image listlengths 1 1 | messages listlengths 2 2 | task_name stringclasses 5 values | dataset_name stringclasses 17 values | rvl_cdip_class stringclasses 12 values |
|---|---|---|---|---|
[
"./val_imgs/TURL/col_type_167628.jpg"
] | [
{
"role": "user",
"content": "<|image|>Interpret the image as Markdown format."
},
{
"role": "assistant",
"content": "<md> | restaurant | location | specialty(s) | \n | --- | --- | --- | \n | Sammy's L.A. Pastrami and Burgers | Las Vegas, Nevada | \"The Pastrami Burger\" (1/4-pound burger topped with 1/2-pound pastrami , provolone cheese, pickles and yellow mustard), \"Zombie Burger\" (stack of 3 beef patties, cheese, hot links, bacon and 2 onion rings), \"Chipotle Burger\" (topped with cheese, fries, bacon, spicy ketchup and a fried egg), \"502 Mega Meal\" (pound of fries, 1/2 of pastrami, chili, ribeye steak and cheese topped with jalapenos and fried oinions) | \n | Original Tommy's World Famous Hamburgers | Los Angeles, California | Double Chili Cheeseburger (two 80/20 beef patties, topped with secret-spiced chili, cheese, a tomato, pickles, chopped onions and yellow mustard on toasted buns) | \n | Roberto's Taco Shop | ( Ocean Beach ), San Diego, California | \"California Burrito\" (salt, pepper and garlic spiced carne asada beef, fries, cheese, sour cream and guacamole stuffed into a giant toasted tortilla), Rolled Tacos (deep-fried corn tortilla topped with guacamole, sour cream and cheese) | \n | DBC Bar & Grill (Daiquiri Bay Café) | New Orleans, Louisiana | Drive-thru Daiquiris - Pina Colada , \"Banana Banshee\" ( crème de cacao & rum), \"Chocolate Kiss\" (fudge schnapps & crème de cacao), \"House Special\" - combination of \"Island Citrus\" (orange curacao, 151 rum, 190 everclear , & triple sec ) & \"Jungle Juice\" (190 & vodka ) | \n | Company 7 BBQ | Englewood, Ohio | Slow-cooked dry-rubbed barbeque - pulled pork sandwich, pork ribs and smoked beef brisket, signature sauces - \"Lieutenant Tangy\" (thick Kansas City-style tangy BBQ sauce), \"Commissioner Burns\" (Texas-style hot BBQ sauce), \"Chief Smokey\" (smoky-flavored BBQ sauce) | \n | Sunrise Biscuit Kitchen | Chapel Hill, North Carolina | Drive-thru breakfast – Chicken and Cheddar Biscuit (fried chicken breast, cheddar cheese between a buttery buttermilk biscuit), Egg Sausage & Cheese Biscuit | \n | Cozy Dog Drive-In | Springfield, Illinois | \"Cozy Dog\" - corn dog (cornmeal batter-dipped beef hot dogs fried in hot oil served with ketchup or yellow mustard), homemade chili, famous vinegar & salt hand-cut fries | \n | Maid-Rite Drive-In | Des Moines, Iowa | \"Maid-Rite\" (loose meat sandwich – scoop of Omaha ground beef topped with American cheese, pickles, chopped onions, ketchup and yellow mustard between steamed buns served with homemade potato chips), \"Cheese-Rite\" (with white cheddar cheese) \"Blue-Rite\" (with blue cheese on a ciabatta bun), \"Rare-Bit\" (with marble rye and white cheddar cheese sauce) | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_100546.jpg"
] | [
{
"role": "user",
"content": "<|image|>Transcribe the diagram into Markdown format."
},
{
"role": "assistant",
"content": "<md> | year | champion | runner-up | score | \n | --- | --- | --- | --- | \n | 2011 | Rogério Dutra da Silva | Izak van der Merwe | 6–4, 6–7 (7–5) , 6–3 | \n | 2010 | Izak van der Merwe | Ricardo Mello | 7–6(6), 6–3 | \n | 2009 | Horacio Zeballos | Thiago Alves | 6–7(4), 6–4, 6–3 | \n | 2008 | Brian Dabul | Izak van der Merwe | 7–5, 6–7(6), 6–3 | \n | 2007 | Brian Dabul | Michael Quintero | 7–5, 7–5 | \n | 2006 | Ricardo Mello | Ivo Klec | 6–3, 6–4 | \n | 2005 | André Sá | Juan Martín del Potro | 6–4, 6–4 | \n | 2004 | Takao Suzuki | Giovanni Lapentti | 6–4, 6–3 | \n | 2003 | Giovanni Lapentti | Gouichi Motomura | 6–4, 6–0 | \n | 2002 | Ricardo Mello | Maximilian Abel | 7–6(2), 6–3 | \n | 2001 | Ramón Delgado | Daniel Melo | 7–6(3), 6–2 | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_334291.jpg"
] | [
{
"role": "user",
"content": "<|image|>Transform the diagram into Markdown format."
},
{
"role": "assistant",
"content": "<md> | crossing | carries | location | river mile | year built | coordinates | \n | --- | --- | --- | --- | --- | --- | \n | Knight's Bridge | Knight's Bridge road | Canby | 2.7 | 1877 (original structure) | | \n | Rail bridge | Southern Pacific rail (Canby-Aurora) | Canby | 3.7 | | | \n | 99E Bridge | Oregon Route 99E | Canby | 3.8 | | | \n | Goods Bridge | Hwy 170 (S Kropf Road) (Canby-Marquam Hwy) | Canby | 6.0 | | | \n | Rail Bridge | Canby-Molalla rail spur | Canby | 10.0 | | | \n | Hwy 213 Bridge | Hwy 213 (Cascade Hwy) | Mulino , Liberal | 14.5 | | | \n | Hwy 211 Bridge | Hwy 211 (Woodburn-Estacada Hwy) | Molalla | 18.5 | | | \n | Feyrer Park Bridge | Feyrer Park road | Molalla | 20.7 | | | \n | Private Bridge | Molalla Forest Service road | Molalla | 22.4 | | | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_272475.jpg"
] | [
{
"role": "user",
"content": "<|image|>Parse the figure content behind with markdown code: <md> | team | pld | w | l | pts | bowsr | \n | --- | --- | --- | --- | --- | --- | \n | Kent | 4 | 4 | 0 | 12 | 32.605 | \n | Surrey | 4 | 3 |"
},
{
"role": "assistant",
"content": "1 | 9 | 30.154 | \n | Essex | 4 | 2 | 2 | 6 | 39.226 | \n | Sussex | 4 | 1 | 3 | 3 | 38.938 | \n | Cambridge University | 4 | 0 | 4 | 0 | 65.667 | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_157357.jpg"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the image in markdown code: <md> | year | title | character / role | \n | --- | --- | --- | \n | 2000 | Double Whammy | Ricky Lapniski | \n | 2002 | Stuart Little 2 | Irwin | \n | 2004 | Shortcut to Happiness | Tommy Anderson | \n | 2007 | Chasing Tchaikovsky |"
},
{
"role": "assistant",
"content": "Misha Stone | \n | 2010 | Song in a Convince store | Teen B | \n | 2010 | Fred: The Movie | older Evan Weiss | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_264439.jpg"
] | [
{
"role": "user",
"content": "<|image|>Convert the photo to Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | position | club | played | points | wins | draws | losses | goals for | goals against | goal difference | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | 1 | Elche CF | 30 | 40 | 18 | 4 | 8 | 73 | 38 | +35 | \n | 2 | Levante UD | 30 | 37 | 16 | 5 | 9 | 49 | 33 | +16 | \n | 3 | CA Almería | 30 | 32 | 14 | 4 | 12 | 47 | 41 | +6 | \n | 4 | CD Tenerife | 30 | 31 | 12 | 7 | 11 | 34 | 38 | -4 | \n | 5 | CF Extremadura | 30 | 30 | 12 | 6 | 12 | 45 | 47 | -2 | \n | 6 | Real Murcia | 30 | 30 | 13 | 4 | 13 | 40 | 38 | +2 | \n | 7 | Cádiz CF | 30 | 29 | 11 | 7 | 12 | 51 | 57 | -6 | \n | 8 | Córdoba CF | 30 | 29 | 11 | 7 | 12 | 58 | 52 | +6 | \n | 9 | Real Jaén | 30 | 29 | 12 | 5 | 13 | 47 | 51 | -4 | \n | 10 | AD Plus Ultra | 30 | 29 | 11 | 7 | 12 | 39 | 49 | -10 | \n | 11 | Atlético Ceuta | 30 | 29 | 11 | 7 | 12 | 31 | 39 | -8 | \n | 12 | CD San Fernando | 30 | 29 | 11 | 7 | 12 | 39 | 43 | -4 | \n | 13 | Hércules CF | 30 | 28 | 10 | 8 | 12 | 44 | 51 | -7 | \n | 14 | CD Badajoz | 30 | 27 | 9 | 9 | 12 | 44 | 52 | -8 | \n | 15 | CD Málaga | 30 | 27 | 9 | 9 | 12 | 44 | 47 | -3 | \n | 16 | CD Eldense | 30 | 24 | 8 | 8 | 14 | 46 | 55 | -9 | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_106866.jpg"
] | [
{
"role": "user",
"content": "<|image|>Interpret the table as Markdown format."
},
{
"role": "assistant",
"content": "<md> | # | title | length | \n | --- | --- | --- | \n | 1 | 100 100's (featuring T Wayne) | 4:23 | \n | 2 | Skit | 0:40 | \n | 3 | Time Standing Still (featuring J. Stalin ) | 3:32 | \n | 4 | My Dreams | 3:23 | \n | 5 | Aqurius | 3:39 | \n | 6 | In My Spaceship (featuring Macrhuger, Lee Majors & Fed-X ) | 4:09 | \n | 7 | Bay Area Championship (featuring Lee Majors) | 4:03 | \n | 8 | VIP (featuring E-40 ) | 2:36 | \n | 9 | Sick | 1:46 | \n | 10 | Excuse Me | 3:47 | \n | 11 | Hottest in the Summer | 2:50 | \n | 12 | How Many Racks | 3:40 | \n | 13 | Wallet So Fat | 3:34 | \n | 14 | What Am I Supposed to Do (featuring Stubby) | 3:00 | \n | 15 | Long Way | 3:13 | \n | 16 | The Streets (featuring Arjay) | 4:53 | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_54063.jpg"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the figure in markdown code: <md> | position | player | status* | 2010 team | 2011 team | \n | --- | --- | --- | --- | --- | \n | LB | Charlie Anderson | UFA | Kansas City Chiefs | None | \n | RB | Jackie Battle | RFA | Kansas City Chiefs | Kansas City Chiefs | \n | WR | Steve Breaston | UFA | Arizona Cardinals | Kansas City Chiefs | \n | CB | Brandon Carr | RFA | Kansas City Chiefs | Kansas City Chiefs | \n | FB | Tim Castille | UFA | Kansas City Chiefs | None | \n | WR | Keary Colbert | UFA | None | Kansas City Chiefs | \n | WR | Terrance Copper | UFA | Kansas City Chiefs | Kansas City Chiefs | \n | TE | Brad Cottam | RFA | Kansas City Chiefs | None | \n | FB | Mike Cox | RFA | Kansas City Chiefs | Kansas City Chiefs | \n | QB | Brodie Croyle | UFA | Kansas City Chiefs | Arizona Cardinals | \n | WR | Kevin Curtis | UFA | Kansas City Chiefs | Tennessee Titans | \n | CB | Travis Daniels | UFA | Kansas City Chiefs | Kansas City Chiefs | \n | DT | Ron Edwards | UFA | Kansas City Chiefs | Carolina Panthers | \n | OT | Jared Gaither | UFA | Baltimore Ravens | Kansas City Chiefs | \n | DE | Wallace Gilberry | RFA | Kansas City Chiefs | Kansas City Chiefs | \n | DT | Kelly Gregg | UFA | Baltimore Ravens | Kansas City Chiefs | \n | LB | Cory Greenwood | EFA | Kansas City Chiefs | Kansas City Chiefs | \n | LB | Tamba Hali | UFA | Kansas City Chiefs | Kansas City Chiefs | \n | S | Reshard Langford | EFA | Kansas City Chiefs | Kansas City Chiefs | \n | CB | Maurice Leggett | RFA | Kansas City Chiefs | None | \n | FB | Le'Ron McClain | UFA | Baltimore Ravens | Kansas City Chiefs | \n | S | Jon McGraw | UFA | Kansas City Chiefs | Kansas City Chiefs | \n | OT | Steve Maneri | RFA | New England Patriots | Kansas City Chiefs | \n | LB | Corey Mays | UFA | Kansas City Chiefs | None | \n | C | Rudy Niswanger | UFA | Kansas City Chiefs | Detroit Lions | \n | OT | Ryan O'Callaghan | UFA | Kansas City Chiefs | Kansas City Chiefs | \n"
},
{
"role": "assistant",
"content": "| S | Sabby Piscitelli | UFA | Tampa Bay Buccaneers & Cleveland Browns | Kansas City Chiefs | \n | TE | Leonard Pope | UFA | Kansas City Chiefs | Kansas City Chiefs | \n | OT | Barry Richardson | RFA | Kansas City Chiefs | Kansas City Chiefs | \n | LB | Brandon Siler | UFA | San Diego Chargers | Kansas City Chiefs | \n | DE | Shaun Smith | UFA | Kansas City Chiefs | Tennessee Titans | \n | LB | Mike Vrabel | UFA | Kansas City Chiefs | Retired | \n | C | Casey Wiegmann | UFA | Kansas City Chiefs | Kansas City Chiefs | \n | * RFA: Restricted free agent , UFA: Unrestricted free agent , ERFA: Exclusive rights free agent , Franchise: Franchise tag | * RFA: Restricted free agent , UFA: Unrestricted free agent , ERFA: Exclusive rights free agent , Franchise: Franchise tag | * RFA: Restricted free agent , UFA: Unrestricted free agent , ERFA: Exclusive rights free agent , Franchise: Franchise tag | * RFA: Restricted free agent , UFA: Unrestricted free agent , ERFA: Exclusive rights free agent , Franchise: Franchise tag | * RFA: Restricted free agent , UFA: Unrestricted free agent , ERFA: Exclusive rights free agent , Franchise: Franchise tag | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_89731.jpg"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the photo with markdown style: <md> | team 1 | agg. | team 2 | 1st leg | 2nd leg | \n | --- | --- | --- | --- | --- | \n | Real Madrid | 1–3 | Dynamo Kyiv | 1–1 | 0–2 | \n | Manchester United | 3–1 | Internazionale | 2–0 | 1–1 | \n | Juventus | 3–2 | Olympiacos | 2–1 | 1–1"
},
{
"role": "assistant",
"content": "| \n | Bayern Munich | 6–0 | Kaiserslautern | 2–0 | 4–0 | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_118172.jpg"
] | [
{
"role": "user",
"content": "<|image|>Parse the illustration content behind with markdown code: <md> | rank | cyclist | time | \n | --- | --- | --- | \n | | Tanya Dubnicoff ( CAN ) | 35.394 | \n | | Nancy Contreras ( MEX ) | 35.962 | \n | | Yumari González ( CUB ) | 36.255 | \n | 4. | Daniela Larreal ("
},
{
"role": "assistant",
"content": "VEN ) | 36.589 | \n | 5. | Jennie Reed ( USA ) | 37.109 | \n | 6. | Daniela Donadio ( ARG ) | 37.841 | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_218560.jpg"
] | [
{
"role": "user",
"content": "<|image|>What are the following picture content in markdown style: <md> | title | winners | runners-up | \n | --- | --- | --- | \n | Brunei Premier"
},
{
"role": "assistant",
"content": "League | 2002, 2004 | | \n | Brunei FA Cup | 2004 | | \n | Brunei Super Cup | 2002, 2004 | | \n | Singapore League Cup | 2009, 2012 | | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_228247.jpg"
] | [
{
"role": "user",
"content": "<|image|>Convert the diagram into Markdown format."
