Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
as employed herein , the term &# 34 ; roughened surface &# 34 ; will refer to a surface of either a rotatable plate or stationary plate which is adapted to contact a specimen to be rheologically examined with the surface being discontinuous either due to ( a ) outwardly projecting elements of the plate material , or ( b ) pores which pass through the entire plate . the apparatus shown in fig1 may have a conventional support frame consisting of a pedestal 2 with four vertical posts 4 , 6 and two spaced behind plates 4 and 6 ( not shown ), which may be of the same shape as those shown , supporting an upper platform 8 . the upper and lower plate system 12 which will be discussed hereinafter as a stationary plate 18 which receives a rotatable plate 20 . transducer 22 underlies and is operatively associated with stationary plate 18 such that when axial rotation is effected in one of the directions indicated by arrow a , either in repeated 360 ° degree cycles of rotation in the same direction , or in an oscillating movement , the stresses will result in the stationary plate 18 receiving through the specimen forces which may be projected in three orthogonal directions and torque . this series of forces applied to transducer 22 will result in a plurality of output signals over lead 24 to processor 26 which may be any sort of computer means . the processor 26 converts the output of transducer 22 which is the nature of a charge to a voltage and emits an output signal over lead 28 to data acquisition and control unit 30 which delivers the signals to computer means 32 for processing and storage over lead 33 . the computer means 32 will determine the rheological properties viscosity of the material . such properties may be viscosity and stresses in a direction normal to the rotatable plate 20 . these properties may be stored , computer enhanced , displayed or made the subject of hard copy as desired . among the suitable transducers , usable as transducer 22 , is a piezoelectric four component transducer available from kistler instrument corporation . suitable software for use in the computer means 32 is that sold by national instruments under the trade designation labview . the wide range capability in respect of loads on the transducer 22 facilitates use of the system of the present invention with a wide range from granular materials , such as coal and rice , for example , to thick sludge similar to bread making dough , for example . the transducer 22 will generally provide output signals which are responsive to the torque and axial force . if a coordinate system has the x and y axes in the plane of shear , which is generally parallel to the plates 18 , 20 , with the z axis directed upwardly , the transducer will provide a reading of ( a ) the axial force along the z axis , i . e ., normal to the shear plane and ( b ) two forces that are perpendicular to one another in the plane of shear . the torque represents a moment about the z axis . when the rotatable plate 20 and the stationary plate 18 are coaxial the two forces normal to each other in the plane of shear during axial 360 ° rotation or oscillation will generally be zero , i . e ., when the rheometer is in a torsional configuration . the forces monitored to determine rheological properties are , therefore , the normal or z axis force and the moment force which represents torque . a motor 40 , which is energized over lead 45 by a suitable power supply 42 through lead 43 to control means 44 is shown overlying the plate assembly 12 . the motor is adapted to effect rotary movement of rotatable plate 20 . it will be appreciated that the control means 44 receives control signals from computer means 32 through a data acquisition and control unit 30 over lead 34 . this facilitates electrical switching to effect operation of the motor 40 in a first mode which provides continuous 360 ° axial rotation of rotatable plate 20 and in a second mode which provides for angular oscillation of rotatable plate 20 through a desired arc which may be on the order of + 90 ° to - 90 ° at 15 hz , + 35 ° to - 35 ° at 25 hz and + 90 ° to - 90 ° at 50 hz , for example . the output of the motor 40 is converted to the desired speed through an appropriate gear box 48 and delivers rotary motion to output shaft 50 . in order to facilitate relative separating movement between stationary plate 18 and rotary plate 20 , the plate 20 is adapted to be translated axially moving with an assembly that rides on liner bearings 54 . once the specimen is in place , axial movement of the plate 20 in the reverse direction , i . e ., toward the stationary plate 18 is also effected to effect initial compaction of the specimen . control of operation of this function is effected by computer means 32 by its labview software by emitting appropriate signals through acquisition and control unit 30 over lead 60 to control means 61 which may be a three - axis controller of the type available from nulogic . power supply 63 has output over lead 65 enter control means which emits a signal over lead 67 to servo motor 66 and through a gear box 68 to ball screw and nut 62 which moves shaft 70 vertically in an up and down path . shaft 70 is fixedly secured to upper support 72 which has four depending supports with 74 and 76 being shown , secured to lower support 80 which , in turn , is secured to the liner bearings 54 . the motor shaft 50 is coupled to plate shaft 90 using a low or no backlash coupler 84 . the vertical orientation of the plate shaft 90 is achieved with assistance of bearing assembly 86 which , in the form shown , has two tapered roller bearings . the rotatable upper plate 20 is mounted on shaft 90 and may easily be changed , if desired , for the particular specimen being tested . referring to fig2 there is shown a more detailed view of rotary plate 20 and stationary plate 18 , as well as transducer 22 . it will be noted that the rotatable plate 20 is fixedly secured to annular flange 92 of shaft 90 with bolts 100 , 102 securing an upper portion 104 of the rotatable plate to a lower portion 106 of the rotatable plate . the stationary plate 18 has an upwardly projecting annular wall and is generally cupshaped . plate 18 defines an upwardly open chamber 110 which is of greater diameter than rotatable plate 20 so that the rotatable plate can be received within chamber 110 . the lower plate has two elements 120 , 122 with a pair of bolts 124 , 126 securing the assembly . in essence , this approach provides means for replacing plate elements 106 and 122 , which are generally circular , after wear or in the event of damage . an important aspect of the present invention is that the lower surface 130 of plate dement 106 , which is the portion of the plate which faces the specimen which will be received in chamber 110 , is roughened . the degree of toughening may be varied depending on the material being analyzed . similarly , surface 132 of stationary plate portion 122 has its surface , which will face and contact the specimen , roughened . it will be appreciated that the transducer 22 has an annular plate 140 fixedly secured to the upper end thereof which , in turn , is secured to the lower surface of stationary plate 18 such that forces applied to the stationary plate 18 will be transferred to the transducer 22 to facilitate an electrical output signal over lead 24 to processor 26 . a pedestal supporting base 142 is secured to the lower surface of transducer 22 . fig3 is similar to fig2 except shows the plates 20 , 18 in relative closed position such that chamber 110 is relatively small . a specimen would normally be placed into the chamber with the roughened surfaces 130 , 132 being in intimate contact therewith and penetrating the same to provide firm interengagement . the specimen , which would fill chamber 110 , has not been shown for clarity of illustration . referring now to fig4 a , there is shown by way of an example , a part of lower portion 106 of the rotatable plate wherein a plurality of integrally formed projections 160 , which preferably cover the entire surface of lower portion 106 . the projections 160 have a height &# 34 ; h &# 34 ; which may generally be in the range of about 10 microns to 1 cm . the projections 160 preferably will have a shape which has alternating peaks and grooves . the size and shape may vary , as to granular materials , to correspond generally to the size and shape of the granular materials and will be uniformly spaced from each other such that the entire roughened surface will have projections of generally uniform shape and dimension with the identical relative spacing . it will be appreciated that the roughened surface 132 ( fig3 ) of stationary plate element 122 may have substantially identical configuration as plate element 106 . the plates may preferably be made of steel , stainless steel , cast iron , copper , brass , aluminum , resinous plastic or plexiglas with the roughened projections 160 being integrally formed therein . an alternate embodiment is shown in fig4 b wherein the plate element 106 &# 39 ; has a plurality of similarly configurated projections 160 &# 39 ; provided by a coating which may consist of abrasive containing materials , or materials such as sand , coal , powder , grain or other suitable materials glued or otherwise fixed to the surface of the plate . fig4 c shows a portion of a roughened surface of the present invention wherein the surface 164 cooperates with a plurality of generally rectangular projections 166 , 168 having a rectangular shape in plan and defining a plurality of grooves 170 therebetween . fig4 d has a plurality of projections 172 cooperating with surface 174 to define a plurality of grooves , such as 176 . fig4 e has a plurality of projections 180 having curved sidewalls 182 defining grooves 184 . fig4 f has a plurality of projections 186 generally similar to those of fig4 a , but having a larger base 188 between projections 186 . grooves 190 which , in the form shown , are generally u - shaped may be of any desired shape . fig4 g has a plurality of projections 192 with grooves 194 therebetween . it will be appreciated from fig4 a through 4g that various projection shapes , sizes and relative spacing provided are examples of different size grooves and different roughened surfaces . these roughened surfaces , if desired , may be provided by coatings or be integrally formed . when granular material is subjected to rheological analysis by the system of the present invention , it is preferred that the average size and shape of the granules approximate the height and shape of the projections 160 . in the case of a slurry , thick sludge , bread making dough , or the like , the surface projections will preferably be large enough so that slipping between the test material and the sample does not occur . in general , these projections are in the shape shown in fig4 a with the depth of the projection being about 5 mm to 10 mm depending upon the consistency of the sample . even in test materials , such as light grease , which adhere to the surface of the plate , the plate surfaces need to be roughened to resist stick slip . while initially there might be no slipping , once the rotatable plate moves above a certain shear rate , the material starts to slip without use of the projections . referring to fig5 and 6 , a further embodiment of the present invention will be considered . this embodiment is adapted for use with gas - solid mixtures . while it has been known to attempt to do studies on gas having entrained solids , there has not been an effective means of rheologically evaluating the mixture of both . in this embodiment of the invention , the lower plate 218 is generally cup - shaped and provides an upwardly open chamber 210 which receives the specimen . the rotatable upper plate 220 is not only mounted for axial rotation as indicated by arrow b , either through repeated 360 ° cycles or by oscillation through an arc , which may be on the order of + 90 ° to - 90 ° at 15 hz , + 35 ° to - 35 ° at 25 hz , and + 9 ° to - 9 ° at 50 hz , but also may be subjected to axial movement to separate plates 218 , 220 to facilitate sample insertion and relative closing movement to permit plate 220 to enter cavity 210 to provide the desired specimen receiving volume between the circular plates 218 , 220 . it will be noted that underlying stationary plate element 230 is a chamber 232 which is adapted to receive air . similarly , overlying plate element 240 is a chamber 242 which is adapted to receive air . as is shown in fig6 upper plate 240 has a plurality of pores 244 which will cover essentially the entire plate with all of the pores 244 being essentially the same size and generally equally spaced from each other . the pore sizes of both plates 230 , 240 and spacings are preferably identical for most specimens . the pore openings 244 should be such that they are smaller than the average size of the solid particulate material entrained in the gas to resist clogging of the pores by the solid particles . in the event the process is employed to determine rheological properties of fine powders , the plates may be made of sintered material of various pore sizes to obtain micro - pores . the mechanics of performing the rheological testing may be essentially as that described with respect to fig1 with certain supplemental apparatus and practices being employed . a compressor 250 provides air through tube 252 and air filter 254 which is adapted to remove material entrained within the air . tube 252 is in communication with chamber 232 and introduces air into the chamber which air passes upwardly through the pores in plate 230 to impinge upon the sample which is a mixture of gas and solids and maintain the solids distributed within the gas . ( if the solids in the specimen are mixed with a gas other than air , it may be desirable to provide an airtight chamber around the plates 218 , 220 and employ circulating gas in lieu of air in order to resist contamination of the gas by air .) the air then flows out of chamber 210 through pores in plate 240 into chamber 242 . the air in chamber 242 is exhausted through tubes 260 , 262 and , respectively , air filters 264 , 266 so as to remove any undesired entrained particles . when the apparatus is not in operation , nozzle 270 may be employed to pump air into chamber 242 to clear any clogged pores that may be in the plate in plate 240 after the experiment . it will be apparent that , if desired , the plates 230 , 240 may be substituted for by plates having different porosity for particular types of samples or experimental needs . by providing for more effective interengagement relatively slip - free interaction between the rotary plate and the stationary plate , on the one hand , and the specimen , more accurate results regarding the rheological properties of the specimen , such as viscosity , may be obtained . normal stress differences may be determined based on the mathematical model to be employed to describe the behavior of the specimen being tested . the integrally formed roughened surfaces of the present invention may be created by any desired means , such as milling machines , electrochemical machines or for very small projections , chemical etching techniques . referring to fig7 and 8 , a further embodiment of the present invention will be considered . this embodiment is suitable for use with materials where the normal forces exhibited by the material under shear are small or where there is a need to measure local forces normal to the plane of shear , such as in the case of biological fluids , polymer solutions , and the like . in this embodiment of the invention , the stationary lower plate 271 is generally cup - shaped and provides an upwardly open chamber 272 which receives the specimen . the overlying rotatable plate 280 is structured to be received within chamber 272 . the bottom surface of the lower plate 271 is made out of a flexible membrane 273 , the underside of which consists of an electrically conducting membrane 274 . fig8 shows the details of the stationary bottom plate 271 which consists of a unique transducer . the flexible membrane 273 is separated from the rigid bottom surface 275 by means of a relatively small fluid gap 276 , which may be filled with air or any non - conducting liquid or gas . the rigid bottom surface 275 has embedded in it a plurality of small metallic plates 277 which may be the size of a pin head and which are connected to an electronic circuit 285 . the electronic circuit 280 is electrically connected to conductive membrane 274 by lead 278 and to the rigid bottom surface 275 by lead 279 . the output signal from electronic circuit is transferred by lead 281 to capacitive measurement unit 282 and which outputs signals over lead 283 to data acquisition unit 284 . the embedded metallic plates 277 and the conducting membrane 274 form the two plates of a series of capacitors . in testing a specimen , when a load is applied to the flexible membrane 273 , the gap between the conducting membrane and the embedded metallic plates 277 changes which , in turn , changes the capacitance at each of the locations where the embedded metallic plates 277 are located . knowing the capacitance at each location , one can determine the deflection of the membrane 273 from its initial position and the force required to achieve this deflection . before the stationary plate 271 is placed in the instrument , it is calibrated using a known load and known gap between the conducting membrane 273 and the embedded metallic plates 277 . the top plate 280 can be either a plate 290 &# 39 ; cooperating with a stationary plate 271 &# 39 ; or a cone 290 &# 34 ; cooperating with a stationary plate 271 &# 34 ;, for example , as shown in fig9 a and 9b . this transducer is ideal for measuring the forces in small sample volumes as is the case with bio - fluids , such as blood , plasma , polymer solutions , and the like . in addition , knowledge of the local normal forces will greatly enhance the ability to characterize the rheological properties of the samples . referring to fig1 , a flow chart of the processing of data received within computer means , such as computer 32 in fig1 will be considered . the measured axial force 300 and torque 302 pass through data acquisition unit 306 and to computer 308 . also introduced into the computer 308 is the mathematical material model 312 which is processed by the axial force and torque equation 314 with the output going to computer 308 . the computer 308 processes the actual measured data on the axial force and torque and the mathematical material model employing data analysis and regression employing the least squares method . the output of the computer 308 provides the material parameters 310 and statistical analysis 312 . the final output 316 provides the mean , standard deviation , and variance of the material parameters based on a comparison of the actual data entering computer 308 from data acquisition unit 306 with the mathematical model predictions of axial force and torque supplied to computer 308 by axial force and torque equation unit 314 . it will be appreciated , therefore , that the present invention provides an effective means for enhancing the efficiency of rotary rheometers in working with a wide variety of specimen materials . in one embodiment , this is accomplished by providing &# 34 ; toughened surfaces &# 34 ; on at least one of the two plates and , preferably , on both with the degree of roughness being adjusted according to the nature of the material being processed . all of this is accomplished in a manner which is readily adaptable to existing rotatable rheometers merely by changing the nature of the plate . in another embodiment , a deformable capacitive sensor is provided within the base of the stationary plate . whereas particular embodiments of the invention have been described herein for purposes of illustration , it will be evident to those skilled in the art that numerous variations of the details may be made without departing from the invention as set forth in the appended claims .	6
referring now to the drawings in greater detail , fig1 illustrates a fragmentary jet engine 10 having a nacelle 12 and inlet cowl 13 , with an opening 14 around which a combination bird deflector and air replacement structure 15 is either permanently or detachably mounted . a generally conically shaped bird deflector 16 includes bars 18 ( fig2 ) extending outwardly from a central nose 20 in an equally spaced relationship . a plurality of bar segments 22 having progressively shorter lengths are secured between the adjacent outwardly extending bars 18 . for larger deflectors 16 , the segments 22 are progressively farther apart as they approach the nose 20 . the cross - sectional shapes of the various bars 18 and 22 may be one of round , four - sided , or triangular , with pointed edge directed outwardly . the various shapes may affect air flow differently at engine full power . suitable fasteners represented at 24 in fig1 may consist of a full round or other shaped flanges 26 to connect the combination structure 15 around the jet engine inlet . as shown in fig3 , a bird deflector 30 has an upper half formed by downwardly extending and converging arcuate - shaped bars 32 , and a lower half formed by upwardly extending and converging arcuate - shaped bars 32 , the two halves meeting as a rounded forward nose 34 . a plurality of progressively shorter cross bars 36 are mounted between adjacent arcuate - shaped bars . as shown in fig4 , a deflector 40 is a canopy type structure with downwardly extending arcuate bars 42 which terminate in a spaced apart relationship to form a partial circle 44 below the center of engine inlet , simulating an eagle &# 39 ; s beak . bottom bars 46 are bent as much as necessary to extend rearwardly from the partial circle 44 . cross bars 48 may be secured between adjacent bars 42 and 46 . as shown in fig1 , 2 , 3 and 4 , a frustum 50 , which may be a frustum - like element of any shape , such as conforming to the shapes shown in fig5 a , 5 b , 5 c , and 5 d , has a large opening 52 and a small opening 54 connected respectively between any of the three bird deflector embodiments and the jet engine inlet opening 14 . the various rear ends of the longitudinal bars 18 , 32 , and 42 are suitably secured , as by welding , to the large end 52 of the frustum 50 . alternately , both the small opening 54 and the rear ends of the longitudinal bars may be secured adjacent the engine inlet opening 14 , with the large opening 52 extended around the bird deflector . it is a theory of this invention embodiment that the air flow blocked by the bird deflector components can be replaced by the air flow against the inside portion of the frustum 50 surface not blocked by the various deflector bars in front thereof , and then directed inwardly in front of the jet inlet 14 . as such , the total air flow being sucked into the jet engine inlet will be equal to that which would normally occur when the bird deflector and air replacement combination are not in place . some acceleration of the air through the converging length of the frustum 50 surface will have occurred in the sense of it being a large nozzle . as a further alternate embodiment of the invention , in lieu of the frustum 50 , a tube 56 , or conduit of any shape , such as the shapes shown in fig5 , is provided intermediate any of the above described bird deflector designs and a suitable connection 58 around the inlet 14 of the jet engine body 12 . spaced apart openings 60 , such as holes or edge notches ( not shown ) are formed adjacent the rear end of the tube 56 . spaced apart streamlined channels 62 are formed at their bottom surfaces to conform to the outer surface of the tube 56 . each channel 62 is open at the front end 64 as a round or oval shape and closed at the rear 66 , with a bottom edge opening 68 ( fig9 ) matching a respective opening 60 in the rear of the tube 56 . thus , air entering each front opening 64 will flow through openings 68 and 60 into the tube 56 to then be sucked into the jet engine inlet 14 . as shown in fig1 , the channel 62 may have its opening conform to , and be open against , the outer surface of the tube 56 . the total air flow through the channels 62 must substantially equal the total air flow that is blocked by the bird deflector elements . as such , it is a theory of this second invention embodiment that the total air flow entering the jet inlet will equal the normal air flow therein when the deflector and replacement assembly are not in place . to further deflect birds outwardly , the front channel ends 64 may be sloped rearwardly . while the channels 62 serve to replace air being blocked by the bird deflector components , their efficiency may be improved by being formed as either a nozzle 62 a ( fig1 ) or a venturi tube 62 b ( fig1 ), or by having an orifice 64 ( fig1 ) formed in the channel . a nozzle 62 a is a conduit with a variable cross - sectional area in which a fluid accelerates into a high - velocity stream . it may be convergent - divergent or simply convergent . a venturi tube 62 b is a device that consists of a gradually decreasing nozzle through which the fluid is accelerated , followed by a gradually increasing diffuser section that eliminates flow separation and allows the fluid to nearly regain its original pressure head . an orifice 64 is a plate that is mounted inside a channel 62 , and has a sharp edged aperture through which the fluid in the channel is accelerated . as a still further alternate embodiment of the invention , it is also conceivable that the inlet cowl 13 of a jet engine may be modified to become an integral part of an air replacement apparatus . for example , the cowl 13 may have the shape of the frustum 50 of fig1 , 3 , and 4 . referring now to fig1 , the cowl 13 , with its usual progressively expanding shape , replaces the tube 56 and has the openings 60 foamed therein . the channels 62 , with their openings 68 aligned with the openings 60 , are mounted around the cowl . preferably , the channels are shaped to attach to the cowl with a feathered rear edge to keep the height as low as possible . as such , each modified cowl 13 arrangement is secured to the body 12 or nacelle in the usual manufacturing manner . some one of the above bird deflectors is mounted around the jet inlet 14 . as a further possible air replacement embodiment , and realizing that bird deflectors of any shape in front of the jet inlet hamper air flow suction , there may be some current engine cowl designs that lend themselves to modification . for example , the cowl of the above referenced me262 junkers mumo 004 engine , for one , is a gradual arcuate continuation of the nacelle in which the engine is mounted . as such , this invention embodiment teaches extending the cowl 13 as a cylinder to the plane of the normal inlet and having an inwardly extending flange 69 to provide a vertical frontal surface around an opening 14 a equivalent to the usual inlet 14 . small spaced - apart openings 70 are formed completely around that frontal surface flange 69 to receive a total air flow substantially equal to the air flow being blocked by the longitudinal and lateral bars of a bird deflector secured by suitable fasteners to the flange 69 immediately adjacent the opening 14 a . this air replacement embodiment is shown in fig1 and 16 , with the original cowl shape shown in phantom lines in fig1 . in keeping with the aim to replace as much air as possible both through and around a bird deflector , it is noted that many nacelle 12 and cowl 13 shapes are streamlined to have the air inlet 14 as a smaller diameter than that of the nacelle 12 . as such , with a suitable bird deflector in place , i . e ., secured by a suitable fastening arrangement 24 around the air inlet 14 , the spaced - apart circumferential openings 60 , as shown in fig1 , are formed around the cowl 60 . a cylinder 72 , or frustum is connected at its rear in a suitable manner , as by welding , to the usual connection between the nacelle 12 and the cowl 13 , or immediately behind the openings 60 , and extends to the plane of inlet 14 , or just past the openings 60 . in this embodiment , a substantial amount of air is sucked in by the jet engine through the opening 74 ( fig1 ), and thence , almost immediately , through the cowl openings 60 to make up for the air being blocked by the bird deflector components . tests would determine the required number and preferable cross - sectional shapes of bars 18 , 32 , 42 and 46 , bar segments 22 , and cross bars 36 and 46 , i . e . round , triangular , or rectangular , that would be most suitable for deflecting birds of sizes ranging from sparrows to herons , while presenting as small a total area as possible . tests would also determine the type of metal alloy , such as a titanium alloy , or plastic , or suitable carbon fiber materials , such as possibly in carbon nanotube technology , for the bars and cross bars which could be as small in cross - section as possible , and light weight , while being strong enough to withstand the impact of various size birds . in keeping with the theories of the invention embodiments , air flow tests in a test facility for a given engine model could determine the compatible deflector design and any of the frustum or tube and channel shapes or cowl modifications which provide a total air flow equivalent to the air flow which would occur if no deflector and air replacement apparatus were present . while three bird deflector , two add - on air replacement embodiments and several original cowl air replacement embodiments of the invention have been shown and described , other modifications thereof are possible . once the amount of air that is blocked by a particular bird deflector is measured , as in a test facility , further cowl modifications may be readily tested . for example , in lieu of the cowl having either a sloped or a frustum shape , it could have a tubular shape with the bird deflector secured to the forward end thereof , thereby admitting additional air . additionally , sloping cowls on some nacelle streamlined shapes could simply be perforated for testing , without the cover 72 shown in fig1 , 18 .	1
1 . cloning , expression and purification of 222delt / l74w and δex - 2 pp13 variants ( fig2 ) a . polymerase chain reaction ( pcr ) for the 222de 1 t / l74w mutation variant based on a polymorphism analysis of the pp13 gene and correlation with the occurrence of polymorphism and the development of preeclampsia , the sequence of pp13 wild type ( fig5 ) was used as a template to generate the 222delt / l74w ( also referred to herein as the truncated ) sequence by pcr techniques . two primers were designed with the following sequences : a sense primer : cgaatccatgtcttctttacccgtgc ( seq . id . no : 12 ) and an anti - sense primer : the restriction site sequences of bamh i and sac i were introduced in the sense and anti - sense primers respectively . both primers were synthesized by sigma - genosys . to amplify the truncated pp13 dna sequence , 1 ng of wild type pp13 dna ( in plasmid ) was used as a template . 0 . 1 - 1 μm of the above mentioned specific primers , 1 u of pfu dna polymerase ( promega ), 200 μm dntp - mix and pfu dna polymerase × 10 buffer . pcr was carried out at the following high temperature cycles : 94 ° c . for 2 min , 94 ° c . for 30 sec , 60 ° c . for 30 sec and 72 ° c . for 1 min over 35 cycles . a final extension was carried out at 72 ° c . for 4 min and the pcr product , analyzed by agarose gel and revealing the expected size of 288 bp , was stored at 4 ° c . until use . screening of a cdna library derived from a preeclamptic placenta revealed an exon - 2 deleted ( also referred to herein as the spliced ) sequence ( deletion of 30 amino acids ) of pp13 . based on nucleotide sequence analysis of the deleted pp13 variant , a set of primers was designed to flank the full length of the dna . two primers were designed with the following sequences : a sense primer : 5 ′- cgatacggatccatgtcttctttacccgtgc - 3 ′ ( seq . id . no : 14 ) and an anti - sense primer : 5 ′- taagtcgagctcattgcagacacacactgagg - 3 ′ ( seq . id . no : 15 ). both primers were synthesized by sigma - genosys . to amplify the deleted δex - 2 pp13 dna sequence , 1 ng of deleted pp13 dna was used as a template , 0 . 1 - 1 μm of the above mentioned specific primers , 1 u of pfu dna polymerase ( promega ), 200 μm dntp - mix and pfu dna polymerase × 10 buffer . pcr was carried out at the following high temperature cycles : 94 ° c . for 2 min , 94 ° c . for 30 sec , 55 ° c . for 30 sec and 72 ° c . for 1 min over 35 cycles . a final extension step was carried out at 72 ° c . for 4 min and the pcr product , analyzed by agarose gel and revealing the expected size of 338 bp , was stored at − 20 ° c . until use . the resulting pcr fragments were inserted into a puc57 - t cloning vector ( t - cloning kit # 1212mbi fermentase ) and the clones containing the insert were selected and sequenced by automated dna sequencing at the biological services at the weizmann institute , rehovot , israel . 2 - cloning of the truncated and spliced form dna into expression vectors . a - ligation : the pcr products of the truncated and spliced pp13 dna were purified using a qiaquick pcr purification kit prior to ligation . the purified pp13 dna product ( 1 μg ) and the expression vector pqe 30 ( 0 . 5 μg , qiagen ) were digested with bamh i and sac i ( 20 u each , new england biolabs - neb ) in nebuffer bamh i and nebuffer sac i , respectively . insert : vector ratios of 3 : 1 , 1 : 1 and 1 : 3 were used for ligation of the digested pcr product dna with 50 ng of digested pqe - 30 using 100 u of t4 ligase ( neb ) and t4 ligase buffer for 2 hr at 22 ° c . b - transformation : the ligation mixture was transformed into m15 ( prep4 ) cells ( qiagen ) and 10 μl of the ligation mixture were added to 100 μl competent m15 prep4 ) cells for 10 min in ice and then transferred to a 42 ° c . water bath for 50 sec . after heat shock , the mixture was placed on ice for another 2 min and 900 μl of lb medium was added to the transformation reaction and incubated for 60 min at 37 ° c . with shaking of approximately 225 rpm . 10 - 100 μl of the cells were plated on lb agar plate containing 100 μg / ml ampicillin ( sigma ) and 25 μg / ml kanamycin ( sigma ) for overnight at 37 ° c . c - screening for positive colonies : 20 single colonies grown on the plate were picked and cultured in 2 ml lb medium containing ampicillin ( 100 μg / ml ) and kanamycin ( μg / ml ) for overnight at 37 ° c . with 225 rpm shaking . plasmid dna was purified from each colony culture with wizard plus sv minipreps dna purification system ( promega ). the presence of the pp13 dna insert was tested by pcr as follow : the pcr reaction ( 20 μl volume ) composed of 1 ng of dna template , 0 . 1 - 1 μm truncated pp13 and spliced variant specific respective primers and 10 ml of × 2 ready mix for pcr ( bio - lab ltd ). the pcr conditions were as detailed above . pcr products were separated on 1 . 5 % agarose and the dna bands were visualized in las - 3000 image system ( fuji ). the potential positive clones ( 4 ) were selected according to the calculated size of the pcr product . the final dna sequence of each clone was determined by sequencing carried out in the multi - disciplinary laboratories unit ( rappaport institute of medical science — technion , haifa ). based on verified sequence analyses , one positive clone was selected for expression of the protein and inoculated in 20 ml of lb medium containing ampicillin and kanamycin at 37 ° c . for overnight with shaking . the culture was mixed 1 : 50 in lb medium containing antibiotics and grown at 37 ° c . until reaching an od600 of 0 . 6 . the expression of the protein was induced with 1 mm — isopropyl - b - d - thiogalactopyranoside - iptg for 3 hrs . bacterial cells were harvested by centriftigation at 4000 g × 20 min at 4 ° c . the cell pellet was stored until use at − 80 ° c . aliquots were tested by sds - page analysis to determine the molecular weight of the recombinant protein . based on sds - page analysis , the recombinant , truncated pp13 was localized to be trapped in the inclusion bodies . the method used to obtain soluble polypeptides was as follows . cell pellet was resuspended in lysis buffer containing 20 mm tris - hcl , ph 8 , 150 mm nacl , 5 mm imidazole and protease inhibitor ( roche ), 10 % glycerol and incubated with 0 . 2 mg / ml lysozyme ( sigma ) for 1 hr at 4 ° c . the cells were disrupted by sonication on ice 6 × 10 sec of 200 w or alternatively disrupted by applying pressure of 1000 psi in minicell french press ( thermo ). soluble proteins were discarded and the pellet containing the inclusion bodies ( 0 . 75 gr ) was resuspended in binding buffer ( 20 mm tris - hcl , ph 8 . 0 , 300 mm nacl , 5 mm imidazole , 6 m urea , pmsf , complete ( protease inhibitor — roche ), 1 mm dtt and 10 % glycerol ). after 1 hr of incubation at room temperature , the insoluble proteins were discarded by centrifugation at 20 , 000 g for 20 min ( ss34 rotor , sorval - rc ). the soluble fraction was filtered through 0 . 45 μm pore size filters and mixed with 1 ml of pre - equilibrated ni - nta agarose ( qiagen ) for 1 hr at rt . the refolding of the bound recombinant truncated pp13 was performed on the column using a step - wise linear 6 - 0 m urea gradient . first the ni - nta agarose column was washed with 10 ml of wash buffer ( 20 mm tris - hcl , ph 8 . 0 , 300 mm nacl , 20 mm imidazole , 6 m urea , pmsf , complete , 1 mm dtt and 10 % glycerol ) followed by washing the column with 10 ml of refolding buffers ( wash buffer containing 4 , 2 , 1 , 0 . 5 and 0 m urea ). bound recombinant pp13 was eluted with 5 ml of elution buffer ( 20 mm tris - hcl , ph 8 . 0 , 300 mm nacl , 0 . 5 m imidazole , pmsf , complete , 1 mm dtt and 10 % glycerol ). recombinant , truncated pp13 protein was dialyzed against tbs ( 20 mm tris - hcl , ph - 8 , 150 mm nacl ) and diluted with equal volume of 60 % glycerol in tbs and stored at − 80 ° c . until use . the protein concentration was determined by bradford assay and stored at − 20 ° c . for further analysis . recombinant truncated and spliced pp13 variants ( 1 - 5 μg ) were resuspended in sample buffer in the presence of 5 % β - mercaptoethanol and boiled for 5 min at 95 ° c . proteins were loaded on 15 % sds - page and separated by applying 120 volts for approximately 2 hrs . to visualize the protein bands , the gel was washed with h 2 o for min and stained for 1 hr with gelcode reagent ( pierce ). the staining reagent traces were removed by several washes with h 2 o until reaching enough clarity of the stained pp13 . the approximate molecular size of the pp13 protein variants was determined by molecular weight standard proteins which were separated in parallel on the same gel and compared to the calculated molecular size of the protein based on its amino - acid composition . the gel is shown in fig3 . it may be seen that the native , wild - type pp13 has the highest molecular size ( appx . 16 - 17 kda ), followed by the spliced ( appx . 14 - 15 kda ) and the truncated ( appx . 12 - 13 kda ) variants . the elisa test was used to test the recognition of the truncated recombinant pp13 by anti - pp13 monoclonal antibodies . briefly , micro - plate wells were coated with 1 - 10 μg / ml of the recombinant wild - type , truncated and spliced pp13s for 2 hrs at 37 ° c . followed by blocking the free binding sites by 1 % bovine serum albumin - bsa in carbonate buffer for 1 hr . coated proteins were incubated with serial dilution of the following monoclonal antibodies : clones 27 - 2 - 3 , 215 - 28 - 3 and 534 - 16 and anti - histidine ( control ) for overnight at 4 ° c . unbound antibodies were washed with phosphate buffer saline containing 0 . 05 % tween - 20 . goat anti - mouse igg conjugated to hrp was used for detecting bound antibodies followed and tmb was used a substrate for the hrp . the optical density of the resulting enzymatic product was measured with an elisa reader at 650 nm . the reaction was stopped after 30 min and the optical density was re - measured at 450 vs . 650 nm . the results are shown in fig4 a , 4 b and 4 c . it may be seen that while the wild type pp13 reacted with the specific anti - pp13 antibodies , the truncated and spliced variants did not ( fig4 a & amp ; 4b ). all of the pp13 proteins reacted with the control anti - histidine antibody ( fig4 c ). this may provide an explanation for the observation that during the first trimester , a woman with high risk for preclampsia has a low measured amount of pp13 in her bodily substances . wild type , truncated and spliced pp13s were absorbed to nitrocellulose membrane ( biorad ) and free binding sites were blocked with 5 % milk in tris buffer saline ph 8 . 0 ( tbs ) for 1 hr . membrane was incubated with anti pp13 monoclonal antibodies ( clones 27 - 2 - 3 , 215 - 28 - 3 and 534 - 16 ) for 2 hrs at 37 ° c . and free antibodies were washed with tbs - tween 20 . to detect bound anti - pp13 antibodies , a secondary antibody of goat anti - mouse igg conjugated to hrp enzyme was added to the membrane and incubated for 90 min at room temperature ( rt ) followed by discarding the free excess antibodies by washes as indicated above . enhanced chemiluminescene ( ecl ) reagents were used as a substrate for the hrp and the signals were visualized , captured and analyzed by using the las3000 image system ( fuji ). the following is a description of the identification and analysis of the 222deltt / l74w mutation , with reference to fig9 a - 9e . intronic oligonucleotide primer sets for pcr were designed to flank each of the four lgals - 13 gene exons as well as a short portion of the 5 ′ and 3 ′ untranslated regions . each generated amplicon was subjected to multiphor sscp / heteroduplex analysis ( fig9 b ). conformational variants were further characterized by automated sequencing and where appropriate , by restriction enzyme analysis . the intronic variants were genotyped in a small group of primigravida patients ( n & lt ; 20 ). the identified deletion was further characterized in a larger cohort ( n & gt ; 80 ) of primigravida patient who developed early ( ga & lt ; 34 weeks ) preeclampsia , their infants and a matched control group of ˜ 100 individuals , comprising healthy mothers and unrelated newborn infants . the results of the analysis are summarized in the table below ( fig9 a ). four sequence variants were identified in this cohort . the majority of the preeclamptic patients carried 1 - 2 mutations in the pp13 gene . among them , the 222deltt / l74w mutation associated with truncated pp13 was discovered in 6 % preeclamptic ( 5 % hetro and 1 % homozygotes , compared to 1 % among control ), and 8 % of their infants ( compared to 4 % in the control ) inferring a higher proportion among the early ( ga & lt ; 34 weeks ) preeclampsia vs . control and an inferred paternal contribution to the route of transfer to the newborn . point mutations between exons 2 and 3 , that could be critical for the development of spliced variants in exon 2 ( mutation ivs2 - 22a & gt ; g and ivs2 - 36a & gt ; g )) appear only in the preeclamptic cases ( 15 % and 28 % respectively ) and only in a heterozygous form , and are also detected at a little higher frequency in the newborns ( 19 % and 37 % respectively ) the deletion ( t ) frame - shift mutation ( 222deltt / l74w ) was detected in exon - 3 in preeclamptic patients , their infants and paternal contribution was inferred in several cases . the mutation is predicted to create a novel 28 or 27 c terminal region which is 38 or 37 amino acids shorter than the wild - type pp13 . the mutant exon 3 . 1 sscp / hetroduplex was run in a gel against the wild type ( fig9 b ). the mutant delt222 /— was analyzed using an electropherogram ( fig9 c ). an alignment of the amino acid sequences of lgals13 wt and lgals13delt is shown in fig9 d . the delt frameshift creates a new 27aa terminal region ( underlined ) which is 37aa shorter than the wild type peptide . fig9 e shows the relative positions of the different mutants with respect to the wild type gene .	8
fig1 is discussed in conjunction with fig2 . fig1 is a rear perspective view of a grill pan 100 with a base 102 and a lid 101 pivotally registered to the base 102 by an adjusting hinge 115 . fig2 presents an exploded perspective view of individual components that make up a grill pan 100 according to an embodiment of the present invention . a base 102 supports a corrugated food cooking surface with grill rods 103 a , or grill veins , disposed at a distance from one another , and drain channels 103 b , or valleys , alternately positioned between the base grill veins 103 a . similarly , a lid 101 has grill veins 104 a disposed at a distance from one another , and channels or valleys 104 b alternately positioned between the lid grill veins 104 a . preferably , the lid grill veins 104 a are sized and spaced apart such that the lid grill veins 104 a rest in an interlocking position with the base grill veins 103 a when the lid 101 is placed in a closing position onto the base 102 for nonuse or storing purposes . in fig1 and 2 , an upstanding wall 105 surrounds the periphery of the base 102 and , advantageously , is of a height greater than the height of the base grill veins 103 a . two side portions 105 b of the wall 105 and a back portion 105 a of the wall 105 of the base 102 are adjacent to the grill veins 103 a . a front portion 105 c of the wall 105 , however , is spaced at a distance from the front edges of the grill veins 103 a . within this space is a collecting channel , or grease channel 106 , which runs transverse to the base grill veins 103 a . the collecting channel 106 provides for collecting grease , juice , and other food liquids , which are produced during a grilling process . as shown in the side section view , in fig2 , the base grill veins 103 a are positioned at a slight downward slope 107 , from a higher elevation at the back portion 105 a of the wall 105 of the base 102 to a lower elevation at the front portion 105 c of the wall 105 of the base 102 , in order to facilitate the flow of food liquids for easy disposal . grease , juice , and other food liquids may run along the sides of the base grill veins 103 a and temporarily collect in the drain channels 103 b alternately positioned between the base grill veins 103 a . the downward slope 107 of the base grill veins 103 a then provides for a natural flow of the grease , juice , and other food liquids into the collecting channel 106 , where it keeps until the grill pan 100 is removed from a conventional oven , or a convection oven . although fig1 - 5 present a rectangular base 102 and a rectangular lid 101 , the grill pan 100 of the present invention may have other shapes , including circular , oval , and polygonal shapes . as shown in fig2 , the collecting channel 106 has a top edge 108 , which is lower than the top edge of the front portion 105 c of the wall 105 of the base 102 . two indents 109 are positioned on the front portion 105 c of the wall 105 of the base 102 , above the upper edge 108 of the collecting channel 106 . the indents 109 extend through the width of the front portion 105 c of the wall 105 and allow for lift handles 110 to be hooked onto the upper edge 108 of the collecting channel 106 , allowing a user to lift and move the grill pan 100 without physically touching the grill pan 100 , which may be heated to oven temperatures . thus , a user may use the grill pan 100 safely without the worry of being burned and / or spilling food liquids from the grill pan 100 , which may be messy and dangerously hot . preferably , the lift handles 110 are made of a material that is able to withstand high temperatures , able to bear a heavy weight load , and is a poor heat conductor . for example , the lift handles 110 made be made of metal encased in wood or any other material capable of withstanding high temperatures and preventing heat conduction . according to a preferred embodiment , a portion of the lift handle 110 used to hook onto a grill pan 100 may comprise two metal prongs , formed generally parallel to one another and shaped such that the prongs provide a secure fit onto the grill pan 100 . the two prongs may be machined in a bent or angled position with respect to the remaining portion of the lift handle 110 , as shown in fig2 , however , one of ordinary skill would recognize that the lift handles 110 of the present invention may be formed into multiple configurations and still perform their necessary function . a lid 101 of the grill pan 100 includes grill veins 104 a similar to the base grill veins 103 a and disposed at a distance from one another , with channels 104 b alternately positioned between each grill vein 104 a . the lid grill veins 104 a extend from a back edge 111 a of the lid 101 to a front lip at a front edge 111 b of the lid 101 . the front lip provides a surface area for a lid lift lug 112 , or lid handle , and two indents 113 or grooves , which serve as clearance grooves for the lift handles 110 . the lid handle 112 may be positioned in the center of the front lip of the lid 101 , as shown in fig2 , and may be integrally formed from the same material as the lid 101 of the grill pan 100 , or it may be a separate attachment . optionally , the lid handle 112 may have an aperture 114 for hooking the lift handle 110 onto the lid handle 112 in order to lift the lid 101 to an opened position relative to the base 102 . as shown in fig1 and 2 , the clearance grooves 113 in the front lip of the lid 101 are positioned such that the clearance grooves 113 line up with the indents 109 in the front portion 105 c of the wall 105 of the base 102 . the clearance grooves 113 prevent the lid 101 from inhibiting the lift handles 110 ability to hook onto the top edge 108 of the collecting channel 108 when the lid 101 is in a closed or flat position , relative to the base 102 . the lid 101 of the grill pan 100 is pivotally registered to the base 102 via an 115 adjusting hinge , as shown in fig1 and 3 a - 3 b , where fig3 a and 3b . in a preferred embodiment , the adjusting hinge 115 includes a plurality of lid pivot guide pins 116 , as shown in fig1 and 2 , which protrude upwards from the back portion 105 a of the wall 105 of the base 102 and from a location inside the base 102 , where the location is disposed at a distance from the back portion 105 a of the wall 105 of the base 102 . the plurality of lid pivot guide pins 116 , as shown in fig2 , may be separate units that are attached to the base 102 , or may be integrally formed from the same material as the base 102 . the plurality of lid pivot guide pins 116 may include outer lid pivot guide pins , which are located along the back portion 105 a of the wall 105 of the base 102 , and inner lid pivot guide pins , which are positioned at a relatively short distance from the outer lid pivot guide pins , as shown in fig2 . the lid pivot guide pins 116 may be positioned generally perpendicular to the base grill veins 103 a , as shown in fig1 and 2 . alternately , other configurations of lid pivot guide pins 116 that allow the lid 101 to be pivotally registered to the base 102 are within the scope of the present invention . as shown in fig1 and 2 , a lid stop 117 is positioned between the two outer lid pivot guide pins 116 , and protrudes generally upward from the back portion 105 a of the wall 105 of the base 102 and generally perpendicular to the grilling surface . the lid stop 117 permits the lid 101 to rest in an opened position generally upright or perpendicular to the base 102 of the grill pan 100 , and also prevents the lid 101 from falling backwards when in the opened position . as shown in fig1 and 2 , a portion of the back edge of the lid 101 is formed into a smooth cylindrical edge , or bar portion 118 , and when the lid 101 is registered to the base 102 , the bar portion 118 is positioned between the lid pivot guide pins 116 of the base 102 , such that it “ slides ” between the lid pivot guide pins 116 . adjacent to the bar portion 118 is one or more hinge slots 119 carved into the lid 101 of the grill pan 100 , and are positioned generally parallel to the lid grill veins 104 a and generally perpendicular to the bar portion 118 . the bar portion 118 and the hinge slots 119 register the lid 101 to the base 102 with the bar portion 118 sliding between the outer and inner lid pivot guide pins 116 while the hinge slots 119 fit around the lid pivot guide pins 116 . to align the base 101 with the lid 102 , a lid pivot pin or bolt 120 may be attached to each outer end of the bar portion 118 of the lid 101 such that the lid pivot bolts 120 extend beyond the total length of the back portion of the wall 105 of the base 102 from one outer lid pivot guide pin 116 to the other outer lid pivot guide pin 116 . alternately , the lid pivot bolts 120 may be integrally formed from the same material as the lid 101 instead of being separate units for attachment . the adjusting hinge 115 allows the lid to move freely with respect to the base of the grill pan 100 . when food is placed onto the grill surface of the base 102 , the lid 101 adjusts to the height or thickness of the food and may lie generally flat on top of the food instead of at an angle . with the lid 101 lying generally flat , the grill pan 100 is easily placed into a conventional oven or a convection oven . additionally , a greater surface area of the lid 101 comes into contact with the food . advantageously , the lid 101 may be separated completely from the base 102 in order to be cleaned . fig3 a is a rear perspective view of a grill pan 100 , according to an embodiment of the present invention , with a lid 101 of the grill pan 100 placed in an opened position . as shown in both fig3 a and 3b , the lid 101 is pivotally registered to a base 102 of the grill pan 100 by an adjusting hinge 115 with a bar portion resting 118 between a plurality of lid pivot guide pins 116 , similar to fig1 . the lid 101 rests against a lid stop 117 , which permits the lid to rest in an open position generally perpendicular to the base 102 . fig3 b is a front perspective view of the same grill pan 100 . fig3 is a perspective view of a grill pan , according to an embodiment of the present invention , in a closed position while not in use . in this embodiment , a lid stop runs a length of a back portion of the wall portion between two lid pivot guide pins , and both the lid stop and the lid pivot guide pins are integrally formed from the same material as the base of the grill pan . additionally , slots carved into the lid are shown in greater detail . as will be appreciated , there are countless configurations for a grill pan that grills foods inside a conventional or convection oven . fig1 - 7 illustrate only a few possible configurations , and in no way should be construed as limiting the application of the inventive apparatus to those configurations . to the contrary , the invention is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims . the scope of the following claims is to be accorded the broadest interpretation so as to encompass all such modifications and equivalent structures and functions .	0
1 . a method for preparing menthone starting from isopulegol , wherein a rearrangement reaction is carried out , specifically a dehydrogenation / hydrogenation reaction , i . e . dehydrogenation of the oh group at the c1 atom to a keto group and a hydrogenation of the 1 - methylethenyl group at the c2 atom of isopulegol , in the liquid phase using a homeogeneously dissolved catalyst c , comprising at least one metal atom from group 8 , 9 or 10 , particularly 8 or 9 , of the periodic table ( iupac ). 2 . the method according to embodiment 1 , wherein the catalyst c has ruthenium or iridium as the central atom m . 3 . the method according to any of the previous embodiments , wherein the catalyst c comprises at least one phosphine ligand . 4 . the method according to embodiment 3 , wherein the catalyst c , in addition to having at least one phosphine ligand , has at least one further ligand l which is selected from the group consisting of co , hydrido , aliphatic olefins , cyclic olefins , carbocyclic aromatic systems , heteroaromatic systems , aldehydes , ketones , halides , c 1 - c 4 - alkanoate , methylsulfonate , methylsulfate , trifluoromethylsulfate , tosylate , mesylate , cyanide , isocyanate , cyanate , thiocyanate , hydroxide , c 1 - c 4 - alkoxide , cyclopentadienide , pentamethylcyclopentadienide and pentabenzylcyclopentadienide . non - limiting examples of aliphatic olefins are c 2 - c 4 - olefins , such as ethylene , propene , but - 1 - ene , but - 2 - ene , 2 - methylprop - 1 - ene , of cyclic olefins are cyclopropene , cyclobutene , cyclobutadiene , cyclopentadiene , cyclohexene , cyclohexadiene , cyclooctene , cyclooctadiene ; of carbocyclic aromatic compounds are benzene , naphthalene and anthracene , 1 - isopropyl - 4 - methylbenzene , hexamethylbenzene , of heteroaromatic compounds are pyridine , lutidine , picoline , pyrazine , of aldehydes are formaldehyde , acetaldehyde , propionaldehyde , butyraldehyde , isobutyraldehyde , valeraldehyde , isovaleraldhyde , benzaldehyde , of ketones are acetone , menthone , of halides are f , cl , br , i , of c 1 - c 4 - alkanoates are methanoate , ethanoate , n - propanoate and n - butanoate . 5 . the method according to any of the previous embodiments , where the catalyst c is selected from among the compounds : [ ru ( pr 3 ) 4 ( h ) 2 ] ( r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( pr 3 ) 3 ( h ) 2 ( co )] ( r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( pr 3 ) 3 ( h )( cl )( co )] ( r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( pr 3 ) 3 ( cl ) 2 ( co )] ( r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( pr 3 ) 3 ( cl ) 2 ] ( r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( l2 ) 2 ( h ) 2 ] ( l2 = 1 , 2 - bisdicyclohexylphosphinoethane , 1 , 2 - bisdiethylphosphinoethane , 1 , 2 - bisdiphenylphosphinoethane ), [ ru ( l2 )( pr 3 ) 2 ( h ) 2 ] ( l2 = 1 , 2 - bisdicyclohexylphosphinoethane , 1 , 2 - bisdiethylphosphinoethane , 1 , 2 - bisdiphenylphosphinoethane ; r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( l2 )( pr 3 )( co )( h ) 2 ] ( l2 = 1 , 2 - bisdicyclohexylphosphinoethane , 1 , 2 - bisdiethylphosphinoethane , 1 , 2 - bisdiphenylphosphinoethane ; r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( l2 )( pr 3 )( co )( h )( cl )] ( l2 = 1 , 2 - bisdicyclohexylphosphinoethane , 1 , 2 - bisdiethylphosphinoethane , 1 , 2 - bisdiphenylphosphinoethane ; r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( l3 )( h ) 2 ] ( l3 = triphos ), and [ ru ( l3 )( co )( h ) 2 ] ( l3 = triphos ), and [ ru ( l3 )( co )( h )( c )] ( l3 = triphos ) 6 . the method according to any of the previous claims , wherein the catalyst c is used in an amount of 1 to 5000 , 5 to 2000 or 10 to 1000 ppm parts by weight , based on 1 part by weight of isopulegol or of a mixture of one isopulegol with at least one different alcohol . 7 . the method according to any of the previous embodiments , wherein an isomer mixture of isopulegol is used as starting compound . 8 . the method according to any of the previous embodiments , wherein the product obtained is an isomer mixture of menthone . 9 . the method according to any of the previous embodiments , wherein the reaction is carried out without additional solvent . 10 . the method according to any of the preceding embodiments , wherein the reaction is carried out in the range from 100 to 250 ° c . 11 . a reaction product obtainable by a method according to any of the previous embodiments . 12 . the use of a reaction product according to embodiment 11 as a fragrance or flavouring . 13 . a composition comprising at least one reaction product according to embodiment 11 , wherein the composition is selected from foods , confectionery , chewing gum , beverages , cosmetics , toothpastes , mouth rinses , shampoos , toiletries , lotions , skincare products , medicaments and drugs . in the method according to the invention isopulegols and also mixtures of various isopulegols are used . thus , ( 1r , 2s , 5r )-(−)- isopulegol , ( 1r , 2s , 5r )-(−)- isopulegol , ( 1s , 2r , 5r )-(+)- isopulegol , ( 1s , 2r , 5s )-(+)- isopulegol , ( 1s , 2s , 5r )- 5 - methyl - 2 -( 1 - methylethenyl ) cyclohexanol or ( 1r , 2r , 5r )- 5 - methyl - 2 -( 1 - methylethenyl ) cyclohexanol or mixtures of these isopulegols are used as isopulegols . in the method according to the invention at least one catalyst complex is used which comprises at least one element selected from groups 8 , 9 and 10 of the periodic table ( according to iupac nomenclature ). the elements of group 8 , 9 and 10 of the periodic table comprise iron , cobalt , nickel , ruthenium , rhodium , palladium , osmium , iridium and platinum . preference is given to catalyst complexes which comprise at least one element selected from ruthenium and iridium . the active catalyst complex can be generated in its active form or else in situ from a simple metal precursor and a suitable ligand in the reaction mixture . suitable metal precursors are , for example , [ ru ( p - cymene ) cl 2 ] 2 , [ ru ( benzene ) cl 2 ] n , [ ru ( co ) 2 cl 2 ] n , [ ru ( co ) 3 cl 2 ] 2 , [ ru ( cod )( allyl )], [ rucl 3 * h 2 o ], [ ru ( acetylacetonate ) 3 ], [ ru ( dmso ) 4 cl 2 ], [ ru ( cyclopentadienyl )( co ) 2 cl ], [ ru ( cyclopentadienyl )( co ) 2 h ], [ ru ( cyclopentadienyl )( co ) 2 ] 2 , [ ru ( pentamethylcyclopentadienyl )( co ) 2 cl ], [ ru ( pentamethylcyclopentadienyl )( co ) 2 h ], [ ru ( pentamethylcyclopentadienyl )( co ) 2 ] 2 , [ ru ( indenyl )( co ) 2 c1 ], [ ru ( indenyl )( co ) 2 h ], [ ru ( indenyl )( co ) 2 ] 2 , ruthenocene , [ ru ( cod ) cl 2 ] 2 , [ ru ( pentamethylcyclopentadienyl )( cod ) cl ], [ ru 3 ( co ) 12 ], [ ircl 3 * h 2 o ], kircl 4 , k 3 ircl 6 , [ ir ( cod ) cl ] 2 , [ ir ( cyclooctene ) 2 cl ] 2 , [ ir ( ethene ) 2 cl ] 2 , [ ir ( cyclopentadienyl ) cl 2 ] 2 , [ ir ( pentamethylcyclopentadienyl ) cl 2 ] 2 and [ ir ( cyclopentadienyl )( co ) 2 ], [ ir ( pentamethylcyclopentadienyl )( co ) 2 ]. the catalyst complex preferably comprises as ligand a phosphine ligand with at least one unbranched or branched , acyclic or cyclic , aliphatic or aromatic residue comprising 1 to 12 carbon atoms , where individual carbon atoms may also be replaced by & gt ; p —. in terms of branched cyclic aliphatic residues , also included here are residues such as — ch 2 — c 6 h 11 , for example . suitable residues are , for example , methyl , ethyl , prop - 1 - yl , prop - 2 - yl , but - 1 - yl , but - 2 - yl , 2 - methylprop - 1 - yl , 2 - methylprop - 2 - yl , pent - 1 - yl , hex - 1 - yl , hept - 1 - yl , oct - 1 - yl , non - 1 - yl , dec - 1 - yl , undec - 1 - yl , dodec - 1 - yl , cyclopentyl , cyclohexyl , cycloheptyl and cyclooctyl , methylcyclopentyl , methylcyclohexyl , 2 - methylpent - 1 - yl , 2 - ethylhex - 1 - yl , 2 - propylhept - 1 - yl and norbonyl , phenyl , tolyl , mesityl and anisyl . the unbranched or branched , acyclic or cyclic , aliphatic or aromatic residue preferably comprises at least 1 and preferably a maximum of 10 carbon atoms . in the case of an exclusively cyclic residue in the abovementioned terms , the number of carbon atoms is 3 to 12 and preferably at least 4 and preferably a maximum of 8 carbon atoms . preference is given to ethyl , but - 1 - yl , sec - butyl , oct - 1 - yl and cyclohexyl , phenyl , tolyl , mesityl and anisyl residues . the phosphine group may comprise one , two or three of the abovementioned unbranched or branched , acyclic or cyclic , aliphatic or aromatic residues . these may be identical or different . the phosphine group preferably comprises three of the abovementioned unbranched or branched , acyclic or cyclic , aliphatic residues , with particular preference being given to all three residues being identical . preference is given to phosphines p ( n - c m h 2n + 1 ) 3 with m equal to 1 to 10 , particularly preferably tri - n - butylphosphine , tri - n - octylphosphine , triphenylphosphine , diphenylphosphinoethane , chiraphos , triphos and 1 , 2 - bis ( dicyclohexylphosphino ) ethane . as already mentioned above , individual carbon atoms may also be replaced by & gt ; p — in the said unbranched or branched , acyclic or cyclic , aliphatic residues . therefore , these also comprise polydentate , for example bi - or tridentate , phosphine ligands . these preferably comprise the if the phosphine group comprises still other residues than the abovementioned unbranched or branched , acyclic or cyclic , aliphatic residues , these generally correspond to those which are typically used elsewhere in phosphine ligands for organometallic catalyst complexes . examples include phenyl , tolyl and xylyl . the organometallic complex may comprise one or more , for example , two , three or four , of the abovementioned phosphine groups with at least one unbranched or branched , acyclic or cyclic , aliphatic or aromatic residue . the catalyst complex may comprise still other residues , which could be unchanged ligands such as co , olefins , cyclic olefins , dienes , cyclodienes , aromatic systems , aldehydes , ketones and anionic ligands such as fluoride , chloride , bromide , iodide , hydride , formate , acetate , propionate , butyrate , methylsulfonate , methylsulfate , trifluoromethylsulfate , tosylate , mesylate , cyanide , isocyanate , thiocyanate , hydroxide , alkoxide , cyclopentadienide , pentamethylcyclopentadienide and pentabenzylcyclopentadienide . [ ru ( pr 3 ) 4 ( h ) 2 ] ( r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( pr 3 ) 3 ( h ) 2 ( co )] ( r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( pr 3 ) 3 ( h )( cl )( co )] ( r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( pr 3 ) 3 ( cl ) 2 ( co )] ( r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( pr 3 ) 3 ( cl ) 2 ] ( r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( l2 ) 2 ( h ) 2 ] ( l2 = 1 , 2 - bisdicyclohexylphosphinoethane , 1 , 2 - bisdiethylphosphinoethane , 1 , 2 - bisdiphenylphosphinoethane ), [ ru ( l2 )( pr 3 ) 2 ( h ) 2 ] ( l2 = 1 , 2 - bisdicyclohexylphosphinoethane , 1 , 2 - bisdiethylphosphinoethane , 1 , 2 - bisdiphenylphosphinoethane ; r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( l2 )( pr 3 )( co )( h ) 2 ] ( l2 = 1 , 2 - bisdicyclohexylphosphinoethane , 1 , 2 - bisdiethylphosphinoethane , 1 , 2 - bisdiphenylphosphinoethane ; r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( l2 )( pr 3 )( co )( h )( cl )] ( l2 = 1 , 2 - bisdicyclohexylphosphinoethane , 1 , 2 - bisdiethylphosphinoethane , 1 , 2 - bisdiphenylphosphinoethane ; r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( l3 )( h ) 2 ] ( l3 = triphos ), [ ru ( l3 )( co )( h ) 2 ] ( l3 = triphos ), [ ru ( l3 )( co )( h )( c )] ( l3 = triphos ). it can also be advantageous to add a base to the reaction mixture . suitable bases are lioh , naoh , koh , lih , nah , kh , ca ( oh ) 2 , cah 2 , lialh 4 , nabh 4 , libh 4 , na 2 co 3 , nahco 3 , li 2 co 3 , lihco 3 , k 2 co 3 , khco 3 , k 3 po 4 , na 3 po 4 , buli , meli , phli , tbuli , liome , lioet , liopr , lioipr , liobu , lioibu , liopent , lioipent , liohex , liohept , liooct , liobenz , lioph , kome , koet , kopr , koipr , kobu , koibu , kopent , koipent , kohex , kohept , kooct , kobenz , koph , naome , naoet , naopr , naoipr , naobu , naoibu , naopent , naoipent , naohex , naohept , naooct , naobenz , naoph , kn ( sime 3 ) 2 , lin ( sime 3 ) 3 , nan ( sime 3 ) 3 , nh 3 , rnh 2 ( where r 1 = unsubstituted or at least monosubstituted c 1 - c 10 - alkyl , h , (— c 1 - c 4 - alkyl - p ( phenyl ) 2 ), c 3 - c 10 - cycloalkyl , c 3 - c 10 - heterocyclyl comprising at least one heteroatom selected from n , o and s , c 5 - c 14 - aryl or c 5 - c 10 - heteroaryl comprising at least one heteroatom selected from n , o and s ), r 1 r 2 nh ( where r 1 , r 2 independently of each other are unsubstituted or at least monosubstituted c 1 - c 10 - alkyl , h , (— c 1 - c 4 - alkyl - p ( phenyl ) 2 ), c 3 - c 10 - cycloalkyl , c 3 - c 10 - heterocyclyl comprising at least one heteroatom selected from n , o and s , c 5 - c 14 - aryl or c 5 - c 10 - heteroaryl comprising at least one heteroatom selected from n , o and s ), r 1 r 2 r 3 n ( where r 1 , r 2 , r 3 independently of each other are unsubstituted or at least monosubstituted c 1 - c 10 - alkyl , h , (— c 1 - c 4 - alkyl - p ( phenyl ) 2 ), c 3 - c 10 - cycloalkyl , c 3 - c 10 - heterocyclyl comprising at least one heteroatom selected from n , o and s , c 5 - c 14 - aryl or c 5 - c 10 - heteroaryl comprising at least one heteroatom selected from n , o and s ). menthone is formed from isopulegol by the dehydrogenation of the hydroxy group to a carbonyl function with hydrogenation of the c — c double bond of the substrate . here a pure isomer of isopulegol and also an isomer mixture may be used . the menthone obtained from the reaction is a pure isomer or else is obtained as a mixture of isomers . the reaction is carried out preferably with (−)- isopulegol , in which case (−)- menthone and (+)- isomenthon are formed as the main product . in the context of the present invention , “ homogeneously catalysed ” is understood to mean that the catalytically active part of the catalyst complex is at least partly present dissolved in the liquid reaction medium . in a preferred embodiment , at least 90 % of the catalyst complex used in the method is present dissolved in the liquid reaction medium , more preferably at least 95 %, particularly preferably more than 99 %, and most preferably the catalyst complex is present completely dissolved ( 100 %) in the liquid reaction medium , based in each case on the total amount in the liquid reaction medium . the amount of the metal component in the catalyst , preferably ruthenium , is generally 0 . 1 to 5000 ppm by weight , based respectively on the total liquid reaction mixture in the reaction space . the reaction takes place in the liquid phase at a temperature of generally 20 to 250 ° c . the method according to the invention is preferably conducted at temperatures in the range from 100 ° c . to 200 ° c ., particularly preferably in the range from 100 to 180 ° c . the reaction is generally conducted at a total pressure of 0 . 1 to 20 mpa absolute , which can be either the autogenous pressure of the solvent or of the substrate at the reaction temperature or else the pressure of a gas such as nitrogen , argon or hydrogen . the method according to the invention is preferably conducted up to a total pressure of 10 mpa absolute , particularly preferably up to a total pressure of 1 mpa absolute . in the method according to the invention , the reaction may be conducted either with an additional solvent or without solvent addition . suitable solvents are , for example , aliphatic and aromatic hydrocarbons , aliphatic and aromatic ethers , cyclic ethers or esters . examples include , but are not limited to , solvents such as pentane , hexane , heptane , octane , nonane , decane , benzene , toluene , xylenes , mesitylene , anisole , dibutyl ether , diphenyl ether , dimethoxyethane , tetrahydrofuran , methyltetrahydrofuran , dioxane , ethyl acetate , butyl acetate or butyl butyrate . if the reaction is conducted without additional solvent , then the product also does not have to be separated from it , which simplifies the workup . in the embodiment without solvent , the reaction takes place in the reactants and in the product formed in the reaction . for the reaction in the liquid phase , at least one isopulegol and optionally the solvent , the metal catalyst or a suitable metal precursor , and the ligands , optionally with added base , are placed into a reaction space . the reaction may be conducted with the conventional apparatus and reactors for liquid - gas reactions known to a person skilled in the art , in which the catalyst is present dissolved homogeneously in the liquid phase . in principle , all reactors may be used in the method according to the invention which are basically suitable for gas - liquid reactions at the given temperature and the given pressure . suitable standard reactors for gas - liquid and for liquid - liquid reaction systems are given , for example , in k . d . henkel , “ reactor types and their industrial applications ”, in ullmann &# 39 ; s encyclopedia of industrial chemistry , 2005 , wiley - vch verlag gmbh & amp ; co . kgaa , doi : 10 . 1002 / 14356007 . b04 — 087 , chapter 3 . 3 “ reactors for gas - liquid reactions ”. examples include stirred tank reactors , tubular reactors or bubble column reactors . the input of isopulegol and optionally the solvent , the metal catalyst or a suitable metal precursor and the ligands , optionally with an additional base , can take place simultaneously or separately from one another . the reaction may be conducted in a discontinuous batch mode , or continuously or semi - continuously with recycling or without recycling . the mean residence time in the reaction space is generally 15 minutes to 100 hours . after the reaction , the product is separated , preferably by distillation , from unreacted reactants and optionally the solvent . the catalyst remains behind with the high boilers in the distillation bottoms and may be re - used . unreacted alcohol reactant may likewise be recycled back into the reaction . the thermal separation of the alcohol and of the ester takes place according to the prior art methods known to a person skilled in the art , preferably in an evaporator or in a distillation unit , comprising evaporator and column ( s ), which typically has trays , a structured packing or a random packing . the separation of the product may also take place by crystallization , extraction or absorption , although workup by distillation is preferred . unreacted reactant and the metal catalyst are preferably re - used in the reaction to facilitate a highly economical process . the invention is illustrated by , without being restricted to , the following examples : the gas chromatographic determinations are carried out as follows : the gc determination of the yields was carried out with an agilent system with a vf - 23 ms column ( 60 m , 0 . 25 mm , 0 . 25 μm ), helium as carrier gas and a flame ionization detector . the injector temperature was 250 ° c . ; the column temperature was increased during the measurement from 50 ° c . to 150 ° c . with a heating rate of 3 ° c ./ min , and then to 260 ° c . at 20 ° c ./ min . “ inert conditions ”: the procedures were conducted with exclusion of air and oxygen . the initial weighing of the reactant , solvent and catalyst took place in a glovebox , which is operated with purified nitrogen . the procedures outside the glovebox took place using standard schlenk techniques and argon as inert gas . yields : in the rearrangement of isopulegol to menthone , menthol and isopulegone occur as intermediates . with a longer reaction time or by recycling these intermediates , these can be further reacted to menthone , and thus do not constitute any loss of isopulegol with respect to the synthesis of menthone ( see illustrative reaction course in the graph shown in fig1 with respect to these components ). these secondary components are explicitly mentioned in the yields and selectivity for this reason . under inert conditions , 202 mg of [ ru ( pnoct 3 ) 4 ( h ) 2 ], 1 . 8 g of isopulegol and 10 ml of o - xylene ( anhydrous ) are weighed out in a glovebox into a 50 ml two - necked flask . the reaction mixture is then stirred at normal pressure for 12 hours under reflux cooling at an oil bath temperature of 133 ° c . after the reaction , the conversion and the yield of menthone ( sum of isomers ) is determined by gas chromatography ( area %). the conversion of isopulegol is 60 . 5 % with a selectivity for menthone ( isomer mixture of 66 . 2 % (−)- menthone , 33 . 8 % (+)- isomenthone ) of 47 . 3 %. selectivity for the secondary components : menthol 31 . 6 %, isopulegone 14 . 9 %, total selectivity ( menthone + menthol + isopulegone ) 93 . 8 %. under inert conditions , 116 mg of [ ru ( pnbu 3 ) 4 ( h ) 2 ], 54 mg of 1 , 2 - bis ( dicyclohexylphosphino ) ethane , 1 . 8 g of isopulegol and 10 ml of o - xylene ( anhydrous ) are weighed out in a glovebox into a 50 ml two - necked flask . the reaction mixture is then stirred at normal pressure for 12 hours under reflux cooling at an oil bath temperature of 133 ° c . after the reaction , the conversion and the yield of menthone ( sum of isomers ) is determined by gas chromatography ( area %). the conversion of isopulegol is 62 . 9 % with a selectivity for menthone ( isomer mixture of 61 . 7 % (−)- menthone , 38 . 3 % (+)- isomenthone ) of 31 . 9 %. selectivity for the secondary components : menthol 27 . 7 %, isopulegone 15 . 5 %, total selectivity ( menthone + menthol + isopulegone ) 75 . 1 %. under inert conditions , 116 mg of [ ru ( pnet 3 ) 4 ( h ) 2 ], 1 . 8 g of isopulegol and 10 ml of o - xylene ( anhydrous ) are weighed out in a glovebox into a 50 ml two - necked flask . the reaction mixture is then stirred at normal pressure for 12 hours under reflux cooling at an oil bath temperature of 133 ° c . after the reaction , the conversion and the yield of menthone ( sum of isomers ) is determined by gas chromatography ( area %). the conversion of isopulegol is 64 . 2 % with a selectivity for menthone ( isomer mixture of 70 . 0 % (−)- menthone , 33 . 0 % (+)- isomenthone ) of 45 . 2 %. selectivity for the secondary components : menthol 30 . 8 %, isopulegone 20 . 2 %, total selectivity ( menthone + menthol + isopulegone ) 96 . 2 %. under inert conditions , 404 mg of [ ru ( pnoct 3 ) 4 ( h ) 2 ], 3 . 6 g of isopulegol and 10 ml of o - xylene ( anhydrous ) are weighed out in a glovebox into a 50 ml glass autoclave . the reaction mixture is then stirred under autogenous pressure ( 0 . 5 bar positive pressure ) for 12 hours at an oil bath temperature of 130 ° c . after the reaction , the conversion and the yield of menthone ( sum of isomers ) is determined by gas chromatography ( area %). the conversion of isopulegol is 64 . 5 % with a selectivity for menthone ( isomer mixture of 65 . 8 % (−)- menthone , 34 . 2 % (+)- isomenthone ) of 46 . 3 %. selectivity for the secondary components : menthol 30 . 2 %, isopulegone 14 . 4 %, total selectivity ( menthone + menthol + isopulegone ) 90 . 9 %. under inert conditions , 404 mg of [ ru ( pnoct 3 ) 4 ( h ) 2 ], 3 . 6 g of isopulegol and 20 ml of o - xylene ( anhydrous ) are weighed out in a glovebox into a 50 ml glass autoclave . the reaction mixture is then stirred under autogenous pressure for 12 hours at an oil bath temperature of 150 ° c . after the reaction , the conversion and the yield of menthone ( sum of isomers ) is determined by gas chromatography ( area %). the conversion of isopulegol is 92 . 4 % with a selectivity for menthone ( isomer mixture of 65 . 6 % (−)- menthone , 34 . 4 % (+)- isomenthone ) of 51 . 1 %. selectivity for the secondary components : menthol 15 . 4 %, isopulegone 10 . 9 %, total selectivity ( menthone + menthol + isopulegone ) 77 . 4 %. under inert conditions , 460 mg of [ ru ( pnoct 3 ) 4 ( h ) 2 ], 8 . 6 g of isopulegol and 20 ml of o - xylene ( anhydrous ) are weighed out in a glovebox into a 50 ml glass autoclave . the reaction mixture is then stirred under autogenous pressure for 12 hours at an oil bath temperature of 170 ° c . after the reaction , the conversion and the yield of menthone ( sum of isomers ) is determined by gas chromatography ( area %). the conversion of isopulegol is 98 . 2 % with a selectivity for menthone ( isomer mixture of 65 . 4 % (−)- menthone , 34 . 6 % (+)- isomenthone ) of 89 . 6 %. selectivity for the secondary components : menthol 3 . 6 %, isopulegone 0 . 3 %, total selectivity ( menthone + menthol + isopulegone ) 93 . 5 %. under inert conditions , 300 mg of [ ru ( pnoct 3 ) 4 ( h ) 2 ] and 21 . 0 g of isopulegol are weighed out in a glovebox into a 50 ml glass autoclave . the reaction mixture is then stirred under autogenous pressure for 100 hours at an oil bath temperature of 170 ° c . after the reaction , the conversion and the yield of menthone ( sum of isomers ) is determined by gas chromatography ( area %). the conversion of isopulegol is 99 . 3 % with a selectivity for menthone ( isomer mixture of 64 . 3 % (−)- menthone , 35 . 7 % (+)- isomenthone ) of 86 . 4 %. selectivity for the secondary components : menthol 1 . 4 %, isopulegone 4 . 9 %, total selectivity ( menthone + menthol + isopulegone ) 92 . 7 %. under inert conditions , 610 mg of [ ru ( pnoct 3 ) 4 ( h ) 2 ] and 20 . 15 g of isopulegol are weighed out in a glovebox into a 100 ml glass flask . the reaction mixture is then stirred under reflux for 24 hours at an oil bath temperature of 170 ° c . after the reaction , the conversion and the yield of menthone ( sum of isomers ) is determined by gas chromatography ( area %). the conversion of isopulegol is 97 . 5 % at a selectivity for menthone ( isomer mixture of 63 . 1 % (−)- menthone , 36 . 9 % (+)- isomenthone ) of 84 . 0 %. selectivity for the secondary components : menthol 5 . 1 %, isopulegone 4 . 5 %, total selectivity ( menthone + menthol + isopulegone ) 93 . 7 %. under inert conditions , 610 mg of [ ru ( pnoct 3 ) 4 ( h ) 2 ] and 20 . 7 g of isopulegol are weighed out in a glovebox into a 100 ml glass flask . the reaction mixture is then stirred under reflux for 24 hours at an oil bath temperature of 180 ° c . after the reaction , the conversion and the yield of menthone ( sum of isomers ) is determined by gas chromatography ( area %). the conversion of isopulegol is 98 . 5 % at a selectivity for menthone ( isomer mixture of 63 . 0 % (−)- menthone , 37 . 0 % (+)- isomenthone ) of 88 . 7 %. selectivity for the secondary components : menthol 2 . 9 %, isopulegone 2 . 7 %, total selectivity ( menthone + menthol + isopulegone ) 94 . 3 %. the disclosure of the publications cited herein is expressly incorporated by way of reference .	2
the compositions of the present invention provide support for and promote strong immune systems . in a preferred embodiment , the compositions of the present invention are provided in a chewable delivery system and feature a targeted array of nutrients for building and nurturing immune health , especially when stress tends to bear down on the immune system . the preferred chewable delivery system of the compositions of the present invention optimizes the first - line defenses of the mucosal immune system . the oral cavity is the gate of entry to the immune system . the oral cavity mucus membrane cell receptors are activated by immunoreactive ingredients and communicate with the lymphatics , where activated lymphocytes spread signals to the blood and other tissues . the oral cavity epithelial cells and gi tract cells are sites for systemic absorption of smaller sized immunoreactive ingredients . also , immunoreactive ingredients react directly with bacteria , viruses , and fungi in the oral cavity and esophagus . those of ordinary skill in the art will recognize that supporting the mucus membranes that line the mouth , nose , lungs and digestive tract is beneficial since the majority of harmful invaders of the body must pass through these defenses . these membranes comprise the largest barrier in the body and form the first line of defense . when the mucosal immune response is triggered , it makes natural antibodies that “ arm ” saliva , tears , bronchial and nasal secretions , as well as fluids in the digestive tract , turning them into the body &# 39 ; s own powerful , natural antimicrobial wash . the preferred chewable delivery system enhances the ability of the nutrients in the compositions of the present invention to immediately react with mucus membranes in the mouth and esophagus to energize the immune system and begin the fight against bacteria . in addition , the uptake and immune system activities of nutrients from the compositions of the present invention begin in the mouth as they are chewed and continue in a cascade of immune responses throughout the immune system . the components of the compositions of the present invention bind to specific receptor sites that send signals directly to the lymphatic system — the roadway for the approximately trillion circulating white blood cells on patrol against invaders . the nutrient forces in the compositions of the present invention spread throughout the gastrointestinal ( gi ) tract where they facilitate normal cell proliferation , growth of beneficial gi bacteria , and discourage growth of bad bacteria . those of ordinary skill in the art will recognize that the lymphatic tissue in the gi tract is one of the major subdivisions of the immune system . everyday stress such as work , traffic , and taking care of a family can accelerate the body &# 39 ; s use of nutrients . a poor diet and sleep deprivation place additional demands on and challenge the immune system . the job of the immune system is to recognize and eliminate foreign particles and organisms and maintain balance in every part of the body . with the right nourishment , the immune system performs these functions quite admirably . under stress , however , the immune system has to work harder . because stress acts as a drain on nutrients , more nutritional support is needed for the immune system during periods of stress . also , if the immune system is unbalanced , it needs more nutritional power to assist in its efforts to compensate and achieve balance . when the immune defenses are weakened and unprepared , unwanted viruses work around system failures , microbes make themselves at home and toxins take hold . emotional stress is a silent threat to good health . while the signs of emotional stress may be recognized , one often fails to acknowledge the burden it places on the body . in addition , even when one knows they are physically stressed , whether from work or a workout , one often thinks that all that is needed is rest . but that may not be all the immune system needs to bounce back . in addition , one may fail to recognize the environmental stress the body incurs that can make the immune system work harder , or the dietary stress caused by making poor food choices . to help combat environmental stress the compositions of the present invention support the body &# 39 ; s ability to conduct cellular “ house cleaning ” by helping to remove heavy metals , toxins and damaged cellular material from cells . to help the body handle physical stress , the compositions of the present invention include peptides , amino acids and glycoproteins that engage the body &# 39 ; s natural ability to heal and repair itself . the components of the compositions of the present invention help trigger a cascade of immune signaling mechanisms . this is especially important when stress factors work against the immune system . glyconutrients help carry these immune signals to other cells . according to a preferred embodiment , the compositions of the present invention are combined with a complex of essential saccharides such as the dietary supplement sold by mannatech inc . of coppell , texas under the trade name “ ambrotose ®” the ambrotose ® product is preferably produced according to the methods and procedures set forth in international patent application publication number wo 98 / 06418 , the entire disclosure of which is hereby incorporated by reference herein . the combination of the compositions of the present invention and ambrotose ® complex provide a synergistic array of proteins , peptides , polypeptides , and glyco - proteins - nutrients that can help to achieve optimal health through an appropriately immunomodulated immune system . the compositions of the present invention preferably include ingredients that promote the production of new blood cells , cartilage formation and bone growth . the compositions of the present invention enhance muscle protein synthesis and insulin - like growth factor release in tissues . the compositions of the present invention also assist the body in regulating muscle protein breakdown and bio - regulation during stress . the present invention encompasses compositions , dietary supplements and methods for their use that include the following active components : ( a ) prime colostrum has the highest concentrations of immunoglobulins , interferons , proline - rich peptides , amino acids and vital enzymes produced by mammary tissue , being higher than those produced in ordinary colostrum . this provides the newborn with protection against viruses and bacteria and other health threats . besides providing the first complete food for the newborn , prime colostrum has such profound immuno - stimulating properties that administration of very small amounts activates the human immune system . in addition to this immune stimulation capability , prime colostrum provides immunoglobulins directly ( e . g . iga , igg , igm ) and also growth factors ( e . g . igf - i , tgf a and b ). it supplies immunomodulatory proline - rich peptides which moderate the activity of the immune system through their effect upon the thymus gland , stimulating under - active immune systems such as those of immuno - compromised persons , or moderating those that are over - active as in individuals with auto - immune diseases . prime colostrum slows muscle breakdown , improves protein synthesis and utilization , provides digestive enzymes , regulates blood sugar and stimulates growth and repair . in sum , prime colostrum contains powerful healing , growth and repair factors that activate numerous immune , healing , growth and repair systems and assist in synthesis , retention and repair of muscle , bone , nerve and cartilage . as the body ages , becomes weakened by illness , or is subjected to physical stresses , it produces less and less of the factors that are needed to overcome metabolic insults or infection and to heal quickly . see canadian patent application no . 2 , 279 , 791 , the entire disclosure of which is hereby incorporated herein by reference . ( b ) lactoferrin is an iron binding protein that occurs naturally in the body . it is secreted in milk , tears and saliva , and is expressed by white blood cells . lactoferrin is well known in the art as a biological regulator that performs many important functions in the body . these functions include maintaining a healthy balance in the digestive tract , helping the immune system and promoting healthy cell growth . dairy cattle provide a cost - effective source of lactoferrin for inclusion into a dietary supplement . lactoferrin from cows &# 39 ; milk can be prepared free of lactose . lactoferrin bioregulates iron , boosts the immune system , balances the digestive tract , increases energy and stamina , and promotes cell growth and healing . these broad , beneficial properties are surprising in view of the inability of bovine lactoferrin to bind to the lactoferrin receptors at the surface of the mucosal cells of human small intestine . ( c ) citrus pectin is a preferred component that endows the composition with additional benefits as a nutritional supplement . citrus pectin is a protein that contains galactose molecules on its surface which are able to bind lectins involved in the transmission within the body of certain types of cancer . ( d ) citric acid is a preferred component that may be incorporated to promote salivation and to adjust the acidity of the composition in order that solubility , activity and absorption of the components within the oral cavity is enhanced . ( e ) the β - glucan incorporated in the compositions of the present invention is disclosed in u . s . pat . nos . 5 , 223 , 491 , 5 , 397 , 773 , 5 , 519 , 009 , 5 , 576 , 015 , 5 , 702 , 719 , 5 , 705 , 184 , the entire disclosures of which are hereby incorporated herein by reference . glucans are polymers of glucose . such glucans may be derived from the cell walls of yeast . glucan extracted from yeast is a potent stimulator of the immune system . iron is a key mineral required by all microorganisms for maintenance and growth . excess iron in the intestines promotes pathogen growth and proliferation . lactoferrin from cows &# 39 ; milk is partially saturated with iron ( approximately 25 % of total saturation ) providing a dietary source of iron as well as a means of scavenging free iron from the oral cavity and digestive tract . lactoferrin works on contact to starve pathogens of iron so that the correct balance of beneficial bacteria develops and is maintained in the digestive tract . the growth of harmful bacteria that are poorly adapted to these conditions is inhibited . by sequestering iron and delivering it for use by the cells of the body &# 39 ; s internal tissues , lactoferrin improves digestion and boosts the body &# 39 ; s natural defense mechanisms . this generates more energy and increased stamina for physical activities and optimum health . lactoferrin and prime colostrum achieve their optimal effects when dissolved slowly in the mouth , rather than being swallowed directly in the form of a pill or capsule . slowly dissolving the lactoferrin and constituents of colostrum in the mouth permits their absorption into the capillaries at the surface of the oral cavity &# 39 ; s lining , which is able to occur before the lactoferrin and prime colostrum are exposed to the harsh degradatory conditions of the stomach and intestines . for example , bovine lactoferrin is less resistant to degradation in the human digestive tract than is human lactoferrin , and the lactoferrin receptors in the small intestine of humans will not bind bovine lactoferrin . thus administration of bovine lactoferrin to humans in a mucosal delivery format , such as a format that enables its absorption through the lining of the mouth , is particularly efficacious . immunoglobulins from colostrum also pass directly into the blood through the inner mucosal layer of the mouth . orally delivered prime colostrum stimulates the body to replace growth , healing and repair factors as needed and produce them naturally to achieve homeostasis . oral administration of citrus pectin has been shown to be effective for inhibiting spontaneous metastasis of a rat prostate cancer . chewable tablets , in contrast to pills or capsules , provide a ‘ mucosal delivery format ’ ( mdf ) for constituents which can be absorbed through the oral mucosal surface , such as the colostrum , lactoferrin or citrus pectin of the compositions of the present invention . in particular , the chewable tablets of the present invention are able to enhance the benefits associated with absorption of appropriate constituents through the oral epithelial mucosa and into the underlying lymphatic system , for they are designed to be chewed in the mouth ; such tablets are therefore a preferred mdf . the compositions of the present invention provide a nutritional and dietary supplement for immune support that features a chewable formula containing : colostrum , lactoferrin , 1 - 3 / 1 - 6 glucan ; and citrus pectin . the individual components of the composition may be obtained from commercial sources : colostrum ( which is dehydrated by standard spray - drying procedures known in the art ) from any processing facility approved by the united states food and drug authority ( fda ) such as immuno - dynamics , inc . of perry , iowa under the trade name “ prime colostrum ®”; lactoferrin from approved manufacturers such as dmv international nutritionals of frazier , n . y . ; the 1 - 3 / 1 - 6 glucan is commercially available from biopolymer engineering , inc . under the tradename “ beta right ™,” citrus pectin from approved distributors or manufacturers such as g . c . i . of los angeles , calif . ; flavors from approved distributors or manufacturers such as allen flavors , inc . of edison , n . j . manufacturing of the composition , the dietary supplement , and the oral dosage forms may each be performed using standard techniques well known to those of ordinary skill in the art which are appropriate for the food or pharmaceutical industries , such as at any fda approved facility . energizes a cascade of immune responses that begin in the mouth and proceed throughout the body . optimizes response of natural killer cells , b - cells and t - cells which seek out and destroy foreign substances . reacts with the specific cell receptors that cause the cells to engulf and destroy bacteria and cellular debris . initiates communication in the immune system which releases chemical messengers to fight infection and disease . binds iron so that it starves bad bacteria throughout the body — re - routing it to become more bio - available for beneficial uses . contains proteins that are combined with saccharides to make glycoproteins for hormones and enzymes used in immune regulation . table 1 below lists some of the biological activities of various components of the compositions of the present invention . preferred embodiments of the invention include compositions and dietary supplements , as described above , prepared in a ‘ mucosal delivery format .’ a particularly preferred embodiment is an oral dosage form that promotes absorption of the dietary supplement &# 39 ; s components through the epithelial lining of the oral cavity . examples of oral dosage forms that promote absorption of the dietary supplement &# 39 ; s components within the oral cavity are those that either encourage retention of the dose within the oral cavity for an extended period , or discourage swallowing of the dose . such exemplary oral dosage forms include those that are chewable , are appropriate for sucking , and / or encourage salivation , for example , lozenges , particularly chewable lozenges , chewable tablets and chewable gums . the addition of natural or artificial flavouring also encourages retention of the dosage form within the mouth , particularly with children , so that there is greater transfer of the active components through the lining of the oral cavity and into the bloodstream and / or the lymphatic system . such active components include the constituents of colostrum and the lactoferrin , as described above . the physical size and consistency of the dosage form may also be adapted to prevent premature swallowing of the delivered dose . a preferred period for which the dose should remain in the mouth for effective absorption is 30 seconds to 10 minutes , with better effects being observed at the longer retention times . larger chewable forms are appropriate for animals that would otherwise be likely to swallow such foodstuff with little mastication . further preferred embodiments are methods for promoting those beneficial effects in mammals described above , in which such oral dosage forms of these compositions and dietary supplements are administered . exemplary formulations for the dietary supplement of the present invention are described in the following examples . weight percentages indicated for each ingredient are percentages of the total weight of the end product . in a preferred embodiment of the present invention , the composition comprises the following ingredients cold pressed into a chewable lozenge of hardness 14 to 44 kp that is taken as a nutritional supplement one to five times per day : 150 mg to 200 mg bovine prime colostrum ( which is about 5 to about 40 weight percent ), 10 mg to 20 mg bovine lactoferrin ( which is about 0 . 333 to about 4 weight percent ), 5 mg modified citrus pectin ( which is about 0 . 167 to about 1 weight percent ), 1295 mg to 1945 mg dextrose ( which is about 43 . 2 to about 64 . 8 weight percent ), 7 . 5 mg to 12 . 0 mg citric acid ( which is about 0 . 25 to about 2 . 4 weight percent ), 4 . 5 to 15 . 0 mg natural and / or artificial flavour ( which is about 0 . 15 to about 0 . 5 weight percent ), 7 . 5 mg silicon dioxide ( which is about 0 . 25 to about 1 . 5 weight percent ), and 7 . 5 mg magnesium stearate and dextrose ( which is about 0 . 25 to about 1 . 5 weight percent ), to a total weight of 0 . 5 to 3 . 0 grams . the lozenge is chewed for 30 seconds to ten minutes to maximize absorption of the active ingredients through the lining of the oral cavity and their absorption into the blood and lymphatic system . in a preferred embodiment of the invention , each of the following ingredients is placed , in powdered form , into a commercial mixer : 150 parts bovine prime colostrum , ( about 10 weight percent ), 10 parts bovine lactoferrin ( about 0 . 667 weight percent ), 5 parts modified citrus pectin ( about 0 . 333 weight percent ), 1297 . 5 parts dextrose ( about 86 . 5 weight percent ), 7 . 5 parts citric acid ( about 0 . 5 weight percent ), 15 parts natural strawberry flavor ( about 1 . 0 weight percent ), 7 . 5 parts silicon dioxide ( about 0 . 5 weight percent ) and 7 . 5 parts magnesium stearate ( about 0 . 5 weight percent ). if necessary , the materials are passed through a # 10 - 12 mesh screen to remove aggregates . each of the procedures should be performed with precautions against exposure to the powders and dusts that are formed , and particularly against their inhalation . after 20 minutes of thorough mixing , cold pressing the composition in a tablet press set at a maximum pressure of 6 . 4 tons yields lozenges of weight 1500 mg and hardness 34 to 36 kp . in another preferred embodiment of the invention , each of the following ingredients is placed , in powdered form , into a commercial mixer following the same procedure as for example 2 : 200 parts ( about 9 . 09 weight percent ) bovine prime colostrum , 20 parts ( about 0 . 909 weight percent ) bovine lactoferrin , 5 parts ( about 0 . 227 weight percent ) modified citrus pectin , 1943 . 5 parts ( about 88 . 3 weight percent ) dextrose , 12 parts ( about 0 . 545 weight percent ) citric acid , 3 parts ( about 0 . 136 weight percent ) natural strawberry flavor , 1 . 5 parts artificial flavor ( e . g . vanilla , chocolate ) ( about 0 . 068 weight percent ), 7 . 5 parts ( about 0 . 341 weight percent ) silicon dioxide and 7 . 5 parts ( about 0 . 341 weight percent ) magnesium stearate . after mixing and cold pressing as in example 2 , lozenges of weight 2200 mg were formed which demonstrated a hardness of 34 to 36 kp . each of the following ingredients is placed , in powdered form , into a commercial mixer following the same procedure as for example 2 : 200 parts ( about 33 . 3 to about 50 weight percent ) bovine prime colostrum , 20 parts ( about 3 . 33 to about 5 . 0 weight percent ) bovine lactoferrin , 5 parts ( about 0 . 833 to about 1 . 25 weight percent ) modified citrus pectin , approximately 215 parts ( about 35 . 8 to about 53 . 8 weight percent ) dextrose and / or maltodextrin , approximately 10 parts stearic acid as binder ( about 1 . 67 to about 2 . 5 weight percent ). after mixing and cold pressing as in example 2 , lozenges of total weight 400 mg to 600 mg were formed . in another preferred embodiment , the invention comprises a composition in which the lactoferrin is present at a concentration of from about 10 mg to about 100 mg per 1500 mg total weight ( which is about 0 . 667 to about 6 . 67 % total weight ) and colostrum , present at a concentration of from about 125 mg to about 1250 mg per 1500 mg total weight ( which is about 8 . 33 % to about 83 . 3 % total weight ). in such a preferred embodiment , a 1500 mg dose is typically provided from one to about five times per day . supplementary doses may be warranted under particular nutritional or physiological conditions . additional preferred embodiments include such compositions for use as a dietary supplement that additionally comprise modified citrus pectin at a concentration of from about 1 . 5 mg to about 15 mg per dose ( which is about 0 . 100 to about 1 . 00 % total weight ). generally , the effective amount of glucan in a dietary composition prepared according to the present invention will preferably range from about 0 . 001 w / w % to about 10 w / w % of the composition , more preferably from about 0 . 1 w / w % to about 4 w / w %. an exemplary formulation for the dietary supplement of the present invention comprising β - glucan is as follows : a preferred embodiment of the dietary supplement of the present invention comprising β - glucan is as follows : mg / tablet ingredient weight % 9 . 7500 citric acid 0 . 626 1297 . 0000 dextrose 83 . 300 7 . 5000 magnesium stearate 0 . 482 7 . 5000 silicon dioxide 0 . 482 30 . 0000 stearic acid 1 . 930 5 . 0000 citrus pectin 0 . 321 10 . 0000 lactoferrin 0 . 642 20 . 4000 strawberry natural flavoring 1 . 310 150 . 0000 colostrum 9 . 630 20 . 0000 β - glucan 1 . 280 total : 1 , 557 . 1500 100 according to the foregoing examples , dietary supplements prepared according to the present invention comprise β - glucan in an amount from about 0 . 001 to about 10 weight percent , and one or more of colostrum , in an amount from about 5 to about 83 . 3 weight percent , lactoferrin , in an amount from about 0 . 909 to about 6 . 67 weight percent , and citrus pectin , in an amount from about 0 . 1 to about 1 . 25 weight percent . preferred embodiments further comprise citric acid , in an amount from about 0 . 25 to about 2 . 4 weight percent , dextrose , in an amount from about 35 . 8 to about 88 . 3 weight percent , magnesium stearate , in an amount from about 0 . 25 to about 1 . 5 weight percent , silicon dioxide , in an amount from about 0 . 25 to about 1 . 5 weight percent , stearic acid , in an amount from about 1 . 67 to about 2 . 5 weight percent , and a flavoring , in amount from about 0 . 15 to about 1 . 31 weight percent . following below is a certificate of analysis of the colostrum product sold by immuno - dynamics , inc . of perry , iowa : certificate of analysis lot # 555 first milking bovine colostrum powder protein ( n × 6 . 38 ) 53 . 4 % igg ( v . m . r . d ., pullman , wa ) 20 . 4 % = 38 . 2 % of protein total immunoglobulin 23 . 5 % = 44 . 0 % of protein igg ( bethyl labs , montgomery , tx 15 . 7 % fat 21 . 4 % lactose 9 . 5 % moisture 3 . 1 % total coliforms & lt ; 3 cfu / g presumptive salmonella neg ./ 25 g presumptive lead & lt ; 1 ppm nickel & lt ; 1 ppm arsenic & lt ; 0 . 4 ppm mercury & lt ; 0 . 20 ppm other typical analysis physical : color white / cream taste / odor creamy milk bulk density ( tapped ) 350 g / l solubility 200 g / l chemical : ph ( 10 % solution @ 20 c .) 6 . 4 ash 4 . 5 % microbiological : standard plate count & lt ; 3 , 000 cfu / g coliform count neg ./ 25 g e . coli neg ./ 25 g salmonella sp . neg ./ 25 g mold & amp ; yeast neg ./ 25 g mycobacterium bovis negative mycobacterium avis negative m . paratuberculosis negative storage : cool , dry area away from sunlight hazard data : food substance ; no known toxicities or overdoses special handling : none ; food substance ventilation : no special requirements those of ordinary skill in the art will recognize that the foregoing examples are exemplary of the dietary supplement compositions , and that the capsule size , specific amount of each ingredient , and the combination of ingredients can be varied as needed . the dietary supplement compositions of the present invention are preferably administered via the oral mucosal system . the above is a detailed description of particular embodiments of the invention . those of ordinary skill in the art should , in light of the present disclosure , appreciate that obvious modifications of the embodiments disclosed herein can be made without departing from the spirit and scope of the invention . all of the embodiments disclosed herein can be made and executed without undue experimentation in light of the present disclosure . the full scope of the invention is set out in the disclosure and equivalent embodiments thereof . the specification should not be construed to unduly narrow the full scope of protection to which the present invention is entitled . as used herein and unless otherwise indicated , the terms “ a ” and “ an ” are taken to mean “ one ”, “ at least one ” or “ one or more ”. the phrase “ substantially the same ” is taken to mean that a first amount , or property , is about 90 %- 110 %, preferably 95 %- 105 %, or more preferably 99 %- 101 %, of the value of a second amount , or property , respectively . the terms “ substantially ” or “ substantial ” are taken to mean a “ major portion ”, “ more than 50 %”, preferably “ more than 90 %”, or more preferably “ more than 95 %” of a particular amount or property .	0
the present embodiments are directed to an apparatus and method for protecting nails . in particularly useful embodiments , a nail protector is provided that covers a finger or toe nail and provides a stable cover over the nail to prevent contact with the nail . in one embodiment , the nail is protected from top and lateral contact , which is particularly helpful when the nail has been polished and has not yet dried . in one embodiment , the nail protection apparatus includes a flexible portion , which expands to receive a finger or toe and when restored holds the nail protection apparatus in place . the apparatus includes a cover or shield portion that extends over the nail , and a median ridge or raised area that supports that cover portion . the flexible portion includes a longitudinal extension portion that extends along the finger or toe to prevent the cover portion from rotating onto the nail . the present embodiments will illustratively be described in terms of protecting nails after a manicure or pedicure . however , the present invention is much broader and may be applicable as a nail or finger / toe protector for medical applications such as the loss of a nail due to an injury or due to an infection or other condition . referring now to the drawings in which like numerals represent the same or similar elements and initially to fig1 , a nail protector 100 is shown in accordance with one illustrative embodiment . nail protector 100 includes a cover portion 102 which is configured to cover a finger or toe nail of a user without contact to the nail itself . the cover portion 102 is permitted to cover the nail with a gap maintained between the nail and the cover portion 102 . this gap is maintained during use of the nail protector 100 as will be described in greater detail below . nail protector 100 includes two lateral supports 116 , which extend from the cover portion 102 . the lateral supports 116 are connected to the cover at portions 110 . portions 110 and surrounding areas are flexible to permit a gap 112 to be increased by permitting flexure in the direction of arrow “ a ”. to permit flexure of portion 110 and / or of side walls 106 , these portions may be formed from a flexible material . in some embodiments , the materials may include plastics , such as polyethylene , polycarbonate , rubber , etc ., metals , such as steel , brass , etc ., wood , or combinations thereof . the cross - sectional dimensions of side walls 106 may be configured to provide a restoring force to return the original gap size 112 . this assists in maintaining the nail protector 100 on a finger or toe of the user . side walls 106 may be tapered ( either larger or smaller ) as the distance from portions 110 increases . side walls 106 may also be of uniform thickness about the circumference of opening 114 . side walls 106 may follow any other variations in thickness as well to provide sufficient strength and restoring force to maintain gap 112 and secure the nail protector 100 on the user . nail protector 100 includes a ridge or extension portion 108 . the ridge 108 extends under the cover portion 102 nearer to the insertion point of a finger or toe in opening 114 . ridge 108 is configured to contact the skin of the finger or toe to provide support for the cover portion 102 and prevent contact of the cover portion 102 with the nail . in addition , nail protector 100 includes longitudinal extensions 104 which are configured to extend along the finger or toe of the user and prevent rotational motion of the cover portion 102 toward the nail . ridge 108 and longitudinal extensions 104 work together to provide support for the cover portion 102 and prevent rotational motion of the cover portion 102 toward the nail . lateral portions 116 prevent axial rotation of the cover portion 102 on the finger or toe , and employ a restoring force to prevent the nail protector 100 from slipping forward or backward along the finger or toe once the nail protector is in place . an insertion side of the nail protector 100 preferably includes radiused or rounded edges 120 to provide comfort for the wearer and ease application of the protector device . it should be understood that the present principles may be practiced with many different designs and configurations . the presently described embodiments are illustrative only and should not be construed as limiting . referring to fig2 , another view of the nail protector 100 of fig1 is illustratively depicted to show an underside of the nail protector 100 . the ridge 108 is shown extending over a sector of the perimeter of opening 114 below the cover portion 102 . ridge 108 includes generous transitions 204 to permit the nail protector 100 to be easily applied on a finger or toe , and for comfort . a top portion 206 of ridge 108 makes contact with the skin of a finger or toe . the internal upper portion of ridge 108 features a build up of material allowing for adequate nail clearance . ends 202 of lateral portion 116 are preferably rounded and provide sufficient material to extend below the finger or toe once positioned thereon . referring to fig3 , a further explanation of the functionality of the nail protector 100 will now be illustratively described using a cross - sectional view of nail protector 100 depicted on a finger 304 . if for example , a force f 1 is applied to the cover portion 102 , reaction forces f r1 and f r2 will maintain the cover portion 102 in its current position and prevent contact with a nail 302 of finger 304 . reaction force f r1 results from the longitudinal extensions 104 extending along finger 304 on an opposing side of the pivot point created by ridge 108 . reaction force f r2 is provided by contact with ridge 108 with finger 304 . as described previously , lateral portions 116 extend below finger 304 and provide support to generate reaction forces f r1 . nail protector 100 is therefore stable on the finger 304 , and prevents contact of the nail protector or other objects with nail 302 . the nail protector 100 may include other features to provide similar effects . these features are illustratively described below , but should not be construed as limiting . referring to fig4 , a nail protector 400 includes a cover portion 102 and one or two side portions 410 that can extend into a coil 420 . the cover portion includes a ridge 108 as before and employs the coil 420 to generate the reaction force f r1 ( fig3 ). in this way , the nail protector 400 is placed on a side of the finger or toe and the coil 420 is wrapped around the user &# 39 ; s finger to secure the nail protector 400 . the coil 420 is formed from a flexible material and is connected to or formed with the rest of the nail protector 400 . as before , the open ended ring permits the nail protector 400 ( or 100 ) to clamp onto the finger or toe to avoid passing over a painted nail . edges 412 of nail protector 400 are preferably bull - nosed and flared to serve as a necessary guide for placement on the finger . nail protectors 100 and 400 provide a rear stabilizer using longitudinal extensions 104 or using coil 420 ( fig1 ) for preventing the nail cover portion from making contact with the nail . referring to fig5 , a nail protector 500 is conceptually depicted showing a biased hinge 510 to permit opening and closing of a lateral side 512 of nail protector 500 . hinge 510 may include a spring 514 as a biasing means to bias the lateral side 512 in a closed position ( shown ). when the nail protector is to be placed on a finger the lateral side is opened in the direction of arrow “ b ”, the finger is then placed inside the nail protector 500 and the lateral side 512 is closed . an optical latch 516 may be employed to lock the lateral side 512 in place to secure the nail protector 500 to the finger of the wearer . fig5 has omitted features for simplicity of explanation , e . g ., the cover portion , the ridge and rear stabilization portions are not shown . referring to fig6 , a nail protector 600 may include a clasp 610 that rotates about a finger in the direction of arrow “ c ”. the clasp 610 is opened to permit a finger to be placed inside the nail protector 600 and then the clasp 610 is closed to secure the nail protector 600 to the finger of the wearer . the clasp 610 may be stowed on the side of a base portion 612 in the open position . fig6 has omitted features , e . g ., the cover portion , the ridge and rear stabilization portions , for simplicity . the clasp 610 may employ any known mechanical slides , concentric walls or other known elements for providing the mechanical features for sliding the clasp 610 into or out of a closed position . nail protectors 100 , 400 , 500 and 600 , in accordance with the present principles , may include additional features and modifications . in one embodiment , the cover portion 102 is formed from a clear resilient plastic material ( e . g ., polycarbonate ) so that the polished nail is visible . the construction material may include polypropylene , polyethylene , polycarbonate , etc . the nail protectors 100 , 400 , 500 and 600 may be fabricated to be disposable or reusable . reusable embodiments may include the use of washable or sterilizable materials . in either case , the nail protector is preferably ergonomic , light weight and recyclable . in addition , construction materials for the nail protector may be colored , textured or otherwise decorated to suit personal preferences . nail protectors 100 , 400 , 500 and 600 may include a plurality of sizes to permit proper fitting for a plurality of different sized fingers and toes . referring to fig7 , an insert 650 may be employed which detachably snaps into the cover portion 102 to provide the functions the stabilizer and of the lateral walls to hold the nail protector fast on the finger or toe . inserts 650 may provide the proper fit one the finger and lock into the cover portion 102 . the insert 650 as with the other nail protectors are made in accordance with standard finger / toe size dimensions . this is particularly useful for reusable nail protectors . the inserts 650 may be u - shaped and fit over the finger without going over the nail . then , the cover portion 102 may be attached over the insert 650 . the insert 650 may have a locking feature , such as a detent , snap , clasp , etc . to provide attachment to the nail protector 655 to complete a ring formed using both the insert 650 and the nail protector 655 . the inserts may be formed from plastics , metals , foams , etc . and may be utilized to accommodate various finger sizing . nail protectors in accordance with the present invention may be integrally formed as a single piece or may include a removable / detachable cover portion 102 to permit for interchangeable styles of the cover portion 102 . referring to fig8 , a flow diagram shows a method for employing a nail protector in accordance with the present invention . after a manicure / pedicure or a need for protecting nails arises , proper sized nail protectors ( or inserts ) are identified in block 702 . in block 704 , the nail protectors are applied to the fingers or toe from a lateral direction over a finger or toe without passing over the nail in a longitudinal direction . this includes spreading flexible parts , opening a hinge or clasp or otherwise attaching the nail protector to a finger / toe ( e . g ., using inserts and protector to connect and form a ring ). in block 706 , the finger / toe is permitted to heal or the nail permitted to dry . in block 708 , the nail protector is removed and disposed of , cleaned / sterilized or recycled . having described preferred embodiments of a nail protector and method ( which are intended to be illustrative and not limiting ), it is noted that modifications and variations can be made by persons skilled in the art in light of the above teachings . it is therefore to be understood that changes may be made in the particular embodiments disclosed which are within the scope and spirit of the invention as outlined by the appended claims . having thus described aspects of the invention , with the details and particularity required by the patent laws , what is claimed and desired protected by letters patent is set forth in the appended claims .	0
referring to fig1 , in an embodiment , the method of manufacturing the reverse conducting insulated gate bipolar transistor is provided , which includes the following steps . in step s 111 , an n - type substrate 110 is prepared . as shown in fig2 , the n - type substrate 110 is an n - type silicon substrate . in step s 112 , a gate oxide layer 121 is grown at a front side of the n - type substrate 110 . as shown in fig3 , the thickness of the gate oxide layer 121 is from 600 angstroms to 1500 angstroms . in step s 113 , a polysilicon gate 122 is deposited on the gate oxide layer 121 , as shown in fig3 . in step s 114 , a p well 123 is formed on the n - type substrate 110 by photoetching , etching and ion - implanting processes ( referring to fig5 ). referring to fig4 , an implantation window of the p well 123 is formed by selectively etching the polysilicon gate 122 and the gate oxide layer 121 by the photoetching process . referring to fig5 , a p - type impurity is implanted to the implantation window of the p well 123 by the self - aligned implantation process , and the p well 123 is formed by a drive - in process . in step s 115 , an n + region 124 and a front side p + region 125 are formed in the p well 123 by photoetching and ion - implanting processes ( referring to fig7 ). referring to fig6 , ions are selectively implanted to the p well 123 by the photoetching process , and the n + region 124 is formed by the drive - in process . referring to fig7 , ions are selectively implanted to the p well 123 by the photoetching process , and the front side p + region 125 is formed by the drive - in process . the n + region 124 is mainly configured as an emitter of the reverse conducting insulated gate bipolar transistor . in step s 116 , a dielectric layer 126 is deposited at the front side of the n - type substrate 110 . as shown in fig8 , the dielectric layer 126 is made of silicon dioxide and boro - phospho - silicate glass . in step s 117 , a protecting layer 127 is deposited on the dielectric layer 126 . as shown in fig9 , the protecting layer is made of silicon nitride . in step s 118 , the n - type substrate 110 is ground by a back side grinding process . in step 118 , the n - type substrate 110 is ground to the required thickness . in step s 121 , a back side p + region 131 is formed by implanting a p - type impurity to a back side of the n - type substrate 110 , as shown in fig1 . in step s 122 , a trench 132 is formed at the back side of the n - type substrate 110 by photoetching and etching processes . as shown in fig1 , in the embodiment , the trench 132 formed at the back side of the n - type substrate 110 is of a rectangle shape . of course , the trench 132 formed at the back side of the n - type substrate 110 is of a circle , an oval , a trapezium and other appropriate shapes . when the trench 132 formed at the back side of the n - type substrate 110 is of a rectangle shape , a depth of the trench 132 is from 1 to 20 μm , a width thereof is from 1 to 30 μm , and a distance between two adjacent trenches 132 is from 50 to 300 μm . in step s 123 , the trench 132 is filled by depositing polysilicon at the back side of the n - type substrate 110 , and the polysilicon at an area outside of the trench 132 is etched . as shown in fig1 , in step s 123 , the reverse conducting diode is formed by filling polysilicon in the trench 132 . the parameters of the reverse conducting diode at the back side of the manufactured reverse conducting insulated gate bipolar transistor can be adjusted by adjusting the doping concentration of polysilicon in the trench 132 , so that the difficulty of the adjusting process is low and it is easy to control the process . therefore , the manufacturing difficulty of the reverse conducting insulated gate bipolar transistor can be reduced . of course , the parameters of the reverse conducting diode at the back side of the reverse conducting insulated gate bipolar transistor can be also adjusted by adjusting a width and a depth of the trench 132 , or by adjusting the doping concentration of polysilicon in the trench 132 and the width and the depth of the trench 132 at the same time . therefore , the difficulty of the adjusting process of the reverse conducting insulated gate bipolar transistor can be reduced , and then the manufacturing difficulty thereof is reduced . in the embodiment , the polysilicon deposited in the trench 132 formed at the back side of the n - type substrate 110 is n - type polysilicon . the doping concentration of the polysilicon deposited in the trench 132 is 1e17 to 1e21 cm − 3 . in step s 124 , the protecting layer 127 at the front side of the n - type substrate is removed , as shown in fig1 . in step s 125 , a contact hole for shorting the n + region 124 and the front side p + region 125 is formed by selectively etching the dielectric layer 126 , and a front side metal layer 128 is formed . as shown in fig1 , from the manufacturing flow of the reverse conducting insulated gate bipolar transistor described above , it can be understood that step s 122 and step s 123 are performed after performing step s 116 . in other words , forming the trench 132 at the back side of the n - type substrate 110 and depositing the polysilicon in the trench 132 are performed after performing depositing the dielectric layer 126 at the front side of the n - type substrate 110 rather than after performing the whole front side process of the reverse conducting insulated gate bipolar transistor . such a manufacturing method has the following advantages . firstly , after the p - type impurity is implanted at the back side of the n - type substrate 110 in step s 121 , the following front side thermal processes such as the hole reflow process ( the hole reflow process is in forming the contact hole for shorting the n + region 124 and the front side p + region 125 by selectively etching the dielectric layer 126 and forming a front side metal layer 128 of step s 125 , and the temperature of the step s 125 is about 850 degrees centigrade ) and so on are performed . the activity of the p - type impurity at the back side of the n - type substrate 110 is very high without performing the annealing process individually . therefore , the step of the thermal annealing of the p - type impurity at the back side of the n - type substrate 110 can be omitted . further , the polysilicon in the trench 123 at the back side of the n - type substrate 110 and the polysilicon of the front side are processed separately , thus easily controlling the doping concentration of the polysilicon . in step s 126 , a passivation layer 129 is deposited at the front side of the n - type substrate 110 . as shown in fig1 , here , a pad area is formed by performing the etching process . in step s 127 , a back side metal layer 133 is formed by performing a back side metalized process at the back side of the n - type substrate 110 . in the embodiment , from the n - type substrate to an external , the back side metal layer 133 at the back side of the n - type substrate 110 comprises aluminum , titanium , nickel and silver , which are laminated in that order . in other words , the outermost layer is metal silver . in step s 128 , a carrier lifetime at a partial area 111 in the n - type substrate 110 is controlled by a local radiation technique . as shown in fig1 , in the embodiment , the local radiation technique radiates the n - type substrate 110 by using electron or proton to control the life of the carrier at a partial area 111 in the n - type substrate 110 . therefore , manufacturing of the reverse conducting insulated gate bipolar transistor is completed . the method of manufacturing the reverse conducting insulated gate bipolar transistor described above uses polysilicon for filling the trench at the back side of the reverse conducting insulated gate bipolar transistor . thus , the parameters of the reverse conducting diode at the back side of the reverse conducting insulated gate bipolar transistor can be controlled by only precisely controlling the doping concentration of polysilicon , resulting in a lower requirement of controlling the process . therefore , the method of manufacturing the reverse conducting insulated gate bipolar transistor has a lower requirement of controlling the manufacturing process , and a less difficulty of manufacturing . although the invention is illustrated and described herein with reference to specific embodiments , the invention is not intended to be limited to the details shown . rather , various modifications may be made in the details within the scope and range of equivalents of the claims and without departing from the invention .	7
a blank used to construct display modules for a foldable shelf display according to the present invention are depicted in fig1 and 2 generally at 10 and 20 , respectively . preferably , the blanks are made from cardboard stock having sufficient rigidity to maintain their shape yet remain light in weight . blank 10 comprises a series of wall panels 12 , 14 , 16 and 18 connected end to end foldably relative to each other about lines 21 , 22 , and 24 that may be perforated , scored , or otherwise weakened so that folding of the panels relative to each other occurs in a predetermined fashion . wall panels 14 and 16 when foldably aligned cooperatively provide a single rear wall panel 15 , as illustrated in fig5 . to provide a continuous wall structure , the free ends 26 and 28 of the blank are joined . the end 26 has an integral flap 30 which is bendable about a fold line 32 relative to panel 12 . the end 28 has an integral flap 34 which is bendable about a fold line 36 relative to panel 18 . an adhesive 38 of a type known to those skilled in the art is used to facially mate the inwardly folded flap 30 on panel 12 with the inwardly folded flap 34 on panel 18 such that the wall panels cooperatively form the continuous wall structure and bound a triangulated interior storage space 40 ( see fig5 ). a pair of flaps 42 and 44 are struck from and remain integral with side wall panel 12 , and a pair of flaps 46 and 48 are struck from and remain integral with wall panel 18 . flap 42 comprises a shelf panel 42a bendable about a fold line 42b . a free edge 42c has an integral marginal edge portion 42d which is bendable about a fold line 42e and has a notch 42f formed therein to define a tab 42g on the flap 42 . fold line 42b is preferably downwardly inclined with respect to fold line 21 , and shelf panel 42a is angularly cut at 42h for purposes later to be discussed . bending of flap 42 about fold line 42b establishes a generally rectangular opening 43 in panel 12 . similarly , flap 44 comprises a shelf panel 44a bendable about a fold line 44b . a free edge 44c has an integral marginal edge portion 44d which is bendable about a fold line 44e and has a notch 44f formed therein to define a tab 44g on the flap 44 . again , fold line 44b is preferably downwardly inclined with respect to fold line 21 , and shelf panel 42a is angularly cut at 44h . bending of flap 44 about fold line 44b establishes a generally rectangular opening 45 in panel 12 . flap 46 on side wall panel 18 comprises a shelf panel 46a bendable about a fold line 46b . a free edge 46c has an integral panel 46d which is bendable about a fold line 46e and has a notch 46f formed therein to define a tab 46g on the flap 46 . fold line 46b is downwardly inclined with respect to fold line 24 , and shelf panel 46a is angularly cut at 46h . bending of flap 46 about fold line 46b establishes a generally rectangular opening 47 in side wall panel 18 . similarly , flap 48 comprises a shelf panel 48a bendable about a fold line 48b . a free edge 48c has an integral panel 48d which is bendable about a fold line 48e and has a notch 48f formed therein to define a tab 48g on the flap 48 . again , fold line 48b is downwardly inclined with respect to fold line 24 , and shelf panel 48a is angularly cut at 48h . bending of flap 48 about fold line 48b establishes a generally rectangular opening 49 in side wall panel 18 . the steps for converting a display module from the flattened state illustrated in fig1 to a display state illustrated in fig8 are demonstrated in fig6 and 7 . as described above , initially the flap 30 on panel 12 is inwardly folded and facially mated with the inwardly folded flap 34 on panel 18 by means of a suitable adhesive 38 to form an upper display module 50 defining triangulated interior display or storage space 40 . integral panels 42d and 46d are then folded substantially 90 degrees about fold lines 42e and 46e , respectively , and the flaps 42 and 46 are inwardly folded substantially 90 degrees about fold lines 42b and 46b , respectively , to facially mate panels 42d and 46d . because of the downward inclination of fold lines 42b and 46b pointed out above , panels 42a and 46a each swing arcuately and slightly rearwardly to position the angular cuts at 42h and 46h adjacent rear wall panel 15 . notches 42f and 46f of tabs 42g , 46g are then engaged in an opening or slot 52 formed in rear wall panel 15 such that tabs 42g and 46g project through the rear panel to secure and support flaps 42 and 46 in juxtaposed relationship with one another to define a first shelf 54 slightly rearwardly inclined within the triangulated storage space 40 for placement of articles to be displayed . when the tabs are thus engaged , the angular cuts at 42h , 46h are colinear and braced against the rear wall panel 15 in close frictional engagement therewith , as shown in fig8 . as shown in fig1 the lower flap 44 is substantially identical to flap 42 in structure and orientation ; and the lower flap 48 is substantially identical to flap 46 in structure and orientation . thus in a manner similar to that described in relation to flaps 42 and 46 , integral panels 44d and 48d are folded substantially 90 degrees about fold lines 44e and 48e , respectively , and the flaps 44 and 48 are inwardly folded substantially 90 degrees about fold lines 44b and 48b , respectively , to facially mate panels 44d and 48d . notches 44f and 48f engage an opening or slot 56 formed in rear wall panel 15 such that tabs 44g and 48g project through the rear panel to secure and support flaps 44 and 48 in juxtaposed relationship with one another to define a second shelf 58 beneath first shelf 54 . again , the panels 44a and 48a each swing arcuately and slightly rearwardly to position the angular cuts 44h and 48h against the rear wall panel 15 in a close bracing relationship to rigidify the continuous wall structure . referring to fig2 blank 20 is generally similar to blank 10 and has a series of wall panels 62 , 64 , 66 and 68 connected end to end foldably relative to each other about lines 70 , 72 , and 74 that may be perforated , scored , or otherwise weakened so that folding of the panels relative to each other occurs in a predetermined fashion . wall panels 64 and 66 cooperatively provide a single rear wall panel 65 . to provide a continuous wall structure , the free ends 76 and 78 of the blank are joined . the end 76 has an integral flap 80 which is bendable about a fold line 82 relative to panel 62 . the end 78 has an integral flap 84 which is bendable about a fold line 86 relative to panel 68 . a common adhesive 88 is used to secure the facially mating of inwardly folded flap 80 on panel 62 with the inwardly folded flap 84 on panel 68 to form a triangulated interior display or storage space . a pair of similar flaps 92 and 94 are struck from and remain integral with wall panel 62 , and a pair of similar flaps 96 and 98 are struck from a remain integral with wall panel 68 . these flaps 92 , 94 , 96 , 98 are similar respectively to flaps 42 , 44 , 46 , 48 in structure , orientation and function . flap 92 comprises a shelf panel 92a bendable about a fold line 92b . a free edge 92c has an integral panel 92d which is bendable about a fold line 92e and has a notch 92f formed therein to define a tab 92g on the flap 92 . bending of flap 92 about fold line 92b establishes a generally rectangular opening 93 in panel 62 . similarly , flap 94 comprises a shelf panel 94a bendable about a fold line 94b . a free edge 94c has an integral panel 94d which is bendable about a fold line 94e and has a notch 94f formed therein to define a tab 94g on the flap 94 . bending of flap 94 about fold line 94b establishes a generally rectangular opening 95 in panel 62 . flap 96 comprises a shelf panel 96a bendable about a fold line 96b . a free edge 96c has an integral panel 96d which is bendable about a fold line 96e and has a notch 96f formed therein to define a tab 96g on the flap 96 bending of flap 96 about fold line 96b establishes a generally rectangular opening 97 in panel 68 . similarly , flap 98 comprises a shelf panel 98a bendable about a fold line 98b . a free edge 98c has an integral panel 98d which is bendable about a fold line 98e and has a notch 98f formed therein to define a tab 98g on the flap 98 . bending of flap 98 about fold line 98b establishes a generally rectangular opening 99 in panel 68 . each of the flaps 92 , 94 , 96 , 98 have angular cuts at 92h , 94h , 96h and 98h for purposes previously described . formed along fold line 72 between wall panels 64 and 66 are a pair of spaced apart slots or openings 100 and 102 . an upwardly opening slot 104 is formed in alignment with the openings 100 and 102 and communicates with an edge 106 of the blank 20 . a foldable lip 108 is joined to panel 62 about a fold line 110 ; a foldable lip 112 is joined to rear wall panel 65 about a fold line 114 ; and a foldable lip 116 is joined to wall panel 68 about a fold line 118 . as may be appreciated from the foregoing , the steps for converting a display module from the flattened state illustrated in fig2 to a display state illustrated in fig8 are substantially identical to those described above with respect to upper display module 50 . initially the flap 80 on panel 62 is inwardly folded and facially mated with the inwardly folded flap 84 on panel 68 by means of a suitable adhesive 88 to form a lower display module 120 . as will be shown , display module 120 is a lower display module . lip portions 108 , 112 , and 116 are upwardly folded about fold lines 110 , 114 , and 118 , respectively , to define a stable platform upon which the module is supported . integral panels 92d and 96d are then folded substantially 90 degrees about fold lines 92e and 96e , respectively , and the flaps 92 and 96 are inwardly folded substantially 90 degrees about fold lines 92b and 96b , respectively , to facially mate panels 92d and 96d . notches 92f and 96f engage opening 100 such that tabs 92g and 96g project through the rear panel to secure and support flaps 92 and 96 in juxtaposed relationship with one another to define a first shelf 122 within the display module . similarly , integral panels 94d and 98d are folded substantially 90 degrees about fold lines 94e and 98e , respectively , and the flaps 94 and 98 are inwardly folded substantially 90 degrees about fold lines 94b and 98b , respectively , to facially mate panels 94d and 98d . notches 94f and 98f engage opening 102 such that tabs 94g and 98g project through the rear panel to secure and support flaps 94 and 98 in juxtaposed relationship with one another to define a second shelf 124 beneath first shelf 122 . as illustrated in fig8 upper display module 50 and lower display module 120 are arranged in stacked relation to define a four - shelf display tower . tabs 42g and 46g projecting through the rear panel of display module 50 are aligned with slot 104 formed in upper edge 106 of display module 120 , and inwardly folded flaps 30 and 34 ( fig5 ) are aligned with a notch 126 ( fig8 ) formed in a support pillar 128 extending vertically between wall panels 62 and 68 . upper display module is moved downwardly into telescoping engagement with the lower display module , such that tabs 42g and 46g are received in slot 104 in rear wall panel 15 and flaps 30 and 34 are received forwardly in the notch 126 to rigidify the stacked arrangement fore and aft . referring to fig3 a shelf blank is depicted generally at 130 as having a pair of bendable side walls 132 and 134 and a perpendicular rear wall 136 . side wall 132 and 134 are foldable about parallel fold lines 138 and 140 , respectively , and flank a platform 142 . a foldable tab 133 is formed at one end of side wall 132 , and a foldable tab 135 is formed at one end of side wall 134 . rear wall 136 extends between the side wall panels and is bendable about a fold line 144 . a pair of front edge panels 146 and 148 are formed integrally with platform 142 and extend between side wall panels 132 and 134 . front edge panel 146 has a series of spaced apart teeth 150 which are aligned with corresponding openings 152 formed in platform 142 . the steps for converting a removable display tray from the flattened state illustrated in fig3 to a display state illustrated in fig9 can be summarized as follows . side walls 132 and 134 and rear wall 136 are upwardly folded to define a generally upright container 138 . corner portions 154 and 156 intermediate the side walls and the rear wall and tabs 133 and 135 on the side wall panels are inwardly folded such that the outer edges of the container retain a substantially rectangular contour . front edge panels 146 and 148 are then upwardly folded to define a triangular lip 158 along the front edge of the container , with the teeth 150 of panel 146 engaging the openings 152 and the triangular lip securing the tabs 133 and 135 to prohibit unfolding of the tray . fig1 illustrates an assembled display device according to the present invention having a plurality of removable trays 160 positioned therewithin . each tray is supported on a shelf formed within the triangulated storage space by the inwardly folded flaps struck from opposite side wall panels as previously described , and partially extends through the substantially rectangular openings formed in opposite side wall panels by the inwardly folded flaps . in order to enhance the engagement of the trays with the display device , each of the flaps 42 , 44 , 46 , and 48 on upper display module 50 and each of the flaps 92 , 94 , 96 , and 98 on lower display module have an integral triangular portion 162 , such that the openings formed in the wall panels due to the inward folding of the flaps include a congruent triangular notch 164 extending into the support pillar 128 . when each of the trays 160 is inserted in the display device , as illustrated in fig1 and fig1 , the triangular notches 164 receive the triangular lip 158 formed on each tray and securely engage the forward end of the tray . after engaging the lip 158 , each tray is lowered so that its rear wall 136 makes a close , firm frictional fit with the rear wall panel ( such as 15 , 65 ) to provide an interior bracing function fore and aft between the front pillar 128 and the rear wall panel . note also that the bracing function is enhanced because tray side walls 132 , 134 make a close fit rearwardly between opposite side wall panels adjacent the rear wall panel ( fig1 ). thus the trays will not become inadvertently separated from the display , yet the trays may be easily removed to replenish articles to be displayed . in a modification of the exemplary embodiment , fig1 and 12 illustrate a wall blank 166 including a number of interconnected wall panels 167 , 168 and 169 for defining an upper display module 172 with foldable flaps 170 , generally as previously described . wall blank 166 has a plurality of circular apertures 174 formed parallel to a top edge 176 and in vertical alignment with the flaps . the apertures advantageously position articles , such as cylindrical plastic containers or cans 178 , for display adjacent the display trays . in an alternate embodiment , and as shown in fig1 - 15 , a blank 210 comprises a series of wall panels 212 , 214 , 216 , 218 and 220 connected end to end foldably relative to each other about lines 222 , 224 , and 226 and 228 , respectively . to provide a continuous wall structure , the free ends 230 and 232 of the blank are joined . the end 230 has an integral flap 234 which is bendable about a fold line 236 relative to panel 212 . an adhesive 38 of a type known to those skilled in the art is used to facially mate the inwardly folded flap 234 on panel 212 with the free end 232 of panel 220 ( see fig1 ). as in the exemplary embodiment described above , a plurality of flaps 238 are struck from and remain integral with the wall blank and are inwardly folded to define shelves within the display module . a pair of complementary wall blanks are used to form an upper display module 240 and a lower display module 242 , which may be interconnected by means of previously described tabs and notches ( not shown in fig1 ) to form a stacked display device 244 for positioning a number of removable trays 246 . an important feature of the alternate embodiment of fig1 - 15 lies in the front panel 248 formed between the fold lines 222 and 224 . circular apertures 250 are formed in the front panel and allow for the display of generally cylindrical articles 252 in combination with the articles displayed on the trays 246 . they trays 246 are preferably identical to trays formed from previously described tray blank 130 and perform the same functions . it will be understood that the invention may be embodied in other specific forms without departing from the spirit or central characteristics thereof . the present examples and embodiments , therefore , are to be considered in all respects as illustrative and not restrictive , and the invention is not to be limited to the details given herein .	0
with regard to aspects of the invention any ang ii antagonist can be suitable , unless otherwise specified , e . g ., the sartans such as candesartan , eprosartan , irbesartan , losartan , telmisartan , valsartan , olmesartan and tasosartan mentioned hereinbefore , preferably losartan or telmisartan , most preferred telmisartan { 4 ′-[ 2 - n - propyl - 4 - methyl - 6 -( 1 - methyl - benzimidazol - 2 - yl ) benzimidazol - 1 - ylmethyl ] biphenyl - 2 - carboxylic acid } and the pharmaceutically acceptable salts thereof , furthermore , any ace inhibitor can be used with regard to aspects of the invention mentioned hereinbefore , unless otherwise specified , e . g ., benazepril , captopril , ceronapril , enalapril , fosinopril , imidapril , lisinopril , moexipril , quinapril , ramipril , trandolapril , and perindopril , preferably captopril , enalapril , lisinopril and ramipril , most preferred ramipril . in a preferred embodiment of the method - of - treatment aspect ramipril is co - administered with an ang ii antagonist . in a second preferred embodiment of the method - of - treatment aspect an ace inhibitor is co - administered with telmisartan . in a third preferred embodiment of the method - of - treatment aspect ramipril is co - administered with telmisartan . co - administration of an ang ii antagonist and an ace inhibitor is meant to include administration sequential in time or simultaneous administration , the simultaneous administration being preferred . for sequential administration , the ang ii antagonist can be administered before or after administration of the ace inhibitor . the active compounds can be administered orally , bucally , parenterally , by inhalation spray , rectally or topically , the oral administration being preferred . parenteral administration may include subcutaneous , intravenous , intramuscular and intrasternal injections and infusion techniques . the active compounds can be orally administered in a wide variety of different dosage forms , i . e ., they may be formulated with various pharmaceutically acceptable inert carriers in the form of tablets , capsules , lozenges , troches , hard candies , powders , sprays , aqueous suspensions , elixirs , syrups , and the like . such carriers include solid diluents or fillers , sterile aqueous media and various non - toxic organic solvents , etc . moreover , such oral pharmaceutical formulations can be suitably sweetened and / or flavored by means of various agents of the type commonly employed for such purposes . in general , the compounds of this invention are present in such oral dosage forms at concentration levels ranging from about 0 . 5 % to about 90 % by weight of the total composition , in amounts which are sufficient to provide the desired unit dosages . other suitable dosage forms for the compounds of this invention include controlled release formulations and devices well known to those who practice in the art . for purposes of oral administration , tablets containing various excipients such as sodium citrate , calcium carbonate and calcium phosphate may be employed along with various disintegrants such as starch and preferably potato or tapioca starch , alginic acid and certain complex silicate , together with binding agents such as polyvinylpyrrolidone , sucrose , gelatin and acacia . additionally , lubricating agents such as magnesium stearate , sodium lauryl sulfate and talc or compositions of a similar type may also be employed as fillers in soft and hard - filled gelatin capsules ; included lactose or milk sugar as well as high molecular weight polyethylene glycols . when aqueous suspensions and / or elixirs are desired for oral administration , the essential active ingredient therein may be combined with various sweetening or flavoring agents , colouring matter or dyes and , if so desired , emulsifying agents and / or water , ethanol , propylene glycol , glycerin and various like combinations thereof . for purposes of parenteral administration , solutions of the compounds in sesame or peanut oil or in aqueous propylene glycol may be employed , as well as sterile aqueous solutions of the corresponding pharmaceutically - acceptable salts . such aqueous solutions should be suitably buffered if necessary , and the liquid diluent rendered isotonic with sufficient saline or glucose . these particular aqueous solutions are especially suitable for intravenous , intramuscular and sub - cutaneous injection purposes . in this connection , the sterile aqueous media employed are readily obtained by standard techniques well known to those skilled in the art . for instance , distilled water is ordinarily used as the liquid diluent and the final preparation is passed through a suitable bacterial filter such as a sintered glass filter or a diatomaceous - earth or unglazed porcelain filter . preferred filters of this type include the berkefeld , the chamberland and the asbestos disk - metal seitz filter , wherein the fluid is sucked into a sterile container with the aid of a suction pump . the necessary steps should be taken throughout the preparation of these injectable solutions to insure that the final products are obtained in a sterile condition . for purposes of transdermal administration , the dosage form of the particular compound or compounds may include , by way of example , solutions , lotions , ointments , creams , gels , suppositories , rate - limiting sustained release formulations and devices therefor . such dosage forms comprise the particular compound or compounds and may include ethanol , water , penetration enhancer and inert carriers such as gel - producing materials , mineral oil , emulsifying agents , benzyl alcohol and the like . several ang ii inhibitors are already on the market and can be used for administration , e . g ., micardis ®, lorzaar ®, cozaar ®, lortaan ®, losaprex ®, neo - lotan ® or oscaar ®, approvel ®, karvea ®, diovan ®, atacand ®, blopress ® and teveten ®. also several ace - inhibitors are already on the market and can be used for administration , e . g ., briem ®, cibacen ®, cibacne ®, lotensin ®, dynacil ®, elidiur ®, fosinorm ®, fositen ®, fozitec ®, monopril ®, staril ®, tensozide ®, novaloc ®, tanapril ®, fempress ®, perdix ®, univasc ®, accupril ®, accuprin ®, accupro ®, acequin ®, acuitel ®, korec ®, quinazil ®, xanef ®, pres ®, acerbon ®, lopirin ®, tensobon ®, delix ® or vesdil ®. the ace inhibitor may be administered in a daily dosage of 1 . 25 mg ( or 0 . 018 mg / kg , based on a person of 70 kg ) to 450 mg ( 6 . 429 mg / kg ) orally and of about 20 mg ( 0 . 286 mg / kg ) parenterally , preferably of 5 mg ( 0 . 071 mg / kg ) to 100 mg ( 1 . 429 mg / kg ) orally . particularly preferred is an oral daily dosage of 2 . 5 mg ( 0 . 036 mg / kg ) to 10 mg ( 0 . 143 mg / kg ). the ang ii antagonist may be administered in a daily dosage of 10 mg ( or 0 . 143 mg / kg , based on a person of 70 kg ) to 500 mg ( 7 . 143 mg / kg ) orally and of about 20 mg ( 0 . 286 mg / kg ) parenterally , preferably of 20 mg ( 0 . 286 mg / kg ) to 100 mg ( 1 . 429 mg / kg ) orally . particularly preferred is an oral daily dosage of 40 mg ( 0 . 571 mg / kg ) to 80 mg ( 1 . 143 mg / kg ). in all administration modes and dosages mentioned hereinbefore the preferred ace inhibitor is ramipril and the preferred ang ii antagonist is telmisartan . in the most preferred embodiment ramipril is administered simultaneously in a daily dosage of about 10 mg together with telmisartan in a daily dosage of about 80 mg via the oral route . pharmaceutical compositions comprising one ace inhibitor in an amount of 1 . 25 mg to 450 mg and one ang ii antagonist in an amount of 10 mg to 500 mg in single dosage units , optionally together with one or more pharmaceutically acceptable diluents and / or carriers , could be used for the method of treatment aspect of the invention . for instance , pharmaceuticals comprising one ace inhibitor selected from benazepril , captopril , ceronapril , enalapril , fosinopril , imidapril , lisinopril , moexipril , quinapril , ramipril , trandolapril and perindopril in an amount of 1 . 25 mg to 100 mg and one ang ii antagonist selected from candesartan , eprosartan , irbesartan , losartan , telmisartan and valsartan , olmesartan , tasosartan in an amount of 20 to 100 mg in single dosage units , optionally together with one or more pharmaceutically acceptable diluents and / or carriers would be suitable for the method of treatment according to the invention . the most preferred pharmaceutical compositions comprise as ace inhibitor ramipril in an amount of 1 . 25 mg to 100 mg and as ang ii antagonist telmisartan in an amount of 20 mg to 100 mg , in single dosage units , optionally together with one or more pharmaceutically acceptable diluents and / or carriers . especially preferred pharmaceutical compositions comprise as ace inhibitor ramipril in an amount of about 10 mg and as ang ii antagonist telmisartan in an amount of about 80 mg in single dosage units , optionally together with one or more pharmaceutically acceptable diluents and / or carriers . as already mentioned above the present invention also provides the use of an ang ii antagonist for manufacture of a pharmaceutical composition for the treatment of the human or non - human mammalian body for treating the indications mentioned hereinbefore when used in combination with an ace inhibitor . this use aspect is meant to include the manufacture of all pharmaceutical compositions mentioned hereinbefore .	0
as used herein the term &# 34 ; c 1 - c 4 alkyl &# 34 ; refers to a saturated straight or branched chain hydrocarbon radical of one to four carbon atoms . included within the scope of this term are methyl , ethyl , n - propyl , isopropyl , n - butyl , isobutyl and the like . as used herein the terms &# 34 ; halo &# 34 ;, &# 34 ; halogen &# 34 ; or &# 34 ; halide &# 34 ; refer to a chlorine , bromine or iodine atom . as used herein the term &# 34 ; pfaudler reactor &# 34 ; refers to a glass lined steel reactor as appreciated by one of ordinary skill in the art . as used herein the term &# 34 ; baffle &# 34 ; refers to a fixed object placed in the reactor to increase the turbulence and thus improve mixing of the contents within the reactor . the process for preparing the starting material of formula ( ii ) is described generally in scheme i . all the substituents , unless otherwise indicated , are previously defined . the reagents and starting materials are readily available to one of ordinary skill in the art . ## str4 ## in scheme i , a compound of formula ( ii ) is prepared from a dihalo compound of formula ( iii ) under the following conditions . the dihalo compound of formula ( iii ) is combined with magnesium , clsir 1 r 2 r 3 and a suitable aromatic solvent under an inert atmosphere , such as nitrogen . it is preferred that all reagents and starting materials be essentially anhydrous . examples of a dihalo compound of formula ( iii ) are 1 , 3 - dibromobenzene , 1 , 3 - dichlorobenzene , 1 - chloro - 3 - bromobenzene , 1 , 3 - diiodobenzene , 1 - chloro - 3 - iodobenzene and 1 - bromo - 3 - iodobenzene , with the preferred dihalo compound of formula ( iii ) being 1 , 3 - dibromobenzene . the total number of equivalents of magnesium employed in the process of scheme i relative to the dihalo compound of formula ( iii ) is from about 0 . 9 eq to about 1 . 1 eq , with about 1 eq being preferred . in addition , magnesium suitable for grignard reactions is preferred , such as magnesium powder , magnesium granules , magnesium ribbon , magnesium turnings and the like . magnesium turnings are most preferred . the reaction vessel is fitted with an agitator , such as a retreat curve agitator . the agitator is set at a speed sufficient for good mixing . the total number of equivalents of clsir 1 r 2 r 3 employed in the process of scheme i relative to the dihalo compound of formula ( iii ) is from about 0 . 8 eq to about 1 . 2 eq , with about 1 . 1 eq being preferred . examples of clsir 1 r 2 r 3 are chlorotriethylsilane , chloro - tri - n - propylsilane , chloro - tri - n - butylsilane , chlorodimethylethylsilane , chlorodimethylisopropylsilane , chlorotrimethylsilane and the like . chlorotrimethylsilane is the preferred clsir 1 r 2 r 3 . the mass ratio of suitable aromatic solvent to dihalo compound of formula ( iii ) employed in the process of scheme i is from about 3 to about 10 , with about 4 . 6 being preferred . for example , as described in table 1 , batch # 2 , 810 lb of toluene are utilized with 176 lb of 1 , 3 - dibromobenzene resulting in a mass ratio of 4 . 6 ( 810 lb / 176 lb ). examples of a suitable aromatic solvent are benzene , ethylbenzene , xylene , diethylbenzene , toluene and the like . the preferred suitable aromatic solvent is toluene . the above mixture is heated at a temperature of from about 20 ° c . to about 80 ° c . the preferred temperature of the mixture is about 50 ° c . when the temperature of the mixture begins to fall , the addition of a suitable ether is initiated . examples of a suitable ether are diethyl ether , tetrahydropyran , tetrahydrofuran , and the like . the preferred suitable ethers are tetrahydropyran and tetrahydrofuran , with tetrahydrofuran being most preferred . the total number of equivalents of suitable ether employed in the process of scheme i relative to the dihalo compound of formula ( iii ) is from about 1 . 8 eq to about 4 eq , with about 2 . 5 eq of suitable ether being preferred . it is preferred that from about 2 % to about 15 % of the total amount of the suitable ether be added to the mixture in one portion initially , with about 10 % of the total amount of the suitable ether being the preferred initial amount added to the mixture . the remaining portion of the total amount of the suitable ether is then added at a rate of from about 0 . 15 eq / hour to about 2 eq / hour , with about 0 . 7 eq / hour to about 1 . 2 eq / hour being preferred and 1 . 13 eq / hour being the most preferred rate of addition of the suitable ether . the controlled rate of addition of the remaining portion of the total amount of the suitable ether allows the temperature of the reaction to be controlled and essentially maintained at the mixture temperature , such as the preferred temperature of 50 ° c . it is preferred that the temperature of the process of scheme i be maintained at about 50 ° c . during addition of the suitable ether . after addition of the total amount of suitable ether is complete , the reaction is allowed to stir for about 10 hours to about 15 hours at a temperature of from about 20 ° c . to about 70 ° c . with about 50 ° c . being the preferred temperature . the slurry is then cautiously added to water which is at a temperature of from about 5 ° c . to about 50 ° c ., with stirring . the compound of formula ( ii ) is then isolated and purified by techniques well known in the art , such as extractive methods , distillation , chromatography and the like . for example , the mixture is then stirred for about 10 minutes to about 1 hour . the phases are then separated and the organic phase is optionally subjected to a second water wash . the organic phase is then dried with a suitable drying agent , such as anhydrous magnesium sulfate , filtered and concentrated under vacuum to provide the compound of formula ( ii ) which can be further purified by techniques well known in the art such as chromatography and / or vacuum distillation . the process of the present invention is described in scheme ii . all the substituents , unless otherwise indicated , are previously defined . the reagents and starting materials are readily available to one of ordinary skill in the art . ## str5 ## in scheme ii , a suitable reaction vessel , such as a dry 200 gallon pfaudler reactor , fitted with a retreat curve agitator and a baffle , is charged with an excess of magnesium suitable for grignard reactions under an inert atmosphere , such as nitrogen . it is preferred that the suitable reaction vessel be charged with 1 . 0 equivalents of magnesium , with 1 . 05 equivalents of magnesium being most preferred . examples of magnesium suitable for grignard reactions are magnesium powder , magnesium granules , magnesium ribbon , magnesium turnings and the like . magnesium turnings are preferred . then about 10 equivalents of a suitable ether are added to the reactor . examples of a suitable ether are diethyl ether , tetrahydropyran , tetrahydrofuran , and the like . tetrahydrofuran is the preferred suitable ether . the suitable ether must be essentially anhydrous . it is preferred that the water content of the suitable ether not exceed 100 ppm of water . the mixture is heated at a temperature of about 30 ° c . to about 55 ° c ., with a preferred temperature of about 45 ° c . about 0 . 02 eq to about 0 . 10 eq of a suitable initiator , such as 1 , 2 - dibromoethane is then added to the mixture . it is preferred that about 0 . 04 eq of 1 , 2 - dibromoethane be added to the mixture at about 45 ° c . initiation occurs when an exotherm is observed subsequent to addition of the suitable initiator . when the temperature steadies at about 45 ° c ., one equivalent of a suitable 1 - halo - 3 - trialkylsilanyl - benzene of formula ( ii ) is added to the reaction vessel . the suitable 1 - halo - 3 - trialkylsilanyl - benzene is added slowly until an exotherm is indicated . the suitable 1 - halo - 3 - trialkylsilanyl - benzene is then added at a rate that maintains the temperature of the reaction below about 58 ° c ., preferably below 50 ° c . examples of suitable 1 - halo - 3 - trialkylsilanyl - benzenes are 1 - bromo - 3 - trimethylsilanyl - benzene , 1 - chloro - 3 - trimethylsilanyl - benzene , 1 - iodo - 3 - trimethylsilanyl - benzene , 1 - bromo - 3 - triethylsilanyl - benzene , 1 - bromo - 3 - tri - n - propylsilanyl - benzene , 1 - bromo - 3 - dimethylethylsilanyl - benzene , 1 - bromo - 3 - dimethylisopropylsilanyl - benzene , 1 - bromo - 3 - tri - n - butylsilanyl - benzene and the like . the preferred suitable 1 - halo - 3 - trialkylsilanyl - benzene is 1 - bromo - 3 - trimethylsilanyl - benzene . alternatively , one equivalent of a suitable 1 - halo - 3 - trialkylsilanyl - benzene of formula ( ii ) may be slowly added directly to the magnesium / suitable ether mixture in the reaction vessel with caution , without addition of a suitable initiator . however , extreme caution must be exercised when the suitable initiator is eliminated from the process , as addition of a large amount of the 1 - halo - 3 - trialkylsilanyl - benzene of formula ( ii ) prior to initiation of the exotherm can result in an uncontrollable reaction . after addition of the suitable 1 - halo - 3 - trialkylsilanyl - benzene is complete , the reaction mixture is maintained at a temperature of about 45 ° c . for about 2 hours to about 4 hours , with about 3 hours being preferred . the reaction mixture is then cooled to about - 12 ° c . to about 0 ° c ., with about 0 ° c . being preferred . an excess of lithium trifluoroacetate is then added to the reaction mixture at such a rate that the reaction temperature is maintained at less than about 10 ° c . it is preferred that about 1 . 3 eq of lithium trifluoroacetate be added to the reaction mixture , with about 1 . 1 eq being most preferred . in addition , it is preferred that about 1 . 1 eq of lithium trifluoroacetate be combined with about 10 eq of a suitable organic solvent in a suitable addition reactor , such as a dry 50 gallon glass - lined reactor and agitated at about 90 rpm for about 2 - 4 hours . examples of a suitable organic solvent are tetrahydrofuran , diethyl ether , tetrahydropyran , dioxane and the like . the preferred suitable organic solvent is tetrahydrofuran . it is most preferred that about 1 . 1 eq of lithium trifluoroacetate be combined with the suitable organic solvent . it is preferred that the suitable organic solvent / lithium trifluoroacetate solution be essentially anhydrous prior to addition to the reaction mixture . this can be achieved by drying the suitable ether / lithium trifluoroacetate solution over 3a molecular sieves until the water content of the solution is less than about 200 ppm . the solution is then added to the reaction mixture at such a rate that the reaction temperature is maintained at less than about 10 ° c . the reaction mixture is then agitated at about 12 ° c . for about 30 minutes . a suitable quench reactor , such as a 300 gallon pfaudler reactor fitted with a retreat curve agitator and a baffle is then charged with a suitable quench solution . examples of suitable quench solutions are aqueous hydrochloric acid , aqueous sulfuric acid , aqueous hydrochloric acid / heptane , water / 37 % hydrochloric acid / glacial acetic acid / heptane and the like . the preferred suitable quench solution is water / 37 % hydrochloric acid / glacial acetic acid / heptane . in addition , it is particularly preferred that the water / 37 % hydrochloric acid / glacial acetic acid / heptane quench solution have a composition by weight of about 73 % water , 2 % hydrochloric acid ( 37 %), 6 % glacial acetic acid and 19 % heptane . the suitable quench solution is cooled to less than 5 ° c . prior to addition of the reaction mixture . the reaction mixture is then added to the suitable quench solution at a rate that maintains the temperature of the quench reactor mixture at less than about 15 ° c . after the addition is complete , the 200 gallon reactor is rinsed with a suitable organic solvent , such as tetrahydrofuran and the organic rinse is added to the quench reactor . the mixture in the quench reactor is then agitated at about 15 ° c . for about 15 minutes . agitation is then stopped and the mixture is allowed to settle for about 40 minutes . the bottom aqueous layer is decanted out of the quench reactor . the upper organic layer is then transferred to a suitable reactor , such as a 200 gallon glass lined reactor which is used as an in - process holding tank . it is understood by one of ordinary skill in the art that if the starting material of formula ( ii ) used in scheme ii is contaminated with undesired organohalides , such as dihalobenzenes , for example 1 , 3 - dibromobenzene , 1 , 3 - dichlorobenzene , 1 - chloro - 3 - bromobenzene , 1 , 3 - diiodobenzene , 1 - chloro - 3 - iodobenzene and 1 - bromo - 3 - iodobenzene , an additional two equivalents of magnesium in step a and an additional two equivalents of lithium trifluoroactetate in step b must be used in the process of scheme ii for each equivalent of undesired dihalobenzene present in the starting material . for example , if the starting material consists of 1 mole of 1 - bromo - 3 - trimethylsilanyl - benzene contaminated with an additional 0 . 10 moles of 1 , 3 - dibromobenzene , then under the most preferred conditions 1 . 25 moles of magnesium must be used in step a and 1 . 30 moles of lithium trifluoroacetate must be used in step b . the amount of undesired dihalobenzene can be readily determined by techniques and procedures well known in the art , such as gas chromatography . as with any synthetic process , various undesired by - products are produced along with the desired compound . thus , it is preferred that the resulting crude material be purified to remove the undesired by - products . for example , the crude product of formula ( i ) can be purified following the novel extractive procedure set forth in scheme iii . all the substituents , unless otherwise indicated , are previously defined . the materials for extraction are readily available to one of ordinary skill in the art . ## str6 ## in step a , the decanted aqueous layer obtained in scheme ii , is reloaded into the quench reactor and extracted with a suitable organic solvent . examples of a suitable organic solvent are heptane , diethyl ether , hexane , toluene , xylene and the like . the preferred suitable organic solvent is heptane . the lower aqueous layer is decanted out of the quench reactor and the upper organic extract is combined with the first organic layer ( obtained in scheme ii ) in the 200 gallon reactor . the combined organic layers are concentrated under vacuum to a concentration of about 30 - 35 % of formula ( i ) compound by weight in the suitable organic solvent , such as heptane . in step b , the organic solution is washed 2 to 3 times with a methanol / water mixture wherein the methanol water mixture has a composition by volume of about 50 % methanol and 50 % water , with 3 washes being preferred . this washing step removes undesired by - products of formula ( iv ). in step c , the organic solution is extracted 3 to 7 times with a methanol / water mixture wherein the methanol / water mixture has a composition by volume of about 80 % methanol and 20 % water , with 5 extractions being preferred . step c results in extraction of compounds of formula ( i ) away from the undesired by - products of formula ( v ). the methanol / water extracts are then combined and concentrated under vacuum to a concentration of about 13 to 18 % of compound of formula ( i ) in solution ( at this concentration two phases result ). in step d , the concentrated methanol / water layer is then extracted 1 to 2 times with a suitable organic solvent . examples of a suitable organic solvent are heptane , diethyl ether , toluene , hexane and the like . heptane is the preferred suitable organic solvent . a total of 2 extractions are preferred . the organic extracts are then combined and concentrated under vacuum to provide the 1 -( 3 - trialkylsilylphenyl )- 2 , 2 , 2 - trifluoromethyl ethanone derivative of formula ( i ). the compound of formula ( i ) exists in equilibrium with the hydrate of formula ( ia ) and the hemiacetal of formula ( ib ) at various stages of the extraction and purification process described above . the equilibrium can be driven to essentially complete formation of formula ( i ) by techniques well known in the art , such as molecular sieves , distillation , azeotropic distillation and heating at various pressures . the ratio of the desired compound of formula ( i ) to the hydrate of formula ( ia ) and the hemiacetal of formula ( ib ) can be determined by one of ordinary skill in the art , such as by gas chromatography . the compound of formula ( i ) can be further purified , if necessary , by techniques well known to one of ordinary skill in the art , such as chromatography and / or distillation . the following examples present typical syntheses as described in schemes i and ii . these examples are understood to be illustrative only and are not intended to limit the scope of the present invention in any way . as used herein , the following terms have the indicated meanings : &# 34 ; ppm &# 34 ; refers to parts per million ; &# 34 ; g &# 34 ; refers to grams ; &# 34 ; mmol &# 34 ; refers to millimoles ; &# 34 ; l &# 34 ; refers to liters ; &# 34 ; ml &# 34 ; refers to milliliters ; &# 34 ; bp &# 34 ; refers to boiling point ; &# 34 ; mp &# 34 ; refers to melting point ; &# 34 ;° c .&# 34 ; refers to degrees celsius ; &# 34 ; mm hg &# 34 ; refers to millimeters of mercury ; &# 34 ; μl &# 34 ; refers to microliters ; &# 34 ; μg &# 34 ; refers to micrograms ; &# 34 ; μm &# 34 ; refers to micromolar ; &# 34 ; eq &# 34 ; refers to equivalents ; &# 34 ; min &# 34 ; refers to minutes ; &# 34 ; rpm &# 34 ; refers to revolutions per minute ; &# 34 ; thf &# 34 ; refers to tetrahydrofuran ; &# 34 ; litfa &# 34 ; refers to lithium trifluoroacetate ; and &# 34 ; lb &# 34 ; refers to pounds . scheme i ; a 500 ml round - bottomed , 3 necked , fluted flask with a thermowell is fitted with an addition funnel , mechanical stirrer , reflux condenser and thermocouple recorder . the atmosphere is flushed with nitrogen . magnesium ( 4 . 84 g , 0 . 199 mole ), chlorotrimethylsilane ( 45 . 9 g , 0 . 422 mole ), toluene ( 214 g ) and 1 , 3 - dibromobenzene ( 46 . 5 g , 0 . 197 mole ) are then added . the mixture is heated to 50 ° c . with a heat gun and then allowed to slowly cool . when the temperature starts to fall , tetrahydrofuran ( 38 . 1 g ) is added . the temperature continues to fall to 42 ° c . where it stabilizes and then begins to rise . the temperature is controlled at 50 °± 2 ° c . while the remaining tetrahydrofuran ( 342 . 9 g ) is added dropwise ( 1 drop every 5 to 8 seconds ) over a 2 hour period . when about 60 - 70 % of the tetrahydrofuran has been added the exotherm subsides and a fluffy solid forms . the remainder of the tetrahydrofuran is added rapidly without evidence of an exotherm . the mixture is then allowed to cool to room temperature overnight . the slurry is vacuum transferred to a one liter flask containing water heated to 50 ° c . producing a temperature increase . the mixture is stirred for 10 minutes and the phases are separated ( mixture temperature is 45 ° c . when separated ). the organic phase is washed with water ( 50 ml ), dried over anhydrous magnesium sulfate / sodium sulfate , filtered , concentrated under vacuum and distilled through a 40 theoretical plate concentric tube distillation column at 15 mm hg . the title compound is then collected at a temperature of from 94 ° c . to 105 ° c . to provide a colorless oil ( 32 . 7 g , 76 . 8 %). reverse - phase hplc ( high performance liquid chromatography ) analysis of the title compound can be performed utilizing a hitachi model l - 6200 gradient pump , a perkin - elmer diode array 235 detector , a spectra - physics model 4270 integrator , a hitachi model as - 2000 autosampler , and a rheodyne model 7125 injector equipped with a 20 μl sample loop and a 4 . 0 × 80 mm zorbax ods ( 5 μm particles ) column . the detector is set at 255 nm , the mobile phase is 90 : 10 acetonitrile / water and the flow rate is set at 2 ml / min resulting in a retention time ( rt ) for the title compound of about 0 . 92 to 0 . 95 minutes . preparative lc ( liquid chromatography ) of the title compound can be performed utilizing a gilson model 305 pump equipped with a gilson manometric module model 805 , a linear model uv - 106 ( 254 nm ) detector , a sargent - welch model srg - 2 chart recorder , and a rheodyne 7125 injector equipped with a 1 . 0 ml sample loop and an alltech 22 . 5 × 250 mm econosphere c 18 ( 10 μm particles ) column . the crude material is dissolved in acetonitrile prior to injection . the detector is set at 254 nm , the mobile phase can be 90 : 10 or 85 : 15 acetonitrile / water and the flow rate is set at 15 ml / min resulting in an rt range for the title compound of about 8 . 5 to 11 minutes . gas chromatographic analysis of the title compound can be performed utilizing a hewlett packard 5890a gas chromatograph , a hewlett packard 7573a autosampler fitted with a 10 μl syringe , a hewlett packard 7673 autosampler tray , a flame ionization detector , a pe - nelson accesschrom rev . 1 . 9 with model 941 a / d data system , a supelco spb - 1 30 m × 0 . 32 mm id column with 1 μfilm thickness ( cut from a 60 m column ) and helium as the carrier gas . the conditions used are a 10 psi column head pressure , a 105 ml / min split flow , a 1 . 8 ml / min column flow , 20 ml / min detector make up ( nitrogen ), 20 ml / min detector hydrogen flow , 300 ml / min detector air flow , detector range = 2 , injector temperature of 275 ° c . and a detector temperature of 300 ° c . the temperature gradient program used has an initial temperature of 60 ° c . that increases to 130 ° c . at a rate of about 16 ° c ./ min , it is then held at 130 ° c . for 12 min , and finally increased to 320 ° c . at a rate of about 22 ° c ./ min at which time the run is terminated . the retention time is approximately 16 min for 1 - bromo - 3 - trimethylsilanyl - benzene . example 1a provides the general procedure followed for 10 separate batches for the large scale preparation of 1 - bromo - 3 - trimethylsilanyl - benzene . following example 1a , table 1 provides the individual amounts of reagents and starting materials utilized and the results obtained for each of the 10 batches . scheme i , ; magnesium turnings ( 18 . 25 lb ) are loaded into a 200 gallon glass - lined reactor fitted with a retreat curve agitator . the reactor is sealed , pressure tested and purged with nitrogen . 1 , 3 - dibromobenzene ( 176 lb ) is then vacuum loaded into the reactor followed by vacuum loading of toluene ( 806 . 6 lb ). the agitator is set to 130 rpm in order to obtain good mixing . chlorotrimethylsilane ( 180 lb ) is then loaded into the reactor by adding nitrogen pressure to the cylinder of chlorotrimethylsilane and opening the cylinder to the reactor headspace . after loading the chlorotrimethylsilane , the transfer line is blown clear with nitrogen . the temperature control system of the reactor is set to maintain an internal reactor temperature of 50 ° c . when the internal temperature and jacket temperature of the reactor stabilize at 50 ° c ., tetrahydrofuran ( 14 lb ) is pumped into the reactor headspace . the temperature of the reactor is monitored to determine when the reaction ( exothermic ) starts . the reaction is determined to have started when the difference between the internal temperature of the reactor and the jacket temperature is greater than 5 °- 10 ° c . after the reaction starts , tetrahydrofuran ( 130 lb ) is pumped into the reactor at a rate of about 0 . 7 eq / hour to about 1 . 2 eq / hour . after addition of the tetrahydrofuran is complete , the reactor contents are agitated for an additional 10 - 15 hours at 50 ° c . the contents of the reactor are then transferred to a 300 gallon glass - lined reactor fitted with a pitched blade agitator and containing water ( about 100 gallons at 5 °- 10 ° c .). toluene ( about 20 lb ) is vacuum loaded into the original 200 gallon reactor and is used to flush the transfer line between the 200 gallon and 300 gallon reactors . the 300 gallon reactor is agitated for about one hour , agitation is then stopped and the contents are allowed to settle for about 30 - 60 minutes . the aqueous phase is then drained out of the 300 gallon reactor and water ( about 25 gallons ) is again added , followed by agitation for about 30 minutes . the agitation is then stopped , the contents are allowed to settle for about 30 - 90 minutes and the aqueous layer is drained out of the 300 gallon reactor . the organic phase is then drained to 55 gallon drums . the 300 gallon reactor is then pressure tested , purged with nitrogen and about 1600 - 2000 lb of the above organic solution from the 55 gallon drums is vacuum loaded into the reactor . the agitator is set at about 100 rpm and the jacket system set to hold the jacket temperature at 10 °- 20 ° c . above the internal temperature to begin distillation of the volatiles into a distillate receiver . as the level in the reactor decreases , additional organic solution from the 55 gallon drums is loaded until 5 batches have been loaded into the reactor . the distillation is continued until the internal temperature of the reactor reaches 68 °- 72 ° c . the jacket temperature is then set to about 25 ° c . and the vacuum is broken with nitrogen . when the internal temperature of the reactor is less then about 35 ° c ., the manway is opened and diatomaceous earth ( about 20 lb ) and magnesium sulfate ( about 20 lb ) are loaded into the reactor through the manway . the manway is then closed and the reactor is pressure tested and purged with nitrogen . the contents of the reactor are then drained into 55 gallon drums through a nutsche filter ( prepared by placing a new filter cloth in the bottom ) to provide the title compound . table 1__________________________________________________________________________summary of reaction conditions and % yield of 1 - bromo - 3 - trimethylsilanyl - benzene for ten individual batches following the procedure described inexample 1 foreach individual batch in an analogous manner . # 1 # 2 # 3 # 4 # 5 # 6 # 7 # 8 # 9 # 10 total__________________________________________________________________________magnesium ( lb ) 18 . 25 18 . 25 18 . 25 18 . 25 18 . 25 18 . 25 18 . 3 18 . 5 18 . 3 17 . 5 1823 - dibromobenzene ( lb ) 176 176 176 176 176 176 176 176 176 . 3 168 . 9 1753toluene ( lb ) 806 . 6 810 811 812 810 811 810 810 814 780 8075chlorotrimethylsilane ( lb ) 176 180 178 159 176 171 172 215 177 138 1742initial thf ( lb ) 28 14 14 14 14 14 14 14 14 . 1 13 . 3 153final thf ( lb ) 116 130 130 130 130 130 . 1 130 130 120 125 1271total thf ( lb ) 144 144 144 144 144 144 . 1 144 144 144 . 1 138 . 3 1434 . 5time for final thf 140 180 140 145 145 135 160 194 210 215addition ( min ) quench water ( gal ) 100 100 100 100 100 100 100 100 100 100 1000toluene flush ( lb ) 21 . 5 20 20 20 20 20 20 28 20 21 211water wash ( gal ) 25 25 25 25 25 25 25 25 25 25 250agitator speed ( rpm ) 130 . 4 130 . 8 130 110 110 135 133 135 132 . 5 127 % yield of 64 . 58 68 . 78 63 . 93 64 . 90 63 . 53 64 . 39 64 . 35 63 . 40 66 . 20 66 . 04 65 . o1 - bromo - 3 - trimethylsilanyl - benzene__________________________________________________________________________ scheme i ; 1 - chloro - 3 - trimethylsilanyl - benzene is prepared in a manner analogous to the procedure described in examples 1 and 1a utilizing chlorotrimethylsilane and 1 - chloro - 3 - bromobenzene as the dihalo compound of formula ( iii ). scheme i ; 1 - bromo - 3 - trimethylsilanyl - benzene is prepared in a manner analogous to the procedure described in examples 1 and 1a utilizing chlorotrimethylsilane and 1 - bromo - 3 - iodobenzene as the dihalo compound of formula ( iii ). scheme i ; 1 - chloro - 3 - trimethylsilanyl - benzene is prepared in a manner analogous to the procedure described in examples 1 and la utilizing chlorotrimethylsilane and 1 - chloro - 3 - iodobenzene as the dihalo compound of formula ( iii ). scheme i ; 1 - iodo - 3 - trimethylsilanyl - benzene is prepared in a manner analogous to the procedure described in examples 1 and 1a utilizing chlorotrimethylsilane and 1 , 3 - diiodobenzene as the dihalo compound of formula ( iii ). scheme i ; 1 - bromo - 3 - triethylsilanyl - benzene is prepared in a manner analogous to the procedure described in examples 1 and 1a utilizing 1 , 3 - dibromobenzene and chlorotriethylsilane as the clsir 1 r 2 r 3 compound . scheme i ; 1 - bromo - 3 - tri - n - propylsilanyl - benzene is prepared in a manner analogous to the procedure described in examples 1 and 1a utilizing 1 , 3 - dibromobenzene and chloro - tri - n - propylsilane as the clsir 1 r 2 r 3 compound . scheme i ; 1 - bromo - 3 - dimethylethylsilanyl - benzene is prepared in a manner analogous to the procedure described in examples 1 and 1a utilizing 1 , 3 - dibromobenzene and chlorodimethylethylsilane as the clsir 1 r 2 r 3 compound . scheme i ; 1 - bromo - 3 - dimethylisopropylsilanyl - benzene is prepared in a manner analogous to the procedure described in examples 1 and 1a utilizing 1 , 3 - dibromobenzene and chlorodimethylisopropylsilane as the clsir 1 r 2 r 3 compound . scheme i ; 1 - bromo - 3 - tri - n - butylsilanyl - benzene is prepared in a manner analogous to the procedure described in examples 1 and 1a utilizing 1 , 3 - dibromobenzene and chloro - tri - n - butylsilane as the clsir 1 r 2 r 3 compound . scheme ii ; a one liter , three necked round bottom flask fitted with a mechanical stirrer , temperature probe and nitrogen bubbler , is purged with nitrogen . magnesium turnings ( 11 . 9 g , 0 . 49 mol ) and anhydrous tetrahydrofuran ( 250 g ) are added . to this mixture is added 1 , 2 - dibromoethane ( 2 . 4 g , 0 . 0128 mol , dbe ) in one shot . an exotherm is detected almost immediately with the temperature rising to 29 ° c . when the temperature falls to 25 ° c ., 1 - bromo - 3 - trimethylsilanyl - benzene ( 80 . 63 g , 0 . 352 mol , 80 . 63 %) is added over 30 minutes . during the addition , the temperature again rises and is maintained at 50 °± 2 ° c . with an ice bath . after the addition is complete , the exotherm subsides and the mixture is then heated at 45 ° c . with stirring overnight . the temperature of the mixture is then lowered to 0 ° c . and a solution of lithium trifluoroacetate ( 352 g , 0 . 575 mol , 200 ppm water ) in tetrahydrofuran ( 250 g ) is added over 30 minutes . the mixture is then allowed to warm to room temperature . it is then vacuum transferred to a stirred mixture of water ( 583 g ), glacial acetic acid ( 51 g ), aqueous hydrochloric acid ( 27 g , 37 %) and heptane ( 142 g ) while maintaining the temperature at approximately 10 °- 15 ° c . after addition is complete , the mixture is allowed to warm to 20 ° c . the layers are then separated and the aqueous layer is extracted with heptane ( 50 g ). the organic layer and organic extract are combined and concentrated under vacuum ( 45 ° c ., 45 mmhg ) to a concentration of 38 . 5 %. this solution is then washed with methanol / water ( 50 / 50 , v / v , 4 × 185 g ). the solution is then extracted with methanol / water ( 80 / 20 , v / v , 5 × 185 g ). the combined extracts are partially concentrated under vacuum ( 45 ° c ., 45 mmhg ). the two phase mixture is then extracted with heptane ( 150 g ). the organic extract is then dried over anhydrous magnesium sulfate , filtered and concentrated under vacuum ( 45 ° c ., 45 mmhg ) to provide the title compound as a light yellow oil ( 78 . 2 g , 77 . 5 % overall yield ). the title compound can be further purified by distillation through a 40 theoretical plate concentric tube distillation column ( 94 °- 105 ° c ., 15 mmhg ) to provide the title compound as a colorless oil . example 11b provides the general procedure followed for 10 separate batches for the large scale preparation of 1 -( 3 - trimethylsilylphenyl )- 2 , 2 , 2 - trifluoromethyl ethanone . following example 11b , table 2 provides a summary of reaction conditions and % yield of 1 -( 3 - trimethylsilylphenyl )- 2 , 2 , 2 - trifluoromethyl ethanone for 10 individual batches following the procedure described in example 11b for each individual batch in an analogous manner . scheme ii ; a 200 gallon glass - lined pfaudler reactor fitted with a retreat curve agitator and a baffle ( designated reactor a ), and a 50 gallon glass - lined reactor ( designated reactor b ) are dried at 80 ° c . while pulling a vacuum and sweeping the reactors with nitrogen . magnesium turnings ( 15 . 2 lb ) are loaded into reactor a through the manway , followed by addition of tetrahydrofuran ( 390 lb ). the tetrahydrofuran is first sampled and analyzed for water content , with an upper limit of 100 ppm of water in the tetrahydrofuran being permitted . the agitator in reactor a is set to 100 rpm . the reactor a jacket is set for master / slave control with an internal temperature setpoint of 45 ° c . when the reactor a internal temperature steadies at about 45 ° c ., about 2 . 8 to 3 . 6 lb of 1 , 2 - dibromoethane are loaded into reactor a . the load line is flushed with 3 lb of tetrahydrofuran and the jacket temperature is monitored for the exotherm indicating reaction initiation . when the reaction initiates and the internal temperature of reactor a steadies at about 45 ° c ., 1 - bromo - 3 - trimethylsilanyl - benzene ( 6 to 8 lbs ) is loaded into reactor a . a nitrogen operated teflon diaphragm pump is used to control the addition of 1 - bromo - 3 - trimethylsilanyl - benzene to the reaction vessel . the jacket temperature is monitored for the exotherm indicating reaction initiation . when the reaction initiates , the remaining 1 - bromo - 3 - trimethylsilanyl - benzene ( 120 - 122 lb ) are loaded into reactor a maintaining the internal temperature at less than about 50 ° c . after addition is complete , the load line is flushed with tetrahydrofuran ( 5 lb ). the mixture is then maintained at a temperature of about 45 ° c . for approximately 3 hours . the mixture is then cooled to about 0 ° c . lithium trifluoroacetate ( about 88 lbs , litfa ) and tetrahydrofuran ( about 300 lb ) are loaded into reactor b and agitated at 90 rpm for about 2 - 4 hours . the lithium trifluoroacetate / tetrahydrofuran solution is then transferred to reactor a while maintaining the internal temperature in reactor a at less than about 10 ° c . the transfer is stopped as needed to maintain the reactor a internal temperature at less than about 10 ° c . after addition is complete , tetrahydrofuran ( about 64 lb ) is loaded into reactor b . this tetrahydrofuran rinse is then transferred to reactor a and the mixture is agitated at about 12 ° c . for about 30 minutes . a 300 gallon glass - lined pfaudler reactor ( designated reactor c ) fitted with a retreat curve agitator and a baffle is charged with a quench solution consisting of water ( about 751 lb ), 37 % aqueous hydrochloric acid ( about 22 lb ), glacial acetic acid ( 65 lb ) and heptane ( 190 lb ). the quench solution is cooled to less than 5 ° c . and the reaction mixture in reactor a is transferred to reactor c , maintaining the internal temperature of reactor c at less than about 15 ° c . after addition is complete , tetrahydrofuran ( about 60 lb ) is added to reactor a which is then transferred to reactor c . the mixture in reactor c is then agitated at about 15 ° c . for at least 15 minutes . agitation is then stopped and the solution is allowed to settle for at least 40 minutes . the bottom aqueous layer is decanted to drums . the upper organic layer is transferred to a 200 gallon glass lined reactor ( designated reactor d ) which is used as a distillate receiver and an in - process hold tank . the earlier removed aqueous layer is reloaded into reactor c and is extracted with heptane ( 100 lb ). the lower aqueous layer is drained to drums , and the upper organic layer is transferred to reactor d and combined with the first organic layer . the combined organic layers are concentrated at a vacuum at the pump inlet of about 25 mmhg with an internal temperature of 25 °- 30 ° c . and a jacket temperature of about 40 °- 45 ° c . the solution is concentrated to about 40 gallons . this concentrated solution is then transferred to reactor b and concentrated further to about 30 - 35 % title compound by weight in heptane . additional heptane is loaded as needed to achieve the desired weight percent of title compound in heptane . this organic solution is then washed three times with a mixture of methanol / water ( 50 / 50 , v / v , 180 lb ). the organic solution is then extracted five times with a mixture of methanol / water ( 80 / 20 , v / v , 190 lb ). the methanol / water extracts are combined and concentrated under vacuum of about 25 mmhg and an internal temperature of about 20 °- 25 ° c . to about 13 to 18 % of title compound in solution at which point two phases result . the concentrated methanol / water layer is extracted twice with heptane ( 250 lb ). the combined heptane extracts are then concentrated under vacuum to provide the title compound . the title compound can be further purified through distillation . for example , the title compound isolated above ( 436 lb ) is vacuum loaded into a 100 gallon glass - lined reactor which is the distillation vessel and reboiler . a 4 inch distillation column containing 4 feet of structure packing is connected to the head space of the distillation vessel and is equipped with a reflux splitter for either distillate reflux or collection . a 28 ft 2 hastalloy c tube heat exchanger is used as the condenser . a 50 gallon glass lined reactor is used as the distillate receiver . the distillation vessel agitator is set to about 80 rpm . the jacket temperature of the distillation vessel is set to 150 ° c . with a maximum temperature difference of 30 ° c . between the jacket and internal temperatures . the lights fraction is collected at about 150 - 200 mmhg until the internal temperature of the distillation vessel reaches 140 ° c . the contents of the distillate receiver are then drained and the temperature of the distillation vessel is dropped to less than 50 ° c . the pressure is lowered to about 15 mmhg . the jacket temperature of the distillation vessel is set to 150 ° c . with a maximum temperature difference of 30 ° c . between the jacket and internal temperatures . with the reflux splitter set to a reflux ratio of from 3 : 1 to 10 : 1 , the low boiling impurities are distilled off until the overhead temperature levels off at about 100 ° to 105 ° c . the distillate receiver is then drained . the reflux ratio is then set to 1 : 1 or less and the title compound is distilled off until no additional material will distill over . the product fraction in the distillate receiver is then transferred to a shipping drum through a 0 . 1 micron polish filter to provide the further purified title compound . if necessary , this material can be re - distilled under conditions analogous to those described above , by one of ordinary skill in the art . table 2__________________________________________________________________________batch no ./ wgt ( lb ) # 1 # 2 # 3 # 4 # 5 # 6 # 7 # 8 # 9 # 10__________________________________________________________________________magnesium 15 . 3 15 . 2 15 . 2 15 . 2 15 . 2 15 . 2 15 . 2 15 . 2 15 . 2 15 . 2tetrahydrofuran 399 398 398 398 398 398 398 399 398 4001 , 2 - dibromoethane 3 . 1 3 . 5 3 . 2 3 . 4 3 3 . 6 2 . 8 3 . 5 3 . 1 3 . 51 - bromo - 3 - 128 128 . 2 128 . 0 128 . 0 128 . 0 128 . 0 128 . 0 128 . 0 128 . 5 128 . 0trimethylsilanyl - benzenelitfa 88 . 7 88 . 6 87 . 8 88 . 0 88 . 0 88 . 0 88 . 0 88 . 0 88 . 0 87 . 0thf combined 300 301 300 300 300 301 344 300 300 300with litfalitfa / thf addition ( min ) 60 60 59 44 60 60 65 60 55 60thf rinse of reactor b 64 64 64 64 64 64 64 65 65 66quench water 909 751 751 751 751 751 751 751 751 75137 % hcl 22 22 22 22 22 22 22 22 22 22glacial acetic acid 63 65 65 65 65 65 65 65 65 65heptane 191 190 190 190 190 190 190 190 191 196quench addition ( min ) 210 25 25 25 20 20 25 12 10 20thf rinse of reactor a 60 60 60 60 60 60 60 60 60 60title compound ( wgt ) 70 . 9 76 . 9 77 . 7 75 . 1 82 . 7 73 . 3 69 . 7 80 . 8 77 . 4 82 . 1percent yield 66 . 5 72 . 0 72 . 9 70 . 4 77 . 6 68 . 7 65 . 3 75 . 8 72 . 3 77 . 1__________________________________________________________________________ gas chromatographic analysis of the final isolated title compound can be performed utilizing a hewlett packard 5890a gas chromatograph , a hewlett packard 7573a autosampler fitted with a 10 μl syringe , a hewlett packard 7673a autosampler tray , a flame ionization detector , a nelson accesschrom data system , a supelco spb - 1 30 m × 0 . 32 mm id column with 1 μfilm thickness and helium as the carrier gas . the conditions used are a 10 psi column head pressure , a 105 ml / min split flow , a 1 . 8 ml / min column flow , 20 ml / min detector make up ( nitrogen ), 20 ml / min detector hydrogen flow , 300 ml / min detector air flow , injector temperature of 275 ° c . and a detector temperature of 300 ° c . the temperature gradient program used has an initial temperature of 120 ° c . which is held for 22 minutes and then increases to a final temperature of 320 ° c . at a rate of about 30 ° c ./ min at which time the run is terminated . table 3______________________________________approximate retention times using the aboveanalytical method . retentioncompound time ( min ) ______________________________________trifluoroacetophenone 3 . 12 - chloro - p - xylene 6 . 01 -( 3 - trimethylsilylphenyl )- 2 , 2 , 2 - 10 . 0trifluoromethyl ethanone1 -( 3 - trimethylsilylphenyl )- 2 , 2 , 2 - 20 . 5trifluoromethyl ethanone hemiacetal1 -( 3 - trimethylsilylphenyl )- 2 , 2 , 2 - 21 . 7trifluoromethyl ethanone hydrate______________________________________	2
fig1 illustrates a reclosable pouch 50 having a first side - wall 52 and a second sidewall 54 that are connected by , for example , folding , heat sealing , and / or an adhesive , along three peripheral edges 56 , 58 , 60 to define an interior space 62 between the first and second sidewalls 52 , 54 , and a mouth 64 along a top edge 66 where the first and second sidewalls 52 , 54 are not connected , so as to allow access to the interior space 62 . an elongate closure mechanism 68 is disposed along the first and second sidewalls 52 , 54 across the mouth 64 , extending longitudinally between the peripheral edge 56 and the peripheral edge 60 of the pouch 50 , to allow the mouth 64 to be repeatedly occluded and deoccluded , thereby respectively sealing and unsealing the mouth 64 . the closure mechanism 68 , in one aspect , include a first base member 70 and a second base member 72 as illustrated , for example , in fig2 a and 2b . a first pair 74 of opposing interlocking members 74 a and 74 b project from opposing interior surfaces 76 and 78 of the base members 70 and 72 , respectively . similarly , a second pair 80 of opposing interlocking members 80 a and 80 b project from the opposing interior surfaces 76 and 78 of the base members 70 and 72 , respectively . the second pair 80 of opposing interlocking members is parallel to and spaced on an exterior side from the first pair 74 . each pair of the opposing interlocking members 74 a and 74 b , and 80 a and 80 b includes elongate generally constant profiles disposed across the mouth 64 of the pouch 50 . each pair 74 , 80 of opposing interlocking members is illustrated in fig2 a and 2b as having a single male and a female profile . however , each of the pairs 74 , 80 of opposing interlocking members may include one or more sets of elongate profiles , as desired , that form a seal across the mouth 64 of the pouch 50 , for example , as illustrated in pawloski et al . u . s . pat . no . 7 , 437 , 736 , pawloski u . s . pat . no . 7 , 410 , 298 , and dais et al . u . s . pat . no . 5 , 070 , 584 , no . 5 , 478 , 228 , and no . 6 , 021 , 557 . further , the first and second base members 70 , 72 may be integral with or separate and attached to the respective first and second sidewalls 52 , 54 . in a preferred embodiment , the sidewalls 52 , 54 and the closure mechanism 68 are made of thermoplastic , which may be formed by known thermoplastic extrusion and bag forming techniques , such as , disclosed in dais et al . u . s . pat . no . 5 , 070 , 584 , no . 5 , 478 , 228 , and no . 6 , 021 , 557 , geiger et al . u . s . pat . no . 4 , 755 , 248 , zieke et al . u . s . pat . no . 4 , 741 , 789 , and porchia et al . u . s . pat . no , 5 , 012 , 461 . other materials and formation techniques sufficient to form structures as described herein are also within the general purview of the present invention . referring to fig1 - 3 , a first plurality 82 of partial indentations 84 is disposed along an exterior surface 86 of the first base member 70 , wherein the first plurality of partial indentations extends longitudinally along the closure mechanism 68 between the first and second pairs 74 , 80 of opposing interlocking members . a second plurality 88 of partial indentations as may optionally be disposed along an exterior surface 92 of the second base member 72 , wherein the second plurality of partial indentations also extends longitudinally along the closure mechanism between the first and second pairs 74 , 80 of opposing interlocking members . in one aspect , each plurality 82 , 88 of partial indentations is arranged in a generally linear pattern extending completely from the peripheral edge 56 to the peripheral edge 60 , as illustrated for the pluralities 82 and 88 of partial indentations in fig1 . however , each plurality 82 , 88 of partial indentations may extend partially across the sidewalls 52 , 54 or may be broken up into regions including indentations and regions lacking indentations ( not shown ). further , each plurality 82 , 88 of partial indentations may be arranged in a curvilinear pattern between the peripheral edges 56 , 60 , as illustrated for the plurality 88 of partial indentations in fig3 , or may be alternatively arranged as a mix of generally linear and curvilinear patterns . the partial indentations 84 , 90 that make up the first and second pluralities 82 and 88 , respectively , may be generally linear , generally curvilinear , or may have shapes having generally linear and / or curvilinear perimeters . the partial indentations 84 , 90 may be manufactured , in one preferred method , for example , using a double roller mechanism applied to create the partial indentations 84 , 90 , wherein the double roller mechanism includes a first roller wheel with cutting and / or embossing surfaces applied to the exterior surfaces 86 , 92 and a second roller wheel with a smooth surface of a rubber or hard metal such as steel , applied opposite to the first roller wheel . in another method , a double roller having complimentary opposing male and female embossing surfaces may be used to create the partial indentations 84 , 90 . alternatively , the double roller mechanism , may be applied such that the embossing surfaces thereon are applied to interior surfaces of the first and second base members 70 , 72 . the partial indentations 84 , 90 do not extend completely through the respective first and second base members 70 and 72 . rather , each of the partial indentations 84 , 90 extends only part way through the corresponding base member , thereby not allowing any leakage therethrough . the partial indentations 84 , 90 may touch each other , as shown , for example , in fig1 as overlapping offset zigzag or interlocking diamond shapes , which according to one preferred aspect , is used for the indentations 84 . 90 of one or more of the pluralities of indentations 82 , 88 . alternatively , the partial indentations 84 , 90 may be spaced apart from each other longitudinally , as shown , for example , in fig2 and 4 , such that spacing between longitudinally spaced partial indentations 84 , 90 may be constant or variable along the first and / or second pluralities 82 , 88 , respectively . the partial indentations 84 , 90 may include longitudinally spaced apart transverse linear indentations and / or may include indicia , such as words , logos , or other informational patterns , and may be selected for aesthetics of the pattern or to enhance the tactile sensation imparted to a user &# 39 ; s fingers . fig3 illustrates some other exemplary possible patterns that may be utilized for the partial indentations 84 , 90 , such as wavy hues , and longitudinally spaced sets of transversely aligned circles . in one embodiment , illustrated in fig1 and 2a , the exterior surfaces 86 , 92 of the respective first and second base members 70 , 72 do not have indentations and are therefore , smooth in regions that are directly opposite to or coextensive with the pairs of opposing interlocking members 74 , 80 . thus , a transverse space is formed between each of the pluralities 82 , 88 of the longitudinally spaced partial indentations 84 , 90 , respectively , and each adjacent interlocking member . in another embodiment , illustrated in fig2 b , regions that are directly opposite to or coextensive with the pairs of interlocking members 74 , 80 are adjacent to or may slightly overlap with uppermost and lowermost extremes of the pluralities 82 , 88 of the longitudinally spaced partial indentations 84 , 90 , respectively . in another aspect , a closure mechanism 68 a optionally includes a third pair 94 of opposing interlocking members 94 a and 94 b projecting from the opposing interior surfaces 76 and 78 of the base members 70 and 72 , respectively , as shown in fig4 . the third pair 94 of the opposing interlocking members is parallel to and spaced from the second pair 80 on an opposite side thereof from the first pair 74 of opposing interlocking members . in this aspect , the first and second pluralities 82 , 88 of partial indentations 84 , 90 , respectively , are disposed along the respective exterior surfaces 86 , 92 of the respective first and second base members 70 , 72 coincident with the second pair 80 of opposing interlocking members and transversely spaced between the first pair 74 and the third pair 94 of interlocking members . it is contemplated that further aspects may include more than three pairs of opposing interlocking members , as desired . it is contemplated that a third plurality 96 of partial indentations 98 may be disposed along an exterior surface 86 of the first base member 70 , wherein the third plurality 96 of partial indentations 98 extends longitudinally along the closure mechanism 68 below the lowermost pair of opposing interlocking members , for example , the first pair 74 of opposing interlocking members . similarly , a fourth plurality 100 of partial indentations 102 may be disposed along an exterior surface 92 of the second base member 72 , wherein the fourth plurality 100 of partial indentations 102 extends longitudinally along the closure mechanism 68 below the lowermost pair of opposing interlocking members , for example , the first pair 74 of opposing interlocking members . similar to die first and second pluralities 82 , 88 , the third and fourth pluralities 96 , 100 of partial indentations 98 , 102 , respectively , may be longitudinally continuous or longitudinally spaced . in one embodiment , illustrated in fig2 a , the third plurality 96 of partial indentations 98 is transversely spaced from a bottom edge of the first pair 74 of opposing interlocking members . in another embodiment , illustrated in fig2 b , a top edge of the third plurality 96 of partial indentations 98 is adjacent to or may slightly overlap with a bottom edge of the first pair 74 of opposing interlocking members . in use , each of the first and second pluralities 82 , 88 of the partial indentations 84 , 90 , respectively , can provide a tactile guide path tor a user &# 39 ; s finger to facilitate proper occlusion of the closure mechanism 68 . referring to fig2 a , 2 b and 5 , to occlude the closure mechanism 68 that includes the first plurality 82 of the partial indentations 84 , a user grasps the closure mechanism 68 , for example , between a first finger 104 and a second finger 106 , lire user locates the first finger 104 between the first and second spaced apart pairs 74 , 80 of opposing interlocking members by feeling whether the first finger 104 is engaged against the first plurality 82 of the partial indentations 84 . the second finger 106 is located on the exterior surface 92 of the second base 72 opposite to the first finger 104 . thus grasped , the user forces the first and second opposing fingers 104 , 106 , together as indicated by the arrows 108 shown in fig5 , to locally occlude the first and second spaced apart pairs 74 , 80 of opposing interlocking members that are disposed on either side of the user &# 39 ; s fingers . the user slides the first and second opposing fingers 104 , 106 along the closure mechanism 68 , as illustrated by die arrow 110 shown in fig5 , with the first and second fingers 104 , 106 forced together , such that the first finger 104 is guided by the first plurality 82 of the partial indentations 84 . the user maintains the first finger 104 between the first and second spaced apart pairs 74 , 80 of opposing interlocking members , while sliding the first and second fingers 104 , 106 by feeling the first plurality 82 of the partial indentations 84 with the first finger 104 , whereby the first and second spaced apart pairs 74 , 80 of opposing interlocking members are occluded along their entire length , and the mouth 64 is sealed . a closure mechanism has been presented that may be used on reclosable thermoplastic pouches and that includes a tactile guide path . the tactile guide path may facilitate proper occlusion of the closure mechanism by guiding one or more of a user &# 39 ; s lingers along a preferred path along the length of the closure mechanism . it is also contemplated that regions adjacent to and between the pairs of opposing interlocking members 74 , 80 may be thicker than , and , therefore , stiffer than , the pouch sidewalls 52 , 54 or other portions of the closure mechanism 68 . without being bound by theory , it is believed that embossing and / or creation of the partial indentations in the above - noted regions may increase the pliability of the above - noted regions over a base that does not have such partial indentations , which can feel better to a user and can make the opposing interlocking members 74 , 80 easier to occlude . numerous modifications to the present invention will be apparent to those skilled in the art in view of the foregoing description . accordingly , this description is to be construed as being illustrative only and is presented for the purpose of enabling those skilled in the art to make and use the invention , and to teach the best mode of carrying out the same . the exclusive right to all modifications within the scope of the impending claims is expressly reserved . all patents , patent publications and applications , and other references cited herein are incorporated by reference herein in their entirety .	1
