of work in Samoa. First, a swim in the warm lagoon with the glow of sunset for a backdrop. Then the melodies of the local musicians playing in the small resort where we anchored. Finally, the intense black night and bright starlight of the South Pacific.
<urn:uuid:fe361880-45c1-4ae8-bac8-9e8e3e735816>
3
821
Personal Blog
Science & Tech.
53.546895
Like people, planets grow old. They start out full of energy, but over billions of years, they change. Instead of losing their hair, planets can lose their atmospheres and oceans. Instead of wrinkles, they may gather craters. And rather than becoming frail, planets cool and shrink, becoming more dense as they move into their senior years. |Earth's early atmosphere formed from | gases spewed by volcanic eruptions! They continue to contribute to Earth's atmosphere today. Much of the gas is carbon dioxide and water vapor. Later biological activity from early life added oxygen to our atmosphere. Mars is an example of a planet past its youth. Planetary scientists envision a warmer, wetter early Mars, with flowing rivers and ocean and a thicker atmosphere, all surrounded by a protective global magnetic field. As Mars cooled, its core could no longer generate a magnetic field. Its interior became too cool to produce the volcanic eruptions that built and maintained the atmosphere. Without the protective shield of the magnetic field, the solar wind gradually eroded away Mars' diminished atmosphere. Water, once flowing across the surface, evaporated or became trapped in the subsurface or polar ice caps. Exploring how worlds evolve will help us understand more about Earth's own future -- and help us in our search for habitable planets! Join us in this YSS topic as we investigate how planets evolve!
<urn:uuid:31205bfa-902e-4eac-8e20-09576587c5cd>
4.0625
289
Knowledge Article
Science & Tech.
43.542266
Phytoplankton around the Falkland Islands Shades of iridescent blue dominated the Atlantic Ocean east of the Falkland Islands in mid-December 2011. The Moderate Resolution Imaging Spectroradiometer (MODIS) on NASA’s Terra satellite captured this natural-color image on December 14, 2011. Bright swirls form a giant arc hundreds of kilometers long. The blue streak owed its existence to countless microscopic organisms. Phytoplankton—plant-like marine organisms that convert sunlight to energy—thrive in the cold, nutrient-rich waters of the Malvinas Current. Also known as the Falkland Current, it carries cold water along the southeast coast of South America. The phytoplankton-friendly conditions lead to frequent colorful blooms. This image originally appeared on the Earth Observatory. Click here to view the full, original record.
<urn:uuid:5e297b32-3c96-41c1-9fae-82257e62d18b>
3.765625
182
Knowledge Article
Science & Tech.
32.336178
|Exponential-and-logarithmic-functions/429148: Carbon dioxide is a greenhouse| gas in the atmosphere that may raise average temperatures on Earth. The burning of fossil fuels could be responsible for the increased levels of carbon dioxide. If current trends continue, future concentrations of atmospheric carbon dioxide in parts per million (ppm) could reach the levels shown in the accompanying table. The concentration in the year 2000 was greater than it had been at any time in the previous 160,000 years. sCO2d (a) Let x be in years, where corresponds to 2000, to 2001, and so on. Find values for C and a so that models the data. (b) Graph f and the data in the same viewing rectangle. (c) Use to estimate graphically the year when the carbon dioxide concentration will be double the preindustrial level of 280 ppm. Year 2000 2050 2100 2150 2200 CO2 (ppm) 364 467 600 769 987 Answer 310966 by nmo9772(2) on 2011-05-21 14:35:09 (Show Source):
<urn:uuid:612cfbbb-669b-4352-82b2-6c93c3fe6f13>
3.34375
249
Q&A Forum
Science & Tech.
71.664839
25 08 11 - 20:34From the debunking of modern religions department: New genetic evidence reveals that most British men are not descended from immigrant farmers who migrated east 5,000-10,000 years ago -- contrary to previous research. More than 100 million European men have a set of genes called R-M269, including about three-quarters of British men. A key question in understanding the peopling of Europe is when this group spread out across Europe. Researchers say their work shows that the set of genes chosen to estimate the age of this group of men vary the outcome enormously. They add that the previously reported east-west pattern is not found in their larger and more comprehensive dataset. This, the Oxford-Edinburgh team says, leaves little evidence for a farmer-led dispersal of this major group. According to Dr Cristian Capelli, the Oxford geneticist who led the research, the study "resets" the debate on the peopling of Europe. He says, "Our works overturns the recent claims of European Y chromosomes being brought into the continent by farmers." - Science Daily One big happy family!
<urn:uuid:e5a15573-47d1-4268-8264-f90b929563f0>
3.109375
234
Personal Blog
Science & Tech.
50.448019
Before the creation of the HTML Table model, the only method available for relative alignment of text or objects was through the use of the PRE element. While this was useful in some situations, the effects of PRE are very limited, and some other solution was definitely necessary to resolve this need. Current desktop publishing packages provide a high degree of control over table rendering using other document formats. Unfortunately, it would be impractical to reproduce this in HTML given the otherwise simplistic nature of the language, without making HTML into a bulky rich text format [like RTF or MIF.] Given this requirement, the table model that has been developed is still definitely THE most complex formatting structure in HTML. Its design supports rendering to braille or speech, as well as exchange of tabular data with databases and spreadsheets. The model is also designed to work well with style sheets, but does not require them. History of HTML Tables The HTML table model has evolved from studies of existing SGML table models, the treatment of tables in common word processing packages, and looking at a wide range of tabular layouts in magazines, books and other paper-based documents. After HTML 2.0 (RFC 1866) was forwarded as a proposed standard, work had already begun on extending the capabilities of HTML. The result of this was HTML + in late 1993. One of the most important features of HTML + was its Table model which allowed tabular representation of data WITHOUT the use of the preformatted text (PRE) element. HTML + later developed (after much refinement) into the draft for HTML 3.0. The 3.0 draft sported Tables capability like its HTML + predecessor, but improved on its features. Many browsers have since implemented this 3.0 Table model. Since creating this HTML 3 Table model, a great deal of refinement has occurred. The current full Tables specification has risen from the ashes of the expired HTML 3.0 draft to give the author an intuitive and intentionally simple design that is sufficient for most authoring purposes. This makes it practical to create the HTML codes for tables with simple text editors and reduces the learning curve when getting started - factors critical to the success of HTML thus far. Tables in a Nutshell The concept of Tables in HTML involves content that is contained in individual cell structures. These cells can contain other HTML structures such as headers, lists, paragraphs, forms, multimedia objects, preformatted text and even nested tables. The TABLE model is a sort of hybrid element. It exhibits line-breaking behaviors which are similar to other Block formatting structures (like lists and headings) and floating ability similar to that of other replaced elements (like IMG.) The top level Table container element [TABLE] controls global properties for the table structure itself, while the various other elements and attributes for tables organize and format the contained cell content into row and column structures. Table capabilities such as in-cell alignment for example, are allowed in most of the Table elements, from the cell level [TH, TD] to the highest grouping elements [COLGROUP, TFOOT, TR.] This allows for more efficient specification of global properties. In cases where global properties specified at one level conflicts with that specified elsewhere, the most specific value wins - cell properties take precedence over row grouping properties, and properties within cells take precedence over all of these. This is the Table Model that most browsers currently support. The model is from the HTML + and HTML 3.0 Draft specifications which describes tables in terms of table cells grouped into row-based [TR] cell layouts. The row structures are the only grouping mechanism for the Simple Table Model. Organization of content with greater complexity is accomplished with greater finesse using the At the lowest level of a table structure are the table cells which contain all table content. Table cells are distinguished into header [TH] and data [TD] cells. This distinction allows browsers to render header and data cells distinctly, even in the absence of style sheets. Cells can also span or merge across multiple rows and columns, and may be empty. Cells spanning rows contribute to the column count on each of the spanned rows, but only appear in the markup once (in the first row spanned.) The row count is determined by the number of TR elements. Any rows implied by cells spanning rows beyond this should be ignored. If the column count for the table is greater than the number of cells for a given row (after including cells for spanned rows), the missing cells are treated as occurring on the right hand side of the table and rendered as empty cells (or on the left side if the current language direction indicates it.) As can be guessed, it is also possible to create tables with overlapping cells. In these cases, the rendering of the table is left to the browser. The Complex model incorporates all the elements of Simple tables in addition to many new elements that give the author even more organizational control. The Complex model inherits certain aspects of the CALS Table Model, such as the ability to group Table Rows into and TFOOT sections, as well as the ability to specify cell alignment compactly for sets of cells according to the context. The Complex table model is also fully backward-compatible with the Simple table model. This allows simple tables to be expressed simply with extra complexity added only The Complex Table Model offers several rendering advantages over the Simple Model: For large tables or slow network connections, it is desirable to be able to start displaying the table before all of the data has been received. To achieve this, the table must explicitly state the number of columns contained before any of the table content is received [COLS attribute.] Using the COLGROUP and COL elements the author can also specify relative or absolute sizes for each column of the table (all cells in a column have the same width.) Scrolling and Non-Scrolling Table Regions When rendering to a paged device (i.e. a printer), tables will often have to be broken across page boundaries. Grouping Table Rows [TR] in to Header [TBODY] and Footer [TFOOT] elements allows the browser to repeat the table foot at the bottom of the current page, and then the table head at the top of the new page before continuing on with the Table Body. Also, If the table has a large number of rows in the TBODY, a browser may choose to use a scrolling region for its display of the Table Body sections while keeping the Header and Footer sections in a static position. [NOTE: The suggestion about repeated table headers/footers with printed material is a statement originally from the HTML 4 spec - as of the time of writing, only Mozilla 1.0/Netscape 7.0 does this - maybe this feature will gain wider acceptance in the future.] THEAD and TFOOT are placed before the TBODY in the markup sequence, so that browsers can render the header and footer before receiving all of the Table Body data. Each THEAD, TFOOT and TBODY element must contain one or more TR elements. Complex Internal and External Border The Simple table model only offers one universal control mechanism for specifying borders in a table. An author can specify a static border thickness (or none at all) that applies around all cells in the table. The Complex model, on the other hand, offers authors the ability to choose from a set of commonly used classes of border styles to independently control the outer table border [FRAME attribute] and inner table cell borders
<urn:uuid:d5ce2891-7120-468a-ba55-a3659d4c2ecc>
3.90625
1,664
Documentation
Software Dev.
43.204548
Simply begin typing or use the editing tools above to add to this article. Once you are finished and click submit, your modifications will be sent to our editors for review. liquid crystal structure ...aligned, but allow rotation of molecules about their directors. These are the so-called plastic crystals. Many interesting liquid crystal phases are not listed in this table, including the discotic phase, consisting of disk-shaped molecules, and the columnar phases, in which translational symmetry is broken in not one but two spatial directions, leaving liquidlike order only along... What made you want to look up "discotic phase"? Please share what surprised you most...
<urn:uuid:6e7e7e91-2b50-4e32-9a6e-41488bca371e>
2.6875
134
Knowledge Article
Science & Tech.
42.527967
by Brian Hawkins Jan 20, 2005 In this section we go over the general concept of rules and dependencies. If you are familiar with GNU make then you may want to skip this section as the concepts are the same. Those of you from the Ant world may want to take a look as it is different from Ant's way of looking at things What is a Rule? A rule defines what to do when a file is out of date and needs to be updated. Also when defining a rule you provide a list of dependencies, this is how the make system knows when the file is out of date. For example we define a rule that says file A is dependent on file B and the method to call for processing the rule is called "foo". When the build is ran the make system checks the dates on the files A and B. If B is newer then A the method "foo" will be called to updated A. One thing to note here is that the dependencies that are defined while defining the rule are passed to the method as the second parameter. Dependencies that are defined outside of the rule definition are not. Lets look at a real world example. When compiling C code the binary is linked together from the object files. Each object file is built form a corresponding C file. If a C file is newer then the object file then the object file needs to be rebuilt as well as the binary needs to be relinked. In this case we can set up a rule that puts a dependency between the binary and the object files and the method to call would call out to the system linker and relink the binary. We would also set up rules between the object files and the C files. Because a project typically has only one binary and many C/CPP files you can create what is called a pattern rule. This way in one rule you can say all object files depend on the corresponding C file of the same name and the method to call would call out to the system compiler to create the object file. What are Dependencies? A dependency lets you set up, well, dependencies between files that are being built. You may be asking why do I need to do this when I can set this up with rules? Because dependencies set up in rules are passed to the rule method. Dependencies set up outside of rules are not.. A good example is the build directory. In the above example the object files and the binary all depend on the build directory being there but you do not want the build directory being passed to either of the rules. You would then have a rule for creating the directory. What is a Phony Rule? Sometimes you need a rule for something that does not exist. Like clean. Typically build scripts will have way to clean up the droppings of the build process so that you can begin again fresh. Because there is no file "clean", you create a phony rule for it. Phony means that the target of the rule does not exist nor will it. Phony rules are a convenient way of putting human understandable tasks in a build file. Building CPMake from The first thing you need is Bean shell interpreter jar file. Visit www.beanshell.org and download version 1.3.0 or later. The build files expect version 1.3.0. Place the jar file in the ext directory under cpmake. Alternatively you can place it in the CPMake can be built in one of three ways. - Using Ant - Using CPMake All steps assume that your current directory is the root of the cpmake Manual steps for all platforms Create a build directory Compile source to the build directory ext/bsh-1.3.0.jar;build -d build cpmake/*.java Create the cpmake jar file jar -cfm cpmake.jar manifest.txt -C build cpmake Now that you have built it with one of the above steps you can use CPMake to build, well CPMake! >java -jar cpmake.jar When using CPMake to build itself the resulting jar is placed in the build directory so as to not overwrite the good one if you happen to mess up the code. Other build options when using CPMake: This creates the javadocs >java -jar cpmake.jar javadoc This cleans out the project build files and generated doc directory. >java -jar cpmake.jar clean Running CPMake requires that the cpmake.jar file is in your class path. Also depending on what scripting language you have chosen to write your make files in you will need to have the following files Groovy also requires the asm jar file that can be found here. CPMake does not require all jar files to be present to run. Only the for the scripting language you have chosen is required. There is an option in the CPMake build file that lets you extract all of these jar files and place them in the cpmake.jar file. This can make for easier internal distribution of cpmake. To do this download the source from CVS and place the above jar files in the ext directory. Then compile cpmake using 'onejar' as the target. This will extract the jars and place them all in side Command line options CPMake has a small command line help you can get to by the following >java make -? This will be the most up to date information on what command line options are available. Currently CPMake's command line is as follows: [-v] [-f <build file>] [-t <thread count>] [<targets>] -v : Verbose mode. This will echo all calls to exec functions as well as echoing other information about the build. -f : Build File. This specifies the build file to be used. If this option is not specified CPMake looks for the following files in this order "build.bsh", "build.py", "build.gvy", or "build.groovy". The first one found is processed as the build -t : Thread count. This specifies the number of threads to use when processing the build queue. <targets> : This is a list of targets CPMake is to try and make. Each target is processed in order. CPMake is built using java 1.4.2. In this version there is no provided way of getting environment variables into the JVM. To work around this CPMake uses a file called "env.properties". On startup CPMake looks for the file env.properties and parses it for key=value pairs. This file can be easily created by echoing the environment to the file. This can be done on windows by calling: >set > env.properties and on unix platforms: >env > env.properties On startup CPMake takes properties from env.properties, cpmake.properties and System.getProperties() and combines them all together. These properties are made available to the make file via the getProperty method calls. None of the above files need to exist and for cleanliness env.properties is deleted after CPMake is done processing. As of the 1.2 release CPMake can automatically import the environment variabls on Windows and Linux. Other platforms may still need to use the env.properties There are some properties that can effect the way CPMake runs. cpmake.threadCount - sets the number of threads to use when running. This is overridden by the -t option. cpmake.debug - turns on debug messages when set to "on". cpmake.dependencyCheck - turns off the dependency checker when set to "off". It is on by default. cpmake.cacheDir - sets the location of the .cpmakecache file. it defaults to the current directory. Because using a '.' is not valid in the unix environment the above settings can also be done with '_' such as cpmake_threadCount. CPMake reads properties from the env.properties and cpmake.properties files. These properties are combined with the java system properties and are made available via the getProperties() calls. The env.properties and cpmake.properties files doe not need to be present to run. Their main intent is for passing environment and other settings to the build script. The Build File CPMake supports three scripting languages for writing the build script BeanShell, Jython and Groovy. CPMake is fully compatible with all three and the only limitations are those of the languages. Examples here are taken from BeanShell. Rules are the fundamental part of the build file. A rule defines how a file can be created or updated. A rule can also define dependencies that a particular file has. There are three kinds of rules; explicit, pattern and phony. A phony rule is the same as the explicit rule except that the target does not exist, meaning the target is not a file in the file system but a task like "clean" or "build". The sample area has good examples of the use of phony rules. Explicit rules can be created by calling make.createExplicitRule(String target, String prerequisites, String scriptCall, boolean verify). Lets look at an example "test.java", "compile", true); In this rule "test.class" is the target "test.java" is the prerequisite and "compile" is the name of the script method to call to update test.class. The boolean "true" tells CPMake to verify that this file exists after the method "compile" has been called. Here is the example in full context: "test.java", "compile", true); compile(String target, String The variable target in this case would contain the value "test.class" and the variable prerequisites would be an array of one and the first element would be "test.java". These variables use will become more obvious as we talk about pattern rules. When evaluating a target CPMake will run the rule for that target if any of the following are true 1. The target does not exists (except in the case of phony targets) 2. Any of the files the target is dependent on are newer then the Creating pattern rules The above example is a good one but not very practical. Explicit rules are better suited for single targets. In most java applications there are lots of java files to be compiled. In this case you do not want to write an explicit rule for each one. This is where pattern rules can be used. For example lets write a pattern rule that can be used to compile any "$1.java", "compile", true); Here we use regular expressions to set up a patter rule. This rule says that for any target that ends with ".class" it depends on the file of the same name but with a ".java" and the method of this rule is "compile". The boolean is to verify that the target is there after the method has been called. Now to see this in full context: "$1.java", "compile", true); If the file to be compiled was "test.java" then the target variable would contain "test.class" and prerequisites is an array of one element and the first element would be "test.java". Note. As most java guru's know it would be a waist of time to call javac on every java file that needed to be compiled as javac will compile all missing class files needed in one call. For the sake of this example just imagine that it didn't and it only compiled the file you tell it to. For better examples of compiling java code see the samples area. Pattern rules are second priority to explicit rules. If you have both a pattern rule and an explicit rule defined for the same target the explicit rule will be used. You may also have multiple pattern rules for the same target. CPMake will however give favor to the one that has an existing prerequisite. Take the following two rules for example "$1.c", "compile", true); "$1.cpp", "compile", true); Now if the target is main.obj CPMake will look for first main.c and then main.cpp. For the one that exists the appropriate rule will Built in rules CPMake has one built in rule for creating directories. This is useful if your project has a build directory where all the output files go. You can create a rule for the out directory and it will be created for you. For example your project puts its files in the "build" directory. You can create a rule like this: The first parameter is the directory to make. The second parameter is any prerequisites this directory may have (most don't have any). The last parameter is whether to echo the creation of this directory to the console. Dependencies let you set relationships between files that are outside the rule definitions. The only difference between the dependencies set up by calling createExplicitRule and createExplicitDependency is that the dependencies are not passed to the For example in a java application the jar file should be updated if the manifest file is changed, but you do not want to explicitly pass the manifest file as a prerequisite to the method that creates the jar file. In this case you can set up a dependency with the This will trigger the rule for creating the test.jar file anytime the manifest.txt file is updated. Pattern dependencies let you set up dependencies for largest sets of files. For example all the files in the project should be dependent on the build file. If it is updated the entire project needs to be rebuilt to reflect the new changes. This can be setup with the following line: Pattern dependencies use regular expressions for matching a potential target with the prerequisites. Setting a default target Setting a default target is optional. What this does is allow you to run the build file without specifying any target at all and the default will be done. To set the default target somewhere in the build file do the following: Where target is the name of the target you wish to process. If you declare a method in your build script that matches the following It will be called before CPMake begins processing a build target. In this method you may include additional build scripts, change properties values or add additional dependencies. Calling external programs CPMake provides several exec methods for use when calling external programs. Some of the scripting languages used provide their own means of executing external programs, but there are several reasons why you may wish to use those provided by CPMake. 1. CPMake redirects all input and output to the console so you can interact and see the output from running the program. 2. CPMake executes the command synchronously. It will wait for the process to end before proceeding with the rest of the build. 3. CPMake can echo the output of the program to a log file if one is For specifics on each API and the parameters please see the javadoc API CPMake provides an automatic project cleaning target. Because the build file specifies what to build it also specifies what to clean, if you just think about it backwards. If you do not provide a build target 'clean' and clean is specified on the command line CPMake calls the autoClean method. This method looks at all the build targets that are in the build file and then removes them if they exist. Building with multiple CPMake has the ability to process build files using multiple threads. If you have a multi processor or hyper threaded machine this can significantly reduce your build times. When building a target CPMake creates a queue of rules it needs to perform in order to get the job done. The queue is ordered by dependency. For example when compiling a C++ application the tasks for compiling the object files will come before linking together the executable because linking is dependent upon the compilation being done first. When processing with multiple thread the compiling of the object files are done simultaneously but when a thread hits the linking task it will wait until all of the dependencies are done first. Compiling multiple files at the same time can be problematic if the compiler tries to write to a common file. This can be the case in compiling windows applications and writing to a pdb. There is a way as shown in the samples area how to do this on windows and have separate pdb files written. When the linker is ran it links the pdb files together as well as the exe. Recursive calls to CPMake This feature is being worked on for the 1.2 beta.
<urn:uuid:300af8c4-c511-4103-b7bf-1594d316e4d9>
3.921875
3,719
Documentation
Software Dev.
61.190606
Problem 23: A gene is a discrete sequence of DNA nucleotides. Determine the sequence of DNA. Your sister is a molecular biology graduate student. She invited you to visit her lab. Before she could give you a tour, her supervisor called a quick lab meeting. You're now sitting at her desk waiting for her to come back. Your sister has been trying to sequence a gene, and the autoradiogram of the sequencing gel is on her desk. You're going to read the sequence. From bottom to top, starting at the A, what is the sequence of the first 20 nucleotides? CTGCTGATGTTGAATTAGAG (No, the sequence starts with A.) ACTGCTGATGTTGAATTAGA (That is correct.) ACGTACGTACGTACGTACGT (No, these are just the four nucleotides repeated.) GACTAGTGCTCCTGGCCGTG (No, this is not correct.) You read as much of the sequence as you can and write the sequence down in your sister's notebook. Assuming that the DNA strand you just read is the 5' to 3' strand, what is the complement DNA sequence? Start with the 3' end of the DNA complement. 3'ACTGCTGATGTTGAATTAGA 5' (No, this is the 5' to 3' DNA sequence.) 3'ACUGCUGAUGUUGAAUUAGA 5' (No, this is an mRNA sequence.) 3'UGACGACUACAACUUAAUCU 5' (No, this is an mRNA sequence.) 3'TGACGACTACAACTTAATCT 5' (That is correct.) Adenine bonds with thymine; guanine bonds with cytosine. This is the complement DNA sequence. RNA polymerase reads the 3' to 5' DNA sequence to make mRNA. What is the mRNA sequence made in this example? 5'ACTGCTGATGTTGAATTAGA 3' (No, this is 3' to 5' DNA sequence.) 5'ACUGCUGAUGUUGAAUUAGA 3' (That is correct.) 5'UGACGACUACAACUUAAUCU 3' (No, this is not the correct mRNA sequence.) 5'TGACGACTACAACTTAATCT 3' (No, this is 3' to 5' DNA sequence.) mRNA has uracils instead of thymine. Notice that the mRNA is the same as the 5' to 3' DNA sequence with uracils replacing thymines. Your sister probably uses a computer program to decode the mRNA, but it's a short sequence so you use a codon table. What will the first 20 nucleotides of this mRNA sequence code for? Use as the stop codon. T A D V E L (Yes, if the ribosomes start with ACU codon; how do you know it starts here?) L L M L N* (Yes, if the ribosomes start with CUG codon; how do you know it starts here?) C C I R (Yes, if the ribosomes start with UGC codon; how do you know it starts here?) All of the above. (That is correct.) None of the above. (No, theoretically this mRNA can code for something.) Since you don't know where the gene starts, you have to consider all three frames of the sequence. You realize that you don't know how your sister got this sequence, so you really have to consider all six frames. After all, RNA polymerase may be reading the other strand for the "gene." What is the other mRNA that could be made? 5'UUAACGCGUGCCUCUGGUCU 3' (That is correct.) 5'TTAACGCGTGCCTCTGGTCT 3' (No, this is DNA sequence.) 5'TGACGACTACAACTTAATCT 3' (No, this is the DNA sequence in the wrong orientation.) The "other" mRNA sequence reads like the complement DNA with uracils replacing thymines. You deduce the codons for the other mRNA sequence. Based on what you know, which, if any, of these frames should your sister investigate first as being part of a gene? Frames 1, 2, 3 (No, frames 2 and 3 have stop codons and probably don't code for a protein.) Frames 2, 4, 5 (No, frame 2 has a stop codon and probably doesn't code for a protein.) Frames 1, 3, 5 (No, frame 3 has stop codons and probably doesn't code for a protein.) Frames 1, 4, 6 (That is correct.) Frame 1 (Yes, frame 1 is a possibility, but not the only one.) Frame 5 (Yes, frame 5 is a possibility, but not the only one.0 None of the above. (No, there are frames that may code for protein.) Frames 2, 3 and 5 are less likely candidates as genes because of the stop codons in the protein sequence. Frames 1, 4 and 6 are the good candidates as possible genes. YOU'RE SO SMART! rna polymerase, dna strand, mrna sequence, codon table, autoradiogram, complement dna
<urn:uuid:d1b5c11b-bcb1-4355-914e-c1bbf6c604da>
4.125
1,155
Tutorial
Science & Tech.
72.829897
One graph that is often put forward to illustrate the link between global temperature is the Archer 2006 book graph (shown below). It looks as if there is a simple linear relationship between temperature and sea level with 20m/degC! From that you would guess that we would be facing maybe 50m of sea level rise. However, there are several weaknesses with this graph. Rohling et al. 2009 has plotted sea level against Antarctic Temperature over the past 5 glacial cycles. From that you can see that the relationship between temperature and sea level is not linear. During glacials where ice volume was large the sea level response to a was also large. In interglacials, with much less ice volume, the sea level response is much smaller. From the graph it is estimated that for present day we get 3-5m of sea level rise per degC of antarctic warming. Taking polar amplification of (here taken to be 2x) into account we can convert that into a 6-10 m/degC of global average temperature change. (Note that the actual polar amplification valid for dome C is probably somewhat smaller than 2.) I think that the Archer graph is a nice illustrative cartoon. However, it is very unfortunate that it is being picked up in official climate reports like the german WBGU 2006. I have had to defend some of my own work because it was in conflict with a present day slope of 20m/degC. In this figure below i put the rohling curve on a 1961-1990 baseline, converted to global temperatures and also added projections (from Grinsted et al. 2009). I used 1.5 as the polar amplification because we are talking about the Antarctic. The cyan variations include variations of the form: [EDIT: Perhaps the pliocene can be used as an analogy, but i question the present quality of the data. A quick google gave me this quote: "Geologic estimates of maximum Pliocene sea level thus range from +5 to +40 m relative to present, with +25 m typically used by the modeling community." from PLIOMAX: Pliocene maximum sea level project. Combine that with uncertainties in temperature and i wonder if it can give any useful constraint on these types of graphs. EDIT2: Found a mistake in the polaramplification. H/t to Bart Verheggen. EDIT3: Added my take on the Archer Graph based on Rohlings curve. I focused on warmer climate.]
<urn:uuid:a81f596c-2967-4c86-888b-f429b41441b9>
3.25
514
Personal Blog
Science & Tech.
53.534444
ELorenz wrote:When speaking about mathematics you have to be very careful about how you say things. ELorez wrote:However it is not true that x^2 = 1/2*k*x^2. ELorenz wrote:What does f(x) = x^2 describe in nature ELorenz wrote:it states that vectors actually first appeared in geometry The idea of a vector is one of the greatest contributions to mathematics, which came directly from physics. ELorenz wrote:a point itself could be a vector in mathematics. A finite dimensional vector space over R with an inner product defined on it is called an Euclidean space ELorez wrote:are fields and vector spaces. You might be thinking of the Euclidean metric rather than Euclidean space. I think I know the point you're trying to make. Mathematics is a language that can be used to model nature, though, this is not its sole responsibility/endeavour (this is a huge topic). As for your f(x) = x^2, well, this relation describes one of the more important natural laws. The Harmonic Potential: U = 1/2 * k * x^2 U = Harmonic Potential k = a positive constant x = displacement This has been used in a lot of models, for example, an approximation of lattice vibrations in crystals (small amplitude), called the "Harmonic Limit" or "Harmonic Approximation" and the Quantum harmonic oscillator (V. Important) amongst others. Ma77o wrote:Is math discovered, or invented? Users browsing this forum: No registered users and 0 guests
<urn:uuid:69cab969-cd5e-4bc2-b505-9e82e0ecb309>
2.953125
354
Comment Section
Science & Tech.