},
{
"role": "assistant",
"content": "<md> | name | seasons | rounds (starts) | titles | wins | sprint wins | feature wins | 2nd | 3rd | poles | fastest laps | points | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | Karun Chandhok | 2005–06 | 2 (3 starts) | | | | | | | | | 0 | \n | Armaan Ebrahim | 2005–06 , 2006–07 | 11 (22 starts) | | | | | | | | | 0 | \n | Narain Karthikeyan | 2006–07 , 2007–08 , 2008–09 | 20 (40 starts) | | 2 | | 2 | 1 | | 1 | | 93 | \n | Parthiva Sureshwaren | 2006–07 , 2007–08 | 2 (4 starts) | | | | | | | | | 0 | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_210122.jpg"
] | [
{
"role": "user",
"content": "<|image|>Convert the photo into Markdown language."
},
{
"role": "assistant",
"content": "<md> | team | pld | w | d | l | gf | ga | gd | pts | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | Persija Jakarta | 3 | 2 | 1 | 0 | 5 | 0 | +5 | 7 | \n | Sriwijaya FC | 3 | 1 | 2 | 0 | 12 | 2 | +10 | 5 | \n | Persisam Samarinda | 3 | 1 | 1 | 1 | 9 | 5 | +4 | 4 | \n | PSMP Mojokerto | 3 | 0 | 0 | 3 | 2 | 21 | −20 | 0 | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_338845.jpg"
] | [
{
"role": "user",
"content": "<|image|>Convert the figure to Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | year | car | start | qual | rank | finish | laps | led | retired | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | 1920 | 28 | 19 | 92.800 | 6 | 8 | 200 | 0 | Running | \n | 1921 | 25 | 22 | 96.250 | 5 | 22 | 25 | 0 | Crash T3 | \n | 1922 | 10 | 17 | 88.800 | 21 | 10 | 200 | 0 | Running | \n | Totals | Totals | Totals | Totals | Totals | Totals | 425 | 0 | | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_122613.jpg"
] | [
{
"role": "user",
"content": "<|image|>What are the following table content in markdown style: <md> | date | player | from | fee | \n | --- | --- | --- | --- | \n | 19 July 1990 | Mark Hateley | AS"
},
{
"role": "assistant",
"content": "Monaco | £0.5m | \n | 1 August 1990 | Pieter Huistra | FC Twente | | \n | 1 September 1990 | Terry Hurlock | Millwall | £0.325m | \n | Sep 1990 | Oleg Kuznetsov | Dynamo Kyiv | £1.5m | \n | 25 March 1991 | Brian Reid | Greenock Morton | | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_125520.jpg"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the photo in markdown code: <md> | rank | athlete | nation | time | notes | \n | --- | --- | --- | --- | --- | \n | 1 | Lashinda Demus | United States | 54.08 | Q | \n | 2 | Kaliese Spencer | Jamaica | 54.20 | Q | \n | 3 | Perri Shakes-Drayton | Great Britain | 55.19 | | \n | 4 | Hanna Yaroshchuk | Ukraine | 55.51 | | \n | 5 | Irina Davydova | Russia | 55.86 | | \n | 6 | Sara Petersen | Denmark | 56.21 | | \n | 7 |"
},
{
"role": "assistant",
"content": "Anna Jesień | Poland | 56.28 | | \n | 8 | Sarah Wells | Canada | 56.71 | | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_250127.jpg"
] | [
{
"role": "user",
"content": "<|image|>Convert the photo to Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | index & colour | name transliterated into latin script | name in cyrillic script | first opened | latest extension | length ( km ) | stations | \n | --- | --- | --- | --- | --- | --- | --- | \n | 01 | Sokolnicheskaya | Сокольническая | 1935 | 1990 | 26.1 | 19 | \n | 02 | Zamoskvoretskaya | Замоскворецкая | 1938 | 2012 .24 | 39.8 | 21 | \n | 03 | Arbatsko-Pokrovskaya | Арбатско-Покровская | 1938 | 2012 | 45.1 | 22 | \n | 04 | Filyovskaya | Филёвская | 1958 1 | 2006 | 14.9 | 13 | \n | 05 | Koltsevaya (\"Circular\") | Кольцевая | 1950 | 1954 | 19.3 | 12 | \n | 06 | Kaluzhsko-Rizhskaya | Калужско-Рижская | 1958 | 1990 | 37.6 | 24 | \n | 07 | Tagansko-Krasnopresnenskaya | Таганско-Краснопресненская | 1966 | 1975 | 35.9 | 19 | \n | 08 | Kalininskaya | Калининская | 1979 | 2012 | 16.3 | 8 | \n | 09 | Serpukhovsko-Timiryazevskaya | Серпуховско-Тимирязевская | 1983 | 2002 | 41.2 | 25 | \n | 10 | Lyublinsko-Dmitrovskaya | Люблинско-Дмитровская | 1995 | 2011 | 28.2 | 17 | \n | 11 | Kakhovskaya | Каховская | 1995 2 | | 3.3 | 3 | \n | 12 | Butovskaya | Бутовская | 2003 | | 5.5 | 5 | \n | Total: | Total: | Total: | Total: | Total: | 313.1 | 188 | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_265189.jpg"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the table with markdown style: <md> | rank | nation | gold | silver | bronze | total | \n | --- | --- | --- | --- | --- | --- | \n | 1 | Canada (host) | 10 | 4 | 3 | 17 | \n | 2 | Scotland | 5 | 4 | 8 | 17 | \n | 3 | Australia | 4"
},
{
"role": "assistant",
"content": "| 8 | 1 | 13 | \n | 4 | England | 3 | 4 | 9 | 16 | \n | 5 | Wales | 0 | 2 | 0 | 2 | \n | 6 | Norfolk Island | 0 | 0 | 1 | 1 | \n | | | 22 | 22 | 22 | 66 | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_327190.jpg"
] | [
{
"role": "user",
"content": "<|image|>Parse the table content behind with markdown code: <md> | pos | club | p | w/ot | d | l | gf | ga | gd | pts | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | 1 | Jubilo Iwata | 30 | 18/8 | 1 | 3 | 72 | 30 | 42 | 71 | \n | 2 | Yokohama F. Marinos | 30 | 13/6 | 4 | 7 | 44 | 27 | 17 | 55 | \n | 3 | Gamba Osaka | 30 | 15/4 | 1 | 10 | 59 | 32 | 27 | 54 | \n | 4 | Kashima Antlers (C) | 30 | 17/1 | 0 | 12 | 46 | 39 | 7 | 53 | \n | 5 | Kyoto Purple Sanga (P) | 30 | 11/6 | 1 | 12 | 44 | 42 | 2 | 46 | \n | 6 | Nagoya Grampus Eight | 30 | 14/1 | 1 | 14 | 49 | 41 | 8 | 45 | \n | 7 | JEF United Ichihara | 30 | 12/1 | 3 | 14 | 38 | 42 | -4 | 41 | \n | 8 | Shimizu S-Pulse (CW) | 30 | 10/4 | 3 | 13 | 33 | 43 | -10 | 41 | \n | 9 | FC Tokyo | 30 | 11/2 | 2 | 15 | 43 | 46 | -3 | 39 | \n | 10 | Tokyo Verdy 1969 | 30 | 8/5 | 3 | 14 | 41 | 43 | -2 | 37 | \n | 11 | Urawa Red Diamonds | 30 | 7/6 | 2 | 15 | 41 | 38 | 3 | 35 | \n | 12 | Kashiwa Reysol | 30 | 9/1 | 3 | 17 | 38 | 48 | -10 | 32 | \n | 13 | Vegalta Sendai (P) | 30 | 9/2 | 1 | 18 | 40 | 57 | -17 |"
},
{
"role": "assistant",
"content": "32 | \n | 14 | Vissel Kobe | 30 | 8/2 | 3 | 17 | 33 | 44 | -11 | 31 | \n | 15 | Sanfrecce Hiroshima | 30 | 7/1 | 3 | 19 | 32 | 47 | -15 | 26 | \n | 16 | Consadole Sapporo | 30 | 4/1 | 1 | 24 | 30 | 64 | -34 | 15 | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_244671.jpg"
] | [
{
"role": "user",
"content": "<|image|>Parse the picture content behind with markdown code: <md> | country | formal relations began | notes | \n | --- | --- | --- | \n | Iceland | 1956-05-16 | See Foreign relations of Iceland Romania has an honorary consulate in Reykjavík . The diplomatic representation of Romania in Iceland is handled by the Romanian embassy in Copenhagen , Denmark . Iceland has an honorary consulate in Bucharest . The diplomatic representation of Iceland in Romania is handled by the Danish embassy in Bucharest"
},
{
"role": "assistant",
"content": ". Diplomatic relations' level: Legation: May 16, 1956 - December 31, 1963 Embassy: since December 31, 1963 Diplomatic relations' timeline: (between December 1[ O.S. November 18]1918 - June 17, 1944 Romania had diplomatic relations with Denmark who was responsible for Kingdom of Iceland 's foreign affairs) since May 16, 1956 | \n | Liechtenstein | ??? | See Foreign relations of Liechtenstein Romania has an honorary consulate in Vaduz . The diplomatic representation of Romania in Liechtenstein is handled by the Romanian embassy in Bern , in neighbouring Switzerland . Liechtenstein has no diplomatic office in Romania. Liechtenstein's diplomatic representation in Romania is handled by the Swiss embassy in Bucharest . Concerning European matters, the diplomatic representation of Liechtenstein in Romania is handled by Liechtenstein's mission to the European Union in Brussels , Belgium . | \n | Norway | 1917-05-03 | See Norway–Romania relations | \n | Switzerland | 1911-05-09 | See Romania–Switzerland relations | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_254329.jpg"
] | [
{
"role": "user",
"content": "<|image|>Convert the illustration to Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | year | title | role | notes | \n | --- | --- | --- | --- | \n | 1996 | A Touch of Frost | Helen Tudor | Episode: \" Deep Waters \" | \n | 1996 | Kavanagh QC | Helen Kinross | Episode: \" The Burning Deck \" | \n | 1996–1997 | Dangerfield | Alison Dangerfield | 16 episodes | \n | 1998–1999 | The Bill | Carrie Winkler | Episode: \" Deep Secret \" Episode: \" Murder, What Murder? \" | \n | 2000–2001 | Always and Everyone | Dr. Kate Brady | 2 episodes | \n | 2001 | Agatha Christie's Poirot | Christine Redfern | Episode: \" Evil Under the Sun \" | \n | 2003 | The Vice | P.C. Lorraine Johnstone | Episode: \" Birdhouse \" | \n | 2004 | Murder City | Rosa Mansfield | Episode: \"Nothing Sacred\" | \n | 2002–2004 | Teachers | Penny Neville | Main character | \n | 2004–2006 | Bodies | Dr. Polly Grey | Main character | \n | 2009 | Boy Meets Girl | Siobhan | TV miniseries | \n | 2011–present | Midsomer Murders | Dr. Kate Wilding | Main character | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_267201.jpg"
] | [
{
"role": "user",
"content": "<|image|>What are the following figure content in markdown style: <md> | position | athlete | nationality | time | \n | --- | --- | --- |"
},
{
"role": "assistant",
"content": "--- | \n | | Shirley Reilly | United States | 1:37:36 | \n | | Wakako Tsuchida | Japan | 1:37:37 | \n | | Diane Roy | Canada | 1:42:37 | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_259304.jpg"
] | [
{
"role": "user",
"content": "<|image|>Encode the figure in Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | position | first team | second team | \n | --- | --- | --- | \n | Kicker | Pete Stoyanovich , Miami Dolphins (AP, TSN) Morten Andersen , New Orleans Saints (NEA, PFWA) | Morten Andersen, New Orleans Saints (AP-2) Pete Stoyanovich, Miami Dolphins (NEA-2) | \n | Punter | Rich Camarillo , Phoenix Cardinals (AP, PFWA) Rohn Stark , Indianapolis Colts (NEA, TSN) | Rohn Stark, Indianapolis Colts (AP-2) Rich Camarillo, Phoenix Cardinals (NEA-2) | \n | Kick Returner | Deion Sanders, Atlanta Falcons (AP, PFWA, TSN) Mel Gray , Detroit Lions (NEA) | Vai Sikahema , Philadelphia Eagles (NEA-2) Mel Gray, Detroit Lions (AP-2) | \n | Punt Returner | Kelvin Martin , Dallas Cowboys (PFWA) Mel Gray, Detroit Lions (TSN) | | \n | Special Teams | Steve Tasker , Buffalo Bills (PFWA) | | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_15850.jpg"
] | [
{
"role": "user",
"content": "<|image|>Convert the image to Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | district | capital | location | \n | --- | --- | --- | \n | Suzak District | Suzak | south1 | \n | Bazar-Korgon District | Bazar-Korgon | south2 | \n | Nooken District | Massy | south3 | \n | Aksy District | Kerben | south4 | \n | Ala-Buka District | Ala-Buka | south5 | \n | Chatkal District | Kanysh-Kyya | west | \n | Toktogul District | Toktogul | north | \n | Toguz-Toro District | Kazarman | east | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_366858.jpg"
] | [
{
"role": "user",
"content": "<|image|>Render the image in Markdown format."