the method for producing low - substituted hydroxypropyl cellulose by using a raw material pulp will next be described . the raw material pulp can be immersed in an aqueous alkali solution having a concentration of preferably from 20 to 60 % by weight and then compressed for removal of excess of the aqueous alkali hydroxide solution to obtain alkali cellulose having a desired composition . the alkali cellulose may be reacted with propylene oxide through sufficient mixing . the propylene oxide may be used in an amount of preferably from 0 . 15 to 2 . 0 moles per mole of the cellulose . the blending of propylene oxide may be carried out by using any of a method of adding a required amount of propylene oxide all at once , a method of dividing the required amount into two or more portions which will be added in two or more times , and a method of adding the required amount in a continuous manner . in the low - substituted hydroxypropyl cellulose thus obtained , the alkali used as a catalyst has remained so it may be neutralized with an acid . neutralization may be carried out , for example , by putting the crude reaction product in water ( preferably of from 20 to 60 ° c .) containing an acid in an amount stoichiometric to the amount of the alkali . examples of the acid to be used include a mineral acid such as hydrochloric acid , sulfuric acid and nitric acid , and an organic acid such as formic acid and acetic acid . after neutralization with the acid , an optional washing may be carried out . in the step of washing , byproducts such as sodium chloride may be washed away with water , preferably hot water ( preferably of from 70 to 100 ° c .) by taking advantage of the water - insolubility of the low - substituted hydroxypropyl cellulose . this washing may be carried out successively by using a continuous horizontal vacuum filter , a horizontal table filter , or a horizontal belt filter . the hydrous low - substituted hydroxypropyl cellulose thus obtained may then be dehydrated . the water content of the hydrous low - substituted hydroxypropyl cellulose before dehydration may preferably be from 85 to 95 % by weight in consideration of the burden on a drying step to be conducted subsequently . the term “ water content ” as used herein means a percentage of water weight content in the weight of the hydrous low - substituted hydroxypropyl cellulose . for dehydration , a compression type dehydrator may be used . the compression type dehydrator may be an apparatus equipped with a roller or screen for compacting a material to be dehydrated , and applies a pressure to the material for dehydration . examples of a commercially available dehydrator include a screw press ( produced by tsukishima techno machinery co ., ltd .) and a v - shaped disc press (“ asahi press ” produced by flow dynamics ). a screen type v - shaped disc press may be preferred from the standpoint of the properties of the hydrous low - substituted hydroxypropyl cellulose and the throughput capacity of the apparatus and the fact that the hydrous low - substituted hydroxypropyl cellulose itself may serve as a filtering material . in the v - shaped disc press , dehydration is carried out by the aid of a pair of disc - shaped screens which allows the distance between the screens to decrease with rotation . these screens have pores through which water passes , and water having passed through the pores of these screens is collected . the low - substituted hydroxypropyl cellulose is , on the other hand , discharged from the rotating disc press and is collected . the rotational speed of the v - shaped disc press may preferably be from 1 . 0 to 2 . 5 rpm , more preferably from 1 . 5 to 2 . 0 rpm from the standpoint of the filling ratio in the v - shaped disc press . the filling ratio in the compression type dehydrator can be increased by connecting a screw conveyer , which is a push - fit type apparatus , to an inlet of this compression type dehydrator . the throughput capacity of this screw conveyer may preferably be from 1 . 0 to 2 . 0 times the throughput capacity of the v - shaped disc press . the screw conveyer is not limited as long as it is equipped with a casing for covering a shaft therewith and is capable of transferring the hydrous low - substituted hydroxypropyl cellulose to the inlet of the compression type dehydrator and putting it into the compression type dehydrator without causing a loss at the screw conveyer . more specifically , in practice , prior to the dehydration with the compression type dehydrator , the hydrous low - substituted hydroxypropyl cellulose , which is a material to be dehydrated , may be supplied into the compression type dehydrator via the screw conveyer . after the compression type dehydrator is filled fully therewith , in other words , the pressure at the inlet of the compression type dehydrator reaches preferably from 0 . 10 to 0 . 25 mpa , more preferably from 0 . 15 to 0 . 20 mpa , the compression type dehydrator may be started into operation for dehydration . when the pressure at the inlet of the compression type dehydrator is less than 0 . 10 mpa , the filling ratio of the hydrous low - substituted hydroxypropyl cellulose in the v - shaped disc press may be reduced . when the pressure is more than 0 . 25 mpa , returning of the hydrous low - substituted hydroxypropyl cellulose to the screw conveyer , so - called “ back mixing ,” may take place . the feed rate of the hydrous low - substituted hydroxypropyl cellulose to the inlet of the screw conveyer and the discharge rate may each preferably be from 10 to 30 kg / h , more preferably from 20 to 25 kg / h in terms of net weight of cellulose ether . the dehydrated low - substituted hydroxypropyl cellulose may then be dried . in the step of drying , it may be dried with a drier such as a fluidized - bed drier or a drum drier . the drying temperature may preferably be from 60 to 120 ° c ., more preferably from 80 to 100 ° c . the drying time varies depending on the temperature and the water content of the dehydrated cellulose ether . the drying time may preferably be from 2 to 5 hours . since the water content of the hydrous low - substituted hydroxypropyl cellulose can be reduced in the preceding dehydration step , the amount of steam can be reduced greatly . the dehydration of hydrous low - substituted hydroxypropyl cellulose in the method for producing low - substituted hydroxypropyl cellulose from pulp has been explained . however , according to the invention , the dehydration can be applied not only to low - substituted hydroxypropyl cellulose but also to the whole hydrous low - substituted hydroxypropyl cellulose . the dehydration of hydrous low - substituted hydroxypropyl cellulose according to the present invention will next be described in detail by examples and comparative examples . a pulp sheet was immersed in an aqueous 43 % by weight sodium hydroxide solution at 35 ° c . for 5 seconds and then compressed for removing excess of the aqueous sodium hydroxide solution to obtain alkali cellulose . the weight ratio of sodium hydroxide to the cellulose and the weight ratio of the water content to the cellulose were adjusted to 0 . 55 and 0 . 90 , respectively . the alkali cellulose thus obtained was shredded using a slitter cutter and placed in a pressure - resistant reactor equipped with an internal stirrer . after the reactor was purged sufficiently with nitrogen , propylene oxide was charged ( at a molar ratio of 0 . 67 relative to the cellulose ) and a reaction was carried out at 50 ° c . for 3 hours . the sodium hydroxide remaining in the reaction product was neutralized with an aqueous 33 % by weight acetic acid solution , and then the neutralized product was washed and filtered with hot water at 95 ° c . to obtain hydrous low - substituted hydroxypropyl cellulose having water content of 90 % by weight as a material to be dehydrated . dehydration was carried out as follows . first , operation of a screw conveyor was started and via the screw conveyer , the hydrous low - substituted hydroxypropyl cellulose was supplied into a v - shaped disc press (“ asahi press ” produced by flow dynamics ), a compression type dehydrator , at a rate of 20 kg / h in terms of net weight of cellulose ether . at the time when the filling ratio of the hydrous low - substituted hydroxypropyl cellulose in the v - shaped disc press increased and the pressure at the inlet of the v - shaped disc press reached 0 . 2 mpa ( on the presumption that the filling ratio was 100 % because the pressure did not increase any more ), the operation of the v - shaped disc press was started at a rotational speed of 1 . 5 rpm ( bayer : 0 . 2 ) so that the discharge rate from the v - shaped disc press became 20 kg / h equal to the feed rate in terms of net weight of cellulose ether . dehydration was continued for about 2 hours while keeping the pressure at the inlet of the v - shaped disc press at 0 . 2 mpa . the results are shown in table 1 . the water content in the cake obtained by dehydration of the low - substituted hydroxypropyl cellulose was determined to be 70 . 1 % by weight of the water content of the material to be dehydrated . during operation , no reduction in the dehydration degree was observed . further , the amount of steam used in the step of drying was 0 . 50 when the amount of steam used in comparative example 1 is regarded as 1 . in comparative example 1 , a conventional dehydration method was employed and the water content of the cake obtained by dehydration was 82 . 5 % by weight of the water content of the material to be dehydrated . thus , the amount of steam was reduced greatly . hydrous low - substituted hydroxypropyl cellulose obtained in the same manner as in example 1 was supplied to a v - shaped disc press having no screw conveyer connected thereto , followed by dehydration . the dehydration was carried out as follows . the hydrous low - substituted hydroxypropyl cellulose , a material to be dehydrated , was supplied to the v - shaped disk having no screw conveyer connected thereto at a rate of 20 kg / h in terms of net weight of cellulose ether and an attempt was made to increase the filling ratio of the hydrous low - substituted hydroxypropyl cellulose in the v - shaped disc press by taking advantage of the weight of the hydrous low - substituted hydroxypropyl cellulose . however , the weight of the hydrous low - substituted hydroxypropyl cellulose alone could not increase the pressure at the inlet of the v - shaped disc press , and the pressure at the feed port remained at 0 mpa . the filling ratio became lower than that when the screw conveyer was used . the operation of the v - shaped disc press was then started but the discharge rate was 12 kg / h in terms of net weight of cellulose ether . dehydration was continued for about 2 hours . the results are shown in table 1 . the water content of the cake of the low - substituted hydroxypropyl cellulose obtained by dehydration was determined to be 82 . 5 % by weight of the water content of the material to be dehydrated . the operation of a screw conveyer was started first . hydrous low - substituted hydroxypropyl cellulose obtained in the same manner as in example 1 was supplied to the screw conveyer at a rate of 20 kg / h in terms of net weight of cellulose ether . at the time when the filling ratio of the hydrous low - substituted hydroxypropyl cellulose in the v - shaped disc press increased and the pressure at the inlet of the v - shaped disc press reached 0 . 2 mpa , the operation of the v - shaped disc press was started . it was operated at a discharge rate of 22 . 5 kg / h in terms of net weight of cellulose ether from the v - shaped disc press and a rotational speed of 2 . 3 rpm ( bayer : 0 . 3 ) so that the pressure at the inlet of the v - shaped disc press became 0 . 1 mpa . dehydration was continued for about 2 hours while keeping the pressure at the inlet of the v - shaped disc press at 0 . 1 mpa . the results are shown in table 1 . the water content of the cake of the low - substituted hydroxypropyl cellulose thus obtained by dehydration was determined to be 81 . 2 % by weight of the water content of the material to be dehydrated . the amount of steam used in the step of drying was 0 . 92 when the amount of steam used in comparative example 1 was regarded as 1 . in comparative example 1 , a conventional dehydration method was employed and the water content of the cake obtained by dehydration was 82 . 5 % by weight of the water content of the material to be dehydrated . it was evident that the filling ratio in the v - shaped disc press largely affected the water content . the operation of a screw conveyer was started first . hydrous low - substituted hydroxypropyl cellulose obtained in the same manner as in example 1 was supplied to the screw conveyer at a rate of 20 . 0 kg / h in terms of net weight of cellulose ether . at the time when the pressure at the inlet of a v - shaped disc press reached 0 . 2 mpa , the operation of the v - shaped disc press was started at a discharge rate of 24 . 8 kg / h in terms of net weight of cellulose ether from the v - shaped disc press and a rotational speed of 3 . 0 rpm ( bayer : 0 . 4 ). since the feed rate largely exceeded the discharge rate , the pressure at the inlet of the v - shaped disc press during operation was 0 mpa . dehydration was continued for about 2 hours at a discharge rate of 24 . 8 kg / h in terms of net weight of cellulose ether and a rotational speed of 3 . 0 rpm ( bayer : 0 . 4 ). the results are shown in table 1 . the water content of the cake of the low - substituted hydroxypropyl cellulose obtained by dehydration was determined to be 85 . 6 % by weight of the water content of the material to be dehydrated . the amount of steam used in the step of drying was 1 . 26 when the amount of steam used in comparative example 1 was regarded as 1 . in comparative example 1 , a conventional dehydration method was employed and the water content of the cake obtained by dehydration was 82 . 5 % by weight of the water content of the material to be dehydrated . when the throughput capacity of the v - shaped disc press exceeded that of the screw conveyer , the filling ratio in the compression type dehydrator decreased and the water content of the cake obtained by dehydration increased . a it means the water content of the cake obtained by dehydration when the water content of the material to be dehydrated is regarded as 100 % by weight . b it means the amount of steam when the water content 82 . 5 % of cake obtained by dehydration is regarded as 1 . 00 .	2
fig1 shows a schematic block diagram illustrating a network device 20 and terminal devices 10 , 11 , 12 according to an embodiment of the invention . the network device 20 such as an im ( instant messaging ) server , chat server or the like in a packet switched communication network such as an ip multimedia network ( e . g . an ip multimedia subsystem ( ims )) controls a session among at least two users , e . g . among at least two of terminal devices 10 , 11 , 12 shown in fig1 . the network device 20 comprises a recording block 21 for recording contents associated with the session in accordance with a recording request ( e . g . commands such as record , stop , pause , etc .) for recording the contents , and a notifying block 22 for notifying information on a status of recording by the recording block 21 . the network device 20 may further comprise an instantiating block 23 for instantiating a record event package for each recording session , wherein the notifying block 22 notifies information on the status of recording associated with the recording session . the recording block 21 may receive the recording request from one of users , e . g . from one of the terminal devices 10 - 12 involved in the session , and the notifying block 22 may notify the information on the status of recording upon receiving a subscription request . the recording request may be issued by a user or terminal device participating the session . alternatively , there may be a case where the user or terminal device that controls the recording is not a participant of the session , i . e . the recording request can be received from an authorized third party . in addition , not all participants of the session may be authorized to record . stated differently , there are at least two users in an established session , and there may be a controlling user who sends record commands to the session . moreover , the subscription request may be issued by a user or terminal device participating the session or by an authorized user or terminal device not participating the session . in the configuration shown in fig1 , sip may be used between the terminal devices 10 - 12 and the network device 20 as protocol for the recording request , subscription request and for notifying the information . fig2 shows a schematic block diagram illustrating a network device 50 and terminal devices 40 - 42 according to another embodiment of the invention . this embodiment differs from that shown in fig1 in that an http protocol such as xcap ( extensible markup language ( xml ) configuration access protocol ) is used by e . g . the terminal device 40 to send commands ( recording requests ), such as record , stop , pause , etc ., to the network device 50 . it is to be noted that the network devices and terminal devices shown in fig1 and 2 may have further functionality for working e . g . as application servers and ims terminal devices . here the functions of the network devices and terminal devices relevant for understanding the principles of the invention are described using functional blocks as shown in fig1 and 2 . the arrangement of the functional blocks of the network devices is not to be construed to limit the invention , and the functions of the recording , notifying and generating blocks may be grouped together in one block or further split into sub - blocks . the terminal devices 10 - 12 comprise e . g . ims mobile terminals , typically referred to as user equipments ( ues ). an ims mobile terminal attaches to a packet network , such as the gprs ( general packet radio services ) network , through a radio link . ims supports also other types of devices and accesses . personal digital assistants and computers are examples of terminal devices that can connect to the ims . examples of alternative accesses are wlan ( wireless local area network ) or adsl ( asymmetric digital subscriber line ). in the following an implementation example of the invention will be described with reference to fig3 . fig3 shows a diagram illustrating signaling between a user equipment ( ue ) 100 and an application server ( as ) 200 according to the configuration of fig1 . the terminal devices 10 - 12 comprise the user equipment 100 , and the network device 20 comprises the application server 200 . the idea is to develop a “ record ” event package in sip . for this purpose , the functionality is split as described below . when the ue 100 wants to start or stop recording of a session content , e . g . an im , in a network through which it communicates , the ue sends a publish request with an xml content indicating the “ user willingness ” for the network to record the conversation . as shown in fig3 , in message # 1 first of all the ue 100 establishes a new session or joins an existing multi - party session with a sip invite request which traverses allocated p - cscf ( proxy - cscf , not shown ) and s - cscf ( not shown ) which evaluates initial filter criteria and forwards the request to the application server 200 controlling the session . if the new session is created , the session invitation is then forwarded to at least one more user equipment ( not shown ), so that the session is established between at least two user equipments via the application server 200 . then , in message # 2 the ue 100 sends a sip publish request towards the as 200 with an indication of the user &# 39 ; s willingness to start the recording of the session content in the network in the format of a publication to the record event package . such indication can be contained directly in the sip headers of the publish request or as part of an enclosing body . upon receiving the publish request , the as 200 creates a new instance of the record event package ( procedure # 3 ). such instance contains the state information of the current recording conditions , including but not limited to : current state ( idle , recording , paused ), recorded time , size , pointer for retrieval , and any other relevant information . the as 200 may first check if a user associated with the sip publish request has activated or subscribed to a recording service ( to be described below ), and if so , check if the user has storage space left in the server . also other policy checks may be performed by the as 200 . a sip event package is an additional specification which defines a set of state information to be reported by a notifier ( i . e . the as 200 ) to a subscriber ( i . e . the ue 100 ) and to be published by a publisher ( i . e . the ue 100 ). event packages also define further syntax and semantics based on the framework defined by rfc 3265 required to convey such state information . the key part of this invention is the development of a sip event package ( per rfc 3265 ) that provides the means to publish record requests from the user , such as record , pause , stop , inform , etc ., and means to provide notifications ( recording , paused , idle ), any potential limit such as size , time , or number of messages , pointer for retrieval , etc . when the user wants to be informed of the status of the network recording feature , the ue 100 subscribes to the above - mentioned record event package that provides the ue 100 with information on the status of the recording activity . as shown in fig3 , in message # 4 the ue 100 sends a susbcribe request towards the as 200 in which the ue 100 subscribes to the record event package instantiated in procedure # 3 . the information on the status of the recording activity is sent in notify requests ( message # 7 ) that contain the status ( recording or not ), number of stored messages , storage size , any potential limit ( size , time , or number of messages ), time of start / stop , and any other type of information associated to the instance of the record event package . the application server 200 sends notify requests including the current status of the record event package to subscribed parties periodically , or whenever there has been a change in the state of the instantiated record event package . additionally , the application server 200 may have a policy that limits the number of notifications to avoid a high frequency of them . for example , the application server 200 may limit the number of notifications to one every 10 seconds . as the ue 100 has sent an instant message with the msrp ( message session relay protocol ) send request ( message # 5 ) which the as 200 has recorded according to the publish request ( message # 2 ) in a procedure # 6 , when notifying the number of stored messages in the notify request ( message # 7 ), one stored message is notified to the ue 100 . when the user wants to stop or pause an existing recording , the ue 100 sends a publish request that contains the stop or pause command according to the syntax of the recording event package . the application server 200 receives the publish request , acts accordingly , and sends a notify request to the subscriber ue 100 to inform about the new state , including but not limited to the current status ( idle , paused ), the total length and size of the current recording , a pointer for retrieval , and all the necessary information . fig4 . shows a signalling diagram corresponding to another embodiment describing the mechanism whereby a ue 400 sends commands ( e . g ., record , pause , stop ) to an application server as 500 implemented with xcap . the ue 400 uses an xcap put operation to send the commands ( record , pause , idle ) to the application server 500 . as shown in fig4 , in message # 2 the ue 100 sends an xcap put ( record ) request towards the as 200 indicating the user &# 39 ; s willingness to start the recording of the session content in the network . communications and procedures # 1 and # 3 -# 7 of fig4 correspond to those described in connection with fig3 . it must be noted that the xcap server can be separated to a standalone server outside the application server 500 ( not shown ), in which case an interface between the xcap server and the application server 500 is required . according to the invention , a server controlling user &# 39 ; s participation in a communication session also has a control over recording content of the session based on the instructions received from the user . it is to be understood that the above description is illustrative of the invention and is not to be construed as limiting the invention . various modifications and applications may occur to those skilled in the art without departing from the true spirit and scope of the invention as defined by the appended claims . particularly , the user equipment device in the description need not necessarily be governed by a human user , but rather the user equipment may be governed by an automaton . that is the case when , e . g ., the user equipment is the focus of a centralized conference , or when the user equipment is a service controller .	7
fig2 illustrates a first embodiment of the present invention . this embodiment will be described by using a printer as a peripheral device . since a cpu 102 is identical to that in fig1 its description will be omitted . the microcomputer 201 of the first embodiment comprises the cpu 102 , an sog region 203 to which is input a signal from the cpu 102 only when a mode switching signal input from an external input terminal 204 of the microcomputer 102 indicates a normal operation mode , a selection circuit 202 which selectively outputs to external terminals 2011 , 2012 and 2013 the output from the sog region when the mode switching signal input to the external input terminal 204 is in the normal operation mode , and the output from cpu when it is in the test mode , and a printer 104 supplied with signals to the external terminals 2011 , 2012 and 2013 . here , the mode switching signal from the external input terminal 204 indicates the normal operation mode in which an output from the sog region 203 is output to the external terminals 2011 , 2012 and 2013 . in other words , since the output of the sog region 203 is input to the printer 104 via the external terminals 2011 , 2012 and 2013 , the operation of this system is identical to that of the system in fig1 and the description of its operation will be omitted . note , however , that the signal line 1031 in fig1 is replaced in fig2 by signal lines 2031 , 2032 and 2033 corresponding to the signal lines 1021 , 1022 and 1023 from cpu 102 . fig3 illustrate a system for carrying out system debugging by the use of an externally provided gate array when a signal showing the test mode is input to the external input terminal 204 . a microcomputer 301 is constituted of cpu 102 , an sog region 203 , a selection circuit 202 , a gate array 302 to which are input signals from the external terminals 2011 , 2012 and 2013 via a signal line 3021 , and a printer 104 to which is input the output of the gate array 302 via a signal line 3022 . description about the parts identical to those in fig2 will be omitted . namely , the case in which a mode switching signal showing the test mode is input to the external input terminal 204 , and a signal of cpu 102 is output to the external terminals 2011 , 2012 and 2013 is illustrated in the figure . the signal from cpu 102 output to the external terminals 2011 , 2012 and 2013 is input to the gate array 302 having an interface function designed by the user . based on the signal received , a signal is output from the gate array 302 to the printer 104 . since the printer 104 is connected to confirm the operation of the system , use of any circuit is possible as long as it is a circuit to monitor the output information from the gate array 302 . as in the above , it is possible to input a signal from cpu 102 to the gate array 302 installed outside the microcomputer 301 via the external terminals 2011 , 2012 and 2013 . accordingly , it is possible to carry out debugging of the system by connecting the gate array 302 to the microcomputer 301 . shown in fig4 is a more detailed system configuration , especially the internal configuration of cpu 102 , of the first embodiment of the invention . the central processing unit 102 comprises a data bus 4011 through which data is input and output , an address bus 4012 through which an address is input and output , a control bus 4013 through which a control signal such as a read or write signal is input and output , an execution unit ( exu ) 402 connected to the data bus 4011 , the address bus 4012 and the control bus 4013 for generating an address and a control signals , and carries out data processing , a memory 403 connected to the data bus 4011 , the address bus 4012 and the control bus 4013 for storing or reading a program and data , based on the data , address and control signals , an i / o device 404 connected to the data bus 4011 , the address bus 4012 and the control bus 4013 for controlling the input and output of the data , address and control signals for cpu 102 , an sog control circuit 405 connected to the data bus 401 , the address bus 4012 and the control bus 4013 for outputting a control signal to signal lines 4051 and 4052 in response to an input , a switching circuit 406 connected to the signal lines 4051 , 4052 and 4053 to which is input a mode switching signal from the external input terminal 204 , and a gate array 407 to which is input a signal from the switching circuit 406 via signal lines 4061 , 4062 and 4063 . further , the sog control circuit 405 comprises an address decoder circuit 4054 which outputs an activation signal when an address designating the gate address 407 is input , an and circuit 4055 which outputs a read signal to a signal line 4041 when both the activation signal and the read signal on the control bus 4013 are activated , and an and circuit 4056 which outputs a write signal to a signal line 4052 when both the activation signal and the write signal on the control bus 4013 are activated . to the switching circuit 406 there are input a mode switching signal supplied from the external input terminal 204 , a signal from the data bus 4013 , and control signals from the sog control circuit 405 via the signal lines 4051 and 4052 . when the mode switching signal is in the normal operation mode which selects the sog region 203 , the and circuits 4064 and 4065 to which is input the mode switching signal are activated , the signals input to the signal lines 4051 , 4052 and 4053 are output by activating a tristate buffer 4068 to signal lines 4061 , 4062 and 4063 , respectively , which are in turn output to the gate array 407 . when the mode switching signal is in the test mode , the and circuits 4064 and 4065 are inactivated , and the input signals are not transmitted to the signal lines 4061 , 4062 and 4063 by inactivating the tristate buffers 4068 and 4069 , namely , the signals on respective signal lines are not transmitted to the gate array 407 . at this time , the signal lines 4051 , 4052 and the data bus 4053 are connected to the external terminals via the selection circuit which is not shown . further , the data bus 4067 within the switching circuit 406 is a bi - directional bus which is constituted of the two buffers 4068 and 4069 connected in mutually opposite directions to which are input signals of the and circuits 4064 and 4065 , respectively . at the time of reading , only the buffer 4068 on the read side is activated while at the time of writing , only the buffer 4069 on the write side is activated . in this way , the data bus 4067 transfers the data in both directions . in fig5 is shown the second embodiment of the invention . a microcomputer 501 is constituted of a cpu 102 , a gate array 407 , and a selection circuit 503 . the central processing unit 102 comprises an exu 402 connected to a data bus 4011 , an address bus 4012 and a control bus 4013 , and an output circuit 502 and an sog control circuit 405 . although a memory and an i / o controller are also connected to each bus , they are not shown in the figure . an output circuit 502 is activated only when pieces of information are output to external terminals 5011 , 5012 and 5013 . the selection circuit 503 connected to a write signal line 2031 , a read signal line 2032 and a data bus 2033 , inputs respective signals to the gate array 407 when the mode switching signal input from the external input terminal 204 is in the normal operation mode , and connects a read signal line 2031 and a write signal line 2032 to external terminals 5014 and 5015 , respectively , when the mode switching signal is in the test mode . however , when the number of the external terminals connected to an sog region 203 is small , the data on the data bus 2033 cannot be output to the outside of the microcomputer 501 . accordingly , by noting the fact that when the mode switching signal is in the test mode , the output circuit 502 is inactivated because cpu 102 is transferring signals between the sog region 203 within the microcomputer 501 , the signal of the data bus 4011 is output to the outside by using the external terminals 5011 , 5012 and 5013 that are not in use . in order to do this , it is only needed to connect the data bus 4011 to the external terminal 5012 via the selection circuit 507 . debugging of the system can be done by connecting the external terminals 5014 , 5015 and 5012 to the gate array provided in the outside . as in the above , even when the number of external terminals used by the sog region is smaller than the number of signals from cpu 102 , it is possible to debug the gate array 407 by using a signal of a system data bus 5017 output to another system from cpu 102 . in fig6 is shown the third embodiment of this invention . a microcomputer 601 comprises a cpu 102 having a read only memory ( rom ) 603 , a sog region 203 , and a decoder 602 which is connected to a selection circuit 202 and external input terminals 6011 and 6012 , and its control signal is input to cpu 102 , rom 603 and the selection circuit 202 via signal lines 6021 , 6022 and 6023 , respectively . the decoder circuit 602 receives control signals through the terminals 6011 and 6012 , and switches , based on the control signals , among the test mode of rom 603 , the test mode of cpu 102 , the test mode of the sog region 203 and the normal operation mode . when the external input terminals 6011 and 6012 are both at low levels , the control signal line 6021 alone is activated and the system goes to the test mode of cpu 102 , which is the mode to confirm the operation of cpu 102 by means of information output to external terminals 5011 , 5012 and 5013 . when the external input terminal 6011 is high and 6012 is low , the control signal line 6022 alone is activated and the system goes to the test mode of rom 603 , and carries out the internal test of the rom by isolating rom 603 from the various buses and using an externally provided rom ( not shown ). when the external input terminal 6011 is low and 6012 is high , the control signal line 6023 alone is activated , and the system goes to the above - mentioned test mode . finally , when both the external input terminals 6011 and 6012 are high , none of the signal lines is activated and the system goes to the above - mentioned test mode of the normal operation . although in each embodiment in the above the case has been shown in which the mode switching signals are given through the external input terminals , a configuration may also be chosen where the mode switching signals are given by the cpu . furthermore , the case where there is involved only one line for the data bus , address bus , control bus , and each signal line has been described , but the case when there are plural lines also work just as well .	6
fig1 is a block diagram illustrating a random access memory 10 . in one embodiment , random access memory 10 is a double data rate synchronous dynamic random access memory ( ddr sdram ). the ddr sdram 10 includes a memory controller 20 and at least one memory bank 30 . memory bank 30 includes an array of memory cells 32 , a row decoder 40 , a column decoder 44 , sense amplifiers 42 , and data in / out circuit 46 . in other embodiments , data in / out circuit 46 is separate from memory bank 30 . memory controller 20 is electrically coupled to memory bank 30 , indicated at 22 . conductive word lines 34 , referred to as row select lines , extend in the x - direction across the array of memory cells 32 . conductive bit lines 36 , controlled by the column select lines , extend in the y - direction across the array of memory cells 32 . a memory cell 38 is located at each cross point of a word line 34 and a bit line 36 . each word line 34 is electrically coupled to row decoder 40 and each bit line 36 is electrically coupled to a sense amplifier 42 . the sense amplifiers 42 are electrically coupled to column decoder 44 through conductive column decoder lines 45 and to data in / out circuit 46 through data lines 47 . data in / out circuit 46 includes data input / output ( i / o ) circuitry and pins ( dqs ) to transfer data between memory bank 30 and an external device . data to be written into memory bank 30 is presented as voltages on the dqs from an external device . the voltages are translated into the appropriate signals and stored in selected memory cells 38 . data read from memory bank 30 is presented by memory bank 30 on the dqs for an external device to retrieve . data read from selected memory cells 38 appears at the dqs once access is complete and the output is enabled . at other times , the dqs are in a high impedance state . the array of memory cells 32 includes a first portion of memory cells and a second portion of memory cells . a first portion of data lines 47 are configured to pass first data signals between a first portion of dqs and the first portion of memory cells and a second portion of data lines 47 are configured to pass second data signals between a second portion of dqs and the second portion of memory cells . the first and second portions of memory cells are configured to be made inaccessible to eliminate the first and second data signals respectively and the first and second portions of dqs respectively . memory controller 20 controls reading data from and writing data to memory bank 30 . during a read operation , memory controller 20 passes the row address of a selected memory cell 38 to row decoder 40 . row decoder 40 activates the selected word line 34 . as the selected word line 34 is activated , the value stored in each memory cell 38 coupled to the selected word line 34 is passed to the respective bit line 36 . the value of each memory cell 38 is read by a sense amplifier 42 electrically coupled to the respective bit line 36 . memory controller 20 also passes a column address of the selected memory cell 38 to column decoder 44 . column decoder 44 selects which sense amplifiers 42 pass data to data in / out circuit 46 for retrieval by an external device . during a write operation , the data to be stored in array 32 is placed in data in / out circuit 46 by an external device . memory controller 20 passes the row address for the selected memory cell 38 where the data is to be stored to row decoder 40 . row decoder 40 activates the selected word line 34 . memory controller 20 passes the column address for the selected memory cell 38 where the data is to be stored to column decoder 44 . column decoder 44 selects which sense amplifiers 42 are passed the data from data in / out circuit 46 . sense amplifiers 42 write the data to the selected memory cell 38 through bit lines 36 . fig2 illustrates an exemplary embodiment of one memory cell 38 in the array of memory cells 32 . memory cell 38 includes a transistor 48 and a capacitor 50 . the gate of transistor 48 is electrically coupled to word line 34 . the drain - source path of transistor 48 is electrically coupled to bit line 36 and capacitor 50 . capacitor 50 is charged to represent either a logic 0 or a logic 1 . during a read operation , word line 34 is activated to turn on transistor 48 and the value stored on capacitor 50 is read by a corresponding sense amplifier 42 through bit line 36 and transistor 48 . during a write operation , word line 34 is activated to turn on transistor 48 and the value stored on capacitor 50 is written by a corresponding sense amplifier 42 through bit line 36 and transistor 48 . the read operation on memory cell 38 is a destructive read operation . after each read operation , capacitor 50 is recharged with the value that was just read . in addition , even without read operations , the charge on capacitor 50 discharges over time . to retain a stored value , memory cell 38 is refreshed periodically by reading the value from and then writing the value back to the memory cell 38 . all memory cells 38 within the array of memory cells 32 are periodically refreshed to maintain their values . in ddr sdram , the read and write operations are synchronized to a system clock . the system clock is supplied by a host system including the ddr sdram 10 . operations are performed on both the rising and falling edges of the system clock . ddr sdram uses a double data rate architecture to achieve high speed operation . the double data rate architecture is essentially a 2 n prefetch architecture with an interface designed to transfer two data words per clock cycle at the dqs . a single read or write access for the ddr sdram effectively consists of a single 2 n bit wide , one clock cycle data transfer at the internal memory array and two corresponding n bit wide , one half clock cycle data transfers at the dqs . a bidirectional data strobe ( dqs ) is transmitted externally along with data for use in data capture at data in / out circuit 46 . dqs is a strobe transmitted by the ddr sdram during read operations and by an external memory controller during write operations . dqs is edge aligned with data for read operations and center aligned with data for write operations . input and output data is registered on both edges of dqs . ddr sdram operates from a differential clock , ck and bck . the crossing of ck going high and bck going low is referred to as the positive edge of ck . commands such as read and write operations , including address and control signals , are registered at the positive edge of ck . read and write accesses to the ddr sdram are burst oriented . accesses start at a selected location and continue for a programmed number of locations in a programmed sequence . accesses begin with the registration of an active command , which is followed by a read or write command . the address bits registered coincident with the active command are used to select the bank and row to be accessed . the address bits registered coincident with the read or write command are used to select the bank and the starting column location for the burst access . fig3 is a block diagram illustrating an exemplary embodiment of ddr sdram 10 with an array of memory banks 31 . the array of memory banks 31 includes four memory banks , bank zero through bank three , indicated at 30 a - 30 d . each memory bank 30 a - 30 d includes all of the circuitry of memory bank 30 illustrated in fig1 and previously described . in one embodiment , a single data in / out circuit 46 is shared by memory banks 30 a - 30 d . multiple memory banks 30 a - 30 d increase the storage capacity of ddr sdram 10 and reduce the access time of ddr sdram 10 as one bank can be prepared for access while another bank is being accessed . fig4 illustrates a portion of bank zero 100 a and a portion of bank one 100 b of ddr sdram 10 . in the exemplary embodiment , ddr sdram 10 is in a × 16 dq organization . the portion of bank zero 100 a includes word line 34 a , multiple bit lines , blocks of memory cells 110 a , 112 a , 114 a , and 116 a , even and odd data dividing line 102 a , and data lines 120 a , 122 a , 124 a , and 126 a . the portion of bank one 100 b includes word line 34 b , multiple bit lines , blocks of memory cells 110 b , 112 b , 114 b , and 116 b , even and odd data dividing line 102 b , and data lines 120 b , 122 b , 124 b , and 126 b . the portion of bank zero 100 a and the portion of bank one 100 b use data lines dl 1 & lt ; 0 : 7 & gt ; 130 , dl 2 & lt ; 0 : 7 & gt ; 132 , dl 1 & lt ; 8 : 15 & gt ; 134 , and dl 2 & lt ; 8 : 15 & gt ; 136 . in the portion of bank zero 100 a , each block of memory cells 110 a , 112 a , 114 a , and 116 a , includes at least eight memory cells 38 along word line 34 a the memory cells 38 of block 110 a are electrically coupled to data line 120 a through sense amplifiers 42 of bank zero 30 a . the memory cells 38 of block 112 a are electrically coupled to data line 122 a through sense amplifiers 42 of bank zero 30 a . the memory cells 38 of block 114 a are electrically coupled to data line 124 a through sense amplifiers 42 of bank zero 30 a and the memory cells 38 of 116 a are electrically coupled to data line 126 a through sense amplifiers 42 of bank zero 30 a . data line 120 a is electrically coupled to data line dl 1 & lt ; 0 : 7 & gt ; 130 . data line 122 a is electrically coupled to data line dl 2 & lt ; 0 : 7 & gt ; 132 . data line 124 a is electrically coupled to data line dl 1 & lt ; 8 : 15 & gt ; 134 and data line 126 a is electrically coupled to data line dl 2 & lt ; 8 : 15 & gt ; 136 . for the portion of bank one 100 b , each block of memory cells 110 b , 112 b , 114 b , and 116 b , includes at least eight memory cells 38 along word line 34 b . the memory cells 38 of block 110 b are electrically coupled to data line 120 b through sense amplifiers 42 of bank one 30 b . the memory cells 38 of block 112 b are electrically coupled to data line 122 b through sense amplifiers 42 of bank one 30 b . the memory cells 38 of block 114 b are electrically coupled to data line 124 b through sense amplifiers 42 of bank one 30 b and the memory cells 38 of 116 b are electrically coupled to data line 126 b through sense amplifiers 42 of bank one 30 b . data line 120 b is electrically coupled to data line dl 1 & lt ; 0 : 7 & gt ; 130 . data line 122 b is electrically coupled to data line dl 2 & lt ; 0 : 7 & gt ; 132 . data line 124 b is electrically coupled to data line dl 1 & lt ; 8 : 15 & gt ; 134 and data line 126 b is electrically coupled to data line dl 2 & lt ; 8 : 15 & gt ; 136 . data lines 120 a , 122 a , 124 a , 126 a , 120 b , 122 b , 124 b , 126 b , dl 1 & lt ; 0 : 7 & gt ; 130 , dl 2 & lt ; 0 : 7 & gt ; 132 , dl 1 & lt ; 8 : 15 & gt ; 134 , and dl 2 & lt ; 8 : 15 & gt ; 136 are data busses or other suitable data transmission lines for carrying at least eight data bits at a time to pass data into or out of the portion of bank zero 100 a and the portion of bank one 100 b . in other embodiments , the data lines are configured for carrying any suitable number of data bits . word lines 34 a and 34 b activate the selected memory cells 38 during a read or write operation as previously described . in the exemplary embodiment , ddr sdram 10 is in a × 16 dq organization and 32 data bits are read , two per dq , per memory read access . likewise , 32 data bits are written , two per dq , per memory write access . the first 16 data bits on the dqs are referred to as the even data bits . the second 16 data bits on the dqs are referred to as the odd data bits . the array of memory cells 32 in each bank 30 a - 30 d of ddr sdram 10 is divided into even and odd sections to facilitate the data transfer . even and odd data dividing line 102 a divides the upper and lower half of bank zero portion 100 a . the lower half of bank zero portion 100 a includes block 110 a and block 114 a , which represent the even data . the upper half of bank zero portion 100 a includes block 112 a and block 116 a , which represent the odd data . even and odd data dividing line 102 b divides the upper and lower half of bank one portion 100 b . the lower half of bank one portion 100 b includes block 110 b and block 114 b , which represent the even data . the upper half of bank one portion 100 b includes block 112 b and block 116 b , which represent the odd data . data line 120 a passes data from the memory cells 38 in block 110 a to data line dl 1 & lt ; 0 : 7 & gt ; 130 during a read operation . data line 120 a passes data from data line dl 1 & lt ; 0 : 7 & gt ; 130 to memory cells 38 in block 110 a during a write operation . data line 120 b passes data from the memory cells 38 in block 110 b to data line dl 1 & lt ; 0 : 7 & gt ; 130 during a read operation . data line 120 b passes data from data line dl 1 & lt ; 0 : 7 & gt ; 130 to memory cells 38 in block 110 b during a write operation . data lines 122 a and 122 b with data line dl 2 & lt ; 0 : 7 & gt ; 132 perform the same finction for their respective blocks 112 a and 112 b as data lines 120 a and 120 b . data lines 124 a and 124 b with data line dl 1 & lt ; 8 : 15 & gt ; 134 perform the same finction for their respective blocks 114 a and 114 b as data lines 120 a and 120 b and data lines 126 a and 126 b with data line dl 2 & lt ; 8 : 15 & gt ; 136 perform the same function for their respective blocks 116 a and 116 b as data lines 120 a and 120 b . data line dl 1 & lt ; 0 : 7 & gt ; 130 passes data from data lines 120 a and 120 b to the first eight dqs ( eight least significant dqs ) to output as even data . data line dl 2 & lt ; 0 : 7 & gt ; 132 passes data from data lines 122 a and 122 b to the first eight dqs to output as odd data . data line dl 1 & lt ; 8 : 15 & gt ; 134 passes data from data lines 124 a and 124 b to the second eight dqs ( eight most significant dqs ) to output as even data . data line dl 2 & lt ; 8 : 15 & gt ; 136 passes data from data lines 126 a and 126 b to output as odd data . on the rising edge of a clock pulse , the data on data lines dl 1 & lt ; 0 : 7 & gt ; 130 and dl 1 & lt ; 8 : 15 & gt ; 134 is output to the 16 dqs and on the falling edge of the clock pulse , the data on data lines dl 2 & lt ; 0 : 7 & gt ; 132 and dl 2 & lt ; 8 : 15 & gt ; 136 is output to the 16 dqs . one of the banks 30 a - 30 d is read from or written to during each memory access . further , one portion of one bank 30 a - 30 d , such as the portion of bank zero 100 a or the portion of bank one 100 b , is read from or written to during each memory access . the other portions of bank zero 30 a and bank one 30 b are treated similar to the portion of bank zero 100 a and the portion of bank one 100 b . in addition , bank two 30 c and bank three 30 d of ddr sdram 10 are treated similar to bank zero 30 a and bank one 30 b . to reduce the size of ddr sdram 10 , one of at least two options , cut option one 140 and cut option two 142 , can be selected . fig4 illustrates cut options 140 and 142 for the portion of bank zero 100 a and the portion of bank one 100 b . in the portion of bank zero 100 a , cut option one 140 includes blocks 114 a and 116 a and cut option two 142 includes blocks 110 a and 112 a . likewise , in the portion of bank one 100 b , cut option one 140 includes blocks 114 b and 116 b and cut option two 142 includes blocks 110 b and 112 b . if cut option one 140 is selected , blocks 114 a , 116 a , 114 b , and 116 b are no longer used . selecting cut option one 140 also makes data lines 124 a , 126 a , 124 b , and 126 b no longer needed . with data lines 124 a , 126 a , 124 b , and 126 b no longer needed , data lines dl 1 & lt ; 8 : 15 & gt ; 134 and dl 2 & lt ; 8 : 15 & gt ; 136 also are no longer needed and the second eight dqs are no longer needed . if cut option two 142 is selected , blocks 110 a , 112 a , 110 b , and 112 b are no longer used . selecting cut option two 142 makes data lines 120 a , 122 a , 120 b , and 122 b no longer needed . with data lines 120 a , 122 a , 120 b , and 122 b no longer needed , data lines dl 1 & lt ; 0 : 7 & gt ; 130 and dl 2 & lt ; 0 : 7 & gt ; 132 also are no longer needed and the first eight dqs are no longer needed . selecting cut option one 140 deactivates the portions of the array of memory cells 32 of banks 30 a - 30 d that are electrically coupled to the upper eight dqs . selecting cut option two 142 deactivates the portions of the array of memory cells 32 of banks 30 a - 30 d that are electrically coupled to the lower eight dqs . selecting either cut option one 140 or cut option two 142 reduces the addressable memory size of ddr sdram 10 by one half . therefore , with cut option one 140 or cut option two 142 selected , 16 data bits are accessed per read or write operation instead of the original 32 data bits . the ddr sdram 10 in a × 16 dq organization is reduced to a × 8 organization . fig5 is a diagram illustrating an exemplary embodiment of block 114 a and an associated redundant block 214 a . block 114 a includes word line 34 a , data line 124 a , and part of cluster fail 150 . block 214 a includes word line 34 a , data line 224 a , and part of cluster fail 150 . the data lines 124 a and 224 a are electrically coupled to data line dl 1 & lt ; 8 : 15 & gt ; 134 . block 214 a and data line 224 a include the same features as block 114 a and data line 124 a previously described . block 214 a and data line 224 a , however , are not used unless a defect , such as a cluster fail , in block 114 a or data line 124 a prevents block 114 a from being used . similarly , blocks 110 a , 112 a , 116 a , 110 b , 112 b , 114 b , and 116 b shown in fig4 also have an associated redundant block and data line . in the exemplary embodiment , cluster fail 150 extends into block 114 a and 214 a . therefore , neither block 114 a nor block 214 a can be used . cluster fail 150 renders ddr sdram 10 defective , preventing ddr sdram 10 from being sold in a × 16 dq organization . by selecting cut option one 140 , however , blocks 114 a and 214 a are no longer used and cluster fail 150 is bypassed . the resulting ddr sdram 10 in a × 8 organization is not defective and can be sold . fig6 is a block diagram illustrating an exemplary embodiment of a data line multiplexing circuit 306 for cut option one 140 and cut option two 142 . multiplexing circuit 300 is part of data in / out circuit 46 and is used to route data to the lower eight dqs if either cut option one 140 or cut option two 142 is selected . multiplexing circuit 300 includes multiplexers 302 and 304 . multiplexer 302 receives input data lines dl 1 & lt ; 0 : 7 & gt ; 130 and dl 2 & lt ; 0 : 7 & gt ; 132 and select lines cut option one 140 select line ( sc 1 ) and cut option two 142 select line ( sc 2 ). multiplexer 304 receives input data lines dl 1 & lt ; 8 : 15 & gt ; 134 and dl 2 & lt ; 8 : 15 & gt ; 136 and select lines sc 1 and sc 2 . if sc 1 is true , indicated as a logic high level ( logic 1 ), and sc 2 is false , indicated as a logic low level ( logic 0 ), cut option one 140 is selected . if sc 2 is true , indicated as a logic high level ( logic 1 ), and sc 1 is false , indicated as a logic low level ( logic 0 ), cut option two 142 is selected . sc 1 and sc 2 are not both set true as that would result in none of ddr sdram 10 being addressable . sc 1 and sc 2 are shorted to a logic high level or a logic low level during the manufacturing and testing process of ddr sdram 10 . selecting cut option one 140 results in data on data lines dl 1 & lt ; 8 : 15 & gt ; 134 and dl 2 & lt ; 8 : 15 & gt ; 136 being ignored , indicated at 312 , and data on data lines dl 1 & lt ; 0 : 7 & gt ; 130 and dl 2 & lt ; 0 : 7 & gt ; 132 passing through to data lines dl 1 / 2 & lt ; 0 : 7 & gt ; 306 , indicated at 314 . selecting cut option two 142 results in data on data lines dl 1 & lt ; 8 : 15 & gt ; 134 and dl 2 & lt ; 8 : 15 & gt ; 136 being passed through to data lines dl 1 / 2 & lt ; 0 : 7 & gt ; 306 , indicated at 310 , and data on data lines dl 1 & lt ; 0 : 7 & gt ; 130 and dl 2 & lt ; 0 : 7 & gt ; 132 being ignored , indicated at 316 . selecting neither cut option one 140 nor cut option two 142 results in the data on data lines dl 1 & lt ; 0 : 7 & gt ; 130 and dl 2 & lt ; 0 : 7 & gt ; 132 passing to data lines dl 1 / 2 & lt ; 0 : 7 & gt ; 306 and data on data lines dl 1 & lt ; 8 : 15 & gt ; 134 and dl 2 & lt ; 8 : 15 & gt ; 136 passing to data lines dl 1 / 2 & lt ; 8 : 15 & gt ; 308 . fig7 a and 7 b are block diagrams illustrating an exemplary embodiment of the portion of bank zero looa before and after cut option one 140 is selected . in this embodiment the portion of bank zero 100 a illustrated in fig7 a is a portion of a 512 - mbit × 16 ddr sdram with 32 data bits per memory access . the portion of bank zero 100 a illustrated in fig7 b is a portion of the 512 - mbit × 16 ddr sdram after it is reduced to a 256 - mbit × 8 ddr sdram with 16 data bits per memory access . as illustrated in fig7 a , 32 data bits can be accessed during a read or write operation of the 512 - mbit × 16 ddr sdram . when the 512 - mbit × 16 ddr sdram is cut down to the 256 - mbit × 8 ddr sdram illustrated in fig7 b , 16 of the data bits can no longer be accessed . the memory cells within blocks 114 a and 116 a are no longer addressable . in addition , data lines dl 1 & lt ; 8 : 15 & gt ; 134 and dl 2 & lt ; 8 : 15 & gt ; 136 are no longerused . the portions of memory array 32 of banks 30 a - 30 d that are included in cut option one 140 are deactivated ( made inaccessible ) by blowing fuses for the corresponding bit lines 36 , by blowing fuses for the corresponding data lines , or in any other suitable manner . the 512 - mbit × 16 ddr sdram with 16 dqs and a 16 k page size is cut down to produce a conforming 256 - mbit × 8 ddr sdram with eight dqs and an 8 k page size . this same method can apply to other dq organizations as well . for example , a 512 - mbit × 8 ddr sdram can be cut down to produce a conforming 256 - mbit × 4 ddr sdram .	6
fig1 depicts a plate fin and tube heat exchanger 10 containing plate fins 12 that embody the present invention . each plate fin has a plurality of holes 16 . a common method of manufacturing heat exchanger 10 is to first assemble a plurality of plate fins 12 between two tube sheets 18 , then lace a plurality of hairpin tubes 20 through selected holes 16 in the plate fins 12 and similar holes 16 in each of tube sheets 18 . the heat exchanger assembly is completed by fitting up a plurality of return bends 22 to the ends of hairpin tubes 20 so as to form one or more closed fluid flow paths through the tubes of the heat exchanger . when installed and operating in a device such as an air conditioner , a first fluid , such as a refrigerant , flows through heat exchanger 10 via a fluid flow path or paths defined by interconnected hairpin tubes 20 and return bends 22 . a second fluid , such as air , flows over and around plate fins 12 and tubes 20 . if there is a temperature differential between the two fluids , then heat transfer from the warmer to the cooler of the two takes place through the tube walls and plate fins . turning to fig2 , a single tube 20 is shown disposed through a plurality of plate fins 12 . each plate fin 12 is provided with an upstanding fin collar 30 disposed around the openings 16 . as shown , the collar 30 may be curved so that a convex surface 31 faces the tube 20 . the number of plate fins 12 that can be placed around the tube 20 is determined by the height of the collar 30 . in order to manufacture the heat exchanger of the present invention , the tube 20 to fin 12 joint is brazed in a controlled atmosphere braze furnace . the brazing temperatures will range between 1070 ° f . and 1120 ° f . depending on the clad used . the tube 20 may be constructed of an aluminum alloy that is clad or unclad . the tube 20 may be roll formed with a welded seam or a lock seam . as an alternative , the tube 20 may be extruded . the tube 20 may have a wall thickness of 0 . 016 ″ to 0 . 05 ″ depending on the tube diameter and the working pressure . the tube 20 may have a cross - sectional shape that is round , circular , oval , or the like . the tube material is a long life , high strength , corrosion resistant alloy . for extruded tubes , a 3003 aluminum alloy may be used . for roll formed tube an alcan x - 1000 may be used . the clad alloys may be 4045 or 4343 aluminum alloys . the fins 12 and fin collar 30 may be constructed out of an aluminum alloy 3003 with a 4045 or 4343 alloy clad . if unclad , the fin may be constructed from an 1100 aluminum alloy . the fins may be constructed with a thickness of 0 . 003 ″ to 0 . 016 ″. in addition to the aluminum alloys described above , the present invention may be used for brazing a copper fin to copper tubing or brazing an aluminum fin to copper tubing , as will be evident to those of ordinary skill in the art . in fig3 , a first embodiment of the fin collar 30 of the present invention is shown . a plurality of slits 32 are disposed around the circumference of the fin collar 30 . the slits 32 may be formed by removing material from the collar and may be disposed equidistantly around the perimeter of the collar 30 . the slit may extend from the top 43 of the collar 30 and terminate at a point approximately 0 . 02 ″ from the underside of the fin . the slit 32 is defined by a pair of opposed walls 34 and 36 . the walls 34 and 36 may be angled such that the width 40 across the slit 32 gradually increases from the bottom 42 of the slit 32 to the top 43 of the collar 30 . the slit 32 may range from 0 . 015 ″ to 0 . 15 ″ in width depending on the collar height and the number of slits . the slits 32 improve the tube - to - fin joint both thermally and structurally . with regard to structural properties at the joint , the fin collar 30 of the present invention enhances the flux application and the brazing clad flow because the slits 32 allow the cladding to flow through on both sides of the collar 30 . with regard to heat transfer performance , the split fin collar 30 increases heat transfer between the air and tube surfaces . the slits 32 open access to a portion of the surface of the primary tube 20 for the air flow allowing direct heat transfer from air to the tube 20 without the resistance from secondary sources . ordinarily these portions of the primary tube 20 would be covered by a solid fin collar . turning to fig4 , an alternate embodiment of the fin collar of the present invention is shown . fin collar 40 has a rectangular - shaped slit 42 . the slit 42 is defined by a bottom wall 44 and opposed side walls 46 and 48 . the bottom wall 44 may extend to a point approximately 0 . 02 ″ from the underside of the fin 12 . the collars 40 may have a curvature such that they have a convex shape on the side that faces the tubes 20 . in fig5 , another alternate embodiment of the fin collar of the present invention is shown . fin collar 60 is elongated in the longitudinal ( tube axis ) direction . the collar 60 has a plurality of slits 62 defined therein . the slits 62 also have a rectangular shape and are defined by a bottom wall 64 and a pair of opposed side walls 66 , 68 . the bottom wall 64 may extend to a point approximately 0 . 02 ″ from the underside of the fin 12 . in fig6 and 7 , the fin collar 30 of the present invention is shown with arrows 70 representing air flow around the collar 30 during use . the shape of the fin collar 30 provides interruptions around the circumference of the fin collar 30 perpendicular to air flow . the interruptions will provide turbulence , which is indicated by curved lines 80 , in the boundary layer of air along the fin collar 30 which will increase the rate of heat transfer between the air and the tube 20 . the increased turbulence will also occur around the area near the base of the fin collar 30 in the area of highest fin efficiency , increasing heat transfer rates in that area . while the invention has been described in connection with certain embodiments , it is not intended to limit the scope of the invention to the particular forms set forth , but , on the contrary , it is intended to cover such alternatives , modifications , and equivalents as may be included within the spirit and scope of the invention as defined by the appended claims .	5
referring now to the figures , wherein like reference numbers indicate like elements , fig1 shows a flash - spinning spinneret device 1 connected to a polymer solution supply source . polymer solution 2 under pressure is fed through an orifice 3 into intermediate pressure or letdown pressure zone 4 and then through spinning orifice 5 into web forming chamber 6 . the extrudate from spinning orifice 5 is a plexifilamentary strand 7 . due to the pressure drop at spinning orifice 5 and the high temperature of the spinning solution , vaporization of solvent ( i . e ., fluid medium ) creates a vapor blast which , by passage along the surface of baffle 8 concomitantly with plexifilament 7 , generally follows the path of advance from spinning orifice 5 to collection surface 9 , thereby creating a flow pattern within chamber 6 as indicated by the arrows in fig1 . baffle 8 is mounted on shaft 10 which is mounted in bearing 11 and is rotated by means not shown . the surface of baffle 8 is contoured so that the plexifilamentary strand 7 issuing from orifice 5 is deflected into a generally vertical plane and simultaneously spread laterally to form a plexifilamentary web 21 which oscillates from side - to - side as baffle 8 is rotated . the plexifilamentary web 21 passes from baffle 8 directly into the aerodynamic shield which is comprised of front member 18 and a rear member comprising elements 13 and 17 . multineedle ion gun 14 is mounted on the interior surface of front member 18 , and is connected to constant current power source 35 which supplies a potential that depends upon the fluid medium utilized . in the case of trichlorofluoromethane (&# 34 ; cfc - 11 &# 34 ;), a potential of approximately 50 - 60 kilovolts ( kv ) is necessary . a corona discharge occurs between needles 14 and target plate 13 which is disposed so that the vapor blast originating at 5 and deflected by baffle 8 carries the plexifilamentary web along its charging surface . target plate 13 is connected via commutating ring and brushes to ground by wire 15 and microammeter 16 which indicates target plate current . target plate 13 is an annular metal disc electrode , and is preferably covered with a dielectric insulating surface as disclosed in u . s . pat . no . 3 , 578 , 739 . target plate 13 together with concentric annular segment 17 comprise the rear member of the aerodynamic shield , and are adapted to be rotated concentrically with , but independent of , baffle 8 by means not shown . during rotation of the rear member , its interior surface passes by rotating brush 20 , driven by means not shown , so that the surface of target plate 13 and adjacent parts may be cleared of any debris , thereby furnishing a continuously cleaned surface for optimum operation of the corona discharge . at intervals , in a circular pattern , the rear shield member is pierced by ports 19 through which ambient gas may be aspirated into the step region between concentric disc segments 13 and 17 . after exiting the aerodynamic shield , plexifilamentary web 21 is deposited upon a moving collection surface 9 by impinging on the collection surface at a fiber deposition point . the collection surface is shown moving in direction m . the surface illustrated is a continuous electrically conductive belt forwarded by drive roll 36 . the belt may either be grounded or charged to a positive or negative potential by power source 37 . due to differences in their electrostatic charge , the plexifilamentary web 21 is attracted to collection surface 9 and clings to it in its arranged condition as a swath 38 with sufficient force to overcome the disruptive influences of whatever vapor blast may reach the impingement area . according to the invention , pinning of the plexifilamentary web 21 to collection surface 9 is enhanced by the electrostatic field generated by auxiliary electrostatic field enhancing plate 50 which is charged by power supply 52 . in a preferred embodiment , a curved shield 54 is attached to plate 50 to prevent fibers from depositing on the tip of the plate ( see fig2 and 3 ). wide sheets are produced by blending and overlapping the output ( i . e ., swaths ) from several spinning positions placed in an appropriate manner across the width of a receiving surface such as the collection surface 9 . the sheet is then lightly compacted by roll 41 and is collected on windup roll 42 after passing through port 39 and flexible elements ( or rolls ) 40 which assist in retention of vapor within chamber 6 . a conventional solvent recovery unit 44 may be beneficially employed for environmental considerations and to improve economic operation . the inventive apparatus utilizes an electrostatic field enhancing plate 50 positioned above the collection belt and downstream from the fiber deposition point . it will be understood that another electrostatic field enhancing plate 50 ( not shown ) may be placed slightly upstream of the fiber deposition point to further aid web pinning , however this arrangement is not critical to the invention . this arrangement may be helpful in some operations since the web is directed towards the collection belt on a slight upstream angle to help in web laydown . in this embodiment , the plate 50 is flat although this is not critical to the invention . plate 50 should be made of metal ( e . g ., steel or nickel ) or other highly conductive material . plate 50 is attached to a high electrostatic voltage source 52 , which generates voltages of up to 100 kv . suitable voltage sources include commercial power supplies produced by del electronics , inc . of mt . vernon , ny , glassman high voltage , inc . of white horse station , nj or hipotronics , inc of hipo brew , ny . preferably , the plate is positioned between about 3 and 10 cm above the collection surface and between about 5 and 10 cm downstream from the fiber deposition point ( i . e ., laydown position ). as shown , the plate can be positioned parallel with the collection surface although it will understood that the plate may also be slightly slanted ( e . g ., 10 degrees from horizontal ). in a preferred embodiment as shown in more detail in fig3 shield 54 is attached to the leading edge of plate 50 . the purpose of shield 54 is to direct the plexifilaments underneath plate 50 , and to prevent the plexifilaments from depositing on the tip of the plate . shield 54 may be made of acrylic resin , polycarbonate resin , or other non - conductive material . such a suitable acrylic resin material is commercially available from e . i . du pont de nemours and company , wilimington , delaware under the trademark &# 34 ; lucite ®&# 34 ;. the magnitude of the electrostatic field generated by plate 50 will depend on the fluid medium inside the spinning cell , the charge on the fibers , and the aerodynamic forces acting on the fibers . pinning forces are a product of charge and electrostatic field . thus , fibers with high charge need less electrostatic field to pin as effectively as fibers with lower charge and high electrostatic field . the strength of the electrostatic field must not exceed the electrostatic breakdown potential of the surrounding fluid medium . the following is believed to be the most accurate data available for several fluid mediums useful in the invention . for trichlorofluoromethane , known in the trade as cfc - 11 and identified in the prior art as a commercial flash spinning agent , the breakdown potential is about 80 kv / cm . for hydrocarbons containing 4 to 6 carbon atoms , such as butane , pentane or hexane , the breakdown potential is about 50 kv / cm . for 2 , 2 - dichloro - 1 , 1 , 1 - trifluoroethane (&# 34 ; hcfc - 123 &# 34 ;) the breakdown potential is about 75 kv / cm , for 2 - chloro - 1 , 1 , 1 , 2 - tetrafluoroethane (&# 34 ; hcfc - 124 &# 34 ;), the breakdown potential is about 45 kv / cm and for pentafluoroethane (&# 34 ; hfc - 125 &# 34 ;), the breakdown potential is about 25 kv / cm . preferably , the impressed electrostatic field will be no greater than about 95 % of the breakdown potential of the fluid medium . as noted before , although the previous description has focused on flash - spinning operations , the process and apparatus of the present invention may also be advantageously applied to any of several fiber - forming processes in which fibers are formed and collected on a moving collection surface to make a fibrous web , for example , by melt - blowing or spunbonded processes . moreover , it will be understood that spinning orientation is arbitrary and that , as an example , fibers may be deposited horizontally on a vertical collection surface ( e . g ., some melt - blown processes ). the following example is provided for purposes of illustration only and not to limit the invention in any way . fig4 shows the results of a particular computational experiment conducted using a flash - spinning computer study . the lower curve ( a ) represents the prior art ( i . e ., the process and apparatus of brethauer et al ., u . s . pat . nos . 3 , 851 , 023 and 3 , 860 , 369 ) and shows the electrostatic field as a function of distance from a point directly beneath the spinning jet centerline ( i . e ., below the space defined by the center of elements 17 and 18 of fig1 ). the upper curve ( b ) represents the inventive process and apparatus and demonstrates that higher electrostatic fields are generated when a plate ( a flat plate in this case ) of about 12 inches ( 30 . 5 cm ) in width ( w ) and infinite length ( l ) is positioned about 2 1 / 2 inches ( 6 . 4 cm ) downstream ( d ) from the spinning jet centerline and about 3 inches ( 7 . 6 cm ) above ( h ) the collection surface , and is charged to an electrostatic potential of about 100 kv ( see fig2 and 3 ). in both of these curves , the electrostatic field was measured about 1 / 2 inch ( 1 . 3 cm ) above the collection surface . although particular embodiments of the present invention have been described in the foregoing description , it will be understood by those skilled in the art that the invention is capable of numerous modifications , substitutions and rearrangements without departing from the spirit or essential attributes of the invention . reference should be made to the appended claims , rather than to the foregoing specification , as indicating the scope of the invention .	1
fig1 shows a schematic diagram of an internal combustion engine starting system 10 according to an embodiment of the present invention . starting system 10 of fig1 comprises starter motor 14 , alternator 16 , battery 18 , power module 20 , solenoid 32 , and switch 40 . starter motor 14 is an internal combustion engine starter motor comprising a pinion gear ( not shown ). starter motor 14 is installed in a typical arrangement with an internal combustion engine ( not shown ), where the pinion gear of starter motor 14 drives a flywheel ring gear ( not shown ) on the internal combustion engine in order to crank the internal combustion engine . solenoid 32 is an internal combustion engine starter motor solenoid comprising pull - in coil 31 , hold - in coil 33 , and contacts 34 . alternator 16 is an internal combustion engine alternator . after the internal combustion engine has started , the alternator 16 is mechanically driven by the internal combustion engine and provides electric current to recharge battery 18 , and to fulfill the electrical needs of the vehicle or apparatus in which the internal combustion engine is installed . battery 18 is a battery , such as an automotive battery , comprising negative terminal 17 and positive terminal 19 . battery 18 is connected to alternator 16 such that battery 18 can be charged by the electrical current delivered from alternator 16 . switch 40 is an ignition switch of a type known in the art . power module 20 comprises m (+) terminal 22 , b (+) terminal 24 , neg (−) terminal 26 , c terminal 28 , capacitor 30 , relay 42 , relay 44 , control logic device 46 , and , optionally , diode 52 . relay 42 is an electrical relay comprising terminals 41 , 43 , and 45 . relay 42 is shown in fig1 as an electromechanical relay , however it is within the scope of the present invention to deploy a solid state relay as relay 42 . relay 44 is an electrical relay comprising terminals 47 , 49 , and 51 . relay 44 is shown in fig1 as a solid state relay , however it is within the scope of the present invention to deploy an electromechanical relay as relay 44 . terminal 45 of relay 42 is electrically connected to terminal 49 of relay 44 . in an embodiment , capacitor 30 is an electric double layer capacitor of the type referred to as a “ super capacitor ” or an “ ultra capacitor .” in an alternative embodiment , capacitor 30 may comprise a bank of capacitors . as shown fig1 , the positive lead of capacitor 30 is connected to terminal 43 of relay 42 . the negative lead of capacitor 30 is connected to neg (−) terminal 26 and to terminal 47 of relay 44 . control logic device 46 is electrically connected to c terminal 28 and to terminal 51 of relay 44 . the function of control logic device 46 according to the present invention is discussed hereinafter . the function of control logic device 46 may be deployed in a number of different physical forms as may occur to one of skill in the art . for example , control logic device 46 may be comprised of electronic logic devices or may comprise a microprocessor and associated software . b (+) terminal 24 is electrically connected to the positive terminal 19 of the battery 18 . c terminal 28 is electrically connected to node 50 , which is in the electrical path between the starter switch 40 and the solenoid 32 . the m (+) terminal 22 is electrically connected to b (+) terminal 24 , to terminal 41 of relay 42 , and to contacts 34 . diode 52 may be included between the m (+) terminal 22 and b (+) terminal 24 to prevent discharging of capacitor 30 into battery 18 . when relay 42 is closed , m (+) terminal 22 is electrically connected to capacitor 30 . when contacts 34 are closed , m (+) terminal 22 is electrically connected to starter motor 14 . neg (−) terminal 26 is electrically connected to ground . in an embodiment , power module 20 comprises an insulated casing with capacitor 30 , relay 42 , relay 44 , and control logic 46 contained inside the insulated casing , and m (+) terminal 22 , b (+) terminal 24 , neg (−) terminal 26 , and c terminal 28 protruding through the insulated case to electrically connect capacitor 30 , relay 42 , relay 44 , and control logic 46 to other components of the electrical system . in the embodiment of starting system 10 shown in fig1 , battery 18 and capacitor 30 are available to provide cranking current to starter motor 14 . when switch 40 is closed , current flows from battery 18 to pull - in coil 31 and hold - in coil 33 of solenoid 32 , causing the contacts 34 to close . closing contacts 34 short - circuits pull - in coil 31 , and causes the pinion gear of starter motor 14 to engage the flywheel ring gear of the internal combustion engine . when switch 40 is closed , the current flow / voltage change is detected by control logic device 46 at node 50 . upon sensing of this current / voltage change , control logic device 46 implements a short delay ( e . g ., less than one second ) before providing a control signal to relay 44 . when this control signal is applied to relay 44 , a path is established between the windings of relay 42 and ground . current flows through the windings of relay 42 , closing the relay contacts and establishing an electrical connection between capacitor 30 and m (+) terminal 22 . this allows the current from capacitor 30 to be delivered to starter motor 14 through closed contacts 34 . because of the delay implemented by control logic device 46 , the current from capacitor 30 is not delivered to starter motor 14 until the pinion gear of starter motor 14 has been given the opportunity to fully engage the flywheel ring gear of the internal combustion engine . in an embodiment of the present invention , control logic device 46 is designed to close relay 44 two - tenths ( 0 . 2 ) of a second after switch 40 is closed , and to open relay 44 thirty ( 30 ) seconds later or twenty - five ( 25 ) seconds after sensing a condition of greater than 14 volts at node 50 . other timing parameters may be selected according to the needs of a practitioner of the present invention , with each selected parameter falling within the scope of the present invention . because relay 44 is closed for a period of time after the internal combustion engine is started , capacitor 30 is allowed to be recharged by alternator 16 . once capacitor 30 is recharged , it must be prevented from discharging back into the battery . thus , relay 44 is opened after a pre - determined period of time , or upon the sensing of certain conditions . in an embodiment , control logic device 46 also is designed to open relay 44 if a voltage of less than six volts is sensed at node 50 . fig2 shows a schematic diagram of another embodiment of internal combustion engine starting system 10 according to the present invention . the embodiment of starting system 10 of fig2 comprises many of the same elements shown in fig1 . however , in the embodiment of starting system 10 of fig2 , relay 42 and relay 44 are replaced by a single relay 54 . in the embodiment shown in fig2 , relay 54 is a solid state relay comprising terminals 56 , 58 , and 59 , however it is within the scope of the present invention to use an electromechanical relay as relay 54 . terminal 56 of relay 54 is electrically connected to the positive lead of capacitor 30 . terminal 58 of relay 54 is electrically connected to m (+) terminal 22 . terminal 59 of relay 54 is electrically connected to control logic device 46 . in the embodiment of starting system 10 shown in fig2 , when switch 40 is closed , the current flow / voltage change is detected by control logic device 46 at node 50 . upon sensing of this current / voltage change , control logic device 46 implements a short delay ( e . g ., less than one second ) before providing a control signal to relay 54 . when this control signal is applied to relay 54 , relay 54 establishes an electrical connection between capacitor 30 and m (+) terminal 22 . this allows the current from capacitor 30 to be delivered to starter motor 14 through closed contacts 34 . because of the delay implemented by control logic device 46 , the current from capacitor 30 is not delivered to starter motor 14 until the pinion gear of starter motor 14 has been given the opportunity to fully engage the flywheel ring gear of the internal combustion engine . in an embodiment of the present invention , control logic device 46 is designed to close relay 54 two - tenths ( 0 . 2 ) of a second after switch 40 is closed , and to open relay 54 thirty ( 30 ) seconds later or twenty - five ( 25 ) seconds after sensing a condition of greater than 14 volts at node 50 . other timing parameters may be selected according to the needs of a practitioner of the present invention , with each selected parameter falling within the scope of the present invention . because relay 54 is closed for a period or time after the internal combustion engine is started , capacitor 30 is allowed to be recharged by alternator 16 . once the capacitor is recharged , it must be prevented from discharging back into the battery . thus , relay 54 is opened after a pre - determined period of time , or upon the sensing of certain conditions . in an embodiment , control logic device 46 also is designed to open relay 54 if a voltage of less than six volts is sensed at node 50 . as described above , power module 20 not only provides an additional power source for cranking an internal combustion engine , but also implements a delay between the time the ignition switch is closed and the time when the additional power source is called upon to provide cranking power for the internal combustion engine . in particular , power module 20 allows only one power source ( e . g ., a standard battery ) to be used when the pinion gear is moved into engagement with the flywheel ring gear , thereby limiting the rotational speed and force of the pinion gear as it moves into engagement with the flywheel ring gear . this reduces the chance for less than full engagement between the pinion gear and flywheel ring gear as they are moved together , and reduces the chance for milling between the pinion gear and ring gear once the drive shaft of the starter motor transmits torque to the pinion gear . fig3 shows a schematic diagram of a internal combustion engine starting system 10 according to another embodiment of the present invention . starting system 10 of fig3 comprises starter motor 14 , alternator 16 , battery 18 , capacitor 30 , solenoid 32 , switch 40 , optional diode 52 , and current limiting device 60 . starter motor 14 , alternator 16 , battery 18 , capacitor 30 , solenoid 32 , switch 40 , and optional diode 52 are described above in reference to fig1 and 2 . current limiting device 60 comprises a pulse width modulation circuit designed to interrupt direct current at predetermined intervals , thereby producing pulses of direct current . in an embodiment , current limiting device 60 comprises a dc chopper device . in the embodiment of starting system 10 shown in fig3 , when switch 40 is closed , current flows from battery 18 to pull - in coil 31 and hold - in coil 33 of solenoid 32 , causing contacts 34 to close . closing contacts 34 short - circuits pull - in coil 31 , and causes the pinion gear ( not shown ) of starter motor 14 to engage the flywheel ring gear of the motor vehicle engine . the current flow / voltage change through switch 40 is detected by current limiting device 60 at node 50 . upon sensing of this current / voltage change , current limiting device 60 operates to interrupt direct current from battery 18 and capacitor 30 at predetermined intervals . pulses of direct current are thereby delivered to motor 14 . after a predetermined period of time , current limiting device 60 ceases its direct current pulsing effect , and uninterrupted direct current from battery 18 and capacitor 30 then is delivered to motor 14 . the effect of the temporary direct current pulsing created by current limiting device 60 is to reduce the rotational acceleration of starter motor 14 , thus enhancing the probability of proper engagement between the pinion gear and the flywheel ring gear before the full current from battery 18 and capacitor 30 is delivered to starter motor 14 . in the embodiments shown in fig1 - 3 , an electric double layer capacitor is deployed as an additional voltage source for providing internal combustion engine cranking current . however , any number of voltage sources can be used , such as one or more additional batteries . these additional voltage sources enhance battery 18 during engine cranking , and help maintain battery 18 at a higher state of charge , thereby extending the life of battery 18 . in yet another embodiment , starting system 10 is adapted to include a sensor ( not shown ) that provides positional information about the pinion gear of motor 14 . in the embodiment of starting system 10 shown in fig1 and 2 , such a sensor may be used in lieu of control logic device 46 . in operation , the sensor is operable to detect when the pinion gear of motor 14 has moved to a point where it necessarily must be engaged with the internal combustion engine ring gear . when this degree of movement is detected , the sensor is operable to actuate relay 44 ( in the embodiment of fig1 ) or relay 54 ( in the embodiment of fig2 ), thereby making the electrical connection between capacitor 30 and motor 14 . in the context of the embodiment shown in fig3 , when this degree of movement of the pinion gear is detected , the sensor is operable to cause current limiting device 60 to permit uninterrupted direct current from battery 18 and capacitor 30 to be delivered to motor 14 . fig4 shows a schematic diagram of a internal combustion engine starting system 10 according to another embodiment of the present invention . starting system 10 of fig4 comprises starter motor 14 , alternator 16 , battery 18 , capacitor 30 , solenoid 32 , switch 40 , and current booster 70 . starter motor 14 , alternator 16 , battery 18 , capacitor 30 , solenoid 32 , and switch 40 are described above in reference to fig1 and 2 . current booster 70 is operable to enhance the current delivered from battery 18 to starter motor 14 . in an embodiment , current booster 70 comprises a dc - to - dc converter circuit operable to boost the voltage of battery 18 , thereby delivering additional cranking current to starter motor 14 . in the embodiment of starting system 10 shown in fig4 , when switch 40 is closed , current flows from battery 18 to pull - in coil 31 and hold - in coil 33 of solenoid 32 , causing contacts 34 to close . closing contacts 34 short - circuits pull - in coil 31 , and current flows from battery 18 to starter motor 14 causing the pinion gear ( not shown ) of starter motor 14 to engage the flywheel ring gear of the motor vehicle engine . the current flow / voltage change through switch 40 is detected by current booster 70 at node 50 . current booster 70 then is activated a predetermined period of time after the current flow / voltage change is detected at node 50 . when activated , current booster 70 boosts the voltage of battery 18 , thereby delivering additional cranking current to starter motor 14 . because of the delay implemented by current booster 70 , the stepped up current is not delivered to starter motor 14 until the pinion gear of starter motor 14 has been given the opportunity to fully engage the flywheel ring gear of the internal combustion engine . in an embodiment of the present invention , current booster 70 is activated two - tenths ( 0 . 2 ) of a second after switch 40 is closed , and deactivates thirty ( 30 ) seconds later or twenty - five ( 25 ) seconds after sensing a condition of greater than 14 volts at node 50 . other timing parameters may be selected according to the needs of a practitioner of the present invention , with each selected parameter falling within the scope of the present invention . while this invention has been described as having a preferred design , the present invention can be further modified within the scope and spirit of this disclosure . this application is therefore intended to cover any variations , uses , or adaptations of the invention using its general principles . each such implementation falls within the scope of the present invention as disclosed herein and in the appended claims . furthermore , this application is intended to cover such departures from the present disclosure as come within known or customary practice in the art to which this invention pertains and which fall within the limits of the appended claims .	5
a sample of raw undecomposed ; i . e ., unactivated , sewage sludge was obtained from the sewage treatment plant located at the city of woonsocket , r . i . analysis of the material showed the following : ______________________________________total solids 6 % total nitrogen ( solids ) 2 % bacteriological reportculture report indicates the pressureofstreptococcus ( alpha ) gr . 0escherichia colienterobacter groupb . sablilissmear report : gram neg . - gram pos . rods gram positive diplorocci______________________________________ 1 , 000 grams of this raw sewage sludge was treated with 60 grams of a urea - formaldehyde solution prepared in the following manner : 50 grams of commercially available 37 % formaldehyde was neutralized with triethanolamine to a ph of 8 . 0 . to this was added 50 grams of a commercially available prilled urea containing 46 % nitrogen . the negative heat of solution caused a drop in temperature to 5 ° c . the solution was gently heated to 30 ° c at which point the urea was in solution with the formaldehyde . after 10 minutes the temperature of this solution rose to 60 ° c at which point it was added to the 1 , 000 grams of sewage sludge . the resulting mixture ( a heavy viscous mass ) was kept under constant agitation at a temperature of 20 ° to 25 ° c . the temperature was raised to 60 ° c and maintained at this level for a period of about 30 minutes at which time sufficient dilute hydrochloric acid was added to reduce the ph to 3 . 0 . the resulting slurry began to thicken quite rapidly at this point and was transferred to a mechanical kneader for further handling . after a period of about 5 minutes , the methyleneization was considered complete because of an absence of any formaldehyde odor . the compound was further tested by deniges method and a modified schiff &# 39 ; s reagent and no formaldehyde was found to be present . at this point a sufficient quantity of calcium carbonate was added to neutralize the mixture and to raise the ph to 6 . 5 to 7 . 0 . without further treatment , the product was subjected to the same analysis as the raw sewage sludge with the following results : ______________________________________total solids 10 % total nitrogen ( solids ) 21 % bacteriological reportculture -- no growthsmear -- no bacteria______________________________________ a portion of the above sample was passed through a 10 - mesh sieve . the resulting granular product was then subjected to drying at 100 ° c for a period of 30 minutes . the sample was then analyzed for its agronomic usefullness as a high analysis organic nitrogen fertilizer . the qualities sought for in an organic material as a fertilizer are : most nitrogenous organic fertilizers contain about 6 % nitrogen , while the average mineral or inorganic fertilizer contains between 10 and 20 percent of this essential plant food element . from the economic standpoint of transportation and application of fertilizer this means that the currently available sources of organic fertilizers are between 100 and 300 percent more expensive than their mineral counterparts . therefore , an organic compound with competitive nitrogen contents would be highly desirous . organic forms of nitrogen have always commanded a premium price in the fertilizer market because of the relative insolubility of their plant food nitrogen . this insolubility leads to longer lasting nitrogen and considerably less leaching of the nitrogen . from the standpoint of ecology , insoluble forms of nitrogen prevent leaching or washing into surrounding water stratums , rivers , streams , etc .. insoluble forms of nitrogen usually depend on their release of nitrogen plant food through natural bacterial decomposition in the soil . this results in a more gradual release of the nitrogen plant food , as well as a stimulation of the soil micro flora and fauma . many forms of insoluble nitrogen are so tightly bound in complex molecules that for all practical purposes they are available for bacterial breakdown and therefore cannot enter the food chain cycle . recent work has indicated that the availability of insoluble nitrogen can be obtained by determining the percentage of water insoluble nitrogen which dissolves when a sample of 0 . 25 grams of the product is heated to 100 ° c for 30 minutes in 250 milliliters of neutralized water . the percentage figure thus obtained is called the &# 34 ; activity index &# 34 ;. it is generally accepted that a product with an &# 34 ; activity index &# 34 ; of greater than 40 will yield the bulk of its nitrogen within a six - months incubation period in the soil . the analysis of the product obtained from this example was : 1 , 000 grams of a fish meal intended for use as a poultry feed supplement , and containing about 9 % nitrogen , and found to be contaminated with pathogenic salmonella was treated with 10 , 20 , 30 , 40 , 50 , 60 , 70 , 80 , 90 , and 100 grams respectively of a urea - formaldehyde solution prepared in the same manner as indicated in example 1 . the urea - formaldehyde solution was added to the dry fish meal as a fine spray , while the meal was being rotated in a cylinder similar in appearance to a small sized cement mixer . the temperatures of the resulting mixtures were raised to 30 ° c . the products were held at this temperature for a period of about 2 minutes at which point the methyleneization step was introduced by spraying a dilute solution of hydrochloric acid until a ph of 3 . 0 was recorded . the products were held under this condition until methyleneization was complete as indicated by the tests performed in example 1 . a sufficient amount of calcium carbonate was added to the mixtures to insure a neutral ph . without further treatment , the samples were subjected to bacteriological and chemical analysis with the following results : ______________________________________ salmonella % protein______________________________________check 0 treatment + 56 . 25 10 gr . treatment - 57 . 09 20 gr . treatment - 57 . 93 30 gr . treatment - 58 . 78 40 gr . treatment - 59 . 62 50 gr . treatment - 60 . 46 60 gr . treatment - 61 . 30 70 gr . treatment - 62 . 14 80 gr . treatment - 62 . 98 90 gr . treatment - 63 . 82 100 gr . treatment - 64 . 66______________________________________ a sample of tannery waste sludge containing about 10 % solids and composed of such materials as fleshings , hair , entrails , and general nide scrappings ( in addition to these organic constituents there was a sufficient amount of sulfide contamination to cause considerable odor problems ) was subjected to our treatment by adding 166 grs . of urea - formaldehyde solution , prepared in accordance with example 1 , to 1 , 000 grams of the tannery waste sludge . in the same manner as previously disclosed , the resulting slurry was maintained at a ph of 8 . 0 and a temperature of 30 ° c for a period of 30 minutes . the ph was then reduced to 3 . 0 by the addition of a dilute solution of sulfuric acid and the temperature was raised to 60 ° c . sufficient agitation was supplied to maintain a state of equilibrium between solid and liquid phases . methyleneization was allowed to continue to a point where no free formaldehyde was detected by deniges method described in example 1 . the resulting mixture was then neutralized with a sufficient quantity of a dilute sodium hydroxide solution ( 1 % naoh ) to raise the ph level to 7 . 5 , dried by subjecting the mixture to a continuous stream of hot air ( 110 ° c ) while tumbling in a rotating cylinder for a time sufficient to reduce the moisture content to about 5 % and then ground to a uniform particle size (- 10 - 20 mesh ). this product was then analyzed for its agronomic properties and found to contain the following : the process of my present invention has many advantages in the treatment of pathogenic waste materials in so far as the investment of capital equipment is minimal . for example , a small jacketed reaction vessel may be used to prepare the methylol solution . this solution may be added batch - wise or continuously to the organic waste material . the methyleneization step of our process can be carried out by an in - line injection of the mineral or organic acid . neutralization can also be effected in the same manner . both steps can be greatly accelerated by elevating the temperature of the organic waste material to be treated . in the case of a sludge - like material such as the raw sewage sludge and tannery waste used in our experiments , the material can be passed through a heat exchange . the urea - formaldehyde solution can also be handled in the same manner . in the case of dry materials , such as the fish meal used in our second experiment , they can be passed through a rotating cylinder concurrently or countercurrently to a stream of heated air in order to raise the temperature to around 60 ° c . it has been found that the preparation of a preformed urea - methylol solution and prereaction with an organic waste material provides unexpected and increased efficiency in the dewatering of the waste product from the solution . the addition and prereaction of the methylol solution is superior to the addition separately of urea or formaldehyde and in situ condensation . two buckets of sewage sludge were collected from the merrimack , new hampshire waste treatment plant , in each run , 1 , 000 ml of sludge were used . adjustment of ph in the process was done with 12 % koh for the alkaline step , and 30 % h 3 po 4 for the acid step . both samples of sludge contained 3 . 7 - 4 . 0 % solids as determined by overnight drying at 100 ° c . the samples were treated with urea , formaldehyde and urea - formaldehyde methylol solutions as set forth in table i . table i______________________________________ m1 reactant - grams ureasample sludge reactant to - sludge gramsno . taken added solids ratio formaldehyde______________________________________1 1 , 000 u / f 1 / 1 20 / 202 1 , 000 u / f 1 . 5 / 1 30 / 303 500 blank -- -- 4 1 , 000 u - f 1 / 1 20 / 205 1 , 000 f - u 1 / 1 20 / 206 1 , 000 f - u 1 . 5 / 1 30 / 307 1 , 000 u - f 1 . 5 / 1 30 / 308 1 , 000 u / f 1 . 5 / 1 30 / 30______________________________________ * u / f = normal makeup of urea - formaldehyde solution ( methylol solution ) u - f = urea added for 10 minutes followed by formaldehyde for 10 minutes f - u = formaldehyde added first , followed by urea - same time . all samples were treated at 60 °- 65 ° c at ph 7 . 2 to 7 . 5 alkaline conditions , and then subsequently converted to an acid condition ph of 3 . 0 to 3 . 5 . the samples were placed in one quart plastic containers and filtered . filtrations were carried out , of 200 grams of each sample , through two pieces of 12 . 5 cm whatman # 1 filter paper using a vacuum pump set at 15 inches water vacuum . the amount of filtrate obtained in 10 minutes was determined along with the grams and percent solids of the filter cake . sedimentation tests were attempted in 40 ml centrifuge tubes ; however , because of the heavy amount of flocculation , sedimentation rates had to be carried out on diluted samples ( 35 gram sample -- 15 grams water ) and thoroughly shaken before sedimentation . table ii shows the results of the filtration experiment . the processed sludge samples , regardless of the method , filtered well , while the blank sample filtered only slightly in the 10 - minute period . in comparing the ( f - u ) versus the ( u - f ) method , the ( f - u ) gave better filtrations . the u / f preparation gave the highest solids filter cake at both reactant levels of 1 / 1 and 1 . 5 / 1 . table ii______________________________________ react / sludge gms ** % solidssample reactant ratio ml * filter filterno . added ( gms ) filtrate cake cake______________________________________1 u / f 1 / 1 157 40 . 8 21 . 22 u / f 1 . 5 / 1 -- -- -- 3 blank -- 35 too wet to determine4 u / f 1 / 1 134 58 . 9 14 . 75 f - u 1 / 1 151 45 . 9 18 . 56 f - u 1 . 5 / 1 151 47 . 4 23 . 77 u - f 1 . 5 / 1 145 52 . 0 19 . 48 u / f 1 . 5 / 1 151 47 . 8 25 . 5______________________________________ * after 10 minutes filtration at 15 &# 34 ; vacuum ** grams wet filter cake after 10 minutes the sedimentation tests showed only that all the processed samples , regardless of the method , settled out in a uniform rate ; that is , no differences in sedimentation rate were seen . after one hour in the centrifuge tubes , samples 1 , 6 , 7 and 8 showed 6 ml of clearing . the blank showed only 1 ml , indicating that processing did have an affect on the sedimentation . the use of methylol solution ( sample # 1 ) in comparison to the addition of formaldehyde first ( sample # 5 ) provided for an additional 2 . 7 % solids collection or an increased dewatering efficiency of 14 . 5 %. sample # 8 compared with sample # 7 with urea added first provided for an additional 6 . 1 % solids on increase in efficiency of 31 . 4 %. my process has also the advantage that it can reduce organic waste materials to pathologically pure materials which can be recycled to the ecology in a matter of minutes , where as concurrently available methods require 30 to 60 days to achieve a similar result . this process has further advantages in that its products can be recycled to the ecology at a level substantially higher than similarly biologically treated products . biologically treated products are not pathologically pure and therefore cannot be considered for use as an animal or human feed supplement . the products of my invention are pathologically pure and could be considered for these purposes .	8
as used throughout this application , the term halogen includes all four halogens i . e ., fluorine , chlorine , bromine and iodine with chlorine , bromine and iodine being preferred and chlorine being especially preferred . furthermore , as used throughout the application , the term &# 34 ; lower alkyl &# 34 ; includes both straight and branched chain alkyl groups having from 1 to 7 carbon atoms such as methyl , ethyl , propyl , n - butyl , isopropyl etc . with methyl and ethyl being preferred . also as used herein , the term &# 34 ; lower alkanoic acids &# 34 ; comprehend an alkanoic acid of from 1 to 7 carbon atoms such as acetic acid , formic acid and propionic acid . as also used herein , the term &# 34 ; aryl &# 34 ; signifies mononuclear aromatic hydrocarbon groups such as phenyl , which can be unsubstituted or substituted in one or more position with a lower alkylenedioxy , a halogen , nitro , lower alkyl or lower alkoxy substituent and polynuclear aryl groups such as naphthyl , which can be unsubstituted or substituted with one or more of the aforementioned groups . the preferred aryl group is the substituted or unsubstituted mononuclear aryl group , phenyl . the term &# 34 ; aryl lower alkyl &# 34 ; comprehends aryl lower alkyl groups wherein aryl and lower alkyl are as defined above , preferably those groups where lower alkyl is methyl . the preferred aryl lower alkyl substituent is benzyl . the term &# 34 ; aryl lower alkanoic acid &# 34 ; comprehends aryl lower alkanoic acid groups where &# 34 ; aryl &# 34 ; and &# 34 ; lower alkanoic acid &# 34 ; are as defined above and includes aryl carboxylic acids . the preferred &# 34 ; aryl lower alkanoic acid &# 34 ; being an arylcarboxylic acid such as benzoic acid . as used herein , lower alkoxy comprehends lower alkoxy groups having 1 to 7 carbon atoms such as methoxy and ethoxy . the term &# 34 ; lower alkylenedioxy &# 34 ; designates lower alkylenedioxy group contain from 2 to 7 carbon atoms such as ethylenedioxy . in the compound of formula ii which is used as starting material for vitamin e or intermediates for vitamin e , r 1 can be any protecting group removable by basic hydrolysis or by hydrogenolysis . therefore the conventional protecting groups removable either by basic hydrolysis or hydrogenolysis to yield the hydroxy group can be utilized as the protecting group r 1 in the process of this invention . among these protecting groups are included ester groups derived from a lower alkanoic or aryl lower alkanoic acid . any conventional method of forming these ester protecting groups can be utilized in the process of this invention . any conventional ether protecting groups removable by hydrogenolysis can be utilized in this invention . among the preferred ether protecting groups are the aryl methyl ethers such as benzyl ethers . these protecting groups can be removed by hydrogenolysis to yield the corresponding hydroxy group by conventional means well known in the art . the compound of formula ii is converted to the compound of formula i by treating the compound of formula ii with a hydrohalic acid preferably hydrochloric acid at temperatures of from - 30 ° c . to + 30 ° c . preferably from - 10 ° c . to + 10 ° c . in a inert organic solvent medium . generally , this reaction is carried out under anhydrous conditions . in carrying out this reaction , it is generally preferred to utilize an inert organic solvent . any conventional ether solvent can be utilized to carry out this reaction . among the preferred ether solvents are diethylether , tetrahydrofuran , glyme and diglyme . in the next step of this invention , the compound of formula i is reacted with the compound of formula iii to produce either the compound of formula iv or the compound of formula v or the compound of formula vi . formation of either the compound of formula iv , v or vi will depend upon the precise substituent utilized for r 2 in the compound of formula iii . where y in the compound of formula iii is an alkali metal , y can be any conventional alkali metal , such as lithium , sodium or potassium with sodium and potassium being especially preferred . the reaction of the compound of formula i with the compound of formula iii where y is alkali metal is carried out under anhydrous conditions in an inert organic solvent medium . in carrying out this reaction any conventional inert organic solvent can be utilized as the reaction medium with either solvents such as those mentioned hereinbefore being particularly suitable . the preferred inert organic solvent medium is diethylether . in carrying out this reaction temperature are from - 30 ° c . to + 30 ° c . can be utilized with temperatures of from 0 ° c . to 15 ° c . being especially preferred . when y in the compound of formula iii is mgx , the compound of formula i and the compound of formula iii are reacted to produce either the compound of formula iv , v or vi , depending upon r 2 , in an inert organic solvent at temperatures ranging from - 100 ° c . to 0 ° c . it is preferred to carry out this reaction at temperatures from - 80 ° c . to - 30 ° c . this reaction can be carried out at these temperatures in an inert organic solvent medium with the ethers such as those mentioned hereinbefore being especially suitable for this reaction . in accordance with this invention the compounds of formula iv are converted to the known vitamin e intermediates of the formula : ## str5 ## where r 1 is as above by conventional procedures . any conventional method for converting a malonic acid to an acetic acid can be utilized in this conversion . among the preferred methods is hydrolysis followed by decarboxylation . in accordance with this invention the compounds of formula v are converted to the known vitamin e intermediates of the formula : ## str6 ## wherein r 1 is as above ; by conventional procedures for converting a terminal double bond to an aldehyde among the preferred methods for carrying out this reaction is ozonolysis followed by a reductive workup . in the examples , reactions described below were carried out under an atmosphere of argon . column chromatography was performed using em silica gel 60 ( 0 . 063 - 0 . 2 mm ). anhydrous ether and tetrahydrofuran were distilled from sodium benzophenone ketyl immediately prior to use . the ether used in these examples is diethyl ether . to a solution of 5 g ( 16 mmol ) of rac - 3 , 4 - dihydro - 6 -( phenylmethoxy )- 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran - 2 - ol in 50 ml of anhydrous ether was added 5 g of 4 a molecular sieves . the mixture was stirred mechanically with ice - bath cooling while hcl gas was bubbled in for 30 min . stirring was continued at 0 ° c . for 30 min and then the solvent was removed in vacuo . the residue was treated with 500 ml of hexane and the solution was decanted . the hexane solution was then treated with 10 g of anhydrous cacl 2 and the mixture stirred for 2 hr . the solids were filtered and the filtrate was concentrated in vacuo to a volume of ca . 20 ml . crystallization was induced by cooling to - 10 ° c . and stirring , then the remaining solvent was removed in vacuo giving 4 . 9 g ( 92 . 8 % yield ) of rac - 2 - chloro - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 -( phenylmethoxy )- 2h - 1 - benzopyran as a colorless solid . the chlorochroman decomposed upon attempted column or thin layer chromatography . it was stored at 0 ° c . a mixture of 10 g ( 37 . 9 mmol ) of rac - 3 , 4 - dihydro - 6 - acetyloxy - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran - 2 - ol and 10 g of 4 a molecular sieves in 200 ml of anhydrous ether was stirred with ice - bath cooling while hcl gas was bubbled in for 30 min . the mixture was filtered and the filtrate concentrated in vacuo . the residue was taken up in 600 ml of hexane and anhydrous cacl 2 was added . the mixture was stirred for 1 hr then filtered and the filtrate was concentrate in vacuo giving 4 . 3 g ( 40 . 2 % yield ) of rac - 2 - chloro - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran - 6 - ol acetate as a colorless solid , mp 102 °- 106 ° c ., which was unstable to column or thin layer chromatography . a 370 mg ( 9 . 25 mmol ) sample of 60 % by weight sodium hydride 40 % by weight mineral oil dispersion was washed free of oil with hexane and treated with 20 ml of anhydrous tetrahydrofuran . the resulting slurry was stirred with ice - bath cooling while 1 . 056 g ( 8 mmol ) of dimethyl malonate was added dropwise . after stirring for 10 min at 0 ° c ., the sodiomalonate mixture was treated , dropwise , with a solution of rac - 2 - chloro - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 -( phenylmethoxy )- 2h - 1 - benzopyran in 4 ml of dry thf . stirring at 0 ° c . was continued for 1 . 5 hr at which point the reaction mixture was poured into water and extracted three times with ether . the ether extracts were dried ( mgso 4 ), filtered , and concentrated in vacuo giving a yellow , oily residue . this material was dissolved in 5 ml of pet . ether ( 30 ° c .- 60 ° c .) and stirred leading to a white precipitate . the solid was isolated by filtration and recrystallized from pet . ether giving 0 . 4 g ( 23 . 4 % yield ) of rac - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 -( phenylmethoxy )- 2h - 1 - benzopyran - 2 - ylpropanedioic acid dimethyl ester as a colorless solid , mp 80 °- 81 ° c . to 12 ml ( 24 mmol ) of 2m allylmagnesium chloride in tetrahydrofuran , cooled in an ice bath , was added , with stirring , a solution of 4 . 95 g ( 14 . 98 mmol ) of rac - 2 - chloro - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 -( phenylmethoxy )- 2h - 1 - benzopyran in 60 ml of anhydrous ether . the reaction mixture was stirred at 0 ° c . for 6 hr then worked up by being poured into cold , saturated nh 4 cl solution and ether extraction . the product ( 5 . 4 g of a pale - yellow oil ) was dissolved in 40 ml of methanol and 10 ml of ether containing 10 mg of p - toluenesulfonic acid monohydrate . the solution was stirred at room temperature for 21 hr then concentrated in vacuo . the residue was chromatographed on 75 g of silica gel . elution with 40 : 1 parts by volume hexane - ether gave 2 . 88 g ( 57 . 2 % yield ) of rac - 3 , 4 - dihydro - 6 -( phenylmethoxy )- 2 -( 2 - propenyl )- 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran as a colorless oil . a solution of 10 . 44 g ( 45 . 8 mmol ) of ( 3r , 7r )- 3 , 7 , 11 - trimethyldodecan - 1 - ol in 150 ml of anhydrous pyridine was stirred in an acetone - ice bath while 17 . 4 g ( 91 . 3 mmol ) of p - toluenesulfonyl chloride was added in one portion . the mixture was stirred in the acetone - ice bath for 2 hr then kept at 0 ° c . for 40 hr before being quenched by the addition of 300 ml of ice - water . the product was isolated by extraction with 3 × 300 ml of ether . the ether extracts were combined , washed with 400 ml of cold 3n hcl and saturated brine , then dried ( mgso 4 ), filtered and concentrated in vacuo . there was obtained 16 . 6 g ( 94 . 9 %) of ( 3r , 7r )- 3 , 7 , 11 - trimethyldodecyl p - toluenesulfonate . this tosylate ( 43 . 45 mmol ) and 4 . 25 g ( 86 . 7 mmol ) of sodium cyanide , in 80 ml of ethanol and 20 ml of water was stirred and refluxed for 2 . 5 hr . most of the ethanol was removed in vacuo and the residue was treated with 75 ml of water and 75 ml of saturated brine and extracted with 3 × 100 ml of ether . the ether extracts were combined , washed with saturated brine , dried ( mgso 4 ), filtered through a plug of silica gel , and concentrated in vacuo . this afforded 10 . 25 g ( 99 . 5 %) of ( 4r , 8r )- 4 , 8 , 12 - trimethyltridecanenitrile as a yellow oil . gc analysis revealed a purity of 95 . 2 %. a mixture of this nitrile ( 43 . 25 mmol ) and 18 . 4 g ( 0 . 33 mol ) of potassium hydroxide in 162 ml of ethylene glycol and 13 . 5 ml of water was stirred in a 150 ° c . oil bath for 4 hr then cooled to 0 °- 5 ° c . and poured into 300 ml of 6n hcl . the mixture was extracted with 2 × 400 ml of ethyl acetate . the organic extracts were combined , washed with 300 ml of saturated brine , dried ( mgso 4 ), filtered and concentrated in vacuo giving 11 . 1 g ( 100 %) of ( 4r , 8r )- 4 , 8 , 12 - trimethyltridecanoic acid as an oil . a solution of this acid in 50 ml of toluene was stirred at room temperature while 25 ml of sodium bis ( 2 - methoxyethoxy ) aluminum hydride in toluene was added dropwise . after being stirred for 3 hr at room temperature , the reaction mixture was decomposed by the cautious addition of 5 ml of ethanol . the mixture was then treated with 300 ml of 6n hcl and extracted with 3 × 300 ml of ethyl acetate . the organic extracts were combined , washed with 300 ml of saturated brine , dried ( mgso 4 ), filtered , and concentrated in vacuo . kugelrohr distillation ( 160 ° c . bath temperature , 1 mm hg ) of the residue ( 9 . 7 g ) gave 7 . 0 g of ( 4r , 8r )- 4 , 8 , 12 - trimethyltridecanol as a colorless liquid having a gc purity of 94 . 5 %. the distillation residue contained starting acid and was re - reduced with 6 ml of sodium bis ( 2 - methoxyethoxy ) aluminum hydride as described above . this provided an additional 1 . 8 g [ total yield 8 . 8 g ( 84 . 2 %)] of alcohol having a gc purity of 95 . 8 %. to a solution of 9 . 6 g ( 39 . 6 mmol ) of ( 4r , 8r )- 4 , 8 , 12 - trimethyltridecanol in 30 ml of anhydrous n , n - dimethylformamide was added 10 . 7 g ( 40 . 84 mmol ) of triphenylphosphine . the solution was stirred in an acetone - ice bath (- 10 ° c .) while 2 . 1 ml ( 41 mmol ) of bromine was added dropwise . the temperature rose to 5 ° c . the reaction mixture was stirred at room temperature for 1 hr then poured into 100 ml of water and 150 ml of hexane . after filtration , the layers were separated and the aqueous phase was extracted with 2 × 150 ml of hexane . the hexane layers were washed with saturated nahco 3 solution , dried ( mgso 4 ), filtered through a plug of silica gel , and concentrated in vacuo . kugelrohr distillation ( 150 °- 160 ° c . bath temperature , 1 mm hg ) of the residue gave 2 fractions : 5 . 15 g of 95 . 8 % gc purity and 3 . 55 g of 97 . 9 % gc purity ( 72 . 2 % yield ). redistribution of the larger fraction gave ( 4r , 8r )- 1 - bromo - 4 , 8 , 12 - trimethyltridecane as a colorless liquid bp 120 ° c . ( 0 . 15 mm ) having a gc purity of 97 . 9 %; [ a ] 25 d - 3 . 01 ° ( c 2 . 09 , hexane ). a grignard solution was prepared from 0 . 28 g ( 11 . 2 mmol ) of magnesium and 3 . 4 g ( 11 . 2 mmol ) of ( 4r , 8r )- 1 - bromo - 4 , 8 , 12 - trimethyltridecane in 25 ml of anhydrous ether . grignard formation was induced with a few drops of 1 , 2 - dibromoethane and the mixture was stirred and refluxed for 3 . 5 hr . to a stirred solution of 2 . 6 g ( 7 . 87 mmol ) of rac - 2 - chloro - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 -( phenylmethoxy )- 2h - 1 - benzopyran in 25 ml of anhydrous ether , cooled to - 10 ° c . ( ice - acetone bath ), was added the c 16 - grignard solution , dropwise . the resulting mixture was stirred at 0 ° c . for 18 hr then treated with 100 ml of saturated nh 4 cl solution . the product was isolated by extraction with 2 × 100 ml of ether . the ether extracts were washed with saturated brine , dried ( mgso 4 ), filtered , and concentrated in vacuo . the residue ( 4 . 95 g ) was dissolved in 50 ml of methanol and 30 ml of ether containing 200 mg of p - toluenesulfonic acid monohydrate . after being stirred at room temperature for 24 hr , the solution was concentrated in vacuo and the residue was chromatographed on 200 g of silica gel . elution with 40 : 1 parts by volume hexane - ether gave 1 . 82 g ( 44 . 5 %) of pure ( 2rs , 4 &# 39 ; r , 8 &# 39 ; r )- alpha - tocopheryl benzyl ether . the identity of this material was proven by spectral and tlc comparison with an authentic sample of ( 2r , 4 &# 39 ; r , 8 &# 39 ; r )- alpha - tocopheryl benzyl ether . a mixture of 10 g of rac - 2 - methoxy - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 -( phenylmethoxy )- 2h - 1 - benzopyran , 10 g of calcium chloride , 100 ml of hexane and 50 ml of diethyl ether was stirred at - 5 ° to - 10 ° c . while hcl gas was bubbled in for 1 hr . an additional 10 g of calcium chloride was added and stirring was continued at room temperature for 2 hr . the mixture was filtered and the filtrate was concentrated in vacuo giving 10 . 2 g of title product as a light - brown oil . proton nmr analysis revealed that this product consisted of 66 % of the title compound and 33 % of the starting 2 - methoxy chroman . a mixture of 0 . 43 g ( 1 mmole ) of rac - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 -( phenylmethoxy )- 2h - 1 - benzopyran - 2 - ylpropanedioic acid dimethyl ester , 0 . 56 g ( 10 mmoles ) of potassium hydroxide , and 25 ml of 9 : 1 ethylene glycol - water is stirred and refluxed for 8 hr . the mixture is cooled , diluted with water , and extracted with ether ( the ether extract is discarded ). the aqueous , alkaline solution is acidified with 3nhcl and the acid product isolated by ether extraction . the ether extracts are combined , washed with water and brine , dried ( mgso 4 ), filtered and concentrated in vacuo . recrystallization of the residue from aqueous ethanol gives rac - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 -( phenylmethoxy )- 2h - 1 - benzopyran - 2 - acetic acid which can be converted to vitamin e by the procedures in helv . chim acta 61 , 837 ( 1978 ); helv . chim . acta 59 , 290 ( 1976 ) and helv . chim . acta 64 , 1158 ( 1981 ). an ozone - oxygen gas mixture is passed into a solution of 0 . 67 g ( 2 mmoles ) of rac - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 2 -( 2 - propenyl )- 6 -( phenylmethoxy )- 2h - 1 - benzopyran in 100 ml of methanol , with stirring , at - 78 ° c . after the starting olefin has been consumed , the ozone flow is stopped and the solution is treated with excess dimethyl sulfide and allowed to warm to room temperature . the solution is concentrated in vacuo . the residue is chromatographed on silica gel giving rac - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 -( phenylmethoxy )- 2h - 1 - benzopyran - 2 - acetaldehyde , which can be converted to vitamin e by the procedures in helv . chim . acta set forth in example 8 . a 0 . 6 g ( 2 . 13 mmole ) sample of rac - 2 - chloro - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran - 6 - ol acetate is treated with ( 4r , 8r )- 4 , 8 , 12 - trimethyltridecylmagnesium bromide as described in example 6 except that an excess of the grignard reagent is employed . chromatography of the crude product on silica gel gives ( 2rs , 4 &# 39 ; r , 8 &# 39 ; r )- alpha - tocopherol as an oil . using the procedure of example 6 , rac - 2 - chloro - 6 - methoxy - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran is treated with ( 4r , 8r )- 4 , 8 , 12 - trimethyltridecylmagnesium bromide to give ( 2rs , 4 &# 39 ; r , 8 &# 39 ; r )- alpha - tocopheryl methyl ether as an oil . a solution of 0 . 25 g ( 0 . 56 mmole ) of ( 2rs , 4 &# 39 ; r , 8 &# 39 ; r )- alpha - tocopheryl methyl ether in 10 ml of 1 , 2 - dichloroethane is treated with 0 . 7 g ( 2 . 25 mmoles ) of boron tribromide dimethyl sulfide complex and the reaction mixture is stirred and refluxed for 20 hr . the mixture is cooled and treated with water . the organic layer is separated , washed with water and brine , dried ( mgso 4 ), filtered and concentrated in vacuo . the residue is chromatographed on silica gel giving ( 2rs , 4 &# 39 ; r , 8 &# 39 ; r )- alpha - tocopherol as an oil . a mixture of 84 . 3 g ( 0 . 337 mole ) of rac .- 2 , 6 - dimethoxy - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran , 370 ml of acetone , 300 ml of water , and 2 . 5 ml of conc . hydrochloric acid was distilled until the distillate temperature reached 90 ° c . after being cooled , the mixture was diluted with water and extracted three times with ether . the ether extracts were combined , washed with saturated brine , dried ( mgso 4 ), filtered , and concentrated in vacuo . the residue was recrystallized from aqueous acetone giving rac .- 6 - methoxy - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran - 2 - ol as an off - white solid , in crops of 34 . 6 g ( 43 . 5 %) and 11 . 1 g ( 13 . 9 %). using the procedure of example 1 , rac .- 6 - methoxy - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran - 2 - ol was converted into rac .- 2 - chloro - 6 - methoxy - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran , an off - white solid , in 90 . 2 % yield . using the procedure of example 3 , except that diethyl malonate was employed in place of dimethyl malonate , rac .- 2 - chloro - 6 - methoxy - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran was converted into rac .- 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 - methoxy - 2h - 1 - benzopyran - 2 - ylpropanedioic acid diethyl ester , a colorless solid , m . p . 74 °- 76 ° c ., in 54 % yield , purified by a combination of hplc and recrystallization from pet . ether . a mixture of 1 . 29 g ( 3 . 41 mmoles ) of rac .- 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 - methoxy - 2h - 1 - benzopyran - 2 - ylpropanedioic acid diethyl ester , 1 . 68 g of potassium hydroxide , and 75 ml of 9 : 1 parts by volume ethylene glycol - water mixture was stirred and refluxed for 6 hours . the resulting mixture was poured on ice and extracted with ether ( the ether extract was discarded ). the aqueous solution was acidified with 3n hcl and the precipitated acid was extracted 3 times with ether . the combined ether extracts were washed with brine , dried ( mgso 4 ), filtered and concentrated in vacuo . purification of the residue by preparative thick layer chromatography gave 0 . 72 g ( 75 . 9 %) of rac .- 3 , 4 - dihydro - 6 - methoxy - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran - 2 - acetic acid , as a colorless solid , mp 96 °- 98 ° c . dimethylation using the procedure of example 14 gives rac .- 3 , 4 - dihydro - 6 - hydroxy - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran - 2 - acetic acid which can be converted to alpha - tocopherol as described in helv . chim . acta . 59 , 290 ( 1976 ). a mixture of 200 g ( 0 . 847 mole ) of rac .- 3 , 4 - dihydro - 2 - methoxy - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran - 6 - ol , 1200 ml of acetone , 200 ml of dimethyl sulfate , and 100 g of sodium hydroxide in 100 ml of water was stirred at room temperature for 4 hours whereupon 500 ml of 10 % aqueous ammonium hydroxide solution was added and stirring continued for 30 minutes . the mixture was extracted 3 times with ether . the ether extracts were combined , washed with water and saturated brine , dried ( mgso 4 ), filtered and concentrated in vacuo giving 238 . 4 g of residue which was recrystallized from ether - hexane at - 20 ° c . there was obtained 145 . 9 g ( 68 . 9 %) of rac .- 2 , 6 - dimethoxy - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran as a colorless solid . the product upon being recrystallized from hexane at - 60 ° c ., gave a solid , mp 37 °- 38 ° c . anal . calcd . for c 15 h 22 o 3 : c , 71 . 97 ; h , 8 . 86 . found : c , 71 . 84 ; h , 8 . 82 .	2
herein the terms “ nano - powder ,” “ powder ,” nano - particles ,” and “ particles ” refer to the as - synthesized nano - material , the term “ disc ” means nano - powder that that been formed in to selected shaped , such as a disc as illustrated in fig2 a and 2b , and sintered at a sintering temperature for a selected time to form a solid article . the present disclosure is directed to the synthesis of y 2 o 3 nano - powders , and composites of y 2 o 3 / mo x ( both after sintering ), where mo x is at least one other metal oxide in which x is in the range of 1 - 3 , using low - cost precursors in a time - and cost - saving way that is also ease to scale up to produce larger amounts of the material . spinning and ultra - sonication are used to break down the y 2 o 3 soft agglomeration of the nano powders in a fast and efficient way as compared to either traditional ball - milling , which is time - consuming , or freeze - drying which is expensive to use . the y 2 o 3 nano - powder or y 2 o 3 / mo x composites , when consolidated as a composite / solid solution systems , including nanocomposites , are designed to and produced to get multiple functional ceramics or materials with improved thermal - mechanical properties compare to the pure y 2 o 3 . in general , the method involves dissolving yttrium nitrate in water in a vessel and titrating the resulting solution with an ammonium carbonate solution containing ammonium sulfate and a water soluble lubricant , for example , commercially available lutrol e - 400 which a polyethylene glycol ( basf ) or similar material . the vessel is spun during the titration with control of the ph in the range of 8 . 3 - 9 . 5 . in an embodiment the ph is controlled to be in the range of 8 . 7 - 9 . 0 . after the titration is completed the precipitated and sonicated for an additional time to homogenize the precipitants . the precipitants are collected on a filter , an vacuum dried . following the drying the precipitants are calcined . a 0 . 5m solution y ( no 3 ) 3 . 6h 2 o was prepared and place in a vessel . a solution of 2 - 2 . 5m ammonia carbonate solution containing 5 mol % ammonia sulfate and 0 . 3 - 0 . 8 wt . % lutrol e - 400 [ a polyethylene glycol , cas 25322 - 68 - 3 ] as the dispersant . the vessel containing the y ( no 3 ) 3 solution was placed in a 70 ° c . water bath and was titrated with the ammonium carbonate solution at the rate of 2 - ml / min ammonia carbonate while the vessel containing the y ( no 3 ) 3 solution was spun at a speed in the range of 120 - 150 rpm to five a uniform precipitation of the yttrium product . during the titration the ph of the solution was controlled such that the ph of the precipitated material was in the range of 8 . 7 - 9 . 0 ( b ) synthesis of y 2 o 3 - based composites / compounds y 2 o 3 / mo x ( after sintering ) the amount of the non - yttrium metal is determined beforehand and is added to the yttrium - containing solution . depending on the amount of non - yttrium material that is used , the final functional material , after sintering and containing yttrium and at least one additional metal , can be a nano - composite or doped ceramic , a solid solution or a compound . the at least one additional metal m can be added to the yttrium containing solution as a nitrate , chloride or other water soluble salt in a selected percentage or y : m ratio depending on the intended purpose of the final product . the y / m containing solution is then titrated with an ammonium carbonate solution containing ammonium sulfate and a lubricant as described above and spun at a spinning in the range of 120 - 150 rpm while maintaining the ph in the range of 8 . 3 - 9 . 5 , preferably in the range of 8 . 7 - 9 . 0 . the material that can be added into the y 2 o 3 system include mgo , cao , bao , beo 2 , al 2 o3 , tio 2 , zro 2 , sio 2 , hfo 2 , ybo 2 , gdo 2 , lu 2 o 3 and additional rare earth oxides . an exemplary y 2 o 3 — zro 2 — mgo composite y 2 o 3 doped with 6 - 9 mol % zro 2 and 0 . 5 - 2 mol % mgo . describes herein is a general composite system once the titration has been completed , the precipitant in the vessel was further spun while sonicating the solution to homogenize the precipitant . this spinning / sonication treatment was done for a time in the range of 5 - 60 minutes . the fluid in the vessel was decanted and the precipitate was water washed at least once to remove unreacted materials and the lubricant , alcohol washed using a c 1 - c 3 alcohol , and was collected on a 0 . 2 μm - 0 . 4 μm filter paper or equivalent filter , for example a frit filter . 4 . the collected precipitate was then vacuum dried at room temperature , approximately 15 - 30 ° c ., to fully dry and powderize the precipitant . 5 . after the powder had been dried it was calcined in air at a selected temperature in the range of 1050 ° c . to 1150 ° c . for a time of at least 2 hours . in an embodiment the time is at least 4 hours . in a further embodiment the time is at least 6 hours . in an embodiment the calcination temperature 1100 ° c . and the time was 4 hours . once the powder was fully dried and calcined it was used to form an article the dried , calcined nano - powder is illustrated in fig1 a and 1b . fig1 a illustrates of the dried and calcined nano - powder as a soft agglomeration . ( a ) the calcined powder was suspended in an alcohol solution and ultrasonically treated for a time in the range of 5 minutes to 1 hour to breakdown the soft agglomeration of particles that is illustrated in fig1 a . fig1 b is a photograph of particles , ( he bright spots ) from the powder of fig1 a after this ultrasonic treatment . in the fig1 b photograph the size bars indicate nano - particles , the bright “ spots ” in the photograph of size 15 nm and 17 nm . in addition , the photograph shows particles as small as approximately 5 nm ( the small fuzzy circle to the left of the 17 nm particle ). ( b ) the dried , ultra - sonicated nano - powder was then pressed into a die at a pressure 1500 psi , followed by cold isostatic pressing of 25 - 30 kpsi for the final compacting and to form an article that can be further processed . the sintering conditions may change in accordance with the different chemical components present in the nano - particles and the amount of such components . the sintering can be done as a two - stage process or a one stage process . ( 1 ) sintering in air at a temperature in the range of 1400 ° c . to 1500 ° c . for a time in the range of 4 to 10 hours followed by hot isostatic pressing (“ hip ”) at a temperature that is 20 - 50 ° c . lower than above sintering temperature . ( 2 ) oxygen annealing to burn out any residual carbon and / or color centers inside the sintered material that are due to the graphite furnace used during hip treatment . one - stage sintering combines the above traditional 2 - stage treatments into one - step . the sample is placed directly put into the hip furnace and is : ( a ) sintered at a temperature in the range of 1400 ° c .- 1500 ° c . for a time 4 hours to 10 hours using a blended glass consisting of 15 - 20 % o 2 — ar at normal pressure of 1 atmospheric ; and ( b ) increasing the pressure during the hot isostatic pressing to 200 mpa and holding the sample at this pressure for an additional time to achieve the best results , such time being in the range of 1 hour to 5 hours . fig2 a illustrates opaque y 2 o 3 green body pellets that were obtained before sintering and fig2 b illustrate the transparent pellets that were obtained after sintering . the pellets were placed on a sheet of paper with lettering on it to show the transparency of the sintered pellets . some of the major differences between the method describes herein and the art include : ( 1 ) the method disclosed herein does not use any binder or chelating agent s during the synthesis of the pellet . ( 3 ) an ammonium carbonate solution was used as the precipitating agent instead of the ammonium bicarbonate used in the art . the use of ammonium carbonate results in a better product — fewer color centers , better nano - particle size distribution , fine particle size resulting in a clearer product . ( 4 ) the inclusion of ammonium sulfate in the initial titrating solution and sulfate is included in the initial precipitation product . sulfur is burned out as a gaseous oxide during the sintering process . ( 5 ) the use of an alcohol washing agent which aids in dehydrating the product and reduces drying time . ( 6 ) using dispersion in an alcohol solution with sonication to de - agglomerate the soft agglomeration of particles , instead of the traditional ball milling , gives a more uniform nano - particle size distribution . ( 7 ) the use of a 1 - state hip process which results in a time and cost savings over the traditional two - step process . fig3 a is a surface profile graph , generated by a zygo ® interferometer , illustrating that the surface smoothness of sample discs such as those of fig2 a is within the 3 - 5 nm scale . the graph indicates that the peak - to - valley ( pv ) variation is approximately 4 nm and the average pv variation is approximately 0 ± 1 . 5 nm . fig3 b is a surface photograph over a 5 μm portion of as - pressed and unpolished pure y 2 o 3 disc such as shown in fig2 a . the surface indentation are due to the pressing of the material to form the disk and will be substantially removed upon polishing . fig4 is a graph of transmittance versus wavelength illustrating that sample y 2 o 3 discs ( numeral 10 ) made from the y 2 o 3 nano - powder synthesized in accordance with the disclosure of the have a transmittance that is substantially identical to the theoretical transmittance value ( numeral 12 ). fig5 a is an sem image of the of an as - synthesized nano - composite consisting having the composition of y 2 o 3 doped with 2 mol % mgo and 8 mol % zro 2 and showing a 50 nm distance range . fig5 b is the edax analysis ( energy dispersive x - ray analysis ) for the nano - composite of fig5 a confirm that the material comprises y , mg , zr and o , with no other materials . fig6 is flow diagram of the method for preparing the nano - powder according to the disclosure . the numerals 10 to 26 have the meaning shown in table 1 . fig7 is a transmittance vs . wavelength graph over the 200 nm - 8450 nm range ( 0 . 2 μm - 8 . 45 μm ) for discs made from pure y 2 o 3 only ( numeral 30 ) discs and discs made from pure y 2 o 3 doped with 8 mol % zro 2 and 1 mol % mgo ( numeral 32 ). the graph shown that in the 0 . 90 - 7 . 0 μm the transmission of the y — mg — zr oxide composition is greater than 70 % and the transmission is greater than 80 % in the 1 . 6 - 6 . 2 μm range . the pure as - produced y 2 o 3 has greater than 70 % transmission in the range of 0 . 7 - 7 . 5 μm . fig8 a ( 10 μm full width ) and 8 b ( 5 μm full width ) are sem photographs showing the microstructural morphology of composites containing the pure y 2 o 3 disclosed herein doped with 8 mol %- zro 2 - 1 mol % mgo , composite and the figures show that the average grain size is not larger than 2 . 5 μm fig9 is a representative edx ( energy dispersive x - ray ) analysis of the grains shown in fig8 a and 8b which confirmed that there was no compositional difference between grains . fig1 a - 10c are representative nano - indentation and scratch test images of the transparent ceramic composites described herein made from y 2 o 3 - 8 mol %- zro 2 - 1 mol % mgo ( y — zr — mg composite ). fig1 a shows that the vestige image of the y — mg — zr composite material which has a hardness in the range of 17 - 18 gpa . fig1 b is a shows the vestige image of a disk make from pure y 2 o 3 only . a comparison of the vestige images of fig1 a and 10b indicate that the 10 a image is sharper than that 10 b , and that fig1 a does not show the spalling and light scattering ( arrows s ) as is visible in fig1 b , the pure y 2 o 3 material in fig1 b has a hardness in the range of 9 . 5 - 10 gpa . fig1 c is a scratch test of a disc made from the pure y 2 o 3 material of fig1 b which shows that the that there is no spalling or micro - crack propagation in the illustrated vestige image . the use of the pure y 2 o 3 material in composites , for example , the composite of fig1 a , results in composite ceramics that have good scratch resistance and have a uniform compositional structure . without being held to any particular theory , uniform compositional structure is believed to play a role in providing good scratch resistance by preventing the formation of softer areas in the final ceramic material . this disclosure is thus directed to a method of making yttrium oxide nano - particles , yttrium oxide nano - particles containing one or a plurality of selected dopants , and ceramic materials made the nano - particles or doped nano - particles . the method comprises preparing a solution y ( no 3 ) 3 . 6h 2 o placing the solution in a vessel rotatable table ; preparing a solution of ammonia carbonate solution containing ammonia sulfate and 0 . 2 - 1 . 0 wt . % of a water soluble polyethylene glycol as a dispersant ; placing the vessel containing the y ( no 3 ) 3 solution in a 60 - 80 ° c . water bath and titrating the y ( no 3 ) 3 solution with the ammonium carbonate solution at the rate of 1 - 4 ml / min while the vessel containing the y ( no 3 ) 3 solution was rotated at a speed in the range of 100 - 200 rpm to form a uniform precipitation of the yttrium nano - particles ; spinning the precipitated yttrium nano - particles with sonication for a time in the range of 2 - 60 minutes after completion of the titration followed by decantation of the liquid and washing the nano - particles with an alcohol / water solution ; collecting and drying the nano - particles in vacuum at a temperature in the range of 15 - 30 ° c . to provide dried yttrium oxide nano - particles ; and calcining dried yttrium oxide nano - particles at a temperature in the range of 1050 ° c . to 1150 ° c . for a time of at least 2 hours . in one embodiment , during the titration of the y ( no 3 ) 3 solution the ph of the solution was controlled such that the ph of the precipitated material was in the range of 8 . 5 - 9 . 5 . in another embodiment , during the titration of the y ( no 3 ) 3 solution the ph of the solution was controlled such that the ph of the precipitated material was in the range of 8 . 7 - 9 . 0 . making the doped yttrium oxide nanoparticles comprises adding least one water soluble metal salt to the yttrium nitrate solution prior the beginning of the titration for forming a doped yttrium after calcination . the at least one water soluble metal salt is a chloride , nitrate or acetate selected from the group of metal consisting of mgo , cao , beo 2 , al 2 o3 , tio 2 , zro 2 , sio 2 , hfo 2 , ybo 2 , gdo 2 , lu 2 o 3 and the remaining rare earth metals . the disclosure is also directed to a method of making yttrium oxide articles , and articles made from a yttrium oxide doped with a selected dopant , the method comprising preparing a solution y ( no 3 ) 3 . 6h 2 o placing the solution in a vessel rotatable table ; preparing a solution of ammonia carbonate solution containing ammonia sulfate and 0 . 2 - 1 . 0 wt . % of a water soluble polyethylene glycol as a dispersant ; placing the vessel containing the y ( no 3 ) 3 solution in a 60 - 80 ° c . water bath and titrating the y ( no 3 ) 3 solution with the ammonium carbonate solution at the rate of 1 - 4 ml / min while the vessel containing the y ( no 3 ) 3 solution was rotated at a speed in the range of 100 - 200 rpm to form a uniform precipitation of the yttrium nano - particles ; spinning the precipitated yttrium nano - particles with sonication for a time in the range of 2 - 60 minutes after completion of the titration followed by decantation of the liquid and washing the nano - particles with an alcohol / water solution ; collecting and drying the in vacuum at a temperature in the range of 15 - 30 ° c . to provide dried yttrium oxide nano - particles ; calcining dried yttrium oxide nano - particles at a temperature in the range of 1050 ° c . to 1150 ° c . for a time of at least 2 hours ; placing the calcined nano - particles in a hot isostatic pressing apparatus ; sintering the calcined yttrium oxide nano - particle at a temperature in the range of 1200 - 1500 ° c . for a time in the range of 4 - 10 hours in a 15 - 20 % v / v o 2 / ar and a pressure of 1 atmosphere ; and hot isostatic pressing by increasing the pressure to 200 mpa and holding the pressure for an additional time in the range 1 hour to 5 hours ; and cooling to obtain yttrium oxide article . in one embodiment , during the titration of the y ( no 3 ) 3 solution the ph of the solution was controlled such that the ph of the precipitated material was in the range of 8 . 5 - 9 . 5 . in another embodiment , during the titration of the y ( no 3 ) 3 solution the ph of the solution was controlled such that the ph of the precipitated material was in the range of 8 . 7 - 9 . 0 . in addition , doped yttrium oxide articles can be made from a doped yttrium nano - particle by adding at least one water soluble metal salt to the yttrium nitrate solution prior the beginning of the titration for forming a doped yttrium after calcination . the at least one water soluble metal salt is a chloride , nitrate or acetate selected from the group of metal consisting of mgo , cao , beo 2 , al 2 o3 , tio 2 , zro 2 , sio 2 , hfo 2 , ybo 2 , gdo 2 , lu 2 o 3 and the remaining rare earth metals . the resulting yttrium oxide article thus contains the at least one selected metal as a metal oxide . while the invention has been described with respect to a limited number of embodiments , those skilled in the art , having benefit of this disclosure , will appreciate that other embodiments can be devised which do not depart from the scope of the invention as disclosed herein . accordingly , the scope of the invention should be limited only by the attached claims .	2
fig1 is a block diagram of a particular embodiment of a dynamo control circuit according to the present invention . as shown in fig1 the dynamo control circuit comprises a dynamo ( dyn ) 1 serving as a generator ; a rectifier circuit ( rect ) 2 ; an accumulator ( acc ) 3 serving as the power supply for the electrically - powered units ; a lamp ( lmp ) 4 ; and a switch ( sw ) 5 situated between the dynamo 1 and the lamp 4 . dynamo 1 comprises , for example , a hub dynamo housed within the hub of the front wheel of the bicycle . rectifier circuit 2 is a circuit for rectifying the ac voltage output of dynamo 1 , and it includes a diode and the like . accumulator 3 is a device that includes a capacitor , transistor , etc ., and controls on / off operation of switch 5 by means of its charged voltage . fig2 is a detailed schematic diagram of a particular embodiment of the dynamo control circuit shown in fig1 . as shown in fig2 dynamo 1 is coupled with a first capacitor c 1 , a second capacitor c 2 , a first diode d 1 , and a second diode d 2 . in this circuit , the first and second capacitors c 1 , c 2 and the first and second diodes d 1 , d 2 constitute a voltage - doubling rectifier circuit . the first capacitor c 1 is charged during the positive half - cycle of dynamo 1 output , and during the subsequent negative half - cycle the second capacitor c 2 is charged with voltage equal to the voltage generated by dynamo 1 plus the charged voltage of the first capacitor c 1 . thus , the second capacitor c 2 can acquire high charged voltage at low speed . the second capacitor c 2 functions as a power supply for driving first and third field - effect transistors fet 1 and fet 3 , described later . a third diode d 3 serving as a rectifier circuit is coupled with dynamo 1 , and the output of this third diode d 3 is coupled , via the first field - effect transistor ( hereinafter simply “ transistor ”) fet 1 , to a third capacitor c 3 serving as a rechargeable battery . the gate of first transistor fet 1 is coupled , via a first resistor r 1 , to the second capacitor c 2 . in this circuit , the third diode d 3 allows the third capacitor c 3 to be charged , via first transistor fet 1 , with the output of dynamo 1 only during the negative half - cycle thereof . as is well known for such transistors , if the potential at the gate of first transistor fet 1 is higher than that at the source by more than a predetermined level ( 2 v , for example ), first transistor fet 1 switches on . since the voltage of the second capacitor c 2 is applied to the gate of the first transistor fet 1 , the applied voltage is sufficiently high even under the low speed condition described earlier , the first transistor fet 1 is stabilized in the on state , and the third capacitor c 3 charging operation is stabilized . the second transistor fet 2 , third transistor fet 3 ( corresponding to switch 5 in fig1 ) and lamp 4 are connected in series to dynamo 1 . diode d 5 , shown connected in parallel with second transistor fet 2 , and diode d 4 , shown connected in parallel with third transistor fet 3 , are parasitic diodes for the respective transistors fet 2 , fet 3 . the gate of the second transistor fet 2 is coupled via a second resistor r 2 to the second capacitor c 2 , and the gate of the third transistor fet 3 is coupled to a control circuit 10 . a third resistor r 3 is also connected in parallel with the gate of third transistor fet 3 . with this circuit arrangement , the gate potential of the first transistor fet 1 can be controlled by control circuit 10 to control charging of the third capacitor c 3 , and the gate potential of the third transistor fet 3 can be controlled according to the charged voltage of the third capacitor c 3 to control on / off operation of the third transistor fet 3 . by switching off the second transistor fet 2 together with the third transistor fet 3 , the lamp 4 can be extinguished completely . the operation of the circuit will now be described . it is assumed that all capacitors are initially empty . first , during the positive half - cycle of the output of dynamo 1 , current flows over path ( 1 ): this results in charging the first capacitor c 1 . the voltage across the first capacitor c 1 reaches approximately the dynamo output peak voltage of 0 . 6 v . during the subsequent negative half - cycle current flows in reverse over path ( 2 ): this results in charging the second capacitor c 2 . the current supplied to the second capacitor c 2 is equal to the current from dynamo 1 plus current from the charged first capacitor c 1 . thus , the second capacitor c 2 can be charged adequately even at low speed . when the voltage across the second capacitor c 2 reaches {( voltage across c 3 )+( on trigger voltage for gate of fet 1 )}, the first transistor fet 1 turns on . the second transistor fet 2 turns on as well . thus , current now flows also over path ( 3 ): this initiates charging of the third capacitor c 3 . with this arrangement , the third capacitor c 3 can be stably charged to relatively high voltage during the negative half - cycle of dynamo output only . furthermore , as the voltage applied to the gate of the first transistor fet 1 can be stabilized by the second capacitor c 2 , the on state of the first transistor fet 1 can be stabilized . at this time the voltage across the third capacitor c 3 is not adequate for driving other electrically powered units in a stable manner . thus , the voltage applied to the gate of the third transistor fet 3 is controlled by the control circuit 10 so that the third transistor fet 3 remains off . during the positive half - cycle , the first capacitor c 1 is charged by means of current flowing over path ( 1 ): as described above , and the lamp 4 is lit by means of current flowing over path ( 4 ): during the subsequent negative half - cycle , the second capacitor c 2 and third capacitor c 3 are charged by means of current flowing over path ( 2 ): the above operation by means of current flowing over paths ( 1 ) and ( 4 ) during the positive half - cycle of dynamo output and operation by means of current flowing over paths ( 2 ) and ( 3 ) during the negative half - cycle , are performed repeatedly . fig3 ( b ) shows the waveform of dynamo output in this case , and fig3 ( a ) shows the waveform of the voltage applied to the lamp . as will be apparent from the drawings , the lamp 4 is lit during the positive half - cycle of dynamo output , while the rechargeable battery ( capacitor c 3 ) is charged during the negative half - cycle . in fig3 ( b ), the positive peak voltage v 1 is lower than the negative peak voltage v 2 ; this is due to a drop in voltage in the dynamo resulting from the lamp load . the third capacitor c 3 is repeatedly recharged in this manner , and when the voltage across the third capacitor c 3 reaches a level sufficient to drive other devices , the third transistor fet 3 is turned on by the control circuit 10 . this causes current to flow over path ( 5 ); so that the lamp lights . in this state the lamp is lit not intermittently , but continuously during both the positive and negative half - cycles of dynamo output . the lamp 4 can be extinguished completely by switching off the second transistor fet 2 in addition to the third transistor fet 3 . in the embodiment described above , the three transistors fet 1 , 2 , 3 , the second and third capacitors c 2 , c 3 , and the control circuit 10 have uniform gnd level , thus obviating the need to provide a special circuit for providing uniform ground level for the elements and enabling the three transistors to be switched easily . furthermore , since the power for operation of the control circuit 10 is obtained from the third capacitor c 3 , application of high voltage from the dynamo to the control circuit 10 can be prevented , thus obviating the need for circuitry to protect the control circuit 10 . while the above is a description of various embodiments of the present invention , further modifications may be employed without departing from the spirit and scope of the present invention . for example , the size , shape , location or orientation of the various components may be changed as desired . components that are shown directly connected or contacting each other may have intermediate structures disposed between them . the functions of one element may be performed by two , and vice versa . it is not necessary for all advantages to be present in a particular embodiment at the same time . every feature which is unique from the prior art , alone or in combination with other features , also should be considered a separate description of further inventions by the applicant , including the structural and / or functional concepts embodied by such feature ( s ). thus , the scope of the invention should not be limited by the specific structures disclosed or the apparent initial focus on a particular structure or feature .	1
fig1 a and 1b are block diagrams for describing the general features of aspects of the present invention . shown in fig1 a are a clock driver 11 , first and second clock - signal cut - off detectors 12 , 13 for detecting cut - off of an input clock signal cla and output clock signal clb of the clock driver 11 , and an abnormality discriminating unit 14 for outputting an alarm signal , which indicates that the clock driver 11 is abnormal , in a case where the output clock signal clb is cut off but not the input clock signal cla . shown in fig1 b are a clock driver 21 , and a phase - difference monitoring unit 22 for comparing a phase difference between the input clock signal cla and the output clock signal clb of the clock driver 21 , and outputting an alarm signal , which indicates that the clock driver 21 is abnormal , in a case where a phase difference greater than a prescribed value has been detected . according to a first method of the invention , the first and second clock - signal cut - off detectors 12 , 13 , respectively , monitors cut - off of the input clock signal cla and cut - off of the output clock signal clb of the clock driver 11 and an abnormality discriminating unit 14 outputs an alarm upon judging that the clock driver 11 is abnormal in a case where the output clock signal clb has been cut off but the input clock signal cla has not . ( see fig1 a above in regard to the first method .) according to a second method of the invention , the phase - difference monitoring unit 22 monitors the phase of the input clock signal cla and the phase of an output clock signal clb of the clock driver 21 and outputs an alarm upon judging that the clock driver 21 is abnormal in a case where the output clock signal clb has developed a phase shift , in excess of a prescribed value , with respect to the input clock signal cla . ( see fig1 b above in regard to the second method .) a third method of the invention includes monitoring cut - off of the input clock signal and cut - off of the output clock signal of the clock driver , monitoring the phase of the input clock signal and the phase of an output clock signal of the clock driver , judging that the clock driver is abnormal when the output clock signal has been cut off but the input clock signal has not , and judging that the clock driver is abnormal when the output clock signal has developed a phase shift , in excess of a prescribed value , with respect to the input clock signal . fig2 is a circuit diagram illustrating a first embodiment of the present invention for detecting abnormality in a clock driver . numeral 11 denotes the clock driver , 12 the first clock - signal cut - off detector for detecting cut - off of the input clock signal cla of the clock driver 11 , 13 the second clock - signal cut - off detector for detecting cut - off of the output clock signal clb of the clock driver 11 , and 14 the abnormality discriminating unit for outputting an alarm signal , which indicates that the clock driver 11 is abnormal , in a case where the output clock signal clb is cut off but not the input clock signal cla . the clock driver 11 is constituted by a pll circuit , by way of example . as shown in fig3 the clock driver 11 includes a phase comparator 11a for outputting the phase difference between the input clock signal cla and a signal clb &# 39 ; obtained by frequency - dividing the output clock signal clb , a phase - difference voltage generating unit 11b such as a low - pass filter for generating a voltage commensurate with the phase difference , a voltage controlled oscillator ( vco ) 11c , to which the voltage commensurate with the phase difference is applied as an input , for outputting the signal ( the output clock signal ) clb , the frequency of which conforms to the input voltage , and a frequency dividing circuit 11d for frequency - dividing the output clock signal . the first clock - signal cut - off detector 12 comprises a monostable multivibrator ( 74hc123 manufactured by national semiconductor or motorola , by way of example ) 12a , and a resistor r1 and capacitor c1 for setting cut - off detection time . when an input is applied to the monostable multivibrator 12a , the latter outputs a pulse whose duration ( the duration of the low level ) is decided by c1 · r1 (= t1 ). accordingly , as illustrated in fig4 a , by setting c1 · r1 (= t1 ) to be longer than the period ta of the input clock signal cla , the output ( alarm signal ) alm1 of the multivibrator can be made a low - level signal at all times in a case where the input clock signal cla is entering normally . however , when the input clock signal cla is cut off , as shown in fig4 b , the alarm signal alm1 is raised to the high level after a period of time t1 following the leading edge of the last input clock signal cla . the second clock - signal cut - off detector 13 comprises a monostable multivibrator ( 74hc123 manufactured by national semiconductor or motorola , by way of example ) 13a , and a resistor r2 and capacitor c2 for setting cut - off detection time . when an input is applied to the monostable multivibrator 13a , the latter outputs a pulse ( an alarm signal alm2 ) whose duration ( the duration of the low level ) is decided by c2 · r2 (= t2 ). operation is exactly the same as that of the first clock - signal cut - off detector 12 . the abnormality discriminating unit 14 has an inverting gate ( not gate ) 14a for inverting the level of the alarm signal alm1 , and an and gate 14b for taking the logical product between the inverted signal * alm1 and the alarm signal alm2 , which is outputted by the second clock - signal cut - off detector 13 . in a case where the input clock signal cla is entering and the clock driver 11 is delivering the output clock signal clb normally , the alarm signals alm1 , alm2 are both at the low level and , hence , the abnormality discriminating unit 14 does not output an alarm signal indicative of an abnormality . in a case where the input clock signal cla is not entering , the output clock signal clb is not delivered . however , since the alarm signals alm1 , aml2 are both at the high level , the abnormality discriminating unit 14 is not outputted . if an abnormality develops in the clock driver 11 so that the output clock signal clb is not delivered in a case where the input clock signal cla is entering , the alarm signal alm1 assumes the low level and the alarm signal alm2 rises to the high level . as a result , the output of the and gate 14b attains the high level and the abnormality discriminating unit 14 outputs the abnormality alarm signal alm (=&# 34 ; 1 &# 34 ;). fig5 is a circuit diagram illustrating a second embodiment of the present invention . numeral 21 denotes the clock driver . by adopting a pll circuit as the clock driver 21 , the phase difference between the input / output clocks cla , clb is suppressed and made a small value . numeral 22 denotes the phase - difference monitoring unit for comparing the phase difference between the input clock signal cla and the output clock signal clb of the clock driver , and outputting an abnormality alarm signal alm , which indicates that the clock driver is abnormal , in a case where a phase difference greater than a prescribed value has been detected . the phase - difference monitoring unit 22 has a delay circuit ( dly ) 22a for delaying the input clock signal cla by a prescribed period of time , thereby outputting a delayed clock signal cla &# 39 ; and a flip - flop ( 74as74 , etc .) 22b . a power - on reset signal por , which assumes the low level a prescribed period of time after power is introduced , is applied to the set terminal of the flip - flop 22b so that the abnormality alarm signal alm will not be outputted when power is introduced . the delayed clock signal cla &# 39 ; enters the d terminal of the flip - flop 22b , and the output clock signal clb enters the clock terminal of the flip - flop 22b . when the clock driver 21 is operating normally , the flip - flop 22b does not latch the input clock signal cla ( i . e ., does not output the abnormality alarm signal alm ) at the timing of the leading edge of the output clock signal clb . when the clock driver 21 is operating abnormally , the flip - flop 22b latches the input clock signal cla and outputs the abnormality alarm signal alm at the timing of the leading edge of the output clock signal clb . when power is introduced to the electronic apparatus , the low - level power - on reset signal por ( see fig6 ) is generated for a prescribed period of time t , the flip - flop 22b of the phase - difference monitoring unit 22 is reset and the abnormality alarm signal alm is initially set to the low level . when the input clock signal cla subsequently enters , this signal is delayed for a prescribed period of time td by the delay circuit 22a before entering the flip - flop 22b . if the clock driver 21 is operating normally and the output clock signal clb is being generated at a frequency and phase identical with those of the input clock signal cla , then the delayed input clock signal cla &# 39 ; cannot be latched at the timing of the leading edge of the output clock signal clb and the abnormality alarm signal alm will be at the low level . if the clock driver 21 develops an abnormality and the phase of the output clock signal clb shifts at a time tab ( see fig6 ) under these conditions , then the delayed input clock signal cla &# 39 ; will attain the high level at the leading edge of the output clock signal clb , the flip - flop 22b will be set and the high - level abnormality alarm signal alm will be outputted . in the second embodiment shown in fig5 the clock driver 21 outputs the clock signal clb having a frequency and phase identical with those of the input clock signal cla . however , there are cases in which the clock signal clb outputted by the clock driver 21 has a frequency n times that of the input clock signal . in such cases , a frequency dividing circuit 23 for frequency - dividing the output clock signal clb by n is provided , as shown in fig7 and a frequency - divided clock signal clb &# 39 ; outputted by the frequency dividing circuit 23 is applied to the clock terminal of the flip - flop 22b . in the first embodiment , a failure that results in complete cut - off of the output from the clock driver can be detected but a failure that results in a phase shift or loss of synchronization in the pll cannot . in the second and third embodiments , on the other hand , there are cases in which , depending upon the arrangement of the phase - difference monitoring unit , the abnormality alarm signal cannot be outputted owing to an impediment in the alarm - signal output function itself when the output of the clock driver is cut off completely . accordingly , if the first and second embodiments are combined , cut - off of the output clock signal , a phase shift and loss of synchronization can all be detected . fig8 is a block diagram illustrating a fourth embodiment of the invention for achieving this . elements identical with those of the first and second embodiments are designated by like reference numerals . numeral 11 denotes the clock driver ( clk drv ), 12 the first clock - signal cut - off detector ( dwn det ) for detecting cut - off of the input clock signal cla of the clock driver 11 , 13 the second clock - signal cut - off detector ( dwn det ) for detecting cut - off of the output clock signal clb of the clock driver 11 , 14 the abnormality discriminating unit for outputting an alarm signal alm &# 39 ;, which indicates that the clock driver 11 is abnormal , in a case where the output clock signal clb is cut off but not the input clock signal cla , 22 the phase - difference monitoring unit for comparing a phase difference between the input clock signal cla and the output clock signal clb of the clock driver 11 , and outputting an alarm signal alm &# 34 ;, which indicates that the clock driver 11 is abnormal , in a case where a phase difference greater than a prescribed value has been detected , and 31 an or gate for taking the logical sum of the first alarm signal generated by the abnormality discriminating unit 14 and the second alarm signal generated by the phase - difference monitoring unit 22 and outputting the abnormality alarm signal alm . thus , in accordance with the present invention , cut - off of the input clock signal and output clock signal of a clock driver is monitored and an alarm is issued upon discriminating that the clock driver is abnormal in a case where the output clock signal is cut off but not the input clock signal . alternatively , the phases of the input clock signal and output clock signal of a clock driver are monitored and an alarm is issued upon discriminating that the clock driver is abnormal in a case where the output clock signal has developed a phase shift , in excess of a prescribed value , with respect to the input clock signal . as a result , abnormality in a clock driver circuit , which occupies an important position in an electronic apparatus , can be monitored with ease and the reliability of the apparatus can be improved . further , the apparatus for monitoring abnormality in a clock driver according to the present invention is capable of being incorporated in a single - chip ic or the like along with the clock driver circuit . this contributes to an economical and highly reliable clock driver . as many apparently widely different embodiments of the present invention can be made without departing from the spirit and scope thereof , it is to be understood that the invention is not limited to the specific embodiments thereof except as defined in the appended claims .	6
the flow diagram in fig1 shows a preferred embodiment of the invention . the only drawing shows an example of a flow diagram of a cement clinker line . core of the line is a rotary kiln 10 between a clinker cooler 20 and heat exchanger tower 30 . the rotary kiln 10 has a burner protruding into the rotary kiln 10 from the clinker cooler side ( not illustrated ), to produce the heat required for clinker manufacture by combustion in the rotary kiln 10 . the flue gas arising in combustion escapes from the rotary kiln 10 on the heat exchanger tower side . from this side , raw - meal is in return supplied to the rotary kiln 10 . the heat exchanger tower 30 in this example has four cyclones 32 connected in a cascade , i . e . serially connected , for preheating and partial deacidification of raw - meal by heat of the flue gas and for gross dedusting of the flue gas . any other suitable number of cyclones may be used as well . the flue gas escaping from the heat exchanger tower 30 has a typical temperature of 300 - 500 ° c . before the flue gas is supplied to a flue gas filter 50 for further dedusting , it is cooled to a temperature below at least approximately 150 ° c . this leads to condensation of heavy metals in the flue gas , such as mercury and thallium , on the dust contained in the smoke . this dust is separated in the flue gas filter 50 and thus acts as cold trap for heavy metals . additionally , the volume to be dedusted ( per unit of time ) is drastically reduced and more cost - efficient fabric filter techniques can be used . three options are intended to cool the flue gases : ( 1 ) supply of the flue gases to a steam boiler 100 , to produce steam that is expanded in a turbine setup 120 , e . g . to power a generator , ( 2 ) supply of the flue gases to a raw mill 34 , to dry the raw material supplied to the raw mill and preheat the raw - meal , and ( 3 ) supply of the flue gases to an evaporation cooler 36 . the corresponding conduits have flaps 38 to separate the flue gas flow between the three cooling options . in regular operation , as little as possible , that is no or hardly any flue gas should be cooled with the evaporation cooler 36 , since the heat removed from the flue gas in the evaporation cooler 36 is no longer available as process heat . the evaporation cooler thus preferably only has the function of emergency cooling if the steam boiler 100 cannot be used . the cooled flue gas is then dedusted in a flue gas filter 50 and the dedusted flue gas is supplied to an scr - system 60 for catalytic denitrification of the flue gases . for this , it must be heated to at least 230 ° c .- 270 ° c . therefore , it is supplied from the flue gas filter 50 first to a recuperator 62 that is supplied by denitrified flue gas escaping from the scr system in the counterflow , so that heat is transferred from the denitrified ( pure gas ) to the flue gas to be subjected to denitrification ( raw gas ). the flue gas to be denitrified escaping from the recuperator is supplied to a further heat exchanger to heat it further . this further heat exchanger 64 is also referred to as “ second heat exchanger ” in the scope of this patent application . the heat necessary for heating the flue gas is supplied to the second heat exchanger 64 through a thermal oil as heat carrier fluid . the flue gas heated in this manner in two steps ( first step recuperator 62 , second step “ second heat exchanger 64 ”) is supplied to the scr - system 60 and denitrified there . the denitrified flue gas heats the flue gases to be denitrified in the recuperator 62 as already described and is cooled off accordingly . then the flue gas is cooled in another heat exchanger 102 to preferably about 110 ° c . and can be discharged through a stack as indicated . the heat removed from the flue gas in the heat exchanger 102 is used for feed water preheating for the steam boiler 100 and / or a boiler 110 . alternatively , they can also be fed into a district heat network or used for power generation in an orc - procedure . “ orc ” is the common abbreviation for “ organic rankine cycle ”, a procedure in which steam turbines are operated with the steam of low - boiling organic fluids . additionally , the preferably continuous removal of clinker from the rotary kiln 10 removes heat from the rotary kiln 10 . this clinker , which is initially about 1450 ° c . hot , is cooled in the clinker cooler 20 . the cooling agent is preferably air . the clinker cooler 20 therefore is a heat exchanger . part of the cooling agent heated in the clinker cooler 20 is drawn off from the clinker cooler through a middle air outlet 24 . the heat stored in the discharged cooling agent , hereinafter briefly called exhaust , heats thermal oil as heat carrier fluid in a heat exchanger 80 after gross dedusting in a cyclone 77 . the heat transferred to the heat carrier fluid can also be transported across long distances with low heat loss , specifically to heat the flue gas to be denitrified to the temperature required for denitrification in the second heat exchanger 64 . the heat exchanger 80 has an inlet 81 for the exhaust that is routed first through a first conduit 83 in the heat exchanger to heat the heat carrier fluid that flows through the first conduit . subordinately to the first conduit 83 , there is a second conduit 84 through which the exhaust is routed . in the second conduit 84 , another heat carrier fluid flows and is heated by the exhaust . in the example shown , the other heat carrier fluid is water , which is preheated as feed water for the steam boiler 100 and / or a boiler 110 . the exhaust leaves the heat exchanger 80 through an outlet 82 . the exhaust is routed in a flow channel in the heat ex - changer 80 . the flow channel is u - shaped , i . e . it has two free legs 85 , 86 that are connected by a bottom cross leg 87 . each of the two free legs 85 , 86 has one of the two conduits 83 , 84 . deflection of the exhaust in the area of the cross leg 87 leads to clinker dust carried along in the exhaust collecting at the bottom of the cross leg , where it can be separated . the outlet 85 is connected to a cooler 70 to set the temperature for the down - stream filter 75 . the filter 75 is used to dedust the exhaust air , which can then , e . g ., be discharged through an indicated stack . the device for baking of clinker has a chloride bypass in addition to the flue gas treatment described above . part of the flue gas escaping from the rotary kiln 10 is not supplied to the raw - meal preheater but first mixed with fresh air in a mixing chamber 90 . a mixing temperature of about 450 ° c . ( 400 ° c .- 500 ° c .) is set . the temperature achieved in this manner permits hot gas dedusting in a hot gas filter 94 . the hot gas filter is followed by a boiler 110 . in the boiler , steam is gen - erated that is relieved in the turbine setup . the flue gas escaping from the boiler is used as cooling air for the clinker cooler 20 and returned to the rotary kiln 10 through the clinker cooler 20 . because the flue gases escaping from the boiler still have a temperature clearly above the usual ambience temperatures , the return of the flue gases through the clinker cooler enables achievement of a high secondary air temperature and the fuel consumption drops accordingly in return . it will be appreciated to those skilled in the art having the benefit of this disclosure that this invention is believed to provide a method an apparatus for cement clinker manufacture . further modifications and alternative embodiments of various aspects of the invention will be apparent to those skilled in the art in view of this description . accordingly , this description is to be construed as illustrative only and is for the purpose of teaching those skilled in the art the general manner of carrying out the invention . it is to be understood that the forms of the invention shown and described herein are to be taken as the presently preferred embodiments . elements and materials may be substituted for those illustrated and described herein , parts and processes may be reversed , and certain features of the invention may be utilized independently , all as would be apparent to one skilled in the art after having the benefit of this description of the invention . changes may be made in the elements described herein without departing from the spirit and scope of the invention as described in the following claims .	1
the detailed description set forth below in connection with the appended drawings is intended as a description of the presently preferred embodiment of the invention and is not intended to represent the only form in which the present invention may be constructed or utilized . it is to be understood , however , that the same or equivalent functions may be accomplished by different embodiments that are also intended to be encompassed within the spirit and scope of the invention . with reference to fig1 and 2 , the presently disclosed adjustable knee brace 100 with respect to a wearer &# 39 ; s leg 10 is shown . leg 10 is anatomically comprised of femur ( thigh ) section 16 , knee 12 , and tibia ( shin ) section 14 . femur section 16 is braced by femoral frame 200 and is in a pivoting relationship with tibial frame 300 , which braces tibia section 14 . such a pivoting relationship is enabled by hinge components 401 and 402 , which preferably are ratio swing hinges constructed according to the disclosure in u . s . pat . no . 4 , 940 , 044 , owned by the current assignee , the disclosure of which is expressly incorporated herein in its entirety by reference . such hinge components 401 and 402 are designed to closely simulate the rotational movement of the tibia relative the femur , and essentially simulate normal knee movements . all connections herein to hinge components 401 and 402 are as described in the referenced patent . those skilled in the art will recognize that other conventional hinge constructions are clearly contemplated for use herein . referring specifically to fig2 , an exploded view of the knee brace 100 is shown . femoral frame 200 is comprised of medial frame 220 , lateral frame 210 , inner width adjustment plate 260 , and outer width adjustment plate 250 . medial frame 220 has a horizontally elongate section 224 and vertically elongate section 226 . horizontally elongate section 224 includes a width adjustment slot 222 which extends substantially across horizontally elongate section 224 . furthermore , horizontally elongate section 224 is preferably formed in an arcuate configuration to accommodate the shape of leg 10 , specifically the curvature of femur section 16 so as to minimize the profile resulting from and the obstruction caused by the presence of knee brace 100 . vertically extending section 226 is comprised of upper angular adjustment bolt securing hole 228 a , and lower angular adjustment bolt securing hole 228 b . angle adjustment arm 240 has a vertically elongate angle adjustment slot 242 , which slidably engages medial frame 220 at angular adjustment bolt securing holes 228 a and 228 b . angle adjustment retaining bolts ( not shown ) are inserted through angle adjustment holes 228 a and 228 b and angle adjustment slot 240 . in its most extended state , the upper end of angle adjustment slot 242 corresponds in position to that of upper angular adjustment bolt securing hole 228 a . in its most contracted state , the lower end of angle adjustment slot 242 corresponds in position to that of lower angular adjustment bolt securing hole 228 b . thus , the effective height of the medial side of knee brace 100 can be adjusted , and accordingly , adjustable for bow - legged and knock - kneed legs , a condition characterized by the tibia angling towards the medial - side of the leg or the lateral side of the leg . by tightening the angle adjustment retaining bolt , the position of the angle adjustment arm 240 is secured relative to the medial frame 220 . an analogous angular adjustment is disclosed in u . s . pat . no . 6 , 875 , 187 , the disclosure of which is expressly incorporated by reference in its entirety herein . lateral frame 210 , similar to its counterpart medial frame 220 , has a horizontally elongate section 225 and a vertically elongate section 227 . horizontally elongate section 225 includes a width adjustment slot 233 which extends substantially across horizontally elongate section 225 . like the horizontally elongate section 224 of medial frame 220 , the horizontally elongate section 225 of lateral frame 210 is preferably formed having an arcuate configuration to accommodate the shape of leg 10 . unlike medial frame 220 , however , lateral frame 210 has an extended vertically elongate section to compensate in height for the lack of an angle adjustment arm . instead , the lower end of lateral frame 210 has hinge connecting holes 404 to the hinge component 401 shown in fig1 , whereas the medial frame 210 has no hinge connecting holes ; the hinge connecting holes 404 being on the angle adjustment arm 240 . with reference to fig2 , 4 a , and 4 b , the details of the width adjustment mechanism will be explained . specifically referring to fig2 and 3 , width adjustment slot 222 has a distal end 238 and a proximal end 236 . lateral frame 210 also has width adjustment slot 233 configured to mirror width adjustment slot 222 on medial frame 220 . lateral frame adjustment slot 222 has a proximal end 237 and a distal end 239 . outer width adjustment plate 250 has medial extrusion 254 and lateral extrusion 256 , and inner width adjustment plate 260 similarly has medial extrusion 264 and lateral extrusion 266 . medial extrusion 264 and lateral extrusion 266 of inner width adjustment plate 260 is configured to abut slightly into width adjustment slots 222 and 233 so as to facilitate a sliding relationship along semicircular horizontal axis 270 with minimal angular deviation from the same . as illustrated in fig3 , medial frame 220 and lateral frame 210 is sandwiched i . e . disposed between outer width adjustment plate 250 and inner width adjustment plate 260 . outer width adjustment plate 250 and inner width adjustment plate 260 include retaining bolt securing holes 258 . the sandwiched relationship is maintained by retaining bolt 280 , which is passed through retaining bolt securing holes 258 on outer width adjustment plate 250 , then through width adjustment slots 222 and 233 on medial frame 220 and lateral frame 210 , respectively , then through retaining bolt securing holes 258 on inner width adjustment plate 260 , and finally tightened with retaining nut 281 . when the width configuration is determined by the user , retaining bolt 280 and retaining nut 281 is tightened to prevent further movement of medial frame 220 and lateral frame 210 against outer width adjustment plate 250 and inner width adjustment plate 260 . when the width configuration is to be modified , retaining bolt 280 and retaining nut 281 is loosened . now referring to fig4 a and 4 b , the width adjustment functionality of femoral brace 200 is shown . in its most extended position as shown in fig4 a , retaining bolt 280 is positioned in the most inward location , proximal ends 236 and 237 of width adjustment slots 222 and 233 . in its most contracted position as shown in fig4 b , retaining bolt 280 is positioned in the most outward location at distal ends 238 and 239 of width adjustment slots 222 and 233 . as can be seen , the width 232 of femoral brace 200 can be increased or decreased depending on the relative position of the lateral frame 220 and medial frame 210 with respect to the outer and inner width adjustment plates 250 and 260 shown in fig2 . thus , legs of a variety of widths can be rapidly and securely accommodated with the present inventive device . the above description is given by way of example , and not of limitation . given the above disclosure , one skilled in the art could devise variations that are within the scope and spirit of the invention disclosed herein . further , the various features of the embodiments disclosed can be used alone , or in varying combinations with each other and are not intended to be limited to the specific combination described herein . thus , the scope of the claims is not to be limited by the illustrated embodiments .	0
the preferred embodiments will be described with reference to the drawing figures wherein like numerals indicate like elements throughout . with reference to fig1 there is shown plasma treatment chamber 2 which is useful in accordance with the present invention . plasma treatment chamber 2 is divided into a plasma generating side 4 and a plasma focusing side 6 . in use , the plasma generating side 4 and the plasma focusing side 6 are joined together in a sealed relationship except for openings 8 and 10 at the respective upper and lower ends . entry and exit openings are created by the recesses 12 , 14 , 16 and 18 . since the pressure in the plasma treatment chamber 2 is preferably below atmospheric pressure , the recesses 12 , 14 , 16 and 18 will be provided with air locks of foam material or loop pile material , such as is available under the trade name velcro ®. presently , a closed cell polyolefin , such as polyethylene or polypropylene , foam is preferred . when chamber 2 is closed , the walls 20 and 22 will form a channel 24 through the apparatus 2 . a substrate passing between the air locks at openings 8 and 10 will pass into channel 24 and be sufficiently sealed against the atmosphere so as to maintain the desired vacuum level within the plasma treatment chamber 2 . the vacuum in chamber 2 is drawn through the outlet ducts 30 and 32 by a suitable vacuum generating device as will be known to those skilled in the art . currently , the plasma is being generated between 900 milli torr ( 0 . 900 torr ) and 3 torr . in earlier trials , plasma was generated at up to 34 torr . with reference to fig2 taken along line 2 -- 2 of fig1 there is illustrated a substrate 3 as it passes through the plasma treatment chamber 2 and the hollow cathode assemblies 36 . as shown in fig1 and 2 , the hollow cathode assemblies 36 define multiple hollow cathodes 38 . the plasma generated in the hollow cathodes 38 will be initially focused in the vicinity of the substrate 3 . additional focusing of the plasma on the substrate is accomplished by the focusing means included in plasma focusing side 6 . turning now to fig3 there is a view of the plasma focusing side 6 of plasma treatment apparatus 2 that is taken along the line 3 -- 3 of fig1 . the plasma focusing side 6 includes a plurality of focusing arrays 50 which are located in space relative to each other so as to achieve a reinforcement of the magnetic focusing field . surrounding the magnets 50 ( shown in crosshatch for clarity ) are the cooling ducts 52 which serve to control the temperature in the chamber , thereby protecting the magnets from overheating . plasma treatment to remove low molecular weight material or surface impurities will preferably use readily available , inexpensive , environmentally benign gases . in some applications , plasma treatment alone may be sufficient , however , it can be followed by coating with metals , ceramics , or polymerizable compounds . preferred polymerizable compounds are radiation curable organic monomers containing at least one double bond , preferably at least two double bonds , especially alkene bonds . acrylates are particularly well - suited monomers . metals suitable for deposition include , but are not limited to al , cu , mg , and ti . ceramics suitable for deposition include , but are not limited to , silicate - containing compounds , metal oxides particularly aluminum oxide , magnesium oxide , zirconium oxide , beryllium oxide , thorium oxides , graphite , ferrites , titanates , carbides , borides , silicides , nitrides , and materials made therefrom . multiple coatings comprising metal , ceramic or radiation curable compound coatings are possible . plasma treatment leads to one or more of the following benefits : cleaning , roughening , drying , or surface activation . plasma treatment can also lead to chemical alteration of a substrate by adding to a substrate or removing from a substrate , functional groups , ions , electrons , or molecular fragments , possibly accompanied by cross - linking . all materials are of interest for plasma treatment or application of a secondary coating . those of primary interest are polymers , such as aramids , polyesters , polyamides , polyimides , fluorocarbons , polyaryletherketones , polyphenylene sulfides , polyolefins , acrylics , copolymers and physical blends or alloys thereof . preferred secondary layer coating thickness for polymers is in the range of 0 . 1 to 100 microns , more preferably 20 to 100 microns , most preferably 20 to 40 microns . preferred metal or ceramic secondary layer coating thickness is in the range of 50 angstroms to 5 microns , more preferably 100 to 1000 angstroms . a preferred polymer is an acrylate of acrylic acid or its esters . the preferred acrylates have two or more double bonds . monoacrylates have the general formula ## str1 ## wherein r 1 , r 2 , r 3 , and r 4 are h or an organic group . diacrylates are acrylates of formula i wherein either r 1 , r 2 , r 3 , or r 4 is itself an acrylate group . organic groups are usually aliphatic , olefinic , alicyclic , or aryl groups or mixtures thereof ( e . g . aliphatic alicyclic ). preferred monoacrylates are those where r 1 , r 2 and r 3 are h or methyl and r 4 is a substituted alkyl or aryl group . preferred diacrylates have the formula ## str2 ## where r 1 , r 2 , r 3 , r 5 , r 6 , r 7 are preferably h or methyl , most preferably h . r 4 is preferably c 2 - c 20 alkyl , aryl , multialkyl , multiaryl , or multiglycolyl , most preferably triethylene glycolyl or tripropylene glycolyl . the notation , c 2 - c 20 alkyl , indicates an alkyl group with 2 to 20 carbon atoms . r 4 in a mono - or multiacrylate is chosen to yield the desired surface properties after the monomer has been radiation cured to form a surface on a substrate . table 1 contains a list of examples . table 1______________________________________r . sup . 4 surface properties______________________________________ -- ch . sub . 2 ch . sub . 2 ch . sub . 2 och . sub . 2 ch . sub . 2 ch . sub . 2 och . sub . 2ch . sub . 2 ch . sub . 2 -- abrasion resistance -- ch . sub . 2 ch . sub . 2 och . sub . 2 ch . sub . 2 och . sub . 2 ch . sub . 2 -- abrasion resistance -- ch . sub . 2 ch . sub . 2 cooh hydrophilicity -- ch . sub . 2 ch . sub . 2 oh hydrophilicity______________________________________ formula i and ii can also include triacrylate and other polyacrylate molecules . mixtures of diacrylates can be copolymerized , for example a 50 : 50 mix of two structurally different diacrylates . diacrylates can also be copolymerized with other polymerizable components , such as unsaturated alcohols and esters , unsaturated acids , unsaturated lower polyhydric alcohols , esters of unsaturated acids , vinyl cyclic compounds , unsaturated ethers , unsaturated ketones , unsaturated aliphatic hydrocarbons , unsaturated alkyl halides , unsaturated acid halides and unsaturated nitrites . diacrylates of interest also include 1 , 2 - alkanediol diacrylate monomers of formula ## str3 ## where r 1 is in an acrylate radical having about 8 to 28 carbon atoms and r 2 is hydrogen or methyl ( see for example u . s . pat . no . 4 , 537 , 710 ). the agent for promoting polymerization may be radiation , such as uv radiation or electron beam radiation . in some instances , it may be preferred to use a photoinitiator , such as an appropriate ketone . acrylate - based formulations of interest also include heterogeneous mixtures . these formulations contain a very fine dispersion of metal , ceramic , or graphite particles . these coatings are designed to enhance the abrasion resistance and / or the conductivity of the surface . for the photo - curing ( uv / visible ) of these pigmented dark acrylate - based formulations , a long wave length (& gt ; 250 nm ) radiation source in combination with a compatible photoinitiator may be preferred . turning now to fig4 and 5 , there are illustrated apparatuses for sequential plasma treatment , coating , and curing of a continuous substrate which may most easily be thought of as a strand 3 . in fig4 a plasma treatment apparatus 2 , a coating applicator 60 , and a curing unit 70 , provide an integrated system for treatment of the strand 3 . the direction of movement of the strand 3 is indicated by the in and out arrows . the strand 3 moves over a guide roller 88 and enters the plasma treatment apparatus 2 at the opening 8 . to achieve uniform coverage , the strand 3 will not touch either wall 20 or wall 22 . however , the strand 3 will pass closer to wall 22 than to wall 20 . if it is desired to treat only one surface of a strand , the surface to remain untreated may be shielded , such as by contact with wall 22 . after the strand 3 passes through channel 24 , it exits the plasma apparatus 2 through opening 10 . in the preferred embodiment , the coating applicator 60 , is a capillary drip system 400 including a reservoir 402 , a pump 404 , a dispensing manifold 406 , a plurality of capillary tips 408 , and a separating roller 410 having a plurality of grooves 412 dimensioned to receive a substrate as shown in fig5 . the coating solution 61 is pumped from the reservoir 402 into the dispensing manifold 406 and through the plurality of capillary tips 408 . each tip 408 is associated with a groove 412 in the separating roller 410 . in this arrangement , the roller 410 may rotate or be held stationary . the strand 3 is directed to engage the roller 410 horizontally or at an angle up to 45 ° above horizontal . the strand 3 travels around the roller 410 and continues vertically upward into the curing unit 70 . the variation in the initial angle θ determines how the strand 3 is coated . depending on the angle θ , the strand contacts 25 - 50 % of the roller 410 circumference . use of this capillary tip system is accurate and efficient , requires less coating solution 61 , and provides a more uniform coating than other methods . this approach is believed to be beneficial because it allows for remote location of the reservoir 402 away from potential curing radiation which may impact a dip bath . returning to fig4 the strand 3 then enters into the curing apparatus 70 through channel 72 and passes out of the apparatus at channel 74 . the channels 72 and 74 are defined by the extensions 75 and 76 . the central channel 77 is defined by the walls 78 and 79 of the curing apparatus 70 . after passing the last guide roller 88 , the strand 3 is handled in the usual manner associated with normal production of an unmodified product . in one embodiment , curing apparatus 70 has one section 80 with a plurality of uv lamps ( one lamp is noted as 82 ) and an opposed section 84 with a plurality of opposing mirrors ( one mirror is noted as 86 ). in a preferred arrangement for curing certain monomer coatings , there are up to four lamps , in opposed pairs . each lamp is preferably adjustable for controlling their combined output . the sections 80 and 84 are hinged relative to each other to allow access for startup and repair . the uv light used for curing preferably emits radiation between 150 and 400 nanometers . the series of guide rollers 88 change the direction of the strand 3 so it passes continuously through plasma treatment apparatus 2 , coating applicator 60 , and curing apparatus 70 . the system components , plasma treatment apparatus 2 , coating applicator 60 , curing apparatus 70 , and rollers 88 , are secured in a stable manner to preserve the spacial relationship between them . fig7 illustrates the case for multiple strands 3 , such as monofilaments , passing through the plasma treatment apparatus 2 . the strands are spaced across the width , preferably in individual paths , so that the entirety of the strand is exposed to treatment . the individual strands are preferably guided by grooves cut in the rollers 88 . using a series of grooved rollers 88 keeps the strands in the desired relationship as they move through the treatment process . the treated substrate is tested according to test method 118 developed by the american association of textile chemists and colorists ( aatcc ). drops of standard test liquids , consisting of a selected series of hydrocarbons with varying surface tensions , are placed on the surface and observed for wetting , wicking , and contact angle . the oil repellency grade is the highest numbered liquid which does not wet the surface . the method was modified to test for water repellency , using test liquids of isopropanol and water in ratios of 2 : 98 , 5 : 95 , 10 : 90 , 20 : 80 , 30 : 70 , and 40 : 60 ( in percent by volume ) numbered one through six respectively . if surface wetting does not occur within 10 seconds , the next test liquid is applied . lower ratings indicate oleo - or hydrophilicity while higher ratings indicate oleo - or hydrophobicity . using a continuous treatment system shown in fig1 - 5 , a plurality of strands are treated . an extruder is adjusted to produce 10 ends of a polyethylene terephthalate monofilament with a nominal size of 0 . 26 mm × 1 . 06 mm . these sizes have a tolerance of 0 . 22 - 0 . 304 mm and 1 . 01 - 1 . 11 mm respectively , with an expected yield of 2900 denier . additionally the yam would have a relative elongation at 3 grams per denier of 19 %, and a free shrinkage at 200 degrees centigrade of 6 . 5 %. the production speed of the extruder line is set at 216 . 8 fpm , with the godet rolls and oven temperatures appropriately adjusted to give the specified yarn . immediately after exiting the extruder , nine of the ten strands are introduced into the plasma chamber , which is at 1 . 01 torr , with constant induction of 400 ml / min of commercial grade argon . the amplifier and tuner are adjusted to introduce 1326 watts to the hollow cathode , with less than 10 watts of reflected power . an external chiller is used , which maintains the temperature near room temperature , but above the dew point . upon exiting the plasma chamber , the nine ends are then directed to a grooved separator roll where monomer is applied . from a one inch manifold being supplied formulation mm2116 by a diaphragm pump , nine capillaries drop to individual grooves spaced evenly across the roller . the air - operated pump is adjusted with a micro air valve to supply a steady state of monomer to the monofilament . a weighing device is used to continually monitor the amount delivered . coating thickness can be controlled by increasing or decreasing pump pressure , fiber speed or stopping the rotation of the roller . after coating , the yarn proceeds directly upward , and enters the ultra violet cure box , which has three lamps operating . two lamps are set on medium , and one is set on high , providing an immediate and complete cure of the monomer . in the upper section , two of the lamps are opposed to each other rather than having one lamp opposed by a mirror . other applications may demand more or fewer lamps . after the yarn exits the uv chamber , it continues down the line through a nip roll and onto the spools mounted on a conventional spool winder . this particular run experienced an increase in the minor axis of 0 . 0274 mm and in the major axis of 0 . 1486 mm , causing an increase in weight of 178 grams per 9000 meters or approximately a 5 . 8 % add on . the resulting yarn has an oil , water rating of 4 , 6 when tested with aatcc test method # 118 . the yarn was then woven into a filling float fabric using conventional processing methods . the yarn survives the rigors of warping and weaving without abrasion , or flaking indicating the coating is securely affixed . resulting fabrics also have an oil , water rating of 4 , 6 on one surface designated as the face . the untreated pet control has an oil , water rating of 0 , 2 - 3 . in this particular example , a series of acrylate - based fluorinated monomer / oligomer formulations have been tested for this application . these materials cover a broad range of surface energies ( hydrophobic / hydrophilic and oleophobic / oleophilic ), crosslinking densities , abrasion resistance and adhesion to the substrate . the formulation sigma - mm - 2116 is a solvent - free , acrylate based monomer / oligomer mix which contains 50 - 95 % perfluorinated monoacrylate with fluorine content ranging from 30 - 64 %. the formulation also contains 3 - 50 % multi - functional , compatible crosslinking agents , e . g . di - and tri - acrylate monomers . also 1 - 20 % of an adhesion promoter was added to enhance diacrylate monomers functionalized with hydroxyl , carboxyl , carbonyl , sulfonic , thiol , or amino groups . the high fluorine content lowers the surface energy of the cured coating and turns the coated yarn into hydrophobic and oleophobic material . combining the plasma treatment of the surface of the substrate with the functionalization of the coating with a specialty adhesion promoter formulation helps to achieve an excellent adhesion between the coating and the substrate while keeping the energy low , making the surface of the substrate both hydrophobic and oleophobic . in addition to the formulation for hydrophobicity / oleophobicity , formulations are also contemplated in applications for electrostatic dissipation and abrasion resistence . although the presently preferred embodiment uses the capillary drip applicator , initial efforts called for a monomer bath . as shown in the sectional view of fig6 the bath 418 is essentially a tub 420 for holding the monomer solution 61 and a submersible frame 422 for controlling passage through the monomer solution 61 . the frame 422 moves horizontally on shaft 424 and vertically on shaft 425 . the depth of roller 426 in the monomer solution 61 may be controlled by fixing the position of shaft 425 . when the roller 426 is submerged in the monomer solution 61 , each strand 3 is passed around the roller 426 so that it will exit vertically from the bath as indicated by the broken line . using a continuous treatment system as shown in fig1 to 5 , a polyethylene terephthalate ( pet ) monofilament of 0 . 5 mm diameter is treated . in this example , a sample monofilament is fed from the final extrusion process directly to the plasma treatment apparatus . the control sample is fed from the final extrusion process directly to a wind up roll . as used herein , directly means the absence of intermediate processing steps or storage between processing steps for an extrudate . the line speed in the test system is 200 ft / min but speeds up to 700 feet / min are employed during production . the gas in the plasma treatment apparatus may be 10 % argon and 90 % nitrogen but is more preferably 20 % oxygen and 80 % argon . the gas is introduced into the treatment chamber at a rate sufficient to achieve a stable plasma . the vacuum pressure is 10 - 1 - 10 - 4 torr . power supplied to the plasma chamber is about 2 kw ( kilowatts ). the power is created with direct current or alternating current but is preferably created with an alternating current in the range of 10 to 100 khz , with 40 khz being preferred . the monomer bath contains a solution of triethyleneglycol diacrylate . the lamps in the uv treatment apparatus are 15 inch hanovia high pressure hg lamps that generate 300 w / inch . the treated monofilament is compared to the control monofilament by surface tension measurements using the oil and water tests described above . it is preferred to use continuous or in - line processing where the substrate moves through the base processing step , such as extrusion , and plasma / coating treatment at the same speed . other alternative coating means may be used such as u shaped applicators , a kiss roll , eyelet applicators , and clamshell eyelet applicators . in a more traditional finishing device , the strand passes through a liquid - filled u - shaped device , and emerges with a coating around its entire perimeter . where capillary action can be used to carry a coating around the strand , a kiss roll applicator may be used . in this technique , the strand is coated when it &# 34 ; kisses &# 34 ; a liquid covered roller which is rotating with or against the strand &# 39 ; s direction of travel . in yet another embodiment , the strand passes through an eyelet through which the coating is pumped . the eyelet may have a clam - shell design to avoid the need for threading the strand through the eyelet . fig8 a through 8g illustrate exemplary cross - sections of coated strands which are producible in accordance with the above example . all cross - sections are greatly exaggerated to permit demonstration of the point . in fig8 a , the substrate 302 has a plasma - treated outer surface 303 surrounded by a coating layer 304 . more than one type of coating may be applied through repeated coating techniques . in fig8 b , the usually preferred embodiment , the first coating layer 304 and a secondary coating 306 surround the core 302 . in fig8 c , the outer layer 306 is disposed only partly around the first coating layer 304 . in fig8 d , the first coating 304 and the secondary coating 306 are disposed only partly around core 302 . in fig8 e , the coating layer 304 is only partly around the core 302 but the coating 306 is completely around the core 302 . fig8 f illustrates exemplary cross - sections of rectangular strands . in fig8 f , the plasma - treated substrate 302 , like in 7b , is coated with a first layer 304 , such as a metal or polyacrylate , and a second layer , 306 , such as a metal or polyacrylate . in fig8 g , like 7d , the substrate 302 is covered for a portion thereof by a first layer 304 and a second layer 306 . depending on the substrates dimensions , the cross - section in fig8 g can resemble that of a thin film . in general , the coating is nonconformational . that is , it will tend to be self - leveling and will not conform to the geometry of the substrate . fig9 - 12 show alternative plasma treatment chambers and coating and curing units . fig9 shows a representative upper chamber , 126 and a representative lower chamber , 127 , to illustrate one treatment arrangement . in fig9 upper chamber 126 has the hollow cathodes arrays 36 and 36 , and lower chamber 127 has focusing magnets 50 . the arrangement of fig9 will plasma treat only the upper surface 98 of a substrate 97 when it is relatively dense . for an open , less dense substrate , like a web or open fabric , it may be possible to treat surfaces 98 and 99 at one time . if desired , additional hollow cathodes arrays 36 may be located in the adjacent lower chamber and additional focusing magnets 50 may be located in the adjacent upper chamber 126 , to simultaneously treat upper surface 98 and lower surface 99 . fig9 does not show a gas feed connection for introducing gas to be ionized or electrical connections linked to the cathodes as these connections will be known to those skilled in the art as a matter of design choice . fig1 shows a representative upper chamber 128 and a representative lower chamber 129 in an arrangement for metal deposition . lower chamber 129 has resistively heated boats 171 and a supply of aluminum wire 173 on spool 175 . as the wire 173 contacts the resistively heated boats 171 , the wire is vaporized . it then condenses on the lower surface 99 . alternatively , one can create a ceramic coating by introducing oxygen in to chamber 129 to oxidize the aluminum and create aluminum oxide ( al 2 o 3 ). fig1 shows a representative upper chamber 124 and a representative lower chamber 125 for creating a monomer layer on surface 98 . a monomer vaporizer 180 creates a cloud of monomer vapor which will be deposited through condensation on the upper surface 98 . if desired , avaporizer 180 , shown in phantom could be located as a mirror image in lower chamber 125 . fig1 shows a representative upper chamber 130 that has a bank 190 of uv emitting lights 82 that irradiate and cure the monomers on surface 98 . alternatively , the radiation device can be one that emits an electron beam . if the substrate is treated on both surfaces a second bank 190 , as shown in phantom will be located in chamber 131 .	7
