text
stringlengths
81
47k
source
stringlengths
59
147
Question: <p>A bodies genetic material provides the blueprint for your appearance. Your predisposition to be tall, freckled, blue eyed and blonde are encoded from birth.</p> <p>However, external and environmental factors can influence the manner these instructions are carried out. For example malnutrition during childhood will affect bone and tooth growth. A lack of oxygen can lead to cerebral palsy with dramatic affects on the bodies muscle development (amongst other things).</p> <p>Does your current genetic material indicate how you physically appear in real life and not just the genetic markers or 'potential'?</p> <p>eg : If a scientist had a bloodsample taken today, I know they could say that the subject has obesity markers but could they actually say how fat the person was. Could they determine the difference between what the markers say and what the subject actually appears like?</p> <p>Is current research limited but indicating that this might be possible in the future?</p> Answer:
https://biology.stackexchange.com/questions/52410/can-genetic-material-actually-provide-a-physical-description-of-appearance
Question: <p>Most of my body hair is black however my lip hair is light brown/blonde the rest of my beard region is black. Since hair color is genetic what causes this?</p> Answer: <p>The hairs you mention are also called "<a href="http://en.wikipedia.org/wiki/Androgenic_hair" rel="nofollow">androgenic hairs</a>", meaning their growth and pigmentation is influenced by androgens. These include pubic hair, the hairs on the breast and shoulders (almost exclusively for men) and the beard.</p> <p>It seems, that these hair bulbs have different sensibilities (number and expression of androgen receptors) so they react differently to androgen levels. This includes balding, pigmentation, growth and so on.</p> <p>These articles should be a good starting point, if you want to dive deeper into the topic:</p> <ul> <li><a href="http://www.ncbi.nlm.nih.gov/pubmed/23016593" rel="nofollow">Androgen actions on the human hair follicle: perspectives.</a></li> <li><a href="http://www.ncbi.nlm.nih.gov/pubmed/10439260" rel="nofollow">Mechanism of action of androgen in human hair follicle.</a></li> </ul>
https://biology.stackexchange.com/questions/16394/why-is-the-human-body-hair-not-uniformly-colored
Question: <p>Most of the human genes are found to be highly methylated in their 3'UTR region (0.8-0.9%). I was wondering if there is any specific reason for this?</p> Answer: <p>According to <a href="http://genomebiology.com/2009/10/9/R89">Choi et al. Genome Biology 2009, 10:R89</a>, DNA methylation at both coding boundaries may regulate transcription elongation and stabilize splicing by reducing the occurrences of exon skipping.</p> <p>From the abstract:</p> <blockquote> <p>Here we report a genome-wide observation of distinct peaks of nucleosomes and methylation at both ends of a protein coding unit. Elongating polymerases tend to pause near both coding ends immediately upstream of the epigenetic peaks, causing a significant reduction in elongation efficiency. Conserved features in underlying protein coding sequences seem to dictate their evolutionary conservation across multiple species. The nucleosomal and methylation marks are commonly associated with high sequence-encoded DNA-bending propensity but differentially with CpG density. As the gene grows longer, the epigenetic codes seem to be shifted from variable inner sequences toward boundary regions, rendering the peaks more prominent in higher organisms.</p> </blockquote> <p>Their data (figures 1 and S2), however, do not support a generalized increase in the 3' UTR regions in either human T cells, mouse liver, yeast or flies. </p>
https://biology.stackexchange.com/questions/1541/why-is-the-3utr-region-highly-methylated-in-most-of-the-human-genes
Question: <p>I don't know if this is a real claim, I live in Mexico City and most of the people I know are more similar to their father than to their mother? Why is that? Are the x and y cromosomes somehow related to the strength of a particular gen?</p> Answer:
https://biology.stackexchange.com/questions/59639/on-parents-similarity
Question: <p>This came up in a talk with a friend. I wanted to clear this doubt. I've read about it before and did again after her remark (my thoughts didn't change: her concept is Lamarck's, not Darwin's), but wanted to clarify.</p> <p>Regarding Evolution, nothing, absolutely nothing, that a person does to herself in life can be genetically inherited. It does not matter how much this person drinks, the changes they do to their body, how dark their skin gets over life etc. Such changes can not be transmitted to their offspring in any way, correct?</p> <p>*Summary:*Is the assertion "You can not change in life what will be genetically inherited in any possible way" true?</p> Answer: <p>The assertion "You cannot change in life what will be genetically inherited in any possible way" is true, as you cannot (healthily) change the DNA in your germ cells.</p> <p>However, the assertion "You cannot change in life what will be inherited in any possible way" is wrong, because of <a href="http://en.wikipedia.org/wiki/Epigenetics" rel="nofollow noreferrer">epigenetics</a>. Parts of your DNA are marked (in different ways), and this can be inherited and have an effect. E.g. the only causal difference between these two mice is the diet of their mothers:</p> <p><img src="https://i.sstatic.net/1tmOP.jpg" alt="Two mice of same genotype but different phenotype"></p> <p>Image source and a further explanation: <a href="http://learn.genetics.utah.edu/content/epigenetics/nutrition/" rel="nofollow noreferrer">Nutrition and the epigenome</a>. </p>
https://biology.stackexchange.com/questions/884/is-it-the-case-that-all-changes-in-phenotype-during-life-are-not-inheritable
Question: <p>I was reading "<a href="http://www.wisdom.weizmann.ac.il/~/eran/NucleosomeModel.pdf" rel="nofollow noreferrer">A genomic code for nucleosome positioning</a>" (by Eran Segal et al). And I am having 2 doubts. <img src="https://i.sstatic.net/7eyzE.png" alt="enter image description here"></p> <p>The figure(b) in this image from the paper shows the graph of fraction (3-bp moving average) of AA/TA/TT dinucleotides of nucleosome dna sequence they analysed statistically as far as I understand. What is 3-bp moving average here? I also don't understand how they chose 0th position (the so called dyad). Also what does it mean to have oscillations (correlation?) in this graph?</p> <hr> <p>UPDATE : I am adding some supplementary information related to finding the dinucleotide fractions. Still I don't understand why is the fraction found so?</p> <p><img src="https://i.sstatic.net/Lbb33.png" alt="enter image description here"></p> Answer: <p>Dyad is the centre of the DNA that is wrapped around the nucleosome core (It basically is the centre of symmetry of the nucleosome). It is a common practice to set it at 0 thereby making incoming DNA half, negative and outgoing DNA half, positive.</p> <p>By oscillations the authors mean that there is a periodic repeat of A/T dinucleotide. IMO it is actually not correct to call it oscillation which is mostly used in a time course dynamical sense. </p> <p>I guess this is what is meant by the <strong>3-nt moving average</strong>:</p> <p>You have conditional dinucleotide probabilities for each position (As shown in the figure). Now you calculate the A/T dinucleotide probability which is: <pre> P<sub>[A/T]</sub> = P<sub>AA</sub> + P<sub>AT</sub> + P<sub>TT</sub> + P<sub>TA</sub></pre></p> <p>Now you find the moving average for 3 steps:</p> <pre>MA<sub>(n)</sub> = (1/3)×(P<sub>[A/T](n)</sub> + P<sub>[A/T](n-1)</sub> + P<sub>[A/T](n-2)</sub>) <i>where <b>n</b> is the n<sup>th</sup> position of the DNA</i></pre>
https://biology.stackexchange.com/questions/30342/doubt-on-genomic-code-for-nucleosome-positioning
Question: <p>I am looking for examples (if any) of genomic regions which regulates the activity of enhancers, either augmenting or reducing it. Essentially some kind of enhancers (or repressors) of enhancers to make a Russian doll analogy. I know about epigenetic markings but I am really looking at an example of a DNA region directly acting on a enhancer similar to an enhancer acting directly onto a promoter.</p> <p>I am asking that because I couldn't find any examples and was wondering if I missed such a report/paper.</p> Answer: <p>If you're looking for a strictly and directly DNA-DNA mediated effect (no histones, no transcription involved) I'd look for sequence effects on chromatin remodelling, modulating access of transcription factors (TFs) to their elements. Something about this might be in this paper: <a href="http://www.ncbi.nlm.nih.gov/pubmed/21326360" rel="nofollow">Szerlong, H. J., &amp; Hansen, J. C. (2011)</a>. Nucleosome distribution and linker DNA: connecting nuclear function to dynamic chromatin structure. Biochemistry and Cell Biology = Biochimie et Biologie Cellulaire, 89(1), 24–34. doi:10.1139/O10-139</p>
https://biology.stackexchange.com/questions/30416/enhancers-of-enhancers
Question: <p>I was thinking about a fiction world in which all animal (at least vertebrate) could crossbred because they share same number and layout of chromosome but differ in hereditary detail (like human skin color) and/or using epigenetic modifications.</p> <p>Is it actually possible? And how large of DNA it could be to code all vertebrate form and function?</p> <p>I'm programmer so I just think DNA as a code. And it seem we could refactor and reuse most of DNA code between tetrapod species (also between arthropod-arthropod species)</p> Answer: <p>Suppose genome A generates organism oA and genome B generates organism oB. Their phenotypes pA and pB are quite different from each other.</p> <p>Because genome A and B are not similar enough, organism oA and oB cannot sexually produce viable offspring.</p> <p>Your question seems to boil down to: "Would it be possible to generate oA/pA and oB/pB from genome A, or a genome similar enough to genome A such that it can still sexually reproduce with genome A?"</p> <p>So you basically ask whether any genome A could simultaneously produce pA and pB under different external conditions.</p> <p>Answer: Possibly? The genes involved in the development of organisms typically don't respond to external stimuli but to genes which were active before them (in time). Various genes produce proteins which sense temperature, osmotic pressure or particular chemical species or ions. If those were factored into very early developmental programs, feeding into transcription factors to modify gene expression according to external factors, the same genome could produce drastically different organisms.</p> <p>To speculate more about this yourself, it would probably help to go away from a code-based understanding of DNA and think more about what it is physically and biologically. Unlike computer programs, DNA "programs" can modify themselves and other programs or the functions they execute.</p> <p>Biologically, DNA is an information carrier that is transcribed into RNA, which can have functions of its own and/or be translated into proteins. DNA interacts very tightly (physically) with a lot of RNA and protein components, and most things that happen in cells and tissues around them end up modifying the way DNA is handled in some way. Keywords that you could look up are "gene expression", "gene regulation" and "developmental biology".</p>
https://biology.stackexchange.com/questions/51557/is-it-possible-to-create-dna-of-a-species-that-could-be-any-animal
Question: <p>So I am trying to brush up on my knowledge of HATs and HDACs.</p> <p>I am reading the just the 1st paragraph of the background of this <a href="https://www.alzforum.org/therapeutics/amx0035" rel="nofollow noreferrer">study</a></p> <p>I remember learning that HATs turn things on on, and HDACs turn things off.</p> <p>It says that sodium phenylbutyrate (PB), can epigenetically regulate gene expression by inhibiting histone deacetylase.</p> <p>Does this mean that one of the effects this drug can have is turning the thing that turns things off to produce the effect of turning it back on? Similar to that of a double negative?</p> <p>Thanks.</p> Answer: <p>Yes, Sodium phenylbutyrate can upregulate the transcription of silenced genes by inhibiting the activity of Histone deacetylases (HDACs).<br> Histone acetylation performed by Histone acetyltransferases (HATs) helps in activation of genes, while deacetylation performed by HDACs is responsible for gene silencing. This makes HDACs a potent drug target to treat malignancies. </p> <p>The inhibitors of HDAC regulate the chromatin structure which loosens the chromatin and hence effect the binding of transcription factors to DNA. This binding modulates the expression of genes playing role in cell cycle and apoptosis, thus effecting cell growth and differentiation. (<a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3586072/" rel="nofollow noreferrer">Reference</a>)</p> <p>But this is not similar to double negative. Double negative is term used in embryogenesis, where a particular repressor gene is activated in specific regulatory state. (<a href="https://www.pnas.org/content/105/51/20063" rel="nofollow noreferrer">Reference)</a></p>
https://biology.stackexchange.com/questions/93758/histone-deacetylase-inhibition
Question: <p><a href="http://en.wikipedia.org/wiki/Polyploid">Polyploidy</a> is the multiplication of number of chromosomal sets from 2n to 3n (triploidy), 4n (tetraploidy) and so on. It is quite common in plants, for example many crops like wheat or Brassica forms. It seems to be rarer in animals but still it is present among some amphibian species like Xenopus.</p> <p>As I know in mammals polyploidy is lethal (I don't mean tissue - limited polyploidy). I understand that triploidy is harmful due to stronger influence of maternal or paternal epigenetic traits that cause abnormal development of placenta, but why there is no tetraploid mammals?</p> Answer: <p>Great question, and one about which there has historically been a lot of speculation, and there is currently a lot of misinformation. I will first address the two answers given by other users, which are both incorrect but have been historically suggested by scientists. Then I will try to explain the current understanding (which is not simple or complete). My answer is derived directly from the literature, and in particular from Mable (2004), which in turn is part of the <a href="http://onlinelibrary.wiley.com/doi/10.1111/bij.2004.82.issue-4/issuetoc">2004 special issue of the Biological Journal of the Linnean Society</a> tackling the subject.</p> <p><strong>The 'sex' answer...</strong></p> <p>In 1925 HJ Muller addressed this question in a famous paper, "Why polyploidy is rarer in animals than in plants" (Muller, 1925). Muller briefly described the phenomenon that polyploidy was frequently observed in plants, but rarely in animals. The explanation, he said, was simple (and is approximate to that described in Matthew Piziak's answer):</p> <blockquote> <p>animals usually have two sexes which are differentiated by means of a process involving the diploid mechanism of segregation and combination whereas plants-at least the higher plants-are usually hermaphroditic.</p> </blockquote> <p>Muller then elaborated with three explanations of the mechanism:</p> <ol> <li>He assumed that triploidy was usually the intermediate step in chromosome duplication. This would cause problems, because if most animals' sex was determined by the ratios of chromosomes (as in Drosophila), triploidy would lead to sterility. </li> <li>In the rare cases when a tetraploid was accidentally created, it would have to breed with diploids, and this would result in a (presumably sterile) triploid.</li> <li>If, by chance, two tetraploids were to arise and mate, they would be at a disadvantage because, he said, they would be randomly allocated sex chromosomes and this would lead to a higher proportion of non-viable offspring, and thus the polyploid line would be outcompeted by the diploid.</li> </ol> <p>Unfortunately, whilst the first two points are valid facts about polyploids, the third point is incorrect. A major flaw with Muller's explanation is that it only applies to animals with chromosomal ratio-based sex determination, which we have since discovered is actually relatively few animals. In 1925 there was comparatively little systematic study of life, so we really didn't know what proportion of plant or animal taxa showed polyploidy. Muller's answer doesn't explain why most animals, e.g. those with Y-dominant sex determination, exhibit relatively little polyploidy. Another line of evidence disproving Muller's answer is that, in fact, polyploidy is very common among dioecious plants (those with separate male and female plants; e.g. Westergaard, 1958), while Muller's theory predicts that prevalence in this group should be as low as in animals.</p> <p><strong>The 'complexity' answer...</strong></p> <p>Another answer with some historical clout is the one given by Daniel Standage in his answer, and has been given by various scientists over the years (e.g. Stebbins, 1950). This answer states that animals are more complex than plants, so complex that their molecular machinery is much more finely balanced and is disturbed by having multiple genome copies.</p> <p>This answer has been soundly rejected (e.g. by Orr, 1990) on the basis of two key facts. Firstly, whilst polyploidy is unusual in animals, it does occur. Various animals with hermaphroditic or parthenogenetic modes of reproduction frequently show polyploidy. There are also examples of Mammalian polyploidy (e.g. Gallardo et al., 2004). In addition, polyploidy can be artificially induced in a wide range of animal species, with no deleterious effects (in fact it often causes something akin to hybrid vigour; Jackson, 1976).</p> <p>It's also worth noting here that since the 1960s Susumo Ohno (e.g. Ohno et al. 1968; Ohno 1970; Ohno 1999) has been proposing that vertebrate evolution involved multiple whole-genome duplication events (in addition to smaller duplications). There is now significant evidence to support this idea, reviewed in Furlong &amp; Holland (2004). If true, it further highlights that animals being more complex (itself a large, and in my view false, assumption) does not preclude polyploidy.</p> <p><strong>The modern synthesis...</strong></p> <p>And so to the present day. As reviewed in Mable (2004), it is now thought that:</p> <ul> <li>Polyploidy is an important evolutionary mechanism which was and is probably responsible for a great deal of biological diversity.</li> <li>Polyploidy arises easily in both animals and plants, but reproductive strategies might prevent it from propagating in certain circumstances, rather than any reduction in fitness resulting from the genome duplication.</li> <li>Polyploidy may be more prevalent in animals than previously expected, and the imbalance in data arises from the fact that cytogenetics (i.e. chromosome counting) of large populations of wild specimens is a very common practise in botany, and very uncommon in zoology.</li> </ul> <p>In addition, there are now several new suspected factors involved in ploidy which are currently being investigated:</p> <ul> <li>Polyploidy is more common in species from high latitudes (temperate climates) and high altitudes (Soltis &amp; Soltis, 1999). Polyploidy frequently occurs by the production of unreduced gametes (through meiotic non-disjunction), and it has been shown that unreduced gametes are produced with higher frequency in response to environmental fluctuations. This predicts that polyploidy should be more likely to occur in the first place in fluctuating environments (which are more common at higher latitudes and altitudes).</li> <li>Triploid individuals, the most likely initial result of a genome duplication event, in animals and plants often die before reaching sexual maturity, or have low fertility. However, if triploid individuals do reproduce, there is a chance of even-ploid (fertile) individuals resulting. This probability is increased if the species produces large numbers of both male and female gametes, or has some mechanism of bypassing the triploid individual stage. This may largely explain why many species with 'alternative' sexual modes (apomictic, automictic, unisexual, or gynogenetic) show polyploidy, as they can keep replicating tetraploids, thus increasing the chance that eventually a sexual encounter with another tetraploid will create a new polyploid line. In this way, non-sexual species may be a crucial evolutionary intermediate in generating sexual polyploid species. Species with external fertilisation are more likely to establish polyploid lines - a greater proportion of gametes are involved in fertilisation events and therefore two tetraploid gametes are more likely to meet.</li> <li>Finally, polyploidy is more likely to occur in species with assortative mixing. That is, when a tetraploid gamete is formed, if the genome duplication somehow affects the individual so as to make it more likely that it will be fertilised by another tetraploid, then it is more likely that a polyploid line will be established. Thus it may be partly down to evolutionary chance as to how easily a species' reproductive traits are affected. For example in plants, tetraploids often have larger flowers or other organs, and thus are preferentially attractive to pollinators. In frogs, genome duplication leads to changes in the vocal apparatus which can lead to immediate reproductive isolation of polyploids.</li> </ul> <p><strong>References</strong></p> <ul> <li>Furlong, R.F. &amp; Holland, P.W.H. (2004) Polyploidy in vertebrate ancestry: Ohno and beyond. Biological Journal of the Linnean Society. 82 (4), 425–430.</li> <li>Gallardo, M.H., Kausel, G., Jiménez, A., Bacquet, C., González, C., Figueroa, J., Köhler, N. &amp; Ojeda, R. (2004) Whole-genome duplications in South American desert rodents (Octodontidae). Biological Journal of the Linnean Society. 82 (4), 443–451.</li> <li>Jackson, R.C. (1976) Evolution and Systematic Significance of Polyploidy. Annual Review of Ecology and Systematics. 7209–234.</li> <li>Mable, B.K. (2004) ‘Why polyploidy is rarer in animals than in plants’: myths and mechanisms. Biological Journal of the Linnean Society. 82 (4), 453–466.</li> <li>Muller, H.J. (1925) Why Polyploidy is Rarer in Animals Than in Plants. The American Naturalist. 59 (663), 346–353.</li> <li>Ohno, S. (1970) Evolution by gene duplication.</li> <li>Ohno, S. (1999) Gene duplication and the uniqueness of vertebrate genomes circa 1970–1999. Seminars in Cell &amp; Developmental Biology. 10 (5), 517–522.</li> <li>Ohno, S., Wolf, U. &amp; Atkin, N.B. (1968) EVOLUTION FROM FISH TO MAMMALS BY GENE DUPLICATION. Hereditas. 59 (1), 169–187.</li> <li>Orr, H.A. (1990) ‘Why Polyploidy is Rarer in Animals Than in Plants’ Revisited. The American Naturalist. 136 (6), 759–770.</li> <li>Soltis, D.E. &amp; Soltis, P.S. (1999) Polyploidy: recurrent formation and genome evolution. Trends in Ecology &amp; Evolution. 14 (9), 348–352.</li> <li>Stebbins, C.L. (1950) Variation and evolution in plants. Westergaard, M. (1958) The Mechanism of Sex Determination in Dioecious Flowering Plants. In: Advances in Genetics. Academic Press. pp. 217–281.</li> </ul> <p>(I'll come back and add links to the references later)</p>
https://biology.stackexchange.com/questions/935/why-is-polyploidy-lethal-for-some-organisms-while-for-others-is-not