46.953716
Work/Energy problem with Friction A conservation of energy problem where all of the energy is not conserved. Work/Energy problem with Friction ⇐ Use this menu to view and help create subtitles for this video in many different languages. You'll probably want to hide YouTube's captions if using these subtitles. - Welcome back. - I'll now do another conservation of energy - problem, and this time I'll add another twist. So far, - everything we've been doing, energy was conserved by the - law of conservation. - But that's because all of the forces that were acting in - these systems were conservative forces. - And now I'll introduce you to a problem that has a little - bit of friction, and we'll see that some of that energy gets - lost to friction. - And we can think about it a little bit. - Well where does that energy go? - And I'm getting this problem from the University of - Oregon's zebu.uoregon.edu. - And they seem to have some nice physics problems, so I'll - use theirs. - And I just want to make sure they get credit. - So let's see. - They say a 90 kilogram bike and rider. - So the bike and rider combined are 90 kilograms. So let's - just say the mass is 90 kilograms. Start at rest from - the top of a 500 meter long hill. - OK, so I think they mean that the hill is - something like this. - So if this is the hill, that the hypotenuse here is 500 - hundred meters long. - So the length of that, this is 500 meters. - A 500 meter long hill with a 5 degree incline. - So this is 5 degrees. - And we can kind of just view it like a wedge, like we've - done in other problems. There you go. - That's pretty straight. - Assuming an average friction force of 60 newtons. - OK, so they're not telling us the coefficient of friction - and then we have to figure out the normal - force and all of that. - They're just telling us, what is the drag of friction? - Or how much is actually friction acting against this - rider's motion? - We could think a little bit about where that friction is - coming from. - So the force of friction is equal to 60 newtons And of - course, this is going to be going against his motion or - her motion. - And the question asks us, find the speed of the biker at the - bottom of the hill. - So the biker starts up here, stationary. - That's the biker. - My very artful rendition of the biker. - And we need to figure out the velocity at the bottom. - This to some degree is a potential energy problem. - It's definitely a conservation of mechanical energy problem. - So let's figure out what the energy of the system is when - the rider starts off. - So the rider starts off at the top of this hill. - So definitely some potential energy. - And is stationary, so there's no kinetic energy. - So all of the energy is potential, and what is the - potential energy? - Well potential energy is equal to mass times the acceleration - of gravity times height, right? - Well that's equal to, if the mass is 90, the acceleration - of gravity is 9.8 meters per second squared. - And then what's the height? - Well here we're going to have to break out a little - We need to figure out this side of this triangle, if you - consider this whole thing a triangle. - Let's see. - We want to figure out the opposite. - We know the hypotenuse and we know this angle here. - So the sine of this angle is equal to opposite over - So, SOH. - Sine is opposite over hypotenuse. - So we know that the height-- so let me do a little work - here-- we know that sine of 5 degrees is equal to - the height over 500. - Or that the height is equal to 500 sine of 5 degrees. - And I calculated the sine of 5 degrees ahead of time. - Let me make sure I still have it. - That's cause I didn't have my calculator with me today. - But you could do this on your own. - So this is equal to 500, and the sine of - 5 degrees is 0.087. - So when you multiply these out, what do I get? - I'm using the calculator on Google actually. - 500 times sine. - You get 43.6. - So this is equal to 43.6. - So the height of the hill is 43.6 meters. - So going back to the potential energy, we have the mass times - the acceleration of gravity times the height. - Times 43.6. - And this is equal to, and then I can use just my regular - calculator since I don't have to figure out - trig functions anymore. - So 90-- so you can see the whole thing-- times 9.8 times - 43.6 is equal to, let's see, roughly 38,455. - So this is equal to 38,455 joules or newton meters. - And that's a lot of potential energy. - So what happens? - At the bottom of the hill-- sorry, I have to readjust my - chair-- at the bottom of the hill, all of this gets - converted to, or maybe I should - pose that as a question. - Does all of it get converted to kinetic energy? - Almost. We have a force of friction here. - And friction, you can kind of view friction as something - that eats up mechanical energy. - These are also called nonconservative forces because - when you have these forces at play, all of the - force is not conserved. - So a way to think about it is, is that the energy, let's just - call it total energy. - So let's say total energy initial, well let me just - write initial energy is equal to the energy wasted in - friction-- I should have written just letters-- from - friction plus final energy. - So we know what the initial energy is in this system. - That's the potential energy of this bicyclist and this - roughly 38 and 1/2 kilojoules or 38,500 joules, roughly. - And now let's figure out the energy wasted from friction, - and the energy wasted from friction is the negative work - that friction does. - And what does negative work mean? - Well the bicyclist is moving 500 meters in this direction. - So distance is 500 meters. - But friction isn't acting along the same - direction as distance. - The whole time, friction is acting against the distance. - So when the force is going in the opposite direction as the - distance, your work is negative. - So another way of thinking of this problem is energy initial - is equal to, or you could say the energy initial plus the - negative work of friction, right? - If we say that this is a negative quantity, then this - is equal to the final energy. - And here, I took the friction and put it on the other side - because I said this is going to be a negative quantity in - the system. - And so you should always just make sure that if you have - friction in the system, just as a reality check, that your - final energy is less than your initial energy. - Our initial energy is, let's just say 38.5 kilojoules. - What is the negative work that friction is doing? - Well it's 500 meters. - And the entire 500 meters, it's always pushing back on - the rider with a force of 60 newtons. - So force times distant. - So it's minus 60 newtons, cause it's going in the - opposite direction of the motion, times 500. - And this is going to equal the ending, oh, no. - This is going to equal the final energy, right? - And what is this? - 60 times 500, that's 3,000. - No, 30,000, right. - So let's subtract 30,000 from 38,500. - So let's see. - Minus 30. - I didn't have to do that. - I could have done that in my head. - So that gives us 8,455 joules is equal to the final energy. - And what is all the final energy? - Well by this time, the rider's gotten back to, I guess we - could call the sea level. - So all of the energy is now going to be - kinetic energy, right? - What's the formula for kinetic energy? - It's 1/2 mv squared. - And we know what m is. - The mass of the rider is 90. - So we have this is 90. - So if we divide both sides. - So the 1/2 times 90. - That's 45. - So 8,455 divided by 45. - So we get v squared is equal to 187.9. - And let's take the square root of that and we get the - velocity, 13.7. - So if we take the square root of both sides of this, so the - final velocity is 13.7. - I know you can't read that. - 13.7 meters per second. - And this was a slightly more interesting problem because - here we had the energy wasn't completely conserved. - Some of the energy, you could say, was eaten by friction. - And actually that energy just didn't - disappear into a vacuum. - It was actually generated into heat. - And it makes sense. - If you slid down a slide of sandpaper, your pants would - feel very warm by the time you got to the bottom of that. - But the friction of this, they weren't specific on where the - friction came from, but it could have come from the - gearing within the bike. - It could have come from the wind. - Maybe the bike actually skidded a little - bit on the way down. - I don't know. - But hopefully you found that a little bit interesting. - And now you can not only work with conservation of - mechanical energy, but you can work problems where there's a - little bit of friction involved as well. - Anyway, I'll see you in the next video. Be specific, and indicate a time in the video: At 5:31, how is the moon large enough to block the sun? Isn't the sun way larger? Have something that's not a question about this content? This discussion area is not meant for answering homework questions. Share a tip When naming a variable, it is okay to use most letters, but some are reserved, like 'e', which represents the value 2.7831... Have something that's not a tip or feedback about this content? This discussion area is not meant for answering homework questions. Discuss the site For general discussions about Khan Academy, visit our Reddit discussion page. Flag inappropriate posts Here are posts to avoid making. If you do encounter them, flag them for attention from our Guardians. - disrespectful or offensive - an advertisement - low quality - not about the video topic - soliciting votes or seeking badges - a homework question - a duplicate answer - repeatedly making the same post - a tip or feedback in Questions - a question in Tips & Feedback - an answer that should be its own question about the site
<urn:uuid:7355d420-d599-4fcd-941d-e597aebe7982>
3.421875
2,631
Truncated
Science & Tech.
76.400194
Below are the first 10 and last 10 pages of uncorrected machine-read text (when available) of this chapter, followed by the top 30 algorithmically extracted key phrases from the chapter as a whole. Intended to provide our own search engines and external engines with highly rich, chapter-representative searchable text on the opening pages of each chapter. Because it is UNCORRECTED material, please consider the following text as a useful but insufficient proxy for the authoritative book pages. Do not use for reproduction, copying, pasting, or reading; exclusively for search engines. OCR for page 31 Radioisotope Power Systems: An Imperative for Maintaining U.S. Leadership in Space Exploration List of Findings and Recommendations Given below is a complete list of the committee’s findings and recommendations, in the order in which they appear in the report. FINDING. Production of 238Pu. The United States has not produced 238Pu since the Department of Energy shut down its nuclear weapons production reactors in the late 1980s. FINDING. Importance of RPSs. RPSs have been, are now, and will continue to be essential to the U.S. space science and exploration program. FINDING. Plutonium-238 Supply. Plutonium-238 is the only isotope suitable as an RPS fuel for long-duration missions because of its half-life, emissions, power density, specific power, fuel form, availability, and cost. An assured supply of 238Pu is required to sustain the U.S. space science and exploration program. FINDING. Roles and Responsibilities. Roles and responsibilities as currently allocated between NASA and the Department of Energy are appropriate, and it is possible to address outstanding issues related to the short supply of 238Pu and advanced flight-qualified RPS technology under the existing organizational structures and allocation of roles and responsibilities. FINDING. RPS Nuclear Safety. The U.S. flight safety review and launch approval process for nuclear systems comprehensively addresses public safety, but it introduces schedule requirements that must be considered early in the RPS system development and mission planning process. FINDING. Foreign Sources of 238Pu. No significant amounts of 238Pu are available in Russia or elsewhere in the world, except for the remaining 238Pu that Russia has already agreed to sell to the United States. Procuring 238Pu from Russia or other foreign nations is not a viable option. FINDING. Domestic Production of 238Pu. There are two viable approaches for reestablishing production of 238Pu, both of which would use facilities at Idaho National Laboratory and Oak Ridge National Laboratory. These are the best options, in terms of cost, schedule, and risk, for producing 238Pu in time to minimize the disruption in NASA’s space science and exploration missions powered by RPSs. FINDING. Alternate Fuels and Innovative Concepts. Relying on fuels other than 238Pu and/or innovative concepts for producing 238Pu as the baseline for reestablishing domestic production of 238Pu would increase technical risk and substantially delay the production schedule. Nevertheless, research into innovative concepts for producing 238Pu, such as the use of a commercial light-water reactor, may be a worthwhile investment in the long-term future of RPSs. FINDING. Current Impact. NASA has already been making mission-limiting decisions based on the short supply of 238Pu. FINDING. Urgency. Even if the Department of Energy budget for fiscal year 2010 includes funds for reestablishing 238Pu production, some of NASA’s future demand for 238Pu will not be met. Continued delays will increase the shortfall. HIGH-PRIORITY RECOMMENDATION. Plutonium-238 Production. The fiscal year 2010 federal budget should fund the Department of Energy (DOE) to reestablish production of 238Pu. As soon as possible, the DOE and the Office of Management and Budget should request—and Congress should provide—adequate funds to produce 5 kg of 238Pu per year. NASA should issue annual letters to the DOE defining the future demand for 238Pu. OCR for page 32 Radioisotope Power Systems: An Imperative for Maintaining U.S. Leadership in Space Exploration FINDING. Programmatic Balance. Balance within NASA’s RPS program is impossible given the current (fiscal year 2009) budget and the focus on development of flight-ready ASRG technology. However, NASA is moving the ASRG project forward, albeit at the expense of other RPS technologies. FINDING. Multi-Mission Radioisotope Thermoelectric Generators. It is important to the national interest to maintain the capability to produce Multi-Mission Radioisotope Thermoelectric Generators, given that proven replacements do not now exist. RECOMMENDATION. Multi-Mission Radioisotope Thermoelectric Generators. NASA and/or the Department of Energy should maintain the ability to produce Multi-Mission Radioisotope Thermoelectric Generators. FINDING. Flight Readiness. NASA does not have a broadly accepted set of requirements and processes for demonstrating that new technology is flight ready and for committing to its use. RECOMMENDATION. Flight Readiness. The RPS program and mission planners should jointly develop a set of flight-readiness requirements for RPSs in general and Advanced Stirling Radioisotope Generators in particular, as well as a plan and a timetable for meeting the requirements. RECOMMENDATION. Technology Plan. NASA should develop and implement a comprehensive RPS technology plan that meets NASA’s mission requirements for RPSs while minimizing NASA’s demand for 238Pu. This plan should include, for example: A prioritized set of program goals. A prioritized list of technologies. A list of critical facilities and skills. A plan for documenting and archiving the knowledge base. A plan for maturing technology in key areas, such as reliability, power, power degradation, electrical interfaces between the RPS and the spacecraft, thermal interfaces, and verification and validation. A plan for assessing and mitigating technical and schedule risk. HIGH-PRIORITY RECOMMENDATION. ASRG Development. NASA and the Department of Energy (DOE) should complete the development of the Advanced Stirling Radioisotope Generator (ARSG) with all deliberate speed, with the goal of demonstrating that ASRGs are a viable option for the Outer Planets Flagship 1 mission. As part of this effort, NASA and the DOE should put final design ASRGs on life test as soon as possible (to demonstrate reliability on the ground) and pursue an early opportunity for operating an ASRG in space (e.g., on Discovery 12).
<urn:uuid:b36807a5-165f-4527-8228-0a8202106d8b>
2.78125
1,417
Content Listing
Science & Tech.
36.48686
In this example we are going to show the use of java.util.Vector class. We will be creating an object of Vector class and performs various operation like adding, removing etc. Vector class extends AbstractList and implements List, RandomAccess, Cloneable, Serializable. The size of a vector increase and decrease according to the program. Vector is synchronized. In this example we are using seven methods of a Vector class. add(Object o): It adds the element in the end of the Vector size(): It gives the number of element in the vector. elementAt(int index): It returns the element at the specified index. firstElement(): It returns the first element of the vector. lastElement(): It returns last element. removeElementAt(int index): It deletes the element from the given index. elements(): It returns an enumeration of the element In this example we have also used Enumeration interface to retrieve the value of a vector. Enumeration interface has two methods. hasMoreElements(): It checks if this enumeration contains more elements or not. nextElement(): It checks the next element of the enumeration. Code of this program is given below: Output of this example is given below: |C:\Java Tutorial>javac VectorDemo.java C:\Java Tutorial>java VectorDemo the elements of vector: [10, 20, 30, tapan joshi] The size of vector are: 4 The elements at position 2 is: 30 The first element of vector is: 10 The last element of vector is: tapan joshi The elements of vector: [10, 20, tapan joshi] The elements are: 10 The elements are: 20 The elements are: tapan joshi If you are facing any programming issue, such as compilation errors or not able to find the code you are looking for. Ask your questions, our development team will try to give answers to your questions.
<urn:uuid:bc976b42-3d52-4225-901f-ece1f5fb55c7>
4
421
Documentation
Software Dev.
44.048811
Nov. 13, 2007 Scientists are converging on Ethiopia this week to discuss a new and strange form of Space Weatherover Africa. Aug. 15, 2007 Astronomers have discovered something they've never seen before: a star with a tail like a comet. Dec. 3, 2007 Mark your calendar: The best meteor shower of 2007 peaks on Friday, December 14th. Jan. 8, 2007 It's official: The Moonis on the metric system. NASA is returning to the Moon, and the agency has decided to use metric units for all future lunar operations. Nov. 23, 2007 New research by NASA scientists shows that moondust kicked up by the jets of lunar landers can go on a fantastic journey, completely circling The Moonbefore settling back to the ground. This interesting phenomenon may affect the planning of lunar outposts and other activities as NASA prepares its return to the Moon. Dec. 21, 2007 NASA-funded astronomers are monitoring a Tunguska-sized asteroid that will pass within 30,000 miles of Mars on Jan. 30, 2008. Based on data currently available, the space rock has a 1-in-75 chance of actually hitting Mars and blasting a crater more than half-a-mile wide. Feb. 20, 2007 One pole of the sun is cooler than the other. That's the surprising conclusion announced today by scientists who have been analyzing data from the ESA-NASA Ulysses spacecraft. June 27, 2007 For sky watchers in the northern hemisphere, this weekend is the best time of the year to experience the mysterious and beautiful Moon Illusion. Oct. 1, 2007 Earlier this year, Comet Encke was passing a little too close to the Sun when a coronal mass ejection (CME) hit the comet and ripped off its tail. NASA's STEREO spacecraft was watching and recorded a must-see movie featured in today's story. Sept. 7, 2007 Astronomers at NASA's Marshall Space Flight Center are testing a strangely-shaped mirror that will allow them to explore the Universe using super-energetic X-rays.
<urn:uuid:70621dbb-550b-4609-86c8-43a72e703d15>
3.09375
442
Content Listing
Science & Tech.
63.523757
Ever wanted to explore the ocean? Calm down, don't get out of your armchair, yet, Midwest. Thanks to Google Earth and researchers at Columbia University, you can take a sea cruise without leaving your pop or your Twitter account behind. Why should you care about the oceans? Did you know that we have already consumed 90% of the population of large fish species in the ocean? That tiny plankton in the ocean provide 50-85% of the oxygen in the air we breathe? That ocean water is becoming more acidic from the same carbon dioxide emissions that warm our climate, thereby making it tough for some sea-life to survive? Is a life without fish sticks really a life worth living? Of course, you may not get all of that out of a spin on Google Earth, but exploring may well be the first step in your life-long romance with a crafty young cephalopod or a craggy-faced mid-ocean ridge. Plus, it's just darn cool. Have you ever heard of ‘ocean acidification’? If not, don’t feel alone. You are in vast majority. A new study by Dr. Anthony Leiserowitz at Yale University found that that just 25 percent of Americans have ever heard of ocean acidification – the process whereby carbon dioxide released into the atmosphere by human activities eventually dissolves into the sea producing carbonic acid which depresses the pH of the ocean. Ocean acidification threatens to dramatically alter marine life if present trends continue. A more informed citizenry is essential if steps are to be taken to address this threat to our futures. The Science Museum of Minnesota and Fresh Energy on the evening of Thursday, November 4 are hosting the Twin Cities film premiere of the documentary, A Sea Change . The screening of this award-winning, 90-minute film will begin at 6:30 PM followed by Q&A with the film’s director, co-producer, lead NOAA ocean acidification scientist, and Fresh Energy’s science policy director and then concluding with a dessert reception. I hope that you will take advantage of this unique opportunity to see the film and then socialize afterwards. Go to the Science Museum's adult programs to order your tickets. Courtesy bredgurAccording to a report in the journal Mineralium Deposita, there’s really no need for people to fight over mineral resources, because there are lots and lots of them left. The report comes hot on the heals of a political snafu, in which a Chinese fisherman ran afoul of the Japanese coastguard, and China cut off shipments of rare earth metals to Japan, after the fisherman was arrested. Rare earth metals are vital for building electronics and hybrid electric cars, and China pretty much has most of the rare earth metals in town, so China was all, “You want your cars? Give us our fisherman.” Then Japan was like, “Oh, well, actually we can make hybrid cars without your stupid rare earth metals, so whatever.” And everybody else started smacking their lunch trays on the tables and shouting, “Fight! Fight! Fight!” But then Japan was like, “Fine. Just take your stupid fisherman. He’s a jerk anyway.” And China was like, “Fine, then!” And everything went back to normal. But it left the world thinking, are we going to have to tussle over stuff like this eventually? Everyone wants minerals, and we might be running out… Not so, says Lawrence Cathles of Cornell University. We have lots of minerals, more than we could use in thousands of years, even with the whole world living at Western European material standards. Aw, man. What can we fight about now? I suppose there’s always country and rock ‘n roll. Or we could all split up into Sharks and Jets. We could maybe start randomly accusing each other of cheating at Monopoly, regardless of whether or not we’ve been playing Monopoly. But… I just can’t get worked up over that stuff. If I can’t throw down over a chunk of copper, or a pocketful of palladium, I don’t know that I even want to fight. Oh well. I might as well just finish reading that article… So let’s see. The minerals Cathles is talking about come from the ocean floor. At points where the Earth’s crust is pulling apart, molten rock meets ocean water, infusing it with minerals and heating it. The hot seawater rises through the crust, and deposits precipitating minerals on the ocean floor. Lots and lots of copper, uranium, lithium, phosphate, potash, and on and on… all waiting for us in deposits on the ocean floor. A small percentage of the minerals that should be hiding out down there could keep humanity going for “50 centuries or more.” Sweet! But… wait a second. Didn’t it just say that the minerals are sitting on the bottom of the oceans? Where the tectonic plates are pulling apart from each other, areas one might refer to as “ocean spreading centers.” Sooooo… the minerals are under the middle of the oceans. Yes! We’re going to have something to fight over after all! See, I think y’all remember what can happen when you’re trying to get at something on the bottom of the ocean… this sort of thing. And the depths of mid-ocean ridges are nothing to sneeze at. But deep sea oil drilling operations might be a good junior-league analogy for mid-ocean mining—it’s expensive and potentially extremely dangerous, but once we want that resource enough, we’re going to give it a shot. And once we do, that (fortunately!!!) won’t be the end of conflict over the resource. Drilling or mining areas will be disputed, as will environmental liabilities. I mean, what do I know about it. But when has having enough of something for everybody ever kept people from being upset about it? I find this to be a very hopeful report. Someday—maybe not soon, but someday—we’ll engage in high-tech, high risk, deepwater mining in international waters. And there will be fighting! Lots of fighting! Much attention and debate is focused on the role of human releases of carbon dioxide (CO2) in global warming and climate change but there is another facet of CO2 that deserves much more attention. Increasing concentrations of CO2 in the atmosphere lead to more and more CO2 dissolving into the oceans where it turns into carbonic acid. A story in the June 18 issue of Science reports that there is no doubt whatsoever that human releases of CO2 are acidifying the oceans at a scale unprecedented in the geologic record. The closest analogue to present day appears to be the Paleocene-Eocene Thermal Maximum (PETM) of 55.8 million years ago. Over the course of several thousand years, huge amounts of methane and CO2 entered the atmosphere (where the methane was quickly converted to CO2). Much of this CO2 dissolved into the oceans, causing a drop in ocean pH. The difference between the present and the PETM is that human releases of CO2 are occurring at a rate at least ten times faster. At takes about 1,000 years for CO2 dissolved in surface waters to reach the deep sea where sediments eventually neutralize the acid. Human releases of CO2 currently far exceed the rate at which the oceans are able to remove it and so the result is a rapid drop in the pH of surface waters. Many ocean organisms make their shells from carbonate. Acidification changes carbonate into bicarbonate and hydrogen ions, making the mineral much less available to tropical corals, echinoderms, mollusks, and foraminifera. The danger if ocean acidification continues unabated is potentially dramatic and unpredictable changes in marine life everywhere. Some policymakers and scientists increasingly are raising the idea of perhaps mitigating the effects of climate change through large-scale geoengineering projects intended to reduce the amount of solar energy reaching the Earth’s surface as a last ditch effort to counteract the effects of greenhouse gas warming. Such projects would do nothing to mitigate the growing problem of our acidifying oceans. The only way to reduce ocean acidification is to reduce globally the quantities of CO2 that humans release into the atmosphere. And yet, the presence of another garbage island has been declared, in the Atlantic Ocean this time. (The quick Trashlantis disclaimer: it's not really an island or a continent, or something you could even see from the the surface. It's lots and lots of tiny bits of floating plastic. Just thought we'd go over that again.) The patch spans about 16 degrees of latitude, and it shall henceforth be known as... New Rubbishland. (Good looking out, Gene.) My mom just sent me an E-mail. Why's that worthy of a Buzz post? Well, it just so happens that she's on board the OSV Bold, the US Environmental Protection Agency's only ocean and coastal monitoring ship. (It's crawling along the coast of Maine right now.) From the boat, scientists are able to sample the water column, ocean bottom, and sea life to get a sense of how the ocean is being impacted by human activities, and how we can better manage what goes into it. If you're curious, you can follow the adventures of the OSV Bold on Twitter, or read the daily observations log. (There's a photo of Moms in the batch posted for day 4, but her face isn't visible. Just trust me: she's the beautiful on the Bold. Oh, and lest you think this is a completely frivolous and nepotistic post, check it: www.whitehouse.gov picked up the story, too.) Green energy? What about trying a little blue energy for a change? Blue seems just as wholesome and non-threatening, right? In a similar vane to my last post on algae the geniuses of the world have come up with another truly brilliant "why didn't I think of that" kind of idea. It seems to make so much sense! It's so big ... and powerful ... and blue ... Courtesy Wikimedia Commons Engineers at Blue Energy have developed, with support from the Army Corps of Engineers a turbine for the ocean. No no, not a wind turbine ON the ocean (my mom just made that mistake) but an underwater turbine that will harness the powerful ocean currents to create possibly the most sustainable energy source we know of! Here is what we know: Water turbines will be placed in the Gulf Stream near Florida and they will work much like land wind turbines (using a rotater blade, which when made to spin by wind or water, creates energy!). There is still a considerable amount of work to do before water turbines can be utilized. Frederick Driscoll, director of Florida Atlantic University's Center of Excellence in Ocean Energy Technology strives to be realistic about the future of water turbines. A resource assessment of the Gulf Stream is underway to help understand exactly how much energy can be safely extracted from the ocean, where exactly it should be extracted from and how to get the energy safely and efficiently to our homes without disrupting the ocean environment. So much to think about! Courtesy Library of Congress Florida is the fourth largest state in the U.S. and the third largest consumer of energy. They are in dire need of a new energy source as many experts insist that Florida is on the brink of a very serious energy crisis. Much still needs to be done in the way of turbine technology in order to move ahead with incorperating them into the fleet of renewable energy sources. This past spring four acoustic Doppler current profilers were lauched off the coast of Florida to gather information about the currents, mainly to learn about the speed of the ocean currents. Ocean energy may become the crown jewel of the fleet. Sperm whales might just be those mean kids of the ocean who shake you down for your lunch money. Or, they may simply be pretty smart hunters who've figured out how to get the better of human technology and steal fish off of commercial fishing lines in the ocean. Watch some amazing video (below) of a sperm whale "cleaning off" a fishing line. Here's an amazing video from National Geographic of an underwater volcano eruption. Pretty incredible.
<urn:uuid:04de88eb-7d4f-492c-8217-69ce36b5a778>
3
2,597
Content Listing
Science & Tech.