},
{
"role": "assistant",
"content": "<md> | district | incumbent | party | first elected | result | candidates | \n | --- | --- | --- | --- | --- | --- | \n | Kentucky 1 | Alben Barkley | Democratic | 1912 | Re-elected | Alben Barkley (D) 64.3% Miller Hughes (R) 35.7% | \n | Kentucky 2 | David Hayes Kincheloe | Democratic | 1914 | Re-elected | David Hayes Kincheloe (D) 55.8% Erskine B. Bassett (R) 44.2% | \n | Kentucky 3 | Robert Y. Thomas, Jr. | Democratic | 1908 | Re-elected | Robert Y. Thomas, Jr. (D) 50.4% John H. Gilliam (R) 49.6% | \n | Kentucky 4 | Ben Johnson | Democratic | 1906 | Re-elected | Ben Johnson (D) 52.5% John P. Haswell (R) 47.5% | \n | Kentucky 5 | Charles F. Ogden | Republican | 1918 | Re-elected | Charles F. Ogden (R) 53.7% James H. Richmond (D) 43.8% James H. Ross ( FL ) 2.4% | \n | Kentucky 6 | Arthur B. Rouse | Democratic | 1910 | Re-elected | Arthur B. Rouse (D) 53.7% Rodney G. Beyson (R) 35.2% Harry V. Dill (I) 11.1% | \n | Kentucky 7 | J. Campbell Cantrill | Democratic | 1908 | Re-elected | J. Campbell Cantrill (D) Unopposed | \n | Kentucky 8 | King Swope | Republican | 1919 | Lost re-election Democratic gain | Ralph Waldo Emerson Gilbert (D) 52.0% King Swope (R) 48.0% | \n | Kentucky 9 | William Jason Fields | Democratic | 1910 | Re-elected | William Jason Fields (D) 52.9% W. G. Blair (R) 47.1% | \n | Kentucky 10 | John W. Langley | Republican | 1906 | Re-elected | John W. Langley (R) Unopposed | \n | Kentucky 11 | John M. Robsion | Republican | 1918 | Re-elected | John M. Robsion (R) 75.4% J. E. Sampson (D) 24.6% | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_317551.jpg"
] | [
{
"role": "user",
"content": "<|image|>Convert the photo into Markdown language."
},
{
"role": "assistant",
"content": "<md> | | team | pld | w | d | l | b | pf | pa | pd | pts | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | 1 | Melbourne | 24 | 21 | 0 | 3 | 1 | 627 | 277 | +350 | 44 | \n | 2 | Manly | 24 | 18 | 0 | 6 | 1 | 597 | 377 | +220 | 38 | \n | 3 | North Queensland | 24 | 15 | 0 | 9 | 1 | 547 | 618 | -71 | 32 | \n | 4 | New Zealand | 24 | 13 | 1 | 10 | 1 | 593 | 434 | +159 | 29 | \n | 5 | Parramatta | 24 | 13 | 0 | 11 | 1 | 573 | 481 | +92 | 28 | \n | 6 | Canterbury | 24 | 12 | 0 | 12 | 1 | 575 | 528 | +47 | 26 | \n | 7 | South Sydney | 24 | 12 | 0 | 12 | 1 | 408 | 399 | +9 | 26 | \n | 8 | Brisbane | 24 | 11 | 0 | 13 | 1 | 511 | 476 | +35 | 24 | \n | 9 | Wests Tigers | 24 | 11 | 0 | 13 | 1 | 541 | 561 | -20 | 24 | \n | 10 | Roosters | 24 | 10 | 1 | 13 | 1 | 445 | 610 | -165 | 23 | \n | 11 | Cronulla | 24 | 10 | 0 | 14 | 1 | 463 | 403 | +60 | 22 | \n | 12 | Gold Coast | 24 | 10 | 0 | 14 | 1 | 409 | 559 | -150 | 22 | \n | 13 | St. George Illawarra | 24 | 9 | 0 | 15 | 1 | 431 | 509 | -78 | 20 | \n | 14 | Canberra | 24 | 9 | 0 | 15 | 1 | 522 | 650 | -128 | 20 | \n | 15 | Newcastle | 24 | 9 | 0 | 15 | 1 | 418 | 708 | -290 | 20 | \n | 16 | Penrith | 24 | 8 | 0 | 16 | 1 | 539 | 607 | -68 | 18 | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_323960.jpg"
] | [
{
"role": "user",
"content": "<|image|>What are the following photo content in markdown style: <md> | name | class year | notability | references | \n | --- | --- | --- | --- | \n | John Jenkins | 2009 (Perk) | American football nose tackle | | \n | Jonathan Aldridge | 1996 (Perk) | Professional Athlete & Celebrity Entertainer | | \n | Tom Johnson | 2003-2004 | Professional Athlete Defensive Tackle New Orleans Saints | | \n | Dantrell Savage | 2005 | American football running back | | \n | Brittney Reese | 2006 | American long jumper/olympian | | \n | Terrence Cody | 2007 | American football nose tackle | | \n | Eltoro Freeman | 2008 | American football linebacker | | \n |"
},
{
"role": "assistant",
"content": "Demond Washington | 2008 | American football defensive back | | \n | Chris White | 2009 | American football center | | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_315810.jpg"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the image in markdown code: <md> | rank | athlete | country | time | notes | \n | --- | --- | --- | --- | --- | \n | | Richard Colman | Australia | 1:41.13 | | \n | | Brent Lakatos |"
},
{
"role": "assistant",
"content": "Canada | 1:41.24 | PB | \n | | Joshua George | United States | 1:41.50 | | \n | 4 | Li Huzhao | China | 1:41.83 | | \n | 5 | Yoo Byunghoon | South Korea | 1:42.44 | | \n | 6 | Jun Hiromichi | Japan | 1:42.99 | | \n | 7 | Pierre Fairbank | France | 1:43.02 | | \n | 8 | Brian Siemann | United States | 1:43.09 | | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_40927.jpg"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the photo with markdown style: <md> | regular season | \n | --- | \n | | \n | Steve Mason Category:Articles with hCards | \n | Mathieu Garon"
},
{
"role": "assistant",
"content": "Category:Articles with hCards | \n | David LeNeveu Category:Articles with hCards | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_155587.jpg"
] | [
{
"role": "user",
"content": "<|image|>Encode the table in Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | site | state | established | federal area | non-federal area | total area | \n | --- | --- | --- | --- | --- | --- | \n | Headwaters Forest Reserve | California | 1999 | acres (ha) | 0 | acres (ha) | \n | Jupiter Inlet Outstanding Natural Area | Florida | 2008 | acres (ha) | 0 | acres (ha) | \n | Piedras Blancas Outstanding Natural Area | California | 2008 | acres (ha) | 0 | acres (ha) | \n | Steens Mountain Cooperative Management and Protection Area | Oregon | 2000 | acres (ha) | acres (ha) | acres (ha) | \n | Yaquina Head Outstanding Natural Area | Oregon | 1980 | acres (ha) | 0 | acres (ha) | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_337254.jpg"
] | [
{
"role": "user",
"content": "<|image|>What are the following photo content in markdown style: <md> | team | p | w | d | l | pf | pa | diff | tf | ta | tb | lb | pts | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | London Wasps | 2 | 2 | 0 | 0 | 116 | 27 | +89 | 16 | 3 | 1 | 0 | 9 |"
},
{
"role": "assistant",
"content": "\n | Bayonne | 2 | 1 | 0 | 1 | 47 | 32 | +15 | 5 | 2 | 1 | 0 | 5 | \n | Grenoble | 2 | 1 | 0 | 1 | 46 | 44 | +2 | 6 | 5 | 1 | 0 | 5 | \n | Viadana | 2 | 0 | 0 | 2 | 24 | 130 | −106 | 3 | 20 | 0 | 0 | 0 | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_28160.jpg"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the diagram in markdown code: <md> | | cyclist | team | time | \n | --- | --- | --- | --- | \n | 1 | Jens Voigt ( GER ) | Team Saxo Bank | 4h 43' 28\" | \n | 2 | Rein Taaramäe ( EST ) | Cofidis | s.t. | \n | 3 | Paul Voss ( GER ) | Team Milram | + 34\" | \n | 4 | Michel Kreder ( NED ) | Garmin-Transitions | + 34\" | \n | 5 | David Loosli ( SUI ) | Lampre-Farnese Vini | + 34\" | \n | 6 | Jérémy Roy ( FRA ) | Française des Jeux | + 34\" | \n | 7 | Josep Jufré ( ESP ) | Astana | + 34\" | \n | 8 | Daniel Moreno ( ESP ) | Omega Pharma-Lotto | + 34\" |"
},
{
"role": "assistant",
"content": "\n | 9 | Robert Kišerlovski ( CRO ) | Liquigas-Doimo | + 34\" | \n | 10 | Igor Antón ( ESP ) | Euskaltel-Euskadi | + 34\" | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/TURL/col_type_244905.jpg"
] | [
{
"role": "user",
"content": "<|image|>Transcribe the diagram into Markdown format."
},
{
"role": "assistant",
"content": "<md> | year | flagship station | play-by-play | color commentator(s) | \n | --- | --- | --- | --- | \n | 1989–90 | KGIL | Bob Miller | Nick Nickson | \n | 1988–89 | KGIL | Bob Miller | Nick Nickson | \n | 1987–88 | KGIL | Bob Miller | Nick Nickson | \n | 1986–87 | KGIL | Bob Miller | Nick Nickson | \n | 1985–86 | KGIL | Bob Miller | Nick Nickson | \n | 1984–85 | KGIL | Bob Miller | Nick Nickson | \n | 1983–84 | KWNK | Bob Miller | Nick Nickson | \n | 1982–83 | KPRZ | Bob Miller | Nick Nickson | \n | 1981–82 | KPRZ | Bob Miller | Nick Nickson | \n | 1980–81 | KRLA | Bob Miller | Pete Weber | </md>"
}
] | mp_sft | TURL | null |
[
"./val_imgs/PubTabNet/val/PMC3673908_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following table content in markdown style: <md> | | Group 1 | Group 2 | \n | --- | --- | --- | \n | 1-input | 0.3881 | 0.3626 | \n | 2-input | 0.4193 | 0.2903 | \n | 3-input | 0.3871 | 0.2581 | \n | 4-input | 0.3871 | 0.2903 | \n | 5-input | 0.3871 | 0.3226 | \n |"
},
{
"role": "assistant",
"content": "6-input | 0.3871 | 0.3548 | \n | 7-input | 0.4571 | 0.3548 | \n | 8-input | 0.4839 | 0.4194 | \n | 9-input | 0.5161 | 0.4516 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4643500_001_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the picture with markdown style: <md> | | Process parallelisation | Application of innovative technologies | Methodological modifications | \n | --- | --- | --- | --- | \n | Speed increased |"
},
{
"role": "assistant",