it is believed that one skilled in the art can , based on the description herein , utilize the present invention to its fullest extent . the following specific embodiments are , therefore , to be construed as merely illustrative , and not limitative of the remainder of the disclosure in any way whatsoever . unless defined otherwise , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . also , all publications , patent applications , patents , and other references mentioned herein are incorporated by reference . somatostatin ( somatotropin release inhibiting factor or srif ) has both a 14 amino acid isoform ( somatostatin - 14 ) and a 28 amino acid isoform ( somatostatin - 28 ). see wilson , j . & amp ; foster , d ., williams textbook of endocrinology , p . 510 ( 7th ed ., 1985 ). the compound is an inhibitor of secretion of the growth hormone and was originally isolated from the hypothalamus . brazeau , et al ., science 179 : 77 ( 1973 ). native somatostatin has a very short duration of effect in vivo since it is rapidly inactivated by endo - and exopeptidase . many novel analogs have been prepared in order to enhance the duration of effect , biological activity , and selectivity ( e . g ., for the particular somatostatin receptor ) of this hormone . such analogs will be called “ somatostatin agonists ” herein . various somatostatin receptors ( sstrs ) have been isolated , e . g ., sstr - 1 , sstr - 2 , sstr - 3 , sstr - 4 , and sstr - 5 . thus , the somatostatin agonist may be a sstr - 1 agonist , sstr - 2 agonist , sstr - 3 agonist , sstr - 4 agonist or an sstr - 5 agonist . in one embodiment , the somatostatin agonist of the present invention is an sstr - 5 agonist or an sstr - 2 agonist . what is meant by an “ sstr - 5 agonist ” or an “ sstr - 2 agonist ” is a compound which ( 1 ) has a high affinity ( e . g ., ki of less than 1 μm or , preferably , of less than 10 nm , or less than 2 nm , or of less than 1 nm ) for the sstr - 5 or sstr - 2 , respectively ( e . g ., as defined by the receptor binding assay described below ), and ( 2 ) decreases body weight of a patient ( e . g ., as defined by the biological assay described below ). the somatostatin agonist may also be selective for a particular somatostatin receptor , e . g ., have a higher binding affinity for a particular somatostatin receptor subtype as compared to the other receptor subtypes . in one embodiment , the somatostatin receptor is an sstr - 5 selective agonist or sstr - 2 selective agonist . what is meant by an sstr - 5 selective agonist is a somatostatin agonist which ( 1 ) has a higher binding affinity ( i . e ., ki ) for sstr - 5 than for either sstr - 1 , sstr - 2 , sstr - 3 , or sstr - 4 and ( 2 ) decreases body weight of a patient ( e . g ., as defined by the biological assay described below ). in one embodiment , the sstr - 5 selective agonist has a ki for sstr - 5 that is at least 2 times ( e . g ., at least 5 times or at least 10 times ) less than its ki for the sstr - 2 receptor ( e . g ., as defined by the receptor binding assay described below ). somatostatin agonists which can be used to practice the therapeutic method of the present invention include , but are not limited to , those covered by formulae or those specifically recited in the publications set forth below , all of which are hereby incorporated by reference . horvath , a . et al . abstract , “ conformations of somatostatin analogs having antitumor activity ”, 22nd european peptide symposium , sep . 13 - 19 , 1992 , interlaken , switzerland ; examples of somatostatin agonists include , but are not limited to , the following somatostatin analogs which are disclosed in the above - cited references : ac - d - phe - lys - tyr - d - trp - lys - val - asp - thr - nh 2 ( an amide bridge formed between lys and asp ); note that for all somatostatin agonists described herein , each amino acid residue represents the structure of — nh — c ( r ) h — co —, in which r is the side chain ( e . g ., ch 3 for ala ) except for thr - ol which means — nh — ch ( ch ( ch 3 ) oh )— ch 2 — oh and pro which means prolinyl . lines between amino acid residues represent peptide bonds which join the amino acids . also , where the amino acid residue is optically active , it is the l - form configuration that is intended unless d - form is expressly designated . a disulfide bridge is formed between the two free thiols ( e . g ., cys , pen , or bmp residues ); however , it is not shown . use of linear somatostatin agonists of the following formula is also within the invention : a 1 is a d - or l - isomer of ala , leu , ile , val , nle , thr , ser , β - nal , β - pal , trp , phe , 2 , 4 - dichloro - phe , pentafluoro - phe , p - x - phe , or o - x - phe , wherein x is ch 3 , cl , br , f , oh , och 3 or no 2 ; a 2 is ala , leu , ile , val , nle , phe , β - nal , pyridyl - ala , trp , 2 , 4 - dichloro - phe , pentafluoro - phe , o - x - phe , or p - x - phe , wherein x is ch 3 , cl , br , f , oh , och 3 or no 2 ; a 3 is pyridyl - ala , trp , phe , β - nal , 2 , 4 - dichloro - phe , pentafluoro - phe , o - x - phe , or p - x - phe , wherein x is ch 3 , cl , br , f , oh , och 3 or no 2 ; a 6 is val , ala , leu , ile , nle , thr , abu , or ser ; a 7 is ala , leu , ile , val , nle , phe , β - nal , pyridyl - ala , trp , 2 , 4 - dichloro - phe , pentafluoro - phe , o - x - phe , or p - x - phe , wherein x is ch 3 , cl , br , f , oh , och 3 or no 2 ; a 8 is a d - or l - isomer of ala , leu , ile , val , nle , thr , ser , phe , β - nal , pyridyl - ala , trp , 2 , 4 - dichloro - phe , pentafluoro - phe , p - x - phe , or o - x - phe , wherein x is ch 3 , cl , br , f , oh , och 3 or no 2 ; each r 1 and r 2 , independently , is h , lower acyl or lower alkyl ; and r 3 is oh or nh 2 ; provided that at least one of a 1 and a 8 and one of a 2 and a 7 must be an aromatic amino acid ; and further provided that a 1 , a 2 , a 7 and a 8 cannot all be aromatic amino acids . examples of linear agonists to be used in the method of this invention include : if desired , one or more chemical moieties , e . g ., a sugar derivative , mono or poly - hydroxy c 2 - 21 alkyl , mono or poly - hydroxy c 2 - 21 acyl groups , or a piperazine derivative , can be attached to the somatostatin agonist , e . g ., to the n - terminus amino acid . see pct application wo 88 / 02756 , european application 0 329 295 , and pct application no . wo 94 / 04752 . an example of a somatostatin agonists which contain n - terminal chemical substitutions are : the methods for synthesizing somatostatin agonists is well documented and are within the ability of a person of ordinary skill in the art . synthesis of short amino acid sequences is well established in the peptide art . for example , synthesis of h - d - phe - phe - phe - d - trp - lys - thr - phe - thr - nh 2 , described above , can be achieved by following the protocol set forth in example i of european patent application 0 395 417 a1 . the synthesis of somatostatin agonists with a substituted n - terminus can be achieved , for example , by following the protocol set forth in wo 88 / 02756 , european patent application no . 0 329 295 , and pct publication no . wo 94 / 04752 . the human sstr - 1 , sstr - 2 , sstr - 3 , sstr - 4 , and sstr - 5 cdna clones have been described ( sstr - 1 and sstr - 2 in yamada , y ., et al ., proc . natl . acad . sci . usa , 89 : 251 - 255 ( 1992 ); sstr - 3 in yamada , et al ., mol . endocrinol . 6 : 2136 - 2142 ( 1993 ); and sstr - 4 and sstr - 5 in yamada , et al ., biochem . biophys . res . commun . 195 : 844 - 852 ( 1993 )) and are also available from american type culture collection ( atcc , rockville , md .) ( atcc nos . 79044 ( sstr - 1 ), 79046 ( sstr - 2 ), and 79048 ( sstr - 3 )). based on the restriction endonuclease maps , the entire coding region of each sstr cdna may be excised by suitable restriction endonuclease digestion ( maniatis , t ., et al ., molecular cloning — a laboratory manual , cshl , 1982 ). restriction endonucleases are available from new england biolabs ( beverly , mass .). this cdna fragment was inserted into the mammalian expression vector , pcmv ( russell , d ., et al ., j . biol . chem ., 264 : 8222 - 8229 ( 1989 )), using standard molecular biology techniques ( see e . g ., maniatis , t ., et al ., molecular cloning ,— a laboratory manual , cold spring harbor laboratory , 1982 ) to produce the expression plasmid , pcmv - human sstr - 1 through pcmv - human sstr - 5 . other mammalian expression vectors include pcdna1 / amp ( invitrogen , sandlesy , calif .). the expression plasmids were introduced into the suitable bacterial host , e . coli hb101 ( stratagene , la jolla , calif .) and plasmid dnas , for transfection , were prepared on cesium chloride gradients . cho - k1 ( ovary , chinese hamster ) cells were obtained from atcc ( atcc no . ccl 61 ). the cells were grown and maintained in ham &# 39 ; s f12 media ( gibco brl , grand island , n . y .) supplemented with 10 % fetal bovine serum under standard tissue culture conditions . for transfection , the cells were seeded at a density 1 × 10 6 / 60 ˜ cm plate ( baxter scientific products , mcgaw park , ill .). dna mediated transfection was carried out using the calcium phosphate co - precipitation method ( ausubel , f . m ., et al ., current protocols in molecular biology , john wiley & amp ; sons , 1987 ). the plasmid prsv - neo ( atcc ; atcc no . 37198 ) was included as a selectable marker at { fraction ( 1 / 10 )} the concentration of the expression plasmid . cho - k1 clonal cell lines that have stably inherited the transfected dna were selected for growth in ham &# 39 ; s f12 media containing 10 % fetal bovine serum and 0 . 5 mg / ml of g418 ( sigma ). the cells were ring - cloned and expanded in the same media for analysis . expression of the human sstr - 1 through sstr - 5 receptors in the cho - k1 cells were detected by northern blot analysis of total rna prepared from the cells ( sambrook , j . e ., et al ., molecular cloning — a laboratory manual , ed . 2 ., cold spring harbor laboratory , cold spring harbor , n . y ., 1989 ) and by receptor binding using [ 125 i - tyr 11 ] somatostatin - 14 as a ligand . transfected cell lines expressing the human sstr receptors were clonally expanded in culture and used in the following sstr binding protocol . crude membranes were prepared by homogenization of the transfected cells in 20 ml of ice - cold 50 mm tris - hcl with a polytron homogenizer ( setting 6 , 15 sec ). buffer was added to obtain a final volume of 40 ml , and the homogenate was centrifuged in a sorval ss - 34 rotor at 39 , 000 g for 10 min at 0 - 4 ° c . the resulting supernatant was decanted and discarded . the pellet was rehomogenized in ice - cold buffer , diluted , and centrifuged as before . the final pellet was resuspended in the 10 mm tris hcl and held on ice for the receptor binding assay . aliquots of the membrane preparation were incubated for 30 min at 30 ° c . with 0 . 05 nm [ 125 i - tyr 11 ] somatostatin - 14 ( 2000 ci / mmol ; amersham corp ., arlington heights , ill .) in 50 mm hepes ( ph 7 . 4 ) containing a test somatostatin agonist of various concentrations ( e . g ., 10 − 11 to 10 − 6 ), 10 mg / ml bovine serum albumin ( fraction v ) ( sigma chemical co ., st . louis , mo . ), mgcl 2 ( 5 mm ), trasylol ( 200 kiu ml ), bacitracin ( 0 . 02 mg / ml ), and phenylmethylsulphonyl fluoride ( 0 . 02 mg / ml ). the final assay volume was 0 . 3 ml . the incubations were terminated by rapid filtration through gf / c filters ( pre - soaked in 0 . 3 % polyethylenimine for 30 min ) using a brandel filtration manifold . each tube and filter were then washed three times with 5 ml aliquots of ice - cold buffer . specific binding was defined as the total [ 125 i - tyr 11 ] srif - 14 bound minus that bound in the presence of 1000 rim . the ki values for the tested somatostatin agonists were calculated by using the following formula : ki = ic 50 /[ 1 +( lc / lec )] where ic 50 is the concentration of test somatostatin agonist required to inhibit 50 percent of the specific binding of the radioligand [ 125 i - tyr 11 ] somatostatin - 14 , lc is the concentration of the radioligand ( 0 . 05 nm ), and lec is the equilibrium dissociation constant of the radioligand ( 0 . 16 nm ). the ki values ( nm ) for the tested somatostatin agonists are shown in table i . table i hsstr - 1 hsstr - 2 hsstr - 3 hsstr - 4 hsstr - 5 somato - 2 . 26 0 . 23 1 . 2 1 . 8 1 . 41 statin - 14 somato - 2 . 38 0 . 30 1 . 3 7 . 93 0 . 4 statin - 28 octreotide 875 0 . 57 26 . 8 5029 6 . 78 bim - 23014 2414 0 . 75 97 . 9 1826 5 . 21 bim - 23052 97 . 6 11 . 96 5 . 6 127 1 . 22 bim - 23190 9120 0 . 35 215 7537 11 . 1 bim - 23197 6016 0 . 19 26 . 8 3897 9 . 81 bim - 23272 47 . 7 3 . 23 10 . 9 753 1 . 01 bim - 23284 27 . 9 19 . 3 35 . 6 58 . 6 0 . 85 bim - 23295 86 . 9 6 . 19 9 . 7 3 . 4 0 . 34 bim - 23313 15 . 1 4 . 78 25 . 5 55 . 3 0 . 30 bim - 26268 1227 15 . 06 545 3551 0 . 42 the effect of chronic ( one week ) treatment with bim - 23268 on insulin sensitivity was examined in an obese hyperinsulinemic , insulin resistant animal model , the fatty ( fa / fa ) zucker rats ( bray , g ., federation proceedings 36 : 148 - 153 ( 1977 ); shafris , e ., diabetes / metab . rev . 8 : 179 - 208 ( 1992 )). male fatty zucker rats ( harlan - olac , bicester , oxon , u . k . ), which were 15 - 17 weeks old , were randomly divided into two groups . the animals were house in pairs in a normal 12 hour light : 12 hour darkness cycle at 20 ± 2 ° c . and fed a standard laboratory rat diet ( beekay rat and mouse diet , bantin & amp ; kingman , hull , humberside , u . k .) ad libitum . for the group assigned to receive drug treatment , the rats received bim - 23268c at 3 mg / kg , by subcutaneous injection , twice a day at 10 : 00 am and 5 : 00 pm . the other group , the control group , was treated with a subcutaneous injection of 0 . lml / 100 g of saline twice a day at 10 : 00 am and 5 : 00 pm . the animals were subjected to the bim - 23268 or saline treatment for a total of 7 days . on the last day of treatment , at 5 : 00 pm food was removed , and the rats were fasted overnight . a method for assessing insulin sensitivity is to administer an oral glucose challenge and monitoring the secretion of insulin and disposal of glucose from the blood stream over a 240 min period ( bergman , r . n ., et al ., endocrine review 6 : 45 - 86 ( 1985 )). at 9 : 00 am the next day , both control and bim - 23268 treated animals were administered a 0 . 8 grams / kg body weight glucose challenge at 0 minutes . 20 μl blood samples were taken from tail vein ( abdel - halim , s . m ., et al ., diabetes 43 : 281 - 288 ( 1994 )) at − 60 min , − 30 min , 0 min , 30 min , 60 min , 90 min , 120 min , and 240 min . the 20 μl samples were taken into 380 μl of hemolysis reagents ( sigma , poole , dorset , uk ) containing 50 mg / liter of digitonin ( cat # d - 1407 ) and 100 mg / liter of maleimide ( m - 3766 ). from this , 100 μl of the hemolysed blood sample was added to 0 . 9 ml of tinder reagent ( sigma enzymatic calorimetric assay for blood glucose , cat # 315 - 100 , sigma chemical co . ltd , poole , dorset , uk ). blood glucose was determined according to vendor &# 39 ; s recommendation at 505 nm . insulin was measured by the conventional radioimmunoassay method as described ( dunmore , s ., & amp ; beloff - chain , a ., j endocrinol . 92 : 15 - 21 ( 1982 )). samples were assayed in triplicates with a 1 : 30000 dilution of an insulin antiserum ( from guinea pig ) raised in the laboratory ( dunmore , s . j ., et al ., j . endocrinol . 137 : 375 - 381 ( 1993 ), and using 125 i - labelled bovine insulin , iodinated by the chloramine t method ( sambrook , et al ., molecular cloning - a laboratory manual , ed . 2 ., cold spring harbor laboratory press , 1989 ). rat insulin ( 2000u / 0 . 1 ml , novo nordisk laboratories , basingstoke , hants , u . k .) was used as a standard in the assay . the standards and samples were diluted in assay buffer containing nah2po4 5 . 7 g / l , bovine serum albumin ( sigma a4378 , sigma chemical co . ltd ., poole , dorset , uk ) 5 . 0 g / l , nan3 1 . 0 g / l buffered to ph 7 . 4 ). antibody - bound insulin was separated on from free insulin by the addition of a second antibody ( donkey anti - guinea pig ig ) coated on cellulose , sac - cel ( ids , boldon , tyne & amp ; wear , uk ). the antibody - bound insulin precipitate was separated by centrifugation . counts bound were measured on an lkb rackgamma solid scintillation counter . although the fatty zucker rats in the control ( saline treated ) group were insulin resistant , they were not hyperglycemic ( ˜ 5 mm ambient plasma glucose concentration at time − 60 min , − 30 min and 0 min , after an overnight fast ) because the prevailing hyperinsulinemic state ( 2 - 3 nmol / l after an overnight fast ) of these animals compensated for the reduction in glucose disposal rate in peripheral tissues . this is evident in the plasma glucose curve and the insulin response during a glucose challenge . thus , any normal suppression of plasma insulin in these animals should result in an impairment of glucose tolerance after a glucose challenge . the bim - 23268 treated group , examined after 7 days of treatment with agent by subcutaneous injection at 3 mg / kg , twice daily , showed a significant suppression of glucose stimulated insulin secretion to the glucose challenge . despite an inhibition of pancreatic insulin response to the glucose challenge , the bim - 23268 - treated animals did not show an impairment in glucose tolerance . the plasma glucose profile of the treatment group was not significantly different from that in the untreated group . taken together , the results demonstrate that bim - 23268 treatment , while suppressing hyperinsulinemia , produced an improvement in insulin - sensitivity . the effect of chronic ( 6 day ) treatment with bim - 23268 on body weight gain / loss was examined in an obese animal model , the fatty ( fa / fa ) zucker rats ( purchased from harlan - olac , bicester , oxon , u . k . see bray , g ., federation proceedings 36 : 148 - 153 ( 1977 ). eleven male fatty zucker rats weighing about 450 grams were randomly divided into two groups , and their initial body weights recorded . the animals were housed in pairs in a normal 12 hour light : 12 hour darkness cycle at 20 ± 2 ° c . and fed overnight ad libitum . for the group assigned to receive drug treatment , the rats received the type - 5 somatostatin receptor selective agonist bim - 23268c at 3 mg / kg , by subcutaneous injection twice a day at 10 : 00 a . m . and 5 : 00 p . m . the other group was treated with a subcutaneous injection of 0 . 1 ml / 100 g of saline twice a day at 10 : 00 a . m . and 5 : 00 p . m . the animals were subjected to the bim - 23268 or saline treatment for a total of six days . at 10 : 00 a . m . each day , food was removed and replaced with accurately weight 100 gram food pellet ( a standard laboratory rat diet , beekay rat and mouse diet , bantin & amp ; kingman , hull , humberside , u . k .). the amount of food remaining a 10 : 00 a . m . the next day was accurately weighed , recorded and replaced with 100 grams of fresh food pellets . the animals were weighed each day during the 6 - day treatment period at 5 : 00 p . m . the untreated control group mean weight was 414 . 09 at the start of the trial and was 418 . 89 after six days . the bim - 23268 treated group &# 39 ; s mean weight was 413 . 6 at the start of the trial and remained at 413 . 6 after six days . the average food consumption for the control group was 26 . 0 g / rat / day and for the bim - 26268 group was 25 . 9 g / rat / day . these results showed that body weight gain was lower in animals treated with bim - 23268 . the effect on body weight change was not due to a toxic effect of the agent , as the treated group appeared healthy , and there was no difference in the amount of food consumed over the entire treatment period . obese ( fa / fa ) zucker rats were treated as in example 1 above . on the last day of treatment ( day 6 ), food was removed at 5 : 00 p . m ., and the rats were fasted overnight . at 9 : 00 a . m . the next day , the animals were subjected to a glucose challenge , given as 0 . 8 gram / kg of glucose orally . periodic 400 μl of blood samples were taken from the tail vein ( peterson , r . g ., ilar news , 32 : 16 - 19 ( 1990 )) 60 min . and 30 min . before and at 30 , 60 , 90 , and 120 min . after the administration of the glucose challenge ( 0 . 8 gram / kg orally ). aprotinin ( traysylol , bayer uk , hayward &# 39 ; s health , w . sussex , u . k .) and heparin ( sigma chemical co ., poole , dorset , u . k .) were added to the blood samples to a final concentration of 400 kiu / ml and 100 units / ml , respectively . plasma fractions were prepared from these samples by centrifugation at 4000 × g in a microfuge , for the estimation of triglycerides and glycerol . samples were then stored at − 80 ° c . until assayed . plasma glycerol and triglycerides were determined using the sigma enzymatic ( tinder ) calorimetric assay kit ( cat # 337 - b , sigma chemical co ., poole , dorset , u . k .) and measuring absorbance at 540 nm in a spectrophotometer . after six days of treatment with bim - 23268c at 3 mg / kg twice a day by subcutaneous injection , both plasma glycerol and triglycerides were significantly lowered , as exemplified by the samples taken at tim 30 and 60 minutes before the oral glucose challenge . see fig1 and fig2 + l . the administration of an oral glucose challenge have no significant effect on plasma lipids . the bim - 23628c treated group showed a significantly lower plasma glycerol and triglycerides throughout the 2 - hour test period . the results suggested that bim - 23268c , following a 6 - day treatment period at the prescribed dose was effective in reducing hypertriglyceridemia . the foregoing description has been limited to specific embodiments of this invention . it will be apparent , however , that variations and modifications may be made to the invention , with the attainment of some or all of the advantages of the invention . such embodiments are also within the scope of the following claims .	2
[ 0103 ] fig1 shows a system 10 for producing an early warning advance alert , or notice , to a prospective bus passenger , or an actual bus passenger , that a bus is about to arrive at a selected bus stop : i . e . that the bus they are waiting for is about to arrive , or that the bus they are actually on is about to arrive , at a selected bus stop . the system comprises a bus station 12 , a number of buses 14 a , 14 b , 14 c . . . 14 m ( only two of which are shown ), a number of bus stops 16 a , 16 b , 16 c . . . 16 n ( only some of which are shown ), and a number of passengers 18 a , 18 b , 18 c . . . 18 x ( only three of which are shown ), each with a mobile wireless telecommunications device , in this example a mobile phone , referenced 20 a to 20 x ( only three of which are shown ). the bus station 12 has a control processor assembly 22 , and a transmitter and receiver assembly 24 . the buses 14 have a transmitter 26 and a location finder 28 . the mobile telephones have antennae 30 and position sensors 31 . as seen in fig3 the mobile phones 20 have a display screen 30 , input keys 32 , and navigator buttons 34 . a user 18 who wishes to be informed in advance when a particular bus is expected to arrive at a particular bus stop enters his request for an early warning alert alarm into the processor 22 using their mobile phone 20 . they activate advance notice software on their mobile phone ( e . g . by entering a code , or by moving an active cursor or screen region to an appropriate icon on a menu screen of their mobile phone ) and the telephone displays a request form , referenced 36 in fig3 on the screen 30 . the user completes the request form and sends the data to the processor 22 via the telecommunication antenna 30 of the phone . for example , as shown in fig3 the user may be asked for the route number of the bus they wish to be notified of ( in this example the user has keyed in , using keys 32 , route “ 9 ” into a first data input field 33 a ). the user then presses “ enter ”, or “ ok ”, or shifts down to the next box or field 33 b displayed , using the navigator keys 34 . another item of information is required to be entered : the destination . in this example the user enters “ university ” using the keys 37 . in an alternative embodiment a menu may appear allowing the user to select a chosen destination / disembarkation stop from a menu of possible locations at which the selected bus stops . in another embodiment the user may not be asked for a destination , or may choose not to complete that field . the user navigates to the next field , field 33 c , which is for the answer to the next prompt or question , which relates to the identity of the bus stop which the user wishes to know when the bus will be arriving ( i . e . usually the stop at which the user wishes to catch the bus ). in this example the user has entered “ queens hospital ”. again , this may be done via keys 32 , or via keys 34 , possibly in response to selecting from a possible menu of options ( e . g . a drop down or expand up box ). the user enters the selected bus stop to which they want the early warning to relate and progresses to field 33 d which relates to how much time they want as an early warning that the bus will be at their selected bus stop . they then enter the notice period required , in this example 10 minutes . this is typically entered using keys 32 , but it could be from up or down keys ( indeed any entry may be made by stepping through possible options until the desired option is displayed ). the user then sends their request off to the control processor 22 via the telephone &# 39 ; s cellular , or other wireless , link . the processor 22 has a data base 23 of entries , schematically represented in fig4 linking telecommunications address 40 of user telecoms devices , the bus numbers that the user wishes to be alerted to ( referenced 42 ), optionally the desired destination 44 , the embarkation bus stop 46 , and the desired warning period 48 . in the example shown in fig4 the user wishes to board a bus at either the queens hospital stop or alternatively the green man pub stop ( both bus stops are a convenient walk from their house , for example ), and travel to either the university stop , or the cross street train station stop ( typically either destination , referred 46 in fig4 is close enough to the user &# 39 ; s office which is the user &# 39 ; s eventual destination ). for example bus routes 9 , 16 , and 28 may all go from the queens hospital stop to the university stop , and bus routes 105 and 110 may go from the green man pub bus stop to the cross street train station . the database shows two alternative notice periods have been entered into the database at 48 ; 5 minutes ( a first period ) for one travel option , and a second period ( 10 minutes ) for the second travel option . this is to reflect the fact that the user is closer to the queens hospital bus stop than they are to the green man pub bus stop . the processor 22 also receives present position signals , referenced as 50 in fig2 from each bus . each bus has its location finder 28 which sends a telecommunications signal indicative of the geolocation position of the bus to the control processor 22 . the present position signals may be sent substantially continuously from the buses , or periodically ( for example every 10 or 20 seconds or so ). the location finder 28 could be any suitable menu such as a gps transponder , or possibly an inertial navigation system which monitors the direction of travel , speed , and time of travel of the bus and determines its position from dead reckoning . this latter option is preferred over gps in some environments where the gps signals may be blocked . it is possible for the bus inertial dead reckoning position finder to be recalibrated periodically upon receipt of a location identifying signal from a fixed beacon . for example some , or all , bus stops may have transponders which tell a bus that it is near them when it is near them . this could be used instead of dead reckoning or gps : i . e . noting when a bus is near an earlier bus stop . with a knowledge of the current position of the bus of interest , say bus number 9 , and the position of the embarkation bus stop , the processor can evaluate a predicted time for the bus to reach the selected bus stop , with a knowledge of the expected speed of the bus . the processor can compare the expected time to arrival at the selected bus stop for the selected bus with the early warning notice period required by a user . when the two are equal , or nearly so within a predetermined margin , the control processor instigates the generation of a telecommunication advance warning signal 49 , transmitted via the antenna 24 , to the user &# 39 ; s mobile phone 20 . this signal could result in an sms early warning message being displayed , or an audio tone , or a voice message , or a vibration of the telephone , or any other way of sending an alert alarm to the user . the user may be able to select what type of alert message they want . the antenna 24 may communicate directly with the buses , but more likely the communication will be via a telecomm network , such as via a cellular link , on a metropolitan area wireless network ( possibly bluetooth or 802 . 11 ). [ 0115 ] fig5 shows a modification of the system . a bus 52 has a receiver 54 which receives vehicle position signals 56 from roadside transponders 68 ( e . g . mounted on bus stop poles or street lights / lamp posts 70 ). lamp posts and street lights ( and other electrical street furniture ) already have a power supply 72 for the transponder 68 . the bus has a position output transponder 74 which communicates its position to the control processor 22 . alternatively the roadside transporters could note the proximity of the bus and they could communicate its position to the control processor . [ 0116 ] fig6 shows another modification in which a bus 75 which has an onboard control processor 76 and a position sensor 78 . instead of communicating its position to a central control processor the bus 75 has the database 23 on - board in its on - board processor 76 and emits advance warning signals , via an emitter 24 , 49 to the user &# 39 ; s mobile devices 20 . the mobile telephones 20 are monitored by a device position monitoring system , in this example a gps system , but it could be an inertial system , a proximity to monitor beacon signal system , or a triangulation system , or indeed any suitable system . if a user 18 moves further away from a bus stop for which they have already entered a request for an early warning notification to the server 22 , then whatever warning period they originally requested may or may not be enough time for them to reach the selected bus stop in time to reach the bus ( e . g . a person could enter a 10 minute early warning period when they were 5 minutes walk away from the bus stop , and then walk a further x minute walk from the selected bus stop . since the server 22 knows the position of the bus stop and the position of the user when they entered their “ y ” minutes warning , the server can estimate how much longer it would take a user to walk to the selected bus stop and automatically add that on to the notice period — giving an x + y minutes early warning notice to the user . the server may be able to establish that the user is now , after moving ( or indeed before moving ), closer to another pick - up point for the bus and may inform the user of this , with the identity of the alternative pick up point . the mobile device may be capable of displaying a map , or travel directions , to the user telling than how to get to the selected bus stop , and / or an alternative , possibly computer - selected , bus stop . this may be generated within - the mobile device , or at the base station control processor and transmitted to the mobile device . other information may be displayed / displayable , such as the bus fare for the entered journey or the return timetable ( and / or outward timetable ). in the case of large bus stations ( or train stations ), for example , being the embarkation point , the platform number or bus stop number may be displayed ( or other such identifier — a display of number is not necessarily essential , perhaps “ green line ”, or a representative of a green line ( i . e . a colour ) could be enough to identify a specific bus or train route ). in another embodiment the user can input the desired destination and the control processor , or mobile device , can inform them of the available transport routes and expected times of departure from appropriately local pick up points . this may not be restricted to the buses of one company , or even to one mode of transport . for example bus , train ( overground and / or underground ) and tram timetables may be available for analysis by the user or computer . thus the system may not only provide an early warning , but also route planning / timetable information , and even computer - selected travel plans . in another modification the user does not have to input a desired notice period to the system , and may not be asked to do so . since the control processor knows the position of the selected bus stop and the position of the user ( for example either from user - device position detecting , or because the user has elected to send the advance warning signal to a fixed , stationary , telecoms device ) the control processor can estimate how long it will take the user to walk to the bus stop / location of the event being considered . the computer system can then automatically set the time of the advance notice alert signal . it may evaluate how long it predicts it will take a user to get to the desired location and add on a further short period for the comfort of the user . it will be appreciate that although walking to the site of the event for which an advance notification has been discussed , it may be that the computer knows that the user will use some other mode of transport ( e . g . bicycle , or car ) and the journey - to - site time can be estimated accordingly . for example a user could input the event as being the landing of a particular airliner at a specific airport , ( e . g . to meet someone off the plane ) and the system could give an early warning by using advance knowledge of the progress of the aircraft , or even just from a knowledge of when it really took off , and could give the user advance notice a suitable time before predicted landing , perhaps allowing for driving to the airport and parking . when a user is at a particular location the system could be informed , or learn , that extra time is needed to be added to its normal notice period . for example , in a large skyscraper it could take 5 minutes to leave the building , before the user even begins to walk to a bus stop or train station . the control processor may know that certain geographical locations are associated with extra delays and so could , using the position of the user information , build in extra time in the warning notice period that is generated . [ 0125 ] fig8 shows a schematic representation of a control processor arrangement for use in a system similar to that of fig1 and 2 . the control processor , or control server , referenced 80 in fig8 comprises two servers : a telecommunication access server 82 which uses a session initiation protocol ( sip ) to access an external telecommunication network , ( e . g . wap ), and a data processing control server 84 which receives inputs from the user ( referenced 86 ) and inputs from automatically monitored things 88 ( such as the position of a bus , weather and traffic conditions etc .) and produces early warning notification signals using inputs 86 and 88 and using system known / derived things 89 . the signals sent out from the system 80 to user &# 39 ; s mobile devices ( e . g . phones ) are sent continuously using the telecasting technique . instead of sending a separate message to each user , a single message ( for a particular event , e . g . bus no . 9 arriving at university stop in 5 minutes ) is sent and the message carries a header or flag identifying it as being of interest to a subclass of all possible users ( i . e . the ones looking out for the event that is the no . 9 bus arriving at the university stop ), and those devices which have a filter set appropriately will react to receipt of the telecast broadcast , and those that do not will not . the system 80 sends out the signals continuously indicating for each bus route and each stop when a bus is within any of a number of time periods of the stop . for example signals will be sent out each time that a bus on route a is 5 minutes , 10 minutes , or 15 minutes from a particular stop , and corresponding signals will be sent out for other routes and other stops . each signal gives a header or flag which indicates the bus route and the stop and the time to arrival . each mobile phone or other suitable device which is set up to receive the signals indicates a filter which can be set by a user using the device &# 39 ; s normal user input to filter out all signals except those carrying the flag for the route ( s ) and stop ( s ) of interest to and selected by the user . the device then produces an alarm when a signal relating to a selected stop and bus route is received but does not respond to the other signals . the alarm may be a single audible alarm and / or may indicate to the user , for example on a display of the device , the estimated time to arrival . this arrangement has the advantage that the phone does not need to communicate anything to the session initiation protocol server , and is particularly useful in urban areas , especially in a city centre where the number of users could be very high and the processing request from users could be difficult . [ 0129 ] fig9 schematically shows one embodiment of the inputs a user makes in order to set up an event notification request , and simultaneously set up a filter on their mobile device ( a flag for which bus stop and which bus ). the user may be able to set up a threshold time or window before which or after which , he does not want to be notified . for example he may wish not to know about the event of the correct bus arriving at the correct bus stop all of the time — he may wish to spend a certain period free of alerts . for example , the user may set their request for an alert profile to be such that no alerts are requested before 5 . 00 p . m . this could be useful , for example , if the user wanted to spend a few hours at a meeting , or doing something , and did want to leave at the latest by a certain time to catch the bus but did not want to be interrupted too early before their deadline for leaving . [ 0131 ] fig1 shows schematically steps that a control processor similar to that of processor 22 in fig1 may go through . [ 0132 ] fig1 shows a flow chart for a software routine 110 running in a control processor such as that of processor 22 of fig1 . for each bus the routine determines at 112 , or updates , the expected times of arrival of the selected bus ( e . g . bus id abfgh 14 operating on route number 9 ) at its next scheduled bus stop and indeed all of its scheduled stops . at 114 the routine checks to see if there are any requests awaiting fulfilment for advance notice of that bus arriving at the next bus stop ( the system knows where the bus is and so knows what is its next stop ). if there is an unfulfilled request the system creates a warning message at 116 and transmits it at 118 . the system then increases the bus stop number being considered 120 i . e . it moves on to consider the next bus stop and returning to routine 114 after checking at stop 122 that it has not returned to the start bus stop i . d . it will be appreciated that instead of cycling through each bus stop on the selected route starting with the next stop that the bus will reach , the system could start at the same stop each time ( e . g . stop number one ), and not care , for this purpose , where the bus is located . it will cycle through the available bus stop for the selected bus very fast in any case . once all of the available bus stops have been evaluated the system increments the bus being considered to the next bus , shown as 122 in fig1 . there may be another bus operating the same route , or it may be a bus on a different route . the system checks at routine 126 that the bus identification number has not returned to the start bus i . d . number , and if not proceeds to routine 114 again , but for a different bus than previously . if the route 110 has cycled through all available bus identifications ( and hence all buses for all allowable stops have been considered ) the routine waits a while ( step 128 ), for example 10 seconds or 20 seconds , and then starts again at routine 114 with an initial bus i . d . and an initial bus stop id . it will be appreciated that the system could cycle through the available buses first and then the bus stops ( the opposite way around to that described above ), or , indeed may not cycle in any logical sequence , but could simply check all buses and stops in any order . it will be appreciated that instead of creating warnings as they are needed the system could create them in advance and release them when the expected time of arrival of a selected bus at a selected stop matches the advance notice period . [ 0141 ] fig1 illustrates one particular request for advance notice alert set up routine for a user . a user selects at 130 a bus route , or a destination ( or both ), selects at 132 an embarkation bus stop , selects at 134 a notice period required as advance notice of the bus arriving , selects at 136 a threshold time before which an alert is not desired , selects at 138 the device to which they wait the alert to be sent ( e . g . the mobile phone , or other device making the request , another mobile phone or mobile device , a selected land - line telephone , a selected pc ), and at 140 they select the manner in which they wish to be alerted ( e . g . sms message , audio — e . g . beep or buzzer , voice message , visually — e . g . flashing light or a display message / indication on a screen , by vibration , by e - mail etc ). the control processor may be able to check that the transmitted early warning notification message , e . g . signal 49 in fig2 was received by the user &# 39 ; s device ( e . g . by the device acknowledging receipt / acknowledging a telecoms link ). if the control processor does not receive this confirmation of receipt it may re - send the message , possibly periodically up to a set limit ( e . g . limit in time , or limit in number of attempts ). a user may be able to elect to have an alert sent to more than one telecom address . it will be appreciated that by monitoring a parameter that is associated with the arrival of a specified event ( e . g . a specific type of bus arriving at a specific stop ) advance notifications that are more meaningful than simply pre - planned scheduled event warnings can be achieved . the monitored parameter is preferably representative of a real physical thing ( e . g . the position of a vehicle ). of course , instead of pressing keys on a device to input data a user could talk into the device if it is configured for speech recognition . in one example , the invention may comprise a vehicle arrival ( or event notification ) system which does not monitor the position of the vehicle , but instead varies the timing of the sending out of alert signals dependent upon how far away a user is from the vehicle meeting / pick up point . however , in the vast majority of applications it will be appropriate to monitor the progress of the vehicle in some way . in one specific example the application will use the session initiation protocol to send and receive the alert signals . a device installed in a bus will compute the exact position of the bus using gps or by using the speed of the vehicle , a compass and a map . when the bus reaches any preprogrammed position , the device will send the signal using a multicast mode . the multicast address is function of the distance or the time between the user ( s ) and the bus stop . all these signals can also be sent from the bus station , which tracks all the buses . the user can choose any bus depending on the destination and ask the session initiation protocol server to filter all the other signals except the one concerning the bus he intend to take . it will be possible to send the signal on the phone . as suggested above , in some embodiments a vehicle may communicate its presence / position to a base station when it reaches predetermined physical locations , instead of a set point in time . for example , each time a bus or train reaches a bus stop or station it may communicate its position to the base station . session initiation protocol is important to some aspects of the invention . it is application layer software ( in the osi model ). it is easy to install on processors . some existing processors , for example of cellular telephones or pda &# 39 ; s , are configured to allow retrofitting of session initiation protocol telecommunications software , possibly remotely . more typically we envisage mobile general purpose telecommunications devices , such as telephones , pda &# 39 ; s laptops etc ., being factory configured to enable session initiation protocol telecommunications . it is then a matter of loading the specific application software to those mobile devices to enable them to receive / recognise alert signals as being for them . it may also be usual for us to load software onto the devices to enable them to input information to a base station / alert generator server and / or to enable them to have user - set filters . in one embodiment a central session initiation protocol enabled server emits signals detailing the expected arrival times of all vehicles known to it at their next stop ( or stops ) and users set the filter on their portable devices to alert them only to the events of interest . the event detection / recognition software and / or the filter - setting software may be downloaded at the point / time of use ( wirelessly ) by a user , and may have a limited duration when it is operable or limited usage conditions . for example , the downloaded software may only be good for a single day , or week , or period , or it may be good for a set number of alerts to the user . in this way the transport company and / or the telecommunications company and / or the device - controlling company may be able to access an on - going income if they make users pay for access to the enabling software . one session initiation protocol is chosen as the telecommunications platform it is not too difficult to convey software solutions to the mobile telecoms devices , and not difficult to change things . for example , the session initiation protocol - enabled multicast signals may be code - protected , and the code may change from time to time , and the user may have to pay for access to new codes to access the signals / decode them . session initiation protocol is a light protocol that is easily downloaded . it operates in real time . it has applications typically in voice - over - ip , but we have realised that it is suitable for our purposes . it is suitable for copying short messages similar to sms messages , but via an ip network . session initiation protocol allows the establishment of a real time application software running to monitor broadcast messages and / or vehicle positions . session initiation protocol has multi - user facilities — so more than one user can input and receive data . this is , of course , useful with many vehicles inputting their position and many passengers wanting to know when they will arrive . we envisage not only one kind of transport vehicle having their arrival times alertable to a user : different kinds of vehicle may have their schedules altertable . for example trains and buses ( and indeed aircraft , ships etc .) may be covered . a user may be able to select between the type of vehicle whose movements are required . in one embodiment a user may not specify which route or which stop they want , just their destination , and the system may report possible options to them . the user may select one preferred event ( vehicle - at - stop ) or more than one , about which they want to be alerted in the future . the software loadable onto the portable device may also enable the device to display the location of a stop ( e . g . a map ), or a plurality of stops , and may also enable the device to display the position of the user ( e . g . on the map ). as discussed , the impromptu downloading of appropriate event - notification software is used when a user decides they would like to be notified of an event is envisaged . a user does not therefore have to choose to buy a device with the specific application software loaded on it , or to subscribe in advance ( days or weeks in advance ) to a service : they just dial up and download there and then ( possibly incurring a cost / fee ). other options can be added : extra / different functionality can readily be loaded in the future , for example using session initiation protocol telecoms . this somewhat “ future proofs ” the portable device — but it does require the device to have appropriate processing capability and hardware / firmware . it is also possible for a user to uninstall the event - notification software from their device ( or for it to cause itself to be uninstalled ( or blocked ) at a future time / event . the portable user device may be battery powered , with replaceable batteries , and may be “ pocketable ” ( small enough to be put into a normal trouser or jacket pocket . the device may telecommunicate at a frequency of the order of about 1 ghz it will be appreciated that many embodiments of the invention use a general purpose mobile telecommunication device to input and / or receive signals relating to the selection of the location ( e . g . bus stop ) and / or advance notice time , and / or bus route / number , and / or the advance notice warning signal itself . for example , there are already millions and millions of mobile telephones ( satellite and even more common cellular phones ). they are well suited to inputting / receiving signals , especially using session initiation protocol techniques . indeed , it may not be necessary to implement hardware changes in existing mobile telephones to implement the invention : software changes may be all that is required , especially with those mobile phones that have a display . such software changes may be achieved wirelessly : i . e . software could be telecommunicated to the mobile telephones ( depending upon the capabilities of the cpu chip in the mobile phone ). thus retro - fitting the functionality discussed to existing mobile phones is conceivable , especially using session initiation protocol . other general purpose wireless telecommunications devices can be configured as receivers / input devices , such as pda &# 39 ; s or palm computers . many portable internet - accessing devices now exist which could be suitable . even if the cpu chip of an existing device is not configured to allow wireless software changes , it is straightforward to manufacture new devices with the requisite software to perform as discussed . by “ general purpose ” wireless telecommunications device is meant a device that has functionality beyond simply the impending event notification and / or input of registration / notice period information functionality discussed . for example a “ general purpose ” device may allow voice communication ( e . g . mobile telephone ) or text communication ( e . g . pda with internet access / e - mail capability ), or both voice and text , or multimedia : more than a dedicated single - use device .	6
fig1 shows a schematic illustration of a cable drum 1 with a drum axis 22 , a drum body 21 , an upper drum wall 12 and a lower drum wall 13 . a cable can be wound onto the drum body 21 of the cable drum 1 . in fig2 a developed view of the drum body 21 of the cable drum 1 is illustrated wherein the cable body 21 is provided with a groove arrangement . the surface of the drum body 21 in the circumferential direction is divided parallel to the drum axis 22 into four areas : two parallel areas 2 , 3 in which grooves 4 and 5 extend parallel to the drum walls 12 and 13 and two incline areas 6 and 7 . the incline areas 6 and 7 have grooves 8 and 10 which are slanted at a positive angle to the horizontal and grooves 9 and 11 which are slanted at a negative angle to the horizontal . the parallel areas 2 and 3 cover approximately 35 % to 40 %, respectively , of the surface area of the drum body 21 and the incline areas 6 and 7 cover approximately 10 % to 15 %, respectively . the grooves 4 and 5 in the parallel areas 2 and 3 have a width a . the pitch c by which the neighboring grooves 4 , 5 , 8 , 9 , 10 , and 11 are displaced relative to one another in the longitudinal direction of the cable drum 1 matches approximately 1 to 1 . 1 times the diameter of the cable to be wound . since the neighboring grooves 4 , 5 contact or touch one another in the longitudinal direction of the cable drum 1 within the parallel areas 2 , 3 , the groove width a corresponds to the pitch c . the parallel areas 2 , 3 are displaced in the axial direction by an axial displacement b which matches half the pitch c . the grooves 8 , 9 , 10 , and 11 are slanted such that they adjoin with one end the grooves 4 of the parallel area 2 and with the other end adjoin the grooves 5 of the parallel area 3 . the grooves 8 and 9 cross one another in the incline area 6 and the grooves 10 and 11 cross one another in the incline area 7 , respectively . as a result of the axial displacement b of the parallel areas 2 and 3 relative to one another , the grooves 4 adjoin directly the upper drum wall 12 and the lower drum wall 13 while a spacing of the size of the displacement b is provided between the grooves 5 and the upper drum wall 12 and the lower drum wall 13 . at the location of this spacing , a filler wedge 14 is arranged in the parallel area 2 and a filler wedge 15 is arranged in the parallel area 3 at the upper drum wall 12 . the filler wedge 14 has a width which matches the pitch c and the filler wedge 15 has a width which matches the axial displacement b . a ramp wedge 16 is arranged on the lower drum wall 13 and extends from the incline area 7 via the parallel area 3 to the incline area 6 . the function of the filler wedges 14 and 15 and of the ramp wedge 16 will be explained infra . when winding the cable in a direction from the left to the right of fig3 the cable extends along the cable path 18 from the cable inlet opening 17 , where the end of the cable secured on the cable drum 1 exits from the interior of the drum body 21 , via an upper groove 4 to the incline area 7 , from there in a groove 11 to a groove 5 , which is displaced downwardly by the displacement b , and via a groove 9 to the parallel area 2 where , after having been wound once about the drum body 21 , it extends in a second groove 4 displaced downwardly by the pitch c relative to the upper groove 4 . all further windings of the cable extend along a corresponding downwardly displaced cable path and thus form the first cable layer . when the cable has reached the lowermost groove 4 , it is lifted in the incline area 7 by the ramp wedge 16 onto a diameter which is larger by approximately twice the diameter of the cable so that a second cable layer can be wound onto the first cable layer . the second cable layer is wound in a direction counter to that of the first cable layer from the lower drum wall 13 toward the upper drum wall 12 . as soon as the cable has reached the upper drum wall 12 , the filler wedges 14 and 15 prevent that the cable can be wound into the spacing between the drum wall 12 and the upper cable winding of the first layer . in fig4 a cable path 20 is illustrated which results when winding the cable in the opposite rotational direction , i . e ., when winding the cable in fig4 from the right to the left . the cable extends from the cable inlet opening 19 via a groove 4 to groove 8 in the incline area 6 , from there in a groove 5 in the parallel area 3 via a groove 10 in the incline area 7 to the parallel area 2 where , after having being wound once about the drum body 21 , it extends in a groove 4 below the first groove 4 . as a result of the mirror - symmetrical configuration of the filler wedges 14 and 15 and of the ramp wedge 16 relative to the center of the parallel area 2 in which the inlet openings 17 and 19 are located , the function of the wedges is ensured for both rotational directions . in another embodiment , the inlet openings 17 and 19 can be arranged in the upper drum wall 12 in the parallel area 2 wherein the inlet opening 17 adjoins the incline area 6 and the inlet opening 19 adjoins the incline area 7 . with this embodiment , the filler wedge 14 is no longer needed because the cable rests against the upper drum wall 12 over the entire width of the parallel area 2 . while specific embodiments of the invention have been shown and described in detail to illustrate the inventive principles , it will be understood that the invention may be embodied otherwise without departing from such principles .	1
reference will now be made to the accompanying drawings , which form a part hereof , and which show , by way of illustration , specific exemplary embodiments . the principles described herein may , however , be embodied in many different forms . the components in the figures are not necessarily to scale , emphasis instead being placed upon illustrating the principles of the invention . in some instances , example measurements are mentioned merely as illustrations of one or more embodiments and not to restrict the invention . moreover , in the figures , like referenced numerals may be placed to designate corresponding parts throughout the different views . an interchangeable rotating free - motion fitness handle system may provide more accurate and consistent results because the tube / cord is always stretching linearly and thus , it &# 39 ; s not manipulated by a fixed point . additional muscles can be targeted by using the rotational features . in one example of an interchangeable rotating free - motion fitness handle system , a fitness handle that features an opening “ oculus ” that permits a resistance tube anchoring mechanism to enter into a sliding channel such that when combined with a rotational - hand - grip , allows a fitness resistance tube equipped with a resistance tube anchoring mechanism to both pan left and right , as well as hinge up and down as users move through exercise motions is disclosed . a “ barb ” that may be located next to the oculus prevents the resistance tube anchoring mechanism from exiting the sliding channel when under any tension . a resistance tube anchoring mechanism can be a mechanism that is applied to the tail end ( s ) of plugged resistance tubes which allows for said tubes to be connected to tube accessories including interchangeable handle ( s ) and any appropriate accessories . such accessories may be equipped with , for example , a button - style fabric tube anchor point ( see fig1 for example ). of course , the length and resistance characteristics of the cables / stretch tubes the resistance tube anchoring mechanism is applied to can vary depending on the needs of the user . a hinge - locking tube anchor and pulley system may be a mechanism that allows users to create an anchor point from which they are able to generate resistance using resistance tubes . key features can include , but are not limited to , the outer ends of a component which allow sewn webbing loop , or suitable design , to be applied and removed from the component when said webbing is not under tension . the component may be made of , but of course , is not limited to plastic . other suitable materials may be also be used . when under tension , the webbing loops may secure the component as an anchor point , while allowing it to rotate , creating a pulley which responds to torsion friction applied by the fitness tube , thereby reducing wear / damage to the tube . this removable webbing loop design allows the hinge - locking tube anchor and pulley system to be secured to door hinges to create a superiorly secure anchor point , regardless of user orientation to the door . this allows the system to work on both open and closed doors , and offers the convenience of remaining in place when not in use , if the user so chooses . one additional feature is the larger pulley guide fins that define the outer limits of the pulley space . these large fins respond to pressure coming from the resistance tube , when in use , and adjust the orientation of the pulley to minimize wear on the tubes as different exercise movements are performed . a button - lock ankle / wrist attachment allows a sewn or otherwise connected cuff to be attached to body regions of the user without requiring hand - grip . the key feature is the sewn button lock ( slit ) which receives the resistance tube anchoring mechanism and holds it securely when under tension , similar to the manner a shirt button behaves . the length of fabric between the sewn button lock and the sewn attachment point to the cuff creates a flexible ‘ hinge ’ which allows the system to remain secure as orientation to the tube forces change . referring to fig1 , an exemplary embodiment of an interchangeable rotating free - motion fitness handle system is illustrated . interchangeable rotating free - motion fitness handle system includes cable / stretch tube / resistance band (“ fitness tube ”) 110 and interchangeable and rotational fitness handle system 120 . fig2 illustrates the components of an interchangeable rotating free - motion fitness handle system . fig2 includes an exemplary stretch tube / resistance band 110 , anchoring mechanism 210 and fitness handle 220 . flat slide surface 211 of anchoring mechanism 210 is also illustrated . fig3 - 5 illustrate various views of fitness handle system 120 . referring briefly to fig4 a and 5 , opening 410 allows the anchoring mechanism 210 to enter into a sliding channel 420 such that when combined with a rotational - hand grip 430 allows a fitness tube to both pan left and right , as well as hinge up and down as users move through exercise motions . barb 440 can prevent the anchoring mechanism 210 from exiting sliding channel 420 when under any tension . fig6 illustrates several embodiments of anchoring mechanism 210 including pill 610 , barrel 620 , and cone 630 . as can be seen , fitness tube 110 can be inserted into the anchoring mechanisms 610 , 620 , and 630 . fig7 a - 7c illustrate various embodiments of a fitness handle 220 . fig7 a - 7c also illustrate more detailed views of some embodiments of sliding channel 710 and rotational - hand grip 720 . fig8 illustrates various views of components of an embodiment of an interchangeable rotating free - motion fitness handle system . fig9 illustrates a more detailed view of the components of an embodiment of an interchangeable rotating free - motion fitness handle system . this embodiment of an interchangeable rotating free - motion fitness handle system includes clip lock 910 , plastic grip with tpr overmold 920 , frame / main body 930 , connection bar 940 and anchoring mechanism 210 . plastic grip with tpr overmold 920 may provide a comfortable grip to a user and may not be required . while this embodiment uses a plastic grip with tpr overmold , numerous alternative grips are also possible within the scope of the invention . the anchoring mechanism 210 includes resistance band insert 950 for inserting a resistance band . clip lock 910 may be made from a variety of different materials . in one embodiment clip lock 910 is made of plastic . other materials may be used within the scope of the invention . additionally , any specific measurements in this figure and others are illustrated to assist in the understanding of the invention and not to restrict or in any way limit the invention . fig1 illustrates detailed views of the components of one embodiment of a fitness handle . clip lock 910 , main body 930 , and connection bar 940 are further broken down to illustrate the components in detail . once again , measurements in fig1 are illustrated to assist in the understanding of the invention and not to restrict or limit the invention . fig1 illustrates detailed views of the components of grip 920 and resistance band insert 950 . fig1 illustrates one embodiment of a fitness cable anchor and pulley system . multi cable pulley 1210 may be designed such that it is wear reducing , thus increasing the life of the system . a rib 1220 may be added for strength purposes . loop 1230 may “ lock ” onto the pulley 1210 contour when under tension , and may completely encompass the hinge for added safety . loop 1230 may be sewn . the material of loop 1230 may be made of nylon but any other suitable material can also be used . the system may be used on both sides of the door 1240 . for example , an open door install may be configured to stay up when the door is opened or not in use . fig1 illustrates one embodiment of a button lock ankle / wrist attachment . in this embodiment , a velcro strap with a soft - inner - backer is used . fig1 illustrates one embodiment of a multi - attachment point fitness harness . fig1 illustrates one embodiment of a 360 degree rotating fitness harness . while various embodiments of the invention have been described , it will be apparent to those of ordinary skill in the art that many more embodiments and implementations are possible within the scope of the invention . accordingly , the invention is not to be restricted , except as set forth in the following claims .	0
referring to the drawings in detail wherein like numerals designate like parts , the numeral 10 designates a main rectangular cabinet body of a modified existing vending machine , such as a well - known semi - honor machine which has had its front and rear access doors and its top wall removed in order to receive the kit in accordance with the present invention . in some cases , the invention may be embodied in a wholly new machine , as previously noted , in which case the cabinet 10 or other support structure may be new . the removed top wall of the converted semi - honor vending machine is replaced by a new top wall 11 having a marginal down - turned flange secured to the cabinet body 10 as by pop rivets 11 &# 39 ;. the top wall 11 serves as a mounting surface for a relocated standard type coin mechanism 12 having a horizontally movable control arm 13 which is released to move forwardly from the position of fig2 to the position of fig3 following the placement of proper coins in the mechanism 12 by a customer . the vending machine comprises a rectangular storage compartment 14 for newspapers 15 to be vended which includes a fixed interior forwardly open box - like housing section 16 , somewhat below the top wall 11 , and suitably secured to the cabinet body 10 . the compartment 14 further comprises a horizontally shiftable box - like housing section 17 telescopically engaged within the fixed housing section 16 and having its rear end open . the movable housing section 17 is biased inwardly to a fully retracted or closed position against the back wall of the fixed housing section 16 by retractile spring means 18 . the bottom wall of the movable housing section 17 has an opening 19 formed therethrough rearwardly of an upturned newspaper retainer flange 20 whose function will be described . the bottom wall of the fixed housing section 16 has a cooperative opening 21 formed therethrough adapted for registration with the opening 19 when a newspaper 15 is being dispensed , fig3 . below the opening 21 , the fixed housing section 16 has a curved deflector plate 22 preferably having a hand recess 23 , fig1 to guide the dispensed newspaper to the hand of the customer in a downward and forward direction , fig3 . preferably , a stiffening member 24 is provided on the bottom wall of the fixed housing section 16 at its forward end . a pair of spaced parallel horizontal channel tracks 25 are fixed to the rear vertical wall 26 of housing section 16 and extend forwardly to points adjacent the top of the deflector plate 22 . the bottom wall 27 of the movable housing section 17 is able to telescope between the bottoms of channel tracks 25 and the bottom wall 28 of the fixed housing section 16 . the forward ends of channel tracks 25 are rigidly interconnected by a steeply inclined abutment plate 29 beneath which the bottom wall 27 may slide freely during the movement of the housing section 17 . a carriage 30 for the stack of newspapers 15 has base wheels 31 guidingly engaged with the channel tracks 25 for horizontal movement . the carriage 30 includes an inclined rest plate 32 for the newspapers parallel to the abutment plate 29 and extending near the top unfolded edges of the inclined stacked newspapers . the abutment plate 29 is vertically shallow and merely laps the lower end portion of the frontmost newspaper in the stack . the folded edges 33 of the newspapers 15 are lowermost and rest on the upper horizontal edges of the tracks 25 . mounted on the wheeled carriage 30 is a spring motor unit 34 of a conventional type connected by a cable 35 to the back of the abutment plate 29 . as newspapers are dispensed one at a time from the front of the stack , the carriage including the back - up plate 32 will creep forwardly under influence of the spring motor 34 so that one newspaper at the front of the diminishing stack will always be held in firm engagement with the inclined abutment plate 29 . the bottom edge of the plate 32 is slotted at 36 , fig4 to clear the channel tracks 25 . a pair of arms 37 are pivoted at 38 to the forward corners of movable housing section 17 . stop pins 39 on the side walls of the movable housing section limit downward movement of the arms 37 to inclined positions substantially normal to the stacked newspapers 15 , fig2 and 3 . at their free ends , the arms 37 have opposing inwardly projecting lateral leaf spring extensions 40 thereon which are tensioned to exert a yielding pressure on the forwardmost newspaper 15 of the stack to stabilize the stack , and to assure the proper dispensing of the newspapers one - by - one in the manner to be further described . the forward creeping action of the carriage 30 will assure that the newspaper stack , regardless of how many papers are in it , will always be held firmly between the back - up plate 32 and leaf spring elements 40 and between the plate 32 and the short abutment plate 39 . also bodily mounted on the front of movable housing section 17 is a customer - operated vertically swingable lever 41 or frame pivoted as at 42 to the housing section 17 and projecting forwardly thereof through slots 43 . within the housing section 17 , the lever 41 carries a cross axis newspaper lift roller 44 preferably having a sand covered periphery , or other friction face , and extending fully across the front of the newspaper stack . the sand roller 44 has a one - way clutch mechanism therein which locks the roller 44 against rotation when the handle bar of lever 41 is depressed by a customer to turn the lever 41 clockwise , fig2 . the locked roller 44 will frictionally engage the forwardmost newspaper 15 in the stack as the lever is swung toward the phantom line position in fig2 and the friction between the roller and newspaper is sufficient to lift the forwardmost newspaper above the abutment plate 29 . on the return stroke of the lever 41 , the roller may rotate in the direction of the arrow , fig2 and on the return stroke , the forwardmost newspaper shown in phantom lines in fig2 will be nudged downwardly so that its folded edge 33 will enter between the front of the abutment plate 29 and the vertical retainer flange 20 while the movable housing section 17 remains in the innermost locked position under control of the arm 13 of the coin mechanism 12 which is not yet released . the manual lever 41 is free to be operated at any time to raise the forwardmost newspaper and place it in the position shown in phantom lines in fig2 but the paper cannot be delivered to the customer until proper coins have been placed in the coin slots of the standard mechanism 12 . when such coins are placed , the mechanism control arm 13 is released and the customer uses a handle 45 on the front of housing section 17 to pull the housing section forwardly to the position of fig3 where the leading newspaper 15 drops by gravity through the openings 19 and 21 of the two housing sections which are now in registration , fig3 . forward movement of the housing section 17 causes the retainer flange 20 to separate from the fixed abutment plate 29 to thus release the forwardmost paper for dropping onto the deflector plate 22 and passing into the hand of the customer with the assistance of gravity . the top wall of housing section 17 is connected to the coin mechanism control arm 13 by a connecting member 46 and both elements 13 and 46 are inside of a protective cover 47 hinged at 48 to the main body portion of the coin mechanism 12 . the cover 47 is locked down by a spring - urged locking bolt 49 beneath the top wall 11 of the cabinet . in some cases , the protective cover 47 can also be externally padlocked for extra security . it may also be mentioned here , in terms of security , that the bottom compartment of the cabinet 10 below the newspaper storage compartment 14 can be weighted down with sand bags up to 300 pounds or more . the movable housing section 17 , fig5 also has a hinged top wall panel 50 carrying the member 46 upon it and normally resting horizontally on a stop bar 51 beneath the top wall of the movable housing section . a further hinged access panel 52 is provided in the rear wall of cabinet 10 to cover access openings 53 and 54 in the cabinet and in the rear wall 26 of the fixed housing section 16 . the hinged panel 50 , fig2 is normally padlocked as at 55 . referring to fig5 when it is necessary to reload the machine with newspapers , authorized personnel may open the lock 55 and the hinged panel 52 , may reach in to the back of the machine and release the bolt 49 which , in turn , allows raising of the protective cover 47 as well as raising of the closure panel 50 after the movable housing section 17 is pulled to the extreme forward position of fig5 where the panel 50 is out from under the top wall of the fixed housing section 16 . the arms 37 may also be raised out of the way at this point and a fresh stack of papers may be loaded through the top of housing section 17 so as to rest on the top edges of tracks 25 . after loading , the various closure parts are returned to their normally locked positions depicted in fig1 through 4 . the entire device is characterized by simplicity and durability , ease and convenience of operation , and comparative economy of manufacture . many existing semi - honor vending machines in the field can be readily converted by the kit to the machine embodied in the invention , and newly manufactured machines can also be provided . in lieu of the cabinet 10 , the two part box - within - a - box horizontally telescoping compartment 14 may be supported on a suitable open framework instead of an enclosed cabinet . it should be mentioned finally in connection with fig5 that the top wall of housing section 16 contains a hand clearance opening 56 through which access to the handle of bolt 49 may be had . it is to be understood that the form of the invention herewith shown and described is to be taken as a preferred example of the same , and that various changes in the shape , size and arrangement of parts may be resorted to , without departing from the spirit of the invention or scope of the subjoined claims .	6
for the purposes of promoting an understanding of the principles of the invention , reference will now be made to the embodiment illustrated in the drawings and specific language will be used to describe the same . it will nevertheless be understood that no limitation of the scope of the invention is thereby intended , such alterations and further modifications in the illustrated device , and such further applications of the principles of the invention as illustrated therein being contemplated as would normally occur to one skilled in the art to which the invention relates . referring to fig1 there is illustrated a cone - stack centrifuge 20 according to a preferred embodiment of the present invention . centrifuge 20 includes as some of its primary components base 21 , bell housing 22 , shaft 23 , rotor hub 24 , rotor 25 , cone stack 26 , jet nozzles 27 and 28 , and modified pelton turbine 29 . as described and used herein , the rotor 25 includes a cone - stack assembly . fig2 provides a diagrammatic top plan view of jet nozzles 27 and 28 as well as impulse turbine 29 showing the direction of the flow jets 27a and 28a exiting from jet nozzles 27 and 28 , respectively . turbine 29 includes a circumferential series of eighteen buckets 32 attached to a rotatable wheel 33 . the flow jets 27a and 28a are directed tangentially to the wheel on opposite sides of the wheel , and are aimed at the center of the buckets which rotate into the tangency zone on the corresponding side of wheel 33 . rotatable wheel 33 is securely and rigidly attached to rotor hub 24 which is concentrically positioned around shaft 23 . the rotor hub is bearingly mounted to and supported by shaft 23 by means of upper roller bearing 34 and lower roller bearing 35 . sealed bearings are used as opposed to shielded bearings in order to reduce bearing leakage flow . while turbine 29 can be configured in a variety of styles , the preferred configuration for the present invention is a modified half - bucket style of pelton turbine . the modified half - bucket turbine 29 is illustrated in fig1 while a conventional pelton turbine 29a ( split - bucket ) is illustrated in fig1 a . the differences between these two turbine options are effectively limited to the geometry of the buckets , 32 and 32a , respectively . with the exception of replacing the modified half - bucket style of turbine 29 in fig1 with the split - bucket style of turbine 29a in fig1 a , the construction of the fig1 and fig1 a centrifuges are identical . while the construction of a split - bucket 32a is believed to be well known , the modified half - bucket 32 configuration is unique to this application . reference to fig2 a and 2b will provide additional details regarding the geometry and construction of each half - bucket 32 . the cone - stack assembly or rotor 25 is defined herein as including as its primary components base plate 38 , vessel shell 39 , and cone stack 26 . the assembly of these primary components is attached to rotor hub 24 such that as rotor hub 24 rotates around shaft 23 by means of roller bearings 34 and 35 , the rotor 25 rotates . the rotary motion imparted to rotor hub 24 comes from the action of turbine 29 which is driven by the high pressure flow out of jet nozzles 27 and 28 . as the flow jets 27a and 28a impinge on the buckets 32 , each corresponding bucket is pushed , rotating the wheel 33 so as to bring the next sequential bucket into position for the point of tangency striking by the flow jets . this procedure occurs on each side of the wheel in a cooperating manner as the points of tangency for flow jets 27a and 28a are 180 degrees apart . the wheel rotates faster and faster until a steady state speed of rotation is achieved based on the characteristics of the flow jets 27a and 28a and the characteristics and dynamics of the turbine . since the turbine is attached to the rotor hub 24 which is bearingly mounted on the shaft 23 , the rotor 25 rotates at a rpm speed which corresponds to the speed of the wheel 33 of the turbine 29 . in the preferred embodiment of turbine 29 , each bucket 32 ( the modified half - bucket style ) has an ellipsoidal profile and a 10 to 15 degree exit angle on the edge of the ellipsoid . a front elevational view of one bucket 32 is illustrated in fig2 a . a perspective view of one bucket 32 is illustrated in fig2 b . the flow exiting from the bucket is directed downward and away from the spinning rotor , thus reducing droplet impingement drag . except for those portions within base 21 and below base plate 38 , the structure of centrifuge 20 is similar in certain respects to the structure disclosed in u . s . pat . nos . 5 , 575 , 912 and 5 , 637 , 217 , which patents have been expressly incorporated by reference herein . more specifically , the outer radial lip 40 of the bell housing 22 is positioned on the upper surface of flange 41 . the interface between radial lip 40 and flange 41 is sealed in part by the addition of an intermediate annular , rubber o - ring 42 . a band clamp 45 is used to complete and complement the sealed interface . clamp 45 is positioned around the lip 40 and flange 41 and includes an inner annular clamp 46 and an outer annular band 47 . as the band 47 is drawn tight , the clamp inside diameter is reduced and the tapered sides of annular channel 48 pull the lip 40 and flange 41 together axially into a tightly sealed interface . the drawing together of the lip 40 and flange 41 compresses the o - ring 42 . at the top of bell housing 22 , a cap assembly 51 is provided for receipt and support of the externally - threaded end 52 of shaft 23 . the details of shaft 23 are illustrated in fig3 . adapter 53 is internally threaded and includes a flange 54 that fits through and up against the edge of opening 55 . sleeve 56 , o - ring 57 , and cap 58 complete the assembly . with the end 52 first threaded into adapter 53 , and with the o - ring assembled , the housing and sleeve are then lowered into position . the cap is attached to secure the cap assembly 51 to the shaft 23 and housing 22 and the band clamp assembled and tightened into position . cap assembly 51 provides axial centering for the upper end 52 of shaft 23 and for the support and stabilizing of shaft 23 in order to enable smooth and high speed rotation of rotor 25 . disposed at the upper end of the rotor 25 , between the bell housing 22 and the externally - threaded end 52 , is an attachment nut 61 and support washer 62 . the annular support washer has a contoured shaped which corresponds to the shape of the upper portion of rotor shell 39 . an alternative envisioned for the present invention in lieu of a separate component for washer 62 is to integrate the support washer function into the rotor shell by fabricating an impact extruded shell with a thick section at the washer location . upper end 63 of rotor hub 24 is bearingly supported by shaft 23 and upper bearing 34 and is externally threaded . attachment nut 61 is threadedly tightened onto upper end 63 and this draws the support washer 62 and rotor shell 39 together . the opposite ( lower ) end 64 of rotor hub 24 is configured with a series of axial notches 64a and an alternating series of outwardly extending splines 64b ( see fig4 and 5 ). this splined end fits tightly within the cylindrical aperture 65 which is centered in base plate 38 . aperture 65 is concentric with hub 24 and with shaft 23 and the anchoring of the hub to the housing and to the base plate ensures a concentric rotation of the cone - stack assembly around the shaft 23 . the fit between the splined end 64 and aperture 65 also creates a series of spaced - apart , exiting flow channels 66 by way of the notches 64a and splines 64b . a radial seal is established between the inner surface 67 of lower edge 68 of rotor shell 39 and the outer annular surface 69 of base plate 38 . this sealed interface is determined in part by the closeness of the fit and in part by the use of annular , rubber o - ring 70 . o - ring 70 is compressed between the inner surface 67 and the outer annular surface 69 . the assembly between the rotor shell 39 and base plate 38 in combination with o - ring 70 creates a sealed enclosure defining an interior volume 73 which contains cone stack 26 . each cone 74 of the cone stack 26 has a center opening 75 and a plurality of inlet holes disposed around the circumference of the cone adjacent the outer annular edge 77 . typical cones for this application are illustrated and disclosed in u . s . pat . nos . 5 , 575 , 912 and 5 , 637 , 217 . the typical flow path for the rotor 25 begins with the flow of liquid upwardly through the hollow center 78 of rotor hub 24 . the flow through the interior of the rotor hub exits out through apertures 79 . a total of eight equally - spaced apertures 79 are provided , see fig4 . a flow distribution plate 80 is configured with vanes and used to distribute the exiting flow out of hub 24 across the surface of the top cone 74a . the manner in which the liquid ( lubricating oil ) flows across and through the individual cones 74 of the cone stack 26 is a flow path and flow phenomenon which is well known in the art . this flow path and the high rpm spinning rate of the cone - stack assembly enables the small particles of soot which are carried by the oil to be centrifugally separated out of the oil and held in the centrifuge . the focus of the present invention is on the design of base 21 , the use of a turbine 29 , the manner of routing a fluid to the flow jet nozzles 27 and 28 , and the configuration of shaft 23 which provides the desired design compatibility with the base 21 , turbine 29 , and nozzles 27 and 28 . the base 21 is configured with and defines an inlet aperture 82 and main passageway 83 . intersecting main passageway 83 at right angles are jet nozzle passageways 84 and 85 . passageway 84 is defined by mounting post 86 and provides a fluid communication path to jet nozzle 27 . on the opposite side of wheel 33 and on the opposite side of base hub 87 for mounting post 86 is a second mounting post 88 which defines passageway 85 . passageway 85 provides a fluid communication path to jet nozzle 28 . the hub 87 of base 21 includes a cylindrical aperture 89 which is internally threaded and which intersects main passageway 83 at a right angle . the base 90 of shaft 23 is externally threaded and threadedly secured and assembled into aperture 89 . base 90 is hollow and defines passageway 91 , which has a blind distal end 92 and throttle passageway 93 . the distal end of passageway 83 is closed ( i . e ., blind ) as is the distal end of passageway 84 and the distal end of passageway 85 . the fit of splined end 64 of rotor hub 24 into cylindrical aperture 65 supports the rotor hub 24 within base plate 38 and maintains the securely assembled status between base plate 38 , rotor shell 39 , and rotor hub 24 . a press fit or even a tight fit between end 64 and aperture 65 is sufficient for the desired support . the splined fit between end 64 and aperture 65 is also designed to prevent relative rotational movement between the rotor hub 24 and base plate 38 . the fit of end 64 within aperture 65 creates exiting flow channels 66 which open into the interior space 95 of base 21 defined by the side wall 96 of base 21 . side wall 96 further defines outlet drain opening 97 which permits the oil exiting from the rotor 25 by way of flow channel 66 to drain out from base 21 and continue on its circulatory path to and through the corresponding engine , or other item of equipment . the lubricating oil which is used through the jet nozzles 27 and 28 to drive the turbine 29 also accumulates in interior space 95 and combines with the oil exiting through flow channel 66 and it is this blended oil which exits through the outlet drain opening 97 . splash plate 98 is attached to the upper end surface 99 and 100 of posts 86 and 88 , respectively . for the operation of the centrifuge 20 as illustrated in fig1 pressurized ( 20 - 90 psi ) fluid flow ( oil ) enters the centrifuge base 21 via inlet aperture 82 and main passageway 83 . pressurized oil is supplied to passageways 84 and 85 as well as to passageway 91 by way of cylindrical aperture 89 . post 86 defines an exit orifice 103 which flow connects with jet nozzle 27 . a similar exit orifice 104 is defined by post 88 and flow connects with jet nozzle 28 . the blind nature of passageways 84 and 85 forces the entering flow out through orifices 103 and 104 in order to create flow jets 27a and 28a which drive the turbine 29 which in turn rotatably drives rotor hub 24 and the remainder of rotor 25 . the high velocity streams of fluid exiting from the two flow jet nozzles create the necessary high rpm speed for the rotor 25 in order to achieve the desired soot removal rate from the oil being routed through the rotor 25 . the requisite speed is a function of the outside diameter size of the cone stack as previously discussed . in the preferred embodiment , jet nozzles 27 and 28 each have an exit orifice sized at a diameter of approximately 2 . 46 mm ( 0 . 09 inches ). each nozzle has a tapered design on the interior so as to create a smooth transition leading to the exit orifice diameter in order to develop a coherent stable jet with minimal turbulent energy and maximum possible velocity . the turbine 29 converts the kinetic energy of the jets to torque which is imparted to the rotor hub 24 . as has been described , various styles or designs for turbine 29 are contemplated within the scope and teachings of the present invention , including a classic pelton turbine , though miniaturized in size , a modified half - bucket style , and a vane - ring or &# 34 ; turgo &# 34 ; style . of these options , the modified half - bucket style is the preferred choice . the turbine is optimized in performance efficiency when the bucket velocity is slightly less than one - half that of the impinging flow jet velocity . in an ideal design , the driving fluid &# 34 ; drops off &# 34 ; the bucket with nearly zero residual velocity and falls down into the interior space 95 of the base and exits by way of drain opening 97 . a target speed of 10 , 000 rpms with a 70 psi jet , a design for turbine 29 with a bucket pitch diameter of 28 . 96 mm ( 1 . 14 inches ), and a delivery torque of approximately 1 inch / pound are characteristics of the design of the preferred embodiment . under these specifications , the pumping horsepower ( parasitic ) loss to the engine is only 0 . 2 hp ( less than 0 . 03 percent of engine output for the size of engine under study for these conditions ). the entering oil by way of passageway 83 also flows up through cylindrical aperture 89 into passageway 91 of shaft 23 . the upward flow exits the interior of shaft 23 by way of throttle passageway 93 . in the preferred embodiment , the exit orifice diameter for passageway 93 is 1 . 85 mm ( 0 . 073 inches ) which limits the flow rate through the rotor 25 to approximately 0 . 6 gallons per minute . under test it has been learned that there is a high - torque drag spike when flow is between 0 . 2 and 0 . 4 gallons per minute through the rotor . a flow of 0 . 6 gallons per minute avoids this problem . a critical aspect of the present invention is the throttling of the incoming flow by the use of passageway 93 which is located adjacent to the inlet end 107 of the rotor hub 24 . in the illustration of fig1 the rotor hub 24 extends in an upward direction from base 21 and base plate 38 to the area of the attachment nut 61 at the upper end or top of the vessel shell 39 . since the incoming oil enters at aperture 82 and from there flows in and up , the lower end 107 of the rotor hub is the inlet end for the purpose of defining the flow path . locating the throttle passageway 93 at the inlet end 107 of the rotor hub in effect depressurizes the interior 78 of the rotor hub 24 and this permits the use of standard deep - groove sealed roller bearings at the locations of upper roller bearing 34 and at lower roller bearing 35 . the use of these styles of roller bearings dramatically reduces the rotational drag compared to the prior art ( old style ) journal bearings . at higher internal pressures within the interior 78 of rotor hub 24 than what is present with the present invention due to the throttling effect , journal bearings are needed since they can withstand the higher pressure . the problem is that journal bearings have substantial levels of rotational drag which limit the rpm speed which can be achieved for the rotor 25 . the resulting soot removal efficiency drops off substantially , resulting in a noticeably less efficient design and arguably an unacceptable design , if control of soot is the objective . there is a domino effect by throttling the flow and reducing the interior pressure in interior 78 . the ability to use roller bearings in the centrifuge design according to the present invention permits higher rotational speeds due to the lower drag and thus speeds in the range of 10 , 000 rpms ( and higher ) can be achieved with the present invention . it has been determined that speeds in this range are required for efficient soot removal . after exiting the shaft throttle passageway 93 , the process fluid ( oil ) travels upwardly in the hollow center or interior 78 of rotor hub 24 between the shaft 23 and hub 24 . near the upper portion of hub 24 , there are a plurality of outlet holes , eight total in the preferred embodiment . the flowing oil passes through each of these outlet holes 79 and the flow is directed up and around the cone stack by a flow distribution plate which is equipped with radial vanes that accelerate the fluid in the tangential direction . the flow is distributed throughout the cone stack through the vertically - aligned cone inlet holes and flows through the gaps in the cone stack radially inwards toward the hub . the stack of cones is rigidly supported by the rotor hub base plate . upon reaching the hub outside diameter , the flow passes down through aligned cut outs on the inside diameter of the cones and exits the interior volume 73 through the flow channels 66 . as an alternative to this configuration , the base plate 38 can be a one - piece design with holes drilled through the plate for fluid exit paths . it is important that the flow exits from the flow channels 66 as near the rotational axis as possible to avoid drag / speed reduction due to centrifugal &# 34 ; pumping &# 34 ; energy loss by dumping flow out at a high tangential velocity , which increases proportionately with radius . also , the exiting flow must leave the cone - stack assembly in a manner such that it does not contact the outside surface of the base plate and , as a result , rob energy by being re - accelerated and &# 34 ; slung &# 34 ; from the outside diameter of the rotor base at a high speed . this result is achieved by routing the exiting oil flow through flow channel 66 to a point beneath splash plate 98 and this diverts the spray of oil down and away from the spinning rotor hub 24 towards the drain opening 97 . if , in an alternative design , the splash plate is not used , then the exiting oil needs to exit from a point lower than the lowest point of the base plate so that oil is not re - entrained on the surface of the spinning rotor as it flies radially outward from the exit point . as has been described , the &# 34 ; clean &# 34 ; process fluid then mixes with the driving fluid and drains out of the housing base 21 by way of drain opening 97 through the force of gravity . with reference to fig6 an alternative cone stack centrifuge 120 is disclosed . it should be noted that centrifuge 120 has a structure which in many respects is quite similar to the cone - stack centrifuge 20 of fig1 . the principal differences between cone stack centrifuge 120 and cone - stack centrifuge 20 involve the designs and the relationships for the base 21 , shaft 23 , cylindrical aperture 89 , and main passageway 83 . comparing these portions of centrifuge 20 with the corresponding portions of centrifuge 120 reveals the following differences . in the fig1 design for centrifuge 20 , the main passageway 83 is in direct flow communication with aperture 89 of base hub 87 . as illustrated , the aperture 89 does not axially extend through the main passageway 83 , but effectively is a t - intersection at that point . in the fig6 design , there is no flow communication between cylindrical aperture 121 in the base and main passageway 122 . instead , the lower end or base 123 of the shaft 124 of centrifuge 120 is axially extended over that of base 90 such that shaft 124 extends through main passageway 122 and exits out through the lower aperture extension 125 of cylindrical aperture 121 . shaft 124 is illustrated in fig7 as a separate component part . this lower aperture extension 125 intersects the main passageway 122 as is illustrated , and is axially aligned with the upper portion of cylindrical aperture 121 which is above the main passageway 122 . the design of base 126 of centrifuge 120 is illustrated in fig8 . the base 123 of shaft 124 still includes a passageway 127 which provides a flow path from inlet aperture 128 to throttle passageways 129 and 130 . turbine 29 is now numbered as 134 , but the designs are basically the same . in fig6 a , the alternative style of turbine with the split - bucket configuration is identified as turbine 134a . it will be noted that shaft 23 includes a single throttle passageway 93 while shaft 124 ( fig6 ) includes two throttle passageways , 129 and 130 . the reason for this is due to the fact that in the fig6 embodiment , it is possible to throttle the incoming flow of oil at almost any point upstream from passageways 129 and 130 , preferably outside of the centrifuge . as a result , passageways 129 and 130 do not have to serve as the sole throttling means . in fig1 the incoming oil is also used to drive the turbine 29 and throttling the flow outside of the centrifuge would adversely affect the turbine speed . for this reason , throttling of the flow to the rotor 25 is accomplished by passageway 93 . it is easier to accomplish the throttling function with one passageway as compared to two . for this reason , only a single passageway 93 is provided in the fig1 embodiment . since the interior passageway 127 through the shaft is not in flow communication with main passageway 122 , the incoming flow ( oil ) at inlet aperture 128 is not used to drive turbine 134 . turbine 134 is virtually identical to turbine 29 and the balance of centrifuge 120 is virtually identical to centrifuge 20 , except as being described herein . in order to drive the turbine 134 by way of flow jet nozzles 135 and 136 , a pressurized fluid is introduced into main passageway 122 by way of inlet aperture 137 . in the preferred embodiment , this pressurized fluid ( i . e ., driving fluid ) is a gas . the pressurized gas follows the same path as the oil in the fig1 configuration except that the pressurized gas does not flow into passageway 127 and , as such , is not introduced into the cone - stack assembly 138 . in order for the pressurized gas to flow to passageway 139 in post 140 and ultimately to jet nozzle 136 , the base 123 of shaft 124 is notched or indented at location 141 in order to permit the pressurized gas a free flow path around the base 123 of shaft 124 . passageway 142 in post 143 is in communication with passageway 122 for the delivery of the pressurized gas to jet nozzle 135 . an o - ring 144 is positioned between base 123 and the lower aperture extension 125 . inlet aperture 128 is internally threaded for coupling the input conduit which delivers the fluid to be introduced into the cone - stack assembly . the gas ( typically air ) which is used to drive the turbine 134 in fig6 must be vented from the centrifuge 120 to the atmosphere . while a variety of vent designs and locations are suitable for this function , it is important to first separate any oil mist which may have co - mingled with the air . for this purpose , a coalescer 150 is attached to bell housing 151 and sealed around outlet 152 . as the spray mist or aerosol of air and oil exits through outlet 152 , the interior of the coalescer 150 pulls the oil out of the air . the air then passes to the atmosphere and the oil gradually drips back into the centrifuge . the interior of coalescer 150 includes a metal mesh or alternatively a woven or non - woven synthetic mesh , all of which are well known in the art . various styles or designs for turbine 29 and the corresponding buckets have been mentioned herein , including a classic pelton turbine 29a with its split - bucket configuration for the individual buckets 32a ( fig1 a ) and a modified half - bucket style of turbine 29 with its buckets 32 ( fig1 ). either style of impulse turbine is suitable for the fig1 and fig6 embodiments as well as for the alternative embodiments of fig1 a and 6a . the diagrammatic illustration of fig2 is intended to be a suitable generic representation of turbines 29 and 29a , even though numbered as turbine 29 . in the discussion of other options or variations for turbine 29 , mention was made of a vane - ring or turgo style of turbine . while the individual vanes of such a turbine style can be placed at virtually any diameter , the efficiency with the gas - driven mode of operation is improved if the vane circle diameter is increased over the illustrated bucket circle diameter for turbine 29 . the vane - ring style of turbine is preferred for gas - driven centrifuges . it is known that the optimal vane velocity is equal to one - half of the jet velocity and , based on choked flow ( sonic velocity jet ), it is preferable to locate the gas - driven vanes around a larger diameter . accordingly , fig9 - 11 illustrate a vane - ring turbine 160 which is created by the attachment of individual vanes 161 to the outer surface of the generally cylindrical portion 162a of the rotor shell 162 which is adjacent the lower edge 163 . each vane 161 has a curved form with a concave impingement surface 164 . with this type of vane , the jet nozzle 165 is directed at an angle of between 5 and 20 degrees relative to the vane centerline , an angle which generally coincides with the leading edge angle of the vane 61 . the jet nozzle 165 delivers a jet of air from passageway 166 which strikes the vanes in rotary sequence and thus drives ( rotates ) the rotor which is bearingly mounted onto the shaft . for gas - driven operation of the centrifuge of fig6 a , and 9 , the gas jet is at sonic velocity ( for pressures above approximately 13 psig ). the optimal vane velocity ( fig9 ) for maximum kinetic energy extraction is about 0 . 4 times the jet velocity , which would be about 440 feet per second ( for a sonic velocity of 1100 feet per second ). at 10 , 000 rmp with a 7 . 3 inch diameter rotor , the vane velocity ( with the vanes 161 located at the perimeter illustrated in fig9 ) is approximately 320 feet per second which is still &# 34 ; slow &# 34 ; relative to optimal . the vane ( vane - ring ) style of turbine used for the fig9 centrifuge can be used with the centrifuge embodiments of fig1 a , 6 , and 6a as a replacement for the modified half - bucket and split - bucket turbine styles . there are though efficiency differences based on the turbine style which is used , the location of the turbine , the rotor diameter , the driving medium , and the jet velocity . while the invention has been illustrated and described in detail in the drawings and foregoing description , the same is to be considered as illustrative and not restrictive in character , it being understood that only the preferred embodiment has been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected .	1
in the following description frameworks and methods of cooperatively processing a task by multiple threads in a multi - threaded computer system are described . in general , upon receipt of a packet associated with the task , a first thread partially processes the task . the packet is then passed from the first thread to a second thread that , upon receipt of the packet , further processes the task . since only the thread currently possessing the packet can process the task , no synchronization primitives , such as mutexes , are required for the threads to cooperate with each other . the invention will initially be described in terms of an interrupt handler for a device driver . the interrupt handler itself is conceptually divided into a plurality of different order handlers . the tasks that are to be handled by the interrupt handler are also divided into various segments with each order interrupt handler being designed to handle an associated segment of the overall task . the tasks can conceptually be organized in any appropriate manner , however , in the context of an interrupt handler it is typically most logical to divide the activities by their relative priority . more specifically , it should be appreciated that some of the activities performed by an interrupt handler may be very time critical and must be handled as quickly as possible , while other tasks are not particularly time critical and may effectively be handled on a less time critical basis . the various order handlers are arranged to partition the work performed by the interrupt handler such that the most time critical activities are handled by the order - 1 interrupt handler . less time critical , but still high priority tasks are handled by the order - 2 interrupt handler . the least time critical tasks are handled by the order - 3 handler . of course , a task could readily be broken into more or less segments based on the nature of the task being handled . in the described embodiment , the order - 1 interrupt handler is designed to perform tasks that are deemed to require the use of a micro - kernal thread . these are generally the tasks that are considered to be the most time critical . the order - 2 interrupt handler is designed to perform tasks that are deemed to require the use of a high priority system thread ( higher than a non - native thread and any other system thread ). thus , tasks that are considered to be very important , but not as time critical as the order - 1 tasks are handled by the order - 2 interrupt handler . the order - 3 interrupt handler is arranged to run non - native threads and to perform the tasks that are not particularly time critical . fig1 illustrates a device driver 100 that may benefit from cooperative task processing performed in accordance with an embodiment of the invention . as will be appreciated by those skilled in the art , a device driver is a program written to support an associated device . in computer systems , devices supported by a device driver may include , but are not limited to input and output devices such as printers , monitors , modems and / or network / telephone connections . the device driver 100 illustrated in fig1 includes an interrupt handler 102 arranged to process hardware interrupts generated by the device that the device driver 100 is managing . the interrupt handler is partitioned into a plurality of sub - parts , including an order - 1 interrupt handler 106 , an order - 2 interrupt handler 108 , and an order - 3 interrupt handler 110 . in alternative embodiments , any combination of these and other orders may be defined for a particular interrupt handler . in the illustrated embodiment , a device interrupt source 104 is provided which defines the particular interrupt handlers used by and associated with the device driver 100 , such as , for example , the interrupt handler 102 . fig2 illustrates a particular relationship 200 between the various interrupt handlers defined by the device interrupt source 104 in accordance with an embodiment of the invention . in the described embodiment , the order - 1 interrupt handler 106 is invoked at 206 in the context of a microkernal interrupt handler 202 included in a microkernal 201 well known by those skilled in the art . the microkernal interrupt handler 202 is software that immediately begins running whenever hardware coupled to the microkernal 201 asserts an interrupt . it is important to note , however , that once the microkernal interrupt handler 202 begins to run , any thread that is currently running in the multi - threaded computer system is immediately suspended . it should also be noted , that once the microkernal interrupt handler 202 returns , a microkernal scheduler 204 ( i . e ., software used to schedule prioritized threads ) un - suspends the highest priority thread even though that thread may or may not be the thread that was interrupted . in one embodiment , the order - 1 handler 206 runs native code ( i . e ., platform dependent code ) and subsequently fulfills the most immediate needs of the interrupting device such as , for example , when the interrupting device is a serial device whose buffer may overrun if not handled fast enough . it should be noted that while the order - 1 handler 106 is running , all further interrupts from the interrupting device are masked . after the microkernal interrupt handler 202 calls the order - 1 interrupt handler 106 and the order - 1 interrupt handler 106 returns ( if it is the lowest order handler ), or after the microkernal interrupt handler 202 signals the order - 2 interrupt handler 108 or order - 3 interrupt handler 110 ( whichever is lowest ), the microkernal interrupt handler 202 transfers control to the microkernal scheduler 204 . all hardware interrupts are for a particular level , and a higher hardware level will pre - empt an interrupt currently being processed at a lower level . for example , if an order - 1 interrupt handler is currently running for a level - 3 hardware interrupt , and an interrupt for a level 4 occurs , that level 4 interrupt will pre - empt the order - 1 handler running for the level - 3 interrupt . in addition , the running order - 1 interrupt handler 106 also preempts other order - 1 interrupt handlers coupled to the microkernal 201 that were invoked by the lower - level microkernal interrupt handler 202 as well as any non - native threads ( i . e ., platform independent threads such as java threads ). it is for at least this reason that the order - 1 interrupt handler 106 should do the absolute minimum that is necessary to satisfy the most immediate needs of the interrupting device and leave the remainder of interrupt handling for higher - order interrupt handlers ( such as the order - 2 and order - 3 interrupt handlers ). it is important to note that in those situations where non - native threads , such as java , are suspended during , for example , garbage collection , the order - 1 interrupt handler 106 is still capable of running . in this way , time critical processes are still capable of being run . in the described embodiment , the order - 2 interrupt handler 108 is , in some cases , signaled from the order - 1 interrupt handler at 208 . in those cases where no order - 1 interrupt handler exists , the order - 2 interrupt handler 108 is signaled from the microkernal interrupt handler 202 at 210 . in a preferred embodiment , the order - 2 interrupt 108 handler runs native code in a high priority system thread ( higher than a non - native thread and any other system thread ) and performs additional interrupt handling . since the order - 2 interrupt handler 108 runs native code ( platform dependent ), and since it has higher priority than any other non - native thread , the order - 2 interrupt handler 108 can handle real time needs of the interrupting device . at the same time , unlike the order - 1 interrupt handler 106 , the order - 2 interrupt handler 108 can continue interrupt processing without masking additional interrupts from the interrupting device . an interrupt can still occur , and the order - 1 interrupt handler 106 can run while the order - 2 interrupt handler 108 is in the middle of interrupt handling . once the order - 2 interrupt handler 108 finishes its interrupt handling , it signals the order - 3 interrupt handler 110 at 212 . it is important to note that the order - 2 interrupt handler 108 should be able to run while the non - native threads are suspended during , for example , garbage collection . in addition to the order - 1 interrupt handler 106 and the order - 2 interrupt handler 108 , the device interrupt source 104 is arranged to define the order - 3 interrupt handler 110 . the order - 3 interrupt handler 110 is signaled to run from either the order - 2 interrupt handler 108 or the order - 1 interrupt handler 106 at 214 in the case where there is no order - 2 interrupt handler . however , if there is neither an order - 1 interrupt handler nor an order - 2 handler present , the signaling can come from the microkernal interrupt handler 202 directly at 216 . it is important to note that in the described embodiment , the order - 3 interrupt handler 110 runs non - native code , such as java , exclusively and for this reason can be especially slow when it is pre - empted for long periods such as when the non - native threads are suspended . for this reason , the order - 3 interrupt handler 110 should not be used for time critical interrupt processing . in addition , since the order - 3 interrupt handler 110 is the only interrupt handler capable of running non - native code , such as java , the device interrupt source 104 must define the interrupt handler 104 , as a minimum , to include the order - 3 interrupt handler 110 in those situations where non - native threads are contemplated . typically , the number and type of interrupt handlers defined by the device interrupt source 104 is determined by the particular application as well as the number and type of hardware devices . in those situations where the delay experienced by native threads when non - native threads are suspended is not significant or doesn &# 39 ; t cause significant system performance problems , the device interrupt source 104 may find it necessary to only allocate the order - 3 interrupt handler 110 . on the other hand , in those situations where it is imperative that native threads be left to run substantially unhindered ( even though non - native threads are suspended for reasons such as garbage collection ) it is important to allocate more of the lower order interrupt handlers . by way of example , the device interrupt source 104 can allocate relatively more of the order - 1 interrupt handlers 106 and / or the order - 2 interrupt handlers 108 in than of the order - 3 handlers 110 when running time critical processes without substantial hindrance is important . referring again to fig1 in one embodiment of the invention , when the device interrupt source 104 is instantiated , an interrupt packet 112 is allocated . in the described embodiment , the actual number of interrupt packets 112 is determined by the device driver 100 based upon particular requirements of the device being managed . it should be noted that based upon these requirements , the device interrupt source 104 can allocate a pool of interrupt packets 114 represented by interrupt packets 112 a - 112 d . fig3 a and 3b illustrates different aspects of an interrupt packet 300 in accordance with an embodiment of the invention . it should be noted that the interrupt packet 300 is one particular implementation of the interrupt packet 112 . in a preferred embodiment , the interrupt packet 300 contains a protected owner field 302 that takes on a value indicative of current ownership of the interrupt packet 300 . the interrupt packet 300 also includes a processing data field 303 used to store relevant task processing information . table 1 lists representative owner field values and associated ownership status according to one embodiment of the invention . by way of example , if the owner field 302 has a value of “ 0 ”, as indicated by table 1 , the interrupt packet 300 is un - owned ( i . e ., no interrupt handler currently owns the interrupt packet 302 ). alternatively , if the owner field 302 has a value of “ 1 ”, as indicated by table 1 , the interrupt packet 300 is owned by the order - 1 handler 106 . it should be noted that , in a preferred embodiment , when the device interrupt source object 102 is instantiated , all corresponding interrupt packets 112 a - 112 d are allocated with their respective owner fields set to 0 indicating that no interrupt handler currently owns the particular interrupt packet . in the described embodiment , the interrupt packet 300 can be extended to include information in addition to the current owner . by extended , it is meant that additional data fields containing information specific to the particular device the associated device driver manages for example , are added . by way of example , the interrupt packet 300 can be extended to include additional data fields associated with , for example , financial data particularly useful for specific financial applications and associated devices . such an interrupt packet 304 is shown in fig3 b . the interrupt packet 304 includes an owner field 306 and a processing data field 307 . for this example , the interrupt packet 304 has been extended to include additional data fields 308 used , for example , in defining particular application specific data depending upon the particular native application for which the additional data fields 308 are associated . it is important to note that since the native operating system only interacts with the owner field , the presence of additional data fields in the extended interrupt packet 304 is irrelevant to the execution of the native operating system . it is for at least this reason , that any extension of an interrupt packet by a particular application leaves the interrupt packet platform independent . since the order - 1 , order - 2 , and order - 3 interrupt handlers for a particular device driver can handle interrupts concurrently it is necessary to avoid any synchronization problems . such problems caused by , for example , garbage collection result in native threads being suspended . in one embodiment of the invention , such synchronization problems are avoided by using an efficient message passing approach . in a preferred embodiment , the efficient message passing utilizes the interrupt packets 112 provided by the device interrupt source 104 . during operation , when an interrupt handler ( of any order ) exclusively processes an interrupt , it stores processing information relevant to the interrupt processing in the interrupt packet 112 . when a particular interrupt handler has completed its processing of the interrupt and is ready to hand the processing off to a higher order interrupt handler ( i . e ., from the order - 1 interrupt handler 106 to the order - 2 interrupt handler 108 , for example ), the lower order interrupt handler passes the interrupt packet to the higher order interrupt handler . the higher order handler then appropriately updates the interrupt packet and continues to process the interrupt . since no two interrupt handlers possess the same interrupt packet at the same time , synchronization is unnecessary . by way of example , fig4 a illustrates a scheme 400 for cooperatively processing an interrupt in accordance with an embodiment of the invention . for this example , the device driver 100 includes an order - 1 interrupt handler 406 as well as an order - 3 interrupt handler 408 ( required to run non - native code ) instantiated by the device interrupt source 104 . when the interrupt int 1 is asserted , the microkernal handler 202 suspends all native threads until such time as it sends an interrupt packet 410 to the order - 1 interrupt handler 406 . it should be noted that while in possession of the microkernal handler 202 , the owner field 412 of the interrupt packet 410 has a value of “ 0 ” indicating that it is un - owned . once the microkernal handler 202 has sent the interrupt packet 410 to the order - 1 interrupt handler 406 , the owner field 412 of the interrupt packet 410 is updated to a value of “ 1 ” indicating that it is now owned by the order - 1 handler 406 . since the order - 1 interrupt handler 406 currently owns the interrupt packet 410 , it is now the only interrupt handler included in the device driver 100 enabled to process the interrupt int 1 . it should be noted as well , that any additional interrupts asserted while the order - 1 interrupt handler 406 is processing the interrupt int 1 are masked until such time as the interrupt packet 410 is passed along to a higher order interrupt handler . in this case , even if the non - native code is suspended , the order - 1 interrupt handler 406 is still able to process time critical native threads since it alone owns the interrupt packet 410 . assuming at a time δt 0 subsequent to the completion of either order - 1 interrupt handling ( if there is one ) or signaling of what is otherwise the lowest order interrupt handler of the interrupt int 1 another interrupt int 2 is asserted . as described above , the interrupt int 2 is masked until the order - 1 interrupt handler 406 sends the interrupt packet 410 to a higher order interrupt handler , such as the order - 3 interrupt handler 408 . therefor , in order for the order - 1 interrupt handler 406 to process the interrupt int 2 , it must send the interrupt packet 410 to the order - 3 interrupt handler 408 . once the order - 1 interrupt handler 406 sends the interrupt packet 410 to the order - 3 interrupt handler 408 , it gets a new interrupt packet 414 from the microkernal interrupt handler 202 in order to process the newly asserted ( and heretofore masked ) interrupt int 2 . it should be noted that the owner field 412 of the interrupt packet 410 has been updated to a value of “ 3 ” indicating that it is now owned by the order - 3 interrupt handler and that the owner field 416 of the interrupt packet 414 is updated to a value of “ 1 ”. in this configuration , the remainder of the interrupt int 1 can be processed by the order - 3 interrupt handler 408 concurrently with the interrupt int 2 being processed by the order - 1 interrupt handler 406 . if an occasion arises where the order - 3 interrupt handler is suspended for any reason unrelated to the native operating system , time critical native threads can still be processed by the order - 1 interrupt handler 406 after it has completed its processing of the interrupt int 2 . fig4 b illustrates processing of the interrupt int 1 shown in fig4 a . for this example , the interrupt int 1 includes a series of tasks identified as 1 , 13 , 18 , d 3 , e 3 , which must be completed in order for the interrupt int 1 to be considered fully processed . it should be noted that “ a1 ” refers to the process “ a ” being performed by the order - 1 handler 406 whereas “ c3 ” refers to the process “ c ” being performed by the order - 3 handler 408 , and so on . therefor , the order - 1 interrupt handler 406 will process tasks “ a ” and “ b ” quickly , since , at least for this example , they represent time critical processes . whereas , when the interrupt packet 410 is passed to the order - 3 interrupt handler 508 , the tasks “ c ”, “ d ”, and “ e ”, are processed by the order - 3 interrupt handler 408 . in this way , the interrupt int 1 is fully processed by the cooperative effort of the order - 1 interrupt handler 406 and the order - 3 interrupt handler 408 as mediated by the interrupt packet 410 that is associated with the interrupt int 1 only . it should be noted that the same procedure is followed for the cooperative processing of the interrupt int 2 . a particular implementation of the invention will now be described with reference to fig5 - 8 . fig5 is a flowchart detailing a possible process 500 for handling device interrupts by a lowest order interrupt handler in accordance with an embodiment of the invention . the process 500 begins at 502 when a device driver receives an interrupt from the device it is managing . once the interrupt is received , the device driver calls a get_next_packet function at 504 . once the get_next packet function has been completed the get_next_packet is passed the order of the interrupt handler that wants the next packet and the fetched interrupt packet is passed to the lowest order handler at 506 . by way of example , if the device driver includes an order - 1 interrupt handler and an order - 3 interrupt handler , then the interrupt packet is passed to the order - 1 interrupt handler . alternatively , if the device driver has only an order - 3 interrupt handler , then the interrupt packet is passed from the microkernal directly to the order - 3 handler . once the interrupt packet has been passed to the lowest order interrupt handler , the interrupt handler processes the interrupt packet by , in one embodiment , storing appropriate lowest order state information in the interrupt packet at 508 . such state information includes information related to processing the interrupt associated with the interrupt packet . a particular example relates to a serial device driver having an array of characters that are read out of some hardware register by an order - 1 interrupt handler . the order - 1 interrupt handler in this case processes only these characters while the order - 2 and order - 3 interrupt handlers do further processing of the state information . a determination at 510 is then made regarding whether or not the interrupt packet is ready to be passed on . by passed on , it is meant that the interrupt packet is ready to be sent to the next interrupt handler . if the determination at 510 is that the interrupt packet is ready to be passed on , then the device driver calls a send_packet function at 512 . after the send_packet function has been completed , the process 500 waits at 514 for a next interrupt from the device being managed by the device driver . alternatively , if it was determined at 510 that the interrupt packet was not ready to be passed on , then control is passed to 514 without calling the send_packet function until such time as a next interrupt is received from the device being managed by the device driver . fig6 is a flowchart detailing a possible process 600 for handling device interrupts by a higher order interrupt handler in accordance with an embodiment of the invention . it should be noted that the process 600 is used in conjunction with the process 500 in those situations where interrupt handlers of more than one order have been instantiated . the process 600 begins at 602 by calling the get_next_packet function . once the next packet has been obtained , the packet is passed to an associated higher order interrupt handler which further processes the packet , by for example , storing appropriate state data in appropriate data fields at 604 . at 606 , it is then determined whether or not the packet is ready to be passed on . if it is determined that the packet is not ready to be passed on , control is returned to 602 where the next packet function is called . on the other hand , if the packet is ready to be passed on , then the packet is passed on to a next appropriate interrupt handler by calling the send_packet function at 608 . fig7 is a flowchart detailing a possible process 700 for getting a next interrupt packet in accordance with an embodiment of the invention . it should be noted that the process 700 is one particular implementation of the get_next_packet function at 504 of the process 500 . the process 700 begins at 702 by a determination of whether or not an unsent interrupt packet exists for the current interrupt handler . if it is determined that there is an unsent interrupt packet , then the unsent interrupt packet is returned to the calling interrupt handler at 704 . if , however , it is determined that there is no unsent interrupt packet , then the next interrupt packet for the calling interrupt handler is identified at 706 . once the next interrupt packet is identified , a determination at 708 is made whether or not the identified interrupt packet is owned by the calling interrupt handler . if it is determined that the identified next interrupt packet does not belong to the calling interrupt handler , then the process waits at 710 for the identified next interrupt packet to be assigned to the calling interrupt handler . if , however , it was determined at 708 that the identified next interrupt packet is owned by the calling handler , then the identified next interrupt packet is returned at 712 . it should be noted , that in one implementation of the invention , an array of state variables is used . fig8 is a flowchart detailing a process 800 for sending a next interrupt packet in accordance with an embodiment of the invention . it should be noted that the process 800 is a particular implementation of the send_next_packet function at 508 of the process 500 . the process 800 begins at 802 by setting an unsent packet flag in the interrupt packet to null indicating that there are no unsent packets . at 804 , the current owner of the packet is set to a value corresponding to the next highest order handler available ( which now becomes the current handler ). at 806 , a determination is made whether or not the current handler is now the highest order handler . if the current handler is now the highest order handler , then the process 800 stops . otherwise , the next highest order handler available is notified at 808 after which the process 800 stops . in one embodiment of the invention , the get_next_packet function and the send_next_packet function taken together manage the array of interrupt packets . in one particular implementation , the interrupt packets are managed as a ring buffer . one such ring buffer is configured in such a way that after a particular order interrupt handler has processed , for example , an interrupt packet p , the next interrupt packet that the particular interrupt handler will process is always the interrupt packet identified by the relation : such a ring buffer arrangement is shown in fig9 . a ring buffer 902 contains 4 interrupt packets arranged between an order - 1 handler , an order - 2 handler , and order - 3 handler , and as unowned . although only a few embodiments of the present invention have been described , it should be understood that the present invention may be embodied in many other specific forms without departing from the spirit or the scope of the present invention . steps may also be removed or added without departing from the spirit or the scope of the present invention . fig1 illustrates a computer system 1000 in accordance with an embodiment of the invention . the computer system 1000 includes a central processing unit (“ cpu ”) 1002 , such as , for example , a sun microsystems sparc , motorola powerpc , or intel pentium processor . cpu 1002 is coupled with a memory 1004 that includes any type of memory device used in a computer system , such as for example , random access memory (“ ram ”) and read - only memory (“ rom ”). cpu 1002 is also coupled with a bus 1006 , such as a pci bus , or an s bus . a variety of input devices 1008 and 1010 , and output devices 1012 are also coupled with bus 1006 . examples of such input and output devices include , but are not limited to , printers , monitors , modems , and / or network / telephone connections . typically each of these devices has an associated with it a device driver . a device driver is an object - oriented program written to support an associated device coupled with computer system 1000 . by way of example , the device driver 114 manages the input device 1008 . likewise , other device drivers can be utilized to support and manage any device , such as devices 1010 and 1012 , coupled to the computer system 1000 . although the methods of cooperative execution of native and non - native threads in a multi - threaded system in accordance with the present invention are particularly suitable for implementation with respect to a java based environment , the methods may generally be applied in any suitable object - based environment . in particular , the methods are suitable for use in platform - independent object - based environments . it should be appreciated that the methods may also be implemented in some distributed object - oriented systems . while the present invention has been described as being used with a computer system that has an associated virtual machine , it should be appreciated that the present invention may generally be implemented on any suitable object - oriented computer system . specifically , the methods of passing interrupt packets with the present invention may generally be implemented in any multi - threaded , object - oriented system without departing from the spirit or the scope of the present invention . therefore , the present examples are to be considered as illustrative and not restrictive , and the invention is not to be limited to the details given herein , but may be modified within the scope of the appended claims along with their full scope of equivalents .	6
the process of manufacturing of medium density fibreboards ( mdf ) or the like is shown in fig1 a and the potential application of high - intensity ultrasound to support or replace part processes are marked in the fig . ( 201 ). in traditional mdf manufacturing biomass chips , preferably on the basis of debarked solid wood , are used as raw material ( 1 a - 1 ); bark residuals and dirt are removed from the chips in a chip washer ( 1 a - 2 ). using this technique requires large amounts of clean water and produces large amounts of contaminated water , handling of which is a very costly process ; the wet chips are milled into fibres in a disc refiner ( 1 a - 3 ). milling the biomass chips into fibres in a disk refiner requires large amounts of electric energy and mechanical wear of machinery ; usually , a aqueous solution of binder is added to the wet fibre furnish in the so - called blow - line at the outlet of the refiner ( 1 a - 4 ). in the blowline , the fibre furnish tend to agglomerate to large lumps and the binder added at this stage of the process has very limited access to the single fibres ; the fibre - binder mixture is dried in an airborne drying process using hot air as a heating and transportation medium ( 1 a - 5 ). also during drying in an air - borne process the fibres tend to agglomerate and thus make drying inefficient . additionally , the transfer of heat energy into the fibres and of water vapour out of the fibres is limited by the laminar boundary layer on the surface of the fibres . alternatively , other techniques to add the binder to the fibre after drying ( see e . g . danish patent application pa 200401297 and patents quoted herein ) are used in mdf manufacturing . application of binder to the fibre furnish after drying is a more modern approach , the efficiency of which , however , in terms of binder distribution on the single fibres is limited by the tendency of the fibres to once again agglomerate into large lumps ; after drying of fibre and application of binder , the fibre furnish is screened , usually in an air - borne system , in order to remove larger fibre agglomerations , which may cause damage in the hot press ( 1 a - 6 ). screening of the fibre furnish to remove fibre lumps is a costly process in terms of equipment , energy and loss of material ; subsequently the fibre furnish is formed into a homogeneous mat ( 1 a - 7 ), either by an airborne or by a mechanical device . forming of the fibre mat in conventional formers establishes a 2 dimensional orientation of the fibres in the plane of the mat ; the fibre mat may be preheated by introducing steam or hot air or a mixture of steam and hot air into the surfaces of the mat ( 1 a - 8 ) may be made ( optimally ); finally , the mat is pressed and cured in a hot press ( 1 a - 9 ). the majority of the part processes of mdf manufacturing is strained by problems in relation to separating particles : to separate contamination from the biomass chips , to disintegrate the chips into fibres , and to keep the fibres separated throughout the process steps of drying of fibre , application of binder and forming of the fibre mat . further , the efficiency of the process of drying fibres in an air - borne process using hot air or superheated steam as a transportation and heating medium is limited by the presence of a laminar boundary layer of air at the surface of the fibres . the part processes in which the application of high - intensity ultrasound has the potential of improvement are marked in fig1 a ( 201 ). the process of manufacturing particleboards ( pb ) is schematically shown in fig1 b and the potential applications of high - intensity ultrasound to support or replace part processes are marked in the figure ( 201 ). in particleboard manufacturing , a wider variety of low quality raw material is used ( wood residuals , recycling wood , agricultural biomass etc . ( 1 b - 1 ); screening into coarse and fine particles ( 1 b - 2 ). the efficiency of screening biomass particles by means mechanical sifters or air - borne equipment is limited by the tendency of fine particles and dirt to stick to larger particles ; large particles are flaked into proper size ( 1 b - 3 ); the particle furnish is dried , usually in drum dryers using hot gas as a heating medium and mechanical devices as a transportation medium ( 1 b - 4 ). the efficiency of the process is limited by the laminar boundary layer at the surface of the particles ; the dry particle furnish is usually separated ( 1 b - 5 ) into a fine fraction to be used for the panel surface and a coarse fraction to be used for the panel core . the separation of coarse and fine particles by traditional mechanical or air - borne techniques is limited by the tendency of coarse and fine particles to stick together ; a binder is added to these fractions separately in mechanical blenders ( 1 b - 6 ); the fractions of particle furnish are formed into a 3 - layer mat ( 1 b - 7 ). the particle mat may be preheated by introducing steam or hot air or a mixture of steam and hot air into the surfaces of the mat ( 1 b - 8 ); the mat is pressed and cured in a hot press ( 1 b - 9 ). the process of manufacturing oriented strand boards ( osb ) is schematically shown in fig1 c and the potential application of high - intensity ultrasound to support or replace part processes are marked in the figure ( 201 ). oriented strand boards ( osb ) are made from regular , debarked round wood from the forest ( 1 c - 1 ); the logs are cut into thin ( 0 . 5 - 0 . 7 mm ), wide ( 20 - 25 mm ) and long ( 100 - 150 mm ) strands ( 1 c - 2 ); cleaning of the strands from dirt and bark contamination is made in a dry process in mechanical sifters ( 1 c - 3 ). the efficiency of traditional cleaning of strands from dirt and bark contaminations in mechanical sifters is limited by the adhesion of fine particles and dirt to the rough surface of the strands ; drying of strands is made in drum dryers using hot gas as a drying medium and mechanical devices for transportation of the strands ( 1 c - 4 ). the process is limited by the laminar boundary layer at the surface of the strands ; application of binder in the form of a powder or an aqueous solution of resin is made in rotating drums ( 1 c - 5 ); forming of strands into a mat is made in mechanical devices , orientating the strands into 3 layers parallel and perpendicular to the process direction , respectively ( 1c - 6 ); the strand mat may be preheated by introducing steam or hot air or a mixture of steam and hot air into the surfaces of the mat ( 1 c - 7 ); the mat is pressed and cured in a hot press ( 1 c - 8 ). common to all 3 manufacturing processes of biomass - based panel board products as illustrated in fig1 a - 1 c is a number of problems with relation to the boundary layer of air between the particles and the surrounding process atmosphere of air , steam or another gas , e . g . : biomass particles tend to stick together , biomass particles and contaminating particles tend to stick together , the exchange of heat energy and moisture at the surface of the particles is inefficient . traditionally , these problems are dealt with by applying shear forces to the flow of particles using a turbulent gas flow . alternatively , especially in cleaning and screening techniques , shear forces are applied to the particle flow by mechanical vibrations or washing water . it is the object of the present invention to provide a system and corresponding method to apply shear forces to the particle flow and the process atmosphere to overcome the above problems in a more efficient way than traditional techniques , using a novel kinetic technique . unlike the above mentioned traditional techniques , the invention is based on high - intensity sound or ultrasound waves created by means of a special device driven by pressurized gas such as atmospheric air , steam or other gases . high - intensity sound or ultrasound in gases leads to very high velocities and displacements of the gas molecules . i . e . a sound level of 160 db corresponds to a velocity of 4 . 5 m / sec and a displacement of 33 μm at a frequency of 22 . 000 hz . in other words , the kinetic energy of the gas molecules increases significantly . the distance between gas - molecules moving in one direction and having the maximal velocity and gas - molecules moving the opposite direction is given by half the wavelength of the ultrasound . the resulting effect is a very efficient separation of the fibre lumps into single fibres . applied to biomass particles , e . g . an air - borne flow of fibre lumps , the kinetic energy and the displacements create a field of shear forces in the fibres and thus tears the fibre lumps apart into single fibres . the same effect is obtained i . e . by applying high - intensity sound or ultrasound to biomass particles contaminated with adhering particles of bark and dirt or large particles with adhering smaller particles which are difficult to unstick by traditional means like mechanical vibration or washing water . in the following firstly , the application of the technique according to the present invention in a number of process steps within the manufacturing processes as illustrated in fig1 a - c is described . other applications within the area of manufacturing of biomass - based panel board products or within other product manufacturing processes characterized by the same problems and features as described above are included in the invention ; secondly , the effect of applying high - intensity sound or ultrasound to a flow of biomass - based particles will be described , using as an example the application of an aqueous solution of binder to an air - borne flow of dry fibres — or fibre lumps — in an mdf manufacturing process ; thirdly , a preferred embodiment of a device designed to create high - intensity ultrasound , driven by a pressurized gas , will be described . cleaning / screening from sand , dirt and other contaminants is usually made by means of water ( chip washing in the mdf process , 1 a - 2 ) or mechanical sifters / screeners ( chips , particles for particleboards or strands for osb , fig1 b - 2 , 1 c - 3 ). using the ultrasound device to replace or support the traditional cleaning techniques will improve the cleaning effect as the ultrasound efficiently unsticks / removes dirt particles from the biomass particle surface as described below . high intensive sound or ultrasound in gases leads to very high velocities and displacements of the gas molecules . for example , 160 db corresponds to a particle velocity of 4 . 5 m / s and a displacement of 33 μm at 22 . 000 hz . in other words , the kinetic energy of the molecules has been increased significantly . the distance between gas - molecules moving in one direction and having the maximal velocity and gas - molecules moving the opposite direction is given by half the wavelength of the ultrasound . the resulting effect is a very efficient separation of the fibre lumps into single fibres . also , for separation of particles of various size and shape as used in multilayer particleboards or oriented strand boards , the separating effect of the high intensity ultrasound can be utilised to support the effect of the mechanical sifters / screeners ( fig1 b - 2 , 1 b - 5 , 1 c - 3 ). in the process of refining biomass chips in a pressurised refiner , ( fig1 a - 3 ), saturated steam at high pressure is fed into the cavity between the refiner discs . feeding the steam into the refiner through one or more of the above mentioned ultrasound generators directed into the refiner cavity , a high - intensive ultrasound level is established which assists a fully or partly disintegration of the biomass chips . as a result , the mechanical energy used in the refiner can be reduced significantly . besides , the high - intensity ultrasound helps keep the refiner discs clean from resin and other contaminations and to prevent clogging up the grooves of the refiner disc . in the traditional mdf manufacturing process the wet fibre furnish from the refiner is fed into the so - called blowline and an aqueous solution of binder is added ( fig1 a - 4 ). as well known , the fibre furnish in this stage forms large lumps , and consequently the application of binder is very inhomogeneous . using one or more ultrasound devices at various positions along the blowline , preferably both before and after the application of binder , will produce a very homogeneous distribution of the binder onto the single fibres . traditional drying of biomass particles such as fibres ( fig1 a - 5 ), particles ( fig1 b - 4 ), strands ( fig1 c - 4 ) or the like by means of hot air or steam is hindered by the so - called laminar sub - layer at the surface of the drying particles . independently of the type of dryer and thermal conditions in relation hereto , a basic condition will always command and limit the efficiency of the drying process : namely the energy and mass ( moisture ) exchange at the surface of the biomass particles ( i . e . heat in , moisture out ). the energy and mass exchange at the surface of the biomass particles is largely determined by the character of the gas flow and more specifically by the character or presence of the so - called laminar sub - layer . heat transport across the laminar sub layer will be by conduction or radiation , due to the nature of laminar flow while mass transport across the laminar sub layer will be solely by diffusion . this will be explained in greater detail in a later part of this chapter . it is an object of the present invention to provide a system and a corresponding method for drying a flow of biomass particles that solves ( among other things ) the above - mentioned shortcomings of prior art . the ultrasound technique removes this sub layer very efficiently and thus facilitates the exchange of heat and water vapour ( heat in , water vapour out ) significantly . the technique can be applied in all kinds of dryers ( drum dryers for larger particles , tube dryers for fibres ) and drying medium ( hot air or steam ). it is a further object of the present invention to provide an efficient drying of biomass particles using less energy than required by traditional processes . yet another object is to provide methods and equipment for drying of biomass particles enabling acceleration of the drying process compared to traditional processes . these objects ( among others ) are solved by a system for drying a flow of biomass particles , the system comprising : a dryer adapted to receive a flow of wet biomass particles and to dry the flow of wet biomass particles using a gaseous drying medium , wherein the dryer comprises at least one ultrasound device ( 301 ) or is in connection with at least one ultrasound device ( 301 ), where said at least one ultrasound device is adapted , during use , to supply at least a part of said gaseous drying medium to said flow of biomass particles . high intensive sound or ultrasound in gases leads to very high velocities and displacements of the gas molecules . for example , 160 db corresponds to a particle velocity of 4 . 5 m / s and a displacement of 33 μm at 22 . 000 hz . in other words , the kinetic energy of the molecules has been increased significantly . the distance between gas - molecules moving in one direction and having the maximal velocity and gas - molecules moving the opposite direction is given by half the wavelength of the ultrasound . the resulting effect is a very efficient separation of the fibre lumps into single fibres . in this way , a more efficient drying of the biomass particles is obtained , which results in a significant reduction in drying time and power consumption of the dryer . the reason is that the ultrasound minimizes or eliminates the laminar sub - layer , as described elsewhere , where the absence of the sub - layer enables a much enhanced heat and moisture exchange . the application of ultrasound ( 201 ) intensifies very efficiently the energy and mass exchange at the surface of the biomass particles and thus helps to reduce the drying time of the biomass particles , to reduce the volume of the dryer vessel , to reduce the surplus volume of drying medium needed to establish heat and mass transfer at the surface of the biomass particles under non - optimal conditions , and to improve the thermal efficiency of the process significantly . in a preferred embodiment , at least one ultrasound device is activated by at least a part of the gaseous drying medium . in this way , the large amount of energy typically present in such systems is utilized in generating ultrasound with a high effect and efficiency . further , since the gaseous drying medium is present in traditional systems already less modifications are needed for modifying traditional system into applying the present invention . in one embodiment , the gaseous drying medium is hot air or superheated steam . the present invention also relates to a method of drying a flow of biomass particles , the method comprising the step of : drying a received flow of wet biomass particles using a gaseous drying medium , wherein the step of drying comprises supplying at least a part of said gaseous drying medium to said flow of biomass particles using at least one ultrasound device ( fig4 , 301 ). in one embodiment , the flow of biomass particles is an airborne flow of fibres ( fig1 a - 4 , fig4 ). in one embodiment , the system further comprises binder application means for applying a binder solution to said flow of biomass particles before they are received in said dryer ( fig1 a - 4 ). in one embodiment , the flow of biomass particles is a mechanically activated flow of larger biomass particles such as particles for traditional particleboards ( fig1 b - 6 ) or strands for oriented strand boards , ( fig1 c - 5 ) or similar biomass - based products . in one embodiment , the dryer comprises a plurality of ultrasonic devices for supplying at least a part of said gaseous medium ( fig4 , 301 ). in one embodiment , the gaseous drying medium is hot air or superheated steam . in one embodiment , the system further comprises binder application means for applying a binder solution comprising binder droplets to the flow of biomass particles wherein the binder application means comprises at least one ultrasound device adapted , during use , to apply ultrasound to the flow of biomass particles before the binder solution is applied , whereby particle lumps , if any , in the flow of biomass particles are separated , or substantially at the same time that the binder solution is applied whereby particle lumps , if any , in the flow of biomass particles are separated and binder droplets are reduced to a smaller size . application of binder to the biomass particles after drying is limited by the access of the binder droplets from the spraying device to the single particles . also in this stage of the process mdf fibres tend to agglomerate into large lumps and thus prevent contact with the binder droplets . to achieve a homogeneous distribution of the binder droplets in a device used in the process after the dryer , these fibre lumps are to be separated into single fibres . at the same time , the binder preferably has to be atomised into droplets of a proper size in relation to the size of the fibres and they have to be brought into contact with the fibres to ensure a homogeneous distribution on the fibre surfaces . besides , the binder droplets preferably have to have a specific viscosity to adhere sufficiently to the fibre surfaces without becoming fully absorbed , and they must be prevented from sticking to the walls of the device . unlike the blow - line application of binder ( fig1 a - 4 ), the dry application of binder after the dryer does not offer the opportunity of homogenizing the mixture during the long travel through the tube dryer . therefore all the above mentioned conditions in relation to traditional application of binder to dry fibres are to be satisfied within little time and space . in the following , a novel method based on a different kinetic technique and an equipment to handle the fibres and binder droplets will be disclosed . it is an object of the present invention to provide a system ( and corresponding method ) for applying a binder to an airborne flow of fibres , that solves ( among other things ) the above - mentioned shortcomings of prior art . it is a further object to provide a method and system enabling efficient separation of fibres in an airflow while applying binder to the fibres . another object is to enable a more uniform and effective distribution of binder to fibres in an airflow . an additional object of the present invention is to improve the probability of collision between fibres and binder droplets in an air stream in order to further homogenize the binder distribution . these objects ( among others ) are solved by a system ( fig4 ) for applying a binder to an airborne flow of fibres ( 105 ), the system comprising : means for applying a binder solution comprising binder droplets to an airborne flow of fibres , wherein said system further comprises at least one ultrasound device adapted ( 301 ), during use , to apply ultrasound to the airborne flow of fibres ( 105 ) before the binder solution is applied ( 401 ) whereby fibre lumps ( fig2 a - d , 201 , 202 , 204 ), if any , in the airborne flow of fibres are separated , or substantially at the same time that the binder solution is applied whereby fibre lumps , if any , in the airborne flow of fibres are separated and binder droplets are reduced to a smaller size ( fig2 b - d , 201 , 203 ). like the known methods , the invention is based on the application of shear forces to split the fibre lumps and binder droplets . however , according to the present invention , the shear forces are not produced by means of turbulent air flow , but by means of ultrasonic waves created by means of a special device driven by a pressurized gas such as atmospheric air , steam or other gases . high intensive sound or ultrasound in gases leads to very high velocities and displacements of the gas molecules . for example , 160 db corresponds to a particle velocity of 4 . 5 m / s and a displacement of 33 μm at 22 . 000 hz . in other words , the kinetic energy of the molecules has been increased significantly . the distance between gas - molecules moving in one direction and having the maximal velocity and gas - molecules moving the opposite direction is given by half the wavelength of the ultrasound . the resulting effect is a very efficient separation of the fibre lumps into single fibres . in fig2 b ultrasound ( 201 ) is applied to the large / normal sized binder droplets ( 203 ) e . g . from a spraying nozzle ( not shown ; see e . g . fig4 ) where the movement of the gas - molecules tears the droplets into smaller and finely distributed droplets ( 203 ). at 22 khz , 160 db the maximum displacement of the gas - molecules will be 33 μm , see 204 in fig2 d . in fig2 c and 2 d the single fibres ( 202 ), typically having a diameter in the range of 20 - 50 μm , and the finely distributed binder droplets ( 203 ), both oscillating with a frequency of 22 khz due to the application of ultrasound , are brought into close contact at high velocity to facilitate the contact . establishing the contact between fibres ( 202 ) and binder droplets ( 203 ) as well as the exchange of energy and moisture between the particles and the atmosphere is governed by the conditions as summarized below . in one embodiment , the pressurized gas is in a first step cooled to a low temperature , preferably below 3 ° c ., and dried , and in a second step heated up to a temperature below 100 ° c ., preferably 50 - 70 ° c . thereby drying the surface of the fibres and the binder droplets on the fibre surface . in one embodiment , steam is used as a part of the pressurized gas to drive the ultrasonic device and to add moisture and heat to the fibres as further a means to control the total moisture content and temperature of the fibre furnish . in one embodiment , an equal electrostatic potential (++ or ÷÷) is applied to both the means for applying a binder solution and to walls of said system , in which the binder is applied to the fibres . in one embodiment , a plurality of ultrasonic devices ( 301 ) are installed as one or several rings along walls of a duct , where the binder solution is applied to the airborne flow of fibres . in one embodiment , the ultrasonic device ( s ) ( 301 ) and the means for applying a binder solution ( 401 ) are used in combination with a section of a duct shaped as a venturi nozzle , where the duct is positioned where the binder solution is applied to the airborne flow of fibres . in one embodiment , the means for applying a binder solution comprises at least one spray nozzle ( 401 ) and in that the at least one ultrasonic device ( 301 ) are integrated with the at least one spray nozzle ( 401 ). in one embodiment , the at least one ultrasound device ( 301 ) and the means for applying a binder ( 401 ) solution are directed in the same direction as the transport air flow . in one embodiment , the binder is applied in a place in a vertically or approximately vertically oriented body of angular or tubular or conical shape , where the transport of the fibres take place mainly by gravity , and where the at least one ultrasound device ( 301 ) or at least a part of the at least one ultrasound device are oriented in an upward angle to meet the fibres falling from a top inlet of fibres to a fibre outlet at the bottom of the device . in one embodiment , a number of the ultrasound devices ( 301 ) are oriented in an angle to the length axis of the system ( i . e . the ultrasound devices are ‘ tilted ’) and the main transport direction as to create a spiral - shaped flow of the fibres . according to another aspect , the dryer comprises one or more ultrasound generators ( 301 ). in this way , a more efficient drying of the fibres is obtained , which result in a significant reduction in power consumption of the dryer . the reason is that the ultrasound minimizes or eliminates the laminar sub - layer , as described elsewhere , where the absence of the sub - layer enables a much enhanced heat and moisture exchange . this aspect may be utilized in connection with the use of ultrasound to separate fibres and / or reduce the size of the binder droplets or alone . the method and embodiments thereof correspond to the device and embodiments thereof and have the same advantages for the same reasons . sorting out of large and heavy lumps of fibres fig1 a - 6 , which frequently cause damage of the steel belts in the continuous hot press is usually made in an airborne sifter , the so - called z - sifter , a vertical , zig - zag - shaped duct with an upstream flow of air . experiments have demonstrated the ability of the ultrasound technique to more efficiently separate these fibre lumps into single fibres . thus , the technique is considered a powerful tool to improve or to replace the z - sifter . the use of the ultrasound technique in the process of mat or sheet forming ( fig1 a - 7 ) profits from the ability to establish a homogeneous airborne suspension of single fibres and , as the fibres are statically loaded by oscillation , a three - dimensional orientation of the single fibres and as a result a mat or a felt with improved properties is achieved . for nearly all practically occurring gas flows , the flow regime will be turbulent in the entirety of the flow volume , except for a layer covering all surfaces wherein the flow regime is laminar ( see e . g . 313 in fig3 a ). this layer is often called the laminar sub layer . the thickness of this layer is a decreasing function of the reynolds number of the flow , i . e . at high flow velocities , the thickness of the laminar sub layer will decrease . fig3 a schematically illustrates a ( turbulent ) flow over a surface of an object according to prior art , i . e . when no ultrasound is applied . shown is a surface ( 314 ) of an object with a gas ( 500 ) surrounding or contacting the surface ( 314 ). as mentioned , thermal energy can be transported through gas by conduction and also by the movement of the gas from one region to another . this process of heat transfer associated with gas movement is called convection . when the gas motion is caused only by buoyancy forces set up by temperature differences , the process is normally referred to as natural or free convection ; but if the gas motion is caused by some other mechanism , such as a fan or the like , it is called forced convection . with a condition of forced convection there will be a laminar boundary layer ( 311 ) near to the surface ( 314 ). the thickness of this layer is a decreasing function of the reynolds number of the flow , so that at high flow velocities , the thickness of the laminar boundary layer ( 311 ) will decrease . when the flow becomes turbulent the layer are divided into a turbulent boundary layer ( 312 ) and a laminar sublayer ( 313 ). for nearly all practically occurring gas flows , the flow regime will be turbulent in the entirety of the streaming volume , except for the laminar sub - layer ( 313 ) covering the surface ( 314 ) wherein the flow regime is laminar . considering a gas molecule or a particle ( 315 ) in the laminar sub - layer ( 313 ), the velocity ( 316 ) will be substantially parallel to the surface ( 314 ) and equal to the velocity of the laminar sub - layer ( 313 ). heat transport across the laminar sub - layer will be by conduction or radiation , due to the nature of laminar flow . mass transport across the laminar sub - layer will be solely by diffusion . the presence of the laminar sub - layer ( 313 ) does not provide optimal or efficient heat transfer or increased mass transport . any mass transport across the sub - layer has to be by diffusion , and therefore often be the final limiting factor in an overall mass transport . this limits the interaction between binder droplets and fibres when binder droplets are dispersed in the gas and the object is a fibre . further , the droplets are generally of a greater size and not as finely distributed . fig3 b schematically shows a flow over a surface of an object according to the present invention , where the effect of applying high intensity sound or ultrasound to / in air / gas ( 500 ) surrounding or contacting a surface of an object is illustrated . more specifically , fig3 b illustrates the conditions when a surface ( 314 ) of a fibre is applied with high intensity sound or ultrasound . again consider a gas molecule / particle ( 315 ) in the same spatial position in the laminar layer as shown in fig2 a ; the velocity ( 316 ) will be substantially parallel to the surface ( 314 ) and equal to the velocity of the laminar layer prior applying ultrasound . in the direction of the emitted sound field to the surface ( 314 ) in fig3 b , the oscillating velocity of the molecule ( 315 ) has been increased significantly as indicated by arrows ( 317 ). as an example , a maximum velocity of v = 4 . 5 m / sec and a displacement of +/− 32 μm will be achieved where the ultrasound frequency f = 22 khz and the sound intensity = 160 db . the corresponding ( vertical ) displacement in fig3 b is substantially since the molecule follows the horizontal air stream along the surface . in result , the ultrasound will establish a forced heat flow from the surface to surrounding gas / air ( 500 ) by increasing the conduction by minimizing the laminar sub - layer . the sound intensity is in one embodiment 100 db or larger . in another embodiment , the sound intensity is 140 db or larger . preferably , the sound intensity is selected from the range of approximately 140 - 160 db . the sound intensity may be above 160 db . the minimization of the sub - laminar layer has the effect that the mass trans - port between the surface of the fibre and the gas containing binder droplets is enhanced whereby a greater interaction between binder droplets and fibres is obtained . the key method and device to be used in the invention shall be briefly described below . according to the present invention , ultrasound is applied to the fibres by a suitable ultrasound generator ( 301 ) at various stages of the process of manufacturing biomass - based panel board products . in this way , the agglomerated particle lumps are transformed into a homogeneous flow of single particles using ultrasound from one or more ultrasound devices driven by pressurized air , steam or another pressurized gas . many types of ultrasound generators ( 301 ) are suitable for this and one preferred well known ultrasound generator is explained in connection with fig5 a - 5 f . fig5 a schematically illustrates a preferred embodiment of a device ( 301 ) for generating high intensity sound or ultrasound . pressurized gas is passed from a tube or chamber ( 309 ) through a passage ( 303 ) defined by the outer part ( 305 ) and the inner part ( 306 ) to an opening ( 302 ), from which the gas is discharged in a jet towards a cavity ( 304 ) provided in the inner part ( 306 ). if the gas pressure is sufficiently high then oscillations are generated in the gas fed to the cavity ( 304 ) at a frequency defined by the dimensions of the cavity ( 304 ) and the opening ( 302 ). an ultrasound device of the type shown in fig5 a is able to generate ultrasonic acoustic pressure of up to 160 db spl at a gas pressure of about 4 atmospheres . the ultrasound device may e . g . be made from brass , aluminium or stainless steel or in any other sufficiently hard material to withstand the acoustic pressure and temperature to which the device is subjected during use . the method of operation is also shown in fig3 a , in which the generated ultrasound 307 is directed towards the surface 308 of the fibres and binder droplets . please note , that the pressurized gas can be different than the gas that contacts or surrounds the object . fig5 b shows an embodiment of an ultrasound device in form of a disc - shaped jet . shown is a preferred embodiment of an ultrasound device ( 301 ), i . e . a so - called disc jet . the device ( 301 ) comprises an annular outer part ( 305 ) and a cylindrical inner part ( 306 ), in which an annular cavity ( 304 ) is recessed . through an annular gas passage ( 303 ) gases may be diffused to the annular opening ( 302 ) from which it may be conveyed to the cavity ( 304 ). the outer part ( 305 ) may be adjustable in relation to the inner part ( 306 ), e . g . by providing a thread or another adjusting device ( not shown ) in the bottom of the outer part ( 305 ), which further may comprise fastening means ( not shown ) for locking the outer part ( 305 ) in relation to the inner part ( 306 ), when the desired interval there between has been obtained . such an ultrasound device may generate a frequency of about 22 khz at a gas pressure of 4 atmospheres . the molecules of the gas are thus able to migrate up to 36 μm about 22 , 000 times per second at a maximum velocity of 4 . 5 m / s . these values are merely included to give an idea of the size and proportions of the ultrasound device and by no means limit of the shown embodiment . fig5 c is a sectional view along the diameter of the ultrasound device ( 301 ) in fig5 b illustrating the shape of the opening ( 302 ), the gas passage ( 303 ) and the cavity ( 304 ) more clearly . it is further apparent that the opening ( 302 ) is annular . the gas passage ( 303 ) and the opening ( 302 ) are defined by the substantially annular outer part ( 305 ) and the cylindrical inner part ( 306 ) arranged therein . the gas jet discharged from the opening ( 302 ) hits the substantially circumferential cavity ( 304 ) formed in the inner part ( 306 ), and then exits the ultrasound device ( 301 ). as previously mentioned the outer part ( 305 ) defines the exterior of the gas passage ( 303 ) and is further bevelled at an angle of about 30 ° along the outer surface of its inner circumference forming the opening of the ultrasound device , wherefrom the gas jet may expand when diffused . jointly with a corresponding bevelling of about 60 ° on the inner surface of the inner circumference , the above bevelling forms an acute - angled circumferential edge defining the opening ( 302 ) externally . the inner part ( 306 ) has a bevelling of about 45 ° in its outer circumference facing the opening and internally defining the opening ( 302 ). the outer part ( 305 ) may be adjusted in relation to the inner part ( 306 ), whereby the pressure of the gas jet hitting the cavity ( 304 ) may be adjusted . the top of the inner part ( 306 ), in which the cavity ( 304 ) is recessed , is also bevelled at an angle of about 45 ° to allow the oscillating gas jet to expand at the opening of the ultrasound device . fig5 d illustrates an alternative embodiment of a ultrasound device , which is shaped as an elongated body . shown is an ultrasound device comprising an elongated substantially rail - shaped body ( 301 ), where the body is functionally equivalent with the embodiments shown in fig5 a and 5 b , respectively . in this embodiment the outer part comprises two separate rail - shaped portions ( 305 a ) and ( 305 b ), which jointly with the rail - shaped inner part ( 306 ) form a ultrasound device ( 301 ). two gas passages ( 303 a ) and ( 303 b ) are provided between the two portions ( 305 a ) and ( 305 b ) of the outer part ( 305 ) and the inner part ( 306 ). each of said gas passages has an opening ( 302 a ), ( 302 b ), respectively , conveying emitted gas from the gas passages ( 303 a ) and ( 303 b ) to two cavities ( 304 a ), ( 304 b ) provided in the inner part ( 306 ). one advantage of this embodiment is that a rail - shaped body is able to coat a far larger surface area than a circular body . another advantage of this embodiment is that the ultrasound device may be made in an extruding process , whereby the cost of materials is reduced . fig5 e shows an ultrasound device of the same type as in fig5 d but shaped as a closed curve . the embodiment of the gas device shown in fig5 d does not have to be rectilinear . fig5 e shows a rail - shaped body ( 301 ) shaped as three circular , separate rings . the outer ring defines an outermost part ( 305 a ), the middle ring defines the inner part ( 306 ) and the inner ring defines an innermost outer part ( 305 b ). the three parts of the ultrasound device jointly form a cross section as shown in the embodiment in fig5 d , wherein two cavities ( 304 a ) and ( 304 b ) are provided in the inner part , an wherein the space between the outermost outer part ( 305 a ) and the inner part ( 306 ) defines an outer gas passage ( 303 a ) and an outer opening ( 302 a ), respectively , and the space between the inner part ( 306 ) and the innermost outer part ( 305 b ) defines an inner gas passage ( 304 b ) and an inner opening ( 302 b ), respectively . this embodiment of an ultrasound device is able to coat a very large area at a time and thus treat the surface of large objects . fig5 f shows an ultrasound device of the same type as in fig5 d but shaped as an open curve . as shown it is also possible to form an ultrasound device of this type as an open curve . in this embodiment the functional parts correspond to those shown in fig5 d and other details appear from this portion of the description for which reason reference is made thereto . likewise it is also possible to form an ultrasound device with only one opening as described in fig5 b . an ultrasound device shaped as an open curve is applicable where the surfaces of the treated object have unusually shapes . a system is envisaged in which a plurality of ultrasound devices shaped as different open curves are arranged in an apparatus according to the invention . although the invention has been described in the above mainly in relation to processes of manufacturing various kinds of board products from biomass raw material such as solid wood , chips from solid wood , wood residuals , recycling wood or agricultural crop residuals , it shall be noted that the invention can also be applied to other biomass product manufacturing processes or manufacturing processes on the basis of other raw materials , as far as these processes are characterized by the same problems and features as described in the summary and scope of the invention . more specifically , the following examples can be mentioned : drying of bulk material , as e . g . grain , feedstock , cereal products etc ; sifting , cleaning and grading of granular material , as e . g . inorganic materials like stone , gravel , sand , cement or organic material like chips , particles , fibres or dust to be utilized for other processes than panel board and related products ; forming of mats , sheets or other shapes of products which require a specific structure and orientation of particles , like dry forming of paper , cardboard or non - woven organic sheets as e . g . tissues , napkins , nappies etc , or inorganic mats or sheets , e . g . insulating products like glass wool and similar products . thus the invention is not restricted to the described and shown embodiment , but may also be embodied in other ways within the scope of the subject - matter defined in the following claims . in the claims , any reference signs placed between parentheses shall not be constructed as limiting the claim . the word “ comprising ” does not exclude the presence of elements or steps other than those listed in a claim . the word “ a ” or “ an ” preceding an element does not exclude the presence of a plurality of such elements .	1
fig1 shows the physical training device 200 in use . attachment hooks 202 and 203 are attached to attachment rings 304 and 305 of ankle fasteners 300 . the attachment hooks 204 and 205 are attached to the curved attachment loops 404 and 405 of the toe fasteners 400 . a shoulder harness 234 is properly positioned to protect the user &# 39 ; s shoulders from being impacted by the elastic , such as rubber cords 206 and 207 . the user athlete is shown properly grasping the handles 250 , 251 in an exercise position . all forward thrusts by the arms will keep the shoulder harness in place . the training device 200 is designed for an athlete , such as a boxer . as shown in fig2 , a series of elastic cords , such as surgical rubber tubes form the main structure of training device 200 . as shown in fig2 , attachment hook 202 attaches to one end of a rubber cord 206 . attachment hook 204 attaches to one end of a rubber cord 208 . attachment hook 203 attaches to one end of a rubber cord 207 . attachment hook 205 attaches to one end of a rubber cord 209 . a rectangular web piece 210 has sleeves 212 and 214 at both ends . rubber cords 206 and 208 are contained by sleeves 212 and 214 , respectively . a rectangular web piece 211 has sleeves 213 and 215 at both ends . rubber cords 207 and 209 are contained by sleeves 213 and 215 , respectively . a web piece 216 , with sleeves 218 and 220 , contains rubber cords 206 and 207 . web piece 222 , with sleeves 224 and 226 , contains rubber cords 206 and 208 . web piece 223 , with sleeves 225 and 227 , contains rubber cords 207 and 209 . web piece 228 , with sleeves 230 and 232 , contains rubber cords 206 and 207 . a shoulder harness 234 made of a soft material to protect the shoulders from being impacted by the rubber cords , has sleeves 236 and 238 . rubber cords 206 and 207 are fed through and contained by sleeves 236 and 238 , respectively . a web piece 240 , with sleeves 242 and 244 , contains rubber cords 206 and 208 . a web piece 241 , with sleeves 243 and 245 , contains rubber cords 207 and 209 . attachment hook 246 attaches to the other end of rubber cord 206 . attachment hook 248 attaches to the other end of rubber cord 208 . attachment hook 247 attaches to the other end of rubber cord 207 . attachment hook 249 attaches to the other end of rubber cord 209 . a pair of plastic handles 250 , 251 have u - shaped portions 252 and 253 and straight portions 254 and 255 . attachment hooks 246 and 248 attach rubber cords 206 and 208 to u - shaped portion 252 of handle 251 . attachment hooks 247 and 249 attach rubber cords 207 and 209 to u - shaped portion 253 of handle 250 . the straight portions 254 and 255 may be fitted with a soft grip . foot attachments and fasteners are shown in fig3 - 5 . the foot attachments are left and right ankle fastener 300 and 301 and toe fasteners 400 , 401 , interlaced with the user &# 39 ; s shoelaces . as shown in fig3 , the ankle fastener 300 has an upper section 302 , which is a mock up of a ring of expandable material or a velcro ™ fastening strip or equivalent structure , that slips over a user &# 39 ; s ankle . the interior surface 308 of the ring is thickly padded . attached to the exterior surface 310 of the ring is an attachment loop 304 . attachment hook 202 of rubber cord 206 attaches to attachment loop 304 . a heel strap 306 is an integral part of the upper section 302 by being attached to the interior surface 308 of the upper section 302 . as can be seen in fig4 , a toe fastener 400 is preferably made of a single piece of plastic , which has of a flat portion 402 and a curved attachment loop 404 . the flat portion 402 contains shoelace holes 406 , 408 , and 410 , which allow the toe fastener 400 to be interlaced with the user &# 39 ; s shoelaces at the toe 401 of the shoe 403 . attachment hook 204 of end 208 attaches to curved attachment loop 404 , for example . fig5 shows the toe fastener 400 attached to the toe section 401 of a shoe 403 by the shoelaces 405 . this invention provides a physical training device 200 that facilitates a workout where the aerobic efforts of the user &# 39 ; s legs and feet simultaneously impacts the effort required by the arms . fig1 shows the physical training device 200 in operation . the physical training device 200 is particularly applicable to , but not limited to , training for boxing , tennis , baseball , basketball , football , and aerobic conditioning . cords 206 , 207 , 208 , and 209 which may be surgical rubber tubing may be made in small , medium , and large lengths . the thickness of the rubber for rubber cords 206 , 207 , 208 , and 209 can also be made in light , medium , and heavy thicknesses for different workout levels . the thickness of the rubber for rubber cords 206 , 207 , 208 , and 209 does not need to be the same for each . for example , a right handed person may want rubber cords 206 and 208 to be thicker than rubber cords 207 and 209 . a person may also want different thicknesses for rubber cords 206 and 208 . for example , a person may want 206 to be of medium thickness and 208 to be of heavy thickness for a workout level between medium and heavy . webbing pieces 210 , 211 , 216 , 222 , 223 , 228 , 240 , and 241 can either be fixed in place or adjustable . to use the physical training device , a user will first put on ankle fasteners 300 and 301 by placing the feet through the upper sections 302 and 303 and resting the heels against heel straps such as 306 . the user will then put on his shoes and interlace the toe fasteners 400 and 401 into the shoelaces of their shoes 403 at the toe 401 . the user then connects attachment hooks 202 and 203 to attachment rings 304 and 305 , and attachment hooks 204 and 205 to curved attachment loops 404 and 405 . the user will then grasp plastic handles 250 and 251 and manipulate the arms to position shoulder harness 234 in a comfortable location . this physical training device 200 exercises several muscle groups at the same time . when the user makes a forward or lateral step with the right foot , web pieces 216 and 218 hold rubber cords 206 and 207 together , forcing them to expand , increasing the amount of resistance , and thus increasing the force required to make a step . this step will also force rubber cord 208 to expand and additionally increase the amount of resistance . in turn , the expansion of rubber cords 206 and 208 will increase the resistance to the user &# 39 ; s attempts to fully extend the arm in a punching motion . when a user extends the right arm forward in a punching motion , for example , rubber cords 206 and 208 will expand and increase the amount of resistance felt . this increased resistance will require the user to apply additional downward force in order to keep their foot planted . when the user throws a punch , they will likely be simultaneously extending their arm and leg , which will simultaneously increase the amount of force required to fully extend the arm and leg , due to the increased resistance provided by the expansion of rubber cords 206 and 208 . there are a great number of exercises that can be done with physical training device 200 , beyond the motions described above . a user can perform any numbers of combination of arm and leg motions in conjunction with one another . the training device 200 is uniquely adaptable to the great variety of arm and leg movements possible in a number of sports . various modifications of the invention are contemplated by the inventor , and they obviously will be resorted to by those skilled in the art without departing from the spirit and scope of the invention as hereinafter defined by the appended claims .	0
it is customary in the fertilizer industry to refer to nitrogen , phosphorus and potassium by their chemical symbols n , p and k , and to collectively refer to combinations containing them as npk fertilizers . the percentage of each are reported in terms of percent n , percent p 2 o 5 ( phosphorus pentoxide ) and percent k 2 o ( potassium oxide ) even though these elements are not present specifically in that form . polyphosphoric acid may be commercially obtained as may polyphosphate salts . potassium polyphoshpates may be prepared by reacting superphosphoric acid with a basic potassium compound such as potassium hydroxide , carbonate or bicarbonate . the distinction between meta -, pyro - and other polyphosphates from orthophosphates is well known and documented such as by u . s . pat . no . 3 , 856 , 500 and standard chemical texts . therefore , it would serve no useful purpose to attempt to discuss the chemical and physical properties of polyphosphoric acid , potassium or ammonium polyphosphates . however , because polyphosphates are relatively unstable and tend to convert back to orthophosphates in the presence of water , they should be used as soon as possible after being diluted for use as a foliar spray . the use of activated carbon as a promoter for increasing polyphosphate uptake is believed to be unique . activated carbon , because of its inertness and extremely high surface area , has been primarily utilized to absorb gases or to filter out impurities from solutions . activated carbon is inert and insoluble in aqueous solutions . it is therefore highly unexpected that this ingredient would , in some way , enable foliar plant tissues to absorb increased amounts of phosphorus from polyphosphates . also , there is evidence to show increased amounts of carbon in these plant tissues . whether it is the activated carbon that is absorbed is not known . it may be that the activated carbon combined with the polyphosphates serves in some way to enable a plant to absorb greater quantities of carbon dioxide from the atmosphere or , in the alternative , to better and more efficiently utilize the carbon dioxide when it is absorbed . the use of activated carbon alone does not show the same results regarding carbon uptake as does carbon combined with polyphosphates . the formulations are preferably prepared as a field solution concentrate which may subsequently be diluted with water just prior to using to provide the proper dosage . polyphosphoric acids may contain about 80 to 85 % by weight p 2 o 5 . on the other hand fertilizer grade potassium and ammonium polyphosphate blends may be prepared containing about 2 to 5 % nitrogen , 15 to 19 % phosphorus ( as p 2 o 5 ) and 15 to 19 % potassium ( as k 2 o ). depending upon the form of polyphosphate used , field solution concentrates may be prepared containing about 0 . 2 to 20 % by weight polyphosphate and a similar range , i . e . 0 . 2 to 20 % by weight , of activated carbon . however , the ratio of polyphosphate to carbon may vary anywhere from about 0 . 1 : 1 to 1 : 0 . 1 . preferably the polyphosphate will be either polyphosphoric acid or a blend of potassium and ammonium polyphosphates . the field solution concentrate is prepared by admixing the various components with sufficient water to form the desired concentration of ingredients . surfactants , wetting agents or other additives conventionally used in foliar sprays may also be added to the concentrate if desired . the field solution concentrate is adapted for use as a foliar spray by being diluted with the desired amount of water in a mixing tank or sprayer and thoroughly mixed just prior to application . dilution ratios may vary from as low as 5 volumes of water per volume of concentrate to as high as 200 volumes of water per volume of concentrate , i . e ., ratios of from 5 : 1 to 200 : 1 . generally speaking , dilution ratios from about 10 : 1 to 150 : 1 are preferable . since activated carbon is insoluble in aqueous solutions the spray solution should be agitated to keep the carbon particles in suspension . the spray equipment should be clean and appropriately sized to prevent plugging of the nozzles by carbon particles . since the npk dosage requirements may vary according to plant species , geographical location , climate , season of year , etc ., it is not possible to specify exact dosages . however , the amount to be applied to any given crop will be referred to herein as an &# 34 ; effective amount &# 34 ;. effective amounts may be determined by calculation or empirically by those having ordinary skill in the art . for this reason , the invention does not lie as much in specific concentrations as in the discovery that a combination of polyphosphates and activated carbon serves to increase phosphorus contents in plant tissues when the combination is applied to plants as a foliar spray . preferably , the composition of the invention is applied to immature crops as a foliar spray one or more times at intervals between germination of the plant and maturity of the fruit or crop to be obtained from the plant . the invention can best be illustrated by the following example which shows the unexpected increase in phosphorus into plant tissues . the example is for purposes of illustration and is not to be interpreted as defining the scope of the invention . sweet corn ( hybrid golden beauty ) was used to illustrate the invention due to the fact that corn plants grow rapidly in green house experiments and corn is not a nitrogen fixing plant and is therefore completely dependent on fertilizers and water applications . all plantings were treated in the same manner with the only variants being in the ingredients contained in the foliar sprays . the corn was planted , fed and watered as according to the following procedure . planting pots ( gallon plastic buckets ) were filled with 10 lbs . of silica sand . each bucket was wetted with 750 mls . of distilled water . the wetted sand in each pot was then planted with eight corn seeds at a depth of between about 3 / 4 &# 34 ; and 1 &# 34 ; with the sand covering the seeds being compressed slightly . the pots were watered weekly with hoagland &# 39 ; s # 2 nutrient solution and with distilled water as needed . hoagland &# 39 ; s # 2 nutrient solution is a combination of calcium nitrate tetrahydrate , potassium nitrate , magnesium sulfate heptahydrate , ammonium dihydrogen phosphate , boric acid , manganese sulfate monohydrate , zinc sulfate , cupric sulfate pentahydrate , sodium molybdate dihydrate and ferrous tartrate containing 196 ppm nitrogen as nitrate , 14 ppm nitrogen as ammonia , 160 ppm calcium , 234 ppm potassium , 48 ppm magnesium , 31 ppm phosphorus , 0 . 1 ppm manganese , 0 . 02 ppm zinc , 0 . 01 ppm copper , 0 . 01 ppm molybdenum , 1 . 0 ppm ironand 62 ppm sulfur . three weeks after germination replicates of four containers each were separated and the plants in each replicate were sprayed with a foliar spray until runoff . a different solution was used for each replicate as follows : replicate a was sprayed with a solution consisting of distilled water ( control ), replicate b was sprayed with a solution containing only activated carbon ( 0 . 2 gms carbon per 100 mls solution ), replicate c was sprayed with a solution containing only polyphosphates ( 0 . 06 ml polyphosphoric acid per 100 mls solution ) and replicate d was sprayed with a solution containing both polyphosphates and activated carbon ( 0 . 2 gms carbon and 0 . 06 ml polyphosphoric acid per 100 mls solution ). eight weeks after germination the plants were harvested and the roots were cut from the foliage . the harvested foliage and roots were washed in distilled water to remove all foreign matter and were then dried in an oven maintained at 75 degrees c . until completely dry . the foliage was weighed and then analyzed for phosphorus and carbon content . the roots were also analyzed for phosphorus content . although four containers were used for each replicate , the results listed in the following table are an average of the four containers which are not reported individually . table i______________________________________ % change in plant phosphorusreplicate foliage roots______________________________________a ( control ) 0 0b ( carbon ) + 0 . 009 - 0 . 13c ( polyphosphate ) + 0 . 009 + 0 . 12d ( carbon + polyphosphate ) + 0 . 026 + 0 . 22______________________________________ the increase in phosphorus content in both foliage and roots is clearly evident from replicate d results . the above description sets forth the invention in the best mode presently available .	2
fig1 is a block diagram of the invention system 100 for improving media data transmission from a mobile device 101 to a recipient device 107 . it is intended that two or more communications networks in wireless communications interface 102 will establish communications sessions with mobile device 101 for the purpose of forming , at least initially , parallel , continuous and simultaneous data packet streams that are transmitted to recipient device 107 . mobile device 101 is a wireless communication device capable of establishing and maintaining the parallel transmission paths just described and is also capable of establishing wireless telephone communications with recipient device 107 . communication network 103 comprises a cellular communication system including its antenna communications devices and its extensive system of communication connection assurance . communication network 105 comprises a wi - fi network comprising a base station and wireless access points establishing a local broadcasting range . communication network 104 comprises a dect radio system equipped with means for establishing data communications with recipient device 107 . peer to peer network 106 ( shown in broken lines ) comprises a direct wireless data packet communication session between mobile device 101 and recipient device 107 . networks 103 , 104 and 105 are adapted to connect to a packet computer network 109 ( such as an internet protocol network ) whereby the packetized media data stream formed at mobile device 101 is transmitted to a recipient interface 108 , which may or may not include intervening communications networks such as those found in interface 102 . wi - fi network 105 may bypass network 109 by using a local protocol for transmitting packetized data between local users of a wi - fi network similar to such transmissions in peer to peer network 106 . fig2 is a high level flow diagram of the invention system . step 120 causes a mobile device as described above to establish parallel and simultaneous communications sessions with one or more of the wireless communications networks described above and to transmit a packetized media data stream to a recipient device , duplicating the transmitted packets along parallel communication paths . step 122 causes a recipient device , comprising a microprocessor and control program , to execute a coordination function to evaluate arrived packets . the coordination function in one form compares timestamps of duplicate packets to assure that such packets are in fact duplicates . the coordination function further compares transmission times from sampled sets of duplicate arrived packets and determines by averaging which of the communications networks has transmitted the media data stream at the fastest overall rate and which of the communications networks has transmitted data at the slowest overall rate . the recipient device in step 124 transmits to the mobile device either or both of said transmission times and the determination of the fastest and / or slowest communications network . in step 126 , the mobile device acts to terminate communication sessions with a slowest rate communication network and determines if sessions with all but one of the communications networks have been terminated . if all but one have not been terminated , step 126 returns the system to step 122 . if all but one communications sessions have been terminated , the mobile device completes transmission of the media data stream to the recipient device in step 128 . in a preferred embodiment of the invention , a determination is made by the invention system that transmission of data packets in a first communications network are more reliable than transmission of data packets by way of other communications networks , all of which a plurality of communications networks current maintain communications sessions with the mobile device described above . in making that determination , the mobile device stores reliability information received from the recipient device concerning previously transmitted data packets . in a first specific example , the recipient device determines packet loss for a predetermined number of packets as indicated by expected packet sequence numbers for each data packet stream received from each communications networks from and with which the mobile device has established communications and which communication networks the recipient device has also established communications . the recipient device operates to determine which communications network &# 39 ; s transmission of data packets has resulted in the lowest number of lost data packets and this result is transmitted to the mobile device , whereupon the mobile device identifies said lowest loss communication network as the most reliable media data stream and acts to terminate communications with other communications networks . in a second specific example , the recipient device determines the strongest signal strength of wireless communications links between the recipient device and each of said communications networks for a predetermined time or over the course of receiving a predetermined number of data packets from the mobile device in parallel over multiple communications networks . said determination of a strongest signal for a communication network is transmitted to the mobile device , whereupon the mobile device identifies said strongest signal strength for a communication network connected with the recipient device as the most reliable media data stream and acts to terminate communications with other communications networks . in a third specific example , the mobile device determines the strongest signal strength of wireless communications links between the mobile device and each of said communications networks for a predetermined time or over the course of transmitting a predetermined number of data packets to the recipient device in parallel over multiple communications networks . said determination of a strongest signal for a communication network is acted upon by the mobile device , whereby the mobile device identifies said strongest signal strength for a communication network connected with the mobile device as the most reliable media data stream and acts to terminate communications with other communications networks . in a fourth specific example , the mobile device obtains the recipient device determination of strongest signal communication network as in the second specific example and also determines the strongest signal strength of wireless communications links between the mobile device as in the third specific example . if the recipient device has determined that a first communications network is the strongest signal network and the mobile device has determined that a second communications network is the strongest signal network for the mobile device , the mobile device identifies said strongest signal strength for a communication network connected with the mobile device as the most reliable media data stream and acts to terminate communications with other communications networks . alternately , the mobile device identifies said strongest signal strength for a communication network connected with the reliable device as the most reliable media data stream and acts to terminate communications with other communications networks . the above design options will sometimes present the skilled designer with considerable and wide ranges from which to choose appropriate apparatus and method modifications for the above examples . however , the objects of the present invention will still be obtained by that skilled designer applying such design options in an appropriate manner .	7
the term “ organic acid ” refers to any organic compound with acidic properties . representative examples include but are not limited to acetic acid , citric acid and propionic acid . the term “ alcohol ” refers to any organic compound in which a hydroxyl group (— oh ) is bound to a carbon atom of an alkyl or substituted alkyl group . representative examples include but are not limited to ethanol , methanol and propanol . in the present invention curcumin nanoparticles were prepared . in one embodiment , nanoparticles were also made out of the mucoadhesive biopolymer chitosan to deliver curcumin orally into mice . curcumin was loaded on the surface of the chitosan nanoparticles . this more efficient delivery vehicle ensured enhanced bioavailability and sustained circulation of curcumin in the blood compared to oral delivery of curcumin alone dissolved in olive oil . importantly , this procedure does not involve any chemical modification of curcumin and binding occurs due to the availability of hydrophobic pockets on the surface of the chitosan nanoparticles . chitosan nanoparticles not only improved the bioavailability of curcumin but also increased its stability . the process involved dissolving a clear solution of chitosan in an organic acid by heating the mixture at 50 ° c .- 80 ° c . the mixture was rapidly cooled to 4 ° c .- 10 ° c . and this process was repeated till a clear solution was obtained . the solution was then heated at 50 ° c .- 80 ° c . and sprayed under pressure into water kept stirring at 2 ° c .- 10 ° c . this solution containing the chitosan nanoparticles was stored for further use . the chitosan nanoparticles can be concentrated by centrifugation at slow speed . a clear solution of curcumin was prepared in alcohol . this curcumin solution was added under pressure to vigorously stirred aqueous suspension of chitosan nanoparticles in an organic acid and the resulting suspension was stirred overnight at room temperature to load curcumin on the chitosan nanoparticle . for the release study , curcumin - chitosan nanoparticles suspension was centrifuged and the pellet was resuspended with equal volume of water and was centrifuged two more times with purified water to remove unbound curcumin from the nano particles . accordingly in one embodiment the process involved dissolving a clear solution of 0 . 025 %- 1 % ( w / v ) chitosan in 0 . 1 % - 10 % or more , preferably 0 . 5 %- 1 % aqueous acetic acid by heating the mixture at 50 ° c .- 80 ° c . the mixture was rapidly cooled to 4 ° c .- 10 ° c . and this process was repeated till a clear solution was obtained . the solution was then heated at 50 ° c .- 80 ° c . and sprayed under pressure into water kept stirring at 200 - 1400 rpm at 4 ° c .- 10 ° c . this solution containing the chitosan nanoparticles was stored for further use . the chitosan nanoparticles can be concentrated by centrifugation at slow speed . a clear solution of 0 . 1 - 1 . 0 g of curcumin was prepared in 100 - 1000 ml of ethanol . this curcumin solution was added under pressure to vigorously stirred aqueous suspension of chitosan nanoparticles in 0 . 1 %- 10 % or more , preferably 0 . 25 % - 1 % acetic acid and the resulting suspension was stirred overnight at room temperature to load curcumin on the chitosan nanoparticle . for the release study , curcumin - chitosan nanoparticles suspension was centrifuged and the pellet was resuspended with equal volume of water and was centrifuged two more times with purified water to remove unbound curcumin from the nano particles . in the case of curcumin bound to chitosan nanoparticles , the concentrations of both chitosan and curcumin affect the size of the nanoparticle . in another embodiment of the invention , curcumin nanoparticles were prepared by dissolving curcumin in alcohol and then spraying the solution kept at 25 ° c .- 40 ° c . under nitrogen atmosphere and high pressure into an organic acid solution kept stirring at room temperature . stabilizers or surfactants were not used and the finished product entirely consisted of curcumin in the form of nanoparticles . accordingly , curcumin nanoparticles were prepared by dissolving 0 . 1 - 1 g curcumin in 100 - 1000 ml 5 %- 100 % of ethanol , preferably absolute ethanol and then spraying the solution kept at 25 ° c .- 40 ° c . under nitrogen atmosphere and high pressure into 0 . 1 %- 10 % or more , preferably 0 . 25 %- 0 . 1 % aqueous acetic acid solution kept stirring at room temperature . stabilizers or surfactants were not used and the finished product entirely consisted of curcumin in the form of nanoparticles . dynamic light scattering ( dls ) ( malvern , autosizer 4700 ) was used to measure the hydrodynamic diameter and size distribution ( polydispersity index , pdi = — μ2 — / γ2 ). chitosan loaded curcumin nanoparticles of size 43 nm to 325 nm , preferably 43 nm to 83nm , and curcumin nanoparticles of size 50 nm to 250 nm , preferably 50 nm to 135 nm were obtained as indicated in fig1 . 1 & amp ; 1 . 2 . the zeta potential and viscosity of nanoparticles was measured on a zeta potential analyzer ( brookhaven , usa ) and a viscometer fig1 . 3 & amp ; 1 . 4 . particle morphology was examined by transmission electron microscopy ( tem ) ( hitachi , h - 600 ). fig2 . 1 - 2 . 3 nanoparticles were dried in a vacuum dessicator and their ftir were taken with kbr pellets using the nicolet magna 550 ir spectrometer fur spectra of chitosan nano particle has similar absorbance pattern as that of chitosan . ( fig9 . 1 - 9 . 2 ). similarly the ftir spectra of curcumin and curcumin nano particles were similar indicating that curcumin was not chemically modified when it is converted into nanoparticles ( fig9 . 3 - 9 . 4 ). the ftir spectra of curcumin bound to chitosan nano particles as expected had all the features of chitosan and curcumin indicating the curcumin is not altered in the process of binding to chitosan nano particles ( fig9 . 5 ). both the curcumin nanoparticle and the curcumin bound to chitosan nanoparticle cured 100 % of the mice infected with a lethal strain of plasmodium yoelii parasite compared to infected untreated control where all animals died fig4 . 1 - 4 . 6 . the cured mice populations survived for at least 100 days and were resistant to subsequent reinfection in 100 % cases . it was found that curcumin preferentially accumulated inside the infected erythrocytes , the quantity increasing with increase of parasite load in the erythrocyte fig5 . 5 . confocal microscopy revealed that curcumin was bound to the parasite fig5 . 7 . just like chloroquine , curcumin inhibited hemozoin formation in vivo which the parasite makes to avoid the toxicity of heme ( fig6 .) curcumin nanoparticles and curcumin bound to chitosan nanoparticles demonstrated a 10 fold increase in bioavailability of curcumin ( fig3 .) and they were efficient in killing malaria parasite in vivo in mice . fig4 . 5 - 4 . 6 . the scope of the invention extends to all possible pharmacological uses of curcumin such as use of curcumin in the treatment of cancers , diseases involving an inflammatory reaction , alzheimer &# 39 ; s disease , cholesterol gall stones , diabetes , alcohol and drug induced liver diseases , parasitic infestation , malaria and other parasitic diseases , neurological disorders and all other diseases that can be treated or managed using curcumin . a clear solution of 0 . 2 % chitosan ( w / v ) in 1 % acetic acid was prepared by heating the mixture to 75 ° c . the mixture was rapidly cooled to 4 ° c . and this process was repeated several times till a solution of chitosan was obtained . this solution was then heated to 75 ° c . again and sprayed under pressure into water kept stirring very rapidly at 4 ° c . this ensured production of uniformly dispersed chitosan nanoparticles which can be concentrated by centrifugation a clear solution of 1 gm of curcumin in 1000 ml of absolute ethanol was added under pressure to vigorously stirred aqueous suspension of chitosan nanoparticles in 1 % acetic acid and the resulting suspension was stirred overnight at 200 - 1400 rpm at room temperature to load curcumin on the chitosan nanoparticle . 1 gm of curcumin was dissolved in 1000 ml of absolute ethanol . the solution was kept at 40 ° c . and then sprayed under nitrogen atmosphere and high pressure into 0 . 1 % aqueous acetic acid solution which was kept stirring at 200 - 1400 rpm at room temperature . this lead to the production of uniformly dispersed curcumin nanoparticles . the particle size can be controlled by varying the pressure at which curcumin solution is sprayed into 0 . 1 % aqueous acetic acid kept at different temperatures ( 25 ° c . - 40 ° c .). dynamic light scattering ( dls ) was used to measure the hydrodynamic diameter and size distribution ( fig1 . 1 - 1 . 2 ). dynamic light scattering ( dls ) experiments were performed ( scattering angle = 90 °, laser wavelength = 632 . 8 nm ) on a 256 channel photocor - fc ( photocor inc ., usa ) that was operated in the multi - tau mode ( logarithmically spaced channels ). during the titration process , a few milliliters of the sample was drawn from the reaction beaker and loaded into borosilicate cylindrical cell ( volume = 5 ml ) and dls experiment performed . the data was analyzed both in the contin regularization and discrete distribution modes ( multi - exponential ). the contin software generates the average relaxation time of the intensity correlation function , which is solely related to brownian dynamics of the diffusing particles for dilute solutions . the intensity correlation data was force fitted to a double - exponential function without success . thus , we have relied on a single exponential fitting ( with polydispersity ) and the chi - squared values were & gt ; 90 % consistently for all the correlation data . this yielded the apparent translational diffusion coefficient values . correspondingly , the apparent hydrodynamic radii , r h of the particles , at room temperature (° c .) were determined from the knowledge of translational diffusion coefficient d γ . these values were used in stoke - einstein equation , d = k b γ / f with the translational friction coefficient , f = 6πη 0 r h , where k b is boltzmann constant , and n 0 is solvent viscosity . electrophoretic mobility measurements were performed on the prepared nanoparticles ( fig1 . 3 ). the instrument used was zeecom - 2000 ( microtec corporation , japan ) zeta - sizer that permitted direct measurement of electrophoretic mobility and its distribution . in all our measurements the migration voltage was fixed at 25 v . the instrument was calibrated against 10 − 4 m agi colloidal dispersions . all measurements were performed in triplicate . particle morphology was examined by transmission electron microscopy ( tem ) ( hitachi , h - 600 ). samples were immobilized on copper grids . they were dried at room temperature , and subsequently examined using transmission electron microscope after staining with uranyl acetate ( fig2 . 1 - 2 . 3 ). chitosan nanoparticles and chitosan nanoparticles loaded with curcumin were separated from suspension and were dried ., and their ftir was recorded with kbr pellets on nicolet , magna - 550 spectrum . hplc was performed after extracting curcumin from the nanosuspension . the particles were collected after high centrifugation and washed several times till the presence of curcumin was not detected in the supernatant by spectroscopic measurnent ( absorbance recorded at 429 nm against ethanol ). curcumin was extracted from the pellet by the extraction solvent consisting of ethyl acetate and isopropanol ( 9 : 1 ). the upper organic layer was dried under nitrogen atmosphere . it was then reconstituted in ethanol and absorbance was recorded at 429 nm against ethanol as blank . hplc was performed using c18 column and isocratic solvent system consisting of acetonitrile : methanol : water : acetic acid :: 41 : 23 : 36 : 1 , at a flow rate of 1 ml / min . mass was determined by using maldi - tof mass spectrophotometer from bruker daltonik gmbh , ( germany ). curcumin was dissolved in ethanol while curcumin nanoparticles were resuspended in 20 % ethanol and the mass spectra was recorded . both curcumin and curcumin nanoparticles showed the presence of curcumin ( mass 369 ), demothoxy curcumin ( 339 ) and bisdemethoxy curcumin ( 309 ) indicating that the original molecules present in the curcumin sample are not modified by conversion to curcumin nanoparticles ( fig1 . 1 and 10 . 2 ). viscosity of nanoparticles : the viscosity of individual nanoparticle suspension was measured at room temperature and normal atmospheric pressure . the result indicates a change in viscosity of chitosan nanoparticles bound to curcumin from that of chitosan nanoparticles and curcumin nanoparticles ( fig1 . 4 ). this indicates binding of curcumin to chitosan which also correlates with changes in zetapotential of chitosan nanoparticles bound to curcumin from that of individual nanoparticles , indicating the binding of curcumin to chitosan . blood samples were obtained at different time intervals , that is , 30 min , 2 h , 4 h and 6 h after oral administration of curcumin ( 100 mg / kg through olive oil , 160 micrograms per mice through curcumin bound to chitosan nanoparticles and 160 micrograms per mice through curcumin nanoparticles ). plasma was collected ( after heparinization ) by centrifugation at 4300 g for 10 min . plasma ( 0 . 5 ml ) was acidified to ph 3 using 6 n hcl and extracted twice ( 1 ml each ) using a mixture of ethyl acetate and isopropanol ( 9 : 1 ; v / v ,) by shaking for 6 min . the samples were centrifuged at 5000 g for 20 min . the organic layer was dried under inert conditions and the residue was dissolved in an eluent containing ethanol and filtered to remove insoluble material . the amount was quantitated from standard plot of curcumin in ethanol , by measuring the absorbance at 429 nm . the identity of curcumin was established by hplc ( c18 column , isocratic solvent system acetonitrile : methanol : water : acetic acid :: 41 : 23 : 36 : 1 , at a flow rate of 1 ml / min ) and by mald1 - tof mass spectrophotometer . ( fig1 . 1 - 10 . 4 ) the increase in bioavailability of curcumin in terms of folds when compared to curcumin delivered through olive oil is depicted in fig3 . the results show enhanced bioavailability of curcumin when fed through chitosan nanoparticles and as curcumin nanoparticles along with sustained release in the plasma till 6 hours . male swiss mice weighing 25 - 30 g were maintained on a commercial pellet diet and housed under conditions approved by the institutional animal ethics commitee of the university . p . yeolli n - 67 rodent malarial parasite , was used for infection . mice were infected by intra peritoneal passage of 10 6 infected erythrocytes diluted in phosphate buffered saline solution ( pbs 10 mm , ph 7 . 4 , 0 . 1 ml ). parasitemia was monitored by microscopic examination of giemsa stained smears . in vivo antimalarial activity was examined in groups of 6 male swiss mice ( 25 - 30 g ) intraperitoneally infected on day 0 with p . yeolli such that all the control mice died between day 8 and day 10 post - infection . the mice were divided in to 4 groups of six mice each . untreated control group which was further subdivided into infected control group , olive oil control group and chitosan control group 1 . group treated with curcumin in olive oil control group 2 . group treated with curcumin on chitosan nanoparticles 3 . group treated with curcumin nanoparticles for the group treated with curcumin in olive oil , curcumin was suspended in olive oil ( 100 mg / kg body weight ). they were given curcumin at a dose of 3 mg / mice once , suspended in olive oil through the oral route . for the group treated with curcumin bound to chitosan nanoparticles and curcumin nanoparticles , 160 micrograms of curcumin ( through chitosan or curcumin nanoparticles ) was made available per mouse and was introduced by means of feeding gauge into the oral cavity of non - anesthetized mice as daily doses . each of the groups was infected with 1 × 10 6 red blood cells taken from an animal having approximately 30 % parasitemia . treatment , in each case , was started only when individual mouse showed parasitemia of 1 - 3 %, that is , by the 4 th day of infection . survival of mice was monitored for a period of 120 days . all the mice in the infected control group and olive oil control group died between 7 th to 11 th day post - infection ( fig4 . 1 - 4 . 2 ). all the mice in the chitosan control group died between 7 th to 12 th day post infection ( a delay of two days in comparison to the infected control and olive oil control groups ) ( fig4 . 3 ). in the group treated with curcumin in olive oil control , 2 out of the 6 mice survived for more than 100 days after cure while 4 died between 10 th to 12 th day post infection ( fig4 . 4 ). all the mice survived in the groups treated with curcumin bound to chitosan nanoparticles and curcumin nanoparticles . all of the mice survived for more than 100 days after cure and were resistant to reinfection by the same parasite ( fig4 . 5 - 4 . 6 ). infected mice with different parasitemia ( 0 % to 17 . 8 %) were given curcumin bound to chitosan nano particles orally . red blood cells were purified from each mice by density gradient centrifugation and curcumin fluorescence was detected by using facs . facs data showing curcumin fluorescence intensity of uninfected and infected rbcs is depicted in fig5 . 2 - 5 . 3 . red blood cells from both control and infected mice were purified by density gradient centrifugation , and curcumin was extracted out from 1 × 10 8 red blood cells using the procedure as described in example 5 and the result shows more accumulation of curcumin in rbc having higher level of parasitemia as indicate in the fig5 . 5 . 7 . 3 accumulation of curcumin in infected red blood cells by confocal microscopy slides for confocal microscopy were prepared by fixing erythrocytes or lymphocytes separated by density gradient centrifugation using ficoll from non infected plasmodium yoelli infected mice fed with curcumin nanoparticles . the isolated cells ( erythrocytes ) were then sealed with cover slip using mounting medium . fluorescence imaging of cells was performed with an olympus fluoview 500 confocal laser - scanning microscope ( olympus , tokyo , japan ) equipped with a multi - argon laser for excitation at 458 , 488 and 515 nm . the images were acquired either with 20 × objective or a 60 × water immersion objective using the fluoview software ( olympus , tokyo , japan ). the curcumin emission was collected using the barrier filter ba505 . the excitation wave length was 458 nm for curcumin . fig5 . 6 - 5 . 7 . in vivo inhibition of hemozoin synthesis by chloroquinine as well as curcumin infected mice were divided into 4 groups ( each having 4 mice ), namely : 1 . control group which was further sub - divided into the infected control group , olive oil control group and chitosan control group 2 . infected and fed with chloroquinine ( 1 . 7 mg in 100 μl of normal saline / mouse / day orally ) 3 . infected and fed with curcumin bound to chitosan nanoparticles ( 160 μg of curcumin bound to 200 μg of chitosan nanoparticles / per mouse / twice a day ) through oral route 4 . infected and fed with chitosan nanoparticles ( 200 micrograms of chitosan / day ) orally treatment in each group except the control was started when parasitemia had reached ˜ 10 % in each mouse and was carried out for 3 days . red blood cells were purified on the third day of treatment . approximately 4 × 10 7 cells were suspended in 25 mm tris hcl ph 7 . 8 containing 2 . 5 % sds . the cells were centrifuged at 10 , 000 g for 10 min , supernatant was discarded and the pellet washed in 1 ml of 0 . 1 m alkaline bicarbonate buffer ( ph 9 . 2 ). the washed pellet was dissolved in 0 . 05 ml of 2 n sodium hydroxide and absorbance was read at 400 nm after dilution to 1 ml using 2 . 5 % sds solution in water . the concentration of heme was calculated by using 90 . 8 as the milli molar extinction coefficient of heme . the results of in vivo inhibition of hemozoin synthesis in p . yoelii infected mice by feeding chloroquinine in normal saline or curcumin bound to chitosan nanoparticles ( hemozoin concentration is measured in terms of dissociated heme ) is depicted in fig6 . terminaldeoxynucleotidyl transferase - mediated deoxyuridine triphosphate biotin nick - end labelling ( tunel ) was performed using the apoalert ™ dna fragmentation assay kit ( r & amp ; d systems ). parasitic cells were isolated from infected rbcs from different groups by density gradient centrifugation . the parasitic cells were washed twice with 1 ml pbs and fixed with 4 % formaldehyde / pbs for 25 min at 4 ° c . after two washes with pbs , the pellet was resuspended in 5 ml permeabilization solution ( 0 . 2 % triton x - 100 in pbs ) and incubated on ice for 5 minutes . eighty microlitres of equilibration buffer was added and was incubated at room temperature for 5 minutes . the cells were labeled by adding 50 ml tunel mix followed by incubation for 60 minutes at 37 ° c . in a dark , humidified incubator . one millilitre of 20 mm edta was then added to terminate the tailing reaction . the samples were washed with pbs and the pellet was resuspended in 250 ml pbs for flow cytometry analysis . the results of this experiment are depicted in fig7 and 8 . toxicological studies were carried out on five groups of swiss albino mice and five groups of male wister rats as per the details in table 3 . histopathological examination of organs was completed in six animals from each group . the organ taken for histological study from each animal included brain , liver , kidney and heart . eosin and hematoxylin stained section were available for study from all these organs . no histological evidence of damage to the liver , heart , brain or kidney was seen in any animal in any group . the histological features clearly indicate that the preparations administered by the oral route , that is , curcumin in olive oil , curcumin bound to chitosan nanoparticles , chitosan nanoparticles and curcumin nanoparticles are non - toxic in wister rats and swiss albino mice . blood samples from members of the five groups of swiss albino mice and wister rats after oral feeding to pbs , curcumin in olive oil , curcumin bound to chitosan nanoparticles , chitosan nanoparticles and curcumin nanoparticles as directed in table 3 , were subjected to determination of serum glutamic oxaloacetic transaminase ( scot ) level , serum glutamic pyruvic transaminase ( sgpt ) level , serum urea level , serum creatinine level , serum cholesterol level , serum albumin level and serum hemoglobin level . no rise was seen in the serum sgot , sgpt , urea and creatinine levels after oral feeding of pbs , curcumin in olive oil , curcumin bound to chitosan nanoparticles , chitosan nanoparticles and curcumin nanoparticles . the serum levels of cholesterol , albumin and hemoglobin were also not significantly altered . this indicates that the curcumin nanoparticles of the present invention are non - toxic and safe . curcumin nanoparticles at a dose of 500 mg / day / person were given orally to nine human volunteers ( 1 , 3 , 4 , 6 , 8 , 9 , 10 , 11 & amp ; 12 ) who gave their informed consent to participate in the study . their blood glucose level was measured under fasting conditions before the start of the experiment ( dark spots ) and after 15 day of continuous oral consumption of same quantity of curcumin nanoparticles ( white spots ) normal curcumin was given orally to another group of seven human volunteers ( 2 , 5 , 7 , 13 , 14 , 15 & amp ; 16 ) at a dose of 500 mg / day / person . the results of the analysis are depicted in fig1 . while fasting glucose level was not altered in the curcumin control group there was a significant decrease in the nanocurcumin group indicating its ability to lower blood glucose level . curcumin nanoparticles at a dose of 500 mg / day / person were given orally to nine human volunteers ( 1 , 3 , 4 , 6 , 8 , 9 , 10 , 11 & amp ; 12 ) who gave their informed consent to participate in the study . normal curcumin was given orally to another group of seven human volunteers ( 2 , 5 , 7 , 13 , 14 , 15 & amp ; 16 ) at a dose of 500 mg / day / person . the level of serum urea , creatinine and potassium ( in case of potassium human volunteers ( 1 , 3 , 4 , 6 were given curcumin nanoparticles where as 2 , 5 , 7 were given normal curcumin ) were measured before the start of the experiment ( dark spots ) and after 15 day of continous oral comsumption of same quantity of curcumin nanoparticles ( white spots ). results of said tests are depicted in fig1 . 1 - 12 . 3 . the serum creatinine , urea and potassium levels ( 7 volunteers ) of all the volunteer under the study were within the normal range both before and after 15 days of continous oral consumption . there is slight decrease in serum creatinine and urea levels and increase in potassium level indicating tubular reabsorption of potassium by kidney , thereby showing an overall beneficial effect of curcumin on kidney . curcumin nanoparticles at a dose of 500 mg / day / person were given orally to nine human volunteers ( 1 , 3 , 4 , 6 , 8 , 9 , 10 , 11 & amp ; 12 ) who gave their informed consent to participate in the study . normal curcumin was given orally to another group of seven human volunteers ( 2 , 5 , 7 , 13 , 14 , 15 & amp ; 16 ) at a dose of 500 mg / day / person . the level were measured before the start of the experiment ( dark spots ) and after 15 day of continous oral comsumption of same quantity of curcumin nanoparticles ( white spots ). the effect of curcumin and nanocurcumin was studied on the levels of serum total cholesterol , hdl cholesterol , ldl cholesterol , triglycerides and sodium ( in case of sodium only seven human volunteers 1 , 3 , 4 , 6 were given curcumin nanoparticles where as 2 , 5 , 7 were given normal curcumin ). results of said tests are depicted in fig1 . 1 - 13 . 5 . a decline in total cholesterol level was seen in the nanocurcumin group consistently as compared to normal curcumin group . furthermore there is a marked increase in hdl cholesterol ( good cholesterol ) in case of curcumin nanoparticle group . level of ldl cholesterol ( bad cholesterol ) and triglycerides were lowered consistently in curcumin nanoparticle group as compared to normal curcumin group . decrease in serum sodium level was also observed indicating the promising anti - cholesterolic , anti - stroke , and other beneficial effects on cardiovascular diseases . effect of oral intake of curcumin and nanocurcumin on hemoglobin and rbc level of human volunteers curcumin nanoparticles at a dose of 500 mg / day / person were given orally to nine human volunteers ( 1 , 3 , 4 , 6 , 8 , 9 , 10 , 11 & amp ; 12 ) who gave their informed consent to participate in the study . normal curcumin was given orally to another group of seven human volunteers ( 2 , 5 , 7 , 13 , 14 , 15 & amp ; 16 ) at a dose of 500 mg / day / person . the levels were measured before the start of the experiment ( dark spots ) and after 15 day of continuous oral consumption of same quantity of curcumin nanoparticles ( white spots ) the effect of curcumin and nanocurcumin was studied on the levels of blood hemoglobin and rbcs . results of said tests are depicted in fig1 . 1 - 14 . 2 , which indicates that there is no adverse effect in terms of induction on anemic condition or lowering of rbc counts following the treatment regime . ( ). curcumin nanoparticles at a dose of 500 mg / day / person were given orally to nine human volunteers ( 1 , 3 , 4 , 6 , 8 , 9 , 10 , 11 & amp ; 12 ) who gave their informed consent to participate in the study . normal curcumin was given orally to another group of seven human volunteers ( 2 , 5 , 7 , 13 , 14 , 15 & amp ; 16 ) at a dose of 500 mg / day / person . the level were measured before the start of the experiment ( dark spots ) and after 15 day of continuous oral consumption of same quantity of curcumin nanoparticles ( white spots ). the effect of curcumin and nanocurcumin was studied on the levels of serum sgpt , sgot , alp , albumin and bilirubin . results of said tests are depicted in fig1 . 1 - 15 . 5 . it is apparent that sgot and sgpt levels are not significantly altered and albumin levels are increased in naocurcumin treated group indicating that nanocurcumin is good for the liver . the alp and bilirubin levels were also in the normal range except in one or two cases showing that curcumin and nanocurcumin do not have any adverse effect on liver function . effect of oral intake of curcumin and nanocurcumin on globulin level , eosinophils and neutrophils count and platelet count of human volunteers curcumin nanoparticles at a dose of 500 mg / day / person were given orally to nine human volunteers ( 1 , 3 , 4 , 6 , 8 , 9 , 10 , 11 & amp ; 12 ) who gave their informed consent to participate in the study . normal curcumin was given orally to another group of seven human volunteers ( 2 , 5 , 7 , 13 , 14 , 15 & amp ; 16 ) at a dose of 500 mg / day / person . the level were measured before the start of the experiment ( dark spots ) and after 15 day of continuous oral consumption of same quantity of curcumin nanoparticles ( white spots ). results of said tests are depicted in fig1 . 1 - 16 . 4 . the result indicates that there is no significant effect of curcumin on the levels of eosinophiles , neutrophils and platles . patients suffering from malaria were administered nanocurcumin capsules after having their informed consent under the supervision of a traditional medicine practitioner at a dose of 200 mg twice daily for 5 to 7 days for plasmodium vivax cases and 200 mg four times per day for 5 to 7 days for plasmodium falciparum cases . all nine patients were cured ( table 4 ). another group of five patients were studied for relapse . the patients who were cured did not show any relapse for at least 9 months . ( table 5 ).	8