55.079804
Tephritidae Main | Diptera Home | SEL Home Fruit Fly (Diptera: Tephritidae) Behavior This section is mainly copied from Norrbom et al. (1999). More recent and more detailed reviews and analyses of most aspects of fruit fly behavior were published in Aluja & Norrbom (1999). Also see Biology, Host Plants, and Parasites & Predators. Tephritids exhibit a wide array of interesting and sometimes spectacular behaviors in many aspects of their life, both as adults and larvae: in their dispersal, feeding, and oviposition behaviors, but especially in their courtship and mating. Males of many species secrete pheromones to attract females, and in some species gather in groups (leks) for this purpose. Males of some species fight for territories, including species of Phytalmia which have large genal processes used in these bouts (click here to see a video on Gary Dodson's page). Mate-guarding and male defense of food resources attractive to females have been reported. Courtship behavior may be complex and usually involves various types of body, leg, and wing movements, and/or transfer of a "nuptual gift" (trophallaxis) (see Sivinski et al. 1999: 751). Females often deposit a marking pheromone on the fruit (or other plant part into which eggs are laid) that deters oviposition by other females (see Díaz-Fleischer et al. 1999: 825). Tephritid larvae live in and feed on various plant tissues, depending on the species. They may be single or gregarious, and resource partitioning is common among different species utilizing the same flower head of an Asteraceae species (Zwölfer 1983, 1988, Headrick & Goeden 1990). Species of Tephritinae that breed in Asteraceae (about 1/3 of all species) often have stout, spherical or subspherical maggots, apparently selected for their minimal need for movement. Such maggots usually pupate within the plant. Other tephritid larvae may move relatively long distances, first inside the plant tissues and then outside the plant, which they leave in order to pupate in the soil. In many frugivorous and florivorous species (e.g., many Dacina, Ceratitidina, Adramini and Blepharoneura), the larvae can jump several centimeters or more at a time (Fletcher 1987, Yuval & Hendrichs 1999: 431, M. A. Condon, pers. comm.). Adults of many species, especially those that are univoltine and/or narrowly host specific, may spend most of their life on one plant or adjacent plants of the same species. Other species, especially those that are polyphagous, may have dispersive phases and may fly distances as great as tens or hundreds of kilometers, as in the case of some species of Anastrepha and Bactrocera (Christenson & Foote 1960, Fletcher 1989). Some multivoltine species of Tephritinae migrate with the seasons to a series of hosts at different altitudes in California (Goeden et al. 1987, Headrick & Goeden 1991). Larvae of a species of Blepharoneura are dispersed by frugivourous bats that carry their host fruits (Condon & Norrbom 1994). Tephritid foraging and host finding behaviors were reviewed by Prokopy & Roitberg (1989) and Katsoyanos (1989). Feeding behavior, especially in nature, is a poorly understood aspect of tephritid biology (Hendrichs & Prokopy 1994). Adult nutritional requirements vary, largely depending upon the quality of the larval food (Tsitsipis 1989), and usually include at least carbohydrates and water, although some gall-forming species do not feed at all (Steck 1981, Freidberg & Kugler 1989). Many species also need amino acids, sterols, vitamins, and minerals to reproduce (Aluja 1994, Hendrichs & Prokopy 1994). In some species, including many that feed in galls or on seeds, females are proovigenic, i.e. they emerge with mature eggs and do not require protein for egg development, whereas in other species protein is needed for this purpose (synovigeny) and for optimal development of male salivary glands and pheromone production (Steck 1981, Landolt 1984, Hendrichs & Reyes 1987, Aluja 1994). Adults may feed on plant exudates, including those from oviposition holes or rotting fruit, bird feces, nectar, honeydew, and leachates, microorganisms, pollen and other matter on plant surfaces or in rain drops (Christenson & Foote 1960, Tsitsipis 1989, Hendrichs & Prokopy 1994). Microorganisms may play a role in the nourishment of some frugivourous species (Fletcher 1987, Howard 1989, Drew & Lloyd 1989). Adults of Blepharoneura (and probably Baryglossa and Hexaptilona, which have similarly modified labella) are unusual in being able to rasp and feed on plant tissues (Driscoll & Condon 1994, Condon & Norrbom 1994). In many fruit flies, both males and females have a premating development period of a week or more during which they do not mate (Steck 1981, Landolt 1984, Williamson 1989). The appearance of some Tephritidae (e.g., Toxotrypana, some Anastrepha, some Pseudophorellia, various Adramini and Dacina) strongly suggests that they are wasp mimics, and at least in T. curvicauda this is reinforced by behavior (Knab & Yothers 1914). Other fruit flies with banded wings and/or spotted abdomens may be jumping spider mimics (Hasson 1995). Many fruit flies mate on their host plants, but mating tactics vary, even within some species. Lek formation by males, usually on nonhosts, has been observed in Ceratitis capitata and species of Dacina, Anastrepha, Rhagoletis, and Procecidochares (Prokopy & Hendrichs 1979, Dodson 1986, Sivinski & Burk 1989, Aluja 1994). Males of most species of Tephritidae that have been studied secrete some type of sex-attractant chemical, either by inflating the lateral abdominal membranes or by extruding an anal pouch (Pritchard 1967, Headrick & Goeden 1994). They disperse these pheromones by wing fanning, which also produces sounds of possible significance in courtship (Sivinski & Webb 1985, Mankin et al. 1996). Males of many species of Bactrocera and Dacus have specialized structures, including a tibial pad, a microtrichose area of the wing, and a row of setae on the abdomen called the pecten, which are used for pheromone dispersal (I.M. White, pers. comm.). The pecten has been proposed as a stridulatory organ (Monro 1953, Kanmiya 1988). In Anastrepha robusta, the calling behavior includes short looping flights (Aluja 1993). Visual stimuli, as well as chemical and auditory stimuli, play an important role in communication between and among the sexes and with other insects. The body, which is often brightly colored, and the wings, which are usually patterned and are often held or moved in particular ways, no doubt act as releasers. Males of some species engage in antagonistic displays or bouts (Boyce 1934, Landolt & Hendrichs 1983, Headrick & Goeden 1994), including species of Phytalmia which have large genal processes used in these bouts (Moulds 1977). Mate-guarding and male defense of food resources attractive to females also have been reported (Hendrichs & Reyes 1987, Headrick & Goeden 1994, Opp et al. 1996). Courtship can be elaborate in some species, or simple and brief in others. Headrick & Goeden (1994) defined 14 movements or behaviors that commonly occur in courtship, which may include various types of body, leg, and wing movements, and/or transfer of a nuptual gift (trophallaxis). The latter behavior has been observed in diverse taxa, including species of Dirioxa (Acanthonevrini), Anastrepha (Toxotrypanini), and various genera of Tephritinae (Freidberg 1986, Aluja, Jacome et al. 1993, Headrick & Goeden 1994). The gift may be passed before or after copulation, and it may consist of liquid transferred by direct contact of the mouthparts (Freidberg 1982, Aluja, Jacome et al. 1993) or may be a solidified froth deposited on the substrate (Stoltzfus & Foote 1965, Pritchard 1967, Novak & Foote 1975, Freidberg 1981, Jenkins 1990). Copulation is determined by female choice (Headrick & Goeden 1994) and may last from several minutes to several hours or more. Oviposition behavior appears to be much more uniform than epigamic behavior and consists of the following stages: a) movement towards and arrival at the oviposition site; b) testing the site; c) drilling with the ovipositor; and d) oviposition. In the case of Anastrepha grandis, which lays a large batch of eggs in a tough, thick-skinned fruit, this process may last many hours (Gomes Silva 1991). Species in five genera have been reported to deposit a marking pheromone that deters oviposition by other females (Prokopy et al. 1976, Averill & Prokopy 1989, Straw 1989). This involves the female dragging her aculeus over the substrate, secreting and smearing the pheromone. In the case of Rhagoletis cerasi, the pheromone has been identified, synthesized, and used in orchards to combat damage to cherries (Aluja & Boller 1992). See the Fruit Fly Bibliography Database for full information for cited references. |Top of Page|| Content by Allen L. Norrbom. Last Updated: November 10, 2004.
<urn:uuid:11c6dd04-3f09-4af4-ab68-5dbd456e668a>
3.703125
2,223
Knowledge Article
Science & Tech.
38.216332
By Blane Perun Rate: (24 Ratings) The seahorse is a type of fish that belongs to the Hippocampus genus. In addition, the seahorse belongs to the family Syngathidae, which is a family that includes the pipefish, the leafy sea dragons, in addition to the seahorse. While many believe that there is just one type of seahorse, there are actually 32 different species of the seahorse. Most of the 32 seahorse species are found in very shallow tropical and subtropical waters throughout the world. The seahorse tends to live in sheltered areas such as mangroves, coral reefs, and sea grass beds. The species are found in all tropical waters around the world including in Europe, North America, and South America. The seahorse ranges in size from about an inch long to over a foot long depending on which species of the seahorse you are looking at. Forming territories, the seahorse male stays in about one square meter of their habitat at all times while the females from any given seahorse territory will move about much more freely, roaming an area that is about 100 times bigger than the males. When simply swimming about the seahorse is usually a brown and gray pattern that will allow them to camouflage into the mangroves, coral reefs, and mangrove stands that they like to hang around in. While they can camouflage into these areas, when they are being social with one another the seahorse will turn very bright colors. In fact, it has been established that seahorse mates will turn a pale yellow color when they see one another each morning. The seahorse was very definitely named for its horse like appearance. Many don't realize it, but the seahorse is a fish. While the seahorse is a fish it does not have scales, instead it has a very thin skin that covers bony plates that are put together in the shape of rings throughout their body. Each species of seahorse can be determined by the number of rings under its skin, as each seahorse species has a distinct number of rings. Every seahorse species swims in an upright position, which is one more thing that distinguishes the seahorse from other fish. An interesting fact about the seahorse is that they each have a very individualized coronet on their head, one different from every other, much like the human fingerprint! The seahorse moves very slowly through the waters not because it necessarily wants to, but because the seahorse is generally not a talented swimmer. The seahorse swims using a dorsal fin, which they have to move about rapidly in addiction to pectoral fins that are located behind the eyes. The seahorse is often seen sitting in the sea grass instead of swimming, and this is because they are poor swimmers, most seahorses find that it is easier just to be relatively stationary. The long snout of the seahorse is used to suck up the food that they eat and they have eyes that can move independent of the other, which aides in hunting for food. The seahorse is known to dine on small shrimp, small fish, and plankton. The seahorse is known to have courtship rituals that are quite interesting to watch. When a male and a female see one another they often turn bright colors, do a courtship dance, and then do an actual mating dance together. Mates that have been together for some time will greet one another with bright colors each morning and even swim together with their tails entwined. Mates are known to stay together for a lifetime. Due to the intense relations of the seahorse, the seahorse has long been used as a symbol for friendship.
<urn:uuid:be1930b7-425a-42f1-9083-3110aba67ccf>
3.15625
785
Knowledge Article
Science & Tech.
43.868223
Each year our planet is rocked by more than 50,000 earthquakes, of which approximately 99% are earthquakes too small to pose a real danger. In contrast, the remaining 1% consists of demonstrations that can be a source of serious harm if they occur in populated places. Did you know that many of the worst earthquakes in history have happened in the last century?, What we will be saying the Earth?. Nothing good, surely. Most earthquakes do not come to light, or even out of the archives of the seismological center. They are events that go to swell the statistics to shape theories of forecasts of seismic events. However, despite all this information, you can not determine exactly how and when earthquakes will occur. It is one of the great unfinished business of science. What we can know, more or less certain, is the energy released (Richter scale) and the destructive effects (Mercalli scale) of different possible earthquakes. Come on, we can assess what can be catastrophic but we can not avoid them. Anyway. Let’s see. Using this index we can determine the potential effects of earthquakes. Low levels of the scale are associated with how people feel the tremor, while higher grades are associated with structural damage. Level I – Very weak. It is unlikely that a person can detect Level II – Weak. Perceived by those people who are at rest and / or concentrates, especially on the upper floors of buildings. Hanging objects may swing. Level III – Slight. It may be noted on the upper floors. At street level would be similar to the vibration that produces a small truck tonnage. Level IV – Moderate. Would equate to the vibration generated by the passage of heavy trucks. It is noticeable to most. Some objects such as doors or walls may crack slightly. Those who have a very mild sleep may be awakened. Level V – Somewhat stronger. At this point it really gets ugly. The vibrations are now considering, walking is difficult, falling objects and walls may crack. Level VI – Strong. This is where you usually start to panic people, where many go into the street and it is difficult sustain standing. There may be structural damage to buildings which are suited to seismic tremors. Level VII – Very strong. Those poorly designed structures fall to the ground, while good buildings, although damaged, can still stand. Level VIII – Destructive. The buildings built specifically to withstand earthquakes damaged remarkable. By vibration furniture out of their holes, possible collapse of cities due to the inability to walk and move. Level IX – ruined. Widespread panic. Buildings designed to withstand severe earthquakes damaged. Some buildings are out of their bases. Level X – Disastrous. Rails bent, thousands dead. Few buildings remain standing. Level XI – Very disastrous. Probably no building would be on foot, the area would be devastated. Few survivors. Level XII – Catastrophic. Total destruction. Probably no survivors. The terrain would change its appearance. The Richter scale measures the energy released by an earthquake. To give you a rough idea here are some examples: The first, those who are below 3 are virtually undetectable from the seismological point of view. In this scale, the earthquake generates an intensity equivalent to that of a conventional bomb or gas explosion. Sounds very appealing, but in reality, apart from hardly noticeable, the effect is minimal. 4 to 5 would be talking about an energy equivalent to the explosion of 200 tons of TNT. The damage would be minimal and the earthquake can be detected by humans. 5 to 6 hard start to feel the effects on building structures. On this scale we might get, for example, the earthquake in El Calvario (Colombia), 2008. From 6 to 7. On this scale it gets more serious. The effects of an earthquake of this level could cause the destruction of an area of 100 km from the epicenter. The earthquake in Haiti in 2010, is on this scale. The energy released would equate to four times the power of “the Tsar Bomba, the most powerful bomb ever exploded. In total about 200 kilotons. 7 to 8. The energy released in this range would amount to approximately 450 joint blast bombs like Hiroshima. The devastation in the area is full if not have adequate facilities. An earthquake of this type could be the one that devastated Pisco (Peru) in 2007. 8 to 9. Are earthquakes that can destroy areas hundreds of miles. An example would be the recent earthquake in Mexico City 1985. It is clear that a greater extent it depends on what country you are prepared to endure. From 9 to 10. On this scale we have from the strongest earthquakes which data are available (Valdivia Earthquake, 1960, and Chile 2010) to the impact of a meteorite than 2 km in diameter that impacts to 90000 km / h. In the case of earthquake, if the country is ready, could be arranged, in the case of the meteorite that God we caught confessed. 12 to 13. The energy released in these scales would mean the end of life on earth. Come to mean the planet’s internal breakdown or, for instance, the impact of a meteorite like the one that collided with the Yucatan Peninsula. The energy released would be something like the equivalent of the simultaneous explosion of two million artifacts as “the Tsar Bomba.” Over 13. At this level the energy released is unknown. It would be similar to the one generated the collision of Earth and Mars
<urn:uuid:0645f0c1-8fd6-4785-8c7b-ae78fe19e01f>
3.515625
1,143
Knowledge Article
Science & Tech.
56.999512
Venus receives more sunlight than Earth. The atmosphere is thicker and denser. A day on Venus can last many months. So it should be ideal for a solar powered aircraft. Such an aircraft could stay high above the clouds powered by ample solar energy. Due to Venus's very slow period of rotation the aircraft could always remain in day side meaning bulky batteries wont be required. Such an aircraft could survery venus for a long time untill mechanical failures bring it down. Since it is flying within the atmosphere much closer to the surface it should be able to gather more detailed data than an orbiting spacecraft. Would such a mission actualy be a good idea ?
<urn:uuid:b73ec220-a976-4b91-b082-1ae606c0139c>
3.203125
134
Comment Section
Science & Tech.
56.255385
Gustav Robert Kirchhoff's contribution to our understanding of how light and matter interact is his set of three laws of radiation. They predict what sort of spectrum an object will emit based upon the physical properties of the object. Kirchhoff devised these laws in the latter half of the nineteenth century, prior to our understanding of atomic physics and quantum mechanics, but on a macroscopic level they describe the interaction of matter and radiation quite well. The laws are as follows: Any hot, dense object will emit a continuous spectrum -- a black body spectrum. A hot, thin gas will emit light only at specific wavelengths according to the electron configuration of the atoms in the gas -- an emission line spectrum. A continuous spectrum passed through a cool, thin gas will result in a continuum spectrum with breaks at the same wavelengths as the emission lines described in the Second Law -- an absorption line spectrum. These three laws embody much of the fundamental physics of radiation and radiative transfer. The first is a simplified explanation of black body radiation, namely that any dense object will emit a characteristic, continuous spectrum. It was later determined that the shape and intensity of this spectrum is only a function of the object's temperature, and nothing else, but from a purely phenomenological standpoint, the first law is a good descriptor of black bodies. In particular, it makes no qualifications as to the properties of the object -- it could be a metal rod in a fire, it could be a jar full of mercury, or an incredibly dense sphere of gas. All that matters is that it is dense. More accurately, we now say it is "optically thick"(*) rather than dense, but Kirchhoff's description is good enough. The second and third laws also cover a large swath of physics, that of emission and absorption processes by atoms in a gas or plasma. The second law says that a thin ("optically thin"), hot gas will have an emission line spectrum; the third law states that a cool gas will behave the opposite way, and exhibit absorption lines. As the theory behind atomic structure and quantum mechanics grew during the late nineteenth century, Kirchhoff and others (notably Robert Bunsen) realized that each element has its own unique signature of emission and absorption lines, governed by its electron configuration. The lines are generated by electrons emitting and absorbing energy by shifting their position within the electronic structure of a given atom. All atoms of a given element exhibit the same set of lines. This is important, because it means that hydrogen atoms (and all other elements) behave the same way on the Sun as they do here on Earth. In this way, we can apply our knowledge of gases here on Earth to what we see elsewhere in the universe, and use light as a way to study the physical properties of distant objects. This is precisely what Kirchhoff and others did in their studies of the Sun -- by comparing the absorption lines in the solar spectrum to those of gases here on Earth, they found the Sun's photosphere is composed of elements like hydrogen, helium, calcium, iron, and nearly every other element we see here on Earth. (*) The optical depth of a material is defined as the ability a photon to pass through it without being scattered or absorbed. A material with an optical depth τ of exactly one is one in which the intensity of light passing through it will be reduced by a factor of e. Mathematically, this is I = I0 e-τ Thus, when the optical depth becomes large, the amount of light which passes through is very small. Physically, it indicates that the mean free path of a photon is shorter than the thickness of the material itself.
<urn:uuid:86cbcb2a-5cb4-4bbf-8cf3-74295e755431>
3.734375
813
Knowledge Article
Science & Tech.
37.836302
Module 4: Studying Mass Extinctions - Students will research the causes of mass extinctions including, but not limited to: - Climate change (global warming/glaciation) - Tectonic activity - Changes in Sea level/chemistry - Changes in atmospheric chemistry - Bolide impact (iridium anomalies as evidence along with craters) - Others: including extinction of food species, competition, parasites, epidemics, etc. - Groups of students will choose one of the Earth’s mass extinction events and research the proposed cause(s) of that event. * Students will then produce a presentation to share their finding with the rest of the class or another appropriate audience in the form of a power point presentation, news report video, newspaper article, or other acceptable form. May be used as a summative assessment at the teacher’s discretion. *One or more groups of students may be assigned research on the current extinction rate, its causes, and how this extinction event compares to those in the past. - In conclusion: the class may want to discuss what lies in the near and distant future for Earth’s living creatures, including humans. I have also purchased the DVD Walking with Prehistoric Beasts from The Discovery Channel. This is an excellent video that could be used as a review of the entire unit and to stimulate interest in further discussion and to prepare the students for biology and inquiry into Charles Dawin’s theory of Natural Selection.
<urn:uuid:79a3abac-a21d-4730-b422-ede865e8c0f2>
3.78125
305
Tutorial
Science & Tech.
27.421673
Von Kármán vortices, which can appear as long linear chains of spiral eddies, form nearly anywhere that fluid flow is disturbed by an object. The atmosphere behaves like a fluid, so the wing of an airplane, a bridge, and even an island can cause the vortices to form. Von Karman vortices are named after aeronautical engineer Theodore von Kármán Strong northerly winds frequently blow across Greenland, carrying cold, relatively dry polar air out across the Greenland Sea. As the air passes over the moist, warmer waters, conditions are right for cloud formation. As a result, the Greenland Sea is often cloud-filled. In the image above the Jan Mayen Island in the Greenland Sea is responsible for the spiraling cloud pattern. Jan Mayen Island is situated about 500 km east of central Greenland, and about 600 km west of North Cape, Norway, positioning it an area prone to both clouds and wind. The island is dominated by the Beerenberg volcano, which rises 2,277 m on the northeastern end. This tall, ice-capped mountain forms a formidable barrier to wind flow. When a strong wind slams against the tall, immovable volcano, the air becomes quite turbulent, and forms a swirling pattern as it passes by. As winds pass around the volcano, the disturbance in the flow propagates downstream in the form of a double row of vortices that alternate their direction of rotation. The image below covers a larger area. In the left lower corner of this image, a pattern of feathery white can be seen. This pale veil appears to float above the lower clouds, because the von Karman vortex patterns can be seen beneath the veil in some areas. Viewing the 5 minute swath data used to create this image, the veil can be seen to extend well over Greenland. The color, texture and altitude are suggestive of a large plume of wind-borne snow, possibly mixed with high clouds. It is difficult, however, to differentiate snow from clouds using true-color imagery. Various Views of von Karman Vortices can be found at this NASA page, including the animation below (courtesy of Cesareo de la Rosa Siqueira at the University of Sao Paulo, Brazil), that shows how a von Karman vortex street develops behind a cylinder moving through a fluid. Here is the technical explanation: "As a fluid particle flows toward the leading edge of a cylinder, the pressure on the particle rises from the free stream pressure to the stagnation pressure. The high fluid pressure near the leading edge impels flow about the cylinder as boundary layers develop about both sides. The high pressure is not sufficient to force the flow about the back of the cylinder at high Reynolds numbers. Near the widest section of the cylinder, the boundary layers separate from each side of the cylinder surface and form two shear layers that trail aft in the flow and bound the wake. Since the innermost portion of the shear layers, which is in contact with the cylinder, moves much more slowly than the outermost portion of the shear layers, which is in contact with the free flow, the shear layers roll into the near wake, where they fold on each other and coalesce into discrete swirling vortices. A regular pattern of vortices, called a vortex street, trails aft in the wake."
<urn:uuid:0df9bf6e-6426-4076-a876-1c5fb2406900>
3.78125
686
Knowledge Article
Science & Tech.
48.052128
The Heat is On For California Wines Topics: Biology, Climate, Environment, News, Radio - Copy and Paste to Embed They're wine grapes that are well-adapted to hotter climates – the kind of conditions that California may be facing as the climate continues to warm. But for wineries that have staked their reputations on certain wines, adapting to climate change could be a tough sell. Talk to any wine lover in California and they'll tell you how lucky they are to live in such rich wine-producing region. Take the recent meeting of the San Francisco Wine Lovers Group at Toast wine bar in Oakland, where the favorites are California Pinot Noir, Russian River Zinfandel, and Napa Cabernet. In fact, the type of grape – or varietal – is how most of us think about wine. "That's the big problem," says Andy Walker, a grape breeder in Viticulture and Enology at the University of California-Davis. "We've spent the last 100 years emphasizing varieties and we've really marketed those names very effectively." Walker is strolling through UC Davis's test vineyard, where hundreds of different wine grapes from around the world are grown. The vast majority are unknown to consumers, because most wineries focus on only a handful of grapes. "Chardonnay, cabernet, merlot, pinot noir – those would make up probably a large percentage," he says. Those are all French varieties, mostly suited for cool climates. California is warm by comparison and thanks to climate change, it's expected to get a lot warmer. Extreme heat can be the enemy of good wine. "It destroys acidity primarily and it changes color and aromatics," says Walker. According to a recent study from Stanford University, about two degrees of warming could reduce California's premium wine-growing land by 30 to 50 percent. That could happen as soon as 2040. Water supply is also expected to be an issue. "I think the interesting thing for me as a breeder is to take advantage of this and say, OK, here's a chance now to change thought and let's actually readapt varieties to California," he says. But in many circles, grape breeding is a dirty term, according to Walker. "Viticulture is the most backward form of horticulture that exists. We use these varieties that haven't been changed for decades, for millennia in some cases. And it really doesn't make any sense." The problem starts in today's vineyards. If you look at rows of Pinot Noir vines, you aren't just looking at the original varietal. You're looking at clones. That's because vines are grown from a branch that's taken off an existing plant. "Pinot noir is being propagated year after year after year. This essentially means that grapes have not been having sex very much," says Sean Myles , a geneticist at the Nova Scotia Agricultural College. He says breeding is key for other crops, since farmers need seeds to plant every year. Wine grapes miss this opportunity to develop adaptability and disease resistance, since vines don't grow from seeds "That means that we're not allowing the genetic material to be shuffled anymore. That genetic material is now standing still in time. And while the pathogens are evolving, the pinot noir is not," says Myles. Andy Walker says there's plenty of genetic diversity out there for breeding, if you wanted to make today's varieties more heat tolerant or drought resistant. But there's a very big problem. Once your breed your pinot noir with something else, you can't call it pinot noir anymore. "The last decision that hardest. Can we market this variety? We know it produces exceptional wine. We know the quality is better. But the next step is can we actually market it," says Walker. That's a deal breaker for many vineyards, who think consumers won't buy varieties they don't recognize. Walker says looking ahead to climate change, there are already varieties out there today from Italy and Spain that would do well in a warmer California. "We could produce Barbera instead, or Negroamaro or Nero d'Avola from southern Italy and we'd be far better ahead." These lush reds are popular in Italy but not so well known to Californians. Walker says it'll come down to marketing. "I don't think it's the consumer that's gonna make the shift. They have to be directed." "I think it's really a pull from consumers," says Nick Dokoozlian, a Vice President at E & J Gallo Winery, the largest family-owned winery in the US. "In most cases, we're responding to consumer demand for a cultivar." Dokoozlian says Gallo has been testing new wine varieties throughout its vineyards and has found some promising grapes. "The problem is we can't necessarily sell those varieties. Consumers aren't aware of them. The marketing aspect of climate change and the adaptation to climate change, really, the hurdles on the marketing side are much, much more significant." Since vineyards can last up to 30 years, he says switching varieties is a major financial gamble. "The wine business is an extremely capital intensive business. The financial risk of planting the wrong variety in the wrong place is pretty significant." Still, given the temperature and water supply changes projected for California, Dokoozlian sees the market shifting eventually. "I'm looking forward to having world-class California Nero d'Avola soon."Tags: breeding, Climate, climate change, genetics, grapes, napa, pinot noir, plants, sonoma, UC Davis, wine
<urn:uuid:815e40d5-ed6f-4091-a9d2-499aa7c173e9>
3.234375
1,185
Truncated
Science & Tech.
50.117257
Contrary to previous predictions and measurements, rain patterns have got more uniform as the world has warmed over the past 70 years. So say Michael Roderick and his teammates from Australian National University, Canberra, who’ve developed an ‘accounting system’ that looks closely at where and when rain fell. And the reason could be aerosols – clouds of pollutant particles – produced by humans. “The existing dogma is that increasing greenhouse gas concentrations in the atmosphere have raised rainfall variability,” Michael told me. “In that context, our results emphasise the importance of taking a whole system approach in trying to understand how something complex, like rainfall, is changing in different places.” When scientists want to understand how climate has been changing over large areas, they usually look at maps of long-term average data that ignore patterns of change in time, Michael explained. When they want to look at how it’s changed over time, they usually either look at a single place or a worldwide average, which ignores patterns in where the changes are. But Michael, along with fellow scientists Fubao Sun and Graham Farquhar, wanted to find a way to link place and time. To do this Fubao started from a common statistical test called Analysis of Variance or ANOVA. Normally it’s used to compare the effect of different “treatments” – such as a variety of temperatures – on the yield of a crop, for example. In such cases each treatment must be repeated more than once, giving different “replicates”, for the test to be valid. ANOVA can be used to give a value for variance – a measure that shows how spread out an experiment’s measurements are. A grand plan In 2010, along with four other scientists, Fubao, Graham, and Michael used a similarity between this design and how climate records are organised. For example, were the experiments put through the ANOVA test done in dishes, a scientist could organise those dishes in a grid in their lab. To know which is which, they could sort them in treatment order along one side and replicate order along another. Climate measurements can be organised in a similar way, replacing the treatment with place information, and replicate information with dates. So the team replaced replicates and treatments in the ANOVA test with place and date, in the process changing the nature of the analysis. “It is not a test,” Michael said. “It is better described as an accounting procedure where variations, either through space, or through time, both contribute to the overall variance. By formulating it as an accounting procedure one can disentangle the sources of variation and develop a new way of summarising the overall variability of the precipitation. The basic method would work with any two – or more – dimensional data set, like those with variation in space and time, including temperature or radiation. It can also work with socio-economic data, such as GDP by country.” This overall, or “grand” variance is especially interesting for rain as, when averaged across the entire planet, rainfall hardly changes from one month to the next. That link means that when some people experience unusually wet summers, others can expect unusually dry ones, Michael explained. “One consequence is that if a place receives more rain than usual in a given month, then another place must receive less,” he said. Michael, Fubao, and Graham subjected detailed data on rainfall in 1,967 grids covering over two thirds of the Earth’s land area to their procedure. They compared data from 1940-2009 from all seven publicly available rainfall databases and cross-checked the results between each of them, finding the results almost identical. “We found a reduction in global land precipitation variability because wet places/times of the year, tended, on average to get a little drier whilst dry places/times of the year, tended, on average, to get a little wetter,” Michael said. “That change has not previously been documented.” As rain is a critical ingredient in growing food, among many other things, understanding how it has changed and will change with humans adding chemicals to the air is important. But this finding, published in the scientific journal Geophysical Research Letters last month, contradicts previous climate models predicting that rain should get more variable with higher CO2 levels in the air. It also disagrees with measurements made at sea saying that wet places have got wetter and dry areas drier with climate change. However Fubao and Michael point out that these previous measurements look at the difference between evaporation and rainfall, while their new study only looks at rainfall. The Australian scientists also note the largest changes in rainfall variability seem to be where clouds of pollutant particles are being produced. Climate models have also shown that these aerosols can lower rainfall variability – and Michael speculated that they will play a big part in explaining what they’ve seen. “Model results have suggested that aerosol emissions are important in changing the dynamics of rainfall,” Michael said. “Our results suggest that aerosol emissions have likely dominated the changes in rainfall dynamics over the past 70 years.” Fubao Sun, Michael L. Roderick, Graham D. Farquhar (2012). Changes in the variability of global land precipitation Geophysical Research Letters DOI: 10.1029/2012GL053369
<urn:uuid:3cce7e3b-3914-4b99-8b59-721d91909ddf>
3.3125
1,120
Academic Writing
Science & Tech.
36.760843
What is a smart pointer and when should I use one? A smart pointer is a class that wraps a "bare" C++ pointer, to manage the lifetime of the object being pointed to. With "bare" C++ pointers, the programmer has to explicitly destroy the object when it is no longer useful. A smart pointer by comparison defines a policy as to when the object is destroyed. You still have to create the object, but you no longer have to worry about destroying it. The simplest policy in use involves the scope of the smart pointer wrapper object, such as implemented by Note that scoped_ptr instances cannot be copied. This prevents the pointer from being deleted multiple times (incorrectly). You can however pass references to it around to other functions you call. Scoped pointers are useful when you want to tie the lifetime of the object to a particular block of code, or if you embedded it as member data inside another object, the lifetime of that other object. The object exists until the containing block of code is exitted, or until the containing object is itself destroyed. A more complex smart pointer policy involves reference counting the pointer. This does allow the pointer to be copied. When the last "reference" to the object is destroyed, the object is deleted. This policy is implemented by Reference counted pointers are very useful when the lifetime of your object is much more complicated, and is not tied directly to a particular section of code or to another object. There is one drawback to reference counted pointers — the possibility of creating a dangling reference. Another possibility is creating circular references. To work around this problem, both boost and Also note that the existing standard C++ library does define a special kind of smart pointer |show 7 more comments| Smart pointer is a pointer-like type with some additional functionality, e.g. automatic memory deallocation, reference counting etc. Small intro is available on page Smart Pointers - What, Why, Which?. One of the simple smart-pointer type is Another convenient type is Subject is covered in depth in book "C++ Templates: The Complete Guide" by David Vandevoorde, Nicolai M. Josuttis, chapter Chapter 20. Smart Pointers. Some topics covered: Definitions provided Chris,Sergdev and Llyod is correct. I prefer a simpler definition though, just to keep my life simple: Smart pointer is simply a class that overloads -> and * operators. Which means that your object semantically looks like a pointer but you can make it do way cooler things, including reference counting, automatic destruction etc. shared_ptr and auto_ptr are sufficient in most cases, but come along with their own set of small idiosyncrasies.. Most kinds of smart pointers handle disposing of the pointer-to object for you. It's very handy because you don't have to think about disposing of objects manually anymore. The most commonly-used smart pointers are A smart pointer is like a regular (typed) pointer, like "char*", except when the pointer itself goes out of scope then what it points to is deleted as well. You can use it like you would a regular pointer, by using "->", but not if you need an actual pointer to the data. For that, you can use "&*ptr". It is useful for: You may not want to use a smart pointer when: Note that the implementation of std::auto_ptr in Visual Studio 2005 is horribly broken. Use the boost ones instead. A smart pointer is an object that acts like a pointer, but additionally provides control on construction, destruction, copying, moving and dereferencing. One can implement one's own smart pointer, but many libraries also provide smart pointer implementations each with different advantages and drawbacks. For example, Boost provides the following smart pointer implementations: These are just one linear descriptions of each and can be used as per need, for further detail and examples one can look at the documentation of Boost. Additionally, the C++ standard library provides three smart pointers; protected by Bo Persson Jul 2 '12 at 23:38 This question is protected to prevent "thanks!", "me too!", or spam answers by new users. To answer it, you must have earned at least 10 reputation on this site.