"content": "Yes | Yes | Yes | \n | Cost reduced | No | Yes | Yes | \n | Risk of bias increased | No | Possibly | Possibly | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4736912_004_01.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the diagram to Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | Presence of relevant MTrPs in EDC and/or ECRB | LE diagnosisCramer's V Coefficient (p value) | Presence of forearm painCramer's V Coefficient (p value) | \n | --- | --- | --- | \n | E.1 | 0.541 (p > 0.001) | 0.684 (p > 0.001) | \n | E.2 | 0.459 (p > 0.001) | 0.606 (p > 0.001) | \n | E.3 | 0.022 (p = 0.873) | 0.135 (p = 0.400) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4329122_004_01.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the photo in markdown code: <md> | <COLSPAN=2> Data fetching timing | \n | --- | --- | \n | Turning on the screen | Turning off the screen | \n | Connecting the headset | Disconnecting the headset | \n | Connecting the battery | Disconnecting the battery | \n | Reacting to the proximity sensor | Losing reaction with the proximity sensor | \n | Setting the silent mode | Canceling the silent mode | \n | Dialing a phone call | Receiving an incoming call | \n | Connecting a phone call | Returning to standby | \n | Setting Wi-Fi on | Setting Wi-Fi off | \n"
},
{
"role": "assistant",
"content": "| Changing volume | Idle for 1 min | \n | Charging a remaining battery | Pushing the home button | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5585547_007_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the illustration into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Statistics of angle difference | Value | \n | --- | --- | \n | Average of absolute differences | 10.50° | \n | Standard deviation of absolute differences | 8.02° | \n | Maximum difference | 41.38° | \n | Minimum difference | −29.40° | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4549906_007_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following table content in markdown style: <md> | CorSiM (Laser) | Parameters | SD | Mean AIC | % favored model | \n | --- | --- | --- | --- | --- | \n | PB | r 0.45 | 0.01 | −2258 | 0 | \n | BD | r 0.45; a 0 | 0.01; 0 | −2556 | 0 | \n | DDL | r 0.72; kd 635.7 | 0.04; 73.57 | −2593 | 94.6 | \n | DDX | r 2.13; xp 0.3 | 0.12; 0.01 | −2588 | 5.4"
},
{
"role": "assistant",
"content": "| \n | CorSiM (TreePar) | | | | | \n | PB | Λ 0.452 | 0 | 878.9 | 0 | \n | BD | Λ 0.452 ; μ 3.14e-7 | 0.0055; 7.60E-07 | 880.9 | 0 | \n | Y2r | Λ2 0.58, Λ1 0.326, st 1.405 | 0.033; 0.029; 0.399 | 850.3 | 88.6 | \n | BD2r | a1 16.5; a2 0.01; r1 -1.73; r2 0.61; st 1.08 | 71.0; 0.04; 6.99; 0.046; 0.57 | 852.8 | 11.4 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4251309_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the illustration in markdown code: <md> | <COLSPAN=4> Experiment 1 | \n | --- | --- | --- | --- | \n | Track No. | Song | Artist/band, album, year | Tempo (bpm) | \n | 1 | Al Vaivén Mi Carretara | Nico Saquito, Good Bye Mr Cat, 1982 | 121 | \n | 2 | A deeper love | Aretha Flanklin, Greatest Hits, 1980–1994"
},
{
"role": "assistant",
"content": "| 121 | \n | 3 | Avalon | Jacques Lu Cont vs. Remix, 2005 | 127 | \n | 4 | Sahib Balkan | Buscemy, Gypsy beat, and Balkan bangers, 2006 | 128 | \n | 5 | Crystal frontier | Calexico, Bucemi remix, 2006 | 121 | \n | 6 | Shake it | Extended Mix, Lee Cabrera, Housworks Boom The Ultimative Hits, 2010 | 128 | \n | 7 | Vino vino | Ian Oliver and Eastenders, Vino Vino, 2008 | 125 | \n | 8 | Kiss my eyes | Bob Sinclair, US Hot Dance Music/Club Play, 2003 | 126 | \n | 9 | Istanbul Çocuklari | Baaba Zula and Mad Professor, Duble Oryantal, 2005 | 121 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5759254_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Encode the photo in Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | Antigens | PTB Median (IQR) | HHC-LTBI Median (IQR) | p-value* | AUC (95% CI) | Cut-off (pg/ml) | Sensitivity (%) | Specificity (%) | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | <COLSPAN=8> DosR | \n | Rv1737c | 70.7 (18.8–664.2) | 1742.0 (209.2–2528.0) | 0.0041 | 0.76 (0.60–0.92) | 1014.96 | 65.0 | 90.5 | \n | Rv2029c | 233.4 (38.9–961.3) | 2421.0 (1182.0–4426.0) | 0.0003 | 0.82 (0.69–0.96) | 763.15 | 90.0 | 76.2 | \n | Rv2628 | 452.3 (29.1–1363.0) | 2489.0 (281.0–7006.0) | 0.0173 | 0.72 (0.55–0.88) | 1569.41 | 65.0 | 81.0 | \n | <COLSPAN=8> Rpf | \n | Rv0867c | 121.8 (19.3–437.2) | 576.8 (181.0–1224.0) | 0.0091 | 0.74 (0.58–0.89) | 454.89 | 65.0 | 81.0 | \n | Rv2389c | 15.5 (6.3–200.3) | 349.5 (74.72–932.6) | 0.0126 | 0.73 (0.57–0.89) | 28.36 | 85.0 | 61.9 | \n | <COLSPAN=8> Control | \n | E6-C10 | 56.5 (2.4–1027.0) | 2623.0 (461.0–6761.0) | 0.0006 | 0.80 (0.66–0.94) | 1070.36 | 75.0 | 81.0 | \n | PPD | 2355.0 (401.3–3949.0) | 5453.0 (2137.0–18,874.0) | 0.0042 | 0.76 (0.60–0.91) | 4464.11 | 65.0 | 86.0 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3877907_006_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the illustration to Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | | <COLSPAN=8> Construct | \n | | <COLSPAN=8> Fatty Acid Composition (Molar %) ± SD | \n | Fatty Acid | Ost809D6 Gal − | Ost809D6 Gal + | Ost809D4 Gal − | Ost809D4 Gal + | FcElo6 Gal − | FcElo6 Gal + | FcElo6 Gal − | FcElo6 Gal + | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | 16:0 | 22.3 ± 0.1 | 22.2 ± 0.4 | 32.8 ± 0.3 | 34.4 ± 0.2 | 24.5 ± 0.3 | 22.1 ± 0.1 | 20.1 ± 0.4 | 21.4 ± 0.1 | \n | 16:1 | 25.4 ± 0.3 | 26.1 ± 0.3 | 38.9 ± 0.4 | 37.8 ± 0.3 | 26.8 ± 0.2 | 25.1 ± 0.3 | 22.3 ± 0.2 | 21.9 ± 0.3 | \n | 18:0 | 3.7 ± 0.5 | 3.3 ± 0.3 | 7.9 ± 0.4 | 7.3 ± 0.5 | 3.7 ± 0.4 | 3.2 ± 0.3 | 3.7 ± 0.3 | 2.8 ± 0.4 | \n | 18:1 | 13.4 ± 0.4 | 14.2 ± 0.4 | 17.8 ± 0.3 | 17.2 ± 0.4 | 15.3 ± 0.3 | 13.2 ± 0.5 | 3.4 ± 0.2 | 3.6 ± 0.3 | \n | LA | ND | ND | ND | ND | ND | ND | ND | ND | \n | GLA | ND | ND | ND | ND | 29.7 ± 0.2 | 22.3 ± 0.1 | 28.2 ± 0.4 | 18.6 ± 0.5 | \n | ALA | 32.9 ± 0.2 | 15.7 ± 0.1 | ND | ND | ND | ND | ND | ND | \n | SDA | 2.3 ± 0.6 | 18.5 ± 0.1 | ND | ND | ND | ND | 22.3 ± 0.3 | 12.2 ± 0.4 | \n | 20:4n-3 | ND | ND | ND | ND | ND | ND | ND | 7.8 ± 0.3 | \n | DGLA | ND | ND | ND | ND | ND | 14.1 ± 0.2 | ND | 11.7 ± 0.4 | \n | DPA | ND | ND | 2.6 ± 0.3 | 2.8 ± 0.2 | ND | ND | ND | ND | \n | DHA | ND | ND | ND | 0.5 ± 0.2 | ND | ND | ND | ND | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5620548_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>Encode the illustration in Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | <ROWSPAN=2> AIV 1 | <ROWSPAN=2> Input | <COLSPAN=4> Vaccinated Cohorts | \n | 2006–2007 | 2008–2009 | 2009–2010 | 2010–2011 | \n | --- | --- | --- | --- | --- | --- | \n | A/H5N1 | | | | | | \n | | Pre-vaccine GMT2 (CI 95%) | 5.3 (4.9–6.0) | 4.9 (4.9–4.9) | 5.2 (4.9–5.8) | 5.3 (4.9–5.6) | \n | | Post-vaccine GMT (CI 95%) | 11.3 (8.4–15.9) | 6.5 (5.7–7.6) | 8.5 (7.0–10.5) | 14.0 (10.8–18.4) | \n | A/H7N3 | | | | | | \n | | Pre-vaccine GMT (CI 95%) | 5.3 (4.9–6.0) | 4.9 (4.9–4.9) | 5.2 (4.9–5.5) | 4.9 (4.9–4.9) | \n | | Post-vaccine GMT (CI 95%) | 5.3 (4.9–6.0) | 4.9 (4.9–4.9) | 5.2 (4.9–5.5) | 5.3 (4.9–5.9) | \n | A/H9N2 | | | | | | \n | | Pre-vaccine GMT (CI 95%) | 6.1 (5.5–6.9) | 6.0 (5.4–6.6) | 6.7 (5.9–7.7) | 5.9 (5.4–6.4) | \n | | Post-vaccine GMT (CI 95%) | 19.7 (14.0–29.4) | 9.2 (7.6–11.2) | 8.9 (7.5–10.8) | 8.2 (6.9–10.0) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2806311_004_01.png"
] | [
{
"role": "user",
"content": "<|image|>Express the picture as Markdown code."
},
{
"role": "assistant",
"content": "<md> | | | <COLSPAN=3> LH | <COLSPAN=3> Androstenedione | \n | | | Preoperative | Postoperative | P | Preoperative | Postoperative | P | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | Total study population | | 15.1 ± 6.0 | 6.4 ± 4.0 | < 0.001 | 3.2 ± 0.9 | 2.2 ± 1.6 | < 0.001 | \n | LH | ≤12.1 IU/l | 8.4 ± 2.2 | 6.1 ± 3.3 | 0.004 | 3.1 ± 1.0 | 3.0 ± 2.7 | 0.708 | \n | | >12.1 IU/l | 18.0 ± 4.6 | 6.6 ± 4.3 | < 0.001 | 3.2 ± 0.9 | 1.9 ± 0.7 | < 0.001 | \n | Androstenedione | ≤3.26 mg/dl | 14.5 ± 5.4 | 6.5 ± 4.3 | < 0.001 | 2.6 ± 0.5 | 1.8 ± 0.6 | < 0.001 | \n | | >3.26 mg/dl | 16.0 ± 6.7 | 6.4 ± 3.5 | < 0.001 | 6.4 ± 0.9 | 2.7 ± 2.3 | < 0.001 | \n | LH and androstenedione | LH ≤ 12.1 IU/l or androstenedione ≤ 3.26 mg/dl | 13,7 ± 5,4 | 6,6 ± 4,0 | < 0.001 | 2.8 ± 0.8 | 2.3 ± 2.0 | 0.029 | \n | | LH >12.1 IU/l and androstenedione >3.26 mg/dl | 18,3 ± 5,9 | 6,1 ± 4,0 | < 0.001 | 3.9 ± 0.8 | 2.0 ± 0.6 | < 0.001 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2923156_001_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the diagram in markdown code: <md> | | l/r | <COLSPAN=3> Coordinates of max t value | t | \n | | | x | y | z | value | \n | --- | --- | --- | --- | --- | --- | \n | Inferior parietal lobe | r | 48 | -57 | 9 | 11.24 | \n | Middle occipital cortex | l | -48 | -81 | 0 | 9.59 | \n | Superior parietal cortex | l | -33 | -45 | 57 | 7.63 | \n | Fusiform gyrus | l | -42 | -51 | -15 | 6.84 | \n | Dorsal premotor cortex | r | 45 | 0 | 51 | 6.53 | \n | Occipital gyrus | r | 24 | -78 | 36 | 6.30 | \n | Dorsal premotor cortex | l | -30 | -9 | 54 | 5.89"
},
{
"role": "assistant",
"content": "| \n | Cerebellum | l | -12 | -78 | -42 | 5.52 | \n | Dorsal premotor cortex | l | -9 | -3 | 66 | 5.10 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3907798_013_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the table in markdown code: <md> | Target Gene | Primer | Sequence | \n | --- |"
},
{
"role": "assistant",
"content": "--- | --- | \n | <ROWSPAN=2> hCYP1A1 | Forward | TCAACCATGACCAGAAGCTA | \n | Reverse | AAGATAATCACCTTCTCACTTAACAC | \n | <ROWSPAN=2> hCYP1A2 | Forward | GCTTCTACATCCCCAAGAAAT | \n | Reverse | ACCACTTGGCCAGGACT | \n | <ROWSPAN=2> hCYP3A4 | Forward | ACTGCCTTTTTTGGGAAATA | \n | Reverse | GGCTGTTGACCATCATAAAAG | \n | <ROWSPAN=2> hGAPDH | Forward | GGAGTCAACGGATTTGGT | \n | Reverse | AAGATGGTGATGGGATTTCCA | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2275259_007_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transcribe the image into Markdown format."