an immunotoxin is defined as any immunological molecule such as an antibody which has been conjugated with a toxin , preferably a cytotoxin . the present invention is directed to a method of treating an individual having a pathophysiological state , comprising the step of administering to said individual an a pharmacologically effective dose of an agent which upregulates the expression of a cellular target . this administration is followed by the administration of a pharmacologically effective dose of an immunotoxin directed against the cellular target . preferably , the administered agent is selected from the group consisting of differentiating agents , cytokines , interleukin - 2 , tumor necrosis factor , interferon - α , interferon - γ and peptide hormones . in one embodiment , the invention comprises the administration of a pharmacologically effective dose of a retinoid . preferably , the retinoid induces expression of cd38 antigen in cells . if this is the case , a pharmacologically effective dose of a anti - cd38 immunotoxin is administered . representative pathophysiological states which may be treated using the methods of this embodiment of the invention include rarα selective acute myeloid leukemia , acute promyelocytic leukemia , lymphomas , and myelomas . representative retinoic acid metabolites which may be used in the methods of the present invention include all - trans - retinoic acid ( ra ); 9 - cis retinoic acid ( 9 - cis ra ); ( e )- 4 -[ 2 -( 5 , 6 , 7 , 8 - tetrahydro - 5 , 5 , 8 , 8 - tetramethyl - 2 - naphthalenyl )- 1 - propenyl ] benzoic acid ( ttnpb ); ( e )- 4 -[ 2 -( 5 , 6 , 7 , 8 - tetrahydro - 3 , 5 , 5 , 8 , 8 - pentamethyl - 2 - naphthalenyl )- 1 - propenyl ] benzoic acid ( 3 - met ttnpb ); and other retinoids that can bind and activate the rarα receptor . preferably , the retinoid is administered in a dose of from about 0 . 1 mg / kg to about 2 mg / kg . the immunotoxin used in the methods of the present invention specifically target cells expressing the cd38 antigen . preferably , the immunotoxin comprises a monoclonal antibody directed against the cd38 antigen conjugated to a toxin molecule . although a person having ordinary skill in this art could substitute any toxin , a preferred toxin useful in these methods is gelonin . although a person having ordinary skill in this art could substitute any monoclonal antibody specific for the cd38 antigen , ib4 or ib6 antibodies were used herein to demonstrate the present methods . preferably , the immunotoxin is administered in a dose of from about 0 . 05 mg / kg to about 2 mg / kg . the following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion . cd38 expression in normal tissues is limited mainly to the thymus . the tissue specificity of cd38 was examined by the hybridization of a radiolabeled cd38 nucleic acid probe against a commercial ( clontech ) tissue specific mrna dot blot . the results of the hybridization are shown in fig1 . it was observed that cd38 is mainly expressed in the thymus with significantly lower levels of expression in the prostate . retinoic acid ( ra ) augments the cytotoxic effect of immunotoxin through enhanced expression of cd38 . hl - 60 cells were incubated with either immunotoxin alone or in the presence of 5 nm retinoic acid ( ra ). increasing concentrations of unconjugated ib4 monoclonal antibody were added to the cells incubated with immunotoxin and retinoic acid . after three days , the cells were assayed for viability with the mts assay . briefly , 6 . 5 mg / ml mts solution [( 3 -( 4 , 5 - dimethylthiazol - 2 - yl )- 5 -( 3 - carboxymethoxyphenyl )- 2 -( 4 - sulfophenyl )- 2h - tetrazolium ] and 0 . 5 mm pms ( phenazine methosulfate ) solution were mixed at a ratio of 20 : 1 . 20 μl of the combined mts / pms solution was placed in each well of a 96 well plate containing samples of the cells to be tested . the plate was incubated for 1 – 4 hours at 37 ° c . in a 5 % co 2 atmosphere , after which time , the amount of formazan produced by live cells from cellular reduction of mts was measured by reading the absorbance at 490 nm . the results are shown in fig2 . immunotoxin alone had little effect on the viability of the cells ( c ). however , when the cells were incubated with immunotoxin in the presence of 5 nm retinoic acid , a significant reduction in cell viability was observed . increasing concentrations of unconjugated ib4 monoclonal antibody blocked the cytotoxic effect of immunotoxin and retinoic acid . the fact that unconjugated ib4 blocked the ability of the immunotoxin to kill the cells demonstrates that the immunotoxin is specifically interacting with the cd38 surface marker and that the effect of the retinoic acid is to increase the expression of the cd38 antigen . all - trans - retinoic acid ( ra ) pretreatment enhances the induced killing of hl - 60 cells . hl - 60 cells were preincubated overnight in either the presence or absence of 5 nm all - trans - retinoic acid . the cells were washed twice and incubated in increasing concentrations of immunotoxin in either the presence or absence of ib4 unconjugated anti - cd38 moab . after three days , the cell were assayed for viability . the results are shown in fig3 . preincubation with all - trans - retinoic acid followed by immunotoxin treatment resulted in more cell death than treatment with immunotoxin alone . the presence of 100 fold excess of the unconjugated anti - cd38 monoclonal antibody ib4 blocked the toxicity of the immunotoxin in both cases by competing with the immunotoxin for access to the cd38 markers on the cells . these results demonstrate that the all - trans - retinoic acid ( ra ) was causing some change in the cells which render them more susceptible to the immunotoxin rather than playing a direct role in the death of the target cells . gelonin must be conjugated to the anti - cd38 antibody to have a toxic effect on the target cells . hl - 60 cells were incubated for three days with increasing concentrations of either immunotoxin or gelonin in either the presence or absence of 5 nm retinoic acid . afterwards , the cells were assayed for viability using the mts assay . as seen in fig4 , gelonin alone had no toxic effect in either the presence of absence of 5 nm . thus , the toxic effect of gelonin depends on it being conjugated to the anti - cd38 monoclonal antibody in order to deliver the toxin to the cell . even nominal levels of all - trans - retinoic acid ( ra ) lead to increased toxicity of the immunotoxin . hl - 60 were incubated with either immunotoxin or unconjugated ib4 monoclonal antibody in increasing concentrations of monoclonal antibody . fig5 shows that even the lowest level of all - trans - retinoic acid ( ra ) ( 1 nm ) lead to almost complete killing of the target cells by the immunotoxin . this effect was not observed with the unconjugated monoclonal antibody . this result indicates that it is the gelonin conjugated to the monoclonal antibody in the immunotoxin that leads to the increased cell death rather than some effect of the antibody itself . retinoic acid can induce expression of the cd38 marker in a variety of cell lines . the daudi , thp - 1 , k562 , and hl60 - rarα cell lines were treated with increasing concentrations of immunotoxin in either the presence or absence of 5 nm all - trans - retinoic acid ( ra ). after three days , the viability of the cells was examined using the mts assay , which is shown in fig6 . in the thp - 1 and hl60 - rarα cell lines , all - trans - retinoic acid induced cell death while the cell which were cultured in the absence of all - trans - retinoic acid were mostly unaffected by the immunotoxin . in the daudi cells , which have a high basal expression of cd38 , the immunotoxin resulted in almost complete cell death regardless of whether retinoic acid was present . on the other hand , k562 , which are resistant to ra - induced cd38 expression , were unaffected by the immunotoxin regardless of the presence of retinoic acid . hl - 60 subcloned cells , resistant to adriamycin - induced killing were cultured with immunotoxin either alone or in the presence of 5 nm all - trans - retinoic acid . after three days , the mts assay was used to test cell viability . fig7 shows the results obtained . some cell death was observed in the presence of immunotoxin alone which was greatly augmented by the addition of 5 nm all - trans - retinoic acid . cells which have high basal expression of cd38 are killed by immunotoxin regardless of the presence or absence of all - trans - retinoic acid ( ra ). mz , a non - hodgkin lymphoma cell line which has a high basal expression of cd38 , was treated with increasing amounts of immunotoxin in either the presence or absence of 5 nm all - trans - retinoic acid . the addition of immunotoxin resulted in a high level of cell death regardless of the presence or absence of retinoic acid ( fig8 ). this is strong evidence that retinoic acid is increasing the toxicity of immunotoxin by enhancing the level of cd38 on other cell lines which do not have a high basal level of cd38 . retinoic increases cd38 expression in a number of lymphoid tumor cells . table i lists the potential targets for anti - cd38 bound toxin treatment a number of different lymphoid tumor cell lines were treated with 5 nm all - trans - retinoic acid ( ra ). afterwards , the expression of cd38 in untreated versus treated cell was measured by flow cytometry . a significant rise in cd38 expression was observed in acute myeloid leukemia ( aml ), acute promyelocytic leukemia ( apl ), lymphoma , and myeloma tumor cells . the increase in cd38 expression ranges from 2 . 5 to 20 fold . thus , retinoic acid can be used in all of these tumor types to increase the vulnerability of the tumor cells to immunotoxin treatment . hl - 60 cells with a mutated rarα gene that renders the cells resistant to the effects of retinoic acid were treated with immunotoxin in either the presence or absence of 5 nm retinoic acid . in these cells , the addition of retinoic acid had no effect on the toxicity of the immunotoxin . as shown in fig9 , no appreciable cell death was observed in the cells treated with all - trans - retinoic acid ( ra ), with unconjugated ib4 and gelonin , or with gelonin alone . this is further proof that the immunotoxin kills cells which are affected by retinoic acid because of a retinoid induced increased in expression of cd38 target of the immunotoxin . any patents or publications mentioned in this specification are indicative of the levels of those skilled in the art to which the invention pertains . these patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference . one skilled in the art will readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned , as well as those inherent therein . the present examples along with the methods , procedures , treatments , molecules , and specific compounds described herein are presently representative of preferred embodiments , are exemplary , and are not intended as limitations on the scope of the invention . changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention as defined by the scope of the claims .	0
the present invention is further described below with reference to the accompanying drawings . as shown in fig1 , the bottom portion of the wind power generator of the present invention is a support , and at a middle height position of the support 1 , a platform with a generator and a speeder installed thereon is configured . a central shaft 2 is arranged in the center of the support . a wind wheel is sleeved on the central shaft , in which a radial thrust bearing is installed on the lower end thereof and a journal bearing is installed on the top end thereof to ensure that the wind wheel can flexibly rotate while being sleeved on the central shaft 2 . a generator 9 , a speeder 8 , and a controller can also be implemented through landing installation . when rotating , the wind wheel drives the speeder 8 at the lower end to rotate and then drives the generator 9 to generate power . the positions of vanes 7 where the vanes change their locations among different quadrants under the effect of the wind power are restrained by a stop mechanism . a baffle or anemometer of a strong wind cutout protection device 6 is disposed at the top portion . when the wind power exceeds a predetermined value , the baffle falls down , the stop mechanism is withdrawn , and the vanes 7 automatically orientate windward in the strong wind , and the force impinged on the vanes 7 are turned to a minimum state , so as to protect the vanes 7 from being damaged . as shown in fig2 , the number of the vanes 7 in the wind power generator of the present invention is selected to be 6 , that is , a first vane 7 - 1 , a second vane 7 - 2 , a third vane 7 - 3 , a fourth vane 7 - 4 , a fifth vane 7 - 5 , and a sixth vane 7 - 6 respectively . an upper wind disc 5 and a lower wind disc 3 are both of a regular polygon structure and the upper and lower wind discs and supporting rods 11 constitute a truss - type wind wheel . each of the vanes 7 is perpendicularly arranged at a corresponding vertex angle position of the upper and lower wind discs . pivots 10 of the vanes are all installed with bearings . as shown in fig3 , an overall shape of the vanes 7 of the present invention is an air - foil shape and of a hollow structure with a framework braced therein . the vanes 7 are designed with equal cross sections and the height of the vanes is equivalent to that of the wind wheel . the shape of the cross section is specifically that , a circular - arc radius of a head portion r 1 is 1 / 18 - 1 / 22 of a vane chord length l , an arc radius of an outer surface r 3 is ⅜ of the chord length l , an arc radius of an inner surface r 2 is 3 / 16 of the chord length ; a central angle γ of an overall circular - arc portion is 40 - 50 degrees , an arch height of a circular arc of the outer surface ( i . e ., an outer arch height h 1 ) is ⅕ - 1 / 7 of the chord length , an arch height of a circle chord of the inner surface ( i . e ., an inner arch height h 2 ) is 1 / 10 - 1 / 14 of the chord length , a back portion of each of the vanes is linear intersection between the outer surface and the inner surface , and the pivots 10 of the vanes are located at positions 1 / 7 - ⅙ of the chord length from the head . the vanes 7 are made of light , weather - resistant , and corrosion - resistant materials , so that the requirement for the mechanical intensity of the materials of the vanes 7 is rather low . the present invention may further add an arc - shaped wind collecting baffle in an upwind direction of the wind wheel , so as to collect the incoming winds , increase the force impinged on the vanes , and increase the output power . as shown in fig4 , a stop mechanism is disposed at a bottom portion of the pivots 10 of the vanes , and the bottom portion of the pivots 10 is correspondingly sleeved with a disc 16 having a fan - shaped notch β fitting with the pivots . a central angle of the notch is 65 - 75 degrees , and the stop mechanism is axially or radially arranged to fit with the fan - shaped notch β , so as to control a maximum angle of attack to be 25 - 30 degrees when the vanes 7 are in an upwind direction and a maximum angle of attack to be 40 - 45 degrees when the vanes 7 are in a downwind direction . as shown in fig4 , a mechanical - type stop mechanism includes a stop assembly 12 and a sliding rod 14 . a guiding wheel 13 is disposed at a top end of two sides of the sliding rod 14 , a front end is connected with a sliding wheel 15 , and a back end is connected with a windward baffle at the upper portion of the wind wheel through steel wires . in a normal situation , the sliding rod 14 is inserted into the notch of the disc 16 and performs a stopping operation on a rotating angle of the vanes . when encountering a strong wind , the windward baffle drives the sliding rod 14 to be withdrawn out of the notch , and the vanes 7 automatically rotate downwind to reach a position where the wind force is at the minimum level , so as to avoid being damaged , and then the vanes 7 are restored automatically after the strong wind . the vanes 7 of the present invention are changed at the illustrated positions . under the effect of the wind power , four quadrants are all corresponding to the lift force due to the aerodynamic principle . the stop mechanism may be disposed at a top portion of the pivots 10 of the vanes , and may also be disposed at the top or bottom portion of the pivots at the same time . in additional to the above mechanical - type structure , the stop mechanism may further adopt an electrical - type structure . the electrical - type stop mechanism automatically detects and controls the sliding rod to be withdrawn out of and inserted into the fan - shaped notch of the pivots of the vanes through an anemometer and a motor mechanism , so as to control the angle of attack of the vanes . when encountering a strong wind , the anemometer enables the sliding rod 14 to be withdrawn out of the notch under an electrical driving motion , and the vanes 7 automatically rotate downwind to reach a position where the wind force is at the minimum level , so as to avoid being damaged , and then the vanes 7 are automatically restored after the strong wind . in order to increase the power generation capability , the wind wheel can be stacked and expanded in a building block mode . in order to enhance the wind - resistant capability of the entire generator , medium and large - scaled units are fixed by adding inclined steel wire cables at a top end thereof . the number of the vanes in the wind power generator of the present invention may be selected as three or an integral multiple of three , the upper and lower wind discs of the wind wheel can adopt a corresponding regular polygon structure , and each of the vanes is perpendicularly arranged at a corresponding vertex angle position of the wind wheel . as shown in fig5 , zxvwg - 300 denotes an output characteristic curve of a 300 w generator designed according to the present invention , zxvwg - 200 denotes an output characteristic curve of a 200 w generator designed according to the present invention , and fd - 400 denotes an output characteristic curve of a 400 w traditional horizontal shaft wind power generator . upon the comparison test with the traditional wind power generator , the swept area of the generator according to the present invention is 26 % less than that of the horizontal - shaft generator . in a situation that the capacity of the generator is 25 % less than that of the traditional generator , at a wind speed of 12 m / s , the generation power of the wind power generator designed according to the present invention is about 26 % higher than that of the traditional wind power generator , and has a rising tendency along the curve of the cube of the wind speed .	5
reference now should be made to the drawings , in which the same or similar components have the same reference numbers throughout the different figures . fig1 is a side view of a short length of elongated flexible tube or conduit , which is intended to be formed into a coiled spring conduit member designed to interconnect two different parts of a powdered medicine delivery inhaler mechanism . an inhaler device , in which the tube shown in fig1 and 3 , is used , is subjected to air pressure of approximately 80 psi when air is released through the dispenser device and the tube 10 . the tube 10 of fig1 is formed from thermoplastic material , which may be extruded and then subsequently heat formed . initially , extruded tubular material , having the desired internal and external diameters , is cut into the desired length ; and segments 14 and 16 , at both ends , are flared by means of heat forming insert mandrels . the manner in which this is accomplished is not important to an understanding of the present invention . it is to be noted , however , that the starting material for use with the machine described subsequently is the tube 10 , shown in fig1 with the enlarged or flared segments 14 and 16 on the ends . the flared segments are selected to have an internal diameter which is greater than the uniform internal diameter of the main body 10 of the tube , for purposes of interconnecting the finished product in an inhaler with a uniform internal diameter airflow passage throughout the length of the entire mechanism , including the portions to which the flared end segments 14 and 16 are attached . in order to form a substantially single - turn helical coil 12 , thermoset into the shape shown in fig2 from the straight length of tube 10 of fig1 the machine shown in fig4 through 9 is employed . this machine is designed to simultaneously produce six thermoset coiled spring tube members of the type shown in fig2 and 3 with each cycle of operation . the finished product , as shown in fig2 and 3 , is a thermoplastic tube 10 with a uniform cross - sectional thickness throughout its length . the tube is thermoset formed as a helical spring which may be extended and released repeatedly to its thermoset - biased coiled condition , for use in manually - charged , powdered medication delivery systems . fig4 is a top perspective view of the primary operating components of the machine of the preferred embodiment used to form the product shown in fig2 . some conventional mechanisms , which may be associated with the machine of fig4 and 5 , have not been shown in order to more clearly present the features which are unique to the operation of the preferred embodiment of the invention . basically , the machine includes two spaced - apart parallel mounting blocks 20 and 22 , which are secured to a machine base ( not shown ) in any suitable manner . the blocks are spaced a uniform distance apart ; and each of them includes six aligned , equally spaced support bearings for rotating mandrels . the mandrels , in turn , are supported in a pair of movable , bearing support members 24 and 26 for the blocks 20 and 22 , respectively . six mandrels 28 extend through bearings 32 in the member 24 ; and a corresponding six mandrels 30 extend through bearings 34 in the mandrel support member 26 . as shown in both fig4 and 5 , the mandrels 30 also slidably extend through the bearings 36 in the main support block 22 , as well . similar bearings ( not shown ) in the support block 20 are used for allowing pivotal rotation of the mandrels 28 in that support block for either or both sets of mandrels 28 and 30 . the mandrel support members 24 and 26 for either or both sets of mandrels 28 and 30 are arranged to be moved toward and away from the blocks 20 and 22 , respectively , through means of a suitable electromechanical system 94 . this is diagrammatically illustrated in fig4 by means of the dotted lines 100 and 102 interconnecting the mandrel support members 24 and 26 with a control and drive motor unit 94 . in the operation of the machine , at the beginning of each cycle , six pre - formed plastic tube sections of the type shown in fig1 are dropped into aligned slots 62 and 83 , formed on the upper surfaces of opposite sleeves 60 and 82 , respectively , which surround the mandrels 30 and 28 , as shown most clearly in fig6 . one of the pre - formed lengths of tube 10 , with the flared end segments 14 and 16 , is placed in each of these opposing sleeves in the slots on the top of the mandrels 30 and 28 , in each of the six different positions of the six - unit machine shown in fig4 . each of the different positions are identical ; and one of them is diagrammatically illustrated in fig6 . fig5 illustrates , in an exploded view , the portions of the sleeves and operating parts which are associated with one of the mandrels 30 . it should be noted that each of the mandrels 30 are identical , and that the corresponding parts which are associated with those mandrels are identical . for that reason , only one has been shown in exploded detail . similarly , the mandrels 28 are surrounded with sleeves and operating collars which are identical to one another , and are identical to the one shown in exploded view in fig5 . in order to avoid cluttering the drawing with unnecessary details , only one of the mandrel and sleeve sets is shown in exploded detail ; and only a partial cross section of some of the operating features is shown in fig6 . when a part 10 is dropped into the slots 62 and 83 , as shown in fig5 and 6 , the flared end rests on a wider flat portion 61 on the sleeve 60 ( and a corresponding flat portion on the sleeve 82 ) with the main body of the tube 10 which is located between the end segments 14 and 16 extending through the narrower slot 62 , for example , in the sleeve 60 . an identical construction on all of the other sleeves on both sides of the machine is employed ; so that the tube 10 extends through the narrow slots 60 on the machine portion carried by the block 22 , and a similar set of slots 83 carried by the sleeves 82 on the block 20 . fig7 is a cross - sectional view of this portion of the machine , which illustrates the orientation of the sleeve 82 and its slot 83 , with respect to the mandrels 28 . again , a similar cross section taken on any of the other sleeves and mandrels , on both sides of the machine , is identical to the one shown in fig7 . in order to lock the thermoplastic tube section 10 / 14 / 16 into place for effecting a subsequent rotating operation , a second sleeve is provided at each of the mandrel positions . this is a larger sleeve , 90 for the mandrels associated with the block 20 , and 54 for the mandrels 30 associated with the block 22 . the cross - sectional views of fig6 and 7 illustrate the general orientation of the locking sleeves 90 and 54 with respect to the other parts . after the tube section 10 of fig1 is placed in the slots on the smaller sleeves 82 and 60 , as described above , the locking sleeves 90 and 54 are rotated to cause the open gap , such as the gap 84 shown in fig6 and 7 , to rotate over and close the opening over the top of the flanges 14 and 16 . the flanges 14 and 16 stick up just slightly above the upper diameter projection of the sleeves 60 and 82 ; so that when this rotation of the sleeves 90 and 54 is effected , a vice - like clamping action is provided to tightly grip the end segments 14 and 16 in place , and hold them against any rotation of the tube 10 during the next cycle of operation of the machine . to effect the clamping of the end segments 14 and 16 , a rectangular sliding bar assembly , including a pair of spaced - apart horizontal end members 76 and 88 , which are interconnected by elongated side members ( not shown ) is provided . this rack slides in facing slots 70 and 72 in the support blocks 22 and 20 , respectively , and . is operated by the control and drive motor mechanism 94 at the beginning and end of each cycle to reciprocate back and forth , as indicated by the double - ended arrow at the left - hand end of fig4 . once all of the tubes 10 are in place as described above , the rack 76 / 88 is moved toward the right , as viewed in fig4 to cause six spaced engaging pins 78 , on the right - hand end side of the rack 76 , and a corresponding set of six engaging pins 80 on the left - hand side of the rack , to engage corresponding slots 52 and 42 located , as is most readily apparent in fig4 and 5 , on the lower sides of circular operators 48 and 38 which are fixedly attached for rotation with the sleeves 54 and 90 , respectively . when the rack 76 / 88 moves toward the right , as seen in fig4 the operators 48 associated with the sleeves 54 are rotated clockwise ( as viewed in fig5 ); and the operators 38 , associated with the sleeves 90 in the support block 20 , are operated counterclockwise ( as viewed in fig4 ) to rotate over the openings in the ends of the slots 62 and 83 and effect the clamping of the flanges 14 and 16 , as described above . the rack 78 / 88 remains in its rightmost position for the duration of the next portion of the cycle of operation . it should be noted , however , that for the operation just described , the pins 78 and 80 engage the slots 52 and 42 , respectively , to effect the rotation . this causes a second set of slots ( located 180 ° from the slots 42 and 52 engaged by the pins 78 and 72 ) to be rotated into position for subsequent engagement for rotating the assembly back to the starting position , once a complete cycle of operation has taken place . for the purposes of the next portion of the ensuing discussion , however , it should be noted that the rack 78 / 88 moves from the position shown in fig4 toward the right ( as shown in fig4 ), as described above , and remains there until it is time to commence a new cycle of operation . after the flanges 14 and 16 are locked into place , the control and drive motor mechanism 94 commences rotation of the mandrels 30 , through a set of drive shafts , while the mandrels 28 remain in a fixed or non - rotating condition . at the same time , the control and drive motor 94 moves the mandrel support members 24 and 26 toward the blocks 20 and 22 , respectively , in synchronism with the rotational force applied through the drive shafts 96 to the mandrels 30 to cause a coil 12 to be formed in the center of the pre - formed cut length of thermoplastic tubing 10 of fig1 . in fig2 the coil 12 is shown offset from the center , but in reality , the coil 12 will form at the center of the tube 10 because of the uniform wall thickness and strength of the material . the movement of the mandrel support blocks 24 and 26 , toward one another , is at a rate to accommodate for the reduction in length between the ends of the tube 10 as the coil 12 is formed in it . the coil 12 forms around the path of the mandrels 28 and 30 ; and in fact , as they approach one another , the coil 12 is wound around the mandrels 28 and 30 . at the end of the rotation to form the coil 12 ( chosen to be slightly more than 360 ° of relative rotation between the mandrels 30 and 28 ), the mandrel ends 29 and 31 engage one another . fig6 and 9 show details of this portion of the mechanism . the mandrels 28 have a slot 29 formed in their end ; and the mandrels 30 have a flat projection 31 formed in the end , which mates with the slot 29 . as a consequence , when the mandrel 30 is moved into engagement with the end of the mandrel 28 , the flat projection 31 extends into the slot 29 . continued rotation of the mandrel 30 under control of the drive motor 94 , through the shaft 96 , now causes the entire assembly of joined mandrels 30 and 28 to rotate together at the same rate . this occurs immediately after the coil is formed in the tube 10 . during the time mandrels 28 and 30 are engaged ( as indicated in dotted lines in fig6 ) for rotation together , hot air at a sufficiently high temperature to exceed the thermosetting temperature characteristics of the plastic used in the tube 10 , is applied to the coils 12 through a heater 110 . the coils 12 rotate in the region of the hot air applied from the heater 110 ; and this rotation in thermosetting heat is effected for a length of time sufficient to cause the thermosetting formation of the coil 12 . once thermosetting of the coil 12 in the tube 10 has been completed , heat application from the heater 110 is discontinued . continuous rotation of the mandrels 30 and 28 together is effected ; and if desired , cooling air may be blown across each of the coils 12 in a conventional manner ( not shown ) to effect a more rapid cooling down of the parts . once the parts are sufficiently cooled , the rack 78 / 88 is operated by the control and drive motor mechanism 94 , through the control link indicated in dotted lines 98 , to move back toward the left and to rotate the sleeves 54 and 90 back to the relative positions shown in fig4 and 7 . the slots 62 and 84 once again are opened . continued rotation of the mandrels 30 and 28 then causes the assembly , including the sleeves 54 , 90 , 60 and 82 , to rotate where the openings 62 , 83 , 56 and 84 are pointed downwardly ; so that gravity allows the finished parts of the type shown in fig2 to drop out of the open slots . rotation another 180 ° back to the position shown in fig4 and 7 is effected . rotation of the mandrels 30 / 28 ceases ; and the mandrel support members 24 and 26 are moved back to the positions shown in fig4 by the control and drive motor mechanism 94 . the finished parts drop free . the system now is ready for a new cycle of operation , repeating all of the steps which have been described above . the foregoing description of a preferred embodiment of the invention is to be considered as illustrative and not as limiting . various changes and modifications will occur to those skilled in the art for performing substantially the same function , in substantially the same way , to achieve substantially the same result without departing from the true scope of the invention as defined in the appended claims .	0
fig2 a - 2 c illustrate a method of forming a conductive polymer bump on a substrate , such as a silicon wafer , a printed circuit board , or the like , of the present invention . fig2 a illustrates an exposed electrode substrate assembly 200 comprising a substrate 202 which has at least one conductive electrode 204 , usually aluminum electrodes , disposed thereon . a passivation film 208 may be formed over a face surface 206 of the substrate 202 . the passivation film 208 is selectively etched to expose the conductive electrode 204 . the exposed electrode substrate assembly 200 is immersed in an electroless plating bath plating bath containing palladium in solution , whereby through an exchange reaction the exposed conductive electrodes 204 are selectively plated with a palladium layer 210 atop an upper surface 212 of the conductive electrode 204 , as shown in fig2 b . as shown in fig2 c , a conductive polymer is applied to an upper surface 214 of the palladium layer 210 to form a conductive polymer bump 216 . the conductive polymer bump 216 preferably comprises a two - stage epoxy which does not completely set . the conductive polymer used to form the conductive polymer bump 216 preferably has a high electrical conductivity metal , such as palladium , gold , silver , or the like , dispersed therein . the conductive polymer bump 216 is preferably formed by stencil printing or stenciling the conductive polymer onto the conductive electrode 204 . it is , of course , understood that the passivation film 208 may be stripped from the substrate 202 . fig3 a - 3 c illustrate a method of forming a conductive polymer bump on a printed circuit board of the present invention . fig3 a illustrates an exposed bond pad chip assembly 300 comprising a printed circuit board 302 which has at least one bond pad 304 , usually copper pads , disposed thereon . the bond pad 304 has a lead 306 ( shown in shadow ) within the printed circuit board 302 attached to a lower surface 308 of the bond pad 304 . optionally , a passivation film 310 such as at least one layer of resist polyimide film , or the like , is formed over a face surface 312 of the printed circuit board 302 . the passivation film 310 is selectively etched to expose the bond pad 304 . the exposed bond pad chip assembly 300 is immersed in an electroless plating bath containing palladium in solution , whereby through an exchange reaction the exposed bond pads 304 are selectively plated with a palladium layer 314 atop an upper surface 316 of the bond pad 304 , as shown in fig3 b . as shown in fig3 c , a conductive polymer is applied to an upper surface 318 of the palladium layer 314 to form a conductive polymer bump 320 . the conductive polymer bump 320 preferably comprises a two - stage epoxy which does not completely set . the conductive polymer used to form the conductive polymer bump 320 preferably has a metal , such as palladium , gold , silver , or the like , dispersed therein . the conductive polymer bump 320 can be formed in a manner discussed for the conductive polymer bump 216 of fig2 . it is of course , understood that the passivation film 310 may be stripped from the printed circuit board 302 . fig4 illustrates a substrate assembly 400 of the present invention . the substrate assembly 400 comprises a first substrate 402 with a plurality of conductive electrodes 404 disposed on a facing surface 406 of the first substrate 402 . a palladium metal layer 408 is disposed on each conductive electrode 404 by electroless plating . the substrate assembly 400 further comprises a second substrate 410 with a plurality of bond pads 412 disposed on a facing surface 414 of the second substrate 410 . a palladium metal layer 416 is also disposed on each bond pad 412 . the first substrate 402 and the second substrate 410 are mechanically attached to and in electrical communication with one another via a plurality of conductive polymer bumps 418 extending between the first substrate 402 palladium metal layers 408 and the second substrate 410 palladium metal layers 416 . an under - fill encapsulant 420 may be disposed between the first substrate 402 and the second substrate 410 for environmental protection and to enhance the attachment of the first substrate 402 and the second substrate 410 . fig5 illustrates a first embodiment of a substrate / chip assembly 500 of the present invention . the substrate / chip assembly 500 comprises a substrate 502 with a plurality of conductive electrodes 504 disposed on a facing surface 506 of the substrate 502 . a palladium metal layer 508 is disposed on each conductive electrode 504 by electroless plating . the substrate / chip assembly 500 further comprises a semiconductor chip 510 with a plurality of bond pads 512 disposed on a facing surface 514 of the semiconductor chip 510 . a palladium metal layer 516 is also disposed on each bond pad 512 . the substrate 502 and the semiconductor chip 510 are mechanically attached to and in electrical communication with one another via a plurality of conductive polymer bumps 518 extending between the substrate 502 palladium metal layers 508 and the semiconductor chip 510 palladium metal layers 516 . an under - fill encapsulant 520 may be disposed between the substrate 502 and the semiconductor chip 510 for environmental protection and to enhance the attachment of the substrate 502 and the semiconductor chip 510 . fig6 illustrates a second embodiment of a substrate / chip assembly 600 of the present invention . the substrate / chip assembly 600 comprises a substrate 602 with a plurality of conductive electrodes 604 disposed on a facing surface 606 of the substrate 602 . the conductive electrodes 604 may comprise any suitable type metal electrode , such as aluminum . the substrate / chip assembly 600 further comprises a semiconductor chip 610 with a plurality of bond pads 612 disposed on a facing surface 614 of the semiconductor chip 610 . a palladium metal layer 616 is also disposed on each bond pad 612 . the substrate 602 and the semiconductor chip 610 are mechanically attached to and in electrical communication with one another via a plurality of conductive polymer bumps 618 extending between the substrate 602 conductive electrodes 604 and the semiconductor chip 610 palladium metal layers 616 . the conductive material in the conductive polymer bumps 618 is capable of making electrical contact with the conductive electrodes 604 and penetrating any coating thereon whether an oxide coating or a passivation layer coating . an under - fill encapsulant 620 may be disposed between the substrate 602 and the semiconductor chip 610 for environmental protection and to enhance the attachment of the substrate 602 and the semiconductor chip 610 . it is , of course , understood that , although the assemblies shown in fig4 and 6 show substrates and / or semiconductor chips which use the palladium layered structures of the present invention , one of the substrates and / or semiconductor chips could be one of industry standard manufacture . having thus described in detail preferred embodiments of the present invention , it is to be understood that the invention defined by the appended claims is not to be limited by particular details set forth in the above description as many apparent variations thereof are possible without departing from the spirit or scope thereof .	7
in the description of the invention above and in the detailed description of the invention , and the claims below , and in the accompanying drawings , reference is made to particular features of the invention . it is to be understood that the disclosure of the invention in this specification includes all possible combinations of such particular features . for example , where a particular feature is disclosed in the context of a particular aspect or embodiment of the invention , or a particular claim , that feature can also be used , to the extent possible , in combination with and / or in the context of other particular aspects and embodiments of the invention , and in the invention generally . referring now in detail to the fig1 though 11 a , wherein the same numbers are used where applicable , a fuel control apparatus , namely a servo , constructed in accordance with an embodiment of the invention is identified generally as the reference number 100 . although the description below anticipates the servo ( 100 ) will be used on homebuilt aircraft , it will be obvious to those skilled in the art that the servo ( 100 ) can be used on any type of aircraft and generally , on any combustion engine of appropriate size . referring to fig4 and 5 , the servo ( 100 ) comprises an air passage mechanism (“ throttle body ”) ( 200 ), a fuel pressure modifying mechanism ( 300 ), and a fuel metering mechanism ( 400 ). the throttle body ( 200 ) comprises a central section ( 210 ) that defines a plenum ( 205 ). the throttle body ( 200 ) further comprises a first end ( 201 ) and a second end ( 202 ). a venturi ( 500 ) is mounted within the plenum ( 205 ) at a location between the first end ( 201 ) and the second end ( 202 ). also mounted within the plenum ( 205 ) is a throttle valve ( 204 ). the fuel pressure modifying mechanism ( 300 ) comprises a mixture control valve and an idle valve ( 305 ), as shown in fig7 . the underlying principles of the servo ( 100 ) are well known in the art . generally , air flows through the throttle body ( 200 ) and works in combination with the venturi ( 500 ), fuel metering system ( 400 ), and other components to provide the proper amount of fuel to the combustion chambers of the engine . the amount of fuel received in the combustion chamber is directly proportional to air flow . this is accomplished by channeling ambient air impact pressure and venturi suction pressure to opposite sides of an air diaphragm into the fuel metering system ( 400 ). more specifically , referring to fig8 , fuel is supplied to the engine from the aircraft fuel system . this system usually comprises an engine driven pump (“ fuel pump ”) ( 600 ) and a boost pump ( 605 ) that supplies fuel , at a relatively constant pressure , to the pressure modifying mechanism ( 300 ). engine manufacturers specify the required fuel pump ( 600 ) pressure for a specific type of fuel injection servo . the fuel injection servo is calibrated at the servo inlet pressure . the fuel injection servo is tuned to assure that metered fuel flow will not be affected by changes in inlet fuel pressure caused by boost pump on or off operations . air flow through the throttle body ( 200 ) generates an air pressure differential which is the difference between the impact pressure and the venturi suction pressure . this pressure differential applied across the air diaphragm exerts force f 1 . fuel flow to the engine , passes through a main metering jet ( 305 ), generating a fuel pressure differential which is the difference between un - metered fuel and metered fuel pressure . this pressure deferential , applied across the fuel diaphragm exerts force f 2 . when f 1 is equal to f 2 , the servo valve ( 310 ) is held in a fixed position allowing discharge of enough metered fuel to maintain a pressure balance . if the throttle valve ( 204 ) is opened to increase power , air flow increases resulting in a increase pressure differential across the air diaphragm asserting a force of f 1 ′. f 1 ′ causes the servo valve ( 310 ) to move to the right causing a decrease in differential pressure across the fuel diaphragm which asserts a force f 2 ′. when f 2 ′ equals f 1 ′, the system reaches a steady state condition described above . this sequence of operations is true over all power changes . in this system , it is essential to have the largest differential pressure over the air diaphragm . one way to adjust the differential pressure is by adjusting the venturi ( 500 ). fig1 and 1a shows a fuel injection servo that is well known in the art . as described above , a fuel injection servo can be tuned by changing the size of the venturi ( 500 ). this is difficult and time consuming . referring to fig9 and 9a , the servo ( 100 ) allows the manufacturer to easily adjust the differential air pressure over the air diaphragm . the servo ( 100 ) has a single venturi suction tube ( 505 ) and a shim ( 506 ). the venturi suction tube ( 505 ) senses the venturi pressure . the shim ( 506 ) allows the manufacturer to make minor changes in the location of the venturi suction tube ( 505 ). consequently , it is easier for the manufacturer to adjust the venturi pressure prior to leaving the factory . the amount of fuel received by the engine at lower speeds can be optimized by modifying the idle valve ( 305 ). fig6 shows an exploded view of a idle valve ( 305 ) known in the art . the idle valve ( 305 ) comprises a metering jet ( 310 ) and a rotating plate ( 315 ). the metering jet ( 310 ) defines a metering jet hole ( 311 ) that allows fuel to flow into the servo ( 100 ). the rotating plate ( 315 ) defines a notch ( 316 ). as the rotating plate ( 315 ) turns the size of the metering jet hole ( 311 ) changes depending on up the location of the notch ( 316 ). fig7 shows an exploded view of the idle valve ( 305 ) on the servo ( 100 ). the idle valve ( 305 ) comprises a metering jet ( 320 ) and a means to modify the metering jet ( 328 ). the metering jet ( 320 ) screws into a barrel valve ( 321 ). the barrel valve ( 321 ) is comprised of a sleeve piece ( 322 ) and a barrel ( 324 ). the barrel ( 324 ) fits into the sleeve ( 322 ). the sleeve defines an outlet hole ( 325 ). the barrel defines a notched hole ( 326 ). the effective size of the outlet hole ( 325 ) is reduced depending on the location of the notched hole ( 326 ). that is when the notched holed ( 326 ) is lined up with the outlet hole ( 325 ), fuel flow through the metered jet ( 320 ) is at a maximum . the means to modify the metering jet ( 328 ) comprises a needle valve ( 329 ). the needle valve ( 329 ) sits inside the barrel valve ( 321 ). depending on the position of the needle valve ( 329 ) the effective size of the metering jet ( 320 ) can decrease thereby , decreasing the amount of fuel the engine receives . the position of the needle valve ( 329 ) is controlled by screw ( 327 ). the screw ( 327 ) is accessible to the homebuilder , allowing the homebuilder to fine tune the amount of metered fuel entering the engine . also , because of the smooth travel and minimal loading of the barrel valve ( 321 ), wear and tear is minimal . additionally , if a component of the idle valve ( 305 ) wears , only that component would need to be replaced . in a second embodiment , the servo ( 100 ) is spis which replaces the carburetor of smaller aircraft . carburetor flaws are discussed above . homebuilders who prefer a fuel injection system can adapt a mpis for their smaller aircraft . however , adaptation of a mpis is not an ideal solution for the homebuilder . carburetors , known in the art , receive fuel at a point above the throttle valve leaving fuel to vaporize causing icing on the carburetor and , in some cases , icing on the throttle valve . referring to fig1 and 10a , fuel enters the servo ( 100 ) at a position downstream the throttle valve ( 205 ). as discussed above , smaller aircraft have a delayed response at lift off ( or acceleration ). this is a natural occurrence in smaller aircraft because the fuel discharge is further away from the cylinders . consequently , in the second embodiment , the fuel pressure modifying mechanism ( 300 ) further comprises an accelerator pump with a fuel reservoir ( 350 ) to compensate for the distance between the fuel discharge and the cylinder , as shown in fig1 and 11a . accelerator pumps are well known in the art . the greater inertia of liquid gasoline , compared to air means that if the throttle is suddenly opened , the airflow will increase more rapidly than the fuel flow , which can cause a temporary lean condition which causes the engine to stumble under acceleration . this is remedied by the use of an accelerator pump . the fuel reservoir ( 350 ) holds a reserved amount of fuel to compensate for the distance between the fuel outlet and the cylinder . when the throttle valve ( 205 ) opens there exists an increase in the pressure differential across the air diaphragm which causes the servo valve ( 310 ) to open creating a sudden drop in metered fuel pressure and causing the reservoir ( 350 ) to empty . when the throttle valve ( 205 ) is still or is closing and the metered fuel stabilizes , the fuel reservoir ( 350 ) fills .	5
reference to the drawings illustrating various views of exemplary embodiments of the present invention is now made . in the drawings and the description of the drawings herein , certain terminology is used for convenience only and is not to be taken as limiting the embodiments of the present invention . furthermore , in the drawings and the description below , like numerals indicate like elements throughout . illustrated in fig1 is a top view of an exemplary embodiment of a magnetoelastic sensor , generally designated as 100 , in accordance with an exemplary embodiment of the present invention . fig2 a illustrates a right - side view along a cross - section of the magnetoelastic sensor 100 at a section line 180 , and fig2 b illustrates a left - side view along a cross - section of the magnetoelastic sensor 100 taken at a section line 170 . referring to fig1 , 2 a , and 2 b , the magnetoelastic sensor 100 comprises a plate 110 , a first distribution bar 120 connected to the plate 110 at a first end 111 of the plate 110 , and a second distribution bar 130 connected to the plate 110 at a second end 112 of the plate 110 . disposed in the plate 110 is a magnetic band 140 . in the exemplary embodiment of the magnetic band 140 illustrated in fig1 , the magnetic band 140 is an annulus . in other exemplary embodiments of the magnetic band 140 , different shapes of the magnetic band 140 are contemplated . for example , the magnetic band 140 may be diamond shaped . it is to be understood that the plate 110 may have various dimensions , may not be perfectly planar on either surface , and may not have a perfectly uniform thickness across its entire length . disposed above the magnetic band 140 are a plurality of sensor assemblies 150 a , 150 b , 150 c , and 150 d . each of the sensor assemblies 150 a , 150 b , 150 c , and 150 d comprises , respectively , a sensor platform 152 a , 152 b , 152 c , and 152 d on which a respective sensor 154 a , 154 b , 154 c , and 154 d is disposed . the sensors 154 a and 154 c are disposed along the section line 170 ( also referred to herein as “ centerline 170 ”). the sensors 154 b and 154 d are disposed along the section line 180 ( also referred to herein as “ centerline 180 ”). the centerline 170 longitudinally bisects the sensor assemblies 150 a and 150 c and their respective sensors 154 a and 154 c . the center line 170 longitudinally bisects the sensor assemblies 150 b and 150 d and their respective sensors 154 b and 154 d . the sensors 154 a , 154 b , 154 c , and 154 d are disposed symmetrically about a center point 165 of the plate 110 , which center point 165 is also the center point of the magnetic band 140 . the sensors 154 a , 154 b , 154 c , and 154 d are disposed over the magnetic band 140 such that a centerline 145 of the magnetic band 140 laterally bisects the sensors 154 a , 154 b , 154 c , and 154 d . the sensor assemblies 150 a , 150 b , 150 c , and 150 d are disposed on the magnetic band 140 each at a respective angle , − α , α , − α , and α , relative to a longitudinal axis 160 of the plate 110 . the angles , α and − α , are chosen so that the centerlines 170 and 180 are neither parallel to the longitudinal axis 160 nor perpendicular thereto . in an exemplary embodiment , the angles , α and − α , are chosen so that the centerlines 170 and 180 intersect the magnetized band 140 perpendicularly to a tangent of the centerline 145 of the magnetic band 140 , and where the magnetic field produced by the magnetic band 140 at the points of intersection is neither parallel nor perpendicular to the centerline 160 of the plate 110 . in another exemplary embodiment , the magnitude of angle , α , − α , is chosen to be greater than or equal to 30 ° and less than or equal to 60 °. in yet another exemplary embodiment , the magnitude of angle , α , − α , is chosen to be greater than or equal to 40 ° and less than or equal to 50 °. in still another exemplary embodiment , the magnitude of angle , α , − α , is 45 °. the magnetic field sensors 154 a , 154 b , 154 c , and 154 d each produce an output signal that changes when a magnetic field produced by the magnetized band 140 in a direction parallel to the centerlines 170 and 180 changes . the magnetic field sensors 154 a and 154 c have high sensitivity to magnetic fields parallel to the centerline 170 , and the magnetic field sensors 154 b and 154 d have high sensitivity to magnetic fields parallel to the centerline 180 . the first and second distribution bars 120 , 130 at the top 111 and the bottom 112 of the plate 110 are thicker than the plate 110 . thus , as forces , f 1 and f 2 , are applied to the distribution bars 120 , 130 , respectively , an even amount of strain or compression is produced in the plate 110 , rather than a large amount of strain or compression along the center line 160 of the plate 110 and less elsewhere . in an alternative exemplary embodiment of the magnetoelastic sensor 100 , the first and second distribution bars 120 , 130 are formed integrally with the plate 110 and are areas of the plate that are thicker than the portion of the plate 110 in which the magnetized band 140 is disposed . in such embodiment , as forces , f 1 and f 2 , are applied to the distribution bars 120 , 130 , respectively , an even amount of strain or compression is produced in the plate 110 , rather than a large amount of strain along the center line 160 of the plate 110 and less elsewhere . in the exemplary embodiment of the magnetoelastic sensor 100 described above , the magnetic band 140 is formed within the plate 110 . in such embodiment , the magnetic band 140 may be formed from a magnetized band that is molded within a nonmagnetized or nonmagnetizable , e . g ., non - ferromagnetic , plate 110 . in another exemplary embodiment of the magnetoelastic sensor 100 , the magnetic band 140 may be a magnetized region of the plate 110 , in which case the plate 110 is formed entirely from a ferromagnetic material . it is to be understood that other exemplary embodiments of the magnetoelastic sensor 100 in which the magnetic band 140 is disposed above or on a top surface 113 of the plate 110 are contemplated . in such other embodiments , the plate 110 is not magnetized and may be formed from a material that is not capable of being magnetized . in yet another exemplary embodiment of the magnetoelastic sensor 100 , the plate 110 is made from a non - magnetic material where the region 140 can be subjected to a process to change its metallurgical phase . a type of austenitic non - magnetic stainless steel alloy is selected to form the plate 110 . the area corresponding to the region 140 is cold - worked to convert it to martensite , which is ferromagnetic . the plate 110 is rotated around an axis perpendicular to the center point 165 of the plate 110 , and then while it is rotating , a permanent magnet is brought close to the surface 113 of the plate 110 near the area of the plate 110 corresponding to the region 140 for a large number of revolutions . the permanent magnet is removed after a magnetization direction has been imparted in the region 140 . this approach is beneficial because forming the plate 110 from a homogeneously ferromagnetic material could lead to problems , and molding or attaching the region 140 could be problematic because of the extremely high interface shear stresses in the plate 110 in certain applications . sensor assemblies in accordance with the exemplary embodiments described herein are then mounted above the surface 113 of the plate 110 . in an exemplary embodiment in which the plate 110 is formed from a ferromagnetic material , the magnetized band 140 having a circumferential magnetization direction indicated by the arrowed centerline 145 in fig1 is produced by rotating the plate 110 around an axis perpendicular to the center point 165 of the plate 110 , and then while it is rotating , bringing a permanent magnet close to the surface 113 of the plate 110 for a large number of revolutions . the permanent magnet is removed after a magnetization direction has been imparted in the magnetic band 140 , which is a magnetized region of the plate 110 . in this exemplary embodiment , the plate 110 is formed from a ferromagnetic material . it is to be understood that reference number 145 also refers to the magnetic field produced by the magnetic band 140 . sensor assemblies in accordance with the exemplary embodiments described herein are then mounted above the surface 113 of the plate 110 . although fig1 illustrates a single magnetic band 140 , it is to be understood that other exemplary embodiments in which a plurality of permanent magnets placed at various azimuthal locations in the plate 110 can also be used . in other exemplary embodiments , more than one magnetic band may be formed in or on the plate 110 , in which case the magnetoelastic sensor comprises four sensor assemblies for each ring . in still other exemplary embodiments , instead of a permanent magnet forming the magnetic band 140 , an electromagnet is used to produce the magnetized band 140 . fig2 a illustrates the relative positions of the sensor assemblies 150 b and 150 d and the plate 110 . fig2 b illustrates the relative positions of the sensor assemblies 150 a and 150 c and the plate 110 . as illustrated in fig2 a and 2b , the sensor platforms 152 a , 152 b , 152 c , and 152 d comprise , respectively , inside surfaces 151 a , 151 b , 151 c , and 151 d on which the sensors 154 a , 154 b , 154 c , and 154 d are respectively disposed . the sensor platforms 152 a , 152 b , 152 c , and 152 d further comprise , respectively , outside surfaces 153 a , 153 b , 153 c , and 153 d . the inside surfaces 151 a , 151 b , 151 c , and 151 d face the magnetic band 140 such that the sensors 154 a , 154 b , 154 c , and 154 d , as disposed on the respective inside surfaces 151 a , 151 b , 151 c , and 151 d , are between the magnetic band 140 and the respective sensor platforms 152 a , 152 b , 152 c , and 152 d . fig3 illustrates a detailed view of a region 300 of the plate 110 under the sensor assembly 150 c and specifically a region 300 of the magnetic band 140 under the sensor assembly 150 c , in accordance with an exemplary embodiment of the present invention . inside this region 300 , there are illustrated a tension axis ( also referred to as a “ magnetoelastic anisotropy axis ”) 310 , a first effective anisotropy axis 320 , and a second effective anisotropy axis 330 . the first effective anisotropy axis 320 is the direction of the magnetic field 145 produced by the magnetic band 140 when the forces , f 1 and f 2 , are not present . the second effective anisotropy axis 330 is the direction of the magnetic field 145 produced by the magnetic band 140 when the forces , f 1 and f 2 , are present . the second effective anisotropy axis 330 is a result of the combination of the tension axis 310 and the first effective anisotropy axis 320 and is proportional to the strength of the forces , f 1 and f 2 . the first effective anisotropy axis 320 is offset from the second effective anisotropy axis 330 by an angle β , which changes as the magnitude of the forces , f 1 and f 2 , change . the angle , β , increases as the magnitude of the forces , f 1 and f 2 , increase and decreases at the magnitude of the forces , f 1 and f 2 , decrease . fig4 illustrates another detailed view of the region 300 of the plate 110 , in accordance with an exemplary embodiment of the present invention . the view of the region 300 in fig4 illustrates an effect of the tension caused by the forces , f 1 and f 2 . the magnetic field 145 in the magnetic band 140 is represented in fig4 by a vector 410 . as the direction of the effective first anisotropy axis 320 changes to the direction of the second anisotropy axis 330 , the magnetic field 410 inside the magnetic band 145 changes direction to a direction represented by a vector 420 . the change in magnetic field is represented by a vector 430 , which is perpendicular to the vector 410 , the sum of the vectors 410 and 430 being the vector 420 . the change of the magnetic field , i . e ., the magnetic field component 430 , produces a change in the magnetic field outside the plate 110 in the region 300 . the sensor 154 c is positioned to detect the change in the magnetic field 430 outside the plate 140 . the sensor 154 c is positioned to be especially sensitive to magnetic fields in an outwardly radial direction , i . e ., in a direction parallel to the centerline 170 . thus , the sensor 154 c is positioned to sense the component of the magnetic field outside the plate 140 caused by the magnetic field component 430 . the sensor 154 c is configured to output a signal indicative of the magnetic field 430 when the tension caused by the forces , f 1 and f 2 , is present . the sensors 154 a , 154 b , and 154 d are positioned similarly to the sensor 154 c . thus , the sensor 154 a is positioned to be especially sensitive to magnetic fields in an outwardly radial direction , i . e ., in a direction parallel to the centerline 170 . the sensors 154 b and 154 d are positioned to be especially sensitive to magnetic fields in a direction parallel to the centerline 180 . the sensors 154 a , 154 b , and 154 d are positioned to sense a component of the magnetic field outside the plate 140 caused by a change of the magnetic field outside of the plate 110 because of tension in the plate 110 . although fig3 and 4 are described with reference to a tension in the plate 110 , it is to be understood that such description is applicable to an instance in which the forces , f 1 and f 2 , cause compression in the plate 110 . under compression , however , the changes in the anisotropy axis and the magnetic fields are opposite to the changes described with reference to fig3 and 4 when tension is present . referring now to fig5 , there is illustrated the magnetoelastic tension sensor 100 of fig1 annotated to show strain axes 510 and 520 , in accordance with an exemplary embodiment of the present invention . the strain axis 510 passes through a center point of the sensor 154 c and the center point of the sensor 154 b . the strain axis 520 passes through a center point of the sensor 154 d , and the center point of the sensor 154 a . the sensor assembly 150 a is positioned to sense a portion 145 a of the magnetic field 145 ; sensor assembly 150 b is positioned to sense a portion 145 b of the magnetic field 145 ; sensor assembly 150 c is positioned to sense a portion 145 c of the magnetic field 145 ; and sensor assembly 150 d is positioned to sense a portion 145 d of the magnetic field 145 . the sensors 154 a through 154 d produce respective signals indicative of the magnetic fields that they sense . each sensor signal produced by the sensors 154 a through 154 d comprises a first component resulting from the tension or compression in the plate 110 caused by the forces , f 1 and f 2 , and a second component resulting from environmental magnetic field ( s ). when connected correctly to electronic circuitry ( described below with reference to fig1 ), the first components of the sensor signals provided by the magnetic field sensors 154 a , 154 b , 154 c , and 154 d in response to the tension or compression created by the forces , f 1 and f 2 , add constructively . the second component of the sensor signals provided by the magnetic field sensors 154 a , 154 b , 154 c , and 154 d in response to environmental magnetic fields largely add destructively . thus , the final sensor output ( described below with reference to fig1 ) is mostly insensitive to environmental magnetic fields . referring now to fig6 , there are illustrated various directions of the changes in the magnetic fields produced at the locations of the sensor assemblies 150 a , 150 b , 150 c , and 150 d as a result of tension in the plate 110 , in accordance with an exemplary embodiment of the present invention . when the plate 110 is placed under tension , the magnetic field 145 a under the sensor assembly 150 a changes , as represented by a vector 650 a ; the magnetic field 145 b under the sensor assembly 150 b changes , as represented by a vector 650 b ; the magnetic field 145 c under the sensor assembly 150 c changes , as represented by a vector 650 c ; and the magnetic field 145 d under the sensor assembly 150 d changes , as represented by a vector 650 d . the angles of the vectors 650 a , 650 b , 650 c , and 650 d are − α , α , α , and − α relative to the centerline 160 of the plate 110 ( illustrated in fig1 ). providing for the magnetic field sensors 154 a , 154 b , 154 c , and 154 d to have identical polarity of sensitivity to the changes 650 a , 650 b , 650 c , and 650 d in the magnetic field 145 produced by the magnetized band 140 causes the sensitivity of the final sensor output to the tension to be high . note that the direction of the vector 650 c is the same as the vector 430 . in one exemplary embodiment , the magnetic field sensors 154 a , 154 b , 154 c are fluxgate magnetometers . in another exemplary embodiment , the magnetic field sensors 154 a , 154 b , 154 c are hall sensors . the various embodiments of the magnetoelastic sensor 100 described herein are advantageous in that the magnetic field sensors 154 a , 154 b , 154 c , and 154 d sense very little magnetic field when the tension or compression is not present . this is the result of the magnetic band 140 being ring shaped or generally symmetrical about the center point 165 . thus , the magnetoelastic sensor 100 ideally has no unpaired magnetic poles where the sensor assemblies 150 a , 150 b , 150 c , and 150 d are disposed . illustrated in fig7 is an exemplary alternative embodiment of the magnetoelastic sensor 100 , generally designated in fig7 as 700 , in accordance with an exemplary embodiment of the present invention . in the magnetoelastic sensor 700 , the sensor assemblies 150 a through 150 d are replaced with sensor assemblies 750 a through 750 d . the magnetoelastic sensor 700 is otherwise similar to the magnetoelastic sensor 100 . illustrated in fig8 a and 8b are cross - sectional views of the magnetoelastic sensor 700 , in accordance with an exemplary embodiment of the present invention . fig8 a illustrates a right - side view along a cross - section of the magnetoelastic sensor 700 at the centerline 180 , and fig8 b illustrates a left - side view along a cross - section of the magnetoelastic sensor 700 taken at the centerline 170 . the sensor assemblies 750 a through 750 d comprise respective sensor platforms 752 a , 752 b , 752 c , and 752 d , respectively , having inside surfaces 751 a , 751 b , 751 c , and 751 d and outside surfaces 753 a , 753 b , 753 c , and 753 d . the sensor assemblies 750 a through 750 d further comprise , respectively , first sensors 754 a , 754 b , 754 c , and 754 d disposed , respectively , on the inside surfaces 751 a , 751 b , 751 c , and 751 d and second sensors 755 a , 755 b , 755 c , and 755 d disposed , respectively , on the outside surfaces 753 a , 753 b , 753 c , and 753 d . the first sensors 754 a , 754 b , 754 c , and 754 d and the second sensors 756 a , 756 b , 756 c , and 756 d are symmetrically disposed about the center point 165 of the plate 110 . the second sensors 756 a , 756 b , 756 c , and 756 d are disposed near the first sensors 754 a , 754 b , 754 c , and 754 d but at a distance greater from the magnetic band 140 than the first sensors 754 a , 754 b , 754 c , and 754 d . the first sensors 754 a , 754 b , 754 c , and 754 d are chosen to have a direction of sensitivity opposite ( 180 °) from their respective paired second sensors 756 a , 756 b , 756 c , and 756 d . the pairing reduces the sensitivity of the magnetoelastic sensor 700 to ambient magnetic fields compared to the magnetoelastic sensor 100 . the first sensors 754 a and 754 c are disposed above the magnetic band 140 along the centerline 170 , and the first sensors 754 b and 754 d are disposed above the magnetic band 140 along the centerline 180 . the centerline 170 longitudinally bisects the first sensors 754 a and 754 c , and the centerline 180 longitudinally bisects the first sensors 754 b and 754 d . the sensors 754 a , 754 b , 754 c , and 754 d are disposed over the magnetic band 140 such that a centerline 145 of the magnetic band 140 laterally bisects the sensors 754 a , 754 b , 754 c , and 754 d . the second sensors 756 a and 755 c are respectively disposed above the first sensors 754 a and 754 c along the centerline 170 , and the second sensors 756 b and 756 d are respectively disposed above the first sensors 754 b and 754 d along the centerline 180 . the centerline 170 longitudinally bisects the second sensors 756 a and 756 c , and the centerline 180 longitudinally bisects the second sensors 756 b and 756 d . the sensors 755 a , 755 b , 755 c , and 755 d are disposed over the magnetic band 140 such that a centerline 145 of the magnetic band 140 laterally bisects the sensors 755 a , 755 b , 755 c , and 755 d . fig9 , 10 a , and 10 b illustrate an exemplary alternative embodiment of the magnetoelastic sensor 700 , generally designated in fig9 , 10 a , and 10 b as 900 , in accordance with an exemplary embodiment of the present invention . fig1 a and 10b illustrate cross - sections of the magnetoelastic sensor 900 taken along the centerlines 180 and 170 , respectively . the magnetoelastic sensor 900 comprises the elements of the magnetoelastic sensor 700 . in the magnetoelastic sensor 900 , the sensor assemblies 750 a through 750 d are replaced with sensor assemblies 950 a through 950 d . the sensor assemblies 950 a through 950 d comprise respective sensor platforms 952 a , 952 b , 952 c , and 952 d respectively having inside surfaces 951 a , 951 b , 951 c , and 951 d and outside surfaces 953 a , 953 b , 953 c , and 953 d . the sensor assemblies 950 a through 950 d further comprise , respectively , first sensors 954 a , 954 b , 954 c , and 954 d disposed , respectively , on the inside surfaces 951 a , 951 b , 951 c , and 951 d and second sensors 956 a , 956 b , 956 c , and 956 d disposed , respectively , on the outside surfaces 953 a , 953 b , 953 c , and 953 d . the sensor assemblies 950 a through 950 d are similar to the sensor assemblies 750 a through 750 d , but they differ in that the second sensors 956 a , 956 b , 956 c , and 956 d are inset radially relative to the center point 165 of the magnetic band 140 compared to the second sensors 755 a , 755 b , 755 c , and 755 d . this inset is best seen in fig9 . the magnetoelastic sensor 700 includes no such inset . referring now to fig1 , there is illustrated a schematic drawing of an exemplary embodiment of a sensor assembly , generally designated as 1100 , in accordance with an exemplary embodiment of the present invention . the sensor assembly 1100 comprises a magnetoelastic sensor 100 , 700 , or 900 connected to circuitry 1110 via a communications link 1115 . the magnetoelastic sensor 100 , 700 , or 900 outputs the signals from its sensor assemblies via the communications link 1115 to the circuitry 1110 . the circuitry 1110 combines the signals provided by the sensor assemblies and outputs the combined signal via an output 1120 . the output 1120 indicates the amount of tension or compression sensed by the magnetoelastic sensor 100 , 700 , or 900 . referring now to fig1 , there is illustrated a graph of data from a test of an exemplary implementation of the magnetoelastic sensor 100 . weights were hung from the exemplary implementation of the magnetoelastic sensor 100 , and the output voltage was recorded . the slope in the graph shows a sensitivity of 0 . 56 mv / pound . these and other advantages of the present invention will be apparent to those skilled in the art from the foregoing specification . accordingly , it is to be recognized by those skilled in the art that changes or modifications may be made to the above - described embodiments without departing from the broad inventive concepts of the invention . it is to be understood that this invention is not limited to the particular embodiments described herein , but is intended to include all changes and modifications that are within the scope and spirit of the invention .	6
in one embodiment , the invention provides a salt of l - carnitine or an alkanoyl - l - carnitine with benzoic acid . examples of alkanoyl - l - carnitines benzoic acid salts include acetyl - l - carnitine benzoic acid salt , propionyl - l - carnitine benzoic acid salt , butyryl - l - carnitine benzoic acid salt , valeryl - l - carnitine benzoic acid salt , and isovaleryl - l - carnitine benzoic acid salt . in one embodiment , the invention provides a composition suitable for human consumption containing a benzoic acid salt of l - carnitine or an alkanoyl l - carnitine selected from the group consisting of acetyl , propionyl , butyryl , valeryl and isovaleryl , in an amount sufficient to stabilize at least one property of the composition selected from the group consisting of flavor , color , smell and a combination of these ; and sufficient to at least partially compensate for a carnitine insufficiency in an individual ; and at least one additional edible ingredient . in certain embodiments , the composition can be in liquid form such as a functional beverage , flavored water , dietary supplement , energy food or a combination of these ; or a solid food product . furthermore , in other embodiments , separately or in combination with the above , the composition can also contain at least one additional source of l - carnitine or a salt thereof such as an alkanoyl derivative of l - carnitine or a salt thereof . in certain embodiments , separately or in combination with the above , the composition can also contain other edible ingredients such as an electrolyte , a mineral , a vitamin , a coenzyme , an antioxidant , a sweetener , a flavorant , and mixtures thereof . in one embodiment , the invention provides a packaged material such as a bottle , can or box , containing the composition described herein , which are preferably suitably structured to store and / or deliver the product to the consumer . in certain embodiments , the composition can be used to treat carnitine deficiency in an individual in need thereof , by providing the composition described herein to the individual whereby the individual consumes at least a part of the composition . in one embodiment , the invention provides food and / or beverage compositions containing l - carnitine benzoate , and / or any benzoic acid salt of l - carnitine . in such compositions , the treatment or supplementation of carnitine deficiency while simultaneously extending the shelf life of the product into which it is contained can be achieved . the stable , non - hygroscopic benzoic acid salts of l - carnitine have enhanced nutritional and / or therapeutic efficacy with respect to their inner salts congeners and to the compositions containing the benzoic acid salts of l - carnitine , particularly suited to ingestion in humans . carnitine and derivatives of carnitine can be used in various therapeutic uses such as e . g . in the cardiovascular field for the treatment of acute and chronic myocardial ischemia , angina pectoris , heart failure and cardiac arrhythmias . acetyl l - carnitine is used in the neurological field for the treatment of both central nervous system disturbances and peripheral neuropathies , particularly diabetic peripheral neuropathy . propionyl l - carnitine is used for the treatment of chronic arteriosclerosis obliterans , particularly in patients showing the symptom of severely disabling intermittent claudication . in professional athletes and other individuals engaging in physical activity , l - carnitine supplies energy to the skeletal musculature and increases the resistance to prolonged , intense stress , enhancing the performance capability of such individuals . in addition , the beverages and food compositions described herein can be used as nutritional supplements for both vegetarians , whose diets have a low carnitine content as well as a low content of the two amino acids , lysine and methionine ( the precursors of the biosynthesis of l (−)- carnitine in the kidneys and liver ) and those subjects who have to live on a diet poor in protein for prolonged periods of time . consequently , the beverage and food compositions described herein containing benzoic acid salts of carnitine or derivatives thereof , either as single components or in combinations with further active ingredients , can be in the form of functional beverages , flavored waters , dietary supplements , health foods , energy foods and similar products , such as oleomargarine , butter , cheese , sport supplements , meat replacement products , vegetarian products , baked goods , confectionaries , etc . other salts that may be used in place of or in addition to the benzoic acid salts include l - carnitine sorbate ( sorbic acid ), l - carnitine adipate ( adipic acid ) and l - carnitine lactate ( lactic acid ). each of these salts can perform anti - microbial action within the specific ph range characteristic for meat replacement , vegetarian , bakery and confectionary functional food platforms while providing a source of l - carnitine supplementation . in addition , other carnitine derivatives , such as salt forms and alkanoyl derivatives may be included in the compositions described herein . many fruit flavors , herbs , sweeteners , level of sweetness , vitamins , and nutritional supplements can be chosen , and therefore may combinations and products are possible . packaging design sometimes can serve as a good product differentiator . therefore , in one embodiment , an article such as a bottle , can or box containing the compositions of the invention is provided . the article can be composed of food - grade materials such as plastics , paper , aluminum and others . in a preferred embodiment , the article is configured in such a way to permit storage and / or delivery of the composition to the consumer . the compositions can be provided as dry powders by freeze drying , spray drying , etc , and as liquids , each of which may be premixed to deliver ready - to - use composition or as a concentrate which can be incorporated into liquid and / or solid edible mediums . if liquid , the composition can be carbonated or still . the compositions of the present invention can be provided as a variety of forms of . foods and beverages , for example , beverages such as sport drinks , fruit beverages , tea beverages , vegetable juices , dairy beverages , milk beverages , alcoholic drinks , jelly drinks , carbonated drinks , and the like ; confectionaries such as jelly , chewing gum , chocolate , ice cream , candy , biscuit , or the like ; starch - based processed foods such as snacks , breads , cakes , or the like ; protein - based processed foods such as . meat or meat substitute products , cheese , etc ; and supplements . additional additives to the compositions described herein include carbohydrates , electrolytes , carotenoids , vitamins , minerals , antioxidants , proteins , amino acids such as taurine , glutamine , and arginine , sugar or other natural or artificial sweeteners such as sucralose , aspartame , acesulfame - k , saccharin , cyclamate , neohesperidin dihydrochalcone , thaumatin , altame , stevioside , and glycyrrhzin , caffeine , ginseng , natural lipids and oils , plant extracts , fiber , fruits , jerry , or the like , milk components , flavors , flavor enhancers , food - approved colors , glucides such as flour , starches , hormones , nourishing components , and the like . the flavors useful in the compositions described herein are sometimes available as dry ingredients , liquids or emulsions . they can be mixed into the concentrate or final product form . in addition to the active flavor itself , industrially available flavors can contain , weighting agents , emulsifiers , emulsion stabilizers , antioxidants , liquid vehicles , and other common beverage and food manufacturing ingredients . the particular amount of the flavor component effective for imparting flavor characteristics depend upon the flavor , the flavor impression and formula flavor component . for example , using beverages as an example , the flavor can be included in at least 0 . 05 % by weight of the beverage composition and , for example , in a range of from 0 . 1 % to about 2 % by weight of the beverage in its final ready - to - use stage . in addition to fruity flavors , such as lemon , orange , lime , cherry , strawberry , raspberry , grape , grapefruit , and others , other flavors , e . g . cola , root beer , coffee , tea , botanical flavors can also be included in the compositions as well as those derived from nuts , bark , roots and leaves . combinations are may also be used . the ideal combination of color , taste , consistency ( mouth feel ) and appearance can pose shelf stability problems . a citrus green or carrot orange beverage will look best on the shelf if packaged in a clear container . clear , light admitting containers , along with the aqueous environment and contained sweeteners may significantly contribute to fermentative and oxidative reactions that at least tend to rapidly destroy the delicate flavor attributes of these products . flavor systems , critical to both brand development and repeat sales ; tend to be the most expensive part of any beverage formulation . the addition of benzoic acid salts of l - carnitine can improve shelf life for these types of products relative to a similar product not containing the benzoic acid salt of l - carnitine . food grade benzoic acid , itself difficult to handle for reasons of dissolution , performs relatively well in a reduced sodium or potassium salt . such preservatives have wide acceptance in the beverage industry , since they maintain a consistently acidic ph that naturally inhibits mold and other microbial growth of the type that disturbs beverage gas content and destroys flavor attributes . this is typically accomplished at concentrations of 0 . 1 % on a w / v basis . this can permit the preparation of ready to mix flavor bases that may be economically shipped to distant markets , an additional benefit . l - carnitine inner salt can be made in an acid base reaction with molten benzoic acid in such a way as to produce the a salt solution that may be dried to a fine white powder within a gas fired , rotary drum or similar dryer to a water content of lt 2 %. it may then be further processed , e . g ., drummed , or entered in various forms of roller compaction ( chilsonation ) then milled and screened to obtain preferred particle sizes . in one embodiment , particle size would be 100 % to pass a number 100 usbs mesh screen . particles may then be blended with a food grade , hydrophobic fumed or precipitated silica ( s ) that possesses an overall surface area of 190 - 475 square meters per gram and a tapped density of 80 - 275 grams per liter . obviously , numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described herein .	2
the problems associated with the use of sodium silicate cure accelerators that contain ec stemming from the relatively high freezing point of ec are alleviated by the instant discovery that mixtures of pc and another alkylene carbonate known as glycerine carbonate ( hereafter “ gc ”) accelerate the cure of sodium silicates to about the same extent as does pure ethylene carbonate . however , unlike ec , gc does not disadvantageously freeze at temperatures above − 40 ° c . thus , the invention provides blends of gc and pc that offer a wide range of curing times to the industry , while retaining liquid - state status over a broader temperature range than the cure accelerators of the prior art . it is known that the reactivity of alkylene carbonates with amines follows the order : ec & gt ; pc & gt ; bc . thus , the prior art teaches that the reactivity of the carbonates with amines decreases with the size of the substituent attached to the carbonate ring , and one of ordinary skill would naturally expect that gc should possess a relative reactivity somewhere between pc and bc , based on substituent size , given its molecular structure . however , as the data herein show , the reactivity of gc actually lies very close to that of ec in the case of catalyzing the cure of sodium silicate . cure accelerator blends according to the invention containing gc were found to cure sodium silicate as fast as ec as the data set forth herein shows . this result is unexpected in view of the reaction rate of gc in reactions with other chemical species , such as amines . the rate of sodium silicate cure in the presence of alkylene carbonates was determined by measuring the time required for the mixture to first show visible signs of gellation following the addition of the sodium silicate . in all cases , aqueous sodium silicate solution was added to a glass vial containing the desired alkylene carbonate or alkylene carbonate mixture . the resulting mixture was then stirred vigorously with a metal spatula and the time required for the mixture to change from a translucent liquid to an opaque gel was recorded . for each of the examples herein , the weight ratio of sodium silicate solution to carbonate ( s ) was maintained at 9 : 1 ( 10 wt . % carbonate ). sodium silicate mixtures possessing different ratios of silica ( sio 2 ) to sodium oxide ( na 2 o ) were tested . relevant properties of the different sodium silicate solution tested are given in the table i below : table i sio 2 / nao 2 water density viscosity brand * ratio ( wt . %) ( g / ml ) ( centipoise ) 1 3 . 22 62 . 4 1 . 38 180 2 3 . 21 61 . 7 1 . 40 237 3 2 . 40 52 . 9 1 . 56 600 4 1 . 80 62 . 5 1 . 44 * brand 1 - pq corporation , n ® clear * brand 2 - fisher scientific products , technical grade * brand 3 - pq corporation , ru ™, 10 % dilution with water * brand 4 - pq corporation , starso ® table ii below displays gel times ( in seconds ) for each of the aforementioned sodium silicate solutions in the presence of ec , pc , bc , gc , and mixtures thereof data is given in the format x - y , wherein x and y represent the time required to reach the onset of gel and a fully gelled state , respectively . note that the onset of gel is usually accompanied by an abrupt increase in the viscosity and cloudiness of the mixture , whereas a mixure that ceases to flow under the stirring action of the spatula is considered a gelled mixture . the time required for mixtures to fully harden was not measured . all values are an average of two trials . table ii carbonate component ( wt . %) sodium silicate brand ec pc bc gc 1 2 3 4 *** 100 — — — 10 - 13 13 - 16 39 - 61 104 - 108 100 — — 23 - 29 61 - 70 & gt ; 240 & gt ; 240 — — 100 — 215 - 234 * & gt ; 240 & gt ; 240 & gt ; 240 — — — 100 10 - 24 12 - 30 14 - 36 ** & gt ; 240 25 75 — — 14 - 18 26 - 32 240 - 260 & gt ; 240 50 50 — — 13 - 16 12 - 16 150 - 164 & gt ; 240 75 25 — — 10 - 12 12 - 16 103 - 114 195 - 199 — 90 10 — 27 - 33 81 - 87 & gt ; 240 & gt ; 240 — 70 30 — 46 - 60 * 122 - 130 * & gt ; 240 & gt ; 240 — 50 50 — 68 - 82 * 182 - 197 * & gt ; 240 & gt ; 240 — 95 — 5 18 - 22 48 - 54 & gt ; 240 & gt ; 240 — 90 — 10 16 - 20 31 - 39 & gt ; 240 & gt ; 240 — 80 — 20 10 - 12 13 - 22 235 - 252 & gt ; 240 — 70 — 30 10 - 12 11 - 16 151 - 168 & gt ; 240 — 50 — 50 & lt ; 10 10 - 15 58 - 76 & gt ; 240 — 25 — 75 & lt ; 10 & lt ; 10 33 - 43 & gt ; 240 90 — — 10 & lt ; 10 10 - 14 52 - 59 102 - 109 75 — — 25 & lt ; 10 10 - 14 34 - 46 107 - 114 40 — — 60 & lt ; 10 & lt ; 10 25 - 35 & gt ; 240 20 — — 80 & lt ; 10 12 - 20 ** 19 - 31 & gt ; 240 * unlike most mixtures , gellation of formulations containing bc is not accompanied by an abrupt viscosity increase . rather , gellation occurs over a broader time range . formulations containing significant amounts of gc are not initially compatible , which results in longer than expected mixing times to reach a gelled state . * unlike most mixtures , a slight to moderate exotherm accompanies gellation of all formulations containing sodium silicate brand 4 . it can be concluded from the data in table ii that the general order of cure enhancement due to the presence of added alkylene carbonate is as follows : ec ≅ gc & gt ; pc & gt ; bc . it can also be concluded that the rate of cure is strongly dependent on the sio 2 / na 2 o ratio and increases with this ratio . a ratio of sio 2 / na 2 o greater than 2 . 4 is required if fast curing is desired . in general mixtures of gc / pc blends outperformed the analogous ec / pc blends for all but brand 4 , which possesses an sio 2 / na 2 o ratio much too low to promote fast curing . in addition , ec / gc blends outperformed the analogous ec / pc blends as well . these results are set forth graphically in fig1 .	2
referring now to the figures of the drawings in detail and first , particularly to fig3 and 4 thereof , there is shown a measuring device with a cartridge according to the invention that is now explained in more detail . a frequency oscillator with mass balance 30 of the measuring device according to the invention has already been explained with reference to fig1 and 2 . such a frequency oscillator with mass balance 30 is inserted in the measuring device according to the invention or a part thereof . the frequency oscillator with mass balance 30 is inserted into a housing 21 , wherein the housing 21 is in the form of a cartridge 20 ; the cartridge 20 receives the frequency oscillator with mass balance 30 . furthermore , measuring and sensor electronics 23 are arranged in the cartridge 20 , and receive oscillation parameters of the frequency oscillator with mass balance 30 and / or forwards them and / or evaluates them . further , there is a memory unit 22 in the cartridge 20 , in which data are stored prior to the start of the measuring , wherein the data were obtained using density measurement standards for the frequency oscillator with mass balance 30 . alternatively , another frequency oscillator with mass balance could be used here . the inventive measuring device is shown in more detail in fig3 in its entirety . the measuring device 28 has an end part , in which may be arranged the displays , settings and / or the measuring and evaluation unit 50 , with which the data obtained from the measurement and sensor electronics 23 are evaluated . in principle , it would also be possible to arrange the measurement and evaluation unit 50 in the cartridge 20 . the measurement and evaluation unit 50 can also control the oscillation movement of the frequency oscillator with mass balance 30 . it can also do this , however , with its own control unit 51 . the cartridge 20 has connecting elements or a connection 25 via which the cartridge 20 can be connected with a base body 29 of the measuring device 28 , and which is connected with the end part . connecting parts , correspondingly adapted to one another , may be formed on the base body 29 and / or on the cartridge 20 as shown in fig3 by the number 31 . the measured fluid is supplied through the oscillator tube 10 , 11 , 12 , 13 via a connection 26 and an outlet 26 ′, which preferably link the inlet and outlet directly to the oscillator tube 10 , 11 , 12 , 13 . a corresponding contact 27 to which the evaluation unit 50 is connected , is provided for the transmission of the electrical signal . the control unit 51 is provided in the measuring device 28 and / or in the base body 29 to adjust the oscillation parameters of the frequency oscillator with mass balance 30 . a tube 35 may also be connected to the base body 29 , via which the medium to be examined can be supplied to the cartridge 20 via the inlet 26 . with appropriate suction or pump devices ( not shown ) medium can be sucked through the tube 35 and passed through the frequency oscillator with mass balance 30 for measurement . all relevant parts of the measurement and evaluation electronics together with the oscillator tube for the behavior characteristics may be housed together in an easily exchangeable , mechanically - resistant , partially - transparent , thermally - insulating , liquid - tight , sample - resistant enclosure or a cartridge , and electrically , mechanically and fluidly coupled to the measuring device or its housing via a detachable connection . the components housed in the cartridge include the relevant electronics containing exciter amplifier , exciter and sensor for the oscillation , for example , magnets , piezo elements , temperature sensors and / or as well as actuators , for example , for switching the excitation angle as well as backlighting for optical inspection of the cell filling . these components are preferably installed on at least a printed circuit board and fitted together with the frequency oscillator in the housing or in the cartridge . the cartridge can be factory - set for the respective measuring device through measurements of measurement standards , while the calibration data are made available to be electronically readable with the cartridge . the cartridge can thus be made available as a standalone part or kept in stock . the measuring device , optionally featuring a handle , contains in its housing , the control and evaluation electronics , including a microcontroller or computer , and the keyboard , monitor , voltage / power supply including power supply unit , battery , accumulator , and filling aids , e . g . syringe , pump or sampler , and , where appropriate , storage media for recording data and interfaces for the output of measured data . the measuring device may be equipped with different cartridges . the measuring device displays the calibration constants stored in the respective cartridge from the cartridge for each of the cartridges used , in order to calculate the measured value , e . g . density , by using the calibration constants that are stored in the cartridge . the liquid - tight and / or shock - absorbing and / or thermally - insulating cartridge can be connected with the measuring device via a plug for electrical or electronic coupling and grommets or cables and connection openings or openings for fluid coupling as well as mechanical fixings e . g . screws and / or clamps . at least the following electrical connections are made between the cartridge and the measuring device : electrical connections for the exciter mechanism and pick - up coil or excitation and pick - up piezo elements between the measuring device and the cartridge . in addition , a control signal for the phase angle of the excitation of the oscillator is sent to the cartridge . a control signal is sent to the cartridge to switch the backlighting of the oscillator on and off . an electrical periodic signal that is generated from the pick - up signal of the oscillator is sent as a characteristic signal for the density analysis from the cartridge to the measuring device . at least one , but preferably two , temperature measurement signal ( s ), for example concerning the environment and / or oscillator temperature , that are required for temperature compensation of the density measurement or pre - calculate equilibrium temperature , is / are sent from the cartridge to the measuring device . the voltage and / or current supply of the cartridge is supplied from the measuring device . a 1 - wire bus signal transmits the calibration constants from the cartridge to the measuring device . in addition , it is possible to store values from the measuring device in the data storage of the cartridge , such as oscillator - relevant data or the maximum acceleration during operation as well as quality checks ; for example , a water check is possible . thus , particularly in handheld devices , simple field replacement of defective frequency oscillators can be ensured without the need to re - set them . after aging , existing cartridges may be used again through factory re - setting . the contamination of the measuring device with the sample fluid can be prevented . after a breakage , defective measuring devices can be easily repaired by exchanging cartridges . servicing the device is simplified and is possible in the field . a set can be easily exchanged for suitable cartridges for different samples with frequency oscillators with mass balance . the frequency oscillator with mass balance can be protected against environmental influences . the entire cartridge can be immersed in the medium to be examined in order to generate optimized temperature control . in a particular embodiment , in addition to the excitation amplifier , an evaluation unit , for example a micro - controller , together with wired or wireless interfaces , such as rs232 , usb , bluetooth and / or wlan , is integrated into the cartridge . it is thus possible , to create a simple density measurement device with the cartridge in the form of a module or smart sensor without local operation or keyboard or visualization or display . the visualization and operation is effected by a pc , tablet pc or mobile phone medium by means of a pc program or application . the power for such a module can be supplied either directly from the communication interface , e . g . usb , can , or through a battery supply . in addition , the combination of a supply from the wired interface , e . g . usb , and wireless communication , e . g . bluetooth is also conceivable . for a preferred embodiment , the cartridge or its housing can be connected or screwed onto the housing of the measuring device or an additional housing or compartment of the measuring device via a connecting part , in particular a screw cap . an additional housing can be used as a battery compartment or as a support for communication ports , e . g . usb , can plugs / sockets , or , in the case of a wireless interface , as a carrier for the antennas . alternatively , it would also be possible to integrate the evaluation unit , not in the housing but in an additional housing in order to protect the evaluation unit in the event of an oscillator tube breakage . the tubing or the fluid path can be provided through this additional housing via connection nozzles or a tube adapter to the frequency oscillator with mass balance . ideally , this additional housing also serves as a base on which the housing is mounted . the coupling between the cartridge and the measuring device can be effected via a fluid distributor , which serves as a point of suspension and support and may optionally also be replaced . the two legs of the oscillator which are used for the supply and discharge of the sample are coupled or tightly connected to the fluid distributor . the fastening of the sensor of the frequency oscillator with mass balance in the housing is so configured that it is only fixed at the supports , and does not make mechanical contact with the housing wall . in this way , one can achieve an influence on the oscillation mechanical decoupling from environmental influences , for example , caused by impact or stress on the cartridge . the mounting of the cartridge on the measuring device is configured advantageously so that the fluid connections of the frequency oscillator in the measuring position of the measuring device are inclined upwards at an angle , for example , of 10 °, in the standing position of the measuring device , in particular they may be oriented directly upwards thus allowing gas bubbles , which are troublesome for density measurement , to escape . the connection is sealed by seals on the frequency oscillator with mass balance or the fluid distributor . the inlet and outlet of the fluid may be performed in principle by any filling mechanism . i . e . the sample may be supplied either manually by a manual pump , but also electrically supplied by a pump motor or a linear drive for the supply of the hand pump . the hand pump can be in the form , for example , of a spring - loaded syringe that is tensioned against the spring force by the user and then the sample is automatically sucked out under the action of the spring force . in a simple form that is preferred for high - viscosity liquids , the sample can be passed from a syringe into the frequency oscillator with mass balance . sampling by pumping from a reservoir is also possible , such as an arrangement in the handheld device for controlled withdrawal from a sample container by a syringe . the connections from the respective filling system can be made to the fluid distributor of the measuring device . the cartridge is secured to the measuring device by dowel pins , quick release fasteners , screw caps with a union nut or similar devices . the electrical connections are made separately via a plug contact , or the plug contacts are already on the measuring device and the cartridge is so fixed that the contact is made by a precisely fitting insertion . an electrically contactless coupling is also possible between the cartridge and the measuring device . by known procedures , e . g . transformers , optocouplers , rfid , etc ., both the power supply and the data communication can take place wirelessly . this can thus prevent the problem of fluid sealing or the disadvantages of mechanical plugs due to corrosion , contact problems , and so on . the encapsulation of the frequency oscillator with mass balance and the electronic components is carried out in a preferred manner with unbreakable material . this can be done simply , for example , by a metallic enclosure in the case of metallic oscillators . a visual check of the filled fluid for bubbles is possible in the case of glass oscillators . these glass oscillators are , therefore , preferably encased with transparent materials . this may be glass but also , for example , shatterproof plastic material , e . g . polycarbonate . in addition , at least a part of the cartridge is transparent and the cartridge can have a viewing window . the cartridge can be fitted with lighting of the frequency oscillator with mass balance to facilitate the optical control of the filled fluid . backlighting may be attached to the back of the oscillator tube against the viewing window . optionally , a reflective film for observing the filling level may be mounted behind the oscillator . a partial section of the cartridge may be in the form of a magnifying glass in order to facilitate and improve the visual inspection . in one embodiment , the housing of the cartridge may also be thermally insulated . thus the influence of changing environmental conditions can be minimized especially in handheld instruments . the insulation can provide a more rapid achievement of stable measurement conditions which means shorter measuring times in combination with the measurement of two temperature values for the housing and the oscillator by pre - calculated temperature equilibrium . the housing contains at least one , preferably two , temperature sensor ( s ), e . g . ntcs , ptc &# 39 ; s , thermocouples etc . in order to detect the attainment of stable temperature conditions in the housing . thus , both the temperature of the oscillator tube on filling the oscillator with the fluid as well as the temperature in the interior of the cartridge , can be measured . this allows a stable measurement point to be reached in the measurement by a hand - held measuring device without temperature control and this allows to measure the temperature of the sample at the time of measurement . by using calibration tables , optionally calibration polynomials , for the temperature dependence of the density of different samples , the density at any temperature can be determined . in the case of laboratory equipment with temperature control of the sample , the sample temperature can be checked as necessary . the calibration data of the temperature measurement used and the calibration constants for the evaluation of the density from the measurement signals of the frequency oscillator are determined for each factory - set frequency oscillator with mass balance and made available in the cartridge for incorporation into , or transfer to , the measuring device . in the simplest case , the cartridges are provided with a unique identifier , such as a number or an electronically - readable code such as a barcode . the calibration data can be entered from a datasheet with this number to ensure compatibility with the measuring device and can be accessed with the number in the storage media for evaluation of the measured data . the calibration data can thereby also be transmitted on a data carrier / storage media and copied or interpreted from the measuring device with a reader . the calibration data can be read out electronically , for example , via an interface and read by the measuring device . in one embodiment , the cartridge can be automatically recognized by the measuring device and the factory calibration data can be stored directly on the non - volatile memory on the cartridge . on aging of the oscillator , it can possibly be factory reset through additional calibration measurements . in one embodiment , the calibration data are made directly available to the cartridge from a non - volatile memory , where they can be read out directly from the measuring device for example an i - button from dallas using a known one - wire bus system via a single contact and be stored in the memory on calibration . in another embodiment , the data can be written at the factory to a rfid - tag and be read from the measuring device by an optional non - contact reader , for example , incorporated in the measuring device . the installation of the cartridge can be performed with an additional degree of freedom for shock absorption in order to reduce the likelihood of breakage of the oscillator and to increase the robustness of the entire measuring device . for this purpose , the connection between the instrument and the cartridge may be cushioned by the use of resilient elements , for example , rubber seals . the cartridge advantageously completely or fully encloses the components arranged inside .	6
fig1 shows a foldable box 1 in the folded state , comprising i ) panels 2 which are linked by folds 4 , together with ii ) flaps 6 . each panel 2 has a width w 2 , measured perpendicularly to the folds 4 , corresponding to the height of the foldable box 1 in the unfolded state . each flap 6 is linked to a respective panel 2 by a fold 8 formed by a corrugating machine . two neighboring flaps 6 are separated by a respective slot 10 . each slot 10 extends between a central region 11 and a peripheral face 12 of the foldable box 1 . the slot 10 has a peripheral end 14 opening on the peripheral face 12 and delimiting a lateral interval 16 between the two neighboring flaps 6 . the slot 10 has a central end located in the central region 11 , and therefore opposite to the peripheral end 14 . as shown in fig1 , the foldable box 1 has a fault , because the slots 10 have oblique edges , instead of edges parallel to one another . one of the slots 10 has an excessively wide peripheral end 14 , and therefore an excessively large lateral interval 16 , while the other slot 10 has an excessively narrow peripheral end 14 , and therefore an excessively small lateral interval 16 . this fault may be due to incorrect cutting , incorrect gluing and / or incorrect folding . sometimes , a width w 10 of a slot 10 is determined near the folds 8 , by measurement in a prior art device , or by extrapolation in the case of the present invention . fig2 shows a manufacturing installation 50 intended to manufacture foldable boxes 1 and comprising at least : a gluing device 52 configured to apply glue to a gluing area of each foldable box 1 , a folding device 54 configured to fold panels 4 so as to glue an area to be glued onto the gluing area , a stacking device 56 configured for stacking the foldable boxes 1 in the folded state , a squaring device 60 configured for squaring the foldable boxes 1 so as to form packs 201 , a conveying device 58 , configured to place the foldable boxes 1 in the gluing device 52 , then in the folding device 54 , then in the stacking device 56 ; in this case , the conveying device 58 is a belt conveyor providing an output rate of the installation equal to about 1800 foldable boxes 1 per hour , and in the example of fig2 and 3 , the checking devices 200 are placed downstream of the stacking device 56 and of the squaring device 60 . the gluing device 52 , the folding device 54 , the stacking device 56 and the squaring device 60 follow one another from the upstream to the downstream end , in the direction of circulation determined by the conveying device 58 . each checking device 200 therefore checks the foldable boxes 1 in packs 201 . additionally , the two checking devices 200 are arranged so as to form respective images of two peripheral pack faces 212 , particularly the two opposite faces of each pack onto which the respective slots open and where the interval of the flaps at each face are seen and measured . this arrangement can be used to check all the slots of each foldable box 1 contained in a pack 201 . fig3 , 5 and 6 show one of the checking devices 200 . the checking device 200 comprises an illumination system 202 with two illumination sources 202 . 1 and 202 . 2 , two cameras 204 forming an imaging device , and an image processing system 206 . the illumination system 202 and the cameras 204 are mounted on a framework 203 . in this case , the checking device 200 is positioned in line ; that is to say , the checks are made when the conveying device 58 brings the packs 201 to a position in front of the checking device 200 . the conveying device 58 is arranged to convey the packs 201 in a horizontal direction . the illumination system 202 is configured to illuminate a pack 201 formed from superimposed foldable boxes , wherein the illumination system 202 is configured to illuminate the foldable boxes 1 one by one . the pack 201 has two peripheral pack faces 212 on which the slots 210 open , which are defined by peripheral faces of all the foldable boxes composing the pack 201 . the solid angle illuminated by one illumination system 202 . 1 is therefore larger than the solid angle illuminated by the other illumination system 202 . 2 . as shown in fig6 , the checking device 200 comprises two cameras 204 . the cameras 204 are placed at two different heights , so as to form plural images 205 of a lower part and an upper part , respectively , of the peripheral pack face 212 . thus the two cameras 204 can be used to form high - resolution plural images 205 , even if the packs 201 contain large numbers of foldable boxes 1 . in this case , the cameras 204 are configured for producing an overlap area between a plural image of the lower part of the pack 201 and a plural image of the upper part of the pack 201 . the checking device 200 is arranged so that the optical axis of each camera 204 forms an angle ( not shown ) of about 60 degrees to the horizontal direction . each camera 204 is a matrix camera , while the camera 204 may be a line scan camera . each camera 204 is configured to form at least one plural image 205 ( fig8 and 10 ) of the peripheral pack face 212 when the illumination system 202 illuminates the peripheral pack face 212 . each plural image 205 represents at least a part of the peripheral pack face 212 when the illumination system 202 illuminates the peripheral pack face 212 . fig8 , 13 , 14 and 16 show equivalent plural images 205 . the field of view of one camera 204 is therefore greater than the field of view of the other camera 204 . i ) detecting each peripheral end 214 ( fig4 and 8 ) in the plural image , that is to say all the peripheral ends 214 of the slots 210 defined by the foldable boxes composing the pack 201 , ii ) generating a set of data representing the geometry of each peripheral end 214 , iii ) analyzing the set of data so as to determine the width of each lateral interval 216 ( fig4 and 8 ). in the example of fig2 to 6 , the image processing system 206 is also configured for : a ) detecting the boundaries of the peripheral face 212 perpendicularly to the largest dimension of the peripheral pack face 212 , b ) measuring a reference level of brightness between one of these boundaries of the peripheral pack face 212 and an edge 205 of the plural image , and c ) generating a binary plural image 207 ( fig1 to 19 ) by using this reference brightness level to perform a thresholding operation on the plural image 205 . on the basis of a binary plural image 207 , the image processing system 206 can then : vii ) compare the height h 220 of each dark object 220 with the nominal thickness of a foldable box 1 in the folded state , viii ) select each dark object 220 having a height h 220 equivalent to the nominal thickness of a foldable box in the folded state subject to a predetermined tolerance , so that each dark object of the height is one folded box , and its folded condition can be singled out for consideration by the image processing system , xii ) extract dark objects 220 from each binary plural image 207 , xiii ) detect , in each binary plural image 207 , the boundaries of the foldable boxes forming the ends of the pack 201 perpendicularly to the largest dimension of a foldable box 1 in the folded state , and xiv ) discriminate each foldable box in the pack 201 ; the image processing system 206 carries out the discrimination of each foldable box by processing a binary plural image 207 ( fig1 to 19 ). the image processing system 206 then generates a set of data representing the geometry of the peripheral ends 214 of the slots 210 , so as to determine the width of each lateral interval 216 , for all the foldable boxes appearing in the binary plural image 207 , and therefore in the plural image 205 . by processing a single plural image 205 , the image processing system 206 can thus determine the lateral intervals 216 of the slots 210 of all the foldable boxes composing a pack 201 . in practice , the image obtained from one camera 204 is larger than the plural image 205 . the plural image 205 is the useful portion of the image obtained from a camera 204 , that is the portion where the lateral ends can be detected . in other words , the other portions of the image obtained from a camera 204 show no lateral ends . the useful portion can be selected automatically on the basis of the dimensions of each foldable box 1 , with a margin intended to compensate for imperfect alignment of the foldable boxes in the pack 201 . by reducing the image obtained from a camera 204 to the useful portion forming a plural image 205 , the duration of the image processing can be minimized . fig7 and 9 show schematically , in cross section , the geometry of two types of slots . fig7 shows a first type of slot called “ straight ”, because the edges of the slot are parallel to one another . fig9 shows a second type of slot called “ v - shaped ”, because the edges diverge obliquely toward the peripheral end . fig8 and 10 show the plural images 205 obtained for the first type of slot ( fig7 ) and for the second type of slot ( fig9 ), respectively , when the illumination sources 202 . 1 and 202 . 2 simultaneously illuminate the peripheral pack face 212 . the plural image 205 of fig8 has peripheral ends whose edges have a high level of contrast . that is because the edges defining the slot do not project into the slot . the image processing system 206 can therefore easily process the plural image 205 of fig8 , in order to detect the peripheral ends of the slots and determine the width of each lateral interval . conversely , the plural image 205 of fig1 has peripheral ends whose edges have a low level of contrast , because the slot is of the “ v - shaped ” type and the end edges of the flaps extend into the slot . the image processing system 206 therefore finds it more difficult to process the plural image 205 of fig1 than the plural image of fig8 . the two illumination sources 202 . 1 and 202 . 2 are arranged on either side of the cameras 204 . as shown in fig1 and 13 , the illumination sources 202 . 1 and 202 . 2 are configured to illuminate the same peripheral pack face 212 successively . thus each camera 204 successively forms two different plural images 205 . 1 and 205 . 2 , visible in fig1 and 14 , for the same peripheral pack face 212 . the plural image 205 . 1 is formed during the illumination by the illumination source 202 . 1 , and the plural image 205 . 2 is formed during the illumination by the illumination source 202 . 2 . in the plural image 205 . 1 , the left - hand boundary of each peripheral end 214 has a high contrast level , and in the plural image 205 . 2 the right - hand boundary of each peripheral end 214 has a very high contrast level . the illumination system 202 is configured to illuminate the peripheral pack face 212 in a pulsed manner . the duration of an illumination pulse is about 20 ms in this case . between the two pulses , the pack 201 remains immobile , to ensure that the two successively formed images coincide . the image processing system 206 then processes the plural images 205 . 1 and 205 . 2 for the purpose of : i ) detecting the left and right boundaries of each peripheral end 214 , ii ) generating a set of data representing the geometry of each peripheral end 214 , iii ) analyzing said set of data so as to determine the width of each lateral interval 216 . this configuration of the illumination sources 202 . 1 and 202 . 2 enables the illumination system 202 to produce alternating illumination , which improves the detection of all the peripheral ends 214 of the v - shaped slots . in use , the checking device 200 is operated according to a checking method 2000 according to the invention , illustrated in fig1 . the checking method 2000 comprises the steps of : 2002 . illuminating , by means of the illumination system 202 , a peripheral pack face 212 , 2004 . forming , by means of each camera 204 , plural images 205 of the peripheral pack face 212 when the illumination system 202 illuminates the peripheral pack face 212 , 2006 . actuating the image processing system 206 for the purpose of : 2008 . i ) detecting each peripheral end 214 in each plural image 205 of the peripheral pack face 212 , 2010 . ii ) generating a set of data representing the geometry of each peripheral end 214 , and 2012 . iii ) analyzing the set of data so as to determine the width of each lateral interval 216 . fig2 and 21 show part of a checking device 300 according to a second embodiment of the invention . to the extent that the checking device 300 is similar to the checking device 200 , the description of the checking device 200 given above in relation to fig1 to 19 can be transposed to the checking device 300 , with the exception of the notable differences stated below . any element of the checking device 300 which is identical or similar , in its structure and / or function , to an element of the checking device 200 carries the same reference , increased by 100 . thus an illumination system 302 with two light sources 302 . 1 and 302 . 2 , a framework 303 , a camera 304 and an image processing system 306 are defined . the checking device 300 differs from the checking device 200 , notably , in that the camera 304 is a line scan camera , whereas the checking device 200 comprises two matrix cameras 204 . a line scan camera is a camera in which the photosensitive part is composed of a line of sensors ( with a dimension of 1 × n ). the sensors may be ccd (“ charge - coupled device ”) sensors , or cmos (“ complementary metal - oxide - semiconductor ”) sensors . the camera 304 is configured to receive an optical beam 304 . 4 . the checking device 300 also differs from the checking device 200 , notably , in that its imaging device is formed by a single camera 304 , whereas the imaging device of the checking device 200 comprises two cameras 204 . the camera 304 has an optical correction device 304 . 5 and a heat sink 304 . 6 configured to cool the camera 304 in use . furthermore , the checking device 300 differs from the checking device 200 , notably , in that each illumination source 302 . 1 and 302 . 2 is composed of light - emitting diodes ( led ) 302 . 5 arranged in a rectangular matrix , whereas the illumination system 202 is formed by two linear illumination sources . each illumination source 302 . 1 and 302 . 2 comprises a respective heat sink 302 . 6 and 302 . 7 . additionally , the checking device 300 differs from the checking device 200 , notably , in that the checking device 300 further comprises a reflecting mirror 308 arranged so as to reflect the light received from each pack of foldable boxes toward the camera 304 . this reflecting mirror 308 makes it possible to form a compact checking device 300 . each illumination source 302 . 1 and 302 . 2 directly illuminates each pack of foldable boxes through an aperture 309 formed in the framework 303 . in use , the checking device 300 can be operated according to the checking method 2000 illustrated in fig1 . clearly , the present invention is not limited to the specific embodiments described in the present patent application , nor to embodiments within the compass of a person skilled in the art . other embodiments may be envisaged without departing from the scope of the invention , using any element equivalent to an element indicated in the present patent application .	1
by way of disclosure , and not by way of limitation , a tubular doorbeam constructed in accordance with a preferred embodiment of this invention is illustrated in fig1 - 3 and generally designated 10 . the doorbeam 10 is formed from a web stock 40 and generally includes a center section 20 and end portions 30 . the center section 20 interconnects the end portions 30 , which secure the doorbeam 10 in a door 100 , as shown in fig1 . the web stock 40 includes opposing lateral edges 50 , as illustrated in fig2 and 4 . in the preferred embodiment , the web stock 40 is formed from a martinsitic steel ( i . e . martinsite ) such as inland m220 ultra high strength low alloy steel . of course , other materials that have the suitable properties for the performance requirements of a doorbeam may be used . the edges 50 are generally linear and uniformly spaced from one another , allowing the web stock 40 to have a uniform width . the web stock 40 may include a varying thickness profile , but will be described in relation to the preferred embodiment with the web stock 40 having a first and second thicknesses 42 and 44 , although in some embodiments , more than two thicknesses may be used ( not illustrated ). the location of the first and second thicknesses 42 and 44 may vary , but in the preferred embodiment , the second thickness 44 is approximately centered between the edges 50 as illustrated in fig2 . the thickness profile between the first and second thickness 42 and 44 may change abruptly or gradually . the type of change may depend on the location of the first and second thickness 42 and 44 . the type of change also may be chosen to ensure that the beam is no thicker at any given point than required , thereby allowing for the optimal balance of weight and impact strength . the web stock 40 is rolled into a tubular shape , and formed into a doorbeam 10 . a cross section of the tubular shape generally includes a varying thickness circumferential profile , relatively proportional to the varying thickness profile of the web stock 40 , rolled into the tubular shape . the web stock 40 is generally rolled into a continuous tubular shape that is then formed into the doorbeam 10 . the beam 10 generally includes a center section 20 and end portions 30 . in some embodiments , the beam 10 may be formed without the end portions . the formed center section 20 includes a first thickness 22 , the second thickness 24 , and a seam 26 . the first thickness 22 and second thickness 24 are the first thickness 42 and second thickness 44 of the web stock 40 rolled into the tubular shape . the first thickness 22 and second thickness 24 are illustrated in fig3 and 5 as being located approximately opposite on the doorbeam 10 , but may be located almost anywhere on the beam , with varying thickness . the location of the thicknesses depends on the location of the thicknesses on the web stock 40 . of course any third thickness and / or an additional second thickness on the web stock will show up proportionately on the beam 10 . the seam 26 may be located anywhere on the beam 10 but for ease of manufacture is preferably located as shown in fig3 and 5 , approximately in the middle of the first or second thickness 22 and 24 . in the preferred embodiment , the seam 26 is a weld sean . the end portions 30 are usually brackets formed from the ends of the center section 20 . the end portions 30 are generally well known in the art and may be formed to any shape or size to attach to a variety of doors 100 . the beam 100 may also be formed without end brackets ( not illustrated ), for example , as an elongate center section 20 that is attached to a door 100 by clamp , fastener , weld , or other means . for ease of manufacture , the end portions 30 may also include the varying thickness . the thickness variations may also increase the strength of the end brackets 30 while saving weight . the doorbeam 10 starts out as a web stock 40 that includes a first and second thickness 42 and 44 as may be seen in fig2 and 4 . in the preferred embodiment , the first and second thicknesses 42 and 44 are formed while the web stock 40 is formed . of course , the first and second thickness 42 and 44 may be formed at any other time before the web stock 40 is enclosed upon itself into the tubular shape . the first and second thickness 42 and 44 may be formed by rolling , stamping , or any other process . in the preferred embodiment , the web stock 40 is formed from continuous web stock 40 into a continuous beam , cut to length , and formed into individual doorbeams 10 . a continuous web stock 40 may also be formed into individual metal blanks ( not shown ) and then formed into the doorbeam 10 or the web stock may be made as individual metal blanks that are formed into the doorbeam 10 . the beam 10 is then welded along the seam 26 . the preferred welder is a laser welder to obtain high weld quality , but any other suitable welding technique may be used . either before or after the beam is welded , the end brackets 30 are formed . the method of forming end brackets is well known in the art . the end brackets 30 may also be attached by welding , fasteners , or any other means . [ 0036 ] fig4 and 5 show a first alternative embodiment of the web stock 40 , and a sectional view of the doorbeam 10 . in this alternative embodiment , the web stock 40 is formed having a greater thickness near the lateral edges 50 , than the center . therefore , the seam 26 is along the area of greater thickness . [ 0037 ] fig6 and 7 show a second alternative embodiment of the doorbeam 10 . in this alternative embodiment , the web stock 40 includes a base stock 48 with at least one metal strip 46 attached approximately in the center of the base stock 48 . the base stock 48 forms the first thickness 42 . the combination of the metal strip 46 and the base stock 48 form the second thickness 44 . in the preferred embodiment , the metal strip 46 is attached to the base stock 48 by welding . the methods of welding may include , laser , resistance , electron beam , or any other suitable welding means to attach the metal strip or strips 46 to the base stock 48 . additional spot welds 54 may be added to further secure the metal strips 46 , as may be seen in fig6 and 8 . [ 0038 ] fig8 and 9 show a third alternative embodiment of the doorbeam 10 . the third alternative embodiment is similar to the second alternative embodiment , except that the metal strips 46 are located near each of the lateral edges 50 . of course , it should be apparent that the metal strips 46 may be located anywhere on the base stock 48 . the actual placement of the metal strips 46 is not critical , so long as when the beam 10 is added to the door 100 , the areas needing extra thickness are somewhat positioned to provide maximum strength against impacts . this positioning may also be set when the end brackets 30 are formed , or when the beam is installed into the door 100 . [ 0039 ] fig1 and 11 show a fourth alternative embodiment of the doorbeam 10 . in the fourth alternative embodiment a doorbeam 10 is formed with a high strength center portion 20 and lightweight end portions 30 , as seen in fig1 . the web stock 40 is formed as discussed above with the preferred embodiment . one difference is that the web stock 40 in the fourth alternative embodiment has a much greater distance between the opposing lateral edges than in the preferred embodiment . the web stock 40 is cut into metal blanks 52 , approximately perpendicular to the opposing lateral edges 50 . the width of a metal blank 52 is approximately the circumference of the center section 20 of the doorbeam 10 . the length of the doorbeam 10 is approximately the width between the lateral edges 50 of the web stock 40 . the web stock 40 is rolled into a doorbeam as shown in fig1 . variations of the fourth alternative embodiment should be readily apparent . for example , varying the proportions of the first and second thicknesses 42 and 44 on the web stock 40 may easily change the proportions of the center section 20 and end brackets 30 . also , if the web stock 40 is formed as in the second alternative embodiment , with the second thickness 44 located near the edges 50 and the first thickness 42 located near the center , the beam 10 may be formed with a lightweight center portion 30 and high strength end portions 30 . the present invention can be used to create a wide and indeed limitless variety of light - weight , yet high - strength tubular doorbeams 10 , reinforced only as needed for a balance of strength and weight . the present invention results in an improved doorbeam 10 that is manufactured at a lower cost with increased impact strength and decreased weight . the above descriptions are those of preferred embodiments of the invention . various alterations and changes can be made without departing from the spirit and broader aspects of the invention as defined in the appended claims , which are to be interpreted in accordance with the principles of patent law , including the doctrine of equivalents .	8
fig1 has been described with respect to the related art . referring next to fig2 , is the block diagram of a jtag unit and target device test configuration 20 according to the present invention . the jtag unit 211 exchanges signals with and is controlled by a host processing unit ( not shown ). the jtag unit 211 exchanges the tms signals , the tdo signals and the tdi signals with the jtag interface unit 212 . the jtag interface unit 212 exchanges sck signals with the i . c . interface unit 220 , the t . d . interface unit 220 being a part of the target device 22 . the sck signals are exchanged over a single conducting path and are coupled to the target device 22 by a single pin . the t . d . interface unit exchanges tck signals , tms signals , tdi signals and the tdo signals with the jtag tap controller 221 . the jtag tap controller 221 exchanges signals with the emulation unit 222 . the emulation unit 223 exchanges signals with the core logic 223 . referring to fig3 , the basic timing for the serial interface according to the present invention is shown . the serial communication uses time division multiplexing . three time slots are allocated tms_slot , tdi_slot , and tdo_slot . these slots are indicated under the clock cycle diagram in fig3 . data from jtag unit is written between two logic high states during the high time of the sck clock cycle . these two levels are referred to as v ih and v ihh . the v ih level never exceeds the logic high level for normal device operation . in the case of cmos operation , this voltage is typically the provided by the upper supply rail . the v ihh level can exceed the upper supply rail voltage . these voltages are modulated by the incoming data stream . to write a logic “ 1 ”, the jtag unit drives the sck line to the v ihh voltage level during the high cycle . to write a logic “ 0 ”, the jtag unit drives the sck line to the logic high ( v ih ) level . circuitry in the t . d . interface unit determines when the v ihh signal is present and will store the associated data on the falling edge of the sck signal . because the sck is clocked by the jtag unit , a good time - base is formed with each falling edge , thereby allowing for relatively high speed data transfer . the sck signal is set to input both on the tms slot and the tdi slot . internally to the target device , the serial sdata signal stream is shifted into a two bit register at each falling edge of the sck clock . during the tdo_slot , the shift register is disabled . at the end of three cycles , the serial shift register is transferred into a two bit register . the contents of this register are then entered in the jtag tap controller . fig3 also includes some of the internal signals in the target device . the shift_count signal keeps track of the current clock cycle . the jtag_reg signal is the two bit register that stores the parallel jtag commands . this register is updated each time shift_count reaches zero . note that the tck signal for the jtag tap controller is delayed one cycle from the jtag_reg update as required . therefore , the jtag tap controller state changes at each rising edge of the tck signal . the tclk signal represents the test clock signal . the value of the tclk signal value is determined by writing a “ 1 ” or a “ 0 ” during the tdi_slot during the run - test - idle of the jtag algorithm . referring once again to fig3 , the tdo signal stream is allocated one time slot . the jtag interface unit releases sck signal at the end of the tdi slot , the release being triggered by the falling edge of the sck signal . once the sck signal is released , tdo data can be placed on the sck conductor from the t . d . interface device . two possibilities can be considered . the first case occurs when tdo data is a high logic level , referred to in fig3 as “ slave read 1 . in this case , the t . d . interface unit will drive the sck conductor to a logic signal high . the sck conducting path is driven actively for a predetermined period of time , the period of time determined by the parameters of one - shot multi - vibrator . the use of a one shot component allows for a fast transition of the sck signal under heavy loads . the one shot component is required because no sck signal is available during the tdo_slot to indicate when the t . d . interface unit is to be disabled . the one shot component automatically disables the t . d . interface unit after a set period of time . the jtag interface unit has a weak signal holder to prevent the sck line form floating . therefore , once the signal on the sck conductor is released , the last previously driven value will be maintained . as shown in fig3 , the jtag interface unit is enabled at the end of the tdo_slot . for the case when tdo data is a logic high signal , this signal causes the sck conductor to transition from high to a logic low signal . for the case when the tdo signal is a logic low signal , (“ slave read ”), the t . d . interface unit does not actually drive the sck conducting path . the bus holder simply maintains the logic low signal imposed by the jtag interface unit . in this case , no high to low transition is imposed on the sck conducting path during the tdo_slot . apparatus inside the t . d . interface unit handles both cases to ensure proper shifting of the data into the internal two bit register . referring to fig4 , detection apparatus 40 for the sck signals by the t . d . interface unit is shown . as discussed before , the lower voltage is the supply ( rail ) voltage v dd . the sck conductor is coupled through a strong p - channel fet 42 and a weak n - channel fet 43 to ground potential . an amplifier 44 is coupled between the p - channel fet 42 and the n - channel fet 43 . the v dd voltage is coupled to the control terminal of both fet devices . at normal input voltages the p - channel fet 42 is not turned on . once the signal on the sck conductor exceeds the threshold voltage above v dd , the p - channel begins to conduct . the process for fabricating the components must be selected to provide for the higher voltages . for mixed mode components , e . g ., 3 . 3v / 1 . 8v systems , this interface circuit is easily implemented . the sck conductor can be switched between 1 . 8v and 3 . 3v . the i / o components are implemented with 3 . 3v tolerant transistors . while the invention has been described with respect to the embodiments set forth above , the invention is not necessarily limited to these embodiments . accordingly , other embodiments , variations , and improvements not described herein are not necessarily excluded from the scope of the invention , the scope of the invention being defined by the following claims .	6
referring now to the drawings , fig1 depicts a bat 40 which has a core component 42 , a handle 44 , a knob 46 , and a cap 48 at the end of core component 42 . the core component 42 has a hollow barrel 50 and an integral , hollow stem 52 extending from , and axially aligned with , barrel 50 . handle 44 surrounds the stem 52 of core component 42 . annular , elastomeric decouplers are installed between core component 42 and handle 44 , preferably near or at opposite ends of the handle . the decouplers isolate handle 44 from core component 42 , keeping shock ( and to a significant extent other vibrations ) from being transmitted to the batter &# 39 ; s hands when a ball is struck . consequently , the batter is not stung or otherwise subjected to pain or discomfort . this is per se advantageous and also improves performance by keeping the batter from flinching when swinging at a ball . one of the just - discussed decouplers is shown in fig1 and identified by reference character 54 . further , significant , isolation of a batter &# 39 ; s hands from shock and other vibrations may be obtained by installing a grip 56 as shown in fig2 on the handle 44 of bat 40 . this grip isolates the user &# 39 ; s hands from the bat by tuned , progressive resistance , which keeps pain - and discomfort - attributable energy from reaching the user &# 39 ; s hands . grip 56 is fashioned by training an elastomeric wrap 58 as shown in fig4 - 7 around handle 44 in the helical manner shown in fig2 . elastomeric wrap 58 is constructed in accord with , and embodies , the principles of the present invention . isolation from shock and vibration and the adverse effects those phenomena can cause is achieved by the use of the above - discussed tuned progressive resistance technology in wrap 58 . to this end , integral pillars 60 are formed on an exposed side 62 of wrap substrate 64 . continuing deformation of pillars 60 results in progressively increasing resistance of the elastomeric material and highly efficient prevention of shock and vibration energy transfer . the pillars may have the illustrated frustoconical shape or an elliptical , square , rectangular , triangular , or other configuration . a recess 66 may be formed in each integral pillar . at one end , the recess opens onto that exposed end 68 of the pillar opposite the substrate 64 ( see fig7 ). the recess may extend through the substrate and open onto its opposite face , or it may have a blind inner end . each pillar may have multiple open - ended recesses , and they may be of the through - bore or blind - end type or a mixture of those types . the recesses 66 of elastomeric wrap 58 have a conical configuration and a blind inner end 70 . the pillars 62 in which recesses 66 are formed have the above - mentioned frustoconical configuration ; and there is one , centrally located aperture in each pillar . the pillars are closely packed with adjacent pillars touching . as discussed above , the use of recesses is one factor that may be employed in tuning the progressive resistance of the pillars . grasping grip 56 produces suction akin to that of an octopus tentacle , improving the grasp of the bat afforded by the grip . the grasp is further enhanced by virtue of grip 56 conforming to the contour of the batter &# 39 ; s hand due to ability of the pillars 60 to deform and deflect . referring now most particularly to fig2 , 6 , and 8 , it was pointed out above that wrap 58 is trained around handle 44 in a helical manner in fashioning grip 56 . wrap 58 has a central section 72 , relatively narrow , elongated , integral end segments 74 and 76 , and transition sections 78 and 80 with edges 82 and 84 which angle from end segments 74 and 76 to the central section 72 of wrap 58 . the edges 86 and 88 of wrap central section 72 , the edges 90 and 92 of end segment 74 , the edges 94 and 96 of end segment 76 , and transition segment edges 82 and 84 are all chamfered as shown in fig6 . when wrap 58 is trained around handle 44 as shown in fig2 , a chamfered , central segment edge 86 ( or 88 ) in one turn 98 , and the adjacent segment of the same edge in the next turn 99 overlap in the manner shown in fig8 . thus , grip 56 lies flat on handle 44 instead of bulging or bunching up as successive turns are laid down which might otherwise be the case . similarly , the tampered edges 82 and 84 of transition segments 78 and 80 and the chamfered edges 90 . . . 96 of elastomeric wrap end segments 74 and 76 cooperate in like manner to form a smooth , advantageously bulge - free grip . it is also to be noted ( see fig4 and 5 ) that the end segments 74 and 76 of elastomeric wrap 58 are free of the pillars 60 found in the central and transition segments 72 , 78 and 80 of the wrap . among other things , this allows segment 74 ( and / or segment 76 ) to be tucked under the end 96 or 98 of the wrap to secure the wrap in place without forming a bulge in grip 56 . also , the winding of the wrap around a handle can be started without bunching or bulging of the wrap . it is apparent from the foregoing that a wide variety of alternate embodiments are subsumed by the compass of the present invention . fig9 and 10 depict a wrap 100 embodying the principles of the present invention which has a substrate 102 , pillars 104 , and centrally located apertures 106 in the pillars . these pillars in this wrap do not have blind ends , but are the through - type in that they extend between and open onto the tops 108 of pillars 104 and the opposite ( or reverse ) side 110 of wrap 100 ; i . e ., the back or bottom side of substrate 102 . fig1 - 13 depict a wrap 120 with a substrate 122 and other , exemplary forms of pillars ; viz . : also , and as is shown in fig1 , a single wrap embodying the principles of the present invention may have pillars with both blind and through apertures , as well as pillars with apertures of different configurations , pillars with multiple apertures , and pillars with no apertures at all . above , wrap 58 was disclosed by relating it to an exemplary application in which the wrap is employed to form a grip on a bat handle . this is not intended to limit the scope of the invention in that wrap 58 wrap 120 , and other wraps embodying the principles of the present invention may be employed equally well , and in the same manner , to form wraps on other handles . as examples only , those of : golf clubs ; bicycle and motorcycle handlebars ; hammers , lawn mowers , weed - eaters ; and a host of other products . the principles of the present invention may be embodied in a wide variety of artifacts other than the elongated wraps discussed above and illustrated in fig1 - 13 . fig1 and 15 , for example , depict an elastomeric pad 180 with a substrate 182 and closely - packed pillars 60 on one side of the substrate . fig1 - 18 similarly depict a pad 190 which differs from pad 180 in that there are closely - packed sets or arrays of pillars 60 on both sides 192 and 194 of substrate 196 . pads embodying the principles of the present invention need not have the rectangular shape of pads 180 and 190 , but may be of generally any desired , geometric configuration . pads such as those identified by reference characters 188 and 190 may be used for many different purposes : as examples only , to isolate human anatomy from shock and vibration and to similarly protect a host of artifacts and devices from the adverse effects of shock and vibration . it was pointed out above that v / si &# 39 ; s employing the principles of the present invention may have pillars with any of a wide variety of configurations and that combinations of different pillars may be used in a single device . a v / si with both of these features is illustrated in fig1 and 20 and identified by reference character 200 . v / si has a substrate 202 and pillars 204 . . . 212 of circular , square , triangular , hexagonal , and pentagonal configurations . while apertured pillars are shown in fig1 , it is to be understood that apertures need not be provided , irrespective of the pillar configuration . also , fig1 and 20 make it clear that pillars need not touch , or even be in close proximity , for a v / si embodying the principles of the present invention to be effective . the invention may be embodied in many forms without departing from the spirit or essential characteristics of the invention . the present embodiments are therefore to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the appended claims rather than by the foregoing description ; and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein .	0
referring to fig1 a , the underlayment of the system 10 incorporates a three dimensional confinement structure 1 for filler material 2 comprising sub - assemblies ; each made up of a plurality of interconnected open cells of fabric material ( see fig1 b ) that have openings in the vertical dimension relative to a horizontal surface , such as the earth . an exemplary embodiment of the confinement structure 1 is sold under the tradename groundgrid ® ground stabilization system , manufactured by dupont . the three dimensional confinement structure 1 as illustrated in fig1 b and 2a is usually constructed from a nonwoven fabric . it is laid over a prepared base 3 and anchored on one end . the base 3 may comprise : about a ¼ ″ ( 0 . 25 inch ) crushed fine gravel or decomposed granite added to a stabilized about 1 . 0 to about 4 . 0 inches sub - base . crushed gravel may be spread and compacted to create an about 3 . 0 inch height base 3 . in other exemplary embodiments , the base may have a thickness that ranges from about 1 . 0 inches to about 6 . 0 inches , and preferably about 2 . 0 inches in height . in some instances , base 3 may be omitted from the system 10 . for example , base 3 may be omitted if the system 10 is to be provided on a surface comprising concrete . meanwhile , the confinement structure 1 may have thickness that ranges between about 0 . 5 of an inch to about 5 . 0 inches . more preferably , the confinement structure may have thickness that lies between about 2 . 0 inches to about 4 . 0 inches . particulate filler 2 , as illustrated in fig1 a - 1b and 2 a , is placed into the three dimensional confinement structure 1 at a depth that is equivalent to the top of the structure 1 in the vertical dimension , usually which is about two inches ( but the range of the vertical dimension for the structure may comprise between about ¼ ( 0 . 25 ) of an inch to about 5 . 0 inches ). the turf 4 may have a thickness that ranges between about 1 . 0 to about 3 . 0 inches , and preferably , from about 1 . 75 inches to about 2 . 25 inches as illustrated in fig1 . particulate filler 2 may comprise any type of elastomeric material such as styrene - butadiene rubber , butyl rubber , cis - polyisoprene rubber , neoprene rubber , nitrile rubber , ethylene propylene diene monomer , polyurethane , elastomeric polyester and other similar materials . the diameter of such particulate fillers is usually about ⅜ ″ inch , however , diameters larger or smaller are within the scope of this disclosure . particulate filler 2 of other synthetic polymers not normally considered to be elastomers may also be used as the particulate filler 2 . these include the vinyls , e . g ., vinyl chloride , vinyl ethers , vinyl acetate etc ., the acrylates and methacrylates , polyvinylidene chloride , urethanes , polyethylene , polypropylene , polystyrene , polyamides and polyesters . inorganic aggregate such as sand and gravel that has been coated with an elastomeric coating such as polyurethane , acrylic , vinyl and polyester may also be used . the size of the particulate filler 2 may vary between about 4 . 0 to about 70 . 0 u . s . screen mesh size . preferably , the particulate filler 2 will lie between about 6 . 0 to about 60 . 0 u . s . screen mesh size . it is also possible to use a mixture of particulate fillers 2 of two or more different materials . for example , a mixture of rubber and sand particulate may be used to adjust drainage and resiliency characteristics for the system . when sand is utilized as the particulate filler 2 , then generally sand smaller in size than 30 . 0 u . s . screen mesh size is used . preferably , sand between about 40 . 0 to about 200 . 0 u . s . screen mesh size is used for the particulate filler 2 . the figures of this disclosure illustrate a mixture of particulate fillers having different diameters and screen mesh size . one of ordinary skill in the art recognizes that the cross - sectional view of each granule for a particular filler 2 would be uniform if only one type of material and size were used in an exemplary embodiment . other three dimensional confinement structures 1 than those illustrated in fig1 b - 2a 1 may be used . other three dimensional confinement structures 1 may have the same or similar dimensions but with alternative cellular geometries than those illustrated in fig1 b - 2a . alternative cellular geometries include , but are not limited to , circles , triangles , quadrilateral shapes such as squares , rectangles and diamonds , pentagons and octagons . three dimensional geotextiles that have a waffle shaped thick three - dimensional cusp shaped profile such as is disclosed in u . s . pat . no . 5 , 616 , 399 ( which is hereby incorporated by reference ) may also be used for the three dimensional confinement structure 1 . geocells , three dimensional , expandable panels made from high density polyethylene , polyester , or other polymer material may be used for the confinement structure 1 . examples of such structures 1 include matrix and erocells produced by fiber web , ega produced by geo products llc , huitex produced by huikwang corp , geoweb produced by presto products co ., scc produced by strata systems inc . and tenax tenweb produced by syntec . other similar structures may also be used without departing from this disclosure . for example , other structures for the confinement structure 1 besides those listed above , may include an elastomeric or foam panel with open cells . these cells can be filled with elastomeric particulate 2 and such a structure 1 could be used instead of the geotextile fabric for the confinement structure 1 . the synthetic turf 4 that may be used may comprise any of the following artificial turfs sold by foreverlawn , inc . located in ohio as listed in table 1 provided below . the several figures also illustrate the synthetic turf 4 , the three dimensional confinement structure 1 , and prepare base 3 having very similar or close thickness dimensions . the dimensions provided in the figures have been exaggerated for clarity and for teaching purposes . fig2 b illustrates water drainage through the system 10 . specifically , the arrows penetrating the turf 4 , confinement structure 1 , and base 3 illustrate the direction that water from rainfall or other sources may take through the system 10 . water from rain may enter the top turf 4 and then flow through that layer to the particulate filler 2 contained by the confinement structure 1 . the water flows through the particulate filler 2 and then into the base 3 in which the water spreads out and disperses within the base layer 3 . fig2 c is a cross - sectional view of the system 10 and it illustrates how both the synthetic turf 4 and the confinement structure 1 may be secured . according to this exemplary embodiment , the system 10 comprises one or more staples 6 that penetrate through the turf 4 to couple to a nailer board 5 . the staples 6 may be made from stainless steel and may be galvanized . the staples 6 may comprise about ¼ ″ inch to about ½ ″ inch in length , and in some instances , about 1 ″ inch in length . the nailer board 5 may comprise a standard wood 2 ″× 4 ″ as understood by one of ordinary skill in the art . the nailer board 5 may also comprise a composite material . the nailer board 5 may be oriented so that its longer side is in the vertical position relative to the earth . generally , the nailer boards 5 are provided on the periphery or outline of a two - dimensional space . for example , for a square - shaped or rectangular area , the nailer boards 5 would be provided on the edges or border of the square - shaped area such that the boards 5 would define the perimeter of the area . see fig2 d which illustrates the nailer boards 5 provided on the periphery of a two dimensional space occupied by the synthetic turf 4 . the boards 5 in this figure have been illustrated with dashed lines to convey that they are hidden from view under the turf 4 . the dashed arrows adjacent to the boards 5 and staples 6 convey that the staples 6 are continuously positioned within the boards 5 along their length . however , as appropriate , intermediate boards 5 may be provided within an area as understood by one of ordinary skill in the art . other fasteners , besides staples 6 and boards 5 , like screws , nails , tacks , adhesives like glue , spikes , hook and loop fasteners , may be used without departing from the scope of this disclosure . typically , the boards 5 may be attached to a sidewalk , building , curb , or if in an open area , will be anchored to some type of rebar or metal stake . once the perimeter of the area to be covered is defined , the confinement structure 1 is spread out or expanded . usually , the confinement structure 1 does not need to be attached to the boards 5 , but sometimes the confinement structure may open / expand easier and holds in place better if it is stapled it to the boards 5 . once it is opened up , the confinement structure 1 is then filled with the particulate filler 2 . finally , the turf 4 may be laid over the area and attached to the boards 5 with the fasteners 6 noted above . in many exemplary embodiments , the turf 4 is usually not attached to the confinement structure 1 : the turf 4 usually just lays over the confinement structure 1 . fig3 a - 3c illustrate some exemplary steps of a method 300 ( see fig3 g for complete method ) for installing the system 10 . step 305 of fig3 a generally refers to preparing an appropriate base 3 using one or more different materials . this step 305 may include spreading the 0 . 25 crushed fine gravel or decomposed granite which may be added to a stabilized about 3 . 0 inches to about 4 . 0 inches sub - base . step 305 in fig3 a corresponds with a worker taking an appropriate tool , such as a shovel rake , and spreading the material forming the base 3 . step 305 may also include spreading crushed gravel and compacting it to create a base 3 having a height of approximately 3 . 0 inches . steps 310 , 320 in fig3 b generally correspond to laying down the confinement structure 1 across an area of interest . according to one exemplary embodiment , the confinement structure 1 is manufactured in strips that may be expanded or opened up in an accordion - like are fan - like manner . one strip when it is opened up were spread out may cover an area of approximately 107 . 0 square feet . however , one of ordinary skill the art recognizes that other areas greater or less than 107 . 0 square feet can be made and used without departing from the scope of this disclosure . how the confinement structure 1 is secured to the prepared base 3 is described in detail below in connection with fig3 d - 3f . step 330 in fig3 c generally corresponds with spreading the particulate filler 2 into the confinement structure 1 . how the particulate filler 2 is spread into the confinement structure 1 depends on the size of the area of interest . for smaller areas of interest , a 50 pound bag of rubber may be poured into each cell of the confinement structure 1 and may be spread across the cells with the back edge of a landscape rake as understood by one of ordinary skill the art . for larger areas of interest , the particulate filler 2 may be transported and applied with a wheelbarrow . in other instances , a “ cannon ” that disperses rubber into the confinement structure 1 may be used as understood by one of ordinary skill the art . fig3 d - 3f also illustrate some exemplary steps of a method 300 for installing the system 10 . fig3 e - 3f illustrate steps 315 through step 325 . in step 315 of fig3 e ( see fig3 d which illustrates locations for the first two anchors 7 ), the ends of the confinement structure 1 — before it is expanded — may be anchored with anchors 7 . each anchor 7 may comprise a long nail or a short pole . in step 325 of fig3 f , the remaining one or more ends of the confinement structure 1 may be anchored with the anchors 7 . as illustrated in fig3 f , the confinement structure 1 may secured every several feet . however , in many exemplary embodiments , this securing of the confinement structure 1 with this frequency of anchors 7 is only temporary as the anchors 7 should not be present in a “ fall safe ” areas , such as in children playgrounds . in some exemplary embodiments , the confinement structure 1 may be anchored close to the base 3 , such as with landscape staples 6 where they are positioned low enough that they could remain in the base 3 after the turf 4 is secured to the nailer boards 5 . in other embodiments , most of the anchors 7 for the confinement structure 1 may be removed after the turf 4 is secured . fig3 g is a flow chart illustrating an exemplary method 300 for installing the system 10 . step 305 may comprise the first step of the method 300 . in step 305 , the base 3 as illustrated in fig1 and fig3 a may be prepared . as described previously , this step may include spreading the 0 . 25 crushed fine gravel or decomposed granite which may be added to a stabilized about 3 . 0 inches to about 4 . 0 inches sub - base . step 305 in fig3 a corresponds with a worker taking an appropriate tool , such as a shovel rake , and spreading the material forming the base 3 . step 305 may also include spreading crushed gravel and compacting it to create a base 3 having a height of approximately 3 . 0 inches . subsequently , in step 310 , the three - dimensional confinement structure 1 may be laid down across the area of interest defined by the base 3 . next , in step 315 , one end of the confinement structure 1 may be anchored with nails or poles as illustrated in fig3 e . in step 320 , the confinement structure 1 may be spread out to cover the area of interest defined by the base 3 as illustrated in fig3 f . in step 325 , one or more additional ends of the confinement structure 1 are anchored with nails or poles to remain in place over the area of interest . next , in step 330 , the particulate filler 2 is spread across the area of interest and evenly into the confinement structure 1 . a rake or a broom may be pulled across the confinement structure 1 in order to spread the particulate filler 2 . the particulate filler 2 to be dropped into cells of the confinement structure that are below capacity and slide across cells that may be full . if needed , more particulate filler 2 may be added , and then raked or pulled across the confinement structure 1 in order to fill the cells of the confinement structure 1 that may have been low as illustrated in fig3 c . in step 335 , the contents of each cell of the confinement structure is checked for an adequate height for the particulate filler 2 . step 335 may be completed with foot traffic from workers as the confinement structure 1 is filled . such foot traffic may compact and settle in the particulate filler 2 into each of the cells of the confinement structure 1 . as appropriate , a power tamper may be used to further compact and settle the particulate filler 2 into the confinement structure 1 . in block 340 , the anchors 7 of fig3 f may be removed from the confinement structure 1 . next , in step 345 , a synthetic turf 4 for may be installed on top of the filled confinement structure 1 . the turf 4 may be unrolled from storage rolls or unfolded . in step 350 , the synthetic turf 4 may be secured to the confinement structure 1 using one or more various techniques . according to one exemplary embodiment , nailer boards 5 may be used to secure the synthetic turf 4 on top of the confinement structure 1 as illustrated in fig2 c - 2d . alternatively , instead of using nailer boards 5 or perimeter anchor boards , the synthetic turf 4 may be filled with a ballast in order to weigh - down the synthetic turf for so that it remains on top of the confinement structure 1 . the ballast may comprise at least one of sand , chunk rubber , or other particular matter as appropriate for synthetic turfs 4 . the method 300 then ends . a three dimensional cellular confinement structure 1 , groundgrid ® ground stabilization system from dupont , was laid down on a prepared base 4 and restrained on one end with vertically placed rods that extended above the top of the structure . the confinement structure 1 was stretched out to open the cells of the structure 1 and to cover the installation area that had an approximate size of about 4 . 0 feet by about 25 . 0 feet . chunk rubber particulate 2 , having a diameter of about ⅜ ″ ( inch ), was added to the open cells of the confinement structure 1 starting at the constrained end and working out to completely fill the three dimensional confinement structure 1 . after the three dimensional confinement structure 1 was completely filled , the surface was tamped to consolidate particulate 2 . additional particulate 2 was added and smoothed to fill in to the top of the three dimensional confinement structure 1 . the vertically placed rods were removed . synthetic turf 4 , playground grass having product name of forever lawn playground grass ultra and a thickness of approximately 1 . 875 inches ( including backing ), sold by forever lawn , inc . located in ohio , was installed on top of the particulate filled three dimensional confinement structure 1 and secured in place nailer boards . referring now to fig4 , this figure illustrates a graph 400 listing the head injury criteria ( hic ) corresponding to the astm standard specification for impact attenuation of surface systems under and around playground equipment , astm f1292 . if a person experiences a head impact equivalent to a hic score of 500 , then there is about a 79 . 0 % chance ( corresponding to point a which point also defines curve a on graph 400 ) that the person will likely suffer a minor injury . in other words , after an hic score is calculated from the standard , one reads the hic score along the x - axis of graph 400 to see where the hic score corresponding to the y - axis intersects one of the five curved lines a - e . at about 38 . 0 % ( corresponding to point b which point also defines curve b on graph 400 ), then there is the risk of a moderate injury ( curve b ) at this hic level . the risk of this impact having an hic score of 500 producing a severe or fatal head injury is very low ( corresponding to points d , e on graph 400 ). curve d defines critical head injuries while curve e defines fatal head injuries . however , it is also noted that the chance of experiencing a 500 hic score without suffering an injury of any kind is only about 21 . 0 % ( corresponding to point c which point also defines curve c on graph 400 ). for the two inch and four inch sample in table 2 above ( which corresponds to the height of the confinement structure 1 ), the synthetic turf 4 had a height of approximately 1 and ⅞ths of an inch . however , the synthetic turf 4 may comprise a height dimension anywhere from about 1 . 0 inch up into an excess of about 2 . 0 inches as understood by one of ordinary skill in the art . also , for these two samples , no ballast ( no particulate or granules were spread within the synthetic turf 4 ) was utilized . additionally , no base 3 was used for these two samples as required by astm 1292 - 04 . astm 1292 - 04 requires testing over a concrete surface so there was no base material 3 or one could state that the base was concrete for these two examples . the type of synthetic turf 4 which was utilized was the type sold under the name playground grass ultra , by foreverlawn , inc . located in ohio . the technical specifications for playground grass ultra are listed in the last column of table 1 provided above . what is unexpected and surprising about the system 10 is that such a relatively simple system 10 , as illustrated in fig1 a , may provide such adequate shock attenuation , stabilization and drainage for playgrounds , as evidenced by the astm f1292 data in table 2 listed above . specifically , a person of ordinary skill in the art would not have reasonably predicted the inventive system 10 yielding hic scores between 510 . 0 and about 755 . 0 for simulated fall heights between about 8 . 0 and 11 . 0 feet , wherein the inventive system 10 comprises a confinement structure 1 having a vertical dimension of about ¼ ( 0 . 25 ) of an inch to about 5 . 0 inches ), more preferably between about 2 . 0 and about 4 . 0 inches ; synthetic turf 4 having a thickness that ranges between about 1 . 0 to about 3 . 0 inches , and more preferably about 1 and ⅞ths of an inch ; a particulate filling material 2 comprising any type of elastomeric material such as styrene - butadiene rubber , butyl rubber , cis - polyisoprene rubber , neoprene rubber , nitrile rubber , ethylene propylene diene monomer , polyurethane , elastomeric polyester and other similar materials , and wherein the particulate filling material 2 may vary between about 4 . 0 to about 70 . 0 u . s . screen mesh size , and the filling material 2 preferably comprising chunk rubber with a diameter of about ⅜ ″ ( inch ). it is noted that in some conventional turf systems which have deflection layers , such layers may be a nonwoven or woven , however , they are generally laid flat . meanwhile , the system 100 is dependent on the resilience of the nonwoven or woven material of the structure 1 to absorb shock . conventional turf systems do not provide any teachings of resilient materials used for the particulate filler 2 . the particulate filler 2 usually should have some resilient / elastomeric properties . the system 10 combines the function of a deflection layer and a flexible grid system . the word “ exemplary ” is used herein to mean “ serving as an example , instance , or illustration .” any aspect described herein as “ exemplary ” is not necessarily to be construed as preferred or advantageous over other aspects . certain steps in the processes or process flows described in this specification naturally precede others for the invention to function as described . however , the invention is not limited to the order of the steps described if such order or sequence does not alter the functionality of the invention . that is , it is recognized that some steps may performed before , after , or parallel ( substantially simultaneously with ) other steps without departing from the scope and spirit of the invention . in some instances , certain steps may be omitted or not performed without departing from the invention . further , words such as “ thereafter ”, “ then ”, “ next ”, etc . are not intended to limit the order of the steps . these words are simply used to guide the reader through the description of the exemplary method . although selected aspects have been illustrated and described in detail , it will be understood that various substitutions and alterations may be made therein without departing from the scope of the disclosure , as defined by the following claims .	4
the present invention relates to break - open firearms of the type in which the barrel or barrels of the firearm are mounted on a barrel housing that is pivotally secured to the frame of the firearm , the barrel and barrel housing being rotatable from their closed ready - to - fire position to their open loading - and - unloading position . the improved monolithic ejector system of the invention will be described in conjunction with the over - and - under shotgun shown in the drawings but is not limited to this particular firearm . as shown best in fig1 - 3 , the over - and - under shotgun 10 embodying the invention has a stock 12 , a frame 14 mounted on the stock 12 , an upper barrel 16 , a lower barrel 18 , a monoblock or barrel housing 20 and a forearm stock 22 . the barrel housing 20 is formed with an upper barrel receiving bore 24 and with a lower barrel receiving bore 26 ( shown best in fig3 ) in which the chamber portion of the upper and lower barrels 16 , 18 are received and to which they are secured . the forearm stock 22 is releasably secured to the underside of the lower barrel 18 by a forearm latch ( not shown ), the barrel housing 20 and forearm stock 22 being pivotally mounted on the frame 14 so that the barrels can be rotated from their closed positions as shown in fig1 to their open position as shown in fig2 . in a prior art dovetailed ejector system 30 illustrated in fig4 and 5 , an ejector 32 is mounted in a pair of slots 34 , ( 36 not shown ) milled in a chamber portion 28 of a barrel . an annular shoulder 38 includes sections 38 a and 38 b , in which the section 38 b travels with the ejector 32 and section 38 a is a rigid portion integrally formed with the chamber portion 28 . this ejector system 30 requires precision milling on both the ejector 32 and the chamber portion 28 , and the rim recess geometry is dependent on the chamber geometry . further , in the prior art ejector system 30 , the spent cartridge is pulled from only one small section ( typically 120 °) of the circular ejector 32 . the inventive ejection system 40 comprises a chamber portion 42 of barrels 16 , 18 and a separate extractor 44 as illustrated in fig6 - 12 . when the barrels and barrel housing in a break - open firearm are rotated from their closed position to their open loading - and - unloading position , the longitudinally movable ejector ejects a spent cartridge from one of the barrels 16 , 18 . the maximum length of travel of the extractor is called its full throw . this travel is restricted by the chamber &# 39 ; s outer surface geometry interfering the extractor &# 39 ; s inner surface geometry . the interior surface of chamber 42 is uninterrupted , whereas the outer surface 46 of chamber 42 has sections of reduced diameter ( fig6 , 12 ). the outer surface 46 of chamber 42 has a first section 48 having a first diameter a that is generally the outer diameter of the barrels 16 , 18 . a second section 50 is adjacent first section 48 and has a second diameter b that is smaller than the diameter a of section 48 . a third section 52 is adjacent second section 50 and has a diameter c that is slightly larger than the diameter b of second section 50 but smaller than the diameter a of section 48 . the intersection of section 48 and section 50 form a first ledge 54 and the intersection of section 50 and section 52 form a second ledge 56 ( fig6 , 12 ). the extractor 44 is a hollow cylindrical tube having first and second ends 58 , 60 respectively . the first end 58 includes a rim 62 positioned around the circumference of the first end 58 . rim 62 also includes a generally u - shaped cutout 64 ( fig6 , 10 , 11 ). the u - shaped cutout 64 is provided for shooters who desire to reload spent shells and for the extraction of an unfired shell . the second end 60 includes a plurality of slots 66 placed equal - distant around the circumference of the second end 60 ( fig6 , 10 ). the number of slots 66 is generally at least four , preferably between four to eight , but can be even more depending upon the diameter of the chamber 42 . the slots 66 extend at least one half to one third of the distance of the extractor 44 . the slots 66 are for the purpose of assembling the extractor 44 and chamber 42 to form the ejection system 40 . slots 66 allow expansion of the second end 60 of extractor 44 so that is can be slid over chamber section 52 until it matches up with chamber section 50 . the lower interior portion 68 of each slot 66 includes an expanded portion 70 that is configured to engage the second ledge 56 of the chamber 42 when the extractor 44 is in the full throw position ( fig1 ). in the closed position , the second end 60 of the extractor 44 is adjacent to and buts up against the first ledge 54 of chamber 42 ( fig9 ). the length of the extractor 44 can be generally from 2 inches to 0 . 8 inches and the diameter will depend upon the diameter of the chamber 42 . the length of the slots 66 can range from about 1 . 5 inches to 0 . 375 inches . the extractor 44 can be sized to accommodate any gauge shell and can be configured for a variety of rifles . the inventive ejection system 40 provides a number of advantages . first , the two piece ejection system separates the chamber geometry from the rim recess geometry wherein the rim recess geometry now becomes the extractor for the spent cartridges . this allows for more flexibility in manufacturing the ejection system . second , the inventive ejection system 40 requires little milling on the extractor 44 and no milling on the chamber 42 . third , with the extractor 44 of the present invention , the spent cartridge is pulled from almost all of the circumference of the rim 62 of the cylindrical ejector 44 . the ejection system can be constructed from material well know to one skilled in the art of rifle manufacturing . although the present invention and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims . moreover , the scope of the present application is not intended to be limited to the particular embodiments of the process , machine , manufacture , composition of matter , means , methods and steps described in the specification . as one of ordinary skill in the art will readily appreciate from the disclosure of the present invention , processes , machines , manufacture , compositions of matter , means , methods , or steps , presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present invention . accordingly , the appended claims are intended to include within their scope such processes , machines , manufacture , compositions of matter , means , methods , or steps .	5
fig1 and 2 show the right - hand part , tubular in the usual fashion , of a steering device 1 for a motor - driven double - wheeled vehicle . the steering device 1 consists of an ordinary , surface - cleaned steel tube , nickel - plated , for example . a rotatable tubular handle 2 , made of plastic , is set on the steering device 1 ( compare also fig3 and 4 ). the tubular handle 2 is held by the grip 3 , made of a rubber - like material , which is grasped by the right hand of the vehicle driver . the tubular handle 2 turns with rotation of the grip 3 . the end of the tube handle 2 projecting from the grip 3 ( to the left of fig1 and 2 ) is covered and surrounded by a two - sectioned housing 4 , for example , fixed to the steering device . both parts 5 and 6 of the housing 4 are secured to the steering device 1 by screws in a conventional and therefore not separately described fashion . the upper part 5 of the housing is closed by a cover 7 , held to part 5 by the screw 8 . a rotatable cable drum 11 , on which a bowden control cable 12 can be wound in the usual manner , is set on a circular axle journal 9 above the upper housing part 5 . the underside of cable drum 11 is formed with a unitary bevel gear 13 . the bevel gear 13 meshes with bevel gear 14 formed as a unitary part at the free end of the tubular handle 2 . when the tubular handle 2 is correspondingly rotated by means of the grip 3 , the cable drum 11 is forced to turn and the bowden control cable is wound up to a greater or lesser extent such that , in this fashion , the fuel feed to the motor can be controlled in the usual way . to keep the bevel gear 14 continually meshed with the bevel gear 13 and thus secure the tubular handle against axial shifting on the steering device 1 , the housing 4 fixed to the steering device 1 -- compare fig3 and 4 in particular -- has an annular flange 15 which meshes with the circular groove 16 at the free end of the tubular handle 2 . the side walls of the circular groove 16 are formed by the back wall of the bevel gear 14 on one side , and on the other by a unitary collar 17 on the tubular handle 2 . to prevent friction wear between the arm 15 and the side walls of the groove 16 in the invention embodiment described , a clip or clamp type sheath 18 ( fig5 ) is fixed on the section of the annular flange 15 on the upper part 5 of the housing 4 , against which the inner walls of the groove 16 rub when the tubular handle 2 is turned . the sheath 18 is made of a material that is more resistant to wear than the material -- e . g ., magnesium alloy -- from which the flange 15 is made . the sheath 18 may , for example , consist of tempered or hardened steel . special types of synthetic material may also be suitable in certain cases . in any event , depending on the materials of which the arm 15 and the inner walls of the groove 16 are made , one can select a material for the sheath 18 that is wear - resistant and has practically no erosive effect on the inner walls of the groove 16 . in this way , the life of the system described is considerably extended . as shown in fig5 sheath 18 is in the form of a clamp that can be placed loosely over the upper part of the annular flange 15 . thus , sheath 18 covers only part of the flange 15 . if desired , a corresponding sheath may also be placed -- compare with fig2 -- on the part of flange 15 in the lower part 6 of housing 4 . this , however , is not required as a rule . in the design above , cable drum 11 is mounted on the upper part 5 of the housing ( fig3 ) so that it can rotate around the axle journal 9 . here also , to prevent wear on the axle journal 9 made of magnesium alloy , for example , by the constant rotation of a cable drum 11 made of a plastic , an improved version of the invention has a shell 19 on the axle journal 9 formed of a suitable material such as steel . this too almost completely precludes wear and extends the life of the system .	1
network devices perform a variety of operations to process packets . these operations can include packet classification , determining how to forward a packet , and so forth . to perform these operations on the large volume of rapidly arriving packets , some devices feature multi - core processors where the different cores simultaneously operate on packets in parallel . in some processors , the cores can execute multiple threads . the threads can further mask the latency of certain operations such as memory accesses . for example , after one thread issues a memory read , a different thread can execute while the first thread awaits the data being retrieved . a wide variety of software architectures can be used to process packets . for example , fig1 a depicts a sample packet processing architecture where a packet 104 is processed by a thread 102 . the thread 102 can feature a series of packet processing stages such as a de - encapsulation stage , packet classification stage , metering stage , queueing stage , and so forth . by performing operations on a packet using the same thread , data associated with the packet can remain in quickly accessible local memory . though different threads may operate on different packets , the threads may nevertheless need to share access to the same data . for example , the different packets may belong to the same packet flow ( e . g ., an asynchronous transfer mode ( atm ) circuit or transmission control protocol / internet protocol ( tcp / ip ) connection ). thus , the different threads may vie for access to update the flow - related data ( e . g ., the number of flow packets received ). to coordinate access to this shared data , the threads may feature one or more critical sections of instructions ( shaded ) executed by each thread . a critical section protects shared data by preventing more than one thread from executing the shared data access operations of the critical section at a time . for example , the critical section may use a lock ( e . g ., a mutual exclusion ( mutex )) that a thread acquires before it can continue critical section execution . after acquiring the lock , the thread can read , modify , and write the shared data back to memory . the thread can then release the lock to permit access by other threads . while ensuring coherency in the shared data , threads implementing a critical section , as described above , may experience a delay awaiting completion of the initial memory read of the shared data performed by the thread 102 upon entering the critical section . for example , as shown in fig1 a , after entering a critical section , the thread 102 issues a read to access the data shared by the different threads . due to the latency associated with memory operations , the thread 102 may wait a considerable period of time for the access to complete . in a “ lock - step ” implementation where each thread must complete each critical section within a fixed period of time , the memory access may leave the thread 102 with little time to perform operations on the shared data after the read completes . as shown in fig1 b , to avoid the latency associated with the initial critical section read of the shared data , thread 102 can issue a memory read operation to initiate a memory read ( labeled mr ) of the shared data from memory before thread 102 execution reaches the critical section . in the example shown , the retrieved value of the shared data has an arbitrarily labeled value of “ a ”. as shown , by using the retrieved copy , the thread 102 can avoid the initial memory access latency after entering the critical section , essentially moving the latency to a more convenient time . use of the copy of shared data in fig1 b , however , assumes that the shared data was not changed in the period of time between the read of thread 102 and the entry of thread 102 into the critical section . as shown in fig1 c , to preserve coherence in the shared data in this scenario , a core executing thread 102 may receive one or messages from another core indicating that one or more threads on the other core made changes to the shared data . the updated values ( arbitrarily labeled “ δ ”) may completely replace the “ early ” copy made by the thread 102 or only update a few data elements . as shown , by using the updated values instead of the copy (“ a ”), thread 102 can preserve data coherence while still avoiding a costly read operation inside the critical section . that is , the thread 102 either uses data obtained by the pre - critical section read and / or data included in the update messages . in either case , a memory read to retrieve the shared data is not needed upon entering the critical section to recap , in the absence of update message ( s ) ( fig1 b ), the thread 102 can safely assume that the value (“ a ”) copied from memory before reaching the critical section can be used . however , when update messages indicate changes to the shared data ( fig1 c ), the thread 102 uses the updated data (“ δ ”) instead of the data copied from memory earlier . fig2 a - 2b illustrate the use of this technique in a software architecture designed for a multi - threaded multi - core environment . as shown in fig2 a , in this architecture , each packet 104 a - 104 i is processed by a respective thread 102 a - 102 i . in the example shown , each thread 102 a - 102 i features multiple critical stages ( arbitrarily labeled x , y , and z ). entry into each critical stage by different threads 102 a - 102 is controlled by a signaling scheme . that is , each thread awaits a signal from a previous thread completing a given critical section before entering that critical section . for example , thread 102 d awaits a signal from thread 102 c before executing critical section y . thread 102 c provides this signal ( the solid arrow between threads 102 c and 102 d in fig2 a ) to thread 102 d when thread 102 c completes critical section y . likewise , thread 102 e awaits a signal from thread 102 d before entering a given critical section , thread 102 f awaits a signal from thread 102 e , etc . this chain of signals sent by each thread permitting entry into a given critical section creates a sequence of threads 102 a - 102 i entering the critical section . as shown , the sequence of threads spans multiple cores with each core providing some set of the threads . the sequence may “ wrap - around ” ( not shown ). that is , thread 102 i may signal thread 102 a to enter a given critical section for a next packet . as shown in fig2 a , in addition to signaling the next thread in the sequence to enter a completed critical section , a thread can issue a signal that permits a pre - critical section read . for example , as shown , thread 102 c not only issues a signal to thread 102 d permitting entry of thread 102 d into critical section y , the thread 102 c also issues a signal ( shown as a dotted line between threads 102 c and 102 g ) to core 100 c that permits threads 102 d - 102 f on core 100 c to initiate a pre - critical section read ( labeled mr ( y )) of shared data protected by critical section y . as shown , the signal triggering the pre - critical section read skipped the set of threads 102 d - 102 f provided by an intermediate core 100 b in the thread sequence . as shown , the pre - critical section read may be provided by one or more instructions executed at the end of a previous critical section ( e . g ., mr ( y ) occurs at the end of critical section x ). thus , as thread 102 d enters critical section y , thread 102 g can initiate a pre - critical section read ( mr ( y )) that will complete before thread 102 g enters critical section y . as shown in fig2 b , eventually , after sequential execution of critical section y by threads 102 d , 102 e , and 102 f , thread 102 g on core 100 c receives a signal from thread 102 f permitting entry into critical section y . again , due to the signal earlier received from thread 102 c , thread 102 g has already copied shared data for critical section y into local core 100 c memory before thread 102 g enters critical section y . potentially , however , any of the intervening threads 102 d - 102 f that executed critical section y after / during the pre - critical section read of thread 102 g may have altered the shared data . thus , as shown , the thread ( s ) 102 d - 102 f can write messages indicating changes ( labeled “ δ ”) to the shared data to the core 100 c executing the thread 102 g that performed the pre - critical section read . the messages indicating an update of data can include a flow identifier and a sequence of variable values and , potentially , field identifiers indicating which data values have been changed . the flow identifier may be formed from a tuple of header data ( e . g ., the ip source and destination addresses and transport layer source and destination ports ). if such messages were sent , the thread 102 g can use the updated data instead of data obtained in the pre - critical section read . in either case , the latency associated with a memory operation to read the shared data within the critical section can be avoided . fig2 a - 2b simplified some aspects of the implementation for ease of illustration . for example , fig2 a illustrated a single signal permitting entry into a critical section and a single signal permitting the pre - critical section read . in operation , thread 102 c may issue both types of signal at the completion of each critical section ( e . g ., x , y , z ) so configured . additionally , threads 102 f and 102 i ( and other lcore threads ) may similarly provide such signals to threads / cores downstream in the thread sequence . further , these signals may also “ wrap around ”. for example , thread 102 f may signal thread 102 a to perform a pre - critical section read for critical section “ x ” for a next packet after thread 102 f completes critical section x . while fig2 a - 2b illustrated a core that provided three threads , a core may provide many more threads ( e . g ., 8 or 16 ) or less . similarly , a processor will typically include more than three cores ( e . g ., 8 or 16 ). additionally , while fig2 a - 2b illustrated a given packet being processed by a single thread , a packet may be processed by more than one thread . for example , a first core may perform a first set of operations for a packet and pass the packet off to a second core for the next set of operations . the techniques can be implemented in a wide variety of hardware environments . for instance , fig3 depicts an example of network processor 200 . the network processor 200 shown is an intel ® internet exchange network processor ( ixp ). other network processors feature different designs . the network processor 200 shown features a collection of processing cores 202 on a single integrated semiconductor die . each core 202 may be a reduced instruction set computing ( risc ) processor tailored for packet processing . for example , the cores 202 may not provide floating point or integer division instructions commonly provided by the instruction sets of general purpose processors . individual cores 202 may provide multiple threads of execution . for example , a core 202 may store multiple program counters and other context data for different threads . as shown , the network processor 200 also features at least one interface 202 that can carry packets between the processor 200 and other network components . for example , the processor 200 can feature a switch fabric interface 202 ( e . g ., a common switch interface ( csix )) that enables the processor 200 to transmit a packet to other processor ( s ) or circuitry connected to the fabric . the processor 200 can also feature an interface 202 ( e . g ., a system packet interface ( spi ) interface ) that enables the processor 200 to communicate with physical layer ( phy ) and / or link layer devices ( e . g ., mac or framer devices ). the processor 200 also includes an interface 208 ( e . g ., a peripheral component interconnect ( pci ) bus interface ) for communicating , for example , with a host or other network processors . as shown , the processor 200 also includes other components shared by the cores 202 such as a hash core , internal scratchpad memory shared by the cores , and memory controllers 206 , 212 that provide access to external memory shared by the cores . the network processor 200 also includes an additional processor 210 ( e . g ., a strongarm ® xscale ®) that is often programmed to perform “ control plane ” tasks involved in network operations . the core processor 210 , however , may also handle “ data plane ” tasks . the cores 202 may communicate with other cores 202 via core 210 or other shared resources . the cores 202 may also intercommunicate via neighbor registers featuring a direct wired connection to adjacent core ( s ) 202 . the next neighbor registers can be used as a first - in - first - out ( fifo ) queue between adjacent cores . alternately , cores 202 may communicate with non - adjacent cores , e . g ., via a control and status register proxy reflect operation that moves data between transfer registers of the cores . individual cores 202 may feature a variety of local memory elements in additional to a given amount of local core 202 ram . for example , each core 202 may include transfer registers that buffer data being read from / written to targets external to the cores 202 ( e . g ., memory or another core ). additionally , each core may feature a command fifo queue that queues commands being sent to other elements . in addition to the transfer registers , the individual cores 202 may also feature other local core memory such as a content addressable memory ( cam ). the features of the network processor may be used to implement the techniques described above . for example , the cam of a core may be used to determine whether shared data has been updated . for example , the cam may store an id of shared data ( e . g ., a packet flow and , potentially , field identifier ) and a pointer to the location where shared data is currently stored ( e . g ., in one or more transfer registers or local core ram ). when a core receives a shared data update message , a thread executing on the core can compare the flow id of the messages against the flow ids currently stored in the cam . a match indicates that the update messages correspond to a shared data obtained by a pre - critical section read and the thread can correspondingly write the updated values into local ram and set a corresponding “ dirty ” bit in a predefined memory location indicating that the value to be used is in local core memory instead of the transfer registers . upon entering a critical section , a thread can check the associated “ dirty ” bit to determine which data to use . in the event of a cam “ miss ”, the core can disregard the update message as the updated data is not needed . potentially , the cam may be logically divided into segments to identify shared data of different critical sections . for example , a first set of cam entries may be used to store shared data ids for the critical section being executed while the next set of cam entries is used to store shared data ids for the following critical section . for example , a critical section identifier may be prepended to the flow id key stored in the cam or a fixed number of entries ( e . g ., entries 1 - 8 ) may be assigned to the section . in such an implementation , before a first thread of a core starts a critical section ( e . g ., critical section x ), the thread also clears the cam segment related to the next critical section ( e . g ., y ) so that pre - critical section reads launched for y can be stored in the cam segment . to illustrate application of the techniques described above , fig2 a - 2b will be renarrated using the features of the network processor architecture shown in fig3 . in this sample implementation , when the last thread 102 c of core 100 a exits critical section y , the thread 102 c , if necessary , sends the shared data ids and updates to shared data affected by core 100 a execution of critical section y through the next neighbor registers to core 100 b along with a next neighbor signal that enables core 100 b threads to enter critical section y . the core 100 a also sends a signal towards thread 102 g in core 100 c by placing a command in the core 100 a command fifo after a command writing the shared data to external memory . due to the sequential handing of commands in the command fifo , when the signal reaches core 100 c , it is guaranteed that the write back of data modified by core 100 a execution of critical section y has moved towards its destination . on receiving this signal , threads in core 100 c are permitted to initiate memory reads ( e . g ., to sram or dram ) for the critical section y and store the shared data in the core &# 39 ; s 100 c transfer registers . the results of a pre - critical section read can be tracked by a cam entry storing the corresponding shared data id and location of the copy of the shared data in the transfer registers . the core 100 c threads continue execution until reaching critical section y when a core 100 c thread reaches critical section y , the thread checks for a signal coming from core 100 b signaling that updated data messages have been queued in the core &# 39 ; s 100 c next neighbor registers . if the signal is available , the thread uses the shared data id from the next neighbor registers to do a cam search . if the id matches a cam entry , the pre - critical section data read into the core transfer registers from memory is obsolete and needs to be updated with the data included in the update messages currently in the core &# 39 ; s 100 c next neighbor registers . at this point , a dirty bit for the cam entry may be set and the update data stored in local core memory . after all the update messages ( e . g ., ( shared data id , var ) pairs ) enqueued to the core 100 c in the next neighbor registers have been processed , threads on core 100 c can enter critical section y in turn . the threads can access the dirty bit to determine whether to access the shared data from the transfer registers or the local core memory . as described above , the sequence of critical sections may “ wrap around ”. e . g ., execution of critical section x by thread 102 a follows execution of critical section x by thread 102 i . to provide such wrap - around signaling , the cap may be used to write signals and update messages to a core that is not directly connected by next neighbor circuitry . fig4 depicts a network device that can process packets using techniques described above . as shown , the device features a collection of line cards 300 (“ blades ”) interconnected by a switch fabric 310 ( e . g ., a crossbar or shared memory switch fabric ). the switch fabric , for example , may conform to csix or other fabric technologies such as hypertransport , infiniband , pci , packet - over - sonet , rapidio , and / or utopia ( universal test and operations phy interface for atm ). individual line cards ( e . g ., 300 a ) may include one or more physical layer ( phy ) devices 302 ( e . g ., optic , wire , and wireless phys ) that handle communication over network connections . the phys translate between the physical signals carried by different network mediums and the bits ( e . g ., “ 0 ”- s and “ 1 ”- s ) used by digital systems . the line cards 300 may also include framer devices ( e . g ., ethernet , synchronous optic network ( sonet ), high - level data link ( hdlc ) framers or other “ layer 2 ” devices ) 304 that can perform operations on frames such as error detection and / or correction . the line cards 300 shown may also include one or more network processors 306 that perform packet processing operations for packets received via the phy ( s ) 302 and direct the packets , via the switch fabric 310 , to a line card providing an egress interface to forward the packet . potentially , the network processor ( s ) 306 may perform “ layer 2 ” duties instead of the framer devices 304 . while fig3 and 4 described specific examples of a network processor and a device incorporating network processors , the techniques may be implemented in a variety of architectures including network processors , general purpose processors ( e . g ., a central processing unit ( cpu )), and network devices having designs other than those shown . additionally , the techniques may be used in a wide variety of network devices ( e . g ., a router , switch , bridge , hub , traffic generator , and so forth ). the term packet can apply to ip ( internet protocol ) datagrams , tcp ( transmission control protocol ) segments , atm ( asynchronous transfer mode ) cells , ethernet frames , among other protocol data units . the term circuitry as used herein includes hardwired circuitry , digital circuitry , analog circuitry , programmable circuitry , and so forth . the programmable circuitry may operate on computer programs such as instructions included on an article of manufacture such as a read only memory or other storage medium .	6