<urn:uuid:3466f7b0-207a-40e3-a58f-3f4f7c27d3fb>
3.21875
898
Q&A Forum
Software Dev.
48.238085
Cats & Other Carnivores by Dr. Carlos López González Aileen from the Murray Language Academy asks: 'Is it hard finding the wild cats even with the traps and advances in technology?' The answer is definitely 'yes.' These cats are very shy and elusive animals. The box traps, camera photos, and tracks left in scent stations help us to make estimates about numbers of animals, their diversity, and their physical condition. However, we really do not know much about what they do or where they go the rest of the day or night. There is a whole lot more to be learned. Collaring animals with radio transmitters and then tracking them 24 hours a day has been a tremendous help to us in finding out more about their daily activity patterns. So far, we have been able to radio-collar and track ocelots, jaguarundis, coyotes, gray foxes, coatimundis, pygmy spotted skunks, and hog-nosed skunks In the photo, you see a collared coyote. The collar contains a small radio transmitter that beeps signals that can be picked up by a radio receiver and antenna. Depending on how loud the beeps are, we can figure out the animal's direction and take a compass bearing. With a compass reading from another hilltop taken at the same time, we can determine through a process called 'triangulation' the exact location of the animal. Through recording compass locations and triangulation data over a 24-hour period, we have found out a lot about the home ranges of different animals and the distance they travel each day. For example, you can compare the daily distances we've calculated for each of the animals coyote: 12 to 20 km ocelot: 6.45 km coatimundi: 3.5 km pygmy spotted skunk: 1.48 km Through radio tracking we have also discovered three resting areas for ocelots two located along drainages, and one under a human-built culvert. We have also been able to find out more about the areas of the forest that different animals use more frequently and the extent that their territories overlap. For example, ocelots appear to be using more of the dense cover of the forest. Coyotes are using less of the forest than expected, and more of the grasslands. All of this information will help us better manage the forest resources for conservation of wild cats and
<urn:uuid:b962e2b8-f3e2-401d-8d0d-9e536f9515db>
3.390625
553
Knowledge Article
Science & Tech.
50.195594
Computing (FOLDOC) dictionary Jump to user comments PARALlel reLATION. Sabot, MIT 1987. A framework for parallel programming. A "field" is an array of objects, placed at different sites. A paralation is a group of fields, defining nearness between field elements. Operations can be performed in parallel on every site of a paralation. ["The Paralation Model: Architecture Independent Programming", G.W. Sabot firstname.lastname@example.org, MIT Press 1988].
<urn:uuid:d6bab878-2425-4387-88bd-e99d6b544154>
2.734375
116
Structured Data
Software Dev.
37.581043
Errors in Measurement Lecture Demonstrations Re-do calculation of density of bowling ball done earlier paying more attention to accurate measurement of diameter, and correct precision of measurements and calculated results. Measure diameter precisely with large caliper (or bar on ring stand lowered to top of ball). Care with propagation of errors gives: D = 5.44 x 103 g / 5.58 x 103 cm3 = 0.974910394 g/cm3
<urn:uuid:ae3c063b-14a3-46ac-a66d-3d8ff274dbac>
2.90625
96
Tutorial
Science & Tech.
57.422176
Science Fair Project Encyclopedia Spontaneous symmetry breaking Spontaneous symmetry breaking in physics takes place when a system that is symmetric with respect to some Lie group goes into a vacuum state that is not symmetric. At this point the system no longer appears to behave in a symmetric manner. It is a phenomenon that naturally occurs in many situations. A common example to help explain this phenomenon is a ball sitting on top of a hill. This ball is in a completely symmetric state. However, it is not a stable one: the ball can easily roll down the hill. At some point, the ball will spontaneously roll down the hill in one direction or another. The symmetry has been broken because the direction the ball rolled down in has now been singled out from other directions. In physics, one way of seeing spontaneous symmetry breaking is through the use of Lagrangians. Lagrangians, which essentially dictate how a system will behave, can be split up into kinetic and potential terms It is in this potential term (V(φ)) that the action of symmetry breaking occurs. An example of a potential is illustrated in the graph at the right. - V(φ) = - 10 | φ | 2 + | φ | 4 (2) This potential has many possible minimums (vacuum states) given by for any real θ between 0 and 2π. The system also has an unstable vacuum state corresponding to φ = 0. In this state the Lagrangian has a U(1) symmetry. However, once it falls into a specific stable vacuum state (corresponding to a choice of θ) this symmetry will be lost or spontaneously broken. More generally, we can have spontaneous symmetry breaking in nonvacuum situations and for systems not described by actions. The crucial concept here is the order parameter. If there is a field (often a background field) which acquires an expectation value (not necessarily a vacuum expectation value) which is not invariant under the symmetry in question, we say that the system is in the ordered phase and the symmetry is spontaneously broken. This is because other subsystems interact with the order parameter which forms a "frame of reference" to be measured against, so to speak. - For ferromagnetic materials, the laws describing it are invariant under spatial rotations. Here, the order parameter is the magnetization , which measures the magnetic dipole density. Above the Curie temperature, the order parameter is zero, which is spatially invariant and there is no symmetry breaking. Below the Curie temperature, however, the magnetization acquires a constant (in the idealized situation where we have full equilibrium; otherwise, translational symmetry gets broken as well) nonzero value which points in a certain direction. The residual rotational symmetries which leaves the orientation of this vector invariant remain unbroken but the other rotations get spontaneously broken. - The laws of physics are spatially invariant, but here on the surface of the Earth, we have a background gravitational field (which plays the role of the order parameter here) which points downwards, breaking the full rotational symmetry. This explains why up, down and the horizontal directions are all "different" but all the horizontal directions are still isotropic. - General relativity has a Lorentz gauge symmetry, but in FRW cosmological models, the mean 4-velocity field defined by averaging over the velocities of the galaxies (the galaxies act like gas particles at cosmological scales) acts as an order parameter breaking this Lorentz symmetry. Similar comments can be made about the cosmic microwave background. - Here on Earth, Galilean invariance (in the nonrelativistic approximation) is broken by the velocity field of the Earth/atmosphere, which acts as the order parameter here. This explains why people thought moving bodies tend towards rest before Galileo. We tend not to be aware of broken symmetries. - For the electroweak model, as explained earlier, the Higgs field acts as the order parameter breaking the electroweak gauge symmetry to the electromagnetic gauge symmetry. Like the ferromagnetic example, there is a phase transition at the electroweak temperature. The same comment about us not tending to notice broken symmetries explains why it look so long for us to discover electroweak unification. - For superconductors, there is a collective condensed matter field ψ which acts as the order parameter breaking the electromagnetic gauge symmetry. - In general relativity, diffeomorphism covariance is broken by the nonzero order parameter, the metric tensor field. - Catastrophe theory - Vacuum fluctuation - Second-order phase transition - Goldstone boson - Grand unified theory The contents of this article is licensed from www.wikipedia.org under the GNU Free Documentation License. Click here to see the transparent copy and copyright details
<urn:uuid:2745fba0-b298-4139-b9ec-c884d8e8cd33>
4
1,011
Knowledge Article
Science & Tech.
31.59142
Biofuels: Their Negatives with Respect to Nitrogen Erisman, J.W., van Grinsven, H., Leip, A., Mosier, A. and Bleeker, A. 2010. Nitrogen and biofuels: an overview of the current state of knowledge. Nutrient Cycling in Agroecosystems 86: 211-223. To bring us up to date on this important subject, Erisman et al. provide "an overview of the state of knowledge on nitrogen and biofuels," particularly as pertaining to several sustainability issues. The five researchers show, in their words, that "the contribution of N2O emissions from fertilizer production and application make the greenhouse gas balance for certain biofuels small positive or even negative for some crops compared to fossil fuels," because of the fact that "N2O is a 300 times more effective greenhouse gas than CO2," and because N2O emissions in the course of biofuel production "might be a factor 2-3 higher than estimated up until now from many field trials." In addition, they mention a number of other nitrogen-related environmental impacts of biofuel production, including modification of land for the growing of biofuels, wastes associated with biomass processing, and the "pollution entailed in constructing and maintaining equipment, transportation and storage facilities," as well as "the higher levels of eutrophication, acidification and ozone depletion" that are associated with biofuels due to the nitrogenous compounds that are released to the atmosphere during their agricultural production. And, of course, there are the potentially serious negative consequences of using precious land and water resources to produce biofuels, when they could instead be used to provide much-needed food and fiber for the world's still-expanding human population. Given such findings, we need to look a lot deeper into the many potential negative side effects of the production and use of biofuels before we leap headlong into this purported panacea for the many CO2-induced-warming problems that are claimed by the world's climate alarmists, especially those side effects related to nitrogen, which may only make things worse than they already are on a number of different environmental fronts.
<urn:uuid:874f9bdc-5a4a-4a4a-8cf1-e27a7813dd50>
2.984375
453
Academic Writing
Science & Tech.
29.030531
Temperature Record of the Week This issue's Temperature Record of the week is from Anderson, South Carolina. Visit our U.S. Climate Data section to plot and view these data for yourself. Where Have All the Flowers Gone?: Nowhere … yet. But a new study has been construed to suggest that "one in every five species of wild flower could die out over the next century if levels of carbon dioxide in the atmosphere double." Subject Index Summaries FACE Experiments (Trees -- Sweetgum): How does the hardwood deciduous sweetgum tree respond to atmospheric CO2 enrichment? Data from two multi-year FACE experiments reveal it fares quite well. Blizzards on the Canadian Prairies: As atmospheric CO2 concentrations continue to rise, climate alarmists offer up all sorts of scary scenarios about increases in extreme weather events associated with global warming. This report, however, provides a much different perspective on the issue. The Search for Trends in Total Solar Irradiance: Is it bearing any fruit? Effects of Elevated CO2 and Temperature on the Growth of Scots Pine and Norway Spruce Seedlings: How do the "twin evils" of the climate-alarmist movement, i.e., rising temperatures and atmospheric CO2 concentrations, affect the growth rates of boreal tree species? Sex-Specific Responses of Dioecious Plants to Atmospheric CO2 Enrichment: Do male and female plants respond differently to increases in the air's CO2 content? In some ways they do; in other ways they don't. Effects of Elevated CO2 on Woody Tissue Respiration Rates: Are the respiration rates of tree trunks and branches increased or decreased by increases in the air's CO2 content? Although the answer to this question is important to global carbon cycling, the authors of the reviewed journal article say that very few studies have addressed this topic.
<urn:uuid:a66d5798-2504-4373-91d0-7220238be238>
2.796875
391
Content Listing
Science & Tech.
42.686558
A series of "Powers of Ten" is sequentially displayed, beginning with a square covering 1023 m on a side and progressing through 10-16 m on a side. The scale and description of what is being seen is given on each image. 9-12: 4A/H3. Increasingly sophisticated technology is used to learn about the universe. Visual, radio, and X-ray telescopes collect information from across the entire spectrum of electromagnetic waves; computers handle data and complicated computations to interpret them; space probes send back data and materials from remote parts of the solar system; and accelerators give subatomic particles energies that simulate conditions in the stars and in the early history of the universe before stars formed. AAAS Benchmark Alignments (1993 Version) 11. COMMON THEMES 11D (9-12) #1. Representing large numbers in terms of powers of ten makes it easier to think about them and to compare things that are greatly different. 12. HABITS OF MIND B. Computation and Estimation 12B (9-12) #6. Express and compare very small and very large numbers using powers-of-ten notation. %0 Electronic Source %A Davidson, Michael %D 2006 %T Science, Optics & You: Secret Worlds - The Universe Within %V 2013 %N 21 May 2013 %9 application/java %U http://micro.magnet.fsu.edu/primer/java/scienceopticsu/powersof10/ Disclaimer: ComPADRE offers citation styles as a guide only. We cannot offer interpretations about citations as this is an automated procedure. Please refer to the style manuals in the Citation Source Information area for clarifications.
<urn:uuid:eed3bec9-d175-4a61-9c5a-17dd4f68c64f>
3.734375
360
Knowledge Article
Science & Tech.
48.423222
When you need to work with numbers bit by bit, as when working with the mode bits returned by stat, you’ll need to use the bitwise operators. These operators perform binary math operations on values. The bitwise-and operator (&) reports which bits are set in the left argument and in the right argument. For example, the expression 10 & 12 has the value 8. The bitwise-and needs to have a one-bit in both operands to produce a one-bit in the result. That means that the logical-and operation on ten (which is1010in binary) and twelve (which is1100) gives eight (which is1000, with a one-bit only where the left operand has a one-bit and the right operand also has a one-bit). See Figure 11-1. Figure 11-1.Bitwise-and addition The different bitwise operators and their meanings are shown in Table 11-2. Table 11-2. Bitwise operators 10 & 12 Bitwise-and; which bits are true in both operands (this gives8) 10 | 12 Bitwise-or; which bits are true in one operand or the other (this gives14) 10 ^ 12 Bitwise-xor; which bits are true in one operand or the other but not both (this gives6) 6 << 2 Bitwise shift left; shift the left operand the number of bits shown by the right operand, adding zero-bits at the least-significant places (this gives24) 25 >> 2 Bitwise shift right; shift the left operand the number of bits shown by the right operand, discarding the least-significant bits (this gives6) Bitwise negation, also called unary bit complement; return the number with the opposite bit for each bit in the operand (this gives0xFFFFFFF5, but see the text) So, here’s an example of some things you could do with the$modereturned bystat. The results of these bit manipulations could be useful withchmod, which you’ll see in Chapter 12: # $mode is the mode value returned from a stat of CONFIG warn "Hey, the configuration file is world-writable!\n" if $mode & 0002; # configuration security problem my $classical_mode = 0777 & $mode; # mask off extra high-bits my $u_plus_x = $classical_mode | 0100; # turn one bit on my $go_minus_r = $classical_mode & (~ 0044); # turn two bits off All of the bitwise operators can work with bitstrings, as well as with integers. If the operands are integers, the result will be an integer. (The integer will be at least a 32-bit integer but may be larger if your machine supports that. That is, if you have a 64-bit machine, ~10 may give the 64-bit result 0xFFFFFFFFFFFFFFF5, rather than the 32-bit result0xFFFFFFF5.) But if any operand of a bitwise operator is a string, Perl will perform the operation on that bitstring. That is,"\xAA" | "\x55"will give the string"\xFF". Note that these values are single-byte strings and the result is a byte with all eight bits set. Bitstrings may be arbitrarily long. This is one of the few places where Perl distinguishes between strings and numbers. See theperlopmanpage for more information on using bitwise operators on strings.
<urn:uuid:802d70e5-0d0c-4e09-b820-5e5c8d35ce6d>
3.25
773
Documentation
Software Dev.
55.331979
Last week we talked about Daniel Bernoulli and his famous Bernoulli Principle, which is the cornerstone of fluid dynamics. As we’ll see in this week’s installment, the Bernoulli Principle doesn’t just apply to water flowing inside pipes. Let’s consider another instance in which it is instrumental, that of an airplane wing. Figure 1 shows the side view of a wing with arrows indicating direction of air flow as the plane moves through the air. Figure 1 – A Side View of an Airplane Wing Even though he lived more than 100 years before the first airplane, Bernoulli’s Principle can be used to explain why such a contraption can fly. You see, when comparing air flowing above and beneath a wing, its very shape makes the air flow want to travel faster along the top than it does on the bottom. Bernoulli’s principle comes into play with the airplane wing just as it did in last week’s water pipe flow example. That is, the total energy of flow is the same at all points as the air flows above and below the wing. Now, if air flow speeds up on top of the wing, then the flow’s kinetic energy increases along with it. And remember last week’s analogy of change for $100? Well, something has to give, so in this example the increase in kinetic energy is accomplished at the expense of pressure energy, but the total energy remains the same. This decrease in pressure energy then translates into a drop in pressure on top of the wing. The higher pressure beneath the wing overcomes the lower pressure above the wing. This imbalance is what provides the plane’s lift, enabling it to get off the ground once it achieves a high enough speed on its race down the runway. The Wright brothers, men ahead of their time, were actually among the first aeronautical engineers. They possessed remarkably advanced knowledge of mathematics and mechanical engineering principles. They also understood what Bernoulli taught, and they used his Principle to design and test the shapes of wings on their gliders and planes. They met with success when they determined that the wing’s shape was crucial to supplying lift. In fact, they determined that, depending on the wing’s shape, it would provide the plane with the most lift for the least amount of air speed, allowing them to use a lighter engine to drive the propellers. Weight is always a factor when flying, and the ability to use a lighter engine went a long way towards getting their first plane off the ground. That’s it for Fluid Mechanics. Next week we’ll continue with a discussion of heat transfer, which is the study of how heat moves through vacuums, gases, liquids, and solid objects. Posts Tagged ‘Bernoulli’s Principle’ Last week we began our discussion on fluid dynamics. We saw how it’s used to determine flow and velocity of water within a pipe. This week we’ll continue our discussion, exploring in some detail the Bernoulli Principle and what it has to say on the subject. Daniel Bernoulli was a Dutch born mathematician who studied fluid dynamics during the 18th Century. He analyzed the flow of water and determined that as fluid flow speeds up, its pressure goes down, and vice versa. In 1738, he came up with what is now known as the Bernoulli Principle. This Principle is based on the First Law of Thermodynamics, which you will remember teaches us that energy cannot be created or destroyed. One of the conclusions that can be drawn from the Bernoulli Principle is that for fluid flowing steadily, say water within a pipe, or even air flowing over a pitcher’s curve ball in flight, the total energy of the flow remains constant. By “total energy,” I mean the sum of three types of energy: pressure energy, kinetic energy, and potential energy. Total energy will remain constant all along the flow, although its three parts can change. The “pressure energy” part of the total energy is due to the pressure of the fluid flow. For example, pressure energy can be added by a pump to make water flow through a pipe more readily. The “kinetic energy” part of total energy is due to the speed of the fluid flow. And as its name implies, kinetic energy is the energy of movement. The “potential energy” part of the total energy is related to a change in elevation from one end of the fluid flow to the other, like you’d have on a pipe running downhill. It can be said that water at the top of the hill has high potential energy because gravity wants to make it flow down to the bottom of the hill. So how does this Principle help us today? Well, Bernoulli’s Principle is the very foundation upon which fluid dynamics is built, and it’s consistently used to solve complex problems involving fluid flow. To illustrate Bernoulli’s Principle, let’s take a look at Figure l. Here water is flowing through a level pipe with three sections: Figure 1 – Water Flowing Through a Pipe With Three Sections According to Bernoulli, the total energy of the flowing water is the same from one end of the pipe to the other, and the total energy is equal in each of the three sections of pipe. As the water flows through the pipe from Section 1 to the narrower Section 2, it speeds up as it squeezes through, so its kinetic energy increases. Since the total energy must remain the same and the pipe is level, (this is significant because it means that potential energy is zero), the kinetic energy increases at the expense of pressure energy. This results in a pressure drop in Section 2. Not following? Well, it’s like making change for a hundred dollar bill. Let’s say pressure energy is represented by $20 bills and kinetic energy is represented by $10 bills. Let’s also say that you have $100 worth of these bills in your wallet. The $100 represents the total energy. Now, pretend that you are water flowing into Section 1 of the pipe. While in Section 1, you look in your wallet and you find that you have four $20 bills and two $10 bills, which add up to $100. Okay. Now, when you move into Section 2, you check your wallet again. You discover that your wallet now has three $20 bills and four $10 bills. So you now have fewer $20 bills, more $10 bills, but you still have a total of $100. Fewer $20 bills means lower pressure, and more $10 bills means higher speed. Okay, getting back to the water, what do you think is going to happen when it flows from narrow Section 2 into wide Section 3? Well, the flow will slow down as it fills the extra space present in Section 3. Since the Bernoulli Principle tells us that the total energy of the flow must remain the same, the pressure energy must increase at the expense of the kinetic energy. This in turn causes the pressure within the pipe to go up and the flow’s speed to go down. Thanks to Bernoulli, if we can calculate the total energy in one section of the pipe, then we can calculate the speed of the water flow in another section if the pressure within that section is known. Again, this is possible because we know that the total energy must remain constant all along the flow. Next week we’ll see how the Bernoulli Principle applies to the other type of fluid, air.
<urn:uuid:d124956b-649f-4843-ae2c-c8f5a0f21326>
4.3125
1,586
Personal Blog
Science & Tech.
58.39151
Editor’s note: This is the fourth in a series of articles called Working Conditions, about the unusual environments in which some University of Hawaiʻi faculty conduct their scholarly work. The clock ticks quickly for the Institute for Astronomy’s Shadia Habbal. In all of 2008 she had just one minute and forty-nine seconds to complete her field experiments. That’s because Habbal, a University of Hawaiʻi at Mānoa astronomer, conducts her research during the brief span of a total solar eclipse. She and her team travel to remote parts of the planet to study the sun’s corona—its outer atmosphere, which is only visible on Earth when the moon blocks 100 percent of the sun’s light. For reasons scientists have not yet discovered, the corona is much hotter than the sun’s disk, reaching temperatures of a million-plus degrees. The intense heat strips elements of their electrons, ionizing them. These ionized elements fly off into space on the solar wind, a phenomenon that affects astronauts, space stations and shuttles, communication satellites and even the earth’s magnetic field. “Our magnetic field is like an umbrella,” Habbal explains. “It protects us but can get pushed around by a gust of wind, exposing us to rain, or in this case, to energetic particles in the solar wind that zap instrumentation and disrupt communications.” Total solar eclipses occur every year and a half. Each creates a shadow band barely a few hundred kilometers wide across Earth’s surface. To see the corona, viewers must be within this band. In 2008 that requirement took Habbal, her team and their 800 pounds of specialized cameras, telescopes and other equipment to China’s Gobi Desert. The sensitive equipment was set up in a tent with a portable AC unit and a large window flap that could be opened for viewing. “We pitched our sleeping tents on the sand,” says Habbal, “but the cooks pitched their tent on two aluminum bed frames raised above the sand—because they knew there were scorpions.” Working in diverse locations, Habbal has learned to expect surprises. In China, a taxi collided with her bus, the team was left without food for 24 hours, and driving rain threatened to sink the scientific undertaking. “The clouds parted just minutes before the eclipse,” she says, relieved, “and conditions were perfect during totality.” Not so in Mongolia. A snowstorm obliterated any chance of seeing the eclipse. In India, however, the 42-second event was spectacular, says Habbal, “with streamers seemingly shooting out to infinity.” Habbal flirted with danger in South Africa when three rhinos charged her walking party. “They were like small mountains. I thought that was the end of us,” she exclaims. She’s grateful for the animals’ excellent hearing—just five yards from the group, the rhinos stopped and turned around when the guide tapped on the wooden handle of his rifle. On the way to the Zambia, Africa, site in 2001, at the end of the rainy season, Habbal’s party drove for eight hours through Kafue National Park on a road filled with deep, muddy potholes. When they reached a checkpoint and opened a window for the guard, a swarm of tsetse flies flew into the jeep. “It was awful,” says Habbal. “They just stick to you. We had to keep swatting them for miles.” The eclipse site was on the banks of a river filled with hippos, so guides constructed showers using inverted buckets filled with river water. “There weren’t enough tarps, so our pit toilets were open on the side facing the savannah. We called it the toilet with a view,” Habbal says, laughing. “We never went there at night because we didn’t know what would be lurking,” she adds. During the Syria 1999 eclipse at ʻAyn Dīwār, a village at the border with Turkey and Iraq, the temperature reached 120°F on the concrete roof of a government building where Habbal’s team had set up their tents and equipment. “We couldn’t take a shower during the day because the water was literally boiling,” she says. In her study of the sun’s elements, Habbal has investigated several spectral lines of iron. One is FeXI. “It’s existence has been known for some time,” she explains, “but nobody had observed and photographed it because it’s near the end of the visible spectrum—borderline infrared—and the technology wasn’t available.” Habbal made the first recorded image of FeXI during the 2006 eclipse working from a tent in Libya’s Sahara Desert. A year earlier, she had scouted the area off-road with a Tuareg guide. “The first night it was bitter cold,” she recalls. “We camped at a beautiful oasis where the palm trees were buried all the way to just below their heads, and the sand was finer than on any beach.” The next day they passed a changing landscape of dunes, rocky outcrops, and an extinct volcano surrounded by a salt lake, high grass and black sand known as Valley of the Mosquitoes. When they arrived at a flat, featureless area, the guide said, “This is where you want to be.” Habbal’s GPS coordinates confirmed that they were at the exact spot she had requested, and her guide had not used GPS. “We were in the middle of nowhere. I don’t know how he found it or the oasis at night with only the jeep’s headlights,” she says in amazement, “but his people were once nomads, and he told me that it’s enough for them to go to a place once and they never forget how to get there.” At eclipse time, Habbal’s team was transported from Tripoli to the site in Libyan Air Force C-130 planes and helicopters. “Everything we asked for, they delivered,” she says. That included generators, liquid nitrogen, internet and phone lines, water for showers and even an unrequested flock of sheep. Habbal’s eclipse observations have answered many questions but more remain. She knows from FeXI and other irons that heavy elements are temporarily trapped in certain regions of the sun’s magnetic field and have trouble escaping with the solar wind. “They’re not getting enough energy to push them away from the sun,” she says, “so the question is, what’s holding them back?” Habbal is determined to look for answers no matter where the quest takes her. Each finding, she says, will provide another clue to our understanding of the sun and the solar wind.
<urn:uuid:6474ab3f-6c3d-4007-9d38-ac0f4f713b2b>
3.453125
1,527
Truncated
Science & Tech.
55.531495
The Development of Telescope Optics in the Middle of the Seventeenth Century Author: Willach R. Source: Annals of Science, Volume 58, Number 4, 1 October 2001 , pp. 381-398(18) Publisher: Taylor and Francis Ltd Abstract:The author performed optical tests on four telescopes dating from the first half of the seventeenth century and on four objective lenses made by the Italian optician Giuseppe Campani. These tests consisted of the method of Ronchi and of the highly sensitive method of Foucault on an optical bench. The two incomplete surviving telescopes in Skokloster made by Wiesel have been reconstructed and compared with a telescope made by Divini and a telescope made by Campani. The contributions of Schyrl de Rheita and Johannes Wiesel to the development of the telescope, and the influence of their new methods upon the opticians of the second half of the seventeenth century, especially Giuseppe Campani, are discussed. Document Type: Research article Publication date: 2001-10-01
<urn:uuid:827563d8-4f86-4479-b5b7-89e8c23c2444>
2.765625
219
Academic Writing
Science & Tech.