Question: <p>Recently Southern California experienced extreme wind velocities and afterwards the news reported over 300 trees had fallen in San Diego County. I had either heard or read somewhere that the action of the wind and bending of a tree assists to strengthen the roots ( I suppose as long as the wind is not strong enough to pull the tree out of the ground). And so that brings me to the point of my question. </p> <p><strong>Does some kind of mechanism exist within the tree that connects mechanical bending of the trunk with increased rate of root growth?</strong> I can imagine that bending might stimulate fluid movement through the phloem &amp; xylem, and perhaps this might be the mechanism. Or does the bending cause a release of some type of growth hormone? Or perhaps the mechanism is epigenetic?</p> <p>I suppose that if such a mechanism were to exist it would provide one means of evolutionary weeding; removing the weaker part of the gene pool. Perhaps that's what happened in San Diego this last week.</p> Answer: <p>In tree growth there is principle called <em>The axiom of universal stress</em> whereby the growth is in such a way as to equalise the stress across the whole of its structure. The roots, the stem and the branches are one continuous system and can not be thought of as separate.</p> <p>On a simplistic level for a branch to grow, there must be a corresponding equal and opposite growth in the stem and roots. Of course it is not quite like this as the growth happens across the whole structure at the same time.</p> <p>The trees on the edge of an even-age stand of trees will have grown to be more stable against wind. They are referred to as being a <em>wind-firm</em> edge to the stand. The trees that have grown up within a stand, with the shelter of their neighbours will not have the same stability in the face of wind, so that if the stand is opened up too quickly it can lead to <em>wind-blow</em>. In uneven-age woodlands, the same principle is true but the dynamics make it less pronounced.</p> <p>The reason for mentioning this is just to illustrate that, absolutely the wind, and other external factors, gravity being the obvious one, will have an effect on the growth of the roots, as well as the rest of the tree. As the wind exerts a force on a tree that force will travel through the structure and into the roots and into the ground.</p> <p>To come back to the specific question then.</p> <blockquote> <p>Does some kind of mechanism exist within the tree that connects mechanical bending of the trunk with increased rate of root growth?</p> </blockquote> <p>Yes, and no. Because the increased rate of growth will be across the whole structure, but not equally. It will put on growth at the points where the stresses are, in order to self-optimise the loading including within the root system.</p> <p>The next time you cut either the stem of a leaning tree, or a branch of a tree, take a look at the orientation, and thickness of the rings. You will see that in broadleaf trees (or more correctly <em>angiosperms</em>) the rings on the side under tension will be thicker. In conifers (or <em>gymnosperms</em>) it is the opposite. The thicker growth is found on the compression side.</p> <p>Here is a great photo of compression wood in a conifer from <a href="http://www.copperman.co.uk/didgeridoo/how_to_make_a_wooden_didgeridoo/what_is_wood_2.php" rel="nofollow noreferrer">http://www.copperman.co.uk/didgeridoo/how_to_make_a_wooden_didgeridoo/what_is_wood_2.php</a></p> <p><a href="https://i.sstatic.net/Y0NmQ.png" rel="nofollow noreferrer"><img src="https://i.sstatic.net/Y0NmQ.png" alt="enter image description here"></a></p> <p>The same principle will be happening in the roots also.</p> <p>As to the actual physiological mechanism that causes this response I have not yet come across a definitive answer. The consenus, at least as far as I know, is that it is not fully understood. </p> <p>The closest I have come across so far is from this phd in 1994. <a href="http://etheses.whiterose.ac.uk/2438/1/DX184141.pdf" rel="nofollow noreferrer">http://etheses.whiterose.ac.uk/2438/1/DX184141.pdf</a></p> <p>I dare say there has been more work done on this in the last couple of decades.</p>
https://biology.stackexchange.com/questions/43014/does-the-bending-of-a-trees-trunk-in-the-wind-stimulate-and-strengthen-root-gro
Question: <p>I'm familiar with how CRISPR works to make either knockdown or amplification effects for a single gene because you can make precision cuts. </p> <p>What exactly does a pooled crispr screen do &amp; how does it work?</p> Answer: <p>In the context of pooled CRISPR screen, you first design a library of gRNAs against a certain set of targets (instead of just one target). </p> <p>The library can have the size you want, most commonly it is either targeting the kinome, or the whole genome (genome-wide). In this context, you would add the full library on your cell of interest in which you want to make the perturbations.</p> <p>Depending on how the screen is set-up you try to select the perturbations which either allow you to pass a selection process (toxicity, fluorescent readout, etc). Usually an elegant way is to have either a label also code barcode which helps you to identify the gRNA which generated the surviving/selected phenotype. With the barcode/gRNA you can track back which gene was likely perturbed in the screening process.</p> <p>Hope that helps and that answers you question, please don't hesitate to further refine it if this is not clear to you.</p>
https://biology.stackexchange.com/questions/92506/simple-explanation-of-a-crispr-screen-vs-pooled-crispr-screen
Question: <p>&quot;CRISPR&quot; and &quot;Cas9&quot; are different things. When a virus attacks a bacteria, the bacteria stores the viral code of the virus in CRISPR. And when the virus attacks again the Cas9 protein uses the RNA in the CRISPR to find the viral DNA and then destroy it.</p> <p><strong>So, what is the use of CRISPR when scientists use the CRISPR/Cas9 system to edit genes, as we have already given the Cas9 protein a guide RNA?</strong></p> <p>Sorry if this is a stupid question, I am new to genetic engineering and couldn't find the answer on google.</p> Answer: <p><a href="https://i.sstatic.net/hdnyG.png" rel="nofollow noreferrer"><img src="https://i.sstatic.net/hdnyG.png" alt="Diagram of adaptive immunity mediated by CRISPR RNA, from https://sitn.hms.harvard.edu/flash/2014/crispr-a-game-changing-genetic-engineering-technique/" /></a> <strong>Figure 1. Process of bacterial immunity mediated by CRISPR/Cas9. Scissors are Cas9 enzyme, black diamonds are CRISPR elements in DNA.</strong></p> <p>As suggested in the comment, there are some subtle differences here. Cas9 knows where to cut based on the spacer (the colored squares). That serves as a guide to the enzyme through sequence complementarity of the transcribed spacer RNA in the crisprRNA (crRNA, shown as the squiggled black line with a green piece).</p> <p>The crRNA itself is composed of the spacer and also a transcribed CRISPR repeat (black diamonds), which form the structural hairpin of the RNA molecule (the squiggly black piece) that allows Cas9 to recognize it as a crRNA. Otherwise the spacer would just be a random little piece of RNA floating around the cell; with a full mature crRNA Cas9 knows how to bind to both the crRNA and the spacer-defined target to do its cutting.</p> <p>To directly answer your question then, the crRNA <em>is</em> the guide RNA. You have a CRISPR (or CRISPR-like) sequence already in there. It doesn't exist in the array named as CRISPR in bacteria, but the functional component allowing the enzyme to bind and then recognize the target exists in there.</p> <p>It's a little more complex than that in the actual organisms, if you have more questions I recommend reading more on <a href="https://en.wikipedia.org/wiki/CRISPR" rel="nofollow noreferrer">wikipedia</a>.</p>
https://biology.stackexchange.com/questions/100421/is-crispr-being-utilized-when-scientists-use-the-crispr-cas9-system-to-edit-gene
Question: <p>I need to splice a gene into a human cell genome, with highest rate possible. I mean, doesn't really matter where the gene enters, nor does it matter if some cells die as a result of this.</p> <p>CRISPR know to knock-in genes with very high specifically, this reduce the success rate if we have a low amount of gRNA and/or of the protein.</p> <p>I need to insert the gene, without the need of targeting some specific place. </p> <p>Is this possible in some way with CRISPR?</p> <p>I know that there may be better technique to do this, but I can only use CRISPR.</p> Answer: <p>A paper was published about a week ago in Nature Biotechnology and adresses your question, <a href="http://www.nature.com/nbt/journal/vaop/ncurrent/full/nbt.3190.html" rel="nofollow">Maruyama T et al., 2015</a>. I must say I found the authors' strategy extremely clever.</p> <p>It is not about increasing efficiency by reducing specificity, but simply increasing efficiency (which is your ultimate goal anyway). What the authors did was to inhibit nonhomologous end joining (NHEJ) to promote homology-directed repair (HDR), two DNA repair mechanisms that compete in cells and of course HDR is the mechanism needed for the CRISPR/Cas9 system.</p> <p>They achieve NHEJ inhibition using the molecule Scr7, a DNA ligase IV inhibitor which in turns perturbes NHEJ.</p> <p><strong>Using Scr7 they boosted by 3 to 19 fold</strong> (depending on the cell line) the insertion of the target gene. Here the graph showing these results</p> <p><em>See paper figures</em></p> <p>Moreover using 1μM of Scr7 over 24h on DC2.4 cells increased the % of transfected cells from <strong>4.58% to 58.3%</strong>, a neat ~13-fold increase. Here their results:</p> <p><em>See paper figures</em></p> <p>Hopefully this should give you some ideas.</p>
https://biology.stackexchange.com/questions/30839/splice-in-with-crispr-cas
Question: <p>In the context of the bacterial systems (not the gene editing tool), I was wondering what happens to the foreign DNA after the Cas proteins have created a new spacer. </p> <p>It is really not clear to me, most of the documentation I have found focuses on the subsequent steps (expression and interference) and do not discuss the fate of said foreign DNA. For example, see this image from wikipedia <a href="https://en.wikipedia.org/wiki/CRISPR#/media/File:Crispr.png" rel="nofollow">https://en.wikipedia.org/wiki/CRISPR#/media/File:Crispr.png</a></p> Answer:
https://biology.stackexchange.com/questions/34811/crispr-cas-systems
Question: <p>With CRISPR-Cas9 I have conducted a targeted knockout of a DNA region encoding a certain protein (working with leukocytes). My question is, how long does it take until this protein is not detectable any more (e.g. via surface staining + flow cytometry) after the DNA has been manipulated? Or in other terms: how often are transcription, translation etc. taking place?</p> Answer: <p>To answer your question multiple parameters which one should be taken into account. </p> <p>There are two main sets of parameters: <strong>gene specific</strong> and <strong>cell line specific</strong>.</p> <p>Parameters related to your specific gene of interest :</p> <ul> <li>Do you know the half-life of the RNA of your gene of interest? Most of the time it is not known but there are several tools and resources which can predict it based on a lot of different features such lengths and stability of 3'UTR, 5'UTR, number of exons introns, etc. Another indication is if there are already people who have either perform a genetic perturbation (siRNA, CRISPR, etc) or a degradation assay. In this case you might be able to guess what is the relative half-life of the RNA or the protein.</li> <li>Which leads us to the half-life of the protein of interest. Proteins which are soluble tends generally to have a smaller half-life than membrane proteins (not necessary true there are exceptions). For example doing a complete functional knockout of a transcription factor might be easier than a GPCR receptor. If it is a membrane protein, to which organelle does it localize? Is the organelle recycling the membrane a lot or is the cell dividing? In this case you might have chances that the viable proteins present before the genetic perturbation get diluted. In these examples, you might get ride of a soluble protein in less than 24-48 hours, whereas a very stable membrane protein might take 7-10 days.</li> <li>The number of RNA copies is important as well as the number bound to ribosomes (less important) and their localization in the cell (less important)</li> <li>The abundance of the protein in general.</li> </ul> <p>Parameters related to your cell line of interest:</p> <ul> <li>The lineage of the cell line you selected: different cell lines have different global transcription and translation rates.</li> <li>The rate of division of the cell line (<strong>extremely important parameter</strong>): the faster the cell line will divide the faster the mRNA copies which were not perturbed (wild-type) and the proteins present before the genetic perturbation will be diluted between daughter cells.</li> <li>Number of copies in the cell line: if there are multiple copies of your gene of interest, you would need to make sure that each copy of the gene has been perturbed to lead to a functional KO.</li> <li>Genomic stability of the cell line: some cells lines like HeLa are quite known for genomic instability where a lot of the genome can be rearranged can perturbed copies can be fix using viable copies</li> </ul> <p>Last but not least, it depends technically how you do the CRISPR-Cas9 genetic perturbation: transfection of the gRNA, electroporation of the Cas9 with the gRNA, lentiviral mediated delivery etc. The time I have provided are after all the components have been delivered and are present in large amount in the nucleus.</p> <p>I hope that helps!</p>
https://biology.stackexchange.com/questions/91082/crispr-cas9-knockout
Question: <p>Are Restriction Enzymes obsolete with CRISPR?</p> Answer: <p>No.</p> <p>While CRISPR allows you cut a piece of DNA anywhere, you need to order a guide RNA to target your desired cut site. All standard plasmids still carry traditional restriction sites, and it's often convenient to use these. Using CRISPR as a restriction enzyme is probably more expensive and more complicated than using traditional restriction digest. Additionally, there are limitations about PAM sites with CRISPR. And you can always PCR a plasmid using whatever primers you want to produce a blunt end product that is "cut" where ever you want, and I'd bet the DNA oligos needed for PCR are cheaper than the guide RNA you need for CRISPR.</p>
https://biology.stackexchange.com/questions/74475/are-restriction-enzymes-obsolete-with-crispr
Question: <p>Using the CRISPR/Cas9 technology, it is possible that after inducing a DSB with the Cas9 endonuclease guided with an RNA designed by the user and using a template DNA, get a desired Knock-In (KI) by homologous recombination.</p> <p>I have read that for desired KI-s that are less than 200 bp, a olygonucleatide should be enough as template. On the contrary, if the desired KI is bigger than that, a plasmid vector should be used.</p> <p>Is that information accurate and correct? and, where is the upper limit for the KI length?</p> Answer:
https://biology.stackexchange.com/questions/30460/crispr-knock-in
Question: <p>Is the crispr (where the parts of Virus DNA is saved) section of the DNA existing in human cells aswell or is it just in bacteria cells?</p> Answer: <p>No analogues of the CRISPR-Cas system have been found in any eukaryotic species, including humans. So far, it appears to have evolved only in prokaryotes and archaea.</p> <p>Reference: <a href="https://doi.org/10.1186/s13062-017-0177-2" rel="nofollow noreferrer">Evolution of RNA- and DNA-guided antivirus defense systems in prokaryotes and eukaryotes: common ancestry vs convergence</a></p>
https://biology.stackexchange.com/questions/78609/crispr-complex-in-human-cells
Question: <p>I'm learning about CRISPR at my college.<br/> I understand that when viral DNA is inserted into a bacterial cell, the <strong>Cas1-Cas2</strong> proteins identify the <strong>PAM</strong> site in the viral DNA and then cut the protospacer from the viral DNA to make it a spacer in the CRISPR array for the adaptive immunity of the bacteria. I'm confused about why a complex CRISPR system is necessary if the <strong>Cas1-Cas2</strong> cuts the protospacer, and at that time only the viral DNA gets inactivated.</p> Answer:
https://biology.stackexchange.com/questions/115330/why-do-bacteria-need-the-crispr-system
Question: <p>I am doing CRISPR/Cas9 experiment on <em>E. coli</em>. I am introducing recombinant plasmid BPK764 (which carries Cas9 + sgRNA designed and added later in that plasmid) into compentent <em>E.coli</em> cells which already carries another plasmid with GFP gene. sgRNA will be designed so that it corresponds to that GFP gene becouse my main point is to cut out GFP gene. The main result of this experiment will be <em>E.coli</em> cells that do/don't express GFP gene (depending on CRISPR/Cas9 efficacy), therefore, the resultant cells will or hoply won't light green. I will see that under UV lamp, and by fluorescent microscopy.</p> <p>Now I'm getting to my question. Is there something on those resultant cells (some trait, like membrane structure, youngs modulus, that differs from CRISPR untreated cells) that can be visualized on AFM (atomic force microscopy)? Something that changes on cells after inserting plasmid that can confirm efficacy of this experiment?</p> <p>Or maybe some other idea on this experiment using AFM?</p> Answer: <p>Unless you're specifically targeting genes involved in the physical morphology of the cell, I doubt you would find any differences with CRISPRed vs non-CRISPRed cells that is measurable via AFM.</p> <p>Perhaps you should instead target genes known to contribute to the structure of the cell wall, which I would expect to be the <a href="https://dx.doi.org/10.1111%2Fj.1365-2958.2012.08063.x" rel="nofollow noreferrer">dominant material contributing to the Young's modulus</a>. Since you mentioned GFP as a tool for selecting for "successful" cuts, it might be worthwhile looking into generating a multiplex plasmid that allows you to target several loci with a single construct. Such kits are available on <a href="https://www.addgene.org/crispr/yamamoto/multiplex-crispr-kit/" rel="nofollow noreferrer">Addgene</a> and contain associated publications and manuals on how they can be used.</p> <p>So to summarize, no, I don't think there is anything physically different about cells that have been CRISPR treated compared to a control group. If you did want to use CRISPR to effect a knockout of the fluorescence in the competent cells you described <em>and</em> alter the cell mechanics, you would likely have to generate a multiplex CRISPR plasmid with multiple gRNA cassettes for both GFP and perhaps some gene involved in cell wall formation. Keep in mind that your efficiency percentage is compounded with each new target in the same multiplex – instead of a single cut being deemed successful, you will have raised the bar to 2 cuts being deemed successful without doing anything to improve the efficiency of a single cutting event.</p> <p>Hope this helps, and I'd be happy to discuss this more.</p>
https://biology.stackexchange.com/questions/82134/crispr-cas9-edited-e-coli-on-afm
Question: <p>The use of crisper-cas systems is currently applied to cells cultivated in vitro. As control of the ‘off target’ effects of Crispr improves and Crispr is used in vivo, why won’t the immune system neutralize it?</p> Answer: <p>Usually not. the Crispr/Cas proteins can be delivered to the cell as DNA/RNA and the proteins will only exist inside the cell in low numbers.</p> <p>Even in systems that deliver the protein from the outside <em>in vivo</em> almost always the proteins would be encapsulated in a delivery system to ensure they and any necessary accompanying nucleic acids get into the cell. Getting Crispr/Cas into a cell is difficult to do and they don't just pop in by themselves. They also require guide RNA, which will not easily stay whole in the blood stream and tissues for long.</p> <p>if you want to just inject a fluid into the blood with unprotected CRISPR/CAS proteins, an immune reaction might stop them. Not all proteins produce an immune reaction. Sometimes just 2-3 proteins of an entire bacterium produce an immune reaction (antibodies). But then again its unlikely the proteins would have edited any genomes in any host cells even so.</p>
https://biology.stackexchange.com/questions/94978/does-immunity-to-crispr-proteins-limit-their-effectiveness
Question: <p>I need to stop some protein from being active and searching for some universal way to do so. In mammalians. </p> <p>With CRISPR it is possible to knock-out the entire gene. But it's a little complicate (need two gRNA for eg.). There are also another reasons, so I need to do this with only one gRNA.</p> <p>So I am thinking about inserting some mutation.</p> <p><strong>My question</strong>: Is there way to make some mutation that will prevent creation of functional protein, with high efficiently - with one gRNA. And without need to know the active site of protein.</p> <p>For example, frame-shift or mutation around start codon? Is it possible? If so, how can I do this? To where I need to send the gRNA?</p> <p>Thanks. </p> Answer: <p>You can do with a single gRNA. All that CRISPR-Cas, ZFN or TALEN systems do is to introduce a double strand break at a specific site. The DNA gets repaired via two mechanisms — non-homologous end joining (NHEJ) and homologous recombination (HR). NHEJ is error prone and it may introduce indels that can compromise with gene function (frameshifts etc). While HR can be used to integrate a transgene or repair a mutation, NHEJ can be used to create mutations. </p> <p>I haven't really knocked out a gene using CRISPR-Cas but it is good to target the initial part of the ORF. There will be many other factors too that will determine what site should be chosen for targeting and an important factor would be the uniqueness of the target sequence. See <a href="https://labnodes.vanderbilt.edu/resource/view/id/5265" rel="nofollow">this</a> site for guidelines on selecting a good target sequence.</p> <p>You would have to do rigorous screening nonetheless; the advantage of insertional knock out is that screening can much be easier (for e.g. by inserting GFP or puromycin-resistance gene).</p> <p>You can have a look at <a href="http://www.sciencemag.org/content/343/6166/84" rel="nofollow">this paper</a> and the supplemental information; they have targeted 18080 genes with a CRISPR-Cas library.</p>
https://biology.stackexchange.com/questions/31928/mutations-deletions-with-crispr
Question: <p>If CRISPR is used to modify the DNA sequence to cure a disease - say MS in a woman - will the RNA guides also modify the sequence in her eggs so her children could be born without MS inherited from her.</p> Answer: <p>First off, CRISPR can't be used to cure diseases in an adult human or, more generally, for any adult vertebrate at present.</p> <p>As you can see in <a href="http://www.nature.com/nrd/journal/v16/n2/full/nrd.2016.238.html" rel="nofollow noreferrer">this paper</a>, a major problem with CRISPR is it has to target specific cell types in tissues. As long as the targets are somatic and not germline, the edits made by CRISPR will not be heritable.</p>
https://biology.stackexchange.com/questions/62675/inheriting-modified-dna-after-crispr-editing
Question: <p>If I'm not mistaken only RNA viruses insert themselves into the host genome. As an example of DNA viruses, herpes viruses for example do not insert themselves in the host genome.</p> <p>Can CRISPR cut DNA that isn't in a chromossome, like a DNA virus?</p> Answer: <p>Yes, this should in principle work, and a number of groups have shows that it works in cultured cells:</p> <blockquote> <p>We found that CRISPR/Cas9 introduced InDel mutations into exon 2 of the ICP0 gene profoundly reduced HSV-1 infectivity in permissive human cell culture models and protected permissive cells against HSV-1 infection.... Combined treatment of cells with CRISPR targeting ICP0 plus the immediate early viral proteins, ICP4 or ICP27, completely abrogated HSV-1 infection. We conclude that RNA-guided CRISPR/Cas9 can be used to develop a novel, specific and efficacious therapeutic and prophylactic platform for targeted viral genomic ablation to treat HSV-1 diseases.</p> </blockquote> <p>--<a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4827394/" rel="nofollow noreferrer">Inhibition of HSV-1 Replication by Gene Editing Strategy</a></p> <p>There's also been at least one trial in an animal model:</p> <blockquote> <p>Using a hydrodynamics-HBV persistence mouse model, we further demonstrated that this system could cleave the intrahepatic HBV genome-containing plasmid and facilitate its clearance in vivo, resulting in reduction of serum surface antigen levels. These data suggest that the CRISPR/Cas9 system could disrupt the HBV-expressing templates both in vitro and in vivo, indicating its potential in eradicating persistent HBV infection.</p> </blockquote> <p>--<a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4221598/" rel="nofollow noreferrer">The CRISPR/Cas9 System Facilitates Clearance of the Intrahepatic HBV Templates In Vivo</a></p>
https://biology.stackexchange.com/questions/81849/can-crispr-also-remove-dna-viruses
Question: <p>I had a quick questions on the size limitations of a CRISPR guide. More specifically on the shorter end. Can I make a guide that is say 7-10bp and still have an active complex? I transfect using an RNP system. </p> <p>Just curious. </p> <p>Thanks in advance. </p> Answer:
https://biology.stackexchange.com/questions/80464/size-constraints-on-crispr-guide-rna