},
{
"role": "assistant",
"content": "<md> | | <COLSPAN=2> Not self reported diabetes | <COLSPAN=2> Self reported diabetes | \n | | HbA1c (%)<7 | HbA1c (%)≥7 | HbA1c (%)<7 | HbA1c (%)≥7 | \n | Cause of death | (n = 1004) | (n = 36) | (n = 36) | (n = 63) | \n | --- | --- | --- | --- | --- | \n | All causes (n = 619) | 523 | 27 | 25 | 44 | \n | Hazard ratio (95% CI) | 1.0 | 1.8 (0.9,3.3) | 1.2 (0.4,3.2) | 1.3 (0.8,2.1) | \n | Cardiovascular disease (n = 316) | 260 | 15 | 10 | 31 | \n | Hazard ratio (95% CI) | 1.0 | 1.9 (0.9,3.7) | 0.5 (0.2,1.6) | 2.1(1.2,3.7) | \n | Ischaemic heart disease (n = 165) | 136 | 6 | 6 | 17 | \n | Hazard ratio (95% CI) | 1.0 | 1.4 (0.4,4.6) | 0.5 (0.1,1.7) | 2.1 (1.0,4.3) | \n | Cerebro disease (n = 120) | 97 | 6 | 3 | 14 | \n | Hazard ratio (95% CI) | 1.0 | 2.4 (0.8,7.1) | 0.6 (0.1,2.5) | 2.0 (0.8,4.6) | \n | Non-cardiovascular disease (n = 303) | 263 | 12 | 15 | 13 | \n | Hazard ratio (95% CI) | 1.0 | 1.7 (0.7,4.5) | 1.8 (0.6,5.4) | 0.6 (0.2,1.4) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5347807_006_01.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the photo to Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | <ROWSPAN=2> | <COLSPAN=2> Univariate | <COLSPAN=2> Multivariate | \n | HR (95% CI) | p-value | HR (95% CI) | p-value | \n | --- | --- | --- | --- | --- | \n | Tumor size (cm) | | | | | \n | <5 | Ref | | Ref | | \n | ≥5 | 1.78(1.05-3) | 0.031 | 1.83(1.06-3.17) | 0.031 | \n | PVTT | | | | | \n | No | Ref | | Ref | | \n | Yes | 2.25(1.36-3.73) | 0.002 | 1.31(0.63-2.72) | 0.472 | \n | Extrahepatic metastasis | | | | | \n | No | Ref | | Ref | | \n | Yes | 2.09(1.22-3.58) | 0.008 | 0.94(0.43-2.05) | 0.881 | \n | Duration of sorafenib treatment | 0.9(0.87-0.93) | <0.001 | 0.9(0.87-0.93) | <0.001 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3414749_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Translate the picture into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Position | Landmarks | \n | --- | --- | \n | Wrist dorsal central | The third extensor digitorum tendon, tip of radius, carpometacarpal joint, os lunatum and os capitatum. | \n | Wrist dorsal radial | The extensor carpi radialis longus tendon, tip of radius, carpometacarpal joint, os scaphoideum and os trapezoideum | \n | Wrist dorsal ulnar | The middle of caput ulnae placed minimum 1 centimetre from the right side and minimum 2 from the left side of the image margins | \n | Wrist volar central | N. medianus, tip of radius, radiocarpal and intercarpal joints | \n | MCP* dorsal radial | Joint space, diaphysis of the metarcarpal and proximal phalanx bones. The joint space has to be placed minimum 2 centimetre from the right side and minimum 1 centimetre from the left side of the image margins | \n | MCP* dorsal ulnar | Joint space, diaphysis of the metarcarpal and proximal phalanx bones. The joint space has to be placed minimum 2 centimetre from the right side and minimum 1 centimetre from the left side of the image margins | \n | MCP* joint volar | Joint space and flexor tendon. The joint space has to be placed minimum 2 centimetres from the right side and minimum 1 centimetre from the left side of the image margins. | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4637138_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the figure with markdown style: <md> | | | <COLSPAN=4> Number of misperceptions held about “light cigarettes"
},
{
"role": "assistant",
"content": "| \n | --- | --- | --- | --- | --- | --- | \n | <ROWSPAN=3> “Light” cigarettes are smoother on the throat and chest | | 0 | 1 | 2 | Total | \n | Agree | 37.2 % | 26.5 % | 36.3 % | 100 % | \n | Disagree | 82.6 % | 15.3 % | 2.1 % | 100 % | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC1277868_003_01.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the illustration in markdown code: <md> | DDE (ng/mL serum) | No. of Cases | No. of Controls | Adjusteda OR (95% CI) | Adjustedb OR (95% CI) | \n | --- | --- | --- | --- | --- | \n | <COLSPAN=5> All cases | \n | < 27.0 | 21 | 42 | Reference | Reference | \n | 27.0–43.9 | 53 | 107 | 0.95 (0.50–1.77) | 0.99 (0.52–1.89) | \n | 44.0–60.9 | 35 | 83 | 0.79 (0.41–1.55) | 0.86 (0.43–1.70) | \n | ≥61.0 |"
},
{
"role": "assistant",
"content": "28 | 51 | 1.02 (0.50–2.09) | 1.24 (0.58–2.63) | \n | p-Value for trend | | | 0.89 | 0.72 | \n | <COLSPAN=5> Cryptorchidism | \n | < 27.0 | 10 | 42 | Reference | Reference | \n | 27.0–43.9 | 30 | 107 | 1.16 (0.52–2.60) | 1.17 (0.51–2.66) | \n | 44.0–60.9 | 19 | 83 | 0.94 (0.40–2.24) | 0.95 (0.39–2.30) | \n | ≥61.0 | 16 | 51 | 1.29 (0.52–3.22) | 1.34 (0.51–3.48) | \n | p-Value for trend | | | 0.77 | 0.75 | \n | <COLSPAN=5> Hypospadias | \n | < 27.0 | 12 | 42 | Reference | Reference | \n | 27.0–43.9 | 24 | 107 | 0.73 (0.33–1.62) | 0.81 (0.36–1.84) | \n | 44.0–60.9 | 16 | 83 | 0.61 (0.26–1.43) | 0.68 (0.28–1.64) | \n | ≥61.0 | 14 | 51 | 0.86 (0.35–2.10) | 1.18 (0.46–3.02) | \n | p-Value for trend | | | 0.7 | 0.82 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5700481_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the picture with markdown style: <md> | Characteristics | Frequency (N = 45) | \n | --- | --- | \n | Sex | | \n | Female | 25 | \n | Male | 20 | \n | Age (in years) | | \n | 18–24 | 3 | \n | 25–34 | 21 | \n |"
},
{
"role": "assistant",
"content": "35–44 | 14 | \n | 45 and above | 7 | \n | Marital status | | \n | Single | 8 | \n | Married | 23 | \n | Divorced/separated | 4 | \n | Widow(er) | 10 | \n | Level of education | | \n | None | 3 | \n | Primary school | 29 | \n | Secondary school | 13 | \n | Tertiary | 0 | \n | Source of livelihood | | \n | Formal employment | 2 | \n | Self-employed | 32 | \n | Unemployed | 7 | \n | Dependents | 4 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4258883_001_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the figure content behind with markdown code: <md> | Participants (n = 20) | \n | --- | \n | Age in years (SD) | 37 (11.79) | \n | <COLSPAN=2> Employment status (%) | \n | Employed full- or part-time | 65 | \n | <COLSPAN=2> Marital status (%) | \n | Married | 55 | \n | Single | 30 | \n | Divorced | 15 | \n | <COLSPAN=2> Education (%) | \n | High school graduate | 30 | \n |"
},
{
"role": "assistant",
"content": "Some college | 25 | \n | College graduate | 20 | \n | <COLSPAN=2> Residency status (%) | \n | Child living in home full-time | 55 | \n | Child living in home part-time | 20 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3735486_001_00.png"
] | [
{
"role": "user",
"content": "<|image|>Translate the table into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Norm | Description | \n | --- | --- | \n | <ROWSPAN=4> Dutch Norm for Health-enhancing Physical Activity (DNHPA) | Adults (18-54 years): | \n | Thirty minutes or more of at least moderate-intensity aerobic (endurance) physical activity (≥ 4 MET; combined intensity score SQUASH ≥ 3) on at least five days each week. | \n | Adults (55 years and older): | \n | Thirty minutes or more of at least moderate-intensity aerobic (endurance) physical activity (≥ 3 MET; combined intensity score SQUASH ≥ 3) on at least five days each week. | \n | <ROWSPAN=4> Fit-norm | Adults (18-54 years): | \n | Twenty minutes or more of vigorous-intensity physical activity (≥ 6.5 MET; combined intensity score SQUASH ≥ 6) on at least three days each week. | \n | Adults (55 years and older): | \n | Twenty minutes or more of vigorous-intensity physical activity (≥ 5 MET; combined intensity score SQUASH ≥ 6) on at least three days each week. | \n | Combi-norm | Meeting at least one of the previous mentioned norms (i.e. the DNHPA or Fit-norm). | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3258189_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the image in markdown code: <md> | Familles | Patients | <COLSPAN=3> PAX6 intronic variations | <COLSPAN=2> PITX3 subtitution polymorphisms | <COLSPAN=2> HSF4 intronic variation | \n | | | IVS4 -274insG | IVS12 -174G>A | IVS4 -195G>A | c.439 C>T (exon 3) | c.930 C>A (exon 4) | <COLSPAN=2> IVS7 +93C>T | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | F1 | III9 | homozygous | heterozygous | wild type | heterozygous | heterozygous | <COLSPAN=2> heterozygous | \n | | IV13 | homozygous | homozygous | wild type | heterozygous | heterozygous | <COLSPAN=2> heterozygous | \n | | IV14 | homozygous | homozygous | wild type | wild type | heterozygous | <COLSPAN=2> wild type | \n | | IV16 | homozygous | homozygous | wild type | wild type | heterozygous | <COLSPAN=2> wild type | \n | F2 | III19 | homozygous | heterozygous | wild type | wild type | wild type | <COLSPAN=2> wild type | \n | | III20 | homozygous | homozygous | wild type | wild type | wild type | <COLSPAN=2> wild type | \n | | IV35 | homozygous | homozygous | wild type | wild type | wild type | wild type | |"
},
{
"role": "assistant",
"content": "\n | | IV36 | homozygous | homozygous | wild type | wild type | wild type | <COLSPAN=2> wild type | \n | | IV37 | homozygous | homozygous | wild type | wild type | wild type | <COLSPAN=2> wild type | \n | F3 | III9 | homozygous | heterozygous | heterozygous | wild type | wild type | <COLSPAN=2> wild type | \n | | III10 | homozygous | heterozygous | heterozygous | wild type | wild type | <COLSPAN=2> wild type | \n | | IV11 | homozygous | heterozygous | wild type | wild type | wild type | <COLSPAN=2> wild type | \n | | IV12 | homozygous | heterozygous | heterozygous | wild type | wild type | <COLSPAN=2> wild type | \n | F4 | III7 | homozygous | heterozygous | heterozygous | wild type | wild type | <COLSPAN=2> wild type | \n | | III8 | homozygous | heterozygous | heterozygous | wild type | wild type | <COLSPAN=2> wild type | \n | | IV10 | homozygous | wild type | homozygous | wild type | wild type | <COLSPAN=2> wild type | \n | | IV11 | homozygous | heterozygous | heterozygous | wild type | wild type | <COLSPAN=2> wild type | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4099385_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the diagram content behind with markdown code: <md> | Isolates | Number of isolates (%) (n = 79) | Number isolated before or within 2 days of hospital admission (n = 53) | \n | --- | --- | --- | \n | Penicillin sensitive S. aureus (PSSA) | 12 (15%) | 10 (83%) | \n | Methicillin sensitive S. aureus (MSSA) | 55 (70%) | 38 (70%) | \n"
},
{
"role": "assistant",
"content": "| Methicillin resistant S. aureus (MRSA) | 12 (15%) | 5 (45%) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC6035799_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the figure with markdown style: <md> | Characteristic | Index | \n | --- | --- | \n | Agea | 67.00 (17.00-114.00; 14.00) | \n | <COLSPAN=2> Sexb | \n | Female | 420 (51.20) | \n | Male | 400 (48.80) | \n | <COLSPAN=2> PCU-staya | \n | Days | 10.54 (0.00 – 53.00; 9.12) | \n | Hours | 266.15 (0.00 – 1275.00; 219.37) | \n | <COLSPAN=2> Diagnosis groupb | \n | Cancer | 690 (84.00) | \n | Non-cancer | 59 (7.20) | \n | Previous cancer | 68 (8.30) | \n | Missing | 3 (0.50) | \n | <COLSPAN=2> Palliative stagecb | \n | Rehabilitation stage | 34 (4.15)"
},
{
"role": "assistant",
"content": "| \n | Early terminal stage | 129 (15.73) | \n | Late terminal stage | 152 (18.54) | \n | Final stage | 28 (3.41) | \n | Missing | 477 (58.17) | \n | <COLSPAN=2> ECOG Performance Status Scalecb | \n | 0 Normal activity | 4 (0.50) | \n | 1 Able to walk, light activity possible | 45 (5.50) | \n | 2 Self-care possible; able to walk < 50% of daytime | 20 (2.40) | \n | 3 Limited self-care; < 50% bedridden | 220 (26.80) | \n | 4 In need of care; bedridden | 399 (48.70) | \n | Missing | 132 (16.10) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3502283_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transcribe the image into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Independent variables | <COLSPAN=2> Model 11 | <COLSPAN=2> Model 22 | \n | | OR (95%CI) | p-value | OR (95% CI) | p-value | \n | --- | --- | --- | --- | --- | \n | % E Protein | 1.01(0.99-1.02) | 0.31 | | | \n | % E Fat | 1.00(0.99-1.01) | 0.81 | | | \n | % E Carbohydrates | 0.99(0.99-1.00) | 0.09 | 0.99(0.98-1.00) | <0.01** | \n | Fibre (g)3 | 0.99(0.97-1.01) | 0.33 | | | \n | % E High Sugar Drinks4 | | | | | \n | Low (1%-15.5%)vs No | 1.43(1.05-1.95) | 0.02* | 1.53(1.12-2.11) | <0.01** | \n | High (>15.5%)vs No | 1.59(1.15-2.19) | <0.01** | 1.91(1.34-2.72) | <0.01** | \n | % Soft Drinks | | | | | \n | Yes vs No | 1.25(0.96-1.61) | 0.10 | | | \n | % E High Fat Foods5 | 1.00(1.00-1.01) | 0.28 | 1.00(0.99-1.01) | 0.84 | \n | % E Saturated Fat | 1.00(0.97-1.03) | 0.83 | | | \n | % E Traditional Food | | | | | \n | Low (1% - 25%)vs No | 1.00(0.75-1.33) | 0.98 | | | \n | High (26%-100%)vs No | 1.16(0.84-1.62) | 0.37 | | | \n | HEI6 | 1.00(0.99-1.01) | 0.77 | | | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4613292_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the picture content behind with markdown code: <md> | Methods of Identification | No. of Samples | No. of Species | Correct Identification (%) | Incorrect Identification (%) | Ambiguous"
},
{
"role": "assistant",
"content": "Identification (%) | \n | --- | --- | --- | --- | --- | --- | \n | BLAST1 | 364 | 64 | 85.9 | 0 | 14.1 | \n | Distance | 364 | 64 | 82.8 | 0 | 17.2 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3715828_001_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the picture with markdown style: <md> | Period | <COLSPAN=2> 1990–1993 | <COLSPAN=2> 1994–1997 | <COLSPAN=2> 1998–2001 | <COLSPAN=2> 2002–2005 | <COLSPAN=2> 2006–2009 | \n | Microorganism | No. of patients | Percent | No. of patients | Percent | No. of patients | Percent | No. of patients | Percent | No. of patients | Percent | \n | --- | --- | --- | --- | --- | --- |"
},
{
"role": "assistant",
"content": "--- | --- | --- | --- | --- | \n | Stapylococcus aureus | 27 | 47 | 38 | 46 | 35 | 43 | 74 | 53.5 | 136 | 51.5 | \n | Coagulase-negative staphylococcus | 15 | 26 | 26 | 32 | 28 | 34 | 51 | 37 | 78 | 29.5 | \n | Beta-hemolytic streptococcus | 4 | 7 | 8 | 10 | 6 | 7.5 | 8 | 6 | 21 | 8 | \n | Non-hemolytic streptococcus | 2 | 3.5 | 2 | 2.5 | 1 | 1 | 2 | 1.5 | 4 | 1.5 | \n | Enterococcus species | 11 | 19 | 10 | 12 | 10 | 12 | 33 | 24 | 58 | 22 | \n | Corynebacterium species | 5 | 9 | 9 | 11 | 13 | 16 | 9 | 6.5 | 23 | 85 | \n | E. coli | 2 | 3.5 | 7 | 8.5 | 10 | 12 | 7 | 5 | 24 | 9 | \n | Enterobacter species | 6 | 10.5 | 1 | 1 | 0 | 0 | 0 | 0 | 20 | 7.5 | \n | Other Enterobactericeae | 10 | 17.5 | 14 | 17 | 9 | 11 | 41 | 30 | 48 | 18 | \n | Anaerobic bacteria | 3 | 5 | 7 | 8.5 | 6 | 7.5 | 21 | 15 | 36 | 13.5 | \n | Candida species | 0 | 0 | 1 | 1 | 1 | 1 | 0 | 0 | 2 | 1 | \n | Other types | 8 | 14 | 7 | 8.5 | 8 | 10 | 16 | 11.5 | 45 | 17 | \n | Total | 93 | | 129 | | 127 | | 270 | | 495 | | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4573674_003_01.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the photo in markdown code: <md> | <ROWSPAN=2> 123 episodes of suspected LONS | <ROWSPAN=2> | <COLSPAN=6> Confirmed clinical and culture proven LONS | \n | <COLSPAN=6> n = 58 (47.2 %) | \n | | prevalence | sensitivity | specificity | ppv | npv | LR+ | LR− | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | Presence of glucosuria | 56.7 % | 69.0 % |"
},
{
"role": "assistant",
"content": "53.8 % | 57.1 % | 66.0 % | 1.49 | 0.58 | \n | Increase in glucosuria | 22.8 % | 29.3 % | 83.1 % | 60.7 % | 56.8 % | 1.73 | 0.85 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4162928_003_02.png"
] | [
{
"role": "user",
"content": "<|image|>Encode the image in Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | Variable | Crude odds ratio (95% CI) | Adjusted odds ratio (95% CI) | \n | --- | --- | --- | \n | Newborn sex | | | \n | Male | 1.00 | 1.00 | \n | Female | 1.15 (0.85-1.54) | 1.15 (0.86-1.53) | \n | Mother’s level of education | | | \n | ≤7 y | 1.00 | 1.00 | \n | ≥8 y | 1.40 (1.05-1.87) | 1.31 (0.97-1.77) | \n | Age group (y) | | | \n | 20–39 | 1.00 | 1.00 | \n | ≤19 and ≥40 | 1.29 (0.95-1.75) | 1.24 (0.91-1.67) | \n | Type of delivery | | | \n | Normal | 1.00 | 1.00 | \n | Cesarean section | 1.13 (0.84-1.51) | 1.01 (0.65-1.15) | \n | Number of prenatal visits | | | \n | 4+ | 1.00 | 1.00 | \n | 1–3 | 1.79 (1.17-2.73) | 1.67 (1.10-2.53) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4083864_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the picture with markdown style: <md> | <COLSPAN=2> Checklist for quality assessment and scoring of nonrandomized studies | \n | --- | --- | \n | <ROWSPAN=3> Selection | 1. Assignment for treatment-Any criteria reported (if yes, 1 star)? | \n | 2. How representative was the reference group (CPB) in comparison to the general population for CABG? (If yes, 1 star, no star if the patients were selected or selection of group was not described.) | \n | 3. How representative was the treatment group (OPCAB) in comparison to the general population for CABG? (If drawn from the same community as the reference group, 1 star, no star if drawn from a different source or selection of group was not described.) | \n | <ROWSPAN=2> Comparability | 4. Group comparable for 1, 2, 3, 4, 5. (If"
},
{
"role": "assistant",
"content": "yes, 1 star was assigned for each of these characteristics. No star was assigned if the two groups differed.) | \n | 5. Group comparable for 6, 7, 8, 9, 10. (If yes, 1 star was assigned for each of these characteristics. No star was assigned if the two groups differed.) | \n | <ROWSPAN=2> Outcome assessment | 6. Clearly defined outcome of interest. (If yes, 1 star for information ascertained by record linkage or interview, no star if this information was not reported.) | \n | 7. Follow-up (1 star if described.) | \n | | Comparability variables: (1) Age; (2) Gender; (3) Hypertension; (4) Diabetes; (5) Ejection fraction; (6) 3-Vessel Disease; (7) Left Main Stem Disease; (8) Urgent or Emergent Operation; (9) Viability Studies; (10) Surgeon or Hospital Volume | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2706836_007_00.png"
] | [
{
"role": "user",
"content": "<|image|>Express the image as Markdown code."