27.763915
Introduction to Harmonic Motion Intuition behind the motion of a mass on a spring (some calculus near the end). Introduction to Harmonic Motion ⇐ Use this menu to view and help create subtitles for this video in many different languages. You'll probably want to hide YouTube's captions if using these subtitles. - Let's see if we can use what we know about springs now to - get a little intuition about how the - spring moves over time. - And hopefully we'll learn a little bit - about harmonic motion. - We'll actually even step into the world of differential - equations a little bit. - And don't get daunted when we get there. - Or just close your eyes when it happens. - Anyway, so I've drawn a spring, like I've done in the - last couple of videos. - And 0, this point in the x-axis, that's where the - spring's natural resting state is. - And in this example I have a mass, mass m, - attached to the spring. - And I've stretched the string. - I've essentially pulled it. - So the mass is now sitting at point A. - So what's going to happen to this? - Well, as we know, the force, the restorative force of the - spring, is equal to minus some - constant, times the x position. - The x position starting at A. - So initially the spring is going to pull - back this way, right? - The spring is going to pull back this way. - It's going to get faster and faster and faster and faster. - And we learned that at this point, it has a lot of - potential energy. - At this point, when it kind of gets back to its resting - state, it'll have a lot of velocity and a lot of kinetic - energy, but very little potential energy. - But then its momentum is going to keep it going, and it's - going to compress the spring all the way, until all of that - kinetic energy is turned back into potential energy. - Then the process will start over again. - So let's see if we can just get an intuition for what x - will look like as a function of time. - So our goal is to figure out x of t, x as a function of time. - That's going to be our goal on this video and - probably the next few. - So let's just get an intuition for what's happening here. - So let me try to graph x as a function of time. - So time is the independent variable. - And I'll start at time is equal to 0. - So this is the time axis. - Let me draw the x-axis. - This might be a little unusual for you, for me to draw the - x-axis in the vertical, but that's because x is the - dependent variable in this situation. - So that's the x-axis, very unusually. - Or we could say x of t, just so you know x is a function of - time, x of t. - And this state, that I've drawn here, this is at time - equals 0, right? - So this is at 0. - Let me switch colors. - So at time equals 0, what is the x position of the mass? - Well the x position is A, right? - So if I draw this, this is A. - Actually, let me draw a line there. - That might come in useful. - This is A. - And then this is going to be-- let me try to make it - relatively-- that is negative A. - That's minus A. - So at time t equals 0, where is it? - Well it's at A. - So this is where the graph is, right? - Actually, let's do something interesting. - Let's define the period. - So the period I'll do with a capital T. - Let's say the period is how long it takes for this mass to - go from this position. - It's going to accelerate, accelerate, accelerate, - Be going really fast at this point, all kinetic energy. - And then start slowing down, slowing down, slowing down, - slowing down. - And then do that whole process all the way back. - Let's say T is the amount of time it takes to do that whole - process, right? - So at time 0 today, and then we also know that at time T-- - this is time T-- it'll also be at A, right? - I'm just trying to graph some points that I know of this - function and just see if I can get some intuition of what - this function might be analytically. - So if it takes T seconds to go there and back, it takes T - over 2 seconds to get here, right? - The same amount of time it takes to get here was also the - same amount of time it takes to get back. - So at T over 2 what's going to be the x position? - Well at T over 2, the block is going to be here. - It will have compressed all the way over here. - So at T over 2, it'll have been here. - And then at the points in between, it will be at x - equals 0, right? - It'll be there and there. - Hopefully that makes sense. - So now we know these points. - But let's think about what the actual function looks like. - Will it just be a straight line down, then a straight - line up, and then the straight line down, and then a - straight line up. - That would imply-- think about it-- if you have a straight - line down that whole time, that means that you would have - a constant rate of change of your x value. - Or another way of thinking about that is that you would - have a constant velocity, right? - Well do we have a constant velocity this entire time? - Well, no. - We know that at this point right here you have a very - high velocity, right? - You have a very high velocity. - We know at this point you have a very low velocity. - So you're accelerating this entire time. - And you actually, the more you think about it, you're - actually accelerating at a decreasing rate. - But you're accelerating the entire time. - And then you're accelerating and then you're decelerating - this entire time. - So your actual rate of change of x is not constant, so you - wouldn't have a zigzag pattern, right? - And it'll keep going here and then you'll have a point here. - So what's happening? - When you start off, you're going very slow. - Your change of x is very slow. - And then you start accelerating. - And then, once you get to this point, right here, you start - Until at this point, your velocity is exactly 0. - So your rate of change, or your slope, is going to be 0. - And then you're going to start accelerating back. - Your velocity is going to get faster, faster, faster. - It's going to be really fast at this point. - And then you'll start decelerating at that point. - So at this point, what does this point correspond to? - You're back at A. - So at this point your velocity is now 0 again. - So the rate of change of x is 0. - And now you're going to start accelerating. - Your slope increases, increases, increases. - This is the point of highest kinetic energy right here. - Then your velocity starts slowing down. - And notice here, your slope at these points is 0. - So that means you have no kinetic - energy at those points. - And it just keeps on going. - On and on and on and on and on. - So what does this look like? - Well, I haven't proven it to you, but out of all the - functions that I have in my repertoire, this looks an - awful lot like a trigonometric function. - And if I had to pick one, I would pick cosine. - Well why? - Because when cosine is 0-- I'll write it down here-- - cosine of 0 is equal to 1, right? - So when t equals 0, this function is equal to A. - So this function probably looks something like A cosine - of-- and I'll just use the variable omega t-- it probably - looks something like that, this function. - And we'll learn in a second that it looks - exactly like that. - But I want to prove it to you, so don't just - take my word for it. - So let's just figure out how we can figure out what w is. - And it's probably a function of the mass of this object and - also probably a function of the spring - constant, but I'm not sure. - So let's see what we can figure out. - Well now I'm about to embark into a little bit of calculus. - Actually, a decent bit of calculus. - And we'll actually even touch on differential equations. - This might be the first differential equation you see - in your life, so it's a momentous occasion. - But let's just move forward. - Close your eyes if you don't want to be confused, or go - watch the calculus videos at least so you know what a - derivative is. - So let's write this seemingly simple equation, or let's - rewrite it in ways that we know. - So what's the definition of force? - Force is mass times acceleration, right? - So we can rewrite Hooke's law as-- let me switch colors-- - mass times acceleration is equal to minus the spring - constant, times the position, right? - And I'll actually write the position as a function of t, - just so you remember. - We're so used to x being the independent variable, that if - I didn't write that function of t, it might get confusing. - You're like, oh I thought x is the independent variable. - Because in this function that we want to figure out, we want - to know what happens as a function of time? - So actually this is also maybe a good review - of parametric equations. - This is where we get into calculus. - What is acceleration? - If I call my position x, my position is equal to x as a - function of t, right? - I put in some time, and it tells me what my x value is. - That's my position. - What's my velocity? - Well my velocity is the derivative of this, right? - My velocity, at any given point, is going to be the - derivative of this function. - The rate of change of this function with respect to t. - So I would take the rate of change with - respect to t, x of t. - And I could write that as dx, dt. - And then what's acceleration? - Well acceleration is just the rate of change - of velocity, right? - So it would be taking the derivative of this. - Or another way of doing it, it's like taking the second - derivative of the position function, right? - So in this situation, acceleration is equal to, we - could write it as-- I'm just showing you all different - notations-- x prime prime of t, second derivative of x with - respect to t. - Or-- these are just notational-- d squared x over - dt squared. - So that's the second derivative. - Oh it looks like I'm running out of time. - So I'll see you in the next video. - Remember what I just wrote. just wrote Be specific, and indicate a time in the video: At 5:31, how is the moon large enough to block the sun? Isn't the sun way larger? Have something that's not a question about this content? This discussion area is not meant for answering homework questions. Share a tip When naming a variable, it is okay to use most letters, but some are reserved, like 'e', which represents the value 2.7831... Have something that's not a tip or feedback about this content? This discussion area is not meant for answering homework questions. Discuss the site For general discussions about Khan Academy, visit our Reddit discussion page. Flag inappropriate posts Here are posts to avoid making. If you do encounter them, flag them for attention from our Guardians. - disrespectful or offensive - an advertisement - low quality - not about the video topic - soliciting votes or seeking badges - a homework question - a duplicate answer - repeatedly making the same post - a tip or feedback in Questions - a question in Tips & Feedback - an answer that should be its own question about the site
<urn:uuid:b088208d-d724-43c9-81a8-a62156174f40>
3.921875
2,919
Truncated
Science & Tech.
77.71642
Topic: Java and XML Java Serialization to XML (JSX) aims to to provide a simple and lightweight mechanism for compact serialization of object data that uses only a single method invocation to take in an object and write out its contents as XML (and vice versa). Java objects are serialized as XML elements, and object fields as attributes. Because of its specific purpose, JSX does not require the sophistication of SAX or DOM. It is simpler to use, and its memory footprint is sufficiently small for use in applets.
<urn:uuid:f5f28c8e-fabc-4ff1-9410-7b548962d43e>
2.796875
108
Knowledge Article
Software Dev.
41.66698
The Delmarva fox squirrel is a very, very large squirrel. It can tip the scales at as many as three pounds, which is about twice the size of its cousin, the Eastern gray squirrel. But it otherwise has all the typical squirrel traits -- a long tail, small, round ears, and an acorn-shaped head. Unlike the prolific Eastern gray (Sciurus carolinensis) -- the squirrel most people in the United States are familiar with -- the Delmarva fox squirrel (Sciurus niger cinereusis) is an endangered species. By the mid-1960s, it was reduced to just 10 percent of its natural range on the Delmarva Peninsula, which juts out between the Delaware and Chesapeake bays along the Atlantic Coastal Plain. (“Delmarva” is a combination of the names of the states that share the peninsula: Delaware, Maryland, and Virginia.) Much of the Delmarva fox squirrel’s preferred habitat, which consists of mature mixed pine and hardwood forest, was cleared for agriculture or converted for timber production in the 19th and early 20th centuries. During that time, the species was hunted for food by humans, which compounded the effects of predation by others animals, such as foxes, minks, and raptors. The Delmarva fox squirrel was added to the U.S. Endangered Species List in 1967, giving momentum to habitat protection projects begun in the 1940s in Maryland. Hunting of the species was banned in 1971, and in that decade and the following, biologists carried out a series of translocations, in which groups of squirrels from existing populations were introduced to uninhabited sites within the species' historical range. Translocations at various sites were successful. Had recovery efforts failed, the Delmarva fox squirrel might not be here today, and that would have been a great tragedy. The species is truly unique among tree squirrels (genus Sciurus). It is a shy animal and is beautiful. It has a silvery gray coat, white feet, and an unusually fluffy, white- and black-accented tail. The fluffiness of its tail resembles that of a fox's, explaining its common name. The Delmarva has adapted its behavior to occupy a niche distinct from that of the Eastern gray squirrel. The main difference between the two is that the Delmarva prefers to stick to the ground. It nests in trees and will run up trees to flee from predators, but it spends most of its time foraging for nuts and seeds in the open understory of mature forests and in open areas along streams and fields. It frequently travels by running along the ground, rather than by leaping between the branches of trees, which is typical of the more agile, tree-dwelling Eastern gray. While the Delmarva's numbers have increased, habitat fragmentation and residential development have left populations isolated and vulnerable to catastrophic events, such as disease or natural disaster. To secure a future for the species, biologists continue to monitor populations and to promote habitat protection. The conservation of forest corridors connecting woodlots to ensure safe passage for the squirrel from one area of its habitat to another is one such effort currently underway.
<urn:uuid:6b24345e-edcb-4734-a05b-8d9fa2f8b932>
3.53125
664
Knowledge Article
Science & Tech.
41.302488
Changing Planet: Adaptation of Species As the Earth system warms due to rising levels of greenhouse gases in the atmosphere, the environments that some species live in are rapidly changing. If the environmental conditions change too quickly, the species may not be able to adapt to the change, and may become threatened or even extinct. Scientists are working to try to understand how species adapt, to help prevent loss of species diversity. Butterflies specifically are beautiful, tiny and very sensitive to climate change impacts on the environment. Click on the video at the left to watch the NBC Learn video - Changing Planet: Adaptation of Butterflies. Lesson plan: Changing Planet: Adaptation of Species (Birds and Butterflies) Shop Windows to the Universe Science Store! is a fun group game appropriate for the classroom. Players follow nitrogen atoms through living and nonliving parts of the nitrogen cycle. For grades 5-9. You might also be interested in: Energy from the Sun can enter the atmosphere, but not all of it can easily find its way out again. This is a natural process called the greenhouse effect. Without any greenhouse effect, Earth’s temperature...more A new report from the Intergovernmental Panel on Climate Change (IPCC) highlights how natural environments and human communities are coping with changing climate, how vulnerable they are, and whether they...more The title of this page is a little deceiving. We will also talk about arachnids, centipedes and other "tiny creatures" of the rain forest. So, let's get started! The most feared and well known spider in...more This Windows to the Universe Exploratour examines the scientific evidence of biological evolution. Take the tour to travel through 10 web pages about the scientific theory that explains how and why living...more The world's surface air temperature increased an average of 0.6° Celsius (1.1°F) during the last century according to the Intergovernmental Panel on Climate Change (IPCC). This may not sound like very...more Altocumulus clouds (weather symbol - Ac), are made primarily of liquid water and have a thickness of 1 km. They are part of the Middle Cloud group (2000-7000m up). They are grayish-white with one part...more Altostratus clouds (weather symbol - As) consist of water and some ice crystals. They belong to the Middle Cloud group (2000-7000m up). An altostratus cloud usually covers the whole sky and has a gray...more
<urn:uuid:7ec4d66f-1b4c-4a12-b14d-d3514d1f583b>
3.953125
522
Tutorial
Science & Tech.
53.486243
Lets say I have an array like this: How would I trim off all the leading and trailing whitespaces? char str = " Hello "; I tried doing this with a cnt of all non ' ' then making a new array with the size of cnt. Then I noticed that I can't create an array with a variable. So how should I go about this? Use a for loop to count the number of leading spaces Use another for loop to count the trailing spaces Use strncpy() to copy the bit in between The problem you ran into is that unless you use dynamic memory allocation, the size of the array must be constant. Assuming you have not yet studied dynamic memory allocation, you can get around this using the std::string class in the <string> header. A quick reference on what you find in the class here: cpprefence.com's strings
<urn:uuid:e7f5ea7f-1946-409a-b994-d06702e0420a>
2.984375
186
Q&A Forum
Software Dev.
67.130671
Last Updated: 12:26 AM GMT on May 20, 2013 — Last Comment: 2:04 PM GMT on May 23, 2013 Celebrating Space Exploration Posted by: GardenGrrl, 5:43 PM GMT on June 05, 2012 This is an amazing year for space exploration and star gazing. Watching the live feed of Spacex Dragon docking to the International Space Station put goosebumps on my arms. Science fiction has long predicted we would explore the cosmos. The day the Dragon docked to the ISS marked the real start to space travel. It's not the government, but private industry who will colonize the galaxies. Each generation their own group of genuises that bring us new tech. Thomas Edison, Alexander Graham Bell; American giants followed by Jack Kilby and Robert Noyce who invented the pivotal semi-conductor chip. We now have Elon Musk and his associates to bring us new marvels. This is truly a historic time. It seems fitting that we have the Venus Transit across the the sun. The world will not see this again until 2117. What fancies will become reality then? Will we "surf" planet orbits to skip through the galaxy? Discover "space currents" to sail? The biggest question, will we perfect FTL?
<urn:uuid:46595d54-ae65-4fd2-ae75-88cd902a93c4>
3.015625
265
Comment Section
Science & Tech.
68.490785
Energy is commonly defined as the capacity to do work or to transfer heat. Work is energy used to cause an object with mass to move. Heat is energy used to cause the temperature of an object to increase. Kinetic energy is the energy of motion, represented by the equation: Ek = 1/2 mv2 Atoms and molecules have mass and are in motion, Potential energy is energy of position, based on the relative position of one object with another. therefore they have kinetic energy. Gravitational potential energy is represented by the equation: Ep = mgh Gravity, near the surface of the Earth, accelerates all objects at a rate equal to the gravitational constant, g, 9.8 m/s2.
<urn:uuid:65373635-ed30-40f9-a7fa-bf27c52cd532>
3.71875
160
Knowledge Article
Science & Tech.
38.746923
The two images below show variations in primary productivity based on satellite measurements of chlorophyll pigment. Red colors indicate high values and purple colors indicate low values (see colorbar scale below). Black areas are parts of the ocean where no data were collected. Two factors affect the amount of primary productivity in the ocean: light and nutrients. Light changes seasonally, particularly at high latitudes. High nutrient levels are often associated with areas of upwelling currents and low levels are often associated with downwelling currents. In the displayed images, notice how the productivity values relate to the oceanic currents we studied in another exercise. (NOTE: To obtain larger-sized images (each are about 330K in size), double-click on the displayed images.) a.) Describe the locations in the ocean that have high productivity values (i.e., high pigment concentrations) and explain why values are high at these locations. b.) Describe the locations in the ocean that have low productivity values and explain why values are low at these locations. c.) Compare the winter and summer images in terms of high and low productivity regions.
<urn:uuid:34318b7b-3f55-4783-b368-afd23dc7522f>
3.65625
241
Tutorial
Science & Tech.
33.884954
Houghton, R.A. 1993. The flux of carbon from changes in land use. pp. 39-42. In I.G. Enting and K.R. Lassey (eds.). Projections of Future CO2. Technical paper 27, CSIRO Division of Atmospheric Research, Mordialloc, Australia. Houghton, R.A. 1999. The annual net flux of carbon to the atmosphere from changes in land use 1850-1990. Tellus 51B:298-313. Houghton, R.A., R.D. Boone, J.R. Fruci, J.E. Hobbie, J.M. Melillo, C.A. Palm, B.J. Peterson, G.R. Shaver, G.M. Woodwell, B. Moore, D.L. Skole, and N. Myers. 1987. The flux of carbon from terrestrial ecosystems to the atmosphere in 1980 due to changes in land use: Geographic distribution of the global flux. Tellus 39B:122-139. Houghton, R.A., and J.L. Hackler. 1995. Continental Scale Estimates of the Biotic Carbon Flux from Land Cover Change: 1850-1980. ORNL/CDIAC-79, NDP-050, Carbon Dioxide Information Analysis Center, Oak Ridge National Laboratory, U.S. Department of Energy, Oak Houghton, R.A., and J.L. Hackler. 1999. Emissions of carbon from forestry and land- use change in tropical Asia. Global Change Biology Houghton, R.A., J.E. Hobbie, J.M. Melillo, B. Moore, B.J. Peterson, G.R. Shaver, and G.M. Woodwell. 1983. Changes in the carbon content of terrestrial biota and soils between 1860 and 1980: A net release of CO2 to the atmosphere. Ecological Monographs 53:235-262. Houghton, R.A., and D.L. Skole. 1990. Carbon. pp. 393-408. In B.L. Turner, W.C. Clark, R.W. Kates, J.F. Richards, J.T. Mathews, and W.B. Meyer (eds.), The Earth as Transformed by Human Action. Cambridge University Press, Cambridge, U.K. Houghton, R.A. 2002. Revised estimates of the annual net flux of carbon to the atmosphere from changes in land use and land management 1850-2000. Tellus (in press).
<urn:uuid:5ad8c618-b958-484e-a1f2-a9175bd41cf6>
2.734375
574
Content Listing
Science & Tech.
97.579742
They are small, scorching hot, and reside in a pretty odd solar system. Earlier today, NASA announced the discovery of two Earth-sized planets – a first for the Kepler mission. The planets are part of the Kepler 20 system, which also includes three larger planets. The newly discovered planets – dubbed Kepler-20e and Kepler-20f – orbit extremely close to its star, making it almost impossible for life as we know to survive. A planet must be within the “habitable zone” for it to have a chance at harboring life, scientists say. If a planet is too close to its star, water evaporates. If its too far, water freezes. That’s why the “habitable zone” is often called the “Goldilocks zone.” Life only forms when things are just right. But, that information is based on what we know about our solar system and our way of life. For all we know, planets could harbor some sort of life – microbial or intelligent – and not be located in the “habitable zone.” Perhaps, life doesn’t necessarily need water. Who really knows? You see, scientists are learning more and more about peculiar planets and systems that don’t necessarily make sense. This discovery, for example, shows a very different kind of solar system when compared to ours. The system has an unexpected arrangement. In our solar system, small, rocky worlds orbit close to the sun and large, gaseous worlds orbit farther out. In comparison, the planets of Kepler-20 are organized in alternating size: large, small, large, small and large. “The Kepler data are showing us some planetary systems have arrangements of planets very different from that seen in our solar system,” said Jack Lissauer, planetary scientist and Kepler science team member at NASA’s Ames Research Center in Moffett Field, Calif. “The analysis of Kepler data continue to reveal new insights about the diversity of planets and planetary systems within our galaxy.” Scientists think that these planets were once further away from the sun, but “migrated” inward. Hmm, they got an answer for everything, right? Is it really impossible for large, gaseous planets to form close to its sun? That would change everything we know about planet formation. More on that later. Let’s get back to the point: This discovery is huge, according to scientists. It shows that Kepler can detect smaller, Earth-sized planets. So far, Kepler has confirmed 33 planets and has found more than 2,300 planetary candidates. Earlier this month, NASA announced the discovery of Kepler 22-b, a planet believed to be habitable. Read more about that discovery, and its controversy, here. In other exoplanet news, scientists discovered a massive gas giant orbiting a “rapidly pulsating” star called NY Vir. There is, perhaps, another planet on the system, according to the abstract.
<urn:uuid:91683d59-3ac3-4f6e-a7e0-bd6630a7f912>
3.71875
626
Personal Blog
Science & Tech.
49.812233
Apr 20, 2000, 6:11 AM Post #2 of 3 I just read up on it and from what I undrstand umask is just short for the Unix Permission Mask, and the Unix Permission Mask is simply the permission. But to set a permission when using the mkdir you have to use permissions that are only similar to the ones that we really use like, 777, 755, and 666. 666 is 0666, 777 is 0777, and 755 is 022. I was also suprise that 022 would be 755 but I just read it in two different books. Perl Cookbook, and Mastering Perl 5. Don't buy the second one. I went to perl.com and I didn't find much other than what I read and told you but if you want to see go ahead, http://www.perl.com/cgi-bin/msearch.pl?searchfor=permission and
<urn:uuid:71126a25-b832-4363-b7cc-966e53cafc25>
2.78125
199
Comment Section
Software Dev.
98.311725
This view of Titan's south polar region reveals an intriguing dark feature that may be the site of a past or present lake of liquid hydrocarbons. The true nature of this feature, seen here at left of center, is not yet known, but the shore-like smoothness of its perimeter and its presence in an area where frequent convective storm clouds have been observed by Cassini and Earth-based astronomers make it the best candidate thus far for an open body of liquid on Titan. If this interpretation is correct, then other very dark but smaller features seen in the south polar region, some of which are captured in this image, may also be the sites of liquid hydrocarbon reservoirs. In addition to the notion that the dark feature is or was a lake filled with liquid hydrocarbons, scientists have speculated about other possibilities. For instance, it is plausible that the lake is simply a broad depression filled by dark, solid hydrocarbons falling from the atmosphere onto Titan's surface. In this case, the smoothed outline might be the result of a process unrelated to rainfall, such as a sinkhole or a volcanic caldera. A red cross below center in the scene marks the pole. The brightest features seen here are methane clouds. A movie sequence showing the evolution of bright clouds in the region during the same flyby is also available (see PIA06241). This view is a composite of three Cassini spacecraft narrow-angle camera images, taken over several minutes during Cassini's distant flyby on June 6, 2005. The images were combined to produce a sharper view of Titan's surface. The images were taken using a combination of spectral filters sensitive to wavelengths of polarized infrared light. The images were acquired from approximately 450,000 kilometers (279,000 miles) from Titan. Resolution in the scene is approximately 3 kilometers (2 miles) per pixel. The view has been contrast-enhanced to improve the overall visibility of surface features. The Cassini-Huygens mission is a cooperative project of NASA, the European Space Agency and the Italian Space Agency. The Jet Propulsion Laboratory, a division of the California Institute of Technology in Pasadena, manages the mission for NASA's Science Mission Directorate, Washington, D.C. The Cassini orbiter and its two onboard cameras were designed, developed and assembled at JPL. The imaging team is based at the Space Science Institute, Boulder, Colo. For more information about the Cassini-Huygens mission visit http://saturn.jpl.nasa.gov. For additional images visit the Cassini imaging team homepage http://ciclops.org.
<urn:uuid:8b5cf19a-5476-4ac9-9a4e-eb7eb6867a45>
3.515625
539
Knowledge Article
Science & Tech.
37.058129
Science Fair Project Encyclopedia Fundamental theorem of arithmetic In mathematics, and in particular number theory, the fundamental theorem of arithmetic or unique factorization theorem is the statement that every positive integer greater than 1 can be written as a product of prime numbers in only one way. For instance, we can write - 6936 = 23 ˇ 3 ˇ 172 or 1200 = 24 ˇ 3 ˇ 52 and there are no other possible factorizations of 6936 or 1200 into prime numbers, if we ignore the ordering of the factors. To make the theorem work even for the number 1, we can think of 1 as being the product of zero prime numbers (see empty product). The theorem establishes the importance of prime numbers. Essentially, they are the "basic building blocks" of the positive integers, in that every positive integer can be put together from primes in a unique fashion. Knowing the prime number factorization of a number gives complete knowledge about all factors of that number. For instance, the above factorization of 6936 tells us that the positive factors of 6936 are of the form - 2a ˇ 3b ˇ 17c with [0 ≤ a ≤ 3], [0 ≤ b ≤ 1], and [0 ≤ c ≤ 2]. This yields a total of 4 ˇ 2 ˇ 3 = 24 positive factors . Once the prime factorizations of two numbers are known, their greatest common divisor and least common multiple can be found quickly. For instance, from the above we see that the greatest common divisor of 6936 and 1200 is 23 ˇ 3 = 24. However if the prime factorizations are not known, the use of Euclid's algorithm generally requires much less calculation than factoring the two numbers. The proof consists of two parts: first, we have to show that every number can indeed be written as a product of primes; then we have to show that any two such representations are essentially the same. Suppose there was a positive integer which can not be written as a product of primes. Then there must be a smallest such number: let's call it n. This number n cannot be 1, because of our convention above. It cannot be a prime number either, since any prime number is a product of a single prime, itself. So it must be a composite number. Thus - n = ab where both a and b are positive integers smaller than n. Since n was the smallest number for which the theorem fails, both a and b can be written as products of primes. But then - n = ab The uniqueness part of the proof hinges on the following fact: if a prime number p divides a product ab, then it divides a or it divides b. This is a lemma, to prove first. For that, if p doesn't divide a, then p and a are coprime and Bézout's identity yields integers x and y such that - px + ay = 1. Multiplying with b yields - pbx + aby = b, and since both summands on the left-hand side are divisible by p, the right-hand side is also divisible by p. That proves the lemma. Now take two products of primes which are equal. Take any prime p from the first product. It divides the first product, and hence also the second. By the above fact, p must then divide at least one factor in the second product. But the factors are all primes themselves, so p must actually be equal to one of the factors of the second product. So we can cancel p from both products. Continuing in this fashion, we eventually see that the prime factors of the two products must match up precisely. Another proof of the uniqueness of the prime factorization of a given integer uses infinite descent: Assume that a certain integer can be written as (at least) two different products of prime numbers, then there must exist a smallest integer s with such a property. Call the two products of s p1 ... pm and q1 ... qn. No pi (with 1 ≤ i ≤ m) can be equal to any qj (with 1 ≤ j ≤ n), as there would otherwise be a smaller integer factorizable in two ways (by removing prime factors common in both products) violating our assumption. We can now assume without loss of generality that p1 is a prime factor smaller than any qj (with 1 ≤ j ≤ n). Take q1. Then there exist integers d and r such that - q1/p1 = d + r/p1 and 0 < r < p1 < q1 (r can't be 0, as that would make q1 a multiple of p1 and not prime). We now get - p2 ... pm = (d + r/p1) q2 ... qn = dq2 ... qn + rq2 ... qn/p1. - k = rq2 ... qn/p1. This gives us - p1k = rq2 ... qn. The value of both sides of this equation is obviously smaller than s, but is still large enough to be factorizable. Since r is smaller than p1, the two prime factorizations we get on each side after both k and r are written out as their product of primes, must be different. This is in contradiction with s being the smallest integer factorizable in more than one way. Thus the original assumption must be false. - Baker, Alan (1984). A Concise Introduction to the Theory of Numbers. Cambridge: Cambridge University Press. ISBN 0521286549 - GCD and the Fundamental Theorem of Arithmetic - PlanetMath: Proof of fundamental theorem of arithmetic The contents of this article is licensed from www.wikipedia.org under the GNU Free Documentation License. Click here to see the transparent copy and copyright details
<urn:uuid:bb3c215a-addd-4e9c-be0d-ccece1d291a1>
4.5
1,240
Knowledge Article
Science & Tech.
72.151772
Physicist: In terms of things like space travel, the difference between 100mph and light speed is academic. Everything out there is really far apart. The speed of light, “C”, is woven into the laws of the universe from top to bottom, mostly in the context of electro-magnetism. Changing the speed of light would have profound effects on chemistry and the fundamental forces. But those changes are boring. What’s more interesting is the effects that special relativity would have on every day life. For what follows, the speed of light is now C = 100 mph (161 km/h for our Canadian or otherwise foreign readers). Movement? Nopers: If you’ve taken intro physics you may have learned that the kinetic energy of an object is . But this is just a low-velocity approximation of the true equation (found by Einstein), which is . The first term is the famous rest mass energy (E=mc2), the second term is the regular kinetic energy, and the third, fourth, fifth (and so on) terms are only important when the velocity is a substantial fraction of light speed (so Newton can be forgiven for getting this one wrong). But if C=100mph, then suddenly those later terms become important even at low speeds, and you’ll find that moving as fast as 0.01mph would require something like a rocket or a nuclear-powered car. But that’s boring, so let’s pretend that it isn’t the case. No long range communication: 100mph is about 45m/s, so having a conversation with someone who isn’t close at hand will result in really annoying delays. It would be like those satellite interviews, only in person. To send a message to someone on the other side of the world would take at least 5 days and 4 hours at the speed of light. I’m ignoring the effects, by the way, of the Earth rotating at about 1,000 mph (at the equator). Leave your watch at home: The act of walking around would cause you to lose about half a second for every mile you walk, which isn’t to bad. But if you started moving around in a car at highway speeds (65 mph), then you could expect to lose about 17 seconds for every mile you travel. “Super Speed”: One of the slick things about traveling at relativistic speeds is that, although you can only pass things at up to 100mph, you can actually cover more distance than the 100mph speed limit might imply. There are two ways to look at this. From your point of view the world around you undergoes length-contraction. So, for example, at about 87mph you would see the world contracted by a factor of 2. So while you’d see things pass by at 87mph, you’d be eating up distance as though you were traveling at 174mph (2 x 87mph). From everyone else’s point of view, you’re traveling through time slower. At 87mph they’d see your watch ticking at half the usual rate, so the trip will only take half the time it should. Pretty colors: Even at running speed there would be enough relativistic doppler shift to change the colors around you. If you were driving past a yellow field of grain, it would appear blue in front of you and fade to deep red as it passed behind you. There are just a hell of a lot of other effects, so if you’re wondering about any of them, just ask in the comments.
<urn:uuid:f0ba03cb-133f-4826-88f1-d76591c6f697>
3.421875
758
Q&A Forum
Science & Tech.