Question: <p>As a critical stage in the CRISPR-Cas9 system, two different mechanisms of DNA repair can occur in the target DNA after RNA has been introduced: non-homologous end joining (NHEJ) and homologous recombination (HR).</p> <p>Can these repair mechanisms be intentionally controlled or manipulated, and if so, what effects do they have on the target DNA? If the repair mechanisms cannot be controlled, how can we determine which mechanism has been employed in the target DNA, and if an undesired repair mechanism has been performed, can it be distinguished from the desired one?</p> Answer: <p>I would recommend reading some basic resources on current Cas9 technologies. <a href="https://www.nature.com/articles/s41434-021-00263-9" rel="nofollow noreferrer">Here is one such review on prime editing</a>, which illustrates one mechanism by which you can force cells to use a favorable precise repair mechanism. The way that you do this is by providing a repair template as part of the guide RNA that can be directly incorporated (see figure illustrating mechanism).</p> <p>Properly, this mechanism uses neither of the two pathways that you mention:</p> <blockquote> <p>Since almost all precise repair strategies generally require repair templates, they must exploit the endogenous HDR machinery, restricted to dividing cells. This has been a bottleneck in therapeutic applications of gene editing, especially for the many neurological diseases involving mutations that affect post-mitotic neurons. However, as [prime editing] bypasses the need for HDR machinery, precise genome substitutions were observed (albeit at low frequency) in primary mouse cortical neurons.</p> </blockquote> <p><a href="https://i.sstatic.net/JRDWn.png" rel="nofollow noreferrer"><img src="https://i.sstatic.net/JRDWn.png" alt="5-step mechanism illustrating how prime editing using a pegRNA with both guide and template included, as well as a reverse transcriptase, can yield a precise genome edit. Figure 1 from Scholefield and Harrison 2021, Gene Therapy." /></a></p> <p>Note that this is only one example of how you can control repair mechanisms. I suggest reading that review (Scholefield and Harrison 2021, <em>Gene Therapy</em>), which includes information on other methods such as base editing.</p> <p>As for distinguishing NHEJ vs HDR, there are a variety of references on this that can easily be found by google, such as <a href="https://www.nature.com/articles/srep23549" rel="nofollow noreferrer">this one</a>. I'd recommend doing some cursory research there as well.</p>
https://biology.stackexchange.com/questions/111668/crispr-cas9-system-dna-repair
Question: <p>I am currently designing a mock CRISPR knock-out experiment, and I’m wanting to insert a plasmid for selection. Using a restriction enzyme at 2750bp for cutting, would the location of the cut site then be considered position 1?</p> <p>I’m wanting to run PCR after insertion to confirm it has been successfully transfected, and I have been supplied PCR primers - would these primer locations have to be shifted to fit in with the new linearised plasmid from location 1 at cut site?</p> <p><strong>E.g</strong> primer at location 3320 would now become location 570 after the plasmid was cut at 2750?</p> <p>I’m very new to this!</p> Answer: <p>No. Plasmids should generally be considered as a circular DNA rather than linear. However, no matter where you cut it, the positions don't change.</p> <p>The position of the cut site is still the position on the plasmid at which the RE cuts. The numbering on plasmids is based on the position of a common restriction site, which depends a bit on which plasmid you are using. For <a href="https://en.wikipedia.org/wiki/PBR322" rel="nofollow noreferrer">pBR322 based plasmids, it is in the middle of an EcoRI site</a>. This is because when plasmids were first discovered and used, we didn't have sequencing so the sequences were determined by restriction fragment mapping. Thus the start site was determined based on the position of a cut site in one of the restriction enzymes.</p> <p>The positions of your primers are relative to the sequence you are inserting - if you are using something like SP6/T7 from the plasmid, those are sites on the plasmid and would be noted as such at the relevant sites when publishing the sequence. If you are sequencing off sites internal to your insert, then you would add on the bases of the plasmid when reporting these sites. You can also report the bases position on the insert; as an example:</p> <blockquote> <p>We inserted gene <em>ABC</em> into plasmid pBR322 between HindIII and EcoRV and sequenced using primer specific to insert <em>ABC</em>, at position XX on the plasmid (YY on the insert).</p> </blockquote> <p>However, if you take your linear (cut) sequence and put it into a sequence manipulation program (e.g. Snapgene, Lasergene, Genious, etc. (no affiliations or recommendations for any of those, just commonly used ones)), then it might annotate your plasmid as having position 1 at the cut site, but this is an artificial annotation based on what you have told the program. If you circularize the sequence, the program may well recognize the plasmid and annotate the sites of interest (e.g. resistance markers, MCS, Ori) correctly with their proper positions marked.</p> <p>Edited to add: Some positions on the plasmid do change once you have put an insert into it. These are the positions after the insert. For example, let's say you have a (hypothetical) plasmid of 500 bp in length, which has a promoter at position 50 and a resistance marker starting at position 300. If you insert a 100 bp fragment at position 250. The plasmid is now 600 bp long, the position of the promoter is still 50, but the resistance marker now starts at 350.</p>
https://biology.stackexchange.com/questions/111705/linearising-plasmids-for-crispr-experiment
Question: <p>I am collecting literature to start a new project on CRISPR/Cas9 gene editing. I must put together a protocol to start and am intending to use the following paper as guidance:</p> <p>"Genome engineering using the CRISPR-Cas9 system". Nature Protocol 8(11):2281-308 · November 2013</p> <p>Could you please indicate whether this is the most reliable and recent published general protocol for the CRISPR/Cas9 system.</p> Answer: <p>It really depends on what you want to do with it. Sticking to genome engineering in Human cells, <a href="http://www.nature.com/nprot/journal/v8/n11/full/nprot.2013.143.html" rel="nofollow noreferrer">Nature Protocol 8(11):2281-308 · November 2013</a> is the de-facto standard. One improvement I suggest is to replace the "Surveyor Assay" with deconvolution analysis of sequencing traces using <a href="https://tide.nki.nl" rel="nofollow noreferrer">TIDE</a>.</p>
https://biology.stackexchange.com/questions/45836/what-is-the-most-up-to-date-crispr-cas9-protocol
Question: <p>I am trying to understand how CRISPR has made the gene knockout or gene editing process simpler to make transgenic animals. Here is an old (pre CRISPR) flowchart from <a href="https://pubmed.ncbi.nlm.nih.gov/18077807/" rel="nofollow noreferrer">Manis, 2007</a> that shows how knockouts can be made. <a href="https://i.sstatic.net/QLUOf.jpg" rel="nofollow noreferrer"><img src="https://i.sstatic.net/QLUOf.jpg" alt="enter image description here" /></a></p> <p>I assume much of this process remains the same even with CRISPR. But I want to understand what part of this flowchart has become easier with CRISPR? Is it that we do not need to wait for a random recombination event to occur? Is it that the yield has increased because we directly cut at the site and ask for HDR to happen rather than just sit and wait for it to happen?</p> Answer:
https://biology.stackexchange.com/questions/100416/how-was-gene-knock-out-done-in-pre-crispr-era
Question: <p>CRISPR-cas9 uses a string of RNA that matches with DNA and makes a double stranded cut at that point. </p> <p>If the RNA is just a few letters in length, the enzyme would cut DNA in many places. It would be unspecific. But if you can make the RNA string very long, it would only cut at the exact place where you want to cut.</p> <p>So how long can you make the RNA sequences? And is this enough to avoid unintended cuts?</p> Answer: <p>The problem of off-targets in CRISPR/Cas is often discussed. It was shown that the system allows mismatches <a href="http://www.nature.com/nbt/journal/v31/n9/abs/nbt.2623.html" rel="nofollow">up to five basepairs</a>. For your question, if it is helpful to elongate the gRNA: it was shown that <a href="http://www.nature.com/nbt/journal/v32/n3/abs/nbt.2808.html" rel="nofollow">truncating the RNA</a> enhances the specificity more than elongating (<a href="http://www.nature.com/nbt/journal/v33/n2/abs/nbt.3117.html" rel="nofollow">see also here</a>). </p> <p>So what can we do? Well, there are different methods to improve the specificity. The simplest may be the usage of <a href="http://www.nature.com/nmeth/journal/v11/n10/full/nmeth.3108.html" rel="nofollow">lower dosages</a> of the CRISPR/Cas system. Another method is to use <a href="http://www.nature.com/nature/journal/v523/n7561/full/nature14592.html#affil-auth" rel="nofollow">altered PAM motifs</a>.</p> <p>A more complicated method is to convert the <a href="http://www.sciencedirect.com/science/article/pii/S0092867413010155" rel="nofollow">Cas9 into a nickase</a>. In this strategy you would use two different gRNAs for two different target sites and introduce ssbreaks. A modification of this method is to completely knock-out the enzymatic activity of Cas9 and fuse it to a <a href="http://www.nature.com/nbt/journal/v32/n6/full/nbt.2908.html" rel="nofollow">FokI nuclease</a> which will cut the DNA only when it dimerizes.</p> <p>There are several advantages in these methods, however, you may also loose on-target effects.</p> <p>There is another method which, in my opinion, is really awesome. It is possible to alter the energetics of the DNA binding site resulting in high-fidelity variants of Cas9 (<a href="http://science.sciencemag.org/content/351/6268/84" rel="nofollow">HF1</a> and <a href="http://www.nature.com/nature/journal/v529/n7587/full/nature16526.html" rel="nofollow">HF2</a>)</p> <p>So, I hope I could help you. There are other and even more effective ways to increase CRISPR/Cas specificity instead of altering the gRNA. If you're interested, have a look on the references. </p>
https://biology.stackexchange.com/questions/49106/how-specific-are-crispr-cas9-cuts
Question: <ol> <li><p>Theoretically speaking, can you insert the gene sequences for cas9, sgRNA, and promoters into the host genome so that the cell perpetually produces CRISPR components?</p> </li> <li><p>In this scenario, I'm guessing there would be no way to have the host cell produce DNA templates for HDR?</p> </li> <li><p>How long do CRISPR plasmids last in the nucleus and is there any way have them persist for 10+ days?</p> </li> </ol> Answer:
https://biology.stackexchange.com/questions/111231/can-the-genetic-sequences-for-crispr-components-be-inserted-into-the-host-genome
Question: <p>While at school, I learnt about restriction enzymes and how you could insert foreign DNA into an organism.</p> <p>When I first heard about CRISPR I thought it was very similar except much more precise/targeted.</p> <p>It seems however that CRISPR only allows editing (substituting nucleotides)</p> <p>What are the differences, advantages, etc?</p> Answer: <p>Bacteria and archaea evolved CRISPR as part of their adaptive immune system to protect themselves from invading viruses and foreign plasmids. The defence system relies on small, non-coding RNA molecules (CRISPR RNAs/guide RNA) that in association with a CRISPR associated (Cas) protein silence foreign sequences by means of cleavage. Twenty nucleotides at the 5’ end of the CRISPR RNA, corresponding to the protospacer region, direct the Cas9 protein to a specific sequence within the DNA using predictable Watson and Crick base pairing between the target DNA and the guide RNA, triggering enzymatic cleavage of the foreign DNA. Essential for cleavage is the presence of a sequence motif immediately downstream of the target region, known as the protospacer-adjacent motif (PAM),the PAM sequence in S. pyogenes (the most widely used system) is NGG. Because a sequence match also exists between the guide RNA and the host’s DNA that encodes it, it is vital that the guide RNA identifies bona fide targets without attacking the host chromosome. Discrimination between the target and host protospacer is achieved by the Cas effector recognition of a PAM sequence that initiates binding and cleavage of the foreign DNA. Changing the DNA target site that is specified by the 20 nucleotides at the 5’ end of the guide RNA redirects the system to target a different DNA sequence, making it a highly versatile and programmable tool. In 2012, the CRISPR system was programmed to cleave specific DNA sites in vitro and since then, the system has been widely used in many gene modification applications.</p> <p>CRISPR allow so much more than just substituting nucletodies. Like you say, CRISPR is a much more precise system than restriction enzymes, the guide RNA for CRISPR systems is typically around 20 nucleotides long so it can theoretically be used to target a unique site in the genome (4^20 = 10^12, so only the recognition site is expected to feature once 1 in 10^12 bases, N.B. the human genome is only 3x10^9 base pairs in size).</p> <p>There are several options using the CRISPR with an active Cas9 protein, the first is to create a gene knockout, which removes the function of a gene. Gene knockouts can be performed by targeting the CRISPR-Cas9 system to the start of the gene and cleaving both strands of the DNA to generate a double stranded break which will be repaired most likely by the cellular repair pathway non homologous end joining (NHEJ). NHEJ results in insertions or deletions and so will most likely result in a frameshift mutation which alters a large amount of the amino acid sequence in the gene or introduces an early stop codon, so the protein produced is non functional. Alternatively a conserved residue (e.g. a catalytically important residue) in the protein can be targeted and mutation of this can remove the catalytic function or recognition domain in an enzyme or protein. NHEJ can also be used to mutate DNA that codes for RNA products. Additionally, the CRISPR system can be targeted to regions outside of the coding sequence such as the promoter or enhancers and silencers/operators (depending on whether prokaryotic or eukaryotic), which can also remove the functionality of the gene.</p> <p>The CRISPR system can also be introduced to the cell together with a single-stranded or double-stranded DNA template to make very small and precise changes to the DNA (e.g. single base mutations), or insert DNA sequences up to thousands of bases in length so that entire genes can be incorporated into the target region. This more precise editing method also involves the double stranded break formation by the cas9 protein, but relies on different cellular repair pathways: homology directed repair, the most common form of which is homologous recombination. Importantly, the template DNA must have homologous sequences to the DNA flanking either side of the double stranded break. In the presence of the correct exogenous DNA template, homology directed repair can occur in which the exogenous template DNA is incorporated into the target DNA in exchange for the damaged DNA. </p> <p>Other use of CRIPSR include using a catalytically inactive cas9 protein (dead Cas9). This system is unable to cleave DNA, but is still able to target specific sites in the DNA. dead Cas9 can be fused to or recruit effector proteins for regulating gene expression at the transcriptional level, as well as guiding enzymes capable of precise base editing without introducing double stranded breaks. The dead cas9 system can be fused to transcription repressor domains such as the Krüppel-associated box (KRAB) or transcriptional acitvators such as VP64 for effective and specific repression or activation of gene expression at sites that don't contain recongion sequences for these effectors. dead Cas9 can also be used to recruit epigenetic modifitying enzymes such as methylases and acetylases to regulate gene expression this way. Additionally, this system can be fused to DNA base editors, which are enzymes created by directed evolution that are capable of causing efficient and specific point mutations in DNA and RNA (this is much more specific and effective than point mutations using homology directed repair), although RNA editing required using cas13.</p> <p>Gene editing can be used to repair disease causing mutations, introduce new genes with novel functions into organisms' genomes, transiently alter gene expression to treat diseases; create knockout, knockdown and knock in strains for studying the effects of genetic factors on phenotype and even more.</p> <p>In contrast, restriction enzymes typically have recognition site of 6 nucleotides and so they will cut at many orders of magnitude more sites than CRISPR will (4^6 = 4096, so 1 in 4096 nucleotides are expected to be a cut site for restriction enzymes) so they are not suitable for specific editing of genomes as they will cause non specific fragmentation of genomic DNA, which will kill the organism, so CRISPR is a much better enzyme for editing genomes. Instead, restriction enzymes are used in molecular cloning to generate sticky overhangs (or blunt ends) for the assembly of DNA molecules to generate recombinant DNA.</p> <p>Although the PAM appears to limit the number of target sites that the CRISPR system can be targeted to (around 1 in every 16), through directed evolution, a Cas9 variant with increased PAM compatibility has been developed. This new Cas9 is capable of recognizing PAM sequences including NG, GAA, and GAT, this makes it more versatile and greatly expands the number of targets available for site-sensitive genome editing applications.</p> <p>Whilst CRISPR based gene editing is very exciting, a lot of work is still needed to: increase the specificity of the system as it causes numerous off site mutations, which can be lethal to cells; to increase the effectiveness of delivery of the system in vivo to large organisms such as humans; to reduce the immunogenicity of the system (it can trigger an immune response in humans) so that it is safe to use; as well as increase our understanding of the affect of making specific mutations in humans (e.g. which mutations can treat diseases safely).</p> <p>References/further reading: </p> <p>Jinek, M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science (80-. ). 337, 816–821 (2012).</p> <p>Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression. Cell 152, 1173–1183 (2013).</p> <p>Liu, X. S. et al. Editing DNA Methylation in the Mammalian Genome. Cell 167, 233–247.e17 (2016).</p> <p>Zalatan, J. G. et al. Engineering complex synthetic transcriptional programs with CRISPR RNA scaffolds. Cell 160, 339–50 (2015).</p> <p>Hu, J. H. et al. Evolved Cas9 variants with broad PAM compatibility and high DNA specificity. Nature (2018). doi:10.1038/nature26155</p> <p>Cox, D. B. T. et al. RNA editing with CRISPR-Cas13. Science (80-. ). 358, 1019–1027 (2017).</p>
https://biology.stackexchange.com/questions/88193/whats-the-difference-between-traditional-genetic-engineering-and-and-crispr
Question: <p>One confusing thing I have found when reading articles about possible CRISPR based gene therapy treatments in humans is that there is vey little discussion about what percentage of your cells will actually have their DNA edited, the rate at which the editing takes place, and how to quantitatively estimate how many edited cells would be needed to "cure" a specific disease. (It's not so confusing how edits could be made to a small embryo, what's confusing is what is actually possible for grown patients)</p> <p>Can someone provide a few basic facts that calibrate what is currently possible and what is needed. </p> <p>For instance, is it currently possible to edit more than 50% of the cells of an adult nematode (or more complicated organism) using CRISPR? How long does it take (minutes, hours, days, weeks).</p> <p>For the current list of human diseases that are possible targets for gene therapy, how many cells need to be edited for one of those diseases to be "cured" (hundreds, thousands, billions, etc)</p> <p>But in general is there a name for the mathematical models that try to predict how many cells will end up being edited, how those edited cells will multiply and replace diseased tissue, and how many edits are needed to generate a concentration of missing protein for a treatment to be successful?</p> <p>cheers!</p> Answer: <p>There are several probabilities that you need to take into account. </p> <ul> <li>The efficiency of DNA transformation of CRISPR encoding DNA and target DNA into the host cell (varies between cell types and transformation agent).</li> <li>Efficiency of cutting by CRISPR at target site. (varies by DNA compaction - which varies by site and cell type, and guide RNA) </li> <li>Number and cutting efficiency at off targeting sites. </li> <li>Efficiency of degradation of free DNA by cellular antiviral systems (varies between cell types)</li> <li>Efficiency of DNA repair machinery to fix dsDNA breaks. (thus removing CRISPR cut sites. Varies by cell type)</li> <li>Efficiency of recombination machinery (homologous recombination and microhomologous recombination) (which is used to insert new DNA sequence). </li> <li>Probability of NHEJ damaging target site. (which can delete the CRISPR cut site)</li> </ul> <p>Too many things to count. </p> <p>However to give you some idea. The efficiency of CRISPR making a correctly targeted knock in for DT40 (chicken lymphoma) is ~1% of all resistant colonies (ie colonies that have taken up the DNA seq used to make the knock in), when lipofectamine reagents are use. Lipofectamin trasfromation efficiency varies depending on the size of the transformed DNA, host cell type and plating density. So for a 5kb construct that transformation efficiency varies between 30%-50%. </p> <p>CRISPR is nearly 100% efficient in yeast cells, ie all knock in cells are correctly targeted. This is likely due to the high levels of HR in yeast</p>
https://biology.stackexchange.com/questions/74171/mathematical-models-of-gene-editing-using-crispr
Question: <p>Can CRISPR-Cas9 make changes on a living organism? What's the limit here? E.g. reversing/restoring hearing loss in a living adult mice.</p> Answer: <p>Answer is yes, but it depends on which kind of phenotype you're going to restore/change. As you can imagine, using crispr cas9 on an high amount of cells require one condition: edited cells need to have a clear advantage in surviving besides the previous. </p> <p><a href="https://www.nature.com/articles/nbt.2884" rel="nofollow noreferrer">Here's an example of a crispr-cas9 protocol</a> followed to restore a wildtype phenotype in adult mice. </p>
https://biology.stackexchange.com/questions/66782/can-crispr-cas9-make-changes-on-a-living-organism
Question: <p>I am currently reading an article about a particular assay of Cas9 nucleases. In one of the experiments, they have used ApoCas9 (Apo variants of other CRISPR nucleases) as some sort of control. </p> <p>But the whole article they have not defined ApoCas9? I did check online of definition and activity of ApoCas9, but came across without any fruitful results.</p> <p><a href="https://pubs.rsc.org/en/content/articlepdf/2019/sc/c8sc03426e" rel="nofollow noreferrer">A universal method for sensitive and cell-free detection of CRISPR-associated nucleases</a></p> Answer: <p>In general, "apo" is used to indicate an <a href="https://en.wikibooks.org/wiki/Structural_Biochemistry/Enzyme/Apoenzyme_and_Holoenzyme" rel="nofollow noreferrer">apoenzyme</a> — that is the protein part of an enzyme without essential cofactor(s). </p> <p>This is actually defined in the <strong>Experimental</strong> section of the paper:</p> <blockquote> <p>Cas9/Cpf1 without gRNA (ApoCas9/Cpf1)</p> </blockquote> <p>So, in this case ApoCas9 is Cas9 endonuclease that is not bound to a guide RNA.</p>
https://biology.stackexchange.com/questions/85949/what-is-apocas9-in-the-crispr-cas9-system
Question: <p>I've been researching into the biohacking world where people most notable <a href="https://en.wikipedia.org/wiki/Josiah_Zayner" rel="nofollow noreferrer">Josiah Zayner</a> and <a href="https://www.bbc.com/news/world-us-canada-41990981" rel="nofollow noreferrer">Tristan Roberts</a> have used a CRISPR solution developed in their backyard for gene therapy.</p> <p>There is even a <a href="http://www.the-odin.com/diyhumancrispr/" rel="nofollow noreferrer">CRISPR guide</a> floating online for the curious, published by Zayner's startup.</p> <p>However, the guide doesn't help us identify the injection sites in the human body to deliver the solution. Zayner injected Myostatin in his arm muscle.</p> <p>Another biohacker's Youtube video describes making a pill for targeting stomach cells in a bid to cure lactose intolerance "<a href="https://www.youtube.com/watch?v=J3FcbFqSoQY" rel="nofollow noreferrer">Developing a Permanent Treatment for Lactose Intolerance Using Gene Therapy</a>"</p> <p>In general, how does one determine the most suitable site and or methodology for administering CRISPR in the human body that is appropriate for the gene and/or condition we are targeting? </p> <p>EDIT: Personally, in my case, the gene of interest is <a href="https://en.wikipedia.org/wiki/ABCC11" rel="nofollow noreferrer">ABCC11</a>. I do note that most CRISPR (or any other gene therapy technique for that matter) attempts may target conditions involving more than one gene. However, why I think this gene and its associated conditions is unique is due to the fact much is written online about the effects of a single gene mutation in this particular gene. A paragraph on Wikipedia states:</p> <blockquote> <p>Physical human traits that are controlled by a single gene are uncommon. Most human characteristics are controlled by multiple genes (polygenes) although ABCC11 is a peculiar example of a gene with unambiguous phenotypes that is controlled by a SNP. Additionally, it is considered a pleiotropic gene.</p> </blockquote> <p>Official Pubmed documentation : <a href="https://www.ncbi.nlm.nih.gov/pubmed/16444273" rel="nofollow noreferrer">A SNP in the ABCC11 gene is the determinant of human earwax type.</a></p> Answer: <p>Creating changes in the genome in order to get your favorable results is not always as easy as it looks. Expression of a particular gene is not necessarily bound to its existence. There are other factors (mainly proteins) that have to be in the cell at the right time to make that gene expressed. Yet a trait is not always the result of one gene being expressed. So basically adding <strong>one gene</strong> will never give you bigger muscles and still, this is not really why performing gene editing in your garage is absurd. (Yes those videos are just hoaxes.)</p> <p>In order to have a CRISPR/Cas9 system work, you gotta send both the Enzyme Cas9 and the guide RNA into the cell. You can't inject proteins or RNA directly to a cell or expecting cells to uptake them from the bloodstream. The gene constructs for both guide RNA and Enzyme have to be added to a vector which is mostly a virus. The virus had specific receptors on its envelope which help it to target the right cell to infect then viral genome will be inserted into the infected cells and thus they receive the genes that will express CRISPR/Cas system. Designing the gRNA, viral vector and engineering the virus for the specific target cells and applying the virus to the tissue requires precise and professional skill and a decent lab. By no means works done by those guys can lead to verified and trusted consequences. I recommend reading <a href="https://www.broadinstitute.org/research-highlights-crispr" rel="nofollow noreferrer">this</a> if you are interested in gene therapy and CRISPR/Cas.</p>