},
{
"role": "assistant",
"content": "<md> | Gene Symbol | Gene Name | TaqMan Assay Number* | Genebank accession | \n | --- | --- | --- | --- | \n | Hprt | Hypoxanthine phosphoribosyltransferase | Rn01527840_m1 | NM_012583 | \n | Gapdh | Glyceraldehyde-3-phosphate dehydrogenase | Rn99999916_s1 | NM_017008 | \n | Oaz1 | Ornithine decarboxylase antizyme 1 | Rn00821793_g1 | NM_139081 | \n | β2m | Beta-2 microglobulin | Rn00560865_m1 | NM_012512 | \n | Ppia | Peptidyl-prolyl cis-trans isomerasa | Rn00690933_m1 | NM_017101 | \n | Rpl13a | Ribosomal Protein L13A | Rn00821946_g1 | NM_173340 | \n | 18S | Eukaryotic 18S rRNA | Hs99999901_s1 | X03205.1 | \n | Ywhaz | Tyrosine 3-monooxygenase | Rn00755072_m1 | NM_013011.3 | \n | Sdha | Succinate dehydrogenase complex, subunit A | Rn00590475_m1 | NM_130428.1 | \n | Gusb | Glucuronidase, beta | Rn00566655_m1 | NM_017015.2 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4538381_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the diagram with markdown style: <md> | Ligand | RLN | ML290 | \n | --- | --- | --- | \n | Receptor | \n | Human | *** | *** | \n | Macaque | *** | *** | \n | Pig | *** | *** | \n | Guinea pig | *** | No | \n | Guinea pig/human | *** | * | \n | Rabbit 1 and 2 | No | ** | \n | Human/rabbit | ** | ** |"
},
{
"role": "assistant",
"content": "\n | Rabbit 1(2)/human | No | ** | \n | Mouse | *** | No | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5539750_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the photo with markdown style: <md> | Parameter | 2.4 GHz | 5.8 GHz | \n | --- | --- | --- | \n | Transmitted power | 10 dBm | 10 dBm | \n | Transmission data rate | 250 Kbps | 1 Mbps | \n | Antenna type | Monopole | Monopole | \n | Antenna gain | 0 dB | 0 dB | \n"
},
{
"role": "assistant",
"content": "| Launched rays angle resolution | 1° | 1° | \n | Maximum permitted reflections | 6 | 6 | \n | Cuboids resolution | 20 cm | 20 cm | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5970437_006_01.png"
] | [
{
"role": "user",
"content": "<|image|>Render the photo in Markdown format."
},
{
"role": "assistant",
"content": "<md> | KEGG pathway | Genes count | Percent | p value | \n | --- | --- | --- | --- | \n | Cell adhesion molecules (CAMs) | 32 | 1.8 | 9.60E-09 | \n | Neuroactive ligand-receptor interaction | 45 | 2.5 | 8.80E-05 | \n | Melanogenesis | 20 | 1.1 | 5.20E-04 | \n | Cytokine-cytokine receptor interaction | 30 | 1.7 | 6.80E-04 | \n | ECM-receptor interaction | 15 | 0.8 | 7.60E-03 | \n | PPAR signalling pathway | 12 | 0.7 | 2.10E-02 | \n | Tyrosine metabolism | 8 | 0.4 | 2.30E-02 | \n | Vascular smooth muscle contraction | 17 | 0.9 | 2.70E-02 | \n | Calcium signalling pathway | 24 | 1.3 | 2.90E-02 | \n | Nicotinate and nicotinamide metabolism | 7 | 0.4 | 3.70E-02 | \n | Focal adhesion | 26 | 1.4 | 4.00E-02 | \n | TGF-beta signalling pathway | 13 | 0.7 | 4.40E-02 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5929415_007_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the picture with markdown style: <md> | Genetic factor | <65 years (n = 52) | ≥65 years (n = 122) | OR | 95% CI | P value | \n | --- | --- | --- | --- | --- | --- | \n | HLA-Bw4 | 28 (53.8) | 75 (61.5) | 0.73 | 0.38-1.41 | 0.35 | \n | HLA-C1 | 52 (100.0) | 120 (98.4) | - |"
},
{
"role": "assistant",
"content": "- | 0.35 | \n | 2DL2 | 15 (28.8) | 16 (13.1) | 2.69 | 1.21-5.96 | 0.013 | \n | 2DS2 | 13 (25.0) | 14 (11.5) | 2.57 | 1.11-5.95 | 0.024 | \n | 2DS5 | 7 (13.5) | 39 (32.0) | 0.33 | 0.14-0.80 | 0.011 | \n | 3DS1 | 13 (25.0) | 54 (44.3) | 0.42 | 0.20-0.86 | 0.017 | \n | 2DL2+HLA-C1 | 15 (28.8) | 15 (12.3) | 2.89 | 1.29-6.48 | 0.008 | \n | 2DL2+HLA-C1C1 | 15 (28.8) | 12 (9.8) | 3.72 | 1.60-8.66 | 0.0015 | \n | 2DS2+HLA-C1 | 13 (25.0) | 13 (10.7) | 2.79 | 1.19-6.55 | 0.015 | \n | 2DS2+HLA-C1C1 | 13 (25.0) | 10 (8.2) | 3.73 | 1.52-9.20 | 0.0027 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5735588_007_01.png"
] | [
{
"role": "user",
"content": "<|image|>Encode the figure in Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | Gender | <COLSPAN=3> Reaching dominant limb | <COLSPAN=3> Reaching nondominant limb | \n | Parameter | Males | Females | p value | Males | Females | p value | \n | --- | --- | --- | --- | --- | --- | --- | \n | T (s) | 0.99 ± 0.22 | 0.99 ± 0.22 | 0.479 | 0.96 ± 0.21 | 0.95 ± 0.27 | 0.277 | \n | SE (°) | 103.41 ± 7.19 | 104.16 ± 9.19 | 0.279 | 106.04 ± 6.13 | 106.73 ± 9.43 | 0.448 | \n | EF (°) | 15.3 ± 7.6 | 14.73 ± 7.09 | 0.416 | 17.56 ± 7.87 | 15.52 ± 5.67 | 0.202 | \n | ST (Nm) | 7.02 ± 0.55 | 7.08 ± 0.55 | 0.265 | 7.19 ± 0.62 | 7.02 ± 0.5 | 0.109 | \n | SEI (Nms) | 5.51 ± 1.5 | 5.56 ± 1.52 | 0.436 | 5.59 ± 1.48 | 5.35 ± 1.89 | 0.149 | \n | NJ | 42.05 ± 29.44 | 40.1 ± 16.92 | 0.307 | 42.51 ± 22.95 | 41.48 ± 18.25 | 0.326 | \n | ACP | 0.82 | 0.86 | 0.085 | 0.82 | 0.86 | 0.235 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3397549_006_01.png"
] | [
{
"role": "user",
"content": "<|image|>Render the table in Markdown format."
},
{
"role": "assistant",
"content": "<md> | | | | <COLSPAN=3> Parameters | \n | Samples | Degradation Time [days] | Composition | Tensile Strength [MPa] | Elongation at Break [%] | Elastic Modulus [MPa] | \n | --- | --- | --- | --- | --- | --- | \n | SMC | 0 | MCCh: 66.7Glycerol: 33.3 | 0.172 | 1.53 | 1.40 | \n | SMC-TCP | 0 | MCCh: 53.4β-TCP: 13.3Glycerol: 33.3 | 0.015 | 2.41 | 1.00 | \n | SMC | 60 | MCCh: 66.7Glycerol: 33.3 | 0.0073 | 1.88 | 0.005 | \n | SMC-TCP | 60 | MCCh: 53.4β-TCP: 13.3Glycerol: 33.3 | 0.0055 | 3.14 | 0.015 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4087267_001_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the photo content behind with markdown code: <md> | | <COLSPAN=2> Platelet count | \n | | <1 lac/cumm | >1"
},
{
"role": "assistant",
"content": "lac/cumm | \n | --- | --- | --- | \n | Age (years) | 25 ± 7 | 27 ± 6 (P value 0.13) | \n | Males | 26 (61.9%) | 37 (63.79%) | \n | Females | 16 (38.09%) | 21 (36.2%) | \n | RBS (gm%) | 115.08 ± 16.77 | 110.90 ± 21.4 (P value 0.38) | \n | BP (systolic, mmHg) | 115.90 ± 12.22 | 118.5 ± 10.09 (P value 0.17) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4877978_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the figure content behind with markdown code: <md> | Method and references | Abbreviation | Program for estimation | \n | --- | --- | --- | \n | Bootstrap kernel density estimator [14, 26] | bootkde | bda R package, bde function, bootkde method |"
},
{
"role": "assistant",
"content": "\n | Piecewise cubic Hermite interpolating polynomial [21, 27] | hermite spline | signal R package, interp1 function, pchip method | \n | Spline interpolation with Hyman filter [5, 18, 28] | hyman spline | demography R package, cm.spline function | \n | Iterated conditional expectation kernel density estimator [15, 29] | ickde | ICE R package, ickde function | \n | Penalized composite link model [22] | pclm | R code in Rizzi et al. (2015) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3649416_013_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the picture content behind with markdown code: <md> | Method | | MSS | Single-scan | \n | --- | --- | --- | --- | \n | Missed stems | (missed stem/the total)"
},
{
"role": "assistant",
"content": "| 6/128 | 34/128 | \n | | (%) | 4.7 | 26.6 | \n | DBH | Min | 5.70 | 5.70 | \n | (cm) | Max | 32.70 | 34.20 | \n | | Mean | 14.27 | 15.13 | \n | | std | 9.94 | 8.47 | \n | Height | Min | 8.00 | 4.40 | \n | (m) | Max | 16.90 | 25.00 | \n | | Mean | 11.13 | 13.95 | \n | | std | 3.95 | 6.42 | \n | Distance * | Min | 4.52 | 4.40 | \n | (m) | Max | 8.18 | 9.79 | \n | | Mean | 5.95 | 8.23 | \n | | std | 1.33 | 1.28 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3268718_006_00.png"
] | [
{
"role": "user",
"content": "<|image|>Interpret the picture as Markdown format."