68.406352
Advocacy for Animals School & Library Products Toys & Games Types of insect wing venation. Credit: From (top left) J. Comstock, The Wings of Insects , Comstock Publishing Co.; (top right) An Introduction to the Study of Insects , 3rd ed. by Donald J. Borror and Dwight M. DeLong, copyright © 1964, 1971 by Holt, Rinehart and Winston, Inc., copyright 1954 by Donald J. Borror and Dwight M. DeLong, reproduced by permission of Holt, Rinehart and Winston, Inc.; (bottom right) J. Comstock, An Introduction to Entomology (1966), Comstock Publishing Co. More Image Galleries Browse all Image Galleries The Solar System The Human Body Share this page with your friends, associates, or readers by linking to it from your web site or social networking page. (Please limit to 900 characters)
<urn:uuid:9db19a4f-fdb7-4482-95d8-2cedd9fc6a68>
2.8125
204
Truncated
Science & Tech.
61.384107
By: Tom Muck on Thursday, April 23, 2009 In the last article in this series I talked about calculations on a web page. There are two ways that this can be done—in your scripting language on the web page (PHP, ColdFusion, C#, or other languages) or in the SQL statement that retrieves the results from the database. For displaying data, it is almost always a better idea to create the calculations in your SQL statement, to keep the business logic out of the web page and take advantage of the data processing speed in the database. This second, and last, part will show a few simple examples of doing calculations directly in INSERT and UPDATE statements, and when not to use the technique. The article is intended as a basic introduction to doing calculations in SQL and to get the reader thinking about alternative ways of doing things. The Doing Calculations with SQL Series: Doing Calculations with SQL - Part 1 Doing Calculations with SQL - Part 2 Purchase this item You can purchase this piece of content separately for $4.00 Community MX members get unlimited access to daily articles, tutorials, extensions and support. The most comprehensive resource for Macromedia designers and developers today. Take a tour of what we offer, and discover the benefits of subscribing. Already a member? Simply log in using the form in the top right area of the site.
<urn:uuid:e70cf587-7bd1-4f0e-80e0-d9ecd55ca8d9>
2.859375
290
Truncated
Software Dev.
48.581643
he Java 2 Platform, Micro Edition (J2ME) is targeted at cell phones, smart cards, pagers, and other consumer devices. J2ME technology consists of a virtual machine and a set of APIs suitable for tailored runtime environments for these devices. PHP, on the other hand, is a widely used server-based language to build Web applications. But these two radically different technologies work very well together. In this article you'll see how they can interact via HTTP (Hyper Text Transfer Protocol). Of course, this is not intended to be a thorough explanation of how HTTP worksyou only need to know that HTTP is a request/response protocol. That simply means that the client application performs a request and the server application returns a response. illustrates a typical HTTP-based Client/Server communication. In this case, the client requests the latest news to a Server sending it the type of news wanted. The Server simply responds to the Client sending it the news requested. You understand then, that as long as client and server "speak" the same protocol they can communicate without problems. HTTP is the ad hoc protocol for our purposes. In fact, HTTP doesn't specify which entity is supposed to be either the client or the server. The client can be a Web browser, a mobile device, or anything else, provided that the applications on both ends can communicate through HTTP. For example, suppose you write something like this in PHP: |Figure 1. Client/Server Communication: The figure illustrates the process by which a client requests and receives news from a server.| echo "Hello World"; The result depends on the client performing the request. If the client is a Web browser then it will display the string "Hello World." If the client is a mobile phone it will just receive the string "Hello World" as a stream of bytes from the server. The point is that it's not hard to get a mobile device, running J2ME to communicate with a server running PHP as long as both use the HTTP protocol. A Sample Project As I'm sure many of you developers out there are, I'm fed up with parsing RSS feeds to get information and links. RSS feeds are nothing more than XML files with a particular structure. They are used mainly to represent a set of items published on a Web site. Here's an RSS feed excerpt: <title>The title of the first article</title> <description>The description of the first article</description> <link>The link to the full article</link> <title>The title of the second article</title> Each item has title elements as well as link elements that point to the full article online (and other elements that are of no interest for this project). In this article I'll show you how to design and implement an application for mobile devices that retrieves the latest news from some Web sites that offer RSS feeds as a service. The application will fetch the title and the corresponding description of each article of the RSS feed. The following images serve to clarify the intent and overall functionality of the application. |Figure 2. Available Channels: The first screen lists the available news channels.| |Figure 3. News Item Titles: After selecting a channel, you'll see a list of titles for the type of news chosen.| |Figure 4. Article Description: After selecting a title from the list, you'll see the complete description of the selected article.| I won't discuss the server side of the application in detail because it just parses the RSS feedyou can find numerous tutorials and articles that explain that process, and both the server PHP code and the client J2ME code are included in the sample code that accompanies this article. The only thing that matters for this article is that the server-side PHP script fetches the titles and the descriptions from the news Web sites (www.nytimes.com and www.bbc.co.uk), and returns them in this fashion: <t>The title of the first article</t> <d>The description of the first article</d> <t>The title of the second article</t> <d>The description of the second article</d> There are two main reasons for "shrinking" the news feeds this way. First, reducing the number of bytes downloaded from the Web server decreases download costs for clients who pay by byte volume for their mobile devices (which is often the case). Second, the less data you download, the faster the application will be. Of course, the client side is responsible for restoring the information in a convenient fashion.
<urn:uuid:e1b0199f-192d-496b-a854-bbb7fdf753ee>
3.140625
962
Truncated
Software Dev.
56.746395
Photography with cameras Nikon D3x, Nikon D300, Canon 50D Image editing with Photoshop |Seite 1 von 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 | |Sheep bot fly| |The sheep bot fly (Oestrus ovis) belongs to the genus Oestrus in the order Diptera and is the most common member of the subfamily Oestrinae, in the family of bot flies (Oestridae). The sheep bot fly originally came from the Palearctic eco-zone but is now found throughout the world. The sheep bot fly reaches body lengths of 10-12 mm. The thorax is covered with thick golden fur. The abdomen is whitish-grey with black markings. The sheep bot fly has a broad head with large, reddish to brown compound eyes. The mouth tools are degenerate and allow only a small quantity of food to be ingested. The large, strong wings are brownish in colour. The legs are dark, hairy, and strong. The sheep b...| ...s a broad head with large, reddish to brown compound eyes. The mouth tools are degenerate and allow only a small quantity of food to be ingested. The large, strong wings are brownish in colour. The legs are dark, hairy, and strong. The sheep bot fly is active in summer. The females lay their eggs in the nostrils or eyes of sheep. The larvae hatch from their eggs inside the females and are shot into the host animals in drops of liquid. The host animals resist this. The laying of the ... ... symptoms such as sneezing and inflammatory discharge. The larvae are up to 30 mm in length. After the last larval stage, the larvae are sneezed or coughed out by the host animals and fall down to the soil in which they pupate. The sheep bot fly occasionally lays its larvae in humans, especially in the eyes. |Grey flesh fly| |The grey flesh fly (Sarcophaga carnaria) is also known as the "camouflaged flesh fly" or "carrion fly". The scientific name is more accurately Sarcophaga (Sarcophaga) carnaria. This species is in the order two-winged flies (Diptera), the suborder flies (Brachycera), the infraorder Muscomorpha (section Schizophora, subsection calyptrata), the su...| ...ion calyptrata), the superfamily Oestroidea, the family flesh flies (Sarcophagidae), the subfamily Sarcophaginae, the genus Sarcophaga, and the subgenus Sarcophaga (Sarcophaga). A scientific synonym for this species is Musca carnaria. The grey flesh fly is found in the Palaearctic ecozone from the Arctic Circle to North Africa and from Western Europe to East Asia, and occurs very frequently. |The Taurus fly (Cyrtus gibbus) belongs to the order (Diptera), the suborder Brachycera , intraorder Asilomorpha, Nemestrinoidea and to the family Acroceridae. It belongs to the genus Cyrtus. The Taurus fly can be found throughout southern Europe, but is rare. It is medium-sized, compact and almost spherical in shape. It is mostly yellow in colour and has black spots and ligatures. It is covered in fine hairs. The head is spherical and black an...| ...halteres are covered. The abdomen is yellow and with black spots on the top as also with three black bandages , which to the rear end are wedge-shaped and extended. The legs are long , thin and from reddish-yellow to yellow in colour. The Taurus fly feeds on the nectar of the various plant species whose blossoms she visits. The female lays her eggs on branches of trees or on blades of grass. The number of eggs (located singly or in or in small clusters) can amount to more than 1000. |Bluebottle blow fly| |The bluebottle blow fly (Cynomya mortuorum), also known as the fly of the dead, blue bottle or green bottle, belongs to the family of blowflies (Calliphoridae) in the order two-winged flies (Diptera), the suborder flies (Brachycera), the infraorder Muscomorpha (section: Schizophora; subsection: Calyptrata) and the ...| ... and the superfamily Oestroidea. It belongs to the genus Cynomya in the subfamily Calliphorinae and the tribe Calliphorini. Scientific synonyms for Cynomya mortuorum are: Cynomya hirta, Musca mortuorum and Cynomya gregorpovolnyi. The bluebottle blow fly is widespread in Europe and Asia up to the Arctic Circle and prefers colder regions. This species is not regarded as endangered. |Common yellow dung fly| |The common yellow dung fly (Scathophaga stercoraria), also called the golden dung fly, belongs to the family dung flies (Scathophagidae) and the genus Scathophaga. This species is common and widespread throughout Europe, North America and Asia. |... a family of flies in the order Diptera and are encountered throughout the world. There are approximately 2000 species worldwide, 178 of which can be found in Central Europe. Some examples of frit flies are: Lipara lucens , Oscinella frit , gout fly (Chlorops pumilionis), yellow swarming fly (haumatomyia notata) and Meromyza saltatrix. Frit flies reach body lengths of 2-7 mm. Their bodies can be yellow, orange, brown, dark brown or black in colour, depending on which species they are. They have strong mouth parts, but their front w...| Frit flies reach body lengths of 2-7 mm. Their bodies can be yellow, orange, brown, dark brown or black in colour, depending on which species they are. They have strong mouth parts, but their front wings and halteres are often weak. They do not fly, but use their strong, well-developed, hairy legs to move. Frit flies are mainly active in autumn and can often be found in large numbers on lawns. Frit flies also often enter human dwellings, en masse where they are perceived as an annoyance.... |The yellow swarming fly reaches body lengths of up to 2 mm. Its body is yellow with black markings. Its head is very broad and there is a round black spot on a yellow background between its compound eyes. The spot is located in a wedge-shaped strip of dark hair, which ta...| ...are 3 wide, black stripes lengthwise. The stripe in the middle reaches from the neck to the scutellum. The outer stripes are shorter. Beside each outer stripe is one more black stripe which is much thinner and only half as long. The yellow swarming flyís wings are transparent and extend far beyond the end of its abdomen in resting position. The wings are well developed, unlike those of other frit fly species. The halteres are white. The scutellum is yellow and has no markings. On the upper surface of the abdomen, which is yellow, are 4 black crossways. The legs are a weak brownish-yellow colour. |Green long-legged fly| |The green long-legged fly (Poecilobothrus nobilitatus) belongs to the order Diptera, the family long-legged flies (Dolichopodidae) and to the genus Poecilobothrus. This species is commonly found throughout the world especially in Europe. The green long-legged fly reaches body lengths of 2-8 mm. The males are larger than the females. The bodies of the flies are brightly coloured and have a metallic sheen. Their large compound eyes have a red and greenish shimmer.| |... approximately 100 species found worldwide, 11 of which are encountered in Central Europe. The family of Bot flies is divided into three subfamilies: Oestrinae, Cephenemyiinae and Hypodermatinae. Some examples of species of Bot flies are: sheep bot fly (Oestrus ovis), Gasterophilus intestinalis, Hypoderma diana, Rhinoestrus purpureus, Hypoderma Acteon, Crivellia Silenus, the warble fly (Hypoderma bovis), Hypoderma lineatum and Pharyngomyia picta. Bot flies reach body lengths of 10-13 mm. They are covered in thick furry hair. The mouth parts of this fly are often highly degenerated, thus many species do not eat solid food. Some species, however, take in fluid. The well developed, large wings have a central vein spreading out in different angle. The thorax is covered with scales and has a number o...| |Common cluster fly| |The common cluster fly (Pollenia Rudis), also known simply as the cluster fly, belongs to the order (Diptera), suborder Brachycera, infraorder Muscomorpha (Sub-Department: Calyptratae) the superfamily Oestroidea and to the family blowflies (Calliphoridae). It is of the subfamily Polleniinae and the genus Pollenia. This spec...| |green bot fly (5)| |yellow legged fly (2)| |fly species with green eyes (2)| |small blue flies (2)| |the scentific name of a brown fly of order diptera (2)| |green bottle fly eyes (1)| |flies with green eyes (1)|
<urn:uuid:ac04a7c1-97aa-4dae-96b3-112bb0d63626>
2.8125
2,088
Structured Data
Science & Tech.
60.019976
Functions and Graphs By M Bourne In the real world, it's very common that one quantity depends on another quantity. For example, if you work in a fast food outlet, your pay packet depends on the number of hours you work. Or, the amount of concrete you need to order when constructing a building will depend on the height of the building. The cartesian plane This chapter is about functions (this is how we express relationships between quantities) and their graphs. The graph of a function is really useful if we are trying to model a real-world problem. ("Modeling" is the process of finding the relationships between quantities.) Sometimes we may not know an expression for a function but we do know some values (maybe from an experiment). The graph can give us a good idea of what function may be applied to the situation to solve the problem. In this Chapter 1. Introduction to Functions - definition of a function, function notation and examples 2. Functions from Verbal Statements - turning word problems into functions Graphs of Functions 3. Rectangular Coordinates - the system we use to graph our functions 4. The Graph of a Function - examples and an application Domain and Range of a Function - the `x`- and `y`-values that a function can take 5. Graphing Using a Computer Algebra System - some thoughts on using computers to graph functions 6. Graphs of Functions Defined by Tables of Data - often we don't have an algebraic expression for a function, just tables 7. Continuous and Discontinuous Functions - the difference becomes important in later mathematics 8. Split Functions - these have different expressions for different values of the independent variable 9. Even and Odd Functions - these are useful in more advanced mathematics Let's now learn about definition of a function and function notation. Didn't find what you are looking for on this page? Try search: Online Algebra Solver This algebra solver can solve a wide range of math problems. (Please be patient while it loads.) Go to: Online algebra solver Ready for a break? Play a math game. (Well, not really a math game, but each game was made using math...) The IntMath Newsletter Sign up for the free IntMath Newsletter. Get math study tips, information, news and updates each fortnight. Join thousands of satisfied students, teachers and parents! Short URL for this Page Save typing! You can use this URL to reach this page: Math Lessons on DVD Easy to understand math lessons on DVD. See samples before you commit. More info: Math videos
<urn:uuid:c0da4b66-41db-4c41-83a8-73feab0002d7>
4.25
554
Truncated
Science & Tech.
59.6707
Last week, we started working with a fundamental aspect of database structure -- database keys. This week, we'll take a look at how keys are used to construct relationships between different tables in a database. This is the core function of relational databases. You may have a rocky relationship with your database, but after this week, your data should relate just fine! Your first relationship There is nothing magical, complex, or inherently hard about data relationships. In a nutshell, the most simple database relationship is formed by taking the key field value of a record in one table and inserting it into an identical field in the related record in a second table. We'll work through an example from the beginning. In this scenario, you're building a database for your music collection. You may have started with a single database table that looks something like this: You've got a single table with a primary-key value called CDID that contains information about a single CD in your collection. But if you have an extensive collection of Peter Gabriel albums, you'd end up with a lot of redundancy in your database. Also in aboutSQL: You can imagine the progression from here, especially for a large database of music like an e-commerce site. This brings us to our first SQL Wisdom in a long time: SQL Wisdom #5: Data redundancy is generally a result of bad design. Any time you have to re-enter data, you're likely to enter it incorrectly. In addition, redundant data takes up extra space in the database. There are cases where this is a good idea, typically for specific performance reasons; but in general, you can assume that you need to redesign your database if you see a lot of redundant data. And that's the whole essence of relational databases. Relationships are all about reducing database redundancy. We can take the record for Peter Gabriel and break it into a separate table. Now that we have the information about the artist separated from the album information, we can redesign the table of information for the CDs themselves. I've highlighted the column where the ArtistName string was replaced with a primary key from the table containing the related data record. In database parlance, this is typically called a foreign key. The two database tables are now related by the ArtistID key field. The database relationship we created in the previous section is simple, but it is an example of the most common type of database relationship. There are three standard types of database relationships: - One-to-one relationships link a single record in one table to 0 or 1 records in a related table. - One-to-many relationships link a single record in one table to 0, 1, or more records in a related table. - Many-to-many relationships link multiple records in one table to 0, 1, or more records in another table through an intermediate linking table. The example shows a one-to-many relationship -- the most common type of database relationship. The Artist table contains a single "Peter Gabriel" record which can have 0, 1, or more related records in the CDs table. Before we move on to the details of different types of relationships, I want to point out a few features of all relationships: - Any fixed-size field can be used as a key to join fields, but try to use the smallest integer types or a short character string. - Numbers are always better than text. - Any single field can be used as a key in n other tables. - Fields that are used for relationships should typically be indexed for performance. There are many other details to discuss -- referential integrity, cascaded NULLs figure into relationships, and a host of other topics that we'll discuss as we move forward with aboutSQL. Now that we've got the basics of keys and relationships, we'll spend next week discussing one-to-one and many-to-many relationships. After that, we'll move back to SQL proper and cover using the JOIN keyword to create SQL statements that use database relationships. Until then, feel free to send me your comments, questions, and feedback. Read more aboutSQL columns. Return to ONLamp.com.
<urn:uuid:773b0562-8049-4d43-917a-e2ad061d82c9>
3.453125
874
Documentation
Software Dev.
43.816558
Limits of Sequences, Lim We already know what are arithmetic and geometric progression - a sequences of values. Let us take the sequence an = 1/n, if k and m are natural numbers then for every k < m is true ak > am, so as big as it gets n as smaller is becoming an and it's always positive, but it never reaches null. In this case we say that 0 is the lim an->∞ if n->∞, or the other way to write it down limn->∞ an = 0. The number a is called limit of a sequence, if for every ε > 0 it can be found a number nε, so that for all the members of the sequence an with index n > nε is true that a - ε < an < a + ε. A sequence not always has limit, and sometimes has unreal limit( -∞ or +∞ ). The limits +∞ and -∞ are called unreal limits. If the sequences an and bn both have real limits then, an + bn, an - bn, an.bn and an / bn also have real limit and: limn -> ∞(an - bn) = limn -> ∞an - limn -> ∞bn limn -> ∞(an . bn) = limn -> ∞an . limn -> ∞bn limn -> ∞(an/ bn) = limn -> ∞an / limn -> ∞bn if bn ≠ 0 and limn->∞bn ≠ 0 If an < bn for every natural n and limn->∞an = a, limn->∞bn = b then a ≤ b If an ≤ bn ≤ cn or every real n and if limn->∞an = limn->∞cn = A then limn->∞bn = A. If an ≥ 0 and limn->∞an = a, then the sequence bn = √an also has a limit and limn->∞√an = √an. If an = 1/nk and k ≥ 1 then limn->∞an = 0. (1+1/n)n < e < (1 + 1/n)n-1 e is the number of Neper. If sequence an has a unreal limit( -∞ or +∞ ) then the sequence 1/an has a limit and limn->∞1/an = 0 If sequences an and bn have unreal limits and limn->∞an=+∞, limn->∞bn=+∞ then: limn->∞(an . bn) = +∞ limn->∞ank = +∞ if k > 0 limn->∞ank = 0; if k < 0 limn->∞-an = -∞ If an = 5.4n, limn->0an = ? limn->0an = limn->05 . limn->04n = 5 . 40 = 5.1 = 5 |If an =|| |then limn->∞an = ?| |If liman->1 =|| More about lim in the maths forum
<urn:uuid:5746a7fb-537d-4f90-a824-f650f5a4a907>
3.640625
725
Knowledge Article
Science & Tech.
99.420957
They say that in the 1970s, climate scientists claimed that we were headed for a mini ice-age. They then point out that this never happened, and so question the strength of current predictions that the globe will be between 2 and 5 °C warmer by 2100. Fair enough. But was there ever a consensus over global cooling in the 1970s? A few climate scientists have now scanned through the research literature of the time. For 1965 to 1979, they found seven articles that predicted cooling, 44 that predicted warming and 20 that were neutral. The results are being published in the Bulletin of the American Meteorological Society. You can also read summaries on RealClimate and on ScienceNews, though if you're interested in how the myth of global cooling was turned on its head, it is well worth reading the researchers' own version, which is freely available (as a PDF). In other words, it appears there was not a scientific consensus over global cooling. So what created the fuss? Possibly a careful selection of news items by certain politicians. According to the version of the study currently available online: When the myth of the 1970s global cooling scare arises in contemporary discussion over climate change, it is most often in the form of citations not to the scientific literature, but to news media coverage. That is where US Senator James Inhofe turned for much of the evidence to support his argument in a Senate floor speech in 2003 (Inhofe 2003). Chief among his evidence was a frequently cited Newsweek story: "The Cooling World" (Gwynne 1975).Or possibly, as Andrew Revkin of the New York Times suggests, "the tyranny of the news peg". News reporters have to hang their stories on a recent events, and in the 1970s the cold weather was a convenient peg. Numerous studies have since shown that the cooling trend was the result of fine aerosol pollution, which reflected solar radiation back out into space (also known as "global dimming"). Clean air policies in the 90s in Europe, the US and the former Soviet Union resolved the problem - although it is again rearing its ugly head in China, India and other emerging economies. Catherine Brahic, environment reporter
<urn:uuid:d8321eeb-0f64-4e8c-8fd1-138321bb3429>
2.71875
452
Nonfiction Writing
Science & Tech.
49.095315
Global warming poses one of the world's most serious and potentially devastating environmental threats. But the changing climate doesn't just threaten the world, it threatens our world, right here in the Bay Area. Development has cost us much of our wetlands; climate change could claim more. It could flood our coastline, and make high-tide levels seen only every 100 years in the bay occur 10 times as often. Warmer waters could eliminate cold-water fish from our streams, expanded wildfires could rob us of our signature oaks, and higher temperatures could make the Central Valley's agricultural lands even thirstier for water from the Bay-Delta. The Bay Area's specific contribution to the problem is difficult to quantify precisely. But gasoline consumption, vehicle use, and household electricity consumption have been increasing in our region. And with electric power plants and motor vehicles the main sources of greenhouse gases, the trends, until recently, were going in the wrong direction. The good news is that the Bay Area joined the rest of California in reducing electricity use significantly in the first half of 2001. NRDC researchers examined the two chief causes of global-warming pollution in the United States: vehicle use and electricity consumption. According to California Department of Transportation data, vehicle miles traveled in the nine Bay Area counties increased more than 20 percent between 1990 and 2000. In addition, California Energy Commission data for 1992 and 1997 indicate that annual residential electricity use in the Bay Area increased by 9.5 percent, an average of about 1.6 percentage points each year. Neither increase is accounted for by population growth alone -- electricity consumption increased for each household, and the rate of increase in vehicle miles driven far outpaces population (Bay Area population grew 12.6 percent over the last decade). But population increases have, and will continue to have, a multiplying effect. There is good news, however: significant reductions in electricity use occurred in the Bay Area between January and June 2001, in response to the state's energy crisis. In June alone, almost 30 percent of households served by PG&E cut their consumption by at least 20 percent, compared with June 2000, and statewide consumption dropped by 8 percent.
<urn:uuid:57bf98eb-08d1-4062-a41c-1271aace19f3>
3.421875
435
Knowledge Article
Science & Tech.
37.003705
The following resources are intended to assist in learing basic physics principles. Additional resources for physics students are available at The Physics Classroom Tutorial and the Multimedia Physics Studios. A multitude of problems (37) involving the analysis and interpretation of position-time and velocity-time graphs. Each problem is accompanied by an answer and an explanation, both of which are hidden in a pull-down text field. Seven physical situations are described and students are requested to recognize the presence or absence of a variety of forces based on the given descriptions. Consists of 11 different problems involving the identification of the magnitude and direction of a vector from a scaled vector diagram. Answers are given. Consists of 12 problems involving the head-to-tail addition of two vectors. Students are to use an accurately drawn scaled vector diagram to determine the resultant. Answers (with diagrams) are given.
<urn:uuid:f19eb735-93c9-4ab2-a2e2-f57f2c86e5dc>
4.09375
177
Content Listing
Science & Tech.
30.044081
An iframe is used to display a web page within a web page. Syntax for adding an iframe: The URL points to the location of the separate page. The height and width attributes are used to specify the height and width of the iframe. The attribute values are specified in pixels by default, but they can also be in percent (like "80%"). The frameborder attribute specifies whether or not to display a border around the iframe. Set the attribute value to "0" to remove the border: An iframe can be used as the target frame for a link. The target attribute of a link must refer to the name attribute of the iframe: |<iframe>||Defines an inline frame| Your message has been sent to W3Schools.
<urn:uuid:3e19d67c-7120-41b8-900f-741d9fe49e48>
2.90625
168
Documentation
Software Dev.
48.6124
Humans for eons assumed that whales and dolphins chirped, clicked, or sang to communicate with each other until they discovered, quite recently, that there were other means being used. As anyone underwater when a stone strikes an object will attest, sound traveling underwater is magnified beyond the affect above the surface. Of course, this is simply the mass of water moving, rather than the mass of air moving, and water is heavier, affecting the ear drum with greater force. Thus, when utilizing sound waves setting water in motion, whales and dolphins chirp or sing little notes, but never shout. But communication has been observed between members of a family many miles apart, even an ocean apart, and the means of communication is little understood. Man, who uses ricocheting radio waves as a form of communication, understands that as long as the sender and receiver are using the same code, any directed wave can be used as a communication tool, be it water waves or otherwise. Just as humans hundreds of miles from each other can be in telepathic communication by sharing the same brain wave frequencies in similar patterns, whales and dolphins as species with common biological backgrounds speak to each other in this way. They are suspected of having even greater communication talents by the military, which in their envy has studied them. Being biological creatures, whales and dolphins can only produce as a means of communication that which the corporeal body will support! Human beings clap their hands, wave, vibrate their vocal cords in recognizable patterns, and throw rocks. Whales and dolphins slap their tails on the ocean surface, chirp and sing, and swim in patterns that carry meaning to the others. Humans send telepathic signals that other humans attuned to them can and on occasion do receive. Whales and dolphins, not having an opposable digit that allows them to experiment with various means of communication, worked more intensely with what they had. Their telepathy for one another is operant, not only sent but listened to by the others. They not only speak soundlessly, they are heard. However, their songs, carried mile after mile through the water, does not lose its intensity as would a song in the atmosphere. Water in the ocean does not blow about as does air, as being more dense it sends pressure forward in the form of a wave, and from one side of an ocean to another this sound can carry. For a lost member of a family, hearing the song heard when young is a call to rejoin the family. Thus what humans are observing is not only the whale or dolphin's ability to receive what appears to be soundless communications, but strong hearts that act on these communications. They love one another.
<urn:uuid:a8c17875-ec99-4ace-af79-bcde7ade5a3e>
3.578125
548
Nonfiction Writing
Science & Tech.
40.815072
Some 40 million people depend on the Colorado River Basin for water but warmer weather from rising greenhouse gas levels and a growing population may signal water shortages ahead. The Earth Institute provides executive training in environmental sustainability through science, policy, and economics; we invite you to learn from our leading experts and practitioners to become an effective environmental leader and decision-maker. The Center for Environmental Research and Conservation has grown into two institutions—and now it has a new name: the Earth Institute Center for Environmental Sustainability. In the spectacular collapse of ice sheets as the last ice age ended about 18,000 years ago scientists hope to find clues for what regions may grow drier from human caused global warming. In a talk Thursday at the American Geophysical Union’s annual meeting, Aaron Putnam, a postdoctoral scholar at Lamont-Doherty Earth Observatory, painted a picture of earth’s dramatic transformation as seen in climate records extracted from ancient cave formations, ice cores, lake shorelines and glacial moraines. In a live webcast this afternoon from Hunter College, Earth Institute scientists Cynthia Rosenzweig and Klaus Jacob will join a panel on “Hurricane Sandy and Challenges to the NY Metropolitan Region.” The Earth Institute’s Professional Development Program in Environmental Sustainability provides three graduate credits in human ecology coupled with curriculum development for the secondary school classroom. The Program is designed to support educators in increasing their understanding of the inquiry process and environmental sustainability in the urban context that is New York City; and, then integrate their new knowledge with STEM and literacy, inclusive of skills acquisition. During Hurricane Sandy the seas rose a record 14-feet in lower Manhattan. Water flooded city streets, subways, tunnels and even sewage treatment plants. It is unclear how much sewage may have been released as plants lost power or were forced to divert untreated wastewater into the Hudson River. Four days after Sandy, the environmental group [...] “Everything is so alive in the forest. After a nice summer rain it teems with insects, birds and the famous coquis, Puerto Rico’s native frogs. The song of the coquis take a little getting used to, but they soon lull you to sleep in the humid nights,” says Jennifer Mendez, a student in the first class of the Summer Ecosystem Experience for Undergraduates in Puerto Rico. The Center for Environmental Research and Conservation provides executive training in environmental sustainability through science, policy, and economics; we invite you to learn from our leading experts and practitioners to become an effective environmental leader and decision-maker. Summer temperatures on the archipelago of Svalbard, 400 miles north of Norway, are now higher than at any other period in the last 1,800 years, according to a new study in the journal Geology.
<urn:uuid:4fd7c64b-bfa6-48c1-bc5b-c8bd6705042a>
3.140625
574
Content Listing
Science & Tech.