https://biology.stackexchange.com/questions/81004/diybio-crispr-injection-sites-for-targeting-the-abcc11-gene
Question: <p>I need some help about Crispr / Cas9. The CRISPR/Cas9 technic consists (for bacterias) in "cut" bacteriophage's DNA, in order to make it unfunctional. When the RNA is transcribed (RNA which is complementary to the bacteriophage's DNA), it will be associated with crRNA and tracrRNA to form the sgRNA (single guide RNA). But I would like to know where crRNA and tracrRNA are from? and what are their function(s)/ goal(s).</p> <p>Sorry If I made mistakes I'm French.</p> Answer: <p>I have also been wondering the same thing for a while now and I think that the best answer that I could find after reading several review papers on CRISPR/Cas9 and online information, points to tracrRNA as serving the role of multiplexing with pre-crRNA which helps pre-crRNA mature to crRNA. This process activates the crRNA. I'm not exactly sure how this multiplexing action "matures" the pre-crRNA or what exactly that even means, but that is as much insight as the literature provides (see e.g. <a href="https://www.biochemistry.org/Portals/0/Conferences/abstracts/SA148/SA148P039.pdf" rel="nofollow noreferrer">this</a> abstract to a conference talk).</p> <p>There most likely are some more important functions that have not yet been discovered for tracrRNA yet.</p>
https://biology.stackexchange.com/questions/58400/functions-of-tracrrna-and-crrna-in-the-crispr-cas9-system
Question: <p>I've been out of Biology for about a year polishing my programming skills. I know CRISPR/Cas9 allows targeted 'cutting' of DNA via RNA-guidance. Few questions regarding this.</p> <ol> <li><p>Regarding to its natural phenomenon, when a virus infects a microbe with CRISPR capabilities, how does the genome get integrated into the 'spacers' of CRISPR region versus elsewhere of the prokaryote genome so that when transcribed, the Cas enzymes know that it's a foreign DNA element to be targeted? My understanding of virus infections is a little cloudy too; I'm thinking random transpositions.</p></li> <li><p>I'm looking into it now, so I may figure this out before someone answers, but when the target DNA is located via the guiding RNA, where does the Cas9 enzyme decide to 'cut' -- rendering it useless -- the DNA, and how does it identify the location? </p></li> </ol> <p>-EDIT- Ah. The target sequence must also include a 'PAM' sequence downstream (Protospacer Adjacent Motif), which allows binding of the riboprotein complex(guiding RNA + Cas9), and biochemistry magic cuts it ~3-4 bases upstream of the PAM). citation: <a href="https://www.addgene.org/CRISPR/guide/" rel="nofollow">https://www.addgene.org/CRISPR/guide/</a></p> <ol start="3"> <li>Just thought of another question, if the DNA is cut at the seemingly specific spot, is the DNA repair that ensues downstream totally random? I feel like it would be in the organism's best interest (anthropomorphogenic, oops), and evolution generally says it usually does, to have a mechanism to repair it to its original state.</li> </ol> Answer: <p><a href="http://www.nature.com/nbt/journal/v32/n4/full/nbt.2842.html" rel="nofollow noreferrer">This paper</a> should clear up a lot more than anyone on here truly can about the CRISPR system.</p> <p>CRISPR/Cas9 is very unique, even compared to other proteins purified from bacteria like Taq Poly.</p> <p><a href="https://i.sstatic.net/I4vNh.jpg" rel="nofollow noreferrer"><img src="https://i.sstatic.net/I4vNh.jpg" alt="enter image description here"></a></p> <p>The reason is due to how complex it is actually induce this protein. Essentially <a href="https://www.systembio.com/images/Cas9-smartnuclease-vectors.jpg" rel="nofollow noreferrer">you are transfecting a plasmid with the Cas9 protein and its guide RNA (gRNA) on the vector.</a> Transfecting itself is not easy, not to mention you are essentially adding a mechanism to a cell trying to knockout genes and you've got a handful. In fact doing that for one cell line, and noting the effects of what you knocked out, would be enough to produce a paper in a pretty impactful journal. (Image from: <a href="https://www.systembio.com/" rel="nofollow noreferrer">https://www.systembio.com/</a>)</p> <p>Also some recent advancements in CRISPR include:</p> <ul> <li><a href="http://www.nature.com/nchembio/journal/v11/n3/full/nchembio.1753.html" rel="nofollow noreferrer">Light-induced CRIPSR/Cas9</a> (easier regulation of enzymatic activity)</li> </ul> <p>Basically these researchers were trying to deduce a method allowing for more control of the CRISPR technique, since CRISPR has had issues with off-target effects. While it isn't a change in how CRISPR works, or even where, the change is how much you can control the reaction. Simply put they devised a way that allows you to turn CRISPR on/off using light allowing more precise control of its activity. Surely it will be helpful to reduce off target effects.</p> <p>"This was accomplished by fusing the light-inducible heterodimerizing proteins ​CRY2 and ​CIB1 to a transactivation domain and the catalytically inactive d​Cas9, respectively." (Lauren R Polstein &amp; Charles A Gersbach)</p> <ul> <li><a href="http://www.technologyreview.com/news/541681/new-crispr-protein-slices-through-genomes-patent-problems/" rel="nofollow noreferrer">Cpf1 to replace Cas9 as cutting protein</a> (more percise activity)</li> </ul> <p>This one is a bit more interesting in that it is a direct change to the CRISPR system itself. Cas9 has been the standard cutting protein used for the CRISPR system although it has had controversy due to its somewhat imprecise cutting. Cpf1 has been shown to be more precise (so their data says) and it is now being implemented by some to see if this is truly the case. Combined with the above "light-induced" system this brings CRISPR down to safer levels when talking about off-target effects.</p> <p>Here are some good online seminars to get you started:</p> <ol> <li><a href="http://labroots.com/webinar/id/73" rel="nofollow noreferrer">CRISPR/Cas9 from start to finish</a></li> <li><a href="https://www.labroots.com/ms/webinar/id/145/ge-dharmacon-baskin-sept29" rel="nofollow noreferrer">Improve CRISPR-Cas9 experiments with rationally designed guide RNAs</a></li> </ol> <p>These seminars I can't really comment directly on because they explain everything so well on their own. Anything I say really will only detract from what they are teaching since I am by no means an expert with CRISPR but simply someone who is looking into possibly using it for my lab. Right now there is a lot of guide material on how to properly format your CRISPR experiments but my personal opinion is to give the technique maybe a year or two more when it is more standard for research.</p> <p>That is unless you want to directly research the method and improve it in your own way.</p> <p>Let me know if this answers your questions sufficiently.</p> <p>Sorry that I cannot do much more in terms of explaining the links. The studies are not ones I can easily access unless I am at work since I usually access them through the university.</p> <p>As far as the repair mechanism goes (your #3 question) I can't really answer that for sure but I have recently received a pamphlet that describes how to ensure the cells uses HJ rather than NHEJ.</p>
https://biology.stackexchange.com/questions/40576/in-crispr-bacteria-how-does-viral-genomes-get-integrated-into-the-spacers-of-cr
Question: <p>I would like to insert a 1500 bp or longer gene to the broken site in E.coli (or may be <em>bacillus subtilis</em> which support NHEJ) after cut with Crispr-Cas9. Is this possible for both NHEJ or HDR?</p> Answer:
https://biology.stackexchange.com/questions/79267/can-crispr-cas9-be-used-to-insert-a-large-gene
Question: <p>I am new to the CRISPR Cas9 genome editing system and I have the above basic question.</p> <p>Another way to think about this: what would happen if after cells are transfected, the cultures are left to grow without any selection. Thus, if a mutation disrupts a cell cycle gene (e.g. p53), such cells will proliferate more and the culutre will be populated by those cells rather than healthy cells.</p> <p>Is this a valid reasoning?</p> Answer:
https://biology.stackexchange.com/questions/46094/why-selecting-cells-after-gene-editing-with-crispr-cas9
Question: <p>I am trying to knockout huntingtin gene from HeLa cells (human epithelial cells). I used CRISPR explorer and benchling.com to determine the best guide RNA sequence that would bind to the target DNA sequence and cas9 could then make the cut. The gRNA I have is as follows:</p> <p>GGAGGCCTCGGGCCGACTCG Strand (-)</p> <p>The next step for me is to design the primers with the following sticky ends</p> <p>Forward primer: 5'-TTGTTGN(19)-3' Backward primer: 3'-ACN(19)AAA-5'</p> <p>The problem I'm having is writing the oligonucleotide sequence of the primers. Since the gRNA strand is negative, I'm assuming it's a 3'-5' sequence, hence the reverse of it will be the 5'-3' sequence, which I can then just use as the forward primer. Sequentially, I can take the reverse and complement of this forward primer sequence to then determine the backward primer. Is that correct? I appreciate all your help.</p> <p>Thank you!</p> Answer: <p>A quick check with BLAST returned the following result:</p> <pre><code>Homo sapiens huntingtin (HTT), mRNA Sequence ID: NM_002111.7Length: 13669Number of Matches: 1 Related Information Gene-associated gene details GEO Profiles-microarray expression data PubChem BioAssay-bioactivity screening Range 1: 267 to 286GenBankGraphicsNext MatchPrevious Match Alignment statistics for match #1 Score Expect Identities Gaps Strand 40.1 bits(20) 0.017 20/20(100%) 0/20(0%) Plus/Minus Query 1 GGAGGCCTCGGGCCGACTCG 20 |||||||||||||||||||| Sbjct 286 GGAGGCCTCGGGCCGACTCG 267 </code></pre> <p>The sequence you have is 5'-3' and it matches the Minus strand on the human genome. <strong>You don't need to reverse the sequence!</strong></p> <p>Here is a screenshot from IGV showing the gRNA sequence matching the minus strand of the HTT gene.</p> <p><a href="https://i.sstatic.net/DJmA0.png" rel="nofollow noreferrer"><img src="https://i.sstatic.net/DJmA0.png" alt="enter image description here" /></a></p>
https://biology.stackexchange.com/questions/59627/crispr-guide-rna-design-and-primer-synthesis
Question: <p>From what I understand, in a CRISPR cas9 complex, gRNA is comprised of tracrRNA and crRNA. I've read that crRNA is the part which is matched to the DNA which is targeted, but what role does tracrRNA play in the process? That I'm not clear about. Also, unless this should be its own question; how is gRNA prepared with cas9 protein? Does the protein automatically bind to certain RNA strands?</p> Answer: <p>Your two questions are related and you are correct in your supposition that the Cas9 protein associates to a specific RNA sequence. That of the tracrRNA processed with the crRNA into a gRNA. This is achieved without any other aid so could be considered to do so automatically. How specific the tracrRNA sequence needs to be is an interesting and often overlooked question. </p> <p>When comparing tracrRNA from different species it is clear that there is not a lot of sequence conservation but they are predicted to be contain similar secondary structures. </p> <p>Matching tracrRNA and Cas9 from closely related species does result in <em>in vitro</em> DNA cleavage but this does not work with more distantly related species. Nevertheless they are remarkably versatile and this has been exploited in a number of exciting genome engineering applications where additional structures are added without compromising the binding of the RNA to the Cas9.</p> <p>The tracrRNA and the crRNA together form the gRNA which targets the Cas9 protein to the location of cleavage. In the endogenous bacterial systems the gRNA takes the form of a processed RNA duplex but in the genome editing implementations this takes the form of a single chimeric RNA with the two components already fused together. </p> <p>When it comes to actual cleavage of DNA it is important that the Cas9 is in the correct conformation and changes in this are known to occur when binding to the target DNA. Recent work suggests the tracrRNA plays a role in maintaining the Cas9 protein in an active form allowing it to be able to target DNA. </p> <p>It likely also contributes to the overall stability (and thus efficiency) of the CRISPR-Cas9 complex.</p> <p>Ultimately the tracrRNA is an essential component of the CRISPR-Cas9 system via it's role in both guiding the Cas9 protein to its target and aiding it's function.</p> <p>The following references might be of interest to you:</p> <p><a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3737331/#!po=47.0109" rel="nofollow noreferrer" title="The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems">The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems</a></p> <p><a href="http://m.nar.oxfordjournals.org/content/early/2016/10/12/nar.gkw908.full.pdf&amp;ved=0ahUKEwj1teLIz6DRAhUKo5QKHcq2D58QFgg8MAM&amp;usg=AFQjCNHWrbtZ0ltKHSc0ltLIHY_Fyz-Deg" rel="nofollow noreferrer" title="Guide RNA engineering for versatile Cas9 functionality">Guide RNA engineering for versatile Cas9 functionality</a></p> <p><a href="http://www.nature.com/articles/ncomms13350" rel="nofollow noreferrer">Structural roles of guide RNAs in the nuclease activity of Cas9 endonuclease</a></p>
https://biology.stackexchange.com/questions/54690/what-is-the-role-of-tracrrna-in-crispr-cas9
Question: <p>I'm a student started who has started learning about CRISPR/Cas9. As I understand it, CRISPR/Cas9 is an enzyme that is used to cut a gene at a specific sequence. I would like to know how scientist do the next step to insert/edit a genome.</p> <p>For example, say I have an original sequence ...AAATTT... Is it possible for me to insert a new sequence into the middle so it becomes like this: ...AAA<strong>GCGCGC</strong>TTT... ? Or is it possible for me to edit a single nucleotide of the sequence like this : ...AA<strong>C</strong>TTT... ?</p> <p>How is a new sequence inserted at the cut region? Is there any enzyme required to make them join each other? How is it ensured that the sequence is not inserted or joined at the wrong position ?</p> Answer: <p>Cas9 is used to create a double-stranded break (DSB) in genomic DNA. The cell can then use <a href="https://en.wikipedia.org/wiki/Homology_directed_repair" rel="nofollow noreferrer">homology directed repair (HDR)</a> to repair the break. The cell can also use <a href="https://en.wikipedia.org/wiki/Non-homologous_end_joining" rel="nofollow noreferrer">non-homologous end joining (NHEJ)</a> to repair DSBs, but this isn't useful for inserting specific sequences. In HDR, a sequence homologous to either side of the break site is used as a template so that the break can repaired error free. Naturally, the homologous template could be a homologous chromosome or replicated copy of the broken chromosome.</p> <p>However, consider a situation where you introduce DNA into the cell with regions of homology to the break site and whatever other sequence(s) you wish to insert/delete/change. In this case, the break can be repaired using this exogenous DNA as a template and your changes will then be incorporated into the genome.</p> <p>There are other methods of introducing site-specific DSBs to the genome, such as <a href="https://en.wikipedia.org/wiki/Transcription_activator-like_effector_nuclease" rel="nofollow noreferrer">TALENs</a>. The big advantage of CRISPR/Cas9 is that site recognition is performed by RNA rather than protein (it is much easier to synthesize small RNAs than to engineer large proteins).</p>
https://biology.stackexchange.com/questions/50562/how-to-edit-insert-new-gene-after-cutting-with-crispr-cas9
Question: <p>Can gene knockout (e.g. by CRISPR) be referred to as gene inhibition? I am trying to use precise words for a manuscript. We first showed siRNA of a gene has effect X. We also found knockout of the gene has the same effect. For the MS, could I say:</p> <p>Knockout of the gene showed effect X, confirming inhibition of the gene causes X.</p> Answer: <p>Looking to a standard source of definitions, the <a href="https://www.ebi.ac.uk/sbo/main/SBO:0000169" rel="nofollow noreferrer">Systems Biology Ontology definition of inhibition</a> is &quot;Negative modulation of the execution of a process.&quot;</p> <p>As such, it doesn't really make sense to talk about inhibiting a <em>gene</em> per se. What people are actually doing when they say that is using a shorthand to describe inhibiting either the <em>expression</em> of the gene or the <em>activity</em> of its product.</p> <p>siRNA fits this quite well, as there you are talking about inhibiting gene expression. Knockout, on the other hand, means the gene isn't there to have its expression inhibited.</p> <p>I would thus recommend not referring to knockout as inhibition. A better phrasing of your sentence above might be: &quot;Knockout of the gene showed effect X, consistent with the prior result in which siRNA inhibition of the gene also produced effect X.&quot;</p>
https://biology.stackexchange.com/questions/104967/can-crispr-knockout-of-a-gene-be-referred-gene-inhibition
Question: <p>I've been reading up a bit on the CRISPR-Cas9 system for gene manipulation. From what I read, it introduces double-strand breaks at specific points determined by the choice of sgRNA. But how do you get from double-strand breaks to editing genes in incredibly specific ways? As far as I read you can fix point mutations, insert whole genes or disable genes with CRISPR-Cas9. How do you specify which kind of repair mechanism is invoked?</p> Answer: <blockquote> <p>But how do you get from double-strand breaks to editing genes in incredibly specific ways?</p> </blockquote> <p>You should read the wikipedia page on CRISPR-Cas system. The target specificity is provided by the tracrRNA. </p> <blockquote> <p>How do you specify which kind of repair mechanism is invoked?</p> </blockquote> <p>The repair can be done either by Non Homologous End Joining (NHEJ) or Homologous Recombination (HR). If you provide excessive DNA template by transfection then it is likely to increase the chance of HR and this can be used for trangenesis. </p> <p>When no template is provided then DNA can be repaired by HR with sister chromatin or NHEJ. Depending on the stage of the cell cycle one of these mechanisms is preferred over the other. HR is <a href="http://www.ncbi.nlm.nih.gov/pubmed/18769152" rel="nofollow">shown</a> to be the most active in S-phase and starts declining in G2-phase. </p> <p>So when you want to make transgenics or specific edits then co-transfect CRISPR-Cas with transgene DNA (with flanks homologous to target DNA sequence) or a homologous DNA with point mutation(s), preferably in cells at S-phase. It is possible to synchronize the cells using nocodazole or other molecules that arrest cell cycle.</p>
https://biology.stackexchange.com/questions/29735/how-is-the-type-of-genetic-manipulation-determined-in-crispr-cas9
Question: <p>Although I believe there is a good reason -- or reasons -- why this theory, that CRISPR could disable the genes for division in cancerous cells, is incorrect, I haven't been able to find them.</p> <p>In short, the theory is that multiplexed CRISPR could knock out the genes responsible for cellular division (mitotic and meiotic genes) and thereby prevent the uncontrolled division of the cancer cells.</p> <p>I understand that off-site edits, multiple mitotic and meiotic pathways, and the resiliency of cancer are difficulties, but in theory the idea makes sense.</p> <p>Obviously, if the theory would work, probably someone would have done it already, so there must be a good reason why this won't work. Please could someone explain it to me? Please let me express my gratitude for your consideration in advance!</p> Answer: <p>As with all cancer therapeutics one of the biggest problems is how you get the therapeutic to kill cancer cells without also killing so many healthy cells that the therapy kills the patient.</p> <p>For CRISPR to work you have to get the CRISPR components into the target cells. Right now this is done using relatively harmless viruses like adenoviruses. The viruses &quot;smuggle&quot; the CRISPR components into the cells as they infect them. <a href="https://www.nature.com/articles/s41392-023-01309-7" rel="noreferrer">Nanoparticle containers are being researched as an alternative</a> to viruses. The problem with your proposed therapy is that there is no way to target the viruses only at the cancer cells. You'd end up shutting down the cell division genes in healthy tissues too. Turning off cell division of a bunch of your healthy tissues is likely to kill you. There is also no way to ensure that <em>all</em> of the cancer cells would pick up the CRISPR components. You leave a few cells behind and the cancer quickly comes back.</p> <p><a href="https://www.mskcc.org/news/crispr-edited-car-cell-therapy-clinical-trial-lymphoma" rel="noreferrer">Currently the most promising CRISPR cancer therapies are aimed at enhancing immune therapies</a>. You take blood/bone marrow from the patient, sort out the immune T-cells, edit their genome using CRISPR to enhance their ability to identify and kill cancer cells, then inject them back into the patient. The result is hopefully a robust, ongoing immune attack on the cancer cells.</p>
https://biology.stackexchange.com/questions/113734/could-multiplexed-crispr-disable-the-mitotic-and-meiotic-genes-of-cancerous-cell
Question: <p>Here's a silly idea I had this morning:</p> <ol> <li>Sequence a bunch of normal patient cells.</li> <li>Sequence a bunch of tumor cells from a biopsy.</li> <li>Find a DNA sequence that we're reasonably certain exists in the cancer cells but doesn't exist in normal cells.</li> <li>Create a guide DNA that matches the sequence identified in (3).</li> <li>Send in a <a href="https://www.nature.com/articles/s41598-019-49837-z" rel="nofollow noreferrer">nuclease dead cas9</a> which stops cell replication through an AAV to all the cells anywhere in the vicinity of the tumour. It specifically binds only to the DNA in the cancer cells, and therefore disables DNA replication only for those cells. Then, target the now-stagnant tumour using conventional chemotherapy.</li> <li>Alternatively, send in a CRISPR dead cas that induces apoptosis upon binding to the target strand, though this seems harder to pull off.</li> </ol> <p>Would something like this work? If so, has this been attempted? If not, what specific step is impossible?</p> Answer: <p>There are a lot of assumptions implicit in the system you describe, all of which need to be addressed prior to any serious discussion of your method's feasibility.</p> <blockquote> <ol> <li>Sequence a bunch of normal patient cells.</li> <li>Sequence a bunch of tumor cells from a biopsy.</li> <li>Find a DNA sequence that we're reasonably certain exists in the cancer cells but doesn't exist in normal cells.</li> </ol> </blockquote> <p>Depending on the tumor stage, its constituent cells may have a great amount of genomic heterogeneity.<sup><strong>1,2</strong></sup> How do you know your biopsy will capture all the distinguishing variation?</p> <blockquote> <ol start="4"> <li>Create a guide DNA that matches the sequence identified in (3).</li> <li>Send in a nuclease dead cas9 which stops cell replication through an AAV to all the cells anywhere in the vicinity of the tumour. It specifically binds only to the DNA in the cancer cells, and therefore disables DNA replication only for those cells. Then, target the now-stagnant tumour using conventional chemotherapy.</li> </ol> </blockquote> <p>What proportion of distinguishing mutations do you expect to have a structure that can be differentially targeted by a dCas9 effector? Are SNPs easily distinguished without off-target effects in healthy cells? Is the purpose of using dCas9 to mitigate off-target effects, as opposed to Cas9, for which off-target effects would be more severe (binding vs. cutting)? Can you provide a citation describing the process by which dCas9 binding prevents replication? Is it trivial to design and deliver a pool of AAV vectors that express a guide for each of your targets? Considering the cost (time and money) of your proposed treatment, can you provide a citation asserting that tumor growth stagnation prior to chemotherapy has an added benefit over chemotherapy alone?</p> <blockquote> <ol start="6"> <li>Alternatively, send in a CRISPR dead cas that induces apoptosis upon binding to the target strand, though this seems harder to pull off.</li> </ol> </blockquote> <p>Again, please provide a citation describing the mechanism by which dCas9 association induces apoptosis.</p> <hr /> <p><strong>References</strong></p> <ol> <li>Turajlic S, Sottoriva A, Graham T, Swanton C. Resolving genetic heterogeneity in cancer. <em>Nat Rev Genet</em>. 2019 Jul;20(7):404-416.</li> <li>Navin N, Krasnitz A, Rodgers L, Cook K, Meth J, Kendall J, Riggs M, Eberling Y, Troge J, Grubor V, Levy D, Lundin P, Månér S, Zetterberg A, Hicks J, Wigler M. Inferring tumor progression from genomic heterogeneity. <em>Genome Res</em>. 2010 Jan;20(1):68-80.</li> </ol>