},
{
"role": "assistant",
"content": "<md> | N = 119 | Number in Group | Multiple lesions(N = 95) | % | OR - UNI | CI 95% - UNI | OR - MULTI1 | CI MULTI | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | Age ≤ 32 years | 62 | 47 | 75.8% | 1 | | | | \n | Age > 32 years | 57 | 48 | 84.2% | 1.702 | 0.679-4.267 | 1.699 | 0.620-4.653 | \n | Scars at diagnosisNO | 101 | 79 | 78.2% | 1 | | | | \n | Scars at diagnosisYES | 18 | 16 | 88.9% | 2.228 | 0.476-10.434 | 1.81 | 0.349-9.383 | \n | CRP < 12 mg/dL | 58 | 45 | 77.6% | 1 | | | | \n | CRP > = 12 mg/dL | 58 | 47 | 81.0% | 1.234 | 0.501-3.039 | 1.151 | 0.425-3.117 | \n | Negative urinary cultures or hemocultures | 81 | 60 | 74.1% | 1 | | | | \n | Positive urinary cultures and/or hemocultures | 38 | 35 | 92.1% | 4.083 | 1.136-14.679 | 4.204 | 1.139-15.515 | \n | Presence of the 3 main symptoms | 77 | 65 | 84.4% | 1 | | | | \n | Absence of at least one of the 3 main symptoms | 42 | 30 | 71.4% | 0.462 | 0.186-1.146 | 0.437 | 0.168-1.13 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5387278_007_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the table to Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | | n | No. of motions/day (min–max) | Mean average no | SD | Two-sample independent t test | \n | --- | --- | --- | --- | --- | --- | \n | Single infection | 30 | 2–30 | 10.71 | 12.6 | Equal variance (0.001015)** | \n | More than one infections | 44 | 12–25 | 17.5 | 3.2 | Unequal variance (0.006885)** | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4601141_006_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following figure content in markdown style: <md> | <ROWSPAN=2> | Diffuse injury | Surgical lesion | <ROWSPAN=2> P value | \n | (n = 31) | (n = 30) | \n | --- | --- | --- | --- | \n | Age (yrs, mean ± SD) | 35.1 ± 14.3 | 40.6 ± 14.9 | 0.917 | \n | Male, n (%) | 24 (77.4)"
},
{
"role": "assistant",
"content": "| 23 (76.7) | 0.944 | \n | GCS, median (range) | 6 (3–8) | 6 (3–8) | 0.071 | \n | GCS 3–5, n (%) | 10 (32.3) | 14 (46.7) | <ROWSPAN=2> 0.300 | \n | GCS 6–8, n (%) | 21 (67.7) | 16 (53.3) | \n | <COLSPAN=4> Pupil reactions, n (%) | \n | Both present | 20 (64.5) | 13 (43.3) | <ROWSPAN=2> 0.126 | \n | At least one unreactive pupil | 11 (35.5) | 17 (56.7) | \n | <COLSPAN=4> 6-month outcome, n (%) | \n | Death/alive | 15 (48.4)/16 (51.6) | 11 (36.7)/19 (63.3) | 0.440 | \n | Unfavorable/favorable | 20 (64.5)/11 (35.5) | 13 (43.3)/17 (56.7) | 0.202 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2861663_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transform the photo into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Countries | Number of MJD | Number of SCA | Frequency (%) | Reference | \n | --- | --- | --- | --- | --- | \n | Portugal | 32 | 38 | 84.2 | 16 | \n | Brazil | 96 | 114 | 84.2 | 17 | \n | Present study | 100 | 138 | 72.5 | | \n | Portugal/Brazil | 67 | 106 | 63.2 | 44 | \n | Germany | 32 | 77 | 41.6 | 45 | \n | France | 25 | 87 | 28.7 | 46 | \n | Holland | 64 | 227 | 28.2 | 47 | \n | America* | 31 | 149 | 20.8 | 48 | \n | Spain | 11 | 72 | 15.3 | 49 | \n | Australia | 11 | 88 | 12.5 | 13 | \n | Mexico | 13 | 108 | 12.0 | 50 | \n | South Africa | 2 | 54 | 3.7 | 51 | \n | Italy | 2 | 183 | 1.1 | 52 | \n | UK | 0 | 22 | 0 | 53 | \n | Serbia | 0 | 38 | 0 | 54 | \n | Finland | 0 | 49 | 0 | 55 | \n | Norway | 0 | 19 | 0 | 56 | \n | Czech | 0 | 118# | 0 | 11 | \n | Combined | 486 | 1687 | 28.8 | | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4928618_007_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the photo in markdown code: <md> | <ROWSPAN=2> Domains | <COLSPAN=2> Communication | <COLSPAN=2> Fine Motor | <COLSPAN=2> Gross Motor | <COLSPAN=2> Problem-Solving | <COLSPAN=2> Personal social | \n | Delay(+) | Delay(-) | Delay(+) | Delay(-) | Delay(+) | Delay(-) | Delay(+) | Delay(-) |"
},
{
"role": "assistant",
"content": "Delay(+) | Delay(-) | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | MeanStress | 28.611(6.7) | 28.57(6.6) | 31.01( 6.6) | 28.42(6.7) | 29.22(6.5 ) | 28.52(6.7) | 28.36( 6.8) | 28.57( 6.6) | 28.08( 7.9) | 28.57(6.6) | \n | Result of In depended T test | <COLSPAN=2> P=0.956 | <COLSPAN=2> P=0.004 | <COLSPAN=2> P=0.453 | <COLSPAN=2> P=0.288 | <COLSPAN=2> P=0.0651 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5192591_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the photo in markdown code: <md> | SOC | Order | \n | --- | --- | \n | Infections and infestations | 1 | \n | Neoplasms benign, malignant and unspecified (incl cysts and polyps) | 2 | \n | Blood and lymphatic system disorders | 3 | \n | Immune system disorders | 4 | \n | Endocrine disorders | 5 | \n | Metabolism and nutrition disorders | 6 | \n | Psychiatric disorders | 7 | \n | Nervous system disorders | 8 | \n | Eye disorders | 9 | \n | Ear and labyrinth disorders | 10 | \n | Cardiac disorders | 11 | \n | Vascular disorders | 12 | \n | Respiratory, thoracic and mediastinal disorders | 13 | \n | Gastrointestinal disorders | 14 | \n | Hepatobiliary disorders | 15 | \n | Skin and subcutaneous tissue disorders | 16 | \n | Musculoskeletal and connective tissue disorders | 17 | \n | Renal and urinary disorders | 18 | \n | Pregnancy, puerperium and perinatal conditions | 19 | \n | Reproductive system and breast disorders | 20 | \n | Congenital, familial and genetic disorders | 21 | \n | General"
},
{
"role": "assistant",
"content": "disorders and administration site conditions | 22 | \n | Investigations | 23 | \n | Injury, poisoning and procedural complications | 24 | \n | Surgical and medical procedures | 25 | \n | Social circumstances | 26 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3985316_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following photo content in markdown style: <md> | Upregulated genes | Downregulated genes | \n | --- | --- | \n | (1) Nuclear factor (Nf-116)(2) Epidermal keratin type II(3) MEF2C transcription factor(4) Metalloproteinase(5) Tyrosine phosphatases CIP 2(6) Transforming growth factor beta binding protein(7) Mitogen inducible gene 2(8) Oncofetal antigen 5T4 | (1) Epidermal keratin types 1, 13, 15, and 16(2) Transforming growth factor beta 3 receptor(3) Differentiation dependent A4 protein(4) Ribosomal proteins L3, L8, L28, L31, and L35(5) ARF"
},
{
"role": "assistant",
"content": "activated phosphatidylcholine-specific phospholipase D1a(6) Zinc finger protein(7) DNA binding protein FKHL 15 (8) PRAD1 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3922903_001_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transform the picture into Markdown format."
},
{
"role": "assistant",
"content": "<md> | | | Group A | Group B | \n | --- | --- | --- | --- | \n | Age | | 7-21 years | 18 months-19 years | \n | Genetic features | | | | \n | Duplicate segment length | | 107.5 Kb-700 Kb | 0.29 Kb-16.6 Mb (for two cases the size is unknown but cytogenetic visible) | \n | Inheritance | de novo | 4 | 8 | \n | | Maternal | 5 | 0 | \n | | Unknown | 0 | 1 | \n | XCI | Random | 6 | 2 | \n | | Skewed | 3 | 1 | \n | | Unknown | 0 | 6 | \n | Clinical features | | | | \n | Abnormal general conditions | | 5/9 (55%) | 9/9 (100%) | \n | Dysmorphic patterns | | 3/9 (33%) | 9/9 (100%) | \n | Delayed motor development | | 4/9 (44%) | 9/9 (100%) | \n | Abnormal language development | | 6/9 (67%) | 9/9 (100%) | \n | Intellectual disability | | 7/9 (78%) | 9/9 (100%) | \n | Mood and behaviour | Affected | 4/9 (44%) | 1/9 (11%) | \n | | Unknown | 5/9 (55%) | 8/9 (88%) | \n | Social conduct | Affected | 8/9 (88%) | 0/9 (0%) | \n | | Unknown | 1/9(11%) | 9/9 (100%) | \n | Autistic features | | 4/9 (44%) | 0/9 (0%) | \n | Seizures | | 1/8 (13%) | 3/9 (33%) | \n | Brain MRI | Abnormal | 0/9 (0%) | 3/9 (33%) | \n | | Unknown | 1/9 (11%) | 6/9 (67%) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5840678_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transform the diagram into Markdown format."
},
{
"role": "assistant",
"content": "<md> | <ROWSPAN=2> Groups characteristic | <COLSPAN=2> Baseline | <ROWSPAN=2> p value | \n | PFD + MDD-O | KTS | \n | --- | --- | --- | --- | \n | Age (years) | 57.3 ± 12.6 | 51.7 ± 9.9 | 0.069 | \n | <ROWSPAN=2> Gender n (%) | Male 18 (76.9%) | Male 12 (57.7%) | <ROWSPAN=2> 0.139 | \n | Female 5 (23.1%) | Female 18 (42.3%) | \n | Years with diabetes | 14 ± 9.1 | 17 ± 10.4 | 0.416 | \n | Months with ulcers | 8.6 ± 2.7 | 6.5 ± 2.2 | 0.989 | \n | Smoking | 7 (26.9%) | 2 (7.7%) | 0.140 | \n | Glucose (mg/dL) | 139.1 ± 71.7 | 152.8 ± 85.7 | 0.597 | \n | HDL (mg/dL) | 31.4 ± 14.7 | 38.9 ± 11.8 | 0.840 | \n | VLDL (mg/dL) | 27.5 ± 11.6 | 42.6 ± 40.3 | 0.211 | \n | LDL (mg/dL) | 78.9 ± 13.5 | 101.7 ± 39.1 | 0.107 | \n | Creatinine clearance/24 h (mL/min) | 59.9 ± 20.9 | 74.2 ± 40.8 | 0.517 | \n | Urea (mg/dL) | 37.5 ± 24.4 | 46.0 ± 21.4 | 0.173 | \n | Creatinine (mg/dL) | 1.0 ± 0.5 | 1.6 ± 1.1 | 0.128 | \n | ALT (U/L) | 14.4 ± 5.4 | 25.2 ± 15.4 | 0.073 | \n | AST (U/L) | 16.0 ± 3.2 | 23.4 ± 15.0 | 0.404 | \n | GGT (U/L) | 37.1 ± 12.9 | 90.4 ± 14.5 | 0.973 | \n | VSG (mm/h) | 78.1 ± 39.2 | 64.2 ± 29.2 | 0.456 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5796448_007_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following figure content in markdown style: <md> | <ROWSPAN=2> | <ROWSPAN=2> | <COLSPAN=3> 2nd Derivative Spectra | <COLSPAN=3> PCA Loadings | \n | par | cal | pre | par | cal | pre | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | <ROWSPAN=3>"
},
{
"role": "assistant",
"content": "Sample set 1 | PLS-DA | 6 | 93.75 | 80.00 | 6 | 96.25 | 82.50 | \n | SVM | (1.7411, 0.1895) | 95.00 | 82.50 | (48.5029,0.3299) | 97.50 | 80.00 | \n | RBFNN | 28 | 100 | 97.50 | 11 | 100 | 97.50 | \n | <ROWSPAN=3> Sample set 2 | PLS-DA | 7 | 95.00 | 95.00 | 9 | 98.70 | 92.50 | \n | SVM | (3.0314,5.2780) | 97.50 | 82.50 | (5.2780,3.0314) | 98.75 | 87.50 | \n | RBFNN | 31 | 100 | 92.50 | 16 | 100 | 95.00 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4224692_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the diagram with markdown style: <md> | | Health centre | 1st level referral hospital | Total | \n | --- | --- | --- | --- | \n | Operating budget/inhabitant/year | $6.05 | $11.86 | $17.91 | \n | Utilization rate (cases/inhabitant/year)"
},
{
"role": "assistant",
"content": "| 0.4 | 0.15 | N/A | \n | No. of activities included | 98 | 117 | 215 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4057821_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the image into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Country | Participating hospital | Type of Hospital | Total no. of beds | No. of beds for general medicine | No. of beds for paediatrics | No. of beds for geriatrics | No. of ICU beds | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | <ROWSPAN=6> Spain | | | | | | | | \n | General CS | General | 580 | 437 | 79 | 0 | 58 | \n | La Plana | General | 251 | 100 | 19 | 0 | 9 | \n | Pesset | General | 540 | 211 | 41 | 0 | 16 | \n | San Juan | General | 350 | 230 | 37 | 0 | 13 | \n | Elda | General | 514 | 410 | 30 | 0 | 13 | \n | <ROWSPAN=6> France | | | | | | | | \n | Cochin | - | 1074 | - | - | - | - | \n | Bichat | University hospital | 1000 | 954 | 0 | 20 | 24 | \n | Limoges | - | 858 | - | - | - | - | \n | Montpellier | - | 3000 | - | - | - | - | \n | Lyon | University hospital/tertiary care | 683 | 603 | 0 | 64 | 53 | \n | <ROWSPAN=2> Moscow | | | | | | | | \n | Hospital #1 | Infectious diseases | 1000 | 506 | 231 | 0 | 12 | \n | <ROWSPAN=4> St. Petersburg | | | | | | | | \n | Hospital #30 | Infectious diseases | 1200 | 1175 | 0 | - | 25 | \n | Hospital #5 | Children's infectious diseases | 650 | 0 | 635 | 0 | 15 | \n | Hospital #4 | Children's city hospital | 360 | 0 | 345 | 0 | 15 | \n | <ROWSPAN=8> Turkey | | | | | | | | \n | Hacettepe Univ. Hospital | - | 1200 | 156 | 228 | - | 60 | \n | Gazi Univ. Hospital | - | 1150 | - | - | - | - | \n | Trakya Univ. Hospital | University hospital | 1042 | 951 | 72 | 0 | 50 | \n | Istanbul Univ. Cerrahpaşa Hospital | University hospital | - | 36 | 60 | 0 | 30 | \n | Uludağ Univ. Hospital | - | 1000 | 800 | 112 | 0 | 87 | \n | Dr. Siyami Ersek Hospital | - | - | - | - | - | - | \n | Kartal Research Hospital | Research and education Hospital | 880 | 750 | 90 | 0 | 41 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3924948_010_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following figure content in markdown style: <md> | Variable | Mean | Std.Dev. | N* | R*** | P**** | Remark | \n | --- | ---"
},
{
"role": "assistant",
"content": "| --- | --- | --- | --- | --- | \n | Perception of abstinence-onlysexual education on | 31.2350 | 3.5843 | 2000 | -0.122** | 0.000 | Sig. | \n | Religion | 01.0800 | 0.3500 | <COLSPAN=4> | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4385021_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the image into Markdown language."