the invention is described in detail below with reference to the drawings for purposes of illustration only . modifications within the spirit and scope of the invention , set forth in the appended claims will be readily apparent to one of skill in the art . referring to fig1 through 10 , there is shown a high capacity napkin dispenser 10 including a housing 12 , a faceplate 14 and a movable support plate 16 provided with a biasing spring 18 . faceplate 14 is hinged to a mounting bracket 20 which , in turn , is secured to housing 12 . a hinge suitably includes a pin ( not shown ) as well as a hinge plate 22 to secure faceplate 14 to bracket 20 such that it pivots between a closed position ( fig1 ) and an open position for reloading . hinge plate 22 includes ribs 23 . housing 12 and faceplate 14 thus define a storage chamber generally indicated at 13 for receiving a stack of napkins . housing 12 suitably includes two multi - faceted panels 24 , 26 as well as an end plate 28 . panels 24 , 26 define opposed sidewalls 30 , 32 , 34 and 36 when secured together by way of tabs 38 which fits in slots 40 . preferably , plates 16 , 28 are injection - molded and of identical construction . this reduces fabrication costs as well as provides an opportunity to include molded - in features in the plate such as the quick lock mounting for spring 18 described herein . so also , panels 24 , 26 are of identical construction which saves considerable capital costs when producing the molds . injection - molding allows for providing multiple molded - in features which reduces the number of parts as well as the labor required to fabricate the inventive dispensers . an optional tether 42 secures plate 28 to movable support plate 16 so that when the empty dispenser is opened support plate 16 is not pushed out of the interior of the housing by spring 18 . preferably , the ends of the spring are bent inwardly at ends 18 a , 18 b and secured to support plates 16 , 28 provided by way of quick locking hooks 17 , 19 with fingers 17 a and 19 a over apertures 17 b and 19 b respectively configured so that a tether is not necessary . details are best seen in fig8 . in particular , retention finger 17 a projects radially outward while retention finger 19 a projects tangentially with respect to the coils of helical spring 18 . retention protuberance 19 c formed on the lower surface of retention finger 19 a serves to retain the inwardly projecting free end 18 a of helical spring 18 . guide posts 21 and 23 together with rack 17 and 19 as well as stop pin 25 define an imaginary mounting circle 29 . during assembly , inwardly projecting end 18 a of helical spring 18 may be placed between stop pin 25 and retention hook 19 while diametrically opposed portion 31 of helical spring 18 is slipped under retention finger 17 b with guide posts 21 and 23 restraining lowermost coil 33 of helical spring 18 . helical spring 18 is then locked into position by urging inwardly projecting end 18 a of helical spring 18 under retention finger 19 a and past a retention protuberance protuberance 19 c thereby locking helical spring 18 in place . this arrangement ( repeated with plate 28 on the other end of spring 18 ) greatly expedites assembly of the dispenser . further , plates 16 and 28 may be substantially identical eliminating extra cost for an additional mold . after assembly and loading with napkins , the weight of a napkin stack compresses spring 18 which , in turn , forces the stack to the faceplate as the stack is depleted . faceplate 14 is provided with an elongate aperture 44 which extends between sidewalls 30 and 36 and provides access to the napkin stack . at the outer surface 46 of the faceplate there is optionally provided a molded - in label film layer 48 , which extends substantially over the entire outer surface of faceplate 14 . at the inner surface 50 of faceplate 14 there is provided a plurality of triangular guide ridges 52 , 54 and so forth inclined towards aperture 44 as is seen in fig3 . aperture 44 is suitably configured to restrict access to the napkins and encourage withdrawal of 1 napkin at a time . in this regard , the length of the aperture at 55 is typically about 5½ inches and the opening has a maximum width of about 1⅜ inches when single fold napkins having a tail of about 6½ are aligned with axis 55 of the aperture . the faceplate , with its relatively restrictive aperture , is also effective to hinder or prevent contaminants and debris such as drinking straws , used packaging material and so forth from finding their way into the interior of the dispenser . it is appreciated from fig3 in particular that the guide ridges extend progressively further from the inner surface of faceplate 14 with increasing distance from the dispensing aperture , thereby flaring away therefrom . the guide ridges are further characterized in that they are generally orthogonal to an elongate axis 55 of the dispensing aperture . it is also appreciated from the various diagrams , that the guide ridges are generally parallel to an axis 57 of the storage chamber when the faceplate is in the closed position . faceplate 14 is preferably injection - molded and of unitary structure . a preferred class of materials are acrylonitrile - butadiene - styrene ( abs ) molding compositions due to their unique combination of impact resistance and warp resistance . faceplate 14 is also provided with a unitary injection - molded locking latch 56 which is provided with a molded - in spring in the form of a pair of arms 58 , 60 which bear upon the guide ridges to bias latching member 62 of the latch to a locking position where it is maintained when mounted in the faceplate . when faceplate 14 is closed ( fig1 ) lock member 62 is thus maintained in locking engagement with portion 64 of bracket 20 when the faceplate is closed so that the faceplate cannot be opened . moreover , the locking latch 56 is mounted at inner surface 50 of faceplate 14 adjacent an end 66 of aperture 44 . latch 56 is thus concealed from view when the dispenser is closed , but readily accessible through aperture 44 to a technician aware of its placement at the end of the dispensing aperture . in order to release the latch , a technician simply pulls the latch away from the locking position by pulling on a lip 68 of the latch to displace it inwardly toward the center of the aperture . preferably , the latch has a beveled edge 72 to facilitate closing and is made of relatively durable polymer such as nylon or polyacetal . celcon acetal copolymer is available from celanese limited , dallas , tex . optionally , faceplate 14 and bracket 20 are provided as part of a kit with an additional collar 80 as shown in fig5 . collar 80 is sized to fit around an existing dispenser and to be secured to bracket 20 through an existing flange , for example . holes 82 , 88 , 94 and 96 are provided to secure the collar to bracket 20 , while holes 84 , 86 , 90 and . 92 can be used to secure the collar to a counter in which the dispenser is mounted . a cutaway 98 in the collar can be used to accommodate features of an existing dispenser , such as a latch which is no longer used . thus , the inventive arrangement is used to retrofit existing dispensers so that they are easier to operate . in a preferred construction of the inventive dispenser , bracket 20 defines an opening 100 ( fig3 ) suitable for retaining a stack of napkins 102 so that the dispenser may be more easily loaded . to this end , opening 100 is adjacent a pair of lateral retention ledges 102 , 104 which progressively project inwardly so that the napkins will be restrained within the dispenser when the cover ( faceplate 14 ) is open . preferably retention ledges 102 , 104 have a profile configured to grip the napkins lightly but allow them to slip out without imposing such a force on them that they will not be torn or otherwise damaged as they are dispensed . in this regard , it is noted that a geometry with simply a rectangular cantilever projecting over the opening of the storage chamber was less desirable than the bowed geometry seen in fig6 . the relative dimensions of opening 100 and a napkin stack 106 are better understood with reference to fig6 and 7 . fig6 is a view in section along line 6 - 6 of fig3 showing the profile of bracket 20 . bracket 20 has two laterally inwardly projecting retention ledges 102 , 104 as shown in the figures . each of these retention ledges 102 and 104 has an arcuate profile which flares upwardly and inwardly from its lower portions to its upper portions located adjacent dispensing opening 100 . at the lower portion , the bracket defines a lateral span 108 which is generally larger than the lateral span or width 110 of napkins to be dispensed through opening 100 . at the upper part of opening 100 the span between edges 102 , and 104 as shown at 112 is generally less than the span 110 of a napkin stack 106 to be dispensed there through . thus , if it is desired to dispense a stack of interfolded , single folded napkins 106 as shown in fig7 through opening 120 , the progressively inwardly projecting retention ledges 102 , 104 will restrain the stack as well as guide it through opening 102 . as will be appreciated from the diagram , portions 102 , 104 most preferably have an inwardly bowed , convex profile which projects progressively toward the center of the dispenser with height ( toward the aperture ) to facilitate dispensing through the opening without tearing or otherwise damaging the napkins . this geometry is also effective for hindering upward motion of the stack which is biased by spring 18 . it will be further appreciated from fig6 and 7 that the tails ( such as tail 105 ) of the napkins have their edges parallel to the contour lines of convex profiles 102 , 104 in a preferred embodiment . that is to say , the edges of the tails of the napkins are generally parallel to axis 55 of aperture 44 as may be seen in fig1 . in a preferred embodiment , span 110 of the napkins may be about 5 inches or so and the span at 112 may be about 4 . 5 inches , about 10 % less than the width of the napkin stack . fig8 is a detail showing spring 18 attached to end plate 16 , there is shown in fig9 an enlarged view of hook 19 and stop pin 25 for purposes of illustration . it will be appreciated from the discussion above that plate 28 is most preferably identical to plate 16 and secured to spring 18 in an identical manner . to this end , posts such as 21 , 23 and hooks such as 17 , 19 position and secure the plates to the spring . the radial hooks 17 have a finger 17 a extending generally in a radial direction with respect to axis 57 of spring 18 to secure the spring axially , while the tangential hooks 19 have a finger 19 a extending generally in a tangential direction with respect to the coils of spring 18 to hinder rotation of the spring and secure it to the plates . plates 16 , 28 are suitably injection - molded from an abs resin composition which is used for the other components of the dispenser such as the u - shaped panels defining the storage chamber for the napkins . a napkin dispenser faceplate of the invention is likewise made by injection - molding such that it has molded - in guide ridges inclined to the aperture in a unitary structure as illustrated . a preferred faceplate has a molded - in label film at its outer surface which gives the faceplate a brushed stainless steel appearance , for example , when a polymer layer printed with an appropriately pigmented ink is used . the inventive dispenser is most preferably provided with a decorative cover film 48 of the type illustrated schematically in fig1 . in fig1 there is shown a film such as film 150 which is provided with an ink layer 152 as shown in the diagram . film 150 may be a relatively thin , polycarbonate film if so desired , while ink layer 152 may be any suitable ink , preferably an ink which provides a metallic appearance to film 150 . a preferred method of fabrication is to print ink 152 onto film 150 and then thermoform the film into the desired shape . the thermoformed film is then positioned in a mold . thereafter a structural resin , such as resin 154 , is injection - molded onto the ink layer of the film while it is disposed in the mold . thus , the surface appearance is provided by way of a thermoformed film which has been positioned in the mold and provided with a structural backing to form the faceplate . the bilayer film preferably extends substantially over the entire outer surface of the faceplate . alternatively , metallic foil containing label film is used . a label film is shown schematically in fig1 . film 200 includes an optional adhesive layer 202 for securing it to the mold , optionally a protective outer layer 204 of transparent polymer , a facestock layer 206 and another optional melt - activated adhesive layer 208 . other suitable films are disclosed in u . s . pat . no . 6 , 773 , 653 to miller et al . the films are pre - cut and adhered to the mold by way of layer 202 , then the part is injection - molded from a molten injection - molding composition applied over the film . the heat - activated adhesive layer 208 of the film melt - bonds with the part to produce a durable structure which provides a very large number of decorative options by way of choosing a suitable facestock layer . moreover , other layers may be added as desired . the faceplate of the invention can thus be made with a metallic appearance on one side and integral plastic guide ridges on the other side without the need for making multiple parts to achieve the desired effect . the optional heat activated or heat - activatable layer of the label film is a layer of material which is activated by heat during the molding process to improve bonding of the label to a plastic article in the molding process . materials for the heat - activatable adhesive layer may comprise any heat - activatable adhesive or thermoplastic film material . such materials include but are not limited to the following film - forming materials used alone or in combination such as polyolefins , ( linear or branched ), metallocene catalyzed polyolefins , syndiotactic polystyrenes , syndiotactic polypropylenes , cyclic polyolefins , polyacrylates , polyethylene ethyl acrylate , polyethylene methyl acrylate , acrylonitrile butadiene styrene polymer , ethylene - vinyl alcohol copolymer , ethylene - vinyl acetate copolymers , polyamides such as nylon , polystyrenes , polyurethanes , polysulfones , polyvinylidene chlorides , polycarbonates , styrene maleic anhydride polymers , styrene acrylonitrile polymers , ionomers based on sodium or zinc salts of ethylene / methacrylic acid , cellulosics , fluoroplastics , polyacrylonitriles , and thermoplastic polyesters . more specific examples are the acrylates such as ethylene methacrylic acid , ethylene methyl acrylate , ethylene acrylic acid and ethylene ethyl acrylate . also , included are polymers and copolymers of olefin monomers having , for example , 2 to about 12 carbon atoms , and in one embodiment 2 to about 8 carbon atoms . these include the polymers of alpha - olefins having from 2 to about 4 carbon atoms per molecule . these include polyethylene , polypropylene , poly - 1 - butene , etc . an example of a copolymer within the above definition is a copolymer of ethylene with 1 - butene having from about 1 to about 10 weight percent of the 1 - butene comonomer incorporated into the copolymer molecule . the polyolefins include amorphous polyolefins . the polyethylenes that are useful in the heat seal layer include those with various densities including low , medium and high density ranges . the ethylene / methyl acrylate copolymers available from chevron under the tradename emac can be used . these include emac 2260 , which has a methyl acrylate content of 24 % by weight and a melt index of 2 . 0 grams / 10 minutes at 190 ° c ., 2 . 16 kg ; and emac sp 2268t , which also has a methyl acrylate content of 24 % by weight and a melt index of 10 grams / 10 minutes at 190 ° c ., 2 . 16 kg . polymer film materials prepared from blends of copolymers or blends of copolymers with homopolymers are also useful . also , the heat activatable first adhesive layer may contain antiblock additives ( such as silica , diatomaceous earth , synthetic silica , glass spheres , ceramic partides , etc .) this layer also may contain an antistatic additive ( such as an amine or an amide or a derivative of a fatty acid ). the heat activatable adhesive layer is designed for and activated at temperatures known to those skilled in the art . generally the heat - activatable first adhesive layer has a lower melting point than any of the other layers of the in - mold label . while the heat activatable layer may activate at temperatures below those specified for activation , the layer is designed to activate at certain temperatures based on the substrate material under normal in - mold labeling conditions . in one embodiment , the heat activatable adhesive layer activates at temperatures between about 80 ° c . to about 300 ° c ., more often the heat seal layer activates at temperatures between about 87 ° c . to about 250 ° c . the facestock layer may include or consist of paper , foils , pigmented polymer layers and so forth as enumerated in u . s . pat . no . 6 , 773 , 653 noted above . the polymer facestock and the heat activatable first adhesive layer may be formed by simultaneous extrusion from two or more extruders with a suitable coextrusion die whereby the facestock and first adhesive layer are adhered to each other in a permanently combined state to provide a unitary coextrudate . a tie layer ( adhesion promoting layer ) may also be coextruded with the facestock and the heat - activatable first adhesive layer to improve the adhesion of the heat - activatable layer to the facestock . alternatively , a coating process may be used to lay down a layer of the heat - activatable material on the facestock , or the two layers can be formed separately and thereafter laminated together with or without the acid of an adhesive layer . while the invention has been illustrated in connection with several examples , modifications to these examples within the spirit and scope of the invention will be readily apparent to those of skill in the art . in view of the foregoing discussion , relevant knowledge in the art and references discussed above in connection with the background and detailed description , the disclosures of which are all incorporated herein by reference , further description is deemed unnecessary .	0
reference will now be made to the drawings , wherein to the extent possible , like elements are designated by like reference numerals in the various views . in fig1 , an exemplary prior art quick connector assembly 10 is illustrated . such quick connector assemblies typically include a male adaptor 12 which is received and sealingly retained in a plastic or metal female connector housing 14 defining a through bore . within the connector housing 14 , an o - ring sealing element 16 is typically seated within an o - ring groove 18 defined on one side by a sealing ring 20 . in the prior art construction , the sealing ring 20 is fixed in place by welding or the like so as to contain the o - ring sealing element 16 within the o - ring groove 18 . in this configuration , the o - ring sealing element 16 is substantially blocked against axial movement . as illustrated , in the exemplary prior art construction , a spring clamp 30 of metal or the like is positioned rearward of the sealing ring 20 . as shown , the spring clamp 30 may be of a generally ring - shaped configuration with a substantially elliptical or other non - circular geometry . the male adaptor 12 may include a proximal end 32 which matedly engages a hose or other structure ( not shown ). the male adaptor 12 also includes a distal end 34 which is adapted for insertion into the connector housing 14 in substantially coaxial relation to the housing through bore . an enhanced diameter intermediate collar 36 is disposed between the proximal end 32 and the distal end 34 . a radial groove 40 is disposed within the intermediate collar 36 . as the male adaptor 12 is inserted into the connector housing 14 , the spring clamp 30 is first engaged and caused to deform radially outwardly by outward force from the distal end 34 . as the male adaptor 12 is advanced further into the connector housing 14 , the distal end 34 is forced through the o - ring sealing element 16 , thereby causing the o - ring sealing element 16 to expand radially outwardly to fill the o - ring groove 18 . upon full insertion of the male adaptor 12 into the connector housing , the spring clamp 30 falls into the radial groove 40 at the intermediate collar 36 . with the spring clamp 30 captured in the radial groove 40 , the male adaptor 12 is blocked against axial displacement . the radial expansion of the o - ring sealing element 16 provides a fluid tight seal between the male adaptor 12 and the surrounding connector housing 14 . in this configuration a sealed fluid passageway is established across the connector housing 14 . referring now to fig2 and 3 , an improved quick connector assembly 110 consistent with the present disclosure will now be described wherein elements corresponding to those previously described will be designated by like reference numerals within a 100 series . as illustrated , the quick connector assembly 110 includes a male adaptor 112 and a connector housing 114 defining an axial through bore . the male adaptor 112 and the connector housing 114 are adapted for mated engagement as illustrated by the force arrows in the various views . as shown , the male adaptor 112 may have a configuration generally as described in reference to the prior art . in this regard , the male adaptor 112 may include a proximal end 132 which matedly engages a hose or other structure ( not shown ). the male adaptor 112 may also include a flared distal end 134 having a rounded nose 135 as best seen in fig3 which is adapted for insertion into the connector housing 114 . in the illustrated exemplary construction , an enhanced diameter intermediate collar 136 is disposed between the proximal end 132 and the distal end 134 . a radial groove 140 may be disposed within the intermediate collar 136 . referring jointly to fig2 and 3 , it may be seen that the illustrated , exemplary quick connector assembly 110 includes a compressible sealing element 150 in combination with a floating retainer ring 160 . this combination facilitates the insertion of the male adaptor 112 by reducing the force required during the initial stage of insertion . in particular , the use of the floating retainer ring 160 which may slide axially relative to the adjacent surface of the connector housing 114 permits early stage insertion forces to be minimized , while nonetheless permitting compression and reshaping of the compressible sealing element 150 to establish a fluid tight seal . as best illustrated in fig3 , the floating retainer ring 160 may have a generally wedge - shaped cross - section construction incorporating a rear forward sloped face 162 projecting in a direction generally opposing the direction of male adaptor insertion . the floating retainer ring 160 may also include a forward face 164 which is adapted to engage and compress the compressible sealing element 150 as will be described further hereinafter . prior to insertion of the male adaptor 112 into the connector housing 114 , the compressible sealing element 150 may be disposed in resting relation within the interior of the connector housing 114 adjacent to a supporting radial shoulder surface 168 . in this regard , it will be understood that the compressible sealing element 150 may be a generally ring - shaped structure with a cross - section adapted for folding deformation upon the application of compression in the axial direction . in this regard , the cross - section of the compressible sealing element 150 may define one or more leg segments intersecting to form living hinges to facilitate such folding deformation . the compressible sealing element 150 may be formed from an elastomer with sufficient dimensional stability such that the sealing element 150 maintains a general ring structure within the connector housing 114 prior to use and does not fall out . prior to insertion of the male adaptor 112 into the connector housing 114 , the floating retainer ring 160 may be disposed in floating relation between the compressible sealing element 150 and a sealing ring ( not shown ) as previously described in relation to fig1 . thus , the floating retainer ring 160 is initially permitted to slide axially relative to the opposing surface of the connector housing 114 within a zone bordered by the compressible sealing element 150 and the sealing ring . of course , other arrangements may likewise be used if desired . as best seen in fig3 , in the exemplary construction , the male adaptor 112 may include a forward projecting sloped shoulder surface 170 defining a portion of flared distal end 134 in spaced apart relation to the rounded nose 135 . the sloped shoulder surface 170 of the male adaptor 112 is adapted to contact and bear against the rear sloped face 162 of the floating retainer ring in the final assemble condition . in this final condition , the compressible sealing element 150 may be deformably compressed between the forward face 164 of the floating retainer ring 160 and the opposing radial shoulder surface 168 . the compressible sealing element 150 is also compressed between flared distal end 134 and the opposing surface of the connector housing 114 thereby providing a fluid - tight seal . at the same time , axial withdrawal of the male adaptor 112 may be blocked by engagement between in the same manner as described in relation to fig1 . as noted previously , a significant benefit of the quick connector assembly 110 is the reduction in the force required to achieve full insertion of the male adaptor 112 . in this regard , upon initial insertion of the male adaptor 112 , the male adaptor 112 will first contact the floating retainer ring 160 and will cause the floating retainer ring 160 to move axially forward generally into the position illustrated in fig3 as the male adaptor 112 itself moves inwardly . as will be appreciated , during this initial stage of insertion , the male adaptor 112 encounters minimal resistance as the surface of the male adaptor moves over the compressible sealing element 150 . at the final stage of insertion , as axial force is applied to the male adaptor 112 , the sloped shoulder surface 170 urges the floating retainer ring 160 progressively forward against the compressible sealing element 150 until the final locked relation is achieved . however , this final distance of movement by the floating retainer ring 160 may be quite short such that the overall insertion effort is still relatively minimal . in the final assembled condition , the compressible sealing element is compressed to a deformed shape thereby forming the desired sealed relationship . as indicated previously , the compressible sealing element 150 may be a generally ring - shaped structure with a substantially non - circular cross - section adapted for folding deformation or reorientation upon the application of compression in the axial direction . in this regard , the compressible sealing element may have one or more leg segments with a length to thickness ratio greater than about 1 . 2 and more preferably a length to thickness ratio greater than about 2 . 0 and more preferably a length to thickness ratio greater than about 3 . 0 . as illustrated in fig2 and 3 , one possible configuration for the compressible sealing element 150 is an elastomer ring structure with a generally “ v ” shaped cross - section . as will be readily understood , as axial forces are applied , such a “ v ” configuration may undergo folding deformation at the living hinge formed at the intersection of the leg segments forming the “ v ”. thus , the structure may fold in a hinging manner as the compressible sealing element 150 is pressed between the floating retainer ring 160 and the radial shoulder surface 168 . as this folding takes place , the compressible sealing element 150 will be urged to adopt an increased height within its zone of confinement thereby pressing against the opposing surfaces of the male adaptor 112 and the connector housing 114 and establishing the desired sealed condition . it is also contemplated that any number of other cross - sectional configurations may be used for a compressible sealing element within a quick connector assembly consistent with the present disclosure . by way of example only , and not limitation , fig4 illustrates one exemplary configuration for a compressible sealing element 250 for use in a quick connection assembly 210 consistent with the present disclosure . in the embodiment illustrated in fig4 , a compressible sealing element 250 may be an elastomeric ring having a generally “ m ” shape or “ w ” shape cross section . such a sealing element may be disposed in a compression zone bordered by the male adaptor 212 , the connector housing 214 and the floating retainer ring 260 as previously described . such a configuration may undergo folding deformation as axial forces are applied . more particularly , the structure may fold in a hinging manner as the compressible sealing element 250 is pressed between the floating retainer ring 260 and the radial shoulder surface 268 . as this folding takes place , the compressible sealing element 250 will also be urged to adopt an increased height within its zone of confinement thereby pressing against the opposing surfaces of the male adaptor 212 and the connector housing 214 and establishing the desired sealed condition . fig5 illustrates yet another exemplary configuration for a compressible sealing element 350 for use in a quick connection assembly 310 consistent with the present disclosure . in the embodiment illustrated in fig5 , a compressible sealing element 350 may be an elastomeric ring having a generally tilted , elliptical cross section for disposition in a compression zone bordered by the male adaptor 312 , the connector housing 314 and the floating retainer ring 360 as previously described . such a configuration may undergo folding deformation and / or reorientation to a more vertical orientation as axial forces are applied and the compressible sealing element 350 is pressed between the floating retainer ring 360 and the radial shoulder surface 368 . as this folding and / or reorientation takes place , the compressible sealing element 350 will also be urged to press against the opposing surfaces of the male adaptor 312 and the connector housing 314 and establish the desired sealed condition . it is also contemplated that the use of a floating retainer ring may be eliminated if desired . by way of example only , and not limitation , fig6 - 8 illustrate one exemplary construction for a quick connector assembly 410 consistent with the present disclosure and wherein no floating retainer ring is used . in fig6 - 8 , elements corresponding to those previously described will be designated by like reference numerals within a 400 series . as illustrated , the quick connector assembly 410 includes a male adaptor 412 and a connector housing 414 defining an axial through bore . the male adaptor 412 and the connector housing 414 are adapted for mated engagement as best illustrated in fig7 and 8 . as shown , the male adaptor 412 may include a proximal end 432 which matedly engages a hose or other structure ( not shown ). the male adaptor 412 may also include a flared distal end 434 having a rounded nose 435 which is adapted for insertion into the connector housing 414 . in the illustrated exemplary construction , an enhanced diameter intermediate collar 436 is disposed between the proximal end 432 and the distal end 434 . a radial groove 440 may be disposed within the intermediate collar 436 for engagement with the spring clamp 430 . referring jointly to fig6 - 8 , it may be seen that the illustrated , exemplary quick connector assembly 410 includes a compressible sealing element 450 adapted for disposition in sealing relation between the distal end 434 of the male adaptor and an interir surface of the connector housing 414 . as can be best seen through joint reference to fig6 and 7 , the compressible sealing element 450 may be a generally ring - shaped structure with a cross - section adapted for folding deformation upon the application of compression in the axial direction . in this regard , the cross - section of the compressible sealing element 450 may define one or more leg segments intersecting to form living hinges to facilitate such folding deformation . such leg segments may be characterized by a length to thickness ratio greater than about 1 . 2 and more preferably a length to thickness ratio greater than about 2 . 0 and more preferably a length to thickness ratio greater than about 3 . 0 . prior to insertion of the male adaptor 412 into the connector housing 414 , the compressible sealing element 450 may be disposed in resting relation within the interior of the connector housing 414 adjacent to a supporting radial shoulder surface . the compressible sealing element 450 may be formed from an elastomer with sufficient dimensional stability such that the sealing element 450 maintains a general ring structure within the connector housing 414 prior to use and does not fall out . as illustrated , in the exemplary construction , the male adaptor 412 may include a forward projecting sloped shoulder surface 470 defining a portion of the flared distal end 434 in spaced apart relation to the rounded nose 435 . the sloped shoulder surface 470 of the male adaptor 412 is adapted to contact and bear against the rear face 452 of the compressible sealing element 450 in the final assembled condition . as shown , the sloped shoulder surface 470 and the rear face 452 of the compressible sealing element 450 may have generally complementary angles such that they may slide over one another as the male adaptor is being inserted into the final sealed condition illustrated in fig8 . in this final condition , the compressible sealing element 450 may be deformably compressed between the sloped shoulder surface 470 of the male adaptor and and an opposing radial shoulder surface 468 in the connector housing , thereby providing a fluid - tight seal . at the same time , axial withdrawal of the adaptor 412 may be blocked by engagement between the spring clamp 430 and the radial groove 440 in the same manner as described in relation to fig1 . of course , variations and modifications of the foregoing are within the scope of the present disclosure . the use of the terms “ a ” and “ an ” and “ the ” and similar referents in the context of describing the invention ( especially in the context of the following claims ) are to be construed to cover both the singular and the plural , unless otherwise indicated herein or clearly contradicted by context . the terms “ comprising ,” “ having ,” “ including ,” and “ containing ” are to be construed as open - ended terms ( i . e ., meaning “ including , but not limited to ,”) unless otherwise noted . recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range , unless otherwise indicated herein , and each separate value is incorporated into the specification as if it were individually recited herein . all methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context . the use of any and all examples , or exemplary language ( e . g ., “ such as ”) provided herein , is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed . no language in the specification should be construed as indicating any non - claimed element as essential to the practice of the invention . preferred embodiments of this invention are described herein , including the best mode known to the inventors for carrying out the invention . variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description . the inventors expect skilled artisans to employ such variations as appropriate , and the inventors intend for the invention to be practiced otherwise than as specifically described herein . accordingly , this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law . moreover , any combination of the above - described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context .	5
embodiments of the fuel cell discharge - gas processing device of the present invention shall be explained hereinbelow referring to the drawings of fig1 to fig4 . fig1 is a schematic lineblock diagram of a fuel cell system equipped with the discharge - gas processing device according to this invention , which in this embodiment is mounted in a fuel cell vehicle . a fuel cell 1 is of the type that obtains electrical power through chemical reactions of reactant gases . it is constituted by , for example , laminating a plurality of cells formed by sandwiching a solid polymer electrolyte membrane 2 including a solid polymer ion exchange membrane etc . between an anode 3 and a cathode 4 ( shown by the single cell in fig1 ). when hydrogen gas ( reactant gas ) is supplied to the anode 3 as a fuel gas , and air containing oxygen ( reactant gas ) is supplied to the cathode 4 as an oxidizing agent gas , hydrogen ions generated by a catalytic reaction in the anode 3 pass the solid polymer electrolyte membrane 2 and travel to the cathode 4 , where electricity is generated by the electrochemical reaction with the oxygen and water is produced . since a portion of the produced water generated at the cathode side penetrates the solid polymer electrolyte membrane 2 and back diffuses to the anode side , produced water also exists at the anode side . air is pressurized to a prescribed pressure by a compressor 7 , such as a supercharger ( s / c ), and is supplied to the cathode 4 of the fuel cell 1 through an air supply path 8 . after the air supplied to the fuel cell 1 is used for electricity generation , it is discharged , along with the produced water of the cathode side , from the fuel cell 1 to an air exhaust path 9 , and introduced into the discharge - gas processing device 50 through a pressure control valve 10 . hereinafter , the air supplied to the fuel cell 1 is referred to as supply air , and the air discharged from the fuel cell 1 is referred to as discharged air to distinguish between them . either supply air or discharged air may be used as diluent gas . the hydrogen gas supplied from a hydrogen tank 15 flows through a hydrogen gas supply path 17 , is decompressed to a prescribed pressure along the way by a regulator 16 , controlled to a prescribed flow rate by a flow control valve 23 , and supplied to the anode 3 of the fuel cell 1 through an ejector 19 . the unreacted hydrogen gas which was not consumed is discharged as anode off - gas from the fuel cell 1 , sucked by the ejector 19 through an anode off - gas path 18 , merged with the fresh hydrogen gas supplied from the hydrogen tank 15 and supplied again to the anode 3 of the fuel cell 1 . to wit , the anode off - gas discharged from the fuel cell 1 circulates through the fuel cell 1 , passing the anode off - gas path 18 and the hydrogen gas supply path 17 downstream of the ejector 19 . in this embodiment , the hydrogen gas supply path 17 downstream of the ejector 19 and the anode off - gas path 18 constitute a fuel gas circulation path 20 . an anode off - gas exhaust path 22 equipped with an exhaust valve 21 branches off from the anode off - gas path 18 , and the anode off - gas exhaust path 22 is connected to the discharge - gas processing device 50 . in this discharge - gas processing device 50 , the anode off - gas discharged from the anode off - gas exhaust path 22 is diluted by the discharged air discharged from the air exhaust path 9 , and then discharged to a discharge section through a mixed gas exhaust path 30 . moreover , the discharge - gas processing device 50 is constituted to be able as required to discharge gas therein from the upper portion thereof through a gas venting path 32 by opening a gas venting valve 31 . the gas venting path 32 is connected to an air exhaust path 33 to which air is supplied from a fan 34 , with an ejector 35 provided at the connection with the gas venting path 32 . electric power obtained by power generation of the fuel cell 1 is supplied to a load , such as a motor for driving a vehicle ( not illustrated ). moreover , the rotation frequency of the compressor 7 , opening of the pressure control valve 10 and the flow control valve 23 , the exhaust valve 21 , the gas venting valve 31 , and the fan 34 are controlled by an electronic control unit ( hereafter , ecu ) 40 . in the fuel cell system constituted thus , as mentioned above power generation of the fuel cell 1 may become unstable during continuous operation due to an increased concentration of impurities ( such as water and nitrogen ) in the hydrogen gas flowing though the fuel gas circuit 20 . therefore , when it is judged by the ecu 40 in this fuel cell system that the fuel cell system has been in continuous operation for a definite period of time , or when it is judged that the stability of power generation of the fuel cell 1 has dropped , determining there is a demand to discharge impurities , it opens the exhaust valve 21 , intermittently discharges anode off - gas containing the impurities from the anode off - gas path 18 to the discharge - gas processing device 50 through the anode off - gas exhaust path 22 , and controls the impurity concentration in the hydrogen gas which flows through the anode 3 of the fuel cell 1 to not exceed a predetermined value , and so maintains power generation of the fuel cell 1 in a stabilized state . next , the structure of the discharge - gas processing device 50 shall be explained in detail referring to the drawings of fig2 to fig4 . the discharge - gas processing device 50 is equipped with an airtight cylindrical dilution container 51 . the dilution container 51 is provided in a vehicle with its axial center oriented in a substantially horizontal direction , with its cross - sectional shape perpendicular to the axial center direction forming an identical elliptical shape along the full length in the axial direction , and the long axis of this ellipse arranged in the vertical direction . in other words , the axial center of the dilution container 51 is set in a substantially horizontal orientation , and its cross - sectional shape perpendicular to the axial center is composed of a curve forming a convex curve shape on the outside along the perimeter of the closed cross section . an anode off - gas introduction pipe ( anode gas introduction path ) 52 arranged horizontally with its axial center slightly lower than the axial center of the dilution container 51 is passed through and fixed to an end plate 51 a of one end side of the dilution container 51 in the axial direction . the distal end of the anode off - gas introduction pipe 52 inserted into the dilution container 51 is cut obliquely to be made into an anode off - gas emission hole 52 a . the opening of the anode off - gas emission hole 52 a is oriented obliquely upward . the anode off - gas exhaust path 22 is connected to the base end of the anode off - gas introduction pipe 52 , so that when the exhaust valve 21 opens , anode off - gas is introduced into the dilution container 51 from the anode off - gas emission hole 52 a . moreover , in the inside of the dilution container 51 , a partition panel 53 is fixed forward of the distal end of the anode off - gas introduction pipe 52 , in substantially the middle of the dilution container 51 in the axial direction , with a substantially vertical orientation . the partition panel 53 forms the shape of an ellipse with its upper portion cut away , and is closely fixed to the inner surface of the dilution container 51 except for a notch portion 53 a . the inside of the dilution container 51 is divided by the partition panel 53 into an upstream chamber 54 communicating with the anode off - gas introduction pipe 52 and a diluent gas emission hole 58 to be described hereinbelow , and a downstream chamber 55 communicating with a mixed gas discharge hole 61 described hereinbelow , with the side above the notch portion 53 a forming a communication gas path 56 that communicates with the upstream chamber 54 and the downstream chamber 55 . the notch portion 53 a of the partition panel 53 is positioned sufficiently above the axial center of the dilution container 51 , with the partition panel 53 existing on the axial extension of the anode off - gas introduction pipe 52 . accordingly , as shown in fig3 , most of the anode off - gas emitted from the anode off - gas emission hole 52 a is emitted toward the partition panel 53 , with a portion being emitted obliquely upward from the anode off - gas emission hole 52 a . moreover , a top gas discharge hole ( gas discharge hole ) 62 is formed above the partition panel 53 in the dilution container 51 , and the gas venting path 32 is connected to this top gas discharge hole 62 . furthermore , a diluent gas pipe ( diluent gas path ) 57 that passes from the end plate 51 a on one side of the dilution container 51 to an end plate 51 b on the other side in the axial direction is fixed along the lowest portion ( inner bottom ) of the inner surface of the dilution container 51 . this diluent gas pipe 57 also penetrates the partition panel 53 . the air exhaust path 9 is connected to an upstream end portion 57 a of the diluent gas pipe 57 , and the mixed gas exhaust path 30 is connected to the downstream end portion 57 b . the discharged air discharged from the cathode of the fuel cell 1 to the air exhaust path 9 passes through the diluent gas pipe 57 and is discharged to the discharge section through the mixed gas exhaust path 30 . the diluent gas emission hole 58 is provided in the portion of the diluent gas pipe 57 accommodated in the upstream chamber 54 , in the vicinity of the end plate 51 a . the diluent gas emission hole 58 opens at the top portion of the diluent gas pipe 57 , and is provided at a position that is closer than the anode off - gas emission hole 52 a of the anode off - gas introduction pipe 52 to the end plate 51 a . this diluent gas emission hole 58 emits a portion of the discharged air flowing through the diluent gas pipe 57 to the upstream chamber 54 . in addition , in this embodiment , since the diluent gas emission hole 58 is directly provided in the diluent gas pipe 57 , the diluent gas emission hole 58 itself doubles as a communicating portion with the diluent gas emission hole 58 and the diluent gas pipe 57 . here , since the anode off - gas emission hole 52 a is oriented facing obliquely upward as described above , and the diluent gas emission hole 58 faces straight up , it can be the that the anode off - gas emission hole 52 a and the diluent gas emission hole 58 are in a mutually non - opposing spatial relationship . since this can prevent the anode off - gas emitted from the anode off - gas emission hole 52 a from flowing backward in the diluent gas pipe 57 through the diluent gas emission hole 58 , it can prevent discharge of insufficiently diluted anode off - gas . moreover , a constriction portion 59 that depresses the top portion of the diluent gas pipe 57 to reduce the opening area is provided in the portion of the diluent gas pipe 57 accommodated in the upstream chamber 54 , downstream of the diluent gas emission hole 58 . the constriction state ( opening area ) of the constriction portion 59 can adjust the flow rate of the discharged air introduced into the upstream chamber 54 from the diluent gas emission hole 58 . in addition , in this embodiment , the diluent gas pipe 57 is formed with a uniform pipe diameter except for the constriction portion 59 . furthermore , drain holes 60 are provided in the diluent gas pipe 57 , downstream of the constriction portion 59 , at portions accommodated in each of the upstream chamber 54 and the downstream chamber 55 . as shown in fig4 , paired left and right drain holes 60 are provided at the lower half portion of the diluent gas pipe 57 , near the point of contact with the lowest part ( inner bottom ) of the inner surface of the dilution container 51 . liquid that accumulates at the inner bottom of the upstream chamber 54 or the downstream chamber 55 is drawn into the diluent gas pipe 57 through these drain holes 60 . in addition , in this embodiment , since the drain holes 60 are directly established in the diluent gas pipe 57 , the drain holes 60 themselves become communicating portions of the drain holes 60 and the diluent gas pipe 57 . moreover , a mixed gas discharge hole 61 is provided in the portion of the diluent gas pipe 57 accommodated in the downstream chamber 55 , downstream of the drain holes 60 and near the end plate 51 b . the mixed gas discharge hole 61 opens at the top portion of the diluent gas pipe 57 , with gas in the downstream chamber 55 being discharged into the diluent gas pipe 57 through this mixed gas discharge hole 61 . in this embodiment , since the mixed gas discharge hole 61 is directly formed in the diluent gas pipe 57 , the mixed gas discharge hole 61 itself doubles as a communicating portion with the mixed gas discharge hole 61 and the diluent gas pipe 57 . next , the operation of the discharge - gas processing device 50 shall be explained . in this discharge - gas processing device , always while supplying air from the compressor 7 to the cathode 4 of the fuel cell 1 , the discharged air discharged from the cathode 4 of the fuel cell 1 is introduced into the diluent gas pipe 57 of the discharge - gas processing device 50 through the air exhaust path 9 and the pressure control valve 10 , flows through the diluent gas pipe 57 toward the mixed gas exhaust path 30 , with a portion of the discharged air flowing through the diluent gas pipe 57 being emitted from the diluent gas emission hole 58 into the upstream chamber 54 . on the other hand , as mentioned above , when the ecu 40 judges there to be a demand to discharge impurities , the exhaust valve 21 opens , anode off - gas is discharged from the anode off - gas path 18 , introduced into the anode off - gas introduction pipe 52 of the discharge - gas processing device 50 through the anode off - gas exhaust path 22 , and emitted from the anode off - gas emission hole 52 a into the upstream chamber 54 . accordingly , when anode off - gas is not emitted from the anode off - gas emission hole 52 a to the upstream chamber 54 , ( to wit , when the exhaust valve 21 is closed ), the pressure in the dilution container 51 hardly rises . however , when the exhaust valve 21 is open and anode off - gas is intermittently emitted from the anode off - gas emission hole 52 a to the upstream chamber 54 , the internal pressure of the dilution container 51 suddenly rises . that is , a pressure change occurs in the dilution container 51 according to the discharge cycle of the anode off - gas . the dilution container 51 in this embodiment has a cross - sectional shape perpendicular to the axial center direction that consists of a curve ( ellipse ) forming a convex curve shape on the outside along the perimeter of the closed cross section . therefore , the dilution container 51 has extremely high mechanical strength ( pressure capacity ) against internal pressure and deformation ( repetitive stress ) due to breathing of the dilution container , which can be sufficiently withstood without a special reinforcing structure . a special reinforcing structure is unnecessary , the discharge - gas processing device 50 can be easily manufactured . as shown in fig3 , anode off - gas emitted from the anode off - gas emission hole 52 a collides with the partition panel 53 , altering its flow direction , and the collision with the partition panel 53 reduces its flow speed so that it spreads mostly throughout the inside of the upstream chamber 54 at a moderate flow speed . thereby , while being partially mixed with the discharged air in the upstream chamber 54 , the anode off - gas flows into the downstream chamber 55 through the communication gas path 56 and flows toward the mixed gas discharge hole 61 . in the meantime , blending is further performed between the mixed gas flowing in from the upstream chamber 54 and the gas in the downstream chamber 55 . the gas of the downstream chamber 55 is discharged from the mixed gas discharge hole 61 to the diluent gas pipe 57 to be further diluted by being mixed with discharged air flowing through the diluent gas pipe 57 before being discharged . in this embodiment , the travel distance of the gas within the dilution container 51 can be lengthened by providing the partition panel 53 . furthermore , the travel distance of the gas in the dilution container 51 can also be lengthened even by disposing the diluent gas emission hole 58 in the vicinity of one end portion in the axial direction of the dilution container 51 and disposing the mixed gas discharge hole 61 in the vicinity of the other end portion in the axial direction of the dilution container 51 . as a result , since the stagnation time of the gas in the dilution container 51 can be prolonged to be able to ensure sufficient time necessary for dilution , the anode off - gas can be reliably diluted . in addition , as stated above , since the flow rate of the discharged air introduced into the upstream chamber 54 from the diluent gas emission hole 58 can be adjusted by the constriction state ( opening area ) of the constriction portion 59 provided downstream of the diluent gas emission hole 58 in the diluent gas pipe 57 , by setting the constriction state ( opening area ) of the constriction portion 59 to a predetermined value , the flow rate of diluent gas emitted from the diluent gas emission hole 58 to inside the upstream chamber 54 can be set to the optimal flow rate for dilution of the anode off - gas , so that the anode off - gas can be discharged sufficiently diluted . moreover , water is contained in a liquid or gas ( steam ) state in the anode off - gas introduced into the dilution container 51 as mentioned above . in this embodiment , the axial center of the anode off - gas introduction pipe 52 is disposed horizontally , and the distal end of the anode off - gas introduction pipe 52 is obliquely cut to form the anode off - gas emission hole 52 a . this can prevent accumulation of liquid at the distal end of the anode off - gas introduction pipe 52 , and can prevent blocking of the anode off - gas introduction pipe 52 by liquid accumulation . furthermore , in this embodiment , since the anode off - gas is emitted toward the partition panel 53 from the anode off - gas emission hole 52 a , liquid contained in the anode off - gas collides with and adheres to the partition panel 53 , and then falls along the vertically oriented partition panel 53 . moreover , condensation is promoted because the steam in the anode off - gas also collides with the partition panel 53 , and this condensate also falls along the vertically oriented partition panel 53 . that is , the partition panel 53 catches the moisture in the anode off - gas , aiding collection at the bottom of the dilution container 51 . moreover , the water in the anode off - gas ( liquid and steam ) is caught also on the inner surface of the dilution container 51 . liquid adhering to the inner surface of the dilution container 51 and the condensate condensed on the inner surface of the dilution container 51 fall along the inner surface of the dilution container 51 , as shown in fig4 . in this embodiment , since the axial center of the dilution container 51 is provided in a horizontal orientation , and the cross - sectional shape perpendicular to the axial center direction forms a convex curve on the outside along the perimeter of the closed cross section , liquid can be reliably collected at the lowest portion of the dilution container 51 in the vertical direction ( that is , the inner bottom portion of the dilution container 51 ), with no stagnation occurring at the other areas . in particular , in this embodiment , since the cross sectional shape of the dilution container 51 is elliptical , and the long axis of this ellipse is disposed in the vertical direction , the flow speed of liquid that falls along the inner surface of the dilution container 51 can be quickened , and as a result , the liquid can be swiftly collected at the lowest portion ( that is , the inner bottom portion ) of the dilution container 51 . liquid collected at the inner bottom portion of the dilution container 51 is thus drawn from the drain holes 60 into the diluent gas pipe 57 , to be discharged to the mixed gas exhaust path 30 together with the mixed gas . in this embodiment , since the drain holes 60 are provided in the lower half of the diluent gas pipe 57 , at a position near the inner bottom portion of the dilution container , liquid that stagnates at the bottom of the dilution container 51 can be easily discharged , and the un - discharged liquid that remains in the dilution container 51 can be reduced , thereby enhancing drainage performance . in addition , in this embodiment , since the constriction portion 59 is formed immediately upstream of the drain holes 60 , stagnate liquid inside the dilution container 51 can be effectively sucked up . for this reason , liquid can be discharged promptly . the suction force can be increased because the pressure on the downstream side of the constriction portion 59 is less than the upstream side . moreover , while the fuel cell 1 is stopped , the slight amount of anode off - gas ( hydrogen gas ) which remains in the dilution container 51 may stagnate at the top portion . when this happens , opening the gas venting valve 31 can discharge the anode off - gas to the air exhaust path 33 via the gas venting path 32 . in this case , activating the fan 34 forces air into the air exhaust path 33 through the ejector 35 . thereby , anode off - gas stagnated at the top portion of the dilution container 51 during stoppage of the fuel cell 1 can be diluted and discharged while being drawn by negative pressure of the discharged air . as a result , the anode off - gas in the dilution container 51 can be prevented from flowing backward upstream while the fuel cell 1 is stopped . moreover , in this embodiment , since the diluent gas emission hole 58 , the mixed gas discharge hole 61 , and the drain holes 60 are all directly provided in the diluent gas pipe 57 , the structure of the discharge - gas processing device is simple . for example , in the aforementioned embodiment , the cross section of the dilution container was made elliptical , but it is also possible to be circular . also , in the aforementioned embodiment , discharged air ( cathode off - gas ) discharged from the cathode of the fuel cell was used as the diluent gas , but the diluent gas is not limited thereto . moreover , it is also possible not to provide the diluent gas emission hole , the mixed gas discharge hole , and the drain holes in the diluent gas path directly , but to provide these holes in branch pipes that branch from the diluent gas path . moreover , in this embodiment , although there was only one partition panel , there may be a plurality , for example , alternately arranged . in this case , among the plurality of partition panels , some of the partition panels form an upstream chamber and a downstream chamber , with places that communicate with the upstream chamber and the downstream chamber forming communication gas paths . in addition , in the present embodiment , the partition panel is closely fixed to the inner surface of the dilution container except for the notch portion , but slits may be provided in the lowest portion of the partition panel . this is preferable since liquid inside the dilution container can move through the partition panel , and drainage can be performed at places where drain holes are not provided , such as when drain holes are only set in one of the upstream chamber and downstream chamber . moreover , although the communication path in the aforementioned embodiment is a cutaway portion , it may also be formed by piping . while preferred embodiments of the invention have been described and illustrated above , it should be understood that these are exemplary of the invention and are not to be considered as limiting . additions , omissions , substitutions , and other modifications can be made without departing from the spirit or scope of the present invention . accordingly , the invention is not to be considered as being limited by the foregoing description , and is only limited by the scope of the appended claims .	8
before the subject invention is described further , it is to be understood that the invention is not limited to the particular embodiments of the invention described below , as variations of the particular embodiments may be made and still fall within the scope of the appended claims . it is also to be understood that the terminology employed is for the purpose of describing particular embodiments , and is not intended to be limiting . instead , the scope of the present invention will be established by the appended claims . where a range of values is provided , it is understood that each intervening value , to the tenth of the unit of the lower limit unless the context clearly dictates otherwise , between the upper and lower limit of that range , and any other stated or intervening value in that stated range , is encompassed within the invention . the upper and lower limits of these smaller ranges may independently be included in the smaller ranges , and are also encompassed within the invention , subject to any specifically excluded limit in the stated range . where the stated range includes one or both of the limits , ranges excluding either or both of those included limits are also included in the invention . in this specification and the appended claims , the singular forms “ a ,” “ an ” and “ the ” include plural reference unless the context clearly dictates otherwise . fig2 a - 2f show a method of forming a vacuum insulated cabinet 10 according to the present invention . fig2 a shows a first forming tool 24 having a generally quadrilateral perimeter formed from a base wall 29 and a plurality of sidewalls 31 with two extending flanges 28 configured to extend from a bottom portion 25 of the quadrilateral perimeter . the first forming tool 24 may further include at least one vacuum channel 26 . fig2 a also shows a first material sheet 20 . the first material sheet 20 is typically comprised of a first layer of thermoplastic material that is partially permeable to oxygen , nitrogen and water vapor and a second layer of material that is substantially impermeable to oxygen , nitrogen and water vapor . a typical plastic composite used in this process is a first layer of high impact polystyrene ( hips ) food grade , specially tailored for refrigeration products and a second impermeable layer of evoh . one exemplary embodiment uses polystyrol 2710 by basf and edistr rr740e by polimeri europa as the first layer . the first material sheet 20 is first softened typically using heat until the first material sheet 20 reaches a temperature at which the first material sheet 20 can be plastically deformed . typically , the first material sheet 20 is deformed into a semi - circle like shape typically formed by blowing air centrally on the first material sheet 20 while the first material sheet 20 has its edges clamped down to hold the edges in place , as shown in the dashed lines in fig2 a . the first material sheet 20 is then lowered onto a top perimeter 27 of the first forming tool 24 . the edges of the first material sheet 20 are configured to be clamped onto the flanges 28 of the first forming tool 24 . the flanges 28 are typically comprised of the sidewalls 31 of the first forming tool 24 . a vacuum is then used to thermoform the first material sheet 20 over the first forming tool 24 to form the first intermediate structure 30 ( shown in fig2 b ). next , as shown in fig2 b , the first intermediate structure 30 is aligned over a second forming mold 50 . as also shown in fig2 b , the first intermediate structure 30 has a base sidewall 32 defining a generally quadrilateral perimeter 34 and a plurality of first sidewalls 36 , typically four sidewalls , extending transversely from the quadrilateral perimeter 34 in order to define a cavity 38 which has an opening 40 that opens in a first direction and defines a peripheral edge 42 extending around the opening 40 . the opening 40 of the cavity 38 of the first intermediate structure 30 is aligned with a second forming tool 50 . the second forming tool 50 is typically comprised of sidewall portions 52 which define a plurality of generally rectangular outwardly facing surfaces 54 and a plurality of generally rectangular inwardly facing surfaces 56 , and at least one end surface 58 extending transversely between the inwardly 56 and outwardly 54 facing surfaces . again , the second forming tool 50 includes vacuum holes 53 , to help form the first intermediate structure 30 onto the second forming tool 50 in order to produce the second intermediate structure 60 . as shown in fig2 b , the first intermediate structure 30 is heated to a temperature at which it can plastically deform . the first intermediate structure 30 is then formed over the second forming mold 50 using vacuum holes 53 to help form the second intermediate structure 60 . optionally , a third forming tool 80 may be utilized . the third forming tool 80 is configured to engage the second forming tool 50 in order to help form the second intermediate structure 60 . the third forming tool 80 is typically an opposite version of the second forming tool 50 . for example , if the second forming tool 50 is a female mold , the third forming tool 80 is a corresponding male mold , and vice versa . fig2 c shows the second intermediate structure 60 . the second intermediate structure 60 typically includes a base sidewall 62 and a plurality of inner sidewalls 64 extending transversely from the base sidewall 62 and defining a second cavity 66 that opens in a second direction that is substantially opposite the first direction . the inner sidewalls 64 are spaced apart inwardly from the first sidewalls 62 to define an annular space 70 that opens in the first direction . next , a second material sheet 22 is sealingly connected to the second intermediate structure 60 . the second material sheet 22 is extended across the peripheral edge of the second intermediate structure 60 in order to substantially close off the opening 68 of the second intermediate structure 60 and form an annular space 70 . as shown in fig2 e , the porous insulation material 90 is typically inserted and compacted to a density to withstand atmospheric pressure into the annular space 70 through at least one opening hole 92 typically located on the second material sheet 22 . additionally , the second material sheet 22 may have additional holes 94 in order to let air exit out of the annular space 70 . alternatively , the pre - formed and compacted insulation material 90 may be inserted into the annular space 70 of the second intermediate structure 60 prior to the sealing of the second material sheet 22 . once the insulation material 90 is inserted and the second material sheet 22 is sealingly connected to the second intermediate structure 60 , a vacuum is used , typically in holes 92 and 94 , in order to form a vacuum within the annular space 70 and sealed to produce a vacuum insulated cabinet 10 . moreover , as shown in fig2 f , a sheet wrapper 100 may optionally be disposed over the vacuum insulated structure 10 in order to provide additional structural support . the sheet wrapper 100 is typically comprised of steel and is generally quadrilateral in shape having an opening 102 on one side configured to receive the vacuum insulated cabinet 10 . fig3 a - 3d show an alternate embodiment of the present invention . fig3 a shows a first forming tool 24 having a base sidewall 29 defining a generally quadrilateral perimeter and a plurality of sidewalls 31 extending transversely from the quadrilateral perimeter in order to define a cavity 33 having an opening 35 that opens in a second direction . as shown in fig2 a and 3a , the first forming tool 24 may be a male or a female type mold structure . the first material sheet 20 is plastically deformed through heating the first material sheet 20 which allows the first material sheet 20 to form a first intermediate structure 30 utilizing the first forming tool 24 . edges of the first material sheet 20 are clamped to the flanges 28 or transversely extending sidewalls 31 in order to form the first intermediate structure 30 . once the first intermediate structure 30 is formed , it typically comprises a base sidewall 32 defining a generally quadrilateral perimeter 34 and a plurality of sidewalls 36 extending transversely from the quadrilateral perimeter 34 in order to define a cavity 38 having an opening 40 that opens in the second direction . next , a second forming tool 50 is disposed inside of the cavity 38 of the first intermediate structure 30 . the second forming tool 50 typically has sidewall portions 52 defining a plurality of generally rectangular outwardly facing surfaces 54 and inwardly facing surfaces 56 and at least one end surface 58 extending transversely between the inwardly 56 and outwardly 54 facing surfaces . moreover , the second forming tool 50 includes a cavity 57 defined by the at least one base sidewall 55 and plurality of inner sidewalls 64 extending transversely from the base wall 55 defining a second cavity 59 that opens in the first direction . once the second forming tool 50 is engaged with the first intermediate structure 30 , the first intermediate structure 30 is plastically deformed using a vacuum system to produce a second intermediate structure 60 . the second intermediate structure 60 typically has a base wall 62 and inner sidewalls 64 extending transversely from the base wall 62 defining a second cavity 68 that opens in the first direction and the inner sidewalls 64 are spaced apart inwardly from the first sidewall 62 in order to define an annular space 70 . in the embodiment shown in fig3 a - 3d , the second forming tool 50 is comprised of pre - formed and compacted highly porous insulation material 90 . the insulation material 90 is configured to be solid enough to withstand atmospheric pressure when evacuated and to allow the first intermediate structure 30 to be formed over the insulation material 90 to produce the second intermediate structure 60 . in the embodiment shown in fig3 c , the second forming tool 50 remains within the annular space 70 , and is sealed inside by the second material sheet 22 . the second material sheet 22 is sealingly connected to the second intermediate structure 60 around an edge of the base sidewall 62 of the second intermediate structure 60 . as shown in fig3 d , air can then be evacuated from the structures shown in fig3 c in order to produce a vacuum insulated cabinet 10 . as shown in fig4 , the insulation material 90 may be inserted into the second intermediate structure prior to the covering of the structure 60 with the second material sheet 22 . the insulation material 90 may be inserted in such a way that forms a semi - circle shape rising above the cavity 66 in the second intermediate structure . the second material sheet 22 is configured to compact the insulation material 90 to a desired compaction level during the sealing process . the addition and compaction steps can be repeated as desired to reach the desired compaction level of the insulation material 90 to withstand atmospheric pressure when the annular cavity is which contains material 90 is evacuated . the insulation material 90 is typically a highly porous granular insulation such as fumed silica or an open cell polyurethane foam or may be any other insulation material 90 known to one of ordinary skill in the art . any ambient air is then evacuated from the annular space 70 forming a vacuum insulated cabinet 10 . the processes described above result in less thinning of the first 20 and second 22 material sheet in order to ensure that the first material sheet 20 and the second material sheet 22 remain intact in order to provide a vacuum insulated structure .	5
the present invention relates to utilization of virtual rename buffers in a superscalar processor to reduce dispatch stalls . the following description is presented to enable one of ordinary skill in the art to make and use the invention and is provided in the context of a patent application and its requirements . various modifications to the preferred embodiment and the generic principles and features described herein will be readily apparent to those skilled in the art . fig1 is a block diagram of a processor system 10 for processing information in accordance with the present invention . in the preferred embodiment , processor 10 is a single integrated circuit superscalar microprocessor , such as the powerpc ™ processor from ibm corporation , austin , tex . accordingly , as discussed further hereinbelow , processor 10 includes various units , registers , buffers , memories , and other sections , all of which are formed by integrated circuitry . also , in the preferred embodiment , processor 10 operates according to reduced instruction set computing (&# 34 ; risc &# 34 ;) techniques . as shown in fig1 a system bus 11 is connected to a bus interface unit (&# 34 ; biu &# 34 ;) 12 of processor 10 . biu 12 controls the transfer of information between processor 10 and system bus 11 . biu 12 is connected to an instruction cache 14 and to a data cache 16 of processor 10 . instruction cache 14 outputs instructions to a sequencer unit 18 . in response to such instructions from instruction cache 14 , sequencer unit 18 selectively outputs instructions to other execution circuitry of processor 10 . in addition to sequencer unit 18 which includes execution units of a dispatch unit 46 and a completion unit 48 , in the preferred embodiment the execution circuitry of processor 10 includes multiple execution units , namely a branch unit 20 , a fixed point unit a (&# 34 ; fxua &# 34 ;) 22 , a fixed point unit b (&# 34 ; fxub &# 34 ;) 24 , a complex fixed point unit (&# 34 ; cfxu &# 34 ;) 26 , a load / store unit (&# 34 ; lsu &# 34 ;) 28 and a floating point unit (&# 34 ; fpu &# 34 ;) 30 . fxua 22 , fxub 24 , cfxu 26 and lsu 28 input their source operand information from general purpose architectural registers (&# 34 ; gprs &# 34 ;) 32 and fixed point rename buffers 34 . moreover , fxxua 22 and fxub 24 input a &# 34 ; carry bit &# 34 ; from a carry bit (&# 34 ; ca &# 34 ;) register 42 . fxua 22 , fxub 24 , cfxu 26 and lsu 28 output results ( destination operand information ) of their operations for storage at selected entries in fixed point rename buffers 34 . also , cfxu 26 inputs and outputs source operand information and destination operand information to and from special purpose registers (&# 34 ; sprs &# 34 ;) 40 . fpu 30 inputs its source operand information from floating point architectural registers (&# 34 ; fprs &# 34 ;) 36 and floating point rename buffers 38 . fpu 30 outputs results ( destination operand information ) of its operation for storage at selected entries in floating point rename buffers 38 . sequencer unit 18 inputs and outputs information to and from gprs 32 and fprs 36 . from sequencer unit 18 , branch unit 20 inputs instructions and signals indicating a present state of processor 10 . in response to such instructions and signals , branch unit 20 outputs ( to sequencer unit 18 ) signals indicating suitable memory addresses storing a sequence of instructions for execution by processor 10 . in response to such signals from branch unit 20 , sequencer unit 18 inputs the indicated sequence of instructions from instruction cache 14 . if one or more of the sequence of instructions is not stored in instruction cache 14 , then instruction cache 14 inputs ( through biu 12 and system bus 11 ) such instructions from system memory 39 connected to system bus 11 . in response to the instructions input from instruction cache 14 , sequencer unit 18 selectively dispatches through a dispatch unit 46 the instructions to selected ones of execution units 20 , 22 , 24 , 26 , 28 and 30 . each execution unit executes one or more instructions of a particular class of instructions . for example , fxua 22 and fxub 24 execute a first class of fixed point mathematical operations on source operands , such as addition , subtraction , anding , oring and xoring . cfxu 26 executes a second class of fixed point operations on source operands , such as fixed point multiplication and division . fpu 30 executes floating point operations on source operands , such as floating point multiplication and division . processor 10 achieves high performance by processing multiple instructions simultaneously at various ones of execution units 20 , 22 , 24 , 26 , 28 and 30 . accordingly , each instruction is processed as a sequence of stages , each being executable in parallel with stages of other instructions . such a technique is called &# 34 ; pipelining &# 34 ;. in a significant aspect of the preferred embodiment , an instruction is normally processed as six stages , namely fetch , decode , dispatch , execute , completion , and writeback . in the preferred embodiment , each instruction requires one machine cycle to complete each of the stages of instruction processing . nevertheless , some instructions ( e . g ., complex fixed point instructions executed by cfxu 26 ) may require more than one cycle . accordingly , a variable delay may occur between a particular instruction &# 39 ; s execution and completion stages in response to the variation in time required for completion of preceding instructions . in response to a load instruction , lsu 28 inputs information from data cache 16 and copies such information to selected ones of rename buffers 34 and 38 . if such information is not stored in data cache 16 , then data cache 16 inputs ( through biu 12 and system bus 11 ) such information from a system memory 39 connected to system bus 11 . moreover , data cache 16 is able to output ( through biu 12 and system bus 11 ) information from data cache 16 to system memory 39 connected to system bus 11 . in response to a store instruction , lsu 28 inputs information from a selected one of gprs 32 and fprs 36 and copies such information to data cache 16 or memory . as an example of the interaction among the execution units , e . g ., fxua 22 , fxub 24 , rename buffers 34 , and the dispatch unit 46 , an instruction &# 34 ; add c , a , b &# 34 ; is dispatched from the dispatch unit 46 to the fxua 22 . the dispatch unit 46 provides the fxua 22 with tags for the operands &# 34 ; a &# 34 ; and &# 34 ; b &# 34 ; to tell the fxua 22 where to retrieve the data for the operands , as is well understood by those skilled in the art . for example , in a system with six rename buffers , the dispatch unit 46 might suitably tag the operand for &# 34 ; a &# 34 ; as being located in a rename buffer 1 with a six bit tag 100000 . a tag of 010000 might then suitably be used to indicate that the operand &# 34 ; b &# 34 ; is in the rename buffer 2 . since the fxua 22 does not write into gprs 32 , the dispatch unit 46 must use a rename buffer tag for the target of the operation , such as 001000 , for the result of the ` add ` instruction to be placed in rename buffer 3 . since the dispatch unit 46 suitably employs rename buffers 34 and 38 to identify the location of the operands and results of operations , an allocation / deallocation table is preferably employed to track which buffers have been renamed . for example , fig2 illustrates a suitable allocation / deallocation table 70 , stored in the processor , for a superscalar processor system having , as a representation , six rename buffers . by way of example , the table 70 includes six slots , one for each rename buffer , with each slot including fields for the instruction identifier ( idn ), gpr identifier ( gprs ), rename register identifier ( rename ) and a valid field ( valid ). with the use of the rename buffer table 70 , the dispatch unit 46 can accurately keep track of which rename buffers have been used and which are available . also , the relationship between the gprs with the rename buffers is maintained in order to identify which register or rename buffer has the appropriate data for subsequent instructions . typically , the dispatch unit 46 stops allocating rename buffers 34 once all of the rename buffers 34 have been allocated . unfortunately , execution units may be idle while all of the rename buffers 34 are full thus , potential instructions for execution by idle execution units are delayed due to the lack of dispatching by the dispatch unit 46 . accordingly the present invention provides a method and system for allowing dispatch of instructions to execution units when all of the rename buffers of a system are in use . as shown in fig3 extra slots for virtual rename buffers are added to form an allocation / deallocation table 70 &# 39 ;. with the addition of the data for these slots in the allocation / deallocation table 70 &# 39 ;, stalls in the dispatch unit due to a lack of an available rename buffer are significantly reduced . by way of example , fig4 and 5 illustrate how the table 70 &# 39 ; is utilized in accordance with the present invention . as shown in fig4 each dispatched instruction is loaded into a real rename buffer if there is an empty slot available in the real rename buffer portion of the table . suppose , for example , that an instruction with identifier 0 ( idn 0 ) comprises a 1 wzx g18 , op1 , op2 ( load word and zero indexed , which adds the operands , op1 and op2 , to produce the effective address for loading a word from memory into the location of a target register , gpr 18 ). since the table in initially empty and no other real rename buffers have been assigned , g18 is renamed as rename buffer 0 , r0 . thus , the target tag for the instruction suitably is represented by a 100000 bit sequence . however , in accordance with the present invention , an additional bit , a rename busy bit , would also be included in the target tag . using the data shown in fig4 once the real rename buffers were all allocated , a next instruction , i . e ., instruction 6 ( idn 6 ), would be assigned to a virtual rename buffer slot , e . g ., virtual rename buffer 6 , r6 . in a preferred embodiment , the virtual rename buffers do not physically exist but are assigned to the instructions so that the instructions can be dispatched to the appropriate execution units if there are no operand conflicts . since the instruction has been allocated a virtual rename buffer , the rename busy bit for the instruction is set . thus , a suitable representation of the bit tag sequence for idn 6 comprises 1100000 , with the most significant bit representing the set rename busy bit . the execution units thus recognize the set value for the rename busy bit and determine that the instruction can be operated upon but not finished until the rename busy bit is reset fig5 illustrates how the rename busy bit for an instruction becomes reset as shown , once an instruction , i . e ., instruction 0 , is completed , it is deallocated from the table 70 &# 39 ;. at this point , a real rename buffer , r0 , is available for use by the first instruction entry in the virtual rename buffer portion of the table , i . e ., idn 6 . the instruction idn 6 is then placed into the real rename buffer portion of the table . in conjunction , a rename available signal is asserted to inform the appropriate execution unit that the rename buffer for the instruction is now a real rename buffer . a search for the appropriate idn , e . g ., idn 6 , among the execution units suitably provides the rename available signal to the proper execution unit fig6 presents a flow diagram illustrating the allocation / deallocation of rename buffers including virtual rename buffers in accordance with the present invention . when an instruction is received , via step 100 , a determination is made as to whether any real rename buffers are available for allocation of the instruction , via step 102 . if there is a real rename buffer available , the instruction gets allocated to the real rename buffer via step 104 . if there is no real rename buffer available , i . e ., the real rename buffer portion of table 70 &# 39 ; is full a determination is made via step 106 as to whether a virtual rename buffer is available . if no virtual rename buffer is available , the dispatch unit stalls via step 108 until a virtual rename buffer is available . when a virtual rename buffer is available , the virtual rename buffer is allocated to the instruction , and the rename busy signal for the instruction is set via step 110 . a determination is then made via step 112 as to whether a current instruction in the real rename buffer portion of the allocation / deallocation 70 &# 39 ; has completed . when completed , the current instruction is deallocated from the real rename buffer portion of table 70 &# 39 ;, via step 114 . a determination is then made , via step 116 , as to whether there is a next instruction allocated in the real rename buffer portion . if so , the next instruction becomes the current instruction , via step 118 . the process continues with a determination of whether there is an instruction in a virtual rename buffer via step 120 . when there is an instruction allocated to a virtual rename buffer , i . e ., step 120 is positive , the instruction is deallocated from the virtual rename portion and allocated via step 122 , to the real rename buffer , which had been deallocated from the completed current instruction in step 114 . the rename available signal is also transmitted to the appropriate execution unit via step 122 when the instruction is allocated the real rename buffer portion , and the process continues , via step 112 . if step 120 is negative , and no instructions are in the virtual rename buffer portion , the process returns to step 112 . when there are no next instructions , as determined via step 116 , the process is completed . thus , overall operation of the use of the table 70 &# 39 ; proceeds as summarized below . instructions are loaded into the real rename buffer portion of the table 70 &# 39 ; if there in an empty slot available . each instruction is completed out of the real rename buffer . an instruction is loaded into the virtual rename buffer portion when all of the real rename buffer slots are filled . when the virtual rename buffer portion is also full , the problem of dispatch stalling occurs , but , the number of slots in the virtual rename buffer portion of the table can be increased rather inexpensively to combat such problems . the rename busy bit is set for each valid instruction in the virtual rename buffer portion . each instruction in the virtual rename buffer portion is loaded into the real rename buffer portion upon completion of an instruction in the real rename buffer portion . once loaded into the real rename buffer portion , a rename available signal is asserted to notify the particular execution unit that the real rename buffer is now valid for the instruction , and the instruction can be finished , since it has been allocated a real rename buffer for its target operand . although the present invention has been described in accordance with the embodiments shown , one of ordinary skill in the art will recognize that there could be variations to the embodiment and those variations would be within the spirit and scope of the present invention . for example , although the rename busy bit has been identified as one bit , a plurality of bits may be used as desired without departing from the present invention . further , although the examples have used a particular number of rename buffers and virtual rename buffers , the numbers chosen have been used for illustrative purposes and are not meant as restrictive of the present invention . accordingly , many modifications may be made by one of ordinary skill without departing from the spirit and scope of the present invention , the scope of which is defined by the following claims .	6
the hydroxamic acid derivatives of the present invention may form salts with alkali metals , such as lithium , sodium or potassium . in addition , the compounds of formula i will form salts with dicyclohexylamine or other amines as well as with tris ( hydroxymethyl ) aminomethane , glucamine a amines as set out in u . s . pat . no . 4 , 294 , 759 . the term &# 34 ; lower alkyl &# 34 ; or &# 34 ; alkyl &# 34 ; as employed herein by itself or as part of another group includes both straight and branched chain radicals of up to 12 carbons , preferably 1 to 8 carbons , such as methyl , ethyl , propyl , isopropyl , butyl , t - butyl , isobutyl , pentyl , hexyl , isohexyl , heptyl , 4 , 4 - dimethylpentyl , octyl , 2 , 2 , 4 - trimethylpentyl , nonyl , decyl , undecyl , dodecyl , the various branched chain isomers thereof , and the like as well as such groups including a halo - substituent , such as f , br , cl or i or cf 3 , an alkoxy substituent , an aryl substituent , an aralkyl substituent , a haloaryl substituent , a cycloalkyl substituent , an alkylcycloalkyl substituent , hydroxy , an alkylamino or dialkylamino substituent , an alkanoylamino substituent , an arylcarbonylamino substituent , a nitro substituent , a cyano substituent , a thiol substituent or an alkylthio substituent . the term &# 34 ; cycloalkyl &# 34 ; employed herein by itself or as part of another group includes saturated cyclic hydrocarbon groups containing 3 to 12 carbons , preferably 3 to 8 carbons , which include cyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl , cycloheptyl , cyclooctyl , cyclodecyl and cyclododecyl , which groups are substituted with the same , or a different cycloalkyl . the term &# 34 ; aryl &# 34 ; or &# 34 ; ar &# 34 ; as employed herein by itself or as part of another group refers to monocyclic or bicyclic aromatic groups containing from 6 to 10 carbons in the ring portion , such as phenyl , naphthyl , substituted phenyl or substituted naphthyl wherein the substitutent on either the phenyl or naphthyl may be 1 or 2 lower alkyl groups , 1 or 2 halogens ( cl , br or f ), 1 or 2 lower alkoxy groups , 1 or 2 hydroxyl groups , 1 or 2 alkylamino or dialkylamino groups , 1 or 2 alkanoylamino groups , 1 or 2 arylcarbonylamino groups , 1 or 2 amino groups , 1 or 2 nitro groups , 1 or 2 cyano groups , 1 or 2 thiol groups and / or 1 or 2 alkylthio groups . the term &# 34 ; aralkyl &# 34 ;, &# 34 ; aryl - alkyl &# 34 ; or &# 34 ; aryl - lower alkyl &# 34 ; as used herein refers to lower alkyl groups as discussed above having an aryl substituent , such as benzyl . the term &# 34 ; lower alkenyl &# 34 ; or &# 34 ; alkenyl &# 34 ; as employed herein by itself or as part of another group includes an unsaturated hydrocarbon group having from 2 to 8 carbons and a single carbon - carbon double bond , such as ethenyl , 1 - propenyl , 2 - propenyl , 1 - butenyl , 2 - butenyl , 3 - butenyl and the like . the term &# 34 ; lower alkynyl &# 34 ; or &# 34 ; alkynyl &# 34 ; as employed herein by itself or as part of another group includes an unsaturated hydrocarbon group having from 3 to 8 carbons and a single carbon - carbon triple bond , such as 1 - propynyl , 2 - propynyl , 1 - butynyl , 2 - butenyl , 3 - butenyl and the like . the term &# 34 ; alkanoyl &# 34 ; as used herein by itself or as part of another group refers to an alkyl carbonyl or alkenyl carbonyl group . the term &# 34 ; aroyl &# 34 ; as used herein by itself or as part of another group refers to an aryl carbonyl group . the term &# 34 ; halogen &# 34 ; or &# 34 ; halo &# 34 ; as used herein refers to chlorine , bromine , fluorine or iodine with chlorine being preferred . preferred are those compounds of the invention wherein r 1 is methyl , r 2 is hydrogen , r 3 is n - hexyl , a is ch 2 -- ch ═ ch and n = 3 or 4 . the various compounds of the invention may be prepared as described below . to make the compounds of formula i , a carboxylic acid of the formula ## str4 ## the preparation of which has been described in u . s . pat . no . 4 , 582 , 854 , is reduced with lithium aluminum hydride in the presence of a dry organic solvent , e . g . tetrahydrofuran or ether , to the alcohol ## str5 ## the reaction of the alcohol iii with a complex prepared from n - bromosuccinimide and triphenylphosphine at a temperature within the range of from about 0 ° c . to about 25 ° c . affords a bromide of the formula ## str6 ## the bromide iv can be reacted with a hydroxylamine in which the oxygen is protected , e . g . o - tetrahydropyranyloxy hydroxyl amine in the presence of a solvent , e . g . dimethylformamide , and a base , e . g . sodium bicarbonate , at a temperature within the range of from about 25 ° c . to about 70 ° c . to produce ## str7 ## in which the tetrahydropyranyl ( thp ) &# 34 ; o &# 34 ;- protecting group &# 34 ; appears as shown . amine v can thereafter be reacted with a carboxylic acid chloride of the formula ( wherein r 1 is the desired alkyl or aryl group ) in the presence of a base , e . g . aqueous sodium hydroxide and a solvent such as tetrahydrofuran to afford the &# 34 ; o - protected &# 34 ; hydroxamic acid ## str8 ## compound vii , where r 1 = h , can be prepared by the reaction of v with acetic formic anhydride preferably in the presence of a base such as triethylamine . compound vii is thereafter &# 34 ; de - protected &# 34 ;, such as by treatment with pyridinium - paratoluene sulfonate in methanol or dilute hydrochloric acid in methanol , to remove the thp group and provide the compounds of the present invention . alternatively , the alcohols of formula iii can be prepared by the wittig reaction of an aldehyde of the formula ## str9 ## with the phosphonium salts of the formula in the presence of bases to afford ## str10 ## wherein the protecting group can be thp , t - butyl dimethyl silyl , or the like . compound x can thereafter be &# 34 ; deprotected &# 34 ;, e . g . by treatment with tetrabutylammonium fluoride or dilute acetic acid ( in the case of t - butyl dimethyl silyl ) or pyridinium paratoluene sulfonate or dilute hydrochloric acid in methanol ( in the case of thp ) to produce the alcohols iii . the aldehyde viii may be substituted by the hemiacetal xi ## str11 ## for reaction with the phosphonium salt ix and afford alcohols of the formula xii ## str12 ## alcohols of formula xii can be reacted with mesylates or tosylates of formula where x = mesyloxy or p - toluene sulfonyloxy in the presence of an inorganic base like potassium hydroxide in an organic solvent like xylene at temperatures within the range of 100 ° c . to 150 ° c . to afford ethers of the formula x which can thereafter be &# 34 ; deprotected &# 34 ; as described before to produce alcohols iii . another alternative includes converting the alcohols iii into tosylates or mesylates , instead of the bromides iv , for reaction with the o - tetrahydropyranyloxy hydroxylamine . the compounds of this invention have four centers of asymmetry as indicated by the asterisks in formula i . however , it will be apparent that each of the formulae set out above which do not include asterisks still represent all the possible stereoisomers thereof . all of the various stereoisomeric forms are within the scope of the present invention . the various stereoisomeric forms of the compounds of the invention , namely , cis - endo , cis - exo and all trans forms and stereoisomeric pairs may be prepared as shown in the working examples which follow and by employing starting materials and following the procedures as outlined in u . s . pat . no . 4 , 582 , 854 . examples of such stereoisomers are set out below . ## str13 ## the nucleus in each of the compounds of the invention is depicted as ## str14 ## for matter of convenience ; it will also be appreciated that the nucleus in the compounds of the invention may be depicted as ## str15 ## the compounds of the invention are inhibitors of the arachidonic acid enzymes 5 - lipoxygenase and cyclooxygenase and prevent formation of certain leukotriene and prostaglandins . the administration of compounds of this invention to humans or animals provides a method for treating allergy of a reagin or non - reagin nature . asthma and psoriasis are preferably treated but any allergy or inflammation wherein leukotrienes or prostaglandins are thought to be involved as pharmacological mediators can be treated . for example , the compounds of this invention can be used for treatment of such conditions as allergic rhinitis , food allergy and urticaria , as well as asthma and psoriasis . an effective but essentially non - toxic quantity of the compound is employed in treatment . the compounds of the invention can be administered parenterally , orally or topically to various mammalian species known to be subject to such maladies , e . g ., humans , cattle , horses , cats , dogs , and the like in an effective amount within the dosage range of about 1 to 100 mg / kg , preferably about 1 to 50 mg / kg and especially about 2 to 25 mg / kg on a regimen in single or 2 to 4 divided daily doses . the active substance can be utilized in a composition such as tablet , capsule , solution or suspension , lotion , cream or ointment containing about 5 to about 5000 mg per unit of dosage of a compound or mixture of compounds of formula i . they may be compounded in conventional matter with a physiologically acceptable vehicle or carrier , excipient , binder , preservative , stabilizer , flavor , etc . as called for by accepted pharmaceutical practice . also as indicated in the discussion above , certain members additionally serve as intermediates for other members of the group . a solution of 3 - iodopropanol ( 15 g , 80 . 65 mole ), dihydropyran ( 14 . 7 ml , 161 . 29 mole ) and pyridium p - toluenesulfonate ( 500 g , 2 . 0 mole ) in 100 ml of dry dichloromethane was stirred at room temperature under an atmosphere of nitrogen for 2 . 5 hours . the resulting mixture was diluted with dichloromethane ( 150 ml ), washed with water and a saturated sodium bicarbonate solution , dried over anhydrous magnesium sulfate and evaporated in vacuo . the residue was flash chromatographed on a silica gel to give 20 . 43 g of the title a compound as an oil . a solution of 3 - iodo - 1 - tetrahydro - 2 - pyranyloxy propane ( 20 . 43 g , 75 . 63 mmole ), and triphenylphosphine ( 19 . 84 g , 75 . 63 mmole ) in 150 ml of dry benzene was refluxed under an atmosphere of nitrogen for 24 hours . the solvent was evaporated in vacuo to give a sticky gum . this was rinsed with acetonitrile ( 80 ml ) when a white solid precipitated out . the solid was filtered and dried over phosphorous pentoxide at 60 ° c . in vacuo for 20 hours to give 32 . 8 g of the title b compound . to a chilled and stirred slurry of 3 - tetrahydro - 2 - pyranyloxy triphenyl phosphonium iodide ( 4 . 224 g , 9 mmole ) in 40 ml of dry tetrahydrofuran was added dropwise potassium - t - amylate ( 4 . 03 ml , 1 . 7m in toluene ) over five minutes under nitrogen . the orange solution was stirred at - 20 ° for 2 hours and then a solution of 1r -[ 4ar -( 4aα , 5α , 8α , 8aα )] octahydro - 5 , 8 - epoxy -( 1h )- benzopyrane - 3 - ol ( 510 mg , 3 mmole ) in 10 ml of dry tetrahydrofuran was added dropwise . the solution was gradually warmed up to room temperature , stirred for 18 hours and quenched with acetaldehyde ( 1 . 5 ml ). after stirring at room temperature for another 30 minutes , the mixture was diluted with 30 ml of a saturated sodium bicarbonate solution and extracted three times with ethyl ether . the combined ether extracts were washed with brine , dried over anhydrous magnesium sulfate and evaporated in vacuo . the residue was flash - chromatographed on a silica gel to give 810 g of the title c compound as an oil . powdered potassium hydroxide ( 900 mg , 16 mmole ) in 80 ml of dry xylene was refluxed under stirring in an atmosphere of nitrogen and 35 - 40 ml of xylene was removed by distillation . to this was added dropwise a solution of the alcohol of step c ( 400 mg , 1 . 35 mmole ) and n - hexylmesylate ( 1 . 216 g , 6 . 75 mmole ) in 25 ml of dry xylene . the mixture was refluxed for one hour and was then cooled . water ( 25 ml ) was added and the solution was extracted three times with ethyl ether . the combined ether extracts were washed with brine , dried over anhydrous magnesium sulfate and evaporated in vacuo . the residue was flash chromatographed on a silica gel column to give 455 mg of title d compound as an oil . a solution of the ether of step d ( 125 mg , 0 . 328 mmole ) and pyridium p - toluenesulfonate ( 91 mg , 0 . 361 mmole ) in 5 ml of methanol was stirred at 70 ° ( oil bath temperature ) under an atmosphere of nitrogen for 1 . 5 hours . the methanol was mostly removed in vacuo , the residue diluted with 15 ml of water and extracted three times with ethyl ether . the combined ether extracts were washed with brine , dried over anhydrous magnesium sulfate and evaporated in vacuo . the residue was flash chromatographed on a silica gel column to give 85 mg of the title e compound . n - bromosuccinimide ( 356 mg , 2 mmole ), triphenylphosphine ( 524 . 6 mg , 2 mmole ) and dry celite ( dried at 100 ° in vacuo overnight ) were mixed in benzene ( 15 ml ) at 0 ° under an atmosphere of nitrogen and then stirred at room temperature for 1 . 5 hours . a solution of the alcohol of step e ( 296 . 5 mg , 1 mmole ) in dichloromethane ( 5 . 0 ml ) was added . after stirring for 18 hours , the mixture was filtered through a bed of celite and washed with a small amount of dichloromethane . the filtrate and washings were dried over anhydrous magnesium sulfate and evaporated in vacuo . the residue was chromatographed on a silica gel column to give 340 mg of the title f compound as an oil . a mixture of the bromide of step f ( 450 mg , 1 . 25 mmole ), o - tetrahydropyranyloxy hydroxylamine ( 293 mg , 2 . 5 mmole ) and anhydrous sodium bicarbonate ( 1 . 05 g , 12 . 5 mmole ) in 7 ml of dry hmpa was stirred at 70 ° c . ( oil bath temperature ) under an atmosphere of nitrogen for 18 hours . the mixture was then cooled to room temperature , diluted with water ( 20 ml ) and extracted three times with ethyl ether . the ether extracts were combined and washed several times with water , dried over anhydrous magnesium sulfate and evaporated in vacuo . the residue was chromatographed on a silica gel column to give 400 mg of the title g compound as an oil . a mixture of the compound of step g ( 395 . 6 mg , 1 mmole ) and 1 . 0n sodium hydroxide ( 20 ml , 20 mmole ) in 10 ml of tetrahydrofuran was stirred vigorously at ˜ 0 ° c . under an atmosphere of nitrogen . a solution of acetyl chloride ( 0 . 285 ml , 4 mmole ) in 3 ml of tetrahydrofuran was then added dropwise . the mixture was stirred at ˜ 0 ° for five hours and extracted three times with ethyl ether . the combined ether extracts were washed with brine , dried over anhydrous magnesium sulfate , filtered and evaporated in vacuo to give 415 mg of slightly impure the title h compound , as an oil . a solution of the compound of step h ( 415 mg , 0 . 948 mmole ) and pyridium p - toluenesulfonate ( 400 mg , 1 . 59 mmole ) in 20 ml of dry methanol was stirred at 75 ° c . ( oil bath temperature ) under an atmosphere of nitrogen for five hours . the solvent was then evaporated in vacuo . the residue was diluted with water ( 20 ml ) and extracted three times with ethyl ether . the combined ether extracts were washed with brine , dried over anhydrous magnesium sulfate and evaporated in vacuo . the residue was chromatographed on a silica gel to give 245 mg of the title compound as an oil . a slurry of 3 - carboxypropyltriphenylphosphonium iodide ( 41 . 13 g , 0 . 086 mole ) and [ 4ar ( 4aα , 5α , 8α , 8aα )]- octahydro - 5 , 8 - epoxy -( 1h )- benzypyrano - 3 - ol ( 10 g , 0 . 059 mole ) in dry toluene ( 236 ml ) was chilled to ˜ 0 ° c . under nitrogen and treated dropwise with a solution of 1 . 74m potassium t - amylate in toluene ( 97 . 1 ml , 0 . 169 mole ) over a period of ninety minutes . the mixture was then stirred at room temperature for twenty hours , chilled to ˜ 0 ° c . and treated slowly with glacial acetic acid ( 9 . 5 ml ) in toluene ( 11 . 8 ml ) in the course of thirty minutes . the thick suspension was treated with water ( 177 ml ) and brought to a ph of about 1 . 5 with concentrated hydrochloric acid ( 12 ml ). the mixture was diluted with ethyl acetate ( 177 ml ), treated with sodium chloride ( 41 . 3 g ) and stirred vigorously for fifteen minutes . the resultant precipitates were removed by filtration , washing the solids twice with ethyl acetate . the toluene - ethyl acetate layer was separated and the aqueous layer extracted twice with ethyl acetate . the combined organic extracts were dried over anhydrous magnesium sulfate and concentrated in vacuo to a thick oil . this oil was stirred vigorously with 5 % potassium carbonate ( 177 ml ) for 30 minutes , filtered and the resultant solid washed thoroughly with water ( 100 ml ). the aqueous filtrate was extracted with ethyl ether : toluene ( 1 : 1 ; 5 times ), chilled in an ice bath and treated slowly with concentrated hydrochloric acid to ph 2 . 5 . the aqueous layer was extracted three times with ethyl acetate and the combined extracts were dried over anhydrous magnesium sulfate , filtered and concentrated in vacuo to give 15 . 2 g of the title a compound as a thick oil . a solution of the title a compound ( 15 . 2 g , 0 . 059 mole ) in dry methanol ( 78 ml ) was stirred vigorously with crushed amberlyst - 15 resin ( 7 . 70 g ) at room temperature for two days . the mixture was diluted with ether ( 80 ml ) and filtered through a celite pad , washing the pad thoroughly with ether . the combined filtrate and washings were concentrated in vacuo , the resultant oil was dissolved in ether ( 150 ml ) and washed with a 5 % sodium bicarbonate solution ( 25 ml ), water ( 20 ml ) and brine ( 20 ml ). the organic phase was dried over anhydrous magnesium sulfate , filtered and concentrated in vacuo to a thick oil which contained the title compound as the major component and small amounts of three less polar components . this product mixture was chromatographed on a silica gel column to give 8 . 88 g of the title b compound as an oil . a stirred suspension of crushed potassium hydroxide ( 18 . 4 g ) in dry xylene ( 700 ml ) was brought to reflux under nitrogen and 180 ml of xylene was removed by distillation . the mixture was cooled and a solution of the title b compound ( 9 . 2 g , 0 . 036 mole ) and n - hexylmesylate ( 33 g , 0 . 18 mole ) in dry xylene ( 60 ml ) was added . the mixture was gently refluxed , azeotroping off xylene (˜ 180 ml ) over a period of one hour , cooled and treated with a solution of potassium hydroxide ( 18 . 5 g , 0 . 33 mole ) in water ( 220 ml ). the solution was refluxed under vigorous stirring for 1 . 5 hours , cooled , diluted with water ( 450 ml ) and extracted with ether ( 2 . 0 liters ). the aqueous layer was acidified with concentrated hydrochloric acid ( 50 ml ), extracted three times with ether , and the combined organic extracts washed with brine ( 450 ml ), dried over anhydrous magnesium sulfate , filtered and evaporated in vacuo to give the acid corresponding to the title compound as a thick oil ( 10 . 4 g ). the crude acid was dissolved in ether ( 150 ml ), cooled down to 0 ° c . and treated with excess diazomethane in ether . the yellow solution was allowed to stand at 0 ° c . for thirty minutes , at room temperature for one hour and the excess diazomethane blown off with a stream of nitrogen . the resulting solution was evaporated in vacuo and the residual oil chromatographed on a silica gel column to give 10 . 05 g of the title c compound as a homogeneous oil . a solution of the title c compound ( 5 g , 0 . 015 mole ) in dry tetrahydrofuran ( 25 ml ) was added under nitrogen to a cooled (˜ 0 ° c .) suspension of lithium aluminum hydride ( 936 . 2 mg , 0 . 025 mole ) in dry tetrahydrofuran ( 115 ml ). the mixture was stirred at ˜ 0 ° c . for thirty minutes , at room temperature for 2 . 5 hours and quenched by the subsequent addition of water ( 1 . 0 ml ), 10 % sodium hydroxide ( 1 . 5 ml ) and water ( 3 . 0 ml ). the slurry was stirred for thirty minutes , diluted with ether ( 100 ml ) and the supernatant solution was decanted , washing the precipitates thrice with ether ( 225 ml ). the combined organic extracts were dried over anhydrous magnesium sulfate , filtered and evaporated to dryness to give an oil ( 5 . 04 g ) which contained the title compound as the major component and traces of three more polar components . the crude product was chromatographed on a silica gel to give 353 g of the title d compound as a homogeneous oil . a mixture of 99 % triphenylphosphine ( 5 . 44 g , 20 . 5 mmole ), n - bromosuccinimide ( 3 . 67 g , 20 . 6 mmole ) and celite ( 11 . 6 g ) was stirred at ˜ 0 ° c . in a mixture of dry benzene ( 116 ml ) and dry dichloromethane ( 29 ml ) under nitrogen for ten minutes and at room temperature for one hour . a solution of the alcohol of step d ( 2 . 89 g , 9 . 3 mmole ) in dry dichloromethane ( 50 ml ) was added to the resulting complex and the stirring continued at room temperature for 24 hours . the mixture was diluted with dichloromethane ( 50 ml ), stirred and filtered , washing the solids with more dichloromethane ( 300 ml ). the filtrate and washings were combined and evaporated to dryness and the residual oil partitioned twice between water ( 150 ml ) and dichloromethane ( 300 ml ). the organic phase was dried over anhydrous magnesium sulfate , filtered and evaporated to dryness to give an oil containing traces of triphenylphosphine and a slightly more polar component . the crude product was chromatographed on a silica gel column to give 3 . 10 g of the title e compound as a homogeneous oil . a mixture of the title e compound ( 800 mg , 2 . 14 mmole ), 0 - tetrahydropyranyloxy hydroxylamine ( 501 . 6 mg , 4 . 28 mmole , 2 eq .) and sodium bicarbonate ( 1 . 8 g , 21 . 4 mmole ) in dry hmpa ( 10 . 4 ml ) was heated at 70 ° ( oil - bath ) under nitrogen for 6 . 5 hours . the mixture was then cooled , diluted with water ( 50 ml ) and extracted three times with ether . the combined organic extracts were washed with brine ( 40 ml ), dried over anhydrous magnesium sulfate , filtered and evaporated to dryness . the residual oil was chromatographed on a silica gel column to give 838 . 9 mg of the title f compound as a homogeneous oil . a solution of the title f compound ( 833 . 6 mg , 2 . 04 mmole ) in 1n sodium hydroxide ( 40 . 7 ml , 20 eq .) and tetrahydrofuran ( 20 . 4 ml ) was stirred vigorously at ˜ 0 ° c . and treated dropwise with a solution of acetyl chloride ( 1 . 45 ml , 20 , 3 mmole , 10 eq .) in dry tetrahydrofuran ( 20 ml ). the mixture was stirred at ˜ 0 ° c . for six hours and extracted three times with ether . the combined organic extracts were washed with brine ( 30 ml ), dried over anhydrous magnesium sulfate , filtered and evaporated to dryness to give 925 . 9 mg of the title g compound as an oil . a solution of the title g compound ( 500 mg , 1 . 11 mmole ), in dry methanol ( 25 ml ) was mixed with 98 % pyridinium p - toluenesulfonate ( 467 . 1 mg , 1 . 29 mmole ) and heated at 75 ° ( oil bath ) under nitrogen for 5 hours . the solvent was then evaporated in vacuo and the resdiual oil partitioned between water ( 25 ml ) and ether ( 3 × 50 ml ). the combined organic extracts were washed with brine ( 25 ml ), dried over anhydrous magnesium sulfate , filtered and evaporated to dryness . the residual oil was chromatographed on a silica gel column to give 305 . 2 mg of the title compound as an oil . a solution of [ 1r -[ 1α , 2β ( z ), 3β , 4α ]- 7 -[ 3 -[( hexyloxy ) methyl ]- 7 - oxabicyclo ( 2 . 2 . 1 ) hept - 2 - yl ]- 5 - heptenoic acid ( 900 mg , 2 . 66 mmole ) in dry ether ( 50 ml ) was treated with an excess of diazomethane in ether and stirred at room temperature for one hour . the excess diazomethane was blown off with a stream of nitrogen and the colorless solution evaporated to dryness . the residual oil was chromatographed to give 1 . 1 g of the title a compound as an oil . a solution of the title a compound ( 2 . 1 g , 6 . 55 mmole ) in dry tetrahydrofuran ( 10 ml ) was added dropwise to a suspension of lithium aluminum hydride ( 410 mg , 10 . 8 mmole ) in dry tetrahydrofuran ( 50 ml ) under nitrogen at ˜ 0 ° c . the mixture was stirred at 0 ° c . for 30 minutes and at room temperature for 2 . 5 hours , then quenched by the sequential addition of water ( 0 . 41 ml ), 10 % sodium hydroxide for 30 minutes , diluted with ether ( 200 ml ) and filtered , washing the precipitates well with ether ( 50 ml ). the filtrate was dried over anhydrous magnesium sulfate , filtered and evaporated to dryness to give 1 . 93 g of the title b compound as a homogeneous oil . a mixture of 99 % triphenylphosphine ( 901 mg , 3 . 4 mmole ), n - bromosuccinimide ( 611 . 7 g ) and dry celite ( 2 . 0 g ) in a mixture of benzene ( 20 ml ) and dry dichloromethane ( 5 ml ) was stirred at 0 ° c . ( ice bath ) under nitrogen for 10 minutes and at room temperature for one hour . a solution of the title b compound ( 500 mg , 1 . 71 mmole ) in dry dichloromethane ( 5 ml ) was added to the complex and stirring continued at room temperature for 20 hours . the mixture was diluted with dichloromethane , stirred and filtered , washing the solids with more dichloromethane ( 50 ml ). the organic extracts were evaporated to dryness and the residual oil partitioned twice between water ( 25 ml ) and dichloromethane ( 25 ml ). the organic phase was dried over anhydrous magnesium sulfate , filtered and evaporated to dryness to give an oil containing traces of starting material and triphenylphosphine . the crude product was chromatographed on a silica gel column to give the title c compound as a homogeneous oil ( 519 mg ). a mixture of the title c compound ( 434 . 5 mg , 1 . 12 mmole ), o - tetrahydropyranyloxy hydroxylamine ( 262 . 4 mg , 2 . 24 mmole ) and sodium bicarbonate ( 940 . 8 mg , 11 . 2 mmole ) in hmpa ( 5 . 4 ml ) was heated at 60 ° under nitrogen for 12 hours . the reaction mixture was cooled , diluted with water ( 25 ml ) and extracted twice with ether . the organic extracts were washed with water , dried over anhydrous magnesium sulfate , filtered and evaporated to dryness to give an oil which contained the desired compound as the major component and traces of the starting material and another product . this mixture was chromatographed on a silica gel column to give 432 . 5 mg of the title d compound as a homogeneous oil . an emulsion of the title d compound ( 541 mg , 1 . 28 mmole ) in 1n sodium hydroxide ( 28 ml ) was stirred in an ice bath and was treated with acetyl chloride ( 0 . 91 ml , 12 . 8 mmole ). the mixture was stirred at ˜ 0 ° c . under nitrogen for another 2 hours , at room temperature overnight , and was extracted thrice with ether . the organic extracts were washed with brine ( 50 ml ), dried over anhydrous magnesium sulfate , filtered and evaporated to dryness to give 510 . 5 mg of the title e compound as a homogeneous oil . a solution of the title e compound ( 510 . 5 mg , 1 . 1 mmole ) in dry methanol ( 20 ml ) was treated with 98 % pyridinium p - toluenesulfonate ( 500 mg , 1 . 94 mmole ) and heated under nitrogen at 55 ° for 35 hours . the solvent was evaporated in vacuo and the residual oil partitioned twice between methylene chloride ( 100 ml ) and water ( 25 ml ). the organic phase was washed with brine ( 25 ml ) dried over anhydrous magnesium sulfate , filtered and evaporated to dryness to give a product mixture of the desired compound and starting material . this mixture was chromatographed on a silica gel column to give 217 mg of the title compound as an oil . the following additional compounds within the scope of the present invention may be prepared by employing the teachings as outlined above and in the working examples . __________________________________________________________________________ ## str16 ## ex . no . r . sub . 1 r . sub . 2 r . sub . 3 a n__________________________________________________________________________4 h h ch . sub . 3 ch . sub . 2chch 25 h ch . sub . 3 c . sub . 2 h . sub . 5 ch . sub . 2chch 16 c . sub . 2 h . sub . 5 ch . sub . 3 c . sub . 5 h . sub . 11 ch . sub . 2chch 3 ## str17 ## h ## str18 ## ch . sub . 2chch 38 ## str19 ## h c . sub . 2 h . sub . 5 -- 59 ch . sub . 2ch . sub . 2chch ch . sub . 3 c . sub . 6 h . sub . 13 ch . sub . 2chch 310 ch . sub . 3 ## str20 ## ch . sub . 2ccch . sub . 2 ch . sub . 2chch 411 c . sub . 3 h . sub . 7 ## str21 ## c . sub . 3 h . sub . 7 -- 612 ## str22 ## ## str23 ## ch . sub . 3 ch . sub . 2chch 213 c . sub . 4 h . sub . 9 h ch . sub . 2chch -- 714 ## str24 ## ## str25 ## ch . sub . 2chchc . sub . 2 h . sub . 5 ch . sub . 2chch 315 ch . sub . 2chchch . sub . 3 h c . sub . 7 h . sub . 15 ch . sub . 2chch 816 ch . sub . 2chchch . sub . 3 c . sub . 3 h . sub . 7 ch . sub . 2ccch . sub . 3 -- 917 ## str26 ## c . sub . 4 h . sub . 9 ch . sub . 3 ch . sub . 2chch 418 ## str27 ## c . sub . 5 h . sub . 11 ## str28 ## ch . sub . 2chch 319 ## str29 ## c . sub . 6 h . sub . 13 ## str30 ## ch . sub . 2chch 220 ch . sub . 2chchc . sub . 3 h . sub . 7 c . sub . 7 h . sub . 15 c . sub . 3 h . sub . 7 ch . sub . 2chch 2__________________________________________________________________________	2
a connector 1 according to a first embodiment of he invention is disclosed with reference to fig1 to 3 . connector 1 is shown in a perspective view and in a not tight condition in fig1 , in a longitudinal section in fig2 and in a partly assembled perspective view and in a partly tight condition view in fig3 . connector 1 comprises a mid section 2 , two outer bodies 3 and a number of shims 4 . each outer body 3 is coupled to one respective side of the mid section 2 . a threaded coupling is shown in fig1 - 3 by way of an example . a number of shims 4 is housed between each outer body 3 and the mid section 2 . more specifically , the mid section 2 comprises a central disc wall 5 , which may be solid as shown or bored ( compare fig5 ), and two collars 6 each having an outer threading 7 . the inner wall of each collar 6 is conical as shown at 8 , specifically flared , for reasons that will be clear hereinafter . each outer body 3 is an essentially cylindrical hollow body . each outer body 3 has an inner threading 9 at a first longitudinal end 10 , matching and coupled with the outer threading 7 of the mid section . each outer body 3 has an inner conical surface 11 at a second longitudinal end 12 opposed the first longitudinal end 10 . each shim 4 is an elongate rigid member shaped as a section of a cylindrical wall , having a first and a second , conical , specifically tapered longitudinal end 13 and 14 . each longitudinal end 13 and 14 matches the conical surface 8 of flared collar 6 of mid section 2 and the conical surface 11 at the second longitudinal end 12 of outer body 3 , respectively . in use of the connector 1 , a conductor c is axially inserted in one of the outer bodies 3 and its associated shim assembly 4 . the end portion or free end of the conductor c is preferably brought to abutment with the flared surface 8 or the disc wall 5 of mid section 2 . the mid section 2 partially surrounds the exposed section of the conductor c . the outer body 3 is then axially moved towards the mid section 2 and coupled therewith , screwed thereto in the example shown . both the outer body 3 and the mid - section 2 have hexagonal profiles 15 , 14 cut into the outer surface as shown , allowing the use of a wrench , preferably of a torque wrench to tighten the connector 1 to a specific torque . the outer bodies 3 may be further locked to the mid - section 2 using a safety means to stop the connector 1 from loosening off , e . g . a pin and groove locking mechanism as disclosed below in connection with fig5 . the provision of the disclosed matching conical or slanted surfaces 8 , 13 , and 11 , 14 allows the shims 4 to be forced radially inwards , towards axis x of connector 1 , when they are forced axially while the outer body 3 is coupled with the mid section 2 during tightening of the connector 1 . namely , as the length of the assembly of mid section 2 and outer body 3 decreases because of threading them together , the axial compression onto the shims 4 causes a radial compression or force of the shims 4 around and towards the conductor c . the shims 4 thus close down onto the conductor c , also becoming closer to each other . the tightening of the outer bodies 3 to the mid section 2 can be completed using a torque wrench up to a specified torque as said . the slant of the conical surfaces 8 , 13 , and 11 , 14 and the length and circumferential extent of the shims 4 are properly selected so that the shims 4 may get closer to each other to clamp onto a connector c essentially all around , irrespectively of the outer diameter of the connector c within a range of outer diameters . thus , connector 1 has range taking capability as far as the outer diameter of the conductor c is concerned . three shims 4 each extending slightly less than 120 ° are shown in the exemplary embodiment but they can be less or more than three , of a proper angular extent . each shim 4 preferably has a scored inner surface to promote gripping on the conductor c and also to break oxidisation of an aluminium conductor c . when aluminium reacts with oxygen in the air it develops a thin oxide film on the outer surface of the conductor c and / or on the inner surface of the shims 4 . this film can affect the conductivity and therefore it is necessary to remove it just before connection , e . g . using a wire brush . advantageously , a scored inner surface of the connector 1 will penetrate the thin oxides and will make a clean connection without the necessity to remove it manually . preferably , the scores on the inner surface of shims 4 comprise grooves circumferentially arranged . in one version , the grooves are helically arranged . in order to keep together the shims 4 that are associated with a same outer body 3 or shim assembly , in the embodiment shown a collapsible spacing ring 17 extends in a groove 18 of the shims 4 . this aids assembly of the connector 1 as well as mounting thereof to conductor c . in order to preserve an equal circumferential spacing or gap between the shims 4 , collapsible spacing ring 17 advantageously has a round pin or bulge 19 between adjacent shims 4 . bulges 19 maintain the orientation of the shims 4 and their spacing so as to aid fitting by allowing easy insertion of conductor c inside the shim assembly . upon tightening the connector 1 , all the bulges 19 collapse together so that the gaps between shims 4 reduce together and the circumferential distribution of contact surfaces with conductor c is kept . the size and resistance of the bulges 19 of collapsible spacing ring 17 is so selected that the shims 4 may clamp the conductor c but are prevented to slip around the conductor and group together at the bottom of the connector 1 , what would leave too great of a gap at the top of the connector 1 . apart from the collapsible spacing ring 17 , the connector 1 is made of metal , preferably of aluminium , brass or copper to ensure electrical conductivity between the two conductors c . collapsible spacing ring 17 is made for example of a soft rubber . it is emphasised that the connector 1 of the invention provides for several advantages : the shims 4 ensure each conductor c is kept concentric to the outer surface of the connector 1 , and therefore also with each other in the case of a straight joint as shown ; thanks to bulged ring 17 , the shims 4 are evenly spaced around the conductor c ensuring good surface contact and , from an electrical point of view , low electrical resistance and absence of voltage differences between the layers of strands of the conductor c ; as seen above , the radial movement of the shims 4 allows for some range taking capability what allows less components to be manufactured , stored and carried at junction sites ; moreover there is no need of providing a stepped connector in case two different diameter conductors c are to be jointed ; range taking capability also easily allows jointing connectors c of different diameters ; no special tool is required for installation , rather a wrench suffices ; the connector 1 is highly resistant to axial forces , in that any attempt to withdraw the conductor c from the connector 1 will only result in tightening of the shims 4 . in an alternative embodiment , two or more collapsible spacing rings may be used for each shim assembly . in an alternative embodiment , the shims may have bevelled end ( s ) and the outer body and / or the mid section may have flared surface ( s ). in an alternative embodiment , only one or two of the ends of the outer body and the mid section may be bevelled or conical . in other embodiments , interchangeable shims and / or either interchangeable outer bodies or mid sections may be provided to further extend the range take with respect to the diameter of conductor c . fig4 shows a termination lug 1 a wherein instead of one symmetrical mid section 2 and two outer bodies 3 as disclosed thus far , only one outer body 3 and one lug 2 a that plays the role of one half mid section and that is shaped to allow e . g . ground or mass connection are used . shims ( not visible in fig4 ) as discussed above are provided within the single outer body . although the threaded engagement of mid section 2 and outer bodies 3 or lug 2 a is particularly advantageous because it allows tightening by a usual wrench , different tightening mechanisms and use of specialized tooling may be provided . a torque limiting device that indicates the connector is tight may also be provided for . by way of an example , fig5 shows a connector 21 differing from connector 1 in that instead of a screw thread coupling , a pin and groove locking mechanism is used , resembling a bayonet coupling . as the connector outer body 23 is turned to lock the conductor c , a pin 26 of the mid section 22 clicks into one of a plurality of grooves 25 in the side of the outer body 23 , that are arranged at different longitudinal positions along a diagonal groove wherein the pin 26 can slide . there may be provided one groove 25 for each of a plurality of specific size conductors c . an increasing depth of engagement of the outer body 23 with the mid section 22 will again cause an increasing clamping of the shims around the conductor c . two diametrically opposed pins 26 and corresponding grooves 25 , or a larger number thereof , may also be provided to increase the axial force onto the shims . as mentioned , the screw thread coupling of fig1 and the pin and groove locking mechanism of fig5 may be both provided for in a single connector , to enhance the coupling . fig6 shows a connector 31 that differs from that of fig1 - 3 in that the mid section 32 is made longer , and comprises an internal cylindrical wall 35 adjacent a conical surface 38 at an intermediate position thereof . the outer bodies 33 having a hexagonal profile 16 are matingly threaded with the mid section 32 , internally thereto , and exert an axial force onto the shims 34 through a clamping ring 36 having a conical inner surface 37 ( not visible ). in use , an outer layer of conductor strands s is splayed and spread outside the shims 34 , and held by clamping ring 36 , as the connector 31 is tightened the shims 34 clamp onto the inner layers of strands whilst the outer layer of strands s is held by the clamping ring 36 . this advantageously produces a great surface contact between connector 31 and conductor c for an improved electrical connection . the differences highlighted above may be individually provided as a modification of the connector 1 of fig1 - 3 . fig7 shows a connector 41 wherein again the mid section 42 is made longer , and comprises an internal cylindrical wall 45 and no conical surface . the outer bodies 43 are e . g . matingly threaded with the mid section 42 and exert an axial force onto a collapsible inner member 44 . collapsible inner member 44 is a tube shaped body comprising two end collars 46 and an intervening portion that comprises apertures 47 . more specifically , apertures 47 are rhomboidal and each wall 48 between two such apertures is hourglass - shaped . moreover each wall 48 is so slanted with respect to the collars 46 that the neck of the hourglass - shaped wall 47 lies on a smaller circumference than the collars 46 . when the connector 41 is tightened , inner member 44 collapses and the hourglass - shaped walls 48 indent onto the conductor c . in order to increase the grip and electrical contact , more than one series of apertures 47 and hourglass - shaped walls 48 might be provided along the length of the inner member 44 . fig8 shows a connector 51 wherein the two outer bodies 53 are one piece , mid section missing . each outer body has , at its cable - side end , two or more fingers 55 having a radially inward protruding collar 56 . conical shaped shims 54 having at least one groove 57 are forced inside the fingers 55 against the action of a spring 58 that surrounds the fingers 55 . as the shims 54 are pushed further in , they clamp the conductor c and are locked in by the radially inward protruding collars 56 of the fingers 55 . collars 56 exert an axial force onto the shims 54 against axial displacement thereof . fig9 shows a connector 61 wherein again the mid section 62 is made longer , and in this case is preferably comprised of three parts 62 a , 62 b , 62 c threaded together . lateral parts 62 a , 62 c preferably have female threading and intermediate part 62 b preferably has two male threading matching therewith . mid section 62 comprises a first internal cylindrical wall 65 having a first diameter at the cable side , and a second internal cylindrical wall 66 having a second diameter smaller than the first diameter and adjacent the first cylindrical wall 65 . each outer body 63 is matingly threaded with the mid section 62 , internally thereto , and exerts an axial force onto a collapsible inner member 64 axially forcing it towards the step formed by the second internal cylindrical wall 66 . collapsible inner member 64 is in the form of an o ring having an olive - shaped cross section . in the various embodiments , the outer body ( ies ) or outer member ( s ) exert a force in an axial direction onto the shims or inner member ( s ), which in turn exert ( s ) a force in a radial direction onto the conductor ( s ) c . as said terms outer and inner are used relative to each other , not with an absolute meaning . indeed , in the embodiments of fig6 , 7 , 9 the mid section 32 , 42 , 62 is outer with respect to the outer bodies 33 , 43 , 63 . in the various embodiments , the mid section , where provided for , acts as a counter member configured to engage with the outer member ( s ) to exert the force in axial direction . in the various embodiments , the mid section where provided for may be split into two or three portions connectible with each other as shown in fig9 or with flanges connected through bolts , so that each of two conductors c may first be independently coupled to a respective connector half . this may simplify the assembly operation . the connectors of the invention are suitable for connecting the inner conductor of a coaxial power cable , or each conductor of a non coaxial power cable . in other embodiments , the inner face of shims 4 may depart from a portion of a cylindrical wall to better adapt to shaped conductors such as lobe shaped conductors or to cables having conductors lying in a plane . the collapsible spacing ring 17 of the embodiment of fig1 - 3 can be provided for in the other embodiments also . as said in connection with fig8 , the mid section may be missing , the two outer bodies being one piece . in other embodiments , the mid section may be missing , the two outer bodies being coupled to each other , such as by providing an outer threading of one outer body and a matching inner threading of the other outer body , or through bolted flanges . it is highlighted that in the above embodiments the conductor c is held almost about its entire circumference , instead of using screws that screw inside the conductor , that might damage the strands or create voltage differences among them . experimental testing showed that the connectors of the invention perform well both in terms of resistance to traction and in electrical terms .	7
referring first to fig3 it will be seen that the punch of the present invention generally designated at p is formed to present eight symmetrically disposed corners or edges 1 each defined by right angularly disposed adjoining wall portions 2 and 2 which define a corner angle &# 34 ; x &# 34 ; of 90 ° at each of the corners . with reference to fig7 and 8 the edges or corners 1 starting from the top and moving clockwise are designated 1a , 1b , 1c , 1d , 1e , 1f , 1g , and 1h and the defining wall portions are designated 2a 3a , 2b 3b , 2c 3c , 2d 3d , 2f 3f , 2g 3g , 2h 3h . it will be seen that the corners 1a , 1c , 1e , and 1g in conjunction with the wall portions 2a 3a , 2c 3c , 2e 3e , and 2g 3g define one square outline 4 shown in solid line and cross hatched . the alterntative sequence of corners and wall portions 1b , 1d , 1f , and 1h and 2b 3b , 2d 3d , 2f 3f , and 2h 3h also define a square outline 4 &# 39 ; shown in dotted line in fig7 in a 45 ° angular relation to the square outline 4 . adjoining wall portions such as 2a and 3h meet to define an included angle &# 34 ; y &# 34 ; of 135 ° and an internal angle of 225 °. as seen in fig9 the wall portions 2 and 3 , all of which are identical in shape and area preferable deviate slightly from the vertical and incline inwardly at an angle of from 3 to 31 / 2 ° towards the bottom wall 5 of the punch which preferably is of conical form having an angle from 50 ° to 56 ° to the horizontal . at the top the punch is also preferably bevelled as at 6 at an angle of 45 ° to provide a chamfered recess entrance . the juncture of the conical bottom wall 5 and the side walls 2 and 3 are defined by arcutate juncture lines 7 and 8 . as will be seen from fig8 the eight cornered punch of the present invention will provide a recess having an increased area of entrance as compared to the recess produced by prior art square recess producing punches . in this connection the inner circle 9 represents the area which would be cleared by a square cross section punch and hence the area available for entrance of a square driver bit into such a square recess . the second inner circle 10 represents the area which in fact is cleared by the present punch and hence the area available for entrance of a square cross section bit into a recess produced by a punch of the present invention . the area between the two circles 9 and 10 represents increased area for entrance , i . e . the increased ease of driver bit entrance produced by the punch of the present invention over a square recess producing punch . in forming a recess in a screw head the distortion to which the head is subjected has been found to vary almost directly to the degree that the recess deviates from a circle . thus , as seen with reference to fig8 a square punch involves the displacement out of circular form of four times the mass of metal lying between the inner circle 9 and the outer circle 11 between say corner 1a and corner 1c and represented by the shaded areas , 12 , 13 , 14 . in the case of the punch of the present invention the amount of metal displaced out of circular form is represented only by four times the shaded areas 12 and 14 and all of this mass lies between the second inner circle 10 and the outer circle 11 . as a result , it has been found that the eight cornered punch can form a recess in a screw head without distorting the round configuration of the head . this ability to maintain a precisely circular head configuration has not heretofore been possible with square punches . the precisely circular form is achieved by the ability of the punch to uniformly stress the metal of the head so that essentially no crystallized or highly stressed metal areas which are subject to fracture occur in the head . further this ability to maintain perfectly round screw heads while forming the recess coupled with the esthetic appearance of the eight point recess enables the punch to produce a screw of highly desirable appearance for use on exposed surfaces . the punches p of the present invention while having recess forming shank portions s of corresponding cross sections may be adapted for use with different types of screws . for example , the punch p of fig1 has the shank portion s projecting from the end of the punch body 15 and is used to produce a flat head screw 16 shown in fig2 . one of the critical points of wear in a punch occurs at a corner such as the corners 1 which form the points of corners 17 of the screw socket . this wear is particularly concentrated at the juncture points 18 of the edges 1 with the bottom wall formation 5 . in the case of the square cross section punch for producing a square recess , the impact blow of the punch is absorbed at only four corners and when these corners wear , the recess will not be sufficiently accurate to allow the driving bit to seat firmly and properly in the recess . this problem is compounded when the side walls of the punch and hence recess are tapered because of the mismatch of the driver bit taper with the recess taper if the bit cannot seat fully home . in the case of the punch of the present invention , eight corner juncture impact absorbing points 18 are provided with the result that the wear per corner is substantially reduced . this fact coupled with the ease of forming the metal of the screw head around the more clearly circular shape of the punch in comparison with the flat sided prior art square punch provides a substantially increased punch life so that each punch can produce a substantially greater number of recessed screws before replacement . moreover the more nearly circular shape of the punch greatly facilitates the ease and cost of making the punch itself so that the initial punch cost is less than the present square punches . desite the provision of the eight corners 1 and the eight junctures 19 intermediate of the corners 1 on the punch , there are not corners or junctures less than 90 ° and therefore no thin punch sections which would tend to fracture , and there are correspondingly no thin recess sections which would tend to ream out under high torque . furthermore , this punch is not easily broken by the side deflection forces from off center punching blows because the wall portions , in effect , reinforce each other . this advantage can be better understood by referring to fig7 where the cross hatched square 4 can be regarded as a cross section of conventional prior art square punch ; note that the sides of square 4 are relatively wide and flat . however , the corners 1b , 1d , 1f , and 1h of the dotted square 4 &# 39 ; are at the center of the sides of square 4 . thus , the corners of square 4 &# 39 ; act as reinforcing ribs for square 4 , and vice versa , thereby preventing fracture of the punch by side deflection forces . fig4 illustrates a punch having a modified form of body 20 used to produce the screw 21 . in this case the shank s is set in a recess 22 formed in the end of the body 20 and this recess 22 is adapted to shape the rounded head 23 of the screw 21 at the same time that the recess forming shank s forms the screw recess . while the preferred punch has been illustrated , variations may for example be made in the punch taper . for instance because the displacement of metal out of circular form in producing screws with punches of the present invention is less than in the case of simple square cross section punches , the fall away of metal from this punch during forming is less and therefore more nearly vertical recess side walls forming an accurate reproduction of the punch can be obtained with the present punch than with simple square punches . also , square punches produce a larger number of fasteners with defective recesses because they require that the metal being deformed flow across the entire relatively broad surface of each of their four sides . in the present eight sided punch , the corners 1 of each square 4 and 4 &# 39 ; function as tapered wedges which uniformly spread the flow of metal and ease the entry of the punch into the blank being deformed . fig7 reveals that corners 1b , 1d , 1f , and 1h of dotted square 4 &# 39 ; are centered on the sides of cross hatched square 4 . as seen in fig3 such corners define inwardly tapered wedges , the projections of which would terminate on the center axis of the punch . such wedges spread the flowing metal laterally and therefore cause it to flow more evenly over the entire surface of any side of either square 4 or 4 &# 39 ;. the present punch also provides a larger number of driver bit engaging wall surfaces in the resulting recess than is available from a simple square punch , thereby enabling the taper of the recess wall to be increased without loss of driver bit cling . an eight cornered driver bit having a cross section corresponding to this punch is disclosed in co - pending application ser . no . 835 , 533 , filed june 23 , 1969 . although the forms of the invention shown and described herein constitute preferred embodiments , it is not intended to illustrate herein all equivalent forms and ramifications thereof . also , the words used are words of description rather than of limitation , and various changes may be made without departing from the spirit or scope of the invention .	1
a first example shown in fig1 to 5 will be described . in fig1 ( outer appearance view ), fig2 ( outer appearance view showing a state in which a nib projects from a front barrel ) and fig3 ( sectional view taken on line 3 — 3 of fig1 ), a front barrel ( or a ferrule ) 2 is detachably attached to a forward part of a tubular exterior body 1 , preferably made of polymethyl methacrylic resin , by a hinge or the like ( hereinafter , the upside of the illustration is referred to a “ backward ” and the downside as “ forward ”, respectively ). a clamping member 3 made of soft resin or rubber is secured to the front barrel 2 . a resilient member 4 such as a coiled spring is attached to an inner side of the front barrel 2 such that a front end of the resilient member 4 is fixed to an internal hole of the front barrel 2 . a displaceable refill body 5 contains a writing medium and is attached with a nib t of a ballpoint pen or the like and is arranged on inner sides of the exterior body 1 and the front barrel 2 such that the refill 5 is biased backward by the resilient member 4 and capable of moving back and forth . the nib t will described in detail later . in a vertical sectional view of fig4 showing only a rear part of fig1 on an enlarged basis , ink is sealed , by a float 5 a and a highly viscous fluid 5 b , in the refill 5 which is biased backward of the exterior body 1 . an operating member 6 formed of polyoxymethylene resin is in abutment with a rear end of the refill 5 . the operating member 6 includes a sliding sleeve portion 6 a and an engagement portion 6 b . a lateral hole la is formed in the exterior body 1 . the engagement portion 6 b is fitted to the lateral hole 1 a such that the engagement portion 6 b can slide back and forth . a clip 7 made of polycarbonate resin is fixed to a rear end opening portion of the exterior body 1 by press - fit or the like . this clip 7 includes an attachment basal portion 7 a with respect to the exterior body 1 and a deformation plate portion 7 b as an intermediate portion . an engagement element , i . e ., a small piece 7 c , with which the engagement portion 6 b is to be engaged , is disposed at an inner surface of the deformation plate portion 7 b . the clip 7 is resiliently biased towards the exterior body 1 and it also has a resilient force in a lateral direction which is perpendicular to a direction towards the exterior body 1 . the small piece 7 c has a pair of opposite and generally parallel flat surfaces 7 c 1 , 7 c 2 and a pair of opposite inclined surfaces 7 c 3 , 7 c 4 at front and rear ends thereof , respectively . the surfaces 7 c 3 , 7 c 4 are inclined relative to the surfaces 7 c 1 , 7 c 2 . the inclined front surface 7 c 3 facilitates engagement and disengagement of the clip 7 with the edge of a user &# 39 ; s pocket . a step portion 6 c of the operating member 6 is in abutment with a front end of the sleeve portion 7 d of the clip 7 to prohibit the operating member 6 from escaping backward . in fig5 there are shown the configurations of the engagement portion 6 b and the small piece 7 c , as well as a relation between the small piece 7 c and the engagement portion 6 b . there are shown various states of the nib from a first state in which the nib is in a received state to a last state in which the nib is brought back to the received state again via an intermediate state in which the nib is in a projected position , seven scenes of states in total each in the form of a perspective view when viewed from the back side of fig4 . here , fig5 is the only exception of the above - mentioned definition on the directions in the drawings . in fig5 the leftside is referred to as “ backward ” and the rightside as “ forward ”, respectively ( the rightward in fig5 indicates the nib side ). the engagement portion 6 b of the several perspective views labeled first with no 1 ( nib received state at an initial state ) includes an engagement overriding portion 6 d projecting laterally in such a manner so that the engagement portion 6 b overrides the small piece 7 c at the time of engagement of the nib t and overrides the slant surface 6 e which is subjected to abutment with the small piece 7 c first . the overriding slant surface 6 e determines an angle of deviation when the engagement portion 6 b overrides the small piece 7 c . this angle of deviation is set to 45 degrees in this example . the engagement portion 6 b includes a recess 6 f at its one side surface and an engagement recess gg at its front side which engagement recess 6 g is abutted and engaged with a front end of the small piece 7 c . the recess 6 f has a second overriding slant surface 6 i which is open at the upside in fig5 and which reaches an upper surface portion 6 h as it goes backward . a positional relation and a state of engagement between the engagement portion 6 b and the small piece 7 c will now be described in detail . when the operating member 6 is pressed against the bias of the resilient member 4 , the engagement portion 6 b in the perspective view no . 1 moves forward . when the operating member 6 is further pressed , the overriding slant surface 6 e of the engagement portion 6 b is brought into abutment with a rear end of the small piece 7 c . in that state , the overriding slant surface 6 e and the small piece 7 c are in line - connection or in point - connection ( see the perspective view no . 2 ). when the operating member 6 is kept pressed , the small piece 7 c is deviated laterally ( towards the viewer &# 39 ; s side in the illustration ) by the overriding slant surface 6 e . when the operating member 6 is still kept pressed , the engagement portion 6 b moves along the side of the small piece 7 c ( see the perspective views nos . 3 and 4 ). when the pressing of the operating member 6 is released , the engagement portion 6 b moves backward . however , since the small piece 7 c is restored , when viewed from the viewer , to the opposite side in the illustration by a lateral resiliency of the clip 7 and entered into the recess 6 f so as to be abutted with the engagement recess 6 g , the engagement between the engagement portion 6 b and the small piece 7 c is achieved ( see the perspective view no . 5 ). in order to release the engagement , the operating member 6 is pressed again . then , the engagement portion 6 b moves forward and the second overriding slant surface 6 i pushes up the small piece 7 c . as a result , the engagement between the engagement portion 6 b and the small piece 7 c is released . when the upper surface portion 6 i of the engagement portion 6 b comes to an undersurface , in the illustration , of the small piece 7 c , the small piece 7 c is caused to slide laterally on the upper surface portion 6 h of the engagement portion 6 b by the lateral resiliency of the clip 6 and returned to the back side in the illustration ( see the perspective view no . 6 ). when the pressing of the operating member 6 is released , the engagement portion 6 b moves along the underside of the small piece 7 c and returned to its initial state ( see the perspective view no . 7 ). in the present invention , if the writing instrument is put into a pocket or the like in the engaged state in which the refill 5 is left exposed from the tip of the front barrel 2 , the small piece 7 c of the clip 7 is raised from an outer peripheral surface of the exterior body 1 . by this motion , the engagement between the engagement portion 6 b and the small piece 7 c is released and the initial state is restored . at the same time , the refill 5 is extracted into the front barrel 2 . a knock pressure ( nib projecting load ) in accordance with a knocking stroke of the operating member 6 will now be described with reference to fig6 to 9 . when the operating member 6 is moved forward from the nib received state at the initial stage against the resilient force of the resilient member 4 , the knock pressure of the operating member 6 is gradually increased ( see fig6 { circle around ( 1 )} and fig7 ). when the operating member 6 is kept moved , the knock pressure is abruptly raised to reach a maximum value by the overriding - contact of the small piece 7 c with respect to the overriding slant surface 6 c of the engagement portion 6 b . at that time , the tip of the nib t of the refill 5 is not yet projected from the tip of the front barrel 2 . that is to say , the overriding relation between the overriding slant surface 6 e and the small piece 7 c is achieved before the tip of the nib t is not yet projected from the tip of the front barrel 2 ( see fig6 { circle around ( 2 )} and fig8 ). subsequently , when the operating member 6 is kept pressed , the nib t is projected from beyond the tip of the front barrel 2 . since the overriding contact relation between the overriding slant surface 6 c and the small piece 7 c is finished , a moving resistance load becomes to have a value which corresponds to the resilient force of the resilient body 4 ( see fig6 { circle around ( 3 )} and fig9 ). it should be noted that the moving resistance load of the operating member 6 at the time when the nib t is received , is a value within a range not exceeding a value of { circle around ( 3 )} in fig6 . for the above - mentioned one example , test samples 1 to 10 were produced by varying the load which the engagement portion 6 b and the small piece 7 c receive at the time of a nib projecting operation , the angle of deviation at the time for the engagement portion 6 b to override the small piece 7 c and the spring constant of the coiled spring for biasing the refill backward . and the obtained samples were each tested as for { circle around ( 1 )} a load at the time the nib is projected , { circle around ( 2 )} a feel of operation at the time the nib is projected and { circle around ( 3 )} a state of handwriting . the results are shown in table 1 . the load which the engagement portion 6 b and the small piece 7 c receive at the time the nib is projected was measured by measuring the load required for the engagement portion 6 b and the small piece 7 c to override using a platform scale and in a state in which the coiled spring for biasing the refill backward is removed . { circle around ( 1 )} load at the time the nib is projected a load amount for each sample at the time the nib is locked in its projected position was measured by pressing the platform scale with the operating member 6 of each sample . { circle around ( 2 )} feel of operation at the time the nib is projected 10 monitors made a nib projecting operation for each sample and then made an evaluation as for feel of operation in three ranks , a ; too light - weighted to feel easy , b ; feel easy because the operation is right and the nib is assuredly locked in its projected position , and c ; too heavy - weighted and so operation tends to be stopped before the nib is locked in its projected position . { circle around ( 3 )} state of handwriting and presence or absence of leakage of ink a projecting and retracting operation was repeated 1 , 000 times for each sample and visually determined whether or not there is a leakage of ink from a rear end opening portion of an ink tank . thereafter , a handwriting of 100 cm was carried out at a writing speed of 70 mm per second under the conditions of a writing load of 100 g and an angle of 70 degrees and then , it was visually determined whether or not there occurs blurring of the handwriting . a second embodiment will now be described with reference to fig1 to 14 . like component parts of the preceding embodiment are denoted by like reference numerals and description thereof is omitted . a clip 7 is fixed to a rear end portion of an exterior body 1 by press - fit or the like . an operating member 6 is attached to a rear of the exterior body 1 such that the operating member 6 can move back and forth . a lateral hole la is formed in rear of the exterior body 1 and an engagement wall portion 8 a is formed on an outer peripheral surface of a sliding barrel 8 of the operating member 6 . the engagement wall portion 8 a is fitted to the lateral hole la such that the engagement wall portion 8 a can move back and forth but it is prohibited from rotation . reference numeral 8 b denotes a split groove formed in front of the sliding barrel 8 . the operating member 6 having the engagement wall portion 8 a can be attached from the rear of the exterior body 1 by deformingly contracting the split groove 8 b part . the engagement wall portion 8 a will now be described with reference to fig1 and 13 . the engagement wall portion 8 a comprises a wall portion 9 vertically upstanding from the sliding barrel 8 , a projecting lock portion formed on a side surface ( viewer &# 39 ; s side in the illustration ) of the wall portion 9 and a guide portion 11 . a front part of the lock portion 10 is defined as a slant surface 10 a slanted leftward and downward . a v - shaped recess 10 b is formed in a rear part of the lock portion 10 . a slant surface 11 a slanted rightward and upward and another slant surface 11 b slanted rightward and downward are formed on a front part of the guide portion 11 . reference numeral 11 c denotes a small slant surface of a triangular , planar configuration . a wall surface 11 d , which is formed on a leftmost end , in the illustration , of the small slant surface 11 c is connected to the slant surface 11 b of the guide portion 11 . the clip 7 includes a projecting engagement protrusion 13 formed on the other side ( opposite side when viewed from the viewer in the illustration ) of the small piece 12 . the clip 7 has resiliency and can resiliently be deformed leftward and rightward in the illustration . in a normal condition , however , it is arranged such that a right end , in the illustration , of the small piece 12 is located at the outer peripheral surface of the exterior body 1 . in this embodiment , a front end portion of the clip 7 extends so far as to cover the lateral hole 1 a formed in the exterior body 1 . operation of the second embodiment will now be described . when the operating member 6 is pressed in the state of fig1 , the engagement wall portion 8 a moves forward ( downward in the illustration ). when the operating member 6 is kept pressed , the slant surface 10 a of the lock portion 10 is brought into abutment with the engagement protrusion 13 . when the operating member 6 is still kept pressed , the small piece 12 of the clip 7 is displaced rightward in the illustration and the lock portion 10 is brought leftward , in the illustration , of the engagement protrusion 13 . when the operating member 6 is kept pressed , the slant surface 11 a of the guide portion 11 is brought into abutment with a rear end of the engagement protrusion 12 and therefore , the operating member 6 is caused to stop advancement . when the pressing of the operating member 6 is released , the clip 7 is moved back leftward , in the illustration , by the resilient restoring force . as the clip 7 is moved back , the recess 10 b of the lock portion 10 is brought into abutment with the front end of the engagement protrusion 13 so that the lock portion 10 is locked . since the refill 5 is fitted into the sliding barrel 8 of the operating member 6 , the refill 5 is exposed from the tip of the front barrel 2 by the above - mentioned operation and locked in that state ( see fig1 ). in order to release the locked state , the operating member 6 is pressed again . then , the lock portion 10 is disengaged from the engagement protrusion 13 . when the operating member 6 is kept pressed , the wall surface 11 d formed on a final end of the small slant surface 11 c is brought into abutment with the rear part of the engagement protrusion 13 . when the operating member 6 is still kept pressed , the engagement protrusion 13 is displaced leftward , in the illustration , by the slant surface 11 b . and an end face 14 of the engagement wall portion 8 a is brought rightward , in the illustration , of the engagement protrusion 13 . when the pressing of the operating member 6 is released , the engagement wall portion 8 a moves rightward of the engagement protrusion 13 and returned to its initial state . as the engagement wall portion 8 a is moved back , the refill 5 is also retracted into the front barrel 2 . according to this embodiment , since the resilient force , which acts in the direction enabling the clip 7 to move towards the exterior body 1 , is chiefly utilized when the engagement protrusion and the engagement portion are engaged with each other or disengaged from each other by operation , durability of the attachment basal portion of the clip can be ensured . a third embodiment will now be described with reference to fig1 and 15 . description of like parts of the above - mentioned embodiments is omitted for simplification only . in this embodiment , an engagement protrusion 15 is formed on an inner surface of the clip 7 such that the engagement protrusion 15 has a protruded and recessed shape . an engagement portion 16 is formed on a sliding barrel 8 of an operating member 6 such that the engagement portion 16 has a protruded shape . in this embodiment , the resilient force , which acts in a lateral direction which is a direction perpendicular to the direction for enabling the clip 7 to move towards the exterior body 1 , is chiefly utilized for the operation . when the operating member 6 is pressed in the state of fig1 , the engagement portion 16 moves forward ( downward in the illustration ). when the operating member 6 is kept pressed , the engagement portion 16 is brought into abutment with a slant surface 10 a of a lock portion 10 . when the operating member 6 is still kept pressed , the clip 7 is displaced laterally as the engagement portion 16 moves forward and therefore , the engagement portion 16 is brought leftward , in the illustration , of the lock portion 10 . when the operating member 6 is kept pressed , the engagement portion 16 is brought into abutment with a slant surface 11 a of a guide portion 11 and therefore , the operating member 6 is caused to stop advancement . when the pressing of the operating member 6 is released , the clip 7 is moved back laterally by the resilient restoring force . then , the engagement portion 16 moves towards ( rightward and upward in the illustration ) the lock portion 10 along the slant surface 11 a , as the clip 7 is moved back . subsequently , a rear end of the engagement portion 16 is brought into abutment with a recess 10 b of the lock portion 10 so that the engagement portion 16 is locked to the lock portion 10 . in order to release the above locked state , the operating member 6 is pressed again . then , the engagement portion 16 is disengaged from the recess 10 b . when the operating member 6 is kept pressed , a front end of the engagement member 6 is brought into abutment with the slant surface 11 b and the clip 7 is displaced laterally so that a left end 16 a of the engagement portion 16 reaches an end face 15 a of an engagement protrusion 15 . when the pressing of the operating member 6 is released , the engagement portion 6 is moved along the right side of the lock portion 10 and returned to its initial state without being moved back to the recess 10 b . according to this embodiment , even if the writing instrument is put into the pocket or the like in the engaged state in which the refill 5 is left exposed from the tip of the front barrel 2 , the engagement protrusion of the clip 7 and the engagement portion is more easily disengaged from each other and therefore , it is less likely that the user &# 39 ; s clothes get stained by the nib . a fourth embodiment will now be described with reference to fig1 and 17 . description of like parts of the above - mentioned embodiments is omitted . in this embodiment , an engagement protrusion 15 is formed on an inner surface of the clip 7 such that the engagement protrusion 15 has a protruded shape . an engagement portion 16 is formed on a sliding barrel 8 of an operating member 6 such that the engagement portion 16 has a protruded and recessed shape . when the operating member 6 is pressed in the state of fig1 , the clip 7 is displaced laterally as the engagement portion 16 moves forward . when the pressing of the operating member 6 is released , the clip 7 is moved back laterally by the resilient restoring force . then , a lock portion 10 is locked to an engagement protrusion 15 , as the clip 7 is moved back laterally . in order to release the above locked state , the operating member 6 is pressed again . then , the engagement portion 16 is disengaged from the engagement protrusion 15 and returned to its initial state . according to the fourth embodiment of the invention , the engagement protrusion 15 of the clip 7 can be formed smaller in configuration compared with the third embodiment . the nib t used for the refill 5 of the above - mentioned various embodiments will now be described in detail . for the convenience of explanation , the nib is faced upward in the illustration . in fig1 , a spring for biasing a ball upward is incorporated in the nib t . in fig1 , there is no need of a provision of a spring for biasing the ball . in fig1 to 21 , a ball 18 is rotatably attached to a ball pinchingly holding portion 17 disposed at a tip of the nib t . a ball retaining seat 19 and a center hole 20 serving as an ink passageway are formed below , in the illustration , the ball 18 . an upper part of the center hole 20 is defined as a radial wedge grooves 21 for feeding ink to the ball 18 . a rear hole 22 is formed below the center hole 20 . a counter bore portion 20 a having a diameter larger than a diameter dimension of the center hole 20 but smaller than a diameter dimension of the ball retaining seat portion 19 is formed at an upper part of the center hole 20 . the ball retaining seat portion 19 is formed by striking the ball 18 downward , in the illustration , so that the ball retaining seat portion 19 has the same r as the ball 18 . as shown in fig2 , comparing with the conventional product , the ball retaining seat is formed narrower in width to the extent of a provision of the counter bore portion 20 a . the diameter dimension of the ball retaining seat portion varies depending on lubricating property of ink and raw material of the tip . preferably the diameter dimension of the ball retaining seat portion is about 75 % to 90 % of the ball diameter . for example , for a ball having a diameter dimension of 0 . 7 mm , the diameter dimension of the ball retaining seat portion may be set to 0 . 57 mm ( 81 . 4 % of the ball diameter ), the diameter dimension of the counter bore 20 a may be set to a proper value and the width of the ball retaining seat portion 19 may be set to 0 . 01 mm to 0 . 1 mm . a spring 23 is disposed at the rear hole 22 of the tip t shown in fig1 . one end of the spring 23 extends perpendicularly upward and is defined as a spring end portion 23 a passing through the center hole 20 . the ball 18 is carried by the spring end portion 23 a and biased upward so as to be abutted with a distal end inner edge portion 24 of the ball pinchingly holding portion 17 . reference character h denotes a nib holder . the nib holder h includes an inner hole 25 thereabove , an inner hole step portion 25 a serving as a bottom of the inner hole 25 and a lead hole 26 . a lower outer periphery of the nib t is a reduced diameter portion 27 which is assembled and fixed to the inner hole 25 of the nib t holder h by a press - fit or the like . a vertical length of this reduced diameter portion 27 is set slightly larger than the depth of the inner hole 25 . the nib holder h fixedly supports the reduced diameter portion 27 of the nib t by its inner hole step portion 25 a and also supports a rear end portion 23 b of the spring 23 . when the ball 18 is brought into abutment with a writing surface , the ball 18 is pressed , the spring end portion 23 a is moved backward by the pressing operation and the ink is fed to the writing surface via the tip inner edge portion 24 of the ball pinchingly holding portion 17 through the ball 18 . when the ball 18 is brought away from the writing surface , the spring 23 is sprung back ( or restored ) to cause the ball 18 to contact the tip inner edge portion 24 intimately so that ejection of ink is blocked . function of the counter bore portion 20 a in the nib t will now be described . when the diameter dimension of the hole portion 20 a of the counter bore portion 20 a is properly set beforehand and the ball 18 is knocked , a spring back of the knocking hardly occurs due to a provision of the counter bore portion 20 a . as a result , the ball retaining seat portion 19 having the same r as the ball 18 and a small width , can be formed . when the writing instrument is to be used , that portion of the ball 18 which has an is enlarged diameter sits on the ball retaining seat portion 19 having a small width and rotates the ball 18 . accordingly , lateral play is reduced and centering of the ball 18 is retained . as a result , there can be obtained such writing characteristics that a smooth rotation is ensured and ink blobbing hardly occurs . although , in the nib t of fig1 , the diameter dimension of the center hole 20 is set to a required least possible diameter in order to maintain the centering property in the center hole 20 of the spring end portion 23 a on which the ball 18 is carried , a required quantity of ink can be delivered to the ball pinchingly holding portion 17 owing to a provision of the counter bore portion 20 a nevertheless the center hole 20 has a small diameter . as described hereinbefore , according to the present invention , there is provided a retractable type writing instrument wherein an operating member movable relative to an exterior body through operation is interlocked with a refill body having a nib at its tip , an engagement portion for engaging an engagement protrusion formed on an inner surface of a clip attached to the exterior body is formed on the operating member , the engagement protrusion is engaged with the engagement portion , thereby locking the nib of the refill body in a state of the nib projected from a tip of the exterior body , and the locking of the nib in its projected position is released by an operation to be made in the same direction as the operation for locking the nib in its projected position , the retractable writing instrument being characterized in that when the engagement protrusion and the engagement portion are to be engaged with or disengaged from each other by the operation , a relative movement between the engagement protrusion and the engagement portion at the time of engagement or disengagement consists of a combination of a movement in a same plane direction and a movement towards or away from the plane , or a retractable type writing instrument wherein a clip including an attachment basal portion with respect to an exterior body having a nib projection hole at a tip thereof , a deformation plate portion as an intermediate part and an engagement protrusion at an inner surface of the deformation plate portion is arranged outside the exterior body , a refill body having a nib at a tip thereof and storing therein ink is received in the exterior body such that the refill body can move back and forth in a state in which the refill body is biased backward by a coiled spring , an operating member is moved to cause the refill body or a connecting member with respect to the refill body to move so that the nib projects from the nib projection hole , the refill body or the member to be connected to the refill body is brought into engagement with the engagement protrusion of the clip , thereby maintaining the projected state of the nib from the exterior body , the operating member is moved again to release the engagement so that the nib is received in the exterior body by a backward biasing force of the coiled spring , the retractable type writing instrument being characterized in that the engagement protrusion of the clip is formed of polycarbonate resin , an engagement portion of the refill body or the member to be connected to the refill body with respect to the engagement protrusion is formed of polyoxymethylene resin , and a surface of the engagement portion and a protruded portion of the engagement protrusion are contacted with each other at the time of an overriding engagement for projecting the nib . accordingly , the mechanism for locking / releasing the projection and retraction is simple , the number of component parts is reduced , assembling is easy and the cost is low . moreover , the barrel length can be reduced to the extent of the feature in that the mechanism for locking / releasing the projection and retraction is not incorporated in the internal rear part of the barrel . furthermore , sureness of the locking of the projection / retraction through operation and actual feel of the operation can be obtained . in addition , no leakage of ink and no blurring of the handwriting occurs even if the projecting and retracting operation of the nib is repeated . moreover , there is no such a fear that the user &# 39 ; s clothes get stained by accidental pressing of the knock member after use .	1
referring now more particularly to fig1 this version of the basement enclosure invention includes footers 10 - 10 which support columns 11 - 11 which in turn support beams 12 - 12 . these beams 12 - 12 may be made of prestressed , reinforced concrete , steel , or any other suitable material , depending upon the span involved . hanging from the beams 12 - 12 is a conventional wooden framework consisting of headers 13 - 13 , studs 14 - 14 , attached to sills 15 - 15 , and floor joists 16 - 16 . attached and surrounding this structural enclosure is a gas and moisture impermeable shell 17 which may be made from a variety of materials , a preferred material being a fiberglass reinforced polymer . the shell 17 may be attached directly to the floor joists 16 - 16 , studs 14 - 14 , and sills 15 - 15 by adhesives or by any other means which do not affect the integrity of the shell 17 to prevent transmittal of moisture or gases . referring now more particularly to fig2 the shell 17 is shown attached to a plywood sheeting 18 in the floor area and sidewalls 19 - 19 which in turn are attached by conventional means to studs 14 - 14 , headers 13 - 13 , and joists 16 - 16 . the headers 13 - 13 are attached to the beams 12 - 12 by conventional methods . the unit shown in fig2 may be preassembled at the factory or the shell 17 may be shipped to the site as a unit or in module form and assembled at the site with the structural elements assembled thereto and the entire unit hung from the beams 12 - 12 . if desired , the shell 17 may be made thick enough to provide structural support for construction of a building on it without the use of the conventional stud , joist , and plywood construction . however , for economical reasons , the conventional interior wood construction is preferred . of course , other materials than wood may be used . referring now more particularly to fig3 there is shown a version of the basement enclosure which may be placed directly on the bottom of the basement excavation . if desired , this unit can be placed on the leveled soil of the basement excavation , it can be placed on a concrete pad formed with conventional footers , or it can be placed on a leveled sand bed . the unit consists of headers 13 - 13 connected by means of studs 14 - 14 to sills 15 - 15 and floor joists 16 - 16 . ceiling joists 21 - 21 which become the floor joists of the first above ground story of the structure are provided and connected to the headers 13 - 13 . the entire structure may be covered with plywood sheeting 18 in the floor area and sheeting 19 in the wall area with the gas and moisture impermeable shell 17 attached thereto and completely enclosing the side walls and the floor of the unit . after the unit has been installed in the ground the area around it is back filled as is shown in section in fig1 and 3 with dirt 20 to grade level . in the case of the version of the invention shown in fig1 there is space remaining between the bottom of the excavation and the bottom of the shell 17 in the final installation . in the case of factory construction , one option is to form and cure the shell 17 on a wooden frame work , or it can be molded in a separate operation and then fastened to the wood frame , either at the factory or at the site . any joints in the shell 17 would be sealed with a similar material thus to insure the integrity of the shell 17 . for example , if a fiberglass reinforced polymer were used to form the shell 17 , this could be sealed with fiberglass reinforced polymer . in new construction of the version of the invention shown in fig1 the footers 10 - 10 would be installed and the columns 11 - 11 would then be installed and the basement shell 17 and accompanying structural members would be placed in the excavation , the beams 12 - 12 would be attached to the columns 11 - 11 and the shell 17 would be firmly attached to the beams 12 - 12 , thus completing the installation procedure . in some soil situations , the footers 10 - 10 may be omitted and the columns 11 - 11 can take the form of pylons , which are driven down into the ground . appropriate openings can be made either at the factory or on site for sewer , water , and gas lines and appropriately sealed to prevent the entry of any moisture or gases . the structures shown are particularly adaptable to a finished basement with conventional insulation being installed between the studs 14 - 14 and then finished wallboard or panelling being attached to the studs . in an existing building having a foundation , it is possible to excavate under the building , install the appropriate beams and then install the module by hanging it freely from the support beams . it will be seen that this basement enclosure provides a continuous barrier to moisture and gases and will not be subject to most of the problems of conventional basements . in the case of the version of the invention shown in fig1 the reinforced shell 17 will hang from the support beams 12 - 12 and thus bear no forces of compaction due to the weight of the structure . the problem of heave is eliminated because the bottom of the shell 17 is suspended above the level of the ground at the bottom of the excavated hole rather than resting on it . the problems of any settling of the foundation can be compensated with adjustments made at the point where the support beams 12 - 12 attach to a foundation support . furthermore , since the basement enclosure allows for the secure anchoring of the enclosure to a foundation , potential problems of buoyancy due to high ground water are minimized . in the case of the version of the invention showin at fig3 the basement enclosure will have sufficient structural strength to support the additional construction to be placed on the top thereof , such as would be the case in a two - or three - story building , for example . this basement enclosure could be considered to be the below ground first story of a multi - story structure . while this invention has been described in its preferred embodiment , it is to be appreciated that variations therefrom may be made without departing from the true scope and spirit of the invention .	4
fig1 shows a well 10 being drilled in the earth with a rotary drilling rig 12 . the drilling rig includes the usual derrick 14 , derrick floor 16 , draw works 18 , hook 20 , swivel 22 , kelly joint 24 , rotary table 26 , and a drill string 28 made up of drill pipe 30 secured to the lower end of a kelly joint 24 and to the upper end of a section of drill collars 32 , which carry a drill bit 34 . drilling fluid circulates from a mud pit 36 through a mud pump 38 and a mud supply line 41 and into the swivel 22 . the drilling mud flows down through the kelly joint , drill string and drill collars , and through nozzles ( not shown ) in the lower face of the drill bit . the drilling mud flows back up through an annular space 42 between the outer diameter of the drill string and the well bore to the surface , where it is returned to the mud pit through a mud return line 43 . a reference sensor 7 is mounted on the upper portion of the drill string 28 . in a particular preferred embodiment , reference sensor 7 is mounted on swivel 22 . normally , a plurality of field sensors , such as geophones 8 and 9 , are located at the earth &# 39 ; s surface 2 at suitable locations . the sensor 7 and the geophones 8 and 9 are connected by means of conductors 53 - 55 or by telemetering to an amplifier 50 connected to a recorder 52 . in a preferred embodiment sensor 7 may be an accelerometer . the impact of the bit 34 on the rock at the bottom of the borehole 10 generates elastic waves which propagate vertically upward through the drill string , and radially outward into the earth formation . the drill string path has little attenuation of acoustic energy by virtue of its steel composition and , therefore , the signal received by the sensor 7 is representative of the vibrations emitted by the drill bit 34 into the earth formation . signals emitted into the earth will travel upwardly to the field sensors and will also be reflected from subsurface interfaces , such as interface 60 beneath the drill bit , back to the field sensors . normally , the transmission time of seismic energy from the drill bit to the field sensors is determined from cross - correlation of the signal detected by the sensor 7 with the signals detected by the field sensors . because at least a portion of the acoustic signal will be reflected from discontinuities in the drill string and from locations where there is a change in diameter of the drill string ( primarily the interface between the drill collars and drill pipe ), the signal detected at the top of the drill string will include not only the primary signal emanating from the drill bit but also drill string multiples resulting from reflections of the primary signal from the drill collar - drill pipe interface and the top and bottom of the drill string . acoustic energy resulting from such drill string multiples is also emitted from the drill bit into the earth . such reflected energy travels to the field sensor from the drill bit along with the primary energy emitted by the drill bit . fig2 illustrates the reflections of acoustic energy from the top and bottom of the drill string 28 and from the interface 62 between the drill collars 32 and drill pipe 30 . fig2 also illustrates possible travel paths of seismic energy from the drill bit 34 to a field geophone 8 . the acoustic signal travels up from the drill bit to the drill collar - drill pipe interface where a portion of the energy is reflected and a portion is transmitted and travels to the top of the drill string . when the reflected portion reaches the bottom of the drill string , a portion of the reflected energy emanates into the earth and a portion is reflected upwardly . when the reflected energy again reaches the interface between the drill collars and drill pipe , a portion thereof is re - reflected , and so on , so that a short period drill string multiple having a period related to the travel - time between the drill bit and the drill collar - drill pipe interface emanates from the bottom of the drill string . because a portion of the short period multiple is transmitted through the drill collar - drill pipe interface , this short period multiple is detectable at the top of the drill string . the following equation represents in transform notation the short period signal time series emanating from the lower end of the drill bit which is detected by the field geophone . p = fractional portion of energy at the bottom of the drill string which is radiated into the earth r = fractional portion of upward traveling energy which is reflected downwardly at the drill pipe - drill collar interface bha = one - way travel time between the bottom of the drill string and the drill collar - drill pipe interface . the multiple sequence enclosed in brackets may be represented as bhamult ( z ) so that the geophone signal may be written as the convolution of a source signal with the impulse response of the bottom bole assembly and the impulse response of the earth . in z transform notation the signal detected by sensor 7 at the top of the drill string is referred to as the pilot ( or reference ) signal . the time series for the short period energy which reaches the top of the drill string may be written in z transform notation as : p = fractional portion of energy at the bottom of the drill string which is radiated into the earth r = fractional portion of upward traveling energy which is reflected downwardly at the drill pipe - drill collar interface bha = one - way travel time between the bottom of the drill string and the drill collar drill pipe interface . note that , except for an amplitude factor , and a delay factor , z bha , the bracketed term is exactly equivalent to the bracketed term for the geophone signal . therefore , the pilot signal can be used to derive an operator to attenuate the short period drill string multiple in the field signal . the time series can also be represented by the convolution in addition to the short period multiples , there will also be present in the pilot signal and field geophone signal , longer period multiples resulting from reflections from the top of the drill string . at the lower end of the drill string , a portion of the reflected energy is emitted into the earth and a portion is re - reflected ( either from the bottom of the drill string or from the drill pipe - drill collar interface ) and travels back to the top of the drill string . however , the longer period multiples detected at the field geophones will have different characteristics from the long period multiples detected in the pilot signal at the top of the drill string . these characteristics do not allow the pilot signal to be used to derive a deconvolution operator for the long period multiples in the field geophone signal . if long period multiple energy in the pilot signal is excluded , the term dpipe ( z ) is a pure delay filter , and the pilot signal convolution equation may be written as where γ = travel time for energy to travel from the bottom of the drill pipe to the pilot sensor at the top of the drill string . the autocorrelation of the pilot signal may be written in z transform notation as the autocorrelation function for short period multiple energy may also be written as : to generate the autocorrelation function which excludes the long period acoustic energy , the pilot signal is windowed to exclude delays equal to or greater than the two way travel time between the top of the drill string and the drill pipe - drill collar interface . an operator is generated from this windowed auto - correlation function , which when convolved with the field geophone signal , attenuates the short period multiple reflection in the field geophone signal . the operator , which may be the minimum phase inverse of the pilot signal may be derived using wavelet compression techniques known to those of ordinary skill in the art . when this operator is applied to the geophone signal to the earth ( z ) response is obtained : ## equ2 ## by convolving the derived operator with the geophone signal , the magnitude of the short period multiples in the geophone signal is attenuated . when the drill bit is utilized as the energy source , the field signal is normally cross - correlated with the pilot signal . typically , the cross - correlation of t - he field signal and the pilot signal will be performed and the operator is then convolved with the cross - correlation function . the operator may , however , be convolved with the field signal prior to cross - correlation of the field signal with the pilot signal . although the preferred embodiment has been described in terms of using the energy emitted from the drill bit as the seismic source , it is understood that other sources positioned at the lower end of the drill string may be utilized . such sources may be of any suitable type for producing vibrations , impulses , implosions , explosions , or sudden injections of fluid against the walls of the wellbore . various changes in the details of the invention as described herein may be apparent to those skilled in the art . it is intended that such changes be included within the scope of the claims appended hereto .	6
referring to fig1 – 6 , a convertible roof system 21 is part of an automotive vehicle and includes a hard - top front roof 23 , a hard - top rear roof 25 , a top stack mechanism 27 operable to move the roofs , a rigid tonneau cover 29 , a tonneau cover mechanism 31 and a tonneau latching system 32 . roofs 23 and 25 are automatically movable from fully raised and closed positions covering a passenger compartment 33 , as shown in fig1 , to fully retracted and open positions , as shown in fig3 , 5 and 6 , wherein roofs 23 and 25 are stowed in a roof storage area or compartment 35 . roof storage compartment 35 is located between a metal , seat back panel or bulkhead 35 a and a metal rear panel 36 . bulkhead 35 a separates roof storage compartment 35 from passenger compartment 33 and rear panel 36 separates roof storage compartment 35 from an externally accessible storage area for miscellaneous articles such as a trunk or pickup truck bed 37 . a rigid , glass back window or backlite 39 is secured to rear roof 25 while front roof 23 is disengagably attached to a front header panel 41 by latches . weatherstrips or seals are also employed around the peripheral edges of roofs 23 and 25 . roofs 23 and 25 are preferably stamped from steel sheets and include inner reinforcement panels , but the roofs may alternately be formed from polymeric composites or aluminum . roofs 23 and 25 have opaque outside surfaces 43 that are typically painted . these outside surfaces 43 define three - dimensionally curved planes which are stored in a predominantly vertical and parallel nested orientation when fully retracted and stowed ; this can be observed best in fig5 . top stack mechanism 27 is in mirrored symmetry in both outboard sides of the vehicle and will only be described for the left - hand side with reference to fig3 , 6 and 21 . top stack mechanism 27 includes a linkage assembly 51 and a hydraulic actuator 55 . linkage assembly 51 is preferably constructed in accordance with german patent application serial number 101 39 354 . 7 entitled “ cabriolet - fahrzeug ” ( vehicle ) which was filed on aug . 17 , 2001 , which is incorporated by reference herein . roofs 23 and 25 can be tightly and closely nested together when fully retracted and the centerline , fore - and - aft roof storage area opening can be minimized due to linkage assembly 51 . tonneau cover mechanism 31 and tonneau cover 29 are best shown in fig7 – 10 and 19 ; only one side will be discussed since the other is in mirrored symmetry . tonneau cover mechanism 31 includes a linkage assembly 103 having a pair of arcuate gooseneck links 105 and 107 , a first straight link 109 and a second straight link 111 . proximal ends of gooseneck links 105 and 107 are pivotably mounted to a vehicle body - mounted bracket ( see fig1 ). straight links 109 and 111 are coupled at a pivot 113 . a hydraulic actuator 115 ( see fig1 ) is coupled to and drives gooseneck link 105 . accordingly , when hydraulic actuator 115 is energized , tonneau cover mechanism 31 will cause tonneau cover 29 to rearwardly pivot from the closed position of fig1 to the open position of fig4 . this allows roofs 23 and 25 to enter roof storage area 35 . tonneau cover 29 will be automatically returned to its closed position in order to cover and externally hide the stowed roofs . a rigid flipper door or closeout panel 141 is attached to a front section of tonneau cover 29 by a pair of hinges 143 . for each hinge 143 , a first plate is secured to a bottom surface of tonneau cover 29 and a second plate is secured to a bottom surface of closeout panel 141 . if necessary , the plates are coupled at a pivot pin with a torsion spring 489 ( best observed in fig1 ) biasing the plates into a co - planar extended orientation ( as shown in fig3 , 7 and 19 ). an aesthetic trim panel 144 ( see fig1 ) covers a portion of each tonneau cover mechanism 31 and a latch trim panel covers a portion of each latch assembly . preferably , a pair of automatic , hydraulic fluid actuators 629 each have a first , linearly extendable rod end 633 coupled to a bracket mounted to closeout panel 141 . a fluid cylinder end 631 of each fluid actuator 629 is mounted to a tonneau cover bracket . thus , actuation of fluid actuators 629 rotate closeout panel 141 relative to tonneau cover 29 . adjustable bumpers 635 assist in locating tonneau cover 29 in its closed position . in an alternate embodiment , shown in fig2 and 26 , a first end of a cable actuator 145 , which slides within a protective sheath , is connected to and operably drives a corresponding lever / bracket 146 mounted to closeout panel 141 . the opposite end of each cable 145 is secured to a fixed cable bracket 147 stationarily mounted to a main bracket 149 supporting roof linkage assembly 51 , which in turn , is fastened to bulkhead 35 a . referring to fig1 – 13 , the preferred embodiment of latching system 32 includes a stamped steel plate 201 , upon which is fixed a linearly extendable hydraulic actuator 203 , a latching linkage assembly 205 and a lost motion device 207 . latching linkage assembly 205 includes an arcuately shaped first link 209 , an elongated second link 211 and an offset angled third link 213 . a first pivot 215 of arcuate link 209 is linearly slid within an elongated and diagonally oriented slot 221 disposed in plate 201 upon automatic actuation of actuator 203 which causes extension of a piston rod coupled to pivot 215 . second link 211 is rotatably coupled to arcuate link 209 at a floating pivot 223 . thus , automatic actuator - driven movement of arcuate link 209 causes the coupled link 211 to rotate about a fixed pivot 225 such that a follower pin 227 coupled to link 211 is linearly slid from an unlatched position shown in fig1 and 12 to a latched position as shown in fig1 . a catch or roller 229 is journaled about follower pin 227 and follower pin 227 is operably slid within an arcuate surface defining a slot 231 in plate 201 . roller 229 engages within a tapered bifurcated opening of a striker 241 downwardly and forwardly projecting from a lower surface of tonneau cover 29 ( see fig7 , 8 and 18 ), when tonneau cover 29 is in its fully closed and covering position as shown in fig1 and when latch assembly 32 is in its fully latched position as shown in fig1 and 14 . when a microprocessor based controller 407 ( see fig1 ) automatically causes retraction of the piston rod into the hydraulic cylinder of actuator 203 , the links will reverse operation and cause roller 229 to rotate from its latching position to an unlatching position thereby releasing striker 241 . a manual override feature is provided within latching system 32 to allow a vehicle operator to manually latch or unlatch roller 229 with striker 241 even when electrical or hydraulic power is not present , such as could happen during vehicle servicing or due to battery failure . such an override feature is achieved through a metallic disk 251 of lost motion device 207 which is rotatable about a fixed pivot 253 . an internal , straight , camming slot 255 is disposed within disk 251 and has a pair of abutting surfaces 257 and 259 . a cam follower pin 261 projecting from link 213 is allowed to freely move in a lost - motion manner within slot 255 during normal automatic operation of latch assembly 32 . flexible and elongated cables 271 are attached to disk by spaced apart fasteners 273 ; operator accessible handles 275 ( see fig2 ) are located within the automotive vehicle and are attached to an opposite end of each cable 271 such that manual pulling of one handle causes manually actuated rotation of disk 251 in that direction while manual pulling of the other handle causes reverse rotation of disk 251 . thus , manually actuated rotation of disk 251 serves to back drive the linkages through contact of the respective abutting surface 259 against pin 261 of link 213 ; this causes link 213 then upwardly and rotatably pulls or pushes pivot 215 attached to arcuate link 209 for coincidentally driving link 211 and roller 229 . the manually overridden unlatching position can be viewed in fig1 while the manually overridden unlatching position can be observed in fig1 . it is noteworthy that linkage assembly 32 is extremely thin in its cross - car package . plate 201 is secured to a quarter inner panel of the vehicle body outboard of the roof storage compartment with all of the linkages and actuators disposed between the quarter inner panel and the outer quarter panel skin of the vehicle . essentially , only roller 229 , a portion of the hydraulic lines and a portion of the manual override cables / handles are exposed on the in - board side of plate 201 thereby reducing the accessibility of components which might otherwise interfere with retraction or extension of the convertible roofs . reference should now be made to fig1 and 18 wherein a hall effect magnet 410 is mounted on an outboard face of each striker 241 . a hall effect switch 409 is affixed to each plate 201 which operably senses the location of magnet 410 ; if magnet 410 is sensed as being in the tonneau striker closed position , then switch 409 sends a signal to microprocessor 407 which causes cylinder 203 to engage roller 229 with striker 241 . referring to fig2 – 25 , an alternate embodiment of a latching system 32 ′ includes a stamped steel plate 201 ′, upon which is fixed a linearly extendable hydraulic actuator 203 ′, a latching linkage assembly 205 ′ and a lost motion device 207 ′. latching linkage assembly 205 ′ includes an arcuately shaped first link 209 ′, an elongated second link 211 ′ and a hook - like third link 213 ′. a first pivot 215 ′ of arcuate link 209 ′ is linearly slid within an elongated and diagonally oriented slot 221 ′ disposed in plate 201 ′ upon automatic actuation of actuator 203 ′ which causes extension of a piston rod coupled to pivot 215 ′. second link 211 ′ is rotatably coupled to arcuate link 209 ′ at a floating pivot 223 ′. thus , automatic actuator - driven movement of arcuate link 209 ′ causes the coupled link 211 ′ to rotate about a fixed pivot 225 ′ such that a follower pin 227 ′ coupled to link 211 ′ is linearly slid from an unlatched position shown in fig2 to a latched position as shown in fig2 . a roller 229 ′ is journaled about follower pin 227 ′ and follower pin 227 ′ is operably slid within an arcuate surface defining a slot 231 ′ in plate 201 ′. roller 229 ′ has a somewhat inwardly tapered , h cross sectional shape which operably engages within a tapered bifurcated opening of a striker 241 downwardly and forwardly projecting from a lower surface of tonneau cover 29 ( see fig7 , 8 and 18 ), when tonneau cover 29 is in its fully closed and covering position as shown in fig1 and when latch assembly 32 ′ is in its fully latched position as shown in fig2 . when a microprocessor based controller automatically causes retraction of the piston rod into the hydraulic cylinder of actuator 203 ′, the links will reverse operation and cause roller 229 ′ to rotate from its latching position to an unlatching position thereby releasing striker 241 . a manual override feature is provided within latching system 32 ′ to allow a vehicle operator to manually latch or unlatch roller 229 ′ with striker 241 even when electrical or hydraulic power is not present , such as could happen during vehicle servicing or due to battery failure . such an override feature is achieved through a metallic disk 251 ′ of lost motion device 207 ′ which is rotatable about a fixed pivot 253 ′. a depressed camming slot 255 ′ is disposed within disk 251 ′ and has a pair of abutting surfaces 257 ′ and 259 ′. a bent , cam following finger 261 ′ of hook - like link 213 ′ is allowed to freely move in a lost - motion manner within slot 255 ′ during normal automatic operation of latch assembly 32 ′. flexible and elongated cables 271 ′ are attached to disk by spaced apart fasteners 273 ′; operator accessible handles 275 ( see fig2 ) are located within the automotive vehicle and are attached to an opposite end of each cable 271 ′ such that manual pulling of one handle causes manually actuated rotation of disk 251 ′ in that direction while manual pulling of the other handle causes reverse rotation of disk 251 ′. thus , manually actuated rotation of disk 251 ′ serves to back drive the linkages through contact of the respective abutting surface 259 ′ against finger 261 ′ of link 213 ′; this causes a follower pin 291 ′ attached to link 213 ′ to slide within a camming slot 293 ′ such that link 213 ′ then upwardly and rotatably pulls or pushes an intermediate pivot 295 ′ attached to arcuate link 209 ′ for coincidentally driving link 211 ′ and roller 229 ′. the manually overridden unlatching position can be viewed in fig2 while the manually overridden unlatching position can be observed in fig2 . all of the top stack mechanism actuators and tonneau cover actuators may be controlled in accordance with the control system disclosed in u . s . pat . no . 5 , 451 , 849 entitled “ motorized self - correcting automatic convertible top ” which issued to porter et al . on sep . 19 , 1995 , which is incorporated by reference herein , or through hall effect sensors coupled to a microprocessor controller . for example , in the alternate embodiment , fig1 illustrates a locator pin 401 downwardly extending from a bracket attached to an underside of tonneau cover 29 ( see fig7 and 8 ). when fully closed , locator pin 401 enters within a body - mounted receptacle 403 and pushes a tongue of a micro switch 405 coupled to a microprocessor - based controller 407 . such micro switch 405 actuation serves to then actuate a hydraulic pump which causes extension of hydraulic actuator 203 ( see fig1 ). referring now to fig1 , when roller 229 is fully engaged within striker 241 , roller depresses a tongue of a micro switch 409 which transmits a signal to controller 407 to cause deactivation of hydraulic actuator 203 . while various embodiments of the latching and convertible roof system have been disclosed , it should be appreciated that variations may be made to the present invention . for example , the presently disclosed latch can be used in other areas of the vehicle such as for the front header - to - one bow attachment or as a roof downstack latch , although certain advantages of the present invention may not be achieved . furthermore , the present latch can be used to secure a hook or striker extending from a trunk lid which may be used to cover a retracted roof . also , the hard - top roofs can be covered with vinyl , fabric or painted , or can include transparent glass panels . the present invention latch can alternately be used with a soft top roof . moreover , electric motor actuators can be used in place of one or more of the disclosed hydraulic actuators . it should also be appreciated that the trunk compartment can be in front of the passenger compartment for a mid or rear engine vehicle . while certain materials and shapes have been disclosed , it should be appreciated that various other shapes and materials can be employed . it is intended by the following claims to cover these and any other departures from the disclosed embodiments which fall within the true spirit of this invention .	8
the cargo space is defined between a floor 10 , side walls 12 , a front wall 14 , and an enclosing roof structure ( not shown ). the side walls 12 may conveniently be in the form of corrugated aluminum sheeting provided along the upper edge with longitudinal support elements 16 which are interconnected by permanently attached transverse top bars 18 , thus maintaining the side walls 12 in parallel vertical relationship . at each corner of the longitudinally elongated cargo space defined between the side walls 12 of the vehicle are corner posts 20 . in order to provide an adequate support for the structure later to be described , l - shaped support brackets 22 having vertical legs 24 and horizontal legs 26 are welded to the tops of the rear posts 20 . identical brackets 23 are provided and are welded to the top of the front corner posts . brackets 22 and 23 constitute end supports for elongated upper rails 28 which may be of one - piece construction and adapted to extend between the rear l - shaped bracket 22 and the front l - shaped bracket 23 . the upper rails 28 may be of one - piece or they may be of shorter lengths interconnected by splice elements 30 . as best seen in fig3 each of the upper rails 28 include integrally extending flat end portions 32 adapted to be permanently and rigidly connected to the support brackets 22 and 23 . conveniently , the rails 28 are in the form of extrusions having a cross - sectional shape which will presently be described in detail , the end portions of the extrusions being cut away to provide the flat end attachment portions 32 . the connection between the horizontal legs 26 of the l - shaped brackets and the attachment portions 32 may be by conventional fastening means such for example as nuts and bolts . referring now to fig5 the upper support element 28 is provided with a longitudinally extending inwardly facing continuous recess 34 which provides space for the splice elements 30 if used and which also provides additional space for the reception of the ends of latching elements 36 and 38 provided at the ends of cargo restraint bars 40 . extending longitudinally over and enclosing the longitudinally extending space 34 is an upper belt rail 42 the upper and lower edges of which may be affixed to the rail 28 by conventional fastening means such for example as expanding rivets 44 . referring now to fig6 the configuration of the bottom rails 46 is illustrated . these rails are similar in cross - sectional shape to the upper elements 28 and are provided with a longitudinally extending continuous inwardly facing recess 48 . the outer sides of the rails 46 include ribs 50 apertured as indicated at 52 for the reception of fasteners 54 by means of which the bottom rail 46 is affixed to the side 12 of the cargo container adjacent its bottom edge . the elongated continuous inwardly facing recesses or channels 48 are covered by lower belt rails 56 attached to the lower rail by suitable fastening means such for example as the split rivets indicated at 58 . the space between the recess 48 and the lower belt rails 56 receives the latch elements 36 and 38 at the end of the transversely extending cargo restraint bar 40 . attached to the vertical posts 20 are vertically extending belt rails indicated generally at 64 . these belt rails are of generally l - shaped cross - section and include longitudinally extending legs 66 terminating in short flanges 68 which are welded as indicated at 70 to the vertical posts 20 . the vertical belt rails 64 include transversely extending legs 72 which if desired may also be welded to the posts 20 . the longitudinally extending vertical legs 66 are spaced from the adjacent side of the posts to provide a space 74 for the reception of latch elements such as those illustrated at 36 , 38 at the ends of cargo restraint bars 40 . panels indicated generally at 76 are provided each of which has secured thereto short lengths of belt rails 78 provided with a multiplicity of openings 80 for the reception of the latching elements 36 , 38 provided at the ends of the restraint bars 40 . at the sides of the panels 76 there are provided releasable lock structures 82 each of which comprises a spring pressed pin 83 adapted to be projected downwardly from the lower locking structure 82 and upwardly from the upper lock structure as indicated at 84 . each of the pins is adapted to be received in pin receiving openings 86 in the lower rails or corresponding openings 88 provided at the lower side of the upper rails 28 . the pins include laterally extending actuating portions 90 which are movable in slots 92 . the arrangement is such that when the laterally extending actuating portions 90 are moved to retract the locking pins from the openings 86 , 88 , the pins and actuating portions may be turned so that the actuating portions are out of alignment with the slots 92 , thus latching the locking portions in retracted position . at this time the individual panels may be adjusted to whatever position is required , such for example as the position indicated at 76b in fig4 . the panel in the position 76b occupies an intermediate position between an end panel 76a and additional panels such as the one indicated at 76c in fig1 . by providing for release of the panels 76 and shifting them into desired positions and relocking them in such adjusted position , a considerable savings in weight and material is provided as will be readily apparent . it may be mentioned at this time that the openings in the various belt rails including the short sections 78 thereof provided on the panels 76 may be adapted to receive conventional latch means provided at the ends of presently available cargo restraint bars 40 . referring now to fig7 there is illustrated an arrangement in which elongated trays 96 are provided on the floor 10 of the cargo container , being attached thereto by any suitable hold - down means such as screws . trays 96 are provided with a multiplicity of short rollers 98 so that the rollers facilitate movement of heavy cargo components over the floor of the cargo container . fig7 illustrates the trays 96 and rollers 98 in position to receive cargo components introduced through the open rear end of the cargo container . inasmuch as the addition of the trays 96 and rollers 98 raises the effective support height of the floor 10 , a feature of the present invention is the provision of the short sections 78 of the belt rail on the individual adjustable panels 76 at a spacing such that the panels may be inverted end for end depending on whether or not the rollers 98 are provided , thus positioning the short sections 78 of belt rail structure at desired vertical spacing from the effective floor support structure heights .	1