21.599356
Specifying the stroke and fill properties Use the Stroke tab on the Inspector to define the stroke properties for vector shape and text objects. The stroke refers to the outline of an object; the fill refers to the interior of an object. You can choose to define a color for the stroke, or display no outline for an object by choosing a stroke value of None. If you define a color, you can additionally define the stroke width and several other stroke attributes. You can choose to fill an object with either a color or a pattern, or define a fill value of None. You can animate the stroke color, stroke width, and fill color properties.
<urn:uuid:4a389703-68cc-495d-85c8-3aaaf89a2ec5>
3.1875
134
Documentation
Software Dev.
48.642701
ANSI Common Lisp 12 Numbers 12.2 Dictionary of Numbers - Arguments and Values: integer-1 - an integer. integer-2 - an integer. generalized-boolean - a generalized boolean. Returns true if any of the bits designated by the 1's in integer-1 is 1 in integer-2; otherwise it is false. integer-1 and integer-2 are treated as if they were binary. Negative integer-1 and integer-2 are treated as if they were represented in two's-complement binary. (logtest 1 7) true (logtest 1 2) false (logtest -2 -1) true (logtest 0 -1) false - Exceptional Situations: Should signal an error of type type-error if integer-1 is not an integer. Should signal an error of type type-error if integer-2 is not an integer. (logtest x y) ==(not (zerop (logand x y))) - Allegro CL Implementation Details:
<urn:uuid:23377d79-aa5f-45af-9acb-1b7ea3f92a99>
3.21875
227
Documentation
Software Dev.
59.311825
From CNN.com today: Oil from the Deepwater Horizon spill may have settled to the bottom of the Gulf of Mexico further east than previously suspected and at levels toxic to marine life, researchers reported Monday. Initial findings from a new survey of the Gulf conclude that dispersants may have sent the oil to the ocean floor, where it has turned up at the bottom of an undersea canyon within 40 miles of the Florida Panhandle. Plankton and other organisms showed a "strong toxic response" to the crude, according to researchers from the University of South Florida. "The dispersant is moving the oil down out of the surface and into the deeper waters, where it can affect phytoplankton and other marine life," said John Paul, a marine microbiologist at USF. Nancy Rome is a documentarian and writer based in Baltimore. She sent us this thoughtful guest post. The question on everyone's mind right now and for the foreseeable future is: Where has the oil gone? Much of the scientific community scoffs at the White House’s claim last week that 75% of the oil has been cleaned up, even going so far as to call the claim ludicrous, because tracking the spill is so difficult. To say how much has really been cleaned up is nearly impossible, and oil continues to wash up "under" beaches and marshes on barrier islands and will continue to do so for some time. If we still do not know exactly how much oil actually gushed from the Deepwater Horizon, then how can we know the exact amount that has been cleaned up? Well, BP’s “static kill” seems to have finally plugged the leak in the Gulf of Mexico, more than 3 months after it began spewing oil into the ocean. (Though the final nail in the coffin won’t come until the “bottom kill” succeeds.) And despite the optimistic reports today, the amount of oil remaining in the gulf is still equivalent to at least four times the amount that spilled in the Exxon Valdez disaster, and possibly double that. NOAA predicts that 26% of the oil is “residual” or still residing in the gulf and that another 24% was “dispersed” but much of that may still be hanging around waiting for mother nature (a.k.a. bacteria) to break it down. Further, NOAA says some of the oil is “dissolved” which doesn’t mean the same thing as “disappeared.” So more than half of the oil could still be dwelling in the Gulf – maybe as much as 8 Exxon Valdez spills’ worth. And there are still many, many unanswered questions. Oceana campaign director Jackie Savitz discussed the dangers of dispersants on CNN’s “The Situation Room” last night, check it out: And tomorrow she will testify before the full Senate Environment & Public Works Committee about the known effects of dispersants. Savitz will offer her perspective on use of Corexit, and will argue that dispersant use is “the lesser of two evils.” Warning: what follows isn’t exactly light reading. The New York Times reported yesterday on the complicated task of performing necropsies -- i.e., animal autopsies -- on sea turtles and other creatures that have been found dead in the Gulf of Mexico since the spill started. It’s not easy to determine the cause of death of these creatures. Of the 1,978 birds, 463 turtles and 59 marine mammals found dead in the Gulf since April 20th, few show visible signs of oil contamination. And in the case of sea turtles, a more familiar culprit may be at fault: shrimp trawls and other commercial fishing gear that scoop up turtles as bycatch and prevent them from going to the surface to breathe. Here’s a simplified breakdown of how the veterinary investigators begin to determine the cause of death: Sea turtles can become coated in oil or inhale volatile chemicals when they surface to breathe, swallow oil or contaminated prey, and swim through oil or come in contact with it on nesting beaches. As of yesterday, 32 oiled sea turtles have been found in the Gulf of Mexico and more than 320 sea turtles have been found dead or injured since the spill began April 20. While some dead and injured sea turtles are found by search crews or wash up on the beach, some never will. Ocean currents often carry them out to sea where they can sink or be eaten by predators. Our report shows that the ongoing oil spill can have the following impacts on sea turtles: The most familiar victims of the oil spill are the ones with faces: birds, sea turtles, dolphins, whales. But as the New York Times reports today, there are at least three extensive deep-sea coral reefs lying directly beneath the oil slick in the gulf. And coral reefs can’t swim or fly away from the plumes of partly dispersed oil spreading in the deep sea. Both oil and dispersants are toxic to corals and have been found to impede the ability of corals to grow and reproduce, and the effects are amplified when they are mixed, which may be the case with these plumes. It’s unknown exactly how sensitive deep-sea corals are to oil and dispersants, though as Oceana’s Pacific science director Jeffrey Short told the Times, “It might be locally catastrophic, particularly if there’s an oxygen-depleted mass that develops.” There is no truly effective way of cleaning up an oil spill. All the options available are not fully effective or have negative impacts. Burning the Slick Unfortunately, burning the oil is a no-win situation; it creates large, toxic plumes of smoke that can result in respiratory problems and eye, nose, throat and skin irritations in both wildlife and humans. Birds may also become disoriented in the smoke. Burning may be the lesser of two evils as it removes large amounts of oil that can result in immediate and long-term impacts to wildlife in the area, including skin irritations, organ damage, reproductive failures, developmental abnormalities and death. One plan involves building up almost 70 miles of barrier islands by dredging sand and mud, including some from the bottom of the Mississippi River, and depositing it onto the outer shores of the islands, a process that would normally require years of environmental assessment. Sediments from the river are likely to be contaminated with a host of other chemicals, like mercury, which could add insult to injury in the already badly contaminated Gulf waters. Some of these islands are home to bird and wildlife sanctuaries, including the Breton National Wildlife Refuge. The plan may not work because the barrier islands have shrunk significantly, in part as a result of human engineering that has altered the flow of Mississippi for a variety of reasons -- including in efforts to facilitate oil and gas production.
<urn:uuid:23085d64-f92e-48a7-b489-93486e9f9f00>
2.75
1,510
Personal Blog
Science & Tech.
49.626683
To deduce this, You have to specify the kind of decay and the nature of the "compund" is it a crystal, a small molecule in gas phase, a organic material? Beta decay shifts the nucleus one position upward in PSE, thus any "compound" will be transformed into a cation by loss of an electron, and whre say a iodide Ion had been, there will be an Xe atom. (which will not "fit" chemically of course) There will be some recoil in this process, which can cause the nucleus to leave its place. The electron will ionize everything along its path, those products of ionisation can alter/ destroy the molecule (compound) where the electron was emitted. Similar is the case of alpha, with a strong recoil and severly ionisation. The decaying nucleus is shifted two "down" in PSE. The alpha particle will stay in the crystal, if it is big enough. Think of Helium gassing out of Pechblende when heated. For Gamma, recoil will be less, ionisation is distributed along a long path There are special cases in crystals, when the recoil is taken not by the emitting nucleus alone, but collectively ba the crystal lattice. (Mößbauer effect) In general, radioactive decay is so energetic, that any chemical bonds/lattice forces are broken. What happens then is very complicated and not to be answered by a simple scheme.
<urn:uuid:93a365c2-ce82-44d8-abe9-03c6a52f63ac>
3.296875
319
Q&A Forum
Science & Tech.
45.01332
MORE SNAKES AROUND US THAN WE THINK? I write about snakes each spring when they emerge from hibernation. This year, I asked J. D. Willson, a University of Georgia doctoral student who studies snake ecology at the Savannah River Ecology Laboratory, to provide his perspective. Here is his response. "A warm spring day is a great time for snake walks. On just such a day several years ago I went to check out snake activity along a local river. Streams and rivers are good places to observe watersnakes as they hunt for fish and frogs in the shallow water or bask on overhanging tree limbs. This particular river was home to a healthy population of northern and brown watersnakes. At some times of the year snakes are rarely seen there; at others you might see several of these harmless serpents in the course of an afternoon’s walk. I felt certain the warm weather would coax snakes out of hiding and provide a satisfying wildlife-watching experience. "As I walked, I scanned the shoreline for the characteristic blotched pattern common to brown and northern watersnakes. Before long I spotted a large brown watersnake stretched along a protruding snag. I could tell by the lump in her stomach that she (females get much bigger) had recently eaten a large fish and was now warming up in the sun to aid digestion. I was right; it was going to be a good day for snakes. "As I continued along the shoreline path I began to see more snakes. A large bush overhanging the water held three northern watersnakes in various poses, soaking up the spring sunshine. A tree that had collapsed into the water contained no fewer than eight snakes. Over the course of the next hour I saw well over 100 snakes along about a mile of shoreline. As I walked, I began to wonder how many snakes really lived in that stretch of river and why I didn’t always see them. Just how important was their role in this ecosystem? "As a herpetologist, I know snakes are secretive. Most spend the vast majority of their time hidden in underground burrows or in logs, tree holes, or other inaccessible places. In fact, herpetologists who use radio transmitters to track snakes seldom see the ones they are tracking. This secretive behavior makes it difficult for scientists to gauge just how many snakes live in a given area. However, as my watersnake experience shows, snake abundance is not always what it seems. Indeed, research has shown that more than 500 snakes can inhabit a single acre of Florida wetland habitat or Kansas prairie. large, warm-blooded predators are relatively rare because they need large tracts of land to support their prey. For example, sighting a bobcat in the Southeast is an uncommon experience; each bobcat needs hundreds of acres of land in which to hunt. So a high abundance of snakes is especially amazing when you consider that all snakes are predators; they feed on many types of animals from insects, fish, and frogs to mice, rabbits, and birds. Some snakes even eat other snakes. For every fox, bobcat, or hawk in the forest there may be hundreds of snakes. And though we don’t see snakes all the time, their abundance makes them an important part of the food chain. For every rodent eaten by a fox or cat, hundreds may be eaten by rat snakes, corn snakes, and kingsnakes that are common in suburban areas throughout the Southeast. a critical part of their ecosystems, but they are unobtrusive. They don't call attention to themselves by trilling, flitting from branch to branch, leaping through the woods, or soaring up above. But if you stroll along a riverbank on a warm spring day and pay close attention, you may be as fortunate as J. D. was.
<urn:uuid:8527ed13-f037-4f40-a8f4-5db44c763524>
3.171875
814
Personal Blog
Science & Tech.
54.452311
We all love the blame game, so I think I found what to blame the heat wave on, the North Atlantic Oscillation (NAO). (See below for explanation of the NAO.) During the month of June, we saw the lowest recorded NAO value since 1950. I have to credit Ralph, a blog reader, for picking that out. Some studies have suggested that low values of NAO in the summer can lead to heat waves and certainly, the correlation between the lowest values in June and the extreme heat seems to be there. In the winter, the snow lovers in the East cheer on the negative NAO because that means blocking which in turns means, colder weather in the East and the potential for slow-moving East coast snowstorms. So we have to blame the NAO for the heat wave, but I will go back to what I said in a previous post. The NAO is just one part the equation, and it's a chicken-and-egg situation in regards to what caused the lowest NAO. Could the El Nino that is developing have already caused the jet stream to change which in turn has caused blocking? Is the NAO/blocking a signal that the winter will be opposite of last winter where we had no blocking so this winter we have continuous blocking and snow up to our chins? I do think the winter will more challenging then last winter in regards to snowstorms and figuring out the strength of the El Nino will be the critical factor in regards to the distribution of snow across the U.S. In any case, we know that the NAO was low, so let's just blame blocking for the heatwave and an extreme record-setting June into early July. What is the NAO? One of the most prominent teleconnection patterns in all seasons is the North Atlantic Oscillation (NAO) (Barnston and Livezey 1987). The NOA combines parts of the East Atlantic and West Atlantic patterns originally identified by Wallace and Gutzler (1981) for the winter season. The NAO consists of a north-south dipole of anomalies, with one center located over Greenland and the other center of opposite sign spanning the central latitudes of the North Atlantic between 35°N and 40°N. The positive phase of the NAO reflects below-normal heights and pressure across the high latitudes of the North Atlantic and above-normal heights and pressure over the central North Atlantic, the eastern United States and western Europe. The negative phase reflects an opposite pattern of height and pressure anomalies over these regions. Both phases of the NAO are associated with basin-wide changes in the intensity and location of the North Atlantic jet stream and storm track, and in large-scale modulations of the normal patterns of zonal and meridional heat and moisture transport (Hurrell 1995), which in turn results in changes in temperature and precipitation patterns often extending from eastern North America to western and central Europe (Walker and Bliss 1932, van Loon and Rogers 1978, Rogers and van Loon 1979). Strong positive phases of the NAO tend to be associated with above-average temperatures in the eastern United States and across northern Europe and below-average temperatures in Greenland and oftentimes across southern Europe and the Middle East. They are also associated with above-average precipitation over northern Europe and Scandinavia in winter and below-average precipitation over southern and central Europe. Opposite patterns of temperature and precipitation anomalies are typically observed during strong negative phases of the NAO. During particularly prolonged periods dominated by one particular phase of the NAO, anomalous height and temperature patterns are also often seen extending well into central Russia and north-central Siberia. The NAO exhibits considerable interseasonal and interannual variability, and prolonged periods (several months) of both positive and negative phases of the pattern are common. The wintertime NAO also exhibits significant multi-decadal variability (Hurrell 1995, Chelliah and Bell 2005). For example, the negative phase of the NAO dominated the circulation from the mid-1950s through the 1978/79 winter. During this approximately 24-year interval, there were four prominent periods of at least three years each in which the negative phase was dominant and the positive phase was notably absent. In fact, during the entire period, the positive phase was observed in the seasonal mean only three times, and it never appeared in two consecutive years. An abrupt transition to recurring positive phases of the NAO then occurred during the 1979/80 winter, with the atmosphere remaining locked into this mode through the 1994/95 winter season. During this 15-year interval, a substantial negative phase of the pattern appeared only twice, in the winters of 1984/85 and 1985/ 86. However, November 1995 - February 1996 (NDJF 95/96) was characterized by a return to the strong negative phase of the NAO. Halpert and Bell (1997; their section 3.3) recently documented the conditions accompanying this transition to the negative phase of the NAO. Severe storms and snow mark the Memorial Day weekend. Severe storms will hit the Northeast and western Texas today. Tornadoes could occur in Texas. Severe weather for the Ohio Valley and Northeast today. One more day of tornadoes, some which can be large and devastating. Tornadoes could be worse today given the jet coming out into the Plains. We are going into a five- to seven-day period of severe weather which will include tornadoes. We could see over 100 reports of tornadoes.
<urn:uuid:f5f932a7-9f0e-46c0-ac4f-8b13ae057a51>
3.03125
1,132
Personal Blog
Science & Tech.
42.344928
|But wait! We don't need to store the date and time information AND the corresponding timestamp in the database. All we really need to store is the act_timestamp_1 and act_timestamp_2 because these timestamps contain the indiviual date and time information. So that reduces the table fields to just these six.| Now that we know what pieces of data or information that will be stored for each activity, we also need to tell MySQL what type of data is in each field. For example, is it a numeric value or a character string? What is the size of the data? What will be the default value or can there be no data (null). MySQL has a list of data types (definitions or descriptive words) that you can use for this purpose. Here is a list of the most frequently used and you can find a complete list at the MySQL website (http://dev.mysql.com/doc/mysql/en/column-types.html). However, in our example, we will not use all of these. There are three types of data fields in our example (integer, variable character and text). MySQL Data Types for Activities Table So, what would this table look like with data stored in it? Well, the data for each activity will be stored altogether and this group of data is called a record. So two activities will result in two records in the table. Here is what the sql code will look like. As you can see, we first connect to the server as you learned in a previous tutorial. The field names and descriptions are placed between the parenthesis, i.e. between activities(...). Each field name and its description ends with a comma. The entire code is placed between the quotation marks for the sql statement. $sql = "";
<urn:uuid:29a0c4a0-5ad1-4529-ad70-8dd8f98b851d>
3.15625
377
Tutorial
Software Dev.
66.40829
Image 1. - Three column layout This control allows you to simply and automatically divide your HTML content into multiple columns and present articles in better readable multi-column layout. If you look at the web pages of random newspapers, you'll notice that the width of article text is about 400px. This is because wider texts are less comfortable to read. In paper newspapers, the text of an article is divided into more columns. This technique isn't used on the web pages, because it is more difficult to implement since you need to manually divide articles into more columns. This control makes it possible... See online demos Multi-column layout is part of CSS 3 specification (More at w3c.org - CSS3 module: Multi-column layout[^]), but since CSS 3 is still only a draft it will take a long time before it will be possible to implement multi-column layout on your web page using CSS 3. If you want to use it now you have to divide every article into columns manually and put these columns in table or floating This control does all the work automatically, so all you have to do is to put it into your web page, column control then takes its content and divides it into specified number of columns. <cc:ColumnControl ColumnCount="3" runat="server"> .. your original long html content .. How does this control work The control contains many features that allow you to specify how the original HTML code should be divided. The control groups HTML tags into the following types: header tags ( h2, ...), paragraph tags ( div, ...), list tags ( dl) and list items ( dt) and others. If control reaches the limit of column while rendering, its behavior depends on the current top level tag. If breaking occurs in header tag, this header is moved to the beginning of the next column. In the paragraph tag, the control breaks the tag into two parts and the second part is moved to the next column. In list, control waits to the end of the current list item and moves the rest of the list items to the next column. Other tags can't be divided, the control just moves to the end of the tag. Header and list division These images show how the control behaves when dividing content. Text highlighted with green color is first and red is second part when calculating where it should be divided. In gray boxes, you can see the result. An interesting fact that you can see from second image is that if you add some more attributes to list (and also to paragraphs) it is automatically copied to the second column, so these attributes aren't lost. Automatic division works great, but sometimes you may need to specify something more. For example, you want to define that one section of the document should be divided into three columns, second section shouldn't be divided and third section should be two columns. Sometimes you may also need to insert some additional white space to a specified column (and move content to the following). This is exactly what formatting tags are good for! Formatting tags can be inserted into HTML code as HTML comments, so it is quite simple. Formatting tags can be also very useful when you want to load content form external resources and still be able to change division settings simply. Image 2. - Usage of formatting tags The following code shows how you can control dividing behavior. If you enable formatting tags using EnableFormatTags property, control will not divide whole content into columns, but it will only divide sections marked by the cc:section tag. (Image on the right side shows what this code generates.) This very long paragraph will be divided into three columns... Second use for formatting tags is when you need to move some content to the next column and you need to insert additional space to first one. In this case, you can use the cc:space tag as you can see in the following example: <cc:ColumnControl ColumnCount="3" runat="server"> For more advanced examples with formatting tags, see online demo application[^]. Minimal control width As you can see below (look at image no. 3), the control allows you to specify the minimal width at which multi-column layout is preserved. This prevents the control from displaying more very narrow columns to users with low screen resolution or smaller browser window. This feature is available only when the control renders column layout using div elements. The control contains two different implementations of this feature, one for Internet Explorer and the other for other browsers. I think that IE implementation is very interesting, so I'd like to write a few words about it. When you use this control to display HTML in two columns, it generates two div elements with CSS style width:50%. When controls width is less than the specified width we need to change it to This does exactly what we need! If width of an element with ID col_ctrl (this element contains whole control) is more than 600 pixels, width of column is 50% (and content is displayed in multi-column layout), otherwise width is set to 100% and content is displayed in one column. As you can see from previous examples, you can change column number using ColumnCount property. When you want to control division from content using formatting tags, you can use EnableFormatTags. If formatting tags are enabled ColumnCount is used as default value when you don't specify column count in section tag ( Image 3. - What can be done with In current HTML, there are two ways of doing multi-column layout. First is using table with specified number of columns and second is using div tags (with CSS styles). Each of this approach has its advantages and disadvantages, so you can decide which one should be used by the RenderMode property. It has the following three possible values: DivFixed - generates columns using div elements. All columns except last one has CSS style float:left to achieve column layout. Each column has CSS class cc_col and it contains another div element with cc_cont class. Last column contains element with cc_last CSS class. TableFixed - generates table with specified number of columns. Each column has CSS class set to cc_col and it also has exactly set width in percents, so column width can't change. TableVariable - Like previous method, generates table and each column has CSS class set to cc_col. Table columns don't have specified width, so width can be adjusted by web browser. If you use DivFixed render mode, you can also use MinColumnsWidth property to specify minimal width of control at which column layout will be preserved. This means that if you resize control to smaller width, it will display whole content in one column. This feature is demonstrated in the second example[^]. Appearance - column division Because it is difficult to estimate size of elements, you can help the control by setting properties ElementsSizes. First one can be used to specify ratio between sizes of elements. For example if you expect that one character in pre element has the same size as 10 characters in p element, you can set this property to "pre=10" and control will use this settings for better division. ElementsSizes property allows you to specify how much space is taken by non-pair tags. This is very useful if you want to insert image into document, just use this property (for example "img=500") and control will be able to better estimate size of img tags. Usage of these properties is demonstrated in the third online example page[^]. As described above, the control uses three different approaches to division. You can specify what HTML tags should be considered as header tags using the HeaderTags property (control will never divide tags into multiple columns and it won't be left at the end of column). Next type are lists that are divided only after the end of list item. Tags that are handled as lists can be set using ListTags and list items can be changed using ListItemTags. Last type of tags are ParagraphTags that can be divided into multiple columns. SpaceChars allows you to specify characters that can be used to divide content of paragraph. Control also uses list of all other tags used for text formatting. This list can be modified using PairTags property, but be careful - control expects that all these tags have matching end tag! - Parser that is used for dividing HTML content passed to the control isn't very smart. It doesn't expect fully valid XHTML (it doesn't try to work with it using XML classes), but it expects that all pair tags have ending tag. - I tried to test control as I could, but if you find any example when it generates strange results, please contact me! I'm looking forward to improving it. Future work and history - (7/7/2005) - Control available for ASP.NET 1.1 and ASP.NET 2.0 beta 2. - (7/7/2005) - First version of this article published at CodeProject.
<urn:uuid:74a5b35a-1e8b-4a08-93b2-aa909f642d39>
2.984375
1,890
Documentation
Software Dev.
56.867484
Brian Tarbox is a Principal Staff Engineer in Motorola's Home and Network Mobility group. Stored Procedures are programs that execute within a database server. They are usually written in a database language such as PL/SQL or ANSI SQL:2003 SQL/PSM. (Granted, some database servers do support Java stored procedures, but I don't examine them here.) There are any number of books for learning to write Stored Procedures -- MySQL Stored Procedure Programming, by Guy Harrison, and Teach Yourself PL/SQL in 21 Days,by Jonathan Gennick and Tom Luers, come to mind), but there are a handful of general reasons to write code in a stored procedure: - The logic being implemented might be database logic and so a database language is closer to the problem domain than a general purpose language like Java. - A stored procedure can be significantly faster than a Java program which might make multiple calls to the database. - A stored procedure can be more secure. Regardless of the reasons for choosing to write a stored procedure, the problem remains of how to debug one. What if you could debug in both development and production at little to no cost to the performance of the Stored Procedures? Traditional debuggers do not generally work with stored procedures which can leave a developer with a fast and broken procedure executing within their database server. Approaches That Don't Work Debug the SQL in your Stored Procedure. This approach works on the assumption the main logic of your Stored Procedures is the actual DDL and DML within the procedure, in other words, the queries, inserts and so on. It assumes that the rest of the Stored Procedures is largely scaffolding to support the database operations. In many cases this is a valid assumption, after all if the Stored Procedure wasn't manipulating the database you probably wouldn't have written it as a Stored Procedure. It goes without saying that regardless of how much non-SQL code you have in your Stored Procedures you need to validate the SQL itself, especially since this level of testing can be relatively straightforward. It can be as simple as starting your database command line tool (or query browser for the gui inclined) and pasting in the guts of your SQL statements to verify correctness. This of course goes beyond simple syntactic correctness, you must validate the semantic correctness as well. In some cases however it's not quite that simple, for a couple of classes of reasons. First, your SQL code can (and usually will) rely on variables and parameters that have been defined and/or manipulated by the Stored Procedures. If you have a select statement that stored its results into a variable, and then a later SQL statement that uses that variable, then your "paste the sql into the command line" approach of testing gets a bit harder. You have to insert the one or more statements, execute them, perhaps creating temporary variables along the way, and possibly modify the SQL you are actually trying to test. This happens by degree but you can certainly reach a point where it's clear that you're no longer testing the SQL you started with. The second class of problem with this approach is that often the logic of the Stored Procedures lives in the procedural code of the procedure and not in the SQL statements themselves. SPs are commonly used to instantiate business logic -- and this is usually embodied in the flow of the code through the procedure or procedures. In this kind of situation simply bench testing the SQL statements does not really test the procedure. Insert print statements in your Stored Procedure. Another common approach is to sprinkle print statements throughout your procedure. This has also been described as "Sherman set the way back machine to 1980" or so when print statements were about the only game in town. This approach can actually be very useful, especially during the early stages of development. Each database server tends to have its own way of doing print statements and each has their own idiosyncrasies. For example when using MySQL concat() calls to build up a string to output you have to guard against null values, which turn your entire string to null. For example, the following code can be danagerous: select someColumn from someTable into myVar where. concat('better hope myVar is not null', myVar); If the where condition results in no rows being selected then myVar might be null and the output of the concat will also be null. It's better to use concat_ws("delimiter", "text to store") which handles null values appropriately. There are two main drawbacks to using print statements in this way. First, the print statements are live during production (unless you guard each one with a conditional flag), meaning that you pay the significant performance penalty for logging all the time. Second and more serious is that if your stored procedures are invoked from a Java application, the print statements don't go anywhere. The print statements can only be seen if you execute your Stored Procedures from the command line. What's the point of log messages that you can't see? Develop a rigorous set of return codes. In this approach you define a detailed set of return codes to cover all interesting cases. The implied contract here is that a given specific return code tells you everything you need to know about the execution of the procedure. Theoretically this is a fine approach but in the real production world it tends to fall apart. A return code might tell you what finally went wrong with a procedure but it's just too easy to imagine needing to know more about how the procedure got to that failure condition. Put another way, if you get a support call from your most important customer at 3:00 AM do you want to have to a grand total of one return code to tell you what went wrong?
<urn:uuid:81ca090c-c06c-463c-97d5-fc6cf3c7a833>
3.21875
1,179
Personal Blog
Software Dev.
43.924279
I’ll bet when you think of all the studies being done on CO2 and Global Warming, you probably figure a lot of it has to do with the atmosphere or the ocean or plants of some kind—since that’s what it seems to affect the most. However, scientists have recently developed a method for finding and tracking CO2 underground. Why underground? Well, consider that a lot of emissions come from power plants—coal plants and the like—so, scientists started investigating underground caverns, fissures and coal beds to find places where those emissions can be stored; thus reducing the amount of greenhouse gases… - Greenfudge.org on Facebook FUNDRAISINGWe are currently fundraising to start our first real-live nature conservation project. Even $1 can be a big help! Add your green newsYou must be logged in to submit a story Tip of the Day Home/Posts Tagged ‘coal beds’
<urn:uuid:1d9f3f4f-86b7-4e4f-afd4-b5208b70c7f2>
3.234375
198
Content Listing
Science & Tech.
49.484
There was a thread on Haskell-Cafe about how to pronounce Haskell. Below are some notes for beginners on how to pronounce those strange Haskell operators and 'read' Haskell programs. This is meant to be a table with formal and informal ways of saying various operators and code snippets. |has type (in definitions); at type (in expressions or patterns)| |maps to, to| |is a witness for, implies||Type Classes and Overloading| |dot (could be used anywhere, but especially in, for example, Data.Char.ord), ring, compose (for example, negate . (+1)), (silent) (for example, forall a. (Num a) => a)| |drawn from, from| |arrow application||Arrows syntax| |applied over||Applicative Functors| |bang; strict (in patterns or data definitions); index (in expressions)||Bang Patterns| |irrefutable, lazy (in patterns)| |[3-]tuple [of] a, b, and c| |just as inconvenient to convey grouping verbally, whether it's layout or punctuation| f :: Int -> Int |f has type Int to Int| Thoughts on improving this page: The tables above would be best split into more columns to distinguish Informal, possibly bad suggestions like "then", "is", "gets", from Formal correct ways of saying the same thing. The Symbols could also be named in a literal way in another column, such as "arrow" or "double-colon". The Description column can be quite brief and a link provided to the relevant wiki page for the operator. Some words, particularly the informal ones, may be good for several different symbols, but these can hopefully be arranged so that their context will make them unambiguous when reading a code snippet.
<urn:uuid:1e279088-8106-46d7-b45b-029c5c8a9ce0>
3.078125
392
Tutorial
Software Dev.