},
{
"role": "assistant",
"content": "<md> | Drug | Dose | Source | China | India | Russia | Zambia | \n | --- | --- | --- | --- | --- | --- | --- | \n | ASA | 500 mg | <ROWSPAN=2> International drug price indicator guide | $ 0.004 | $ 0.004 | $ 0.004 | $ 0.004 | \n | Propranolol | 160 mg | $ 0.005 | $ 0.005 | $ 0.005 | $ 0.005 | \n | Amitriptyline | 100 mg | | $ 0.006 | $ 0.006 | $ 0.006 | $ 0.006 | \n | Topiramate | 100 mg | | $ 0.13 | $ 0.03 | $ 0.12 | $ 0.133 | \n | Sumatriptan | 50 mg | IMS database | $ 0.81 | $ 0.11 | $ 1.07 | $ 0.66 | \n | Almotriptan | 12.5 mg | | $ 5.19 | $ 5.19 | $ 5.19 | $ 5.19 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3231943_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transform the table into Markdown format."
},
{
"role": "assistant",
"content": "<md> | | <COLSPAN=2> All GCRtypesa | <COLSPAN=2> CAN1/LYP1/ALP1translocationsb | \n | Relevant genotype | Rate | 95% CI | Rate | Frequency | \n | --- | --- | --- | --- | --- | \n | wildtype | 1.1 | < 1-6.2 | ND | ND | \n | rad51a | < 8 | < 7-15 | ND | ND | \n | rad52 | 138 | 16-267 | ND | ND | \n | rad59 | 24 | 13-50 | ND | ND | \n | sgs1 a | 220 | 144-276 | < 7.3 | 0/30 | \n | mec3 a | 46 | 18-75 | < 1.5 | 0/30 | \n | sgs1 rad59 | 126 | 107-300 | ND | ND | \n | sgs1 rad59 rad51 | 118 | 49-154 | ND | ND | \n | sgs1 mec3 a | 1297 | 1120-2030 | 173 | 20/150 | \n | sgs1 mec3 rad51 a | 1491 | NDc | 198 | 4/30 | \n | sgs1 mec3 rad52 a | 3168 | NDc | < 23 | 0/136 | \n | sgs1 mec3 rad59 | 2476 | 1595-3187 | 16 | 1/158 | \n | sgs1 mec3 rad59 rad51 | 1124 | 734-1460 | 7 | 1/168 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5551178_012_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the illustration into Markdown language."
},
{
"role": "assistant",
"content": "<md> | <ROWSPAN=3> Neighborhood Land-Use Mix and Intensity | <COLSPAN=2> Outdoor Walking Levels | \n | Low-Deprivation Areas | High-Deprivation Areas | \n | B (SE) | B (SE) | \n | --- | --- | --- | \n | Land-use mix | 0.47 (0.22) * | −0.30 (0.25) | \n | Intensity of social infrastructure | 0.11 (0.14) | −0.27 (0.25) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2287168_004_01.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following image content in markdown style: <md> | | Physical health | Psychological health | Social relationships | Environmental health | \n | --- | --- | --- | --- | --- | \n | Bodily pain | 0.57 | 0.19 | 0.10 | 0.31 | \n | General"
},
{
"role": "assistant",
"content": "health | 0.64 | 0.43 | 0.21 | 0.42 | \n | Vitality | 0.65 | 0.58 | 0.29 | 0.47 | \n | Physical functioning | 0.47 | 0.38 | 0.21 | 0.33 | \n | Role physical | 0.55 | 0.32 | 0.18 | 0.33 | \n | Mental health | 0.50 | 0.56 | 0.27 | 0.38 | \n | Role emotional | 0.52 | 0.52 | 0.08 | 0.46 | \n | Social functioning | 0.67 | 0.49 | 0.33 | 0.47 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5139771_001_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the table in markdown code: <md> | Stage | Definition | \n | --- | --- | \n | I | tumor confined to gastrointestinal tract | \n | II |"
},
{
"role": "assistant",
"content": "tumor extending into abdomen from primary site | \n | II1 | local nodal involvement (perigastric) | \n | II2 | distal nodal involvement (para-aortic or paracaval) | \n | IIE | penetration of serosa to involve adjacent organs | \n | IV | disseminated disease or supradiaphragmatic nodal involvement | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5146889_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the figure in markdown code: <md> | <ROWSPAN=2> Primary Healthcare Centersa | <COLSPAN=5> Prescribing Indicators | \n | Average number of medicines prescribed per patient encounter | Percent medicines prescribed by generic name | Percent encounters with an antibiotic prescribed | Percent encounters with an injection prescribed | Percent medicines prescribed from essential medicines list | \n | --- | --- | --- | --- | --- | --- | \n | 1 | 3.4 (1.4) | 81.2 | 64.0 | 38.0 | 98.5 | \n | 2 | 3.6 (1.5) | 85.1 | 63.0 | 32.0 | 87.6 | \n | 3 | 3.4 (1.3) | 83.0 | 87.0 | 21.0 | 89.2 | \n | 4 | 3.2 (3.1) | 43.7 | 40.0 | 18.0 | 90.7 | \n | 5 | 3.2 (1.4) | 88.5 | 56.0 | 30.0 | 100 | \n | 6 | 1.9 (1.0) | 50.0 | 31.0 | 25.0 | 100 | \n | 7 | 5.0 (2.3) | 60.0 | 30.0 | 9.0 | 80.5 | \n | 8"
},
{
"role": "assistant",
"content": "| 4.3 (2.4) | 76.0 | 28.0 | 28.0 | 100 | \n | 9 | 2.9 (0.7) | 66.7 | 29.0 | 43.0 | 100 | \n | 10 | 3.4 (1.1) | 82.0 | 61.0 | 27.0 | 87.9 | \n | Mean (SD) | 3.4 (0.8) | 71.6 (15.7) | 48.9 (20.2) | 27.1 (9.8) | 93.4 (7.1) | \n | ANOVA | p < .0005 | p < .0005 | p < .0005 | p < .0005 | p < .0005 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3895774_003_02.png"
] | [
{
"role": "user",
"content": "<|image|>Transform the image into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Plant genera | Cadmium (μg/g) | Copper (μg/g) | Lead (μg/g) | Zinc (μg/g) | \n | --- | --- | --- | --- | --- | \n | Ceratophyllum | 3.52±2.08 | 22.71±21.08 | 20.06±8.68 | 104.2±22.80 | \n | Potamogeton | 1.42±1.38 | 10.75±5.18 | 12.26±16.19 | 41.60±6.10 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4547079_006_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transform the image into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Dependent variable | Independent variables | Regression coefficients | P* | \n | --- | --- | --- | --- | \n | EE† | Global job satisfaction | -0.22 | 0.03 | \n | <ROWSPAN=4> | Trainees | | | \n | Global work stress = 30 points | -6.84 | | \n | Global work stress = 64 points | 1.86 | 0.003 | \n | Global work stress = 98 points | 10.56 | | \n | <ROWSPAN=4> DP‡ | Trainees | | | \n | Global work stress = 30 points | -8.17 | | \n | Global work stress = 64 points | -7.30 | 0.002 | \n | Global work stress = 98 points | -6.44 | | \n | <ROWSPAN=4> PA§ | Living alone (reference) | 1 | | \n | First-degree relatives | -0.43 | 0.76 | \n | Second-degree relatives | -10.26 | <0.001 | \n | Both | -0.75 | 0.74 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5390398_009_00.png"
] | [
{
"role": "user",
"content": "<|image|>Interpret the photo as Markdown format."
},
{
"role": "assistant",
"content": "<md> | Region | Peak t | x | y | z | k | \n | --- | --- | --- | --- | --- | --- | \n | R mid temporal gyrus | 5.14 | 48 | −42 | 3 | 55 | \n | R orbital superior frontal gyrus | 5.01 | 15 | 54 | −15 | 42 | \n | L inferior/mid frontal gyrus | 4.47 | −36 | 24 | 18 | 43 | \n | R mid cingulate gyrus | 4.17 | 6 | −21 | 27 | 36 | \n | L caudate | 3.99 | −9 | 9 | 9 | 29 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3813054_012_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following photo content in markdown style: <md> | <ROWSPAN=2> Compounds | <COLSPAN=7> Minimum Inhibitory Concentration (MIC) in μg/mL | \n | S.typhii | K. pneumoniae | E.coli | P. aeruginosa | S.aureus | β-H. streptococcus | M.luteus | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | 17 | 100 | 100 | 200 | 100 | 50 | 50 | 6.25 | \n | 18 | 200 | 100 | - | 100 | 12.5 | 6.25 | 12.5 | \n | 19 | 6.25 | 6.25 | 25 | 6.25 | 12.5 | 6.25 | 25 | \n | 20 | 200 | - | 200 | 200 | 6.25 | 12.5 | 12.5 | \n | 21 | 12.5 | 25 | 6.25 | 12.5 | 12.5 | 25 | 6.25 | \n"
},
{
"role": "assistant",
"content": "| 22 | 25 | 25 | 100 | 6.25 | 100 | 25 | 50 | \n | 23 | 25 | 12.5 | 50 | 6.25 | 6.25 | 25 | 12.5 | \n | 24 | 25 | 12.5 | 25 | 25 | 12.5 | 6.25 | 50 | \n | Ciprofloxacin | 25 | 25 | 50 | 25 | 25 | 50 | 25 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC553982_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Interpret the illustration as Markdown format."
},
{
"role": "assistant",
"content": "<md> | | No. | % | \n | --- | --- | --- | \n | Patients | | | \n | Treated | 39 | 100.0 | \n | Evaluable for response | 36 | 92.3 | \n | Age | | | \n | Median (years) | 51.3 | | \n | Range | 41.2 – 64.1 | | \n | ECOG performance status | | | \n | 0 | 3 | 7.7 | \n | 1 | 27 | 69.2 | \n | 2 | 9 | 23.1 | \n | Site(s) of metastatic lesion(s)* | | | \n | Lung | 27 | 69.2 | \n | Liver | 9 | 23.1 | \n | Lymph node | 15 | 38.5 | \n | Soft tissue | 3 | 7.7 | \n | Bone | 24 | 61.5 | \n | Brain | 3 | 7.7 | \n | Response to prior anthracyclines | | | \n | Primary resistant | 24 | 61.5 | \n | Secondary resistant | 15 | 38.5 | \n | Interval from the cessation of last chemotherapy | | | \n | Median (months) | 4.1 | | \n | Range | 1.0 – 11.2 | | \n | No. of prior chemotherapy regimens | | | \n | Hormonal therapy (total) | 20 | 51.3 | \n | 1 | 9 | 23.1 | \n | 2 | 21 | 53.8 | \n | 3 or more | 9 | 23.1 | \n | Characteristics of prior chemotherapy† | | | \n | CMF | 24 | | \n | CAF | 15 | | \n | FEC | 9 | | \n | VE | 21 | | \n | High-dose therapy with stem cell rescue | 6 | | \n | AT | 3 | | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4794635_001_00.png"
] | [
{
"role": "user",
"content": "<|image|>Translate the figure into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Arabidopsis | Ref | Rice | Ref | Barley | Ref | Wheat | Ref | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | AG | (1) | OsMADS53‐58 | (2) | | | | | \n | EMS1/TPD1 | (3,4,5) | MSP1/OsTDL1 | (6, 7) | | | | | \n | DYT1 | (8,9) | UDT1 | (10) | | | | | \n | TDF | (11) | | | | | | | \n | AMS | (12,13,14) | TDR | (13,15,16) | | | | | \n | MYB103/80 | (17) | OsMYB103/80 | (18) | | | | | \n | MS1 | (19,20,21) | PTC1 | (16) | HvMS1 | (22) | | | \n | MYB33‐65 | (23) | OsGAMYB | (24) | HvGAMYB | (25) | | | \n | MS2 | (26) | OsDPW | (27) | | | | | \n | DEX1 | (28) | OsDEX1 | (28) | HvDEX1 | (28) | | | \n | | | RAFTIN | (29) | | | RAFTIN | (29) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3199207_004_01.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the diagram in markdown code: <md> | | Anosmics | Hyposmics | Normosmics | Total | \n | --- | --- | --- | --- | --- | \n | Normosmic sample | 0 | 23 |"
},
{
"role": "assistant",
"content": "384 | 407 | \n | Anosmic sample | 16 | 1 | 0 | 17 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3526773_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Translate the figure into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Items on CTCS-SP | CGI-I | \n | --- | --- | \n | 1. Agenda setting | −.35 | \n | 2. Dealing with questions/objections/problems | −.43 | \n | 3. Clarity of communication | −.46 | \n | 4. Pacing and efficient use of time | −.65** | \n | 5. Interpersonal effectiveness | −.51** | \n | 6. Resource activation | −.61** | \n | 7. Reviewing social-phobia questionnaires and other measures | −.21 | \n | 8. Reviewing previously set homework | −.31 | \n | 9. Use of feedback and summaries | −.22 | \n | 10. Guided discovery | −.48 | \n | 11. Focus on social-phobia-related cognitions, self-focused attention, safety behaviors, and biased imagery | −.49* | \n | 12. Rationale | −.36 | \n | 13. Selection of appropriate strategies for change in social-phobia-related cognition and maintaining factors (including selection of behavioral experiments and other experiential exercises). | −.59** | \n | 14. Appropriate implementation of techniques for change in social-phobia-related cognition and maintaining factors (including selection of behavioral experiments and other experimental exercises). | −.56** | \n | 15. Integration of discussion and experiential techniques | −.34 | \n | 16. Setting homework | −.23 | </md>"
}
] | mp_sft | PubTabNet | null |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.