https://biology.stackexchange.com/questions/104755/can-we-cure-cancer-with-crispr-dead-cas
Question: <p>I read this article <a href="https://www.quantamagazine.org/20150206-crispr-dna-editor-bacteria/" rel="nofollow">https://www.quantamagazine.org/20150206-crispr-dna-editor-bacteria/</a> and am slightly puzzled as to why the CRISPR/Cas 9 system is seen as being so revolutionary. It seems like the very same thing that micro RNA and short interfering RNA does- cleaves synthesised mRNA strands by attaching to the complementary part of the mmRNA strand, and the restrictive enzymes combine to this RNA and cleave it. I don't see how the CRISPR system is any different or better...</p> <p>Thank you in advance :)</p> <p>EDIT: Also, does anyone know whether Cas 9 cuts both DNA strands at the same place, or whether it leaves 'sticky ends'? Thank you.</p> Answer: <p>The CRISPR Cas 9 system is used to introduce insertion or deletion in a genomic sequence not mRNA.</p> <p><a href="https://www.addgene.org/CRISPR/guide/" rel="nofollow">https://www.addgene.org/CRISPR/guide/</a></p>
https://biology.stackexchange.com/questions/41050/difference-between-micro-rna-and-short-interfering-rna-and-crispr-cas-9-system
Question: <p><a href="https://knowyourmeme.com/memes/people-with-blue-eyes" rel="nofollow noreferrer">Blue eyes are unsaleable garbage.</a> How would you use CRISPR and gene editing to change a man's eye color from blue to dark brown?</p> Answer:
https://biology.stackexchange.com/questions/116480/how-can-i-using-gene-therapy-crispr-change-my-eye-color
Question: <p>I know that <em>Vibrio Cholerae</em> infects the body through the GM1 ganglioside. So, would it be possible to engineer a CRISPR gene editing tool to prevent <em>Vibrio Cholerae</em> from getting into our cells?</p> <p>Specifically, would it be possible to insert a piece of DNA into our genes that allow the synthesis of cholera toxin-suspressing protein shown <a href="https://dx.doi.org/10.1093%2Fglycob%2Fcwv080" rel="nofollow noreferrer"> here</a> (<a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4672148/" rel="nofollow noreferrer">Pubmed link</a>).</p> <p>The reason I ask this question is that there are obvious benefits to being immune to cholera from birth. While I'm definitely not planning on being the next He Jiankui, I find the prospect of such a vaccine highly intriguing.</p> <p>Edit: changed link because I posted the wrong link.</p> Answer: <blockquote> <p>So, would it be possible to engineer a CRISPR gene editing tool to prevent Vibrio Cholerae from getting into our cells?</p> </blockquote> <p>Vibrio Cholerae doesn't get into our cells.</p> <p>Did you observe that your paper has no in vitro experiments?</p> <p>It's going to be tough to get a cell to transcribe and translate something so small, and will the peptide work if it needs a leader sequence to be exported out of the cell?</p> <p>Its much much easier to break a gene in every cell than to add a new gene and have just a small subset of cell types make large quantities of that gene product.</p>
https://biology.stackexchange.com/questions/88889/how-to-design-a-permanent-vaccine-to-cholera-using-crispr
Question: <p>In a CRISPR-Cas9 experiment, the protein cuts the site matching the cRNA part of the gRNA. My question is: How many cuts are possible if multiples sites matching the cRNA are found in the cell?</p> <p>Especially, considering DNA is made of multiple chromosomes, if more than one chromosome have a site matching the cRNA, will they all be cut? Does it depend of the quantity of Cas9 protein brought in during the experiment (meaning is some Cas9 protein &quot;consumpted&quot; at each cut)?</p> Answer: <p>On a single molecule level, Cas9 from <em>Streptococcus pyogenes</em> cuts but does not move to other targets for a few days (<a href="https://doi.org/10.1021/jacs.7b13047" rel="nofollow noreferrer">Raper et al. 2018</a>). In contrast, Cas9 from <em>Staphylococcus aureus</em> cuts multiple targets, though also it takes hours for a single round (<a href="https://doi.org/10.1261/rna.067355.118" rel="nofollow noreferrer">Yourik et al. 2019</a>). However, inside a cell, even <em>S. pyogenes</em> Cas9 is rapidly dislodged either by RNA polymerase (Clarke et al. 2018) or FACT histone chaperone (Wang et al. 2020). So even if only one Cas9-sgRNA complex enters a cell, it will be able to cut multiple targets. There are several methods to measure the efficiency of Cas9 cleavage of multiple target and off-target sites that differ in accuracy and sensitivity. The PCR amplification-free method, RGEN-seq, is the latest innovation in this field (<a href="https://doi.org/10.1038/s41598-021-03160-8" rel="nofollow noreferrer">Kuzin et al. 2021</a>).</p> <p><strong>References</strong></p> <ul> <li><a href="https://doi.org/10.1021/jacs.7b13047" rel="nofollow noreferrer">Raper et al. (2018) Functional Insights Revealed by the Kinetic Mechanism of CRISPR/Cas9. <em>JACS</em>, <strong>140</strong>(8), 2971–2984.</a></li> <li><a href="https://doi.org/10.1261/rna.067355.118" rel="nofollow noreferrer">Yourik et al. (2019) Staphylococcus aureus Cas9 is a multiple-turnover enzyme. <em>RNA</em>, <strong>25</strong>, 35-44.</a></li> <li><a href="https://doi.org/10.1016/j.molcel.2018.06.005" rel="nofollow noreferrer">Clarke et al. (2018) Enhanced Bacterial Immunity and Mammalian Genome Editing via RNA-Polymerase-Mediated Dislodging of Cas9 from Double-Strand DNA Breaks. <em>Mol. Cell</em>, <strong>71</strong>(1), 42-55.e8.</a></li> <li><a href="https://doi.org/10.1016/j.molcel.2020.06.014" rel="nofollow noreferrer">Wang et al. (2020) The Histone Chaperone FACT Induces Cas9 Multi-turnover Behavior and Modifies Genome Manipulation in Human Cells. <em>Mol. Cell</em>, <strong>79</strong>(2), 221-233.e5.</a></li> <li><a href="https://doi.org/10.1038/s41598-021-03160-8" rel="nofollow noreferrer">Kuzin et al. (2021) RGEN-seq for highly sensitive amplification-free screen of off-target sites of gene editors. <em>Sci Rep</em>, <strong>11</strong>, 23600.</a></li> </ul>
https://biology.stackexchange.com/questions/111127/how-many-cuts-are-done-during-crispr-cas9-in-one-cell
Question: <p>CAS9 is the RNA-guided endonuclease that cleaves DNA as specified by the RNA sequence and is used to target viruses that infect bacteria. So why doesn't this RNA+endonuclease combo also cleave the original CRISPR spacer sequences (which also have the same DNA?). Is it the same reason that the bacterial genome is methylated (and hence protects from restriction enzymes)? Does methylation also make a difference to CAS9 as it does to restriction enzymes?</p> <p>This actually was a doubt asked to Eric Lander in <a href="https://youtu.be/pI59If4FOU4?t=13m15s" rel="nofollow noreferrer">this lecture</a>. </p> Answer: <p>It is not the methylation status. The crRNA is not only complementary to the spacer sequence within the CRISPR array but also to the repeat sequence flanking that spacer. The additional base pairing of the sgRNA with the repeat prevents a nucleolytic cleavage by Cas9. In addition, the arrays typically do not contain PAM sequences.</p> <p>Here you will find a nice illustration:</p> <p><a href="https://i.sstatic.net/GhzlC.jpg" rel="nofollow noreferrer"><img src="https://i.sstatic.net/GhzlC.jpg" alt="http://www.nature.com/nrg/journal/v11/n3/images/nrg2749-f4.jpg"></a></p>
https://biology.stackexchange.com/questions/54696/why-doesnt-cas9-cleave-the-original-crispr-sequence-in-the-bacterial-genome
Question: <p>So from what I understand, in gene editing, the CRISPR vector expresses a small RNA sequence comprised of a small guide-RNA that is complementary to your target sequence. The sgRNA comprises a 20 Bp CrRNA and a truncated (cut down) TracrRNA right ? </p> <p>My main question is how does this truncation enable gene editing ? After all, the bacteria have a full TracrRNA and not a truncated one. </p> Answer: <p>You are correct about the components of the sgRNA.</p> <p>However the truncation of the tracrRNA does not enable gene editing. Rather it is all that is required.</p> <p>In bacteria the crRNA and tracrRNA are distinct molecules which must pair through the complementary palindromic repeat sequences. This is not the case in gene-editing as the crRNA and tracrRNA have been fused with a synthetic stem loop. Thus the palindromic repeat sequence is not required and the tracrRNA is shorter.</p> <p>Check out <a href="https://pubmed.ncbi.nlm.nih.gov/23287718/" rel="nofollow noreferrer">Cong et al. (2013) in <em>Science</em></a>.</p>
https://biology.stackexchange.com/questions/57503/crispr-cas9-what-are-the-main-differences-between-sgrna-and-the-crtracrrna
Question: <p>Does anyone have experience with the CRISPR/CAS9 platform performed on MEF? Or does anyone recall any relevant articles?</p> Answer: <p>From <a href="http://genesdev.cshlp.org/content/27/23/2602.long" rel="nofollow">this</a> paper:</p> <blockquote> <p>We chose to test for Cas9-driven targeted mutagenesis on the endogenous Trp53 gene in mouse embryonic fibroblasts (MEFs), a cell line in which the biology of p53 has been thoroughly characterized and where the gene is structurally intact.</p> </blockquote> <p>Furthermore:</p> <blockquote> <p>Seventy-two hours post-transduction, cells were cultured in the presence or absence of Nutlin-3a, a specific inhibitor of the MDM2–p53 interaction (Tovar et al. 2006). Cells were scored for the fraction of GFP+ cells after 4 d of Nutlin-3a exposure using flow cytometry (Fig. 2B). Nutlin-3a potently activates a p53-dependent anti-proliferative cellular response, which strongly and specifically selects for any cells with disrupted Trp53 function (Efeyan et al. 2007). Much like MLP-p53.1224 infected cells, the pQCiG-p53 GFP+ cells were rapidly enriched for in the presence of Nutlin-3a, suggesting that CRISPR-mediated gene disruption had initially occurred in at least a proportion of the initial Cas9-expressing cells.</p> </blockquote>
https://biology.stackexchange.com/questions/19829/has-anyone-used-crispr-cas-to-induce-a-knock-in-in-mef-cells
Question: <p>I've read about on-target efficiency and off-target effects in use of CRISPR/Cas9, and about tools that suggest good guide sequences. I am wondering: how many guide sequences do typical CRISPR users try -- i.e. is there any iteration or parallelism involved?</p> <p>I think the answer is yes for some use cases, but I am not sure:</p> <ul> <li><em>Knocking out one particular locus</em>: There are only a few possible guide sequences, so you can just make a library that includes all of those and run one experiment, without iteration. You would not know which guide sequence worked best, though, but users may not need this information.</li> <li><em>Knocking out one gene, no matter at which loci</em>: Since there are many possible loci for indels, the key is to choose a locus for which the guide sequence is effective and produces the last off-target effects elsewhere in the genome. This would mean iterating/trying several of the top suggested guide sequences individually. These could be tried in parallel across several experiments.</li> <li><em>Knocking out multiple genes, aka multiplexing</em>: The user would want to find good guide sequences for each gene separately to avoid any interactions. This would reduce to the previous example above.</li> </ul> <p>Is my understanding above correct?</p> Answer:
https://biology.stackexchange.com/questions/49133/do-users-of-crispr-cas-iterate-or-parallelize-to-try-multiple-guide-sequences
Question: <p>In <a href="http://elifesciences.org/content/2/e00471" rel="nofollow">Jinek et al.</a>, the authors show nuclease activity of their CRISPR/Cas9 system using the so-called <em>Surveyor assay</em> method. This assay recognizes small mismatches in dsDNA which are introduced by error prone non-homologuous end-joining after dsDNA breaks have been introduced by some foreign agent (such as Cas9). The Surveyor assay then -again- breaks the DNA at those points where it recognizes mismatches. The newly broken DNA fragments can be assayed and so one can identify the position of the initial, Cas9 dependent breakage.</p> <p>My question is: for direct demonstration of Cas9 activity at the programmed position, why not first silence non-homolguous end-joining repair mechanisms in the cell and then directly analyse the lysate? Is this technically not feasible? Or is it not done in order to not introduce another change in the cell for which there would be no control?</p> Answer:
https://biology.stackexchange.com/questions/38933/why-is-dsdna-nuclease-activity-by-crispr-cas9-only-shown-indirectly
Question: <p>In <a href="https://www.cell.com/trends/biotechnology/fulltext/S0167-7799(15)00274-7?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS0167779915002747%3Fshowall%3Dtrue" rel="nofollow noreferrer">this</a> paper<sup>1</sup>, I read that mutant versions of Cas proteins such as a deactivated Cas9 (dCas9) are used alongside a guide-RNA (gRNA) to form variants of CRISPR tool that can function as transcription regulators. </p> <p>Since the mutant Cas9 has lost its nuclease functionality, the mutant gRNA-dCas9 complex can "block" transcription factors such as RNA polymerase from binding a certain gene, hence repressing transcription or elongation. </p> <p>Another way that dCas9 can regulate transcription is by "carrying" another transcription factor - be it an activator or repressor - and this can be done by engineering a dCas9 fused to the other transcription factor of choice. </p> <p>I understand how the dCas9 can block the binding of another transcription factor to repress transcription initiation or elongation, but what is the point of fusing another transcription factor with the dCas9? It seems to me that in this scenario, the dCas9 is just a passive carrier of the transcription factor that is actually doing the job, so why can't the transcription factor be fused with the gRNA instead, so that it can directly affect transcription when the gRNA forms complimentary base pairs with the target gene, instead of it being on a passive dCas9? </p> <p><sup> 1. Jusiak, B., Cleto, S., Perez-Pinera, P. and Lu, T.K., 2016. Engineering synthetic gene circuits in living cells with CRISPR technology. Trends in biotechnology, 34(7), pp.535-547. </sup></p> Answer: <blockquote> <p>so why can't the transcription factor be fused with the gRNA instead, so that it can directly affect transcription when the gRNA forms complimentary base pairs with the target gene, instead of it being on a passive dCas9?</p> </blockquote> <p>The main reason for that is that both the gRNA and the dCas9-TF (transcription factor) combination can (each) be encoded genetically, while a combination of a gRNA with a transcription factor could only be generated chemically.</p> <p>The possibility to genetically encode the dCas9-TF + gRNA unit allows one to:<br> a) use established methods for transferring DNA into cells,so that the cells make the Cas9 and the gRNA by themselves and<br> b) generate cells that will stably express the whole unit (dCas9-TF + gRNA) forever. </p> <p>Neither of these options would be possible with a chemically linked gRNA-TF (which is also much harder to make for molecular biology labs that don't have the proper chemistry equipment).</p>
https://biology.stackexchange.com/questions/76567/what-is-the-role-of-crispr-dcas9-in-grna-dcas9-transcription-regulator-complexes
Question: <p>Are scientist able to correct mutiple gene defect in whole body by using CRISPR recently?</p> <p>AS i know, it is in a beginning stage</p> Answer: <p>Certainly not yet - there is not yet any evidence that this can be used to correct specific deficiencies in an adult, though the in vivo applications are growing.</p> <p>In particular, an exciting recent advance is the opportunity to better understand carcinogenesis by 'editing in' certain known mutations into a mouse, say, that should cause a cancer, and watching for when the cancer actually arises...</p>
https://biology.stackexchange.com/questions/42862/are-scientist-able-to-correct-mutiple-gene-defect-in-our-body-by-using-crispr
Question: <p>I've read that CRISPR/Cas9 is currently being implemented and tested for its ability to edit genomes in live cells, and that it is supplanting other genome editing tools in labs, such as TALENs and Zinc finger nucleases. </p> <p>I understand that there may be a few metrics used for analyzing any genome editing system. One is the efficiency, which could be measured perhaps in edits per time or edits per molecule. Another metric might be error-rate. What is the probability that a genome is altered in something other than the intended way? Another metric might be the length of the genome that may be edited at once.</p> <p>I've also read that CRISPR/Cas9 evolved in bacteria. When did CRISPR/Cas9 evolve in the history of life on earth? </p> <p>If CRISPR/Cas9 evolved in bacteria, and before other evolutionary advances, including some of those that may have enabled certain multiceullar forms of life, I have to wonder if other systems like CRISPR/Cas9 but superior to it in some metric evolved as well. </p> <p>How does recombination in sexual reproduction work? Might it involve biomolecular machinery like that of CRISPR/Cas9?</p> <p>How does the adaptive immune system work? How does VDJ recombination work? Does it involve an advanced (relative to CRISPR/Cas9) genome editing system?</p> <p>How might one estimate the probability that a system superior to CRISPR/Cas9 exists already?</p> Answer: <p>Lots of interesting questions! Let me try to address a few of them as I don't think I am qualified to answer them all but hopefully I can get this thread started. I am a graduate student in the biophysical chemistry field and have been following a little bit of the Crispr Cas9 craze in the last couple of years. So I am not an expert on Cas9 by any means but I do find it interesting.</p> <p>Many speculate that as long as their have been cellular life, viruses or some obligate parasites have existed as well. This stems from the idea that viruses perhaps are not "non-self" but rather are parts of the host that happen to become inanimate particles that escape the cell and then find another suitable host. Some viruses have co-evolved with the host, perhaps to prevent other viruses from invading its "home/birth mother". Again, much of this paragraph is just speculation, but it is likely that CRISPR systems, or an adaptive immune systems like it have existed as long as viruses/obligate parasites have. </p> <p>Error rates, you can look at some of the papers that have come out recently but the idea is that there are a lot of error rates, especially if the RNA is constitutively transcribed from a plasmid. Some people have suggested delivering, not the plasmids for the guide RNAs and the Cas9 protein, but instead, the Cas9 protein complexed to the RNA itself. Other ways to control the amount you deliver to a cell include delivering the RNA for the Cas9 protein so it is eventually degraded. This avoids the complication of delivering DNA which can be transcribed multiple times potentially flooding your cell with cas9 protein or guide RNAs, increasing the likelihood of off target effects. Or you can have the cas9 protein and the guide RNA plasmids under inducible promoters, so you only get expression say if you introduce a small molecule to your cultured organism and limit the amount you deliver of it.</p> <p>As to if there are other systems "superior" to it, and by superior you mean more efficient, and has less off targeting effects? Sure those things may very well exist, since we haven't sequenced the entire planet yet! All joking aside, maybe start looking around at research groups that do adaptive immunity in prokaryotes, you might find some interesting ideas...</p> <p>VDJ is a very cool system that I know only a little about but this review might be worth checking out:</p> <p>"Mechanism and Control of V(D)J Recombination versus ClassSwitch Recombination: Similarities and Differences", which can be found <a href="http://web.archive.org/web/20120109190037/http://www.idi.harvard.edu/uploads/investigators/Dudley_Adv_Immunol_05.pdf" rel="nofollow noreferrer">here</a>.</p> <p>Also recombination in meiotic versus mitotic replication is covered in this review: "Meiotic versus Mitotic Recombination: Two Different Routes for Double-Strand Break Repair", which is available <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3090628/" rel="nofollow noreferrer">here</a>.</p> <p>So to answer your question, I will have to defer to someone else!</p> <p>My question to you is what is "advanced"? Life as we understand it has been evolving for about 3-4 billion years. "Advanced" suggests that one organism has evolved better or faster. I don't know if I would call anything more advanced per se, but maybe more complicated and more capable of rapidly adapting to new environmental pressures? Bacteria have us trumped if there were rapid changes to the environment, global warming, asteroids careening into the planet etc.</p> <p>Estimating this probability requires knowing how large the entire sequence space of the Earth is, some have estimated 5-50 million eukaryotic species but depends on what metric you would use to define a new species. It is unknown for prokaryotes. My guess is that you have 100's of millions of different organisms that are capable of having some type of adaptive immune system that may be inherently different from CRISPR/Cas9 system but still use some similar elements, like nucleic acid complementation, as a mode of defending against obligate parasites. Then the questions are how many of those organisms have we sequenced and how many proteins do we have any idea how they function based on sequence similarities to other proteins? Or if we have directly characterized their 3D structure based on Cryogenic Transmission Electron Microscopy (Cryo EM), NMR or X-ray crystallography. So, I imagine we have just hit the tip of the iceberg in finding natural enzymes that can function as gene editing and gene locating tools. Plus, we may start designing our own enzymes like what Professor David Baker at UW works on. Huge ocean to go exploring, bring a molecular fishing pole :-)</p>
https://biology.stackexchange.com/questions/20665/when-did-crispr-cas9-evolve-and-what-is-the-likelihood-that-a-superior-system-fo
Question: <p>According to <a href="https://www.sciencedirect.com/science/article/pii/S109727651830546X" rel="nofollow noreferrer">this diagram</a>, the high efficiency and the high specificity of CRISPR lies in its reversible binding with the target DNA. The Cas protein unzips the target DNA and have the gRNA to base pair with it, forming a short R-loop. Because the formation of the R-loop doesn’t change the number of basepairs, there is minimal free energy change. If there is a mismatch, the R-loop formation is inhibited which facilitates the release of the Cas from the DNA. <a href="https://i.sstatic.net/MiUCF.jpg" rel="nofollow noreferrer"><img src="https://i.sstatic.net/MiUCF.jpg" alt="enter image description here" /></a> However, RNA are single stranded and can basepair with the gRNA directly. As a result, the formation of dsRNA should be strongly exothermic even with one or a few mismatches. As a result, the Cas assembly will be trapped on the slightly mismatched target RNA, which will greatly reduce the efficiency of RNA editing and interfere with the functions of the target RNA (such as protein translation).</p> Answer:
https://biology.stackexchange.com/questions/108213/is-crispr-mediated-rna-editing-less-specific-and-less-efficient-than-dna-editing