41.700729
2 A Short Tutorial 2.4 Viewing output There are many different ways to view output generated by the environment. In many tools, for example, output appears as soon as it is generated -- this happens, for instance, when you compile code in the built-in editor. At other times, you can view output in a tool called the output browser. This tools collects together all the output generated by the environment, and is particularly useful for viewing output generated by your own processes (which cannot be displayed in any other environment tool). The output browser displays all the output sent to the default value of the variable - 1. Evaluate the following in the listener. :items '(:red :yellow :blue) #'(lambda (data interface) "Pressed button in interface ~S~% data=~S~%" - This is a piece of CAPI code that creates a window with three buttons, labeled RED, YELLOW and BLUE, as shown in Figure 2.4. Pressing any of these buttons returns the value of the button pressed. Figure 2.4 Example CAPI window - 2. Choose Tools > Output Browser from the podium window to create an output browser. - 3. Try clicking on any of the buttons in the window you just created, and look at the output generated in the output browser. - 4. Now try a second example by typing the form below into the listener. :callback #'(lambda (text interface) "You entered: ~S~%" text))) :title "My Text Input Pane") - The object that this code creates is going to demonstrate the inspector tool. The code above creates a window containing a text input pane. You can type text directly into a text input pane, and this can be passed, for instance, to other functions for further processing. - 5. Type the word hello into the text input pane and press Return. Look at the generated output in the output browser. Common LispWorks User Guide, Liquid Common Lisp Version 5.0 - 18 OCT 1996 Generated with Harlequin WebMaker
<urn:uuid:199e70de-0921-449f-8d00-33387e0aa73a>
3.046875
439
Documentation
Software Dev.
57.121431
by Tom Robertson, Minnesota Public Radio Near GRAND RAPIDS, Minn. -- Normally, the sounds of birds and frogs are about all anyone will hear in the peat bogs of Itasca County. But lately the Marcell Experimental Forest has buzzed with the hum of bobcats as workers build a large network of boardwalks into the bog. Scientists in north central Minnesota are preparing for a massive federal research project to study the effects of climate change on peatland ecosystems. Funded by the U.S. Department of Energy, the $50 million project in a remote bog north of Grand Rapids could help researchers over the next decade answer critical questions about global warming. Work crews are laying the groundwork for this fall, when crews will begin constructing more than a dozen huge transparent chambers -- 36 feet wide and 32 feet tall. Scientists will use the chambers to artificially raise the temperature in the bogs. "This is going to be a unique experiment on the planet," said Randy Kolka, a research soil scientist for the U.S. Forest Service in Grand Rapids. "No infrastructure like this has ever been put in place into a similar ecosystem." During the growing season, researchers will heat the air and soil inside the open-topped chambers. They'll also raise carbon dioxide levels, exposing plants and trees to the changes. Following methods tested in a prototype of the octagon-shaped warming chamber at the Oak Ridge National Laboratory in Tennessee, researchers will use electric heaters inserted into the soil to warm below ground. They'll raise air temperatures using four propane heaters per chamber. Read the rest of the article here.
<urn:uuid:a9a5f887-5a13-4031-aae8-281ce8952338>
3.5
337
Truncated
Science & Tech.
49.821053
A germ layer is a collection of cells, formed during animal embryogenesis. Germ layers are only really pronounced in the vertebrates. However, all animals more complex than sponges (eumetazoans and agnotozoans) produce two or three primary tissue layers (sometimes called primary germ layers). Animals with radial symmetry, like cnidarians, produce two called ectoderm and endoderm, making them diploblastic. Animals with bilateral symmetry produce a third layer in-between called mesoderm, making them triploblastic. Germ layers will eventually give rise to all of an animal’s tissues and organs through a process called organogenesis. For more information about the topic Germ layer, read the full article at Wikipedia.org, or see the following related articles: Recommend this page on Facebook, Twitter, and Google +1: Other bookmarking and sharing tools:
<urn:uuid:6cd123d1-8a13-4048-bcce-c0aa4dc38e2a>
3.859375
196
Knowledge Article
Science & Tech.
24.3625
The Milky Way galaxy is bigger, heavier, and faster-spinning than researchers once thought. In work presented this week at the meeting of the American Astronomical Society, scientists reported that our home galaxy is rotating about 100,000 miles per hour faster than previously understood. The revised rotation speed also corrects estimates of the galaxy's mass, making our galaxy closer in mass to that of Andromeda, which was previously thought to be significantly bigger than the Milky Way. On the down side, the larger mass estimates also mean that our galaxy is more likely to collide with other nearby galaxies due to increased gravitational pull. We'll take a look at the new vital stats of the Milky Way, and talk about what they mean to astronomers. Produced by Annette Heist, Senior Producer
<urn:uuid:c1fbeb1f-aa0c-48b5-bbe4-c4920768ba98>
3.28125
156
Truncated
Science & Tech.
34.424045
At various times, roller coasters, or more specifically the trains of these, undergo acceleration, which is defined as the rate of change in velocity. The change may be in speed (magnitude) or direction, or in both. Roller coasters accelerate when they speed up and make the ride faster, slow down, or change direction. It decelerates as, for example, it ascends as if going up a hill. In this case, acceleration is dependent on its mass and the other forces acting on it. It is the acceleration of roller coasters what makes the ride more thrilling and exciting. When riding in a roller coaster a person may at some point feel weightlessness because they do not feel the chair they are sitting in as the roller coaster and yourself move vertically at 9.8 m/s^2. Therefore, you encounter with Galileo and Newton’s principle of free fall, an object moving under the influence of gravity only. Newton’s laws of motion state that the sum of the forces acting on free-falling objects, gravitation and its inertia, equals to zero. Because these forces add up to zero as gravity cancels out with the object’s inertia, then the rider while riding in an arched... [continues] Cite This Essay (2010, 09). The Physics of Roller Coasters. StudyMode.com. Retrieved 09, 2010, from http://www.studymode.com/essays/The-Physics-Of-Roller-Coasters-416918.html "The Physics of Roller Coasters" StudyMode.com. 09 2010. 09 2010 <http://www.studymode.com/essays/The-Physics-Of-Roller-Coasters-416918.html>. "The Physics of Roller Coasters." StudyMode.com. 09, 2010. Accessed 09, 2010. http://www.studymode.com/essays/The-Physics-Of-Roller-Coasters-416918.html.
<urn:uuid:80ee54be-30b5-45dc-8849-a8ddae2dd6fe>
3.921875
427
Truncated
Science & Tech.
69.152219
22.214.171.124 Butterflies are well-documented, recognisable and popular with the public. 126.96.36.199 Data is available for 42 of the 50 regularly occurring butterfly species in the South West since 1990, from annual abundance data collected at 300 monitored sites. 188.8.131.52 The species can be divided into two categories: habitat specialists that are largely restricted to blocks of semi-natural habitat and wider countryside species that can utilise a broader range of habitats, including linear features across intensively managed countryside (Asher et al., 2001). Butterfly indicators can play an important role in assessing habitat diversity, habitat fragmentation and the impacts of climate change. 184.108.40.206 Butterfly numbers have fluctuated greatly from year-to-year largely according to weather conditions and the assessment is based on an analysis of an underlying 'smoothed' trend. This analysis shows that both habitat specialist and wider countryside species have declined substantially since 1990. 220.127.116.11 For habitat specialist species, the smoothed index in 2008 was significantly lower than over the period 1990-2007, with the 2008 index 65% lower than in 1990. Similarly for wider countryside species, the smoothed index was significantly lower in 2008 than from 1990-2007, with abundance halving since 1990. 18.104.22.168 For 15 of the 42 species assessed, the trend was classed as a rapid decline, including for seven habitat specialists. One species increased rapidly (the calcareous grassland specialist, the Adonis Blue), whilst 26 species had a stable trend. The habitat specialists in significant decline were High Brown Fritillary, Grayling, Duke of Burgundy, Wood White, Chalkhill Blue, Silver-studded Blue and Grizzled Skipper. 22.214.171.124 This indicator is a multi-species index compiled by the Centre for Ecology and Hydrology and Butterfly Conservation, primarily from the UK Butterfly Monitoring Scheme. Annual indices for each species at each site were calculated from weekly counts over the season (Rothery and Roy, 2001). 126.96.36.199 The indicator has potential to be updated annually.
<urn:uuid:50b95f91-d75b-47dd-88a1-723fc8760a98>
3.203125
449
Knowledge Article
Science & Tech.
53.367327
Wind, bees, or other agents transfer plant pollen from flower anthers or cones to stigmas, thereby fertilizing plants for reproduction. North American Pollinator Protection Campaign [ More info] An effort focused on encouraging the health of resident and migratory pollinating animals in North America. USGS participates in the leadership of this effort. Potential effects of anthropogenic greenhouse gases on avian habitats and populations in the Northern Great Plains [ More info] Report on effects of the increase of atmospheric carbon dioxide on plants and animals, especially birds, in the Great Plains including effects of carbon dioxide fertilization, ultraviolet radiation, climate change, and harmful effects on bird habitats. The saga of leafy spurge (Euphorbia esula) in the northern Great Plains [ More info] Explains why this invasive plant is successful in taking over land in many northern states, and what might be done to impede its dominance. Alphabetical Index of Topics a b c d e f g h i j k l m n o p q r s t u v w x y z
<urn:uuid:ed8ead11-87e0-49cf-bbb9-8af2891fb4ac>
3.390625
222
Content Listing
Science & Tech.
27.455884
Mercury's thin atmosphere contains hydrogen, helium, and oxygen. It also has smaller amounts of sodium, potassium, calcium, and magnesium. This picture shows sodium near Mercury. Red and green areas have the most sodium. Sunlight and the solar wind constantly "blow away" Mercury's atmosphere. Instruments on spacecraft can detect the gases from Mercury's atmosphere on the side of the planet away from the Sun. This picture was taken by the MESSENGER spacecraft in October 2008. Image courtesy of NASA/Johns Hopkins University Applied Physics Laboratory/Carnegie Institution of Washington.
<urn:uuid:788353c4-0cdc-44ff-af35-68e01a2849d2>
3.875
116
Knowledge Article
Science & Tech.
36.315749
Discover the cosmos! Each day a different image or photograph of our fascinating universe is featured, along with a brief explanation written by a professional astronomer. 2004 November 10 Explanation: Why isn't this small galaxy simple? The above image and contemporary observations of small nearby galaxy Leo A were supposed to show it has a simple structure. Now Leo A is known to be a dwarf irregular galaxy - one of the most common types of galaxies in the universe and a type that is likely a building block of more massive galaxy like our Milky Way Galaxy. In general, larger galaxies have recently been shown to continually eat, and be primarily composed of, many of the smaller satellite galaxies that have surrounded them. Leo A's surprising complexity indicates that that it, and possibly many small galaxies, have formation histories nearly as complex as large galaxies. Leo A spans about 10,000 light years and lies about 2.5 million light years away toward the constellation of Leo. Authors & editors: NASA Web Site Statements, Warnings, and Disclaimers NASA Official: Jay Norris. Specific rights apply. A service of: LHEA at NASA / GSFC & Michigan Tech. U.
<urn:uuid:745894d3-29ab-4ed2-9e86-fa3c9bdcd145>
3.65625
241
Knowledge Article
Science & Tech.
41.065385
CID 1711 and CID 3083 in 60 Seconds Narrator (April Hobart, CXC): Astronomers have recently completed a large survey of the sky using some of the powerful telescopes both on the ground and in space. This survey, known as the Cosmic Evolution Survey, or COSMOS, has revealed many results. The latest comes from a study of galaxies, both in pairs and others on their own. Researchers wanted to test whether or not close encounters between two galaxies trigger activity in the supermassive black holes at their centers. The two galaxies seen here are just samples from the thousands of galaxies they studied. The Chandra data were key because the X-rays can pinpoint just how active these black holes are. It turns out that the black holes within these galaxies are, in fact, growing more rapidly if they are in the early stages of an encounter with another galaxy. Maybe galaxies and their black holes are social after all.
<urn:uuid:2cd69c2e-67c0-469b-bc3e-00e24f1e9bb0>
3.21875
191
Truncated
Science & Tech.
48.322252
(Submitted October 16, 1997) Can you please tell me in plain language what a Red Giant is? I'll give you a short answer and a longer one. The short answer is that towards the end of a star's life, the temperature near the core rises and this causes the size of the star to expand. This is the fate of the Sun in about 5 billion years. You might want to mark your calendar! The long answer is that stars convert hydrogen to helium to produce light (and other radiation). As time progresses, the heavier helium sinks to the center of the star, with a shell of hydrogen around this helium center core. The hydrogen is depleted so it no longer generates enough energy and pressure to support the outer layers of the star. As the star collapses, the pressure and temperature rise until it is high enough for helium to fuse into carbon, i.e. helium burning begins. To radiate the energy produced by the helium burning, the star expands into a Red Giant. For Ask an Astrophysicist
<urn:uuid:8acb856d-0797-412f-b713-05c9da3aebd7>
3.53125
226
Q&A Forum
Science & Tech.
63.924312
At school I've always learned that you can view Current and Voltage like this: The current is the flow of charge per second and the Voltage is how badly the current 'wants' to flow. But I'm having some trouble with this view. How can we have a Voltage without a current? There is nothing to 'flow', so how can it be there? Or is it 'latent' voltage, I mean is the voltage just always there and if a current is introduced it flows? Also, I believe you can't have current without voltage. This to me seems logical from the very definition of current. But if you have a 'charge' without a voltage, doesn't it just stay in 1 place? Can you view it like that? If you introduce a charge in a circuit without a voltage it just doesn't move?
<urn:uuid:788b4f5e-d506-481d-a1f4-bd1e91600e17>
3.03125
172
Q&A Forum
Science & Tech.
71.927155
Because the wolves are rarely seen, one of the few ways biologists have to monitor (check on) their activities is to radio-track them. Radio-tracking (also known as radio telemetry) has been used for many years to study wildlife. The collars used on wolves weigh a little over a pound. The main components (parts) are a battery and a transmitter which emits a signal on a specified frequency or channel. To pick up this signal, biologists use a special receiver and an antenna. When the correct frequency is dialed in and the antenna is pointed toward the wolf, trackers hear a steady beeping signal the closer the wolf, the stronger the signal. Some radio collars have the ability to emit different types of signals, depending on what the wolf is doing. For instance, if the wolf is active, the beeps might become more rapid. Most collars are equipped with a "mortality mode" the one signal biologists hate to hear. It only comes on when the collar has not moved for several hours, which means the wolf is no longer wearing the collar or the wolf has died. To locate a wolf, the biologist stands with the antenna above his head and slowly turns it in a circle until he hears the signal. The direction the signal is coming from is marked on a map. The biologist then moves to another location (usually a mile or so away) and gets a second bearing on the wolf. The wolf's location is approximately where the bearings intersect (cross) on a map. Ground tracking can be very difficult and is often inaccurate. Signals can be interrupted by hills and trees. Another disadvantage is that the tracker has to be relatively close to the wolf to pick up the signal usually within two or three miles. A much more reliable system of radio-tracking (also more expensive) is to track by air. The antennas are attached outside the airplane and the biologist sits next to the pilot and listens for the signal on a headset attached to the receiver. Tracking by air has many advantages over ground tracking: Signal interference is much less because you are above the hills and trees; on a clear day, the signal can be picked up from as far away as ten miles; locations are more accurate because you can fly right over the wolf and pinpoint where it is. Christopher Lucash is the supervising biologist working with the red wolves in the Great Smoky Mountains National Park.
<urn:uuid:72f0e9dd-e43d-4758-af5a-844d70bbea45>
4.0625
499
Knowledge Article
Science & Tech.
49.160714
WatchList Species Account for Wilson’s Plover | Qualifies for the list as a Declining Yellow List Species |Photo: Bill Hubick The Wilson’s Plover is a strictly coastal species that breeds from the eastern shore of Virginia to Florida and along the Gulf Coast into Mexico, in the West Indies and Bahamas, along both coasts of Mexico and Central America either as a resident or wintering bird, and on both coasts of South America. Its breeding range in the U.S. is shrinking at its northern limits; the bird formerly bred in New Jersey and Maryland. Its preferred habitat includes areas along the coast with high salinity and sparse vegetation, including sand dunes, coastal lagoons, and salt flats, but also barrier islands and dredge spoil islands; it sometimes co-occurs with Piping and Snowy Plovers. The Wilson's Plover nests in isolated pairs or loose colonies. In winter it is often found foraging on intertidal mudflats. It feeds largely on crustaceans but also small mollusks, marine worms and insects and their larvae. As is the case with Piping and Snowy Plovers, threats to the Wilson’s Plover include loss of beach habitat through development, disturbance to nesting areas by beachgoers and pets, vehicle traffic on the beach, and occasionally free-ranging cattle and pigs. An approximate estimate of total numbers in North America is 6,000 individuals. Conservation of the Wilson's Plover could be improved by fencing protected areas and patrolling by these areas to protect breeding birds.
<urn:uuid:41feee4e-5600-45a8-8e0e-a2e7278d0f8e>
3.53125
325
Knowledge Article
Science & Tech.
42.859091
Last summer, tropical storms Irene and Lee inflicted major damage on the Hudson River’s watershed. While the events may seem like a distant memory now, affected ecosystems are still recovering. Not surprisingly, the storms caused large changes in the Hudson River. For example, roughly a year’s worth of water and sediment transport occurred within the span of a few short weeks. There were also less visible consequences that have taught us something new about the river’s ecology. Ecosystems “breathe” much the same way we do, taking in oxygen and other gases, and releasing carbon dioxide. We have known for some time that because of the respiration, or “breathing,” activity of fish and other creatures, notably microbes, the Hudson River consumes a lot of oxygen. As a result, its waters are undersaturated with oxygen. Oxygen saturation is a measure of the amount of dissolved oxygen carried in water. Cold water holds more gas than warm water — so warmer water becomes saturated with oxygen faster. Salinity and depth also play a role. As you add in aquatic life, the scenario becomes more complex, with plants producing oxygen during the daytime and aquatic life such as fish and microbes consuming it. In the Hudson, water near the surface tends to have the most oxygen, because of the photosynthetic activity of plants. Scientists pay close attention to oxygen levels, because when they get too low, we can wind up with fish kills. The Hudson River Environmental Conditions Observing System is a series of seven monitoring stations that spans from the Port of Albany southward to the Tappan Zee Bridge. Every 15 minutes, the stations record a number of environmental variables, including dissolved oxygen, providing scientists and resource managers with a window into the river’s health. During the summer storm activity, the system’s data showed scientists something quite remarkable. Shortly after the rainfall started, the river drew in a large quantity of oxygen. It turns out this was because the creeks and streams that feed the river were delivering water with higher-than-normal oxygen levels. Within about 36 hours of Irene’s arrival, oxygen levels in the Hudson River below Albany were about 20 percent greater than expected. It was as if the river had a larger than normal “lungful” of air. In the days after the storms departed, oxygen levels rapidly fell — two to three times faster than normal — as microbes and other aquatic organisms used the oxygen. If you saw the Hudson in early September, it looked brown. This was because of the large quantities of soil and organic matter that washed into the main channel. These tiny bits of terrestrial-generated leaves and woody debris fueled microbial growth. And as microbes took advantage of this extra “food” by growing faster, they rapidly gobbled up oxygen in the process. In the Hudson River, this was the first time scientists were able to trace such a dramatic and rapid delivery and decline in oxygen levels to organic matter delivered from the watershed. The finding is important because following large storms or hurricanes, wastewater treatment facilities can leak sewage and are often blamed for oxygen problems. In the Irene/Lee case, the oxygen drawdown was offset by a new supply of oxygen delivered from tributaries, and we believe that watershed inputs, rather than wastewater, were the major source of organic matter. These findings show that the organisms in the Hudson can handle and even benefit from organic matter inputs, especially when the water delivering the organic matter is also high in oxygen. It also confirms earlier research showing that while aquatic plants in the Hudson are important, organic material from the watershed also plays a large role in subsidizing the food web. Our ability to see and interpret these rapid changes relies on the monitoring system’s network, which has the capability to reveal important things that happen quickly and under stormy conditions.
<urn:uuid:ec4b3261-b12a-44d1-bc2f-d2920f09ddf3>
3.953125
802
Knowledge Article
Science & Tech.
34.224882
The Use of RAPD Markers to Assess Catfish Hybridization Source: Biodiversity and Conservation, Volume 14, Number 12, November 2005 , pp. 3003-3014(12) Abstract:Taiwan's endemic catfish Clarias fuscus is gradually disappearing from its native habitat, and has been proposed for genebank preservation. Environmental pressures, including exotic species interference and habitat destruction, as well as possible competitive advantages of the hybrids over this species. In order to quickly and effectively provide a reliable DNA fingerprint for the pure strain of C. fuscus we used RAPD markers to assess C. fuscus, C. mossambicus, and C.batrachus. Of the 200 primers screened to prime PCR amplification of DNA from wild-caught C. fuscus, 16 yielded reproducible DNA bands. Unique RAPD markers generated from 3 PCR primers (#211, #245 and #287) are shown to be alleles present in the genomes of C. mossambicus but absent in the genome of C. fuscus. Hybrids of C. fuscus and C. mossambicus, therefore, could possibly be distinguished by the use of these specific molecular markers. Catfish caught from the Mingder Dam were then cautiously removed from the preserved stock because of the appearance of hybrid markers in their genomes. Document Type: Research article Affiliations: 1: Freshwater Aquaculture Research Center (Chupei station) FRI, Chupei, 302, R.O.C, Taiwan, 2: Department of Aquaculture, National Taiwan Ocean University, 202, Keelung, R.O.C, Taiwan, 3: Department of Aquaculture, National Taiwan Ocean University, 202, Keelung, R.O.C, Taiwan, Email: firstname.lastname@example.org Publication date: 2005-11-01
<urn:uuid:ab6ecc16-5bba-4570-b391-7185341db171>
2.71875
398
Academic Writing
Science & Tech.
46.4354
A 2010 Orionid meteor, seen over Western Ontario, Canada. A waxing gibbous moon shines brightly at the left side of the image. (Meteor Physics Group, University of Western Ontario) Chart showing Orionid meteor ablation -- or "burn-up" -- altitudes. (NASA's Meteoroid Environment Office/MSFC/Danielle Moser) The most famous of all comets, Comet Halley is noted for producing spectacular displays when it passes near Earth on its 76-year trip around the sun. However, you don't have to wait until 2061 to see a piece of the comet -- you can do it this very week! Halley's Comet leaves bits of itself behind -- in the form of small conglomerates of dust and ice called meteoroids -- as it moves in its orbit, which the Earth approaches in early May and mid-October. When it does, it collides with these bits of ice and dust, producing a meteor shower as the particles ablate -- or burn up -- many miles above our heads. The May shower is called the Eta Aquarids, as the meteors appear to come from the constellation Aquarius. The October shower has meteors that appear to come from the well-known constellation of Orion the Hunter, hence the name: Orionids. Orionids move very fast, at a speed of 147,300 miles per hour. At such an enormous speed, the meteors don't last long, burning up very high in the atmosphere. Last year, the NASA allsky cameras at Marshall Space Flight Center in Huntsville, Ala., and in Chickamauga, Ga., recorded 43 definite Orionid meteors. Most of these appeared at an altitude of 68 miles and completely burned up by the time they were 60 miles above the ground, seen in the graph at right. Even though the peak isn't until October 21, the shower is going on now. The NASA camera systems saw their first Orionid on Oct. 15. Unfortunately, the light from the nearly full moon will wash out the fainter meteors, so expect to see fewer than the 30-per-hour rate you might see under completely dark skies. The good news is that watching Orionids is easy. Go out into a clear, dark sky after 11 p.m. at night -- your local time -- and lie on a sleeping bag or lawn chair. Look straight up. After a few minutes, your eyes will become dark-adapted, you'll start to see meteors. Any of these that appear to come from Orion will be an Orionid, and therefore represent a piece of Halley's Comet doing its death dive into our atmosphere. Most folks would consider seeing one or two of these a fair exchange for an hour or so of time. :) Below is a video of the bright Orionid meteor streaking over Western Ontario on Oct. 17, 2010. The bright object to the left side of the screen is the waxing gibbous moon: Bill Cooke, NASA's Meteoroid Environment Office Marshall Space Flight Center, Huntsville, Ala.
<urn:uuid:e437ccc1-412e-42bc-9a0b-509a5feee100>
3.578125
636
Knowledge Article
Science & Tech.
61.919948
Introducing: D. Radiodurans better known as Connan the Bacterium. It withstands attacks from acid baths, extreme temperatures, and even radiation doses. It was found living on cow patties and elephant dung and came to scientists’ attention when it refused to die in food sterilization tests. Connan is looking to be our ticket into Mars; as it beats most of the survival constraints like vacuum, dormancy, oxidative damage, etc. It is also predicted to be used in creating more portable medicine for astronauts. The bacterium’s genetic code as the unique ability to repeat itself so many times that damage in one area can be recognized and quickly repaired. Needless to say, this seems like the Superman of microscopic organisms.
<urn:uuid:ea9d4e13-c94e-42c0-ae66-3be47bc09aac>
3.09375
156
Knowledge Article
Science & Tech.
37.466287
measure from A to B, fold her tape in four and mark off the point E, which is thus one quarter of the side. Then, in the same way, mark off the point F, one-fourth of the side AD. Now, if she makes EG equal to AF, and GH equal to EF, then AH is the required width for the path in order that the bed shall be exactly half the area of the garden. exact numerical measurement can only be obtained when the sum of the squares of the two sides is a square number. Thus, if the garden measured 12 poles by 5 poles (where the squares of 12 and 5, 144 and 25, sum to 169, the square of 13), then 12 added to 5, less 13, would equal four, and a quarter of this, 1 pole, would be the width of the
<urn:uuid:34cafd10-0584-40a7-aa97-65f0061af193>
3.515625
187
Tutorial
Science & Tech.
67.668444
At the moment it is a faint object, visible only in sophisticated telescopes as a point of light moving slowly against the background stars. It doesn't seem much – a frozen chunk of rock and ice – one of many moving in the depths of space. But this one is being tracked with eager anticipation by astronomers from around the world, and in a year everyone could know its name. Comet Ison could draw millions out into the dark to witness what could be the brightest comet seen in many generations – brighter even than the full Moon. It was found as a blur on an electronic image of the night sky taken through a telescope at the Kislovodsk Observatory in Russia as part of a project to survey the sky looking for comets and asteroids – chunks of rock and ice that litter space. Astronomers Vitali Nevski and Artyom Novichonok were expecting to use the International Scientific Optical Network's (Ison) 40cm telescope on the night of 20 September but clouds halted their plans. It was a frustrating night but about half an hour prior to the beginning of morning twilight, they noticed the sky was clearing and got the telescope and camera up and running to obtain some survey images in the constellations of Gemini and Cancer. When the images were obtained Nevski loaded them into a computer program designed to detect asteroids and comets moving between images. He noticed a rather bright object with unusually slow movement, which he thought could only mean it was situated way beyond the orbit of Jupiter. But he couldn't tell if the object was a comet, so Novichonok booked time on a larger telescope to take another look. Less than a day later the new images revealed that Nevski and Novichonok had discovered a comet, which was named Comet Ison. A database search showed it has been seen in images taken by other telescopes earlier that year and in late 2011. These observations allowed its orbit to be calculated, and when astronomers did that they let out a collective "wow."
<urn:uuid:1a773f61-841a-4976-8f38-ab0ac4cf6436>
3.734375
407
Truncated
Science & Tech.
41.261616
RE: Inserting White Space ( ) through XSL. Someone might give you the answer, but you're on the wrong list. If you know what HTML you want to generate and don't know how to generate it, this is the place to ask. If you don't know what HTML you need in order to produce a particular effect on the screen, your problem is not an XSLT problem. Michael Kay > -----Original Message----- > From: Animesh Sharma [mailto:asharma@xxxxxxxxxxxxxxxx] > Sent: 30 April 2004 08:05 > To: xsl-list@xxxxxxxxxxxxxxxxxxxxxx > Subject: Inserting White Space ( ) through XSL. > > hi, > > I'm trying to insert white space or using following XSL. > > <xsl:template > match="//body/namespace/form/snip/csf/div/center/p[position()=1]"> > <xsl:copy><xsl:apply-templates select="*|text()|@*"/></xsl:copy> > <table width="300" border="1" cellpadding="1" cellspacing="5"> > <tbody> > <tr> > <td> </td> > <td> </td> > <td> </td> > </tr> > > <tr> > <td> </td> > <td> </td> > <td> </td> > </tr> > > </tbody> > </table> > > </xsl:template> > > As can be seen, whole purpose of writing this XSL is to > create Empty table where borderline(of cell) is visible. But > no matter whether I use <xsl:text></xsl:text> or > <td> </td>. I'm not getting Empty Table. > No Empty cell is visible inside the table. Only outer > boundary of Table is visible. > > Thanks and regards, > Animesh PURCHASE STYLUS STUDIO ONLINE TODAY! Purchasing Stylus Studio from our online shop is Easy, Secure and Value Priced! Download The World's Best XML IDE! Accelerate XML development with our award-winning XML IDE - Download a free trial today! Subscribe in XML format
<urn:uuid:d949685d-6445-490d-b6c4-8975f7bc1e56>
2.8125
498
Comment Section
Software Dev.
75.682436
Here, friends and neighbors, is the eighth and final video of Engineer Guy series #4. The element of the week is called plumbum in Latin, abbreviated to Pb on the periodic table, and generally known as lead. Formed into electrodes with its oxide and submerged in sulfuric acid, lead is an essential component in the ignition batteries that start cars and other gas-powered vehicles. Though the lead-acid cell dates to the mid-19th century, and in spite of lead’s density and toxicity, this technology remains a keystone of modern industrial society, and may well continue in that role for a long time. Bill and company explain this anachronism, and lots more, with all their usual flair. [Thanks, Bill!]
<urn:uuid:c2c4b099-a2d3-4fc2-b447-f9dfbe1358af>
3.125
157
Truncated
Science & Tech.
49.327817