with reference to the drawings in general , and fig1 in particular , the two front legs 4 , 5 of the easel are fitted at their upper ends into axle recesses 2 , 3 defined by a pivot head 1 , each leg being secured to the pivot head by means of a shaft 6 for pivoting movement in a common plane . the upper end of the rear leg 8 is inserted into a rear axle recess 7 , and the rear leg 8 is pivotably attached to the pivot head 1 by a shaft in a manner similar to the front legs 4 and 5 but pivotable in a plane perpendicular to the common plane of the first and third legs . each of the easel legs 4 , 5 and 8 may be made from e . g . aluminum channel having a u cross section . each of the three legs consists in this example of an upper or outer leg section 9 , and an inner or lower leg section 10 . the inner leg section 10 is telescopically slideable within the outer leg section 9 , and each leg is provided with a leg lock 11 , 12 , 13 , respectively , mounted to and fixed near the lower end of each outside leg section 9 . the leg lock is actuable between a released and a locked position , for locking the inside leg section 10 at an arbitrarily extended position relative to the outer leg section 9 . a shoe 14 of rubber or other suitable material may be fitted to the lower end of each lower leg section 10 . each of the leg locks 11 , 12 and 13 has a locking lever 15 provided with a cam element 16 disposed over an opening in the outer leg 9 , and configured such that when the lever is pivoted to the locked position shown in fig1 the cam element pushes against the inner leg 10 within the outer leg 9 , urging the leg 10 against the outer leg in frictional locking engagement , thereby locking the two leg sections against telescoping movement . each of the leg locks has a socket mount which includes a pair of parallel ears 17 extending upwardly and away from the inner side of the easel leg , on the side opposite that of the locking lever 15 . turning now to fig2 the mounting socket of the leg lock 11 on the front leg 4 has a pair of parallel ears 17 between which are disposed corresponding ears 19 on the first tie - bar 18 . a helical spring 20 is inserted between the two tie - bar ears 19 coaxially about a shaft 21 which extends through aligned holes in the tie - bar ears 19 and leg lock ears 17 to thereby pivotably secure the tie - bar 18 to the leg 4 , allowing the tie - bar to move up and down between a folded and an extended position . the spring 20 has one end 22 which acts against the inside surface 23 of the leg lock socket while the opposite end 24 of the coil spring is held captive underneath the tie - bar 18 . the natural tendency of the coil spring is to unwind , the spring end 24 thus acting to support the tie - bar 18 against its own weight . when the legs are unfolded and the first tie - bar 18 is released downwardly , the action of the spring 18 prevents the free end of the tie - bar from dropping to the ground , and tends to maintain the tie - bar in a near horizontal attitude . turning now to fig3 the opposite free end of the first tie - bar 18 , which is a u channel in cross section , has cutouts 25 in the side flanges of the channel , and a bent edge 26 . the second front leg 5 is provided with a leg lock 12 similar to leg lock 11 already described in connection with fig2 and which is provided with a horizontally extending shaft 27 between its parallel ears 17 . the free end of the tie - bar 18 pivots downwardly onto the shaft 27 which is received in a snap fit within the cutouts 25 and under the bend edge portion 26 , which acts as a resilient spring element . the two front legs 4 and 5 are thus interconnected in fixed spaced apart relationship by the tie - bar 18 . turning back to fig1 the rear leg 8 is provided with a tie - bar support 29 , similar to the front tie - bar support described in connection with fig2 and provided with a spring 30 which is capable of supporting the rear tie - bar 28 almost horizontally without support of the front end of the rear tie - bar 28 , in a manner similar to that of spring 20 of the front tie - bar support . as shown in fig4 the free end of the rear tie - bar 28 , which is also u - shaped in cross section , has a pair of cutouts 31 in its side flanges , and a bent edge 32 at its end . the second tie - bar is engaged to the first tie - bar 18 by inserting the bent edge 32 into a slot 33 defined at an intermediate point of the first tie - bar 18 . the cutouts 31 and bent portion 32 are dimensioned such that a snap locking engagement takes place between the free end of the rear tie - bar 28 and the front tie - bar 18 . when so engaged , the front and rear tie - bars 18 , 28 form a t - shaped structure and maintain the three legs 4 , 5 , 8 at a correct angle of the deployment . the interconnection of the three legs by the two tie - bars 18 , 28 reinforces and stabilizes the three legs , and the tie - bars 18 , 28 interconnected in a t configuration may be used as a shelf support for a paint box , etc . in fact , placing a load such as a paint box or the like on the interconnected tie - bars 18 , 28 is beneficial to the easel &# 39 ; s overall stability in that it tends to anchor the easel by lowering its center of gravity , and thus may prevent the easel from overturning , particularly in view of the fact that easels such as disclosed herein may be manufactured from lightweight aluminum , and when a canvas is placed thereon , the resultant center of gravity is relatively high off the ground , making the structure susceptible to tipping over . further , the springs 20 , 30 provided in the pivotal mounting of the two tie - bars 18 , 28 have the effect of supporting the tie - bars in a near horizontal position when the legs are deployed and the tie - bars are allowed to swing downwardly under their own weight . the result is that the free ends of the tie - bars naturally fall to and are suspended just over the portions with which the free ends of the tie - bars interlock to secure the easel in the deployed configuration . similarly , when the tie - bars are released from mutual engagement in order to fold up the easel , they are easily raised to their folded position towards the inside of the respective legs 4 , 8 with the assistance of the urging of the corresponding spring 20 , 30 . thus , setting up and releasing the tie - bars 18 , 28 is easily and quickly accomplished . the springs 20 , 30 prevent the tie - bars 18 , 28 from pivoting so far downwardly tht the ends of the tie - bars touch the ground and are soiled by mud , etc . the springs 20 , 30 further are capable of absorbing shocks imposed on the tie - bar ears 19 , etc ., of each tie - bar 18 , 20 since the pivoting movement of the tie - bars is stopped elastically by the corresponding spring 20 , 30 . thus , there is no possibility that the tie - bar ears 19 , or related portions , are damaged or bent . turning now to fig5 each of the front legs 4 and 5 is provided with a lower canvas support whose position is adjustable by sliding movement along the outer leg section 9 of each leg 4 and 5 . each lower canvas support assembly includes a socket - like mounting member 41 , which is freely slideable along the outer leg section 9 of each leg 4 , 5 . this mounting member 41 is similar to the equivalent mountiing elements provided in each of the leg locks 11 , 12 and 13 , and includes a locking lever 42 provided with a cam element adapted to engage the surface of the outer leg section 9 so as to make frictional locking engagement therewith , thereby to fix the mounting member 41 at an arbitrarily selected position along the outer leg section 9 . each of the mounting members 41 have a pair of axle - supporting ears 43 similar to ears 17 of the leg locks already described , and between which is disposed a tubular sleeve 45 made of synthetic resin or the like , and a spring washer 44 . an l - shaped canvas holder 46 is inserted through aligned holes 43a in the portions 43 of the socket 41 , and also through the washer 44 and tube 45 . the diameter of the rod - like canvas holder 46 is somewhat larger than the inside diameter of the sleeve 45 so as to make a friction fit by the canvas holder 46 within the sleeve 45 . the tube 45 is force - fitted between the pair of axle supports 43 with the washer 44 . thus , when the canvas holder 46 is swiveled within the support ears 43 , frictional resistance takes place between the tube 45 and the support portions 43 of the socket 41 . thus , free swiveling of the canvas holder 46 is restricted by the elastic tube 45 , and the bent leg 47 of the canvas holder 46 may be maintained pointing upwardly , and its position adjusted relative to the easel leg by both rotation of the holder , as well as pushing and pulling of the canvas holder axially through the aligned bores 43a in the socket 41 , to thereby accommodate thicker or thinner canvases . end covers 48 , preferably made of rubber or synthetic resin , are fitted onto both ends of the canvas holder 46 . the spring washer 44 may , if desired , be eliminated , and only the elastic tube 45 used between the support ears 43 . turning back to fig1 the pivot head 1 has a slot 51 extending vertically therethrough and disposed between the two front legs 4 and 5 . a vertical slide bar 52 is slideably inserted through this slot 51 , and is movable up and down therethrough relative to the pivot head 1 . a screw provided with a knob 53 is threadable into the pivot head 1 against the vertical slide bar 52 , such that the slide bar may be locked or released relative to the pivot head 1 by means of this screw . turning now to fig6 which illustrates the upper canvas holder assembly , it is seen that a pair of t - brackets 55 are pivotably mounted to the upper end of the vertical slide bar 52 by means of a shaft 54 extending through aligned bores in the t - brackets and the vertical slide bar . each of the t - brackets has horizontal bar guides 56 , 57 formed by bending the upper edge and the side edges , respectively , of each bracket . the bent portions of each bracket face the opposite t - bracket 55 . a horizontal slide bar 58 , which may be a u channel in cross section , is held between the bar guides 56 , 57 of the two t - brackets , allowing the horizontal bar 58 to slide between the two brackets 55 . a screw 63 provided with a knob 62 passes through washer 59 and enlarged hole 60 in one of the brackets 55 , and is threaded into hole 61 in the other bracket 55 . thus , the two brackets held together by the screw 63 form a swivel whose fulcrum is the shaft 54 . by tightening the screw 63 , the two brackets 55 may be drawn together against the vertical slide bar 52 , thus locking the brackets 55 against swiveling relative to the vertical bar , while simultaneously locking the horizontal slide bar 58 against sliding movement between the two brackets 55 . an upper canvas holder 64 , which is concave in cross section , is affixed to the underside and at the end of the horizontal slide bar 58 at right angles thereto , to form a figure t as shown in fig1 and 6 . an anti - skid rubber sheet 65 may be glued to the inner surface of the upper canvas holder 64 . an end stop pin 66 , or the like , extending downwardly from the opposite end of the horizontal bar 58 may be provided to prevent the slide bar 58 from being withdrawn from between the t - brackets 55 , by locking against the upper end of the vertical slide bar 52 when such withdrawal is attempted . the various shafts or axles 6 , 21 , 27 , 54 are desirably provided with a hole 68 at one end , and a head 67 at the other end at each shaft , as best seen in the case of shaft 54 in fig6 . after each of these shafts are inserted into their corresponding supports , the shaft end with the hole 68 is flattened so as to enlarge its diameter and prevent the shaft or axle from being withdrawn . when setting up this easel , the leg locks 11 , 12 , 13 of the three easel legs 4 , 5 , 8 , respectively , are released by means of the locking levers 15 to thereby allow telecoping height adjustment of each leg , and the tie - bars 18 , 28 are deployed and interconnected in the figure t in fig1 in order to secure the three legs in fixed spaced apart relationship . the canvas support units 41 are then released and adjusted in height as required , and a canvas 71 shown in dotted lines in fig1 is placed in the two canvas holders 46 . the lock screw 53 of the vertical slide bar is loosened to allow sliding adjustment of the position of the vertical slide bar 52 , as required by the size of the particular canvas 71 . the two t - fasteners 55 at the upper end of the vertical slide bar are then loosened to allow movement of the horizontal slide bar 58 , and thus allow the upper canvas holder 64 to be engaged with the upper edge of the canvas 71 . simultaneously , by sliding the horizontal slide bar 58 relative to the vertical slide bar , the angle of inclination of the canvas 71 on the easel may be adjusted by pushing or pulling the horizontal slide bar through the t - fasteners 55 . finally , the adjustments are secured by locking up the various elements by tightening the screws 53 and 63 . when folding up the easel , each tie - bar 18 , 28 is released and pivoted upward towards its folded position against the respective leg 4 , 8 , and the three easel legs 4 , 5 , 8 are folded together . then , the vertical slide bar 52 is slid downwardly , and the horizontal slide bar 58 is pulled out towards the front and swiveled downwardly . by this operation , the upper canvas holder 64 is folded down against the front easel legs 4 , 5 into a compact folded configuration for easy transport and storage . it will be understood that while a coil spring is used for spring 20 , the coil spring may be replaced by others springs such as plate springs , etc . while a particular embodiment of the invention has been shown and illustrated for purposes of clarity , it will be understood that many changes , modifications and substitutions may be made by those possessed of ordinary skill in the art . therefore , the scope of the invention is limited only by the following claims :	5
in the transmission system according to fig1 a tv signal to be transmitted is applied to the input of a transmitter 1 . the tv signal , which can have an analog format ( e . g . pal , ntsc or secam ) or a digital format ( e . g . mpeg ) is modulated and upconverted to an rf signal in the desired frequency band . this frequency band can be the band from 40 . 5 ghz - 42 . 5 ghz in cept countries and the band from 27 . 5 ghz - 29 . 5 ghz in other countries . also other microwave frequencies an be used if they are made available for broadcast purposes by the regulating authorities . the rf signal generated by the transmitter 1 is radiated by the antenna 2 . the antenna 2 can be a horn antenna , or can be a small parabolic reflector with corresponding feed . the signal transmitted by the antenna 2 is received by a number of receivers each present at a subscriber site to be provided with the tv signal . at each subscriber site the signal transmitted by the transmitter 1 is received by means of the corresponding antenna 3 , 6 , 9 or 12 . the signal from the antenna 3 , 6 , 9 , 12 is processed by the corresponding receiver 4 , 7 , 10 or 12 to obtain a tv signal which is delivered to the corresponding tv set 5 , 8 , 11 or 14 . it is observed that the use of a transmission system according to fig1 is not limited to tv signals , but that it also can be used for other type of signals , e . g . data signals . in the receiver 4 according to fig2 the input signal is coupled via the transmission line being here a waveguide 15 to an input of an outdoor unit 16 . the input of said outdoor unit 16 is formed by a first input of the mixer 17 . an output of the local oscillator unit 18 is coupled to a second input of the mixer 17 . the local oscillator unit 18 comprises a local oscillator 21 having an output coupled to an input of an amplifier 20 . the output of the amplifier 20 is coupled to the input of a tripler 19 . the output of the tripler 19 constitutes the output of the local oscillator unit 18 . the output of the mixer 17 is coupled to an input of the down converter 22 . the input of the down converter 22 is coupled to an input of a low noise amplifier 23 . the output of the low noise amplifier 23 is coupled to a first input of a mixer 24 . the output of an oscillator 35 is coupled to a second input of the mixer 24 . the output of the mixer 24 is coupled to the input of an amplifier 25 . the output of the amplifier 25 constitutes the output of the outdoor unit 16 . the outdoor unit 16 is coupled via a coaxial cable to the indoor unit 26 , the output of which is connected to the tv set . the antenna signal is fed via the waveguide 15 to the mixer 17 . the dimensions of the waveguide 15 are chosen to obtain a cut off frequency which is well above the frequency of the signal generated by the local oscillator unit 18 . the length of the waveguide 15 is chosen to obtain sufficient suppression of the local oscillator signal . the standard down converter 22 is commercially available from philips components under type nos . sc 813 and sc 815 . assuming an input frequency for the down converter 22 of 11 . 5 ghz and a reception band from 40 . 5 to 42 . 5 ghz the frequency from the local oscillator unit 18 must be adjustable from 29 ghz to 31 ghz . to generate the local oscillator signal the local oscillator 21 generates a signal in the 10 ghz range . this signal is amplified by means of the amplifier 20 to a sufficient level . the output signal of the amplifier 20 is multiplied in frequency by a factor of three by the tripler 19 so that a signal having the desired frequency is available at the second input of the mixer 17 . the tripler 19 can be built using a varactor diode mounted in a waveguide . a suitable varactor diode is commercially available from philips components under type no . cxy 12 / 38 / 073 . the output signal from the mixer 17 is amplified by the low noise amplifier 23 of the down converter 22 . the output signal of the low noise amplifier is converted to a frequency in the range from 0 . 95 ghz to 1 . 7 ghz by mixing a 10 ghz signal from the oscillator 35 with the output signal of the low noise amplifier 24 by means of the mixer 24 . the output signal of the mixer 24 is amplified by the amplifier 25 and transmitted to the indoor unit 26 . the indoor unit 26 converts the signal received from the outdoor unit 16 into a signal which is suitable for a customary tv set . the indoor unit is of the type used for the reception of direct broadcast satellites and is commercially available from philips consumer electronics . in the mixer 17 according to fig3 the received signal is applied to the waveguide section 27 . the dimensions of said waveguide section are chosen to obtain a cut off frequency above the frequency of the local oscillator . the relation between cut off frequency and dimensions of the waveguide is well known to those skilled in the art , and is e . g . described in the book &# 34 ; microwave engineering &# 34 ; by a . f . harvey published by academic press inc . 1963 section 1 . 4 pp . 11 - 14 . the length of the waveguide section 27 to obtain a desired attenuation of the local oscillator signal can also be easily determined from the expressions presented in the above mentioned book . the output of the waveguide section 27 is guided via a transition section 28 to a waveguide section 31 large enough to conduct the if signals having a frequency of approximately 11 . 5 ghz . furthermore the output signal of the local oscillator unit 18 is coupled into the waveguide section 31 via the waveguide section 29 and the transition section 30 . in the waveguide section 31 the electric fields from the input signal and the local oscillator signal are added . due to the non - linear transfer characteristics of the diode 32 an if signal having the desired frequency is generated , and is available at the output of the waveguide section 31 . in the mixer 17 according to fig4 a carrier 52 is introduced in the waveguide 50 . this carrier is positioned in parallel with the e - plane of the field in the waveguide 50 . in the cross section according to fig5 of the mixer 17 according to fig4 the rf signal enters the mixer in taper 52 which transforms the received signal into a signal which is carried by the fin line waveguide 54 . the part 63 forms an impedance transformation section which adapts the impedance of the waveguide 50 to the impedance needed for the mixing diodes 62 and 64 . at the mixing diodes 62 and 64 the received signal is split in two equal parts being in phase . the local oscillator signal is applied via the stripline 55 to the mixer . this local oscillator is transferred via the high - pass filter 65 to the stripline 57 . the signal carried by the stripline 57 is transformed into two signals which are opposite in phase , being carried by the fin line waveguides 58 and 59 . the signal which is carried by the fin line waveguide 58 is applied to the mixer diode 62 , and the signal carried by the fin line waveguide 60 is applied to the mixer diode 64 . the mixer diodes are connected in series , and are biased with a dc current of 1 ma . suitable diodes are gallium arsenide mott diodes of the cay 18 or cay 19 type . the if signal is available at the stripline 67 , and is tapped off via the low pass filter 68 . the high pass filter 65 is formed by a z formed spacing which is made in the stripline 55 . in fig6 it is shown that the mixer diodes 62 and 64 are connected in series between the conducting planes . the junction between the two mixer diodes 62 and 64 is connected to the stripline 57 for tapping off the if signal . in the receiver arrangement according to fig7 a horn antenna 45 is attached to the input of the mixer 17 via the waveguide section 15 of fig1 . above the horn antenna 45 a parabolic reflector 3 is mounted . the parabolic reflector 3 can be slid partially into the box 40 , enabling the adaption of the effective area of said parabolic reflector 3 . in this way the strength of the received signal level can be adjusted to avoid overload of the mixer 17 when a signal from a very near transmitter is received . in this way the application of passive attenuators can be avoided .	7
referring now to the drawings and more particularly to fig1 there is shown a portion of a composite body constructed according to the present invention and designated generally by reference numeral 10 . composite body 10 is formed of a plurality of layers of prepreg tape 12 , three of which are shown partially exposed in fig1 and with a layer of thin perforated foil 14 disposed between each adjacent two layers of prepreg tape . the prepreg tapes making up each layer in composite body 10 are commercially available from a variety of manufacturers in various widths and thicknesses and are fabricated from unidirectional fibers impregnated with a thermosetting resin . one such prepreg material is available from the whittaker corporation , narmco materials division , 600 victoria street , costa mesa , california , 92627 , under the tradename rigidite 5208 . this tradename material is a thermosetting epoxy resin employed as the matrix system with a variety of carbon fibers to produce rigidite prepreg . the term &# 34 ; prepreg &# 34 ; is a term of art that denotes preimpregnated unidirectional continuous filament fiber materials that may be temperature cured to provide a rigid composite structure . the impregnation of the carbon fibers is accomplished by the hot melt process that is free of solvents to provide outstanding handling characteristics , tack , long out - time , and essentially voidfree laminates . after impregnation with the epoxy , the resulting prepreg is cut into the desired width and rolled for storage under refrigeration in the temperature range of 0 ° c . or below and in a sealed container . the storage life of the prepreg at these temperatures is at least six months although the manufacturer only provides a warranty period of 90 days . if maintained at room temperature , that is , 70 °± 5 ° f ., the storage life is approximately 14 days . the graphite or carbon fibers utilized in making the prepreg are available in various diameters from numerous commercial sources , for example , hercules , union carbide , and others . in one specific example of the whittaker corporation product , the prepreg employed was rigidite 5208 - t - 300 wherein the t - 300 refers to union carbide &# 39 ; s tradename thornel 300 graphite fibers . these and other fibers contemplated in use of the present invention are continuous type fibers that extend the length of the prepreg tapes . other prepreg tapes that are suitable for practice in the present invention are commercially available from the 3 - m company , fiberite company , and others . although the prepreg tapes are sold commercially in various widths , from slit widths as narrow as 0 . 376 inch to 12 inch widths , the most commonly used width is 3 inch . these widths may be cut when ready for use to that desired for the particular application . also , the thickness of the prepreg tapes that are commercially available vary from those providing a cured ply thickness in the range of 0 . 0015 inch to 0 . 0025 inch for ultra - thin applications to the standard range of 0 . 005 inch to 0 . 008 inch as employed in the specifically described application herein . the cured thickness of a single - ply or layer is primarily dependent upon the graphite fiber diameter with the prepreg tapes having a fiber content of 58 ± 3 % by volume , an epoxy content of 42 ± 3 % and with a 60 - 40 % graphite / epoxy being preferred . as shown in fig1 a plurality of equal lengths of prepreg tape 12 are cut and laid down on a clean surface for example , an aluminum or stainless steel plate . when the width of the final structure to be built exceeds the width of the tape employed , the various lengths of tapes are combined and laid up in side - by - side relationship to provide the necessary width . each layer or ply of the thus formed wide surface area is provided with staggered surfaces between the adjacent tape sections forming the ply to prevent bulges at the seams where the various widths of tapes are connected . a layer of a thin perforated foil material 14 such as for example , a polyester , is disposed between each ply of the prepreg tapes as shown more particularly in fig2 . the layup or plurality of lengths of material formed are stacked to obtain the desired thickness and in the specific examples tested herein ten layers or plys of tape were stacked by hand to form the laminate approximately 0 . 050 inch thick . the stacked assembly is then cured under vacuum and pressure at an elevated temperature in a conventional manner . after cooling to room temperature the final cured structure 10 may be machined , cut or otherwise utilized to obtain the final exterior configuration desired . during the curing process the epoxy in prepreg tapes 12 flows through the perforations in the preforated foil sheets 14 to cause interbonding between the adjacent laminae of the stacked assembly . although the epoxy does not adhere readily to the polyester foil separator sheets , the bonding occurring through the perforations thereof ensure an adequate lamination for the entire assembly 10 . as shown in fig2 of the drawings , the graphite fibers in the prepreg tape layers 12 are maintained in a unidirectional relationship throughout the stacked assembly 10 of this embodiment . referring now more particularly to fig3 and 4 , and alternate embodiment of composite body 20 is shown . in this embodiment the prepreg tape layers 22 are also provided with a thin perforated foil layer 24 between each two layers of prepreg tape . however , the direction of the fibers in the prepreg tape layers 22 are alternated such that alternate layers of the prepreg tape have the direction of the unidirectional fibers extending therethrough in a perpendicular or 90 ° relationship to that in the next adjacent prepreg layer . rectangular perforations or slots for foil layers 24 were employed in this embodiment in lieu of the circular perforations employed in the embodiment illustrated in fig1 . thus , in the composite structural components shown , holes and slots interrupt the adjacent fiber layers . in unidirectional composites , only intralaminar shear stresses in the matrix material transfer loads from interrupted fibers to continuous fibers . in multidirectional composites , interlaminar shear stresses transfer loads from interrupted fibers in one laminae to continuous fibers in other laminae . the notch - strength and fracture behavior of these two kinds of composites , differ as will be further explained hereinafter . in the fracturing of notched - unidirectional composites ( fig1 and 2 ), matrix shear failures occur before the fibers are loaded to the ultimate strength . thus , longitudinal cracks will form along the edges of the notch before the section of the test piece fails . this type of rupture or damage is considered matrix controlled . thus , the rupture force flows out of the interrupted fibers and into the matrix surrounding the unidirectional fibers which transfers force from the interrupted fibers to the continuous fibers . in most epoxy - matrix composites these shear stresses are high enough to cause matrix shear failure before the tensile stress in the continuous fibers reaches the fiber tensile strength . the resulting longitudinal cracks move the load - transfer sites away from the edge of the notch and limit the stress concentration in the continuous fibers . this is in contrast to the multidirectional graphite / epoxy composites illustrated in fig3 and 4 which fail by transverse cracking at net section stresses much lower than in unidirectional or 0 ° composites . in these composites there is less matrix cracking before the most highly stressed longitudinal fibers reach the ultimate strength and start a catastrophic failure . the onset of failure and the failure mode are considered to be fiber controlled in the multidirectional composites . this is because of stiffness of the fibers in the diagonal or oppositely disposed laminae wherein most of the forces from the interrupted longitudinal fibers flow through the interlaminar matrix into the diagonal fibers and then back into the uninterrupted longitudinal fibers . the matrix shear transfer then occurs over the interlaminar interface and because of the great extent of the interface transfer area , these shear stresses are lower than were the maximum intralaminar shear stresses in the unidirectional composites . the fracture of the multidirectional composites occurs because the longitudinal fiber stresses reach the fiber strength before the matrix shear stresses reach the matrix shear strength . thus , comparatively little load redistribution occurs before total fracture of the composite . to redistribute the stress around a notch or other opening , the local shear stress between laminae of unlike orientation can be increased by grouping laminae of like orientation . in the present invention , however , it has been shown the matrix shear strength can be reduced by partially separating the graphite / epoxy laminae with a thin perforated polyester film . in the specific examples of the present invention described herein , a 0 . 014 mm thick perforated polyethylene terepthalate film , commercially available under the dupont tradename &# 34 ; mylar &# 34 ;, was used as the separating layer between adjacent laminae in a composite layup . the adjacent laminae are thus bonded through each perforation , but because of the poor mylar - to - epoxy bond , the laminae are essentially unbonded elsewhere . the particular shape of the perforations in the thin polyester films does not appear to be critical and test results obtained with both round and rectangular shaped openings were essentially identical . it was also found that the open area in the polyester film could range between 35 - 45 % of the total film area and still obtain adequate bonding between the adjacent prepreg tape layers . also , the polyester film layers need not be inserted between each adjacent layer of prepreg since test results showed that , even in composites constructed with only one layer of perforated foil within the composite body , the physical characteristics of the composites was improved . for maximum fracture and impact improvement , however , a layer of the perforated foil would be employed in each adjacent two layers of the prepreg material . also , the layup for the prepreg material need not be confined to the 0 , ± 45 °, 90 °, layup but may be laid up such that the fibers in adjacent laminae are disposed in various angular relationships to that of the next adjacent laminae . it is preferred , however , that at least 40 % of the fibers within the composite body be oriented in the load direction area anticipated for use with the composite body . all fracture and impact specimens of the present invention and the control specimens were tested in a 1 mn servo - hydraulic testing machine . also , all tension and compression tests were made in a 100 mn servo - hydraulic testing machine . in a series of comparative tests , the interlaminar strength of unidirectional and multidirectional composites was shown to be reduced by placing perforated mylar films between laminae ; tests on notched and slotted specimens showed that the interlaminar films promoted delamination and longitudinal cracking near the notches and that , as a result , toughness , notch - strength and impact strength were substantially increased . the specifically described examples and process described herein are considered exemplary to describe the present invention and are not to be deemed as exhaustive . there are obviously many modifications and variations of the present invention that will be readily apparent to those skilled in the art in the light of the above teachings without departing from the spirit and scope of the appended claims .	8
referring now to fig1 the vor / loc panel 10 of a navigation ( nav ) system comprises a housing 12 having a panel surface 14 . the panel surface 14 has walls forming apertures for a plurality of press keys 16 numbered &# 34 ; 0 &# 34 ; through &# 34 ; 9 &# 34 ;, respectively , a multiple function controller 18 , a plurality of function control press keys 20 , 22 , and 24 and a display 26 including a pair of digital displays 28 and 30 with decimal indicators and data annunciators . the function controller 18 includes on / off / volume / ident / mode control knobs 32 and 34 . the control knob 32 has an off position indicator which is aligned with a panel supported off indicator when the system is off and rotated therefrom for turn on and volume selection . control knob 32 is stacked on the control knob 34 which has a diameter greater than that of knob 32 for ease of manipulation . the control knob 34 has a segmented periphery . the adjacent segments are spaced with one space bearing a function selection indicator for selection alignment with panel supported mode function indicators 36 . the control mode function indicators 36 include a frequency indicator labeled &# 34 ; f &# 34 ;, a to / from indicator &# 34 ; t / f &# 34 ;, a clock indicator &# 34 ; ck &# 34 ; and a distance / time indicator &# 34 ; d &# 34 ;. control 32 is also a push / pull switch for selectively enabling and disabling the station identification information . function control press keys 20 , 22 , and 24 , and the ten numerically numbered (&# 34 ; 0 &# 34 ;-&# 34 ; 9 &# 34 ;) press keys 16 have dual function capability , and the pair of digital displays 28 and 30 are multiple purpose displays of five digits each and data annunciators . each digit is a seven segment electronic digit and a decimal point indicator is positioned between the third and fourth digits . display ( 26 ) contains annunciators in its center area labeled &# 34 ; k &# 34 ; and &# 34 ; fr &# 34 ; or &# 34 ; to &# 34 ; for annunciating , respectively , the speed in knots on the left side display presentation and bearing from station or to station on the right side display presentation ( when the unit is in the f / t mode ). control press keys 20 , 22 and 24 are located in a row between the function selection switch 18 and the display 26 and adjacent to the top of the panel 14 ; while the ten numerically numbered press keys are located in a row beneath the display 26 and function control keys 20 , 22 and 24 . function control keys 20 , 22 and 24 are labeled respectively , &# 34 ; sto &# 34 ; ( store ), &# 34 ; rcl &# 34 ; ( recall ), and &# 34 ;←→&# 34 ; ( digital display 28 or 30 selector ); the panel 14 supports a label , adjacent function control key 22 . the panel 14 also supports a &# 34 ; scan &# 34 ; label adjacent to the top of press key 16 labeled &# 34 ; 0 &# 34 ;. the communication panel 38 ( fig2 .) except for a function selection indicator 40 of the function controller 18 and the display labels is identical to the vor / loc panel 10 . the function mode indicator 40 includes an active channel selection indicator labeled &# 34 ; a &# 34 ; and a standby channel selection indicator labeled &# 34 ; s &# 34 ;. the left side of display 26 is labeled &# 34 ; t &# 34 ; for indicating transmitting selection . referring now to table 1 which is a function matrix for the airborne navigation system , the operation of the panel functions included are as follows . with the function controller 18 in the &# 34 ; f &# 34 ; ( frequency ) position a channel frequency is entered into the appropriate display blank by pressing the appropriate numerals as follows : the leading &# 34 ; 1 &# 34 ; is pressed and a one appears as the first digit with zero appearing in the remainder of the display blanks . the zeros for the digit blink successively to indicate the position for the next digit to be entered . if a mistake is made in a display blank , the &# 34 ; back &# 34 ; key is pressed to back to the display blank in error for entering the correct digit ; thus alleviating the need to recycle the frequency . the frequency entering mode can be exited at any time by pressing the store &# 34 ; sto &# 34 ; key . after entering the frequency , which appears in the standby display the transfer key &# 34 ;←→&# 34 ; is either pressed to sway the contents of the active and standby displays or the store &# 34 ; sto &# 34 ; key pressed followed by pressing one of the &# 34 ; 0 &# 34 ; to &# 34 ; 9 &# 34 ; keys for a selected memory location . this procedure is repeated for storing up to ten frequencies at ten memory locations . the channel frequency stored in locations 0 - 9 may be recalled into the standby display by pressing the recall &# 34 ; rcl &# 34 ; key and the number ( 0 - 9 ) of the desired frequency location . if the &# 34 ; 0 &# 34 ; ( scan ) key is pressed ( without a prior command ) the memory location addressed by an internal pointer will be displayed for 0 . 5 seconds and the frequency stored at that location displayed in the standby display . the internal pointer will then be incremented by one . repetitively pressing the &# 34 ; 0 &# 34 ; ( scan ) will recall the station frequencies stored in locations 0 - 9 in a consecutive manner ( loop ). the internal pointer is automatically set to location &# 34 ; 0 &# 34 ; at power up . upon use of the channel storage or recall functions the pointer is set to the particular location used . with the function controller in the to / from ( t / f ) position the active display shows the channel frequency and the standby display at power up displays the bearing from the station to the aircraft . the &# 34 ; fr &# 34 ; indicator preceding the bearing display is illuminated . to display the bearing to &# 34 ; to &# 34 ; the station from the aircraft the transfer &# 34 ;←→&# 34 ; key is pressed . in this situation , the bearing is preceeded by the &# 34 ; to &# 34 ; indicator which is illuminated . in mode &# 34 ; t / f &# 34 ; frequency entry and memory operations can be conducted as described for mode &# 34 ; f &# 34 ; except that these functions operate directly on the active frequency . the bearing display is blanked and the receiver disabled during frequency entry . when a localizer channel has been selected as the active frequency , the bearing display remains blanked and the &# 34 ; to &# 34 ;/&# 34 ; from &# 34 ; indicators are not illuminated . with the controller in the clock &# 34 ; clk &# 34 ; mode , the active display shows the active channel frequency . the standby display shows the elapsed time in minutes and seconds . the time is reset to zero by pressing the transfer &# 34 ;←→&# 34 ; key . this &# 34 ; stop watch &# 34 ; feature is useful in executing timed approaches and timed turns . frequency entry is the same as in the mode &# 34 ; f &# 34 ; position except that functions operate directly on the active frequency . the receiver is disabled during the frequency entry ; the clock timer display is not disturbed . finally , in the dead reckoning computer &# 34 ; d &# 34 ; mode , the unit is used as a calculator to continuously display distance and time remaining to a desired way point . the distance to a way point and expected ground speed are entered , respectively , into the active and standby displays using the press keys 0 - 9 . thereafter , the unit calculates the distance and time remaining assuming a straight line course at the entered ground speed . the operation of the communication ( com ) transceiver panel where possible is identical to that of the vor / loc receiver system . thus the procedures are identical when the system is in the standby mode ; when the system is in the &# 34 ; active &# 34 ; mode the frequency in the active display may be changed directly , during which time the standby display is blanked . also the &# 34 ; 0 &# 34 ; numbered key is reserved for the emergency channel frequency ( 121 . 5 mhz ) and the communication unit function controller does not have the clock position or the distance / time position . further the push / pull knob 32 selectively enables or disables the audio squelch circuitry in the communication system . examples of the various operations of the nav . and com . units are set forth in the following tables 1 , 2 , 3 , 4a , 4b , 5a , 5b , and 6a , 6b , 6c , 7 , 8a , 8b , 9a and 9b . table 1__________________________________________________________________________function matrixfunction sw display content key functionposition left right mode ←→ sto rcl__________________________________________________________________________1 frequency freq freq entry toggle ( freq ) enter ( freq ) back display toggle ( freq ) store ( freq ) recall ( freq ) 2 to / from freq bang / radial display toggle ( to / fr ) inop inop3 clock freq elapsed time display reset ( clock ) inop inop4 dist / ete leg dist ground speed entry start → disp inop back dist rem est time enr display stop → entry inop inop__________________________________________________________________________ table 2______________________________________freq entry with correction using back key : key second functionpress back / enter______________________________________ 119 . 00 119 . 50 ## str1 ## 119 . 00 100 . 00 ## str2 ## 119 . 00 120 . 00 ## str3 ## 119 . 00 123 . 00 ## str4 ## 119 . 00 120 . 00 ## str5 ## 119 . 00 121 . 00 ## str6 ## 119 . 00 121 . 00______________________________________ table 3______________________________________freq entry with transfer to active windowkey second functionpress back / enter______________________________________ 119 .. 0 .. 0 . 119 . 5 . 0 . ## str7 ## 119 .. 0 .. 0 . 1 . 0 .. 0 ... 0 .. 0 . ## str8 ## 119 .. 0 .. 0 . 12 . 0 ... 0 .. 0 . ## str9 ## 119 .. 0 .. 0 . 121 .. 0 .. 0 . ## str10 ## 121 .. 0 .. 0 . 119 .. 0 .. 0 . ______________________________________ table 4a______________________________________store standby freq in specified memory : key second functionpress back / enter______________________________________ 119 . 00121 . 00 ## str11 ## 119 . 00x * ## str12 ## 119 . 00 5 119 . 00121 . 00 ( after . 5 sec ) ______________________________________ * preceeding channel . table 4b______________________________________enter standby freq & amp ; storein specified memory : key second functionpress back / enter______________________________________ 119 . 00119 . 50 ## str13 ## 119 . 00100 . 00 ## str14 ## 119 . 00120 . 00 ## str15 ## 119 . 00121 . 00 ## str16 ## 119 . 00121 . 00 ## str17 ## 119 . 00x * ## str18 ## 119 . 00 5 119 . 00121 . 00 ( after . 5 sec ) ______________________________________ preceeding channel . table 5a______________________________________recall of freq from memory withtransfer to active window : key second functionpress back / enter______________________________________ 119 .. 0 .. 0 . 119 . 5 . 0 . ## str19 ## 119 .. 0 .. 0 . x * ## str20 ## 119 .. 0 .. 0 . 3 119 .. 0 .. 0 . 121 .. 0 .. 0 . ( after . 5 sec ) ## str21 ## 121 .. 0 .. 0 . 119 .. 0 .. 0 . ______________________________________ * preceeding channel . table 5b______________________________________recall of freq from memorywhile in freq entry mode : key second functionpress back / enter______________________________________ 119 . 00119 . 50 ## str22 ## 119 . 00100 . 00 ## str23 ## 119 . 00120 . 00 ## str24 ## 119 . 00120 . 00 ## str25 ## 119 . 00x * ## str26 ## 119 . 00 3 119 . 00121 . 00 ( after . 5 sec ) ______________________________________ * preceeding channel . table 6a______________________________________to / from position ( 2 t / f ); navactive position ( act ); comfreq entry : key second functionpress back / enter______________________________________ freq . brg . 117 . 50 to 359 ## str27 ## 100 . 00 ## str28 ## 110 . 00 ## str29 ## 114 . 00 ## str30 ## 114 . 30 ## str31 ## 114 . 30 to 020______________________________________ table 6b______________________________________to / from toggle ( nav only ) key second functionpress back / enter______________________________________ 114 . 3 . 0 . to . 0 . 2 . 0 . ## str32 ## 114 . 3 . 0 . fr 2 . 0 .. 0 . ______________________________________ table 6c______________________________________to / from position ( t / f ); navactive position ( act ); comrecall of freq from memory intoactive window with abortkey second functionpress back / enter______________________________________ 114 . 3 . 0 . to . 0 . 2 . 0 . ## str33 ## x cycle 114 . 3 . 0 . to . 0 . 2 . 0 . mode sw______________________________________ reverts to previous display after 5 secs . table 7______________________________________clock position ( ck ); nav onlyclock timer operationkey second functionpress back / enter______________________________________ 114 . 3 . 0 . 7 . 0 . : 59 ## str34 ## 114 . 3 . 0 . . 0 .:. 0 .. 0 . ______________________________________ note : ## str35 ## 2 . changing mode switch does not affect timer . table 8a______________________________________distance / time position ( d ); nav onlyinitial entry : key second functionpress back / enter______________________________________ naut / miles knots / hr . ## str36 ## tk 000 ## str37 ## 000 mn tk 000 ## str38 ## 100 mn tk 000 ## str39 ## 110 mn tk 000 ## str40 ## 110 mn tk 000 ## str41 ## 110 mn tk 100 ## str42 ## 110 mn tk 180 ## str43 ## 110 mn 0 : 37______________________________________ table 8b______________________________________toggle to check speedkey second functionpress back / enter______________________________________ ## str44 ## . 0 . : 35 ## str45 ## 1 . 0 . 4 mn tk 18 . 0 . ## str46 ## 1 . 0 . 3 mn . 0 . : 35______________________________________ table 9a______________________________________2nd pass entry dist only : dist rem above 99 : key second functionpress back / enter______________________________________ ## str47 ## . 0 . : 35 ## str48 ## 1 . 0 . 4 mn tk 18 . 0 . ## str49 ## 1 . 0 .. 0 . mn tk 18 . 0 . ## str50 ## 11 . 0 . mn tk 18 . 0 . ## str51 ## 115 mn tk 18 . 0 . ## str52 ## 115 mn . 0 . : 38______________________________________ table 9b______________________________________2nd pass entry dist 69 ; dist rem below 99 : key second functionpress back / enter______________________________________ ## str53 ## . 0 . : 32 ## str54 ## 95 mn tk 18 . 0 . ## str55 ## 8 . 0 . mn tk 18 . 0 . ## str56 ## 85 mn tk 18 . 0 . ## str57 ## 85 mn tk 2 . 0 .. 0 . ## str58 ## 85 mn tk 24 . 0 . ## str59 ## 85 mn . 0 . : 21______________________________________ referring now to fig3 a - 3f for a description of the vor / loc receiver unit , an antenna 42 ( fig3 a ) receives rf signals for the vor / loc receiver . the receiver amplifies and demodulates the rf carrier to provide audio to the voice circuits ( also morse code signals ) ( fig3 a and 3b ) and navigational data to a vor / loc converter ( fig3 d - 3f ). varactor tuning is used for the receiver rf circuits and the channel frequencies are determined and controlled by the data processor . ( fig3 a and 3c ). the preselector 44 ( fig3 a ) is continuously tuned by the lpe 78 to pass frequencies near a selected channel frequency between 108 . 000 to 117 . 950 mhz with 50 khz spacing to the rf amplifier 46 which receives agc from feedback lead 48 . lead 48 is connected to an rf / agc amplifier 50 ( fig3 b ) which has its input connected to an if / agc amplifier 52 . if agc amplifier 52 is connected to the output of am detector 54 , the rf amplifier 46 ( fig3 a ) has its gain controlled by the rfagc amplifier 50 . the output of the rf amplifier 46 ( fig3 a ) is connected to a postselector 56 for further removing any signals other than those near the desired channel . the output of the postselector 56 is connected to a first mixer 58 . the function of the first mixer 58 is to act as a first intermediate frequency converter . the first mixer 58 may be , for example , a dual gate mos - fet . the rf input to the mixer is beat with the signal from local oscillator amplifier &# 39 ; s 60 output that is connected to the second input of the mixer . the input to the lo amplifier 60 is the voltage controlled oscillator output of a frequency synthesizer . the frequency synthesizer is comprised of a vco buffer 62 having its output connected to the lo amplifier 60 and a prescaler buffer 64 in the divide by n counter feedback path . prescaler buffer 64 is connected to a divide by 40 / 41 prescaler 66 of the divide - by n counter which also includes an ab counter 68 and a programmable phase - locked loop ic . a loop phase detector 70 input is connected to the ab counter 68 and to a divide by 256 divider 72 for its reference frequency output . the divide by 256 divider 72 is connected to a crystal oscillator 74 and divides the output of the crystal oscillator 74 to provide a stable 25 khz reference signal to the phase detector 70 for comparison with the divide by n counter frequency . the phase detector 70 and lpf 78 produce an error voltage that is proportional to the phase difference between the reference and input frequency . the lpf 78 input is amplified in amplifier 76 and its output applied to a voltage controlled oscillator ( vco ) 80 and the preselector 44 and postselector 56 for tuning . the applied voltage to the vco 80 is polarized to bring the input frequency at the phase detector 70 in agreement with the reference frequency . the phase detector 70 , lpf 78 and vco 80 make up the forward path of the loop , while the divide by n counter ( amplifier 64 , divide by 40 / 41 prescaler 66 , and ab counter 68 ) constitute the feedback path . a data processor 82 ( fig3 c ) provides the digital word for the selected frequency to the ab counter as follows . the data processor ( fig3 c ) includes , for example , the microprocessor 82 which determines the necessary 19 bit code that programs the vor / loc frequency synthesizer . this code is for any of the local oscillator frequencies covering 40 . 20 to 100 . 15 mhz in 50 khz intervals ; these frequencies correspond to the nav frequencies of 108 . 00 mhz to 117 . 95 mhz . the microprocessor 82 is connected to a keyboard strobing latch 84 which monitors the keyboard panel 14 ( fig1 ). the microprocessor 82 ( fig3 c ) is connected to an anode counter ( digit select ) 86 . anode counter 86 continuously counts eight digits in a preselected sequence , e . g . 1 , 3 , 5 , 7 , 2 , 4 , 6 , 8 . the anode counter is connected to an anode driver 88 which is connected to the anodes of eight segments of each of the eight digits of displays 28 and 30 of digital display 26 to supply a high anode voltage to the digits in sequence . the microprocessor 82 is also connected to a display decoder / latch 90 for decoding binary to binary coded decimal ( bcd ) words for digit segment selection . the display decoder / latch 90 is connected to a cathode driver 92 . cathode driver 92 is connected to the segment cathodes of the display digits to sink the cathode current of the segments selected by the microprocessor 82 to be time coincident with a particular digit counted by the anode counter 86 to display the selected frequency numbers . all outputs consist of switchable and programmable current sinks which provide current to the cathodes . a segment line that is turned on will not sink any current unless there is an anode voltage . it will be recalled that the first digit is always a &# 34 ; 1 &# 34 ; in both the active and standby displays , thus the counters eight counts are for digits 2 - 5 of eacy display . a digit dimming control 94 is connected to the display decoder / latch 90 for controlling the brightness of the display 26 . in addition the microprocessor 82 is connected to a nonvolatile earom ( electrically alterable read only memory ) interface 96 which is connected to earom 98 and delays microprocessor 82 access to the nonvolatile earom 98 at turn on until power up . this is essential to the proper location of information stored in the memory . the data representing selected active and standby channel frequencies are stored in earom 98 . also the microprocessor 82 is connected to the function switch 18 . the function controller 18 controls the operation mode of the microprocessor . to provide a remote dme , dme lines 100 are connected to a dme driver 102 . also the microprocessor 82 can be remotely controlled through a hybrid filter 103 connected to a remote control switch not shown . the microprocessor 82 is connected by leads 104 , 106 , and 108 , respectively , to the clock , data and strobe terminals of a shift register / latch 110 ( fig3 a ). the shift register latch 110 is connected to the ab counter 68 and controls the ab counter of the frequency synthesizer ; control is in response to the selected channel frequency data word it receives at its data terminal through lead 106 from the microprocessor 82 . returning now to the first mixer 58 , the first mixer is connected to crystal filter 112 . the output of the first mixer 58 of the first if stage is filtered in crystal filter 112 . crystal filter 112 is connected to amplifier 114 to amplify the filtered signal to a working level . amplifier 114 is connected by lead 116 to a second mixer 118 ( fig3 b ). mixer 118 is also connected to a second local oscillator 120 . the mixer 118 beats the frequency of the first if stage with the frequency of the local oscillator 120 to provide the standard 455 khz if signal . the mixer 118 is connected to a ceramic filter 122 to remove any unwanted signals . the ceramic filter 122 is connected to a first if amplifier 124 . the if amplifier 124 is connected to a second if amplifier 126 . the first and second if amplifiers are connected to the if agc amplifier 52 . as agc is applied the output is stabilized at a preset level as a positive going agc voltage reduces the gain of the if amplifiers . am detector &# 39 ; s 54 input is connected to the amplifier 126 and the nav receiver output is applied to the navigation system audio and vor / loc buffer circuits . the audio circuit includes elements connected in series as follows : an audio amplifier 128 , a high pass filter 130 , an identification filter including a bandpass filter 132 and switch 134 , a summer 136 , an amplifier 138 , a low pass filter ( passive ) 140 , low pass filter 142 ( active ), volume control 144 , audio amplifier 146 and current limiter 148 . when the identification switch 134 is closed the bandpass filter 132 provides a 1020 hz filtered signal to the summer and when open the audio signal from the hp filter 130 is applied through lead 150 to the summer 136 and the identification filter is bypassed . with the switch closed the 1020 hz morse code identification is subtracted from the audio signal leaving only the voice information . the audio signal , amplified to a working level by amplifier 138 , is filtered in the passive and active low pass filters 140 and 142 to eliminate undesired noise . the wiper arm of volume control 144 is connected to the audio amplifier 146 . the audio amplifier 146 output is current limited in current limiter 148 and applied to an audio transformer 152 of the power stage which supplies the large current variations necessary to drive a headphone ( not shown ). the vor / loc converter circuits convert the navigation information obtained from the receiver detector into data suitable for display on the l - r ( left / right ) deviation meter and to / from flag of the auxiliary display . the am detector 54 ( fig3 ) is connected by lead 154 to a vor / loc signal buffer 156 ( fig3 d ) which amplifies the detector signal ( hereinafter referred to as the vor / loc signal ) to a working level . the vor / loc signal is applied to a nav composite output 157 , reference channel , a variable channel and a pair of localizer channels . the vor signal includes a 9960 hz carrier that is frequency modulated at a 30 hz rate and amplitude modulated by a 30 hz signal . the 9960 hz fm signal is for the reference channel and the 30 hz signal is for the variable signal . the localizer ( loc ) signal consists of 150 hz and 90 hz signals . in the reference channel the vor signal is applied to a 9960 hz bandpass filter 158 which strips the 30 hz portion from the composite signal . a limiter 160 connected to the filter 158 and a phase locked loop used as a discriminator 162 connected to the limiter provides a 30 hz demodulated signal . a 30 hz bandpass filter 164 connected to the discriminator 162 strips any excess noise from the signal . a phase adjuster 165 is connected to the junction of bp filter 164 and a vor fault detector 186 by lead 192 &# 39 ;. the phase adjuster 165 is for adjusting any imbalance in phase shift between the reference and variable channels . a phase locked loop 166 is connected to the phase adjuster 165 for converting the 30 hz reference sine wave to a 30 hz reference square wave . a filter 167 is connected to the junction of a phase locked loop 166 for converting the 30 hz square wave output to a 30 hz sine wave output for a resolver 169 and lead 180 to a 30 hz square wave selector 182 ( fig3 c ). filter 167 ( fig3 d ) is connected by lead 168 to the rotor of a resolver 169 ( fig3 e ). the resolver 169 shifts the phase , as measured from the rotor signal , from 0 degrees to 360 degrees . the exact phase shift is set as the course knob is rotated to set the course . an amplifier 170 with gain adjust is connected to the resolver 169 and a variable phase shifter 172 with phase adjust is connected to the amplifier 170 to correct the gain and the phase for the fixed phase offsets inherent in the system . the phase shifter 172 is connected to a 90 degree phase shifter 174 and a phase detector 176 . the 90 degree phase shifter 174 ( fig3 e ) is connected to phase detector 188 ( fig3 e ). phase detector 188 and phase detector 176 receive as inputs a 30 hz signal from the 30 hz variable channel as follows . the 30 hz variable channel includes a 30 hz bandpass filter 190 ( fig3 d ) connected to the vor / loc buffer 156 . the filter 190 is connected to the junction of fault detector 186 and lead 192 . lead 192 connects the filter 190 to a phase locked loop 194 ( fig3 e ). phase locked loop 194 converts the 30 hz variable signal from a sine wave into a 30 hz square wave . the phased locked loop 194 is connected by lead 196 to the 30 hz square wave select circuit 182 ( fig3 c ) and to the phase detectors 188 and 176 ( fig3 e ) to provide the squared 30 hz variable signal as previously mentioned . in phase detector 188 , the 30 hz reference phase signal is summed with the 30 hz variable phase and compared to a reference voltage . the difference signal is amplified in amplifier 198 to provide a to / from indicating signal -- a negative voltage indicates a to bearing and a positive voltage a from ( radial ) bearing . phase detector 176 is connected as a switching integrator amplifier and produces from the 30 hz reference frequency and 30 hz variable frequency an error voltage when the signals differ in phase . when in phase no error signal is produced and a reference voltage is produced ; a negative change indicates the aircraft is to the left of the course and a positive change indicates the aircraft is to the right of the course . the phase detector 176 is connected to a vor filter 200 for removing any ac signals . the vor filter 200 is connected by lead 202 to a vor / loc channel select switch 204 ( fig3 f ). the vor / loc channel select switch 204 is connected to an amplifier 206 to restore the l / r signal to a working level . amplifier 206 is connected to low pass filters 208 and 210 . low pass filter 208 is connected to buffer 212 to provide a working level right / left course deviation indicating signal for an aircraft cdi instrument . while low pass filter 210 is connected to a buffer 214 and switch 216 . buffer 214 provides a working level right / left course deviation indicating signal for an auto - pilot . while switch 216 has its pole controlled by lead 218 to a warning flag driver 220 ( fig3 e ). one pole of switch 216 is connected to a reference voltage 222 and the other pole to a course deviation indicator return to apply the reference voltage to the cdi return line and autopilot when the switch 216 is closed . the localizer circuits include a 150 hz channel and a 90 hz channel ( fig3 d ). the 150 hz channel and 90 hz channel include , respectively , a 150 hz bandpass filter 222 and a 90 hz bandpass filter 224 connected to the vor / loc buffer 156 for filtering the loc signal . the filters ( 222 and 224 ) 150 hz and 90 hz outputs are biased to a reference voltage (+ 41 / 2 v ) applied to their non - inverting (+) inputs . the filters 222 and 224 are connected to a loc fault detector 226 , and respectively , to rectifying diodes 228 and 230 . diode 228 is connected to one end of a loc zero potentiometer 232 to provide a positive half wave rectified signal and diode 230 is connected to the other end of potentiometer 232 to provide a negative half wave output . the wiper arm picks the average of the two signals from the potentiometer . the arm is connected by lead 234 to a loc course width adjust potentiometer 236 ( fig3 f ). the course width adjust potentiometer 236 is connected to the vor / loc channel switch 204 for processing through the right / left course deviation indicating signal circuitry previously described for the vor right / left course deviation indicating signals . the loc fault detector 226 ( fig3 d ) and the vor fault detector 186 amplifier outputs are connected , respectively , by leads 238 and 240 to a wired or gate ( fig3 d ). the or output is connected to the warning flag driver 220 and to lead 244 . lead 244 is connected to the nav fault terminal of microprocessor 82 ( fig3 c ). finally , the microprocessor 82 ( fig3 c ) has a vor / loc indicating terminal connected to lead 246 to a vor / loc driver 248 ( fig3 f ). the vor / loc driver 248 is also connected to the vor / loc switch 204 and to lead 250 to provide vor / loc channel selection signals , respectively , to the vor / loc switch 204 and to an external output for vor / loc channel selection by the navigator . referring now to fig4 a - 4e for a description of the communication transceiver , the front panel press keys 16 , 20 , 22 , and 24 ( fig2 ) comprise the keyboard 252 ( fig4 e ). the keyboard 252 is connected to the keyboard strobing latch 84 which continuously monitors the keyboard keys for entries for the controller ( microprocessor 82 ). both the active and standby channel frequencies and reference numbers are stored by the controller 82 through the interface 96 into the nonvolatile earom 98 . the function controller 18 sets the controller to the active or standby mode of operation . the controller 82 has a receive and a transmit terminal . the receive terminal is connected by lead 254 to digital switches 256 and 258 in a receiver control section 261 ; while , the transmit terminal is connected by lead 260 to a digital switch 262 located in the transmitter circuit . insofar as the receiver elements of the communication transceiver are identical to those of the vor receiver previously described , they will be grouped into subsystems shown in dashed lines on the drawing . the antenna 42 ( fig4 d ) is connected to a bandpass filter 264 for removing any unwanted frequencies ( frequencies outside the bandpass ) from the received or transmitted signals . the bandpass filter 264 is connected by leads 266 and 268 , respectively , to the output of the transmitter circuit ( fig4 e ) and input of the receiver circuit ( fig4 a ). the receiver circuit comprises an rf stage 270 connected to a first mixer stage 272 . the rf amplifier amplifies the signals of the bandwidth filter to a working level and applies them to the first mixer stage . the first mixer stage is connected by lead 274 to a local oscillator 276 ( fig4 b ). the local oscillator is tuned by a controller controlled programmable frequency synthesizer 278 to put out a signal at a frequency that is above the rf frequency by a fixed difference for every channel at 25 hz interval . the local oscillator output is mixed with the rf carrier in the first mixer stage 272 ( fig2 a ). the fixed frequency difference is the first if output of the first mixer . a first if amplifier stage 280 is connected to a first mixer stage for amplifying the first if output of the first mixer . a second mixer stage 282 is connected to the first if stage amplifier output to reduce the if frequency to the second if of 455 khz . a second if stage 284 is connected to the second mixer stage for amplifying the second if output of the second mixer stage . a detector stage 286 ( fig4 a and 4b ) is connected to the second if stage for separating the audio from the rf component . the receiver control 261 ( fig4 c ) has its digital switch 258 connected by lead 287 to the audio output of the detector stage 286 . digital switch 258 has its output connected to a summer 288 where the audio is summed with any auxillary input such as , for example , a second receiver , applied through attenuate - by - 11 attenuator 290 and digital switch 256 . an amplifier 292 is connected to the summer 288 to restore the summer &# 39 ; s output to a working level . an audio amplifier stage 294 ( fig4 c and 4d ) is connected to the amplifier 292 of the receiver control 261 for providing audio signals to a speaker . the audio amplifier 294 includes a summing network 295 ( fig4 c ) of adders a , b , and c for producing a constant output voltage from the adders a , b , and c for , respectively , a headset transmitter hearing circuit , the receiver circuit , and the microphone bias circuit . referring to fig4 c , lead 296 connects a push - to - talk microphone ( not shown ) to a microphone bias circuit 298 . a summer 300 is connected to the bias circuit and to an agc circuit 302 . an amplifier 303 is connected to the summer 300 and to a compression level set circuit 304 . the amplifier 303 is connected to the circuit control digital switch 262 . switch 262 is also connected by lead 263 to the local oscillator 276 ( fig4 b ) for receiving the carrier frequency of the selected transmitter channel for modulation with the audio frequency output of amplifier 303 . an amplifier 306 is connected to the digital switch 262 and to an rf power level set circuit 308 . a low pass filter 310 is attached to the amplifier 306 to filter the rf carrier modulated signal . a modulator driver 312 is connected to filter 310 and a sidetone adjust potentiometer 314 whose arm is connected to the audio amplifier for adjusting the volume of the transmission being monitored through the receiver headset . the modulator driver 312 is connected by lead 314 to the agc circuit 302 for feedback to summer 300 , output stage 316 ( fig4 e ) and diode 318 . diode 318 is connected to a driver stage 320 . the driver stage 320 is connected to predriver stages which include a first stage predriver 322 connected to the controller &# 39 ; s transmit terminal and a second stage predriver 324 connected to the first stage predriver stage 322 and a reference voltage . the second predriver stage 324 is connected to the driver stage 320 . the output stage 316 is connected to lead 260 to the controller &# 39 ; s transmit control terminal , to a diode 326 for cutting off the output stage 316 to the antenna during receive and by lead 266 to the bandpass filter 264 for transmission of the modulated signal by antenna 42 . referring now to fig5 when the vor / loc navigation receiver and communication transceiver are turned on the systems are powered up 328 and a power up self - test 330 performed . the system is then initialized 332 . after initialization , the computer checks the input lines 334 including those from the keyboard strobing latch and makes a decision 336 whether any change has been made . if no , the input lines are continuously checked for change ( 334 . 336 ); if yes , a decision 338 is made whether an active frequency is to be modified . if yes , the audio is turned off 340 . if no , the turn off frequency instruction is by - passed and the following inputs monitored for instructions as follows : function switch distance / time ( d / t ) mode 342 ( d switch 18 ), transfer frequency 344 from standby to active and vice versa (←→ key 24 ), recall frequency 346 ( key rcl 22 ), memory scan 348 (&# 34 ; 0 &# 34 ; key 16 ), standby frequency modification 350 (&# 34 ; 1 &# 34 ; key 16 ), store frequency 352 (&# 34 ; sto &# 34 ; key 20 ), push - to - talk 354 ( microphone ), frequency increase / decrease 356 ( remote control ), clock mode 358 ( function switch 18 ck position ) and bearing mode 360 ( t / f switch 18 ). after frequency selection or change a key check , an instruction 362 to send frequency and turn on audio is issued which is followed by an instruction 364 to update the earom . although a preferred embodiment of the present invention has been described in detail , it is to be understood that various changes and substitutions and alterations can be made therein without departing from the scope of the invention as defined by the appended claims .	7
the following is the detailed description of the present invention with reference to the drawings as an embodiment of a one component magnetic developer . fig1 shows an illustrative view showing how a white streak is caused . wherein , the space between the circumferential surface of a developing sleeve 1 as a developer transport member , and a doctor blade 2 as developer layer thickness regulating member is uniformly maintained at the distance of the order of 0 . 2 mm to 0 . 5 mm . said space is quite narrower than that in the case of using a two - component developer . on the other hand , a one - component developer is apt to be coagulated and be much the more in the case of high temperature and humidity . if coagulation of developers happen , a coagulated developer hitch in the space between the developing sleeve 1 and the doctor blade 2 and supplying of the developer is stopped at the hitched place to cause a white streak . if a development was made as the toner was on the circumferential surface of the developing sleeve 1 in such a state as described above , a density unevenness causes therefrom on an image . with the purpose of eliminating such a trouble , there have been proposed the developing means in which a member for cleaning the doctor blade 2 is provided , and methods in which coagulation of a developer is prevented from occurring or in which coagulated developer is destroyed , however there cannot be found any definite measure to eliminate them . the present invention is so devised as to have a magnetic flux distribution of which the peaks are of the homopolar , by arranging such homopolar magnets inside but adjacent to nonmagnetic developing sleeve 1 as shown in fig2 . when the homopolar magnets are arranged adjacent to the developing sleeve 1 as shown in fig2 the magnetic force distribution thereof makes such a curve as shown in fig3 . when the developing sleeve 1 stands still , developers form two peaks because of the force corresponding to the gradient of the magnetic field and forms a portion where no developer exists , between the peaks . while the developing sleeve 1 is being moved , developers are distributed according to the changes of the magnetic field strength , however , ears of the developer are low in density between the peaks of the magnetic field strength and they will become in a mobile state according to the magnetic field . in the case that a white streak is caused on the circumferential surface of the developing sleeve 1 , the magnetic field around the white streak will have an inclination . when the developer layer on which there caused a white streak of the developer is put in a magnetic field as shown in fig2 and fig3 the developer are mobile according to the inclination of the magnetic field at the place where said developers are liable to be mobile according to the changes of said magnetic field , so that said white streak is buried with developers so as to make the developer layer even . thus , such a white streak is thereby disappeared after the magnetic field in question passed on . the present invention was so devised as to arrange such a special magnetic field as described above between the doctor blade 2 and the development area and as to make a white streak caused by the doctor blade 2 disappear before it reaches the development area . in the magnetic flux distribution shown in fig3 it is required to set the minimum value to the values of two peaks at a rate between 20 % and 95 % and in accordance with the experiments the best result was obtained at the rate of the order of 70 %. fig4 illustrates an example of the present invention , wherein the numeral 1 is a non - magnetic cylindrical developing sleeve which revolves in the direction of an arrow . the diameter thereof was 30 mmφ and the rate of revolutions was at 300 r . p . m . numeral 2 is a doctor blade for regulating a thickness of the developer layer and the space between the circumferential surface of said developing sleeve 1 and said doctor blade 2 was maintained so as to be 0 . 2 mm . inside a developer supply hopper 3 , there were stored insulated one component magnetic developer which comprises a resin and 50 wt % of a magnetite being dispersed into the resin so as to be supplied to the sleeve . numeral 4 is an electrophotosensitive drum vacuum - evaporated a selenium as an image forming member in which the space between said drum and the cylindrical developing sleeve 1 was kept so as to be 0 . 3 mm to form development area a . inside said cylindrical developing sleeve 1 , there arranged the fixed permanent magnets , and in the development are there arranged main magnet of the s - pole , and further there arranged magnets 6 for developer transport in other positions . each of permanent magnets 7a and 7b of the n - pole was arranged so that the angle θ made to the center of the sleeve can be 15 ° ( θ = 15 °). the magnetic flux density thereof was 600 gauss on the cylindrical developing sleeve 1 . the magnetic flux density of these permanent magnets 7a , 7b are preferable to be 400 - 1000 gauss respectively , and as long as they are homopolar and within the said range said two pieces of the magnets 7a , 7b can well stand even if there is any difference of the magnetic force between them . whenever they have such constitution as mentioned above , the minimum value of the magnetic flux density taken between the two pieces of magnet 7a , 7b is within the range of 20 %- 95 % on the cylindrical developing sleeve 1 . the insulated one component magnetic developer having come out from toner supply hopper 3 was forming a developer layer on the surface of the cylindrical developing sleeve 1 and said developer layer was transported on said sleeve 1 . the thickness of the developer layer was regulated by the doctor blade 2 to be transported to development area a passing on magnet series 7 in the state adhered over to the cylindrical developing sleeve 1 , and the ears of the developer developed a latent image on the electrophotosensitive drum 4 . in the case that coagulated developer was produced in the portion of doctor blade 2 on the cylindrical developing sleeve 1 , a white streak was also buried with developer while said streaked portion passed on magnet series 7 by the abovementioned effect to disappear before it reached development area a , and thus the density unevenness was eliminated on the image . as described of the example above , whenever the present invention is applied , it is possible to eliminate any unevenness of a developer layer such as a white streak caused on a cylindrical developing sleeve to obtain an excellent image without any density unevenness , so that the maintenance cycles can be prolonged . by the way , the present invention is not to destroy or to remove such a coagulated developer causing a white streak , and accordingly it is of course effective to provide a member for cleaning a doctor blade or to provide a member for destroying such coagulated developer , jointly with the use of the means of the present invention . every developer to be used in the invention contains preferable not less than 10 wt % of magnetite and 50 - 60 wt % thereof were the most effective to use . and , as for a developer transport member of the present invention besides a cylindrical developing sleeve , a belt and the like can also be used for , and as for a member for regulating the thickness of developer layer besides a doctor blade , a member for regulating the thickness by means of a roller or the like is of course included therein .	6
a method for fabricating a tft using a crystal silicon film obtained by crystallizing an amorphous silicon film using a plurality of island nickel films formed on coning 7059 glass substrate as starting points will be described in the present embodiment . there are two methods for forming the island nickel films depending on whether it is formed on or under the amorphous silicon film . fig2 ( a - 1 ) shows the method wherein it is formed under the film and fig2 ( a - 2 ) shows the method wherein it is formed on the film . what must be careful especially about the later is that because nickel is selectively etched after forming it on the whole surface of the amorphous silicon film in the process , nickel and amorphous silicon react each other and produce nickel silicide , though it is a small amount . because a good crystalline silicon film which the present invention aims for cannot be obtained if this nickel silicide remains as it is , it is necessary to remove this nickel silicide fully by hydrochloric acid or hydrofluoric acid . due to that , the amorphous silicon is thinned down from the initial state . on the other hand , although no such problem is caused in the case of the former , it is desirable to completely remove the nickel film other than that of the island portion 2 by etching also in this case . the influence of the residual nickel may be suppressed by oxidizing nickel other than that of the island region by treating the substrate by oxygen plasma or ozone . in either of the cases , a ground silicon oxide film 1 b with a thickness of 2000 angstrom was formed on a substrate 1 a ( coning 7059 ) by a plasma cvd method . the amorphous silicon film 1 was fabricated by a plasma cvd method or vacuum cvd method with a thickness of 200 to 3000 angstrom or preferably 500 to 1500 angstrom . the amorphous silicon film was readily crystallized after removing hydrogen by annealing 0 . 1 to 2 hours at 350 to 450 ° c . to keep the hydrogen concentration within the film to less than 5 atomic percent . in the case of fig2 ( a - 1 ), the nickel film was accumulated up to a thickness of 50 to 1000 angstrom or preferably to 100 to 500 angstrom by sputtering and was patterned to form the island nickel regions 2 before forming the amorphous silicon film 1 . in the case of fig2 ( a - 2 ) on the other hand , the nickel film was accumulated up to 50 to 1000 angstrom or preferably to 100 to 500 angstrom by sputtering and was patterned to form the island nickel regions 2 after forming the amorphous silicon film 1 . fig1 ( a ) shows this state seen from above . each of the island nickel is a square with a side of 2 micron and an interval therebetween was set at 5 to 50 micron or 20 micron for example . a similar effect may be obtained by using nickel silicide instead of nickel . a good result could be obtained when the substrate was heated up to 100 to 500 ° c . or preferably to 180 to 250 ° c . when the nickel was to be formed . it is because an adhesion of the ground silicon oxide film with the nickel film is improved and because nickel silicide is produced by the reaction of silicon oxide and nickel . the same effect can be obtained by using silicon nitride , silicon carbide or silicon instead of silicon oxide . it was then annealed in a nitrogen atmosphere for 8 hours at 450 to 580 ° c . or at 550 ° c . for example . this annealing may be carried out in a mixed atmosphere of nitrogen and hydrogen . or this annealing may be carried out in a hydrogen atmosphere for x 1 hours and then in a nitrogen atmosphere for x 2 hours . fig2 ( b ) shows the intermediate state of this process wherein nickel advance from the island nickel regions 2 near the edge to the center as nickel silicide 3 a and portions 3 where nickel had passed have become crystal silicon . then as shown in fig2 ( c ), the crystallizations which started from the two island nickel films hit and the nickel silicide 3 a remains in the middle , thereby ending the crystallization . fig1 ( b ) shows the substrate in this state seen from above , wherein the nickel silicide 3 a in fig2 ( c ) is an intercrystalline boundary 4 . when the annealing is continued , nickel moves along the intercrystalline boundary 4 and gathers an intermediate region 5 of those island nickel regions ( though their original shape is not kept in this state ). crystal silicon can be obtained by the aforementioned process , but it is not desirable for nickel to diffuse within the semiconductor coating film from the nickel silicide 3 a produced at this time . accordingly , it is desirable to eliminate the region where nickel is highly concentrated by etching by hydrofluoric acid or hydrochloric acid . by the way , because an etching rate of the nickel and nickel silicide is fully large , the silicon film is not affected in the etching by means of hydrofluoric acid or hydrochloric acid . the regions where the growing point of nickel had been located were removed together in the same time . fig2 ( d ) shows the state after the etching . the portion where there was the intercrystalline boundary turns out to be a groove 4 a . it is not desirable to form semiconductor regions ( active layer or the like ) of a tft so as to pinch this groove . the tft was arranged so that semiconductor regions 6 would not cross the intercrystalline boundary 4 as shown in fig1 ( c ). that is , the tft was formed in a crystal growth region in the horizontal direction parallel to the substrate , not in the thickness direction of the coating film , by the action of nickel . then , the growth direction of the crystal could be uniformly arranged and residual nickel could be minimized . as a result , a high tft characteristics could be obtained . on the other hand , gate wires 7 may cross the intercrystalline boundaries 4 . fig3 and 4 show examples of the method for fabricating a tft using the crystal silicon obtained in the process described above . in fig3 ( a ), the reference character x in the middle indicates the place where there was the groove 4 a in fig2 . as shown in the figure , it was arranged so that semiconductor regions of the tft would not cross this x portion . that is , island semiconductor regions 11 a and 11 b were formed by patterning the crystal silicon film 3 obtained in the process shown in fig2 . then a silicon oxide film 12 which functions as a gate insulating film was formed by such methods as rf plasma cvd , ecr plasma cvd or sputtering . further gate electrodes 13 a and 13 b were formed by forming a polycrystalline silicon film with a thickness of 3000 to 6000 angstrom in which 1 × 10 20 to 5 × 10 20 cm − 3 of phosphorus is doped by a vacuum cvd method and then by patterning it ( fig3 ( a )). then impurity was doped by a plasma doping method . as a doping gas , phosphine ( ph 3 ) was used for an n type tft and diborane ( b 2 h 6 ) for a p type tft . the figure shows the n type tft . an acceleration voltage was 80 kev for phosphine and 65 kev for diborane . the impurity was activated by annealing for four hours at 550 ° c . to form impurity regions 14 a through 14 d . a method of using optical energy such as laser annealing or flash lamp annealing may be also used for the activation ( fig3 ( b )). finally , a silicon oxide film with a thickness of 5000 angstrom was deposited as an interlayer insulator 15 similarly to a case when tft is normally fabricated , and contact holes were formed therethrough to form wires and electrodes 16 a through 16 d in source and drain regions ( fig3 ( c )). the tft ( n channel type in the figure ) was thus fabricated in the process described above . the field effect mobility of the tft obtained was 40 to 60 cm 2 / vs in the n channel type and 30 to 50 cm 2 / vs in the p channel type . fig4 shows a process how a tft for aluminum gate was fabricated . in fig4 ( a ), the reference character x in the middle indicates the place where there was the groove 4 a in fig2 . as shown in the figure , it was arranged so that semiconductor regions of the tft would not cross this x portion . that is , island semiconductor regions 21 a and 21 b were formed by patterning the crystal silicon film 3 obtained in the process shown in fig2 . then a silicon oxide film 22 which functions as a gate insulating film was formed by such methods as rf plasma cvd , ecr plasma cvd or sputtering . when the plasma cvd method was adopted , a preferable result could be obtained by using teos ( tetra - ethoxi - silane ) and oxygen as original gases . then an aluminum film ( 5000 angstrom thick ) containing 1 % of silicon was deposited by sputtering and was patterned to form gate wires and electrodes 23 a and 23 b . next , the substrate was soaked into an ethylene glycol solution of 3 % tartaric acid and anodic oxidation was implemented by setting platinum as a cathode and an aluminum wire as an anode and by flowing current therebetween . the current was applied so that its voltage would increase 2v / min . initially and the voltage was fixed when it reached to 220 v . the current was stopped when it became less than 10 microa / m 2 . as a result , anode oxides 24 a and 24 b with a thickness of 2000 angstrom were formed as shown in fig4 ( a ). then impurity was doped by a plasma doping method . as a doping gas , phosphine ( ph 3 ) was used for an n type tft and diborane ( b 2 h 6 ) for a p type tft . the figure shows the n type tft . an acceleration voltage was 80 kev for phosphine and 65 kev for diborane . the impurity was activated by annealing by laser to form impurity regions 25 a through 25 d . the laser used was a krf laser ( wavelength : 248 nanometer ) and five shots of laser lights having 250 to 300 mj / cm 2 of energy density were irradiated ( fig4 ( b )). finally , a silicon oxide film with a thickness of 5000 angstrom was deposited as an interlayer insulator 26 similarly to the case when tft is normally fabricated and contact holes were formed therethrough to form wires and electrodes 27 a through 27 d in source and drain regions ( fig4 ( c )). the field effect mobility of the tft obtained was 60 to 120 cm 2 / vs in the n channel type and 50 to 90 cm 2 / vs in the p channel type tft . in a shift register fabricated by using this tft , operations at 6 mhz in 17 volts of drain voltage and at 11 mhz in 20 v were confirmed . fig5 shows a case when a tft for an aluminum gate was fabricated similarly to that shown in fig4 . however , the amorphous silicon was used as an active layer in this embodiment . as shown in fig5 ( a ), a ground silicon oxide film 32 was deposited on a substrate 31 and an amorphous silicon film 33 with a thickness of 2000 to 3000 angstrom was deposited further on that . an adequate amount of p type or n type impurities may be mixed in the amorphous silicon film . then island nickel or nickel silicide coating film 34 a and 34 b were formed as described above and the amorphous silicon film was crystallized by growing laterally by annealing for 8 hours at 550 ° c . or for four hours at 600 ° c . in this state . then a crystal silicon film thus obtained was patterned as shown in fig5 ( b ). at this time , because the silicon film contained a large amount of nickel in the middle in the figure ( the intermediate portion between the nickel or nickel silicide film 34 a and 34 b ), the patterning was carried out so as to remove such portion and to form island silicon regions 35 a and 35 b . then a substantially intrinsic amorphous silicon film 36 was deposited further on that . after that , as shown in fig5 ( c ), a coating film was formed by such substances as silicon nitride and silicon oxide as a gate insulating film 37 . a gate electrode 38 was formed by aluminum and an anodic oxidation was implemented in the same manner with the case of fig4 . then impurity was diffused by an ion doping method to form impurity regions 39 a and 39 b . then the tft was completed by depositing further an interlayer insulator 40 , by forming contact holes and forming metallic electrodes 41 a and 41 b at source and drain regions . this tft is characterized in that the semiconductor film at the source and drain portions is thick and that a resistance thereof is small . as a result , a resistance in the source and drain regions is reduced and the characteristics of the tft is improved . further , contact holes can be readily formed . fig6 shows a process when a cmos type tft was fabricated . as shown in fig6 ( a ), a ground silicon oxide film 52 was deposited on a substrate 51 and an amorphous silicon film 53 with a thickness of 1000 to 1500 angstrom was deposited further on that . then as described above , island nickel or nickel silicide coating film 54 was formed and annealing was implemented in this state at 550 ° c . a silicon silicide region 55 moved in the direction of plane , not in the direction of thickness , of the coating film and the crystallization advances by this process . the amorphous silicon film changed into crystal silicon as shown in fig6 ( b ) by four hours of annealing . the silicon silicide regions 59 a and 59 b were driven away toward the edge along the advancement of the crystallization . then an island silicon region 56 was formed by patterning the crystal silicon film thus obtained as shown in fig6 ( b ). here , an attention must be paid on that nickel was highly concentrated in the both ends of the island region . after forming the island silicon reason , a gate insulating film 57 and gate electrodes 58 a and 58 b were formed . then n type impurity regions 60 a and p type impurity regions 60 b were formed by diffusing an impurity by an ion doping method as shown in fig6 ( c ). at this time , the doping can be carried out by using phosphorus as a n type impurity ( doping gas is phosphine ph 3 ) and by doping across the whole surface by 60 to 110 kv of acceleration voltage and then after covering the region of the n channel type tft by a photoresist , by using boron for example as a p type impurity ( doping gas is diborane b 2 h 6 ) and by doping with 40 to 80 kv of acceleration voltage . after the doping , the source and drain region were activated by irradiating laser light similarly to the case in fig4 . then the tft was completed by depositing further an interlayer insulator 61 , by forming contact holes and forming metallic electrodes 62 a , 62 b and 62 c at the source and drain regions . fig7 shows the fourth embodiment . the present embodiment relates to a method in which silicide is produced by reacting a nickel film with a portion of amorphous silicon film by a first heat treatment ( pre - annealing ) and the amorphous silicon is crystallized by annealing after removing a non - reactive nickel film . a ground silicon oxide film 702 ( thickness : 2000 angstrom ) was formed on a substrate ( coning no . 7059 ) 701 by a sputtering method . then a silicon film 703 with a thickness of 300 to 800 angstrom or 500 angstrom thick for example was formed . further , a silicon oxide film 704 was formed by a plasma cvd method . this silicon oxide film 704 acts as a masking material and its thickness was preferred to be 500 to 2000 angstrom . if it is too thin , the crystallization advances from an unexpected location by pinholes and if it is too thick , it takes a time to form the film and is not suited for mass - production . then it was set at 1000 angstrom here . after that , the silicon oxide film 704 was patterned by a known photolithographic process . then a nickel film 705 ( thickness : 500 angstrom ) was formed by a sputtering method . the thickness of the nickel film 705 was preferred to be more than 100 angstrom ( fig7 ( a )). then it was annealed for 10 to 60 minutes in a nitrogen atmosphere at 250 to 450 ° c . ( a pre - annealing process ). for example , it was annealed for 20 minutes at 450 ° c . as a result , a nickel silicide layer 706 was formed within the amorphous silicon . a thickness of this layer was determined by a temperature and time of the pre - annealing and the thickness of the nickel film 705 was almost nothing to do with it ( fig7 ( b )). after that , the nickel film was etched . nitric or hydrochloric solution was suitable for the etching . the nickel silicide layer was barely etched during the etching of the nickel film by those etchants . in the present embodiment , an etchant in which acetic acid was added into nitric acid as a buffer was used . the ratio set was : nitric acid : acetic acid : water = 1 : 10 : 10 . after removing the nickel film , it was annealed for 4 to 8 hours at 550 ° c . ( a crystallizing annealing process ). several methods were tried in the crystallizing annealing process . a first method was to implement this process while remaining the masking material 704 as shown in fig7 ( c ). the crystallization advances as indicated by arrows in fig7 ( c ). a second method was to anneal after removing all the masking material and exposing the silicon film . a third method was to anneal after removing the masking material and after forming a new coating film 707 composed of silicon oxide or silicon nitride on the surface of silicon film as a protection film as shown in fig7 ( d ). although the first method was simple , the surface of the masking material 704 reacted with nickel in the pre - annealing step , and became silicate in the crystallizing annealing process at a higher temperature , and became hard to be etched . that is , because an etching rate of the silicon film and masking material 704 becomes almost equal , the portion where the silicon film is exposed is also largely etched when the masking material is removed later , creating steps on the substrate . the second method is very simple and etching can be easily carried out since the reaction of the masking material with nickel is mild before the crystallizing annealing process . however , because the silicon surface was wholly exposed when the crystallizing annealing was carried out , characteristics of tft or the like fabricated later degraded . although the third method allowed to firmly obtain a good quality crystal silicon film , it was complicated because the number of processes was increased . as a fourth method which was an improved version of the third method , a method comprising steps of putting into a furnace in a state when the silicon surface is exposed , heating for about one hour at 500 to 550 ° c . initially in an oxygen flow to form a thin silicon oxide film with a thickness of 20 to 60 angstrom thick on the surface and switching to a nitrogen flow as it is was studied as a crystallizing annealing condition . according to this method , an oxide film was formed in the initial stage of the crystallization . and that only the neighbor of the nickel silicide layer had been crystallized in this oxidation stage and a region which would be used for the tft later ( right side portion in the figure ) was not crystallized . due to that , the surface of the silicon film at the region far from the nickel silicide layer 706 was very flat . the characteristics improved more than that of the second method and was almost equal with that of the third method . the crystal silicon film was thus obtained . since then , the silicon film 703 was patterned while removing a portion where a value of concentration of nickel was high ( a region where the origin of growth was located ) and growth points ( slanted portions at the end of the arrows in the figure ) and while remaining only the region where the concentration of nickel was low . an island silicon region 708 which would be used for an active layer of the tft was formed as described above . then a gate insulating film 709 composed of silicon oxide with a thickness of 1200 angstrom was formed covering the region 708 by a plasma cvd method . further , a gate electrode 710 and a wire 711 in a first layer were formed by a phosphorus doped silicon film with a thickness of 6000 angstrom and source / drain regions 712 were formed by injecting an impurity into the active layer 708 in a self - aligning manner using the gate electrode 710 as a mask . it was then effective for improving the crystallinity to irradiate visible or near infrared strong light . further , a silicon oxide film with a thickness of 6000 angstrom was formed by a plasma cvd method as an interlayer insulator 713 . finally , contact holes were created in this interlayer insulator and a wire 714 in a second layer , source / drain electrode and wires 715 were formed by an aluminum film with a thickness of 6000 angstrom . the tft was completed by the process described above ( fig7 ( e )). fig9 shows the present embodiment . in the present embodiment , a polysilicon tft is formed in a peripheral circuit and an active matrix region of a tft type liquid crystal display device . at first , a ground oxide film 121 was deposited into a thickness of 20 to 200 nm by a sputtering method on a glass substrate 120 having a heat resisting quality such as a silica glass . further on that , an amorphous silicon film was deposited into a thickness of 30 to 50 nm by a plasma cvd method or vacuum cvd method using mono - silane or di - silane as an original material . here , a concentration of oxygen or nitrogen in the amorphous silicon film should have been less than 10 18 cm − 2 or preferably less than 10 17 cm − 2 . the oxygen concentration was set to be less than 10 17 cm − 2 in the present embodiment . a silicon oxide film with a thickness of 100 to 150 nm or silicon nitride film with a thickness of 30 to 100 nm was formed on the amorphous silicon film by a sputtering method as a cover film . it was then patterned to leave a cover film 122 only in the peripheral circuit region . then it was crystallized by leaving for 4 to 100 hours in an argon or nitrogen atmosphere ( 600 ° c .) containing 20 to 100 volume percent of oxygen or hydrogen . as a result , a crystallinity of a silicon film 123 a in the peripheral circuit region was good and that of a silicon film 123 b in the picture element region was not good . fig9 ( a ) shows this state . next , the silicon film was patterned into a shape of island to form a peripheral circuit tft region 124 a and a picture element tft region 124 b as shown in fig9 ( b ). then a gate oxide film 125 was formed by means of sputtering or the like . it can be formed by a plasma cvd method using teos ( tetraethoxisilane ) instead of the sputtering method . it is desirable to anneal for 0 . 5 to 3 hours at a temperature more than 650 ° c . during or after the formation when forming the film using teos . after that , a n - type silicon film with a thickness of 200 nm to 2 micron was formed by a lpcvd method and by patterning it , gate electrodes 126 a through 126 c were formed on each island region . a metallic material having a relatively good heat resistance such as tantalum , chrome , titanium , tungsten and molybdenum may be used instead of the n - type silicon film . then , an impurity was injected to the island silicon film of each tft by an ion doping method in a self - aligning manner using the gate electrode section as a mask . at this time , phosphorus was injected across the whole surface employing phosphine ( ph 3 ) as a doping gas at first and after covering the right side of the island region 124 a and the matrix region in the figure by a photoresist , boron was injected to the left side of the island region 124 a employing diborane ( b 2 h 6 ) as a doping gas . the dosage of phosphorus was set to be 2 to 8 × 10 15 cm − 2 and that of boron was 4 to 10 × 10 15 cm − 2 so that the dosage of boron would exceed that of phosphorus . a p - type region 127 a and n - type regions 127 b and 127 c were thus created . it was activated by annealing for 2 to 24 hours at a temperature between 550 and 750 ° c . the thermal annealing was carried out for 24 hours at 600 ° c . in the present embodiment . this annealing process activated the region in which ions were injected . this process can be implemented by laser annealing . because a thermal damage on the substrate is small when annealed by laser , a normal non - alkaline glass such as coning 7059 can be used . further , at that time , a material having an inferior heat resistance such as aluminum can be used as a material for the gate electrode . the p - type region 127 a and n - type regions 127 b and 127 c were created by the process described above . a sheet resistance of those regions was 200 to 800 ohm / sheet . after that , a silicon oxide film with a thickness of 300 to 1000 nm was formed across the whole surface by a sputtering method as an interlayer insulator 128 . this may be a silicon oxide film formed by a plasma cvd method . a silicon oxide film having a good step coverage can be obtained by the plasma cvd method especially using teos as an original material . then an ito film was created by a sputtering method and was patterned to form a picture element electrode 129 . contact holes were created in source / drain ( impurity regions ) of the tft to form wires 130 a through 130 e made of chrome or titanium nitride . fig9 ( c ) shows that an inverter circuit have been created by the ntft and ptft on the left side . the wires 130 a through 130 e may be a multi - layered wire with aluminum based on chrome or titanium nitride in order to reduce a sheet resistance . finally , it was annealed for 0 . 5 to 2 hours at a temperature between 200 and 350 ° c . in hydrogen to reduce a dangling bond of the silicon active layer . the peripheral circuit and the active matrix circuit could be integrally created . in the present embodiment , a typical mobility was 80 cm 2 / vs in the nmos , 50 cm 2 / vs in the pmos in the peripheral circuit section and 5 to 30 cm 2 / vs in the picture element tft ( nmos ). fig1 shows the present embodiment . in the present embodiment , a difference of mobility of nmos and pmos is reduced in a cmos circuit utilizing the present invention . at first , a ground oxide film 132 was deposited into a thickness of 20 to 200 nm by a sputtering method on a coning 7059 substrate 131 . further on that , an amorphous silicon film was deposited into a thickness of 50 to 250 nm by a plasma cvd method or vacuum cvd method using mono - silane or di - silane as an original material . here , a concentration of oxygen or nitrogen in the amorphous silicon film should have been less than 10 18 cm − 2 or preferably less than 10 17 cm − 2 . the vacuum cvd method was suited for this purpose . the oxygen concentration was set to be less than 10 17 cm − 2 in the present embodiment . a cover film 133 ( a silicon oxide film with a thickness of 50 to 150 nm ) was provided on the region of pmos . then it was crystallized by annealing for 4 to 100 hours at 600 ° c . in an argon or nitrogen atmosphere at 600 ° c . containing more than 50 percent of oxygen or hydrogen . as a result , although a crystallinity of a region 134 a under the cover film was good , that of a region 134 b where there was no cover film was not good . fig1 ( a ) shows this state . next , the silicon film was patterned into a shape of island to form a pmos region 135 a and an nmos region 135 b as shown in fig1 ( b ). then a silicon oxide film 125 with a thickness of 50 to 150 nm was formed by a sputtering method covering those island regions as a gate insulating film 136 . then an aluminum film was formed with a thickness of 200 nm to 2 micron by a sputtering method , and patterned to form a gate electrode . an anodic oxide film was formed on the upper and side surfaces of the gate electrode by feeding power to it in an electrolyte . gate electrode sections 137 a and 137 b were formed on each island region by the process described above . then , an impurity was injected to the island silicon film of each tft by an ion doping method in a self - aligning manner using the gate electrode section as a mask . at this time , phosphorus was injected across the whole surface employing phosphine ( ph 3 ) as a doping gas at first and after covering only the island region 135 b in the figure by a photoresist , boron was injected to the island region 135 a employing diborane ( b 2 h 6 ) as a doping gas . the dosage of phosphorus was set to be 2 to 8 × 10 15 cm − 2 and that of boron to be 4 to 10 × 10 15 cm − 2 so that the dosage of boron would exceed that of phosphorus . although the crystallinity of the silicon film is broken by the doping process , it was possible to keep its sheet resistance around 1 kohm / sheet . however , if the sheet resistance of this degree is to much , the sheet resistance can be lowered by annealing further for 2 to 24 hours at 600 ° c . the same effect can be obtained by irradiating such a strong light as laser light . a p - type region 138 a and n - type regions 138 b were thus created . a sheet resistance of those regions was 200 to 800 ohm / sheet . then a silicon oxide film with a thickness of 300 to 1000 nm was formed across the whole surface by a sputtering method as an interlayer insulator 139 . this may be a silicon oxide film formed by a plasma cvd method . a silicon oxide film having a good step coverage can be obtained by the plasma cvd method especially using teos as an original material . then contact holes were created in source / drain ( impurity regions ) of the tft to form aluminum wires 140 a through 140 d . finally , it was annealed for 2 hours at a temperature between 250 and 350 ° c . in hydrogen to reduce a dangling bond of the silicon film . a typical mobility of the tft obtained by the process above was 60 cm 2 / vs both in the pmos and nmos . when a shift resistor was fabricated using the process of the present embodiment , an operation of more than 10 mhz with 20 v of drain voltage was confirmed . fig1 shows the present embodiment . the present embodiment relates to a circuit in which a transistor and silicon resistance are combined . silicon doped by impurity can be used as a protecting circuit of the transistor . at first , a ground oxide film 141 was deposited into a thickness of 20 to 200 nm by a sputtering method on a coning 7059 substrate 140 . further on that , an amorphous silicon film 142 was deposited into a thickness of 100 to 250 nm by a plasma cvd method or vacuum cvd method using mono - silane or di - silane as an original material . here , a concentration of oxygen or nitrogen in the amorphous silicon film should have been less than 10 18 cm − 2 or preferably less than 10 17 cm − 2 . a cover film 143 of a silicon oxide film with a thickness of 20 to 200 nm was deposited and it was crystallized by annealing for 4 to 100 hours in an argon or nitrogen atmosphere at 600 ° c . fig1 ( a ) shows this state . next , the silicon film was patterned into a shape of island to form a transistor region 144 a and a resistance region 144 b as shown in fig1 ( b ). then a silicon oxide film with a thickness of 50 to 150 nm was formed by a sputtering method covering those island regions as a gate insulating film 145 . then an aluminum film was formed with a thickness of 200 nm to 2 micron by a sputtering method , and patterned to form a gate electrode . an anode oxide film was formed on the upper and side surfaces of the gate electrode by feeding power to it in an electrolyte . gate electrode section 146 was formed on each island region by the process described above . then , an impurity , e . g . phosphorus , was injected to the island silicon film of each tft by an ion doping method in a self - aligning manner using the gate electrode section as a mask . the dosage of phosphorus was 2 to 8 × 10 15 cm − 2 . impurity regions 147 a and 147 b were created by the doping process described above . since the same amount of impurity is being injected in those two impurity regions , they show the same resistivity when they are thermally annealed as they are . however , there is a such case for example when a higher resistance is demanded to the latter whereas a lower resistance is always demanded to the former . then , a cover film 148 of a silicon oxide film with a thickness of 50 to 150 nm was formed only on the transistor region as shown in fig1 ( c ). it was then annealed for 4 to 20 hours at a temperature between 550 and 650 ° in an argon or nitrogen atmosphere containing more than 50 volume percent of oxygen or hydrogen . phosphine ( ph 3 ) may be used instead of oxygen or hydrogen . however , the annealing temperature is preferable to be less than 800 ° c . because if the annealing temperature is too high , phosphine is thermally decomposed and diffuses within the semiconductor , lowering the resistivity on the contrary . diborane ( b 2 h 6 ) may be used when the impurity region of the resistance is p - type . while a sheet resistance of the impurity region of the transistor was 20 to 800 ohm / sheet , that of the impurity region of the resistance was 2 k to 100 kohm / sheet by the process above . then a silicon oxide film with a thickness of 300 to 1000 nm was formed across the whole surface by a sputtering method as an interlayer insulator 149 . this may be a silicon oxide film formed by a plasma cvd method . a silicon oxide film having a good step coverage can be obtained by the plasma cvd method especially using teos as an original material . then contact holes were created in source / drain ( impurity regions ) of the tft to form aluminum wires 150 a through 150 c . finally , it was annealed for 0 . 5 to 2 hours at a temperature between 250 to 350 ° c . in hydrogen to reduce a dangling bond of the silicon film . a sheet resistance of the regions which had the same thickness and to which the same amount of impurity was injected could be differentiated by the process described above . as described above , the present invention is an epoch - making invention in a sense that it promotes the implementation of lower temperature and shorter time crystallization of amorphous silicon and provides an immeasurable benefit to the industry because facility , equipment and technique therefor are very common and are excellent for mass - production . although the explanation has been made centering on nickel in the aforementioned embodiments , the same process can be applied to another metal element that accelerates the crystallization , i . e . any one of fe , co , ru , rh , pd , os , ir , pt , sc , ti , v , cr , mn , cu , zn , au and ag . for example , assuming that it takes two minutes to treat one sheet of substrate , while 15 annealing furnaces were necessary in the conventional solid phase growing method because at least 24 hours of annealing was necessary , the present invention allows to reduce the number of the annealing furnaces to less than ⅙ of that because the annealing time can be shortened to four hours or less . the improvement of productivity and the reduction of amount of investment on facility brought about by that will lead to the drop of substrate processing cost as well as to the drop of a cost of tfts and thereby to the rise of new demand . accordingly , the present invention is very beneficial to the industry and deserves to be patented . further , the present invention solves the problem in the conventional fabrication process of crystalline silicon tfts by such minimum modification of the crystallization condition of active layer of the tfts that whether a cover film exists or not . the present invention allowed to improve especially a reliability and performance of a dynamic circuit and of a device having such circuit . conventionally , although crystalline silicon tfts had low an on / off ratio for such purpose as an active matrix of a liquid crystal display and was difficult in various ways to put it into practical use , such problems have been considered to be solved by the present invention . although not shown in the embodiments , it will be apparent that the present invention will be effective , when implemented , in tfts used as means for implementing a stereo - monocrystal semiconductor integrated circuit . for example , a memory elements section can be constructed by constructing a peripheral logic circuit by semiconductor circuits on a monocrystal semiconductor and by providing tfts on that through the intermediary of an interlayer insulator . in this case , the memory elements section can be a dram circuit using the tfts of the present invention and its driving circuit is constructed by being cmos - implemented to the monocrystal semiconductor circuit . furthermore , when such circuit is used for a microprocessor , its area can be saved because the memory section is raised to the upstairs . thus the present invention is considered to be a very beneficial invention to the industry . while the present invention has been particularly shown and described with reference to preferred embodiments thereof , it will be understood by those skilled in the art that the foregoing and other changes in form and details can be made therein without departing from the spirit and scope of the invention .	7
the invention can be described in more detail with the help of the accompanying drawing wherein fig1 shows a view in cross section of a portion of the surfaces of a pair of contact elements of a connector in accordance with the invention ; fig1 a shows an alternative embodiment of that shown in fig1 ; fig2 shows a plan view of an exemplary surface of one of the contact elements of fig1 . fig3 and 3a show graphs of contact resistance test results for simulated insertion and removal motions ; and fig4 and 4a show graphs of contact resistance test results for simulated fretting motions . as can be seen in fig1 the surface of a contact element 10 comprises a plurality of raised portions ( islands ) 11 and a plurality of depressed portions ( valleys ) 12 therebetween . the raised portions make mechanical and electrical contact with a second contact element 13 having a substantially smooth surface as shown . as the elements 10 and 13 move relative to each other , as shown by the arrow , the contact surface regions between the raised portions 11 of element 10 and the surface of element 13 tend to generate minute wear particles which would normally tend to be retained between the surface contact regions . in accordance with the invention , however , as movement occurs , such wear particles are swept into and entrapped in depressed portions 12 where they are retained . in a preferred and exemplary embodiment of the invention , for example , the raised or island portions 11 can be formed , as shown in fig1 and 2 , as 100 micrometer ( μm .) square islands separated by 100 μm . square depressed or valley regions 12 having depths of about 100 μm , thereby forming a substantially regular pattern thereof as shown . in the exemplary embodiment shown the pattern of islands and valleys can be formed by any suitable process such as , for example , by using well - known photo - resist techniques , wherein the depressed portions can ultimately be formed by etching or the islands can ultimately be formed by plating , in accordance with a desired pattern thereof . alternatively , the pattern may be formed by an appropriate mechanical embossing process in which the pattern is formed by using a suitably configured embossing cylinder . in a preferred embodiment the plated regions can be plated with a selected material having a selected thickness which provides relatively low electrical resistance and a selected hardness which provides relatively low wear characteristics . for example , as shown in fig1 a , copper islands 11 of the patterned surface can be plated with nickel using an electroless plating process to form a layer 11a of a thickness selected to provide relatively low electrical resistance ( e . g . about 3 . 75 μm .) on each island as the contact surface region . in order to prevent corrosion of the nickel coating , the surface can be further coated with a layer 11b of a lead - tin ( pb - sn ) alloy using various thicknesses from about 0 . 1 μm . to about 2 . 0 μm . a typical surface of such a construction was tested using two kinds of simulated operating tests . a first sliding test provided an oscillating sliding motion having about a 6 . 0 mm amplitude at a frequency of about 1 . 0 hz under a load of 200 g . for up to 200 cycles , the contact resistance being continuously measured during the test . such test simulated the insertion and removal operations of an electrical connector . it was found that the wear debris or wear particles produced by such sliding motion between the top surface of the islands and the sliding surface in contact therewith was substantially completely trapped and retained in the depressed regions between the islands . in two particular samples tested it was found that the contact resistance never exceeded 15 milliohms ( mω .) and accordingly remained well within the desired design limits , as shown in fig3 and 3a for the two samples tested , wherein the peaks of the resistance level excursions for each of the cycles are depicted by pen recorded curves 14 and 15 , respectively . a second test was performed to simulate conditions during use with respect to smaller amplitude and higher frequency motions ( corresponding to vibration or fretting motions ) in which the amplitude of the motion was about 20 μm . at a frequency of about 60 hz . tests on two particular samples were performed at a 200 g load for 100 , 000 cycles . again it was found that the debris was adequately trapped and retained by the depressed regions on the surface of one of the contact elements and the contact resistance again stayed well below the desired maximum 25 mω level , as shown by pen recorded curves 16 and 17 in fig4 and 4a , respectively , for the two samples tested . while the particular preferred embodiment disclosed above utilizes a substantially regular pattern of alternating raised and depressed portions , as shown in fig1 and 2 , it is clear that in some applications it would be within the scope of the invention to change the particular pattern shown to another form of regularized pattern or to change the shape and dimensions of the islands and valleys themselves . moreover , it is entirely possible to use an irregular pattern of such islands and valleys . optimized patterns for each application can be well determined by those in the art utilizing the inventive concept disclosed . it is preferable that the raised portions or islands have contact surface dimensions which are less than the amplitude of the sliding motion required for insertion and removal and normally such dimensions are at least an order of magnitude less than such amplitude . further , although a particular combination of copper , nickel and lead - tin alloy materials has been discussed with reference to preferred embodiments which were made and tested , it is clear that the type of material can be selected for the particular use desired , particularly in terms of its hardness , and such materials may include both noble and base metals and coatings therefor for the specified electrical contact applications involved . other modifications to the basic inventive concept as disclosed herein may also occur to those in the art within the spirit and scope of the invention . hence , the invention is not to be limited to the particular embodiments discussed herein except as defined by the appended claims .	7
the coating composition is useful for substrates that need lubricity as well as wear resistance such as mating surfaces . the firearm industry has a need for these coating compositions . these coatings would allow firearms to be used with a longer maintenance schedule that is required when using the recommended conventional wet lubricants . the maintenance schedule established by firearm manufactures usually instruct users that the guns have be cleaned and then reassembled with fresh grease and oil after every 1000 rounds to prevent corrosion and lock up of the firing mechanisms . by applying the nodular nickel coating parts to the surfaces of mating components the wear life of the components can be extended beyond the wear life provided by wet lubricants . firearm components are one example of mating surfaces that would benefit from nodular nickel coatings . another problem with wet lubricants is that dusts and grime and sand easily attach . this increases the need for cleaning and re - greasing in unfriendly environments . also the continuous firing of rounds wears out the barrel of guns and rifles . these coatings extend the wear of the barrels and acts as sacrificial coating . by acting as a sacrificial coating the barrels can be re - plated allowing the barrel to be reused . the following experiments were done to show the effectiveness of the these coatings : 1 ) guns are known to have close fit tolerances and a nickel boron coating would add additional dimension to all surfaces , so careful measurements were recorded of all critical surfaces before the factory coatings were removed . 2 ) next we stripped the various factory coatings , hard anodize on the aluminum surfaces , manganese phosphate from the steel parts and hard chrome from inside of the gun barrel . 3 ) measurements were retaken to establish the mass removed by removing the various factory coatings . 4 ) we concluded an average nickel boron thickness of 0 . 0005 - 0 . 001 inches could be applied without disrupting function . a . the factory anodized surfaces were stripped by submerging parts in a zincate solution until the surfaces were free of aluminum oxide . b . small threaded holes were plugged to prevent plating from depositing . c . the parts were then placed in a non etch aluminum soak cleaning solution for 2 - 3 minutes . d . the parts were then placed in a chemical etch solution for 40 seconds e . the parts were then placed in a standard zincate solution for 15 seconds f . the parts were then placed in a nickel strike solution to provide a protective layer from the highly alkaline nickel boron bath . g . the parts were then placed in the nickel boron solution as follows : 1 . a solution of water , 0 . 25 pounds of nickel salts , 1 pound of ethylenediamine , ⅓ pound of ammonium hydroxide ⅓ pound of sodium hydroxide topped - off to one gallon . 2 . the above solution was heated to a temperature of 1908 f .+/− 5 * f . 3 . to the solution above ( the bath ) 10 mls of a reducing agent was added . the reducing agent was made as follows : 1 pound of sodium borohydride was added to ½ gallon of water and to that , 2 pounds of sodium borohydride was added , topped - off to one gallon . 4 . to the bath solution above , 10 mls of the stabilizer solution was added . the stabilizer was made as follows ; 10 grams of lead tungstate was added to ¾ gallon of water . to that , 50 grams of sodium hydroxide was added . to that , 150 mls of ethylenediamine , to that , 50 mls of ethylenediamine tetraacetate was added and topped - off with water to equal one gallon . 50 grams of surfactant was added and mixed well . 5 . the gun parts were left in the plating solution for 1½ hours and received 0 . 0006 inch of nickel boron coating . a . the factory magnesium phosphate coating was removed by placing the parts in a solution of water and 16 oz per gallon of sodium hydroxide at a temperature of 150 * f . for 1 hour . b . the parts were then placed in a detergent type soak cleaning solution for 2 - 3 minutes at 160 * f . c . the parts were then placed in an acid solution for 1 - 2 minutes for surface activation d . the parts were then placed in the same nickel boron plating solution for 1½ hours to receive approximately 0 . 0006 inch of nickel boron coating . 1 . a solution of water , 0 . 25 pounds of nickel salts , 1 pound of ethylenediamine , ⅓ pound of ammonium hydroxide ⅓ pound of sodium hydroxide topped - off to one gallon . 2 . the above solution was heated to a temperature of 1908 f .+/− 5 * f . 3 . to the solution above ( the bath ) 10 mls of a reducing agent was added . the reducing agent was made as follows : 1 pound of sodium borohydride was added to ½ gallon of water and to that , 2 pounds of sodium borohydride was added , topped - off to one gallon . 4 . to the bath solution above , 10 mls of the stabilizer solution was added . the stabilizer was made as follows ; 10 grams of lead tungstate was added to ¾ gallon of water . to that , 50 grams of sodium hydroxide was added . to that , 150 mls of ethylenediamine , to that , 50 mls of ethylenediamine tetraacetate was added and topped - off with water to equal one gallon . 50 grams of surfactant was added and mixed well . 5 . the gun parts were left in the plating solution for 1½ hours and received 0 . 0006 inch of nickel boron coating . 6 . to increase hardness , the steel parts were heat - treated at 700 * f . for 90 minutes , by doing so , hardness increased from 980 knoop to 1410 knoop . 7 . the gun barrels , steel were processed along with the other steel parts above but the chrome plating was first removed by using an inhibited hydrochloric acid at 40 % with water . the barrel was submerged in the acid for approximately 2 hours until all of the chrome deposit was removed . plating was as follows : 1 . a solution of water , 0 . 25 pounds of nickel salts , 1 pound of ethylenediamine , ⅓ pound of ammonium hydroxide ⅓ pound of sodium hydroxide topped - off to one gallon . 2 . the above solution was heated to a temperature of 1908 f .+/− 5 * f . 3 . to the solution above ( the bath ) 10 mls of a reducing agent was added . the reducing agent was made as follows : 1 pound of sodium borohydride was added to ½ gallon of water and to that , 2 pounds of sodium borohydride was added , topped - off to one gallon . 4 . to the bath solution above , 10 mls of the stabilizer solution was added . the stabilizer was made as follows ; 10 grams of lead tungstate was added to ¾ gallon of water . to that , 50 grams of sodium hydroxide was added . to that , 150 mls of ethylenediamine , to that , 50 mls of ethylenediamine tetraacetate was added and topped - off with water to equal one gallon . 50 grams of surfactant was added and mixed well . 5 . the gun parts were left in the plating solution for 1½ hours and received 0 . 0006 inch of nickel boron coating . 6 . to increase hardness , the steel parts were heat - treated at 700 * f . for 90 minutes , by doing so , the hardness increased from 980 knoop to 1410 knoop based on a 25 gram load . at times , an inexpensive ammunition was intentionally used because they are known to be damaging to weapon surface finishes by means of corrosive gun powder residue . if this residue isn &# 39 ; t thoroughly removed from all surfaces , the residual material becomes acidic and attacks the base metal of the weapon . an objective of this invention is protecting a gun surface with nickel boron from this chemical attack is . two test guns were reassembled but one was first burnished with a molly disulfide compound as a dry film lubricant on top of the nickel boron coating . the gun without moly lubrication was at first a little “ sticky ” and rough in operation but eventually operated as well as the weapon with the dry film lubrication . extra polishing was required in the breach area of the barrel to prevent the ammunition from hanging - up as it tried to discharge the casing in the non lubricated gun . the first test firing cycle was as follows , 470 rounds of winchester ammo was fired in both semi and full automatic mode without incident . the guns were left as fired with no cleaning as is normally done and required by the manufacture . the same day , but 8 hours later , an additional 500 rounds of wolf brand ammunition were fired as above without incident or cleaning before , during or after firing . 24 hours later , additional 1200 rounds were fired and again without incident and again the weapons were stored without cleaning . 2 days later , the weapons 500 rounds were fired . the following week , the weapons were again fired , 2000 rounds total with 3 miss - fires that were related to a poor quality magazine , completely unrelated to the function of the gun and it &# 39 ; s coated parts . both weapons have fired a total of 4670 rounds total . the only miss fires occurred in the initial start - up of the gun without the moly disulfide dry lubrication . since then , this gun has been incident free . the dry film lubricated gun was had 3 misfires that occurred around 2100 round count due to the poor magazine . these examples show that the maintenance schedule required by wet lubricants can be greatly extended using these coatings . the preferred surface roughness for these coatings on firearm components should be about 20 rms . the coating after an electroless nickel boron deposition usually has surface roughness of about 40 rms . a lower rms is usually needed to reduce the wear between mating surfaces and to prevent unwanted particles like sand from being trapped between the nodules . the surface roughness can be reduced using conventional polishing techniques : the boron content of the coating should be over 2 . 5 %. and not exceeding 6 % as the boron content increase the hardness increases . the preferred range is 4 - 4 . 5 % by weight applying a mixture of tungsten disulfide and moly disulfide 80 : 20 % or 20 : 80 % by weight or volume to a nodular nickel coating enhance the nickel boron coating . about a 50 : 50 mixture is preferred . these ingredients have uniquely different structure and properties that compliment each other . the mixture can be applied as follows . 2 ) thinning it with a solvent and painting on the nickel surface . 3 ) blasting it into the surface mixed with glass bead or by blasting it into the surface with high pressure gas , like nitrogen , at 250 - 1000 psi without glass beads .	8
compounds of the present invention are hexahydropyrrolizines of the following formula ( i ): ## str3 ## wherein a represents the atoms necessary to form a ring system selected from the group consisting of phenyl , naphthyl , cycloalkyl , cycloalkenyl , thienyl , furanyl , pyrrolyl , pyridinyl , pyridazinyl , pyrimidinyl , pyrazinyl or triazinyl ; r 1 is independently cyano , halogen , alkyl , alkyloxy , alkylthio , haloalkyl , alkenyl , alkynyl or cycloalkenyl or r 1 is alkyl , alkenyl or alkynyl substituted by hydroxy ; and provided that when a is phenyl , x is 1 , 2 or 3 , and the pharmaceutically - acceptable acid - addition salts thereof . in more detail , a is phenyl ; naphthyl ; cycloalkyl of about 3 to 7 carbon such as cyclopentyl and cyclohexyl ; cycloalkenyl of about 3 to 7 carbons such as cyclopentenyl and cyclohexenyl , e . g . 1 - cyclohexen - 1 - yl ; thienyl such as 2 - or 3 - thienyl ; furanyl such as 2 - or 3 - furanyl ; pyrrolyl such as 2 - or 3 - pyrrolyl ; pyridinyl such as 2 -, 3 - or 4 - pyridinyl ; pyridazinyl such as 3 - or 4 - pyridazinyl ; pyrimidinyl such as 2 - 4 - or 5 - pyrimidinyl ; pyrazinyl such as 2 - pyrazinyl ; or triazinyl such as 1 , 2 , 3 - triazinyl attached at the 4 or 5 position thereof , 1 , 2 , 4 - triazinyl attached at the 3 , 5 or 6 position or 1 , 3 , 5 - triazinyl attached at the 2 position . r 1 , in more detail , is independently , e . g ., two different r 1 moieties may be attached to the a ring when x is 2 , cyano ; halogen such as fluoro , chloro , bromo and iodo ; alkyl of about 1 to 8 carbons such as methyl , ethyl , n - propyl and sec - butyl ; alkoxy of about 1 to 8 carbons such as methoxy , ethoxy and iso - propoxy ; alkylthio of about 1 to 8 carbons such as methylthio and ethylthio ; haloalkyl of about 1 to 8 carbons independently substituted by one or more of fluoro , chloro , bromo or iodo such as trifluoromethyl and 2 , 2 , 2 - trifluoroethyl ; alkenyl of about 2 to 8 carbons such as ethenyl , 1 - propenyl and 2 - propenyl ; alkynyl of about 2 to 8 carbons such as ethynyl , 1 - propargyl and 2 - propargyl ; cycloalkenyl of about 3 to 7 carbons such as cyclopropenyl and 1 - cyclohexenyl ; or such alkyl , alkenyl or alkynyl substituted by hydroxy such as 3 - hydroxy - n - butyl , 3 - hydroxy - 1 - n - butenyl and 6 - hydroxy - 1 - n - hexynyl . particular a - r 1 ring systems for formula ( i ) include phenyl rings where x is 0 or 1 and r 1 is halogen such as ortho - halophenyl , e . g ., ortho - bromophenyl or r 1 is loweralkyl such as para - loweralkyl , e . g . para - methylphenyl . various isomers are possible in formula ( i ) compounds and the present invention includes all such individual enantiomers , diasteriomers , racemates and other isomer ratios . specifically , formula ( i ) compounds have 3 - substitution and , may exist in the following 4 forms , the pendant 7a bond being to a hydrogen : ## str4 ## structures ( ia ) and ( ic ) are enantiomers of each other as are ( b ) and ( d ). in the present specification , the designation 3α , 7aβ in nomenclature of specific compounds is used for the pair ( ia ) and ( ic ) according to ca usage , it being clear that such 3α , 7aα compound is a racemate composed of the 2 enantiomers ( ia ) and ( ic ). likewise , 3α , 7aα is the designation for the pair of compounds having partial structure ( ib ) and ( id ). resolution of enantiomers shown in the application , of course , results in a single enantiomer without its enantiomeric mirror image and these individual enantiomers are designated by (-) or (+) according to the direction in which they turn polarized light . compounds of this invention may be prepared via either of two routes ( a ) and ( b ). route ( a ) ## str5 ## in route ( a ), compounds of formula ( i ) wherein a is phenyl may be prepared by treatment of hexahydro - 3h - pyrrolizin - 3 - one of formula ( ii ) with phenyl lithium followed by dichloroaluminum hydride . in more detail , hexahydro - 3h - pyrrolizin - 3 - one , ca , vol . 86 , 89512 ( 1977 ), in a dry ethereal solvent , such as thf , is treated with a solution of about one equivalent of phenyllithium in cyclohexane / diethyl ether at a temperature below - 20 ° c . after a period of about 1 - 2 hours , the reaction mixture is added to a suspension of about one equivalent of alcl 2 h in anhydrous ether . the reaction mixture is stirred at about room temperature for a period of about 16 to 24 hours under an inert atmosphere , e . g . nitrogen or argon , and the product of formula ( i ) wherein a is phenyl is recovered by standard techniques . route ( b ) ## str6 ## in route ( b ), pyrrole 2 - carboxaldehyde is condensed with a ketone of formula ( iii ) where y is -- ch 3 , e . g . a substituted acetophenones or heteroaryl methyl ketone , to afford a chalcone of formula ( iv ). the condensation may be carried out under claisen - schmidt conditions , for instance , in water or a lower alcohol solvent at a temperature of - 30 ° to 50 ° c ., depending on the solvent being used , preferably water at about 45 ° c ., in the presence of an alkali metal hydroxide , e . g . potassium hydroxide . other alternative condensation procedures may be used , e . g . the knoevenagel condensation using ammonia or a primary or secondary amine catalyst and a carboxylic acid . for instance , piperidine in acetic acid at an elevated temperature of about 50 ° to 100 ° c . will effect the condensation . the chalcone of formula ( iv ) is then reacted with di - tert - butyldicarbonate to afford the t - boc protected pyrrole chalcone of formula ( v ). the protection reaction is generally carried out in an inert solvent , e . g . acetonitrile , at room temperature . the protected pyrrole chalcone of formula ( v ) is then catalytically hydrogenated to produce the pyrrolidine - ketone of formula ( vi ). the hydrogenation may be carried out over nickel or a noble metal catalyst , e . g . platinum , palladium , rhodium or ruthenium , preferably platinum or rhodium on carbon , in a solvent such as a lower alkenol , e . g . methol . the hydrogenation may be carried out at a temperature of about 20 ° to 120 ° c . at a hydrogen pressure of about 16 psi to 300 psi . route ( b ) is preferably not used if the a - ring constitutes a moiety which is sensitive to hydrogenation . thus , route ( b ) is best used when the a - ring is phenyl , naphthyl or furanyl . in the next step of route ( b ), the pyrrolidine - ketone of formula ( vi ) is reduced to produce a pyrrolidine - alcohol of formula ( vii ) by the action of a hydride reducing agent , e . g . sodium borohydride in a polar solvent , such as a lower alkanol , e . g . methanol , or lah in et 2 o or thf . the pyrrolidine - alcohol of formula ( vii ) is then treated with aqueous concentrated hydrogen bromide to produce the n - deprotected pyrrolidinehalide hydrobromide of formula ( viii ). the deprotection of the pyrrolidine nitrogen and conversion of the alcohol moiety to a bromine moiety is carried out in a single step at an elevated temperature of about 38 ° to 100 ° c ., preferably about 60 ° c . in the last step of route ( b ), the pyrrolidinehalide hydrobromide of formula ( viii ) is cyclized to a hexahydropyrrolizine of formula ( i ) by conversion of the hydrobromide salt to its free base and subsequent cyclization of the free base . the reaction is carried out by the action of a mild base 1 e . g . potassium carbonate , in a polar solvent , e . g . water . route ( b ) may not be employed when the group ## str7 ## contains a group subject to a catalytic hydrogenation such as a c - c double bond , a c - c triple bond , a nitrile , a pyridine ring or a thiophene ring . when the a - c cycle is a phenyl ring , carrying out route ( b ) with exhaustive rh catalyzed hydrogenation affords a 3 - cyclohexylhexahydropyrrolizine . in a variation of route ( b ), the protected pyrrolidine alcohol of formula ( vii ) is reacted with thionyl chloride in place of concentrated hydrogen bromide to produce an n - deprotected chloro pyrrolidine hydrochloride analogous to the bromo pyrrolidine of formula ( viii ) of route ( b ), which is subsequently cyclized to a hexahydropyrrolizine of formula ( i ) by the action of a strong base . the thionyl chloride reaction is generally run in a polar aprotic solvent , e . g . chloroform , at room temperature and the strong base used in the cyclization step is aqueous alkali , e . g . sodium hydroxide . in each of route ( a ) and ( b ), a mixture of diastereomers is produced . the diastereomers may be separated by chromatography on silica or by fractional crystallization . if desired , the compound of formula ( i ) may be resolved into optical isomers , i . e ., enantiomers , by fractional crystallization of a salt with an optionally active acid such as , for instance , di - ρ - toluoyl tartaric acid . the groups r 1 may be attached directly to the -- c - a function during the synthesis of the hexahydropyrrolizine ring . alternatively they may be attached following the synthesis of the 3 - substituted hexahydropyrrolizine . for instance a 3 -( halophenyl ) hexahydropyrrolizine may be converted to the corresponding lithium derivative by reaction with an alkyllithium . 3 -( 2 - lithiophenyl ) hexahydropyrrolizine on reaction with dimethyldisulfide affords 3 -( 2 - methylthiophenyl ) hexahydropyrrolizine . reaction of the lithio derivative with cyclohexanone affords the derivative with a 1 - cyclohexanol attached . a 3 -( 2 - halophenyl ) hexahydropyrrolizine when subjected to palladium catalyzed coupling with cuprous cyanide or a 1 - alkyne gives the corresponding cyano or alkyl derivative . compounds of formula ( i ) wherein the a - ring is cyclohexyl or substituted cyclohexyl may be prepared by catalytic hydrogenation of the appropriate phenyl compound over a noble metal catalyst , for example rhodium , ruthenium or platinum . the activity of compounds of the invention as analgesics may be demonstrated by an abdominal constriction assay as described below : the mouse acetylcholine - induced abdominal constriction assay , as described by collier et al . in brit . j . pharmacol . chemother , 32 : 295 - 310 , 1968 , with minor modifications was one test used to assess analgesic potency . the test drugs or appropriate vehicle were administered p . o . and 30 minutes later the animals received an i . p . injection of 5 . 5 mg / kg acetylcholine bromide ( matheson , coleman and bell , east rutherford , n . j .). the mice where then placed in groups of four into glass bell jars and observed for a ten minute observation period for the occurrence of a writhe which is defined as a wave of constriction and elongation passing caudally along the abdominal wall , accompanied by a twisting of the trunk and followed by extension of the hind limbs . the percent inhibition of writhing ( equated to % analgesia ) was calculated as follows : the % inhibition of writhing , i . e ., % analgesia is equal to the difference between the number of control animals writhing and the number of drug - treated animals writhing times 100 divided by the number of control animals writhing . at least 20 animals were used for control and in each of the drug treated groups . four doses were used to determine each dose response curve and ed 50 ( that dose which inhibits writhing by 50 %). the ed 50 values and their 95 % fiducial limits were determined by a computer assisted probit analysis . the test results are shown in table i . table i______________________________________acetyl choline bromide body constrictioncpd of % inhibitionex # 30 mg kg ed . sub . 50______________________________________1 100 5 . 72f ( diasteriomer a ) 60 -- 2f ( diasteriomer b ) 100 8 . 73d 100 -- ______________________________________ based on the above results , compounds of the invention as well as the compound of formula ( i ) where a is phenyl and x is 0 may be used to treat mild to moderately severe pain in warm blooded animals such as humans in a manner similar to the use of meperidine hydrochloride by administration of an analgesically effective dose . the dosage range would be from about 10 to 3000 mg , in particular about 25 to 1000 mg or about 100 to 500 mg , of active ingredient 1 to 4 times per day for an average ( 70 kg ) human although it is apparent that activity of individual compounds of the invention will vary as will the pain being treated . to prepare the pharmaceutical compositions of this invention , one or more compounds or salt thereof of the invention as the active ingredient , is intimately admixed with a pharmaceutical carrier according to conventional pharmaceutical compounding techniques , which carrier may take a wide variety of forms depending on the form of preparation desired for administration , e . g ., oral or parenteral such as intramuscular . in preparing the compositions in oral dosage form , any of the usual pharmaceutical media may be employed . thus , for liquid oral preparations , such as for example , suspensions , elixirs and solutions , suitable carriers and additives include water , glycols , oils , alcohols , flavoring agents , preservatives , coloring agents and the like ; for solid oral preparations such as , for example , powders , capsules and tablets , suitable carriers and additives include starches , sugars , diluents , granulating agents , lubricants , binders , disintegrating agents and the like . because of their ease in administration , tablets and capsules repressent the most advantageous oral dosage unit form , in which case solid pharmaceutical carriers are obviously employed . if desired , tablets may be sugar coated or enteric coated by standard techniques . for parenterals , the carrier will usually comprise sterile water , though other ingredients , for example , for purposes such as aiding solubility or for preservation , may be included . injectable suspensions may also be prepared , in which case appropriate liquid carriers , suspending agents and the like may be employed . the pharmaceutical compositions herein will contain , per dosage unit , e . g ., table , capsule , powder , injection , teaspoonful and the like , from about 10 to about 500 mg of the active ingredient . in the following examples and throughout the specification , the following abbreviations may be used : ca ( chemical abstracts ); mg ( milligrams ); g ( grams ); kg ( kilograms ); ml ( milliliters ); mmole ( milli moles ); m ( molar ); n ( normal ); psi ( pounds per square inch ); mp ( melting point ); bp ( boiling point ); meg ( milliequivalents ); e ( trans ); z ( cis ); et 2 o ( diethyl ether ); etoac ( ethyl acetate ); meoh ( methanol ); etoh ( ethanol ); lah ( lithium aluminum hydride ); thf ( tetrahydrofuran ); dmf ( dimethylformamide ); p . o . ( per os , orally ); i . p . ( intraperitioneal ); hplc ( high pressure liquid chromatography ; hr ( hours ); min ( minutes ); and c , h , n , o , etc . ( the chemical symbols for the elements ). unless otherwise indicated , all temperatures are reported in ° c . ( degrees centigrade ) and all references to ether are to et 2 o . into a round bottom flask was placed 5 g ( 0 . 04 moles ) hexahydro - 3h - pyrrolizin - 3 - one , described in ca , 86 89512 ( 1977 ) in 100 ml of dry thf . this was cooled to - 40 ° c . and 20 ml of 2 . 0m phenyllithium in cyclohexane / ether was added over 40 min keeping the temperature below - 20 ° c . the reaction mixture was stirred at - 20 ° c . for 40 min and added to a suspension of alcl 2 h made by adding 5 . 34 g ( 0 . 04 moles ) aluminum chloride in 25 ml of dry ether to a suspension of 1 . 52 g ( 0 . 04 moles ) lah in ether . the reaction mixture was stirred overnight under nitrogen . to the reaction mixture was added 120 ml of water and it was stirred for one hr . the solid was filtered off and washed well with ether . the filtrate was made basic with 3n sodium hydroxide and extracted several times with ether . the ether layers were combined , washed with brine and dried ( k 2 co 3 ). the solvent was removed in vacuo . the residue was taken up in ether , washed with water and extracted with 3n hydrogen chloride . the acidic layer was made basic by sodium hydroxide addition and extracted with ether . the ether layer was washed with brine , dried ( k 2 co 3 ) and the solvent evaporated in vacuo . the resulting oil was flashed chromatographed on silica gel using 1 : 7 acetone : hexane as the eluant . the resulting oil was treated with one equivalent of fumaric acid in 2 - propanol to give the salt which was recrystallized from 2 - propanol to give 680 mg of hexahydro - 3 - phenyl - 1h - pyrrolizine ( e )- 2 - butenedioate ( 9 %), mp 143 °- 145 . 5 ° c . a mixture of 20 . 0 g of ( 0 . 21 moles ) 2 - pyrrolecarboxaldehyde , 71 . 4 ml of ( 0 . 52 moles ) o - bromoacetophenone , 72 ml of 1n potassium hydroxide and 800 ml of water was placed in a flask under nitrogen and heated to 45 ° c . for 72 hr . the reaction was cooled in an ice bath until a solid formed . the solid was taken up in methylcyclohexane / etoac , dried over 4a sieves and allowed to cool . the resulting solid was recrystallized from methylcyclohexane / etoac to give 43 . 5 g of 1 -( 2 - bromophenyl )- 3 -( 1h - pyrrol - 2 - yl )- 2 - propen - 1 - one as a yellow solid ( 75 %), mp 76 °- 78 ° c . to a solution of 27 . 7 g ( 0 . 10 moles ) 1 -( 2 - bromophenyl )- 3 -( 1h - pyrrol - 2 - yl )- 2 - propen - 1 - one in 120 ml of acetonitrile was added 26 . 16 g ( 0 . 12 moles ) of di - t - butyldicarbonate and 1 . 27 g ( 0 . 01 moles ) of dimethylaminopyridine . the solution was stirred for 45 min after which 3 . 54 g ( 0 . 03 moles ) of 2 - diethylaminoethylamine was added . after stirring for 15 min the reaction was partitioned between 200 ml of 1m potassium hydrogen sulfate and ether . the ether layer was washed twice with 100 ml portions of 1m potassium hydrogen sulfate , water brine and dried ( k 2 co 3 ). evaporation of the solvent in vacuo gave 34 . 4 g of 1 , 1 - dimethylethyl 2 -[ 3 -( 2 - bromophenyl )- 3 - oxo - 1 - propenyl ]- 1h - pyrrol - 1 - carboxylate as an oil ( 92 %). into a parr shaker bottle was placed a solution of 37 . 47 g ( 0 . 099 moles ) 1 , 1 - dimethylethyl 2 -[ 3 -( 2 - bromophenyl )- 3 - oxo - 1 - propenyl ]- 1h - pyrrol - 1 - carboxylate in 150 ml of methyl alcohol and 1 . 90 g of platinum oxide . the reaction was placed under a 60 psi atmosphere of hydrogen and shaken until hydrogen uptake had stopped . the catalyst was filtered off and the filtrate was evaporated in vacuo to give 32 . 9 g of 1 , 1 - dimethylethyl 2 -[ 3 -( 2 - bromophenyl )- 3 - oxopropyl ]- 1h -]- pyrrolidine - 1 - carboxylate as a yellow oil ( 86 %). to a solution of 20 . 0 g ( 0 . 052 moles ) of 1 , 1 - dimethylethyl 2 -[ 3 -( 2 - bromophenyl )- 3 - oxopropyl ]- 1h - pyrrolidine - 1 - carboxylate in 100 ml of methyl alcohol placed under an atmosphere of nitrogen was added portionwise 3 . 10 g ( 0 . 09 moles ) of sodium borohydride pellets . after stirring overnight water was added and the methanol was evaporated in vacuo . the residue was partitioned between ether and water , and the ether layer was washed with brine and dried ( k 2 co 3 ). evaporation of the solvent in vacuo gave 19 . 42 g of 1 , 1 - dimethylethyl 2 -[ 3 -( 2 - bromophenyl )- 3 - hydroxypropyl ]- 1h - pyrrolidine - 1 - carboxylate as a brown oil ( 97 %). to 550 ml of 48 % hydrogen bromide was added 22 . 03 g ( 0 . 057 moles ) of 1 , 1 - dimethylethyl2 -[ 3 -( 2 - bromophenyl )- 3 - hydroxypropyl ]- 1h - pyrrolidine - 1 - carboxylate . the solution was heated to 60 ° c . for 30 min , placed in a freezer to cool and after five hr a solid was collected . the filtrate was evaporated in vacuo and a solution of 5 % water in 2 - propanol was added to the residue . after sitting in a freezer overnight , a solid was filtered which was identical to the first solid isolated . a total of 9 . 7 g of 2 -[ 3 - bromo - 3 -( 2 - bromophenyl ) propyl ] pyrrolidine hydrobromide was collected ( 40 %), mp 169 °- 170 ° c . to 100 ml of chloroform was added 10 . 21 g ( 0 . 024 moles ) of 2 -[ 3 - bromo - 3 -( 2 - bromophenyl ) propyl ] pyrrolidine hydrobromide and a solution of 6 . 6 g ( 0 . 048 moles ) potassium carbonate in 25 ml of water . the reaction mixture was stirred vigorously for four hr . the organics were separated off , washed with water , brine and dried ( k 2 co 3 ). the solvent was evaporated in vacuo to give 5 . 41 g of two diastereomers of 3 -( 2 - bromophenyl ) hexahydro - 1h - pyrrolizine ( diastereomer a and diastereomer b ). the diastereomers were separated by flash chromatography on silica gel using 1 : 5 acetone : hexane as the eluant . the first diastereomer to elute from the column , diastereomer a , was treated with a solution of hydrogen chloride in ether to give 460 mg of diastereomer a hydrochloride ( 6 . 3 %), mp 154 °- 157 ° c . diastereomer b was distilled in a kugelrohr collecting the distillate between 120 °- 130 ° c . at 0 . 01 mm hg . a 1 . 0 g sample of diastereomer b was collected as a clear oil ( 16 %). to a solution of 10 . 1 g ( 0 . 18 mole ) of potassium hydroxide in 2 . 18 l of water was added 176 . 4 g ( 1 . 32 mole ) of 4 - methylacetophenone and 50 g ( 0 . 53 mole ) of pyrrole - 2 - carboxaldehyde . the mixture was heated to 40 °- 45 ° c . with mechanical stirring under a nitrogen atmosphere overnight . the solid precipitate was filtered , washed with water and 2 - propanol , and air dried to give 42 . 1 g ( 38 % yield ) of the title compound as a solid , mp 158 . 5 °- 159 . 5 ° c . to a suspension of 42 . 1 g ( 0 . 2 mole ) of the product of example 3a in 400 ml of acetonitrile was added 1 . 95 g ( 0 . 16 mole ) of 4 - dimethylaminopyridine and 52 . 3 g ( 0 . 24 mole ) of di - t - butyldicarbonate . the solution was allowed to stir at room temperature overnight . the reaction was poured into 1 . 3 l of 1n potassium bisulfate and extracted with ether . the ether solution was dried over anhydrous potassium carbonate and concentrated to give 61 . 4 g ( 98 % yield ) of the title compound as a dark yellow oil which solidified on scratching . to a solution of 61 g ( 0 . 196 mole ) of the product of example 3b in 300 ml of absolute methanol was added 2 . 4 g of platinum oxide and the mixture was placed on a parr apparatus under 60 psi of hydrogen and shaken for 3 days . the mixture was filtered and the filtrate concentrated to give 56 . 5 g ( 90 % yield ) of the title compound as a brown oil . to a solution of 51 . 8 g ( 0 . 162 mole ) of the product of example 3c in 500 ml of dry chloroform was added 23 . 6 ml ( 0 . 32 mole ) of thionyl chloride dropwise with mechanical stirring . the mixture was allowed to stir for 2 hr at ambient temperature , basified with 3n sodium hydroxide and stirred overnight . the chloroform layer was separated , dried over anhydrous potassium carbonate , and concentrated to an oil . the oil was chromatographed on silica , eluting with 50 % acetone : hexane and the product bearing fractions were combined to give 7 . 5 g of an oil . this oil was distilled , and the fraction boiling at 80 °- 82 ° c ./ 0 . 1 torr was treated with ethereal hcl to give the salt which was recrystallized from acetonitrile to give 2 . 8 g ( 5 % yield ) of the title compound as a tan solid , mp 199 . 5 °- 203 . 5 ° c .	2
control units , especially for controlling passenger protection devices , such as airbags , belt pretensioners , or roll bars , must be highly reliable so as to prevent internal failures resulting in unwanted situations for vehicle passengers . for data transmission between the microcontroller in the control unit and the connected components in the control unit , the so - called asic &# 39 ; s , such as a firing circuit control system , or the sensors or interface modules , the spi ( serial peripheral interface ) is frequently used . in this instance , a line mosi ( master out slave in ) is used by the microcontroller to transmit data to the connected components , and an additional line miso ( master in slave out ) is used to allow the connected asic &# 39 ; s to transmit data to the microcontroller . the lines in question are separate . the serial peripheral interface has still further lines , such as the chip - select line and the clock line . these are indeed separate hardware lines . the μc controller provides this clock pulse via the clock lines to the connected asic &# 39 ; s , resulting in a synchronous data transmission . it is now clear that a clock signal error may result in faults in the functioning of the control unit . therefore , in accordance with the present invention , the clock signal is monitored based on the output signals of two clock outputs of the microcontroller , which can also be a different processor . this monitoring can be carried out by hardware or software . for hardware - based implementation , it is possible to use , for example , an exclusive - or ( non - equivalence ) element , whereas in the case of software - based monitoring , the microcontroller itself is used by feeding the output signals of the clock outputs back to inputs of the microcontroller . the software - based implementation has the advantage that the individual output signals can be monitored separately . in addition , when using two clock outputs , higher redundancy for the clock generation can be achieved by preferably oring the outputs which supply the clock signal . the figure is a block diagram of the control unit according to the present invention . the block diagram concentrates only on the essential elements of the present invention , so that other components which are also present in the device are not shown for the sake of simplicity . a microcontroller μc is connected via a data output mosi to asic &# 39 ; s 1 , 2 and n present in the control unit . line mosi is used for data transmission from μc to asic &# 39 ; s 1 , 2 and n . microcontroller μc is also connected to asic &# 39 ; s 1 , 2 and n via a data input . here , however , lines miso is used for data transmission of the asic &# 39 ; s to the microcontroller . the data transmission between the microcontroller and asic &# 39 ; s 1 , 2 and n can take place virtually in parallel . via further outputs 10 and 11 , clock signals of microcontroller μc are output , said clock signals being generated by microcontroller μc by dividing an oscillator signal . oscillators that can be used here include , for example , a pierce oscillator which can easily be set into oscillation and delivers a stable clock signal . clock outputs 10 and 11 are connected to diodes d 1 and d 2 , respectively ; the diodes , in turn , being interconnected to an input of an amplifier v . amplifier v then delivers the clock pulse sckr . this clock pulse then goes to components asic 1 , asic 2 and asic n . thus , microcontroller μc and asic &# 39 ; s 1 , 2 through n operate in parallel with respect to processing . however , the output signals of clock outputs 10 and 11 are each also supplied to inputs of an exclusive - or element . the exclusive - or element produces a signal at its output when the two input signals are different . this means that the exclusive - or element produces a 1 only if a 0 and a 1 , or a 1 and a 0 are present , otherwise it produces a 0 . a warning light driver 15 is controlled as a function of this output signal of exclusive - or element 12 . in the event of a fault , i . e ., when the two clock signals are different , said warning light driver activates a warning light to indicate the fault . alternatively or additionally , the output signals of clock outputs 10 and 11 can also be monitored by microcontroller μc itself . to this end , the output signals are fed back to two inputs 13 and 14 , respectively . microcontroller μc can then monitor the output signals by means of software . the microcontroller can do this , for example , by simulating the exclusive - or function by means of software , and by separately monitoring the output signals in terms of amplitude . microcontroller μc then generates a monitoring signal as a function thereof , said monitoring signal being used , for example , for controlling the warning light driver . however , it is also possible to display a warning on a display in the vehicle . inputs 3 and 4 should be assigned to different port groups . port groups are understood here to be adjacent inputs and outputs . clock outputs 10 and 11 should also belong to different port groups in order not to be geographically adjacent so as to prevent failure of the two clock outputs in the event of a hardware fault . instead of the spi communication , which is a bus communication , it is also possible to use point - to - point connections between microcontroller μc and the individual asic &# 39 ; s , respectively . however , other bus communications are also possible alternatively to the spi connection .	6
embodiments of the present invention will be described below with reference to the accompanying drawings . as noted previously , the methods and devices of this invention are disclosed herein with particular reference to a system for the automatic transfer of fragile wafers of material as widely used in the semiconductor electronics industry . in addition to the basic operation of wafer transfer , the disclosed system optionally includes pre - alignment and buffered storage of the wafers that have been presented to the system . however , it should be understood that the novel combination and subcombinations of the herein disclosed features have applicability to other fields in which articles analogous to semiconductor wafers require alignment or buffered storage or other specialized handling , as described herein , prior to the subsequent treatment of those articles . furthermore , it should also be understood that the various features of this invention , while highly effective when combined to provide an integrated apparatus such as the automatic wafer transfer system disclosed herein , have applicability independently of each other in the transfer , handling , pre - alignment , and storage or other treatment of semiconductor wafers or analogous material . the functional block diagram of fig1 shows the preferred embodiment with an input path to handle “ dirty ” unprocessed wafers separate from an output path for “ clean ” processed wafers . with the exception of the integrated notch aligner ( ina ) 500 , the subsystems are symmetrical between the two paths . this symmetry reduces the count of unique components comprising the wafer transfer system wts 10 thereby providing for an economy of scale in the manufacture and support of the wts 10 itself . controller 80 is in communication with each of the robotic subsystems within the wts 10 to issue commands to and receive status information from them . computer 70 oversees the entire wts 10 automation through a communication interface with controller 80 . the objective of the entire wts 10 is to transfer semiconductor wafers between one or more foups ( 20 and 25 ) and process bench ( es ) 90 . although process bench ( es ) 90 is depicted here as a single block , it is so labeled to point out that it may comprise a single or multiple processing systems within the block . it is an important advantage of the present invention that multiple processing systems are supported simultaneously by the wts 10 through the particular cassette buffering station 400 described herein . additionally , many of the processing systems that are supported in the block labeled process bench ( es ) 90 are restricted to either left - hand or right - hand interfaces to a wafer transfer system . this restriction requires that other wafer transfer systems be made available in both left - hand and right - hand configurations . the wts 10 of the present invention , through its cassette buffering station 400 , inherently accommodates both left - hand and right - hand configurations in a single wts 10 , whether process bench ( es ) 90 comprises a single or multiple processing systems . the three fig2 and 4 show the component devices of the wafer transfer system wts 10 of the present invention in three views , perspective , top and side , respectively . the system includes five main subassemblies : ( b ) a wafer transfer robot ( wtr ) 100 with an integrated notch aligner ( ina ) 500 , all subassemblies are mounted to a structural frame 60 . the robotics of the wts 10 automation are controlled by controller 80 under the supervision of computer 70 . in operation , a foup 20 containing a collection of one or more wafers , which are in a horizontal orientation , is placed at a load port 50 where the foup 20 is locked into place to prevent contaminants from entering the wts 10 . the foup 20 is then opened by a pod door opener ( pdo ) 30 which is shown for location purposes only but is not detailed here as it is known in the art . a typical pdo 30 will engage pins to support the openable face of the foup 20 , then the pdo 30 will rotate locking devices built into the openable face to unlock it , pull it away from the foup 20 and move it to a holding position below the deck plane 65 of the working area within the wts 10 . the majority of the automation components and all of the wafer transferring exist above the deck plane 65 . the majority of the electrical and mechanical assemblies function below the deck plane 65 . this prevents contamination , enhances safety measures , and facilitates servicing of the wts 10 . the details of the load ports 50 and 55 along with their associated pod door openers are unimportant . these subassemblies , though physically located within the environment of the wts 10 , serve merely as an interface to foups 20 and 25 for the exchange of wafers . for dimensional references herein , consider the openable face of the foup 20 as attaching to the load port 50 in an xz - plane and that the y - axis extends backward , away from such a mounting plane , toward where the wts 10 interfaces with processing bench ( es ) 90 . the wtr arm 120 moves along horizontal rail 110 on the y - axis ( refer to fig5 for a detailed close - up ) and rotates about its point of attachment 130 ( to the horizontal rail 110 ) in order to position the y - shaped end effector 140 at the openable face of the foup 20 . the wtr arm 120 then moves along the horizontal rail 110 to drive the y - shaped end effector 140 into the foup 20 coming to a position directly below and in proximity to a wafer 40 . the wtr pedestal 150 ( in fig6 and 7 ) raises the horizontal rail 110 vertically along the z - axis , lifting the wafer 40 from its support in the foup 20 . the wtr arm 120 then reverses along the horizontal rail 110 withdrawing the wafer 40 from the foup 20 . the wtr arm 120 then rotates about its point of attachment 130 . with the wafer resting on the end effector 140 , fully removed from the foup 20 , the wts 10 can perform notch alignment . fig6 and 7 , along with fig5 are useful to understand the integrated notch aligner ( ina ) 500 in relation to the wafer transfer robot wtr 100 . the ina 500 comprises a vacuum chuck 510 with a rotary drive 515 . to begin integrated notch alignment , the wtr arm 120 rotates , positioning the end effector 140 above the vacuum chuck 510 . the wtr lowers the wafer 40 to position the center of the wafer 40 on top of the vacuum chuck 510 . the end effector 140 remains in this position until the notch is aligned . the vacuum chuck 510 applies a vacuum to the wafer 40 holding the wafer while the wafer is spun by a rotary drive 515 . the laser 520 locates the notch 45 . once the notch 45 is found , the rotary drive 515 turns the vacuum chuck 510 to rotate the wafer 40 in order to place the notch 45 in a pre - selected position . the wtr 100 raises the end effector 140 lifting the wafer 40 from the vacuum chuck 510 . the ina 500 integrates notch alignment with the wafer loading sequence . systems of notch alignment in the prior art deposit wafers to a separate machine for alignment from which they are then retrieved by yet another machine . that method has a larger footprint and lower system reliability than the method disclosed herein . the ina 500 of the present invention introduces a timesaving element by eliminating both the need for a separate mechanism and the number of wafer transfer motions . the ina design herein described also provides more reliable notch alignment functionality than the prior art since reducing the number of moves in the automation results in a safer method of wafer transfer . also , total footprint of the tool can be reduced since a separate location for notch alignment is not necessary . once the wafer 40 is removed from the foup 20 , and notch alignment , if incorporated , is complete , the wtr arm 120 continues rotation and travel along the horizontal rail 110 towards the cassette inversion mechanism ( cim ) 200 until the end effector 140 is positioned at substantially 180 ° rotation away from the openable face of the foup 20 . the end effector 140 and wafer 40 are now positioned directly in front of a cassette 210 for insertion of the wafer 40 into the cassette 210 . the cassette inversion mechanism ( cim ) 200 , described in fig8 and 10 , comprises a cassette holder 220 connected at a distal end of a pivotable arm 280 which in turn is mounted to a vertical rail 270 supported by a rotatable pedestal 260 . the cassette 210 may be any one of several open transfer cases commonly used in the industry to accommodate a specific process system at process bench ( es ) 90 . such cassettes typically have slots that include combs 230 for holding the wafers at three or four points of contact ; such combs being analogous to the mechanism for supporting wafers within a foup 20 . the cassette 210 is locked into place in the cassette holder 220 with a cassette locking member 250 , as the cassette 210 is loaded with wafers 40 by the wtr 100 . the wtr arm 120 advances along the y - axis positioning the wafer 40 horizontally in the cassette 210 above one of a collection of slots . the horizontal rail 110 and attached wtr arm 120 moves vertically down along the z - axis setting the wafer 40 into the slot . the arm wtr 120 then reverses travel along the y - axis towards the foup 20 to retrieve the next wafer 40 . if wafers are needed from the test wafer station ( tws ) 300 , the wtr 100 can position as required to retrieve the necessary wafer or wafers . the tws 300 supports a collection of wafers in a horizontal orientation using a means analogous to the combs of the cassettes . when initial loading of the cassette 210 begins , the cim 200 is at its lowest height . this allows the wtr 100 to load the first wafer 40 into the top - most slot of the cassette 210 . due to the high sensitivity to contaminants , the automation should always be below the wafer 40 . loading of wafers is performed from the top down , while unloading is done from the bottom up . for the first wafer transfer , the top slot of the cassette 210 , the wafer 40 on the wtr end effector 140 , and the bottom slot of the foup 20 are in the same horizontal plane . the cim 200 indexes the cassette 210 upwards in the same increments as the wtr 100 , both indexing to the height of the next wafer in the foup 20 so that the wafer transfer is always accomplished in a horizontal plane . after the cassette 210 is fully loaded , the cim pedestal 260 rotates and the pivotable arm 280 pivots simultaneously to invert the wafers from a wafer horizontal orientation for loading by the wtr 100 , to a wafer vertical orientation for placement at the cassette buffering station ( cbs ) 400 . the cassette inversion mechanism of the present invention allows for cassette loading and unloading in a wafer horizontal orientation . the cassette inversion mechanism of the present invention also allows for inversion of the cassette in a single coordinated motion so that the wafers are positioned in a wafer vertical orientation reducing wafer transfer time , increasing throughput and ensuring safe product handling . the cassette buffering station ( cbs ) 400 ( see fig4 ) is located at the back of the wts 10 in proximity to the process bench ( es ) 90 . the cbs 400 interfaces with the cim 200 and processing bench automation included in the process bench ( es ) 90 . the cbs 400 contains two subsystems ( fig2 and 3 ): a buffer queue and storage area 460 , and a cassette buffer handling mechanism 410 . the buffer queue and storage area 460 contains a plurality of shelves 470 that are static . the shelves 470 are attached to a frame member near the back of the wts frame 60 and are located so as to be accessible by the automation of the process bench ( es ) 90 and the cassette buffer handling mechanism 410 . each of the plurality of shelves 470 includes placement pins to ensure proper placement and alignment of a cassette 210 on the shelf 470 according to the requirements of the specific , perhaps custom , cassette 210 . sensors may also be used to ensure proper alignment of the cassette . the cassette buffer handling mechanism 410 ( fig3 ) is located along an x - axis between the cassette inversion mechanism 200 and the buffer queue and storage area 460 . the cassette buffer handling mechanism 410 ( as detailed in fig1 , 13 and 14 ) includes a motor driven trolley 440 mounted to a carriage 450 for horizontal translation of the trolley 440 along the carriage 450 on an x - axis . a pair of pivotable arms 480 ( detailed in fig1 ) extends from the trolley 440 and is configured to permit rotation of the pair of pivotable arms 480 about a pair of pivotable arm connections 490 . the pair of pivotable arms 480 is attached to the trolley 440 in such a manner as to permit translation of the arms along a z - axis . each of the pair of pivotable arms 480 includes a generally y - shaped active end effector 420 described elsewhere in the art . each of the generally y - shaped active end effectors 420 includes grippers 430 for gripping the cassette 210 firmly during transport . once the cim 200 positions the cassette 210 in the wafer vertical orientation , the carriage 450 of the cassette buffer handling mechanism 410 travels along the x - axis as required to align the grippers 430 with pins at both ends of the cassette 210 . the pivotable arms 480 pivot to position the active end effectors 420 relative to the cassette 210 so that the grippers 430 may secure the cassette 210 . sensors may indicate that the cassette 210 is in position and held securely by the active end effectors 420 . the active end effectors 420 may include active or passive safety devices to ensure that the cassette 210 remains securely held , especially in the event of a power failure . the pivotable arms 480 raise the cassette 210 and the trolley 440 traverses along the x - axis on the carriage 450 . the pivotable arms 480 align the cassette 210 with one of the shelves 470 in the cassette buffering station 400 and move upward along the z - axis as required to permit the pivotable arms 480 to pivot past top dead center to place the cassette 210 in the cbs 400 . placement pins and sensors on the shelf 470 indicate that the cassette 210 is properly placed . the grippers 430 release the pins of the cassette 210 and the pivotable arms 480 pivot back towards top dead center . the cassette 210 is stored at the buffer queue and storage area 460 until retrieved by the bench automation of process bench ( es ) 90 for processing . the process bench automation directly interfaces with the wts 10 at the buffer queue and storage area 460 . access is provided so that the bench automation of process bench ( es ) 90 can pick up from and drop off to any of the storage shelves 470 in the buffer queue and storage area 460 . cassette 210 in the buffer queue and storage area 460 supports wafer 40 in the vertical orientation so as to be ready for immediate direct transfer as needed by the process bench ( es ) 90 for processing . by adding integral cassette storage capacity to this wts 10 design , the cassette buffering station 400 reduces the overall floorspace requirement of the process system . also , since this approach to buffered storage is accomplished without additional interfaces , scheduling and cassette management in this wts 10 become the responsibility of the wts 10 under supervision of its dedicated computer 70 and the associated controller 80 . this offloads the bench automation of process bench ( es ) 90 and allows the bench automation to devote its full functionality to wafer processing , while improving system reliability through reduction of the number of machines required . an additional advantage to the cbs 400 of the present invention is that the symmetrical design allows one wts 10 to hand - off or transfer cassettes to more than one discrete processing system within process bench ( es ) 90 . furthermore , the carriage assembly 450 of the cbs 400 is expandable to service multiple processing systems within process bench ( es ) 90 , providing a very cost effective cassette buffering solution to many industry customers . the present invention , described above as an apparatus , also includes a method for wafer transport which includes the steps of picking a wafer 40 from a transport carrier ( such as a foup 20 ), the wafer 40 having a wafer horizontal orientation , placing the wafer in a wafer horizontal orientation in a cassette 210 held by a cassette inversion mechanism ( cim ) 200 , inverting the cassette 210 and the wafer 40 contained in the cassette to a wafer vertical orientation , picking the cassette 210 and the wafer 40 from the cassette inversion mechanism 200 and placing the cassette 210 and the wafer 40 into a cassette buffering station 400 with the wafer in a wafer vertical orientation . although the present invention has been described herein with reference to particular embodiments and drawing figures , it should be apparent to those skilled in the art that there are a host of other designs which can be implemented in keeping with the intent of the present invention . for example , although the invention has been described as being used in the automatic handling , transporting and pre - alignment of thin fragile wafers of semiconductor material , and more specifically that which is 300 - mm in diameter , the principals of the present invention could be employed in any context in which a compact and efficient handling mechanism is required . the selection , design and arrangement of the various components described herein may be modified without departing from the spirit and scope of the invention as represented in the attached claims . it should also be understood that the various features of this invention , while highly effective when combined to provide an integrated apparatus such as the herein disclosed wafer transfer system , have applicability independently of each other in the retrieval , handling and pre - alignment or other treatment of wafers or analogous devices of other composition .	8
the following patents and patent applications are hereby incorporated by reference in their entirety as though fully and completely set forth herein : u . s . provisional application no . 60 / 031350 titled &# 34 ; spread spectrum cordless telephone system and method &# 34 ; and filed nov . 21 , 1996 , whose inventors are alan hendrickson , paul schnizlein , stephen t . janesch , and ed bell ; u . s . application ser . no . 08 / 975 , 142 , titled &# 34 ; passband dqpsk detector for a digital communications receiver front end &# 34 ; and filed nov . 20 , 1997 , whose inventors are alan hendrickson and paul schnizlein ; u . s . application ser . no . 08 / 968 , 202 , titled &# 34 ; an improved phase detector for carrier recovery in a dqpsk receiver &# 34 ; and filed nov . 12 , 1997 , whose inventors are stephen t . janesch , alan hendrickson , and paul schnizlein ; u . s . application ser . no . 09 / 078 , 225 , titled &# 34 ; symbol - quality evaluation in a digital communications receiver &# 34 ; and filed may 13 , 1998 , whose inventor is alan hendrickson ; u . s . application ser . no . 08 / 968 , 029 , titled &# 34 ; a carrier - recovery loop with stored initialization in a radio receiver &# 34 ; and filed nov . 12 , 1997 , whose inventors are stephen t . janesch , paul schnizlein , and ed bell ; and u . s . application ser . no . 09 / 078 , 145 , titled &# 34 ; a method for compensating filtering delays in a spread - spectrum receiver &# 34 ; and filed may 13 , 1998 , whose inventor is alan hendrickson , now u . s . pat . no . 5 , 940 , 435 . as shown in fig1 a digital communication system comprises at least one transmitter 100 and one receiver 150 for the communication of data . such communication systems are well known in the art . the system described in this figure uses differential quadriphase - shift keying ( dqpsk ) to convey data from a transmitter to a receiver . although not depicted here , other modulation schemes such as ask , fsk , and other variants of psk could also be used to convey the data . in the transmitter 100 , digital data 102 are provided to a modulator 106 . a transmitter reference oscillator 104 generates a sinusoidal carrier wave 105 for the modulator 106 . the digital data 102 are encoded onto the sinusoidal carrier wave 105 by the modulator 106 which shifts the carrier &# 39 ; s phase by multiples of 90 ° according to the technique of dqpsk modulation , a technique well - known in the art . in this technique , the modulator 106 shifts the phase of the carrier wave by multiples of 90 ° to generate a transmitted signal 108 ; these phase shifts are the symbols that encode the data . each symbol lasts for a duration of time t after which the next phase shift is introduced to the carrier . the differences in phase angle between successive symbols represent the transmitted data 102 . since there are four possible symbols ( shifts of 0 °, 90 °, 180 °, or 270 °) in qpsk modulation , each phase difference represents two bits of the transmitted data . the carrier wave &# 39 ; s frequency is determined by the reference oscillator 104 in the transmitter . the transmitted signal 108 is the sinusoidal carrier wave with the data - bearing phase shifts of duration t . the transmitted signal 108 is sent via a physical commnunication channel 190 to the receiver 150 . the channel depicted in this figure is a radio transmission system that modulates the transmitted signal onto a radio wave 194 with a frequency greater than the carrier wave frequency . the channel 190 depicted here comprises the radio - frequency ( rf ) modulator 192 , the radio wave 194 transmitted through the air , and the rf demodulator 196 . as would be known to one skilled in the art , other communications channels such as transmission line , waveguide , or optical fiber systems can of course be used instead of ( or in conjunction with ) the depicted radio transmission system . under ideal conditions the received signal 158 would be an exact replica of the transmitted signal 108 . in practice , however , there may be some differences between these two signals due to degradation suffered in the communication channel . in the receiver 150 , the received signal is demodulated by a demodulator 156 to extract the received data 152 . ideally , the received digital data 152 would replicate the transmitted digital data 102 , but in practice the two sets of data may differ due to decoding errors in the receiver , or degradation of the transmitted signal in the communications channel . to extract the data from the received signal , the demodulator 156 requires a reference signal that closely reproduces the carrier wave 105 . since the original carrier wave 105 is not usually available in the receiver unit , this reference 155 is generated by a reference oscillator 154 in the receiver . in a preferred embodiment of the receiver , the reference oscillator 154 is a digitally controlled oscillator ( dco ); that is , it accepts a digital input word that controls the frequency of the oscillator &# 39 ; s output . this oscillator 154 must match the frequency of the transmitter oscillator 104 that generated the carrier wave 105 : if the frequencies of the two oscillators are not matched , the receiver unit 150 cannot efficiently demodulate the transmitted signal . the receiver oscillator 154 can be built so that its natural frequency is close to that of the transmitter oscillator 104 , but due to variations in manufacturing and differences in operating environments there will be drifts between the two oscillators . to compensate for such offsets in frequency between the carrier wave and the receiver oscillator , the receiver oscillator is locked to the carrier wave by incorporating it into phase - locked loop ( pll ). the pll is a carrier - recovery loop 162 that ties the frequency of the receiver oscillator 154 to the frequency of the transmitter oscillator 104 . the feedback from the carrier - recovery loop 162 corrects offsets between the frequencies of the receiver oscillator and the carrier . the depiction of the receiver in fig1 includes a basic block diagram of the carrier - recovery loop 162 . the carrier - recovery loop 162 includes the basic elements of a pll : the receiver oscillator 154 , a phase detector 164 , and the loop filter 166 . fig2 shows an embodiment of the carrier - recovery loop 162 . the phase detector 164 receives the received signal 158 and the receiver reference signal 155 . with these two inputs , the phase detector 164 compares the receiver oscillator &# 39 ; s phase to the phase of the carrier wave and generates a digital phase error signal 165 indicative of the phase shift between them . the phase error signal 165 is then provided to the loop filter 166 which comprises a novel configuration as described below . the loop filter 166 uses digital processing elements to condition the phase error signal 165 to generate a feedback signal 167 ; this feedback signal is fed back to the digitally controlled receiver oscillator 154 to nullify its offset from the carrier frequency . in the implementation of the carrier - recovery loop presented in this figure , the digital feedback signal is fed back to the receiver oscillator 154 , which produces the receiver reference signal 155 . the receiver reference signal 155 is made available to the phase detector for comparison with the received signal 158 . as shown in fig2 the loop filter 166 comprises a multiplier 201 with a gain coefficient k1 , which receives the phase error signal 165 and provides an output to a digital adder 204 . the loop filter 166 also comprises a multiplier 202 with a gain coefficient k2 , which receives the phase error signal 165 and provides an output to an integrator 203 in the loop filter . the integrator 203 in turn provides an output to the digital adder 204 . the digital adder 204 provides the sum of its two inputs to the receiver oscillator 154 . the gain coefficients k1 and k2 in multipliers 201 and 202 are adjustable binary values stored in a memory 210 . the integrator 203 accumulates the value of the phase error signal 165 after it has been scaled by the gain coefficient k2 in multiplier 202 . the digital adder 204 combines this integrated signal with a version of the original phase error signal that has been scaled by the gain coefficient k1 in multiplier 201 . thus the complex - frequency transfer function of the loop filter is k 1 + k 2 / s . with this implementation of the loop filter , the complex - frequency transfer function h . sub . θ ( s ) for the full carrier - recovery loop is given by the following equation . ## equ1 ## here φ ( s ) represents the phase of the receiver oscillator ( in the complex - frequency domain ), and θ ( s ) represents the phase of the received signal 158 . the pll thus has a low - pass response to changes in input frequency . the time constant for its response is determined by the gain coefficients k1 and k2 . since the gain coefficients are binary values stored in the memory 210 , they can be adjusted to put the carrier - recovery loop into one of several different operating modes . in the present invention , the receiver has three operating modes : acquisition , tracking , and hold . to enter the acquisition mode , the receiver sets these coefficients to the appropriate acquisition values each time the receiver begins carrier recovery . in acquisition mode , the pll of the preferred embodiment has a low - pass response to input frequency change . the receiver changes from the acquisition to tracking mode by reprogramming the gain coefficients k1 and k2 in the loop filter to lower values that are appropriate when the oscillator is close in frequency to the received signal . in tracking mode , the values of k1 and k2 are reduced so that the pll slows its response time , thereby reducing its sensitivity to high - frequency noise . this change from acquisition mode to tracking mode occurs when the receiver oscillator is determined to be adequately matched to the frequency of the received signal . there are several possible criteria for changing between these modes . one criterion for making this switch from acquisition mode to tracking mode is that the recovered frequency should be within a set range ( typically 1 khz ) of the actual input frequency . a second requirement is useful in systems that receive digital data in these systems , the switch to tracking mode can be additionally delayed until the receiver has acquired a frame synchronization with the received signal . in hold mode the receiver oscillator is not allowed to adapt , so that it continues to produce its last known frequency . this mode is used to sustain the appropriate frequency during fades in the received signal . in this mode the gain coefficients k1 and k2 have values of zero . alternatively , this mode can be accomplished by holding the value of the digital feedback signal constant or by forcing the ( phase error ) input to the loop filter to zero . the latter means can be used to conserve power in tdd ( time - division duplex ) communication systems . it allows the clock to the multipliers for k1 and k2 and the integrator to be stopped during the transmit portion of the tdd frame , reducing their power requirements by up to a factor of two . the block diagram in fig3 shows an implementation of the preferred embodiment of the loop filter 166 . in this implementation , an input register 305 receives a 5 - bit number representing the digital phase error signal 165 . the bits of this number are sent to a multiplier 301 that multiplies them by the gain coefficients k1 and k2 . since these gain coefficients are powers of 2 , the multiplier works by shifting the input by an appropriate number of bits , as described below , to generate a 14 - bit product 325 in an output register 320 . the multiplier alternates between using k1 and k2 to multiply the phase error signal 305 , so the product 325 represents the phase error multiplied by k1 on one clock cycle , and then the phase error multiplied by k2 on the next clock cycle . the product 325 is sent to a time - multiplexed adder 330 that alternates its function from cycle to cycle . during a cycle in which it receives the product of k1 and the phase error signal from the multiplier 301 , it adds this product to a value that it receives from an integrator register 340 . the resulting sum is a 14 - bit number representing the feedback signal 167 , which is the output of the loop filter . on alternate cycles , the time - multiplexed adder 330 receives the product of k2 and the phase error signal from the multiplier 301 . during these cycles it adds the product to the value it receives from an integrator register 340 ; this sum 335 is then sent back to the integrator register 340 and is stored there . this implementation realizes the function of the loop filter 166 that was described in the discussion of fig2 . when the carrier recovery loop is in the hold mode , the input register is simply set to contain all zeroes , regardless of the value of the phase error 165 . the resulting feedback signal 167 is then also zero , as required for the hold mode . for the other two modes , tracking and acquisition , the multiplier multiplies the phase error signal 165 by the appropriate values of k1 and k2 . the multiplier 301 is implemented by the connections and elements contained in the dashed box in fig3 . the five bits in the input register 305 are sent via a set of connections 310 to fourteen selection units 315a - n . these selection units are each coupled to one of the bits in the multiplier &# 39 ; s output register , and they each copy either one of the bits from the input register or a zero into their corresponding bit in the output register . the different selection units are configured so that the output register receives a copy of the bits in the input register , but shifted by the appropriate number of places according to the multiplier ( k1or k2 ). fig4 presents a more detailed block diagram of the selection units 315a - n in the multiplier 301 . as described earlier , each selection unit receives one or more bits from the input register 305 via the a set of connections 310 . in this figure , these bits are shown as the binary inputs 410 for one of the selection units . the inputs are sent to a multiplexer 415 which selects one of them , or a zero 411 , as the selection unit &# 39 ; s output 420 . this output is sent to one of the bits in the multiplier &# 39 ; s output register ( as was shown in fig3 ). a logic block 440 controls the multiplexers 415 in the selection units 315a - n by generating a shift code 460 that determines which of the binary inputs 410 is selected by each multiplexer 415 . the logic block 440 chooses which input bit is selected by the multiplexer so that the multiplier output register 320 receives an appropriately shifted copy of the input register 305 . to determine the number of places by which the multiplier input 165 should be shifted , the logic block receives the four different values of the multiplier : the value of k1 for lock mode 431 , the value of k1 for acquisition mode 432 , the value of k2 for lock mode 433 , and the value of k2 for acquisition mode 434 . these values are pre - programmed into a memory as appropriate for the different modes . another input 450 to the logic block 440 indicates the cycle in the time - multiplexing ; that is , whether k1 or k2 is being used as a multiplier . the logic block 440 also has an input 455 that indicates the operating mode of the carrier recovery loop : lock or acquisition . these two inputs 450 and 455 determine which of the four multiplier values 431 - 434 is used by the logic block 440 . with this multiplier value , the logic block 440 generates the shift code 460 and provides it to the multiplexer 415 . in response to the shift code 460 , the multiplexer 415 selects one of the input bits 410 from the input register 305 or a zero 411 as the selection unit output 420 that is sent to the corresponding bit of the multiplier output register 320 . in this preferred embodiment , the output of the logic block 440 indicates the shift code , that is , the number of bits to shift the input value 165 stored in register 305 . the logic needed in block 440 to generate the shift code is easily implemented by one skilled in the art of logic design , and the multiplexer arrangement is well known as a &# 34 ; shifter &# 34 ; or &# 34 ; barrel shifter &# 34 ; the constraint that each of k1 and k2 be a power of 2 allows the shifter to function as a multiplier . this embodiment of the invention utilizes factors k1 and k2 that are less than 1 , thus negative powers of 2 ( k1 , k2 = 2 n ; n =- 1 , - 2 , - 3 , . . . ). however , in another embodiment of the present invention , the factors k1 and k2 can also take values that are greater than or equal to 1 ( k1 , k2 = 2 n ; n = 0 ,± 1 ,± 2 , ± 3 , . . . ), and the shift are chosen appropriately . the sequence of steps which constitute the carrier recovery are illustrated by the flowchart in fig5 . in this diagram , the bold blocks and flow - lines on the right indicate the steps and the flow between them , while the light boxes on the left indicate quantities that are calculated and used in these steps . from the starting conditions 501 , the first step 503 is to program the appropriate gain coefficients for the current operating mode into the memory 210 . the next step is to receive the received signal 505 . the error signal 165 representing the offset of the receiver oscillator 154 ( shown in fig1 and fig2 ) is generated in the next step 510 . the error signal 165 is filtered in the following step 515 according to the gain coefficients k1 and k2 received from memory 530 . this filtering step 515 generates the feedback signal 167 that is used in the next step 520 to adjust the receiver oscillator so that it better matches the received signal . after this adjustment , the recovery loop returns to its initial step 505 to repeat the procedure with a new sample of the received signal . the step 515 of filtering the error signal is expanded in fig6 . here the bold blocks and flow - lines in the middle of this figure indicate the filtering steps and the flow between them , while the light boxes on the left and right indicate quantities that are calculated and used in these steps . the start of the filtering procedure 601 is right after the error signal has been generated 510 ( as was shown in fig5 ). in the first step 610 of the filtering procedure the error signal 165 is multiplied by the gain coefficient k1 received from memory 530 to generate the product 650 of these two quantities . the product 650 is then added in the next step 615 with a signal 660 representing the integral of the error signal 165 multiplied by the gain coefficient k2 . the resulting sum is the digital feedback signal 167 , which is the output of the filtering procedure 515 . to update the integrated signal 660 , the next step 620 in the filtering procedure 515 multiplies the error signal 165 with the gain coefficient k2 received from memory 530 . the resulting product 655 is then added 625 to the integrated signal 660 . the resulting sum , which represents the incremented value of the integrated signal 660 , replaces the old value of the integrated signal 660 . having thus generated an updated value for the feedback signal 167 and the integrated signal 660 , the filtering procedure comes to a termination 699 , and the carrier recovery of fig5 proceeds to adjust the receiver oscillator in step 520 . in one embodiment of the invention , the integrated signal 660 is stored in a memory 665 ( shown in fig6 ) which then holds a stored integrator value . the value in this memory 665 is then used to as an initializing value for the integrated signal 660 . the memory 665 is operable to provide its value back to the integrated signal 660 when the carrier recovery loop begins to acquire a new phase lock . this feature of storing the integrated signal 660 in a memory 665 is especially useful in carrier recovery loops that are incorporated into some time - division duplexing ( tdd ) or time - division multiple access ( tdma ) transceivers , in which a unit alternates between receiving and transmitting data . it is a well - known problem in tdd and tdma radio architecture to have frequency shifts in reference oscillators between transmission and reception modes . this frequency pulling occurs due to operating differences between the transmission and reception modes , such as changes in the output impedance of a reference oscillator . in another embodiment of the invention , the receiver 150 and the rf demodulator 196 from fig1 are incorporated in a tdd radio transceiver along with a local transmitter and a local rf modulator . in this embodiment , an rf oscillator in the rf demodulator 196 is used to demodulate the rf signal 194 during reception , and is also is used by the local rf modulator to generate an rf carrier during transmission . the frequency of this oscillator undergoes transient frequency shifts as shown in fig7 a . in this graph , the rf oscillator frequency is plotted versus time over the duration of a tdd iframe . the vertical axis on the left of the figure indicates a center rf value f 0 . in this embodiment , the oscillator frequency , shown by the light curve , has a rapid positive jump when the transceiver begins to receive data . the rf oscillator frequency gradually returns to f 0 , then suffers a rapid negative jump as the transceiver switches to transmit data , and again gradually returns to f 0 . this pulling of the rf oscillator frequency can lead to significant data losses if it is not compensated , since the large frequency shifts place significant demands on the carrier - recovery loop 162 . if the carrier recovery loop fails to track the frequency shifts for a portion of the data reception , the received data will be lost for that portion of the reception . traditionally , this pulling has been compensated by rf design modifications of the rf demodulators 162 in the prior art . however , in this embodiment of the invention , the stored integrator value in the memory 665 can be used to remedy the effects of the rf frequency pulling . the heavy curve in fig7 a illustrates an example of the recovered frequency for the dco 154 in this tdd embodiment of the invention . the recovered frequency is at an intermediate frequency ( if ) that is lower than the frequency of the rf signal 194 , but variations in the rf oscillator frequency lead to corresponding variations in the recovered frequency . the vertical axis for the recovered frequency is on the right in the figure . the center value f 0 &# 39 ; on this axis indicates the corresponding phase - locked recovered frequency when the rf oscillator is at f 0 . variations in the rf oscillator lead to a corresponding hertz - for - hertz variation in the locked recovered frequency . thus , on this graph , the heavy curve showing the recovered frequency would lie on top of the light curve showing the rf oscillator frequency if the carrier - recovery loop 162 were ideally tracking the frequency - pulling of the rf oscillator . this would not , however , be the optimal condition for carrier recovery , since if the loop 162 is fast enough to track such a large sudden shift , then it may be too susceptible to high - frequency noise to maintain an adequate lock . instead , this tdd embodiment of the invention uses the digital word stored in the memory 665 to mitigate the effects of tdd frequency pulling . as shown by the heavy curve in fig7 a , over the duration of a tdd frame , the recovered frequency starts at some initial value f 1 &# 39 ; and may have a significant offset from the received signal as the carrier - recovery loop attempts to match the sudden change in received frequency . the tdd frames are structured so that no payload data are transmitted during the initial portion of each transmitted data frame . this portion , called the preamble , is used to allow feedback loops to settle during the initial reception of a data frame . at the end of the preamble , the recovered signal has come closer to its target value ( of lying on top of the rf oscillator curve ). the exact curve followed by the recovered frequency depends on the form of the frequency pulling and on the response characteristics of the carrier recovery loop 162 . the recovered frequency f 2 &# 39 ; at the end of the preamble is stored in memory 665 and is used as the initializing value for the recovery frequency at the beginning of the next received frame . as shown in fig7 b , by starting from this improved initial value f 2 &# 39 ; , the carrier - recovery loop more quickly approaches a phase lock during the second received frame . at the end of the preamble in the second received frame , the memory 665 stores a further - improved approximation f 3 &# 39 ; of the starting recovered frequency . this new approximation is used in the following frame , as shown in fig7 c . thus by building on values previously stored in memory 665 , the carrier - recovery loop 162 converges on a good initializing value for the start of a received data frame . this initializing value allows the carrier - recovery loop 162 to maintain a tight lock with the received signal 158 despite the transient frequency jumps in the rf oscillator of the rf demodulator 196 . it is to be understood that multiple variations , changes and modifications are possible in the aforementioned embodiments of the invention described herein . although certain illustrative embodiments of the invention have been shown and described here , a wide range of modification , change , and substitution is contemplated in the foregoing disclosure and , in some instances , some features of the present invention may be employed without a corresponding use of the other features . accordingly , it is appropriate that the foregoing description be construed broadly and understood as being given by way of illustration and example only , the spirit and scope of the invention being limited only by the appended claims .	7