Question: <p>There are multiple widely-used plasmids for using CRISPR/Cas9 with a dual lentiviral vector strategy (Cas9 &amp; sgRNA on different vectors) in mammalian hosts with a Blasticidin selection selection marker.</p> <p>In particular: <a href="https://www.addgene.org/73310/" rel="nofollow noreferrer">Lenti‐Cas9‐2A‐Blast(#73310)</a> and <a href="https://www.addgene.org/52962/" rel="nofollow noreferrer">lentiCas9-Blast (#52962)</a></p> <p>What are differences between the two? Which vector is recommended (for use in mouse small intestinal organoids) and why?</p> Answer: <p>I see these differences in lenti-Cas9-2A (compared to lenti-Cas9):</p> <ul> <li>Absence of a bleomycin resistance. That just affects cloning</li> <li>Changing from a CMV- to a RSV <strong>promoter</strong> for lentiviral mRNA production: That promoter is used for the host cells that produce your lentiviruses. They might react differently to different promotoers. So in the end, your viral titers might differ, when switching these plasmids.</li> <li>Changing from a bGH- to a SV40 <strong>polyA signal</strong> polyA signal. That might affect (production and) half-life of lentiviral mRNA both in your lentivirus producing-host cell culture and your mouse small intestinal organoids after transfection. You <em>might</em> want to start your research here: <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7732963/" rel="nofollow noreferrer">Humes et al. 2020</a></li> </ul> <p>Together, I think <strong>both plasmids should work just fine</strong>. I'd say that the observed differences affect mostly how well your host cell culture performs in producing lentivirus. And these difference might differ a lot between cell types. But like I said, it's just the lentivirus production. If you got enough virus to apply to your mouse organoids for gene editing, it doesn't matter.</p>
https://biology.stackexchange.com/questions/109257/what-are-the-differences-between-dual-vector-crispr-cas9-lentiviral-plasmids-len
Question: <p>We are looking for a way to insert DNA into a genome, but we would like to do it in a way that the recognition site stay intact to be able to add again DNA at the same location. Do you know if it is possible or if it is already the way CRISPR/Cas9 does it? Apparently multiple systems were already engineered but the few papers we read weren't about our problem.</p> <p>Sincerely,</p> <p>Emilie </p> Answer: <p>Look into <a href="http://en.wikipedia.org/wiki/Site-specific_recombination" rel="nofollow noreferrer">site-specific recombination</a>. You can use a site-specific recombinase, specifically an integrase, that can insert a sequence of DNA at a certain attachment site. You can add an identical attachment site into the DNA sequence to insert, allowing for the reintegration of a new attachment site. Note however that you might get SSR onto the insertion plasmid itself, so don't do this if you need a specific amount of integration.</p> <p><img src="https://i.sstatic.net/sES0K.png" alt="Look at the bottom subfigure of A for an example of integration."></p> <p>Look at the bottom subfigure of A for an example of integration. Recombinases can also do other things, such as excision and inversion, based on the orientation of the attachment sites.</p>
https://biology.stackexchange.com/questions/30347/is-it-possible-to-insert-dna-without-cutting-the-recognition-site-with-crispr-ca
Question: <p>I have to make an exposition in my university about Crispr-cas9 edition and I have some questions about the method. In the knock out/knock in technique is used a plasmid containing the DNA that codifies for the Cas9 protein and guideRNA and a <strong>Donor template</strong> that has a gene for puromicine resistance, and a DNA that codifies for a fluorescent protein and <strong>"left homologous arm" and "right homologous arms"</strong>. My questions is What's the fuction of the homologous arms?Furthermore what's the role of the Loxp(look at the image)? The method is described here <a href="http://www.origene.com/assets/documents/CRISPR-CAS9/CRISPR_manual.pdf" rel="nofollow noreferrer">http://www.origene.com/assets/documents/CRISPR-CAS9/CRISPR_manual.pdf</a> (page 5-10)<a href="https://i.sstatic.net/gYrlB.png" rel="nofollow noreferrer"><img src="https://i.sstatic.net/gYrlB.png" alt="enter image description here"></a></p> Answer:
https://biology.stackexchange.com/questions/51857/what%c2%b4s-the-role-or-function-of-the-homologous-arms-in-a-donor-template-in-a-knoc
Question: <p>In the paper on CRISPRs, the following figure is shown: <a href="https://i.sstatic.net/gnwUp.png" rel="nofollow noreferrer"><img src="https://i.sstatic.net/gnwUp.png" alt="enter image description here"></a></p> <p>I added the light-green boxes.</p> <p>What do the red arrows and the line with a filled circle on the far left mean? What does the arrow in the middle mean (also just infront of cas9)? Is the purple square to be understood as the RNA section in the B plot (blue arrow)?</p> <p><a href="http://www.sciencemag.org/content/346/6213/1258096?intcmp=collection-crispr" rel="nofollow noreferrer">Taken from here.</a></p> <p>The caption is (cited):</p> <blockquote> <p>The type II-A system from S. pyogenes is shown as an example. (A) The cas gene operon with tracrRNA and the CRISPR array. (B) The natural pathway of antiviral defense involves association of Cas9 with the antirepeat-repeat RNA (tracrRNA:crRNA) duplexes, RNA co-processing by ribonuclease III, further trimming, R-loop formation, and target DNA cleavage. (C) Details of the natural DNA cleavage with the duplex tracrRNA:crRNA.</p> </blockquote> Answer: <p>The arrow direction denote transcription direction and its location denotes the transcription start site. The circle is probably the transcription terminator (I cannot access this article at the moment, but this is what it should mean).</p> <p>The purple boxes refer to the protospacers which are derived from foreign DNA. These elements help in recognizing and cleaving foreign DNA. These are transcribed as RNA which in turn guide the Cas complex to the target DNA. In a way, these protospacers provide some kind of immunological memory to the bacteria. See the below figure (From <a href="http://dx.doi.org/10.1038/nature14237" rel="nofollow noreferrer"><em>Nuñez et al. 2015</em></a> ):</p> <p><a href="https://i.sstatic.net/pRcfC.jpg" rel="nofollow noreferrer"><img src="https://i.sstatic.net/pRcfC.jpg" alt="enter image description here"></a></p>
https://biology.stackexchange.com/questions/38706/in-this-illustration-about-crispr-function-what-do-these-objects-mean-image-pr
Question: <p>I have recently studied how CRISPR works but there is something that I do not understand at all. I have heard a lot of people claiming that with this method it is possible to modify any genome by inactivating, activating, removing or adding genes. However, as far as I have understood, DNA regions can only be modified if they are in the interspaces of short palindromic repeats. So, my question is whether a gene that is not in the interspace of short palindromic repeats can be modified or removed? And if it is possible to do so, how?</p> Answer: <p>When people talk about genome editing with CRISPR, they are really talking about using CRISPR associated nucleases like Cas9 and Cpf1. These nucleases are useful since their sequence specificity is determined by a guide RNA and they can therefore be used to cut at specific sites in the genome. This actually has nothing to do with the repeats themselves.</p> <p>See <a href="https://biology.stackexchange.com/questions/50562/how-to-edit-insert-new-gene-after-cutting-with-crispr-cas9/55993#55993">this answer</a> for a brief overview of how genome editing with Cas9 works.</p>
https://biology.stackexchange.com/questions/69273/can-a-gene-be-inactivated-using-crispr-if-it-is-not-in-the-interspace-of-short-p
Question: <p>I have here my hypothesis, does this make scientific sense? Assume this situation is occurring in a closed environment with only bacteria and bacteriophages.</p> <p>The effectiveness of CRISPR/Cas9, being an adaptive defence system, is heavily reliant on the phages that it, or its ancestor has previously hosted. This is because Cas proteins require the virus’s physical presence in order to extract spacers from the virus’s genome and implement them into the CRISPR locus. Therefore, an environment bearing a smaller number of different virus types should theoretically lead to a higher degree of effectiveness for CRISPR systems. Low quantitative viral diversity should lead an influx in CRISPR’s effectiveness as, over time, a population of bacteria and its offspring should gain possession of spacers that provide them with a competitive advantage within their given environment. Hypothetically, this should lead to an increased bacterial population size as bacteria are now more easily able to ward-off viral infections. Consequently, this would most likely lead to a relative decrease in the viral population as the abundance of relevant spacers in the bacterial population will lead to a lower successful infection rate, causing an increased number of viruses to die upon the unsuccessful infection of a host bacterium, preventing induced viral lysis of the host, a process consisting of the disruption of the cellular membrane, resulting in the death of the host cell and the release of cytoplasmic compounds, including a large quantity of additional viral particles into the given medium, leading to a steep rise of the viral population. In contrast, CRISPR’s effectiveness should be diminished in an environment containing high levels of viral diversity as it would be far more difficult for bacteria to obtain the necessary spacers for CRISPR to be effective against the vast variety of bacteriophages in the given environment. Due to the decreased effectiveness of CRISPR systems, it would be more strenuous for bacteria to fight of viral infections, leading to a decrease in the bacterial population or a more moderate reproductive rate. Inversely, it is likely that viral population will flourish due to the scarcity of relevant spacers. This shortage in relevant spacers would result in an increased rate of infection of host cells, causing an increase in lysis and a rapidly multiplying viral population. Fluctuations in the bacterial population can be a strong indicator of the current effectiveness and efficiency of CRISPR systems as its main purpose is to aid bacteria in their survival. Quantitively, a good representation of the fluctuations in bacterial population size is percentage (%) rate of change. Percentage rate of change of a population provides a concise value that indicates whether the population in question is stagnant, increasing, or decreasing.</p> <p>To me, it makes perfect sense, but I am not an expert in this field, just a high school student.</p> <p>When I plugged this relationship into an online simulation, found <a href="http://www.netlogoweb.org/launch#http://www.netlogoweb.org/assets/modelslib/Sample%20Models/Biology/CRISPR/CRISPR%20Ecosystem.nlogo" rel="nofollow noreferrer">here</a>, I obtained a trend that suggested there is no correlation between viral diversity and the size of a bacteria or virus populations. I'll attach below a graph that shows the relationship I obtained.</p> <p>Figure 4: Scatter plot graph showing the relationship between viral diversity (maximum virus types | 20, 40, 60, 80, 100) and the percentage (%) rate of change for both the bacterial and viral populations over a period of 500 ticks, within a closed environment. Graph includes two trendlines for each dependent variable, along with an equation for each line, a R2 value, and a R value.</p> <p><a href="https://i.sstatic.net/xBjiJ.png" rel="nofollow noreferrer"><img src="https://i.sstatic.net/xBjiJ.png" alt="enter image description here" /></a></p> <p>Just looking for some insight, have I got this all wrong?</p> <p>(This is a repost as I deleted the other variation of this question due to improper formatting)</p> Answer:
https://biology.stackexchange.com/questions/107756/would-viral-diversity-result-in-a-change-in-the-effectiveness-of-crispr-systems
Question: <p>This paper seems to describe the use of a plasmid delivered by a gene gun to depigment rat skin;</p> <blockquote> <p><a href="https://www.nature.com/articles/3302264" rel="nofollow noreferrer">https://www.nature.com/articles/3302264</a> Published: 27 May 2004 Seeing the gene therapy: application of gene gun technique to transfect and decolour pigmented rat skin with human agouti signalling protein cDNA</p> </blockquote> <p>Could a similar technique using CRISPR and chitosan change the eye and hair color of an an adult?</p> Answer: <p>Let's first breakdown this question</p> <blockquote> <p><strong>What is CRISPR?</strong></p> </blockquote> <ul> <li>CRISPR is a group of DNA sequences that play a key role in the antiviral defense system of prokaryotic organisms such as bacteria and archaea.</li> <li>They are derived from DNA fragments of bacteriophages that had previously infected the prokaryotes.</li> <li>These sequences are used to destroy DNA from similar bacteriophages for future infections.</li> </ul> <blockquote> <p><strong>What is CRISPR-Cas?</strong></p> </blockquote> <ul> <li>The CRISPR-Cas system is an immune system seen in prokaryotes that provides resistance to foreign elements such as plasmids and phages. This is a form of acquired immunity.</li> <li>Some factors allow Cas protein which is an enzyme to recognize and cut foreign pathogenic DNA making them act like a pair of molecular scissors.</li> </ul> <blockquote> <p><strong>What are OCA2, HERC2, and MC1R?</strong></p> </blockquote> <p>Now we know we can cut a specific part (Gene) of DNA. What do we accomplish by cutting out the genes which Andrew mentioned? To answer this we need to know what those three genes do.</p> <ol> <li><strong>OCA2 (P-gene):</strong> Provides instructions for making a protein called the P protein. This protein is located in specialized cells (melanocytes) that produce a pigment called Melanin. <em>Melanin is a natural skin pigment. Hair, skin, and eye color in people and animals mostly depends on the type and amount of melanin they have.</em></li> <li><strong>HERC2 (E3 ubiquitin ligase HERC2):</strong> Protein ligase which helps in DNA repair regulation, pigmentation, and neurological disorders.</li> <li><strong>MC1R (Melanocortin 1 receptor):</strong> Proteins involved in regulating mammalian skin and hair color.</li> </ol> <p>In short, these Genes affect the Eye and Hair Colour and Andrew is suggesting to us that by removing/modifying them using CRISPR we change the Eye/Hair Colours.</p> <blockquote> <p><strong>Can we knock out OCA2, HERC2, and MC1R?</strong></p> </blockquote> <p>Yes, it has been done before and there are sequences available to target these genes within the genome. An example would be the gRNA sequences developed by Sigma-Aldrich and Genscript. I'll provide links of articles which has knocked out the respective gene and links to the gene sequences.</p> <ul> <li><strong>OCA2:</strong> (Article: <a href="https://pubmed.ncbi.nlm.nih.gov/29555241/" rel="nofollow noreferrer">https://pubmed.ncbi.nlm.nih.gov/29555241/</a> | Sequence: <a href="https://www.genscript.com/gRNA-detail/4948/OCA2-CRISPR-guide-RNA.html" rel="nofollow noreferrer">https://www.genscript.com/gRNA-detail/4948/OCA2-CRISPR-guide-RNA.html</a>) <br></li> <li><strong>HERC2:</strong> (Article: <a href="https://jmg.bmj.com/content/early/2020/06/22/jmedgenet-2020-106873" rel="nofollow noreferrer">https://jmg.bmj.com/content/early/2020/06/22/jmedgenet-2020-106873</a> | Sequence: <a href="https://www.sigmaaldrich.com/catalog/genes/HERC2" rel="nofollow noreferrer">https://www.sigmaaldrich.com/catalog/genes/HERC2</a>) <br></li> <li><strong>MC1R:</strong> (Article: <a href="https://www.genscript.com/gRNA-detail/4157/MC1R-CRISPR-guide-RNA.html" rel="nofollow noreferrer">https://www.genscript.com/gRNA-detail/4157/MC1R-CRISPR-guide-RNA.html</a> | Sequence: <a href="https://www.genscript.com/gRNA-detail/4157/MC1R-CRISPR-guide-RNA.html" rel="nofollow noreferrer">https://www.genscript.com/gRNA-detail/4157/MC1R-CRISPR-guide-RNA.html</a>) <br></li> </ul> <blockquote> <p><strong>Can we change the Eye/Hair Colour by modifying the above genes?</strong></p> </blockquote> <p>An Interesting article from MIT Technology Review called <a href="https://www.technologyreview.com/2015/03/05/249167/engineering-the-perfect-baby/" rel="nofollow noreferrer">Engineering the Perfect Baby</a> gives you a nice idea of what I am going to tell you.</p> <p><strong>In Theory:</strong> It's technically possible. We can put up a convincing theory and there is a huge chance that this can be successfully done.</p> <p><strong>In Reality:</strong> Well, Reality kinda sucks cause most of the genetic engineering breakthrough starts from failures. Killing a rat for scientific purposes won't make any big difference but what about killing a fetus? It's almost <em><strong>impossible to get the permissions required to use CRISPR to edit the human genome</strong></em> even if it is to find a cure for a deadly disease that would actually improve the human race significantly. Due to its obvious ethical questions, people always stand against it. I said &quot;almost impossible&quot; cause there are few people who actually got the permissions and there are indeed few ongoing trials experimenting with CRISPR on Human Genome.</p> <p>A popular Example would be <strong>He Jiankui</strong> who gave rise to the first-ever gene-modified human babies &quot;Lulu and Nana&quot;. He had to forged ethical review documents, misled doctors into unknowingly implanting gene-edited embryos into two women, and many more things which haven't come out yet. What are the consequences? <a href="https://www.popularmechanics.com/science/health/a25383837/crispr-baby-scientist-he-missing/" rel="nofollow noreferrer">He's bloody missing</a>! <em>May 2022 Update: <a href="https://www.technologyreview.com/2022/04/04/1048829/he-jiankui-prison-free-crispr-babies/" rel="nofollow noreferrer">He's been found.</a></em></p> <p>The point is, there is absolutely no way they would approve the usage of CRISPR for modifying something as silly as Eye/Hair color.</p> <p>I mean we all like our babies to look like Megan Fox but I totally doubt if anyone would dare to modify a human genome for changing mere appearance cause people would start protesting if they find out someone is putting all those innocent fetuses at unknown and uncalculatable risk for changing external traits.</p> <p>We want people to use CRISPR for things like this - <a href="https://edition.cnn.com/2017/09/29/health/gene-edit-beta-thalassemia-study/index.html" rel="nofollow noreferrer">Scientists edit gene for blood disease in human embryos</a> and not for things like this - <a href="https://www.dailymail.co.uk/femail/article-3433718/The-rise-designer-baby-Parents-paid-20-000-choose-sex-child-say-decision-no-brainer-spending-years-failing-conceive-naturally.html" rel="nofollow noreferrer">The rise of the designer baby: Parents who paid $16,500 to choose the sex of their child.</a></p> <p><strong>TL;DR (Too Long; Didn't Read):</strong> <br></p> <blockquote> <p><strong>What is CRISPR-Cas?</strong></p> </blockquote> <p><em>Technique in which we can edit genes relatively more precise than before.</em></p> <blockquote> <p><strong>What are OCA2, HERC2, and MC1R?</strong></p> </blockquote> <p><em>Genes which control the color of Eyes, Hair, Skin, and has other purposes.</em></p> <blockquote> <p><strong>Can we remove OCA2, HERC2, and MC1R genes using CRISPR?</strong></p> </blockquote> <p><em>Yes</em></p> <blockquote> <p><strong>Has it been done before?</strong></p> </blockquote> <p><em>Yes</em></p> <blockquote> <p><strong>In Humans?</strong></p> </blockquote> <p><em>Nope cause we got all those ethics and stuff.</em></p> <blockquote> <p><strong>What are we trying to accomplish by removing those genes?</strong></p> </blockquote> <p><em>To change the Colour of the Eyes/Hair of a human being.</em></p> <blockquote> <p><strong>Can we change the Colour of the Eyes/Hair of a human being?</strong></p> </blockquote> <p><em>In theory, it'll work. In Reality, nobody would allow it. They'd be better off with Hair Dye and Contact Lenses than to risk the lives of innocent fetuses.</em></p>
https://biology.stackexchange.com/questions/96043/can-we-change-the-eye-hair-color-by-knocking-out-the-oca2-herc2-and-mc1r-genes
Question: <p>The CRISPR/Cas9 method allows new genes to be inserted. After Cas9 cuts the Target-DNA, it can use a homologous piece of DNA as a donor template for homology-directed repair. But HDR only occurs when there are sticky ends, and Cas9's cuts end in blunt ends.</p> <p>What did I miss?</p> Answer: <p>According to <a href="https://blog.addgene.org/crispr-101-homology-directed-repair" rel="nofollow noreferrer">this Addgene blog</a>:</p> <blockquote> <p>There are four different HDR pathways to repair DSBs. Here are three central steps of the HDR pathways:</p> <ol> <li><p>The 5’-ended DNA strand is resected at the break to create a 3’ overhang. This will serve as both a substrate for proteins required for strand invasion and a primer for DNA repair synthesis.</p> </li> <li><p>...</p> </li> </ol> </blockquote> <p>Essentially, this resection process generates the required overhangs through partial degradation of one of the strands.</p> <p>To understand the mechanism of resection a bit better, this is a good read:</p> <blockquote> <p>Huertas, Pablo. &quot;DNA resection in eukaryotes: deciding how to fix the break.&quot; Nature structural &amp; molecular biology 17.1 (2010): 11-16.</p> </blockquote>
https://biology.stackexchange.com/questions/111256/crispr-cas9-how-can-inserted-dna-be-used-as-a-donor-for-the-homology-directed-r
Question: <p>Since i had my first cell class at university i have heard about Cripsr Cas9 method. But I am quite surprised about one fact. Why actually wasnt rewarded by Nobel price? Is it something like Einsteins relativity (to early to reward it)?</p> Answer: <p>My guess is that some people (likely Jennifer Doudna, Emmanuelle Charpentier and Feng Zhang) will eventually be awarded a Nobel Prize for the discovery of CRISPR and the development of its applications for genome editing, because it really is a major advance. But for now, <a href="https://en.wikipedia.org/wiki/CRISPR#Patents_and_commercialization" rel="nofollow noreferrer">the University of California Berkeley and the Broad Institute are still legally fighting over patent conflicts</a>, and the patent situation worldwide is generally complicated. I think this is a possible reason why the Nobel committee decided to wait.</p>
https://biology.stackexchange.com/questions/70708/crispr-cas9-method-and-nobel
Question: <p>It seems that to modify DNA a guide RNA and Cripr are introduced.</p> <p>But I'm unable to understand how the Guide RNA is made or created.</p> <p>Is it a simple method which can be done with simple lab equipment or is it complicated?</p> <p>What is the equipment need to create it?</p> Answer:
https://biology.stackexchange.com/questions/66646/how-is-the-guide-rna-created-for-crispr
Question: <p>I read that Cas9 protein along with guided RNA binds at a specific DNA fragment of foreign organism integrated in a host organism DNA. To make the host immune to virus infection Cas9 along with gRNA which is complementary to viral DNA attaches to it host DNA by unbinding it and then cuts the DNA at this site thereby removing the viral DNA. So the host can only remove the virus that enters second time as it makes a complementary RNA from the first virus that has integrated in it and cannot completely remove virus.</p> <ol> <li>Is the process that I am thinking right?</li> <li>And can we use Cas9 to cut the DNA at any site of our choice?</li> </ol> Answer: <p>We are currently using CRISPR in the lab to modify cells. Like @AMR said, it was modified from the <em>In Vivo</em> immune system to be used in the lab in DNA editing field. The Addgene website features both <a href="https://www.addgene.org/crispr/reference/history/" rel="nofollow">historical background</a> and an <a href="https://www.addgene.org/crispr/guide/" rel="nofollow">application guide</a> that are very well done. To answer your questions:</p> <ol> <li>The bacteria (<em>S. pyogenes</em>, <em>S. aureus</em>, etc) integrates part of the viral DNA (protospacers) inside its genome, flanked by repeats. When transcribed the RNA derived from this newly combined sequence will direct the Cas9 protein to the viral DNA, which is complementary. Another element required is the PAM (protospacer associated motif) which is on the <strong>viral</strong> DNA just besides the protospacer. By not being on the bacterial DNA, it ensures that the Cas9 does not cut its own DNA. </li> <li>The only limitations are the PAM and the off-targets. The PAM is specific for every species (EG <em>S. pyogenes</em> is NGG). Some sequences can be repeated in the genome of an organism, meaning that if you find a sequence that would result in a cut at a desired site, it could still cut elsewhere. That would make the guide sequence a poor choice. </li> </ol>
https://biology.stackexchange.com/questions/38915/how-does-cas9-interact-with-crispr
Question: <p>I am researching a fatty acid amide hydrolase (FAAH) SNP RS324420 and FAAH out microdeletion that together lead to reduced pain sensitivity and reduced anxiety (<a href="https://www.sciencedirect.com/science/article/pii/S0028390807002146" rel="nofollow noreferrer">Moreira et al 2008</a>).</p> <blockquote> <p>The causative mutations for this new pain insensitivity disorder are: the co-inheritance of (i) a microdeletion in dorsal root ganglia and brain-expressed pseudogene, FAAH-OUT, which we cloned from the fatty-acid amide hydrolase (FAAH) chromosomal region; and (ii) a common functional single-nucleotide polymorphism in FAAH conferring reduced expression and activity. Circulating concentrations of anandamide and related fatty-acid amides (palmitoylethanolamide and oleoylethanolamine) that are all normally degraded by FAAH were significantly elevated in peripheral blood compared with normal control carriers of the hypomorphic single-nucleotide polymorphism. The genetic findings and elevated circulating fatty-acid amides are consistent with a phenotype resulting from enhanced endocannabinoid signalling and a loss of function of FAAH. Our results highlight previously unknown complexity at the FAAH genomic locus involving the expression of FAAH-OUT, a novel pseudogene and long non-coding RNA.</p> </blockquote> <p><a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6676009/" rel="nofollow noreferrer">Br J Anaesth. 2019 Aug; 123(2): e249–e253. Published online 2019 Mar 28. doi: 10.1016/j.bja.2019.02.019</a></p> <p>I would like to know, theoretically if CRISPR was used to edit these genes in humans to allow reduced anxiety and pain sensitivity, 'what is the probability that a recurrent mutation would cause the wild-type allele to reemerge in this gene',</p> Answer:
https://biology.stackexchange.com/questions/96379/if-an-snp-were-edited-using-crispr-what-are-the-chances-that-absent-artificial
Question: <p>I understand CRISPR-mediated bacterial immunity to occur in the following simplified steps:</p> <ol> <li>A CRISPR array is transcribed from promoters in the leader sequence to yield a precursor CRISPR RNA (pre-crRNA).</li> <li>The pre-crRNA is processed by ribonucleases (<em>e.g.</em> Cas6 in Type III systems) to create mature crRNAs.<sup><strong>1</strong></sup></li> <li>crRNAs are loaded into Cas proteins to create an active CRISPR-Cas complex.</li> </ol> <p>My question pertains to the timing of steps 1 and 2. <strong>Is there any evidence for co-transcriptional processing of pre-crRNAs?</strong> Put another way, must the full pre-crRNA be transcribed prior to its cleavage by ribonucleases, or can single crRNAs be cleaved from the 5' end of the nascent pre-crRNA. My understanding is that cas6 recognizes and cleaves at the base of the repeat stem-loop,<sup><strong>2</strong></sup> and that these stem loops form spontaneously after a repeat is transcribed, so my hunch is that co-transcriptional pre-crRNA cleavage probably <em>can</em> occur, though I'd like some evidence from the literature to support/refute my intuition. I realize mechanisms of CRISPR immunity are quite diverse, so I'd appreciate references pertaining to any CRISPR system.</p> <p>Some search phrases I've tried in Google:</p> <ul> <li><em>co-transcriptional processing of crRNA</em></li> <li><em>co-transcriptional cleavage of crRNA</em></li> <li><em>crRNA processing concurrent with transcription</em></li> <li><em>ribonuclease processing of nascent pre-crRNA</em></li> <li><em>cas6 proximity to elongating rna polymerase</em></li> </ul> <hr /> <p><strong>References</strong></p> <ol> <li>Carte J, Wang R, Li H, Terns RM, Terns MP. Cas6 is an endoribonuclease that generates guide RNAs for invader defense in prokaryotes. <em>Genes Dev</em>. 2008 Dec 15;22(24):3489-96.</li> <li>Sokolowski RD, Graham S, White MF. Cas6 specificity and CRISPR RNA loading in a complex CRISPR-Cas system. <em>Nucleic Acids Res</em>. 2014 Jun;42(10):6532-41.</li> </ol> Answer: <p>I originally posted this question in an attempt to understand a pattern I observed in my sequencing data. In the time since, I've formalized my interpretation as part of a manuscript, <a href="https://www.biorxiv.org/content/10.1101/2022.04.22.489220v1" rel="nofollow noreferrer">now posted on <em>bioRxiv</em></a>.</p> <p>Some background: we performed <a href="https://doi.org/10.1038/nprot.2016.086" rel="nofollow noreferrer">precision run-on sequencing (PRO-seq)</a> on bacterial cells derived from human stool samples. In short, PRO-seq involves supplementing permeabilized nuclei (or cell lysates, in the case of bacteria) with biotinylated NTPs, such that endogenous RNA polymerases incorporate biotin onto the 3' ends of nascent transcripts. Transcripts are then precipitated on streptavidin beads and sequenced, revealing (1) which genomic features are being <em>actively</em> transcribed and (2) the genome-wide and strand-specific positions of RNA polymerase with base-pair resolution.</p> <p>Looking at the PRO-seq reads mapping to our metagenome-assembled genomes, we observe a wave-like pattern at loci annotated as CRISPR arrays. Figure 3 from our preprint gives one example:</p> <blockquote> <p><a href="https://i.sstatic.net/djb36.png" rel="nofollow noreferrer"><img src="https://i.sstatic.net/djb36.png" alt="PRO-seq signal across a Prevotella CRISPR array" /></a></p> </blockquote> <blockquote> <p><sup>(A) Coverage of PRO-seq and RNAseq reads across a CRISPR array in a US2 <em>Prevotella</em> sp. contig. Shaded boxes represent repeats. The large black arrow in each panel represents the leader sequence containing a putative promoter. Small black arrows in the “PRO-seq 5’ end” panel correspond to the predicted site of crRNA cleavage proximal at the base of the repeat stem loop.<br /> (B) Predicted crRNA repeat secondary structure. The black arrow points to the phosphodiester bond that is likely cleaved by Cas5d during pre-crRNA processing, which marks the same position in the repeat as the small arrows in (A). The sequence logo shows perfect conservation of the repeat sequence for this array.<br /> (C) PRO-seq captures nascent transcription of cas5d upstream of and contiguous with the CRISPR array.</sup></p> </blockquote> <p>Looking specifically at the position of the 5' ends of PRO-seq reads (bottom panel of <strong>A</strong>), we noticed a pile-up at the same position within each repeat corresponding to the putative crRNA cleavage site at the base of the repeat stem loop (arrow in <strong>B</strong>). Notably, transcription across this array coincides with transcription of a cas5d endoribonuclease gene upstream of the array (light blue rectangle in <strong>C</strong>).</p> <p>Coming back to the title question...</p> <blockquote> <p>Does ribonuclease processing of pre-crRNAs happen co-transcriptionally?</p> </blockquote> <p>... I believe the answer is <strong>yes</strong>. Wave-like transcriptional profiles at CRISPR arrays are not a novel observation (see Figure 1 from <a href="https://doi.org/10.1093/nar/gks737" rel="nofollow noreferrer">Richter <em>et al.</em> 2012</a>), but, importantly, our data include only <em>nascent</em> transcripts. This implies that <strong>crRNA cleavage by Cas5d is concurrent with pre-crRNA synthesis</strong>, at least in this human-associated <em>Prevotella</em> species.</p>
https://biology.stackexchange.com/questions/104533/does-ribonuclease-processing-of-pre-crrnas-happen-co-transcriptionally
Question: <p>I know, that the CRISP/Cas approach for "cutting" the human genome is not completely suitable if we can't say not suitable at all. Because we have many repeats and this approach can bring to our genome additional breaks in DNA and after DNA-repair it causes unwanted mutations. If so, why scientist still continue to play with it (See the link, only 16% success chinese scientist got) ? And what other DNA-editing mechanisms we have? I might be wrong, so correct me please.</p> <p>Thanks for explanation.</p> <p><a href="http://www.genengnews.com/gen-news-highlights/chinese-scientists-defy-ethics-double-down-on-editing-human-embryos/81252608/" rel="nofollow">Chinese Scientists Defy Ethics, Double Down on Editing Human Embryos</a></p> Answer: <p>Repeats aren't <em>the</em> problem with CRISPR. They stop you from editing repeats and repeat-like sequences, but in principle they can be worked around through careful design of guide RNA. CRISPR techniques right now do have problems with off target effects, but these problems may yet be solved. The CRISP/Cas approach to gene editing already has a lot of different variants and is under continual improvement, so there's no reason to think it won't get better. There's also no reason to think that the 16% figure there is only influenced by the use of CRISPR/Cas - it's an experiment with lots of other variables.</p>
https://biology.stackexchange.com/questions/45655/crispr-cas-for-editing-the-human-genome
Question: <p>I am still a complete beginner to crispr and I am still trying to learn what it is and how to actually use it. I now realise that you have to order the crispr components after you have actually designed them yourself in software that lets you design and alter the components. </p> <p>Am I correct so far?</p> <p>I am wondering if anyone could help me find which software I should use to design and or alter .dna files . Preferably free and open-source software. Are there any good tutorials for someone who wants to get more into crispr?</p> Answer: <p>You have a long journey ahead. This guy spent about 4 years to learn what he is doing <a href="https://www.youtube.com/watch?v=5Rv6aMdKY40" rel="nofollow noreferrer">here</a>.</p> <p>He is using Snapgene software</p>
https://biology.stackexchange.com/questions/89402/what-software-do-i-need-to-read-write-cas9-and-dna-files
Question: <p><strong>My goals are to use a free webtool to:</strong></p> <ol> <li><em>Identify guide RNAs</em> (direct-repeat sequence followed by the targeting sequence) appropriate for use with <em>AsCpf1</em> in order <em>to target a specific segment of genomic DNA</em>.</li> <li><em>Estimate efficiency and specificity</em> of using the guide RNAs identified by the tool.</li> </ol> <p>Unfortunately, when I tried to do this using the <a href="http://crispor.tefor.net/" rel="nofollow noreferrer">CRISPOR tool</a>, the "Job Status" never advanced past the "Waiting" stage, even after 10 minutes. Attached is a screenshot to show what I see.</p> <p>Specifically, I used the following settings in my query:</p> <p><strong>I named my sequence:</strong></p> <p><code>Mm Acaca block2</code> from BLAT alignment</p> <p><strong>In "Step 1" I submitted this sequence:</strong></p> <pre><code>aactaaatct ccagcatctc catccccttc ttaggtttat ttattttatg ggtatgagtg tatgtccgtg caccacatgt gtgcctggtg tctaccaagg taagtagagg tatacaaacc cttggaattg aattatccac catgccgtca ggtgctggga gcaaattcag gtcctctttt agagcagcaa gtatttccag ccacttagtc acctctgcag ccccttattt tcacagtctt gagacaagaa tctcactctt tagcccatat tggcctggaa ctttaggcag tcctgccgga gtttcagact gctgggatga caggcctgac ccattacgtc cactaaggat ggtttccttt cctgtgagct agcagcatgt agactccaca aggctcctgg ggaagtgttg ttatagtatg ttatagtata gttgcgaaag gaaggttttc agaagatatg ggtattacga agaaattcta tgtaaagttt cttttggatt ctctgtttgt atAGATCCAG CATGTCTGGC TTGCACCTAG TAAAACAAGG TCGAGACAGA AAGAAAATAG ACTCACAACG AGATTTCACT GTGGCTTCTC CAGCAGAATT TGTTACTCGT TTTGGGGGAA ATAAAGTAAT TGAGAAGgta agttaaactt actaaactat ttcgcttgaa gtatgtgaga tttcatgcct agatttgttg tttctgttca aaaggatatt taggttttta gggactttgc ctttttatgc agggctatcc tttctgtctc cctagcatgt tactaataca taatctcact gtgtacctgt gtttttacat </code></pre> <p><strong>In "Step 2" I selected:</strong></p> <pre><code>Mus musculus- Mouse- UCSC Dec. 2011 (GRCm38/mm10)... </code></pre> <p><strong>In "Step 3" I selected:</strong></p> <pre><code>TTTN-23bp - Cpf1 Acidaminococcus / Lachnospiracea </code></pre> <p><strong>My questions are as follows:</strong></p> <ol> <li>Should I do anything differently to use the CRISPOR tool for my goals?</li> <li>Are there other free webtools available for me to achieve the goals I outlined above?</li> </ol> <hr> <p><sub><strong>UPDATE</strong>: I emailed the folks at CRISPOR, and they informed me the site had been down, but they have since restarted it. Hopefully, their restart is sufficient, but I will leave my question up with the hopes that others can point me to more webtools.</sub></p> Answer: <p>Most online tools will only help you to design gRNAs for Cas9 because it is the one that is most commonly used. I found an online suite called <a href="http://www.rgenome.net/be-designer/" rel="nofollow noreferrer">RGEN tools</a> that also has an option for AsCpf1. </p> <p>However, if you don't find it satisfactory then my suggestion is that you either design your gRNA manually or write your own script (which won't be that complex).</p>
https://biology.stackexchange.com/questions/59027/webtool-to-design-guide-rna-grna-for-use-with-crispr-ascpf1
Question: <p>all,</p> <p>Is it only happens in certain phases, like S, G1,...or it can happen any time....or maybe, it has some perferences.</p> <p>Put it in another word, does it going to processe edit if the cell is not growing ?</p> <p>Thanks for any helps or comments.</p> <p>Best</p> <p>Bill Zhang</p> Answer:
https://biology.stackexchange.com/questions/73812/crispr-cas9-genome-editing-is-actually-processed-at-which-phase-of-cell-cycle
Question: <p>I am new to this technology and don't quite understand how it works. Hope someone can give some suggestions! Thank you.</p> Answer: <p><em>Short Answer:</em> No, for CRISPR/Cas9 knockout you do not need to add donor DNA.</p> <p><em>Little bit more detail:</em> CRISPR/Cas9 allows you to cut at a given position (defined by the <a href="https://en.wikipedia.org/wiki/Guide_RNA" rel="nofollow noreferrer">gRNA</a>). This will lead to double strand breaks (DSB).</p> <p>If you do not add any donor DNA, the cell's DNA repair mechanism will <strong>try</strong> to repair the double strand break. Since these CRISPR/Cas9 mediated DSBs usually have a blunt end it is really hard for the DNA repair mechanism to fix it. If will often introduce an error, for example by missing a basepair (or several) leading to a frame-shift mutation. This DNA repair mechanism is called <a href="https://en.wikipedia.org/wiki/Non-homologous_end_joining" rel="nofollow noreferrer">Non-Homologous End Joining</a>. </p> <p>If you do add donor DNA it will contain both the sequence you want to introduce (say a green fluorescent protein) and homologous sequences on both sides of the double strand break. In other words, if you want to cut the sequence ATCGCA exactly in the middle you will get ATC and GCA. You want to insert AGA. The donor plasmid must then have the sequence ATCAGAGCA. As the cell now has the homologous regions, it will use the <a href="https://en.wikipedia.org/wiki/Homology_directed_repair" rel="nofollow noreferrer">Homology Directed Repair</a> mechanism.</p> <p>The sequences are for illustration only - in reality a gene is usually several hundred basepairs and it is recommended to have much longer homology regions. </p>
https://biology.stackexchange.com/questions/94021/does-using-crispr-cas9-knockout-need-to-add-donor-dna-in-the-process
Question: <p>Sometimes people wanna use primary cells to do gene-editing because the cells normally have more interesting characteristics, but can we really do so?</p> Answer: <p>The most efficient CRISPR-based editing of primary cells that I've read about used a technology called <a href="https://en.wikipedia.org/wiki/Prime_editing" rel="nofollow noreferrer">prime editing</a>, developed in 2019.</p> <p><a href="http://blumberg-lab.bio.uci.edu/biod145-w2020/required%20reading/anzalone-2019_prime_editing.pdf" rel="nofollow noreferrer"><strong>Search-and-replace genome editing without double-strand breaks or donor DNA</strong></a> (PDF download)</p> <p>Normal CRISPR-Cas9 protocols involve generating double-strand breaks (DSBs), and then either introducing a template for homologous repair or allowing the cell to repair the break without a template, leading to insertions or deletions at the lesion site. Off-target cutting is common, so normal CRISPR-Cas9 produces undesirable or lethal mutations in a majority of transfected cells. </p> <p>Prime-editing uses a catalytically impaired Cas9 (generates nicks instead of DSBs) fused to a reverse transcriptase. The fusion protein is guided to its target by a prime-editor gRNA ("pegRNA") that contains a normal targeting domain at its 5' end and a template for reverse transcription at its 3' end. A nick is generated by the Cas9 on the exposed strand (<em>i.e.</em> the strand not bound by the gRNA), and the 3' portion of the pegRNA partially hybridizes to the the 5' side of the nick, providing a free 5' end and a stretch of ssRNA for DNA polymerization. Resolution of the resulting "flap" by endogenous nick-repair mechanisms results in editing at the target site without DSBs or exogenous DNA template. </p> <p>This method was assessed for its efficiency in several cell types, including primary mouse cortical neurons, which are post-mitotic and terminally-differentiated. The authors observed the desired edit of <a href="https://www.ncbi.nlm.nih.gov/gene/13433" rel="nofollow noreferrer"><em>DNMT1</em></a> in 7.1% of cells, with 0.58% indels on average. Cas9 nuclease editing of the same cell type with the same lentivirus transfection system resulted in 31% indels, on average, an error rate more than 50 times that of prime-editing. </p>
https://biology.stackexchange.com/questions/94044/can-crispr-be-used-in-editing-primary-cells-how-is-the-transfection-efficiency
Question: <p>I'm talking about CRISPR system. I know the crRNA is transcribed from the palindromic repeat and the "spacer" but I don't know where the tracrRNA comes from.</p> Answer: <p>Usually the tracrRNA is a part of the CRISPR locus and is encoded in the the vicinity of the CRISPR array (e.g. upstream or downstream of the cas genes or the array).</p> <p><a href="http://www.genome-engineering.org/crispr/wp-content/uploads/2013/01/crispr_processing1.jpg" rel="nofollow noreferrer">http://www.genome-engineering.org/crispr/wp-content/uploads/2013/01/crispr_processing1.jpg</a></p>
https://biology.stackexchange.com/questions/65776/where-does-tracrrna-comes-from
Question: <p>In research of seed breeding, I'm trying to understand the impact of genetic engineering techniques like CRISPR (This is the main one as I understand) on traditional seed breeders. Through searching on the internet, I believe to have found the following two types of impact:</p> <ol> <li>research: increased speed of detection which genes make for which vegetable trait. This is supposed to be used already by many breeders.</li> <li>Growing: Reducing the breeding cycles by up to a factor 2, by early selection which plants are the good ones in the breeding process (I don't really understand how this would work)</li> </ol> <p>So the main total impact of new breeding technologies would be the shortening of breeding cycles, putting increased pressure on fast innovation.</p> <p>Am I missing any type of impact? Is CRISPR going to change seed breeding in a dramatic way? For instance, is there a way to take someone else his/her seed, then using crisper (in some way?) to immediately know which genes make up for the desired vegatable traits? Or some increased speed in which one could copy traits of other seeds? Also I'd like to know how the second point works: using CRISPR to reduce the breeding cycles for seeds.</p> Answer:
https://biology.stackexchange.com/questions/67100/what-impact-do-genetic-engineering-techniques-have-on-seed-breeders
Question: <p>I am new to these concepts in biology and need some help understanding. My main concern is how to find the enhancer of my gene of interest, specifically the sequence of the enhancer. I am working on a project where I will be attempting to use CRISPR- mediated deletion of the promoter region and enhancer region in my gene of interest FOXN2, in MCF7 Tamoxifen resistant breast cancer cells. I already have the sequence for the promoter region from UCSC's GenomeBrowser, but I'm not sure if the enhancer region sequence can just be looked up on there or anywhere else. Do I need to do a protocol to find the enhancer region myself? I have seen many things about ChIP-Seq and that I may need to do that to get data to find my enhancer but I am just not sure. I plan to use the sequences of the enhancer and promoter region of my gene of interest to create gRNA for CRISPR. Thank you to anyone who can help.</p> Answer: <p>There are several ways to identify enhancers:</p> <p>(1) Chip seq / chip-chip recognize transcription factor binding sites,</p> <p>(2) Enhancer specific factors can also be used to identify enhancers, such as EP300, the binding sites of EP300 are often used to predict enhancers;</p> <p>(3) RNA polymerase II can bind thousands of enhancers, so POLR2A2a, the largest subunit of RNA polymerase II, can also be used to search for enhancer sites;</p> <p>(4) The high sensitive site of deoxyribonuclease I (DHS) represents the open chromatin region, many of which are covered with enhancers;</p> <p>(5) A large number of active regulatory elements, including enhancers, can be identified by formaldehyde assisted separation regulatory elements (face) combined with sequencing;</p> <p>(6) Some histone modification patterns reflect different chromatin states, such as the binding of h3k4me1 and h3k27ac, which are widely used for enhancer labeling;</p> <p>(7) Enhancer sequence can be transcribed, and the transcriptional enhancer RNA (enrna) is also a marker of enhancer activation;</p> <p>(8) The method of chromosome 3D conformation (e.g. 5C and Chia pet, capture-c) can also provide the information of enhancer promoter interaction.</p>
https://biology.stackexchange.com/questions/88850/how-to-find-the-enhancer-region-of-a-specific-gene
Question: <p>As a computer scientist, I'm interested in the ability of the Cas9 protein to function as an if-gate for DNA. It opens up so many questions for me. Right now the protein works as "if the sequence matches, cleave", but perhaps you could customize it to do "if the sequence matches, [do arbitrary action]". However, I'd feel very dumb if I got all excited about this and it tuned out "no... there are plenty of things that function as [if sequence matches], the real revolution of CRISPR/Cas9 is... [something else]". Is my fear qualified?</p> Answer: <p>There are two classes of proteins that I can think of off the bat that are DNA sequence-specific. First are <a href="https://en.wikipedia.org/wiki/Restriction_enzyme" rel="nofollow">restriction enzymes</a>, which recognize a specific (usually short) sequence of DNA and cleave it, sometimes through both strands at the same spot (blunt ends) and sometimes leaving an overhang or "sticky end". </p> <p>The other class is <a href="https://en.wikipedia.org/wiki/Transcription_factor" rel="nofollow">transcription factors</a>. Instead of altering the DNA, these proteins bind to a <a href="https://en.wikipedia.org/wiki/Consensus_sequence" rel="nofollow">consensus sequence</a> and act as a gathering point for the <a href="https://en.wikipedia.org/wiki/Transcription_(genetics)" rel="nofollow">transcription</a> machinery to bind and begin transcribing the following gene into RNA.</p> <p>What makes the CRISPR/Cas discovery unique is that the binding sequence can essentially be an arbitrary sequence, defined by the scientist, allowing for cuts just about anywhere. Transcription factors and restriction enzymes depend on the local sequence of the DNA itself, so they only bind in certain spots.</p> <p>There are other sequence-specific technologies available, such as <a href="https://en.wikipedia.org/wiki/Transcription_activator-like_effector_nuclease" rel="nofollow">TALEN</a>, but they are basically a combination of a site-specific transcription factor and a fairly non-specific restriction enzyme or nuclease fragment engineered into it that cuts at a specific, user-defined site, depending on which subunits are used. CRISPR is a much more powerful (and easier to implement <em>in vivo</em>) technology, though, so while TALEN still has a place in the molecular biology toolbox, CRISPR is rapidly eclipsing it.</p>
https://biology.stackexchange.com/questions/52480/is-cas9-unique-in-its-ability-to-act-in-response-to-a-specific-dna-sequence
Question: <p>Sorry for the possibly confused question, my knowledge of genetics is limited to medical training only but I have a question.</p> <p>Are gene editing techniques such as CRISPR used on both of the chromosomes in a pair or just on one of them?</p> <p>Some of the general searching I have done suggests that it can hit one or both. Is there a preferred outcome?</p> Answer: <p>Gene editing using CRISPR-Cas9 can result in both heterozygous and homozygous conditions. It is just the event of probability. But even if u get heterozygous line, making it homozygous is not very difficult. You just have to cross two heterozygous line and screen for homozygous line through markers. </p>
https://biology.stackexchange.com/questions/80008/when-gene-editing-are-both-chromosomes-in-a-pair-changed