while the specification concludes with claims particularly pointing out and distinctly claiming the subject matter regarded as forming the present invention , it is believed that the invention will be better understood from the following detailed description of preferred embodiments taken in conjunction with the accompanying drawings , in which : fig1 is a graphical representation which shows the effect of catalase on cytochrome c - rgds - stimulated ingestion of igg - opsonized sheep erythrocytes ( eigg ). ( a ). pmn and eigg were incubated with the final concentrations of cc - rgds ( 20 , 40 , 60 , or 80 μg / ml ) in the presence of either 5000 ( 5k ) units / ml of native catalase (▴) or catalase heated at 100 ° c . for 10 min (). after 30 min at 37 ° c ., phagocytosis was assessed as a phagocytic index , the number of eigg ingested / 100 pmn ( pi ). ( b ). pmn and eigg were incubated with increasing concentrations of catalase in the presence (▴) or absence () of 40 μg / ml of cytochrome c - rgds ( cc - rgds ). after 30 min at 37 ° c ., phagocytosis was assessed as a pi . fig2 is a graphical representation which shows the effect of catalase on ingestion of eigg by pmn adherent to control or vitronectin - coated surfaces . plastic lab - tek chambers were coated with either carbonate buffer , ph 9 . 6 ( control ) or 10 μg / ml of vitronectin in carbonate buffer ( vn ) for 2 hrs at 37 ° c . after washing the chambers , pmn ( 2 . 5 × 10 4 / well ) were adhered in the presence or absence of 5k units / ml catalase for 45 min at 37 ° c . catalase was removed by extensive washing . the eigg were added and phagocytosis assessed as a pi after 30 min at 37 ° c . fig3 is a graphical representation which shows the effect of mab b6h12 and polyclonal fab anti - vitronectin receptor ( vnr ) on cc - rgds - stimulated ingestion of eigg . pmn were incubated with the indicated concentrations of either mab b6h12 ( a ) or polyclonal anti - vnr ( b ) for 15 min at room temperature . without washing , the eigg were added and the mixture incubated with (▴) or without () 40 μg / ml of cc - rgds . after 30 min at 37 ° c . phagocytosis was assessed as a pi . fig4 shows the immunoprecipitation from surface - labelled pmn with mab b6h12 or polyclonal anti - vitronectin receptor . surface - iodinated pmn lysates were immunoprecipitated with the following antibodies : lane 1 , pre - immune rabbit serum ; lane 2 , rabbit polyclonal anti - vnr ; lane 3 , mab 7g2 ( anti - vnr beta chain ); lane 4 , mab b6h12 ; and lane 5 , mab b3f12 ( anti - vnr ). the immunoprecipitates were analyzed under reducing conditions , 50 mm dithiothreitol ( dtt ), by sodium dodecylsulfate polyacrylamide gel electrophoresis ( sds - page ). fig5 shows the immunoprecipitation from surface - labelled platelets and pmn with mab b6h12 and mab 7g2 . surface - iodinated platelets ( lanes 1 & amp ; 2 ) and pmn ( lanes 3 - 5 ) were immunoprecipitated with the following antibodies : lanes 1 and 3 , mab b6h12 ; lane 2 , mab 7g2 ; and lanes 4 and 5 , mab b3f12 . the precipitates were analyzed under non - reducing conditions by sds - page . fig6 is a graphical representation which shows the mab b6h12 profile of normal and leukocyte adhesion deficient ( lad ) pmn as analyzed by fluorescence activated cell sorter ( facs ). normal pmn ( a ) and lad pmn ( b ) were analyzed by indirect immunofluorescence for mab b6h12 . both normal and lad pmn express the b6h12 antigen . lad pmn are unable to express the mac - 1 , lfa - 1 , p150 , 95 because of an abnormality in beta chain synthesis . fig7 is a graphical representation which shows that fibronectin ( fn ) and its cell - binding domain ( cbd ) stimulate ingestion of eigg in a manner dependent on b6h12 antigen . ( a & amp ; b ). pmn were incubated with 5k units / ml catalase and a 1 : 20 dilution of tissue culture supernatant containing either mab b6h12 () or mab b3f12 (▴) for 15 min at room temp . without washing , the eigg were added and the mixture incubated with either increasing concentrations of fn ( a ), increasing concentrations of its purified cbd ( b ), or 40 μg / ml cc - rgds ( open symbols ) ( a & amp ; b ). after 30 min at 37 ° c ., phagocytosis was assessed . ( c ). fn ( 5 g / ml ) or buffer were incubated with either buffer , mab &# 39 ; s fn5 , fn8 , or hfn7 . 1 at 10 μg / ml for 30 min at room temp . pmn , 5k units / ml catalase , and eigg were added and phagocytosis assessed as a pi after 30 min at 37 ° c . fig8 is a graphical representation which shows the effect of mab b6h12 on collagen type iv - and lamin - stimulated ingestion of eigg . ( a & amp ; b ). pmn and 5k units / ml of catalase were incubated with a 1 : 20 dilution of tissue culture supernatant containing either mab b3f12 (▴) or mab b6h12 () for 15 min at room temp . without washing , the eigg were added and the mixture incubated with either increasing concentrations of collagen type iv ( a ), increasing concentrations of lamin ( b ), or 40 μg / ml of cc - rgds ( open symbols ) ( a & amp ; b ). after 30 min at 37 ° c ., phagocytosis was assessed as a pi . fig9 is a graphical representation which shows the effect of mab b6h12 on vitronectin ( vn )-, von willebrand &# 39 ; s factor ( vwf )-, and fibrinogen ( fg )- stimulated ingestion of eigg . ( a - c ). pmn and 5k units / ml catalase were incubated with a 1 : 20 dilution of tissue culture supernatant containing mab b3f12 (▴) or mab b6h12 () for 15 min at room temp . without washing , the eigg were added and the mixture incubated with either increasing concentrations of vn ( a ), increasing concentrations of vwf ( b ), increasing concentrations of fg ( c ), or 40 μg / ml of cc - rgds ( open symbols ) ( a - c ). after 30 min at 37 ° c ., phagocytosis was assessed as a pi . the production of monoclonal antibodies having the characteristics of b6h12 as described herein can be carried out by conventional procedures such as described , for example , by kohler and milstein , nature 256 , 495 - 497 ( 1975 ; eur . j . immunol . 6 , 511 - 519 ( 1976 ). according to this method , tissue - culture adapted mouse myeloma cells are fused to spleen cells from immunized mice to obtain the hybrid cells that produce large amounts of a single antibody molecule . in this procedure , human placental vitronectin receptor protein was used as the immunogen . this protein antigen is sufficiently large so that no hapten is necessary for immunogenicity . a suitable mouse myeloma cell line for use in making these antibodies is the sp2 / 0 - ag14 cell line . this is a well - known cell line of balb / c origin defined by schulman , wilde and kohler , nature 276 , 269 - 270 ( 1978 ). these cells , which do not synthesize ig chains , can be obtained from the basel institute for immunology and are available to the public from the american type culture collection , manassas , va ., under accession number atcc crl - 1581 . a preferred mouse myeloma cell line which also is a non - secretor cell line of balb / c origin is p3 - x63 - ag8 . 653 [ kearney et al ., j . immunol . 123 , 1548 - 1550 ( 1979 )]. a preferred method of carrying out the fusion of the myeloma cells and the spleen cells is by the conventional general procedure described by galfre et al ., nature 266 , 550 - 552 ( 1977 ). this method employs polyethylene glycol ( peg ) as the fusing agent for the cells growing as monolayers , followed by selection in hat medium ( hypoxanthine , aminopterin and thymidine ) as described by littlefield , science 145 , 709 - 710 ( 1964 ). further background information on suitable methodology for producing monoclonal antibodies can be had by reference to texts in the field , for example , goding , &# 34 ; monoclonal antibodies : principles and practice ,&# 34 ; academic press , n . y ., 1983 . it will be appreciated that not all hybridomas prepared as described herein will have optimum antibody activity . as is customary in this field , radioimmunoassay and enzyme immunoassay procedured can be readily used to screen the population of hybridomas for individual clones which secrete optimum specificity . the radioimmunoassay is based upon the competition between radiolabeled and unlabeled antigen for a given amount of antibody which can be determined by conventional general procedure as described , for example , by yalow et al . j . clin . invest . 39 , 1157 ( 1960 ). in the enzyme immunoassay such as elisa , the revealing agent is conjugated with an enzyme instead of 125 i . after washing away any unbound material , the bound enzyme is revealed by addition of a substrate which undergoes a color change . see , e . g ., engvall and perlmann , immunochemistry 8 , 871 - 874 ( 1971 ); j . immunol . 109 , 129 - 135 ( 1972 ). the following detailed example will further illustrate the invention although it will be appreciated that the invention is not limited to this example or the specific details presented therein . in this example , detailed test procedures were carried out to provide the data and results shown in the accompanying fig1 to 9 and in tables 1 and 2 , below , with respect to the preferred monoclonal antibody b6h12 . the following reagents were purchased from sigma chemical co ., st . louis , mo . : chicken egg albumin ( ovalbumin ), catalase ( bovine liver , 52 , 000 u / mg ), cytochrome c ( type xiv , pigeon heart ), and fibrinogen . a 10 × concentrated stock of hank &# 39 ; s balanced salt solution ( hbss ) was purchased from gibco , grand island , n . y . human vitronectin was purchased from calbiochem - behring corp ., la jolla , calif . human fibronectin and the chymotryptic cell - binding domain of 105 - 110 kd were purified as described by bohnsack et al ., j . immunol . 136 , 3793 ( 1986 ). collagen type iv and laminin were obtained from dr . hynda kleinmann , national institute of dental research , bethesda , md . von willebrand &# 39 ; s factor ( vwf ) was obtained from dr . sam santoro , washington university , st . louis , mo . the synthetic peptide lys - tyr - ala - val - thr - gly - arg - gly - asp - ser ( kyavtgrgds ) was obtained from dr . steven adams , monsanto company , st . louis , mo . peptides grgdsc or gdgdsc or amino acid cys ( c ) as a control was linked to cytochrome c via bromacetyl succinamide [( bernatowicz and matsueda , anal . biochem . 155 , 95 - 102 ( 1986 )]. membranes were isolated from fresh human placenta , processed and solubilized as described by calderon et al ., proc . natl . acad . sci . usa 85 , 4837 - 4841 ( 1988 )]. protein was incubated with wheat germ agglutinin and adherent proteins eluted with 0 . 5m n - acetylglucosamine ( glcnac ) in a 0 . 5m nacl , 0 . 05m phosphate , ph 7 . 4 , buffer containing phenyl methyl sulfonyl fluoride , iodocetamide and 50 mm octylglucoside . the eluate was dialyzed to remove the glcnac and applied to a γ - ifn - sepharose column . unbound protein was washed through with octylglucoside - containing buffer and applied to a column bearing decapeptide kyavtgrgds . bound proteins were eluted by edta ( brown and goodwin , supra ). sds page analysis showed only two coomasie stained bands which had m r on both unreduced and reduced gels consistent in the vitronectin receptor . mab a1a5 tissue culture supernatant was obtained from dr . martin hemler , boston , mass . goat polyclonal anti - fibronectin receptor ( vla - 5 ) was obtained from dr . rudolph juliano , chapel hill , n . c . polyclonal antibody to purified vnr was produced in rabbits . the igg was isolated from serum by caprylic acid precipitation and deae chromatography [ steinbuch and audran , arch . biochem . biophys . 134 , 279 - 284 ( 1969 )]. fab fragments were prepared by papain digestion . monoclonal antibodies were produced by immunization of balb / c mice with purified vnr . spleen cells were fused with the nonsecreting myeloma cell line p3x63ag8 . 6 . 5 . 3 . hybridoma culture supernatants were screened for antibodies reactive with purified vnr by elisa . reactive antibodies were screened further for binding to pmn by indirect immunofluorescent staining and fluorescence flow cytometry . antibodies 7g2 , b3f12 , 6h12 , and 3f12 were reactive with purified vnr by elisa but unreactive with pmn . these mab also immunoprecipitated vnr from detergent solubilized placental membrane preparations . mab 7g2 reacted with the vnr beta - chain by western blot but none of the others reacted on western blots , suggesting that they recognized conformational epitopes on vnr . mab b6h12 was reactive both with purified vnr by elisa and with pmn by fluorescence flow cytometry . antibodies were produced in the form of tissue culture supernatant or ascites in pristane - primed mice for further characterization . igg was purified from ascites by caprylic acid precipitation and deae chromatography ( steinbuch and audran , supra ). pmn were isolated from heparinized blood from normal human volunteers and from a single patient with leukocyte adhesion deficiency ( lad ) by the method of boyum , j . clin . lab . invest . 21 ( supp . 97 ), 77 - 89 ( 1968 ) with modifications of gresham et al ., j . immunol . 139 , 4159 - 4166 ( 1987 ). in some tests the erythrocyte lysis step was omitted to prevent possible damage to the pmn during the hypotonic lysis procedure . for cell - surface labelling , 30 - 100 × 10 6 pmn were iodinated by chloroglycoluril [ markwell and fox , biochemistry 17 , 4807 - 4817 ( 1978 )] in the presence of 25 μm p - nitrophenyl p &# 39 ;- guanidino - benzoate ( npgb ) and 0 . 5 % nan 3 for 30 min at 0 ° c . cells were solubilized in hepes buffer containing 200 mm octylglucoside , 20 mm iodoacetamine , 2 μm pepstatin , 2 μm leupeptin , 25 μm npgb , 1 mm cacl 2 , and 1 mm mgcl 2 , ph 7 . 4 . total placental membrane proteins were labelled with 125 i using chloroglycoluril after detergent solubilization . protein - bound and free iodide were separated on sephadex g - 25 columns . aliquots of labelled proteins were incubated with monoclonal or polyclonal antibodies for 2 hours ( h ) at 4 ° c . and then for a further 1 h with either anti - mouse ig sepharose ( cooper biomedical , malvern , pa .) or protein a sepharose ( pharmacia , piscataway , n . j . ), respectively . immunoprecipitates wre analyzed on 6 % sds - polyacrylamide gels and autoradiography performed as described by maizel , meth . virol . 5 , 179 - 246 ( 1971 ). sheep erythrocytes ( e ) were purchased from whittaker m . a . bioproducts , walkersville , md . eigg were prepared as described by gresham et al , supra , using a 1 / 500 dilution of rabbit igg anti - e ( diamedix , miami , fla ). pmn phagocytosis was assessed by a fluid - phase assay as described by gresham et al ., supra ; gresham et al ., j . clin . invest ., in press ( 1988 ). pmn were suspended in hbss containing 4 . 2 mm nahco 3 , 10 mm hepes , 1 . 5 mm cacl 2 , 1 . 5 mm mgcl 2 , and 1 % ovalbumin , ph 7 . 4 ( hbss ++ - 1 % ova ). the reaction mixtures contained 1 . 0 × 10 5 pmn , the indicated antibody concentrations , the indicated stimulatory ligands , 5k units / ml catalase , and 15 μl of eigg ( 5 . 0 × 10 8 / ml ) in a final volume of 115 μl . the assay tubes were incubated at 37 ° c . in 5 % co 2 for 30 min . the non - ingested e were lysed with 0 . 83 % ammonium chloride . phagocytosis was assessed by light microscopy and quantitated as a phagocytic index ( pi ), the number of eigg ingested / 100 pmn ). cytochrome c - rgds was radioiodinated by chloroglycoluril [ markwell and fox , biochemistry 17 , 4807 - 4817 ( 1978 )] for 15 min at 0 ° c . pmn ( 5 . 0 × 10 5 ) in hbss ++ - 1 % ova were incubated with 10 μg of radiolabelled cc - rgds in the presence of 5k u / ml of catalase and 293 μg of unlabelled cc - c in a final volume of 250 μl . the reaction mixtures were incubated in 1 . 5 ml eppendorf tubes for 30 min at 37 ° c . the mixtures were overlayered on versilube ( general electric ) and centrifuged at 12 , 000 × g to assess pellet associated radioactivity . specific binding was determined by subtracting the radioactivity bound in the presence of 293 g of unlabelled cc - rgds from the total radioactivity . unlabelled cc - c was included in the reaction to control for any binding due to cytochrome c and not specifically due to the rgds moiety . for inhibition tests , the various inhibitors were included in the reaction at the indicated concentrations . antibodies were incubated with the pmn at the indicated concentrations for 15 min at room temperature prior to the addition of the other reactants . pmn ( 1 . 0 × 10 6 ) were stained with excess murine mabs and fitc f ( ab &# 39 ;) 2 anti - mouse ig ( tago , inc ., burlingame , calif .) at 0 ° c . after washing with phosphate buffered saline ( pbs ), the cells were resuspended in 0 . 3 ml 0 . 5 % paraformaldehyde in pbs prior to analysis on a facs iv ( becton - dickinson , sunnyvale , calif .). the results of the foregoing detailed test procedures are further tabulated in tables 1 and 2 , below . table 1______________________________________effect of catalase on cc - rgds binding rgds - specific cpm &# 39 ; s bound / 10 . sup . 6 pmn . sup . a______________________________________ + catalase 30 , 267 ± 1 , 930 sem , n = 10 - catalase 3 , 394 ± 931 sem , n = 5______________________________________ . sup . a pmn ( 1 . 0 × 10 . sup . 6 ) were incubated with 40 μg of . sup . 12 icc - rgds in the presence (+) or absence (-) of 5 , 000 units of catalase in 1 ml for 30 min at 37 ° c . the pmn were centrifuged through oil and the pelletassociated counts assessed . specific binding was calculated as described in the detailed test procedures , above . table 2______________________________________inhibition of cc - rgds specific binding to pmn cc - rgds specific cpm &# 39 ; s / 10 . sup . 6 pmn . sup . a % i . sup . b______________________________________cc - c ( 1 . 16 mg / ml ) 30 , 173 ± 1 , 748 n = 11 0 grgdsc ( 500 μg / ml ) 6 , 144 ± 2 , 905 , n = 3 79 . 6 % peptide 32 ( 500 μg / ml ) 39 , 442 ± 7 , 800 , n = 2 0 fn ( 500 μg / ml ) 7 , 106 ± 3 , 568 , n = 3 76 . 5 % fab anti - vnr ( 4 μg / ml ) 1 , 312 ± 867 , n = 5 95 . 7 % b6h12 ( 4 μg / ml ) 1 , 877 ± 1 , 811 , n = 3 93 . 8 % b3f12 ( 4 μg / ml ) 27 , 948 ± 5 , 701 , n = 3 7 . 4 % ______________________________________ . sup . a pmn ( 1 . 0 × 10 . sup . 6 ) were incubated with 40 μg of . sup . 12 icc - rgds with the indicated concentrations of unlabelled inhibitors in th presence of 5 , 000 units of catalase in 1 ml for 30 min at 37 ° c . the pmn were centrifuged through oil and the pelletassociated counts assessed . specific binding was calcualted as described in the detailed test procedures , above . . sup . b calculated from the mean cpm &# 39 ; s . percent inhibition = 100 × ( 1 -[ mean cpm &# 39 ; s in the presence of inhibitor ]/[ mean cpm &# 39 ; s in the presence of ccc ]). a . catalase is required to demonstrate both cytochrome c - rgds ( cc - rgds ) binding and stimulation of pmn fc receptor - mediated phagocytosis . it is reported that while monocytes express both an integrin which binds to rgd - sepharose and a structurally distinct integrin which binds preferentially to sepharose bearing the fibronectin ( fn ) cell binding domain ( cdb ), this is not the case for pmn . instead , pmn express a single integrin - like receptor which binds preferentially to rgd - sepharose columns ( brown and goodwin , supra ). because this presented a simpler system for determination of the characterizations of the rgd - binding receptor involved in phagocytosis enhancement , it was decided to investigate extracellular matrix stimulation of pmn phagocytosis . fibronectin has been reported to stimulate ingestion of c3b - opsonized sheep erythrocytes ( ec3b ) by fmlf - or c5a - stimulated pmn [ pommier et al ., j . exp . med . 159 , 137 - 151 ( 1984 )] but not to stimulate the ingestion of igg - opsonized e ( eigg ) by pmn [ wright et al ., ibid . 158 , 1338 - 1342 ( 1983 )]. it was decided to avoid the added complication of chemotactic peptide stimulation of pmn , as the expression of other adhesive receptors ( i . e . cr3 ) which bind ligand via an rgd sequence [ wright et al ., proc . natl . acad . sci . usa 84 , 1965 - 1968 ( 1987 )] is markedly enhanced by these stimuli . it was therefore determined to investigate further the ability of extracellular matrix proteins to stimulate eigg ingestion . because many adhesive receptors are present on pmn , and matrix proteins such as fn may interact with cell surfaces via several domains , a non - physiologic ligand was developed which would interact with pmn only by an rgd sequence . either the hexapeptide grgdsc or either gdgsc or the single amino acid c as controls was linked to pigeon heart cytochrome c via a bromacetyl succinamide linkage . the amino acid sequence for this cytochrome has been determined and does not contain an rgd sequence . these ligands are referred to as cc - rgds , cc - dgds , or cc - c and were used to assess rgds - stimulated pmn fc receptor - mediated phagocytosis . as shown in fig1 a , in the presence of catalase , cc - rgds stimulated pmn ingestion of eigg in a dose - dependent manner with an optimal concentration of 40 μg / ml . as with other stimuli that affect pmn fc receptor - mediated ingestion , the dose response curve in biphasic [ gresham et al ., j . immunol . 139 , 4159 - 4186 ( 1987 )]. this clearly distinguishes the dose - response of rgds stimulation on pmn from that on monocytes [ pommier et al ., j . exp . med . 157 , 1844 - 1856 ( 1983 )]. in preliminary tests it was discovered that the inclusion of catalase was necessary to consistently observe cc - rgds - stimulated ingestion ( fig1 a ). ingestion performed in the presence of catalase incubated at 100 ° c . for 10 min was significantly reduced ( fig1 a ). cc - c or cc - dgds up to concentrations of 80 μg / ml had no effect on eigg ingestion even in the presence of catalase ( data not shown ). the effect of catalase on cc - rgds - stimulated ingestion was dose - dependent ( fig1 b ). the inclusion of catalase also slightly enhanced non - stimulated ingestion of eigg ( fig1 b ). this effect of catalase and inhibitors of the h 2 o 2 - mpo - halide system on pmn igg fc - and complement - mediated ingestion has been reported [ stendahl et al ., j . clin . invest . 73 , 366 - 373 ( 1984 ); gaither et al ., inflammation 11 , 211 - 227 ( 1987 )]. in addition , the inclusion of either 10 mm nan 3 ( an inhibitor of mpo ) or 10 mm methionine ( a competitor for the damaging oxidant ) also revealed consistent stimulation of ingestion by cc - rgds . these data indicated that the mpo - hydrogen peroxide - halide system was generating an oxidant which damaged either some step in the pathway for rgd - mediated enhancement of phagocytosis or the receptor responsible for cc - rgds - stimulated ingestion . to examine the latter possibility , the effect of catalase on binding of radiolabelled cc - rgds to pmn was examined under the conditions of the phagocytosis assay . in the presence of catalase , a 9 - fold increase in the amount of cc - rgds bound was observed over the amount bound in the absence of catalase ( table 1 ). these data indicated that the effect of catalase was on the binding of the cc - rgds ligand . to further examine this , the effect of catalase on eigg ingestion by pmn adherent to solid - phase vitronectin was assessed . in this assay the catalase was present only during the adherence of the pmn and was washed away prior to the addition of the eigg . vitronectin contains an rgds sequence and enhances monocyte ingestion of ec3b ( brown and goodwin , supra ). as shown in fig2 even though catalase was present only during the adherence of the pmn to either the control or vitronectin - coated surface , it significantly enhanced vitronectin - stimulated ingestion of eigg . these data and those in table 1 indicated that the effect of catalase was on the interaction of the ligand with the pmn surface and not a general one on the phagocytic process . all subsequent assays were performed in the presence of catalase . b . mab b6h12 and polyclonal fab anti - vitronectin receptor ( vnr ) inhibit both cc - rgds binding and rgd - stimulated phagocytosis . to facilitate isolation of the extracellular matrix receptor involved in phagocytosis enhancement , a polyclonal ( rabbit ) and several monoclonal antibodies to human vnr isolated from placenta were prepared . the polyclonal and a single monoclonal antibody , b6h12 , bound to pmn as assessed by fluorescence flow cytometry analysis . the effects of these antibodies on cc - rgds - stimulated ingestion were tested . as shown in fig3 a and b , both antibodies inhibited cc - rgds - stimulated ingestion in a dose - dependent manner with complete inhibition at approximately 4 μg / ml . this dose of either antibody had no effect on eigg ingestion by buffer - treated pmn ( fig3 a and b ); however , at concentrations of 16 μg / ml or greater , treatment of pmn with either antibody significantly stimulated ingestion in the absence of cc - rgds . three other monoclonal antibodies made to the vnr , ( b3f12 , 6h12 , 3f12 ), did not bind to pmn and did not have any effect on either cc - rgds - stimulated or non - stimulated ingestion of eigg . antibody to the vmr beta - chain , mab 7g2 ( brown and goodwin , supra . ), which binds to platelets and can immunoprecipitate vnr from placenta and gp iib / iiia from platelets , was also tested . this mab also did not bind to pmn and did not affect either cc - rgds - stimulated or non - stimulated ingestion by pmn . pmi - 1 , an anti iib mab [ ginsberg , et al ., j . clin . invest . 78 , 1103 - 1111 ( 1986 )], also does not bind to pmn ( brown and goodwin , supra ). in addition , neither polyclonal antibody to the fibronectin receptor ( anti - vla - 5 ) [ brown and juliano , j . cell biol . 103 , 1595 - 1603 ( 1986 )] nor mab a - 1a5 ( anti - vla beta chain ) [ hemler et al ., j . biol . chem . 262 , 3300 - 3309 ( 1987 )] had any effect on either cc - rgds - stimulated or non - stimulated ingestion of eigg . the effect of mab b6h12 and fab anti - vnr was specific for cc - rgds - stimulated phagocytosis because neither antibody had any effect on eigg ingestion stimulated by phorbol ester treatment of pmn ( data not shown ). these data suggest that b6h12 recognizes an antigen which , while it binds to the rgd sequence , is not vnr , gpiib / iiia or a vla . to assess if b6h12 and the fab anti vnr prevented phagocytosis enhancement by inhibiting ligand binding , the binding of radiolabelled cc - rgds to antibody - treated pmn was examined . as shown in table 2 , both mab b6h12 and fab anti - vnr reduced cc - rgds binding by 93 . 8 % and 95 . 7 %, respectively . in contrast , mab b3f12 reduced cc - rgds binding only by 7 . 4 %. these data indicate that the polyclonal and the monoclonal antibody b6h12 inhibited cc - rgds - stimulated phagocytosis because they inhibited binding of the cc - rgds ligand to the cell surface . c . mab b6h12 recognizes a cell - surface heterodimer distinct from previously described members of the receptor family . in order to ascertain the structure of the receptor recognized by the fab anti - vnr and mab b6h12 and compare it to the structure of the receptor isolated by rgd affinity chromatography ( brown and goodwin , supra ), pmn was surface - labelled and immunoprecipitated with the polyclonal anti - vnr and several of the monoclonal antibodies produced against purified vnr from placenta . both the polyclonal antibody and mab b6h12 immunoprecipitate a heterodimer of 140 kd and 105 kd upon reduction ( fig4 lanes 2 and 4 ). however , neither mab 7g2 ( anti - gp iib / iiia ) nor mab b3f12 ( anti - vnr ) immunoprecipitated any detectable proteins from pmn . on the other hand , both mab 7g2 and mab b3f12 but not mab b6h12 immunoprecipitated a heterodimer from iodinated placental membrane proteins of 130 kd and 100 kd upon reduction ( data not shown ). to further distinguish the b6h12 antigen from the gp iib / iiia antigen , surface - labelled platelets were immunoprecipitated with mab 7g2 and the precipitate compared under non - reducing conditions to the mab b6h12 immuno - precipitate from pmn ( fig5 lanes 2 and 3 ). as is readily apparent , these two antibodies immunoprecipitate heterodimers with completely distinct alpha and beta chain m r . the pmn heterodimer cannot be immunoprecipitated with an antibody that recognizes the beta chain of the gp iib / iiia - vnr family ( mab 7g2 ) and is therefore distinct from the cytoadhesin group of integrin receptors . the possibility that the b6h12 antigen was a member of the lfa - 1 , mac - 1 , p150 , 95 family of cell adhesion receptors was then investigated . as shown in fig6 mab b6h12 binds normally to pmn from a patient with leukocyte adhesion deficiency ( lad ) [ anderson and springer , ann . rev . medicine 1987 )] as assessed by facs analysis . this patient has been found previously [ anderson et al ., j . infect . dis . 152 , 668 - 689 ( 1985 )] to lack expression of all members of this family , and pmn from this patient fail to express any beta chain antigen as assessed by facs analysis using antibody to the beta chain , mab 1b4 , [ wright et al ., proc . natl . acad . sci . usa 89 , 5699 - 5703 ( 1985 )] ( data not shown ). in addition , binding of radiolabelled cc - rgds was assessed on both normal and lad pmn ; normal pmn bound 11 , 978 rgds - specific cpms / 10 6 pmn while the lad pmn bound 12 , 616 rgds - specific cpms / 10 6 pmn . moreover , early work indicated that treatment of pmn lysates with mab 1b4 did not immunoprecipitate the pmn receptor which bound to rgd - sepharose ( brown and goodwin , supra ). in concert , these data indicate that the b6h12 antigen is not a member of the lfa - 1 , mac - 1 , p150 , 95 family of cell adhesion receptors and represents a previously unrecognized rgd - binding receptor on pmn . d . many rgds - containing proteins stimulate pmn fc receptor - mediated ingestion via a b6h12 - dependent mechanism . because cc - rgds but not cc - dgds nor cc - c was able to augment pmn phagocytosis of eigg significantly , it was concluded that the rgd ( s ) sequence was the ligand responsible for phagocytosis enhancement . this conclusion was substantiated by the fact that unlinked grgdsc peptide inhibited specific cc - rgds binding by 79 . 6 % while an irrelevant peptide had no effect ( table 2 ). this inhibition was not limited to free rgds peptide but could be demonstrated also by a protein containing an rgds sequence , fibronectin ( fn ), which inhibited specific cc - rgds binding by 76 . 5 %. these data suggested that the mab b6h12 recognizes a receptor which can recognize the rgd sequence of many proteins . the effect of fibronectin ( fn ) on pmn fc receptor - mediated phagocytosis was examined and , as shown in fig7 a , fn stimulated ingestion in a dose - dependent manner . as with cc - rgds stimulation ( fig1 a ), the dose - response curve was biphasic . fn - mediated augmentation of ingestion was completely abrogated by treatment of the pmn with mab b6h12 but not mab b3f12 . however , non - stimulated or baseline levels of eigg ingestion were never affected by mab b6h12 treatment . the cell - binding domain of fn ( cbd ) which contains the rgds sequence also stimulated eigg ingestion , though much less efficiently than the intact fn molecule ( fig7 b ). this is in contrast to monocyte ingestion which is not augmented by the purified cbd fragment [ bohnsack et al ., j . immunol . 136 , 3793 - 3798 ( 1986 ); brown and goodwin , supra ]. however , mab b6h12 and not mab b3f12 completely abrogated cbd - stimulated ingestion ( fig7 b ). to further localize the region of the fn molecule which was involved in phagocytosis enhancement , an optimal dose of fn was incubated with various monoclonal antibodies which recognize distinct domains of fn . as shown in fig7 c , neither fn8 , which recognizes the amino terminus of fn , nor fn5 , which recognizes a site in the cbd carboxy terminal to the rgds sequence , ( bohnsack et al ., supra ) had any effect on fn - stimulated ingestion of eigg . however , hfn7 . 1 , which recognizes a site close to the rgds sequence in the cbd , completely abrogated fn - stimulated phagocytosis . a similar effect of hfn7 . 1 has been observed for fn - stimulated monocyte phagocytosis ( bohnsack et al . supra ). these data indicate that the cbd of the fn molecule which contains the rgds sequence was responsible for augmentation of pmn fc receptor - mediated ingestion by intact fn and that mab b6h12 recognized the receptor which mediated this enhancement . other extracellular matrix proteins which have been reported to contain rgd sequences were investigated for their ability to augment ingestion via the b6h12 antigen . as shown in fig8 a and b , both collagen type iv and laminin enhanced pmn fc receptor - mediated ingestion ; however , mab b6h12 inhibited only collagen - stimulated ingestion and not laminin - stimulated ingestion . therefore , the b6h12 antigen was not able to recognize an rgd sequence in all extracellular matrix proteins . this is not surprising for laminin , because it has been shown to interact with non - integrin receptors via domains completely distinct from the rgd sequence [ graf et al , cell 48 , 989 - 996 ( 1987 )]. because the b6h12 receptor appeared to recognize several proteins with rgd sequences , it appeared to function like the gpiib / iiia receptor of platelets which binds vitronectin , von willebrand &# 39 ; s factor , and fibrinogen , as well as fn . these proteins were also investigated for augmentation of inestion via the b6h12 antigen . as shown in fig8 all three of these ligands stimulated pmn ingestion of eigg in a dose - dependent manner . moreover , the stimulated ingestion by all of these ligands was prevented by treatment of the pmn with mab b6h12 but not mab b3f12 . these data indicate that the b6h12 receptor recognizes rgd sequences in many proteins and mediated phagocytosis stimulation by various but not all adhesive proteins . various other examples will be apparent to the person skilled in the art after reading the present disclosure without departing from the spirit and scope of the invention . it is intended that all such examples be included within the scope of the appended claims .	2
a procedure to encode a picture of a video stream with a limited number of coding passes is provided . on each pass , the picture is coded as a plurality of slices and macroblocks , where image data of the macroblocks are subject to coefficient transforms and to quantization by a quantization parameter . on a first pass , the quantization parameter is established as a first value common to all slices of the picture . if the coded picture size exceeds a predetermined limit , the encoder assigns a quantization step size for each slice for the second pass . small quantization step sizes are assigned to slices that are easy to encode , namely , slices that require few bits to encode for the same or comparable visual quality . this helps preserve visual quality of smooth image areas . if the second - pass coded picture size still exceeds the predetermined limit , a third pass is reached . during the third pass , tough slices ( slices that require more bits to encode for a certain visual quality ) are assigned new quantization step sizes , and high frequency coefficients are dropped if necessary so that no coded slice size exceeds its maximum size calculated based on the results of the second pass . this guarantees the coded picture size never exceeds its predetermined limit . if any pass generates coded picture data that satisfies the predetermined limit , the coded picture data is outputted to a channel , and the procedure ends . the coded picture data has a picture size approximately equal to a target size but not exceeding the predetermined limit . fig1 illustrates an encoder according to an embodiment of the present invention . the encoder 100 a may be implemented in hardware or software and receives a source image 102 , a digital image . for example , the source image 102 may be a picture from a video sequence . it will be understood that the encoder 100 a may also receive a video , where each picture making up the video will be encoded . the source image 102 is first transformed by a discrete cosine transform (“ dct ”) unit 104 . the transform converts spatial variations into frequency variations and produces an array of transform coefficients associated with the source image 102 . a quantization unit 106 then quantizes ( e . g ., divides ) the array of coefficients produced by the dct unit 104 by a quantization parameter , producing an array of quantized coefficients . a plurality of quantization units may be available within the encoder 100 a . the quantization unit 106 may be controlled by a controller 108 . the controller 108 may calculate various values of the quantizer as described and control multiple quantization units 106 within the encoder when encoding in parallel . a scan unit 110 then scans the two - dimensional array of quantized coefficients and converts it into a one - dimensional array ( a string ) of coefficient values . typically , the high frequency corner of the array of quantized coefficients is filled with zeros . by starting in the low frequency corner of the matrix , then zigzagging through the array , the encoder converts the 2 - dimensional coefficient array to a 1 - dimensional list of coefficient values ( a string ). a run - length encoding unit 112 may then scan the string and substitute run - length codes for consecutive zeros in that string . in this process , consecutive zeros are converted to a “ run ” symbol indicating the number of consecutive zeros , and the array of quantized coefficients is converted to a series of run / level pairs . the run length encoding unit 112 may then apply entropy coding to that result , thus reducing the source image 102 to a much smaller bit stream suitable for transmission or storage . the bit stream may be outputted into channel 114 . it will be understood that alternative types of encoding may be used in place of run - length encoding . the process described above may be reversed in a decoder , where the decoder includes a run - length decoding unit 116 , an inverse scan unit 118 , an inverse quantization unit 120 , and an inverse dct unit 122 . each unit performs the inverse of its counterpart in the encoder 100 a , producing a decoded image 124 . the inverse quantization unit cannot perfectly recover coefficients because they have been quantized . therefore , the compression process is lossy . the decoded image 124 is a close approximation of the source image 102 . a plurality of encoders may be available , such as encoder 100 b and 100 c . or a plurality of quantization units may be available in the encoder 100 a . fig2 illustrates a procedure for encoding a picture according to an embodiment of the present invention . the procedure may be executed on an encoder , as depicted in fig1 . in 200 , a picture is received and encoding begins . in 202 , a first pass begins . every slice of the picture is encoded with q — 0 , an initial quantizer . the initial quantizer may be a default value , and different default values can be used for different applications . any value can be used for q — 0 , but in general a small value ( e . g ., 1 ) is used for high quality encoding and a large value ( e . g ., 8 ) is used for standard quality encoding ( low bit rate ). the encoding may be executed in parallel across multiple processors , each processor encoding one or more slices . in 204 , the encoder may test whether a size of the resulting encoded picture produced in 202 is less than a picture maximum size , m . if yes , the picture has been encoded in one pass and the procedure ends . if no , further compression is necessary and the procedure proceeds to 206 . in 206 , a current quantizer value qp is initialized to q — 0 . qp is increased ( in the loop comprising 208 , 210 , 212 , 214 ) until the estimated picture size is smaller than a target picture size t . q — 1_i is the quantization step size to be used in the second pass encoding for slice i , and each q — 1_i will be set by the end of 218 . as qp is increased , q — 1_i is set ( in 208 ) for slice i if the slice is relatively easy to be encoded , as determined in 208 . if q — 1_i is not set before 218 , it will be set in 218 to a value qp * determined in 216 . in 208 , the procedure tests whether the coded size ( when qp is q — 0 ) or estimated coded size ( when qp is not q — 0 ) for slice i at qp is less than a predetermined threshold . the threshold may be a fraction of the average slice size , and may be different for different qp . if the coded size or estimated coded size is less than the threshold , q — 1_i is set to qp for second pass encoding . the quantizer selection is then final for slice i for second pass encoding . every slice is processed independently in 208 . in 210 , qp is increased . for example , qp may be multiplied by 3 . alternatively , qp may be incremented or otherwise increased by an amount . in 212 , a coded picture size is estimated . the estimated picture size may be calculated as the sum of all estimated coded slice sizes . for every slice i , if q — 1_i has been set , its estimated coded size is calculated for q — 1_i ; if q — 1_i has not been set , its estimated coded size is calculated for qp . in 214 , estimated coded pictures size is compared with a target picture size t . if the estimated picture size is smaller than t , the process proceeds to 216 . if not , it proceeds to 208 . in 216 , qp * is calculated for all slices whose second - pass quantizers ( q — 1_i ) have not been set . a value qp * may be calculated as qp =( qp / 3 ) 3 ^ (( estimated_size_of_ ( qp / 3 )− t )/ estimated_size_of_ ( qp / 3 )− estimated_size_of_qp )). note that qp * is between qp / 3 and qp . qp * is calculated so that the second pass coded size will be close to the target size t . in 218 , for every slice i , if q — 1_i has not been set , set it to qp . after 218 finishes and before 220 begins , q — 1_i must have been set for every slice i . in 220 , each slice i is encoded with q — 1_i . the encoding may be executed in parallel . in 222 , the procedure tests whether the picture encoded in 220 is smaller than m . if yes , the procedure ends after two passes . if no , further compression is necessary and the procedure proceeds to 224 for a third pass . in 224 , the third pass begins . a target size t_i and a maximum size m_i is calculated for each slice i that undergoes the third pass . a slice undergoes the third pass if its second - pass coded size exceeds a threshold . the threshold is chosen to balance bit allocation among slices for overall picture quality . it may depend on qp , and is usually a fraction of average slice size . in 226 , q — 2_i is calculated for slice i that undergoes the third pass such that the estimated coded size for slice i is close to its target size t_i . q — 2_i is calculated in a manner similar to that in 208 , 210 , 212 , 214 . in 228 , every slice i that undergoes the third pass is encoded with q — 2_i , as calculated in 226 . for each slice i , high frequency coefficients are dropped during encoding if necessary so that the coded size does not exceed its maximum size m_i calculated in 224 . slices of the picture may be encoded in parallel . in 208 , the slice size is estimated for qp , which is q — 0 * 3 ^ n , where n is an integer equal to log 3 ( qp / q — 0 ). the actual coded size for q — 0 is known from 202 . a method to estimate the size of a coded slice when encoded with qp is outlined as follows . the slice size is the sum of its header size , bits used for dc coefficients , bits used for runs for ac coefficients , and bits for levels for ac coefficients . these values may be separately estimated and summed for the slice size estimate . header size is known from the implementation of the slices , and does not change after quantization . thus , an exact header size may be calculated . dc coefficients generally become smaller when qp increases , except when the coefficients are already zero . the number of bits for dc coefficients can be estimated by subtracting an estimated number of bits from the number of bits used for q — 0 . thus , number_of_bits_at_qp = number_of_bits_at_q — 0 − alpha * number_of_dc_tokens * n , where : alpha is a constant representing the average number of bits reduced per coefficient when quantization step size is increased 3 - fold , alpha varies depending on the actual coding scheme , but in general should be approximately log 2 ( 3 )= 1 . 585 bits , and number_of_dc_tokens is the number of dc coefficients that contribute to dc bits reduction when quantizer is increased , for example , the number of dc coefficients that are nonzero what n quantized with q — 0 , and a histogram of absolute values of quantized coefficients is collected in 202 when encoding with q — 0 . the thresholds for the eight bins are : histogram [ i ] is the number of quantized coefficients ( quantized with q — 0 ) with absolute values greater than t [ i ] and smaller than or equal to t [ i + 1 ]. any coefficient in bin i for q — 0 moves to bin ( i - n ) for q — 0 * 3 ^ n for n & lt ;= i and becomes 0 for n & gt ; i ( assuming no coefficient is greater than 1093 * 3 + 1 = 3280 ). thus , the histogram for q_p = q — 0 * 3 ^ n can be used to estimate the bits for ac levels . the sum of ( histogram [ i ]* beta [ i ]) for i = 0 , 1 . . . 7 is used to estimate ac level bits where beta [ i ] is the estimated bits per coefficient for coefficients in bin [ i ]. the values of beta [ i ] can be derived from a training set prior to encoding ; they depend on the particular coding scheme being used . different number of bins and different thresholds may be used . a number of bits for ac runs as encoded by q — 0 is known from 202 . the number of runs at q — 0 equals the number of nonzero quantized coefficients , calculated as histogram [ 0 ]+ histogram [ 1 ]+ . . . + histogram [ 7 ]. the number of runs at qp = q — 0 * 3 ^ n is calculated from the histogram for qp = q — 0 * 3 ^ n . let t be the number of runs at q — 0 , and b [ t ] be the number of run bits for t . when one coefficient becomes 0 , b [ t − 1 ] can be estimated as : ( 1 / t )( b [ t ]( t − 1 )/ t )+( 1 − 1 / t )( b [ t ]( t − 1 )/ t + gamma )= b [ t ]( t − 1 )/ t + gamma ( t − 1 )/ t , assuming ( 1 ) the probability that the coefficient becoming 0 is the last one is 1 / t ; ( 2 ) gamma additional bits ( usually smaller than 1 ) are need to encode the bigger run resulting from the concatenation of two runs when the coefficient becoming 0 is not the last one ; and ( 3 ) the coefficient becoming 0 has the same number of bits as other coefficients before it becomes 0 . gamma may be determined from a training set , and ( 1 / t + 1 /( t − 1 )+ . . . + 1 /( s + 1 )) may be approximated . it should be appreciated that alternative methods to estimate encoded slice size may be used . the procedure also provides an encoding method where the encoding of each picture does not depend on the result of any other picture . thus , multiple frames may be processed simultaneously in parallel by multiple processors . this also improves the probability that the same quantizer is used for multiple generations of encoding / decoding because the quantizer choice depends only on the picture itself and does not depend on adjacent pictures . multi - generational quality loss occurs when an encoded video is decoded , and the decoded video is re - encoded . if a different quantization step size is used every time a picture is decoded and re - encoded , the picture quality will degrade quickly . the chance that the same quantizer is used for successive generations of decoding / encoding is further improved by assigning small quantizers to easy slices in 208 . the same quantizer will be used for easy slices regardless of other slices , which means that the quality in smooth areas will be preserved even if other parts of the picture undergo some changes during the editing process . this reduces potential quality degradation caused by post - production manipulation of the pictures . fig3 illustrates a bit stream according to an embodiment of the present invention . a video may be a sequence of images 300 including a plurality of frames 302 , 304 , 306 , and 308 . it is understood that while only four frames are depicted in sequence 300 , any number of frames may be included in a sequence . a frame 310 may include a header 312 , picture field 324 , and possibly stuffing data 326 . the header 312 may include header information , such as a size of the picture , frame dimension , frame rate information , and metadata relating to the picture field 324 . the picture field 324 may be an encoded video picture , for example , as encoded by the procedure described later . the stuffing 326 may be filler bits provided as needed to guarantee the frame 310 is a specified size , for example , for storage or transmission reasons . the frame 310 may include one picture field 324 if the frame is intended for a progressive scan . in an alternative embodiment , the frame 310 may include a header 328 , a first picture field 330 , a second picture field 332 , and stuffing 334 . the header 328 may be similar to the header described above . each of the picture fields 330 and 332 may be similar to the picture field described above . the stuffing 334 may be similar to the stuffing described above . frame 310 may store a plurality of picture fields . it is understood that while only two picture fields are depicted , any number of picture fields may be included within a frame . the frame 300 may include two picture fields 330 and 332 if the frame is intended for an interlaced scan . a picture 340 may include a header 342 , which may include header information , such as metadata relating to the picture 340 or as described above . the picture 340 may include a slice table 344 of slice sizes , which may be used to index all slices stored in the picture 340 . the picture 340 may include slices 346 , 348 , 350 and 352 . the slice table 344 may be optional . it is understood that while only four slices are depicted , any number of slices may be included within a picture . each slice may be as described below . a slice 360 may include a header 362 , which may include header information , such as metadata relating to the slice 360 or as described above . the slice 360 may include a field for luminance content 364 , for blue chrominance content 366 , and for red chrominance content 368 . together , the three components may describe a slice of a picture in digital form . the slice 360 may further be divided into macroblocks , where each macroblock is a 16 × 16 array of pixels to be displayed , and display property data associated with the pixels . each macroblock may include a number of blocks or pixel blocks . fig4 illustrates a picture division scheme according to an embodiment of the present invention . for example , a picture 400 may be 720 pixels horizontally and 486 lines vertically . each pixel may be associated with display property data ( luminance , blue chrominance , and red chrominance ). the picture is further divided into macroblocks , with each macroblock including an array of 16 × 16 pixels . any number of macroblocks may be combined into a slice . for example , a plurality of eight macroblocks 42 may be combined into a first slice . similarly , a plurality of four macroblocks 404 may be combined into a second slice . as described in fig3 , a slice may contain display property data of its associated pixels , where the pixels are organized by macroblock . optionally , macroblock data may be organized into sub - macroblock partitions ( e . g ., 8 × 8 blocks ) for coding . although the preceding text sets forth a detailed description of various embodiments , it should be understood that the legal scope of the invention is defined by the words of the claims set forth below . the detailed description is to be construed as exemplary only and does not describe every possible embodiment of the invention since describing every possible embodiment would be impractical , if not impossible . numerous alternative embodiments could be implemented , using either current technology or technology developed after the filing date of this patent , which would still fall within the scope of the claims defining the invention . it should be understood that there exist implementations of other variations and modifications of the invention and its various aspects , as may be readily apparent to those of ordinary skill in the art , and that the invention is not limited by specific embodiments described herein . it is therefore contemplated to cover any and all modifications , variations or equivalents that fall within the scope of the basic underlying principals disclosed and claimed herein .	7
the present invention will be described as set forth in the preferred embodiments illustrated in fig2 - 5 . other embodiments may be utilized and structural or logical changes may be made without departing from the scope of the present invention . a ball grid array ( bga ) package according to the present invention is illustrated generally at 100 in fig2 in diagram form . bga package 100 comprises a substrate 102 having top conductive traces 104 formed on an upper surface of substrate 102 . substrate 102 can be of either a single or multi - layered construction as is commonly known in the art , and typically is formed from an organic epoxy - glass resin based material , such as bismaleimide - triazin ( bt ) resin or fr - 4 board as is commonly known in the art . the thickness of substrate 102 is typically on the order of 0 . 35 mm . bottom conductive traces 106 are formed on a lower surface of substrate 102 and are electrically connected to top conductive traces 104 through vias or plated through - holes 108 . vias 108 contain a conductive material such as copper . top conductive traces 104 terminate with bond posts or pads 110 . bottom conductive traces 106 terminate with ball or terminal pads 112 . top conductive traces 104 , bottom conductive traces 106 , ball pads 112 , and bond posts 110 comprise an electrically conductive material such as copper or copper plated with gold , as is known in the art . not all top conductive traces 104 , bottom conductive traces 106 , and vias 108 are shown . substrate 102 has an opening or aperture 114 , extending from the top surface of substrate 102 to the bottom surface of substrate 102 . an upward facing cavity is formed by securing a support base such as thin sheet material 116 to the bottom of substrate 102 to cover aperture 114 . thin sheet material 116 is typically any type of polyimide or metal foil based or backed material , such as copper or aluminum , on the order of approximately 0 . 025 to 0 . 1 mm thick and preferably 0 . 05 mm thick , and must be able to withstand temperatures involved in typical solder reflow processes without degradation . an adhesive may be used to secure the thin sheet material 116 to substrate 102 . the adhesive could be a thermoplastic , thermoset , or pressure sensitive type . the dimensions ( length and width ) of the thin sheet material 116 are greater than the dimensions ( length and width ) of aperture 114 so as to completely cover aperture 114 , but typically less than the dimensions ( length and width ) of substrate 102 . bga package 100 further comprises a semiconductor element or die 120 mounted in the cavity formed by the aperture 114 and thin sheet material 116 , which minimizes the effect of die thickness on the overall package height . semiconductor element 120 has a plurality of bonding pads 122 formed on an upper surface . each of the plurality of bond pads 122 is electrically connected to top conductive traces 104 with a wire bond 124 . typically , a solder mask material ( not shown ) with openings over the bond posts 110 and ball pads 112 is applied to the outer surfaces of the substrate 102 . typically , semiconductor element 120 , wire bonds 124 , and a portion of substrate 102 are covered by an encapsulating compound 126 , such as epoxy . conductive solder balls 128 are each attached to a ball pad 112 . conductive solder balls 128 are later connected to a next level of assembly or printed circuit board 302 ( fig4 ) using a standard reflow process . the number and arrangement of conductive solder balls 128 on the lower surface of substrate 102 depends on circuit requirements including input / output , power and ground connections . fig3 illustrates a portion of a cross - sectional view of a further embodiment of a bga package 200 according to the present invention . bga package 200 comprises a substrate 202 having bottom conductive traces 204 formed on a lower surface of substrate 202 . substrate 202 can be of either a single or multi - layered construction as is commonly known in the art , and typically is formed from an organic epoxy - glass resin based material , such as bismaleimide - triazin ( bt ) resin or fr - 4 board as is commonly known in the art . the thickness of substrate 202 is typically on the order of 0 . 35 mm . bottom conductive traces 204 terminate with ball or terminal pads 212 . bottom conductive traces 204 and ball pads 212 comprise an electrically conductive material such as copper or copper plated with gold , as is known in the art . not all bottom conductive traces 204 are shown . substrate 202 has an opening or aperture 214 extending from the top surface of substrate 202 to the bottom surface of substrate 202 . a downward facing cavity is formed by securing a support material such as thin sheet material 216 to the top surface of substrate 202 to cover aperture 214 . thin sheet material 216 is typically any type of polyimide or metal foil based or backed material , such as copper or aluminum , on the order of approximately 0 . 025 to 0 . 1 mm thick and preferably 0 . 05 mm thick , and must be able to withstand temperatures involved in typical solder reflow processes without degradation . an adhesive may be used to secure the thin sheet material 216 to substrate 202 . the adhesive could be a thermoplastic , thermoset , or pressure sensitive type . the dimensions ( length and width ) of the thin sheet material 216 are greater than the dimensions ( length and width ) of aperture 214 so as to completely cover aperture 214 , but typically less than the dimensions ( length and width ) of substrate 202 . bga package 200 further comprises a semiconductor element or die 220 inverted and mounted in the cavity formed by the aperture 214 and thin sheet material 216 , which minimizes the effect of die thickness on the overall package height . semiconductor element 220 has a plurality of bonding pads 222 formed on its upper surface , which is now facing downwards . each of the plurality of bond pads 222 is electrically connected to bottom conductive traces 204 with a wire bond 224 . typically , a solder mask material ( not shown ) with openings over the bond pads 222 and ball pads 212 is applied to the outer surfaces of the substrate 202 . typically , semiconductor element 220 , wire bonds 224 , and a portion of substrate 202 are covered by an encapsulating compound 226 . conductive solder balls 228 are each attached to a ball pad 212 . conductive solder balls 228 are later connected to a next level of assembly or printed circuit board 302 ( fig4 ) using a standard reflow process . the number and arrangement of conductive solder balls 228 on the lower surface of substrate 202 depends on circuit requirements including input / output , power and ground connections . fig4 illustrates an integrated circuit 300 , such as a sdram or sldram memory module or the like , which utilizes multiple ball grid array packages according to the present invention . integrated circuit 300 is comprised of printed circuit board 302 . printed circuit board 302 contains a plurality of top conductive traces 304 on the top surface , and may or may not contain conductive traces on the bottom surface or intermediate layers . mounted on printed circuit board 302 are various electronic components 304 , as necessary for operation of the integrated circuit 300 , and low profile ball grid array packages 308 as hereinbefore described with reference to fig2 and 3 . printed wiring board 302 is provided with input / output connectors 310 for connection in an end product system ( fig5 ). the use of the low profile ball grid array packages 308 minimizes the overall height of the integrated circuit 300 and allows for smaller end - product packaging . a typical processor system which includes integrated circuits , such as memory devices , that contain low profile ball grid array packages according to the present invention , is illustrated generally at 400 in fig5 in block diagram form . a computer system is exemplary of a device having integrated circuits such as memory devices . most conventional computers include memory devices permitting the storage of significant amounts of data . the data is accessed during operation of the computers . other types of dedicated processing systems , e . g . radio systems , television systems , gps receiver systems , telephones and telephone systems also contain integrated circuit devices which can utilize the present invention . a processor system , such as a computer system , generally comprises a memory device 402 , such as a sdram or sldram memory module , a memory device controller 403 , a central processing unit ( cpu ) 404 , input devices 406 , display devices 408 , and / or peripheral devices 410 . it should be noted that a system may or may not include some or all of the aforementioned devices , and may or may not include multiple devices of the same type . memory device 402 and cpu 404 include integrated circuits which contain ball grid array packages according to the present invention hereinbefore described with reference to fig2 and 3 . the use of low profile ball grid array packages according to the present invention reduces the size and cost of the integrated circuits , effectively reducing the size and cost of the end product processor system . reference has been made to preferred embodiments in describing the invention . however , additions , deletions , substitutions , or other modifications which would fall within the scope of the invention defined in the claims may be found by those skilled in the art and familiar with the disclosure of the invention . any modifications coming within the spirit and scope of the following claims are to be considered part of the present invention .	7
[ 0027 ] fig1 schematically shows a refrigeration system 1 with a compressor 2 , which supplies a refrigerant under high pressure and at a high temperature to a condenser 3 . in the condenser 3 the refrigerant is cooled . due to this cooling , the refrigerant converts to a fluid . the condenser 3 supplies three connected evaporators 4 , 5 and 6 , connected in parallel , each located in a cold room 7 , 8 or 9 , respectively . the connection between the condenser 3 and each evaporator 4 , 5 and 6 takes place via a valve 10 , 11 and 12 and a throttling member 13 , 14 and 15 . the throttling member can , for example , be a capillary tube or an expansion valve . for reasons of clarity , the valves 10 , 11 , and 12 are shown separately from the throttling members 13 , 14 and 15 . usually , each valve 10 , 11 , and 12 is combined with the related throttling member 13 , 14 , and 15 . a control device 16 controls the valves 10 , 11 , and 12 and the compressor 2 . an example of a valve 10 is shown in fig2 . such a valve 10 can , of course , also be located in other positions in the refrigeration system . in principle , the valve 10 shown in fig2 can be used everywhere where refrigerant must be controlled . the valve 10 has a valve housing 17 with a bottom part 18 and a top part 19 . an inlet 20 and an outlet 21 are located in the bottom part 18 . between the inlet and the outlet is located a valve seat 22 , which interacts with a valve element 23 . in the position shown in fig2 the valve 10 is closed , that is , the valve element 23 bears on the valve seat 22 . the valve element 23 has a pressure release channel 24 , which is connected with the inlet 20 and ends in a pressure chamber 25 , which is located on the side of the valve element 23 facing away from the valve seat 22 generally opposite an inlet end thereof . the pressure in the pressure chamber 25 acts upon the valve element 23 via an area , which has practically the same size as the area , via which the pressure from the inlet 20 acts upon the valve element 23 . the valve element 23 is thus pressure released , that is , the forces acting upon the valve element 23 , loading it in the direction towards the valve seat 22 or away from it , are substantially equalised . while a pressure release channel connected with the inlet has been described , the present invention is not limited in this regard as the pressure release cannel can also be connected with the outlet 21 without departing from the broader aspects of the present invention . the valve element 23 is supported in a guide 26 to be axially displaceable , that is , away from the valve seat 22 or towards it . a sealing 27 is provided between the valve element 23 and the guide 26 . a distortion protection , not shown in detail in fig2 ensures that the valve element can only be axially displaced , however , not turned . for displacing the valve element 23 , a spindle 29 is provided , which has an outer thread 30 . the outer thread 30 threadably engages a displacement member shown in the illustrated embodiment as a nut 31 with a corresponding inner thread , which is connected with the valve element 23 . when the spindle 29 is turned , the threaded connection formed by the outer thread 30 and the nut 31 converts the rotational movement of the spindle 29 to a translational movement of the valve element 23 . the rotation drive of the spindle 29 occurs via a stepping motor 32 , which is controlled by the control device 16 . the stepping motor 32 in a housing 33 has a rotor , whose output shaft 34 is non - rotatably connected with an outer magnet holder 35 . in the outer magnet holder 35 , several permanent magnets 36 are distributed in the circumferential direction . the permanent magnets 36 are , for example , neodymium magnets . the spindle 29 is non - rotatably connected with an inner magnet holder 37 , which carries several permanent magnets 38 on its outer circumference . preferably , the number of permanent magnets 38 on the inner magnet holder 37 corresponds the number of permanent magnets 26 of the outer magnet holder 35 . the permanent magnets 36 , 38 are magnetised so that they attract each other mutually . thus , when the outer magnet holder 35 is turned , the inner magnet holder 37 turns too , as the permanent magnets 36 on the outer magnet holder 35 take along the permanent magnets 38 on the inner magnet holder 37 . an adapter piece 39 is located between the outer magnet holder 35 and the inner magnet holder 37 . the adapter piece 39 is made of a magnetically non - conducting material , for example austenitic steel . the adapter piece 39 is screwed into the top part 19 of the housing 17 by means of a thread 40 . a sealing 41 is provided for sealing the complete housing 17 , that is , also the adapter piece 39 . the sealing is sized so that it can stand a pressure difference of at least 50 bar . the adapter piece 39 is cup - shaped . between the magnets 36 , 38 it has a relatively small wall thickness . the stepping motor 32 has a pipe - shaped extension 42 , which is pushed onto the adapter piece 39 . the extension 42 is made of a magnetically non - conducting material . via the extension 42 , the stepping motor 42 is fixed on the housing 17 , for example by means of two headless screws 43 , which engage in corresponding recesses on the outside of the adapter piece 39 . the inner magnet holder 37 is supported on the adapter piece 39 via ball bearings 44 . the outer magnet holder 35 is fixed on the motor 32 . the valve 10 can now be controlled in a relatively sensitive manner . the rotor 33 of the stepping motor is rotated over a predetermined angular area . the resolution per impulse sent to the stepping motor 32 can , for example , be in the magnitude of 2 °. via the magnetic coupling through the magnets 36 , 38 , the spindle 29 is accordingly rotated . through the transmission formed by the threaded connection 30 , 31 , the valve element 23 is then moved by a predetermined distance away from or in the direction of the valve seat 22 , between an open and a closed position , for each angular increment of the rotor 33 . by counting the impulses , which are supplied to the stepping motor 32 , the position of the valve element 23 in relation to the valve seat 22 can be determined relatively accurately . of course , other motors than stepping motors can be used . in this case , sensors are recommended , which establish the position of the valve element 23 in relation to the valve seat 22 . on the side facing away from the valve element 23 , the motor 32 has a resetting device , which will be explained on the basis of fig3 . the resetting device cannot be seen in fig2 . the resetting device ensures that during current failure or another error resulting in the undesired cessation of motor operation , the valve 10 can be brought to a certain predetermined state . this state could , for example be that the valve 10 is completely closed . however , it could also be that the valve is completely opened . for this purpose , the output shaft 34 of the motor 32 is extended upwards , forming a shaft end 46 . on the shaft end 46 a plate 62 is non - rotatably fixed , that is , the plate 62 rotates with the output shaft of the motor and thus with the spindle 29 , which drives the valve element 23 . a torsion - type suspension 63 is inserted in the plate 62 , that is , with one end fixed non - rotatably with the plate 62 . the other end of the torsion - type suspension 63 is connected with a housing 64 of the resetting device module 65 . thus , when the shaft end 46 and the plate 62 are turned , the torsion - type suspension 63 is tensed . in this case , the outer thread 30 of the spindle 29 has a relatively large pitch of , for example , 5 to 15 mm per rotation . when , for example , the outer thread 30 has a pitch of 10 mm per rotation , and the maximum opening width , that is the maximum distance between the valve seat 22 and the valve element 23 is also 10 mm , one single rotation of the control motor 32 will be sufficient to either open or close the valve completely . accordingly , the torsion - type suspension 63 can do with a force , which reverts the motor 32 by one rotation , when the valve has to be closed in connection with a current failure . the resetting device shown in fig3 is formed as a module 65 , which is located on the side of the motor 32 facing away from the housing 17 , for example between the motor 32 and a housing 61 ( fig2 ) containing control electronics for the motor 32 . the module embodiment has the advantage that it requires no large changes to make the valve with or without resetting device . [ 0046 ] fig4 shows another embodiment , in which the same parts have the same reference numbers . the most substantial change is that the permanent magnets 36 , 38 , which are fixed on the outer or the inner magnet holder 35 , 37 , respectively , are no longer directed in the radial direction , but in the axial direction . this saves accessories . on the other hand , however , the forces transmitted by the magnets 36 , 38 are also smaller . a rotation protection 59 , with which a rotation movement of the valve element 23 shall be prevented , has , in this case , a spring , which engages in a groove in the guide 26 on the one side and at the valve element 23 on the other side . [ 0048 ] fig5 shows a further embodiment of a valve 20 , in which same and functionally same elements have the same reference numbers as in fig2 . contrary to the embodiment according to fig2 and 3 , here a resetting device 70 is provided inside the housing 17 . the resetting device 70 has a pressure spring 71 , shown as a coil spring in the illustrated embodiment , which is supported between the valve element 23 and a spring washer , which retains an outer ring 72 of the ball bearing 44 . the pressure spring 71 presses the valve element 23 in the direction of the valve seat 22 . the nut is made of a plastic , which interacts under little friction with the material of the spindle 29 . this plastic can , for example , be a polyaryl ether ketone , polyether ether ketone ( peek ), or polyoxymethylene ( pom ). in connection with a corresponding diameter of the spindle 29 and a corresponding pitch of the thread 30 , which , for example , causes a movement of approximately 10 mm per rotation of the spindle 29 , it is ensured that the threaded connection between the spindle 29 and the nut 31 is not made to be self - locking , so that a pressure from the pressure spring 71 will not only displace the valve element 23 , but also turn the spindle 29 . this is made possible by the fact that the valve element 23 is pressure - released by means of the pressure release channel 24 . thus , only relatively small external forces act upon the valve element 22 , so that the pressure spring 71 does not have to provide excessively large forces . the pressure spring 71 is located inside the valve housing 17 on the side of the valve element 23 facing the motor , so that the motor can be replaced , when it indicates an error or needs maintenance . in this case , the valve 10 is closed . of course , it depends on the resetting device 70 . when this is made differently , it can also ensure that the valve 10 is opened , when no other forces are available . the pressure spring 71 generates forces , which are sufficient to overcome a catch force of the control motor 32 , which it possesses in the unpowered state . that is , the resetting device 70 can also bring the valve element 23 to rest on the valve seat 22 , when the motor 32 is still fitted on the housing 17 . in fig5 the motor 32 is not mounted to make it clear that the resetting device 70 in fig5 can also work , when the motor has a different embodiment . while preferred embodiments have been shown and described , various modifications and substitutions may be made without departing from the scope of the present invention . accordingly , it is understood that the present invention has been described by way of example , and not by limitation .	5
the compounds of the present invention have one of the following formulae : ## str1 ## and pharmaceutically acceptable salts and esters thereof ; wherein x is one of -- ch 2 --, -- nh --, -- o -- or -- s --; and preferably r is a straight or branched chain alkyl radical having from about 1 to about 20 carbon atoms , more preferably a straight chain alkyl radical having from 6 to 20 carbons . for components of formulae i , ii and iii , r is most preferably --( ch 2 ) 10 -- ch 3 . for compounds of formulae iv , r is most preferably --( ch 2 ) 9 -- ch 3 . the compounds represented by formulae i - iv are useful as penetration inhibiting agents . the compounds may be made by the methods described below . typical examples of compounds of the present invention include : ## str2 ## the compounds of the present invention can be employed as penetration inhibiting agents . the compounds may be formulated into topical compositions that function as barriers to the passage of bioactive compounds and agents through mammalian skin in either direction when applied to the skin . the barrier inhibits the passage of toxic chemicals from the environment through the skin into the bloodstream or underlying tissues and / or organs of the mammal . this utility is especially desirable to prevent individuals and livestock from being exposed to toxic chemicals ; for example , farmers dealing with pesticides , workers cleaning up toxic waste spills and soldiers exposed to chemical weapons . the barrier may also function to prevent allergic reactions to skin products such as cosmetics and sunscreens wherein it is desired to maintain the skin product ingredients on the surface of the skin . additionally , the barrier may function to maintain drugs utilized to treat skin conditions on the skin surface thus inhibiting penetration of the drug into the bloodstream . for purposes of defining the invention , the term &# 34 ; bioactive agent &# 34 ; shall mean any compound capable of passage through the skin or other membrane of a mammal , having any biological effect on the mammal . the biological effect may be either desirable or undesirable . for the purposes of defining the invention , the term &# 34 ; mammal &# 34 ; includes human beings and other forms of animal life , especially domesticated animals and pets . the term &# 34 ; alkyl &# 34 ; as employed herein includes both straight and branched chain radicals of up to 20 carbons , preferably 6 - 20 carbons , such as methyl , ethyl , propyl , butyl , pentyl , hexyl , heptyl , octyl , nonyl , decyl , undecyl , dodecyl and the various branched chain isomers thereof . also included within the scope of the present invention are non - toxic pharmaceutically acceptable salts of the compounds of formula i - iv . basic salts are formed by mixing a solution of a particular compound of the present invention with a solution of a pharmaceutically acceptable non - toxic base , such as , sodium hydroxide , potassium hydroxide , sodium bicarbonate , sodium carbonate , or an amino compound , such as choline hydroxide , tris , bis - tris , n - methylglucamine or arginine . water - soluble salts are preferable . thus , suitable salts include : alkaline metal salts ( sodium , potassium etc . ), alkaline earth metal salts ( magnesium , calcium etc . ), ammonium salts and salts of pharmaceutically acceptable amines ( tetramethylammonium , triethylamine , methylamine , dimethylamine , cyclopentylamine , benzylamine , phenethylamine , piperidine monoethanolamine , diethanolamine , tris ( hydroxymethyl ) amine , lysine , arginine and n - methyl - d - glucamine ). the compounds of the present invention may be prepared by the general procedures outlined in schemes i through vi . ## str3 ## in each of schemes i - v , an appropriate n - heterocyclic ketone is reacted with an acid chloride such as lauroyl chloride , decanoyl chloride or octanoyl chloride , in the presence of an organic solvent , such as toluene , and a base such as triethylamine . in scheme vi , a brominated ketone , such as 1 - bromo - 2 - dodecanone is substituted for the acid chloride employed in the earlier schemes . dosage forms for topical application may include solution nasal sprays , lotions , ointments , creams , gels , suppositories , sprays , aerosols and the like . typical inert carriers which make up the foregoing dosage forms include water , acetone , isopropyl alcohol , freon , ethyl alcohol , polyvinylpyrrolidone , propylene glycol , fragrances , gel - producing materials , liquid crystalline materials , mineral oil , stearyl alcohol , stearic acid , spermaceti , sorbitan monooleate , &# 34 ; polysorbates ,&# 34 ; sorbitol and methyl cellulose . the preferred carriers are those in which the active ingredient is soluble . emulsifiers , stabilizers , humectants and antioxidants may also be included as well as agents imparting color or fragrance , if desired . creams are preferably formulated from a mixture of mineral oil , self - emulsifying beeswax and water in which mixture the active ingredient , dissolved in a small amount of an oil such as almond oil , is admixed . a typical example of such a cream is one which includes about 40 parts water , about 20 parts beeswax , about 40 parts mineral oil and about 1 part almond oil . ointments may be formulated by mixing a solution of the active ingredient in a vegetable oil such as almond oil with warm soft paraffin and allowing the mixture to cool . a typical example of such an ointment is one which includes about 30 % almond oil and about 70 % white soft paraffin by weight . lotions may be conveniently prepared by dissolving the active ingredient , in a suitable high molecular weight alcohol such as propylene glycol or polyethylene glycol . the amount of the composition , and of the penetration inhibiting compound therein , to be administered will obviously be an effective amount for inhibiting penetration of a particular bioactive agent . this , of course , will be ascertained by the ordinary skill of the practitioner . in general , the topical compositions of this invention may comprise from approximately 0 . 1 to 90 percent , by weight , of one or more of the compounds of formulae i , preferably from approximately 1 % to approximately 10 %, and more preferably about 1 % to about 5 % of said compounds . for most drugs the major barrier to penetration resides in the outer layer of the skin , the stratum corneum . the stratum corneum is an extremely impermeable membrane . the impermeability is a result of its structure and lipid composition . macroscopically the stratum corneum is composed of dead cells ( the corneocytes ) and intracellular lipids forming a mortar between the corneocytes . a complex mixture of lipids are packed together to form sequences of bilayers which are responsible for the impermeability of the stratum corneum . materials diffuse through the intracellular channels of the stratum corneum and it is the structural bilayer nature of the lipids that provides the barrier function of the skin . ( hadgraft , &# 34 ; skin penetration enhancement ,&# 34 ; prediction of percutaneous penetration , 3b : 138 - 148 ( 1993 )). while not wishing to be bound by theory , it is believed that the compounds of the present invention function by interacting with ilipid - bilayer interaction mechanism . this ability to interact with charged lipid bilayers appears to play a major role in the functioning of an entire series of penetration enhancers and the penetration barriers of the present invention . the compounds of the present invention find particular utility in inhibiting the penetration of toxic chemicals that may come in contact with the skin of mammals . examples of such compounds include carcinogens such as actinomycin d , arsenic compounds and ddt . it is contemplated that the compounds of the present invention can be used to inhibit the penetration of a host of carcinogens . other exemplary carcinogens whose penetration can be inhibited are listed in the crc handbook of chemistry and physics , david r . lide , editor in chief , 72nd edition ( 1991 - 1992 ), at section 16 , pages 32 - 38 . pesticides are another example of toxic chemicals whose penetration can be inhibited by the compounds of the present invention . exemplary pesticides include organochlorine pesticides such as : aldrin , α - bhc , β - bhc , γ - bhc , δ - bhc , 4 , 4 &# 39 ;- ddd , 4 , 4 &# 39 ;- dde , 4 , 4 &# 39 ;- ddt , dieldrin , endosulfans , endrin , heptachlor , methoxychlor and chlordane . other pesticides whose penetration can be blocked by compounds of the present invention include organophosphorous pesticides such as : thionazin , dimethoate , disulfoton , famphur , parathion , sulfotepp and triethylphosphorothioate . additional toxic chemicals include hazardous compounds such as carbazoles , dibenzofurans , nitroanilines and phenols . additionally , it is contemplated that the the penetration of insecticides such as deet and sunscreens such as paba can be inhibited by compounds of the present invention . a related utility of the compounds of the present invention is the inhibition of water loss occurring by diffusion of water from inside the body through the stratum corneum . having now fully described this invention , it will be understood to those of ordinary skill in the art that the same can be performed within a wide and equivalent range of conditions , formulations , and other parameters without affecting the scope of the invention or any embodiment thereof . all patents and publications cited herein are fully incorporated by reference herein in their entirety .	2
this invention provides fabricated tough hydrogels , tough hydrogel - containing compositions , and methods of making tough hydrogels and tough hydrogel - containing compositions . the invention also provides methods of using the fabricated tough hydrogels and tough hydrogel - containing compositions in treating a subject in need . hydrogels described in the prior art ( see for example , u . s . pat . nos . 4 , 663 , 358 , 5 , 981 , 826 , and 5 , 705 , 780 , us published application nos . 20040092653 and 20040171740 ) can be used as starting materials for making tough hydrogels of the present invention by employing methods described herein for the first time . the tough hydrogels provided in the present invention can be used in a body to augment or replace any tissue such as cartilage , muscle , breast tissue , nucleus pulposus of the intervertebral disc , other soft tissue , interpositional devices that generally serves as a cushion within a joint , etc . tough hydrogels generally include polymer , polymer blends , or copolymers of polyvinyl alcohol ( pva ), polyvinyl pyrrolidone ( pvp ), poly ethylene oxide ( peo ), polyacrylamide ( paam ), polyacrylic acid ( paa ), alginates , polysaccharides , polyoxyethylene - polyoxypropylene co - polymers , poly - n - alkylacrylamides , poly - n - isopropyl acrylamide ( pniaam ), chondroitin sulfate , dextran sulfate , dermatin sulfate , or combinations of two or more thereof . tough hydrogels , as disclosed herein , comprised of uniformly distributed hydrogel molecules or hydrogel particles comprising polyvinyl alcohol ( pva ) copolymerized and / or blended with at least one of the other polymers or gellants , for example , polyvinyl pyrrolidone ( pvp ), poly - n - isopropyl acrylamide ( pnipaam ), poly ethylene oxide ( peo ), chondroitin sulfate , dextran sulfate , dermatin sulfate and the like , or combinations of two or more thereof . according to one aspect of the invention , the tough hydrogels comprise polyvinyl alcohol ( pva ) copolymerized and / or blended with at least one of the other polymers . according to another aspect of the invention , the hydrogel solutions comprise polyvinyl alcohol ( pva ), polyvinyl pyrrolidone ( pvp ), poly ethylene oxide ( peo ), poly - n - isopropyl acrylamide ( pniaam ), or combinations of two or more thereof . according to another aspect of the invention , the hydrogel solution is a polyvinyl alcohol ( pva ) solution . tough hydrogels of the invention can be used in a variety of fashions in joints in mammals such as human joints . for example , an interpositional device can be manufactured from the tough hydrogels , which meet required mechanical strength to withstand high loads of human joints , and can be used in articular cartilage replacement applications . the interpositional devices typically act as a cushion within the joint to minimize the contact of the cartilage surfaces to each other ( see fig1 ). this is beneficial in patients with arthritic joints . early arthritic joints with cartilage lesions can be treated with such interpositional devices , which minimizes the contact between the damaged cartilage surfaces of the patient . the interpositional devices are described by fell et al . ( see u . s . pat . nos . 6 , 923 , 831 , 6 , 911 , 044 , 6 , 866 , 684 , and 6 , 855 , 165 ). these devices can have a variety of shapes and sizes . for a hydrogel interpositional device to perform in vivo in the long - term , the device first needs to have a high creep resistance . this is to minimize the changes to the shape of the interpositional hydrogel device during in vivo use . tough hydrogel materials of the invention with increased stiffness display increased creep resistance . the hydrogel interpositional device according to the invention also have superior mechanical properties , such as toughness , wear resistance , high creep resistance , etc . another method for the use of a hydrogel implant is through the filling of a cavity in the joint . the cavity can be an existing one or one that is prepared by a surgeon . a tough hydrogel plug can be inserted into the cavity . fig2 shows an example of a cavity filled with a hydrogel plug . the hydrogel plug can be of any shape and size ; for instance it can be cylindrical in shape . in some embodiments the plug can be oversized to be elevated from the surrounding cartilage surface . in other embodiments the plug can be undersized to stay recessed in the cavity . the over - sizing or under - sizing can be such that the plug can stand proud above the surrounding cartilage surface or recessed from the surrounding cartilage surface by about less than 1 mm , by about 1 mm , by more than about 1 mm , by about 2 mm , by about 3 mm , or by about more than 3 mm . in some embodiments the hydrogel plug can be slightly dehydrated to shrink its size and to allow an easy placement into the cavity . the hydrogel plug then can be hydrated and swollen in situ to cause a better fit into the cavity . the dehydrated and re - hydrated dimensions of the hydrogel plug can be tailored to obtain a good fit , under - sizing , or over - sizing of the plug after re - dehydration and re - swelling . the re - dehydration in situ can also be used to increase the friction fit between the plug and the cavity . this can be achieved by tailoring the dimensions and the extent of dehydration such that upon re - dehydration the cross - section of the plug can be larger than the cross - section of the cavity ; by for instance about 1 mm , less than 1 mm , or more than 1 mm . in some embodiments the cavity is filled with an injectable hydrogel system that cures in situ such as the one described by ruberti and braithwaite ( see us published application nos . 20040092653 and 20040171740 ), muratoglu et al ( u . s . provisional application no . 60 / 682 , 0008 , filed may 18 , 2005 ), lowman ( us published application no . 2004 / 0220296 ), and other injectable systems . the present invention provides methods of fabricating hydrogel systems to obtain tough hydrogels that can maintain shape under the high loads of human joints . according to one aspect of the invention , the tough hydrogels are obtained by improving the stiffness , toughness and strength of hydrogels to increase resistance to creep and resistance to wear . the invention provides dehydration methods to improve the mechanical properties of the hydrogel . the invention also provides permanent plastic deformation methods to increase the creep resistance of the hydrogel . various dehydration and deformation methods , described above , can be used together in combinations to improve the properties of hydrogels . any of the dehydration methods can be used either by itself or in combination with the other dehydration methods to improve the mechanical properties of hydrogels . plastic deformation method also can be used by itself to increase the creep resistance of the hydrogels . in the case of extreme dehydration of the hydrogel , it can be important for some of the applications to subsequently rehydrate the hydrogel at least to some extent to regain the lubrication imparted by the presence of water for some of the embodiments . if the heat dehydration is carried out starting with a hydrogel that contains water and one or more other ingredient ( s ), which are in most embodiments non volatile such as low molecular weight peg , and others such as pvp , peo , chondrotin sulfate , the dehydrated hydrogel is easily re - hydrated to varying levels . according to one aspect of the invention , the level of re - hydration following heat dehydration depends on the concentration of other ingredient ( s ) in the water phase of the initial hydrogel before dehydration . in contrast , if the starting hydrogel contains no other ingredients but water , then the extent of re - hydration subsequent to heat dehydration is substantially reduced compared to the re - hydration levels of the hydrogels dehydrated in the presence other ingredient ( s ). the presence of the other ingredient ( s ) other than water also has implication on the creep behavior of the hydrogel following heat dehydration and subsequent re - hydration . the hydrogel is more viscoelastic when it is heat treated in the presence of other ingredient ( s ). according to another aspect , pva hydrogels containing a low molecular weight ingredient , such as peg , retain their opacity during heat dehydration . in contrast , pva hydrogels containing no such ingredients and heat dehydrated under identical conditions lose their opacity and turn transparent , an indication for the loss of the molecular porosity . the molecular porosity is thought to be the free space in the structure where the water molecules penetrate the hydrogel , thus hydrating it . the loss of the opacity upon heat dehydration of hydrogels not containing any such ingredient can be the reason for their substantially reduced ability to re - hydrate . according to one aspect on the invention , the non - volatile ingredient remains in the hydrogel structure during heat dehydration and prevents the collapse of the molecular porosity , and thus allowing these hydrogels to re - hydrate following heat dehydration . the invention also provides freeze - thaw prepared pva ( ft - pva ) hydrogels , wherein the hydrogel is toughened by annealing at around 160 ° c . upon re - hydration , the annealed gels remain transparent forming an elastic and tough , almost rubber - like material . while this material is useful in some application , it may not be for applications requiring high water content in the hydrogel . the extent of re - hydration is further tailored in the annealed ft - pva by adding an ingredient such as peg into the water phase prior to the annealing . the invention also provides in another aspect that the permanent deformation can be used to substantially increase the creep resistance of hydrogels . in addition , high dose irradiation also can increase the cross - link density of the hydrogels . in one embodiment , the hydrogel material is plastically deformed . the plastic deformation introduces molecular orientation into the material . the material increases creep resistance in the direction in which it is deformed . therefore , it can be used as a high creep resistant implant . in one embodiment the implant is fabricated such that the deformation is in the direction of the axial load applied in the human joint , see fig1 , for example . in another embodiment , the plastic deformation is induced by uniaxial compression , channel - die compression tension , bending , shear , or other modes of deformation . the plastic deformation is induced at any temperature below the melting point of the hydrogel . the plastic deformation is induced statically or dynamically . in another embodiment , the deformation is induced by uniaxial compression . in another embodiment the deformation is induced by channel - die deformation . see fig3 for examples of deformation types . in another embodiment , the hydrogels are deformed under compression using flat or curved platens . the flat platens result in flat deformed surfaces of the hydrogel . the curved platens result with curved deformed surfaces ( see fig3 ). in another embodiment the deformation is induced by one flat and one curved platen . in another embodiment , the deformation of the hydrogel is carried out with shaped platens such that the deformed hydrogel become the final implant shape or the near - net shape of the final implant . in another embodiment , the deformed hydrogel is machined further to obtain the final implant shape . in another embodiment , the hydrogel implant is packaged and sterilized . the packaging can be such that the hydrogel device is immersed in an aqueous solution to prevent dehydration until implantation , such as during sterilization and shelf storage . the aqueous solution can be water , deionized water , saline solution , ringer &# 39 ; s solution , or salinated water . the aqueous solution also can be a solution of poly - ethylene glycol in water . the solution can be of less than 5 % ( wt ) in peg , about 5 % ( wt ), more than about 5 % ( wt ), about 10 % ( wt ), about 15 % ( wt ), about 20 % ( wt ), about 30 % ( wt ), about 50 % ( wt ), about 90 % ( wt ) or about 100 % ( wt ). the hydrogel device also can be sterilized and stored in a non - volatile solvent or non - solvent . the sterilization of the hydrogel implant is carried out through gamma sterilization , gas plasma sterilization , or ethylene oxide sterilization . according to one embodiment , the hydrogel is sterilized by autoclave . the sterilization is carried out at the factory ; or alternatively , the implant is shipped to the hospital where it is sterilized by autoclave . some hospitals are fitted with ethylene oxide sterilization units , which also is used to sterilize the hydrogel implant . in one embodiment , the hydrogel implant is sterilized after packaging . in other embodiments the hydrogel implant is sterilized and placed in a sterile aqueous solution . in another embodiment , pva hydrogel is prepared using the freeze - thaw method starting with an aqueous pva solution ( at least about 1 % ( wt ) pva , above about 1 % ( wt ) pva , about 5 % ( wt ) pva , about 10 % ( wt ) pva , above about 10 % ( wt ) pva , about 15 % ( wt ) pva , about 20 % ( wt ) pva , about 25 % ( wt ) pva , about above 25 % ( wt ) pva ) and subjecting it to freeze - thaw cycles ( at least 1 cycle , more than 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 or more cycles ). the freeze - thaw cycle is defined as cooling the pva solution below 0 ° c . and heating it back up above 0 ° c . the pva hydrogel is then subjected to dehydration . subsequently , the dehydrated hydrogel is placed in saline solution for re - hydration . this process results in very little re - hydrated pva hydrogel with high mechanical strength . in one embodiment of the invention , peg is used as a non - volatile non - solvent for pva hydrogels . dmso is used instead of water in preparing the aqueous pva solution , the precursor to the hydrogel . in one embodiment of the invention , peg solution is a solution of peg in a solvent ( preferably water , ethanol , ethylene glycol , dmso , or others ). the solution concentration can be anywhere between 0 . 1 % ( wt ) peg and 99 . 9 % ( wt ) peg . the peg in the solution can be of different molecular weights ( preferably 300 , 400 , or 500 g / mol , more than 300 g / mol , 1000 g / mol , 5000 g / mol or higher ). the peg in the solution can be a blend of different average molecular weight pegs . in another embodiment , peg containing pva hydrogel is prepared using the freeze - thaw method starting with an aqueous pva solution ( at least about 1 % ( wt ) pva , above about 1 % ( wt ) pva , about 5 % ( wt ) pva , about 10 % ( wt ) pva , above about 10 % ( wt ) pva , about 15 % ( wt ) pva , about 20 % ( wt ) pva , about 25 % ( wt ) pva , about above 25 % ( wt ) pva ) and subjecting it to freeze - thaw cycles ( at least 1 cycle , more than 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 or more cycles ). at this step the pva hydrogel can be optionally placed in saline to reach full hydration . subsequently , the gel is placed in a low molecular weight peg solution . this is to dope the hydrogel with the non - solvent peg . the duration of peg solution soak can be varied to either reach a uniform equilibrium peg content throughout the hydrogel or to reach a non - uniform peg distribution ( by shortening the soak duration ). the latter results in peg - rich skin and a gradient of peg concentration within the pva hydrogel . in another embodiment , peg containing pva hydrogel is prepared by starting with an aqueous pva solution ( at least about 1 % ( wt ) pva , above about 1 % ( wt ) pva , about 5 % ( wt ) pva , about 10 % ( wt ) pva , above about 10 % ( wt ) pva , about 15 % ( wt ) pva , about 20 % ( wt ) pva , about 25 % ( wt ) pva , about above 25 % ( wt ) pva ) and mixing it with a low molecular weight peg solution at an elevated temperature ( above room temperature or above 50 ° c .). upon cooling down to room temperature , the mixture forms a pva hydrogel containing water and the non - solvent peg . in another embodiment , the hot pva / peg mixture is not cooled to room temperature but instead is subjected to freeze - thaw cycles . in another embodiment , pva hydrogel is heat dehydrated . the pva hydrogel contains peg during heat dehydration ( or annealing ). the heat dehydration is carried out at 40 ° c ., at above about 40 ° c ., at 80 ° c ., at above 80 ° c ., at 90 ° c ., at 100 ° c ., at above 100 ° c ., at 150 ° c ., at 160 ° c ., at above 160 ° c ., at 180 ° c ., at 200 ° c ., or at above 200 ° c . the heat dehydration can be carried out in any environment , preferably in an inert gas like nitrogen or argon or in vacuum . the heat dehydration also can be carried out in air or acetylene gas or mixture of a number of gases . the heat dehydration can be carried out either by placing the hydrogel in an already heated environment to achieve a higher rate of heat dehydration or by heating the hydrogel slowly to achieve a slower rate of heat dehydration . the rate of heat dehydration can be such that the hydrogel loses weight from removal of water at a rate of 1 % weight loss per day , 10 % weight loss per day , 50 % weight loss per day , 1 % weight loss per hour , 10 % weight loss per hour , 50 % weight loss per hour , 1 % weight loss per minute , 5 % weight loss per minute , 10 % weight loss per minute , 50 % weight loss per minute or any amount thereabout or therebetween . the rate of heat dehydration depends on the rate at which the temperature is raised and the size of the hydrogel . prior to heat dehydration , the hydration level of the hydrogel can be reduced by vacuum dehydration . subsequent to the heat dehydration the hydrogel is placed in saline solution for re - hydration . this results in good levels of re - hydration in the pva hydrogel resulting in high mechanical strength and good lubrication when articulating against human cartilage or other hydrophilic surfaces . this hydrogel is expected to maintain its hydrogen bonded structure , thus is not be subject to dissolution over long - term in water , saline or bodily fluid . although the description and examples are given for a pva hydrogel systems , but can be applied to any hydrogel system of a polymeric structure , that is , with long - chain molecules . therefore , the invention provides hydrogel systems that includes , but not limited to , pva as the base material . polymeric materials can be oriented by mechanical deformation . the deformation results in molecular orientation . typically , the mechanical properties in the direction of the molecular orientation is superior to those of the isotropic , undeformed polymeric structure . the invention utilized this property of polymeric materials to improve the mechanical properties of hydrogel systems . by imposing a molecular orientation on a hydrogel material , the stiffness as well as the strength of the polymeric material is improved . at any step of fabrication , the hydrogel can be irradiated by e - beam or gamma to cross - link . the irradiation can be carried out in air , in inert gas , in sensitizing gas , or in a fluid medium such as water , saline solution , polyethylene - glycol solution , etc . the radiation dose level is between one kgy and 10 , 000 kgy , preferably 25 kgy , 40 kgy , 50 kgy , 200 kgy , 250 kgy , or above . the term “ hydrogel ” refers to undeformed or deformed hydrogel or tough hydrogels . the term “ hydrogel ”, as described herein , also encompasses “ tough hydrogels ” including de - hydrated and / or deformed hydrogels . tough hydrogels are networks of hydrophilic polymers containing absorbed water that can absorb a large amounts of energy , such as mechanical energy , before failure . according to one aspect of the invention , polyvinyl alcohol ( pva ) can be used as the base hydrogel . the base pva hydrogel can be prepared by the well - known freeze - thaw method by subjecting a pva solution ( pva can be dissolved in solvents such as water or dmso ) to one or multiple cycles of freeze - thaw . pva solution used in the freeze - thaw method can contain another ingredient like peg . the base pva hydrogel also can be prepared by radiation crosslinking of a pva solution . another method of preparing the pva hydrogel can be used to blend a pva solution with a gellant such as ( peg ) at an elevated temperature and cooling down to room temperature . in one embodiment , the hydrogel can be of any shape , such a cubical shape , cylindrical shape , rectangular prism shape , or implant shape . in another embodiment , nipaam can be used as the base hydrogel . the base nipaam hydrogel can be prepared by radiation crosslinking of a nipaam solution . alternatively , the methods described by lowman et al . can be used . in another embodiment , a double network ( dn ) hydrogel structure can be used as the base hydrogel . the base dn hydrogel can be prepared by methods described by gong et al . ( see advanced materials , 2003 , 15 , no . 14 : 1155 - 1158 ). the first network can be formed by reacting hydrophilic monomers such as 2 - acrylamindo - 2 - methylpropanesulfonic acid ( amps ) in presence of cross - linking agents . the gel is then immersed in the aqueous solution containing another type of monomer such as acrylic amide ( aam ). subsequent synthesis of the second network from those newly introduced monomers produces the dn hydrogel can be used as the base hydrogel . in another embodiment , a topological gel ( tp ) can be used as the base hydrogel . the base tp hydrogel can be prepared by methods described by tanaka et al . ( see progress in polymer science , 2005 , 30 : 1 - 9 ). the polymer chains in tp gels are flexibly bound by cross - linkers that are sliding along the individual chain . in the following embodiments , a nanocomposite ( nc ) gel structure can be used as the base hydrogel . the base nc hydrogel can be prepared by methods described by tanaka et al . ( see prog . polym . sci . 2005 , 30 : 1 - 9 ). in some of the embodiments a dehydrated hydrogel can be used as the base hydrogel . the level of dehydration can be controlled such that the base hydrogel contains between 99 % and 1 % water , more preferably between 99 % and 5 % water , more preferably between 99 % and 25 % water , more preferably between 99 % and 50 % water , more preferably between 99 % and 75 % hydrogel , more preferably about 70 % ( wt ) water , or 80 % ( wt ) water . the water content of the hydrogel can be determined by measuring the weight change of between its equilibrium hydration level and its dehydrated level . in some embodiments , a hot solution of pva / peg in water is cooled down to room temperature and is used in its “ as - gelled ” form . according to one aspect of the invention , the pva / peg hydrogel is immersed in water , deionized water , saline solution , phosphate buffered saline solution , ringer &# 39 ; s solution or salinated water to remove the peg . the process is called the depeging process . during depeging the hydrogel also absorbs water approaching equilibrium water content . therefore , depeging also is a re - hydration process . in one of the embodiments , the hydrogel is deformed under load to create a permanent deformation . in another embodiment , the dehydrated hydrogel is re - hydrated . in some of the embodiments , the re - hydrated hydrogel contains less water than the hydrogel did before the dehydration step . in some embodiments , the hydrogel dimensions are large enough so as to allow the machining of a medical device . in some embodiments the starting hydrogel is dehydrated before any deformation . in some embodiments the hydrogel is subjected to sequential dehydration and deformation cycles . in some embodiments the hydrogel is subjected to simultaneous dehydration and deformation cycles . dehydration of the hydrogel can be achieved by a variety of methods . for instance , the hydrogel can be placed in vacuum at room temperature or at elevated temperatures to drive out the water and cause dehydration . the amount of vacuum can be reduced by adding air or inert gas to the vacuum chamber where the hydrogel is placed during dehydration . dehydration of the hydrogel also can be achieved by keeping it in air or inert gas at room temperature or at an elevated temperature . dehydration in air or inert gas also can be carried out at temperatures lower than room temperature . in most embodiments , if the dehydration is carried out at elevated temperatures , it is necessary to keep the temperature below the melting point of the hydrogel . however , the melting point of the hydrogel can increase during the dehydration step and make it possible to go to higher temperatures as the dehydration evolves . dehydration of the hydrogel also can be carried out by placing the hydrogel in a solvent . in this case the solvent drives the water out of the hydrogel . for example , placing of pva hydrogel in a low molecular weight peg ( higher than 100 g / mol , about 300 - 400 g / mol , about 500 g / mol ) can cause dehydration of the pva hydrogel . in this case the peg can be used as pure or in a solution . the higher the peg concentration the higher the extent of dehydration . the solvent dehydration also can be carried out at elevated temperatures . these dehydration methods can be used in combination with each other . re - hydration of the hydrogel can be done in water containing solutions such as , saline , water , deionized water , salinated water , or an aqueous solution or dmso . in some embodiments , the hydrogel is shaped into a medical device and subsequently dehydrated . the dehydrated implant is then re - hydrated . the initial size and shape of the medical implant is tailored such that the shrinkage caused by the dehydration and the swelling caused by the subsequent re - hydration ( in most embodiments the dehydration shrinkage is larger than the re - hydration swelling ) result in the desired implant size and shape that can be used in a human joint . in some of the embodiments the starting shape of the hydrogel before deformation can be a rectangular prism , a cylinder , a cube , or a non - uniform shape . in one embodiment , the hydrogel is uniaxially compressed between two metal plates . the deformed hydrogel is then held under constant deformation for an extended period of time to achieve permanent deformation . the extent of deformation is measured in terms of compression ratio which equals the ratio of the initial height of the sample to the final height of the sample . the extent of deformation is also measured in terms of strain , which equals the ratio of the displacement to the initial height of the samples . the preferred extent of deformation measured by strain is between 10 % and 99 %, more preferably 20 % and 95 %, more preferably 50 % and 95 %, more preferably 75 % and 95 %, more preferably 80 % and 90 %, and most preferably 90 % or any value thereabout or therebetween . after holding the constant deformation the deformed hydrogel is removed form the press . in some embodiments the deformation is held for a sufficient amount of time to allow stress relaxation to reach equilibrium . in some other embodiments the hydrogel is subjected to cyclic loading during deformation . in one of the embodiments , the deformation induced in the hydrogel is achieved by placing the hydrogel in a channel - die , then compressing it in the channel - die to achieve orientation of the molecules primarily in the flow direction as shown in fig3 . the preferred extent of deformation ratio is between 10 % and 99 %, more preferably 20 % and 95 %, more preferably 50 % and 95 %, more preferably 75 % and 95 %, more preferably 80 % and 90 %, and most preferably 90 % or any value thereabout or therebetween . in another embodiment , the deformation of the hydrogel is achieved by placing the hydrogel in a channel - die , whereby the width of the block is smaller than the width of the channel - die . during initial stages of the deformation there can be biaxial orientation of the molecules until the hydrogel block makes contact with the walls of the channel - die , after which point the continued molecular orientation can take place primarily in one direction , which is the flow direction within the channel - die . in these embodiments the deformed hydrogel can have different levels of deformation in the two orthogonal directions ( principal directions of deformation ) within the plane of deformation . the direction of compression is normal to the plane of deformation . in another embodiment , the deformation of the block is achieved under uniaxial tension . in certain embodiments the deformation is carried out at a deformation rate lower than about 1 mm / min , at about 1 mm / min , more preferably between 1 mm / min and 10 m / min , more preferably between 10 mm / min and 100 mm / min , more preferably at about 20 mm / min or any value thereabout or therebetween . in some of the embodiments the deformation is applied sequentially . in these embodiments the hydrogel is deformed to a portion of the desired deformation ratio , held under constant deformation to allow some stress relaxation , and the deformation and stress relaxation steps are repeated until the desired deformation ratio is achieved . for instance , if the ultimate desired deformation ratio corresponds to a strain of 90 %, the hydrogel can be deformed in 30 % increments with a stress relaxation between each increment . in certain embodiments , the deformation is carried out in gas medium such as air or inert gas , or in fluid medium such as saline , dmso , or peg . in some embodiments the medium is heated during the deformation to below the melting point of the deforming hydrogel . the melting point of the hydrogel may change during deformation ; therefore , the temperature of the medium is adjusted to avoid melting . in some embodiments the deformation is carried out in a fluid medium such as saline solution , ringer &# 39 ; s solution , peg , aqueous peg solution , salt solution and other fluid medium . in certain embodiments the deformation is carried out at room temperature between about 10 ° c . and about 30 ° c ., more preferably between about 17 ° c . and about 25 ° c ., more preferably below the melting point of the hydrogel , more preferably between about 0 ° c . and about 40 ° c ., more preferably between about 10 ° c . and about 100 ° c . or any temperature thereabout or therebetween . in one of the embodiments , the hydrogel is compressed in a uniaxial compression mode between two platens , where the surfaces of the platens abutting the hydrogel during deformation are shaped so that the final compressed hydrogel has the desired final shape of the interpositional device . in one of the embodiments , the hydrogel is compressed in a channel - die , where the plunger and the die surfaces abutting the hydrogel during deformation are shaped so that the final compressed hydrogel has the desired final shape of the interpositional device . in certain embodiments , the hydrogel or deformed hydrogel can be machined into a desired shape to act as medical device , such as a kidney shaped interpositional device for the knee , a cup shaped interpositional device for the hip , a glenoid shaped interpositional device for the shoulder , other shapes for interpositional devices for any human joint . also the machining of the hydrogel or deformed hydrogel can result in a cylindrical , cuboid , or other shapes to fill cartilage defects either present in the joint or prepared by the surgeon during the operation . the hydrogel medical device can be an interpositional device such as a unispacer , to act as a free floating articular implant in a human joint , such as the knee joint , the hip joint , the shoulder joint , the elbow joint , and the upper and lower extremity joints . in some of the embodiments , following the deformation , the deformed hydrogel is dehydrated . subsequently the dehydrated gel is placed in saline solution for re - hydration . in some of the embodiments where the hydrogel is sequentially deformed , the deformed hydrogel can be dehydrated to different levels at all or some of the steps of the sequential deformation before the subsequent step of deformation . in some of the embodiments , the hydrogel or the deformed hydrogel is placed in 100 % peg to dehydrate the deformed hydrogel . subsequently the dehydrated gel is placed in saline solution for re - hydration . this process decreases the equilibrium water content in the gel , and hence result in further improves the mechanical properties hydrogel . in other embodiments , the hydrogel or deformed hydrogel is placed in a peg - water solution for controlled dehydration followed by re - hydration in saline . the concentration of the peg - water solution can be tailored to achieve desired level of dehydration of the hydrogel . higher dehydrations provide more improvements in mechanical properties and at lower dehydrations the improvement is less . in some applications , it is desirable to achieve a lower stiffness ; therefore a lower peg and / or water concentration solution can be used for the dehydration process . in some embodiments the hydrogel or the deformed hydrogel is dehydrated in vacuum at room temperature or at an elevated temperature . the vacuum dehydration can be carried out at about 10 ° c ., above about 10 ° c ., about 20 ° c ., about 30 , 40 , 50 , 60 , 75 , 80 , 90 ° c ., about 100 ° c . or above 100 ° c ., or at 130 ° c . or any temperature thereabout or therebetween . in some embodiments the vacuum dehydration of the hydrogel or the deformed hydrogel is first carried out at room temperature until a desired level of dehydration is reached ; thereafter the temperature is increased to further dehydrate the hydrogel . the temperature is increased , preferably to above about 100 ° c ., to about 160 ° c ., or to above 160 ° c . in some embodiments , the hydrogel is heated in air or inert gas or partial vacuum of inert gas for dehydration . in some of these embodiments , the hydrogel is vacuum dehydrated before heating in air or inert gas . in some embodiments , the heating of the hydrogel is carried out slowly ; for example at less than about 1 ° c ./ min , at more than about 1 ° c ./ min , at 2 , 5 , 10 ° c ./ min or faster . slower heating rates results in stronger gels than higher heating rates with some of the hydrogel formulations . in most embodiments the finished medical device is packaged and sterilized . in some of the embodiments the hydrogel is subjected to dehydration steps . the dehydration is carried out in air or in vacuum or at an elevated temperature ( for instance annealing at about 160 ° c .). the dehydration causes loss of water hence a reduction in volume accompanied by a reduction in weight . the weight loss is due to loss of water . the reduction in volume on the other hand could be due to the loss of water or further crystallization of the hydrogel . in some embodiments the dehydration is carried out by placing the hydrogel in a low molecular weight polymer ( for instance placing a pva hydrogel in a peg solution ). in some cases the dehydration is caused by loss of water , but in most cases , there is also uptake of the non - solvent by the hydrogel . therefore , the weight change of the hydrogel is the sum of loss of water and uptake of the non - solvent . the change in volume in this case is due to loss of water , uptake of the non - solvent , further crystallization of the hydrogel , or partial collapse of the porous structure of the non - solvent that is not occupying the space that water was filling in the pores . in some of the embodiments , the hydrogel is attached to a metal substrate . the metal substrate is a porous backside surface that is used for bone - in - growth in the body to fix the hydrogel implant in place . the metal substrate attachment to the hydrogel can be achieved by having a porous surface on the substrate where it makes contact with the hydrogel ; the porous surface can be infiltrated by the gelling hydrogel solution ( for instance a hot pva and / or peg mixture in water ); when the solution forms a hydrogel , the hydrogel can be interconnected with the metal substrate by filling the porous space . in some embodiments , there can be more than one metal substrate attached to the hydrogel for fixation with the hydrogel in the body to multiple locations . in some embodiments , the hydrogel / metal substrate construct can be used during the processing steps described above , such as depeging , solvent dehydration , non - solvent dehydration , irradiation , packaging , sterilization etc . in some of the embodiments the hydrogel contains hyaluronic acid ( ha ), either by having ha present in the solutions used to make the hydrogel and / or by diffusing ha into the hydrogel . in some of the embodiments the ha - containing hydrogel is irradiated . the irradiation can be carried out before , after , or during the processing steps such as vacuum dehydration , non - solvent dehydration , re - hydration , annealing , and / or deformation . the irradiation cross - links the hydrogel matrix and in some embodiments also forms covalent bonds with the ha . addition ha to some of the hydrogels increases the lubricity of the hydrogel implant . this is beneficial for the tough hydrogels contain substantially reduced water content . in some of the embodiments the hydrated hydrogel implants are slightly heated at the surface to partially melt the hydrogel and allow it to reform with more uptake and more lubricity . in some of the embodiments a microwave oven is used to prepare the pva solution . the pva powder is place in water and the mixture is heated in a microwave oven to form a solution . in some of the embodiments the heat dehydration or annealing of the hydrogel is performed in a microwave oven . according to one embodiment of the invention , tough gel is prepared by a process comprising the steps of : providing polymeric material such as pva powder ; mixing with water at temperature above the room temperature ( such as at about 50 ° c .- 60 ° c . ), thereby forming a solution ; subjecting the solution to at least one freeze - thaw cycle or heating to a temperature below the melting temperature such as about 80 ° c . ; cooling the heated solution to an ambient temperature such as room temperature , thereby forming a hydrogel ( which is generally uniform , may also contain hydrogel particles ); and deforming and / or dehydrating the hydrogel , thereby forming the tough hydrogel . in another embodiment , optionally the hydrogel is dehydrated by heating from about 40 ° c . to above 200 ° c . and is subject to depeging . one embodiment of the invention provides methods of making a tough hydrogel comprising : a ) contacting a hydrogel with an organic solvent , wherein the hydrogel comprises a polymer which is not soluble in the solvent , and wherein the solvent is at least partially miscible in water ; b ) heating the hydrogel to a temperature below or above the melting point of the hydrogel ; and c ) cooling the heated hydrogel to room temperature , wherein the method dehydrates the hydrogel , thereby forming a tough hydrogel . another embodiment of the invention provides methods of making a tough hydrogel comprising : a ) contacting a hydrogel with an organic solvent , wherein the hydrogel comprises a polymer which is not soluble in the solvent , and wherein the solvent is at least partially miscible in water ; and b ) air - drying the hydrogel at room temperature , wherein the method dehydrates the hydrogel , thereby forming a tough hydrogel . another embodiment of the invention provides methods of making a tough hydrogel comprising : a ) contacting a hydrogel with an organic solvent , wherein the hydrogel comprises a polymer which is not soluble in the solvent , and wherein the solvent is at least partially miscible in water ; and b ) subjecting the hydrogel to at least one freeze - thaw cycle and allowing the hydrogel to warm - up room temperature , wherein the method dehydrates the hydrogel sample , thereby forming a tough hydrogel . another embodiment of the invention provides methods of making a tough hydrogel comprising the steps of : a ) providing a polymeric material , wherein the polymeric material is pva powder ; b ) mixing the polymeric material with water and / or peg , thereby forming a solution ; c ) subjecting the solution to at least one freeze - thaw cycle , thereby forming a hydrogel ; and d ) dehydrating and / or deforming the hydrogel , thereby forming a tough hydrogel . another embodiment of the invention provides methods of making a tough hydrogel comprising the steps of : a ) providing a polymeric material , wherein the polymeric material is pva powder ; b ) mixing the polymeric material with water and / or peg at a temperature above the room temperature , thereby forming a solution ; c ) cooling the solution to an ambient temperature , thereby forming a hydrogel or hydrogel particles ; and d ) dehydrating and / or deforming the hydrogel , thereby forming a tough hydrogel . 1 . hydrogels that are capable of re - hydration following dehydration , wherein the tough hydrogel is capable of re - hydration following dehydration , wherein a ) the dehydration reduces the weight of the hydrogel by more than about 34 %; and b ) the re - hydration results in at least about 46 % equilibrium water content in the re - hydrated hydrogel . a . the hydrogel contains water and / or one or more other ingredient ( for example , peg , proteoglycans , water soluble polymers , salts , amino acids , alcohols , dmso , water soluble vitamins ), where the additional ingredients can be completely or partially soluble in water ; b . the ingredient is non - volatile ; c . the ingredient is at least partially miscible with water ; d . at least 0 . 1 % of the hydrogel &# 39 ; s weight constitutes one or more non - volatile ingredient , such as peg , and the like ; e . the ingredient is a water miscible polymer such as peo , pluronic , amino acids , proteoglycans , polyacrylamide , polyvinylpyrrolidone , and the like ; f . the ingredient is selected from the group of peg , salt , nacl , kcl , cacl , vitamins , carboxylic acids , hydrocarbons , esters , amino acids and the like ; g . the ingredient is peg , wherein i . peg of different molecular weights , or ii . blends of pegs ; h . the hydrogel is dehydrated prior to or after deformation , for example , i . dehydration by placing in a non - solvent , which is completely or partially water miscible , wherein a . the non - solvent is selected from peg , isopropyl alcohol , saturated salinated water , vitamins , and carboxylic acids , b . the non - solvent contains more than one ingredient such as water , peg , vitamins , polymers , esters , proteoglycans , and the like , and c . melting the hydrogel , which is a mixture . ii . dehydration by leaving the hydrogel in air , iii . dehydration by placing the hydrogel in vacuum , iv . dehydration by placing the hydrogel in vacuum at room temperature , v . dehydration by placing the hydrogel in vacuum at an elevated temperature , or vi . dehydration by placing in a supercritical co 2 . i . the deformation is uniaxial ; or j . the deformation is carried out by channel - die . 6 . dehydration of a hydrogel containing water and / or one or more other ingredient ( for example , peg or salt ), wherein a . the ingredient is non - volatile such as peg ; b . the ingredient is at least partially miscible with water ; c . at least 0 . 1 % of the hydrogel &# 39 ; s weight constitutes one or more non - volatile ingredient , such as peg , hydrocarbons , and the like ; d . the ingredient is a water miscible polymer such as peo , pluronic , amino acids , proteoglycans , polyvinylpyrrolidone , polyacrylamide , polysaccharides , dermatin sulfate , keratin sulfate , dextran sulfate , and the like ; e . the ingredient is selected from the group of peg , salt , nacl , kcl , cacl , vitamins , carboxylic acids , hydrocarbons , esters , amino acids , and the like ; f . the ingredient is peg , wherein i . peg of different molecular weights , or ii . blends of pegs , g . the dehydration is carried out by placing in a non - solvent , wherein i . the non - solvent is selected from peg , isopropyl alcohol , saturated salinated water , aqueous solution of a salt of an alkali metal , vitamins , carboxylic acids , and the like , or ii . the non - solvent contains more than one ingredient such as water , peg , vitamins , polymers , proteoglycans , carboxylic acids , esters , and the like . h . the dehydration is carried out by leaving the hydrogel in air ; i . the dehydration is carried out by placing the hydrogel in vacuum ; j . the dehydration is carried out by placing the hydrogel in vacuum at room temperature ; k . the dehydration is carried out by placing the hydrogel in vacuum at an elevated temperature ; l . the dehydration is carried out by heating the hydrogel in air or inert gas to elevated temperature , wherein i . the heating rate is slow , ii . the heating rate is fast , or iii . the heating follows the vacuum or air dehydration ; and i . by placing in water , saline solution , ringer &# 39 ; s solution , salinated water , buffer solution , and the like , ii . by placing in a relative humidity chamber , or iii . by placing at room temperature or at an elevated temperature . each composition and attendant aspects , and each method and attendant aspects , which are described above can be combined with another in a manner consistent with the teachings contained herein . the invention is further described by the following examples , which do not limit the invention in any manner . thirty grams of poly ( vinyl alcohol ) ( pva , mw = 118 , 000 ) were added to 170 grams of cold deionized water and stirred while heating for about 2 hours to prepare a fully dissolved 15 % ( wt ) pva solution . the dissolved pva solution was kept in an air convection oven ( dkn600 , yamato ) at 90 ° c . for about 16 hours . poly ( ethylene glycol ) ( peg , mw = 400 ) was heated to 90 ° c . in an air convection oven . 52 . 88 grams of hot peg ( at approximately 90 ° c .) was slowly mixed with 160 grams of hot ( at approximately 90 ° c .) pva solution by mechanical stirring while heating . this hot mixture of pva and peg is called a pva / peg gelling solution . the gelling solution was poured into different size molds kept at 90 ° c . the molds were covered with an insulating blanket and left to cool down to room temperature . the solution formed a hydrogel upon cooling down to room temperature . several batches of pva / peg solution was prepared to cast gels of different dimensions and sizes as described in examples below . in some of the examples , the gels that were cast were removed from the molds and subjected to further processing . in some examples the gels were used for testing and / or subjected to further processing in their “ as - gelled ” form ; that is they contained peg . in some of the examples the gels were first “ depeged ” and then used for testing and / or subjected to further processing in their “ depeged ” form . the “ as - gelled ” gel refers to the state where the gel was blot - dried right after removal from the mold . the “ depeged ” gel refers to the gel that was immersed in copious amounts of saline solution to remove peg and hydrate the gel to equilibrium , which was confirmed gravimetrically . 2 . determination of the equilibrium water content ( ewc ) in a hydrogel following method was used to determine the equilibrium water content ( ewc ) in a hydrogel . the specimens were first immersed in saline solution with agitation for removal of any unbound molecules and for equilibrium hydration . to determine when the gels reached equilibrium hydration , their weight changes were recorded daily and the saline solution was replaced with fresh saline solution . after the equilibrium hydration level was reached , the equilibrium hydration weights of the specimens were recorded . subsequently , the gel specimens were dried in an air convection oven at 90 ° c . until no significant changes in weight were detected . the ewc in a gel was then calculated by the ratio of the difference between the hydrated and dehydrated weights to the weight at equilibrated hydration state . thirty grams of poly ( vinyl alcohol ) ( pva , mw = 118 , 000 ) were added to 170 grams of cold deionized water and stirred while heating for about 2 hours to prepare a fully dissolved 15 % ( wt ) pva solution . the dissolved pva solution was kept in an air convection oven ( dkn600 , yamato ) at 90 ° c . for about 16 hours . poly ( ethylene glycol ) ( peg , mw = 400 ) was heated to 90 ° c . in an air convection oven . 52 . 88 grams of hot peg ( at approximately 90 ° c .) was slowly mixed with 160 grams of hot ( at approximately 90 ° c .) pva solution by mechanical stirring . the mixture was kept at approximately 90 ° c . during stirring . the mixture solution was then poured into a hot mold kept at around 90 ° c . several batches of pva / peg solution were prepared using this method to cast gels in a large mold . the large mold was cylindrical in shape and was made out of plexiglass ™ tube stock ( height : 50 mm , diameter : 160 mm ). one end of the tube was covered by glueing a piece of 7 mm thick plexiglass ™ sheet . the mold was first heated in an air convection oven to approximately 90 ° c . and then topped - off ( completely filled ) with the hot pva / peg mixture that was also kept at approximately 90 ° c . the open top of the mold was covered by another piece of plexiglass ™ sheet to minimize evaporation of water from the mixture and to create a smooth top surface . the mold was covered with an insulating blanket and cooled down to room temperature over 16 hours . upon cooling , the pva / peg aqueous solution mixture formed a hydrogel . the hydrogel was removed from the mold . the height of the hydrogel was measured to be 46 . 8 mm and the diameter was 157 . 3 mm . the hydrogel typically shrinks during its formation and it is generally smaller than the mold in which it is cast . the gel was removed from the mold , placed between two flat platens that were attached to an mts machine ( minibionix ), and deformed . thus , the deformation was carried out in the “ as - gelled ” form of the pva hydrogel that contained both water and peg ( one can also remove peg from the hydrogel by immersion in saline solution with agitation prior to deformation ). the hydrogel was placed between the metal plates and compressed along the short axis of the cylinder . the compression proceeded at a rate of 0 . 2 mm / min to the point where the compression ratio was about 10 . compression ratio is defined as the ratio of the initial height to final height of the hydrogel . when the gel height under compression reached about 5 mm , the displacement was held constant for at least 24 hours to achieve stress relaxation equilibrium . due to the large lateral expansion of the hydrogel during deformation , the circumference of the compressed hydrogel was extruded out of the platens &# 39 ; coverage before reaching the desired compression ratio . one can use slightly smaller diameter molds or increase the platens &# 39 ; diameter to prevent the extrusion . the final height of the hydrogel in the center upon removal from compression was about 8 mm . a cut section of the gel is shown in fig4 . a hydrogel implant with biaxial orientation of the molecules induced by uniaxial compression can be fabricated using the above described method . one would first determine the desired amount of compression ratio so that after deformation the thickness of the hydrogel can be at least equal to or larger than the thickness of the desired implant . the implant can either be machined at this stage from the deformed hydrogel sheet or the platens used during the deformation could have the shape of the inplant imprinted on their faces that make contact with the hydrogel so that after deformation the deformed hydrogel has the net or near - net shape of the implant . additional machining steps is necessary at this stage , especially for the near - net shape implant . a hot pva / peg gelling solution was prepared as described in example 1 . the solution was poured into a hot mold kept at around 90 ° c . the mold was covered with an insulating blanket and was left to cool down to room temperature over 16 hours . upon cooling a hydrogel block formed inside the mold . the mold dimensions were such that the hydrogel block had the shape of a sheet with dimensions of 7 mm × 25 mm × 45 mm . several identical hydrogel sheets were thus fabricated . the hydrogel sheets were cut into cylindrical test samples and these test samples were placed in different media to quantify the extent of equilibrium swelling and / or equilibrium deswelling by recording weight changes . the media used were saturated aqueous nacl ( 5 . 2 m ), saline ( 0 . 9 % aqueous nacl ), acetone , iso - propyl alcohol , polyethylene glycol with a molecular weight of 400 g / mol ( peg400 ). cylindrical test samples were templated from the hydrogel sheets by cutting with a 9 . 5 mm diameter trephine . five cylindrical test samples were used for each medium . weight and dimensions ( diameter and height ) of all pieces were first recorded in their “ as gelled ” form immediately after cutting with the trephine . five test samples were then immersed in the respective media listed above . the samples were kept in glass vials filled with the respective media and shaken on a platform shaker at room temperature ( innova200 platform shaker , new brunswick scientific , edison , n . j .). weight and dimensions of all specimens were recorded in every 1 h for the first 8 h of immersion ; and daily measurements continued until equilibrium swelling or deswelling was reached under continuous shaking . the hydrogel test samples swelled or deswelled to different degrees during storage in different media . subsequently , all test samples were removed from the respective media and placed them in saline until equilibrium re - hydration was reached . the weight changes were recorded in every 1 hour for the first 8 hour of saline re - hydration and daily measurements continued until equilibrium hydration level was reached . the saline solution was changed daily to remove any of the other media that was coming out of the hydrogel test samples . swelling and / or deswelling values were calculated by dividing the difference between the weight at each measurement step and initial weight of the specimen by the initial weight of the specimen . in all cases , the initial weight was the weight recorded immediately after cutting the test samples with the trephine in their “ as - gelled ” form . the hydrogel samples swelled in saline and saturated nacl solution and deswelled in the other media ( fig5 ). the peg400 , acetone and ipa deswelled the hydrogel samples . the deswelling is attributed to loss of water to the surrounding medium . there was likely absorption of the medium in the hydrogels during the first phase , i . e . media immersion . when the samples were placed in saline , following media immersion , there was marked re - hydration . the equilibrium level of re - hydration was comparable with the hydrogel samples that were previously deswelled in acetone , peg400 , and saturated nacl . equilibrium hydration levels of hydrogels can be reduced by immersion in certain media . reduced hydration level improved the mechanical properties of the hydrogel . one can fabricate an implant using the solvent dehydration technique described in this example . dimensional changes caused by solvent dehydration and / or subsequent re - hydration would have to be taken into account so that final equilibrium dimensions achieved with the implant after it is implanted in vivo are the desired dimensions . also the implant can be stored until implantation in a medium that can cause it to deswell and the implant can be inserted into the human body in its swollen state ; bodily fluids can then rehydrate the implant to swell . a hot pva / peg gelling solution was prepared as described in example 1 . the solution was poured into a hot mold kept at around 90 ° c . with a cover to form a hydrogel sheet . after one day of gelling at room temperature the hydrogel was removed from the mold . the dimensions of the hydrogel were 54 mm × 44 mm × 54 mm . two such hydrogel blocks were fabricated . upon removal from the mold , one of the hydrogel was immediately deformed in its “ as - gelled ” form . the second block was first immersed in saline solution with agitation ( for de - peging ; that is peg removal and equilibrium hydration ) and was deformed afterwards . an aluminum channel die with inner channel dimensions of 12 ″ length , 2 ″ height , and 8 ″ width was custom - manufactured . the die was placed between two parallel metal plates attached to an mts loading frame ( fig6 ). the rectangular prism shaped hydrogel was placed in the center of the channel and the die plunger was kept in contact with the top surface of the hydrogel . the compression was carried out on an mts machine ( mts servo - hydraulic testing machine , mts , minneapolis minn .) and proceeded at a rate of 0 . 2 mm / min to the point where the compression ratio was about 10 ( initial height : final height ). when the hydrogel height under compression reached about 5 mm , the displacement was held constant to achieve stress relaxation . upon completion of compression , the hydrogel was removed from the channel die ( fig7 ). the weight of the depeged hydrogel reduced from 124 . 4 g to 55 . 5 g , and its thickness was reduced from 54 mm to 6 . 6 mm . even though the displacement of the plunger was such that the deformation resulted in 5 mm of thickness in the hydrogel block ; upon removal of the load on the plunger , the deformed block recovered elastically to 6 . 6 mm . the deformed gels were cut into 6 equal pieces to serve as samples that were subjected to other processing steps . some of the samples were re - hydrated in saline at room temperature until equilibrium hydration was reached , which was confirmed gravimetrically . some of the samples were vacuum dehydrated at room temperature until equilibrium dehydration was reached ( confirmed gravimetrically ), which took 5 days . some of the samples were dehydrated by placing in polyethylene glycol ( peg400 ; mw = 400 g / mol ) until equilibrium dehydration was reached ( confirmed gravimetrically ), which took 2 days . following the respective dehydration steps some of the samples were subjected to slow annealing and some to flash annealing at 160 ° c . flash anneal was carried out in nitrogen at 160 ° c . by placing the dehydrated samples in an oven already heated to 160 ° c . for one hour ( flash anneal ). slow annealing was carried out by heating from room temperature to 160 ° c . at approximately 5 ° c ./ min and subsequently keeping at 160 ° c . for a total annealing time of one hour ( slow anneal ). after annealing , flash or slow , all samples were immersed in saline until equilibrium hydration was reached , which was confirmed gravimetrically . finally , the gels were analyzed to determine the ewc using the method described in example 2 . table 1 lists the equilibrium weight change and ewc of the channel - die deformed hydrogel sample following different processing schemes . following deformation and re - hydration the gel showed a 36 % weight loss , indicating loss of water . additional experiments also showed that the extent of water loss increases with increasing extent of deformation ; therefore one can tailor the equilibrium water content of deformed hydrogels by varying the extent of deformation . the peg400 dehydration alone did not markedly affect the ewc . on the other hand , both of the annealing schemes substantially reduced the ewc . lower ewc produced stronger and tougher gels . the strongest gels were achieved by vacuum dehydration followed by annealing of the channel - die deformed de - peged gels . one can fabricate a finished implant using any of the steps described above and tailor a desired ewc . a hot pva / peg gelling solution was made as described in example 1 . the solution was poured into a rectangular prism shaped mold ( 40 mm × 45 mm × 50 mm ) kept at 90 ° c ., the mold was covered and insulated with an insulating blanket . the mold was left to cool down to room temperature to form a hydrogel . two such hydrogel blocks were prepared . one block was used in its “ as - gelled ” form and the other one was immersed in saline solution at room temperature for removal of peg ( depeging ) and equilibrium hydration . the rectangular prism shaped gel was placed between two flat metal plates attached to an mts machine ( mts servo - hydraulic testing machine , mts , minneapolis minn .) and compressed along the longest axis . the compression proceeded at a rate of 0 . 2 mm / min to the point where the compression ratio was 10 ( initial height : final height ). when the gel height under compression reached 5 mm , the displacement was held constant for at least 24 hours until stress relaxation equilibrium was achieved . the uniaxial compression allowed us to achieve a permanently deformed gel with biaxial orientation of the hydrogel molecules . subsequent to the deformation the gel was removed from the mts machine . there was some elastic recoil ( recovery of elastic deformation ) upon unloading ; but the resulting gel had permanent deformation . the uniaxial deformation was carried out with both of the as - gelled and depeged hydrogels . at this step a medical device , such as a joint ( hip , knee , or shoulder ) interpositional device , can be machined from the deformed pva gel . upon completion of uniaxial compression , the dimensions of rectangular prism shaped “ as - gelled ” hydrogel specimen changed from a length of 41 . 83 mm , a width of 47 . 37 mm , and a height of 49 . 75 mm , to a length of 88 . 29 mm , a width of 98 . 74 mm , and a height of 6 . 4 mm . in the case of depeged hydrogel , the dimensions of the specimen changed from a length of 43 . 49 mm , a width of 50 . 01 mm , and a height of 53 . 03 mm to a length of 93 . 17 , a width of 97 . 78 , and a height of 6 . 71 . the deformed gels were cut into 5 pieces and each cut sample was subjected to further processing . some of the hydrogel specimens from the “ as - gelled and deformed ” group and “ depeged and deformed ” group were re - hydrated in saline at room temperature until equilibrium hydration was reached , which was confirmed gravimetrically . some of the hydrogel samples from both groups were vacuum dehydrated at room temperature until equilibrium dehydration was reached ( confirmed gravimetrically ), which took 5 days . some of the hydrogels of each group were dehydrated by placing in polyethylene glycol ( peg400 ; mw = 400 g / mol ) until equilibrium dehydration was reached ( confirmed gravimetrically ), which took 2 days . following the respective dehydration steps some of the samples were subjected to slow annealing and some to flash annealing at 160 ° c . flash anneal was carried out in nitrogen at 160 ° c . by placing the dehydrated samples in an oven already heated to 160 ° c . for one hour ( flash anneal ). slow annealing was carried out by heating from room temperature to 160 ° c . at approximately 5 ° c ./ min and subsequently keeping at 160 ° c . for a total annealing time of one hour ( slow anneal ). after annealing , flash or slow , all samples were immersed in saline until equilibrium hydration was reached , which was confirmed gravimetrically . finally , the gels were analyzed to determine the ewc using the method described in example 2 . tables 2 - 3 list the equilibrium weight change and the equilibrium water content ( ewc ) of the deformed hydrogel samples following different processing schemes . after deformation the as - gelled sample re - hydrated more than the depeged ones ; presumably the presence of peg in the as - gelled hydrogel protected the pore structure and prevented their collapse , which , in turn , improved the re - hydration capacity of the hydrogel . the ewc was higher in the as - gelled and deformed samples than it was in the depeged and deformed samples when re - hydration followed deformation immediately . similarly , for all of the other processing schemes the as - gelled samples had higher ewc than the depeged samples . the peg400 dehydration alone did not markedly affect the ewc . on the other hand , both of the annealing schemes substantially reduced the ewc . lower ewc produced stronger and tougher gels . one can fabricate a finished implant using any of the steps described above and tailor a desired ewc . a hot pva / peg gelling solution was prepared as described in example 1 and poured into a hot mold ( 7 mm height × 2 . 5 mm diameter × 4 . 5 mm width ) with a cover to form a hydrogel sheet . after 1 day of gelling at room temperature , the molded hydrogel sheet was cut into cylindrical gels using a trephine blade ( corneal trephine blades , diameter 9 . 5 mm , stradis medical , alpharetta , ga .) mounted on a drill press ( enco manufacturing co , model 105 - 1100 , chicago , ill .). the initial height , diameter and weight of each cylindrical hydrogel sample were measured upon cutting . these cylindrical test samples are called “ as - gelled ” cylindrical test samples because they were not subjected to any treatment after gelling and they contained peg that was in the gelling solution . some of the “ as - gelled ” samples were immersed in 100 % poly - ethylene glycol with a molecular weight of 400 g / mol , ( peg400 ) and five additional “ as - gelled ” samples were immersed in a 50 % peg400 aqueous solution at room temperature with agitation . immersion in peg causes removal of water from the pva hydrogel , thus results in dehydration and deswelling . the peg immersion of the cylindrical test samples lasted for at least 24 hours to ensure equilibrated dehydration state . when the equilibrium deswelling of the hydrogel samples that were in 100 % and 50 % peg400 was achieved , i . e ., no significant changes in each hydrogel weight was detected , these hydrogel samples were removed from their respective media and placed in saline solution with agitation at room temperature for at least 2 days for re - hydration and removal of peg from the hydrogel . the saline solution was replaced with fresh saline everyday during saline immersion of these samples . when equilibrium re - hydration of the hydrogel sample was obtained with no significant changes in weight over time , the final height , diameter and weight of the hydrogel specimens were recorded . gravimetric swelling and / or deswelling of the hydrogel samples after peg immersion and subsequent re - hydration in saline was calculated with respect to the “ as - gelled ” state ( see table 4 ). the degree of deswelling in the hydrogel samples during peg immersion was influenced by the concentration of the peg solutions . the “ as - gelled ” hydrogels deswelled by about 45 % in 100 % peg400 and by about 27 % in 50 % peg400 solution . the gels immersed in 100 % peg had slight distortion in shape : the center regions in the top and bottom surfaces of each cylindrical hydrogel were slightly dimpled , probably due to non - uniform swelling rates in the core and the skin of the hydrogel . in contrast , the samples in the 50 % peg solutions had no discernible shape distortion after dehydration . the samples that were swollen in 100 % peg and 50 % peg solutions , swelled after immersion in saline . the observations of the present example are important for determining the storage protocol of hydrogel implants , such as those that can be used as mosaicplasty plugs or interpositional devices . for example , the gels that can reach the same or similar dimensions at the re - hydrated state can be previously reduced to various dimension ranges for ease of insertion into the body cavity , with minimal distortion in the hydrogel shape , by simply controlling the peg concentration in the hydrogel storing solution . 8 . the effect of peg molecular weight on dehydration of pva hydrogels a hot pva / peg gelling solution was prepared as described in example 1 and poured into a hot mold kept at around 90 ° c . ( 7 mm height × 2 . 5 cm diameter × 4 . 5 cm width ) with a cover to form a hydrogel sheet . the mold was covered by an insulting blanket and was left to cool down to room temperature . after 1 day of gelling at room temperature , the molded hydrogel sheet was cut into cylindrical hydrogels using a trephine blade ( corneal trephine blades , diameter 9 . 5 mm , stradis medical , alpharetta , ga .) mounted on a drill press . height , diameter and weight of each cylindrical hydrogel specimen were measured upon cutting . the hydrogel cylindrical samples were used in their “ as - gelled ” form . the “ as - gelled ” form is the form of the pva hdyrogel that contains water and peg that was present in the pva / peg gelling solution used . the hydrogel samples were immersed in 50 % aqueous solution of poly - ethylene glycol with different molecular weights ( mw ) to determine the effect of peg mw on the extent of hydrogel deswelling . some of the cylindrical hydrogels were immersed in 50 % peg400 ( peg mw = 400 g / mol ) aqueous solution and some of the hydrogels were immersed in a 50 % peg600 ( peg mw = 600 g / mol ) aqueous solution at room temperature with agitation for at least 24 hours to ensure equilibrated deswelling state . some of the hydrogels were immersed in saline with no peg deswelling to serve as controls . immersion in 50 % peg400 or 50 % peg600 solution resulted in weight loss in the hydrogel samples likely due to the removal of water ; hence the immersion of the hydrogel samples in 50 % peg solutions caused deswelling . when the deswelling of the hydrogel samples reached equilibrium i . e ., no significant changes in hydrogel weight were detected over time , the hydrogel specimens were placed in saline solution with agitation at room temperature for at least 2 days for re - hydration and removal of peg from the hydrogel samples . the saline solution was replaced with fresh saline everyday during immersion to remove the peg that was eluting out of the hydrogel samples . when equilibrium re - hydration of the hydrogel was obtained with no significant changes in weight over time , the hydrogel samples were removed from the saline solution , blot - dried , and the final height , diameter and weight of the hydrogel specimens were recorded . gravimetric swelling and / or swelling of the hydrogel after peg dehydration and subsequent re - hydration in saline was calculated with respect to the “ as - gelled ” state ( see table 5 ). that is the percent deswelling or percent swelling of the hydrogel at a given step is the ratio of the difference between the weight of the hydrogel at that step and the “ as - gelled ” weight to the weight of the “ as - gelled ” sample . the molecular weight of peg in the 50 % aqueous peg solutions used during immersion slightly affected the extent of deswelling of the “ as - gelled ” hydrogel samples . the “ as - gelled ” hydrogel samples deswelled by 27 % in 50 % aqueous peg400 and by 31 % in 50 % aqueous peg600 solutions . the higher the peg mw was , the more deswelled the pva hydrogels were after the peg immersion . peg with a molecular weight higher than 600 g / mol would exhibit more deswelling of the hydrogels . the dehydrated hydrogels both in 50 % peg400 and in 50 % peg600 showed no discernible distortion in shape . a hydrogel implant can be fabricated and immersion in different media can be used to tailor mechanical properties and control dimensions of the implant . one such method is to immerse the implant in aqueous solutions of peg with different molecular weights . the above method can also be used by first removing the peg from the hydrogel ( immersion in saline with agitation — depeging ) and then immersing it in the peg solutions . 9 . the effect of the presence of peg in pva hydrogel on the hydrogel &# 39 ; s capacity to rehydrate subsequent to dehydration a hot pva / peg gelling solution was prepared as described in example 1 and was cast in rectangular molds ( 44 mm × 54 mm ) to prepare sheets of thickness of either 7 mm or 21 mm . the molds were covered with an insulating blanket and left to cool down to room temperature over 16 hours . hydrogels were thus formed in these molds . four of each thickness ( 7 mm and 21 mm ) hydrogel sheets were immersed into saline for removal of peg ( depeging ) ( set i ) and another set of four was kept in its “ as - gelled ” form ( set ii ). the hydrogel specimens in both sets were first weighed and subsequently placed in vacuum at room temperature for dehydration . the weight changes were recorded daily until equilibrium dehydration level was reached ( 5 days for “ as - gelled ” set ii and 7 days for the depeged set i ). after vacuum dehydration , one sample from each set was immersed directly in saline for re - hydration . the weight changes were recorded daily until equilibrium re - hydration level was reached ( 5 - 6 days ). another set of 7 mm hydrogel sheets ( set iii ) were used to study the effect of room temperature air dehydration . for this experiment , three hydrogel sheets were weighed and then left in air at room temperature ( approximately 24 ° c .) for up to 9 days . the weight change of the samples was recorded daily . an additional set of hydrogel sheets ( set iv ) were used to study the effect of room temperature air dehydration following peg removal from the hydrogel sheets . for this experiment , three hydrogel sheets were depeged in saline at room temperature with agitation until equilibrium hydration level was reached ( approximately 6 days ). subsequently the hydrogel sheets were weighed and left in air at room temperature for up to 9 days . the weight change was recorded daily . subsequent to vacuum dehydration , one sample from each of set i and set ii was annealed in nitrogen at 160 ° c . by placing in an oven already heated to 160 ° c . for one hour ( flash anneal ). the sample &# 39 ; s weight and dimensions were recorded before and after annealing . another sample from each set was annealed by heating from room temperature to 160 ° c . at approximately 5 ° c ./ min and subsequently keeping at 160 ° c . for a total annealing time of one hour ( slow anneal ). after annealing , flash or slow , all samples were immersed in saline until equilibrium hydration . the weight and dimension of the samples were recorded daily . the equilibrium water content of the 21 mm thick pva - peg as - gelled and depeged were measured at different processing steps . to this end , three samples were cut from each of the ( 1 ) vacuum dehydrated and subsequently re - hydrated , ( 2 ) vacuum dehydrated , then slow annealed and subsequently re - hydrated and ( 3 ) vacuum dehydrated , then flash annealed , and subsequently re - hydrated gels . the equilibrium weights of all samples were determined and then they were placed in a convection oven at 90 ° c . the weight measurements of each sample continued , twice in the first day of oven drying and daily thereafter for 3 days . all samples reached equilibrium after 1 day of oven drying . the equilibrium dry weights of the samples were used to calculate the water content in the three groups of equilibrium re - hydrated gels . fig8 shows the difference in the appearance of the “ as - gelled ” and depeged samples after vacuum dehydration for the 7 mm samples . the starting hydrogel samples were opaque prior to the vacuum dehydration step . the hydrogel that was depeged prior to vacuum dehydration turned translucent after vacuum dehydration , while the one that was vacuum dehydrated in its “ as - gelled ” form retained its opaqueness . this change in appearance is attributed to the retention of the pore structure in the “ as - gelled ” samples during vacuum dehydration . the presence of peg in the “ as - gelled ” samples appears to have protected the pores from collapsing by occupying the porous space in the hydrogel during vacuum dehydration . peg is not a volatile molecule , hence remained in the structure while water evaporated out of the samples during vacuum dehydration . in contrast , depeging removed the peg and left the porous structure of these hydrogel samples filled with water only . evaporation of the water resulted in evacuation of the pores and eventual collapse of the hydrogel during vacuum dehydration , thus making these samples appear more translucent . the vacuum dehydration progressed at a much faster rate than the air dehydration ; the rate of weight loss was faster in vacuum and the samples left in vacuum reached equilibrium dehydration or deswelling levels faster than the samples left in air . the equilibrium dehydration values reached with either method were still comparable . therefore , one can choose either method of dehydration . tables 6 - 7 show the extent of equilibrium re - hydration levels reached after various processing steps of the 7 mm as - gelled and depeged hydrogels . after the vacuum dehydration , the equilibrium re - hydration level was much higher than those achieved by the hydrogels that were treated by either slow or flash annealing steps . in the as - gelled group the flash annealing step resulted in the least amount of re - hydration . the depeged samples showed less re - hydration than their as - gelled counterparts . fig9 shows the 21 mm hydrogel sheets at various steps of processing . the presence of peg in the as - gelled form of the hydrogel resulted in substantially less deswelling in volume upon vacuum dehydration than was the case with the depeged gel that did not contain any peg . tables 8 - 9 show the extent of equilibrium re - hydration levels reached after various processing steps of the 21 mm as - gelled and depeged hydrogels . after the vacuum dehydration , the equilibrium re - hydration level was much higher than those achieved by the hydrogels that were treated by either slow or flash annealing steps . in the as - gelled group the flash annealing step resulted in the least amount of re - hydration . the depeged samples showed less re - hydration than their as - gelled counterparts . the as - gelled samples showed substantially higher re - hydration levels at each one of the dehydration steps than the depeged samples . the equilibrium re - hydration levels after vacuum dehydration were − 6 . 3 % and − 47 . 4 % for the as - gelled and depeged gels , respectively . the equilibrium re - hydration levels after vacuum dehydration and flash annealing steps were − 42 % and − 80 % for the as - gelled and depeged gels , respectively . this is in further evidence for the protective effect of peg in preventing the collapse of the porous structure during dehydration . this in turn allowed higher re - hydration capacity subsequent to the dehydration steps with the as - gelled hydrogels ; while the depeged samples showed lower re - hydration capacity after vacuum or vacuum followed by annealing dehydration steps . one can use one or several or all of the above methods to prepare hydrogel stock material that can be used to machine a hydrogel implant . one can also start with an implant that is shaped appropriately so that the dimensional changes encountered during processing can be accounted for to arrive at the desired implant size and shape . that implant can be subjected to one or several or all of the above methods , to make a net - shape or near - net shape implant . table 10 shows equilibrium water content ( ewc ) of the 21 mm pva / peg gels after various processing steps . the ewc of the re - hydrated samples were lower in the samples that had been subjected to annealing following vacuum dehydration . the vacuum dehydration is an essential step before annealing in that heating a hydrated gel to above 90 ° c . to cause melting of the gel ; but vacuum dehydration elevates the melting point of the gels and allows annealing without melting . the depeged samples showed lower ewc than their as - gelled counterparts . during the ewc measurements it was noticed that the 21 mm thick hydrogel sheets formed a skin layer with different properties than the bulk of the sheets . the skin appeared to be tougher than the bulk . therefore , additional ewc measurements in the skin ( within the first 3 mm of the free surfaces ), at about 5 mm below the surface ( mid ), and at about 10 mm below the surface ( core ) were carried out . table 11 shows the ewc values measured at these depths for both of the as - gelled and depeged 21 - mm hydrogel sheets at different processing steps . the presence of skin was more apparent with the depeged sample , which showed a lower ewc in the skin than the bulk . one can use the annealing process to create a gradient of properties in the hydrogel . the rate of heating affects the thickness of the skin layer and dictates how sharp the gradient can be . the gradient is expected to be smoother with slower heating rate . a deformed gel was prepared as described in example 1 and was deformed in the carver press as described in example 5 . subsequent to the removal of the deformed gel from the carver press , the deformed gel was immersed in 100 % peg400 liquid at room temperature with agitation for 24 hours . immersion in peg400 resulted in partial to complete removal of water from the gel and hence partial to complete dehydration of the gel . the gel height that was 6 . 2 mm upon removal from the deforming press ; and was subsequently decreased to 4 . 36 mm after immersing in peg for 24 hours . following the peg dehydration , the deformed gel was placed in saline solution with agitation either at room temperature or at 37 ° c . for re - hydration and removal of peg from the gel . at this step a medical device , such as a joint ( hip , knee , or shoulder ) interpositional device , can be machined from the pva gel . a deformed gel was prepared and subsequently underwent peg - treatment as described in example 10 . the re - hydrated deformed gel was placed between the top and the bottom pieces of a shaped mold . the gel and mold were pressed together in the carver press until the top mold and bottom molds were in contact , allowing the gel in the middle to conform to the inner shape of the mold ( see fig1 ). the deformed hydrogel that was sandwiched between the shaped molds was kept under constant deformation for 24 hours . subsequently , the deformed hydrogel was removed from the mold and further peg - treated by immersion in 100 % peg400 for 24 hours . after removal from the peg400 , the deformed hydrogel was placed in saline solution at room temperature to reach equilibrium hydration level . the hydrogel retained its molded shape through each step including the step at which it was in its equilibrium hydration . the final gel obtained a shape of interpositional device ( fig1 ). a hot pva / peg gelling solution was prepared as described example 1 and poured into a hot mold ( 7 mm h × 2 . 5 mm d × 4 . 5 mm w ) with a cover to form a hydrogel sheet . after 1 day of gelling at room temperature , the molded hydrogel sheet was cut into cylindrical hydrogels using a trephine blade ( diameter 9 . 5 mm ) mounted on a drill press . height , diameter and weight of each cylindrical hydrogel specimens were measured upon cutting in their “ as - gelled ” form . the hydrogel subsequently treated by immersion into polyethylene glycol with a molecular weight of 400 g / mol ( peg400 ). some of the hydrogels were treated by a single peg immersion step and other by multiple immersion steps with re - hydration in saline between the steps . for single peg immersion , the hydrogel cylinders cut from the molded hydrogel sheet were immersed in 100 % peg400 in their “ as - gelled ” state , with constant mechanical agitation . five out of 70 hydrogel specimens were taken out from peg400 liquid at each of the following time - steps : 1 , 2 , 3 , 4 , 5 , and 6 hours , as well as 1 , 2 , 3 , 4 , and 6 days . at each time - step the height , diameter and weight of the hydrogel specimens were recorded after blot - drying . the percent decrease in the weight of each hydrogel specimen was calculated at each one of the time - steps . the “ as - gelled ” weight of the specimens was used as the initial weight for the percent weight loss calculation . upon removal from peg400 liquid , the specimens were re - hydrated in saline . and the percent change in the weight of the re - hydrated hydrogel specimens from their “ as - gelled ” state was calculated . in the sequential peg immersion , hydrogel cylinders were subjected to peg immersion either in the “ as - gelled ” state or “ depeged ” state . for the “ depeged ” group , upon removal from the mold , the hydrogel specimens were first immersed in saline solution with agitation for at least 2 days for removal of peg and equilibrated hydration . at this step the weight and dimensions of the specimens were recorded and subsequently they were immersed in peg400 . both of the “ as - gelled ” hydrogel cylinders and the “ depeged ” hydrogel cylinders were immersed in 100 % peg400 liquid at room temperature with agitation for at least 24 hours to ensure equilibrated dehydration in each hydrogel specimen . subsequent to the peg - dehydration , the specimens were immersed in saline solution at room temperature with agitation for at least 2 days for peg removal and to reach equilibrium re - hydration . this completed one cycle of single peg - dehydration / re - hydration procedure . the same hydrogels were subjected to additional peg - dehydration / re - hydration steps ( total of three sequential dehydration / re - hydration steps ). the height , diameter and weight of the hydrogel specimens were recorded after blot - drying after each step of dehydration and re - hydration . the percent change in the weight of each hydrogel specimen was calculated at each one of the dehydration and re - hydration for both the “ as - gelled ” and “ depeged ” groups . in both groups , the “ as - gelled ” weight of the specimens was used as the initial weight for the percent weight loss calculation . as shown in fig1 , the pva hydrogels immersed in 100 % peg400 experienced rapid gravimetric deswelling , which closely reached an equilibrium weight loss of about − 40 % within 6 hours of immersion . after one - day of immersion in peg400 , the hydrogel cylinders reached equilibrium deswelling with negligible variation in the weight of the specimens thereafter . therefore , the maximum amount deswelling that can be achieved from a single peg immersion was − 40 %. increasing levels of equilibrium deswelling were observed with the sequential peg immersion and re - hydration steps with both of the “ as - gelled ” and “ depeged ” groups ( table 12 ). in the “ as - gelled ” group , the equilibrium deswelling was about − 45 % during the first peg immersion ; this value went down to − 71 % during the second peg immersion and to about − 76 % during the third peg immersion step . the difference in the equilibrium deswelling in comparison with the previous step decreased with increasing number of dehydration / re - hydration cycles . upon completion of three sequential peg immersion cycles including the final equilibrium re - hydration in saline , there was a − 36 % permanent gravimetric deswelling of the “ as - gelled ” pva hydrogels . the hydrogel samples that were hydrated in saline with no prior peg treatment showed a weight gain ( swelling ) of about + 15 %. in comparison the sequentially peg treated hydrogel samples showed substantial densification and they appeared mechanically stronger . the percent weight change of the hydrogels was calculated with respect to the “ as - gelled ” weight . for example , (−) sign denotes deswelling ( loss of weight ) from the original “ as - gelled ” state , whereas (+) sign denotes swelling ( gain of weight ) from the “ as - gelled ” state . the “ depeged ” specimen group showed more rapid gravimetric deswelling in every peg immersion step than the “ as - gelled ” group . the equilibrium re - hydration achieved in saline at the end of each peg immersion cycle was also lower in the “ depeged ” group than the “ as - gelled ” group . the “ depeged ” specimens showed a similar behavior as that of the “ as - gelled ” group , with a continuous decrease in the dehydration level with increasing number of peg immersion / saline re - hydration steps . 13 . pin - on - disk ( pod ) wear testing with a hydrogel plug articulating against animal cartilage forty grams of poly ( vinyl alcohol ) ( pva , mw = 115 , 000 g / mol ) were added to 160 grams of cold deionized water and stirred while heating for about 2 hours to prepare a fully dissolved 20 % ( wt ) pva solution . the dissolved pva solution was kept in an air convection oven ( dkn600 , yamato ) at 90 ° c . for about 16 hours . poly ( ethylene glycol ) ( peg400 , mw = 400 g / mol ) was heated to 90 ° c . in an air convection oven . 62 . 22 grams of hot peg400 ( at approximately 90 ° c .) was slowly mixed with 200 grams of hot ( at approximately 90 ° c .) pva solution by mechanical stirring while heating . the mixture solution was then poured into a hot mold . several batches of pva / peg solution was prepared to cast gels of different dimensions and sizes . the hot pva - peg mixed solution was poured into a hot mold ( 7 mm h × 25 mm d × 45 mm w ) with a cover to form a hydrogel sheet . other molds with various thickness , such as 8 mm and 9 mm , were also used to fabricate thicker hydrogel sheets . after 1 day of gelling at room temperature , the molded hydrogel sheets were cut into cylindrical hydrogels using trephine blades ( diameter 6 . 5 mm or 7 . 0 mm ) mounted on a drill press . height , diameter and weight of each cylindrical hydrogel specimens were measured upon cutting and served as the weight and dimensions of the “ as - gelled ” reference . some of the cylindrical hydrogels were immersed either in 50 % peg400 aqueous solution or in 100 % peg400 liquid at room temperature with agitation for at least 24 hours to partially remove water from the hydrogel plugs . partial dehydration resulted in reduction of the dimension and weight of the hydrogel plug . this shrinkage was used to facilitate the insertion of the plug to the cylindrical cavity in the cartilage . the hydrogel plug used in this example in particular was dehydrated in 100 % peg400 . an adult cow knee ( left side ) was used for the animal pod model . it was confirmed with x - rays that the knee had good bone stock . the soft tissue around the patella and distal femur was removed . subsequently , two cartilage specimens 30 mm × 15 mm × 15 mm were cutout of the trochelar groove with a bandsaw and were used as an articular pair on a bi - directional pin - on - disk ( pod ) wear tester . the subchondral bone on the backside of the cut pieces of the cartilage was roughened with a drill and cemented onto the stainless steel holders with surgical simplex p bone cement ( stryker howmedica rutherford , n . j .). the holders were attached to the pod and loaded to determine the contact area between the two cartilage specimens . a defect was created on the top cartilage piece using a 5 . 0 mm diameter drill followed by a flat bottom drill to form an approximate 6 . 5 mm deep cylindrical cavity . the defect was within the contact area . the final dimension of the cavity was measured as 5 . 2 mm in diameter , and about 6 . 7 mm in depth ( fig1 ). pressure sensitive fuji film was used to determine the contact area and contact pressure under an axial load of 890n . the fuji film was placed between the cartilage surfaces and load was applied for 2 minutes . the average pressure was 5 . 0 - 6 . 0 mpa . the bottom cartilage piece was mounted on the bi - directional pod , which moved it on a 5 mm × 10 mm rectangular track at 0 . 5 hz using an x - y table ( parkers systems , rohnert park , calif .). the test was run in 100 % bovine serum environment . the serum was mixed with penicillin - streptomycin prior to the test to delay bacterial growth and to protect the cartilage . the table was mounted on an mts servo - hydraulic testing machine ( mts , minneapolis minn .). the load was applied as double - peak paul - type load curve with a peak load of 890n and a preload of 90n ( bragdon et al . journal of arthroplasty , 2001 . 16 ( 5 ): p . 658 - 65 .) as shown in table 13 , the initial dimensions of the hydrogel plug ( table 13 ) cut from the hydrogel sheet were intentionally somewhat larger than those of the cavity ( table 13 ). initially the hydrogel plug was about 6 . 53 mm in diameter and 8 . 76 mm in height and the dimensions of the cavity were about 5 . 2 mm in diameter and about 6 . 7 mm in height . the dehydration of the hydrogel plug in 100 % peg for temporary dimensional shrinkage helped in insertion of the plug into the cartilage cavity . fig1 shows the cylindrical hydrogel plug ready for insertion into the cavity . the hydrogel plug was partially dehydrated ( gravimetrically deswelled by 46 % with respect to the initial as - gelled weight ) after 100 % peg immersion . fig1 shows the hydrogel plug inserted in the cartilage cavity of bovine knee for pod test . both top view and the side view show that the dimension of the inserted hydrogel plug well matched the dimension of the cavity . note that the height of the hydrogel inside the cavity was about the same as that of the surrounding cartilage or minimally higher . after hydrogel plug insertion , the cartilage specimens were mounted on the pod . the specimens were kept in bovine serum for about 1 hour with no motion or load , for re - hydration of the hydrogel plug prior to the pod run . at this time , another cylindrical hydrogel sample (“ soak control ”) was placed in the same container , in order to measure the extent of reswelling ( re - hydration ) of the free floating , unconfined hydrogel plugs in bovine serum during the pod run . the inserted hydrogel plug showed some swelling after 1 hour of exposure in serum , protruding slightly from the surrounding cartilage ( see fig1 ). table 14 shows the dimensional change in the “ soak - control ” hydrogel cylinder that was immersed in the same serum bath as the cartilage setup during the pod runs . similar to the inserted hydrogel plug in fig1 , the soak - control hydrogel plug showed reswelling presumably due to rapid re - hydration after 1 hour exposure to serum resulting in the recovery of over 94 % of the fully re - hydrated equilibrium weight and dimension . after 80 , 000 cycles of articulating against the cartilage counter face , the hydrogel plug seated further inside the cartilage cavity , with a slight decrease in its height ( fig1 ). after space 160 , 000 cycles of pod runs , the plug was still stable , maintaining the same plug height as it had after 80 , 000 cycles . no visible wear or tear of the hydrogel plug was observed ( see fig1 ). a hot pva / peg gelling solution was prepared as described example 1 and poured into a hot mold ( 7 mm h × 2 . 5 cm d × 4 . 5 cm w ) kept at 90 ° c ., the mold was covered and insulated with an insulating blanket . the mold was left to cool down to room temperature to form a hydrogel . after 1 day of gelling at room temperature , the molded hydrogel sheet was cut into cylindrical hydrogels using a trephine blade ( diameter 9 . 5 mm ) mounted on the drill press . height , diameter and weight of each cylindrical hydrogel specimens were measured upon cutting , for “ as - gelled ” reference . some of the cylindrical hydrogels were immersed in 100 % peg400 liquid and some of the hydrogels were immersed in a 50 % peg400 aqueous solution at room temperature with agitation for 30 days . immersion in 100 % peg400 or 50 % peg400 solution resulted in partial to complete removal of water from the hydrogel and hence partial or complete dehydration of the hydrogel . the 100 % peg - immersed hydrogel specimens and 50 % peg - immersed specimens were separately placed in saline solution with agitation at room temperature for re - hydration and removal of peg from the hydrogel for 6 days . the saline solution was replaced with fresh saline everyday during immersion . the final height , diameter and weight of the hydrogel specimens were recorded daily after blot - drying . percent weight changes of the hydrogel after peg dehydration and subsequent re - hydration in saline were calculated with respect to the “ as - gelled ” state . the gels were then further analyzed to determine the equilibrium water content as described in example 2 . the 100 % peg400 - immersed gel specimens and 50 % peg400 - immersed specimens were blot - dried and was annealed by heating from room temperature to 160 ° c . at approximately 5 ° c ./ min and subsequently keeping at 160 ° c . for a total annealing time of one hour ( slow anneal ). the height , diameter and weight of the gel specimens before and after annealing were recorded . after annealing , the specimens were immersed in saline solution with agitation at room temperature for re - hydration and removal of peg from the hydrogel for 6 days . the saline solution was replaced with fresh saline everyday during immersion . the final height , diameter and weight of the gel specimens were recorded daily after blot - drying during re - hydration . percent weight changes of the hydrogel after peg dehydration , annealing and subsequent re - hydration in saline were calculated with respect to the “ as - gelled ” state . the gels were then further analyzed to determine the equilibrium water content as described in example 2 . the 100 % peg400 - immersed hydrogel specimens and 50 % peg400 - immersed specimens were blot - dried and slow - annealed from room temperature up to 160 ° c . for 1 hour and kept at 160 ° c . for 4 more hours . the height , diameter and weight of the gel specimens before and after annealing were recorded . after annealing , the gels were immersed in saline solution with agitation at room temperature for re - hydration and removal of peg from the hydrogel for 6 days . the saline solution was replaced with fresh saline everyday during immersion . the final height , diameter and weight of the hydrogel specimens were recorded daily after blot - drying during re - hydration . percent weight changes of the gel after peg dehydration , annealing and subsequent re - hydration in saline were calculated with respect to the “ as - gelled ” state . the gels were then further analyzed to determine the equilibrium water content as described in example 2 . the control group and the 1 - hour and 5 - hour slow - annealing groups all had reached equilibrium re - hydration in about 1 day of soaking in saline solution at room temperature . * the total percent weight changes of the hydrogels at each step were calculated with respect to the “ as - gelled ” weight . for example , (−) sign denotes deswelling ( loss of weight ) from the original “ as - gelled ” state , whereas (+) sign denotes swelling ( gain of weight ) from the “ as - gelled ” state . a represents the percent weight change between peg400 dehydration step and slow annealing step . b represents the percent weight change between the slow annealing step and equilibrium re - hydration in saline . the hydrogel samples lost weight in the peg400 solutions that is they deswelled as shown in the table 15 . the equilibrium weight loss was about 30 % in 50 % peg400 solution and 40 % in 100 % peg 400 solution . slow annealing caused further weight loss . the 1 - hour and 5 - hour slow annealing caused the same amount of weight loss , approximately an additional 20 %, resulting in a total weight loss of about 50 % from the “ as - gelled ” weight . after annealing , both 1 hour - and 5 hour - annealed hydrogels that had been treated by immersion in 50 % peg400 re - hydrated to the same extent , which was only − 35 % of the “ as - gelled ” weight . on the other hand , the re - hydration in saline of the 50 % peg dehydrated control specimens ( that were not slow - annealed ) showed a much higher equilibrium re - hydration levels . it is noted that after the slow - annealing process , the surface of the hydrogel specimens were slightly wet with residual peg . thus , the additional deswelling during slow - annealing includes the loss of peg as well as loss of water . annealing after peg dehydration can be used to fabricate hydrogel implants . the equilibrium re - hydration levels can be tailored based on the concentration of peg solution used prior to the annealing step . table 16 shows the equilibrium water content ( ewc ) of the as - gelled samples after various steps of processing described above . the peg400 dehydration slightly increased the ewc . both of the slow and flash annealing further decreased the ewc of the peg400 dehydrated samples . the concentration of the peg400 solution used during the dehydration step did not affect the ewc of the subsequently re - hydrated or annealed and then re - hydrated gels . thirty grams of poly ( vinyl alcohol ) ( pva , mw = 115 , 000 ) were added to 170 grams of cold deionized water and stirred while heating for about 2 hours to prepare a fully dissolved 15 % ( wt ) pva solution . the dissolved pva solution was kept in an air convection oven ( dkn600 , yamato ) at 90 ° c . for about 16 hours . poly ( ethylene glycol ) ( peg , mw = 400 ) was heated to 90 ° c . in an air convection oven . 52 . 88 grams of hot peg ( at approximately 90 ° c .) was slowly mixed with 160 grams of hot ( at approximately 90 ° c .) pva solution by mechanical stirring while heating . the mixture solution was then poured into a hot mold ( 7 mm h × 25 mm d × 45 mm w ) and sealed with a cover to form a hydrogel sheet . the mold was then immediately placed in a − 17 ° c . freezer for 16 hours , and taken out to room temperature for thawing for 8 hours . this completed one “ freeze - thaw ( ft )” cycle . this freeze - thaw process was repeated up to five cycles to form 5 - cycle freeze - thaw pva - peg hydrogels . upon removal from the mold , the hydrogel sheet was cut into cylindrical samples using trephine blades ( diameter 6 . 5 mm ). height , diameter and weight of each cylindrical hydrogel specimens were measured upon cutting , for “ as - freeze - thawed ” reference . note the hydrogel samples contained pva , peg , and water at this stage . some of the as - freeze - thawed cylindrical hydrogel specimens were immersed in 100 % peg400 liquid at room temperature with agitation for 7 days . immersion in 100 % peg resulted in removal of water from the hydrogel . subsequent to 7 - day peg400 immersion , the specimens were annealed in nitrogen at 160 ° c . by placing in an oven already heated to 160 ° c . for one hour ( flash anneal ). the annealed samples were then placed in saline solution at room temperature until equilibrium re - hydration was reached . some of the peg400 treated hydrogel samples were placed in saline for re - hydration with no annealing . some of the as - freeze - thawed cylindrical hydrogel specimens were dehydrated in vacuum at room temperature for 7 days . vacuum dehydration resulted in dehydration of the hydrogel specimens . subsequent to 7 - day vacuum dehydration , the specimens were further dehydrated by flash annealing . the annealed samples were then placed in saline solution at room temperature until equilibrium re - hydration was reached . some of the vacuum treated hydrogel samples were placed in saline for re - hydration with no annealing . for both of the peg - dehydrated and vacuum - dehydrated groups of specimens , the height , diameter and weight of the gel specimens before and after annealing were recorded . similarly , the specimens were immersed in saline solution with agitation at room temperature for re - hydration and removal of peg from the hydrogel . the saline solution was daily replaced with fresh saline during immersion . the final height , diameter and weight of the gel specimens were daily recorded after blot - drying . percent weight changes of the hydrogel after peg dehydration , annealing and subsequent re - hydration in saline were calculated with respect to the “ as - freeze - thawed ” state . the as - freeze - thawed gels swelled in saline solution by about 29 %. this swelling was likely a result of peg / water exchange between the gels and the saline solution . the as - freeze - thawed gels deswelled when immersed in peg or placed in vacuum by about − 21 % and − 60 %, respectively . the extent of deswelling was much greater in vacuum than it was in peg . when the deswollen gels were placed in saline for re - hydration , the equilibrium weight change from the as - freeze - thawed weight was 27 and 36 % for the peg and vacuum dehydrated specimens , respectively . the flash annealing did not affect the weight of the gels after vacuum dehydration ; however , the peg dehydrated gels deswelled to − 43 % form their as - freeze - thawed weights . upon equilibrium re - hydration following the flash annealing , the peg dehydrated samples showed more shrinkage ( about − 16 %) with respect to the as - freeze - thawed weight than the vacuum dehydrated samples ( about 0 %). therefore , a denser hydrogel can be obtained with the peg dehydration than the vacuum dehydration when flash annealing is used with freeze - thawed pva / peg gels . these denser gels also were tougher than the less dense ones . 16 . dehydration and re - hydration of 5 cycle freeze - thaw 15 % pva hydrogels thirty grams of poly ( vinyl alcohol ) ( pva , mw = 115 , 000 ) were added to 170 grams of cold deionized water and stirred while heating for about 2 hours to prepare a fully dissolved 15 % ( wt ) pva solution . the dissolved pva solution was kept in an air convection oven ( dkn600 , yamato ) at 90 ° c . for about 16 hours . the hot pva solution was poured into a hot mold ( 7 mm h × 25 mm d × 45 mm w ) and sealed with a cover to form a hydrogel sheet . the mold was then immediately placed in a − 17 ° c . freezer for 16 hours , and taken out to room temperature for thawing for 8 hours . this completes one “ freeze - thaw ( ft )” cycle . this freeze - thaw process was repeated up to five cycles to form 5 - cycle freeze - thaw 15 % pva hydrogels . upon removal from the mold , the hydrogel sheet was cut into cylindrical hydrogels using trephine blades ( diameter 6 . 5 mm ). height , diameter and weight of each cylindrical hydrogel specimens were measured upon cutting , for “ as - freeze - thawed ” reference . some of the as - freeze - thawed cylindrical hydrogel specimens were immersed in 100 % peg400 liquid at room temperature with agitation for 7 days . immersion in 100 % peg resulted in removal of water from the hydrogel . subsequent to 7 - day peg400 immersion , the specimens were annealed in nitrogen at 160 ° c . by placing in an oven already heated to 160 ° c . for one hour ( flash anneal ). the annealed samples were then placed in saline solution at room temperature until equilibrium re - hydration was reached . some of the peg400 treated hydrogel samples were placed in saline for re - hydration with no annealing . some of the as - freeze - thawed cylindrical hydrogel specimens were dehydrated in vacuum at room temperature for 7 days . vacuum dehydration resulted in removal of water form the hydrogel specimens . subsequent to 7 - day vacuum dehydration , the specimens were further dehydrated by flash annealing . the annealed samples were then placed in saline solution at room temperature until equilibrium re - hydration was reached . some of the vacuum treated hydrogel samples were placed in saline for re - hydration with no annealing . for both of the peg - dehydrated and vacuum - dehydrated groups of specimens , the height , diameter and weight of the gel specimens before and after annealing were recorded . similarly , the specimens were immersed in saline solution with agitation at room temperature for re - hydration and removal of peg from the hydrogel . the saline solution was daily replaced with fresh saline during immersion . the final height , diameter and weight of the gel specimens were daily recorded after blot - drying . percent weight changes of the hydrogel after peg dehydration , annealing and subsequent re - hydration in saline were calculated with respect to the “ as - freeze - thawed ” state . * the total percent weight changes of the hydrogels at each step were calculated with respect to the “ as - freeze - thawed ” weight . the (−) sign denotes deswelling ( loss of weight ) from the original “ freeze - thawed “ state , whereas (+) sign denotes swelling ( gain of weight ) from the “ freeze - thawed ” state . the as - freeze - thawed gels deswelled in saline solution by about − 16 %. this deswelling was likely a result of continued curing of the gels ; curing can increase the crosslink density of the gels and expel water . the as - freeze - thawed gels deswelled when immersed in peg or placed in vacuum by about − 75 % and − 81 %, respectively . the extent of deswelling was much greater in vacuum than it was in peg . when the deswollen gels were placed in saline for re - hydration , the equilibrium weight change from the as - freeze - thawed weight was − 31 and − 49 % for the peg and vacuum dehydrated specimens , respectively . the flash annealing did not affect the weight of the gels after neither of the two dehydration methods used . upon equilibrium re - hydration following the flash annealing , the peg dehydrated samples showed substantially more shrinkage ( about − 63 %) with respect to the as - freeze - thawed weight than the vacuum dehydrated samples , which in fact showed a weight gain with respect to their as freeze - thawed weight ( about 2 %). therefore , a denser hydrogel can be obtained with the peg dehydration than one obtained with the vacuum dehydration when flash annealing is used with freeze - thawed pva gels . these denser gels also were tougher than the less dense ones . thirty grams of poly ( vinyl alcohol ) ( pva , mw = 115 , 000 ) were added to 170 grams of cold deionized water and stirred while heating for about 2 hours to prepare a fully dissolved 15 % ( wt ) pva solution . the dissolved pva solution was kept in an air convection oven ( dkn600 , yamato ) at 90 ° c . for about 16 hours . poly ( ethylene glycol ) ( peg , mw = 400 ) was heated to 90 ° c . in an air convection oven . 52 . 88 grams of hot peg ( at approximately 90 ° c .) was slowly mixed with 160 grams of hot ( at approximately 90 ° c .) pva solution by mechanical stirring while heating . the mixture solution was then poured into a hot ( about 90 ° c .) mold of a rectangular prism shape ( 40 mm × 45 mm × 50 mm ). the mold was left to cool down to room temperature under an insulating blanket over 24 hours . two gel blocks were thus fabricated and their respective weights were recorded . one of the gel blocks was used in its “ as - gelled ” state ; therefore it contained peg . the other one was first immersed in saline solution with agitation for removal of peg and to reach equilibrium hydration for 1 day . this block was denoted as “ depeged ” gel . the weight of the depeged gel block was measured . the two blocks were then deformed under uniaxial compression . the gel blocks were then separately deformed by placing between two flat platens that were attached to an mts machine ( minibionix ). the deformation was uniaxial . the compression proceeded at a rate of 0 . 2 mm / min until a compression ratio of 10 ( ratio of initial to final height ) was reached . when the compression ratio of 10 was reached , the displacement was held constant for at least 24 hours until equilibrium stress relaxation . both of the deformed gels were weighed . after uniaxial compression , both of the deformed gels were immersed in saline solution until equilibrium re - hydration . the gels were weighed again in their re - hydrated state . the percent weight changes of the gels form their “ as - gelled ” states were calculated at different steps of processing . upon completion of uniaxial compression , dimension of rectangular prism shaped “ as - gelled ” hydrogel specimen was changed from a length of 41 . 83 mm , a width of 47 . 37 mm and a height of 49 . 75 mm in its as - gelled form , to a length of 88 . 29 mm , a width of 98 . 74 mm , and a height of 6 . 4 mm . in the case of depeged hydrogel , specimen dimension changed from a length of 43 . 49 mm , a width of 50 . 01 mm , and a height of 53 . 03 mm from the depeged state to a length of 93 . 17 , a width of 97 . 78 , and a height of 6 . 71 following the deformation step . when the deformed gels were re - hydrated in saline , the “ as - gelled ” specimen , which was compressed in the presence of peg , exhibited a more anisotropic reswelling than the “ depeged ” specimen , which was compressed in the absence of peg . * the total percent weight changes of the hydrogels at each step were calculated with respect to the “ as - gelled ” weight . the (−) sign denotes deswelling ( loss of weight ) from the original “ as - gelled ” state , whereas (+) sign denotes swelling ( gain of weight ) from the “ as - gelled ” state . table 19 shows the percent weight change of the gels at different steps of fabrication . the depeged gel gained about 13 % weight during the depeging process , likely a result of the water / peg exchange in the gel and additional swelling of the gel in the absence of peg with increased water uptake . uniaxial compression induced weight loss in the gel samples , which is attributed to elution of water and / or peg from the gels . the weight loss was larger with the depeged gel than the as - gelled one , as the former contained more water ; this also indicates that water is the primary ingredient being expelled from the gels during deformation . following the subsequent re - hydration in saline , the as - gelled gel showed an overall 8 % weight loss from its as - gelled state , in contrast with a 50 % loss for the depeged sample . therefore , if the deformation is carried in the presence of a large molecule , such as peg ( 400 g / mol ), the gel has a higher hydration capacity than it was when it is deformed in the absence of any large molecules . it is speculated that the large molecules remain in the porous structure of the gel during deformation and prevent their collapse ; as a result , water uptake into these protected pores is possible even after a large strain plastic deformation . on the other hand , when the large molecule is not present , water is squeezed out of the pores during deformation and thus the pores are collapsed . during the subsequent re - hydration step the ability of the deformed gel to rehydrate is substantially reduced because of the decreased number of pores available for water absorption . it is also shown above in other examples that the large molecules protect the pores from collapsing during high temperature annealing , allowing better re - hydration capacity to the gels . one can either start with hydrogels containing large molecules , like peg , or impregnate the hydrogel with a large molecule to improve its re - hydration capacity following any type of deformation . this can be especially useful if one needs to maximize the water content in an oriented hydrogel . 15 % pva solution was prepared dissolving pva in deionized water at 90 ° c . while stirring continuously . resulting solution was centrifuged to remove air bubbles and poured into a heated rectangular glass mold ( 45 mm by 70 mm by 7 mm ) kept at around 90 ° c . the mold was covered by a glass cover kept at 90 ° c . and the mold was sandwiched between two 20 mm thick stainless steel blocks that were also kept at 90 ° c . the sandwiched mold was immediately placed in to a − 20 ° c . freezer and was kept there for 16 hours for a freeze cycle . subsequently the sandwiched mold was taken out of the freezer and was left to heat up to room temperature for the first thaw cycle . the freezing and thawing was repeated 4 more times to obtain a total of 5 freeze - thaw cycles . these gels are denoted as ft - pva . the 5 - freeze - thaw method was performed with a pva starting solution containing peg . a hot 15 - 28 pva / peg gelling solution was prepared as described in example 1 . resulting solution was treated as described above to obtain a five times freeze - thaw processed pva / peg hydrogel . these gels are denoted as ft - pva / peg . both of the freeze - thaw gels were each cut into 30 cylindrical samples ( total of 60 ) with a 6 . 5 mm trephine blade . the samples were immersed into individual vials containing saline ( 0 . 9 % nacl in water ) to investigate the dissolution behavior of 5 × ft 15 % pva gels . for 10 days three samples of both group were removed at regular intervals from the saline and placed in an air convection oven at 90 ° c . until equilibrium dehydration was reached , which was confirmed gravimetrically . the solid content ( pva only for the pva freeze - thaw gel and pva and peg for the pva / peg freeze - thaw gel ) was determined gravimetrically by dividing the dry weight of the hydrogel by its hydrated weight . the effect of vacuum dehydration duration on the re - hydration ability of ft - pva was also investigated . six cylindrical samples of ft - pva were placed in vacuum at room temperature . three of the samples were removed from the vacuum after one day and the remaining three after 5 days . all samples were immersed in saline right after vacuum dehydration to achieve equilibrium re - hydration , which was confirmed gravimetrically . the ft - pva / peg hydrogel samples were only subjected to 5 - day vacuum dehydration followed by re - hydration . in addition , the effect of annealing on the ft - pva and ft - pva / peg was investigated . three cylindrical samples of each ft - pva and ft - pva / peg were first dehydrated under vacuum at room temperature for 5 days and subsequently annealed under nitrogen atmosphere by placing into an oven already heated to 160 ° c . for one hour ( flash annealing ). the weight change of the samples was determined after vacuum dehydration and again after annealing . following annealing , all samples were re - hydrated in saline for at least 5 days . finally , the equilibrium water content ( ewc ) of these samples was determined using the method outlined in example 2 . the average weight of the hydrated ft - pva samples decreased during storage in saline . this was previously attributed to dissolution of pva in saline . but the pva content measurements showed no measurable change over the 10 day period , suggesting that the ft - pva gel continued to cure , that is crystallized , during saline storage , hence expelling water and having an appearance of loosing weight . the ft - pva / peg gels , on the other hand , showed a weight gain during saline storage . it is expected for the peg to diffuse out of and water to diffuse into the samples during saline storage . likely , the water uptake was larger than peg loss , which amounted to an apparent weight increase with the ft - pva - peg samples . tables 20 - 21 show the weight changes after various processing steps . the duration of vacuum did not substantially affect the extent of dehydration of the gels , indicating that 1 day vacuum dehydration was sufficient to reach equilibrium with these size samples . flash annealing did not affect the weight of the vacuum dehydrated gels . the ft - pva / peg gels showed less weight loss upon vacuum dehydration than the ft - pva samples . the same was true for the subsequent flash annealing step . the ft - pva / peg gels re - hydrated more than the ft - pva gels . the ewc of the vacuum dehydrated , flash annealed , and re - hydrated ft - pva / peg was higher than that of the ft - pva . the ewc of the ft - pva / peg after depeging and re - hydration in saline was 86 %; the vacuum dehydration and subsequent flash annealing reduced the ewc of ft - pva / peg to only 83 %. the ewc of the ft - pva was 81 % and decreased to 48 % upon vacuum dehydration and subsequent annealing forming a very tough , elastic and transparent gel . a pva / peg gel was prepared in a cylindrical shape as described in example 1 and was poured in a hot mold ( diameter 44 mm × height 40 mm ) maintained at about 90 ° c . the mold was cooled down to room temperature under an insulating blanket to form an as - gelled hydrogel . the hydrogel was removed from the mold and placed in 100 % peg with agitation for dehydration for 3 hours prior to deformation . the hydrogel was subsequently deformed in a carver hydraulic press . the initial gel height was 37 mm and the final gel height after deformation was 5 mm . after the deformation step , the gel was immersed in 100 % peg for 24 hours with agitation and subsequently was re - hydrated in saline solution with agitation . after re - hydration , the final gel height of the deformed gel sample was about 10 mm . the total deformation ratio from the initial gel height at the as - gelled state to that of the final gel height following re - hydration after deformation was about 75 %. the deformed gel prepared in example 19 was characterized using an mts machine to determine its compressive deformation behavior in comparison with an undeformed control gel . the thickness of the 75 % deformed gel specimen was about 10 mm . the control gel specimen was prepared by gelling a hot 15 / 28 pva - peg mixture solution in a mold to obtain a 10 mm thin sheet . both of the deformed and undeformed gels cut to obtain a square block shaped test sample ( 16 mm × 17 mm × 10 mm ). the test samples were placed in saline at 37 ° c . for 1 day ; and were then individually tested on the mts machine . the test samples were placed between two flat metal platens and compressed at a rate of 10 mm / min . load needed to maintain the constant deformation rate was acquired as a function of displacement . fig1 shows the load displacement behavior of the deformed and undeformed test samples . the deformed test sample showed a stiffer deformation behavior than the undeformed test sample . at a given load level the undeformed control hydrogel showed substantially higher displacements than the previously deformed hydrogel . one can increase the stiffness of any hydrogel by applying permanent deformation . higher levels of deformation can result in higher stiffness . hydrogel samples form the above examples were machined with a 16 mm diameter trephine and were allowed to equilibrate in saline solution at 40 ° c . for at least 24 hours prior to the start of the creep test . some of the examples included here were irradiated prior to the trephine machining . prior to irradiation the hydrogel sheets were placed in saline and they were irradiated in saline solution . the irradiation was carried out using a 2 . 5 mev van de graaf generator . either 25 kgy or 100 kgy radiation dose was applied to the hydrogel sheets . trephine machining was carried out after irradiation to prepare the creep samples . the hydrogel creep test was done on a mts ( eden prairie , minn .) 858 mini bionix servohydraulic machine . cylindrical hydrogel specimens , approximately 16 mm in diameter and between 5 - 10 mm in height , were placed between stainless steel compression plates for testing . prior to the start of the test , the top and bottom compression plates were brought together and the lvdt displacement was zeroed at this position . after placing the specimen on the bottom plate , the top plate was lowered until it made contact with the top surface of the creep specimen . the displacement reading from the lvdt on the mts was recorded as the height of the specimen . the compressive load was initially ramped at a rate of 50 n / min to a creep load of 100n . this load was maintained constant for 10 hours . the load was subsequently reduced at a rate of 50 n / min to a recovery load of 10 n . this load was also held constant for 10 hours . time , displacement and load values were recorded once every 2 seconds during the loading and unloading cycles . the data was plotted as compressive strain vs . time to compare the creep behavior of different hydrogel formulations described above ( see fig1 ). with this example , it is demonstrated that the creep resistance of pva hydrogels can be improved by a number of methods . for instance , radiation crosslinking increased the creep resistance of the pva hydrogel . similarly , previous permanent deformation imparted by the channel - die increased the creep resistance of the pva hydrogel . the effect of vacuum dehydration followed by annealing was also an increase in the creep resistance . one can use any number of these methods in a number of combinations to tailor the creep resistance of the hydrogel . two hydrogel samples were used in this example . one sample was 15 / 28 pva / peg gel that was depeged and equilibrated in saline solution ( example 1 ). the other sample was 15 / 28 pva / peg gel that was first depeged , then deformed to a compression ratio of 10 in the channel - die , subsequently dehydrated in 100 % peg400 , and finally equilibrated in saline solution . both sheets had a thickness of about 10 mm . the depeged pva hydrogel sheet was machined with a 16 mm trephine to obtain a cylindrical test sample . the test sample was placed in 40 ° c . saline for at least 24 hours prior to testing . subsequently , the cylindrical test sample was placed in an mts machine between two metal plates submerged in 40 ° c . saline . the mts machine applied 100 n of constant load for 10 hours followed by a reduction of the load to 10 n and maintenance of a 10 n constant load for an additional 10 hours . this entire cycle constituted one loading / unloading cycle and was identical to the one described in example 21 . the loading / unloading cycles were repeated 3 times . during the loading / unloading cycles , the extent of deformation of the cylindrical hydrogel was measured on the mts machine as a function of time . fig2 shows the compressive strain as a function of time during the three - loading / unloading cycles . during the first loading cycle , upon application of the 100 n of load , there was a large elastic deformation of about 59 . 5 %. this was followed by a viscoplastic deformation over the course of the 10 hours of constant load reaching a total deformation level of 77 . 4 %. at the completion of the 10 hours , when the load was reduced down to 10 n , there was an elastic recovery of 13 . 4 %, which brought the overall deformation to approximately 64 %. in the subsequent 10 - hour unloading cycle , there was almost no recovery of the creep deformation . the multiple cycles of loading and unloading were used to creep the hydrogel samples in order to increase their creep resistance . when the loading and unloading cycles were repeated , the extent of creep deformation during the subsequent loading cycles decreased indicating that the creep resistance of the material increased . one can use this method to improve the creep resistance of hydrogels for applications in interpositional devices . for instance , one can deform a large block of hydrogel under multiple loading / unloading cycles between two shaped metal plates so as to obtain a near net shaped implant with improved creep resistance . alternatively , one can deform a large block of hydrogel between two metal plates by subjecting it to multiple loading and unloading cycles to improve its creep resistance . the deformed hydrogel can then be machined into the shape of the desired implant . the implant can be packaged and sterilized . the above method of multiple loading / unloading was repeated on a 15 / 28 pva / peg gel that was first depeged , then deformed to a compression ratio of 10 in a channel - die subsequently dehydrated in 100 % peg400 and finally equilibrated in saline solution . the loading / unloading cycles were identical except with shorter durations of each ( 5 hour of loading and 5 hour of unloading ). this sample also showed an increase in its creep resistance with an increasing number of loading / unloading cycles . ( fig2 ) the gel medical devices described in the examples presented here are packaged in saline solution and sterilized . the sterilization is achieved by gamma radiation . in some embodiments , the gamma sterilization is used to both sterilize the packaged device and also to crosslink the gel medical device . in the instances where a high crosslink density is desirable a high radiation dose ( above 40 kgy ) is used . alternatively , the gel medical devices are fabricated from sterile components in a clean room , packaged in sterile saline solution , therefore require no further sterilization . alternatively , the gel medical devices are packaged in gas permeable packages , sterilized using gas plasma or ethylene oxide , and subsequently placed in sterile saline solution in a clean room and packaged for shipping . the saline solution used in the above alternate methods of packaging can be replaced with 100 % peg or a peg / water mixture to achieve different levels of dehydration in the gel medical devices . the gel medical device is shipped in a full or partial dehydrated state . upon insertion into the body re - hydration occurs and the gel medical device swells to partially or completely fill the space that it is placed in ( such as the knee joint , hip joint , shoulder joint , etc .). it is to be understood that the description , specific examples and data , while indicating exemplary embodiments , are given by way of illustration and are not intended to limit the present invention . various changes and modifications within the present invention will become apparent to the skilled artisan from the discussion , disclosure and data contained herein , and thus are considered part of the invention .	0
referring to fig1 and 2 , wherein a drainable pouch according to the present invention is generally designated by the numeral 10 . this pouch 10 has a body - side pouch panel 12 and an opposite side panel 14 . each of these panels is composed of film material typically utilized for ostomy pouches , such as multiple ply film that includes layers of ethylene vinyl acetate copolymer ( eva ) and polyvinylidene chloride ( pvdc ). the body - side pouch panel 12 has a stomal opening 16 and is shown with mechanical coupling structure 18 surrounding the stomal opening 16 . the coupling may , alternatively , be one used in an adhesive coupling system . the coupling 18 is capable of being secured to a mating coupling on the body - side wafer . it is alternatively possible for the pouch to have an adhesive wafer instead of the mechanical coupling 18 and attach directly to the wearer &# 39 ; s skin . commonly , a hydrocolloid adhesive is used for this purpose . the drainable ostomy pouch 10 includes a body portion 20 and a tail portion 22 . the tail portion 22 is shown with a reinforcing member 26 at end 28 of the tail portion 22 on the body - side pouch panel 12 and on the opposite side panel 14 . the tail portion 22 has on its outer surface a thin film 30 . this thin film is capable of self - sealing when pressed against itself . it is also capable of being peeled apart or unbonded and resealed when pressed together again . it can be wetted and dried without losing desirable adhesive properties . it can be referred to as a press and seal film with a specific type being the preferred film . the preferred thin film 30 is textured and coated with an adhesive . the texture includes hills and valleys this encourages the sealing of the film to itself . the preferred type of film was developed by procter and gamble company and is sold commonly by the glad product company to seal food containers . the procter and gamble film is described and discussed in u . s . pat . nos . 5 , 662 , 758 ; 5 , 871 , 607 ; 5 , 965 , 235 ; 6 , 193 , 918 ; 6 , 421 , 052 ; and 6 , 489 , 022 incorporated herein by reference . this preferred film has been referred to occasionally herein as ssat film . the thin film 30 is mounted on the outer surface of both the body - side pouch panel 12 and the opposite side panel 14 . it covers the entire surface of the tail portion 22 except for where the reinforcing members 26 are secured . the reinforcing members may be used as a template or guide when the tail portion 22 is folded or rolled up . the body portion 20 of the pouch 10 has a comfort panel 40 covering the outer surface of the body - side pouch panel and the opposing rear side panel . the comfort panels 40 are welded along their periphery 42 to the panels 12 , 14 . the comfort panel 40 on the body - side pouch panel 12 lies against the skin of the wearer and is composed of material that is more comfortable to the ostomate than the pouch panel film . comfort panels 40 may include perforations to allow air circulation and be composed of material so as to reduce potential stickiness to the ostomate due to perspiration . the comfort panels 40 have a base 46 that is not welded or secured to the body - side pouch film 30 . accordingly , there is access to the pockets formed between the comfort panels 40 and the body portion 20 . the pockets exist because the comfort panels 40 are welded to the pouch film 30 along the periphery 42 but not along the base 42 . it is also possible to utilize the thin film 30 on the tail portion 22 as a closure system by having the material only on one panel of the tail portion 22 and / or utilizing strips of the thin film 30 that do not cover the entire dimensions of the tail portion 22 .	0