Question: <p>Reading Jennifer Doudna's fascinating book on CRISPR. So she describes rare cases where a mutation in a single cell removes the gene responsible for a genetic disease. The cell proliferates and the disease is cured. What I don't understand is--aren't all the aberrant cells also still dividing and passing on the harmful mutation to their progeny? How does the single healthy cell edge out all the other cells to "cure" the patient. </p> Answer: <p>There are some diseases in which a minority population of normal cells can rescue the organism, even in the presence of a majority of mutant cells. Sort of like a group vacation to Kazakhstan with one friend who can speak Kazakh. Very different experience from a vacation where none of you speak Kazakh. </p> <p>Take for example <a href="https://en.wikipedia.org/wiki/Haemophilia" rel="nofollow noreferrer">hemophilia A</a>. Cells have a mutant gene for factor 8. Without factor 8 blood does not clot properly and people have bleeding trouble. You do not need much factor 8. Just a little bit can prevent spontaneous bleeds. People who are heterozygotes for hemophilia A (carriers) are fine at 50% normal. So if you edited mutant liver cells such that they could produce factor 8, even if they were only 10% of the total cell population of the liver, having some factor 8 would sidestep the full hemophilia phenotype. </p> <p>Likewise metabolic mutants - some children are born unable to handle certain substances. <a href="https://en.wikipedia.org/wiki/Phenylketonuria" rel="nofollow noreferrer">Phenylketonuria</a> is the one you read about every time you drink a diet coke. If a minority population of cells could be produced that were able to handle phenylalanine, those would rescue these kids even if most of the cells still could not. </p>
https://biology.stackexchange.com/questions/64247/mutated-cell-proliferation
Question: <p>The CRISPR/Cas defense mechanism uses spacer sequences between palindromic repeats to search for the sequence to cut by an endonuclease. But how are these spacers created?</p> <p>Let's take Bacteriophages, for example, which insert and integrate their genome into the prokaryotic genome. How does this infected cell get rid of the viral genome so that only a piece of the virus remains between palindromic repeats?</p> Answer:
https://biology.stackexchange.com/questions/111138/how-are-spacer-sequences-created-in-a-prokaryotic-genome
Question: <p>I'm interested in the idea of using exosomes as an alternative transfection agent / delivery mechanism for gene editing applications (CRISPR/cas9, etc). </p> <p>Information on the matter is sparse.. Does anyone know of any practical techniques for manufacturing exosomes in the lab?</p> Answer:
https://biology.stackexchange.com/questions/65788/are-there-any-techniques-for-manufacturing-exosomes-in-the-lab
Question: <p>Non-biology background here.</p> <p>I read this very interesting article: <a href="https://www.wired.com/story/crispr-eradicate-invasive-species/" rel="noreferrer">https://www.wired.com/story/crispr-eradicate-invasive-species/</a></p> <p>However I am having a hard time wrapping my head around something:</p> <p>From my basic understanding of natural selection, a gene/trait will spread if it gives the group a relatively higher chance of having children, who will pass on the trait, etc.</p> <p>However in this example, the trait is <strong>infertility</strong>! Doesn't it go completely against natural selection? How could this spread??</p> Answer: <p><strong>Short answer</strong></p> <p>The article in particular that you reference is discussing the possibility of using a mechanism called <a href="https://en.wikipedia.org/wiki/Gene_drive" rel="noreferrer">gene drive</a>. The concept of gene drive breaks the normal "rules" of inheritance and allows a gene to spread much more rapidly than normal in a population.</p> <p><strong>Longer answer</strong></p> <p>Gene drive depends on the idea of a <a href="https://en.wikipedia.org/wiki/Gene-centered_view_of_evolution" rel="noreferrer">selfish gene</a>. There are naturally occurring genes that <em>make copies of themselves</em> to other parts of the genome. Selection pressures can operate at the level of these genes: a gene that can copy itself is going to end up in more offspring than would be expected due to random assortment.</p> <p>For example, imagine a gene present in one chromosome of one parent. Typically, only half of that parent's offspring will have that gene. However, if the gene is able to copy itself to the parent's other chromosome, now all offspring of that parent will have that gene. The prevalence of the gene just doubled. It's possible that the gene will also confer some negative traits, but as long as those negative traits aren't sufficient to cause a >50% reduction in later reproduction of the offspring, they are going to do just fine and go on and mate, spreading the gene further, potentially to an entire population fairly rapidly.</p> <p>The new technology CRISPR makes it easier to create synthetic genes that selfishly copy themselves within the genome (note: this is definitely <em>not</em> the only application of CRISPR) and could confer positive traits that are helpful to humans, like mosquitoes resistant to being carriers of malaria, or to introduce deleterious mutations into a population.</p> <p>As you point out, introducing a mutation that causes sterility and having it spread is still not easy. There are a few clever approaches, though, that can make it possible. Note that the strategy does not to have 100% effectiveness to wipe out a population: once below a certain level, members of the population may have trouble finding mates and face greater predation pressures and the population can collapse.</p> <p>One technique is to boost the proportion of males. If you can force all the offspring of one male to be male, the proportion of males in the next generation will be higher. Those males-that-only-produce-males don't have any immediate reproductive disadvantage versus normal males. If they survive and mate normally, they will continue to compete with normal males (they may also compete with females for food resources during their lifetimes). Any time a normal male mates, sure, it will create a new generation of some females, but every time a transfected male mates it will effectively double the number of transfected males. Even as the total number of individuals in the species drops, the proportion of transfected males remains high. Eventually there are too few normal males to mate, the number of females drop to unsustainable levels, and the population crashes.</p> <p>This approach is similar to the technique of <a href="https://biology.stackexchange.com/questions/71298/how-is-insect-population-control-through-male-sterilization-effective/71301">releasing sterile males</a> which has been used successfully for population control. The difference is that the gene drive technique raises future generations of the (sort-of) sterile males by itself, which might mean it can be used in population control when it is not possible to lab-raise large numbers of sterile males.</p> <p>Note that use of these technologies is very controversial. There are concerns that such a gene could accidentally move from one species to another, for example. Future use of the technique will require combined research into safety and efficacy.</p> <hr> <p>References</p> <p>Burt, A. (2003). Site-specific selfish genes as tools for the control and genetic engineering of natural populations. Proceedings of the Royal Society of London B: Biological Sciences, 270(1518), 921-928.</p>
https://biology.stackexchange.com/questions/71545/how-could-a-species-be-engineered-to-go-extinct
Question: <p>I'm working on a project where I'm trying to use virophages as viral vectors in introducing CRISPR-Cas proteins into other viruses. I was wondering where I might be able to find replication-defective Sputnik virophages or other virophages for this kind of experiment?</p> Answer:
https://biology.stackexchange.com/questions/90146/where-can-i-obtain-sputnik-virophage-samples
Question: <p>I've been transforming E. coli via heat shock in order to insert oligonucleotides (around 50 nt); however, none of my experiments have given positive results so far. I begin to question the efficiency of chemical transformation, especially for short DNA fragments. Is there such a notable difference between chemical and electro transformation?</p> <p><strong>EDIT:</strong> I'm checking for CRISPR array expansion, so my oligos have a protospacer length and structure. I'm using BL21(DE3) cells which have an IPTG-inducible T7 that I'm first transforming with a Cas1-Cas2 plasmid. Then, I induce the cells in order to express those proteins, make them competent, and transform then once again but with the oligos and an eGFP plasmid (for some sort of selection). To check for positive results, I'm amplifying the leader-repeat junction of the CRISPR array and compare its length (via electrophoresis) with a usual array that has no integrands.</p> Answer: <p>How do you detect a potenially positive transfection? Short fragments might have proper teriary structures which may make them behave differently than you would expect. Also, noncircular DNA and RNA is targeted much faster for degradation in most cells if the right head or tail signals are missing.</p> <p>To your question: pulsed electroporation with well prepared bacteria (state, buffer,...) is usually 5-100 x more efficient than chemically competent bacteria.</p>
https://biology.stackexchange.com/questions/73150/heat-shock-vs-electroporation
Question: <p>Let's say a human cell mutates cancerously, we identify the mutated gene sequence and use CRISPR to mutate the patient's cells to include some variation of the cas genes and spacer sequences matching the mutated cancerous sequence.</p> <p>Then design a virus to &quot;infect&quot; cells (cancerous and healthy) with this cas gene sequence and spacer sequences.</p> <p>The infected cells would then produce a specific cas9-like protein targeting the mutated cancerous gene sequence in the patient. As the modified protein producing cells multiplied to replace the old ones, the custom cas9-like protein would detect and remove the targeted cancerous sequence.</p> <p>More elaborately the approach could be used to inject a large library of known cancerous sequences as cas spacers in reproductive cells to start developing a species-wide defense against a significant range of cancerous mutations.</p> <p>What primary obstacles would be in the way? I suspect research has been done on this.</p> <p>My knowledge so far:</p> <ul> <li><a href="https://en.m.wikipedia.org/wiki/Virotherapy#Viral_gene_therapy" rel="nofollow noreferrer">Basic understanding of virotherapy</a> - I'd like to clarify my question is asking about something beyond research I've seen on anti-cancer oncolytic viruses which target cancer cells. My question is about repairing the cells rather than killing them.</li> <li><a href="https://youtu.be/MnYppmstxIs" rel="nofollow noreferrer">A big picture</a> of how CRISPR functions and how it can be modified to achieve specific gene editing functions. Spacer DNA sequences matching targeted gene sequences (usually threats such as bacteriophages) are used by the cas genes to produce proteins called cas9 (or some variation) which couple with crRNA and tracrRNA to match and slice targeted DNA sequences.</li> <li><a href="https://en.m.wikipedia.org/wiki/Cas9" rel="nofollow noreferrer">a closer look</a> at the specifics of cas9 and its behavior.</li> </ul> <p>Potential problems I considered but couldn't find specific studies on:</p> <ul> <li><p>Whether the viral delivery of the modified dna would be prevented by the immune system before all the cancer cells could be &quot;infected&quot;.</p> </li> <li><p>Whether human DNA's size (roughly 1000x the size of some bacteria DNA) might be too &quot;large of a search space&quot; for the cas9 or cas9-like proteins to &quot;find&quot; the targeted sequence.</p> </li> <li><p>Whether customization of cas9 into some more specialized / effective variant would overcome any obstacles to this approach.</p> </li> </ul> Answer:
https://biology.stackexchange.com/questions/97604/what-obstacles-would-be-most-prevalent-in-an-attempt-to-use-virotherapy-to-inj
Question: <p>I live in Egypt, and I do want to perform CRISPR-Cas9 genome modification, but there are no reliable sources of Cas9. I can order some Cas9 online from the US, but not much. So... my question is, is there any way I can replicate a small amount of Cas9 to get a bigger amount? Or maybe extract some from S. Pyogens? I've been searching about this for quite some time, so any support would be really appreciated.</p> <p>Note: I'm not really the "Biology" guy, so please tell me if I sound ridiculous.</p> Answer:
https://biology.stackexchange.com/questions/71189/a-reliable-source-of-cas9
Question: <p>I have many questions about the Cas9 enzyme. When the Cas9-guideRNA (crRNA and transcrRNA) complex is attached to the DNA sequence, what is the type of bond that cuts the Cas9? Does the Cas9 degrade all the sequence of DNA complementary to the guide RNA?</p> <p>If the question before is "Not", then how is the sequence that is going to be cut on the DNA complementary to the guide DNA, determined? What type of enzyme the Cas9 is?</p> <p><a href="https://i.sstatic.net/31zmA.png" rel="nofollow noreferrer"><img src="https://i.sstatic.net/31zmA.png" alt="enter image description here"></a></p> Answer: <p>Cas9 is an endo-deoxyribonuclease (<a href="http://www.uniprot.org/uniprot/Q99ZW2" rel="nofollow">UniProt-Q99ZW2</a>). It also has a 3'-5' exonuclease activity by which it trims the DNA a little bit, from the cut site (but not too much).</p> <p>Although, Cas9 is an endonuclease and is evolved as a mechanism of immunity against viruses (like restriction enzymes), they are not considered restriction enzymes. One of the most important differences is that the restriction enzymes do not need an RNA or a DNA as a tether to identify the target sites in the DNA; their DNA binding domains can recognize the restriction sites by themselves. </p> <p>Cas9 cannot just cleave any DNA complementary to the guide RNA. It needs PAM (<a href="https://en.wikipedia.org/wiki/Protospacer_adjacent_motif" rel="nofollow">protospacer adjacent motifs</a>) sequences adjacent to the target site to cleave that latter.</p> <p>For details check out the <a href="https://en.wikipedia.org/wiki/CRISPR" rel="nofollow">wikipedia page on CRISPR</a> or read a <a href="http://dx.doi.org/10.1146/annurev-biochem-060815-014607" rel="nofollow">review</a>.</p>
https://biology.stackexchange.com/questions/52360/can-the-cas9involved-on-the-crispr-cas9-mechanism-be-considered-as-a-restric
Question: <p>Researchers have proposed the application of CRISPR/Cas9 and <a href="https://en.wikipedia.org/wiki/Gene_drive" rel="nofollow noreferrer">gene drive</a> to genetically alter wild mosquito populations such that they don't transmit malaria. The government of New Zealand has announced a <a href="https://en.wikipedia.org/wiki/Predator_Free_2050" rel="nofollow noreferrer">program</a> to eliminate several invasive mammals from that island, also using gene drive (among other things).</p> <p>Could we use this technology to completely eradicate from the world all species of mosquito that prey on humans? Also, could we accurately predict the extent of the resulting ecological disruption so we could decide if it was worth it?</p> Answer: <blockquote> <p>Could we use this technology to completely eradicate from the world all species of mosquito that prey on humans?</p> </blockquote> <p>Yes, implemented correctly, a gene drive has this capability.</p> <blockquote> <p>Also, could we accurately predict the extent of the resulting ecological disruption so we could decide if it was worth it?</p> </blockquote> <p>The current scientific and political consensus is that, no, we can't predict the potential consequences with high enough confidence to move forward with such a large-scale manuever.</p> <p>One of the leading scientists studying and improving gene drives, Kevin Esvelt at the MIT Media Lab, instead supports a <a href="http://biorxiv.org/content/early/2016/06/06/057307" rel="nofollow noreferrer">"daisy chain gene drive"</a> which is pre-programmed to weaken with each successive generation, allowing humans to effectively control the spread of gene drives to a specific geographic area and time frame.</p>
https://biology.stackexchange.com/questions/58604/could-we-eradicate-mosquitoes
Question: <p>As a someone with beginner knowledge on biology, I have come across the terms "RNA editing".</p> <p>Take this paper for example : <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5793859/" rel="nofollow noreferrer">RNA Editing with CRISPR-Cas13</a></p> <p>From my understanding, DNA -> RNA -> Proteins</p> <p>If we use a vector for delivering a gene to a cell in-vivo, does it mean that corrections aren't permanent for RNA edits?</p> Answer: <p>There are several differences, both mechanistically and functionally.</p> <ol> <li>DNA edits are heritable by the daughter cells and are therefore permanent whereas RNA edits are not.</li> <li>The type of Cas protein used in the editing process for DNA and RNA are different. </li> <li>In the paper that you linked the authors have fused an RNA editing enzyme (ADAR) with dCas13 (a variant that does not cleave the target). So the CRISPR-Cas system directs ADAR to the sites on RNA that need to be edited. Usually when editing the DNA with CRISPR-Cas, people rely on the ability of the complex to cleave the DNA. This double strand break may be then repaired using different pathways (NHEJ and HR) during which editing happens. See these posts for more details: <br> &nbsp;&nbsp;&nbsp;&nbsp; <a href="https://biology.stackexchange.com/q/29735/3340">How is the type of genetic manipulation determined in CRISPR-Cas9?</a> <br> &nbsp;&nbsp;&nbsp;&nbsp; <a href="https://biology.stackexchange.com/q/31928/3340">Mutations/deletions with CRISPR</a> <br> &nbsp;&nbsp;&nbsp;&nbsp; <a href="https://biology.stackexchange.com/q/38828/3340">How does NHEJ cause indels?</a></li> <li>It is also possible to edit DNA in a way that does not involve cutting of the DNA. These techniques use similar principle as in the case of RNA editing described in the paper that you linked (see the abstract and introduction of <a href="https://dx.doi.org/10.1126/science.aaw7166" rel="nofollow noreferrer">this paper</a>). However, if you cut the RNA, then it will be completely degraded instead of being repaired.</li> </ol>
https://biology.stackexchange.com/questions/84567/what-is-the-difference-between-dna-vs-rna-editing-in-the-context-of-gene-therapy
Question: <p>Articles about ’prime’ CRISPR editing generally state that a major advantage is that it only affects one strand…</p> <p>…But what happens to the second, complementary strand of the genome? Doesn’t it have to eventually change to match the first?</p> <p>Or is that edited portion of the genome forever ‘open’, which would surely cause problems in replication etc.?</p> Answer: <p><em>Of course, both DNA strands must be changed.</em></p> <p>The way this is done can be found,for examlple, in the Wikipedia article <a href="https://en.wikipedia.org/wiki/Prime_editing" rel="nofollow noreferrer">“Prime editing”</a>. In brief, there have been several modifications of the main approach to this, which in essence is as follows:</p> <blockquote> <p>After the editing of one strand has been completed, a nick is introduced in the unedited strand. The cell’s natural repair mechanism will act on the nicked (unedited) strand and, in so doing, copy the intact edited strand.</p> </blockquote> <p>Details of how the specific nicking of the unedited strand is achieved can be found in the cited article.</p> <p><em>Postscript</em><br> It is perhaps worth clarifying why editing a single strand, rather than both, is advantageous. As I am no expert in this area, I merely quote verbatim from the Wikipedia article:</p> <blockquote> <p>“The prime editing tool offers advantages over traditional gene editing technologies. CRISPR/Cas9 edits rely on non-homologous end joining (NHEJ) or homology-directed repair (HDR) to fix DNA breaks, while the prime editing system employs DNA mismatch repair. This is an important feature of this technology given that DNA repair mechanisms such as NHEJ and HDR, generate unwanted, random insertions or deletions (INDELs).”</p> </blockquote>
https://biology.stackexchange.com/questions/114552/what-happens-to-the-second-strand-in-single-stranded-prime-editing
Question: <p>The lysis-lysogeny state of bacteriophage lambda is well known. Under certain conditions, the phage will enter the lysogenic state after infection of a bacterium. Then, after a while, the phage switches to the lytic state and breaks the bacterium. I forgot the details but the phage must expressed some proteins toxic to the bacteria, e.g., a protease, to lyse the bacteria.</p> <p>Here is the question: Did bacteria have any immune strategies to defend themselves in face of these toxic proteins? In mammals, both nucleic acid and protein can induce immunological responses and activate T/B cells. In bacteria, I know that the CRISPR system is an immune strategy to degrade viral nucleic acids, but seemingly not proteins.</p> <p>So if the CRISPR system has missed cutting the viral DNA, the phage has switched to lytic state and begun to produce toxic proteins, did the host bacteria still have weapons to defend? Obviously, most of the time the bacteria failed and died. However, after billions of years' evolution, how could bacteria just give up in face of the toxic proteins?</p> Answer: <p>I don't know of any direct defenses available to bacteria once a prophage genome has been integrated. If a prophage has induced and carried out its program to the point that lysis proteins are being produced, it is far too late for the host cell.</p> <p>However, an indirect defense for the bacteria is to simply survive and replicate faster than its prophages induce. You seem to be thinking about this as a purely antagonistic relationship, but once the viral genome is integrated into the bacteria, their reproductive fitness becomes intertwined. When the host replicates, both genomes are copied, so the phage can produce far more progeny by delaying activation until the host builds up its numbers. Phage that boost the fitness of their lysogenic hosts will be even more successful. Prophage can <a href="https://www.nature.com/articles/ismej201679" rel="nofollow noreferrer">defend against infection by other viruses</a>, <a href="https://www.sciencedirect.com/science/article/pii/S0966842X19300599" rel="nofollow noreferrer">confer antibiotic resistance</a>, or <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC515249/" rel="nofollow noreferrer">provide toxins against eukaryotes or rival bacteria</a>. After many generations, mutations that destroy the prophage's ability to induce and kill the host cell but preserve the beneficial genes are selected for; <a href="https://www.pnas.org/doi/10.1073/pnas.1405336111" rel="nofollow noreferrer">bacterial &quot;domestication&quot; of integrated viral genomes appears to be common</a>. A thorough discussion of bacterial/prophage co-evolution could fill a textbook, but is mostly beyond the scope of this question. The links in this answer should provide a good starting point if you'd like to know more.</p>
https://biology.stackexchange.com/questions/110620/how-bacteria-respond-to-toxic-viral-proteins
Question: <p>The use of viruses as transfection or delivery agents for gene editing (CRISPR/cas9, etc) is well known. However, one problem with using viruses to deliver DNA into cells is the possibility of triggering an adverse immune response.</p> <p>Cells already use exosomes to transport various cargo in and out of cells. Does this characteristic make exosomes ideal candidates for delivering gene editing cargo as well? </p> <p>Also, are there any known examples or studies involving repurposing exosomes for gene editing? Specifically for CRISPER/cas9 applications?</p> Answer:
https://biology.stackexchange.com/questions/65786/are-exosomes-useful-as-a-transfection-or-delivery-mechanism-in-gene-editing
Question: <p>I know how plasmids and restriction enzymes work to change the dna of a bacteria cell, but I do not really understand how a bacteriophage works to edit the genome of a cell. Is it related to crispr since its a virus which inserted genetics in bacteria? Also, is it during the lysogenic or lytic stage that the bacteriophage alters the DNA?</p> Answer: <p>As explained in the Wikipedia page that you have linked to, <strong>transduction</strong> is the name given to a particular phenomenon whereby phage can be used to move bacterial DNA between cells. </p> <p>Depending upon the phage, some aberrant or infrequent process can result in the packaging of host cell DNA into a phage particle during a lytic cycle. The resulting defective phage particle is still infective however, and when it infects a new host cell it injects the bacterial DNA that it is carrying. This DNA can then recombine with the host DNA. </p> <p>So, for example, if the second host was a <em>lacZ</em> mutant but the parent host was <em>lacZ⁺</em>, then it would be possible to select <em>lacZ⁺</em> in the second host. </p> <p>Transduction was an important tool in <em>E. coli</em> genetics. <a href="https://en.wikipedia.org/wiki/P1_phage?wprov=sfsi1" rel="nofollow noreferrer">Phage P1</a> can be used for <em>general</em> transduction, which means that any piece of DNA can be moved. As I said in my comment: anything that can happen will happen.</p>
https://biology.stackexchange.com/questions/62854/bacteriophages-and-their-role-in-genetic-editing