while the invention will be described in connection with a preferred procedure , it will be understood that it is not intended to limit the invention to that procedure . on the contrary , it is intended to cover all alternatives , modifications and equivalents as may be included within the spirit and scope of the invention defined by the appended claims . in accordance with the invention , a representative polymerization procedure , comprises contacting about 0 . 1 % to 10 % by weight of a suitable emulsifier or dispersing agent in an aqueous medium , about 0 . 01 % to 5 % by weight of a molecular weight modifier , about 0 . 01 % to 5 % by weight of an initiator , and monomers . the methacrylonitrile is 5 to 80 percent by weight of the monomers and the acrylonitrile is 95 to 20 percent by weight of the monomers . the mixture is placed in a purged reaction vessel which has a means of agitation , such as stirring or shaking . preferably , the reaction vessel and reactants are initially purged with an inert gas , more preferably the gas used is nitrogen or argon . the mixture is heated to a temperature in the range of 40 ° c . to 80 ° c ., preferably about 60 ° c . the mixture is continuously or intermittently agitated . preferably , the mixture is continuously agitated . preferably , a stirrer speed of about 200 rpm is used . the agitation is continued until polymerization has proceeded to the desired extent , usually 40 %- 100 % conversion . preferably , the polymerization continues to at least 60 % to 80 % of completion . in the foregoing polymerization reaction , the molar ratios of an and man reactants must be carefully controlled throughout the reaction , because the monomers react at different rates . man reacts faster with propagating free radicals in this system than does an which leads to excess man in the polymer and excess an in the unreacted monomer mixture . if too great an excess of an becomes present in the monomer mixture , long strings of acrylonitrile units may form . long an strings lead to unprocessable products . for this reason , in the practice of the present invention , the polymerization reaction requires either incremental or continuous addition of the reactants . in one embodiment , the monomer reactants are added in various increments , 10 % of the total monomer reactants as starting materials to initiate the reaction , and three remaining 30 % portions at later periods in the reaction . each of the additions comprises an / man in amounts controlled in order to obtain the desired an / man ratio in the final product . this procedure continues until all of the monomer reactants have been added . once the final reactant addition is made , polymerization is typically complete to at least 40 % to 75 %. of course , other reactant addition increments may be used . in another embodiment , it is possible to add most of the reactants at the initiation of the reaction . as the reaction proceeds , more of the highly reactive man monomer is added . this technique functions to steady the resultant polymer homogeneity by maintaining the same monomer ratio throughout the reaction through matching man addition to the conversion rate to polymer in the proper proportion . in the most preferred embodiment , both reactants are added based on tracking of the polymer conversion in the same amounts as they are removed from the monomer mixture by polymerization . as can be seen from the above embodiments , the primary objective of any procedure is to maintain the desired final an / man ratio throughout the entire reaction . if the ratios become too unbalanced , man may polymerize into long strings and become used up from the monomer mixture , and the remaining an may polymerize into long unprocessable strings . the identified procedures function to produce melt - processable an / man copolymers with excellent physical properties , by preventing the formation of long an strings . the free radical initiator of the present invention may be selected from the group comprising azo compounds , peroxides , hydroperoxides , alkyl peroxides , peroxydicarbonates , peroxyesters , dialkyl peroxides , persulfates , perphosphates or another initiator known to those skilled in the art . of course , the reaction could also be intiated by thermal means rather than the above described chemical means . the molecular weight modifier of the present invention can be mercaptans , alcohols or any other chain transfer agent known to those of ordinary skill in the art . mercaptans are the preferred molecular weight modifier . at the conclusion of the reaction , the polymer of this invention may be isolated as a finely divided powder by crumb coagulation . the crumb coagulation procedure consists of adding the product emulsion to an appropriate electrolyte solution with rapid agitation at a temperature just below the point at which the precipitated particles tend to adhere . this procedure yields a polymer in a form of granules or particles which are filtered and washed . suitable electrolytes include sodium chloride , sodium sulfate , hydrochloric acid , phosphoric acid , calcium chloride , magnesium sulfate and aluminum sulfate which is preferred . after precipitation , the polymer is filtered and washed repeatedly with water to minimize traces of electrolyte and dispersing agent which may adhere to the particles . washing with dilute solutions of caustic soda or ammonium hydroxide may assist in removing the last traces of dispersing agent , and at the same time yield polymers of improved heat stability . it is also beneficial to employ a final wash of an organic solvent such as a lower aliphatic alcohol ( methanol or ethanol ) to remove any residual soap or impurities . other means for isolating the polymer include spraying the solution into a heated and / or evacuated chamber where the water vapors are removed and the polymer falls to the bottom of the chamber . if the polymer is prepared with sufficiently high solids content it can be isolated as a granular powder by filtration or centrifugation . the polymer may also be isolated by cooling the dispersion below the freezing point of the aqueous medium or by the addition of a large volume of a lower aliphatic alcohol such as methanol or ethanol . if desirable , lubricants , dyes , bleaching agents , plasticizers or pseudoplasticizers , pigments , stabilizers , antioxidants , reinforcing agents ( including fillers and fibers ) and antistatic agents may be incorporated into a polymer of this invention . the polymers of this invention can be formed into films having extremely good barrier properties . particularly , the oxygen transmission rate of films of this invention are generally below 0 . 30 ( cc mil / 100 in 2 atm - 24 hr .). preferably , the oxygen transmission rate is below 0 . 10 ( cc mil / 100 in 2 atm - 24 hr .). most preferably the oxygen transmission rate is below 0 . 05 ( cc mil / 100 in 2 atm - 24 hr .). the water vapor transmission rate is generally below 3 . 25 ( g - mil / 100 in 2 - 24 hr .). preferably , the water vapor transmission rate is below 2 . 00 ( g - mil / 100 in 2 - 24 hr .). most preferably , the water vapor transmission rate is below 1 . 00 ( g - mil / 100 in 2 - 24 hr .). the films of this invention may be prepared by solvent casting or preferably by a thermal forming procedure such an extrusion , injection molding , compression molding or calendering , however , for economic reasons and for ease in processing it is most preferred that the polymer be extruded . the polymers of this invention may be extruded from any conventional type extruder at a temperature of about 160 ° c . to 250 ° c . preferably , the extrusion is at about 200 ° c . to 220 ° c . a screwtype extruder employing an annular die to form a thin walled polymer cylinder or sheet die to form a continuous sheet may be used . the polymers of this invention are also suitable for forming fibers . this can be accomplished by solution spinning or melt spinning by procedures known to those skilled in the art . because the copolymer an / man is thermoplastic , it can be oriented as a solvent - free material . this is an advantage because the presence of any solvent in the polymer makes orientation difficult and adversely affects the barrier properties of the polymer . copolymers of methacrylonitrile / acrylonitrile were prepared by means of emulsion polymerization according to the following general procedure . a two liter reactor containing 900 g of deionized water was used . 9 g of gafac re - 610 1 was dissolved in the water overnight . acrylonitrile and methacrylonitrile totalling 300 g ( the specific ratio dependent on the final product desired ) were added . an initiator generically 2 , 2 &# 39 ;- azobis ( 2 , 4 - dimethylvaleronitrile ), specifically vazo ® 52 polymerization initiator made by dupont company ) and n - dodecyl mercaptan were added to the reactants . the reactants and reactor were nitrogen purged . the reaction temperature was 60 ° c . with a stirrer speed of 200 rpm . at the end of the reaction time , ( 40 - 80 % conversion of monomers to polymers ) the products were isolated by crumb - coagulation in an aluminum sulfate solution at 77 ° c ., water washed , methanol soaked , filtered , and fluid bed dried . the oxygen transmission rate and water vapor transmission rate results of films having different an : man ratios can be seen in table 1 . 211 . 0 grams of acrylonitrile and 89 . 0 grams of methacrylonitrile were added as follows : 10 % of the monomers were charged to the reactor before addition of the initiator ; 30 % of the monomers were added in each of three 90 minute periods ; 6 g of n - dodecyl mercaptan were added in three 2 g installments , just prior to each of the three 90 minute monomer addition periods . 1 . 5 g of vazo ® 52 polymerization initiator were added to the reactor when the reaction mass reached 60 ° c . the monomers resulted in a polymer composition of 72 . 4 mole percent acrylonitrile and 27 . 6 mole percent methacrylonitrile . 231 . 4 grams of an and 68 . 6 grams of man were added at the beginning of the reaction . additional man ( 13 . 6 grams ) was added in each of three 90 minute stages of the reaction to compensate for its higher conversion rate and maintain the initial monomer feed ratio in the reactor . 6 g of n - dodecyl mercaptan were added in three 2 g installments , just prior to each of the three 90 minute monomer addition periods . 1 . 5 g of vazo ® 52 polymerization initiator were added to the reactor when the reaction mass reached 60 ° c . the reaction resulted in a polymer composition of 65 . 1 mole percent an and 34 . 9 mole percent man . 183 . 9 grams of an and 116 . 1 grams of man were charged to the reactor at the beginning of the reaction . additional man ( 16 . 4 grams ) was added in each of three 90 minute stages of the reaction to compensate for its higher conversion rate and maintain the initial monomer feed ratio in the reactor . 6 g of n - dodecyl mercaptan were added in three 2 g installments , just prior to each of the three 90 minute monomer addition periods . 1 . 5 g of vazo ® 52 polymerization initiator were added to the reactor when the reaction mass reached 60 ° c . the reaction resulted in a polymer composition of 50 . 7 mole percent an and 49 . 3 mole percent man . 126 . 6 grams of an and 173 . 4 grams of man were added as follows : 10 % of the monomers were charged to the reactor before addition of the initiator ; 30 % of the monomers were added in each of three 90 minute periods ; 6 g of n - dodecyl mercaptan were added in three 2 g installments , just prior to each of the three 90 minute monomer addition periods . 1 . 5 g of vazo ® 52 polymerization initiator were added to the reactor when the reaction mass reached 60 ° c . the polymer composition consisted of 38 . 7 mole percent an and 61 . 3 mole percent man . 300 grams of man were added as follows : 10 % of the monomer was charged to the reactor before addition of the initiator ; 30 % of the monomer was added in each of three 90 minute periods ; 6 g of n - dodecyl mercaptan were added in three 2 g installments , just prior to each of the three 90 minute monomer addition periods . 1 . 5 g of vazo ® 52 polymerization initiator were added to the reactor when the reaction mass reached 60 ° c . the polymer was 100 % man . table 1______________________________________ an / man oxygen transmission water vaporex - ratio rate ( cc mil / 100 transmission rateample ( mole %) in . sup . 2 atm - 24 hr ) ( g - mil / 100 in . sup . 2 - 24 hr ) ______________________________________1 72 . 4 / 27 . 6 0 . 03 0 . 622 65 . 1 / 34 . 9 0 . 03 1 . 743 50 . 7 / 49 . 3 0 . 05 2 . 274 38 . 7 / 61 . 3 0 . 28 3 . 18pman 0 / 100 0 . 33 2 . 52______________________________________ each of the examples showed a good melt processability . particularly , brabendering at 235 ° c . showed torques of 400 to 2000 meter - grams . thus is apparent that there has been provided , in accordance with the invention , new and improved copolymer compositions that fully satisfy the objects , aims and advantages set forth above . while the invention has been described in conjunction with specific embodiments thereof , it is evident that many alternatives , modifications , and variations will be apparent to those skilled in the art in light of the foregoing description . accordingly , the invention is intended to embrace all such alternatives , modifications , and variations as fall within the spirit and broad scope of the appended claims .	2
referring now to fig1 and 2 , a quick release jib stowage system constructed in accordance with the principles of the present invention is shown . a stay sail 5 , such as a jib , is equipped with suitable hanks 20 , hereinafter described , and prerigged on a jib stowage magazine 10 . magazine 10 comprises an elongated , generally flat , longitudinally curved spear - shaped piece of metal or other material of suitable strength and rigidity . the lower end of magazine 10 is mounted on a mounting block or base 2 attached to the deck 1 near the foot of the forestay 3 . the base 2 may be an integral part of the magazine 10 with the base 2 being removably attached to the deck 1 . alternatively , the base 2 may comprise a mounting block 2 attached to the sailboat deck with the magazine 10 removably attached thereto by well - known releasable means , such as a dovetail fitting or a tongue and groove fitting , for example . mounting block 2 may be provided with a securing eye 4 for attaching the tack or bottom corner of the leading edge of the sail 5 . this allows the sail to be prerigged to the magazine 10 for quickly changing one sail for another . alternatively , securing eye 4 may be deleted and the tack secured to the stay deck anchor in a conventional manner . as shown in fig2 a and 2b , the jib magazine 10 comprises a generally straight lower stowage section 7 and a curved blade section 9 . the curved blade section 9 is shaped to provide for opening and closing of a sail hank 20 as the hank 20 slides over the blade section 9 . the blade tip segment 12 is tapered both in thickness and width from a blunted point to a width of approximately 1 inch . tapered segment 14 of the blade 9 is of even thickness and continues to gently taper to a width of approximately 1 3 / 4 inch . straight segment 16 is of even width of approximately 13 / 4 inch while tapered segment 18 gently tapers from 13 / 4 inch to approximately 1 inch transitioning from the blade section 9 to the jib stowage section 7 . the lower stowage section 7 is approximately 1 inch in width having a length of 1 to 3 feet as required by the size of sail to be rigged on the magazine 10 . referring now also to fig2 c , 2d and 2e , the jib magazine 10 is fabricated from aluminum or stainless steel or other suitable material as a single , unitary piece 10 or in two , interlocking sections 7 , 9 . for example , the blade section 9 may be formed with its lower end 15 having a reduced thickness and a locking pin 8 protruding from the surface thereof . preferable , the locking pin 8 protrudes normal to the blade lower end 15 surface and towards the center of the curve 19 . similarly , the stowage section 7 is formed with its upper end 5 having a reduced thickness with an aperture 6 therethrough adapted for engaging the locking pin 8 thereby attaching the stowage section 7 to the lower end 15 of the blade section . the locking pin 8 may be a post , such as a rivet protruding through an aperture ( not shown ) in the blade lower end 15 , or it may be a bolt and nut allowing the jib magazine to be assembled as a single , integral piece . the locking pin 8 preferably comprises a tapered post ensuring that the stowage section 7 is properly centered when the post 8 is received in aperture 6 . as the stay sail is lowered , the hanks 20 are engaged , one by one , by the magazine blade section 9 . tip segment 12 is rounded and tapered as shown to easily enter the sword opening 26 of hank 20 as will be described in greater detail herein below . the blunted , rounded tip 12 also is safety feature to prevent injury to crew members . tapered segment 14 of blade 9 is dimensioned to open the hank 20 as the hank slides down the magazine 10 . the blade straight segment 16 retains the hank suitably open for disengaging of the hank 20 from the stay 3 . tapered segment 18 of the blade 9 allows the hank to return to the closed position as the hank continues down the magazine . the blade section 9 is curved as shown in order to move the hank 20 relative to stay 3 forcing the hank up and out of contact with the stay 3 as the hank slides down the blade section 9 . in operation , as hank 20 slides down stay 3 it is engaged by blade tip segment 12 , blade segment 14 forces the hank 20 open and moves it closer to the stay 3 to relieve any strain on hank 20 and to move stay 3 out of the hank arm curved hook portions 34 ( as shown in fig3 and 5 ). the concave curve 19 is dimensioned so as to begin the movement of the opened hank 20 away from stay 3 just as the hank is fully opened , allowing hank 20 to clear stay 3 . as hank 20 continues down the magazine 10 it is drawn clear of stay 3 and returns to the closed position as it passes over tapered segment 18 . when clear of the stay 3 , each hank 20 drops down over the magazine lower section 7 where the hanks are retained by the magazine base 2 . as the sail 5 is raised , each hank passes up the magazine 10 , is opened at segment 18 , brought in proximity of stay 3 at segment 16 and closes around stay 3 as it passes over segment 14 . as shown in fig2 c , the edges of the magazine 10 are rolled or molded to form a beaded edge 13 . rounded bead 13 provides additional strength to web 17 , especially in the tapered and curved segments of the blade section 9 where the forces required to move the hank 20 up and off of the stay 20 may be considerable under heavy wind conditions . the beaded edge 13 is also provides a smooth sliding surface to receive hank 20 . the width of the magazine 10 is selected within the range of one to five inches to correspond to the dimensions of the hanks as determined by the sail size and is preferably one and one - half inches to two inches at its maximum width at the blade segment 16 . the concave curve 19 preferably has a radius of curvature of approximately 3 inches . in one preferred embodiment , as illustrated in fig1 the jib stowage magazine 10 is used as a single unit which is positioned aft of the forestay 3 with the forestay 3 adjacent and tangent to the blade curve 19 to allow the rigging or unrigging of a stay sail ( such as a jib ). when not in use , the jib stowage magazine 10 is removed from the vicinity of the forestay . alternatively , in a second preferred embodiment , the separate blade section 9 is rigidly attached to the forestay 3 by a u - bolt 33 and nuts 37 , for example , such that the forestay 3 is tangent to the curve 19 with the curve 19 facing aft . a block or spacer 39 clamped between the forestay 3 and the blade section 9 provides the proper spacing between the forestay 3 and the blade section 9 to allow for proper functioning of the hank 20 as it slides over the blade section 9 . when it is desired to raise or lower a stay sail , the lower or jib stowage section 7 is then removeably attached to the blade section 9 at its lower end 15 , the post 8 being engaged in aperture 6 . referring now to fig3 - 5 , a sail hank 20 constructed in accordance with the principles of the present invention is shown . sail hank 20 comprises a pair of generally curved hooked arm members 25 , 27 pivotally coupled together at their ends opposite the hooked ends 34 at pivot point 29 . a sail attachment hook 21 pivotally coupled to the arm members 25 , 27 at the pivot 29 serves to attach the hank 20 to the leading edge or luff of the sail 5 . hank arm 25 and 27 are pivotally joined to hook 21 by use of a suitable fastener means such as a rivet , bolt or clevis pin . tensioning spring 30 is held in place by the fastener means at pivot point 29 and bears on stop surfaces or shoulders 31 and 32 to bias hank arm members 25 and 27 in the normally closed position . if the sail 5 is provided with grommets for attaching hanks , said grommets may be passed through opening 22 which then may be closed by bending or crimping hook 21 . if the sail 5 is designed such that hanks must be sewn on , hook 21 is bent closed to form a loop through which the sewing thread may be passed . the hank 20 encircles and grasps the stay 3 when arms 25 and 27 are closed to form the stay opening 35 . the diameter of the stay opening 35 is larger than the stay 3 thickness so that the hank may slide freely thereon . hank arm members 25 and 27 overlap when closed so that the curved hook portions 34 form a v - shape in the stay opening 35 for receiving stay 3 when the sail 5 is under tension , thus providing a locking force to keep the hank closed and prevent inadvertent release when in use . curved hook portion 34 of stay opening 35 is preferably dimensioned to the same radius as the stay 3 to provide maximum contact area between the stay 3 and hank 20 , but curved portion 34 may be either smaller or larger than the stay thickness and still function properly . hank arm projections 23 and 28 have overlapping tapered ends 36 to provide a smooth closure for stay opening 35 and to form magazine opening 26 . magazine opening 26 is dimensioned to engage the magazine blade 9 and fully open the hank when passing over blade segment 16 as described hereinabove . when a sail 5 is lowered , blade tip segment 12 engages magazine opening 26 as the hank 20 slides down the stay 3 . curved segment 24 on hank arm members 25 and 27 is dimensioned to correspond to the magazine rounded bead 13 to provide a smooth bearing surface . as hank 20 continues to slide down the magazine blade section 9 , arms 25 and 27 open around pivot point 29 , allowing the hank to be withdrawn from the stay 3 as described hereinabove . as the sail is raised , the hank 20 is opened by tapered segment 18 of blade 9 and positioned by straight segment 16 on the stay 3 with the stay 3 within the stay opening 35 . the hank 20 closes over the stay 3 as it passes over tapered portion 14 and blade tip 12 on magazine 10 thus attaching the sail to stay 3 . shoulders 31 and 32 are formed on hank arms 25 and 27 such that they engage the hook 21 preventing hank 20 from opening wide enough to allow the magazine 10 to pass between hank arm projection ends 36 . the dimensions of the spacer 39 ( as shown in fig2 e ) are determined by the thickness of the hank arm projections 23 , 28 and the width of the opening between the hank arm projection ends 36 . referring now to fig6 the forward deck of a sailboat equipped with two jib stowage magazines 10 is shown . tracks 44 are fastened as shown along the outer portion of deck 1 . tracks 44 may be of any conventional design such as the tee track 43 or , alternatively , the channel track 45 . magazine mounting block or base 2 is removably attached to a shuttle 40 , 41 which is of suitable design to function with the track 44 . in use , shuttles 40 and 41 are positioned on the track 44 in the approximate positions shown . suitable rigging , such as a stainless steel cable , couples the shuttles 40 and 41 together and runs either inside channel track 45 or along the outboard edge of tee track 43 , passing over a suitable pulley ( not shown ) where the tracks 44 come together adjacent the foot of the forestay 3 . a shuttle haul line 46 is rigged between each shuttle 40 , 41 and the sailboat cockpit to allow the crew to position the shuttle 40 , 41 without leaving the cockpit . a stowage magazine blade section 9 is attached to the forestay 3 ( as shown in fig2 e ). the desired sails ( not shown ) are each rigged on a jib stowage section 7 of magazine 10 which is then secured to a shuttle 40 or 41 . each sail must be fully rigged with its own halyard , downhaul and sheets . with a sail thus rigged on each shuttle , the crew member may select either sail by positioning the appropriate shuttle at the forward extremity of the track 44 , coupling the jib stowage section 7 to the lower end 15 of the blade section 7 , and raising the sail with the appropriate halyard . the forward end of each track 44 is disposed such that the jib stowage section 7 approaches the forestay 3 on an axis parallel to the sailboat longitudinal centerline thus ensuring proper engagement with the blade section lower end 15 . to change sails , the sail in use is lowered with the assistance of the downhaul line 48 and is secured in an orderly manner on the jib stowage section 7 . when the first sail is thus secured , it is moved out of the way by retrieval of the haul line 46 attached to its shuttle . retrieval of the first shuttle moves the second shuttle into position because of the interconnecting rigging as described above . when the second sail is in position it is raised as described hereinabove . this operation may be repeated as desired by the crew . alternatively , each of the shuttles 40 , 41 may be rigged with a single piece , integral jib magazine 10 which is moved into and held in position adjacent forestay 3 by the shuttle haul lines 46 . several jib stowage magazines 10 may be prerigged with sails . when the crew wishes to change from one sail to another , the sail in use is lowered and stacked in an orderly manner on the magazine 10 in use . the magazine 10 and sail may then be detached from the mounting block 2 and another prerigged magazine positioned in its place . the sail halyard and sheets are switched from the first sail to the second and the new sail is then ready for use . although the present invention has been shown and described with reference to a preferred embodiment , it will be readily apparent to those skilled in the art that various changes in form and arrangement of the components may be made without departing from the spirit of the invention , or exceeding the scope of the appended claims .	1
the main components of the bone harvester device 10 of the invention are shown in fig1 and include the clear , graduated plastic tube 12 , a cutting head 14 , a t - handle 16 and a bone extractor plunger 18 . as shown in fig2 the attachment between the cutting head 14 and the tube 12 may be by a formed end 20 with lock buttons 22 which engage with an l - slot 26 in the cutting head . the cutting head 14 has a number of cutting edges 30 formed along the cutting slots 32 . the number and arrangement of the slots 32 and cutting edges 30 may be varied depending on the size of the harvested bone pieces desired . a number of gradation marks 24 may be etched or otherwise placed on the plastic tube 12 to show volume of bone harvested . when the surgeon is harvesting bone from the iliac crest 74 as depicted in fig3 the site is exposed via a small incision and a starter trocar may be used to penetrate the outer bone . the device 10 of the invention is then positioned as shown and gently rotated against the bone , causing the cutting edges 30 to create small bone chips which enter the hollow tube via the slots 32 . as the tool 10 is used , the harvested bone 40 fills up the clear tube 12 , passing each of the gradations 24 until the desired volume is reached . at that point , the tool is withdrawn and the cutting head 14 is removed . a bone extractor plunger 18 is then inserted through the hollow t - handle 16 to eject the harvested bone 40 from the device so it may be used as desired . the cutting head 14 includes cutting edges 30 and slots 32 to carve chips of bone which enter the hollow tube 12 . the slot and edge combination sizes the bone chips and prevents the bone from exiting the hollow tube 12 when withdrawn from the harvest site . in fig8 an alternate cutting head 42 is shown in which a centrally located spike 44 is located between two cutting edges 46 and slots 48 . it should be recognized that angles of the cutting edges and size of the slots may be varied to select different sized bone chips . a conical cutting head 70 is shown in fig1 and 13 , along with threads 72 to mate to a threaded tube 12 as in fig1 . also , the attachment to the hollow tube 12 via lock buttons 22 and l - slots 26 are simply one of many means to attach the cutting head 14 to the tube 12 . fig1 shows that attachment may be by a threaded end 34 . in the device 50 of the invention shown in fig9 and 10 , the device is strengthened by a reinforcing framework 52 that surrounds the hollow tube 12 . in this embodiment , the framework would typically be formed of stainless steel and would provide the connection to the cutting head at the distal end and to the t - handle or power take - off at the proximal end . as shown , the framework 52 would leave at least two longitudinal slots 54 extending substantially the entire length of the clear tube 12 so the harvested bone could be seen . the device 50 of fig9 and 10 would have greater strength and may be able to harvest bone without the need for a starter trocar . the intimate arrangement of the clear tube 12 against the reinforcing framework 52 increases the torque that may be applied to the cutting head without damage to the device 50 . the tube may be formed by a combination of clear plastic and the metal framework such that clear plastic is inset into windows in the metal framework . gradations 24 may be placed on the clear tube 12 , the framework 52 or both , to show volume of harvested bone 40 . fig1 shows the device attached to a power drill 60 . any power take - off connection may be used to attach the proximal end to a rotary drill , including hudson fittings and the like . in the device shown in fig9 and 10 , the method of use is similar to that previously described , although a starting trocar may not be needed . in all cases , the cutting head is removed after the bone is harvested and bone is extracted by pushing it out of the clear tube 12 from the proximal to the distal end . while this invention may be embodied in many different forms , there are shown in the drawings and described in detail herein specific preferred embodiments of the invention . the present disclosure is an exemplification of the principles of the invention and is not intended to limit the invention to the particular embodiments illustrated . this completes the description of the preferred and alternate embodiments of the invention . those skilled in the art may recognize other equivalents to the specific embodiment described herein which equivalents are intended to be encompassed by the claims attached hereto . ______________________________________reference numeral list______________________________________10 device12 clear , graduated plastic tube14 cutting head16 t - handle18 bone extractor plunger20 formed end , clear tube22 lock buttons24 gradations26 l - slot on end 2030 cutting edges32 cutting slots34 threaded end363840 harvested bone42 cutting head44 spike46 cutting edge48 slot50 reinforced device52 reinforced framework54 longitudinal slots565860 drill6264666870 conical cutting head72 threads ( cutter fig1 ) 74 iliac crest767880______________________________________	0
the invention intends to provide a method for forming structures on a substrate with smaller dimensions than achievable with the aforementioned method . the invention further intends to provide a method for forming structures that may be used for other precursor materials . to that end the invention is characterized in that steps a ) and b ) are performed in a vacuum , and the thin layer is formed by directing a jet of fluid to the substrate . it is noted that because a sandwich of non - converted precursor material may be formed between converted precursor material and substrate , it is possible to fabricate structures with overhanging features , that is : structures in which between a converted , solidified precursor material and the substrate a void is present . it is further noted that a jet of fluid is directed to the substrate , but that this fluid may , depending on the temperature of the substrate when applying the fluid , freeze to the substrate . it is noted that u . s . pat . no . 5 , 827 , 786 discloses a method for forming insulating layers with a predetermined form on a substrate . in this known method a substrate is placed in the evacuable specimen chamber of a focused ion beam ( fib ) apparatus . the fib comprises an ion source producing a beam of ions and particle - optical elements for focusing and positioning the beam of ions on the substrate . the fib is equipped with a gas injection system ( gis ), thereby enabling a jet of fluid , the precursor material , to be directed to the substrate . the gis can direct the precursor material to the substrate so that molecules from the precursor material will adsorb to the surface of the substrate . the thickness of this layer is typically in the range of one mono - atomic layers . the finely focused beam of ions is scanned over the substrate in a predetermined pattern . where the beam hits the substrate , secondary radiation in the form of secondary electrons is caused . these secondary electrons cause a dissociation of the adsorbed precursor material . part of the dissociated precursor material forms a deposit , while another part of the precursor material is turned into gaseous by - products . this method differs from the method of the invention in that the precursor does not form a liquid or solid layer on the surface , but is adsorbed to the surface . the thickness of the layer is governed by the balance of adsorption and desorption , thus depending on , for example , the partial gas pressure ( determining how many molecules are adsorbed per second ), and the sticking time ( describing how long , on average , a molecule is adsorbed to the surface ) the resultant layer is typically one or several mono - atomic layers , see e . g . “ low temperature beam - induced deposition of thin tin films ”, h . o . funsten et al ., j . appl . phys . 71 ( 3 ), 1 feb . 1992 , pages 1475 - 1484 , more specifically in the introduction . although it may seem of little consequence that in this known method precursor adsorbs , the result is that no structures with overhanging features can be found . this is explained as follows : in this known method a very thin layer is formed , and when a part of the layer is irradiated , it forms , for example , a solidified product . immediately new precursor adsorbs to the formed structure and forms a fresh thin layer . the surface will thus follow the relief formed by the solidified parts , and never a non - solidified layer forms under a solidified layer . as a result in this known method no sandwich of unconverted precursor material between converted material and substrate can be formed . this is contrary to method according to the invention , where a liquid or solid layer is formed on the substrate , and when a part of the layer is , for example , solidified , a fresh layer of precursor material is formed on both the irradiated and the non - irradiated parts . it is noted that the material may be converted to a chemically different material . this is , for example , the case when a metallo - organic precursor is used that is dissociated by the irradiation , resulting in a metallic deposit . however , conversion of the precursor material may also take the form of , for example , polymerization . in an embodiment of the method according to the invention the particles are charged particles . many removable materials that can be converted with a charged particle beam into non - removable materials ( or vice versa ) are known per se . such materials are known from e . g . electron beam induced deposition ( ebid ) and ion beam induced deposition ( ibid ). in another embodiment of the method according to the invention the particles are photons . the photons may have a wave length of visible light , but may also be e . g . ultra - violet photons or x - ray photons . in yet another embodiment of the method according to the invention the material removed in step c ) is irradiated precursor material . in this so - named negative process the material removed is the material irradiated with particles . in still another embodiment of the method according to the invention the material removed in step c ) is non - irradiated precursor material . in this so - named positive process the material removed is the material that is not irradiated with particles . this group of materials includes the materials normally used for ebid and ibid , as these materials normally desorb from a surface if not irradiated . in still another embodiment of the method according to the invention the temperature of the substrate is kept below the freezing point of the precursor material while performing step a ) and b ), as a result of which a frozen layer is formed in step a ). by freezing a layer of precursor material on the substrate , and then irradiating the frozen layer , a part of the precursor material can be converted to a material with e . g . another evaporation temperature of sublimation temperature than the other part of the precursor material . this temperature difference can be used in step c ) to differentiate between which part of the precursor material is removed ( the part with the lowest evaporation or sublimation point ) and which part of the material that stays on the substrate . the temperature used may be cryogenic temperatures , e . g . the temperature of liquid nitrogen or liquid helium , but it may also be a temperature below room temperature but above cryogenic temperatures , such as can be achieved with e . g . peltier cooling . also temperatures equal to or above room temperature may for certain precursor materials result in frozen layers . it is noted that often the structure thus formed will be stored and / or be used at room temperature or even higher temperatures . if so , the part of the material that stays on the substrate should have a melting point and sublimation temperature above said room temperature or said higher temperature . in still another embodiment of the method according to the invention step c ) takes the form of evaporating or sublimating material . evaporating or sublimating material is a convenient method to remove frozen or liquid material from delicate structures on a substrate . in still another embodiment of the method according to the invention the particles are focused in a pencil beam that is scanned over the substrate in a predetermined pattern . this method of forming a pattern is well - known for charged particles from electron - beam lithography , ebid and ibid . however , also a pencil beam of photons can be scanned over the surface by using appropriate deflection means , such as deflectable mirrors . in still another embodiment of the method according to the invention the particles form a pattern on the layer in the form of an image of a projection mask , said pattern imaged on the substrate with a projection lens . forming a pattern from a projection mask is known from optical projectors , but also from charged particle beam projection systems . the image projected on the layer may be scale 1 : 1 , but it may also be e . g . a demagnified image of the mask , as is often used in lithographic tools used in the semiconductor industry in still another embodiment of the method according to the invention the particles form a pattern on the layer in the form of an image of a proximity mask , the thin layer positioned between the substrate and the proximity mask . the use of proximity masks is known per se from e . g . x - ray lithography . a proximity mask is a 1 : 1 mask placed close to the surface to be irradiated , and e . g . a parallel beam of x - rays irradiates the mask . in still another embodiment of the method according to the invention the same precursor is used for the repeated applications of a precursor in step a ). in this embodiment a structure consisting of one material is build . in still another embodiment of the method according to the invention at least two different precursors are used for the multiple applications of a precursor in step a ). in this embodiment a structure comprising at least two materials is build . it is noted that the at least two materials will be arranged in layers . even the use of only two precursor materials may result in a multitude of ( alternating ) layers . in still another embodiment of the method according to the invention the precursor material comprises a metal atom . precursors comprising metal atoms are well known for ebid and ibid . often these precursors are organometallic molecules . examples are e . g . tungstenhexacarbonyl [ w ( co ) 6 ], methylcyclopentadientyltrimethyl platinum [( ch 3 ) 3 pt ( cpch 3 )], tetraethylorthosilicate ( teos ), ( ch 3 ) 4 sn , and many others , although also inorganic precursors may be used , such as wf 6 and sncl 4 . such precursor materials decompose when irradiated , forming a deposit comprising the metal on the substrate and gaseous by - products . the deposit may also comprise other atoms , such as carbon atoms resulting from the decomposition . it is noted that , when the temperature of the substrate during steps a ) and b ) is e . g . a cryogenic temperature , the gaseous by - products or part of the gaseous by - products may also freeze on the substrate , to be evaporated when removing the material in step c ) and heating it to , for example , room temperature . in still another embodiment of the method according to the invention the thin layer of precursor material comprises at least two types of molecules that , when irradiated , chemically react with each other . the invention is now explained on the hand of figures , in which identical reference numerals relate to corresponding features . fig1 schematically shows an apparatus equipped to perform the method according to the invention , fig2 a , 2 b , 2 c and 2 d schematically show different intermediate states of a substrate on which a structure is formed , fig1 schematically shows an apparatus equipped to perform the method according to the invention , fig1 schematically shows a particle column in the form of an electron beam column 101 mounted on an evacuable specimen chamber 100 . the specimen chamber may be evacuated by e . g . a turbo - molecular pump , or other known pumping means such as oil diffusion pumps , ion getter pumps , scroll pumps , etc . the electron beam column comprises an electron source 103 for producing electrons and electron - optical lenses 104 a , 104 b forming a finely focused beam of electrons 102 . the beam of electrons can be positioned on and can be scanned over the surface of a substrate 105 with deflection unit 106 . it is noted that lenses and deflection unit may use electric fields to manipulate the electron beam , or that magnetic field may be used , or a combination thereof . such columns , used in e . g . electron microscopes and the like , are capable of forming a beam with a focal diameter of typically several nanometres to less than 1 nm in diameter . the energy of the electrons in the focus may be varied , as a result of which electrons with an energy of typically between 100 ev and 30 kev are focused on the substrate , although higher and lower energies are known to be used . the substrate is mounted on a cooled stage 107 for positioning the substrate . the cooling may be achieved with a peltier unit , or for example by a thermal braid connected to a cold source such as a container containing a cryogenic fluid such as liquid nitrogen . mounted on the vacuum chamber is a gas injection systems ( gis ) 108 . the gis comprises a reservoir 109 for holding the precursor material and a capillary 110 for directing the precursor material to the surface of the substrate . the gis further comprises means 111 for regulating the supply of precursor material to the substrate . in this example the regulating means are depicted as an adjustable valve , but the regulating means may also take the form of e . g . controlled heating of the precursor material . also included is a secondary electron detector 120 . such a detector may be , for example , a everhard - thornley detector , or a semiconductor device capable of detecting low energy electrons . the signal of the detector is fed to a controller 121 . said controller also controls the deflector signals , lenses , electron source , gis , stage and pump , and other items of the instrument . monitor 122 is used to display an image of the substrate using the signal of the detector 120 . fig2 a , 2 b , 2 c and 2 d schematically show different intermediate states of a substrate on which a structure is formed . fig2 a schematically shows a substrate 105 , on which a precursor fluid 133 emanating from the capillary 110 of a gis is directed to the substrate 105 . by positioning the gis to the cooled substrate , and allowing an amount of precursor fluid to be directed to the substrate , said amount of precursor material freezes to the substrate . the surface area that is covered with the precursor material is governed by the distance from the nozzle of the capillary to the substrate , and the form of the nozzle . it is noted that this layer of precursor material does not desorb due to the low temperature of the substrate . in this the process according to the invention differs from standard ebid , as in standard ebid there is a balance of adsorption and desorption of precursor material , and the thickness of the layer of precursor material would desorb at the moment no precursor fluid is directed to the surface anymore . fig2 b schematically shows a finely focused beam of electrons 102 that is scanned over parts of the layer of precursor material . as a result the layer of precursor material show parts 131 that are irradiated and parts 132 that are not irradiated by the electron beam 102 . the energy of the electrons is chosen to be sufficiently high to cause a change of precursor material over the complete thickness of the layer . on top of this layer a fresh layer of precursor material can be deposited . again a pattern is written on the surface , thereby forming a second pattern of irradiated precursor material . it is noted that , when using the same geometry between capillary and substrate , and controlling the amount of fluid in the same way , a further layer with the same or almost the same thickness can be deposited . by changing one of the parameters ( e . g . the time during which the fluid is directed to the substrate , or the flux of fluid ) in a known way , a layer with a known thickness ratio when compared to the first layer may be deposited . it is further noted that only one precursor fluid may be used , but also alternating layers of different precursors may be used by equipping the apparatus with more than one gis . it is also possible to apply two precursors to one layer . the resultant converted precursor may comprise the conversion products of each of the precursors , or it may comprise , for example , a product obtained by the chemical reaction of the precursor fluids or its products with each other . fig2 c schematically shows a stack of layers 130 , each layer showing its own pattern 131 of irradiates precursor material and its own pattern 132 of non - irradiated precursor material . the energy of the electrons , chosen sufficiently high to cause a change of the precursor material over the complete thickness of the layer , is chosen sufficiently low to avoid a change of the precursor material in the whole thickness of the underlying layer . however , for a good adherence of the two layers , an overlap is needed . a penetration depth of between 1 and 2 layer thicknesses is preferred . fig2 d schematically shows the structure that is formed on the substrate after removing material . it is assumed here that the non - irradiated material is removable by e . g . heating the substrate to room temperature , the non - irradiated precursor material evaporating or sublimating to the environment . as a result a structure is formed , which may comprise overhanging parts . it is noted that , by alternating use of different precursor materials for different layers , a structure can be formed with different layers of converted precursor material . it is further noted that the process can be a so - named positive process , in which the material removed in step c ) is non - irradiated material , but that it may also be a so - named negative process , in which the removed material is the irradiated precursor material . the thickness of the first layer can be determined empirically , or it may be determined by measuring the thickness of the layer . measurement systems capable of measuring the thickness of films are known per se . a very advantageous method for determining the energy needed to traverse through one layer of precursor material is by measuring the amount of backscattered electrons with a backscatter detector . a backscatter electron is generally defined as an electron emerging from the irradiated material with an energy of more than 50 ev . when the energy of the electrons is low , all electrons are absorbed in the precursor material and any backscattered electrons come from the precursor layer . when raising the energy of the electrons , at a certain energy part of the electrons will reach the underlying material and will cause backscattering from the material of the substrate . as in most cases the backscatter coefficient of the precursor material and the substrate material differ , this can be observed as a change in backscatter signal . the advantage of this method for measuring the amount of deposited precursor material is that it directly shows the energy needed to pass through one layer . it is noted that the thickness can be measured on a part of the layer where the layer should be irradiated to form the structure , but that it may also be measured on a spatially removed part of the substrate , where the formation of an additional structure due to said measurement is of no importance . it is further noted that , by measuring the thickness of the first layer deposited on the substrate , the person skilled in the art can deposit a layer with a thickness with a known ratio to the thickness of the first layer . it is mentioned that this method can be used ‘ as such ’, indicating that electrons traversed through the whole layer . there is a chance that the energy thus determined is much higher than necessary . this can be explained as follows : when the energy is just sufficient to reach the substrate , many of the electrons backscattered by the substrate have an even lower energy than the impinging electrons . as a result most of the backscattered electrons are absorbed in the precursor layer . only at a much higher energy , presumably twice as high than needed for traversing the layer once , a distinct change in backscatter signal can be expected . however , by comparing the energy thus found with an earlier determined calibration series of this method , the energy can then be reduced to the required energy . another method for determining the energy needed to traverse through one layer , resembling the method described earlier is by detecting x - rays generated by the electron beam instead of backscattered electron . by selectively detecting characteristic x - rays of an element in the substrate , said element not occurring in the precursor layer , it can be determined at which energy the electrons reach the substrate . even better results are obtained by comparing the signal of the characteristic x - rays of the substrate material with the signal of characteristic x - rays of another material , said other material present the precursor . by comparing this ratio with a predetermined calibration series the thickness of the layer can be determined with high accuracy . it is mentioned that said other material may be present in the precursor only , but may also be present in both the precursor and the substrate . although the invention is explained on the hand of an electron beam apparatus only , the person skilled in the art will recognize that the invention can be applied to fib apparatus , lithographic tools ( also known as steppers ) as used in the semiconductor industry , and the like .	7
consider first an arrangement as shown in fig1 . the arrangement comprises first a magnetic field sensing device 10 ( or magnetometer ) whose output is proportional to a local magnetic field vector ; second , an acceleration sensing device 11 whose output is proportional to a local gravity vector ; and third , a means 12 to rotate these devices about an axis 13 which will generally be along a borehole axis . the means to provide rotation may , for example , be a geared timing type motor to provide continuous rotation , or a servoed type motor working with an angle sensor about the rotation axis to provide either continuous rotation or discrete positioning . these devices , along with a resolver 14 , are located in a container or carrier 18 that is suspended by cable 15 in a borehole 16 , and traveled therein by surface means 17 . motor output shaft 19 has extensions at 19a and 19b to rotate devices 10 and 11 , and provide input to the resolver which is also tied to the container . see also fig1 and 6 in u . s . patent application no . 293 , 159 filed aug . 17 , 1981 . for this configuration , both the magnetic field andacceleration sensing devices 10 and 11 ( i . e . h and a ) have single axes of sensitivity , nominally positioned parallel to each other and normal to the rotation axis 13 . as the combination of sensing devices is rotated about its rotation axis 13 in a borehole , both the magnetic field sensing and acceleration sensing devices 10 and 11 will produce variable output indications proportional to the vector dot product of a unit vector along the respective input axis and the local magnetic field vector and gravity vector respectively . for continuous rotation operation at a fixed location in the borehole and a uniform earth &# 39 ; s magnetic field , these signals will be sinusoidal in nature . for discrete step rotation , the sensor output will be just the equivalent of sampling points on the above mentioned sinusoidal signals . thus , from a knowledge of sample point amplitudes and position along the sinusoid , the character of an equivalent sinusoid in amplitude and phase may be determined . the output sinusoidal signals from the acceleration sensing and magnetic field sensing devices may be combined and processed as in circuitry indicated at 22 , and which may be located in carrier 18 or at the surface to provide the azimuth direction of the borehole axis with respect to the vertical plane containing the direction of the local earth &# 39 ; s magnetic field . the output signal from the acceleration sensing device 11 alone may be used to determine the tilt or drift of the borehole axis with respect to the local gravity field vector . such determinations of directional azimuth and tilt or drift from vertical are free of any constant or bias type errors of the sensing devices . the combination of elements as described above is considered as superior to such other rotatable magnetometer systems as disclosed in u . s . pat . no . 4 , 174 , 577 , since there is in the present case no requirement for a flexible drive shaft , or for the two axis pendulous gimbal system required to maintain the magnetometer so that it only senses the horizontal component of the earth &# 39 ; s magnetic field . also , the use of an acceleration sensing device of any desired accuracy can provide much improved direction and tilt measurement than those obtainable from a self - pendulous approach . it should be noted that the signal processing used to derive azimuth direction and tilt or drift from the sinusoidal signal outputs from the magnetic field and acceleration sensing devices 10 and 11 is essentially identical to that disclosed in u . s . pat . no . 3 , 753 , 296 to van steenwyk in which a single axis gyroscope is employed rather than the magnetic sensing device of the present invention . note in this regard that the present configuration provides azimuthal direction with respect to the plane containing the local earth &# 39 ; s magnetic field vector , whereas the apparatus in the van steenwyk patent provides azimuthal direction with respect to true north as defined by the earth &# 39 ; s rotation rate vector . circuitry 28 connected in feedback relation between resolver 14 and motor 12 controls the latter in response to resolver output . the addition of a magnetic signal processing means 30 which may be located in carrier 18 or at the surface is shown in fig2 . it receives the output of device 10 via lead 10a and processes same to provide an harmonic analysis of the magnetic sensor output signal . thus means 30 is an harmonic analyser , having amplitude and phase output . if the local magnetic field is solely that of the earth &# 39 ; s field , the output waveform is a sinusoid at the frequency of rotation of shaft 19 , and the sinusoid amplitude should match that of the sensed component of the assumed known earth &# 39 ; s magnetic field . any observed deviation of the magnetic signal from the above described ideal is an indication of some anomalous magnetic field condition that may influence the accuracy of the magnetically determinable azimuth direction . analysis of the frequency and amplitude characteristics of the deviations from the ideal earth &# 39 ; s magnetic field may be used to quantify the probable errors of such magnetic azimuth determination . such magnetic signal processing can be by either a commercial analyzer or special purpose circuits . a further aspect of the invention concerns canting the input axis or axes 10b and 11b of either or both of the sensing devices 10 and 11 by a selected angle , α , as shown in fig3 . that angle may be fixed for a given configuration or may be variable within a given configuration . the cant angle may be typically on the order of 10 to 30 degrees , but variable angle arrangements can provide capability for variation as great as 0 to 90 degrees . the introduction of a cant angle adds the capability to measure three orthogonal components of either the gravity field or magnetic field with the previously described single axis sensors . the components normal to the rotation axis continue to be determined error free . when the apparatus is periodically operated with the cant angle adjusted to zero , the true sensor bias error may be determined . if , subsequently , the cant angle is adjusted to an angle such as 10 or 20 or 30 degrees , measurements free of fixed bias type errors may be made for all three components of the sensed quantity . fig5 and 6 illustrate technique for adjusting the angularity of the axis of sensitivity of the accelerometer relative to the lengthwise direction of instrument travel in the borehole . as shown , the accelerometer 317 ( corresponding to accelerometer 11 ) has an axis of sensitivity ( input axis ) shown at 317b , which is rotatable about an axis 350 which is substantially normal to the direction or travel 351 in the borehole . shaft extensions 314a and 314b correspond to extensions 19a and 19b in fig1 . the accelerometer 317 is carried by pivots 352 in a frame 353 to which shaft extensions 314a and 314b are connected , as shown . control means 354 is also carried by the frame to adjust the cant of axis 317b , as for example at locations of operation as described above , to improve the determination of azimuthal direction of tilt of the borehole , at &# 34 ; calibration &# 34 ; locations , and / or at other instrument locations in the hole . the control means 354 may , for example , comprise a jack screw 355 driven by a reversible motor 356 suspended at 356a by the frame . the jack screw extends laterally and interfits a nut 357 attached to the accelerometer case , as for example at its top , offset from axis 350 . a servo system 356b for the drive may be employed , so that a chosen angularity of axis 317b relative to direction 351 may be achieved . support or suspension 356a may be resiliently yieldable to allow the accelerometer to be adjustable tilted , without jamming of the drive or screw . when desired , a system similar to that of fig5 and 6 may be used to cant the angle of the sensitive input axis of the magnetic field sensing device 10 . the addition of a second magnetic field sensing device 110 as shown in fig4 provides additional capabilities . first , if operated just as the first magnetic field sensor 10 , it provides a second determination of magnetic azimuth direction which may be used to detect error by direct averaging of first azimuth determination ψ 1 with the second determination ψ 2 . such averaging may be conducted by addition and dividing circuits in block 22 ## equ1 ## . alternatively , the device outputs may be averaged , and the result processed to derive an average azimuth . it also provides redundancy such that measurements are still obtainable from device 110 if the first magnetic field sensing device 10 should fail . most importantly , the second magnetic field sensing device 110 may be used to improve the detection of anomalous magnetic fields in the region of the sensors . assuming that the only magnetic field in the region of the sensors is that of the earth &# 39 ; s magnetic field , both the first and second magnetic fields sensors 10 and 110 produce identical outputs h ( t ) 1 and h ( t ) 2 . since the spacing along the borehole axis is typically on the order of two to five feet , the difference of the two magnetic sensor outputs h ( t ) 1 -( h ( t ) 2 ( on leads 10a and 110a ) is a measure of the gradient of the local field . with the previously discussed cant angle α for the magnetic sensing device 10 set to zero , gradients s 1 of the cross borehole components with respect to the along borehole direction are measured . the gradient s 2 of the along borehole component with respect to the along borehole direction is also measured with the cant angle set to α ( where α may be up to 90 °). as with the single magnetic sensing device arrangement , the individual output signals of both cantable sensors may be analysed by the magnetic signal processing circuit 30 to provide additional detail characterization of any anomalous magnetic fields . the arrangements described above could also make use of acceleration sensing and magnetic field sensing devices having more than one axis of sensitivity . both two and three axes of sensitivity may be used to provide increased redundancy for improved reliability or accuracy whenever the increased complexity of such sensors is acceptable . although the discussions above concerning the use of harmonic errors of the magnetic sensor outputs or of the availability of gradients of the local magnetic field related to the ability to detect errors in the magnetically derived azimuth output , it is also possible to use these same data as means for determining the proximity of the sensor unit to known or expected anomalous magnetic fields resulting from pieces or parts of magnetic materials or from their effects in distorting the uniform earth &# 39 ; s field . thus such outputs could be used for the detection and direction indication of such elements . another useful combination employs a means indicated at g in fig1 a ( to be rotated by shaft 19 ) for sensing angular rate with respect to inertial space in any or all of the arrangements shown in fig1 through 4 . such means can be provided to measure angular rate in one , two , or three axes of an orthogonal coordinate set . see u . s . patent application no . 293 , 159 , referred to above . the inclusion of such an inertial rate sensing device permits the additional measurement of components of the earth rate rotation vector from which an azimuthal direction with respect to a true north direction can be found . this addition provides the capability to survey magnetic variation ( the angle between true north and magnetic north ), to initialize magnetic direction sensing instruments in relation to true north , or to operate in borehole survey operations or borehole magnetic anomaly detection operations in a precise manner with only one multi - purpose sensing array . magnetic field sensing devices ( magnetometers ) may be of any type , such as flux gate type , hall effect type , or nuclear magnetic resonance type . the magnetic signal processing function may be supplied to a commercial harmonic analyzer of any type that provides harmonic amplitudes and phases of the input sensor data , or it may comprise special purpose circuits designed as a part of the sensor system . in the drawings ψ refers to azimuth ; φ refers to tilt ; and θ refers to high side angle .	6
with reference to fig1 an internally driven brushroll a according to the present invention includes a dowel section 10 which optimally is formed from a continuous , solid piece of rigid material such as wood , hard plastic , or the like . embedded in one end of the dowel 10 is a shaft 12 fixed within a closely shaped recess formed in the dowel . the shaft 12 is supported in an end cap 14 , by a bearing assembly 16 . this arrangement permits the shaft 12 and dowel 10 to rotate within the bearing 16 while the end cap 14 remains stationary . attached to the dowel 10 is at least one agitating element 18 , illustrated as a tuft of brush material . at an opposite end , a rigid cylindrical housing 20 is partially pressed and fixed over a portion of the dowel 10 . the housing 20 comprises a magnetic steel tube having an outside diameter matching the outside diameter of the dowel 10 . the housing 20 defines an interior volume or cavity 22 sized to accommodate a motor m . in the illustrated embodiment , the motor m is a brushless type motor with a stationary armature and a rotating magnet . the stationary armature is supported in volume 22 by a stationary shaft 26 . bearing assemblies 30 , 32 support stationary shaft 26 on opposing ends , permitting rotational movement of the dowel 10 and housing 20 around stationary shaft 26 . in the illustrated embodiment , bearing 30 is snugly fit into a bearing insert 38 which is fixed to , and rotates with , dowel 10 . similarly , bearing 32 is positioned in insert 40 which is fixed to housing 20 . electrical leads 42 connect with the motor m through a channel ( not illustrated ) in shaft 26 . the leads extend out through a second end cap 44 . motor m , as illustrated , includes a cylindrical permanent magnet sleeve 50 fixed in place on the interior wall of magnetic steel housing 20 . the magnet sleeve , which serves as the rotor of the electric motor m , can be an extruded magnet made from what to is referred to in the industry as “ bonded ” magnet material . typically , the magnet is extruded in long pieces and cut to length . such magnets may be magnetized either before or after assembly into the housing 20 . these types of tubular magnets 50 can be magnetized with various numbers of discrete poles . alternately , if the magnet sleeve 50 is a molded sintered magnet , then the magnet is not extruded but molded and ground to size after sintering and then magnetized . in yet another alternative , individual magnets can be spaced around the inside periphery of the housing 20 with alternating north , south polarity . the basic magnetic materials are ferrite magnets both bonded and sintered , and bonded neodymium magnets , however any conceivable magnetic material could be used without loss of functionality . one means for preventing the metal tube 20 from spinning on the dowel 10 would be to provide tabs ( not illustrated ) locking the tube to the dowel . with continued reference to fig2 motor m also includes a stator assembly 52 . the stator assembly includes an armature 54 which can be manufactured from a stack of armature laminations or as a single piece of advanced particulate material . regardless of the core selected , a number of wire slots 56 consistent with the number of magnetic poles on sleeve 50 and torque requirements of the motor are incorporated . in general , the number of slots 56 is in the range of about 6 - 20 . the slots 56 , positioned on the outside periphery of the core , permit armature windings 58 ( fig1 ) to be inserted into the armature . the armature windings 58 comprise a three - phase winding in either a wye connection or a delta connection . the winding is fed a phase - sequenced current from a properly commuted power source and a controller ( more fully discussed below ). the motor magnet , in general , will be multi - pole and usually will have on the order of 6 - 20 magnetized poles . although the design could use individual magnets spaced around the inside periphery of the magnet yoke or housing 20 ( which is a high permeability magnetic steel tube ) with alternating north / south polarity , the current design employs a tubular magnet construction made by the extrusion process or the molding process so that the entire magnet is a one piece component that fits snugly into the inside diameter of the housing 20 so that the magnet flux can be efficiently transferred to the housing or magnet yoke and back again without requiring high magnet nmf . if the magnet tube is individual magnets , they would be cemented into place with fixturing directly to the housing or magnet yoke . however the more probable design would employ a single piece magnet sleeve cemented into place in the housing 20 . the motor armature is made from a stack of armature laminations in most cases . however it would be possible to utilize new advanced particulate materials that demonstrate low eddy current loss . if the armature core is made of the new advanced particulate materials , the armature can be one piece with no requirement for individual laminations . however at the moment low cost laminations are still the most practical approach . these laminations or the one piece core would have a given number of wire slots incorporated into them consistent with the number of magnet poles in the magnet and consistent with the torque requirement and manufacturing considerations . in general , the number of slots that would probably be used would be in the range of 6 - 20 . the slots would be positioned on the outside periphery of the lamination and after insulating the slots , the armature winding would be inserted from the outer diameter . there are no limits in terms of the driving voltage necessary for driving the motor of the present invention . thus , the voltage could be 9 or 24 volt dc , 110 volt ac , or 220 volt ac . in addition , the placement of the motor can be varied . while in the embodiments illustrated the motor is placed on the right hand end of the dowel , the placement could be anywhere in the dowel . for that matter a smaller motor could be placed at each end of the dowel if so desired . the motor may be placed in the middle of the dowel if the shaft bearing arrangement provides definite armature support that will maintain a uniform air gap between the armature 54 and the sleeve 50 . the length of the motor is in direct ratio to the torque of the motor ( assuming the same diameter ). thus , a longer motor would be employed if more torque was desired and a shorter motor could be used if less torque were desired . for example , in the motor design illustrated in fig1 and 6 , approximately 40 - ounce inches of torque would be developed . it has been determined that a smaller diameter , longer motor is advantageous from the standpoint of providing more surface area through which to dissipate heat losses inside the motor . in that connection , the metal shell is useful for heat dissipation . it should also be recognized that there is a required minimum thickness of the metal sleeve to carry the necessary flux . it would be disadvantageous to have a shell thin enough that the shell would not carry all of the magnetic flux . with that type of design , the shell or housing 20 would also pick up magnetized or magnetizable metal objects such as paper clips or the like on the subjacent surface being cleaned . one supplier for the magnet sleeve is seiko - epson company of japan . the material is sold by seiko - epson under the code name neodex - 10 . the stator assembly can be made from laminations or can be a solid pressed metal part made from coated particulates . the use of the magnetic material discussed above allows a rather high power density for a reasonable cost . it is made from a rare earth magnet . with reference now to fig3 another embodiment of a motor m according to the present invention includes a stationary shaft 126 illustrated with a square tip or end 160 . the square end 160 is received in a plastic insert cap 140 . the cap can be fitted with a complementary shaped insert 142 having a suitably shaped aperture 144 that accommodates the tip 160 . also provided is a standard ball bearing 132 through which one end of the shaft 126 passes . mounted on the shaft is an armature 154 . rotating about the stationary armature 154 is a sleeve 150 which is mounted in a housing 120 . preferably the sleeve is made from a multi - pole bonded ndfeb magnet . the sleeve 120 can be made from a steel material . located on the other end of the sleeve 120 is a second standard ball bearing 130 . positioned adjacent the second ball bearing 130 is an end cap 138 . another end 162 of the shaft 126 extends through a central opening 139 in the end cap 138 . those skilled in the art will recognize that the permanent magnet brushless dc motor type illustrated , while the presently preferred embodiment , is not the only type of motor which can provide the functionality disclosed herein . for example , so - called switch reluctance type motors can also be suitably adapted as the motor m . typically , these motors do not use magnets , only simple windings in the armature and notched rotors with lobes that are sequentially attracted to the next armature lobe or pole when the proper coils are energized . as above , an inside - out version , in which the coils and armature are stationary and the rotor has shallow lobes that rotate with the brushroll , could also achieve the functionality disclosed above . additionally , motor m could alternately be configured as an induction motor . those skilled in the art will appreciate that this type of motor has an armature and winding similar to that discussed above . the rotor , however is different and employs what is commonly referred to as a “ squirrel - cage ” induction rotor usually with copper or aluminum bars extending from one end of the rotor to the other and shorted out end rings or cast connections . when the stator or armature is excited , induced current flows in the induction rotor causing torque in the motor . again , an inside - out geometry is used with the squirrel - cage being positioned on the inner diameter of the motor tube and rotating along with the brushroll . control schemes for the above - described motors are all somewhat varied , but in general the motors typically use three - phase power or a commuted three - phase power source . alternately , a stand alone system operating from one phase power sources , such as batteries and the like , can also be employed with suitable electronic controllers designed to provide appropriate power signals , no matter what style of motor is used . those skilled in the art will appreciate that electronic control circuits are widespread for the various described motors , and are relatively straightforward to implement . with reference now to fig4 electrical signals to the stator assembly 52 can be provided from a power source 70 through a speed adjusting circuit 72 . alternately , with reference to fig5 a sensor assembly 74 , can be provided within the volume 22 ( fig1 ), for calculating a position of the housing 20 relative to the stator 52 . this position information is forwarded to the speed adjusting circuit 72 which permits selection of the proper commutated signal to be sent along leads 42 to the stator 52 . the sensor assembly 74 may include a magnetic field detector which detects the magnetic polarity of a determined portion of the magnet sleeve 50 . alternately , the sensor assembly could include an optical type sensor configured to detect rotations of the housing . while the speed adjusting circuit 72 is illustrated as being located outside of the motor m , the circuitry could alternately be placed with the motor m inside the interior volume 22 . moreover , the speed adjusting circuit or device 72 incorporates various functional capabilities such as constant brushroll speed maintenance ; overload protection stopping brushroll rotation ; reverse brushroll operation easing , for example , backward vacuum movement ; and variable brushroll rotation depending on floor surface , e . g . no rotation on tile , wood and delicate floor coverings , and fast rotation for heavy duty carpeting or especially dirty environments . with reference now to fig6 a vacuum cleaner 80 is illustrated with an exploded view of an internally driven agitator a ′ according to the present invention . the vacuum cleaner is illustrated as being of an upright design . it has a suction nozzle located on the floor . positioned in the nozzle or adjacent thereto is the agitator according to the present invention . in the current design , the agitator a ′ rotates on its bearings 16 , 30 , and 32 while the shaft 26 remains stationary . thus , the stator assembly 52 remains stationary and the magnet sleeve 50 rotates along with the housing ( which is not illustrated in fig6 ). this illustration shows that the motor is a separate entity from the roller and is indeed much shorter . this permits the use of short shafts and bearings enabling less expensive and more accurate manufacture of the motor components . indeed , with shorter shafts , it is much easier to maintain an accurate air gap between the rotor and the stator thus avoiding rubbing and other undesirable operations . additionally , motors can be assembled in incremental lengths where a magnet of a unit length and an armature stack of unit length comprise the smallest motor . when two magnets and two armatures are joined , a motor of roughly double the power and torque is provided , simplifying the manufacturing process for a variety of applications . with reference now to fig7 an alternate embodiment includes a motorized brushroll a ″ in a carpet extractor 86 . in this embodiment , dowel 10 ″ is configured with agitator elements 18 ″ disposed in a predetermined pattern around the exterior surface of the dowel formed from a plurality of discreet bristle groups . with reference now to fig8 carpet extractor 86 ′ is configured with an internally driven agitator a ′″ having grooves 88 disposed along the exterior surface of the dowel 10 ′″ as a sponge - like cleaning element 87 . in this embodiment , the grooves 88 are especially suited to assist in the extraction of water or other fluid on the floor surface . this type of motor is instantly reversible which is advantageous in a carpet extractor environment . with reference now to fig9 a hand - held vacuum cleaner 90 includes the internally driven agitator a ″″ having a continuous agitating element or fin 92 formed of rubber or the like . thus the present invention pertains to an inside out brushless motor having a stationary armature or “ stator ” and a rotating magnet sleeve or “ rotor .” this is just the opposite of a traditional electric motor . with the motor of the present invention , one can sense and control the speed of the rotating brushroll of the vacuum cleaner . in addition , this design eliminates the driving belt for the agitator or brushroll since the belt , as discussed above , is prone to failure . with reference now to fig1 , a brushroll b includes a brushroll tube 200 which rotates while a shaft 202 remains stationary . thus , the stator assembly ( not shown ) of a custom motor n ( as described above ) remains stationary and a magnetic housing 204 rotates , having slotted tabs 205 fixedly mounted to the motor housing at each end , thus rotating with the magnetic housing 204 . the brushroll tube 200 can be formed from a continuous piece of extruded rigid material such as aluminum , steel , or the like . attached to the brushroll tube 200 is at least one agitating element 206 , illustrated as bristles suitable for press - fitting into a plurality of holes 208 in the brushroll tube 200 . fitted within the brushroll tube 200 is the motor n , with motor supports 210 and bearing assemblies 212 fitted within each end of the brushroll tube 200 . the motor supports 210 have cylindrically shaped outer ends 214 that extend through the bearings 212 , partially protruding beyond the ends of the brushroll tube 200 , and are fitted into cylindrical recesses 216 in stationary end caps 218 for support . the motor supports 210 have inner ends 220 that are configured to fit over respective ends of the motor shaft 202 . as illustrated , each end of the motor shaft 202 is configured with a d shape so that the shaft 202 and the motor supports 210 are keyed together for rotation . further , each of the motor supports 210 is formed with a slot 222 that fits over a tab 224 on the respective end cap . since the end caps 218 are mounted in a manner to prevent rotation , the motor supports 210 and the motor shaft 202 are , likewise , prevented from rotating . while each end of the motor shaft 202 are illustrated as having a d shape , other shapes , square for example , can be employed with equal efficacy . similarly , other suitable structures may be employed to interlock or key the motor shaft 202 , motor support 210 and end cap 218 arrangement together so that they remain stationary while the brushroll tube 200 and the housing 204 are free to rotate in unison . with reference now to fig1 , it illustrates how motor n is cooled . each end cap 218 is formed with an opening 226 permitting air to pass through . one of the openings 226 serves as an air intake while the opening of the remaining end cap 218 serves as an air outlet . air flows in one of the openings 226 , past the respective motor support 210 , through a gap between the motor n and the brushroll tube 200 ( as shown in fig1 ), past the remaining motor support 210 and out of the remaining opening 226 . the gap between the stator and the magnet sleeve is not shown in this embodiment . [ 0054 ] fig1 illustrates another brushroll b ′ having a motor n ′. in this embodiment , four openings 276 are provided in each end cap 268 . these are partitioned by a heat sink 280 into an intake half 282 and an exhaust half 284 . in this embodiment , no gap exists between the motor n ′ and a brushroll tube 250 . air thus enters the intake 282 , passing over the heat sink 280 to a respective end of the motor n ′, thus cooling the respective end of the motor n ′, and exits through the respective exhaust 284 , passing under heat sink 280 , thus transferring heat from the motor n ′ and the heat sinks 280 to the environment . fig1 illustrates a section at the center of brushroll b ′, showing that no gap exists between the brushroll tube 250 and the motor n ′. the gap between the stator and the magnet sleeve is not shown in this embodiment . with reference now to fig1 , another motorized brushroll b ″ is illustrated according to the present invention . as with the previously described brushroll b ′, a brushroll tube 300 rotates while a shaft 302 remains stationary . brushroll b ″ includes a motor n ″, preferably employing a single piece magnet sleeve 304 , cemented , or fixed by other means , into place in a housing 306 , similar in concept to the magnet sleeve 50 and magnetic steel housing 20 of the embodiment described with respect to fig1 . also included in the brushroll b ″ are two motor bearings 308 , respective bearing insulators 310 , support cones 312 , brush bearings 314 and end caps 316 . the support cones 312 are supported at their outer ends by the respective end caps 316 and are each prevented from rotating by a tab 318 on the adjacent end cap 316 that interlocks with a slot 320 on the support cones 312 . also shown are agitating elements 322 in the form of bristles ( see fig1 ) and a drive fastener 324 for fixing the housing 306 inside the brushroll tube 300 . the brushroll tube 300 has a plurality of mounting holes 326 suitable for press - fitting of agitating elements 322 . the tube 300 accommodates the end caps 316 and the drive fastener 324 . cooling holes 328 are provided in the brushroll tube 300 and are described in further detail below . each support cone 312 includes a plurality of ribs 332 separated by slots 336 . with reference now to fig1 , the motor shaft 302 is fixedly mounted , rotation wise , into the inner ends of the support cones 312 so that a stator assembly 330 of the motor n ″ remains stationary while the magnet sleeve 304 and the housing 306 rotate with the brushroll tube 300 . the motor shaft 302 is supported at its ends by respective bearings 308 which are in turn supported by bearing insulators 310 supported by the housing 306 . the drive fastener 324 is shown locking the housing 306 to the brushroll tube 300 . also illustrated in fig1 is a means of removing heat from the motor n ″. heat generated by the motor travels by conduction , shown by arrows 340 , and travels along the motor shaft 302 towards the ends of the shaft . from the ends of the motor shaft , heat is transferred by conduction to the support cones 312 and is conducted along the ribs 332 forming the center portion of the support cones , as shown by arrows 342 . air enters the brushroll tube 300 through openings 334 in the end caps 316 and flows , as shown by arrows 344 , through ventilation openings or slots 336 , between the support cone ribs 332 , thus removing heat from the support cones and carrying it away through cooling holes 328 in the brushroll tube 300 . air flow may be facilitated by the vacuum present in the vicinity of the cooling holes 328 . [ 0059 ] fig1 illustrates the motor shaft 302 , the stator 330 , the magnet sleeve 304 , the magnetic steel housing 306 , the brushroll tube 300 and the agitator elements 322 . a small gap 350 , as previously described , is maintained between the stator 330 and the magnet sleeve 304 to allow relative rotation therebetween . exemplary dimensions for the embodiment of fig1 are as follows : the invention has been described with reference to the preferred embodiments . modifications and alterations will occur to others upon a reading and understanding of the preceding detailed description . it is intended that the invention be construed as including all such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof .	7
embodiments of the present invention will be described below with reference to the accompanying drawings . throughout the following drawings , the same parts are denoted by the same reference numerals and characters . to make it easier to understand , the drawings vary in scale as appropriate . fig1 a is a perspective view of a motor driver according to a first embodiment of the present invention , and fig1 b is a side view of the motor driver illustrated in fig1 a . it is assumed that a motor driver 10 illustrated in fig1 a and 1b is placed near a machine tool or an industrial robot for cutting a workpiece ( not illustrated ). the motor driver 10 mainly includes a housing 20 in a substantially rectangular parallelepiped shape , and a printed circuit board 35 arranged vertically in the housing 20 . as illustrated in fig1 a and 1b , a plurality of electronic components 36 for driving or controlling a servo motor for the machine tool or the industrial robot are mounted on the printed circuit board 35 . as can be seen from fig1 a and 1b , a through - hole 28 is formed in a top plate 21 of the housing 20 . a fan motor 30 is attached to an inner surface 21 b of the top plate 21 so as to be adjacent to the through - hole 28 . in addition , a plurality of through - holes 29 are formed in a bottom plate 22 of the housing 20 . with this configuration , when the fan motor 30 is in operation , the outside air flows into the internal space of the housing 20 through the through - holes 29 in the bottom plate 22 , and then flows out through the through - hole 28 in the top plate 21 . in this way , the electronic components 36 on the printed circuit board 35 can be cooled . fig1 is a schematic side view of part of the motor driver illustrated in fig1 a . as illustrated in fig1 , a wall 41 , such as a ceiling , extends approximately horizontally , above the motor driver 10 . since the motor driver 10 is placed near a machine tool or an industrial robot as mentioned previously , cutting fluid used for machining exists around the motor driver 10 in the form of cutting fluid mist . as a result , when the fan motor 30 is in operation , the cutting fluid mist comes into the housing 20 through the through - holes 29 , and is then discharged from the internal space of the housing 20 through the through - hole 28 as indicated by a white arrow . the cutting fluid mist thus discharged is sprayed onto the wall 41 and then accumulated as a fluid pool 39 . when the fluid pool 39 reaches a certain volume , the cutting fluid drops down to the motor driver 10 under its own weight , as indicated by solid - line arrows . in some examples of the first embodiment of the present invention , an outer surface of the top plate 21 of the housing 20 is configured by two inclined surfaces 21 a . as illustrated in fig1 a , each of the inclined surfaces 21 a is inclined upward toward the center of the housing 20 . accordingly , a line 21 d of intersection of the inclined surfaces 21 a , which extends in parallel with each side plate of the housing 20 , is in a higher position than edge portions of the outer surface of the top plate 21 . in this configuration , even if the cutting fluid sprayed onto the wall 41 positioned above the motor driver 10 drops down to the motor driver 10 , the cutting fluid is guided to the outer surfaces of the side surfaces of the housing 20 along the inclined surfaces 21 a . this can prevent the cutting fluid from flowing into the motor driver 10 , and consequently prevent a breakdown of the electronic components 36 in the motor driver 10 , due to the cutting fluid . fig2 a is a perspective view of another motor driver according to the first embodiment of the present invention , and fig2 b is a side view of the motor driver illustrated in fig2 a . in fig2 a and 2b , each of two inclined surfaces 21 a of the top plate 21 of the housing 20 is inclined downward toward the center of the housing 20 . accordingly , a line 21 d of intersection of the inclined surfaces 21 a , which extends in parallel with each side plate of the housing 20 , is in a lower position than the edge portions of the outer surface of the top plate 21 . in this configuration , even if cutting fluid sprayed onto the wall 41 ( see fig1 c ) drops down to the motor driver 10 , the cutting fluid is guided to an area near the intersection line 21 d on the top plate 21 of the housing 20 , along the inclined surfaces 21 a , and then discharged outside the housing 20 . thus , this configuration can prevent a breakdown of the electronic components 36 in the motor driver 10 , due to the cutting fluid . naturally , the two inclined surfaces 21 a may be designed to differ in size so that the intersection line 21 d is in a position apart from the electronic components 36 . fig3 a is a perspective view of still another motor driver according to the first embodiment of the present invention , and fig3 b is a side view of the motor driver illustrated in fig3 a . in fig3 a and 3b , the outer surface of the top plate 21 of the housing 20 is configured by a single inclined surface 21 a . as can be seen from fig3 a and 3b , an edge portion 21 e of the single inclined surface 21 a is in a higher position than an opposite edge portion 21 f of the single inclined surface 21 a . in this configuration , even if cutting fluid sprayed onto the wall 41 ( see fig1 c ) drops down to the motor driver 10 , the cutting fluid is guided to an outer surface 23 a of a corresponding side plate 23 of the housing 20 with respect to the top plate 21 , along the inclined surface 21 a . thus , it is apparent that this configuration can provide an effect similar to that described above . fig4 a is a perspective view of a motor driver similar to the one illustrated in fig1 a , and fig4 b is a side view of the motor driver illustrated in fig4 a . in the configuration illustrated in fig4 a and 4b , a top plate 21 is attachable to and detachable from the remaining part of a housing 20 . in other words , the top plate 21 functions as a lid of the housing 20 . in addition , as can be seen from fig4 b , each of edge portions 21 e and 21 f of the top plate 21 flushes with an outer surface of a corresponding side plate of the housing 20 . moreover , fig4 c is a side view of a different motor driver according to the first embodiment of the present invention . in fig4 c , each of edge portions 21 e and 21 f of the top plate 21 protrudes sideward from the outer surface of the corresponding side plate of the housing 20 . furthermore , in fig4 d illustrating a modified example of the configuration illustrated in fig4 c , each of edge portions 21 e and 21 f of the top plate 21 protrudes sideward and then extends downward along the outer surface of the corresponding side plate of the housing 20 . in each of these configurations , the edge portions 21 e and 21 f of the top plate 21 protrude sideward from the respective outer surfaces of the side plates . consequently , even if cutting fluid sprayed onto the wall 41 ( see fig1 c ) drops down to the motor driver 10 , the cutting fluid is guided to the edge portions 21 e and 21 f of the top plate 21 . in this way , the cutting fluid is prevented from flowing into the housing 20 from a gap between the top plate 21 and the remaining part of the housing 20 . thus , it is apparent that these configurations can provide an effect similar to that described above . by contrast , when the distance between the edge portions 21 e and 21 f of the top plate 21 is smaller than that between the outer surfaces of the respective side plates of the housing 20 , cutting fluid may flow into the internal space of the housing 20 from a gap between the top plate 21 and the remaining surfaces of the housing 20 . fig5 a is a perspective view of a still different motor driver according to the first embodiment of the present invention , and fig5 b is another perspective view of the motor driver illustrated in fig5 a . in fig5 a and 5b , two grooves 51 a are formed in each of the two inclined surfaces 21 a . moreover , fig6 a is a perspective view of an additional motor driver according to the first embodiment of the present invention , and fig6 b is another perspective view of the motor driver illustrated in fig6 a . in fig6 a and 6b , two protrusions 52 a are formed on each of the two inclined surfaces 21 a . as can be seen from fig5 a , 5 b , 6 a , and 6 b , the grooves 51 a and the protrusions 52 a each extend from a middle area of the corresponding inclined surface 21 a in an inclined direction with respect to the intersection line 21 d , and end at the corresponding one of the edge portions 21 e and 21 f of the corresponding inclined surface 21 a , the edge portions 21 e and 21 f being parallel with the intersection line 21 d . in addition , the two grooves 51 a and the two protrusions 52 a of each of the inclined surfaces 21 a extend in directions different from each other . however , the two grooves 51 a and the two protrusions 52 a of each of the inclined surfaces 21 a may extend in parallel with each other . in fig5 a , 5 b , 6 a , and 6 b , the grooves 51 a or the protrusions 52 a are formed in / on the inclined surfaces 21 a of the top plate 21 . consequently , even if cutting fluid sprayed onto the wall 41 ( see fig1 c ) drops down to the motor driver 10 , the cutting fluid is guided to the outer surfaces of the side plates of the housing 20 , along the grooves 51 a or the protrusions 52 a . thus , it is apparent that these configurations can provide an effect similar to that described above . note that a case in which the inclined surfaces 21 a , where the grooves 51 a or the protrusions 52 a are formed , are level surfaces is also within the scope of the present invention . fig7 a is a perspective view of a still additional motor driver according to the first embodiment of the present invention , and fig7 b is a side view of the motor driver illustrated in fig7 a . as illustrated in fig7 a and 7b , a protrusion 52 b and a groove 51 b each extending in an oblique direction are formed on / in the outer surface of each of the two side plates 23 and 24 of the housing 20 , the side plates 23 and 24 facing each other . each of the side plates 23 and 24 , where the protrusion 52 b and the groove 51 b are formed , is parallel with the intersection line 21 d . as can be seen from fig7 a and 7b , each of the protrusion 52 b and the groove 51 b extends from one side - edge portion to the other side - edge portion of the outer surface of the corresponding one of the side plates 23 and 24 . in the example illustrated in fig7 a and 7b , the protrusion 52 b and the groove 51 b extend in parallel with each other . however , the protrusion 52 b and the groove 51 b need not be in parallel with each other as long as each extends in an oblique direction . in this configuration , cutting fluid dropping down to the motor driver 10 is guided to the outer surfaces of the side plates 23 and 24 of the housing 20 , along the inclined surfaces 21 a . the cutting fluid thus guided is further guided to the side - edge portions of the outer surfaces of the side plates 23 and 24 by the protrusions 52 b and / or the grooves 51 b . with this configuration , it is apparent that the cutting fluid is collected at predetermined areas of the above - described side - edge portions , and consequently prevented from dropping down to other electronic components positioned in a lower part of the motor driver 10 . fig8 a is a perspective view of a motor driver according to a second embodiment of the present invention , and fig8 b is a side view of the motor driver illustrated in fig8 a . in fig8 a and some other drawings , a plurality of through - holes 28 are formed in the top plate 21 of the housing 20 . as can be seen from fig8 b and some other drawings , the fan motor 30 attached to the printed circuit board 35 is positioned below the through - holes 28 . in other words , in the second embodiment , the fan motor 30 is arranged with a distance from the inner surface 21 b of the top plate 21 of the housing 20 . in fig8 a and 8b , the inner surface of the top plate 21 of the housing 20 is configured by two inclined surfaces 21 b . as illustrated in fig8 b , each of the inclined surfaces 21 b is inclined upward toward the center of the housing 20 . accordingly , a line 21 d of intersection of the inclined surfaces 21 b , which extends parallel with side plates 23 and 24 of the housing 20 , is in a higher position than edge portions of the inner surface of the top plate 21 . moreover , fig8 c is a schematic side view of part of the motor driver illustrated in fig8 a . when the fan motor 30 is in operation , cutting fluid mist is sprayed onto the inner surface 21 b of the top plate 21 , as indicated by a white arrow in fig8 c , and then accumulated as a fluid pool 39 . when the fluid pool 39 reaches a certain volume , the cutting fluid drops down under its own weight as indicated by solid - line arrows . in some examples of the second embodiment , the inclined surfaces 21 b are used as the inner surface of the top plate 21 . accordingly , the cutting fluid sprayed onto the inner surface of the top plate 21 of the motor driver 10 is guided to inner surfaces 23 b and 24 b of the side plates 23 and 24 of the housing 20 , along the inclined surfaces 21 b . with this configuration , the cutting fluid does not adhere to the electronic components 36 in the motor driver 10 . hence , this configuration can prevent a breakdown of the electronic components 36 in the motor driver 10 , due to the cutting fluid . fig9 a is a perspective view of another motor driver according to the second embodiment of the present invention , and fig9 b is a side view of the motor driver illustrated in fig9 a . in fig9 a and 9b , each of two inclined surfaces 21 b constituting the inner surface of the top plate 21 of the housing 20 is inclined downward toward the center of the housing 20 . accordingly , the line 21 d of intersection of the inclined surfaces 21 b , which extends in parallel with the side plates 23 and 24 of the housing 20 , is in a lower position than the edge portions of the inner surface of the top plate 21 . in this configuration , cutting fluid mist sprayed onto the inner surface 21 b of the top plate 21 is guided to an area near the intersection line 21 d on the top plate 21 of the housing 20 , along the inclined surfaces 21 b . consequently , the cutting fluid is not collected near the inner surfaces 23 b and 24 b of the side plates 23 and 24 of the housing 20 , preventing the cutting fluid from adhering to the electronic components 36 positioned near the inner surfaces 23 b and 24 b of the side plates 23 and 24 . thus , this configuration can prevent a breakdown of the electronic components 36 in the motor driver 10 , due to the cutting fluid . naturally , the two inclined surfaces 21 b may be designed to differ in size so that the intersection line 21 d would be in a position apart from the electronic components 36 . fig1 a is a perspective view of still another motor driver according to the second embodiment of the present invention , and fig1 b is a side view of the motor driver illustrated in fig1 a . in fig1 a and 10b , the inner surface of the top plate 21 of the housing 20 is configured by a single inclined surface 21 b . as can be seen from fig1 a and 10b , an edge portion 21 e of the single inclined surface 21 b is in a higher position than an opposite edge portion 21 f of the inclined surface 21 b . in this configuration , cutting fluid mist sprayed onto the inner surface 21 b of the top plate 21 is guided to the inner surface 23 b of the one side plate 23 of the housing 20 with respect to the top plate 21 , along the inclined surface 21 b . consequently , the cutting fluid is prevented from adhering to the electronic components 36 in the housing 20 . thus , it is apparent that this configuration can provide an effect similar to that described above . fig1 a is a perspective view of a different motor driver according to the second embodiment of the present invention , and fig1 b is a side view of the motor driver illustrated in fig1 a . as illustrated in fig1 a and 11b , a protrusion 52 b and a groove 51 b each extending in an oblique direction are formed on / in the inner surface of each of the two side plates 23 and 24 of the housing 20 , the two side plates 23 and 24 facing each other . the side plates 23 and 24 , where the protrusions 52 b and the grooves 51 b are formed , are in parallel with the intersection line 21 d . as can be seen from fig1 a and 11b , each of the protrusion 52 b and the groove 51 b extends from one side - edge portion to the other side - edge portion of the inner surface of the corresponding one of the side plates 23 and 24 . in the example illustrated in fig1 a and 11b , the protrusion 52 b and the groove 51 b extend in parallel with each other . however , the protrusion 52 b and the groove 51 b need not be in parallel with each other , as long as each extend in an oblique direction . in this configuration , cutting fluid sprayed onto the inner surface 21 b of the top plate 21 is guided to the inner surfaces 23 b and 24 b of the side plates 23 and 24 of the housing 20 , along the inclined surfaces 21 b . the cutting fluid thus guided is further guided to the side - edge portions of the inner surfaces 23 b and 24 b of the side plates 23 and 24 by the protrusions 52 b and / or the grooves 51 b . with this configuration , it is apparent that the cutting fluid is collected at predetermined areas of the above - described side - edge portions , and consequently prevented from dropping down to other electronic components positioned in a lower part of the motor driver 10 . fig1 a is a perspective view of a cabinet according to the present invention , and fig1 b is a side view of the cabinet illustrated in fig1 a . as illustrated in fig1 a and 12b , a cabinet 10 ′ is provided with electronic equipment 61 including electronic components for driving or controlling a motor for a machine tool or an industrial robot , and a radiator 62 , such as a heat sink . the cabinet 10 ′ includes a first wall 45 extending vertically . the electronic equipment 61 is attached to one surface of the first wall 45 , and the radiator 62 is attached to the other surface of the first wall 45 . in a precise sense , an opening ( not illustrated ) is formed in the first wall 45 , and the radiator 62 is attached directly to the electronic equipment 61 through the opening of the first wall 45 . note that the cabinet 10 ′ may include only the electronic equipment 61 , or may include a combination of the electronic equipment 61 and one or more of the radiator 62 , a first fan motor 31 , and a second fan motor 32 . in some cases , the first fan motor 31 is attached to an upper end of the electronic equipment 61 , and the second fan motor 32 is attached to an upper end of the radiator 62 . the first fan motor 31 and the second fan motor 32 have a function of appropriately discharging heat from the electronic equipment 61 and the radiator 62 , respectively . moreover , as illustrated in fig1 a , 12 b , and 12 c , a second wall 46 extending laterally with respect to the first wall 45 is attached to an upper end of the first wall 45 . in fig1 a , 12 b , and 12 c , the second wall 46 is configured by two partial walls 46 a and 46 b . the two partial walls 46 a and 46 b are inclined so as to abut on the first wall 45 . fig1 d is a schematic view illustrating a case in which the cabinet 10 ′ is configured by the electronic equipment 61 and the first fan motor 31 . as illustrated in fig1 d , the second wall 46 may be configured only by a single partial wall 46 a . fig1 a is a schematic side view of part of another cabinet according to the present invention . moreover , fig1 b is a perspective view of the cabinet illustrated in fig1 a , and fig1 c is a side view of the cabinet illustrated in fig1 a . in fig1 a to 13c , a second wall 46 is flat and extends horizontally . to a bottom surface of the second wall 46 , a bulge 46 c having a substantially triangular cross section is attached . as illustrated in fig1 a to 13c , it is assumed that a first wall 45 is attached to a tip of the bulge 46 c . the bulge 46 c has a function similar to that of the inner surfaces of the partial walls 46 a and 46 b illustrated in fig1 a and 12b . as can be seen from fig1 b , it is preferable that the width of the bulge 46 c in a direction of a line of intersection of the first wall 45 and the second wall 46 be greater than the width of each of the first fan motor 31 and the second fan motor 32 in the above - described direction of the intersection line . when the first fan motor 31 and the second fan motor 32 are in operation , cutting fluid mist comes into each of the electronic equipment 61 and the radiator 62 , and is then discharged from the electronic equipment 61 and the radiator 62 , as indicated by white arrows in fig1 a . the cutting fluid mist thus discharged is sprayed onto the second wall 46 , and accumulated as fluid pools 39 . when each of the fluid pools 39 reaches a certain volume , the cutting fluid drops down under its own weight . in fig1 a to 12c and fig1 a to 13c , the second wall 46 is configured by the two partial walls 46 a and 46 b each inclined downward , or is provided with the bulge 46 c on the one surface . with these configurations , the cutting fluid is guided to the one surface 45 a and the other surface 45 b of the first wall 45 , along the two partial walls 46 a and 46 b or the bulge 46 c . accordingly , the cutting fluid does not adhere to the electronic equipment 61 of the cabinet 10 ′, preventing a breakdown of the electronic equipment 61 of the cabinet 10 ′, due to the cutting fluid . fig1 a is a perspective view of another cabinet according to the present invention , and fig1 b is a back view of the cabinet illustrated in fig1 a . in fig1 a and 14b , inverted v - shaped protrusions 47 a and 47 b are attached to respective surfaces of the first wall 45 . as illustrated in fig1 a and 14b , the inverted v - shaped protrusion 47 a is positioned between the first fan motor 31 and the partial wall 46 a , while the inverted v - shaped protrusion 47 b is positioned between the second fan motor 32 and the partial wall 46 b . as can be seen from fig1 a and 14b , the vertex of each of the inverted v - shaped protrusions 47 a and 47 b is positioned above the corresponding one of the first fan motor 31 and the second fan motor 32 . consequently , cutting fluid guided to the first wall 45 along the partial walls 46 a and 46 b or the bulge 46 c is further guided by the inverted v - shaped protrusions 47 a and 47 b away from the electronic equipment 61 and the radiator 62 . this configuration can further prevent the cutting fluid from adhering to the electronic equipment 61 and the radiator 62 . in addition , the cutting fluid is guided to predetermined areas , preventing the cutting fluid from dropping down to other electronic components . to provide this effect , it is preferable that the length of each of the inverted v - shaped protrusions 47 a and 47 b in the direction of the line of intersection of the first wall 45 and the second wall 46 be greater than the length of each of the electronic equipment 61 and the radiator 62 in the above - described direction of the intersection line . fig1 a is a perspective view of still another cabinet according to the present invention , and fig1 b is a back view of the cabinet illustrated in fig1 a . in fig1 a and 15b , elongated protrusions 48 a and 48 b are attached to the respective surfaces of the first wall 45 . as illustrated in fig1 a and 15b , the elongated protrusion 48 a is positioned between the first fan motor 31 and the partial wall 46 a , while the elongated protrusion 48 b is positioned between the second fan motor 32 and the partial wall 46 b . the cutting fluid guided to the first wall 45 along the partial walls 46 a and 46 b or the bulge 46 c is further guided by the elongated protrusions 48 a and 48 b so as to be away from the electronic equipment 61 and the radiator 62 . this configuration can further prevent the cutting fluid from adhering to the electronic equipment 61 and the radiator 62 . in addition , the cutting fluid is guided to predetermined areas , preventing the cutting fluid from dropping to other electronic components . to provide this effect , it is preferable that the length of each of the elongated protrusions 48 a and 48 b in the direction of the line of intersection of the first wall 45 and the second wall 46 be greater than the length of each of the electronic equipment 61 and the radiator 62 in the above - described direction of the intersection line . fig1 a is a perspective view of a different cabinet according to the present invention , and fig1 b is a side view of the cabinet illustrated in fig1 a . in fig1 a and 16b , receiving parts 49 a and 49 b each having a substantially u - shaped cross section are attached to the respective surfaces of the first wall 45 . as illustrated in fig1 a and 16b , the receiving part 49 a is positioned between the first fan motor 31 and the partial wall 46 a , while the receiving part 49 b is positioned between the second fan motor 32 and the partial wall 46 b . the cutting fluid guided to the first wall 45 along the partial walls 46 a and 46 b or the bulge 46 c is received by the receiving parts 49 a and 49 b . with this configuration , the cutting fluid is prevented from adhering to the electronic equipment 61 and the radiator 62 , further preventing a breakdown of the electronic equipment 61 . to provide this effect , it is preferable that the length of each of the receiving parts 49 a and 49 b in the direction of the line of intersection of the first wall 45 and the second wall 46 be greater than the length of each of the electronic equipment 61 and the radiator 62 in the above - described direction of the intersection line . in addition , it is preferable that the cutting fluid accumulated in the receiving parts 49 a and 49 b be discharged from the receiving parts 49 a and 49 b regularly . for this reason , the receiving parts 49 a and 49 b may be inclined as the elongated protrusions 48 a and 48 b . note that appropriately combining the examples described above is within the scope of the invention . in the first to sixth aspects , the outer surface of the top plate is configured by an inclined surface or inclined surfaces . accordingly , even if cutting fluid sprayed onto the wall positioned above the motor driver drops down to the motor driver , the cutting fluid is guided to the outer surfaces of the side plates of the housing , along the inclined surface ( s ). as a result , the cutting fluid does not flow into the motor driver , preventing a breakdown of the electronic components in the motor driver , due to the cutting fluid . in the seventh to eleventh aspects , the inner surface of the top plate is configured by an inclined surface or inclined surfaces . accordingly , cutting fluid sprayed onto the inner surface of the top plate of the motor driver is guided to the inner surfaces of the side plates of the housing , along the inclined surface ( s ). as a result , the cutting fluid does not adhere to the electronic components in the motor driver , preventing a breakdown of the electronic components in the motor driver , due to the cutting fluid . in the twelfth to fifteenth aspects , a bulge is provided to the one surface of the second wall . accordingly , the cutting fluid sprayed onto the one surface of the second wall is guided to the first wall , along the bulge . as a result , the cutting fluid does not drop down to the electronic components , preventing a breakdown of the electronic components mounted on the cabinet , due to the cutting fluid . the present invention has been described above on the basis of the representative embodiments . however , it should be apparent to those skilled in the art that the above - described modifications as well as various other modifications , omissions , and additions can be made without departing from the spirit of the present invention .	7
fig1 is a plan view of a typical phosphor - based color wheel 100 of the prior art . the wheel , is comprised of multiple color segments 102 , 104 , 106 , each of which is used to generate light having a particular color as will be explained later . the color segments 102 , 104 , 106 are attached to a central hub 108 which has a central aperture 110 through which a shaft is attached to the color wheel 100 . while three segments are shown in fig1 , the color wheel 100 of fig1 may include more segments . for example , many color wheels include a single segment for each of three primary colors such as red , green , and blue . other color wheels include multiple segments for a single color — either adjacent to segments of the same color or separated by segments of another color . color wheels may also include additional colors such as cyan , magenta , and yellow , and may provide segments intended to generate white light — often called white or clear segments . while three primary colors have traditionally been used in display systems , the term multi - primary is typically reserved for systems utilizing four or more primary colors . fig2 illustrates the use of a typical phosphor - based color wheel 100 in an illumination system 200 of the prior art . the color wheel is mounted on a motor 202 by a shaft , or coupled to a motor by a belt , gear , or some other coupler to enable the motor 202 to turn the color wheel 100 . the color wheel 100 is positioned in the path of a light beam 204 generated by a light source 206 and focused on the color wheel by an optical system 208 . light source 206 may be any source of radiant energy , and typically is one or more leds or lasers . while shown as a single lens , optical system 208 often is a lens system comprised of multiple lenses . light focused on the phosphor - based color wheel 100 at point 210 excites phosphors in or on the color wheel . as described in u . s . pat . no . 7 , 547 , 114 b2 , issued 16 jun . 2009 to li et al . and entitled multicolor illumination device using moving plate with wavelength conversion materials , u . s . pat . no . 7 , 726 , 861 b2 , issued 1 jun . 2010 to xu and entitled brightness enhancement with directional wavelength conversion , and u . s . pat . no . 7 , 744 , 241 b2 , issued 29 jun . 2010 to xu and entitled high brightness light source using light emitting devices of different wavelengths and wavelength conversion , various phosphors may be applied on a substrate to enable a conversion from one wavelength band to another wavelength band . while this disclosure will discuss the phosphors as being applied to the substrate or located on the substrate , it is understood that this includes phosphors that are embedded in the substrate or applied to a back surface of the substrate or sandwiched between layers of the substrate . the phosphor color wheel absorbs energy from the illumination beam 204 and reemits the beam 212 on the other side of the wheel . the emitted beam 212 may be collected and focused or collimated by optics 214 . the illumination beam 204 and the emitted beam 212 have different wavelengths at least a portion of the time . for example , segment 102 may include red phosphors — or phosphors that emit light in what is perceived by humans as red light — while segments 104 and 106 include green and blue phosphors respectively . if laser 206 emits blue light 204 , when the red segment 102 is in the light path the red phosphors will absorb the blue laser light and reemit red light 212 . when the green segment 104 is in the light path the green phosphors will absorb the blue laser light and reemit green light 212 . when the blue segment 106 is in the light path the blue phosphors will absorb the blue laser light and reemit blue laser light 212 . while the illumination system of fig2 provides an efficient method and system for generating light of various colors , when used in a display system it has serious disadvantages . for example , while the use of solid state light sources such as leds or lasers provides an efficient source of radiant energy to stimulate the phosphors , the use of a segmented color wheel constrains the display system to the use of single color display periods that are determined by the relative sizes of the various color segments 102 , 104 , 106 . as such , no matter the color needs of the image being generated , a display system using a segmented color wheel 100 can only devote a portion of time to a particular color that is determined by the size of a particular color filter relative to the sizes of the remaining color filters as it is generally necessary to rotate the wheel at a constant velocity . the new color wheel design and illumination system 300 shown in fig3 overcomes this limitation . the color wheel 302 of fig3 includes multiple tracks for bands 304 , 306 , 308 around the color wheel rather than radial segments . these tracks enable the beam of radiant energy 310 produced by source 312 to stimulate the phosphors on any given track for any proportion of the time . this enables the improved color wheel 302 to be used in illumination systems 300 that provide primary color periods having durations that vary relative to one another , generally based on the color needs of an image being generated or on the illumination capabilities of the source 312 and phosphors used to convert the source radiant energy 310 . for example , a bluish image may increase the relative time the radiant energy 310 lingers on a blue phosphor band compared to a yellow or red band . because the illumination system of fig3 does not include radial spokes , a mechanism for moving the beam of radiant energy 310 onto different segments of the color wheel 302 is used . this mechanism may include a servo or other mechanism to move the color wheel itself relative to the radiant energy beam 310 , or a mechanism to move the beam relative to the color wheel . as shown in fig3 , a tilting mirror 314 may be used to direct the radiant energy 310 from one track to another on the color wheel . in systems that move the beam relative to a stationary spinning color wheel , the light beam reemitted by the wheel also moves relative to the wheel . in the example shown in fig3 , an optional integrator rod 316 is used to collect the light from all three of the phosphor tracks . the integrator rod collects the reemitted light and emits the reemitted light from a far end of the integrator light . most of the light passing through the integrator rod reflects from the integrator rod several times as it passes through the integrator rod such that light passing through the exit of the integrator rod 316 is homogenized . a controller , not shown , activates the tilting mirror 314 to select which of the phosphor tracks is impinged by the radiant energy 310 from the source 312 . the controller may sequentially alternate between all of the tracks , may select only a single track , or may alternate between a subset of the tracks . the duration each track is illuminated may be equal nor unequal compared to the duration other tracks are illuminated . the controller may also alter the intensity of the radiant energy 310 produced by the source 312 during or between the illumination periods for each track depending on the intensity needs of the illumination system . in the system of fig3 and the following figures and embodiments , the source 312 may produce a visible or invisible beam of radiant energy 310 . for example , the beam of radiant energy 312 may be ultraviolet light , infrared light , visible light , microwave energy , a beam of electrons , or any other suitable beam of radiant energy . in the system of fig3 and the following figures and embodiments , the color wheel may be wheel shaped , or may have other shapes . for example , the color wheel may be drum shaped or formed on a belt . the term color wheel and the illustration of the color wheel are selected only because a disc - shaped color wheel are the most popular embodiments used in contemporary filter color wheel based display systems and those skilled in the art are familiar with existing color wheels . in the system of fig3 and the following figures and embodiments , the color wheels illustrated as transmissive color wheels may be reflective instead , and vice - versa . the addition of a reflective surface to a far side of a color wheel may be used to convert a transmissive color wheel into a reflective color wheel . the reflective surface may reflect all or only some of the wavelengths of interest in the illumination system . for example , if a blue laser source is used , it may be desired to allow the blue light to pass through the wheel while reflecting light from some or all of the other portions of the visible light spectrum . the reflective surface may be a portion of the moving color wheel — in which case the wheel truly is reflective , or may be an independent or stationary reflector positioned by the color wheel . in the system of fig3 and the following figures and embodiments , the color wheel is illustrated and discussed as having multiple tracks of different colors . it should be understood that one or more of the tracks may be devoid of significant phosphors such that the radiant energy used to illuminate the track is not significantly converted by the phosphors . for example , if the source 312 produces radiant energy 310 in a wavelength band that is useful for the illumination system , one or more tracks of the color wheel may be clear in order to allow the radiant energy to pass through the color wheel without conversion . in the system of fig3 and the following figures and embodiments , optics 318 is illustrated as a single refractive lens . it should be understood that the illustration of the optics 318 or other optical components as a single refractive lens is to simplify the illustration and is not a limitation of the system unless otherwise stated . optics 318 may be comprised of more than one optical element and each optical element may be refractive , diffractive , reflective , or any other type of optical element , with or without optical power . in the system of fig3 and the following figures and embodiments , the order or placement of the various optical components is illustrated schematically for purposes of illustration only and should not be considered as limiting . for example , the relative locations of the tilting mirror 314 and optics 318 may be interchanged or the tilting mirror 314 may be placed between individual elements of the optics 318 . likewise , the integrator rod may be placed before the color wheel or after the color wheel . as the phosphors are generally dispersive , the integrating rod may not be used in some embodiments . an integrating rod is useful , however , to collect light as emitted from various tracks of the color wheel . as the reemission of the energy from the phosphor wheel takes a finite amount of time , the color wheel emits light from an elongated area of the color wheel . the shape and location of the elongated strip depends on the speed of the color wheel , the decay period of the phosphors , and the energy level used to excite the phosphors . the tilting mirror 314 of fig3 may be a gimbaled mirror or an array of gimbaled mirrors . the tilting mirror may also be a single tilting mirror such a scanning mirror used in scanning displays and printers , or an array of such scanning mirrors . fig4 illustrates an illumination system 400 according to another embodiment of the present invention . in fig4 , radiant energy 310 from the source 310 is once again deflected by the tilting mirror 314 through optics 318 to an integrating rod 416 . in this embodiment , however , an input face of the integrating rod 416 includes multiple regions 418 , 420 , 422 on which various phosphors have been deposited . each region on the input face of the integrating rod performs a similar function to the function of the color wheel in fig3 — the conversion of the input radiant energy 310 to a beam of energy in a desired wavelength or the passing of the radiant energy 310 . as shown in fig4 , the tilting mirror 314 may be used to direct the radiant energy 310 to each individual region of the integrating rod . for example , path 424 illustrates the radiant energy being applied to a center region 420 on the input face of the integrating rod 416 while path 426 illustrates the radiant energy being applied to another region 418 of the input face . in additional to the motion shown in fig4 that moves the source beam of radiant energy from one region of the input face of the integrating rod to another region of the input face of the integrating rod , it may be desired to move the point at which the radiant energy 310 impinges on the input face in order to prevent excessive localized heating of the phosphors or the input face or coatings on the input face . it is expected that radiant energy 310 impinging on the input face will have a great enough power level to damage or destroy the phosphor coatings on the input face of the integrating rod 416 . embodiments using an actual color wheel generally spin the color wheel fast enough to avoid the localized heating that can destroy the coatings . embodiments using color wheels may introduce additional motion of the input beam , generally in a direction perpendicular to the rotational direction relative to the beam at the point where the beam illuminates the wheel . the motion across a particular region of the input face of the integrator rod may be linear , circular , elliptical , random , vibratory , or follow a lissajous or any other pattern . the rotation speed of the color wheel and the movement of the beam across a particular region are for purposes of cooling , providing uniformity , and to prevent damage to the coatings . thus , the rotation speed or movement within a given track or region is independent to the frame rate of a display system using the illumination system . this allows the wheel or tilt mirror to operate at speeds much lower as well as much faster than the speeds required by a traditional color wheel and allows the noise generated by the movement to not only be reduced , but also to be generated at frequencies outside the hearing of a human — which can result in significantly quieter operation . fig5 is a schematic view of an illumination system according to another embodiment of the present invention . in fig5 , multiple sources 512 are used to generate multiple source beams of radian energy . the multiple sources may each produce a beam of radiant energy in the same wavelength or band of wavelengths , or they may produce beams of radiant energy in different bands . the multiple source may operate simultaneously or sequentially or any combination thereof the beam of radiant energy from each of the multiple source or groups of the multiple sources or any combination thereof may be directed toward individual tracks on the phosphor based color wheel 302 such that activation of a particular source or sources stimulates the phosphors of a different color . the use of multiple source directed to the multiple tracks or regions on the color conversion device allows the elimination of a tilting mirror or other mechanism to direct the radiant energy to a particular track . embodiments utilizing multiple sources 512 to generate additional power may utilize a tilting mirror as shown in other embodiments . the tilting mirror shown in other embodiments may also be replaced , in the embodiment of fig5 , the embodiments shown in fig3 and 4 , and other embodiments , by an acousto - optical modulator , bragg filter , switchable bragg grating , holographic modulator , or other device as illustrated by modulator 514 . modulator 514 may be controlled to direct the radian energy from one or more of the sources 512 to one or more of the tracks on the color wheel 302 . fig6 is a schematic view of yet another embodiment of the present invention illustrating the use of a color wheel having tracks instead of radial segments . in fig6 , the modulator 602 directs the source radiant energy along one or more multiple paths to reflectors 604 and 606 which direct the radiant energy to the color wheel 302 . modulator 602 may be a modulator as described in fig5 , or it may be a scanning mirror , a tilt mirror , or an array of mirrors such as a micromirror device . a digital micromirror device may be used in this embodiment in a bistable manner to direct light to one or the other of the reflectors 604 and 606 . separate regions , or interleaved regions , of the micromirror array may also be activated in opposite directions to direct different portions of the incident radiant energy to one or the other or both of the reflectors . while fig6 illustrates the use of two separate reflectors , both located in the plane of the drawing , it should be understood that the reflectors may be regions of the same reflector , may be situated on the same side of the path of incident radiant energy , there may be more than two reflectors , and the reflectors maybe positioned in any position in three - dimensions . the modulators and reflectors shown in fig6 and the various embodiments described herein may include coatings designed to modify or limit the band of radiant energy . likewise , the color wheel or the integrating rod may also have coatings to modify or limit the band of radiant energy allowed to pass through the illumination system . fig7 is a schematic view of one embodiment of the illumination system 700 using a reflective color wheel 702 . radiant energy from the illumination sources impinges on the reflective color wheel 702 where it is absorbed and reemitted as radiant energy in another band of wavelengths . the incident illumination is shown by beams from the sources while the reflected beam is shown as a dispersed beam . a dichroic splitter 704 is used to reflect one of the incident and reflected beams while passing the other of the incident and reflected beams . in fig7 , the incident beam is passed through the dichroic splitter while the beam reemitted by the reflective wheel is reflected by the dichroic splitter . fig8 shows the system of fig7 at another point in time when the beams are directed to another track of the color wheel 702 . the beams may be directed between the tracks by any of the methods discussed above . fig9 is a schematic view of a display system 900 utilizing the illumination systems 902 described above . light from the illumination system 902 is directed to a transmissive or reflective spatial light modulator 904 , such as a liquid crystal on silicon or micromirror modulator . the modulator and illumination system are controlled by controller 908 which also received image data describing a desired image to be produced . the spatial light modulator 904 modulates the incoming beam of light from the illumination system to form an image on image plane 906 . some spatial light modulators absorb the light not used to form the image , some spatial light modulators transmit the unused light in a different direction to a different location such as the optical dump shown in fig9 . thus , although there has been disclosed to this point a particular embodiment for a wavelength converter and method therefore , it is not intended that such specific references be considered as limitations upon the scope of this invention except insofar as set forth in the following claims . furthermore , having described the invention in connection with certain specific embodiments thereof , it is to be understood that further modifications may now suggest themselves to those skilled in the art , it is intended to cover all such modifications as fall within the scope of the appended claims . in the following claims , only elements denoted by the words “ means for ” are intended to be interpreted as means plus function claims under 35 u . s . c . § 112 , paragraph six .	7
referring to fig1 an embodiment of this invention as applied to a conventional commercially available apartment size refrigerator 11 is shown in perspective from the rear . the refrigerator 11 comprises an insulated generally rectangular box - like body 12 open at one side . an insulated door 13 is hinged along one of its vertical edges 14 to the open side of the body 12 and is provided with a handle 15 for selectively closing the open side of the body 12 . the refrigerator 11 includes an appropriate power unit 16 including a compressor which may be driven by an electric motor connected to a power source by means of a power cord 18 . the compressor of the power unit 16 is connected to an appropriate cooling coil system 17 filled with an appropriate refrigerant and a portion of which extends within the refrigerator 11 to provide means for maintaining the temperature within the refrigerator 11 below atmospheric in a manner well - known in the prior art . as shown in fig1 the refrigerator 12 is mounted on a frame 20 together with apparatus according to the teaching of this invention , a portion of such apparatus being mounted on and extending through the insulated side wall 19 of the body 12 of the refrigerator 11 into communication with the interior thereof as best shown in fig2 . the purpose of the apparatus according to this invention is to maintain a nitrogen rich atmosphere within the interior of the refrigerator 11 and to this end an air pump 22 , which may take the form of an electrically driven centrifugal blower , is mounted on the side wall 19 with its inlet 23 communicating with the interior of the refrigerator 11 through the side wall 19 . the outlet of the air pump 22 communicates with a substantially closed conduit 24 , a portion of which is formed by a catalytic bed 26 as will be more fully described hereinafter . the conduit 24 extends through the side wall 19 into the interior of the refrigerator 11 where it forms a series of convolutions mounted on the inner surface of the side wall 19 by means of a mounting plate 27 and terminates in an open end or outlet 28 which is spaced from the inlet 23 . a drain pipe 29 communicates with the lowest point of the convolutions formed by the conduit 24 within the refrigerator 11 , the drain pipe passing out through the side wall 19 of the refrigerator 11 and through an appropriate p - trap 30 into communication with an electrolytic tank 32 , as will be more fully described hereinafter . the electrolytic tank 32 is mounted on the frame 20 below the refrigerator 11 and contains water which is to be dissociated into oxygen and hydrogen through electrical action . to this end , the electrolytic tank 32 is provided with appropriate electrodes and electrical terminals , as will be more fully described hereinafter . the oxygen generated by electrolysis is wasted to the air through appropriate apertures in the top of the electrolytic tank 32 whereas the hydrogen generated by electrolysis is trapped and fed through an appropriate pipe 33 into the conduit 24 intermediate the air pump 22 and the catalytic bed 26 . thus , it will be seen that the hydrogen generated by electrical dissociation of the water in the electrolytic tank 32 will be conducted through the pipe 33 into the air flow established through the conduit 24 by the air pump 22 . such hydrogen gas will become intermixed with the air prior to its passage through the catalytic bed 26 and thus the purpose of the catalytic bed 26 is to cause the hydrogen gas to react with oxygen gas in the air flow to produce water . the reaction between oxygen and hydrogen is sufficiently exothermic to heat the catalytic bed 26 to an elevated temperature thus causing the water formed to vaporize and be carried through the catalytic bed 26 by the air flow . upon emergence from the catalytic bed 26 the air flow will consist of a nitrogen rich gas containing water vapor . such air flow passes through the remainder of the conduit 24 including the convolutions thereof within the refrigerator 11 where the water vapor is condensed and the remaining nitrogen rich gas exits from the outlet 28 of the conduit into the interior of the refrigerator 11 . the condensed water vapor flows to the lowest point of the convolutions of the conduit within the refrigerator where it is conducted back through the drain pipe 29 and into the electrolytic tank 32 . it will be understood that the low temperature within the refrigerator 11 will aid in condensing the water vapor and that the p - trap 30 will prevent oxygen gas generated in the electrolytic tank from entering the refrigerator 11 through the drain pipe 29 . in operation , a complex air flow pattern will be established within the refrigerator 11 between the outlet 28 of the conduit 24 and the inlet 23 of the air pump 22 . thus , the nitrogen rich gas exiting from the outlet 29 of the conduit 24 will tend to mix with the oxygen bearing air within the refrigerator 11 for recirculation by the air pump 22 through the conduit 24 . such recirculation of the gases within the refrigerator 11 through the conduit 24 including the catalytic bed 26 will result in substantially all of the oxygen therein being combined with hydrogen introduced into the conduit 24 through the pipe 33 to form water leaving a nitrogen rich atmosphere within the refrigerator 11 . it is well known that the deterioration of foodstuffs is largely due to the presence of oxygen in the air surrounding such foodstuffs and that such deterioration can be inhibited , if not completely avoided , by preventing oxygen gas from reaching the foodstuffs . deterioration of foodstuffs results both from bacterial action and from oxidation of various elements of the foodstuffs . thus , surrounding the foodstuffs with a nitrogen rich atmosphere from which substantially all of the oxygen has been removed will greatly inhibit such deterioration and can substantially eliminate such deterioration in the chilled interior of a refrigerator which is in the conventional apparatus used to inhibit food deterioration . each time the door 13 of the refrigerator 11 is opened warm , oxygen bearing air will , of course , enter the body 12 of the refrigerator 11 , mixing with the cold nitrogen rich gas within the refrigerator . thus , it will be necessary , not only to cool the gases within the refrigerator after the door 13 is closed , but also to remove any oxygen gas which may have entered the refrigerator 11 . thus , according to the teaching of this invention , the apparatus for removing the oxygen from within the refrigerator 11 is adapted to operate each time the refrigerator door 13 is opened for a sufficient length of time to remove any oxygen which may have entered the refrigerator 11 while the door 13 was open . it will be understood that hydrogen gas is highly flammable and therefore dangerous in large volumes . thus , according to one important aspect of this invention , hydrogen gas is generated only as needed and any concentration of hydrogen gas within the refrigerator 11 substantially higher than is normally found in the atmosphere is avoided . to this end , and according to the teaching of this invention , the apparatus of this invention is adapted to generate hydrogen gas for a given period of time after each closure of the door 13 of the refrigerator 11 . such given period of time is just sufficient to generate enough hydrogen to combine with enough oxygen in the catalytic bed 26 to heat the catalytic bed 26 to a preselected minimum elevated temperature provided the level of oxygen present in the gas is above a preselected minimum . if the catalytic bed 26 reaches the preselected minimum temperature within the given time period , then the generation of hydrogen gas is continued until the reaction between hydrogen and oxygen in the catalytic bed falls below that necessary to maintain such temperature , due to depletion of oxygen in the air flow through the catalytic bed 26 . thus , it is impossible for apparatus according to the teaching of this invention to produce an excess of hydrogen gas within the refrigerator 11 under normal operating conditions . furthermore , it is unnecessary to store large amounts of hydrogen gas for use in producing a nitrogen rich atmosphere within the refrigerator 11 according to the teaching of this invention . as will be more fully explained hereinafter , the apparatus of this invention is easily adapted to include various safety devices to avoid the production of excess hydrogen gas under abnormal operating conditions . referring now to fig3 a cross - sectional view of the catalytic bed 26 according to the teaching of this invention is shown . such catalytic bed 26 comprises a simple section of conduit 36 filled with a plurality of platinum coated ceramic beads or pellets 37 . the pellets 37 are shaped in such a way that they do not pack tightly with respect to each other but rather form a myriad of interstices therebetween to provide various passageways for the flow of gases through the bed 26 . the pellets 37 are retained within the conduit 36 of the bed 26 by means of perforated walls or screens 38 at each end thereof . a depression or indentation is formed in the side wall of the conduit 36 of the catalytic bed 26 intermediate the ends thereof to form a socket or cup 39 in which a thermally sensitive switch 40 is mounted in heat conducting relation to the catalytic bed . the switch 40 is designed to close when the catalytic bed reaches a certain predetermined temperature and to remain closed until the temperature of the catalytic bed again drops below such predetermined temperature . as will be more fully described hereinafter , the switch 40 functions to cause the apparatus of this invention to continue to generate hydrogen so long as the reaction between hydrogen and oxygen in the catalytic bed is proceeding at a level sufficient to heat the catalytic bed above such predetermined temperature . referring to fig4 and 5 , an electrolytic tank 32 suitable for use in generating hydrogen according to the teaching of this invention is shown . such tank comprises a cup - shaped body 42 adapted to contain water . the open end of the body 42 is closed by a cap 43 having a centrally located aperture provided with a coupling tube 44 to which the pipe 33 for conducting hydrogen from the tank 32 to the conduit 24 may be connected . the cap 43 is also provided with a first plurality of apertures 45 arranged in circular array about the coupling tube 44 through each of which projects a different one of a plurality of terminal posts 46 . the terminal posts 46 are mounted through a cathode terminal ring 47 which rests on the upper surface of the cap 43 with the terminal posts 46 depending therefrom through the apertures 45 into the upper portion of the interior of the body 42 . the cathode of the electrolytic tank is provided by a pair of coaxial perforated metallic cylinders 48 and 49 mounted by one of their ends on the inner end of the terminal posts 46 in electrically conducting relation thereto . an imperforate cylindrical baffle member 50 coaxially surrounds the cathode cylinders 48 and 49 and has its upper end mounted on the inner surface of the cap 43 in substantially gas - tight relation thereto . a second circular array of a plurality of apertures 55 through the cap member 43 surrounds the array of apertures 45 . a second plurality of terminal posts 56 , each extending through a different one of the plurality of apertures 55 , are mounted on an anode terminal ring 57 which rests on the upper surface of the cap 43 with the terminal posts 56 depending therefrom through the apertures 55 into the upper portion of the body 42 . a pair of perforated metal cylinders 58 and 59 , one surrounding the other and both coaxially surrounding the baffle member 50 and the cathode cylinders 48 and 49 , are mounted on the terminal posts 56 in electrical conducting relation thereto . the cathode and anode cylinders 48 , 49 , 58 and 59 may be made of rolled stainless steel perforated sheet , for example , and the body 42 , cap 43 and baffle member 50 may be made of an appropriate glass or plastic which will not corrode when exposed to water including sufficient electrolytes to enable electrolysis of the water to take place . it will be understood that when an appropriate potential difference is established between the cathode and anode cylinders immersed in water within the electrolytic tank 42 , such water will tend to be dissociated with hydrogen gas collecting at the cathode cylinders 48 and 49 and oxygen gas collecting at the anode cylinders 58 and 59 . we have found that the use of perforated anode and cathode cylinders tends to enhance the production of gases by causing bubbles of such gases to free themselves more rapidly from the cylinders and percolate to the surface of the water for collection . it will be understood that the hydrogen gas is trapped within the baffle 50 and conducted out through the coupling tube 44 and into the tube 33 . however , referring to fig5 it will be seen that certain of the apertures 55 have been left open by not providing the anode terminal ring 57 with a terminal post 56 corresponding to all of the apertures 55 . thus the oxygen produced at the anode cylinders 58 and 59 and percolating to the surface of the water is free to escape into the atmosphere through the apertures 55 which are not closed by terminal posts 56 . we have found that the use of distilled water including in solution 20 % by weight of potassium hydroxide as the electrolyte in the electrolytic tank 32 will enable the dissociation of sufficient hydrogen for use in apparatus according to the teaching of this invention at less than about 10 volts with reasonable power requirements . thus , the electrical requirements of the electrolytic tank 32 can be easily supplied by means of a full wave rectifier operating on conventional household current , as will be more fully described hereinafter . it will be understood that as the oxygen is removed from the air within the refrigerator 11 , there will be a tendency for the pressure of the remaining gases within the refrigerator 11 to fall below atmospheric pressure . this result is undesirable for two reasons . first , it will tend to result in the influx of oxygen bearing air into the refrigerator 11 and secondly , to the extent that the refrigerator 11 is capable of sustaining a reduced pressure , it will make it difficult to open the door 13 of the refrigerator . for the above reasons , it is necessary to maintain the pressure of the gases within the refrigerator 11 at atmospheric pressure and to this end we have found it to be desirable to include a relief valve 61 as shown in fig6 and 8 in the system . referring to fig6 such relief valve comprises a tube 62 sealed through a wall of the system and having a flange 63 at one end thereof . a rubber diaphragm 64 is mounted across the tube 62 as by means of bolts 65 and collar 66 . the diaphragm 64 has a pinhole 68 formed therethrough at its center . thus as as best shown in fig7 when a positive pressure appears at one side of the diaphragm 64 with respect to the other side thereof , the rubber diaphragm will be distended causing the pinhole 68 to become enlarged and allowing the passage of air therethrough to equalize the pressures on opposite sides of the diaphragm 64 . referring to fig1 it has been found that the optimum location for the relief valve 61 is on the housing of the centrifugal blower 22 . the precise location of the relief valve 61 is preferably selected so that the operation of the blower 22 will have minimum effect on the relief valve 61 . thus , it will be understood that is a pressure below atmospheric should develop in the system during operation , the diaphragm 64 would tend to be distended in such a way as to allow the passage of sufficient air through the pinhole 68 to restore atmospheric pressure . such air will enter the system immediately prior to the catalytic bed 26 thus tending to insure the immediate removal of oxygen therefrom before it enters the refrigerator 11 . in any event , when the refrigerator door 13 is opened the relief valve 61 would be actuated should the pressure within the refrigerator 11 be lower than atmospheric thus enabling the door 13 to be opened without undue effort and avoiding the requirement for undue structural rigidity of the refrigerator walls . referring again to fig1 the electrical elements in addition to the centrifugal blower 22 , electrolytic tank 33 and catalytic bed temperature sensor 40 , according to one embodiment with respect to the refrigerator 11 . such electrical elements include a momentary contact , single pole , single throw start switch 70 mounted with respect to the door 13 such that the contacts thereof will be momentarily closed each time the door 13 is closed . the start switch 70 is electrically connected to the timer control circuit 72 as is the centrifugal blower 22 and one lead of the catalytic bed temperature control switch 40 . the timer control circuit 72 is electrically connected to the oxygen content control circuit 74 as is the other lead of the catalytic bed temperature switch 40 and an indicator light 76 . the oxygen content control circuit is electrically connected to the primary windings of a double primary , single secondary transformer 78 . the secondary winding of the transformer 78 is connected to a full wave bridge rectifier 79 the output of which is connected across the electrodes of the electrolytic tank 32 . a power cord 80 electrically connected to the timer control circuit provides the power for the apparatus according to the teaching of this invention . referring to fig9 a wiring diagram of the apparatus according to the embodiment of fig1 is shown in which like reference numerals are used to designate the elements and circuits shown in fig1 . thus the terminals of the power cord 80 are shown connected to the timer control circuit contained within dotted lines 72 of fig9 . as shown in fig9 the timer control circuit includes a normally closed single pole , single throw motor driven timer switch 82 , a double pole , double throw , solenoid actuated switch 84 and a terminal board 88 having ten terminals . as shown in fig9 only the normally open contacts of the double pole double throw solenoid actuated switch 84 are used and the poles of the switch 84 are wired in parallel with each other . one of the input terminals of the power cord 80 is connected both to the first terminal of the terminal board 88 and to the switching element of the normally closed switch 81 of the motor driven timer switch 82 . the other terminal of the power cord 80 is connected through the solenoid 85 of the double pole , double throw , solenoid operated relay 84 to one side of the timer motor 82 of the motor driven timer switch 82 . the normally open momentary contact start switch 70 is connected between terminals 1 and 2 of the terminal board 88 . terminal 2 of the terminal board 88 is connected to terminal 3 thereof which in turn is connected to the contact elements of both poles of the double pole , double throw , solenoid operated relay 84 as well as to the opposite side of the solenoid 85 . thus , the momentary closing of the start switch 70 will activate the solenoid 85 moving the actuator elements of the double pole , double throw switches to their alternate positions . it will be seen that the actuator elements of the double pole , double throw switches are connected to the contact element of the normally closed switch 81 of the motor driven timer switch 82 . thus , upon movement of the actuator elements of the double pole , double throw switches to their alternate positions the solenoid 85 will be connected across the input terminals of the power cord 80 through the double pole , double throw switches and the normally closed switch 81 thus maintaining the double pole , double throw switches in their alternate positions . the motor 83 of the motor driven timer switch 82 is connected in parallel with the solenoid 85 through terminal 4 of the terminal board 88 and thus will begin to turn and will continue to turn until it momentarily opens the contacts of the switch 81 at the end of the time period for which it is designed . the momentary opening of the contacts of the switch 81 will deactivate the solenoid 85 allowing the contacts of the double pole double throw switches to open thus deactivating the timer control circuit and inactivating the apparatus but for the operation of other elements thereof to be described hereinafter . it will be seen from fig9 that the oxygen content control circuit enclosed in dotted lines 74 comprises a pair of double pole , double throw , solenoid operated switches 92 and 94 together with a terminal board 98 having four terminals thereon . the solenoid 93 of the switch 92 is connected in parallel with the solenoid 85 of the switch 84 through the noramlly open catalytic bed temperature switch 40 . thus , when the catalytic bed 26 has reached a predetermined temperature due to the reaction of oxygen and hydrogen therein , the switch 40 will close and if the switch 81 of the motor controlled timer switch 82 has not yet opened , the switch 92 will be operated . it will be seen that the indicator light 76 is connected across the solenoid 93 of the switch 92 through the actuator and alternate contact of one pole 90 of the double pole , double throw switch 92 . thus , the indicator light 76 will be activated whenever the catalytic bed temperature switch 40 is closed providing a visual indication that the reaction between oxygen and hydrogen in the catalytic bed 26 is above a predetermined level . the actuator element and alternate contact of the other pole 91 of the double pole throw solenoid actuated switch 92 is connected in parallel with the switch 81 of the motor driven timer switch 82 through terminals 9 and 10 of the terminal board 88 of the timer control circuit 72 . thus the apparatus will remain in operation even though the switch 81 is open at the end of the predetermined time interval . it will be seen that terminals 1 and 4 of the terminal board 98 of the oxygen content control circuit 74 are connected to terminals 3 and 4 of the terminal board 88 of the timer control circuit 72 . it will also be seen that one primary winding of the double primary windings of the transformer 78 are permanently connected to terminals 1 and 4 of the terminal board 98 of the oxygen content control circuit 74 . since the secondary winding of the transformer 78 is connected to the full wave bridge rectifier 79 which is in turn connected to the electrolytic tank 32 , it will be seen that power will be supplied to the electrolytic tank 32 at all times while the apparatus of this invention is in operation . however , as shown in fig9 the second primary winding of the double primary windings of the transformer 78 are connected to terminals 2 and 3 of the terminal board 98 which in turn are connected to terminals 1 and 4 through the respective poles 96 and 97 of the switch 94 when the contacts are in their normal position . since the solenoid 95 of the switch 94 is connected in parallel with the solenoid 93 of the switch 92 and thus in series with the catalytic bed temperature switch 40 , the switch elements 96 and 97 of the switch 94 will be thrown to their alternate position whenever the temperature switch 40 is closed . in their alternate position the switch elements 96 and 97 disconnect the second primary winding of the double primary windings of the transformer 78 from the terminals 1 and 4 of the terminal board 98 and therefore inactivate such second primary winding . it will be understood that the inactivation of such second primary winding will reduce the turns ratio in the transformer 78 thereby reducing the power applied to the electrolytic tank 32 through the power supply 79 . thus the generation of hydrogen in the electrolytic tank 32 will be reduced by about half as soon as the catalytic bed 26 has reached the predetermined termperature for which the temperature switch 40 is set . by this means , the possibility that an excess of hydrogen will be generated during operation of the apparatus is reduced and in fact the actual operation of the apparatus disclosed in fig1 and 9 has shown that the oxygen will be removed from the air within the refrigerator 11 without a detectable increase in the hydrogen content of such air . it will be understood , when the level of the reaction between oxygen and hydrogen in the catalytic bed 26 falls below that necessary to maintain the temperature at which the switch 40 is set to close , such switch 40 will open and the apparatus will be inactivated . whenever the door 13 of the refrigerator 11 is opened and subsequently reclosed , the cycle of operation of the apparatus will be restarted by the momentary closure of the start switch 70 by the closure of the door 13 . referring to fig1 a and 10b a schematic diagram of a different embodiment of the apparatus of this invention is shown . the embodiment shown in fig1 a and 10b differs from the embodiment shown in fig9 in that the embodiment of fig1 a and 10b includes means for varying the generation of hydrogen gas in more direct proportion to the oxygen content of the air in the refrigerator 11 . thus , as shown in fig1 b , a transformer 101 having a single primary winding and a single secondary winding is substituted for the transformer 78 of fig9 which has a double primary winding and a single secondary winding . the generation of hydrogen gas is instead controlled by a means 102 connected in series with the electrolytic tank across the power supply . since all of the other electrical elements of the embodiment shown in fig1 a and 10b are substantially identical to the electrical elements of the embodiment shown in fig9 like reference numerals have been used to designate like elements in fig9 a and 10b . it will be seen by comparison that the apparatus shown in fig1 a is identical to the timer control circuit 72 and start switch 70 as shown in fig9 and operates in the same way as described hereinabove with respect to fig9 . referring to fig1 b , it will be seen that the double pole , double throw , solenoid actuated switch 94 has been omitted . it will also be seen that the indicator light 76 has been omitted and that the switch element 91 of the double pole double throw solenoid actuated switch 92 is not included in the circuit , the switch element 90 thereof being connected in parallel with the switch 81 of the motor driven timer switch 82 . the centrifugal blower motor 22 and the catalytic bed temperature switch 40 are connected in the circuit in the same way as in the apparatus of fig9 . however , a fuse element 103 has been connected in series with the solenoid 93 of the switch 92 . such fuse element may be of the type designed to open after a predetermined period of continuous operation , for example , in order to inactivate the apparatus if the temperature switch 40 remains closed for an excessive period of time . as shown in fig1 b , the full wave bridge rectifier circuit may consist of four solid state diodes 104 in appropriate array . the means 102 connected in series with the electrolytic tank 32 across the output of the rectifier may take a variety of forms and is conveniently connected in the circuit in parallel with the centrifugal blower motor 22 as shown . for example , the means 102 may comprise a thermistor control device with the thermistor element thereof mounted in heat conducting relation with respect to the catalytic bed 26 as described in connection with the temperature switch 40 . such thermistor control device would of course be adapted to vary the power applied to the catalytic tank 32 in direct relation to the temperature of the catalytic bed 26 . thus the generation of hydrogen could be caused to decrease from maximum as the temperature of the catalytic bed decreases from a predetermined temperature above that necessary to maintain the temperature switch 40 in its closed position . this would tend to insure that the amount of hydrogen generated in the catalytic tank will not be in excess of that needed to react with the oxygen present in the air flow through the catalytic bed . it will be understood that although this invention has been described as applied to a conventional refrigerator , it could also be applied to unrefrigerated containers or to only part of the volume of a refrigerator . the amount of water condensed from the air flow after it has passed through the catalytic bed 26 will vary depending on the moisture content of the air flow initially as well as upon the time rate of reaction between hydrogen and oxygen in the catalytic bed 26 . it is anticipated that little if any make - up water will be required in the catalytic tank 32 yet the provision for the supply of such make - up water utilizing an appropriate inlet and float controlled valve would be an obvious expedient . similarly , as shown in fig1 an overflow outlet from the electrolytic tank 32 may be provided to drain any excess water to an evaporation pan of the type normally utilized in frost - free refrigerators or the return line may be diverted . the combination of the apparatus of this invention with a refrigerator provides many non - obvious features of advantage . for example , the operation of the apparatus of this invention will tend to provide the function of maintaining the refrigerator in a frost - free condition . also , as mentioned above , the fact that the nitrogen rich atmosphere within a refrigerator will be chilled will tend to reduce the diffusion of oxygen bearing gases into the nitrogen rich atmosphere . the compatability of the apparatus according to the teaching of this invention with conventional refrigerator structures is apparent from fig1 of the drawing . it is anticipated that those skilled in the art will make many additions to and modifications of the embodiments of this invention as disclosed in the drawing and described hereinabove without departing from the scope of the teaching of this invention . thus , although some of such modifications and additions have been mentioned hereinabove , it is not to be implied that other modifications and additions could not be made . however , there are certain basic principles according to the teaching of this invention which must be observed . for example , the time rate of generation of hydrogen gas must not exceed 40 % of the time rate of air flow through the substantially closed conduit during the initial predetermined length of time of operation of the apparatus according to the teaching of this invention and must decrease thereafter . this is true , since air normally comprises 20 % by volume of oxygen gas and since a given volume of oxygen gas requires twice the volume of hydrogen gas to combine therewith into water ( h 2 o ). in fact , tests conducted thus far indicate that apparatus according to the teaching of this invention will provide useful results where the initial maximum time rate of generation of hydrogen gas is less than 1 % of the time rate of air flow through the substantially closed conduit . the optimum time rate for the generation of hydrogen gas is believed to be a function of the relationship between the time rate of air flow through the substantially closed conduit to the total substantially closed volume in which the nitrogen rich atmosphere is to be produced . it has been found that if the time rate of air flow is high in comparision to such total volume , then the time rate of generation of hydrogen gas should be a proportionately smaller percentage of such time rate of air flow in order to avoid any increase in the hydrogen content of the atmosphere in such volume . in an actual test of apparatus according to the embodiment of this invention as shown in fig1 - 9 , an atmosphere of nitrogen with only trace amounts of other gases , including hydrogen was established in a volume of about 24 cubic inches ( including the substantially closed conduit ) in about 15 minutes using an estimated time rate of air flow of about 3 cubic feet per minute and an estimated time rate of hydrogen generation of about 1 cubic inch per minute . in this test , the electrolytic tank was operated at 9 volts and 40 amperes for about 5 minutes , after which the voltage and current were reduced to 4 volts and 17 amperes respectively , until the catalytic bed temperature switch deactivated the apparatus at the end of a further time period of about 10 minutes . it will be understood that the above test does not constitute an optimized example of the method and apparatus of this invention . however , such test does show that the desired result can be obtained using the teaching of this invention in practical time periods and at practical power levels . the optimization of the method and apparatus of this invention through the use of fuel cell or thermo - electric devices to both recover electric power from the exothermic reaction and to control such reaction is contemplated . a fuel cell is , of course , a type of catalytic means in the broad sense of this invention . although not shown in the drawing , it is desirable to thermally insulate the catalytic means from the ambient atmosphere in order to prevent variations in ambient temperatures , for example , from affecting the operation of the apparatus .	0
referring to fig1 , there is illustrated therein a general form of bus looping connection topology in accordance with this invention , the bus loop comprising an rj45 cat5 / 5e / 6 twisted pair cable 20 , connecting to a power supply extension unit 10 , supplying power to a chain ofjunction boxes 11 using the said rj45 cat5 / 5e / 6 twisted pair cables 20 , repeated again and again using the said power supply extension units 10 and chains of junction boxes 11 . network terminals , devices , clients and or servers 14 are connected to the said power supply extension units 10 and junction boxes 11 using the said rj45 cat5 / 5e / 6 twisted pair cables 21 . referring to fig2 , there is illustrated therein an alternative form of bus looping with link aggregation connection topology in accordance with this invention , the bus loop comprising an rj45 cat5 / 5e / 6 twisted pair cable 20 with one and or more rj45 cat5 / 5e / 6 twisted pair cables 22 forming a link aggregation to support increase bandwidth and link redundancy , connecting to a power supply extension unit 12 , supplying power to a chain ofjunction boxes 13 using the said rj45 cat5 / 5e / 6 twisted pair cables 20 with one and or more rj45 cat5 / 5e / 6 twisted pair cables 22 forming a link aggregation to support increase bandwidth and link redundancy , repeated again and again using the said power supply extension units 12 and junction boxes 13 . network terminals , devices , clients and or servers 14 are connected to the said power supply extension units 12 and junction boxes 13 using the said rj45 cat5 / 5e / 6 twisted pair cables 21 . referring to fig3 , there is illustrated therein an alternative form of bus looping with loop back connection topology in accordance with this invention , the bus looping comprising an rj45 cat5 / 5e / 6 twisted pair cable 20 , connecting to a power supply extension unit 10 , supplying power to a chain of junction boxes 11 using the said rj45 cat5 / 5e / 6 twisted pair cables 20 , repeated again and again using the said power supply extension units 10 and chains of junction boxes 11 , and finally looping back to the main switch 15 using an rj45 cat5 / 5e / 6 twisted pair cable 23 . network terminals , devices , clients and or servers 14 are connected to the said power supply extension units 10 and junction boxes 11 using the said rj45 cat5 / 5e / 6 twisted pair cables 21 . fig4 illustrates a general form of power supply extension unit 10 of fig1 and fig3 in more detailed . mains power is connected to mains terminal 70 , the mains voltage supply line 71 is directed to an ac to dc converter power supply 72 to produce a regulated dc power supply line 73 , the said regulated dc power supply line 73 is directed to an rj45 cat5 / 5e / 6 terminal 40 and a dc to dc converter power supply 74 to produce a regulated system power supply 75 to power the switch controller 60 and its associated electronics . and eeprom or a microcontroller 64 is used to configure the internal registers of the said switch controller 60 via a serial or parallel interface 63 . unused ports of the said switch controller 60 are disabled and or powered down . physical transceiver pair lines 33 , 43 and 53 of the said switch controller 60 , are connected to the appropriate standard ethernet isolation transformers 32 , 42 and 52 . rj45 terminal 30 is used as input port ; rj45 terminal 40 is used as output port with regulated dc power supply line 73 ; rj45 terminal 50 is used as a standard ethernet port . the said switch controller 60 is capable of 10 mbps , 100 bps , half duplex , full duplex , automatic link negotiation and automatic cable crossover correction . the said switch controller 60 has a link status indicator 62 indicating linked speed of 10 mbps , 100 mbps , half duplex , full duplex , collision , transmit activity and receive activity . the said status indicator 62 is connected to the said switch controller 60 via a serial or parallel interface 61 . fig5 illustrates an alternative form of power supply extension unit 10 of fig1 and fig3 in more detailed . mains power is connected to mains terminal 70 , the mains voltage supply line 71 is directed to the ac to dc converter power supply 72 to produce a regulated dc power supply line 73 , the said regulated dc power supply line 73 is directed to a terminal 79 and a dc to dc converter power supply 74 to produce a regulated system power supply 75 to power the switch controller 60 and its associated electronics . an eeprom or a microcontroller 64 is used to configure the internal registers of the said switch controller 60 via a serial or parallel interface 63 . unused ports of the said switch controller 60 are disabled and or powered down . physical transceiver pair lines 33 , 43 and 53 of the said switch controller 60 , are connected to the appropriate standard ethernet isolation transformers 32 , 42 and 52 . rj45 terminal 50 is used as input port ; rj45 terminal 40 is used as output port ; rj45 terminal 50 is used as a standard ethernet port . the said switch controller 60 is capable of 10 mbps , 100 mbps , 1000 mbps , half duplex , full duplex , automatic link negotiation and automatic cable crossover correction . the said switch controller 60 has a link status indicator 62 indicating linked speed of 10 mbps , 100 mbps , 1000 mbps , half duplex , full duplex , collision , transmit activity and receive activity . the said status indicator 62 is connected to the said switch controller 60 via a serial or parallel interface 61 . fig6 illustrates a general form of power supply extension unit with link aggregation 12 of fig2 in more detailed . mains power is connected to mains terminal 70 , the mains voltage supply line 71 is directed to two ac to dc converter power supply 72 and 76 to produce two regulated dc power supply line 73 and 77 , the said regulated dc power supply line 73 is directed to an rj45 terminal 40 and the said regulated dc power supply line 77 is directed to an rj45 terminal 44 . the two regulated power supply lines 73 and 77 are used in dc to dc converter power supply 74 to produce a regulated system power supply 75 to power the switch controller 60 and its associated electronics . and eeprom or a microcontroller 64 is used to configure the internal registers of the said switch controller 60 via a serial or parallel interface 63 . unused ports of the said switch controller 60 are disabled and or powered down . physical transceiver pair lines 33 , 37 , 43 , 47 and 53 of the said switch controller 60 , are connected to the appropriate standard ethernet isolation transformers 32 , 36 , 42 , 46 and 52 . rj45 terminal 30 and 34 used as input ports ; rj45 terminal 40 and 44 is used as output ports with regulated dc power supply lines 73 and 77 ; rj45 terminal 50 is used as a standard ethernet port . the said switch controller 60 is capable of 10 mbps , 100 mbps , half duplex , full duplex , automatic link negotiation and automatic cable crossover correction . the said switch controller 60 has a link status indicator 62 indicating link speed of 10 mbps , 100 mbps , half duplex , full duplex , collision , transmit activity and receive activity . the said status indicator 62 is connected to the said switch controller 60 via a serial or parallel interface 61 . fig7 illustrates an alternative form of power supply extension unit with link aggregation 12 of fig2 in more detailed . mains power is connected to mains terminal 70 , the mains voltage supply line 71 is directed to an ac to dc converter power supply 72 to produce a regulated dc power supply line 73 , the said regulated dc power supply line 73 is directed to terminal 79 and a dc to dc converter power supply 74 to produce a regulated system power supply 75 to power the switch controller 60 and its associated electronics . an eeprom or a microcontroller 64 is used to configure the internal registers of the said switch controller 60 via a serial or parallel interface 63 . unused ports of the said switch controller 60 are disabled and or powered down . physical transceiver pair lines 33 , 37 . 43 , 47 and 53 of the said switch controller 60 , are connected to the appropriate standard ethernet isolation transformers 32 , 36 , 42 , 46 and 52 . rj45 terminal 30 and 34 are used as input ports ; rj45 terminal 40 and 44 is used as output ; rj45 terminal 50 is used as a standard ethernet port . the said switch controller 60 is capable of 10 mbps , 100 mbps , 1000 mbps , half duplex , full duplex , automatic link negotiation and automatic cable crossover correction . the said switch controller 60 has a link status indicator 62 indicating link speed of 10 mbps , 100 mbps , 1000 mbps , half duplex , full duplex , collision , transmit activity and receive activity . the said status indicator 62 is connected to the said switch controller 60 via a serial or parallel interface 61 . fig8 illustrates a general form of junction box 11 of fig1 and fig3 in more detailed . rj45 cat5 / 5e / 6 terminal 30 carries both dc regulated power line 73 and network signals 31 . the said regulated dc power supply line 73 is directed to an rj45 cat5 / 5e / 6 terminal 40 and a dc to dc power converter power supply 74 to produce a regulated system power supply 75 to power the switch controller 60 and its associated electronics . and eeprom or a microcontroller 64 is used to configure the internal registers of the said switch controller via a serial or parallel interface 63 . unused ports of the said switch controllers are disabled and or powered down . physical transceiver pair lines 33 , 43 , and 53 of the said switch controller 60 , are connected to the appropriate standard ethernet isolation transformers 32 , 42 and 52 . rj45 cat5 / 5e / 6 terminal 30 is used as input port ; rj45 cat5 / 5e / 6 terminal 40 is used as output port ; rj45 cat5 / 5e / 6 terminal is used as a standard ethernet port . the regulated dc power supply line 73 connects both rj45 cat5 / 5e / 6 terminals 30 and 40 . the said switch controller 60 is capable of 10 mbps , 100 mbps , half duplex , full duplex , automatic link negotiation and automatic cable crossover correction . the said switch controller 60 has a link status indicator 62 indicating link speed of 10 mbps , 100 mbps , half duplex , full duplex , collision , transmit activity and receive activity . the said status indicator 62 is connected to the said switch controller 60 via a serial or parallel interface 61 . fig9 illustrates an alternative form of junction box 11 of fig1 and fig3 in more detailed . terminal 78 carries the dc regulated power line 73 while rj45 cat5 / 5e / 6 terminal 30 carries the network signals 31 . the said dc regulated power supply line 73 is directed to terminal 79 and a dc to dc converter power supply 74 to produce a regulated system power supply 75 to power the switch controller 60 and its associated electronics . an eeprom or a microcontroller 64 is used to configure the internal registers of the said switch controller via a serial or parallel interface 63 . unused ports of the said switch controllers are disabled and or powered down . physical transceiver pair lines 33 , 43 and 53 of the said switch controller 60 , are connected to the appropriate standard ethernet isolation transformers 32 , 42 and 52 . rj45 cat5 / 5e / 6 terminal 30 is used as input port ; rj45 cat5 / 5e / 6 terminal 40 is used as output port ; rj45 cat5 / 5e / 6 terminal is used as a standard ethernet port . the regulated dc power supply line 73 connects both terminals 78 and 79 . the said switch controller 60 is capable of 10 mbps , 100 mbps , 1000 mbps . half duplex , full duplex , automatic link negotiation and automatic cable crossover correction . the said switch controller 60 has a link status indicator 62 indication link speed 10 mbps , 100 mbps , 1000 mbps , half duplex , full duplex , collision , transmit activity and receive activity . the said status indicator 62 is connected to the said switch controller 60 via a serial or parallel interface 61 . fig1 illustrates a general form of junction box with link aggregation 13 of fig2 in more detailed . both rj45 cat5 / 5e / 6 terminal 30 and 34 carries both dc regulated power line 73 and 77 network signals 31 and 35 . the said dc regulated power supply line 73 and 77 is directed to an rj45 cat5 / 5e / 6 terminal 40 and 44 . the two regulated dc power supply lines 73 and 77 are used in dc to dc converter power supply 74 to produce a regulated system power supply 75 to power the switch controller 60 and its associated electronics . and eeprom or a microcontroller 64 is used to configure the internal registers of the said switch controller 60 via a serial or parallel interface 63 . unused ports of the said switch controller 60 are disabled and or powered down . physical transceiver pair lines 33 , 37 , 43 , 47 and 53 of the said switch controller 60 , are connected to the appropriate standard ethernet isolation transformers 32 , 36 , 42 , 46 and 52 . rj45 terminal 30 and 34 are used as input ports ; rj45 terminal 40 and 44 is used as output ports with regulated dc power supply lines 73 and 77 ; rj45 terminal 50 is used as a standard ethernet port . the said switch controller 60 is capable of 10 mbps , 100 mbps , half duplex , full duplex , automatic link negotiation and automatic cable crossover correction . the said switch controller 60 has a link status indicator 62 indicating link speed of 10 mbps , 100 mbps , half duplex , full duplex , collision , transmit activity and receive activity . the said status indicator 62 is connected to the said switch controller 60 via a serial or parallel interface 61 . fig1 illustrates an alternative form ofjunction box with link aggregation 13 of fig2 in more detailed . terminal 78 carries the dc regulated power line 73 while cat5 / 5e / 6 terminal 30 and 34 carries the network signal 31 and 35 . the said dc regulated power supply line 73 is directed to terminal 79 and a dc to dc converter power supply 74 to produce a regulated system power supply 75 to power the switch controller 60 and its associated electronics . an eeprom or a microcontroller 64 is used to configure the internal registers of the said switch controller 60 via a serial or parallel interface 63 . unused ports of the said switch controller 60 are disabled and or powered down . physical transceiver pair lines 33 , 37 , 43 , 47 and 53 of the said switch controller 60 , are connected to the appropriate standard ethernet isolation transformers 32 , 36 , 42 , 46 and 52 . rj45 terminal 30 and 34 are used as input ports ; rj 45 terminal 40 and 44 is used as output ; rj45 terminal 50 is used as a standard ethernet port . the said switch controller 60 is capable of 10 mbps , 100 mbps , 1000 mbps , half duplex , full duplex , automatic link negotiation and automatic cable crossover correction . the said switch controller 60 has a link status indicator 62 indicating link speed 10 mbps , 100 mbps , 1000 mbps , half duplex , full duplex , collision , transmit activity and receive activity . the said status indicator 62 is connected to the said switch controller 60 via a serial or parallel interface 61 . numerous other modifications , variations and adaptations may be made to the particular embodiments of the invention described above without departing from the scope of the invention as defined in the claims .	7
as discussed above , the invention comprises several embodiments of a novel vessel for thoroughly and completely mixing an ionized coagulant with a stream of water or other liquid to be treated , and a method and system for its use in removing contaminants from a stream of water or other fluid to be treated . fig1 shows an example of the system of the invention . a mixing vessel 10 receives a stream of contaminated water or other fluid from a source 12 connected to vessel 10 by an inlet conduit 14 . the stream of water from the source 12 is combined with one or more of a selection of ionized coagulants provided along a second conduit 16 . as indicated specifically , the ionized coagulant supplied may be ionized nitrogen supplied from a source 19 , ionized oxygen from a source 20 , an anionic liquid coagulant such as a polymer from a source 21 , a cationic liquid coagulant from a source 22 , further coagulant materials such as ionized halogens or ozone as indicated at 23 and 24 , or mixtures of these , and other known coagulants . in the embodiment of fig1 - 4 , the streams of ionized coagulant and contaminated water or other fluid to be treated from source 12 are initially combined in a venturi 26 . the venturi 26 receives the stream of water to be treated at a relatively large opening . the stream is then constrained to pass through a relatively small flow passage , increasing its velocity and pressure . the ionized coagulant is injected at substantially the smallest cross - section of the venturi , so that when the combined streams then pass into a passage of expanding cross - section , the coagulant tends to be dispersed in the reduced - pressure stream . further details of the venturi are discussed below in connection with fig2 . the stream of water or other fluid to be treated from source 12 and the ionized coagulant , having thus been preliminarily combined , are supplied to the vessel 10 , details of one embodiment of which are discussed below in connection with fig2 - 4 . as shown schematically in fig1 the combined stream is admitted towards the bottom of a vertically - extending vessel 10 having a lower mixing chamber 30 , an intermediate elongated tubular portion 32 , and an upper mixing chamber 34 . a fluid exit tube 36 extending coaxially through the vessel 10 has an open inlet end in the approximate center of the upper mixing chamber 34 and a lower exit end . thus , the preliminarily combined streams of the fluid to be treated and the coagulant enter the lower mixing chamber and travel in a generally spiral path upwardly through the intermediate tubular portion 32 , around the fluid exit tube 36 , and enter the upper end of the fluid exit tube 36 in the center of the upper mixing chamber 34 . this fluid path provides very substantial turbulence and excellent mixing of the ionized coagulant with the water to be treated . a coil 38 of wire is provided around at least the intermediate tubular portion 32 of the vessel 10 and is connected to a dc power supply 40 . when power supply 40 is energized , a magnetic field is emitted by coil 38 , extending generally axially along the direction of elongation of the intermediate tubular portion of the vessel 10 . this magnetic field tends to encourage intimate contact between the ionized coagulants and the contaminants of the fluid to be treated , aiding in coagulation and flocculation of the contaminants to be removed . after exiting the vessel 10 , the stream is directed to one or more of a variety of possible devices for separating the coagulated and flocculated contaminants from the water stream . as indicated in fig1 these may comprise an anode / cathode accelerator 44 , that is , a device defining an electric field extending parallel to the direction of flow of the stream for further separating ionized and polar materials therein . a secondary reactor generally similar to vessel 10 may also be provided as indicated at 46 . the separation of the coagulated contaminants from the water stream is performed in a final separation filter 48 which may comprise any of a variety of known media such as sand filters , activated charcoal filters , mechanical filtration media , and combinations of these and other known filters . the filtered water may be passed at 50 to further purification devices such as ion exchange media , or the like , or may be directly reused . from time to time , filter 48 is backwashed as indicated at 52 , and the collected contaminants removed and disposed of at 54 . further water may be recovered in this process as indicated at 56 by a dewatering step 58 . in connection with removal of certain contaminants , it may be desirable to add magnetite particles to the contaminated water stream . magnetite particles are essentially iron oxide and are highly magnetic , thus tending to form nucleation sites for flocculation or coagulation of the contaminants to be removed from the water stream when exposed to the magnetic field from coil 32 . suitable magnetite particles can be provided by a source 60 , comprising , for example , a device wherein a further water stream flows between coaxial closely - spaced electrically - insulated steel pipes . if a positive potential is applied to one of the pipes and a negative potential to the other , and if ionized oxygen is added as indicated at 62 , particles of iron oxide will tend to form on the facing surfaces of the coaxial steel pipes and enter the water stream . as indicated , such iron oxide magnetic particles are very effective in nucleating the flocculation or coagulation of the contaminants to be removed from the water stream . fig2 shows further details of one embodiment of vessel 10 , taken through its vertical axis , with fig3 and 4 showing sections along the line 3 -- 3 and 4 -- 4 , respectively . the major components of the vessel 10 are , as mentioned above , the lower mixing vessel 30 , an intermediate tubular portion 32 , and an upper mixing vessel 34 . these may be formed integrally of welded steel components . in a successfully tested embodiment , the upper and lower mixing vessels 30 and 34 are 8 inches in diameter , that is , horizontally in fig2 and are 6 inches deep vertically , while the tubular intermediate section 32 is 6 inches in diameter and 24 inches long . within the vessel 10 extends a fluid exit tube 36 substantially coaxial with the intermediate tubular portion 32 and with vessels 30 and 34 . as shown , the fluid exit tube 36 extends vertically downwardly from an upper inlet substantially in the center of the upper mixing vessel 34 to an exit opening beneath the bottom of the lower mixing vessel 30 . the fluid exit tube is approximately two inches in diameter and may also be formed of steel so as to be welded to the lower mixing vessel 30 at its exit to conveniently provide support . the liquid to be treated from source 12 and the ionized coagulant , including an ionized gas or liquid from any one of sources 19 - 24 , or mixtures thereof , or other coagulant or flocculant materials , are combined in venturi 26 , as discussed above . in a successfully tested embodiment , venturi 26 is approximately 11 inches long overall , has 1 . 5 inch diameter inlet and outlet openings , and tapers to a diameter of 5 / 8 inch at its throat . the ionized coagulant is injected substantially at the throat of venturi 26 , as shown , that is , at the maximum pressure point of the fluid stream , such that when the pressure in the mixture decreases towards the exit orifice of venturi 26 , the coagulant tends immediately to be dispersed throughout the stream of liquid to be treated . as indicated , the inlet into lower mixing vessel 30 from venturi 26 is generally horizontal , but is off - axis ( see fig3 ) such that the flow of the mixed liquid to be treated and coagulant tends to be circular , around fluid exit tube 36 . accordingly , the combined streams flow upwardly through intermediate tubular section 32 along a generally spiral flow path extending around fluid exit tube 36 , thus ensuring thorough further mixing of the ionized coagulant with the fluid to be treated . it will be appreciated throughout this discussion that if a stream of magnetite particles is added , this also is thoroughly mixed with the ionized coagulant and the fluid to be treated throughout the passage thereof through mixing vessel 10 . the mixture of the ionized coagulant , the fluid to be treated ( and as noted , magnetite particles , if employed ) exits vessel 10 by way of fluid exit tube 36 . more particularly , the mixture enters fluid exit tube through its upper end as shown by the arrows in fig2 . at this point , there is no pressure in the system , as indicated by vent 70 . this stream thus flows downwardly through the fluid exit tube and on to further filtration steps , as discussed above in connection with fig1 . in a further preferred embodiment , a number of radially inwardly extending ridges , preferably of a ferromagnetic material , such as a suitable stainless steel , may be provided on the facing surfaces of the annular passageway between the fluid exit tube and intermediate tubular portion 32 of the vessel , and on the inner surface of fluid exit tube 36 , by disposition of corrugated sleeves 72 , 74 , and 76 therein . alternatively , such ridges might be formed in the surfaces of fluid exit tube 36 and intermediate tubular portion 32 . these radially extending ridges have the effect of providing further mixing of the ionized gas or liquid and the liquid to be treated . as noted , these ridges are preferably formed of a ferromagnetic material such as a magnetic stainless steel , so that the magnetic field can further cause coagulation of the coagulant materials and the contaminants to be removed from the process stream to be treated . it will be appreciated by those of skill in the art that the combination of ( i ) introduction of the ionized coagulant into the stream of fluid to be treated at a point of high pressure , followed by an immediate reduction in pressure ; ( ii ) the continued swirling , countercurrent , turbulent mixing of the stream provided by the spiral path of the combined streams upwardly through vessel 10 ; ( iii ) the countercurrent change of flow direction when the streams flow over the open upper edge of fluid exit tube 36 and then downwardly through fluid exit tube 36 ; and ( iv ) turbulence due to the radially extending ridges on one or more of the inner surfaces of intermediate vertically extending tubular section 32 and the inner and outer surfaces of fluid exit tube 36 , provides very thorough physical mixing of the ionized coagulant , magnetite particles , if employed , and the contaminants to be removed from the water stream to be treated . more particularly , since these materials tend to be attracted to one another , but may be present in relatively low concentrations , a thorough mixing as provided by vessel 10 according to the invention is highly desirable in order to encourage successful coagulation and flocculation of these materials so that they can be subsequently removed in essentially conventional filtration steps , or by combination of conventional and novel filtration steps , as discussed above in connection with fig1 . according to a further aspect of the invention , and as discussed briefly above , coil 38 is disposed about at least the intermediate tubular section of the vessel 10 and is connected to power supply 40 . when power supply 40 is energized , a magnetic field h of generally solenoidal configuration extends through at least intermediate tubular portion 32 of vessel 10 , including the interior of exit tube 36 , as depicted schematically in fig2 . in order that the magnetic field h can be efficiently employed , it is desirable that the materials of vessel 10 be ferromagnetic , e . g ., mild steel as noted above . it will be appreciated by those of skill in the art that most of the contaminants sought to be removed by the apparatus and system of the invention , these including oil and grease emulsions , heavy metals , materials exhibiting basic oxygen demand such as organic food particulates , materials exhibiting chemical oxygen demand such as organic dyes , colloidal solid particulates , agricultural organic contaminants , and other contaminants , largely comprise polar or ionic molecules responsive to a magnetic field . similarly , the ionized coagulants are , of course , also responsive to a magnetic field , and , indeed , water molecules themselves are polar . accordingly , when a solenoidal magnetic field h is applied as indicated by fig2 these polar materials tend to become aligned with one another and are brought into still more intimate physical contact . this further encourages coagulation and flocculation and thereby increases the efficiency of removal of the contaminants from the process stream to be treated . as indicated generally above , dc power is preferably employed to excite coil 38 to emit magnetic field h . preferably the polarity of the dc power is reversed at intervals on the order of minutes . reversal of the polarity of the power supply reverses the direction of the magnetic field h and tends to remove any polar molecules or the like that may have collected , for example , in the crevices formed by the radially inwardly extending ridges 72 , 74 , and 76 . in the successfully - tested embodiment of the system discussed above , coil 38 comprised 400 feet of 14 awg stranded copper wire wrapped in two layers spiraling up and down the intermediate tubular portion 32 of the vessel 10 . in the preferred embodiment , the amount of power applied to coil 38 varies with the rate of flow of the fluid to be treated , and the ionized coagulant is similarly supplied at a rate responsive to the rate of flow of the fluid to be treated . of course , the rate of supply of the ionized coagulant may also be varied with detected variation in the amount of contaminants present in the process stream to be treated . similarly , the addition of magnetite particles from source 60 may be controlled responsive to the characteristics of the stream to be treated . in a particularly preferred embodiment a controller 80 ( fig1 ) such as a computer or the like , in combination with associated flow sensors , contaminant monitoring instrumentation , solenoid valves , and similarly well - known process control equipment may be provided to automatically control these and other system parameters , such as the periodic reversal of the polarity of the dc power applied to coil 38 . the following table provides typical values of the dc voltage supplied to and the current drawn by coil 38 with respect to the rate of flow of the fluid to be treated from source 12 , and also illustrates typical corresponding rates of injection of a typical gaseous ionized coagulant such as ionized oxygen , together with typical values for the magnetic field strength h . table______________________________________process stream ionized o . sub . 2flow rate injection rate voltage current h ( gpm ) ( cfm ) ( vdc ) ( a ) ( gauss ) ______________________________________25 0 . 5 6 8 100 , 00030 1 . 0 12 14 170 , 00035 1 . 5 18 21 280 , 00040 2 . 0 24 29 400 , 00075 3 . 0 30 40 600 , 000______________________________________ thus , it can be seen from the table that for a typical flow rate of 30 gallons per minute of water contaminated with typical contaminants , e . g ., organics , oily emulsions , and heavy metals , as found in typical water streams from various sources , including metal finishing operations , municipal drinking water supplies , and the like , ionized oxygen may be injected at an injection rate of 1 . 0 cubic feet per minute , and dc power at 12 volts applied to a coil 38 as described above , resulting in a current of 14 amperes being drawn and a magnetic field of 170 , 000 gauss imposed . the last line of entries in the table refers to the embodiment of the mixing vessel of the invention described with respect to fig5 - 7 below . it will be appreciated , of course , that these figures ( as well as other specifics mentioned herein ) are exemplary only and by no means limit the invention . as indicated above , fig5 , and 7 show an additional embodiment of the mixing vessel according to the invention , which may substituted substantially directly for that shown in fig1 - 4 , with certain minor changes to the system configuration which will be apparent from the discussion below . the overall assembly is shown by fig5 while details of the coil are shown by fig6 and fig7 shows a coaxial arrangement of tubes making up the assembly . the mixing vessel , in this embodiment termed 90 , again comprises upper and lower mixing chambers and a coaxial assembly of tubes , such that liquid to be treated flows first in one direction vertically , then the opposite direction , in order to ensure counter - current mixing and highly turbulent flow . in this embodiment , the stream to be treated is admitted at an upper inlet 92 in communication with an upper mixing chamber 94 . the water stream flows downwardly , principally along an inner annular passage 96 between an inner exit tube 98 and an intermediate sleeve 100 . however , a relatively small fraction of the influent water stream , e . g ., 2 - 10 %, flows downwardly along a second outer annular passage 102 , defined between intermediate sleeve 100 and an outer tube 104 supporting coils 106 providing a magnetic field . outer annular passage 102 is employed as a &# 34 ; premixing &# 34 ; chamber , wherein coagulant gases , chemicals and the like injected into the outer annular passage 102 , as indicated at 132 , 136 , are initially dissolved homogeneously throughout a small fraction of the total water stream to be treated . this fraction is then readily dissolved in the remainder of the total stream to be treated , when the two portions of the total stream meet in lower mixing chamber 108 . more specifically , the inner exit tube 98 forms the return path along which water flows upwardly from the lower mixing chamber 108 to an exit passage 110 formed at the upper extremity of the unit 90 . the inner annular passageway 96 , defined between the inner tube 98 and the intermediate sleeve 100 , is substantially open , such that most of the water flows downwardly therein , while a smaller proportion of the water flows downwardly through the outer annular passage 102 , between sleeve 100 and outer tube 104 . flow of water down the outer annular passage 102 is restricted somewhat by the presence of members 112 supporting tube 100 with respect to tube 104 ; members 112 may be ordinary square keystock welded to the respective tubes , to support the assembly . additional sections of keystock 114 may be welded to the outer surface of tube 104 to support and space individual segments 106 , 106 &# 39 ; 106 &# 34 ; of coil axially from one another . each coil segment includes inner and outer windings connected in series to a dc power source 120 , shown as a battery , but not limited thereto . power is supplied over a first conductor 122 , wrapped around the uppermost portion of the outer tube 104 , forming the inner layer of coil segment 106 . a section of wire 107 extends axially along the tube to a second coil segment 106 &# 39 ;, and a further section of wire extends to a third section 106 &# 34 ;. each segment of the coil also includes outer windings , wound upwardly and also connected in series . the return conductor 123 to power source 120 exits the assembly close to conductor 122 , rendering the power supply connections convenient . the overall construction techniques and proportions of the mixing chamber 90 in this embodiment are generally comparable to those of the embodiment of fig1 - 4 . the inner tube 98 may be a section of 11 / 2 inch pvc schedule 80 tubing , supported by a threaded end cap 125 . ( in a further modification discussed below , pvc tube 98 may be replaced by a section of steel tube .) the intermediate sleeve 100 can be a section of 3 inch diameter schedule 80 steel pipe 36 inches long , while the outer tube 104 forming the central section of vessel 90 can be a section of 4 inch diameter schedule 80 steel pipe 36 inches long . the upper and lower mixing chambers are formed by 4 × 6 inch concentric reducing couplings 128 welded on one end to the outer tube 104 , and to 6 inch schedule 40 couplings 129 on the other . two 6 inch threaded steel plugs form end caps 125 at either end . the upper end of the inner sleeve 100 is preferably raised at least about three inches above the point at which upper reducing coupling 128 meets the outer tube 104 , to ensure proper flow splitting , that is , division of the incoming water stream in appropriate proportions between the inner and outer annular passageways 96 and 102 , respectively . as indicated by the elliptical shape shown for inlet opening 138 , inlet tube 92 intersects the upper mixing chamber 94 off - axis , such that a swirling , highly turbulent , mixing flow is provided throughout the flow path of liquid through the vessel 90 . coagulant materials may be introduced into the stream of water to be treated at a venturi , as discussed above . alternatively , ionized gas or other coagulant species from a source indicated at 130 can be introduced at an inlet 132 in communication with the outer annular space 102 , wherein , as noted , a relatively small fraction of the stream to be treated flows downwardly . coagulant materials , including ionized polymers and other coagulants , as well as magnetite ions or the like , may also be provided from a source 134 connected by an inlet passage 136 to upper mixing chamber 94 at a point below the upper end of sleeve 100 , to ensure the coagulant flows downwardly through outer annular space 102 , for mixing with a relatively small fraction of the incoming water stream . as noted , dividing the incoming flow into smaller and larger components , and introducing the coagulants into the smaller component , promotes better mixing thereof . this improvement is facilitated by provision of sleeve 100 . provision of an additional steel tube also further strengthens the solenoidal magnetic field exerted by the coil . dividing the coil into three segments 106 , 106 &# 39 ;, 106 &# 34 ; causes each to function as a separate coil , that is , each segment has north and south poles , further increasing the beneficial effect of the magnetic field on coagulation of materials within the water stream to be treated . however , while provision of the magnetic field by three segments of a single series - connected coil is believed to provide increased magnetic efficiency , up to 50 %, with respect to a single coil having a similar number of turns , the invention is not to be constrained thereby . further , while division of the incoming water stream between the inner and outer annular passageways is believed to increase the turbulence thereof and hence the efficiency of mixing , the invention is again not to be limited in this way . the embodiment of the mixing vessel 90 of fig5 - 7 can be further modified to additionally comprise a source of magnetite ions for coagulation of contaminants . as noted above , magnetite ions can be conveniently generated in situ by passing a stream to be treated therewith between coaxial steel tubes across which a potential difference is maintained . in a corresponding modification of the vessel of the invention to provide magnetite ions in situ , the pvc material of exit tube 98 is replaced by steel tubing ; in order to provide electrical isolation of steel exit tube from sleeve 100 and outer tube 104 , the exit tube is supported by a pvc plastic compression fitting in lieu of end cap 125 . a dc power supply is then connected as shown in phantom at 121 across the steel exit tube and intermediate sleeve 100 , so that a radial electric field is provided therebetween . when current flows therebetween , through the water stream , iron atoms from the charged steel tubes will be released into the water stream ; magnetite ions will be formed thereby by reaction with oxygen dissolved in the water to be treated , or with additional oxygen added , e . g ., at 132 . the polarity of the dc potential supplied should be reversed at intervals , to prevent scaling of either the exit tube or the intermediate sleeve . in that both the exit tube and intermediate sleeve serve as sources of magnetite ions , both will be sacrificial , and will require replacement at intervals depending on the amount of current flow . accordingly , the design of the vessel should permit their convenient replacement . for example , both the exit tube and the intermediate sleeve may be fabricated of standard sizes of steel tubing . as noted , the steel exit tube may be supported by a compression fitting in the end cap , while the intermediate sleeve 100 may be wedged within the outer tube 104 , so that their replacement does not involve welding or the like . in this modification coils 106 , 106 &# 39 ;, 106 &# 34 ; may be omitted , or may be provided downstream , to provide a magnetic field for further stimulating coagulation of contaminants by the magnetite ions . while a number of aspects of several preferred embodiments of the invention have been discussed in detail , it will be appreciated that these are exemplary only and that the invention is susceptible of many modifications and improvements , including those within the state of the art at the time of filing of the application and others that may be subsequently invented . therefore , the invention should not be limited by the above disclosure , but only by the following claims .	1
the cobalt and nickel compounds used are salts , such as bromides , iodides , acetates , formates , propionates , which react with carbon monoxide to form cobalt carbonyl or hydrocobalt carbonyl complexes . the proportion of cobalt in the catalyst system may be considerably reduced and may be smaller than the proportion of nickel . up to around 1 % by weight and preferably from about 0 . 001 to 0 . 5 % by weight of cobalt is used , based on methanol . the quantity of nickel generally amounts to between about 0 . 1 and 5 % by weight and more particularly to between 0 . 15 and 3 % by weight , based on the methanol used . the ligands used are normally used compounds such as 3 - valent phosphorus compounds corresponding to the following formula ## str1 ## in which r 1 , r 2 and r 3 may be for example alkyl , aryl or aralkyl groups . however , many other groups , such as for example bicyclic compounds in which p is incorporated as a hetero atom , phenoxy or alkoxy groups , are also suitable for the reaction . it has proved to be of advantage to use triphenyl phosphine for example . the promoters used for the reaction are halides , particularly hydrogen iodide or bromide and also methyl iodide or methyl bromide . however , elemental iodine or bromine may also be used . very good results are also obtained with iodides or bromides of nickel , cobalt or cesium and also with mixtures of the compounds mentioned . based on the nickel used , iodine and / or bromine is / are used in a quantity of from 0 . 1 to 3 molar and preferably in a quantity of from 0 . 25 to 1 molar . the reaction is carried out at temperatures in the range from 180 ° to 230 ° c . and under pressures of from about 200 to 500 bars , although it can be of advantage to apply even higher pressures . preferred reaction conditions are temperatures of from 190 ° to 210 ° c . and pressures of from 280 to 320 bars . the reaction is carried out using ratios of carbon monoxide to hydrogen of from 2 : 1 to 1 : 2 , 2 , the preferred ratio being 1 : 1 . the yield of acetaldehyde dimethyl acetal is not adversely affected if the starting gas contains small inert fractions such as co 2 , h 2 or ch 4 . accordingly , the usual synthesis gas quality may be used . in the process according to the invention , the residence times of more than 30 hours required in the known processes may be shortened , in some cases to less than one hour . the preferred residence times are from 5 minutes to 2 hours , depending on whether the process is carried out in batches or continuously . the reaction product contains only small quantities of secondary products and may be worked up by distillation in the usual way . the percentages quoted in the examples represent percent by weight . a stirrer - equipped autoclave of hastelloy c was filled with 405 g ( 12 . 6 moles ) of methanol , 10 g ( 0 . 04 mole ) of ni -( acetate ) 2 . 4h 2 o , 4 . 8 g of hi , 0 . 8 g of co ( acetate ) 2 . 4h 2 o ( 8 %, based on ni ) and 40 mmoles of triphenyl phosphine . after the system had been purged with nitrogen , a co / h 2 ( 1 : 1 )- mixture was introduced under pressure up to a pressure of 290 bars . after the reaction temperature of 200 ° c . had been reached , a fresh co / h 2 ( 1 : 1 )- mixture was continuously added during the 1 - hour reaction time so that the pressure of 290 bars was maintained . after the autoclave had been cooled and the reaction product worked up by distillation , it was found that 57 . 9 % of the methanol used had reacted with a selectivity of 79 . 6 % to form acetaldehyde dimethyl acetal . in addition , 8 . 6 % of acetaldehyde and 5 . 8 % of methyl acetate were obtained . the reaction was carried out in the same way as in example 1 except that , instead of 8 %, 4 % of cobalt was used . the conversion amounted to 49 . 9 % for a selectivity of 82 . 6 %. 5 . 0 % of acetaldehyde and 8 . 6 % of methyl acetate were obtained as secondary products . the reaction was carried out in the same way as in example 1 except that 16 % of cobalt , based on nickel , was used . under these conditions , the conversion rose to 67 . 8 % whereas selectivity fell to 63 . 7 % of acetaldehyde dimethyl acetal . the reaction was carried out in the same way as in example 1 except that the residence time was 30 minutes . the conversion amounted to 43 % whereas selectivity rose to 82 . 0 % of acetaldehyde dimethyl acetal . in addition , 3 . 7 % of acetaldehyde and 10 . 6 % of methyl acetate were obtained . the reaction was carried out in the same way as in example 2 except that , instead of triphenyl phosphine , 40 mmoles of tributyl phosphine were used . the conversion amounted to 45 . 5 % for a selectivity of 82 . 8 %. in addition , 3 . 6 % of acetaldehyde and 5 . 3 % of methyl acetate were obtained . the reaction was carried out in the same way as in example 2 except that only 20 mmoles of triphenyl phosphine were used . the conversion amounted to 44 . 2 % for a selectivity of 83 . 7 %.	2

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.